US7999092B2 - Amplicon rescue multiplex polymerase chain reaction for amplification of multiple targets - Google Patents

Amplicon rescue multiplex polymerase chain reaction for amplification of multiple targets Download PDF

Info

Publication number
US7999092B2
US7999092B2 US12/418,532 US41853209A US7999092B2 US 7999092 B2 US7999092 B2 US 7999092B2 US 41853209 A US41853209 A US 41853209A US 7999092 B2 US7999092 B2 US 7999092B2
Authority
US
United States
Prior art keywords
seq id
amplification
primers
target
reaction
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
US12/418,532
Other versions
US20090253183A1 (en
Inventor
Jian Han
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Irepertoire Inc
HudsonAlpha Inst for Biotechnology
Original Assignee
HudsonAlpha Inst for Biotechnology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to US4225908P priority Critical
Application filed by HudsonAlpha Inst for Biotechnology filed Critical HudsonAlpha Inst for Biotechnology
Priority to US12/418,532 priority patent/US7999092B2/en
Publication of US20090253183A1 publication Critical patent/US20090253183A1/en
Application granted granted Critical
Publication of US7999092B2 publication Critical patent/US7999092B2/en
Assigned to HUDSON ALPHA INSTITUTE FOR BIOTECHNOLOGY reassignment HUDSON ALPHA INSTITUTE FOR BIOTECHNOLOGY ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: HAN, JIAN
Assigned to CB BIOTECHNOLOGIES, INC. reassignment CB BIOTECHNOLOGIES, INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: HUDSON ALPHA INSTITUTE FOR BIOTECHNOLOGY
Assigned to iRepertoire, Inc. reassignment iRepertoire, Inc. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: CB BIOTECHONOLOGIES INCORPORATED
Application status is Active legal-status Critical
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00Preparation of compounds containing saccharide radicals
    • C12P19/26Preparation of nitrogen-containing carbohydrates
    • C12P19/28N-glycosides
    • C12P19/30Nucleotides
    • C12P19/34Polynucleotides, e.g. nucleic acids, oligoribonucleotides
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/686Polymerase chain reaction [PCR]
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10TECHNICAL SUBJECTS COVERED BY FORMER USPC
    • Y10STECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10S435/00Chemistry: molecular biology and microbiology
    • Y10S435/975Kit

Abstract

Disclosed is a method for amplifying and detecting polynucleotides which can provide sensitive, specific detection of multiple targets from a clinical specimen within a relatively short time.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

This application claims the benefit of priority of U.S. Provisional Patent Application No. 61/042,259, filed Apr. 3, 2008.

FIELD OF THE INVENTION

The invention relates generally to methods for amplifying nucleic acids. More specifically, the invention relates to methods for using the polymerase chain reaction to amplify multiple nucleic acid sequences.

BACKGROUND OF THE INVENTION

The development of the polymerase chain reaction (PCR) enabled the use of DNA amplification for a variety of uses, including molecular diagnostic testing. There are challenges associated with the use of PCR for molecular differential diagnostic (MDD) assays, however. PCR utilizes specific primers or primer sets, temperature conditions, and enzymes. PCR reactions may easily be contaminated, primer binding may require different conditions for different primers, primers should be specific for a target sequence in order to amplify only that target sequence, etc. This has made it even more difficult to amplify multiple sequences from a single sample.

Diagnostic testing of clinical samples to find one or more causative disease agents has, in the past, required that microorganisms be isolated and cultured. This may take days, however, and in many cases a diagnosis must be acted upon within hours if the patient's life is to be saved. Analysis of a single clinical sample to identify multiple organisms in order to determine which one(s) may be the causative agent(s) of disease is the desired method for MDD, and methods have been developed to better achieve that goal. For example, multiplex PCR methods have been developed to amplify multiple nucleic acids within a sample in order to produce enough DNA/RNA to enable detection and identification of multiple organisms. Multiplex PCR has disadvantages, however. For example, each target in a multiplex PCR reaction requires its own optimal reaction conditions, so increasing the number of targets requires that the reaction conditions for each individual target are less than optimal. Furthermore, multiple sets of high-concentration primers in a system often generate primer dimmers or give non-specific, background amplification. This lack of specificity also requires the additional steps of post-PCR clean-up and multiple post-hybridization washes. Crowded primers reduce the amplification efficiency by requiring the available enzymes and consuming substrates. Differences in amplification efficiency may lead to significant discrepancies in amplicon yields. For example, some loci may amplify very efficiently, while others amplify very inefficiently or fail to amplify at all. This potential for uneven amplification also makes it difficult to impossible to accurately perform end-point quantitative analysis.

One method utilizes nested gene-specific primers used at very low concentrations to enrich the targets during the initial PCR cycling. Later, common primers are used to amplify all the targets. The entire reaction is performed in one tube, no additional rounds of PCR are required, and it does not require specialized instruments but may instead be performed using regular thermal cyclers. There are disadvantages to this method, however. For example, because a low concentration of primers is used to enrich the targets during the initial cycles, the sensitivity of the assay is ultimately decreased, the initial enrichment cycles require longer annealing time for each cycle, and the enzyme is more likely to be less efficient over the number of cycles required to amplify the target.

A need still exists for more sensitive, faster, and more efficient methods for amplifying DNA and/or RNA from multiple targets to promote rapid identification of those targets.

