US8242255B2 - Antisense oligonucleotides against cPLA2, compositions and uses thereof - Google Patents
Antisense oligonucleotides against cPLA2, compositions and uses thereof Download PDFInfo
- Publication number
- US8242255B2 US8242255B2 US11/568,169 US56816905A US8242255B2 US 8242255 B2 US8242255 B2 US 8242255B2 US 56816905 A US56816905 A US 56816905A US 8242255 B2 US8242255 B2 US 8242255B2
- Authority
- US
- United States
- Prior art keywords
- cpla
- seq
- antisense
- oligonucleotides
- antisense oligonucleotide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related, expires
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/04—Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
- A61P11/02—Nasal agents, e.g. decongestants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
- A61P11/06—Antiasthmatics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/02—Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/06—Antipsoriatics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/14—Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
- A61P25/16—Anti-Parkinson drugs
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
- A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P39/00—General protective or antinoxious agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y301/00—Hydrolases acting on ester bonds (3.1)
- C12Y301/01—Carboxylic ester hydrolases (3.1.1)
- C12Y301/01004—Phospholipase A2 (3.1.1.4)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/315—Phosphorothioates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/30—Special therapeutic applications
Definitions
- the present invention relates to the field of use of antisense oligonucleotides in the treatment of medical conditions. More specifically, the present invention describes novel antisense oligonucleotides for inhibition of phospholipase A 2 (PLA 2 ) and treatment of conditions associated with the activation of this molecule.
- PPA 2 phospholipase A 2
- Inflammation is the body's response to injury, infection or to molecules perceived by the immune system as foreign. Absent, excessive or uncontrolled inflammation results in a vast array of diseases such as asthma, arthritis and autoimmune diseases, adult respiratory distress syndrome (ARDS), cardiovascular inflammation and gastrointestinal inflammation. Numerous studies have demonstrated the participation of primed neutrophils, monocytes and macrophages in such inflammatory diseases. More recently, the role of superoxides release by microglia cells in the pathogenesis of neurodegenerative diseases such as Alzheimer's disease (AD), Parkinson's disease (PD) and amyotrophic lateral sclerosis (ALS) as well as brain ischemic and traumatic injury has also been documented.
- AD Alzheimer's disease
- PD Parkinson's disease
- ALS amyotrophic lateral sclerosis
- NSAIDs non-steroidal anti-inflammatory drugs
- these drugs reduce only the production of prostaglandins and do not affect the production of leukotrienes which have a pivotal role in the recruitment of neutrophils to the site of inflammation.
- the present inventor has developed a cell line, stable clones of PLB-985 cells lacking the expression of cytosolic phospholipase A 2 (cPLA 2 ), and demonstrated that cPLA 2 , in addition to its known role in the production of pro-inflammatory lipid mediators, is essential for activation of the phagocyte NADPH oxidase complex after its assembly.
- the association between these two enzymes provides the molecular basis for activation of the assembled NADPH oxidase by arachidonic acid (AA) released by cPLA 2 .
- cPLA 2 Since cPLA 2 is required for oxidase activation, its inhibition should not only diminish the formation of inflammatory mediators, but should also regulate the uncontrolled accelerated release of oxygen radicals that participate in the pathogenesis of inflammatory diseases. Moreover, the inventor's studies have shown that during inflammation in vivo or inflammatory conditions in vitro, the level and activity of both cPLA 2 and NADPH oxidase enzymes are elevated, in neutrophils and monocytes [Levy, R. et al. (1994) Biochim. Biophys. Acta 1220:261-265; Shaked, G. et al. (1994) J. Trauma 37:22-29; Levy, R. et al.
- Antisense oligonucleotides targeted against the cPLA 2 mRNA sequence have been reported in the past as capable of inhibiting cPLA 2 transcript expression [U.S. Pat. No. 6,008,344]. However, these oligonucleotides did not demonstrate inhibition of cPLA 2 protein expression, and were introduced into cells in the presence of lipofectin.
- P1 Table 1, SEQ. ID. No. 8 [Roshak, A. (1994) J. Biol. Chem. 269(42): 25999-26005; Muthalif, M. M. et al. (1996) J. Biol. Chem. 271(47): 30149-30157; Marshall, L. (1997) J. Biol. Chem. 272(2): 759-765; Anderson, K. M. et al. (1997) J. Biol. Chem. 272(48): 30504-30511]; P2 (Table 1, SEQ. ID. No. 9) [Li, Q. and Cathcart, M.
- the present invention provides antisense oligonucleotides directed against the open reading frame (ORF) of the cytosolic phospholipase A 2 (cPLA 2 ) mRNA sequence, and functional analogs, derivatives or fragments thereof, wherein the complementarity of said antisense oligonucleotide is within the region between nucleotides 145 to 400 of said ORF, and wherein said antisense oligonucleotide is capable of inhibiting the expression of the cPLA 2 protein.
- ORF open reading frame
- cPLA 2 cytosolic phospholipase A 2
- the antisense oligonucleotide of the invention is from 15 up to 30 nucleotides long, preferably 17 to 21 nucleotides long.
- Said antisense oligonucleotide directed against the 5 region of the open reading frame of the cPLA 2 , mRNA sequence has the sequence as denoted by any one of SEQ. ID. No. 1, SEQ. ID. No. 2, SEQ. ID. No. 3, SEQ. ID. No. 4, SEQ. ID. No. 5, and SEQ. ID. No. 6, and as detailed in Table 1.
- antisense oligonucleotides of the invention can be chemically modified, so as to possess improved endonuclease resistance.
- a phosphorothioate modification may be present on the first three and/or the last three nucleotides of said oligonucleotides.
- another phosphorothioate modification may be found on the tenth nucleotide of said oligonucleotide, as for example in the oligonucleotides denoted by SEQ. ID. Nos. 4 and 5.
- antisense oligonucleotide of the invention further modifications, like 2-O-methylation, may be found in the first three and/or the last three nucleotides of said oligonucleotide.
- the antisense oligonucleotide may be used as an inhibitor of inflammation processes related to cPLA 2 expression.
- the antisense oligonucleotide of the invention is for use in the treatment and/or prevention of any one of rheumatoid arthritis, adult respiratory distress syndrome (ARDS), asthma, rhinitis, idiopathic pulmonary fibrosis, peritonitis, cardiovascular inflammation, myocardial ischemia, reperfusion injury, atherosclerosis, sepsis, trauma, diabetes type retinopathy, psoriasis, gastrointestinal inflammation, cirrhosis and inflammatory bowel disease, and neurodegenerative diseases, such as for example Alzheimer's disease (AD), Parkinson's disease (PD), amyotrophic lateral sclerosis (ALS), as well as brain ischemic and traumatic injury, i.e. in all diseases where oxidative stress has a significant role in its pathogenesis, and in which there is accelerated release of eicosanoids and superoxides by reactive microglia.
- AD Alzheimer's disease
- PD Parkinson's disease
- ALS amyotroph
- the antisense oligonucleotide of the invention may be used for inhibiting superoxide production and release.
- said inhibition is effectuated in neutrophils, monocytes and macrophages, preferably in neutrophils.
- the antisense oligonucleotide of the invention may be labeled with one of fluorescent, radioactive, metal particle, and any suitable labeling means.
- the present invention relates to a pharmaceutical composition
- a pharmaceutical composition comprising as active agent at least one antisense oligonucleotide as defined in the invention, or functional analogs, derivatives or fragments thereof.
- the antisense oligonucleotide of the invention is generally provided in the form of pharmaceutical compositions.
- Said compositions are for use by injection, topical administration, or oral uptake.
- the pharmaceutical composition of the invention may comprise as active agent a combination of at least two antisense oligonucleotides as defined in the invention, or functional analogs, derivatives or fragments thereof.
- said combination comprises the following oligonucleotides: SEQ. ID. No. 1, together with SEQ. ID. No. 3, or SEQ. ID. No. 1 together with SEQ. ID. No. 2, or SEQ. ID. No. 1 together with SEQ. ID. No. 6, or SEQ. ID. No. 1 together with SEQ. ID. No. 2 and SEQ. ID. No. 3, or SEQ. ID. No. 4 together with SEQ. ID. No. 6, or SEQ. ID. No. 2 together with SEQ. ID. No. 6, or SEQ. ID. No. 2 together with SEQ. ID. No. 3, or SEQ. ID. No. 3 together with SEQ. ID. No. 6.
- the pharmaceutical composition of the invention is intended for medical use.
- the pharmaceutical composition of the invention is intended for the treatment of inflammation processes related to cPLA 2 expression and/or free radical release by phagocyte NADPH oxidase.
- the pharmaceutical composition of the invention is intended for the treatment of inflammatory conditions, wherein said inflammatory conditions may be any one of rheumatoid arthritis, ARDS, asthma, rhinitis, idiopathic pulmonary fibrosis, peritonitis, cardiovascular inflammation, myocardial ischemia, reperfusion injury, atherosclerosis, sepsis, trauma, diabetes type II, retinopathy, psoriasis, gastrointestinal inflammation, cirrhosis and inflammatory bowel disease, CNS-related diseases such as the neurodegenerative diseases AD, PD, ALS, as well as brain ischemic and traumatic injury, i.e. in all diseases where oxidative stress has a significant role in its pathogenesis, and in which there is accelerated release of eicosanoids and superoxides by reactive microglia.
- inflammatory conditions may be any one of rheumatoid arthritis, ARDS, asthma, rhinitis, idiopathic pulmonary fibrosis,
- the pharmaceutical composition of the invention is intended for the treatment of conditions related to A ⁇ plaque accumulation.
- Said conditions are generally CNS-related diseases, particularly the neurodegenerative diseases Alzheimer's, Parkinson's and ALS, or brain ischemic and traumatic head injury.
- composition of the invention may optionally further comprise buffers, additives, stabilizers, diluents and/or excipients.
- the present invention provides the use of the antisense oligonucleotide as defined in the invention, for the preparation of a pharmaceutical composition for the treatment and/or prevention of inflammatory conditions, wherein said inflammatory conditions may be any one of rheumatoid arthritis, ARDS, asthma, rhinitis, idiopathic pulmonary fibrosis, peritonitis, cardiovascular inflammation, myocardial ischemia, reperfusion injury, atherosclerosis, sepsis, trauma, diabetes type II, retinopathy, psoriasis, gastrointestinal inflammation cirrhosis and inflammatory bowel disease, neurodegenerative diseases such as AD, PD and ALS, as well as brain ischemic and traumatic injury, i.e. in all diseases where oxidative stress has a significant role in its pathogenesis, and in which there is accelerated release of eicosanoids and superoxides by reactive microglia.
- inflammatory conditions may be any one of rheumatoid arthritis, ARD
- the present invention provides the use of an antisense oligonucleotide as defined in the invention for the treatment of conditions associated with cPLA 2 activation.
- the present invention presents the use of an antisense oligonucleotide as defined in the invention, for the treatment and/or prevention of conditions related to A ⁇ plaque accumulation.
- CNS-related diseases selected from the group consisting of Alzheimer's disease, Parkinson's disease, ALS, brain ischemic injury and traumatic head injury.
- the present invention presents a method of treatment of conditions associated with cPLA 2 activation, comprising administering a therapeutically effective amount of at least one antisense oligonucleotide as defined in the invention, or compositions comprising thereof, to a subject in need.
- the present invention provides a method of treatment of inflammatory conditions, wherein said inflammatory conditions are any one of rheumatoid arthritis, ARDS, asthma, rhinitis, idiopathic pulmonary fibrosis, peritonitis, cardiovascular inflammation, myocardial ischemia, reperfusion injury, atherosclerosis, sepsis, trauma, diabetes type retinopathy, psoriasis, gastrointestinal inflammation, cirrhosis and inflammatory bowel disease, neurodegenerative diseases such as AD, PD and ALS, as well as brain ischemic and traumatic injury, i.e.
