US7829307B2 - Production of glucagon-like peptide 2 - Google Patents

Production of glucagon-like peptide 2 Download PDF

Info

Publication number
US7829307B2
US7829307B2 US10/993,127 US99312704A US7829307B2 US 7829307 B2 US7829307 B2 US 7829307B2 US 99312704 A US99312704 A US 99312704A US 7829307 B2 US7829307 B2 US 7829307B2
Authority
US
United States
Prior art keywords
glp
peptide
cleavage site
multimer
cleaving
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
US10/993,127
Other versions
US20050164930A1 (en
Inventor
Ken Sasaki
Vanessa Jane Williamson
Alberto de Araujo
Ewa Walczyk
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shire NPS Pharmaceuticals Inc
Original Assignee
NPS Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by NPS Pharmaceuticals Inc filed Critical NPS Pharmaceuticals Inc
Priority to US10/993,127 priority Critical patent/US7829307B2/en
Assigned to NPS ALLELIX CORP. reassignment NPS ALLELIX CORP. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: WALCZYK, EWA, DE ARAUJO, ALBERTO, SASKI, KEN, WILLIAMSON, VANESSA JANE
Publication of US20050164930A1 publication Critical patent/US20050164930A1/en
Assigned to NPS PHARMACEUTICALS, INC. reassignment NPS PHARMACEUTICALS, INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: NPS ALLELIX CORP.
Priority to US12/895,517 priority patent/US20110092424A1/en
Application granted granted Critical
Publication of US7829307B2 publication Critical patent/US7829307B2/en
Anticipated expiration legal-status Critical
Expired - Fee Related legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/575—Hormones
    • C07K14/605—Glucagons
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide

Definitions

  • GLP-2 and analogs thereof are produced not only in relatively high yield, but also as structurally authentic products, comprising only the natural form of the naturally occurring amino acids in the sequence constituting the GLP-2 peptide.
  • the N- and C-terminal residues are “terminally authentic”.
  • the present process yields the desired GLP-2 as a peptide having N- and C-terminal residues that are without residual amino acids and other chemical moieties that often result from recombinant methods of protein production, particularly those which rely on production of the protein as a fused precursor from which the target protein must be released.
  • An acid cleavage site presented in the GLP-2 peptide multimer is suitably the sequence Asp-Pro, which is cut under low pH conditions between the Asp and Pro residues.
  • the GLP-2 peptide units are those that incorporate Asp as a C-terminal residue, and which otherwise lack both an acid cleavage site and a thrombin cleavage site.
  • the N-terminal Pro residue of the linker together with the C-terminal Asp residue of the upstream GLP-2 peptide unit, form the Asp-Pro site that is cleavable in acid, i.e., at low pH, to yield the authentic C-terminus of the GLP-2 peptide.
  • the linker sequence ValSerGlyProArg presents a thrombin recognition sequence that is cleaved by thrombin on the C-terminal side of its Arg residue, to yield an authentic N-terminal residue in the GLP-2 peptide unit downstream thereof. While a specific thrombin cleavage sequence is shown, it will be understood that any equivalent sequence recognized and cleaved by thrombin can be incorporated in the linker, including those sequences reported by Chang, J. (1985) Eur. J. Biochem. 151, 217-224, incorporated herein by reference. It will also be appreciated that any GLP-2 peptide unit within the multimer should not incorporate any thrombin cleavage sequence within the primary structure of that GLP-2 unit.
  • the GLP-2 peptide unit incorporated within the multimer is the analog of human GLP-2 in which the Ala at position 2 is substituted by Gly, i.e., [Gly 2 ]hGLP-2, having the amino acid sequence illustrated in FIG. 2 .
  • the GLP-2 peptide can be the wild type human GLP-2 having the amino acid sequence reported by Buhl et al. in J. Biol. Chem., 1988, 263(18):8621, a homolog thereof, or any other analog thereof that retains a C-terminal Asp residue and is otherwise lacking in both thrombin and acid cleavage sites. Suitable analogs can be selected for instance from those described in co-assigned U.S. Pat. Nos. 5,789,379 and 6,184,201, the disclosures of which are incorporated herein by reference.
  • the GLP-2 peptide multimer can terminate with a GLP-2 peptide unit or, if desired, can terminate with a peptide extension thereof useful, for instance, in the purification of the multimer. If a C-terminal extension peptide is incorporated, it desirably incorporates a Pro residue as its initial residue, so that treatment of the resulting multimer with acid cleaves not only the C-terminal extension but also at the C-terminus of each GLP-2 peptide unit within the multimer.