SUMMARY OF THE INVENTION

The present invention relates to a method for amplifying nucleic acids to enable detection of those nucleic acids, the method comprising the steps of amplifying one or more target nucleic acids using high concentration, target-specific primers in a first amplification reaction, thereby producing at least one nucleic acid amplicon containing at least one common primer binding site; rescuing the at least one nucleic acid amplicon; and amplifying the at least one nucleic acid amplicon in a second amplification reaction utilizing common primers which bind to the at least one common primer binding site. One aspect of the invention utilizes nested target-specific primers. Target nucleic acids may comprise DNA and/or RNA, and may comprise DNA and/or RNA of viral, bacterial, and/or fungal origin, as well as genomic DNA and/or RNA of human or other animal origin. Amplification may be performed by polymerase chain reaction (PCR) and/or RT-PCR. The source of the target nucleic acids may be from one or more clinical, environmental, or food samples and the method may be used in a wide variety of ways, including, for example, clinical diagnosis, environmental sampling, plant testing, food safety analysis, detection of genetic disorders, and/or detection of disease conditions. The method may be used for human and/or veterinary medical diagnoses.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 is an illustration of the method of the invention, where Fo represents forward-out primers; Fi represents forward-in primers with a forward common primer tag (binding sequence); Cf represents a forward common primer; Ri represents a reverse-in primer with reverse common primer tag (binding sequence); Ro represents a reverse-out primer; Cr represents a reverse common primer; Fa represents an additional forward primer; and Ra represents an additional reverse primer, with these primers being positioned generally as indicated.

DETAILED DESCRIPTION

The inventor has developed a new method for amplifying nucleic acids that may be used to detect the presence, and relative amounts present, of nucleic acids from viruses, bacteria, fungi, plant and/or animal cells for the evaluation of medical, environmental, food, and other samples to identify microorganisms and other agents within those samples. The method will be referred to herein as amplicon rescue multiplex polymerase chain reaction (“arm-PCR”). In this method, PCR amplifications of target nucleic acids are performed sequentially in two different reaction systems. These systems may comprise separate columns, reaction containers, or sections of a chip, for example, containing the target nucleic acid(s), primers, enzymes, nucleotides (e.g., dNTPs) and buffers necessary to amplify the target nucleic acid(s) to produce amplicons. By using high concentration primers in the first amplification reaction and rescuing the amplicons formed during that reaction for use in a second amplification reaction in a different reaction system, the inventor has developed a method that increases sensitivity and specificity, decreases the time needed to produce a detectable result, and readily lends itself to automation.

It is to be understood that the term “comprising,” as used herein, may be substituted with the terms “consisting essentially of” and “consisting of.” Where the term “reaction system” is used, it is intended to describe an Eppendorf tube, reaction chamber, or other containment device into which the necessary primers, enzymes, nucleotides, buffers, and/or other reagents are placed in order to perform one or more cycles of at least one polymerase chain reaction. A different “reaction system” may therefore refer to the same reaction containment vessel, but a different component of reagents—particularly primers—for performing the desired amplification step. A “reaction containment vessel” is intended to mean a tube, plate well, or other vessel having a sufficient internal volume to contain primers, enzymes, nucleotides, buffers, and/or other reagents necessary to provide a reaction system. The term “rescue” is intended to mean the separation of amplicons from at least a portion of the primers of the first amplification. “PCR” is intended to mean the polymerase chain reaction, and may include PCR and/or RT-PCR procedures.

In the first step of the method, high-concentration, target-specific, nested primers are used to perform a target-specific first amplification procedure. Primers are chosen from known sequences of viruses, bacteria, fungi, and/or other targets for which identification using nucleic acid detection is desired, and are specific for those target nucleic acids and/or closely related target nucleic acids. Target-specific primers may be used to amplify one or more (and preferably multiple) target nucleic acids of bacterial, viral, fungal, and/or other origin, for example. Nested primer concentration may generally be between 5-50 pmol. As illustrated in FIG. 1, selected primers are “tagged” with additional nucleotides to provide an additional sequence that is not specific for the target nucleic acid(s) so that amplification of the target nucleic acid with such a primer will also incorporate into the resulting amplicon a binding site for a common primer that, unlike a target-specific primer, may be used to further amplify unrelated target nucleic acid amplicons (see A and B in FIG. 1). Amplification is performed for approximately 10-15 cycles, the reaction is terminated, and the resulting amplicons are rescued from the reaction mix for use in a second, target-independent amplification procedure, comprising a polymerase chain reaction primed by common primers which will, in a relatively indiscriminate manner, provide amplification of unrelated nucleotide sequences represented by the variety of amplicons rescued from the target-specific reaction.

Amplicon rescue is then performed to minimize or eliminate the primers of the first reaction, while providing amplicons for use in the second amplification using common primers. Amplicon rescue may be performed in a variety of ways. For example, a small sampling from the completed first amplification reaction may be taken to provide amplicons for the second amplification. When a small sample is taken, it provides sufficient numbers of amplicons for the second amplification, while significantly decreasing (e.g., diluting) the remaining numbers of primers of the first amplification. Amplicon rescue may also be performed by removing a significant portion of the contents of the reaction system of the first amplification and adding to the remaining contents the common primer(s) with the necessary enzyme(s), nucleotides, buffer(s), and/or other reagents to perform a second amplification utilizing the common primer(s) to amplify the rescued amplicons in a second reaction system. Separation techniques may also be utilized to rescue amplicons. Such techniques may rely on size differences between the primers and amplicons, on tags that have been attached to the amplicons, the primers, or both, or other methods known to those of skill in the art. Once separated, all of the rescued amplicons or a part of the rescued amplicons may be used in the second amplification.

The second amplification is performed in a different reaction system, which may or may not utilize the same reaction containment vessel. The second amplification amplifies the rescued amplicons using fresh buffer, nucleotides, and common primer(s). Common primers are chosen to provide efficient amplification of the rescued amplicons to provide significant numbers of copies of those amplicons at the end of the second amplification.

By separating the reactions into a first, target-specific primer-driven amplification and a second, target-independent common primer-driven amplification, the inventor has developed a method that will provide specificity through the use of target-specific primers to amplify only the kinds and numbers of nucleic acids present from a particular target, and sensitivity achieved by the use of nested primers, the high concentration of target-specific primers, and the use of the common primer(s) to provide non-specific (target-independent) amplification at higher copy numbers. Furthermore, the use of high-concentration primers in a first amplification, followed by amplicon rescue—particularly when amplicon rescue is performed by isolating a portion of the first amplification by either removing that portion and placing it into a new reaction system or by removing a significant portion of the first amplification and adding to that the necessary reagents to form a second reaction system for a second, target-independent amplification—lends itself to automation. Not only can these steps be performed within a relatively closed reaction system, which limits the possibility of contamination, but the combination of first amplification; amplicon rescue, and second amplification provided by the method produces a specific, sensitive detection method for multiple targets from multiple samples within a period of less than 2 hours.