- inflammatory conditions are any one of rheumatoid arthritis, ARDS, asthma, rhinitis, idiopathic pulmonary fibrosis, peritonitis, cardiovascular inflammation, myocardial ischemia, reperfusion injury, atherosclerosis, sepsis, trauma, diabetes type retinopathy, psoriasis, gastrointestinal inflammation, cirrhos
- the present invention provides a method of treatment of conditions related to A ⁇ plaque accumulation, comprising administering a therapeutically effective amount of at least one antisense oligonucleotide as defined in the invention, or compositions comprising thereof, to a subject in need.
- Said conditions are generally neurodegenerative diseases, particularly Alzheimer's and Parkinson's disease.
- the present invention provides all in vivo, ex vivo, in vitro method of inhibiting cPLA 2 expression and/or activity, comprising contacting cells, preferably phagocytes, i.e. neutrophils, monocytes, macrophages and/or microglia, with the antisense oligonucleotide described in the invention or with compositions comprising thereof, for a suitable amount of time.
- phagocytes i.e. neutrophils, monocytes, macrophages and/or microglia
- compositions comprising thereof for a suitable amount of time.
- FIG. 1 cDNA Sequence of cPLA2 (SEQ. ID. No. 7), with Position of Antisense Oligonucleotides C2, C3, C4, C8, C9 and C10 Highlighted.
- FIG. 2 Comparison Between Two Anti-cPLA 2 Antibodies (Ab):
- FIG. 2A Levy's Ab [Hazan et al. (1997) id ibid.]
- FIG. 2B commercial antibodies.
- FIGS. 3A-3B Effect of cPLA 2 Antisense PPS Oligonucleotides on cPLA 2 Expression and Superoxide Production in Human Peripheral Blood Monocytes.
- FIG. 3A Western blot analysis showing inhibition of cPLA 2 expression detected by anti-cPLA 2 antibodies after treatment with antisense PPS oligonucleotides C2, C3, C4, C9, and the combination of C2+C4 (2+4), in comparison to control and to the antisense P1 [Roshak, A et al. (1994) id ibid.; Marshall, L. et al. (1997) id ibid.; Muthalif, M. M. et al. (1996) id ibid.; Anderson, K. M. et al. (1997) id ibid.] and P2 [Li, Q. and Cathcart, M. K. (1997) id ibid.].
- FIG. 3B Histogram showing inhibition of superoxide production (SO prod.) by cPLA 2 antisense PPS oligonucleotides C2, C3, C4, C9, and the combination of C2+C4 (2+4), in comparison to control and to the antisense P1 [Muthalif, M. M. et al. (1996) id ibid.; Anderson, K. M. et al. (1997) at ibid.] and P2 [Li, Q. and Cathcart, M. K. (1997) id ibid.].
- FIG. 4A-4B Effect of cPLA 2 , Antisense PPS Oligonucleotides on cPLA 2 Expression and Superoxide Production in Peripheral Blood Human Monocytes.
- FIG. 4A Western blot analysis showing inhibition of cPLA 2 expression detected by anti-cPLA 2 antibodies after treatment with antisense partially phosphorothioated (PPS) oligonucleotides C2, C8, C9, C10 and the combinations C3+C10 and C8+C10, in comparison to control and to the oligonucleotides IS1 and IS2 [U.S. Pat. No. 6,008,344].
- PPS partially phosphorothioated
- FIG. 4B Histogram showing inhibition of superoxide production (SO prod.) by cPLA 2 antisense PPS oligonucleotides C2, C8, C9, C10 and the combinations C3+C10 and C8+C10, in comparison to control (cont.) and to the oligonucleotides IS1 and IS2 [U.S. Pat. No. 6,008,344].
- FIGS. 5A-5C Effect of cPLA 2 Antisense PPS Oligonucleotides on cPLA 2 Expression and Superoxide Production in Peritoneal Murine Macrophages.
- FIG. 5A Western blot analysis showing inhibition of cPLA 2 expression detected by anti-cPLA 2 antibodies after treatment with antisense PPS oligonucleotides C3 and C4 and the combination C3+C4.
- FIG. 5B Histogram showing inhibition of superoxide production by cPLA 2 antisense PPS oligonucleotides C3 and C4 and the combination C3+C4.
- FIG. 5C Histogram showing inhibition of superoxide production by cPLA 2 antisense PPS oligonucleotides C2, C3, C4, C10 and the combinations C2+C10, C3+C10, C4+C10 and C3+C4.
- FIGS. 7A-7C Effect of cPLA 2 Antisense PPS Oligonucleotides on cPLA 2 Expression and Superoxide Production in Peripheral Blood Human Neutrophils.
- FIG. 7A Western blot analysis showing inhibition of cPLA 2 expression detected by anti-cPLA 2 antibodies after treatment with antisense PPS oligonucleotides C2 or C4 and the combination C2+C4.
- the level of cPLA 2 in the different treatment was quantified by densitometry and is presented below the Western blot analysis.
- FIG. 7B Histogram showing inhibition of superoxide production by cPLA 2 antisense oligonucleotides C2, C4 or C10 and the combinations C2+C4, C2+C10, C4+C10, C2+C4+C10 following PMA treatment.
- FIG. 7C Histogram showing inhibition of superoxide production by cPLA 2 antisense oligonucleotides C2, C4 or C10 and the combinations C2+C4, C2+C10, C4+C10, C2+C4+C10 following OZ treatment.
- FIG. 8A-F Inhibition of Superoxide Production Stimulated by Physiologic Agonists Following cPLA 2 Antisense PPS Oligonucleotides Treatment in Neutrophils and Macrophages.
- FIG. 8A Histogram Showing Inhibition of Superoxide Production in PMA-Stimulated Neutrophils Following 6 Hours of Incubation with the cPLA 2 Antisense PPS Oligonucleotides C3 or C4.
- FIG. 8B Histogram showing inhibition of superoxide production in fMLP-stimulated neutrophils following 4 hours of incubation with the cPLA 2 antisense PPS oligonucleotides C3 or C4.
- FIG. 8C Histogram showing inhibition of superoxide production in OZ-stimulated neutrophils following 4 hours of incubation with the cPLA 2 antisense PPS oligonucleotides C3 or C4.
- FIG. 8D Histogram showing inhibition of superoxide production in PMA-stimulated monocytes following 16 hours of incubation with the cPLA 2 antisense PPS oligonucleotides C3 or C4.
- FIG. 8E Histogram showing inhibition of superoxide production in cPLA 2 stimulated monocytes following 16 hours of incubation with the cPLA 2 antisense PPS oligonucleotides C3 or C4.
- FIG. 8F Histogram showing inhibition of superoxide production in OZ-stimulated monocytes following 1.6 hours of incubation with the cPLA 2 antisense PPS oligonucleotides C3 or C4.
- FIGS. 9A-9D Inhibition of Stimulated Superoxide Production in Rat Microglia by cPLA 2 Antisense PPS Oligonucleotides.
- FIG. 9A Western blot analysis showing inhibition of cPLA 2 expression detected by anti-cPLA 2 antibodies after treatment with antisense PPS oligonucleotides C2 or C4.
- FIG. 9B Graph demonstrating the kinetics of the inhibition of superoxide production in PMA-activated rat microglia cells following treatment with the cPLA 2 antisense oligonucleotides C2, C4, C8 or C10, and the combinations C2+C10 or C4+C10.
- FIG. 9C Histogram showing the effect of cPLA 2 antisense PPS oligonucleotides (C2, C4, C8 and C10, and the combinations C2+C10 and C4+C10) on superoxide production in rat microglia cells following PMA stimulation.
- FIG. 9D Histogram showing the effect of cPLA 2 antisense PPS oligonucleotides (C2, C4, and C10, and the combinations C2+C10 and C2+C4) on superoxide production in rat microglia cells following Amyloid ⁇ stimulation.
- FIGS. 10A-10C Animal Model of Collagen-Induced Arthritis (CIA)
- FIG. 10A A picture of exacerbated CIA in experimental compared to control (cont.) mice.
- FIG. 10B Histological assessment of representative section of joint histopathology on whole paws of CIA mice compared to control (cont.) ( ⁇ 100).
- FIG. 10C Infiltration of inflammatory cells ( ⁇ 400) in CIA mice.
- FIGS. 11A-11B Treatment with a Combination of 3 cPLA 2 Antisense PPS Oligonucleotides (“Cocktail”) Caused Remission of Arthritis.
- FIG. 11B Reduction in disease severity score (dis. sev. sc.), in serum (ser.) IL-6 and in serum TNF ⁇ after i.v. treatment with the cocktail (mean ⁇ SEM, from 5 mice in each group).
- FIGS. 12A-12B Number and Composition of Peritoneal Cell Population after Induction of Sterile Peritonitis.
- FIG. 12A Changes in peritoneal cell count in sterile peritonitis mice (mean ⁇ SEM, from 6 mice in each group).
- FIG. 12B Changes in the composition of the peritoneal cell population in sterile peritonitis mice.
- FIGS. 13A-13B LTB 4 Levels after Induction of Sterile Peritonitis.
- FIG. 13A LTB 4 levels in the serum (ser.).
- FIG. 13B LTB 4 levels in the peritoneal cavity (per. cav.).
- FIGS. 14A-14C The Effect of Antisense PPS Oligonucleotide Cocktail Treatment on Peritoneal Cell Population and Activity after 24 Hours of Induction.
- FIG. 14B Graph demonstrating cell count (ce. co.).
- FIG. 14C Superoxide production (SO prod.) by stimulated peritoneal cells of control healthy mice (H), of sterile peritonitis mice (P) and of sterile peritonitis mice after 24 h of cocktail i.v. injection (P+AS).
- H control healthy mice
- P sterile peritonitis mice
- P+AS cocktail i.v. injection
- FIGS. 15A-15B cPLA 2 Antisense PPS Oligonucleotide Cocktail Treatment Decreased Neutrophils Number and Superoxide Production in Inflammation Site 24 Hours after Peritonitis Induction.
- FIG. 15A Graph demonstrating percentage of neutrophils (neu) with and without antisense treatment.
- FIG. 15B Graph presenting stimulated superoxide production (SO prod.) by PMA of peritoneal cells isolated from sterile peritonitis mice without and with antisense treatment.
- FIG. 16 cPLA 2 Antisense PPS Oligonucleotide Cocktail Treatment Decreased Unstimulated Superoxide Production by Resting Peritoneal Cells in Inflammation Site 24 Hours after Peritonitis Induction.
- FIG. 17A-17B Effect of cPLA 2 Antisense PPS Oligonucleotide Cocktail Treatment on the Peritoneal Cell Composition in Mice with Sterile Peritonitis.
- FIG. 17A Peritoneal cell composition during sterile peritonitis.
- FIG. 17B Peritoneal cell composition post antisense treatment.
- FIGS. 18A-18B Effect of cPLA 2 Antisense PPS Oligonucleotide Treatment on Stimulated Superoxide Production (SO Prod.) by Peritoneal Cells During Sterile Peritonitis.
- FIG. 18A Stimulated superoxide production by peritoneal cells in mice with sterile peritonitis.
- FIGS. 19A-19B cPLA 2 Antisense PPS Oligonucleotide Cocktail Treatment Decreased Peritoneal LTB 4 Levels.
- FIG. 19A LTB 4 levels in the peritoneum of sterile peritonitis mice.
- FIG. 19B LTB 4 levels in the peritoneum of sterile peritonitis mice treated with the cocktail.