  • the culturing conditions chosen for the transformed cellular host will also depend of course on the host species, and on the expression system utilized.
  • the transformant will be cultured at commercial scale in the presence of antibiotic to maintain selective pressure on transformants.
  • the culture will receive IPTG to de-repress the promoter and allow expression to commence. Culturing can be performed at commercial scale of at or beyond about 200 litres.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Toxicology (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Endocrinology (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

GLP-2 peptides and analogs thereof are produced in high yield and with desired, authentic termini by isolation from a GLP-2 peptide multimer in which at least two units of GLP-2 peptide are coupled through a linker that presents an N-terminal acid cleavage site and a C-terminal enzyme cleavage site. In a specific embodiment, [Gly2]hGLP-2 is produced from a multimeric precursor comprising 2-30 units thereof.

Description

FIELD OF THE INVENTION
This invention applies the art of molecular biology in the field of protein production. More particularly, the invention relates to the production of recombinant glucagon-like peptide 2, or GLP-2, and analogs thereof.
BACKGROUND OF THE INVENTION
GLP-2 is a 33 amino acid product of the proglucagon gene. Recent evidence indicates that GLP-2 promotes nutrient absorption via expansion of the mucosal epithelium by stimulation of crypt cell proliferation and inhibition of apoptosis in the small intestine. GLP-2 also reduces epithelial permeability, and decreases meal-stimulated gastric acid secretion and gastrointestinal mobility. Many of these effects have been attributed not only to the wild type peptide, but also to analogs thereof, including particularly those rendered resistant to digestion by serum-borne enzymes, such as DPP-IV, by substitution of the alanine resident at position 2 with, for instance, glycine. A variety of bioactive GLP-2 analogs are described, for instance, in U.S. Pat. No. 5,789,379.
With recent recognition of its pharmaceutical properties, there is a demand for large quantities of GLP-2 and analogs thereof to permit development and subsequent medical use of these products. Solid or solution phase synthetic methods have typically been applied to produce the research quantities of GLP-2 and analogs used to date. The production of GLP-2 as a recombinant product of genetically engineered hosts has been suggested, for instance in U.S. Pat. Nos. 5,789,379 and 6,287,806, and is described in U.S. Pat. No. 5,629,205. However, prior art production systems have limitations in terms of product yield and quality, and it would be desirable to provide a system that yields quality GLP-2 peptide in a cost-effective manner.
It is accordingly an object of the present invention to provide a process, and intermediates and reagents useful therein, by which commercial quantities of GLP-2 can be produced.
It is another object of the present invention to provide GLP-2 and analogs thereof, particularly the [Gly2]hGLP-2 analog, in structurally authentic form.
SUMMARY OF THE INVENTION
In accordance with the present invention, there is provided a process by which GLP-2 and analogs thereof are produced not only in relatively high yield, but also as structurally authentic products, comprising only the natural form of the naturally occurring amino acids in the sequence constituting the GLP-2 peptide. Preferably, the N- and C-terminal residues are “terminally authentic”. In particular, the present process yields the desired GLP-2 as a peptide having N- and C-terminal residues that are without residual amino acids and other chemical moieties that often result from recombinant methods of protein production, particularly those which rely on production of the protein as a fused precursor from which the target protein must be released.
More particularly, and according to one aspect of the present invention, there is provided a single chain polypeptide precursor in which two or more copies of the GLP-2 peptide are coupled tandemly through a linker that is cleavable to release each unit of GLP-2 peptide as a product having authentic N- and C-termini. In a particular embodiment of the invention, the GLP-2 peptides are coupled using a linker that presents cleavage sites at each of its flanks. In a specific embodiment, the linker presents an acid cleavage site at one flank, and an enzyme cleavage site at its other flank.
In another aspect, the present invention provides a process for producing a GLP-2 peptide having authentic N- and C-termini, in which the present GLP-2 peptide multimer is cleaved to release each GLP-2 peptide unit resident therein.
In other aspects of the present invention, there are further provided polynucleotides, genetic constructs, and transformed host cells useful in the production of such multimeric GLP-2 peptide precursors.
In still another aspect, the present invention provides [Gly2]hGLP-2 as a recombinant product characterized by a mass essentially identical to theoretical mass. In a related aspect, the present invention provides a pharmaceutical composition comprising such peptide in a therapeutically useful amount and a pharmaceutically acceptable carrier
Both the foregoing general description and the following brief description of the drawings and detailed description are exemplary and explanatory and are intended to provide further explanation of the invention as claimed. Other objects, advantages, and novel features will be readily apparent to those skilled in the art from the following detailed description of the invention.