Target nucleic acids may be isolated from their respective sources by various means known to those of skill in the art. Detection of amplicons produced by the method may also be performed by various means known to those of skill in the art, such as application of the amplicons from the second amplification step to a printed array for hybridization and detection. Common primer sequences may include any sequence that will effectively provide for efficient initiation of an amplification reaction. Such sequences, and methods for designing them, are known to those of skill in the art. The inventor has discovered that primers chosen from among SEQ ID NO: 1 (5′-TTCTTAGCGTATTGGAGTCC-3′), SEQ ID NO:2 (5′-AATGTACAGTATTGCGTTTTG-3′), or a combination of both, provide exceptional results in the second amplification reaction.

The invention also provides primer kits for PCR amplification of target nucleotides, such kits comprising primers chosen from among the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 86, SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, and combinations thereof.

One example of a method for automation of the method may be provided where the amplifications, separation, and detection are performed using a “lab-on-chip” device in a closed system. For example, a first, target-specific amplification may be performed in a first reaction system (PCR1), where nested, unlabeled, high-concentration target-specific primers may be pre-loaded, together with dNTPs, buffer and enzymes to perform the desired PCR or RT-PCR amplification. After the first amplification has been allowed to proceed for the desired number of cycles, unused primers may be separated from nucleotide amplicons using capillary electrophoresis by means of electrodes activated between the PCR1 (negative) and a waste chamber (positive) to separate the primers from the amplicons. Upon movement of the primers to the waste chamber, the electrode in the waste chamber may be turned off and a second reaction system (PCR2) positively charged. The larger molecular weight amplicons may therefore migrate to the PCR2 chamber, where they are mixed with pre-loaded common primers and fresh enzymes, dNTPs and buffer. After the second amplification is performed in PCR2, the PCR products (amplicons) may be electrophoretically moved to the detection chamber to be hybridized to probes covalently fixed onto beads, the position of the beads in an array representing specific molecular targets. Target detection may therefore be performed by imaging analysis, for example, where positive results may be indicated by bright beads, as amplicons products may be labeled with fluorescent dyes or other chemical/biochemical labels. Unused PCR products and primers may then be removed and deposited in the waste chamber.

In some embodiments, a PCR chip may comprise a first reaction system fluidly connected to both a waste reservoir and a second reaction system, the waste reservoir and second reaction system each additionally comprising at least one electrode, the electrodes comprising a means for separating amplicons produced from the first reaction system. The second reaction system may be fluidly connected to a hybridization and detection chamber, the hybridization and detection chamber comprising microspheres, or beads, arranged so that the physical position of the beads is an indication of a specific target polynucleotide's presence in the sampled analyzed by means of the chip.

The chip may be pre-Loaded with reagents, or the reagents may be added by the user. In one embodiment, pre-loaded reagents may include nested, high-concentration target-specific primers, dNTPs, polymerase enzymes, and buffer(s) for a first reaction system. The second reaction system may be preloaded with common primers, dNTPs, buffer, and polymerase enzymes. Using the chip, for example, a patient sample may be loaded into at least one first reaction system by injecting the sample through soft, rubber-like polydimethylsiloxane (PDMS) material covering all or a portion of the chip. In the first reaction system, the first series of PCR cycles may be performed for the first amplification, to amplify the target sequences and to incorporate common primer binding sequences into at least a portion of the resulting amplicons. Amplicon products from the first reaction system may then be separated by on-chip electrophoresis performed in the microfluidic channel, the first reaction system being fluidly connected to at least one second reaction system and at least one waste reservoir, each of the second reaction systems and waste reservoirs additionally comprising at least one electrode, the electrodes promoting movement of the amplicons and unused primers from the first amplification reaction to a second reaction system and a waste reservoir, respectively. Amplicons moved to a second PCR reaction system may then be then subjected to a second amplification using common primers to amplify amplicons into which at least one common primer binding site has been incorporated during the first amplification in the first reaction system. Following completion of the desired amplification cycles in the second reaction system, the PCR products (amplicons) may be moved by microfluidic electrophoresis from the second reaction system to at least one hybridization and detection chamber, a second reaction system being fluidly connected to at least one hybridization and detection chamber. Within the hybridization and detection chamber may be microspheres, or beads, forming an array, the physical position of the beads indicating the specific target for detection. A bead array may comprise from about 1 to about 200 targets, with each target being represented by from about 1 to about 100 beads. If a specific target is not represented by the appropriate primers in the first amplification reaction, a software mask may be used to cover the related beads so that they will not interfere with the analysis. The hybridization and detection chamber may be fluidly connected to at least one wash chamber and at least one detection chamber, the wash chamber comprising reagents to assist in the removal of unused, labeled, primers and probes to reduce background, and the detection chamber comprising reagents such as streptavidine-Quantum dots, or streptavidine-PE for labeling amplified DNA for imaging analysis.

The method of the invention may also be performed using a standard or modified PCR thermocycler. For example, nucleotides, buffers, and primers may be loaded into standard PCR tubes in a first thermocycler for the first amplification. The contents of the tube may be removed by manual or automated means for rescue of the amplicons, and the newly-isolated amplicons may be placed into a second amplification tube where buffers, nucleotides, and enzyme(s) are introduced in order to perform the second amplification in the first or a second thermocycler, the thermocycler being programmed to cycle the reaction through the appropriate temperatures for the desired lengths of time. It should be understood that cycling times and the number of cycles may vary and may be determined by those of skill in the art.