- FIGS. 20A-20B cPLA 2 Antisense PPS Oligonucleotide Cocktail Treatment Decreased Peritoneal Neutrophils Count.
- FIG. 20A Number of neutrophils (Neu No) in the peritoneum of sterile peritonitis mice.
- FIG. 20B Number of neutrophils (Neu No) in the peritoneum of sterile peritonitis mice treated with the cocktail.
- FIGS. 21A-21B Accumulation of Antisense Oligonucleotides in Peritoneal Blood Cells 24 Hours after Injection.
- FIG. 21A Peritoneal blood cells, untreated.
- FIG. 21B Peritoneal blood cells treated with the antisense (as) oligonucleotides.
- Upper panel light microscope.
- Lower panel confocal microscopy.
- each antisense by itself is significantly potent in inhibiting the expression of cPLA 2 , while different combinations of the oligonucleotides totally inhibited cPLA 2 expression in the different phagocytic, as well as microglia cells from humans, mice and rats.
- cPLA 2 cytosolic phospholipase A 2
- the present invention provides antisense oligonucleotides directed against the open reading frame (ORF) of the cPLA 2 mRNA sequence (indicated in FIG. 1 ), and functional analogs, derivatives or fragments thereof, wherein the complementarity of said antisense oligonucleotide is within the region between nucleotides 145 to 400 of said ORF, and wherein said antisense oligonucleotide is capable of inhibiting the expression of the cPLA 2 protein.
- ORF open reading frame
- the antisense oligonucleotides provided by the invention can also inhibit superoxide production by inhibiting NADPH oxidase activity.
- SEQ. ID. No. 7 relates to the cDNA sequence corresponding to the cPLA 2 mRNA sequence [GenBank No. M68874].
- Said region between nucleotides 145 to 400 of the cPLA 2 mRNA is particularly useful for targeting, since it is much more efficient to prevent than to halt protein synthesis, once the process has already begun (the latter being the strategy used in U.S. Pat. No. 6,008,344, for most of its cPLA 2 antisense sequences). Therefore, the antisense oligonucleotides were designed as to target the region of translation site (beginning of the ORF).
- antisense targeting is still very empirical, and a lot of experimentation is needed to find the specific sequence and the optimum conditions for most effective targeting.
- the present inventors originally designed fourteen antisense oligonucleotides targeting the region between nucleotides 1.45-400 of the cPLA 2 sequence, corresponding to the beginning of the ORF, but only six of those worked efficiently, and were then studied in more detail.
- Said antisense oligonucleotide directed against the 5′ region of the open reading frame of the cPLA 2 mRNA sequence has the sequence as denoted by any one of SEQ. ID. No. 1, SEQ. ID. No. 2, SEQ. ID. No. 3, SEQ. ID. No. 4, SEQ. ID. No. 5, and SEQ. ID. No. 6, which sequences are detailed in Table 1.
- the antisense oligonucleotides of the invention can be chemically modified, so as to possess improved endonuclease resistance. Any chemical modification which confers resistance towards endonucleases, such as, but not limited to phosphorothioation or 2-O-methylation, may be adopted.
- a phosphorothioate modification may be present on the first three and/or the last three nucleotides of the oligonucleotides of the invention.
- another phosphorothioate modification may be found on the tenth nucleotide of said oligonucleotide, an inner pyrimidine, as for example in the oligonucleotides denoted by SEQ. ID. Nos. 4 and 5.
- Phosphorothioation of inner pyrimidines has been shown to increase stability and protect from endonuclease cleavage [Pirollo, K. F. et al. (2003) Pharmacology & Therapeutics 99:55-77].
- the antisense oligonucleotides of the invention are partially phosphorothioated, and are thus less toxic than antisense oligonucleotides that have phosphorothioate modifications in all nucleotides.
- the antisense oligonucleotides of the invention may be used as inhibitors of inflammation processes related to cPLA 2 expression and activity.
- the antisense oligonucleotide of the invention is thus suitable for use in the treatment and/or prevention of any one of rheumatoid arthritis, ARDS, asthma, rhinitis, idiopathic pulmonary fibrosis, peritonitis, cardiovascular inflammation, myocardial ischemia, reperfusion injury, atherosclerosis, sepsis, trauma, diabetes type II, retinopathy, psoriasis, gastrointestinal inflammation, cirrhosis and inflammatory bowel disease, neurodegenerative diseases such as AD, PD and ALS, as well as brain ischemic and traumatic injury, i.e. in all diseases where oxidative stress has a significant role in its pathogenesis, and in which there is accelerated release of eicosanoids and superoxides by reactive microglia.
- the present inventors have now demonstrated that the antisense oligonucleotides, which were efficient in inhibiting cPLA 2 expression in mice macrophages, were also efficient in inhibiting superoxide production in macrophages, as well as in monocytes, neutrophils and microglia cells.
- This disparity may be explained by the fact that often “knockout” animal models have normal phenotypes due to, for example, over expression and compensation of isoenzymes, and thus do not accurately mirror the effects of the lack of the gene (i.e., the protein or enzyme) in study.
- the present results were obtained using low levels of oligonucleotides of 1 ⁇ M (final concentration).
- the present antisense oligonucleotides are effective at low, non-toxic concentrations, which makes them suitable for use in clinical purposes, i.e., as a therapeutic agent for the treatment of conditions where inhibition of cPLA 2 is desirable, as discussed herein.
- the antisense oligonucleotides of the invention are suitable for use in the treatment and/or prevention of conditions in which microglia cells are activated, for example by LPS, and release reactive oxygen species (ROS) and/or pro-inflammatory mediators, for example.
- Said conditions are selected from the group consisting of inflammations, infections, and ischemic disease.
- the antisense oligonucleotide of the invention may also be used for inhibiting superoxide production and release. Usually, said inhibition is effectuated in neutrophils, monocytes and macrophages, preferably in neutrophils.
- neutrophils are the first cells arriving at the inflammation site, which then release high levels of eicosanoid and superoxides which accelerates the inflammatory process. Consequently, neutrophils are direct effectors of the pathogenesis of the various inflammatory diseases, and directly inhibiting their function is an efficient way to reduce inflammatory processes. Monocytes (and macrophages) are the second cell population to arrive at the site of inflammation, and thus their inhibition is also important to stall inflammation.
- the antisense oligonucleotides of the invention may be used for inhibiting eicosanoid and ROS production released by microglia that are induced by amyloid ⁇ (A ⁇ ) plaque formation or by other agents such as LYS or cytokines. ROS formation has been shown to be responsible for the dysfunction or death of neuronal cells that contributes to the pathogenesis of various neurological diseases.
- analogs and derivatives is meant the “fragments”, “variants”, “analogs” or “derivatives” of said nucleic acid molecule.
- a “fragment” of a molecule such as any of the oligonucleotide sequences of the present invention, is meant to refer to any nucleotide subset of the molecule.
- a “variant” of such molecule is meant to refer a naturally occurring molecule substantially similar to either the entire molecule or a fragment thereof.
- An “analog” of a molecule can be without limitation a paralogous or orthologous molecule, e.g. a homologous molecule from the same species or from different species, respectively, i.e., an antisense oligonucleotide complementary to the equivalent region of the gene in a different species, which therefore may have slight changes in the sequence.
- antisense oligonucleotides of the invention are those labeled, or conjugated to a reporter molecule, such that the antisense oligonucleotide of the invention may be traced and/or detected in the organism.
- a reporter molecule such that the antisense oligonucleotide of the invention may be traced and/or detected in the organism.
- Any label or reporter molecule that allow its detection may be suitable, like e.g.
- Dabcyl 4-(4′-Dimethylamino-phenylazo)sulfonic acid (sulfonyl chloride)
- Dabsyl 5-((2-aminoethyl)-amino)-naphtalene-1-sulfonic acid
- the present invention relates to a pharmaceutical composition
- a pharmaceutical composition comprising as active agent at least one antisense oligonucleotide as defined in the invention, or functional analogs, derivatives or fragments thereof.
- the antisense oligonucleotide of the invention is generally provided in the form of pharmaceutical compositions.
- Said compositions are for use by injection, topical administration, or oral uptake.
- the pharmaceutical composition of the invention may comprise as active agent a combination of at least two antisense oligonucleotides as defined in the invention, or functional analogs, derivatives or fragments thereof.
- said combination comprises the following oligonucleotides: SEQ. ID. No. 1 together with SEQ. ID. No. 3, or SEQ. ID. No. 1 together with SEQ. ID. No. 2, or SEQ. ID. No. 1 together with SEQ. ID. No. 6 or SEQ. ID. No. 1 together with SEQ. ID. No. 2 and SEQ. ID. No. 3, or SEQ. ID. No. 4 together with SEQ. ID. No. 6, or SEQ. ID. No. 2 together with SEQ. ID. No. 6, or SEQ. ID. No. 2 together with SEQ. ID. No. 3, or SEQ. ID. No. 3 together with SEQ. ID. No. 6.
- the pharmaceutical composition of the invention is intended for the treatment of inflammation processes related to cPLA 2 expression and/or free radical release by phagocyte NADPH oxidase.
- the pharmaceutical composition of the invention is intended for the treatment of inflammatory conditions, wherein said inflammatory conditions may be any one of rheumatoid arthritis, ARDS, asthma, rhinitis, idiopathic pulmonary fibrosis, peritonitis, cardiovascular inflammation, myocardial ischemia, reperfusion injury, atherosclerosis, sepsis, trauma, diabetes type II, retinopathy, psoriasis, gastrointestinal inflammation, cirrhosis and inflammatory bowel disease, neurodegenerative diseases such as AD, PD and ALS, as well as brain ischemic and traumatic injury, i.e. in all diseases where oxidative stress has a significant role in its pathogenesis, and in which there is accelerated release of eicosanoids and superoxides by reactive microglia.
- inflammatory conditions may be any one of rheumatoid arthritis, ARDS, asthma, rhinitis, idiopathic pulmonary fibrosis, peritonitis,
- the pharmaceutical composition of the invention is intended for the treatment of conditions related to A ⁇ plaque accumulation.
- Said conditions are generally neurodegenerative diseases, preferably Alzheimer's, Parkinson's, ALS, or brain ischemic and, traumatic injury.
- the pharmaceutical composition of the invention is also intended to be used in the treatment and/or prevention of conditions, for example exposure to LYS, in which microglia cells are activated and release ROS and/or pro-inflammatory mediators (eicosanoid). Said conditions are selected from the group consisting of inflammations, infections, and ischemic disease.
- Preferred uses of the pharmaceutical compositions of the invention by injection are subcutaneous injection, intraperitoneal injection, intravenous and intramuscular injection.
- the pharmaceutical composition of the invention generally further comprises diluent, and/or a buffering agent, i.e. an agent which adjusts the osmolarity thereof, and optionally, one or more carriers, stabilizers, excipients and/or additives as known in the art, e.g., for the purposes of adding flavors, colors, lubrication, or the like to the pharmaceutical composition.
- a buffering agent i.e. an agent which adjusts the osmolarity thereof
- carriers stabilizers, excipients and/or additives as known in the art, e.g., for the purposes of adding flavors, colors, lubrication, or the like to the pharmaceutical composition.
- a preferred buffering agent is Tris, consisting of 10 mM Tris, pH 7.5-8.0, which solution is also adjusted for osmolarity.
- the antisense oligonucleotides are suspended distilled water or in sterile saline.
- Carriers may include starch and derivatives thereof, cellulose and derivatives thereof, e.g., microcrystalline cellulose, xantham gum, and the like.
- Lubricants may include hydrogenated castor oil and the like.
- compositions are well known in the art and has been described in many articles and textbooks, see e.g., Remington's Pharmaceutical Sciences, Gennaro A. R. ed., Mack Publishing Co., Easton, Pa., 1990, and especially pp. 1521-1712 therein.