BRIEF REFERENCE TO THE DRAWINGS
FIG. 1 illustrates PCR-based construction of a gene that encodes a [Gly2]hGLP-2 unit flanked by a thrombin cleavage site (SEQ ID NO: 5 encodes SEQ ID NO: 6) and an acid cleavage site (SEQ ID NOS 7 and 8);
FIG. 2 illustrates the expected DNA sequence of the amplification product of FIG. 1 (SEQ ID NO: 3 encodes SEQ ID NO: 4). The sequence of the [Gly2]hGLP-2 unit is underlined;
FIG. 3 is a plasmid map of pKS58 carrying a gene that encodes a [Gly2]hGLP-2 hexamer;
FIGS. 4A through 4H provides the nucleotide sequence of pKS58, carrying a construct encoding a [Gly2]hGLP-2 hexamer, where the amino acid sequence is also illustrated, showing the GLP-2 peptide units in bold. Any reference hereafter to “FIG. 4” should be interpreted as a reference to FIGS. 4A through 4H.
FIG. 5 provides a mass spectrometric analysis of a GLP-2 peptide produced as herein described.
DETAILED DESCRIPTION OF THE INVENTION
In one aspect, the present invention provides a genetic construct, in the form of a polynucleotide, adapted to produce the GLP-2 peptide as a single chain, multimeric precursor comprising at least two copies of a GLP-2 peptide. Each such peptide is coupled to the next through a linker having flanks that present cleavage sites permitting the release of the GLP-2 peptides as monomers having N- and C-termini that are authentic, and thus are essentially free from chemical residues originating from the linker or the cleavage process. As a recombinant product, the resulting GLP-2 peptide is also free from chemical moieties such as blocking groups used in solution and solid phase peptide synthesis.
In the present invention, GLP-2 peptide units within the multimer are coupled using a linker that presents cleavage sites at the N- and C-termini of the resident GLP-2 peptide units. These sites, and the agents used to cleave them, are selected so that the GLP-2 peptide remains intact during the cleavage process, so that isolation and purification yields a GLP-2 peptide having the desired N- and C-terminal residues without any requirement for further processing.
In a preferred embodiment of the present invention, the linker is a relatively short peptide sequence, consisting of not more than about 25 residues, desirably less than about 20 residues, suitably less than about 15 residues, and most suitably less than about 10 residues. The sequence of the linker is chosen to avoid formation of complex secondary structures that mask the linker to the chosen cleaving agent. The cleavage site presented by the linker can be a site that is vulnerable to cleavage by enzyme or chemical conditions such as pH.
In a preferred embodiment, the linker is desirably one that presents an enzyme cleavage site at one flank, and an acid cleavage site at another flank. The site sensitive to cleavage by enzyme can be any site that is not reproduced elsewhere in the GLP-2 peptide multimer and is cleaved by any enzyme not present otherwise during the manufacturing process. Enzymes suitable for such cleavage, and sequences recognized and cleaved by those enzymes, include enterokinase and the sequence Asp-Asp-Asp-Asp-Lys (SEQ ID NO: 9), and Factor Xa and the sequence Ile-Glu-Gly-Arg (SEQ ID NO: 10). In a preferred embodiment, the enzyme cleavage site is one cleaved by thrombin, and the thrombin cleavage sequence is ValSerGlyProArg (SEQ ID NO: 11).
An acid cleavage site presented in the GLP-2 peptide multimer is suitably the sequence Asp-Pro, which is cut under low pH conditions between the Asp and Pro residues.
In embodiments of the present invention, the linker provides, within the multimer, an acid cleavage site at its N-terminus and a thrombin cleavage site at its C-terminus. In a specific embodiment, the linker has the amino acid sequence ProValSerGlyProArg (SEQ ID NO: 12). Alternatively, it will be appreciated that the N-terminal Pro residue and the C-terminal thrombin cleavage site can be separated by additional amino acid sequence that does not detract from the vulnerability of the flanks to the desired cleavage conditions. When the noted particular linker is incorporated into the multimer, the GLP-2 peptide units are those that incorporate Asp as a C-terminal residue, and which otherwise lack both an acid cleavage site and a thrombin cleavage site. When linked between such GLP-2 peptide units, the N-terminal Pro residue of the linker, together with the C-terminal Asp residue of the upstream GLP-2 peptide unit, form the Asp-Pro site that is cleavable in acid, i.e., at low pH, to yield the authentic C-terminus of the GLP-2 peptide. Moreover, the linker sequence ValSerGlyProArg (SEQ ID NO: 11) presents a thrombin recognition sequence that is cleaved by thrombin on the C-terminal side of its Arg residue, to yield an authentic N-terminal residue in the GLP-2 peptide unit downstream thereof. While a specific thrombin cleavage sequence is shown, it will be understood that any equivalent sequence recognized and cleaved by thrombin can be incorporated in the linker, including those sequences reported by Chang, J. (1985) Eur. J. Biochem. 151, 217-224, incorporated herein by reference. It will also be appreciated that any GLP-2 peptide unit within the multimer should not incorporate any thrombin cleavage sequence within the primary structure of that GLP-2 unit.