The use of nested primers appears to improve the binding affinity of the polymerase, producing significantly more amplicons during the first amplification reaction. These amplicons may be produced from a variety of target polynucleotides within the sample, using a high concentration of target-specific primers. By incorporating into at least a portion of the amplicons during the first amplification at least one binding site for at least one common primer, it is then possible, during the second amplification, to even more significantly increase the number of amplicons produced as a result of the amplification process. Common primers are chosen for their binding affinity and capacity to prime amplification during the second amplification. By the use of this three-step method (1st amplification step, amplicon rescue, 2nd amplification step), it is therefore possible to increase both the specificity and the sensitivity of the PCR process for identifying one or more target organism(s) from a sample containing multiple organisms. The inventor has discovered that this method does significantly increase both specificity and sensitivity, when compared to previously-described PCR methods.

Automating the amplification-separation-amplification process enables the identification of a significant number of targets within a period of 1-3 hours, and has been shown to be effective for amplifying target nucleic acids from multiple microorganisms within a period of 1.5 hours, allowing rapid identification of a possible causative agent of disease to allow immediate steps to be taken toward treatment, isolation, implementation of public health plans for limiting exposure to epidemic-causing disease agents, bioterror agents, etc.

Samples may be prepared for the PCR reactions by various means known to those of skill in the art. These methods may be provided as instructions provided with PCR kits containing buffers and enzymes, for example, or instructions may be obtained from various journal or patent publications. Methods for handling samples prior to preparation for the PCR amplification steps are also known to those of skill in the art, and may vary depending upon the source of the sample.

Enzymes used for the amplifications are commercially available and may include, for example, Qiagen Multiplex mix or Qiagen Hot Start mix. Buffers are also commercially available, as are nucleotides (dNTPs) and other reagents. Thermocyclers are manufactured by and distributed by a variety of companies including, for example, Applied Biosystems and Bio-Rad. PCR reagent kits may also be obtained from various sources, including, for example, Qiagen (Gaithersburg, Md.).

The invention provides a method that is suitable for identifying a single microorganism or multiple microorganisms, for example, from a sample that may contain a variety of microorganisms. Such a sample may be obtained from a clinical specimen (e.g., blood, saliva, tissue), from an environmental sample (e.g., water, soil), from a food sample, or other source. Microorganisms that may be identified may include various genera and species of bacteria, viruses, and other DNA and/or RNA-containing organisms.

For identification of microorganisms, a method such as the Luminex xMAP® technology may be utilized, and the detection step may be incorporated into the automated system along with the amplifications so that the automated system accomplishes the first amplification, the amplicon rescue, the second amplification, and detection. In the Luminex xMAP® system, for example, microspheres in suspension provide solid support for probe binding, also known as a “liquid chip” or “suspension array.” With xMAP® technology, molecular reactions take place on the surface of color-coded microspheres. For each pathogen, target-specific capture probes may be covalently linked to a specific set of color-coded microspheres. Labeled PCR products are captured by the bead-bound capture probes in a hybridization suspension. A microfluidics system delivers the suspension hybridization reaction mixture to a dual-laser detection device. A red laser identifies each bead by its color-coding, while a green laser detects the hybridization signal associated with each bead. Software is used to collect the data and report the results in a matter of seconds. The data is reported in the form of mean fluorescence intensity (MFI).

The method described herein enables one of skill in the art to couple high-specificity, high-sensitivity amplification and detection into one automated system. Using such a system, it is possible to analyze one or more clinical samples in a shorter period of time with greater sensitivity than has previously been possible with existing systems.

The invention may be further described by means of the following non-limiting examples:

Example 1

An arm-PCR reaction was designed to amplify and detect pathogens responsible for food-borne diseases. The target gene used for each pathogen is listed in Table 1 below.

TABLE 1
Target Organism Target Gene
Escherichia coli (E. coli) rfbE
E. coli eac
Salmonella invA
Campylobacter jejuni (1) and coli (2) ceuE
Shigella ipaH
Yersinia enterocolitica yst
Vibrio cholerae OMPW
E. coli (ETEC) heat labile toxin LT
E. coli (STEC) shiga toxin Stx
Vibrio cholerae-cholera toxin Ctx
E. coli (ETEC) heat stable toxin ST
Vibrio parahaemolyticus tlh

Primers generated for each target are listed in Table 2. SupF and SupR indicate common primer sequences. Common primer sequences forming the tag for target-specific primers are shown in bold letters. Fo, Fi, Ri and Ro indicate the nested primers for each amplification target, while the D oligo indicates the detection probe that hybridizes to a specific sequence within the amplicon. The probe is covalently linked to a color coded bead for detection with the Luminex xMAP® instrument.