- compositions for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders.
- Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable.
- compositions for oral administration include powders or granules, suspensions or solutions in water or non-aqueous media, capsules, sachets or tablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders may be desirable.
- compositions and formulations for parenteral, intrathecal or intraventricular administration may include sterile, aqueous solutions which may also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.
- compositions of the present invention include, but are not limited to, solutions, emulsions, and liposome-containing formulations. These compositions may be generated from a variety of components that include, but are not limited to, preformed liquids, self-emulsifying solids and self-emulsifying semisolids.
- compositions of the present invention may be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In, general the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product. Such compositions may be formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, liquid syrups, soft gels, suppositories, and enemas.
- the compositions of the present invention may also be formulated as suspensions in aqueous, non-aqueous or mixed media. Aqueous suspensions may further contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran. The suspension may also contain stabilizers.
- the pharmaceutical compositions may be formulated and used as foams.
- Pharmaceutical foams include formulations such as, but not limited to, emulsions, microemulsions, creams, jellies and liposomes. While basically similar in nature these formulations vary in the components and the consistency of the final product.
- composition of the invention may further comprise other active agents, e.g. antibiotics, analgesics and the like.
- the present invention provides the use of the antisense oligonucleotide as defined in the invention, for the preparation of a pharmaceutical composition for the treatment and/or prevention of inflammatory conditions, wherein said inflammatory conditions may be any one of rheumatoid arthritis, ARDS, asthma, rhinitis, idiopathic pulmonary fibrosis, peritonitis, cardiovascular inflammation, myocardial ischemic, reperfusion injury, atherosclerosis, sepsis, trauma, diabetes type retinopathy, psoriasis, gastrointestinal inflammation, cirrhosis and inflammatory bowel disease neurodegenerative diseases such as AD, PD, and ALS, as well as brain ischemic and traumatic injury, i.e. in all diseases where oxidative stress has a significant role in its pathogenesis, and in which there is accelerated release of eicosanoids and superoxides by reactive microglia.
- inflammatory conditions may be any one of rheumatoid arthritis, ARDS
- the present invention provides the use of an antisense oligonucleotide as defined in the invention for the treatment of conditions associated with cPLA 2 activation, as well as for the treatment and/or prevention of conditions related to A ⁇ plaque accumulation.
- said conditions are neurodegenerative diseases, selected from the group consisting of Alzheimer's disease, Parkinson's disease, ALS, and brain ischemic and traumatic injury.
- the present invention presents a method of treatment of conditions associated with cPLA 2 activation, comprising administering a therapeutically effective amount of at least one antisense oligonucleotide as defined in the invention, or compositions comprising thereof, to a subject in need.
- Said therapeutic effective amount, or dosing is dependent on severity and responsiveness of the disease state to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of the disease state is achieved.
- Optimal dosing schedules can be calculated from measurements of drug accumulation in the body of the patient. Persons of ordinary skill can easily determine optimum dosages, dosing methodologies and repetition rates. Optimum dosages may vary depending on the relative potency of individual oligonucleotides, and can generally be estimated based on EC 50 , found to be effective in in vitro as well as in in vivo animal models.
- dosage is from 0.01 ⁇ g to 10 mg per kg of body weight, and may be given once or more daily, weekly, monthly or yearly, or even once every 2 to 20 years. Persons of ordinary skill in the art can easily estimate repetition rates for dosing based on measured residence times and concentrations of the antisense oligonucleotide in bodily fluids or tissues.
- oligonucleotide is administered in maintenance doses, ranging from 0.01 ⁇ g to 10 mg per kg of body weight, once or more daily.
- optimal dosage used for treatment of the inflammatory conditions is 1-2 mg/kg/day given daily for between 5 up to 14 days (Example 5), or given in one or two doses of 1-2 mg/kg/day after inflammation (Examples 6 and 7).
- antisense oligonucleotides for inhibiting cPLA 2 expression is an innovative treatment for local inflammatory diseases, since it will inhibit specifically the elevated cPLA 2 at the site of inflammation and will not affect normal cPLA 2 expression. This treatment is potentially even more effective when affecting also the activity of activated or primed phagocytes involved in the pathogenesis of such diseases, since these cells secrete high levels of eicosanoids and superoxides, which accelerate the inflammation process.
- the present invention also provides a method of treatment of inflammatory conditions, wherein said inflammatory conditions are any one of rheumatoid arthritis, ARDS, asthma, rhinitis, idiopathic pulmonary fibrosis, peritonitis, cardiovascular inflammation, myocardial ischemia, reperfusion injury, atherosclerosis, sepsis, trauma, diabetes type II, retinopathy, psoriasis, gastrointestinal inflammation, cirrhosis and inflammatory bowel disease, neurodegenerative diseases such as AD, PD and ALS, as well as brain ischemic and traumatic injury, i.e.
- inflammatory conditions are any one of rheumatoid arthritis, ARDS, asthma, rhinitis, idiopathic pulmonary fibrosis, peritonitis, cardiovascular inflammation, myocardial ischemia, reperfusion injury, atherosclerosis, sepsis, trauma, diabetes type II, retinopathy, psoriasis, gastrointestinal inflammation
- cPLA 2 antisense oligonucleotides may be used in the treatment of neurodegenerative diseases, selected from the group consisting of Alzheimer's disease, Parkinson's disease, ALS, and brain ischemic and traumatic injury.
- the present invention also provides a method for the treatment and/or prevention of conditions in which microglia cells are activated, exposed to LPS for example, and release ROS and/or pro-inflammatory mediators, and wherein aid conditions are selected from the group consisting of inflammations, infections, and ischemic disease.
- Said method comprises administering a therapeutically effective amount of at least one antisense oligonucleotide as defined in the invention, or compositions comprising thereof, to a subject in need.
- the present invention provides a method of treatment of neurodegenerative diseases, as well as brain damage (caused by stroke or trauma, for example), comprising administering a therapeutically effective amount of at least one antisense oligonucleotide as defined in the invention, or compositions comprising thereof, to a subject in need.
- Said conditions are generally neurodegenerative diseases, preferably Alzheimer's and Parkinson's disease, or brain ischemic and traumatic injury, in which there is accelerated release of eicosanoid and superoxides by reactive microglia.
- Oligonucleotides may be delivered via, intravenous (i.v.), intramuscular (i.m.) intraperitoneal (i.p.) injections, orally (in liquid form or prepared as dosage unit forms like capsules, pills, lozenges, etc.).
- oligonucleotides should be prepared in a way that would enable their stability in the system following injection, or vet more preferably, following oral administration.
- the oligonucleotides of the invention may also be delivered via transdermal delivery using patches, ointment or cream.
- compositions comprising as active agent the antisense oligonucleotides described, in the present invention may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including ophthalmic and to mucous membranes including vaginal and rectal delivery), pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal), oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., intrathecal or intraventricular, administration. Oligonucleotides with at least one 2′-O-methoxyethyl modification are believed to be particularly useful far oral administration.
- oligonucleotides against cPLA 2 were originally synthesized. Prior to use, the oligonucleotides were purified by HPLC and tested for purity by mass spectrometry (Sigma, UK). Prior to selection, the sequences were analyzed by screening for uniqueness using the Blast program and were also tested for lack of secondary structure and oligo pairing using Mulfold [Jaeger, J. A. (1989) Methods Enzymol. 183: 281-306].
- oligonucleotides carried phosphorothioate modifications on the last 3 bases at both 5′ and 3′ ends (as indicated by underline, Table 1), and were engineered using computer based approach using RNADraw V1.1 [Mazura Multimedia. Sweden] for the first 400 hundred base pairs (N-terminal) of cPLA 2 mRNA (Table 1).
- PPS partially phosphorothioated oligonucleotides
- Some PPS contain GGGG (C10) and GGG (C8 and C9) which have been shown to increase cellular uptake (see Table 1).
- PPS C8, C9 also contain phosphorothioated on inner pyrimidines (t) which have been shown to increase stability and protect from endonuclease cleavage (Table 1, underlined). Five of the antisense oligonucleotides did not contain CpG, which have been shown to stimulate immune responses.
- naked PPS were added since in this form they can be used for in vivo treatment [Pirollo. K. F. et al. (2003) id ibid.], in contrast to the published studies in vitro, which used different delivery systems to increase the antisense uptake.
- all the clinical trials with antisense oligonucleotides are carried out with naked oligonucleotides.
- an in vivo clinical trial did not require cationic lipids for oligonucleotide delivery against Bcl-2 in cancer patients, in contrast to the experiments performed in tissue culture [Jansen, B. et al. (2000) Lancet 356: 1728-1733].
- the PPS antisense oligonucleotides of the invention are far more efficient than those previously reported [U.S. Pat. No. 6,008,334; Roshak et al. (1994) id ibid; Muthalif et al. (1996) id ibid; Marshall et al (1997) id ibid; Anderson et al, (1997) id ibid; Li, Q. and Cathcart, M. K. (1997) id ibid.; Zhao. X. et al. (2002) id ibid.]. Moreover, in the previous reports, these antisense oligonucleotides were tested only for their capacity to inhibit mRNA synthesis [U.S. Pat. No. 6,008,334]
- the PPS antisense oligonucleotides were more efficient in inhibiting cPLA 2 protein expression in the phagocytic cells, as shown for monocytes, than endothelial or epithelial cells (data not shown). This phenomenon has advantages especially regarding treatment of inflammation directly affecting the phagocyte at the site of inflammation, without affecting the organ.
- cPLA 2 protein was analyzed by Western blot analysis using antibodies against cPLA 2 that were raised by the inventors and which are much more efficient than those available on the commercial market ( FIG. 2 ).
- PPS antisense oligonucleotides were studied in peripheral blood human monocytes ( FIGS. 3 and 4 ) and in murine macrophages ( FIG. 5 ). Naked (free of transfection solutions like lipofectin, etc.) PPS antisense oligonucleotides (final concentration of 1 ⁇ M) were added to the cell suspension in RPMI containing 10% FCS for 16 h at 37° C. The same cells were analyzed for superoxide production stimulated with 5 ng/ml PMA (by cytochrome c reduction) and for the expression of cPLA 2 in cell lysates (by Western blot analysis).
- each of the PPS antisenses caused between 50-75% inhibition of superoxide production, which is in correlation with their effect on inhibiting cPLA 2 expression.
- the level of cPLA 2 was quantitated by densitometry in a reflectance mode (Hoefer, Hoefer Scientific Instruments, San Francisco, USA). The correlation between these two parameters is demonstrated in FIG. 6 .
- FIGS. 2 and 3 demonstrate that the antisense oligonucleotides synthesized (and claimed) by the inventor are superior to the oligonucleotides described in the literature. In particular, it may be highlighted that the former are:
- antisense oligonucleotides are especially preferred, compared to P1, P2, IS1 and IS2 since they may be introduced into the cells and perform their activity without cell delivery systems like lipofectin.
- the effect of the antisenses and their combinations was studied on microglia isolated from rat brain.
- the PPS antisense oligonucleotides were added (at 1 ⁇ M final concentration) to microglia cells for 16 h (similar to the conditions used for monocytes).
- the cells were stimulated with 2 mg/ml PMA or with 10 ⁇ M of Amyloid ⁇ , and superoxide production was analyzed by the fluorescence probe Amplex Red.
- the antisenses caused significant inhibition of superoxide production, in correlation with cPLA 2 protein expression.