Thus, in a valuable aspect of the present invention, there is provided a single chain polypeptide that incorporates at least two GLP-2 peptide units coupled tandemly through a linker having the sequence ProValSerGlyProArg (SEQ ID NO: 12), wherein the GLP-2 peptide incorporates a C-terminal Asp residue, and otherwise lacks both a thrombin cleavage sequence and an acid cleavage sequence.
In a preferred embodiment of this aspect of the present invention, the GLP-2 peptide unit incorporated within the multimer is the analog of human GLP-2 in which the Ala at position 2 is substituted by Gly, i.e., [Gly2]hGLP-2, having the amino acid sequence illustrated in FIG. 2. In the alternative, the GLP-2 peptide can be the wild type human GLP-2 having the amino acid sequence reported by Buhl et al. in J. Biol. Chem., 1988, 263(18):8621, a homolog thereof, or any other analog thereof that retains a C-terminal Asp residue and is otherwise lacking in both thrombin and acid cleavage sites. Suitable analogs can be selected for instance from those described in co-assigned U.S. Pat. Nos. 5,789,379 and 6,184,201, the disclosures of which are incorporated herein by reference.
In other embodiments, the multimeric GLP-2 peptide precursor comprises at least two GLP-2 peptide units, and as many as 10 or more such units, e.g. up to about 30 units and more suitably up to about 20 units, linked in tandem through the noted linker. In specific embodiments, the number of units of GLP-2 peptide in the precursor is 2, 3, 4, 5, 6 or 7. In one preferred embodiment, the multimeric precursor incorporates six GLP-2 peptide units. In another preferred embodiment, the precursor incorporates seven GLP-2 peptide units.
It will be appreciated that the GLP-2 peptide multimer, for expression as a recombinant product, will incorporate an N-terminal extension that incorporates at least an initial Methionine residue. In embodiments, the N-terminal extension is incorporated as a carrier peptide that bears the N-terminal methionine residue and is cleavable from the multimer per se. The carrier peptide thus can be a secretion signal that is cleaved by the host in the process of secreting the mature multimer. Alternatively and desirably, the carrier peptide is not a secretion signal, and the multimeric product accumulates in the cytoplasm of the host where it is recovered optionally in the form of inclusion bodies. Where the carrier peptide is not designed to be removed by the host cell, the carrier peptide desirably further incorporates amino acids that constitute the same enzyme cleavage site presented within the multimer at the N-terminal flank of each GLP-2 peptide unit. In this arrangement, treatment of the expressed GLP-2 multimer with the selected enzyme not only cuts the carrier from the multimer, but also cuts the multimer at the N-terminus of each GLP-2 peptide unit resident therein. In one embodiment, the carrier peptide initiates with a Met residue and terminates with a thrombin cleavage site, such as ValSerGlyProArg (SEQ ID NO: 11). The N-terminal carrier peptide of the GLP-2 multimer can further incorporate other intervening sequences functional, for instance, in purification of the multimer such as the so-called His-Tag, in enhancing the level of expression of the multimer by the selected host, or in promoting formation of the multimer as inclusion bodies such as hydrophobic amino acid sequences.
It will also be appreciated that the GLP-2 peptide multimer can terminate with a GLP-2 peptide unit or, if desired, can terminate with a peptide extension thereof useful, for instance, in the purification of the multimer. If a C-terminal extension peptide is incorporated, it desirably incorporates a Pro residue as its initial residue, so that treatment of the resulting multimer with acid cleaves not only the C-terminal extension but also at the C-terminus of each GLP-2 peptide unit within the multimer.
In a most preferred embodiment of the invention, there is provided a GLP-2 peptide multimer having the sequence illustrated in FIG. 4, comprising 6 units of [Gly2]hGLP-2 and incorporating, as a linker, the sequence ProValSerGlyProArg (SEQ ID NO: 12).