TABLE 2
Primer Name Primer Sequence SEQ ID NO:
Sup F TTCTTAGCGTATTGGAGTCC 1
Sup R /5Biosg/AATGTACAGTATTGCGTTTTG 2
ceuE Fo CAACAAGTTGATTTTGAAGC 3
ceuE Fi TTCTTAGCGTATTGGAGTCCATTAATGCTTTAAAACCTGATC 4
ceuE Ri AATGTACAGTATTGCGTTTTGTTAAAAAATTTGCATTATCAAG 5
ceue Ro ACCATAAAGTTTTGCAACGC 6
ceuE D1 /5AmMC12/CTC CAA CTT TAT TTG TAG 7
ceuE2 Fo CAACAAGTTGATTTTGAAGC 8
ceuE2 Fi TTCTTAGCGTATTGGAGTCCATTAATGCTTTAAAACCTGATC 9
ceuE2 Ri AATGTACAGTATTGCGTTTTGTTAAAAAATTTGCATTATCAAG 10
ceuE2 Ro ACCATAAAGTTTTGCAACGC 11
ceuE D2 /5AmMC12/CTC CAA CTA TGT TTG TAG 12
rfbE2 Fo AGGATTAGCTGTACATAGGC 13
rfbE2 Fi TTCTTAGCGTATTGGAGTCCGGCATGACGTTATAGGCTAC 14
rfbE2 Ri AATGTACAGTATTGCGTTTTGTGTTCTAACTGGGCTAATCC 15
rfbE2 Ro CGTGATATAAAATCATCAGC 16
rfbE2 D /5AmMC12/GACAAATATCTGCGCTGCTAT 17
eac1 Fo CGATTACGCGAAAGATACCG 18
eac1 Fi TTCTTAGCGTATTGGAGTCCCCAGGCTTCGTCACAGTTGC 19
eac1 Ri AATGTACAGTATTGCGTTTTGCCAGTGAACTACCGTCAAAG 20
eac1 Ro TTTTCGGAATCATAGAACGG 21
eac1 D /5AmMC12/TTATGGAACGGCAGAGGTTA 22
invA1 Fo AACAGTGCTCGTTTACGACC 23
invA1 Fi TTCTTAGCGTATTGGAGTCCCTGGTACTAATGGTGATGATC 24
invA1 Ri AATGTACAGTATTGCGTTTTGGCGATCAGGAAATCAACCAG 25
invA1 Ro TGTAGAACGACCCCATAAAC 26
invA1 D /5AmMC12/TCGTCATTCCATTACCTACC 27
ipaH2 Fo GGATTCCGTGAACAGGTCGC 28
ipa H2 Fi TTCTTAGCGTATTGGAGTCCGCATGGCTGGAAAAACTCAG 29
ipa H2 Ri AATGTACAGTATTGCGTTTTGTCAGTGGCATCAGCAGCAAC 30
ipaH 2 Ro CGCGACACGGTCCTCACAGC 31
ipa H2 D /5AmMC12/AGCTTCGACAGCAGTCTTTC 32
yst Fo GAAAAAGATAGTTTTTGTTC 33
yst Fi TTCTTAGCGTATTGGAGTCCATGCTGTCTTCATTTGGAGC 34
yst Ri AATGTACAGTATTGCGTTTTGGTGTCGATAATGCATCACTG 35
yst Ro CTTGTATACCTCAGCGGTTA 36
yst D /5AmMC12/CGGCCAAGAAACAGTTTCAG 37
ompW Fo CAAGTTTGTGTGATTTTTGTG 38
ompW Fi TTCTTAGCGTATTGGAGTCCCACAAAGATAACAACATAGCCC 39
ompW Ri AATGTACAGTATTGCGTTTTGTACGGCTAGGCAAATGGTTT 40
ompW Ro GTGAGCAAATACAGGAGCGG 41
ompW D1 /5AmMC12/AGGAAAACGTCATGAAAC 42
ompW2 Fo GTGAGTTGGCAGTTAATAGC 43
ompW2 Fi TTCTTAGCGTATTGGAGTCCGGTTAACGCTTGGCTATATG 44
ompW2 Ri AATGTACAGTATTGCGTTTTGGTAGAAATCTTATGTGAAAA 45
ompW2 Ro CTACCTAACTCACCACCAGA 46
ompW D2 /5AmMC12/CTGACAACATCAGTTTTG 47
LT1 Fo TCGATAGAGGAACTCAAATG 48
LT1 Fi TTCTTAGCGTATTGGAGTCCTCTTTATGATCACGCGAGAG 49
LT1 Ri AATGTACAGTATTGCGTTTTGGAAACATATCCGTCATCATA 50
LT1 Ro CTTCTCAAACTAAGAGAAGT 51
LT1 D /5AmMC12/GAACACAAACCGGCTTT 52
LT2 Fo TATGTTTAATGTTAATGATG 53
LT2 Fi TTCTTAGCGTATTGGAGTCCATACAGCCCTCACCCATATG 54
LT2 Ri AATGTACAGTATTGCGTTTTGCTGAGAATATGGTATTCCAC 55
LT2 Ro CCAAAATTAACACGATACCA 56
LT2 D /5AmMC12/AGGAGGTTTCTGCGTTA 57
stx Fo CATATATCTCAGGGGACCAC 58
stx Fi TTCTTAGCGTATTGGAGTCCGTGTCTGTTATTAACCACAC 59
stx Ri AATGTACAGTATTGCGTTTTGGTCAAAACGCGCCTGATAGA 60
stx Ro TTATTTTGCTCAATAATCAG 61
stx D /5AmMC12/GGGCAGTTATTTTGCTG 62
stx2 Fo ACAACGGTTTCCATGACAAC 63
stx2 Fi TTCTTAGCGTATTGGAGTCCGGACAGCAGTTATACCACTC 64
stx2 Ri AATGTACAGTATTGCGTTTTGGAAACCAGTGAGTGACGACT 65
stx2 Ro CCATTAACGCCAGATATGAT 66
stx2 D /5AmMC12/ACGTTCCGGAATGCAAAT 67
ctx1 Fo CAGATTCTAGACCTCCTGATG 68
ctx1 Fi TTCTTAGCGTATTGGAGTCCAGCAGTCAGGTGGTCTTATG 69
ctx1 Ri AATGTACAGTATTGCGTTTTGCATTTGAGTACCTCGGTCAA 70
ctx1 Ro CTTGCATGATCATAAAGGTTG 71
ctx1 D /5AmMC12/AGAGGACAGAGTGAGTAC 72
ctx2 Fo GGGCTACAGAGATAGATATTAC 73
ctx2 Fi TTCTTAGCGTATTGGAGTCCAGATATTGCTCCAGCAGCAG 74
ctx2 Ri AATGTACAGTATTGCGTTTTGCATGATGAATCCACGGCTCT 75
ctx2 Ro CGATGATCTTGGAGCATTCC 76
ctx2 D /5AmMC12/TATGGATTGGCAGGTTTC 77
ST Fo CTTTTTCACCTTTCGCTCAG 78
ST Fi TTCTTAGCGTATTGGAGTCCGATGCTAAACCAGCAGGGTC 79
ST Ri AATGTACAGTATTGCGTTTTGCAATTCACAGCAGTAATTGC 80
ST Ro CCGGTACAAGCAGGATTACA 81
ST D /5AmMC12/AGTAGTCCTGAAAGCATG 82
tlh1 Fo GATTCGTTTGACGGACGCAG 83
tlh1 Fi TTCTTAGCGTATTGGAGTCCCATGTTGATGACACTGCCAG 84
tlh1 Ri AATGTACAGTATTGCGTTTTGCGATCTCTTCTTGTGTTGAG 85
tlh1 Ro CAAGCACTTTCGCACGAATT 86
tlh1 D /5AmMC12/AAAGCGCCTCAGTTTAAG 87
tlh2 Fo AAGAGCACGGTTTCGTGAAC 88
tlh2 Fi TTCTTAGCGTATTGGAGTCCGACATCAACCGCTCATCGTC 89
tlh2 Ri AATGTACAGTATTGCGTTTTGCAGAACACAAACTTCTCAGC 90
tlh2 Ro CGGTGAGTTGCTGTTGTTGG 91
tlh2 D /5AmMC12/ATGTACACCCACGCATTG 92