- antisense C8 which did not, match the rat sequence by 1 base, did not cause inhibition of superoxide production, indicating the high specificity of the antisenses. Inhibition was much higher when the cells were stimulated with Amyloid ⁇ . Incubation of microglia for 48 h with the antisense oligonucleotides caused higher inhibition of cPLA 2 expression and of superoxide production (data not shown). The results are of particular importance since Amyloid ⁇ plays an important role in the pathogenesis of brain and neurodegenerative diseases, such as Alzheimer.
- Collagen-induced arthritic is an experimental in odd of autoimmune arthritis that has many clinical and pathological similarities to rheumatoid arthritis (RA), CIA is induced, by immunizing susceptible animals (e.g. DBA black mice) with type II collagen (CII) as described [Bendele, A. M. et al. (2000) Arthritis & Rheumatism, 43:2648-58]. All mice were maintained in a specific pathogen-free environment, and fed standard mouse chow and water. Chick CII (Sigma-Aldrich, 2 mg/ml) was dissolved overnight at 4° C. in 10 mM acetic acid and combined with an equal volume of CFA (complete Freund's adjuvant).
- CFA complete Freund's adjuvant
- Fluid from animal paws was aspirated to determine cytokines (mRNA and protein level) and white blood cells. After sacrifice, paws were collected, fixed, decalcified, and paraffin embedded. Sections were stained with hematoxylin and eosin and scored according to the following scale: 0, no inflammation; 1, slight thickening of the synovial cell layer and/or seine inflammatory cells in the sublining; 2, thickening of the synovial lining, infiltration of sublining, and localized cartilage erosions; and 3, infiltration in the synovial space, pannus formation, cartilage destruction, and bone erosion.
- ELISA for antibodies to CII was performed by HRP-conjugated secondary antibody specific for IgG1, IgG2a, IgG2b, IgG3, or IgM and IgA.
- Synovial fluid leukocytes were obtained from synovial effusions and purified by Ficoll-Hypaque density gradient centrifugation.
- the model of CIA was successfully developed by the inventors, as demonstrated, e.g. by the swollen limb of an exacerbated CIA mouse compared to the limb of a control mouse ( FIG. 10A ). Histological assessment of the CIA mouse limb FIG. 10B ) was in correlation with the severity of arthritis, monitored by direct examination of the limb as presented in FIG. 10A . Infiltration of inflammatory cells (especially neutrophils) is shown in a joint section of a CIA mouse ( FIG. 10C ). CIA mice showed severe difficulties in walking (data not shown).
- the optimal concentration of 2 mg/Kg was defined, for a combination of 3 different PPS ( 2 , 4 and 10 ), also referred to herein as cocktail. This concentration is within the range used for human therapy and in animal models.
- sterile stock of antisenses 100 ⁇ M is dissolved in sterile saline at the desired concentrations, and injected to sick mice either i.v., intradermally at the base of the tail, or at the inflamed joints.
- FIG. 11 intravenous injection of 2 mg/kg of the “cocktail” every day for 14 days caused significant remission of the arthritis, as detected by a reduction in swelling of the limb ( FIG. 11A ), by disease severity score, by full recovery of the mice ability to move and to run freely (data not shown), and by reduction in serum IL-6 and TNF ⁇ levels ( FIG. 11B ).
- Model mice peritonitis is being developed in CD1 mice by injection of Candia as previously described [Levy, R. et al. (1989) J. Biol. Regul. Homeost. R Agents 3:5-12], or by injection of different doses of gram positive bacteria peritonitis will be induced with lethal doses of candida or bacteria ( S. epidermitis ) or gram negative ( E. Coli ) which cause animal killing and with moderate doses which cause a moderate disease. The 50% lethal doses were determined as 6 ⁇ 10 8 CFU for S. epidermitis and 1.5 ⁇ 10 7 for E. coli .
- a model of sterile peritonitis was developed in ICR mice by intraperitoneal injection of 3 ml sterile 4% thioglycollate (TG) as described previously [Segal, B. H. et al. (2002) J Leukoc Biol 71:410].
- Assessment of inflammation was determined by the number and population of blood cells in the peritonitis cavity, the concentration of LTB 4 and the presence of inflammatory cytokines, TNF ⁇ and IL6, in cell free peritoneal fluid and in serum. 10 ml of sterile PBS were injected to the peritoneal cavity in order to collect the cells. The number of cells was determined by microscopy after trypan blue staining.
- the composition of the cell population was determined by FACS using antibodies against anti mouse neutrophils (MCA771F), anti mouse macrophages (F4/80) and anti mouse lymphocytes (CD3).
- the composition of the cell population was also determined under microscopy after Giemsa staining.
- FIGS. 12A-12B present the changes in white blood cell count ( FIG. 12A ) and cell population ( FIG. 12B ) during 4 days of sterile peritonitis. High levels of neutrophils were detected 24 h after TG injection, which were later replaced by monocyte macrophages. There was it significant elevation in stimulated phagocyte superoxide production, with the highest rate at 24 h post peritonitis induction.
- FIGS. 13A-13B The levels of LTB4 in the serum and in the peritoneal cavity during 24 h of sterile peritonitis are demonstrated in FIGS. 13A-13B .
- a similar pattern was observed in the peritoneal cavity, but the decay was slower and only after 24 h, LTB4 ceased, to be detected.
- the first cells to accumulate in the peritonitis model were neutrophils.
- the effect of the antisense oligonucleotides was analyzed primarily on neutrophil accumulation and activity, after 24 h of induction of sterile peritonitis.
- Two doses of a specific combination of PPS antisense oligonucleotides against cPLA 2 (the “cocktail”) dissolved in sterile water (0.2 ml) were administered i.v. in the tail of the mice 1 h and 4 h after induction of peritonitis.
- thecocktail sterile water
- FIGS. 21A-21B Accumulation of antisense oligonucleotides in peritoneal blood cells 24 h after i.v. injection was detected using fluorescently labeled antisense oligonucleotides (labeled with FITC at the last nucleotide) ( FIGS. 21A-21B ). Distribution of the fluorescent antisense oligonucleotides in the different organs by histological section was also analyzed (data not shown). In further experiments, different antisense overdoses were administered, in order to determine their toxicity. A cocktail ⁇ 100 was not toxic to the mice (data not shown).
- mice are anesthetized and mechanically ventilated. During the experiments, oxygen gas is supplied continuously to the ventilatory system.
- One minute prior to intravenous (i.v.) administration two deep inhalations (3 ⁇ tidal volume) are delivered to standardize volume history and measurements are made as baseline.
- Mice then receive 3 mg/kg of LPS from Escherichia coli O111:B4 (Sigma Chemical Co., St. Louis, Mo.) i.v.
- 10 mg/kg of zymosan A from Saccharomyces cerevisiae (Sigma) are administered i.v.
- animals receive saline instead of LPS and zymosan in the same manner, and serve as controls.
- EL measurement is a physiologic parameter to assess acute lung injury.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Biomedical Technology (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Neurosurgery (AREA)
- Neurology (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Pulmonology (AREA)
- Diabetes (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Virology (AREA)
- Microbiology (AREA)
- Rheumatology (AREA)
- Communicable Diseases (AREA)
- Oncology (AREA)
- Heart & Thoracic Surgery (AREA)
- Dermatology (AREA)
- Cardiology (AREA)
- Pain & Pain Management (AREA)
- Emergency Medicine (AREA)
Abstract
Description
| TABLE 1 | |
| Oligonucleotides used in the following examples | |
| Sequence | Sequence | |||
| Oligon. | 5′-3′ | Reference | ID. No. | |
| C2 | ttcaaaggtctcattccaca | — | SEQ. ID. | |
| No. 1 | ||||
| C3 | cactataatgtgctggtaag | — | SEQ. ID. | |
| No. 2 | ||||
| C4 | caaaacattttcctgattagg | — | SEQ. ID. | |
| No. 3 | ||||
| C8 | cacagggtttatgtcattat | — | SEQ. ID. | |
| No. 4 | ||||
| C9 | ccgtaaacttgtgggaatac | — | SEQ. ID. | |
| No. 5 | ||||
| C10 | gctgtcaggggttgtag | — | SEQ. ID. | |
| No. 6 | ||||
| P1 | gtaaggatctataaatgacat | [Roshak et | SEQ. ID. | |
| al. (1994) | No. 8 | |||
| id ibid; | ||||
| Muthalif et | ||||
| al. (1996) | ||||
| id ibid; | ||||
| Marshall et | ||||
| al (1997) | ||||
| id ibid; | ||||
| Anderson et | ||||
| al. (1997) id | ||||
| ibid.] | ||||
| P2 | ccccctttgtcactttggtg | [Li and | SEQ. ID. | |
| Cathcart | No. 9 | |||
| (1997) id | ||||
| ibid] | ||||
| IS1 | gcccaaaactctgttgaa | [U.S. Pat. | SEQ. ID. | |
| No. | No. 10 | |||
| 6,008,344] | ||||
| IS2 | ttgtgaaccagaaacgcc | [U.S. Pat. | SEQ. ID. | |
| No. | No. 11 | |||
| 6,008,344] | ||||
| Note: | ||||
| the underline shows phosphorothioated nucleotides. | ||||
Bronchoalveolar lavage fluid—At the end of experiment, bronchoalveolar lavage (BAL) is performed (using 5×1 ml phosphate-buffered saline) in each group. In each animal, 90% (4.5 ml) of the total injected volume is consistently recovered. After BAL fluid is centrifuged at 450 g for 10 minutes, the total and differential cell counts of the BAL fluid is determined from the cell fraction. The supernatant is stored at −70° C. until measurement of protein content. The concentration of protein is measured by Lowry's method using bovine serum albumin as a standard.
Thromboxane and leukotriene measurement—is determined by using enzyme immunoassay (EIA) kits.