The production of such a multimer can be achieved in any cellular host for which expression systems have been developed. GLP-2 and its analogs do not require post-translational modification for activity, and can thus be produced in a variety of bacterial as well as eukaryotic hosts.
In one embodiment, the multimer is expressed in bacterial cells, such as E. coli cells, using expression systems adapted and well established for this purpose. A polynucleotide encoding the multimer can for instance be incorporated for expression within cassettes that drive expression from such promoters as lac, tac, trp, T7 and the like. The strain of E. coli chosen as host can also vary widely, and includes DH5, JM101 and BL21 among others. Vectors useful in transforming the selected host will typically include plasmids that incorporate origins of replication and selectable markers that enable detection and selective survival of the transformants.
Similarly, a variety of eukaryotic hosts and expression systems can be exploited. These include Saccharomyces cerevisiae and expression systems based on the mating factor alpha system, Aspergillus nidulans hosts utilizing the alcohol dehydrogenase (alcA) system, or Aspergillus nidulans utilizing the glucoamylase gene-based expression system, as well as mammalian cell systems such as the COS cell systems and the CHO-based systems.
Polynucleotides encoding the GLP-2 multimer can of course be produced synthetically de novo, or can be prepared from DNA coding for the GLP-2 peptide unit following a series of amplification and ligation steps, all in accordance with standard practise, and as exemplified herein.
The culturing conditions chosen for the transformed cellular host will also depend of course on the host species, and on the expression system utilized. In one embodiment, where the host is an E. coli species and the expression system relies on the tac promoter, the transformant will be cultured at commercial scale in the presence of antibiotic to maintain selective pressure on transformants. At or near log growth phase, the culture will receive IPTG to de-repress the promoter and allow expression to commence. Culturing can be performed at commercial scale of at or beyond about 200 litres.
Following culturing, the expressed GLP-2 multimer can be isolated by size selection chromatography, by ion-exchange chromatography, or by affinity chromatography particularly in the case where an affinity tag is incorporated in the multimer. When the multimer is produced as an intracellular product, the cultured cells can be treated in a first step to lyse the cells and release the multimer and other intracellular products, for instance using 8M urea or 6M guanidine hydrochloride or mechanical cell disruptions such as a homogenizer or sonicator. It is not necessary to separate the contents for further processing. In an embodiment of the invention, the products of lysis are treated in situ to establish dissociating conditions, such as by the addition of guanidinium chloride, and the mixture is then pH adjusted with HCl, or equivalent acid, to introduce acid conditions, in the pH range from about 1-3. At this pH, the Asp-Pro site is disrupted at each interface between the C-terminus of a GLP-2 peptide unit and the N-terminus of the linker. The resulting cleavage products, including GLP-2 peptide units bearing linker residues at the N-terminus, can then be isolated by any convenient means such as by HPLC, by size exclusion chromatography, by ion-exchange chromatography, or by affinity chromatography. The recovered products can then be subjected to an enzyme cleavage step in which exposure to thrombin results in the removal of residual linker at the N-terminus of each GLP-2 unit. The result is a multi-molar yield of GLP-2 peptides from a single GLP-2 multimer, each GLP-2 peptide having N- and C-termini that, as desired, are authentic and lacking in any undesired chemical modification.
As noted in the examples that follow, production by this method has produced [Gly2]hGLP-2 as a terminally authentic product having a mass (3752.59) that is essentially equivalent to theoretical (3751.99).
The GLP-2 peptide so produced is formulated, on an aspect of the present invention, for pharmaceutical use by forming a pharmaceutical composition in which a therapeutically useful amount of the peptide is combined with a pharmaceutically acceptable carrier. In one embodiment, the composition is formulated for parenteral administration, and comprises a unit dose of the GLP-2 peptide and an aqueous vehicle that is buffered to within a physiologically tolerable pH range and tonicity, e.g., pH 4-8, using for instance phosphate buffer saline as the vehicle. The formulation can also comprise a stabilizing agent, such as histidine, as disclosed in WO 01/49314, or a depot agent such as gelatin as disclosed in U.S. Pat. No. 5,789,379, the disclosures of which are incorporated herein by reference. Unit doses of the GLP-2 peptide lie typically within the range from 0.1 to 50 mg in an injection volume of about 1 mL.
The following examples are given to illustrate the present invention. It should be understood, however, that the invention is not to be limited to the specific conditions or details described in these examples. Throughout the specification, any and all references to a publicly available document, including a U.S. patent, are specifically incorporated by reference.