A primer mix containing 10 pmol of each of the Fo, Fi, Ri and Ro primers in Table 2. For this amplification, only one target template, Campylobacter jejuni, was included. The template was diluted to 10 pg/μl, 1 pg/μl, 0.1 pg/μl, 0.01 pg/μl, and 0.001 pg/μl. A Qiagen Multiplex PCR kit was used to prepare a sample containing 44 μl of Multiplex Mix, 5 μl of primer mix, and 1 μl of template. Cycling conditions were as follows:

    • 95° C. for 15 minutes
    • 94° C. for 15 seconds
    • 55° C. for 15 seconds
    • 72° C. for 15 seconds
    • These three cycles repeated, 2-20 times (15 times total for this example.)
    • 94° C. for 15 seconds
    • 70° C. for 15 seconds
    • These two cycles repeated, 6 times total for this example.
    • 72° C. for 3 minutes
    • 4° C. hold

Upon completion of the first amplification as described above, samples were added to Millipore columns with a molecular weight cut-off of 50 kd and spun for 11 minutes at 13 k RPM to remove a substantial portion of the primers (molecular weight generally below 30 kd), rescuing amplicons with a molecular weight generally above 70 kd on top of the filter. The column was flipped and spun in a new collection tube for approximately 30 seconds to recover the amplicon for the next round of amplification.

10 μl of sample from the collection tube was added to is 15 μl of Multiplex Mix, 1 μl of common primers, 10 pmol for the forward common primer and 40 pmol for the reverse common primer, and 14 μl of H2O. Samples were then placed in a thermocycler (Applied Biosystems, Foster City, Calif.) and run through the following cycles:

    • 95° C. for 15 minutes (to heat activate the enzyme)
    • 94° C. for 15 seconds
    • 55° C. for 15 seconds×30 cycles
    • 72° C. for 15 seconds
    • 72° C. for 3 minutes
    • 4° C. hold

Hybridization was performed using 5 μl of PCR product added to 35 μl of bead (microsphere) mix and allowed to hybridize at 52° C. for 10 minutes. After 10 minutes, 10 μl of SA-PE was added (2× SA-PE, Genaco Biomedical Sciences, Inc., was diluted 1:2 with 1×TMAC) to each sample and allowed to hybridize at 52° C. for 5 minutes. After 5 minutes, 120 μl of 52° C. stop buffer was added to each sample and the samples were analyzed using a Luminex200 machine.

Mean fluorescence intensity (MFI) numbers for arm-PCR and tem-PCR reactions are shown in Table 3.

TABLE 3
Template High concentration Low concentration
Concentration nested primers - MFI nested primers - MFI
10 pg/μl 693 999
1 pg/μl 575 633
0.1 pg/μl 573 281
0.01 pg/μl 430 126
0.001 pg/μl 298 68
Blank 64 59

These results indicate that although the signal is higher at high template concentrations when low concentration nested primers are used, the sensitivity of the high concentration nested primer method is about two logs higher. If the positive signal cutoff is 250 MFI, for example, this method can detect as little as 0.001 pg/μl, while the results of method previously described in the art for low concentration nested primers are negative between 0.1 pg/μl and 0.01 pg/μl. The time required for the entire process is approximately 210 minutes when using low concentration nested primers and approximately 150 minutes when using high concentration nested primers.

Claims (1)

1. A primer kit comprising: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 86, SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91, and SEQ ID NO: 92.
US12/418,532 2008-04-03 2009-04-03 Amplicon rescue multiplex polymerase chain reaction for amplification of multiple targets Active US7999092B2 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US4225908P true 2008-04-03 2008-04-03
US12/418,532 US7999092B2 (en) 2008-04-03 2009-04-03 Amplicon rescue multiplex polymerase chain reaction for amplification of multiple targets

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US12/418,532 US7999092B2 (en) 2008-04-03 2009-04-03 Amplicon rescue multiplex polymerase chain reaction for amplification of multiple targets
US13/210,331 US20120171725A1 (en) 2008-04-03 2011-08-15 Amplicon Rescue Multiplex Polymerase Chain Reaction for Amplification of Multiple Targets

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US13/210,331 Division US20120171725A1 (en) 2008-04-03 2011-08-15 Amplicon Rescue Multiplex Polymerase Chain Reaction for Amplification of Multiple Targets

Publications (2)

Publication Number Publication Date
US20090253183A1 US20090253183A1 (en) 2009-10-08
US7999092B2 true US7999092B2 (en) 2011-08-16

Family

ID=41133627

Family Applications (2)

Application Number Title Priority Date Filing Date
US12/418,532 Active US7999092B2 (en) 2008-04-03 2009-04-03 Amplicon rescue multiplex polymerase chain reaction for amplification of multiple targets
US13/210,331 Pending US20120171725A1 (en) 2008-04-03 2011-08-15 Amplicon Rescue Multiplex Polymerase Chain Reaction for Amplification of Multiple Targets

Family Applications After (1)

Application Number Title Priority Date Filing Date
US13/210,331 Pending US20120171725A1 (en) 2008-04-03 2011-08-15 Amplicon Rescue Multiplex Polymerase Chain Reaction for Amplification of Multiple Targets