Claims (9)
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| IL161579 | 2004-04-22 | ||
| IL16157904A IL161579A0 (en) | 2004-04-22 | 2004-04-22 | ANTISENSE OLIGONUCLEOTIDES AGAINST cPLA2, COMPOSITIONS AND USES THEREOF |
| PCT/IL2005/000399 WO2005101968A2 (en) | 2004-04-22 | 2005-04-17 | Antisense oligonucleotides against cpla2, compositions and uses thereof |
Related Parent Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/IL2005/000399 A-371-Of-International WO2005101968A2 (en) | 2004-04-22 | 2005-04-17 | Antisense oligonucleotides against cpla2, compositions and uses thereof |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US13/547,113 Continuation US8735368B2 (en) | 2004-04-22 | 2012-07-12 | Antisense oligonucleotides against cPLA2, compositions and uses thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| US20080287380A1 US20080287380A1 (en) | 2008-11-20 |
| US8242255B2 true US8242255B2 (en) | 2012-08-14 |
Family
ID=34074024
Family Applications (3)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US11/568,169 Expired - Fee Related US8242255B2 (en) | 2004-04-22 | 2005-04-17 | Antisense oligonucleotides against cPLA2, compositions and uses thereof |
| US13/547,113 Expired - Fee Related US8735368B2 (en) | 2004-04-22 | 2012-07-12 | Antisense oligonucleotides against cPLA2, compositions and uses thereof |
| US14/201,970 Abandoned US20140303233A1 (en) | 2004-04-22 | 2014-03-10 | ANTISENSE OLIGONUCLEOTIDES AGAINST cPLA2, COMPOSITIONS AND USES THEREOF |
Family Applications After (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US13/547,113 Expired - Fee Related US8735368B2 (en) | 2004-04-22 | 2012-07-12 | Antisense oligonucleotides against cPLA2, compositions and uses thereof |
| US14/201,970 Abandoned US20140303233A1 (en) | 2004-04-22 | 2014-03-10 | ANTISENSE OLIGONUCLEOTIDES AGAINST cPLA2, COMPOSITIONS AND USES THEREOF |
Country Status (9)
| Country | Link |
|---|---|
| US (3) | US8242255B2 (en) |
| EP (1) | EP1758996B1 (en) |
| JP (1) | JP2007533318A (en) |
| CN (1) | CN101072788A (en) |
| AU (1) | AU2005235286B2 (en) |
| CA (1) | CA2563741A1 (en) |
| IL (2) | IL161579A0 (en) |
| MX (1) | MXPA06012157A (en) |
| WO (1) | WO2005101968A2 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20100204298A1 (en) * | 2006-09-28 | 2010-08-12 | Rachel Levy | Use of Antisense Oligonucleotides Against CPLA2 in the Treatment of Cancer |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| IL161579A0 (en) | 2004-04-22 | 2004-09-27 | Mor Research Applic Ltd | ANTISENSE OLIGONUCLEOTIDES AGAINST cPLA2, COMPOSITIONS AND USES THEREOF |
| JP2011022726A (en) * | 2009-07-14 | 2011-02-03 | Sony Corp | Image processing apparatus and method |
| CN108431228A (en) * | 2015-12-25 | 2018-08-21 | Sbi生物技术有限公司 | TLR inhibition oligonucleotides and application thereof |
| CN117940117A (en) * | 2021-06-30 | 2024-04-26 | 株式会社普里莫里斯治疗 | Pharmaceutical compositions containing cell-derived natural or artificial nanovesicles loaded with antisense oligonucleotide-based drugs |
| CN114767859A (en) * | 2022-04-11 | 2022-07-22 | 山东大学齐鲁医院 | Application of targeting cPLA2 in prevention and treatment of radiation-induced lung injury |
Citations (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0260032A2 (en) | 1986-09-08 | 1988-03-16 | Ajinomoto Co., Inc. | Compounds for the cleavage at a specific position of RNA, oligomers employed for the formation of said compounds, and starting materials for the synthesis of said oligomers |
| US5998148A (en) | 1999-04-08 | 1999-12-07 | Isis Pharmaceuticals Inc. | Antisense modulation of microtubule-associated protein 4 expression |
| US6008344A (en) | 1999-02-23 | 1999-12-28 | Isis Pharmaceuticals Inc. | Antisense modulation of phospholipase A2 group IV expression |
| US6008334A (en) | 1996-07-24 | 1999-12-28 | The Board Of Regents Of The University Of Oklahoma | Base-protected nucleotide analogs with protected thiol groups |
| US6008311A (en) | 1997-02-12 | 1999-12-28 | Nitto Denko Corporation | Aromatic polycarbodiimide and film thereof |
| WO2002060535A1 (en) | 2001-01-31 | 2002-08-08 | Leff Alan R | Method of treating inflammatory conditions by inhibiting cytosolic phospholipase a¿2? |
| US6797708B2 (en) | 2001-12-03 | 2004-09-28 | Wyeth | Inhibitors of cytosolic phospholipase A2 |
| WO2005101968A2 (en) | 2004-04-22 | 2005-11-03 | Mor Research Applications Ltd. | Antisense oligonucleotides against cpla2, compositions and uses thereof |
| US20060014759A1 (en) | 2001-12-03 | 2006-01-19 | Wyeth | Methods for the use of inhibitors of cytosolic phospholipase A2 |
| WO2006128142A2 (en) | 2005-05-27 | 2006-11-30 | Wyeth | Inhibitors of cytosolic phospholipase a2 |
| WO2008038267A2 (en) | 2006-09-28 | 2008-04-03 | Ben Gurion University Of The Negev Research And Development Authority | Use of antisense oligonucleotides against cpla2 in the treatment of cancer |
-
2004
- 2004-04-22 IL IL16157904A patent/IL161579A0/en unknown
-
2005
- 2005-04-17 CN CNA2005800126742A patent/CN101072788A/en active Pending
- 2005-04-17 JP JP2007509055A patent/JP2007533318A/en active Pending
- 2005-04-17 AU AU2005235286A patent/AU2005235286B2/en not_active Ceased
- 2005-04-17 EP EP05731106.0A patent/EP1758996B1/en not_active Expired - Lifetime
- 2005-04-17 CA CA002563741A patent/CA2563741A1/en not_active Abandoned
- 2005-04-17 WO PCT/IL2005/000399 patent/WO2005101968A2/en not_active Ceased
- 2005-04-17 US US11/568,169 patent/US8242255B2/en not_active Expired - Fee Related
- 2005-04-17 MX MXPA06012157A patent/MXPA06012157A/en not_active Application Discontinuation
-
2006
- 2006-10-19 IL IL178764A patent/IL178764A/en not_active IP Right Cessation
-
2012
- 2012-07-12 US US13/547,113 patent/US8735368B2/en not_active Expired - Fee Related
-
2014
- 2014-03-10 US US14/201,970 patent/US20140303233A1/en not_active Abandoned
Patent Citations (14)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0260032A2 (en) | 1986-09-08 | 1988-03-16 | Ajinomoto Co., Inc. | Compounds for the cleavage at a specific position of RNA, oligomers employed for the formation of said compounds, and starting materials for the synthesis of said oligomers |
| US6008334A (en) | 1996-07-24 | 1999-12-28 | The Board Of Regents Of The University Of Oklahoma | Base-protected nucleotide analogs with protected thiol groups |
| US6008311A (en) | 1997-02-12 | 1999-12-28 | Nitto Denko Corporation | Aromatic polycarbodiimide and film thereof |
| US6008344A (en) | 1999-02-23 | 1999-12-28 | Isis Pharmaceuticals Inc. | Antisense modulation of phospholipase A2 group IV expression |
| WO2000050438A1 (en) | 1999-02-23 | 2000-08-31 | Isis Pharmaceuticals, Inc. | Antisense modulation of phospholipase a2 group iv expression |
| US5998148A (en) | 1999-04-08 | 1999-12-07 | Isis Pharmaceuticals Inc. | Antisense modulation of microtubule-associated protein 4 expression |
| WO2002060535A1 (en) | 2001-01-31 | 2002-08-08 | Leff Alan R | Method of treating inflammatory conditions by inhibiting cytosolic phospholipase a¿2? |
| US20020165119A1 (en) | 2001-01-31 | 2002-11-07 | Alan Leff | Method of treating inflammatory conditions by inhibiting cytosolic phospholipase A2 |
| US6797708B2 (en) | 2001-12-03 | 2004-09-28 | Wyeth | Inhibitors of cytosolic phospholipase A2 |
| US20060014759A1 (en) | 2001-12-03 | 2006-01-19 | Wyeth | Methods for the use of inhibitors of cytosolic phospholipase A2 |
| WO2005101968A2 (en) | 2004-04-22 | 2005-11-03 | Mor Research Applications Ltd. | Antisense oligonucleotides against cpla2, compositions and uses thereof |
| WO2006128142A2 (en) | 2005-05-27 | 2006-11-30 | Wyeth | Inhibitors of cytosolic phospholipase a2 |
| WO2008038267A2 (en) | 2006-09-28 | 2008-04-03 | Ben Gurion University Of The Negev Research And Development Authority | Use of antisense oligonucleotides against cpla2 in the treatment of cancer |
| US20100204298A1 (en) | 2006-09-28 | 2010-08-12 | Rachel Levy | Use of Antisense Oligonucleotides Against CPLA2 in the Treatment of Cancer |
Non-Patent Citations (129)
| Title |
|---|
| Allawi et al., Mapping of RNA accessible sites by extension of random oligonucleotide libraries with reverse transcriptase, 2001, RNA, vol. 7, pp. 314-327. * |
| Anderson et al. "Cytosolic 85-kDa Phospholipase A2-Mediated Release of Arachidonic Acid Is Critical for Proliferation of Vascular Smooth Muscle Cells", The Journal of Biological Chemistry, XP002478503, 272(48): 30504-30511, Nov. 28, 1997. |
| Anderson, K.M. et al., J. Biol. Chem., 1997, pp. 30504-30511, vol. 272(48). |
| Bendele et al. "Combination Benefit of Treatment With the Cytokine Inhibitors Interleukin-1 Receptor Antagonist and PEGylated Soluble Tumor Necrosis Factor Receptor Type I in Animal Models of Rheumatoid Arthritis", Arthritis & Rheumatism, 43(12): 2648-2659, Dec. 2000. |
| Bendele, A.M. et al., Arthritis & Rheumatism, 2000, pp. 2648-2658, vol. 43. |
| Chalk et al., Computational antisense oligo prediction with a neural network model, 2002, Bioinformatics, vol. 18, pp. 1567-1575. * |
| Communication Pursuant to Article 94(3) EPC Dated Apr. 3, 2008 From the European Patent Office Re. Application No. 05731106.0. |
| Communication Pursuant to Article 94(3) EPC Dated Jul. 22, 2010 From the European Patent Office Re. Application No. 05731106.0. |
| Communication Pursuant to Rules 109 and 110 EPC Dated May 24, 2007 From the European Patent Office Re. Application No. 05731106.0. |
| Dana et al. "Essential Requirement of Cytosolic Phospholipase A2 for Activation of the Phagocyte NADPH Oxidase", The Journal of Biological Chemistry, 273(1): 441-445, Jan. 2, 1998. |
| Dana et al. "The Requirement for Phospholipase A2 for Activation of the Assembled NADPH Oxidase in Human Neutrophils", Biochemistry Journal, 297: 217-223, 1994. |
| Dana, R. et al., Biochem J., 1994, pp. 217-223, vol. 297. |
| Dana, R. et al., J. Biol. Chem., 1998, pp. 441-445, vol. 273. |
| Dias et al. "Potential Roles of Antisense Oligonucleotides in Cancer Therapy. The Example of Bcl-2 Antisense Oligonucleotides", European Journal of Pharmaceutics and Biopharmaceutics, 54: 263-269, 2002. |
| Dias, N. and Stein, C.A., Eur. J. Pharmac. and Biopharmac., 2002, pp. 263-269, vol. 54. |
| Dong et al. "Cytoplasmic Phospholipase A2 Levels Correlate With Apoptosis in Human Colon Tumorigenesis", Clinical Cancer Research, 11: 2265-2271, Mar. 15, 2005. |