EXAMPLES
Various multimer constructs of [Gly2]hGLP-2 gene can be made in a one pot reaction by taking advantage of the restriction endonuclease, BsaI. This endonuclease recognizes the non-palindromic sequence (GGTCTC), so that the linker and [Gly2]hGLP-2 genes can be ligated in only one direction, head to tail ligation.
To obtain the maximum level of expression, the multimer gene constructs were inserted into a plasmid under the control of bacteriophage T7 promoter. Using this strategy, seven multimer constructs were obtained, containing 2 to 7 [Gly2]hGLP-2 gene units (from dimer to heptamer). The multimer genes were expressed after induction by IPTG. The greatest level of expression was found from hexamer and heptamer constructs.
A convenient cell lysis and acid cleavage method was also developed. After induction, the cell pellet was lysed with 6M guanidine hydrochloride and centrifuged. The supernatant solution was pH-adjusted to 1.8 by addition of HCl. Thus, cell lysis and acid cleavage were accomplished in very simple steps without any purification between lysis and acid cleavage. It may be possible to achieve cell lysis and acid cleavage in a single reaction, if 6M guanidine hydrochloride is pH adjusted to 1.8 with HCl and then it is added to E. coli cell pellet.
The acid cleaved products were purified by HPLC using a C18 column and then treated with thrombin to obtain mature [Gly2]hGLP-2, which was further purified by HPLC using the same C18 column. Only two HPLC steps (first after acid cleavage and second after thrombin cleavage) were needed to purify [Gly2]hGLP-2, and the purified [Gly2]hGLP-2 was confirmed to be authentic [Gly2]hGLP-2 by mass spectrometry.
Example 1 Gene Construction
To construct multimers of [Gly2]hGLP-2 gene, a [Gly2]hGLP-2 gene, as shown below, was first amplified by PCR using a plasmid, pG3M, which carried a codon optimized [Gly2]hGLP-2 gene and was re-named as pEW3G.
As shown in FIG. 1, the forward PCR primer sequence (Primer KS1-5) contained NdeI and BsaI endonuclease recognition sites, and thrombin cleavage site, which are followed by 18 nucleotides encoding the first six amino acids of [Gly2]hGLP-2.
The reverse PCR primer (Primer KS2-3) contained BamHI and BsaI endonuclease recognition sites, acid cleavage site, and an 18 nucleotide sequence, which encode the last six amino acid residues of [Gly2]hGLP-2.
For PCR reaction, the lower PCR reaction mixture was first prepared in a PCR tube. The lower mixture contained 41 μL of water, 5 μL of 10× TsgPlus buffer, 2 μL of deoxynucleotide mixture (2.5 mM each), 1 μL of primer KS1-5 (100 μM), and 1 μL of primer KS2-3 (100 μM). To the lower mixture, a piece of Ampliwax® was added and heated at 65° C. for 5 min and then cooled to room temperature on a bench. After a thin layer of wax was formed, the upper mixture contained 43.5 μL of water, 5 μL of 10× TsgPlus buffer, 0.2 ng of plasmid, pG3M, in 1 μL, and 0.5 μL of Tsg Plus enzyme. Tsg Plus enzyme was a mixture of Tsg DNA polymerase and Pfu DNA polymerase. The 10× Tsg Plus buffer contained 200 mM Tris-HCl (pH8.8), 100 mM KCl, 100 mM (NH4)2SO4, 20 mM MgSO4, 1% Triton X-100, and 1 mg/mL bovine serum albumin.
The thermocycler conditions were as follows:
    • Step 1: 95° C. for 2 min
    • Step 2: 95° C. for 1 min
    • Step 3: 50° C. for 1 min
    • Step 4: 72° C. for 15 sec
    • Step 5: Go to Step 2 and repeat Step 2 through Step 4 nine more times
    • Step 6: 95° C. for 1 min
    • Step 7: 65° C. for 30 sec
    • Step 8: 72° C. for 15 sec
    • Step 9: Go to Step 6 and repeat Step 6 through Step 8 nineteen more times
    • Step 10: 72° C. for 5 min
    • Step 11: 4° C. overnight
After the whole cycle of PCR reaction, as described above, the expected product (a DNA band of approximately 140 bp), and as shown in FIG. 2, was confirmed by 1.5% agarose gel electrophoresis.
Forty μL out of the 100 μL PCR reaction mixture were purified using a QIA ExII kit according to the manufacturer's instruction, and then digested with BamHI and NdeI restriction enzymes. The digested DNA was separated by 2% agarose gel electrophoresis, the DNA band was cut out of the gel and then purified using QIA ExII. The purified PCR product digested with the two enzymes and purified was ligated into pET29a, which was previously digested with the same two restriction enzymes, NdeI and BamHI. The ligation was performed using Quick T4 DNA ligase at room temperature for 6 minutes.