Country Status (16)

Country Link
US (2) US7999092B2 (en)
EP (1) EP2271767B1 (en)
JP (2) JP5811483B2 (en)
CN (3) CN104928335A (en)
AU (1) AU2009231582B2 (en)
BR (1) BRPI0911082A2 (en)
CY (1) CY1117891T1 (en)
DK (1) DK2271767T3 (en)
ES (1) ES2586457T3 (en)
HR (1) HRP20160923T1 (en)
HU (1) HUE029914T2 (en)
LT (1) LT2271767T (en)
PL (1) PL2271767T3 (en)
PT (1) PT2271767T (en)
SI (1) SI2271767T1 (en)
WO (1) WO2009124293A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013071258A1 (en) 2011-11-11 2013-05-16 Icubate, Inc. Systems and methods for performing amplicon rescue multiplex polymerase chain reaction (pcr)

Families Citing this family (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10081839B2 (en) 2005-07-29 2018-09-25 Natera, Inc System and method for cleaning noisy genetic data and determining chromosome copy number
US10083273B2 (en) 2005-07-29 2018-09-25 Natera, Inc. System and method for cleaning noisy genetic data and determining chromosome copy number
US9424392B2 (en) 2005-11-26 2016-08-23 Natera, Inc. System and method for cleaning noisy genetic data from target individuals using genetic data from genetically related individuals
US8501449B2 (en) 2007-12-04 2013-08-06 Proteon Therapeutics, Inc. Recombinant elastase proteins and methods of manufacturing and use thereof
ES2549184T3 (en) 2008-04-16 2015-10-23 Cb Biotechnologies, Inc. Method to evaluate and compare inmunorepertorios
US10316362B2 (en) 2010-05-18 2019-06-11 Natera, Inc. Methods for simultaneous amplification of target loci
US20120185176A1 (en) 2009-09-30 2012-07-19 Natera, Inc. Methods for Non-Invasive Prenatal Ploidy Calling
CA2821906A1 (en) 2010-12-22 2012-06-28 Natera, Inc. Methods for non-invasive prenatal paternity testing
EP2673729B1 (en) 2011-02-09 2018-10-17 Natera, Inc. Methods for non-invasive prenatal ploidy calling
CN103797366A (en) 2011-01-14 2014-05-14 Cb生物技术公司 Immunodiversity assessment method and its use
US9121051B2 (en) 2011-10-31 2015-09-01 Arkray, Inc. Method of determining the abundance of a target nucleotide sequence of a gene of interest
KR101483576B1 (en) 2011-10-31 2015-01-21 아크레이 가부시키가이샤 Method for measuring abundance of genes
EP2954070A4 (en) * 2013-02-11 2016-10-26 Cb Biotechnologies Inc Method for evaluating an immunorepertoire
US10262755B2 (en) 2014-04-21 2019-04-16 Natera, Inc. Detecting cancer mutations and aneuploidy in chromosomal segments
US10179937B2 (en) 2014-04-21 2019-01-15 Natera, Inc. Detecting mutations and ploidy in chromosomal segments
CN104388579B (en) * 2014-12-16 2018-11-09 上海速芯生物科技有限公司 One gene in soybean and Arm-PCR method for detecting rotation of derivative products
CN104611457B (en) * 2015-03-04 2019-05-10 上海速芯生物科技有限公司 Arm-PCR primer design method for multiple target point gene magnification
DE102015012691A1 (en) 2015-09-28 2017-03-30 Biotecon Diagnostics Gmbh A method for quantitative detection of Vibrio parahaemolyticus, Vibrio vulnificus and Vibrio cholerae
US10011870B2 (en) 2016-12-07 2018-07-03 Natera, Inc. Compositions and methods for identifying nucleic acid molecules
WO2018165593A1 (en) * 2017-03-09 2018-09-13 iRepertoire, Inc. Dimer avoided multiplex polymerase chain reaction for amplification of multiple targets

Family Cites Families (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5629158A (en) * 1989-03-22 1997-05-13 Cemu Bitecknik Ab Solid phase diagnosis of medical conditions
EP0409159B1 (en) * 1989-07-18 1998-11-25 Shimadzu Corporation Method for testing causative microorganism of food poisoning and reagents therefor
US5693502A (en) * 1990-06-11 1997-12-02 Nexstar Pharmaceuticals, Inc. Nucleic acid ligand inhibitors to DNA polymerases
US5763173A (en) * 1990-06-11 1998-06-09 Nexstar Pharmaceuticals, Inc. Nucleic acid ligand inhibitors to DNA polymerases
US5874557A (en) * 1990-06-11 1999-02-23 Nexstar Pharmaceuticals, Inc. Nucleic acid ligand inhibitors to DNA polymerases
DE69433201D1 (en) * 1994-02-28 2003-11-06 Shimadzu Corp Oligonucleotides and methods for detection of bacteria
US5882856A (en) * 1995-06-07 1999-03-16 Genzyme Corporation Universal primer sequence for multiplex DNA amplification
EP2369007B1 (en) * 1996-05-29 2015-07-29 Cornell Research Foundation, Inc. Detection of nucleic acid sequence differences using coupled ligase detection and polymerase chain reactions
DE19849348A1 (en) * 1998-10-26 2000-04-27 Univ Ludwigs Albert Identification and/or sequencing of an unknown DNA or RNA sequence adjacent to a known DNA or RNA region comprises linker-mediated PCR following amplification by linear PCR
US6312913B1 (en) * 2000-07-21 2001-11-06 Incyte Genomics, Inc. Method for isolating and characterizing nucleic acid sequences
AU2003229256A1 (en) * 2003-05-09 2004-11-26 Capital Biochip Company, Ltd. Methods and compositions for optimizing multiplex pcr primers
US20040229269A1 (en) * 2003-05-15 2004-11-18 Ghazala Hashmi Hybridization-mediated analysis of polymorphisms
KR100830623B1 (en) * 2003-10-13 2008-05-20 제나코 바이오메디컬 프로덕츠, 인코포레이티드 Method and kit for primer based multiplex amplification of nucleic acids
US20060141518A1 (en) * 2004-03-24 2006-06-29 Lao Kai Q Detection of gene expression
KR101368446B1 (en) * 2004-03-31 2014-02-28 다나-파버 캔서 인스티튜트 인크. Method for determining the likelihood of effectiveness of an epidermal growth factor receptor targeting treatment in a human patient affected with cancer, kit, nucleic acid probe, primer pair, and isolated protein
FR2860802B1 (en) * 2004-07-28 2008-02-22 Bertin Technologies Sa Method to enable playback of a chip chemiluminescence
KR100671501B1 (en) * 2005-02-28 2007-01-19 삼성에버랜드 주식회사 Primer for detecting food poisoning and method for rapid detection of food born pathogene
WO2006099579A2 (en) * 2005-03-16 2006-09-21 Applera Corporation Compositions and methods for clonal amplification and analysis of polynucleotides
CA2604095A1 (en) * 2005-04-12 2006-10-19 454 Life Sciences Corporation Methods for determining sequence variants using ultra-deep sequencing
KR101515821B1 (en) * 2005-09-01 2015-04-30 오스다이어그나스틱스 피티와이 엘티디. Amplification of nucleic acids, the quantitative analysis and identification method
JP2007274934A (en) * 2006-04-04 2007-10-25 Nippon Meat Packers Inc Primer set and method for detecting food poisoning bacterium