| Dong et al. "Inverse Association Between Phospholipase A2 and COX-2 Expression During Mouse Colon Tumorigenesis", Carcinogenesis, 24(2): 307-315, 2003. |
| Dong et al. "Oncogenic Action of Phospholipase A2 in Prostate Cancer", Cancer Letters, 240: 9-16, 2006. |
| Examiner's Report Dated Apr. 1, 2009 From the Australian Government, IP Australia Re. Application No. 2005235286. |
| Examiner's Report Dated Jun. 11, 2010 From the Australian Government, IP Australia Re. Application No. 2005235286. |
| Gij?n. et al. "Cytosolic Phospholipase A2 Is Required for Macrophage Arachidonic Acid Release by Antagonists That Do and Do Not Mobilize Calcium", The Journal of Biological Chemistry, 275(26): 20146-20156, Jun. 30, 2000. |
| Gijon, M. A. et al., J. Biol. Chem., 2000, p. 20146, vol. 275. |
| Greenbaum et al. "Comparing Protein Abundance and mRNA Expression Levels on a Genomic Scale", Genome Biology, 4(9/Art.117): 117.1-117.8, 2003. |
| Greenbaum, Dov et al. (2003) "Comparing Protein Abundance and mRNA Expression Levels on a Genomic Scale" Genome Biology, 4:117. |
| Griffoni et al. "The Rossmann Fold of Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH) Is a Nuclear Docking Site for Antisense Oligonucleotides Containing A TAAAT Motif", Biochimica et Biophysica Acta, XP002452585, 1530(1): 32-46, Jan. 15, 2001. Relevant to Inventions 1, 2, 5. |
| Griffoni, C. et al., Biochimica et Biophysica Acta, 2001, pp. 32-46, vol. 1530(1). |
| Hazan et al. "Cytosolic Phospholipase A2 and its Mode of Activation in Human Nutrophils by Opsonized Zymosan. Correlation Between 42/44 kDa Mitogen-Activated Protein Kinase, Cytosolic Phospholipase A2 and NADPH Oxidase", Biochemistry Journal, 326: 867-876, 1997. |
| Hazan et al., Biochem J., 1997, pp. 867-876, vol. 326. |
| Hazan-Halevy et al. "The Requirement of Both Extracellular Regulated Kinase and P38 Mitogen-Activated Protein Kinase for Stimulation of Cytosolic Phospholipase A2 Activity by Either Fc?RIIA or FC?RIIIB in Human Neutrophils. A Possible Role for Pyk2 But Not for the Grb2-Sos-Shc Complex", The Journal of Biological Chemistry, 275(17): 12416-12423, Apr. 28, 2000. |
| Hazan-Halevy, I. et al., J. Biol. Chem., 2000, pp. 12416-12426, vol. 275. |
| Hong et al. "Deletion of Cytosolic Phospholipase A2 Suppresses Apc[Min]-Induced Tumorigenesis", Proc. Natl. Acad. Sci. USA, PNAS, 98(7); 3935-3939, Mar. 27, 2001. |
| International Preliminary Report on Patentability Dated Mar. 13, 2007 From the International Bureau of WIPO Re. Application No. PCT/IL2005/000399. |
| International Preliminary Report on Patentability Dated Mar. 31, 2009 From the International Bureau of WIPO Re. Application No. PCT/IL2007/001164. |
| International Search Report and the Written Opinion Dated Jan. 22, 2007 From the International Searching Authority Re. Application No. PCT/IL2005/000399. |
| International Search Report and the Written Opinion Dated May 21, 2008 From the International Searching Authority Re. Application No. PCT/IL2007/001164. |
| Jaeger et al. "Predicting Optimal and Suboptimal Secondary Structure for RNA", Methods in Enzymology, 183: 281-306, 1990. |
| Jaeger, J.A., Methods Enzymol., 1989, pp. 281-306, vol. 183. |
| Jansen et al. "Chemosensitisation of Malignant Melanoma by BCL2 Antisense Therapy", The Lancet, 356: 1728-1733, Nov. 18, 2000. |
| Jansen, B. et al., Lancet, 2000, pp. 1728-1733, vol. 356. |
| Kalyvas et al. "Cytosolic Phospholipase A2 Plays a Key Role in the Pathogenesis of Multiple Sclerosis-Like Disease", Neuron, XP002414424, 41: 323-335, Feb. 5, 2004. p. 323. |
| Kalyvas et al., Neuron, 2004, pp. 323-335, vol. 41. |
| Kappel et al. "Regulating Gene Expression in Transgenic Animals", Current Opinion in Biotechnology, 3: 548-553, 1992. |
| Kiaei et al. Integrative Role of cPLA2 With COX-2 and the Effect of Non-Steriodal Anti-Inflammatory Drugs in a Transgenic Mouse Model of Amyotrophic Lateral Sclerosis, Journal of Neurochemistry, 93: 403-411, 2005. p. 403-404. |
| Kiaei et al., Journal of Neurochemistry, 2005, pp. 403-441, vol. 93. |
| Laktionov et al. "Knock Down of Cytosolic Phospholipase A2: An Antisense Oligonucleotide Having a Nuclear Localization Binds A C-Terminal Motif of Glyceraldehyde-3-Phosphate Dehydrogenase", Biochimca et Biophysica Acta, 1636: 129-135, 2004. |
| Laktionov et al., Knock down of cytosolic phospholipase A2: an antisense oligonucleotide having a nuclear localization binds a C-terminal motif of glyceraldehyde-3-phosphate dehydrogenase, 2004, Biochimica et Biophysica Acta, vol. 1636, pp. 129-135. * |
| Levy et al. "Effect of 1,25-Dihydroxyvitamin D3, Lipopolysaccharide, or Lipoteichoic Acid on the Expression of NADPH Oxidase Components in Cultured Human Monocytes", The Journal of Immunology, 147(9): 3066-3071, Nov. 1, 1991. |
| Levy et al. "Elevated Cytosolic Phospholipase A2 Expression and Activity in Human Neutrophils During Sepsis", Blood, 95: 660-665, 2000. |
| Levy et al. "Elevated NADPH-Oxidase Activity in Neutrophils From Bile-Duct-Ligated Rats: Changes in the Kinetic Parameters and in the Oxidase Cytosolic Factor P47", Biochimica et Biophysica Acta, 1220: 261-265, 1994. |
| Levy et al. "Potential Use of Tuftsin in Treatment of Candida Peritonitis in a Murine Model", Journal of Biological Regulators and Homeostatic Agents, 3(2): 71-78, 1989. |
| Levy et al. "The Requirementof P47 Phosphorylation for Activation of NADPH Oxidase by Opsonized Zymosan in Human Neutrophils", Biochimica et Biophysica Act, 1220: 253-260, 1994. |
| Levy, R et al., Biochim. Biophys. Acta., 1994, pp. 253-260, vol. 1220. |
| Levy, R. and Malech, H., J. Immunol., 1991, pp. 3066-3071, vol. 147. |
| Levy, R. et al., Biochim. Biophys. Acta., 1994, pp. 261-235, vol. 1220. |
| Levy, R. et al., Blood, 2000, pp. 660-665, vol. 95. |
| Levy, R. et al., J. Biol. Regul. Homeost. Agents, 1989, pp. 71-78, vol. 3(2). |
| Li et al. "Selective Inhibition of Cytosolic Phospholipase A2 in Activated Human Monocytes", The Journal of Biological Chemistry, 002924797, 272(4): 2404-2411, Jan. 24, 1997. p. 2406, col.1, § 3-4, Relevant to Inventions 1, 2, 5. |
| Li, Q. and Cathcart, M.K., J. Biol. Chem., 1997, pp. 2404-2411, vol. 272(4). |
| Locati et al. "Inhibition of Monocyte Chemotaxis to C-C Chemokines by Antisense Oligonucleotide for Cytosolic Phospholipase A2", The Journal of Biological Chemistry, 271(11): 6010-6016, Mar. 15, 1996. |
| Locati, M., J. Biol. Chem., 1996, pp. 6010-6016, vol. 271(11). |
| Lowenthal et al. "Essential Requirement of Cytosolic Phospholipase A2 for Activation of the H+ Channel in Phagocyte-Like Cells", The Journal of Biological Chemistry, 274(31): 21603-21608, Jul. 30, 1999. |
| Lowenthal, A. and Levy, R., J. Biol. Chem., 1999, pp. 21603-21610, vol. 274. |
| Marshall et al. "Depletion of Human Monocyte 85-kDa Phospholipase A2 Does Not Alter Leukotriene Formation", The Journal of Biological Chemistry, 272(2): 759-765, Jan. 10, 1997. |
| Marshall, L. , J. Biol. Chem., 1997, pp. 759-765, vol. 272(2). |
| Muthalif et al. "Calcium/Calmodulin-Dependent Protein Kinase II? Mediates Activation of Mitogen-Activated Protein Kinase and Cytosolic Phospholipase A2 in Norepinephrine-Induced Arachidonic Acid Release in Rabbit Aortic Smooth Muscle Cells", The Journal of Biological Chemistry, 271(47): 30149-30157, Nov. 22, 1996. |
| Muthalif, M.M. et al., J. Biol. Chem., 1996, pp. 30149-30157, vol. 271(47). |
| Neufert et al. "An Inducible Mouse Model of Colon Carcinogenesis for the Analysis of Sporadic and Inflammation-Driven Tumor Progression", Nature Protocols, 2(8): 1998-2004, 2007. |
| Office Action Dated Feb. 9, 2009 From the Israel Patent Office Re. Application No. 178764. |
| Office Action Dated Jul. 9, 2009 From the Israel Patent Office Re. Application No. 178401. |
| Office Action Dated Jun. 28, 2011 From the Israel Patent Office Re. Application No. 178764 and Its Translation Into English. |
| Office Action Dated Nov. 10, 2010 From the Israel Patent Office Re. Application No. 178764. |
| Office Action Dated Sep. 5, 2009 From the Israel Patent Office Re. Application No. 178401. |
| Official Action Dated Feb. 11, 2011 From the US Patent and Trademark Office Re. U.S. Appl. No. 12/311,419. |
| Official Action Dated Jul. 6, 2010 From the US Patent and Trademark Office Re. U.S. Appl. No. 12/311,419. |
| Panel et al. "Cytoplasmic Phospholipase A2 Expression in Human Colon Adenocarcinoma Is Correlated With Cyclooxygenase-2 Expression and Contributes to Prostaglandin E2 Production", Cancer Letters, 243: 255-263, 2006. |
| Patel et al. "Cytosolic Phospholipase A2-?: A Potential Therapeutic Target for Prostate Cancer", Clinical Cancer Research, 14(24): 8070-8079, Dec. 15, 2008. |
| Patel et al. "Cytosolic Phospholipase A2-alpha: A Potential Therapeutic Target for Prostate Cancer", Clinical Cancer Research, 14(24): 8070-8079, Dec. 15, 2008. |
| Patel et al. "Cytosolic Phospholipase A2-α: A Potential Therapeutic Target for Prostate Cancer", Clinical Cancer Research, 14(24): 8070-8079, Dec. 15, 2008. |
| Persaud et al. "A Key Role for ?-Cell Cytosolic Phospholipase A2 in the Maintenance of Insulin Stores But Not in the Initiation of Insulin Secretion", Diabetes, XP002452586, 51(1): 98-104, Jan. 2002. Relevant to Inventions 1, 2, 5. |
| Persaud, S. J. et al., Diabetes, 2002, pp. 98-104, vo1.51(1). |
| Pessach et al. "Essential Requirement of Cytosolic Phospholipase A2 for Stimulation of NADPH Oxidase-Associated Diaphorase Activity in Granulocyte-Like Cells", The Journal of Biological Chemistry, 276(36): 33495-33503, Sep. 7, 2001. |
| Pessach, I. et al., J. Biol. Chem., 2001, pp. 33495-33503, vol. 276. |
| Pirianov et al. "Interactions of Vitamin D Analogue CB1093, TNF? and Ceramide on Breast Cancer Cell Apoptosis", Molecular and Cellular Endocrinology, 172: 69-78, 2001. |
| Pirollo et al. "Antisense Therapeutics: From Theory to Clinical Practice", Pharmacology & Therapeutics, 99: 55-77, 2003. |
| Pirollo, K.F. et al., Pharmacology & Therapeutics, 2003, pp. 55-77, vol. 99. |
| Reisenberg, K. et al., Eur. J. Clin. Invest, 1997, pp. 398-404, vol. 27. |
| Response Dated Aug. 11, 2011 to Official Action of Feb. 11, 2011 From the US Patent and Trademark Office Re. U.S. Appl. No. 12/311,419. |
| Response Dated Jan. 12, 2011 to Office Action Dated Sep. 5, 2009 From the Israel Patent Office Re. Application No. 178401. |
| Response Dated Jan. 6, 2011 to Communication Pursuant to Article 94(3) EPC Dated Jul. 22, 2010 From the European Patent Office Re. Application No. 05731106.0. |