Next, competent cells of E. coli DH5α were transformed with the ligation product. To 50 μL of thawed competent cells in a microfuge tube (1.8 mL capacity), 3 μL out of 21 μL ligation mixture were added. The competent cell mixture was kept on ice for 30 min, heat-shocked at 37° C. for 20 sec, and then kept on ice for 2 minutes. To the heat-shocked cells, 900 μL of pre-warmed Super Optimal Catabolite (“SOC”) medium (37° C.) was added. After shaking the cell suspension at 225 rpm at 37° C. for 1 hour, 50 μL and 200 μL of the cell suspension were spread on LB agar plates containing kanamycin (50 μg/mL) and incubated at 37° C. overnight.
Single colonies were isolated from the agar plates the next day, and cultured in 7 mL of LB broth containing kanamycin (50 μg/mL) at 37° C. at 250 rpm overnight. Six mL out of 7 mL culture were centrifuged at 3,000 rpm for 15 min and plasmid was isolated from the cell pellet using QIAprep Spin Plasmid Miniprep kit.
To identify if the plasmid carried the insert, the isolated plasmid was digested by a restriction enzyme, PmlI, at 37° C. for 2 hours and then separated by 0.8% agarose gel electrophoresis. The plasmid was also digested by BsaI enzyme at 50° C. for 2.5 hours and analyzed on 1.5% agarose gel. As seen in FIG. 2, the PCR amplified insert carried a single PmlI site and two BsaI sites, but the vector, pET29a, did not carry those restriction enzyme sites. Therefore, only the plasmid, which carried the insert, was digested by PmlI and BsaI.
The insert portion of the plasmid was then sequenced from both directions using the two primers shown below (Forward and Reverse primers) to confirm the correct sequence of the insert on the plasmid. One of the plasmids, which carried the single insert with a correct nucleotide sequence, was designated as pKS35.
Example 2 Vector Construction
To construct multimers of [Gly2]hGLP-2 gene, pKS35 was digested with BsaI at 50° C. for 2.5 hour and separated on 1.5% agarose gel. The larger DNA band (the vector portion) was cut out of the gel and DNA was extracted from the gel piece using QIA quick gel extraction kit. The smaller DNA band (the insert, approximately 110 bp) was cut out of the gel and the DNA was extracted using QIA ExII. The large vector portion was further treated with calf intestine alkaline phosphatase (CIP) to minimize self-ligation of the vector and purified by QIAPCR purification kit.
The CIP-treated vector DNA and the smaller insert DNA were mixed and ligated using Quick T4 ligase. The ligation mixture was used to transform DH5α, as described above, and then the bacteria cells were plated 2× Yeast Extract (2× YE) agar plates containing kanamycin (30 μg/mL).
To examine the number of [Gly2]hGLP-2 gene units present on plasmid in each transformant, the inserts were directly amplified from heat-lysed E. coli cells by PCR and examined by agarose gel electrophoresis. As shown below, the forward primer used for the PCR (KS003-5) was a 20 base oligo nucleotide, which annealed to the phage T7 promoter region on pET29a. The reverse primer (KS004-3) was a 19 base oligonucleotide, which bound to the T7 transcription terminator region on the plasmid.
Forward Primer: TAATACGACTCACTATAGGG
(SEQ ID NO: 13)
Reverse Primer: GCTAGTTATTGCTCAGCGG
(SEQ ID NO: 14)
The PCR lower mixture contained 42 μL of water, 5 μL of 10× Tsg Plus buffer, 2 μL of deoxynucleotide mixture (2.5 mM each), 0.5 μL of 100 μM forward primer KS003-5, and 0.5 μL of 100 μM reverse primer KS004-3 in the total of 50 μL. A piece of Ampliwax was added to the lower mixture in a PCR tube, heated at 63° C. for 5 minutes, and then solidified at room temperature. To the top of solidified wax, the upper mixture (50 μL) was added. The upper mixture contained 44.5 μL of water, 5 μL of 10× Tsg Plus buffer, and 0.5 μL of Tsg Plus enzyme. Next, a single colony among many transformants was picked with a sterile toothpick from agar plate and suspended in the upper mixture. The PCR tube was then subjected to the PCR heating cycles using a thermocycler, as described below.