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013071258A1 (en) 2011-11-11 2013-05-16 Icubate, Inc. Systems and methods for performing amplicon rescue multiplex polymerase chain reaction (pcr)

Also Published As

Publication number Publication date
HRP20160923T1 (en) 2016-10-21
BRPI0911082A2 (en) 2015-08-04
JP2011516069A (en) 2011-05-26
CY1117891T1 (en) 2017-05-17
AU2009231582A1 (en) 2009-10-08
EP2271767A4 (en) 2011-08-24
CN107385040A (en) 2017-11-24
WO2009124293A1 (en) 2009-10-08
LT2271767T (en) 2016-09-26
EP2271767B1 (en) 2016-06-29
HUE029914T2 (en) 2017-04-28
US20120171725A1 (en) 2012-07-05
CN102066573A (en) 2011-05-18
AU2009231582B2 (en) 2015-02-26
PT2271767T (en) 2016-08-18
ES2586457T3 (en) 2016-10-14
PL2271767T3 (en) 2017-01-31
EP2271767A1 (en) 2011-01-12
JP5811483B2 (en) 2015-11-11
SI2271767T1 (en) 2016-12-30
JP2016013133A (en) 2016-01-28
CN104928335A (en) 2015-09-23
US20090253183A1 (en) 2009-10-08
DK2271767T3 (en) 2016-08-29

Similar Documents

Publication Publication Date Title
Olive Detection of enterotoxigenic Escherichia coli after polymerase chain reaction amplification with a thermostable DNA polymerase.
Wolcott Advances in nucleic acid-based detection methods.
AU753191B2 (en) Devices and methods for detecting target molecules in biological samples
US6605451B1 (en) Methods and devices for multiplexing amplification reactions
KR100920851B1 (en) Probe set, probe immobilized carrier and gene examination method
ES2136059T5 (en) Detecting a nucleic acid sequence or a change therein.
EP0359789B1 (en) Amplification and detection of nucleic acid sequences
JP2719225B2 (en) Detection methods and kits for the Chlamydia trachomatis Chis
US20060257871A1 (en) One step real-time rt pcr kits for the universal detection of organisms in industrial products
US6238866B1 (en) Detector for nucleic acid typing and methods of using the same
RU2435865C2 (en) Method of microorganism detection in biological sample
Daher et al. Recombinase polymerase amplification for diagnostic applications
AU5093001A (en) Microarray-based analysis of polynucleotide sequence variations
EP1255860A2 (en) Methods for amplifying and detecting multiple polynucleotides on a solid phase support
WO2002061122A2 (en) New method for genotype determination
WO2007023461A2 (en) Method for detection of micro-organisms and antibiotic resistance markers and nucleic acid oligonucleotides therefor
JP2692702B2 (en) Detection methods and reagents for the herpes simplex virus
JP4481491B2 (en) Method of detecting nucleic acid
US7951541B2 (en) Assay kit for use in method of detecting a target nucleic acid
KR100434244B1 (en) Amplification and detection method of mycobacterium avium complex species
AU657491B2 (en) Methods and reagents for identifying bacteria
EP2789689B1 (en) Chimeric primers with hairpin conformations and methods of using same
US9938578B2 (en) Multiplex pyrosequencing using non-interfering noise cancelling polynucleotide identification tags
JP4268944B2 (en) Detection or quantification method of nucleic acid
EP2644699B1 (en) Amplified nucleic acid detection method and detection device

Legal Events

Date Code Title Description
STCF Information on status: patent grant

Free format text: PATENTED CASE

FPAY Fee payment

Year of fee payment: 4

AS Assignment

Owner name: HUDSON ALPHA INSTITUTE FOR BIOTECHNOLOGY, ALABAMA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:HAN, JIAN;REEL/FRAME:036181/0976

Effective date: 20080529

AS Assignment

Owner name: CB BIOTECHNOLOGIES, INC., ALABAMA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:HUDSON ALPHA INSTITUTE FOR BIOTECHNOLOGY;REEL/FRAME:036984/0819

Effective date: 20130617

AS Assignment

Owner name: IREPERTOIRE, INC., ALABAMA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:CB BIOTECHONOLOGIES INCORPORATED;REEL/FRAME:043741/0040

Effective date: 20160627

MAFP Maintenance fee payment

Free format text: PAYMENT OF MAINTENANCE FEE, 8TH YR, SMALL ENTITY (ORIGINAL EVENT CODE: M2552); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY

Year of fee payment: 8