| Response Dated Jan. 6, 2011 to Official Action of Jul. 6, 2010 From the US Patent and Trademark Office Re. U.S. Appl. No. 12/311,419. |
| Response Dated Jul. 7, 2008 to Communication Pursuant to Article 94(3) EPC of Apr. 3, 2008 From the European Patent Office Re. Application No. 05731106.0. |
| Response Dated Jun. 29, 2010 to Examiner's Report of Jun. 11, 2010 From the Australian Government, IP Australia Re. Application No. 2005235286. |
| Response Dated Mar. 10, 2011 to Office Action of Nov. 10, 2010 From the Israel Patent Office Re. Application No. 178764. |
| Response Dated May 27, 2010 to Examiner's Report of Apr. 1, 2009 From the Australian Government, IP Australia Re. Application No. 2005235286. |
| Response Dated May 31, 2009 to Office Action of Feb. 9, 2009 From the Israel Patent Office Re. Application No. 178764. |
| Response Dated May 6, 2009 to Office Action of Jan. 14, 2009 From the Israel Patent Office Re. Application No. 178401. |
| Response Dated Nov. 5, 2009 to Office Action of Jul. 9, 2009 From the Israel Patent Office Re. Application No. 178401. |
| Response Dated Oct. 30, 2011 to Office Action of Jun. 28, 2011 From the Israel Patent Office Re. Application No. 178764. |
| Riesenberg et al. "Neutrophil Superoxide Release and Interleukin 8 in Acute Myocardial Infarction: Distinction Between Complicated and Uncomplicated States", European Journal of Clinical Investigation, 27: 398-404, 1997. |
| Roshak et al. "Suppression of Monocyte 85-kDa Phospholipase A2 by Antisense and Effects on Endotoxin-Induced Prostaglandin Biosynthesis", The Journal of Biological Chemistry, 269(42): 25999-26005, Oct. 21, 1994. |
| Roshak, A., J. Biol. Chem., 1994, pp. 25999-26005, vol. 269(42). |
| Rubenstein et al. "Antisense Oligonucleotide Intralesional Therapy for Human PC-3 Prostate Tumors Carried in Athymic Nude Mice", Journal of Surgical Oncology, 62: 194-200, 1996. |
| Rubin et al. "Cytosolic Phospholipase A2-? Is Necessary for Platelet-Activating Factor Biosynthesis, Efficient Neutrophil-Mediated Bacterial Killing, and the Innate Immune Response to Pulmonary Infection", The Journal of Biological Chemistry, 280(9): 7519-7529, Mar. 4, 2005. |
| Rubin, B.B. et al., J. Biol. Chem., 2005, pp. 7519-7529, vol. 280. |
| Scherr et al., RNA accessibility prediction: a theoretical approach is consistent with experimental studies in cell extracts, 2000, Nucleic Acids Research, vol. 28, pp. 2455-2461. * |
| Segal et al. "Thioglycollate Peritonitis in Mice Lacking C5, 5-Lipoxygenase, or P47phox: Complement, Leukotrienes, and Reactive Oxidants in Acute Inflammation", Journal of Leukocyte Biology, 71: 410-416, Mar. 2002. |
| Segal, B. H. et al., J. Leukoc. Biol., 2002, p. 410, vol. 71. |
| Shaik et al. "Enhancement of Antitumor Activity of Docetaxel by Celecoxib in Lung Tumors", International Journal of Cancer, 118: 396-404, 2006. |
| Shaked et al. "Superoxide Production by Neutrophils From Trauma Patients: Regulation of NADPH Oxidase Activity", The Journal of Trauma, 37(1): 22-29, 1994. |
| Shmelzer et al. "Cytosolic Phospholipase A2? Is Targeted to the P47phox-PX Domain of the Assembled NADPH Oxidase Via a Novel Binding Site in Is C2 Domain", The Journal of Biological Chemistry, 283(46): 31898-31908, Nov. 14, 2008. |
| Shmelzer et al. "Unique Targeting of Cytosolic Phosphpolipase A2 to Plasma Membranes Mediated by the NADPH Oxidase in Phagocytes", The Journal of Cell Biology, 162(4): 683-692, Aug. 18, 2003. |
| Shmelzer, Z. et al., J. Cell Biol., 2003, pp. 683-692, vol. 162. |
| Snaked, G. et al., J. Trauma, 1994, pp. 22-29, vol. 37. |
| Sohail et al., Selecting optimal antisense reagents, 2000, Advanced Drug Delivery Reviews, vol. 44, pp. 23-34. * |
| Stein et al. "Physicochemical Properties of Phosphorothioate Oligodeoxynucleotides", Nucleic Acids Research, 16(8): 3209-3221, 1988. |
| Stein et al., Nucleic Acid Res., 1988, pp. 3209-3221, vol. 16. |
| Supplementary European Search Report Dated Nov. 27, 2007 From the European Patent Office Re. Application No. 05731106.0. |
| Supplementary Partial European Search Report Dated Oct. 9, 2007 From the European Patent Office Re. Application No. 05731106.0. |
| Tarsi-Tsuk et al. "Stimulation of the Respiratory Burst in Peripheral Blood Monocytes by Lipoteichoic Acid", The Journal of Immunology, 144(7): 2665-2670, Apr. 1, 1990. |
| Tarsi-Tsuk, D. and Levy, R., J. Immunol., 1990, pp. 2665-2670, vol. 144. |
| Tommasini et al. "Hydrogen Peroxide Generated at the Level of Mitochondria in Response to Peroxynitrite Promotes U937 Cell Death Via Inhibition of the Cytoprotective Signalling Mediated by Cytosolic Phospholipase A2", Cell Death and Differentiation, 11: 974-984, 2004. p. 974. |
| Tommasini, P.S. et al., Cell Death and Differentiation, 2004, pp. 974-984, vol. 11. |
| Translation of Notification of the First Office Action Dated Oct. 9, 2010 From the State Intellectual Property Office of the People's Republic of China Re. Application No. 200580012674.2. |
| Van Rossum et al. "Cytosolic Phospholipase A2 and Lipxygenase Are Involved in Cell Cycle Progression in Neuroblastoma Cells", CMLS, Cellular and Molecular Life Sciences, 59(1): 181-188, 2002. |
| Weiser-Evans et al. "Depletion of Cytosolic Phospholipase A2 in Bone Marrow-Derived Macrophages Protects Against Lung Cancer Progression and Metastasis", Cnacer Research, 69(5): 1733-1738, Mar. 1, 2009. |
| Zhang et al. "Antisense Inhibition of the Photosystem I Antenna Protein Lhca4 in Arabidopsis thaliana", Plant Physiology, 115: 1525-1531, 1997. |
| Zhang, Hong et al. (1997) "Antisense Inhibition of the Photosystem I Antenna Protein Lhca4 in Arabidopsis thaliana" Plant Physiol., 115 pp. 1525-1531. |
| Zhao et al. "Cytosolic Phospholipase A2 (cPLA2) Regulation of Human Monocyte NADPH Oxidase Activity", The Journal of Biological Chemistry, 277(28): 25385-25392, Jul. 12, 2002. |
| Zhao, X. et al., J. Biol. Chem., 2002, pp. 25385-25392, vol. 277(28). |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20100204298A1 (en) * | 2006-09-28 | 2010-08-12 | Rachel Levy | Use of Antisense Oligonucleotides Against CPLA2 in the Treatment of Cancer |
| US8895523B2 (en) | 2006-09-28 | 2014-11-25 | Mor Research Applications Ltd. | Use of antisense oligonucleotides against CPLA2 in the treatment of cancer |
Also Published As
| Publication number | Publication date |
|---|---|
| AU2005235286A1 (en) | 2005-11-03 |
| US20080287380A1 (en) | 2008-11-20 |
| EP1758996A2 (en) | 2007-03-07 |
| IL178764A (en) | 2012-10-31 |
| US8735368B2 (en) | 2014-05-27 |
| US20120277292A1 (en) | 2012-11-01 |
| US20140303233A1 (en) | 2014-10-09 |
| WO2005101968A2 (en) | 2005-11-03 |
| IL161579A0 (en) | 2004-09-27 |
| CA2563741A1 (en) | 2005-11-03 |
| IL178764A0 (en) | 2007-03-08 |
| AU2005235286B2 (en) | 2010-07-29 |
| WO2005101968A3 (en) | 2007-04-12 |
| MXPA06012157A (en) | 2007-04-25 |
| JP2007533318A (en) | 2007-11-22 |
| CN101072788A (en) | 2007-11-14 |
| EP1758996B1 (en) | 2015-04-08 |
| EP1758996A4 (en) | 2007-12-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US8735368B2 (en) | Antisense oligonucleotides against cPLA2, compositions and uses thereof | |
| AU2013207601B2 (en) | RNAi-mediated inhibition of spleen tyrosine kinase-related inflammatory conditions | |
| US20230357774A1 (en) | Compositions and methods for the treatment of angiopoietin like 7 (angptl7) related diseases | |
| RU2663100C2 (en) | Mi-rna and their use in methods and compositions for treatment and / or prevention of eye conditions | |
| CA2599524C (en) | Materials and methods for treatment of allergic disease | |
| CN105899662A (en) | siRNA and their use in methods and compositions for inhibiting the expression of the PDK1 gene | |
| US10017766B2 (en) | SiRNA and their use in methods and compositions for inhibiting the expression of the FLAP gene | |
| US20110092575A1 (en) | Sirna of human osteopontin | |
| US20250197859A1 (en) | Compositions and methods for the treatment of angiopoietin like 7 (angptl7) related diseases | |
| US20080311052A1 (en) | Isis Pharmaceuticals, Inc. | |
| US20040072769A1 (en) | Methods for design and selection of short double-stranded oligonucleotides, and compounds of gene drugs | |
| WO2023234410A1 (en) | Inhibitory agent for myocardial cell death, and prophylactic or therapeutic agent for myocardial disorders or heart failure | |
| JP7412668B2 (en) | antisense oligonucleotide complex | |
| HK40096817A (en) | Sirna for target regulation of pcsk9 gene expression and its application | |
| HK40096817B (en) | Sirna for target regulation of pcsk9 gene expression and its application | |
| WO2025059466A1 (en) | Compounds and methods for reducing apociii expression | |
| HK1212377B (en) | Sirna and its use in methods and compositions for the treatment and/or prevention of eye conditions |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AS | Assignment |
Owner name: BEN-GURION UNIVERSITY OF THE NEGEV RESEARCH AND DE Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:LEVY, RACHEL;REEL/FRAME:018756/0884 Effective date: 20050701 Owner name: MOR RESEARCH APPLICATIONS LTD., ISRAEL Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:LEVY, RACHEL;REEL/FRAME:018756/0884 Effective date: 20050701 |
|
| ZAAA | Notice of allowance and fees due |
Free format text: ORIGINAL CODE: NOA |
|
| ZAAB | Notice of allowance mailed |
Free format text: ORIGINAL CODE: MN/=. |
|
| STCF | Information on status: patent grant |
Free format text: PATENTED CASE |
|
| FPAY | Fee payment |
Year of fee payment: 4 |
|
| MAFP | Maintenance fee payment |
Free format text: PAYMENT OF MAINTENANCE FEE, 8TH YR, SMALL ENTITY (ORIGINAL EVENT CODE: M2552); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY Year of fee payment: 8 |
|
| FEPP | Fee payment procedure |
Free format text: MAINTENANCE FEE REMINDER MAILED (ORIGINAL EVENT CODE: REM.); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY |
|
| LAPS | Lapse for failure to pay maintenance fees |
Free format text: PATENT EXPIRED FOR FAILURE TO PAY MAINTENANCE FEES (ORIGINAL EVENT CODE: EXP.); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY |
|
| STCH | Information on status: patent discontinuation |
Free format text: PATENT EXPIRED DUE TO NONPAYMENT OF MAINTENANCE FEES UNDER 37 CFR 1.362 |
|
| FP | Lapsed due to failure to pay maintenance fee |
Effective date: 20240814 |