The thermocycler conditions were as follows:
    • Step 1: 95° C. for 5 min
    • Step 2: 95° C. for 1 min
    • Step 3: 55° C. for 30 sec
    • Step 4: 72° C. for 1 min
    • Step 5: Go to Step 2 and repeat Step 2 through Step 4 twenty nine more times
    • Step 6: 72° C. for 10 min
    • Step 7: 4° C. overnight
The PCR products were separated by 1.5% agarose gel electrophoresis and seven different sizes of PCR products were detected on the gel. By comparison with DNA size markers (100 bp ladder), they were identified as monomer, dimer, trimer, tetramer, pentamer, hexamer and heptamer. These multimers were also subjected to nucleotide sequencing analysis, which demonstrated that all had correct sequences of multimers.
Example 3 Transformation and Culturing
The [Gly2]hGLP-2 multimer constructs were cloned into a plasmid pET29a in such a way that they were expressed under the control of phage T7 promoter. E. coli RNA polymerase cannot recognize the T7 promoter. T7 RNA polymerase is required for the transcription from T7 promoter. E. coli strain, BLR(DE3), carries a phage T7 RNA polymerase gene on its chromosome. Moreover, recA gene in BLR(DE3) is inactivated so that the chance of losing [Gly2]hGLP-2 gene units in the multimer constructs by homologous recombination is minimal in this strain. Both DH5α and BLR(DE3) strains are available commercially, as is the T7 system used herein.
The pET29a carrying a hexamer construct of [Gly2]hGLP-2 was designated as pKS58 and isolated from the transformant cells using Qiagen Plasmid Midi Prep kit. The frozen competent cells of BLR(DE3) (20 μL) were thawed, mixed with 1 μL of pKS58, kept on ice for 5 minutes, heat-shocked at 42° C. for 30 sec, and then kept on ice for 2 minutes. To the cell mixture, 80 μL of SOC medium was added and incubated at 37° C. at 250 rpm for 1 hour. Portions of cell suspension (20 and 50 μL) were plated on 2× YE agar plates containing kanamycin (30 μg/mL) and incubated at 37° C. overnight.
For expression, a single colony from each of the transformation plates of BLR(DE3), carrying a [Gly2]hGLP-2 gene multimer unit, was suspended in 50 mL of 2× YE broth containing kanamycin (30 μg/mL) in a 250 mL Erlenmeyer flask and shaken at 37° C. at 300 rpm overnight. An aliquot (200 μL) of the culture was added into 50 mL of pre-warmed 2× YE broth containing kanamycin (30 μg/mL) and shaken at 37° C. at 300 rpm. After 2 hours and 10 minutes when O.D. at 600 nm was approximately 0.35, IPTG was added to make a final concentration of 2 mM to induce the multimer gene.
At 2 and 3 hours after addition of IPTG, 2 mL of cell suspension were harvested and microfuged at 15,000 rpm for 15 minutes. The cell pellets were lysed with 50 μL of cell lysis buffer at 100° C. for 5 minutes. A portion of the cell lysate (12 μL) was mixed with 3 μL of SDS-PAGE loading buffer and proteins were separated by SDS-PAGE. The proteins on the gels were stained with Coomassie Blue. The expression of multimer constructs was examined by comparison with the protein molecular weight markers and the protein profile of uninduced cells.
Example 4 Multimer Processing and Peptide Isolation
After induction, the cells were harvested by centrifugation and one gram of the fresh cell pellets were lysed in 20 mL of 6M guanidine hydrochloride. The cell suspension was incubated on ice for 1 hour with occasional mixing and centrifuged at 12,000×g for 30 min. After addition of 30 mL of 6M guanidine hydrochloride to the supernatant solution, the pH of supernatant solution was adjusted to 1.8 by adding drops of 1N-HCl first and 0.1N-HCl and then incubated at 65° C. for 12-14 hours with gentle swirling. The reaction mixture was then separated by HPLC using a C18 column and the elution by an acetonitrile gradient from 30 to 60% in 0.1% trifluoroacetic acid.
The acid-cleaved product peak ([Gly2]hGLP-2 with a short peptide linker) was collected and dried. Next, the dried material was dissolved in thrombin buffer (20 mM Tris, 150 mM NaCl, 2.5 mM CaCl2, pH8.4) and treated with thrombin at 37° C. overnight and the reaction was then stopped by addition of ACN 20% to final volume. The digestion product was then purified by HPLC using the same conditions described above.
The digestion product was then subjected to analysis by mass spectrometry, using a Micromass Quattro Micro™ mass spectrometer equipped with a Z-spray source operating in the positive ion mode with the following parameters: Data range: m/z 400-1600; Cone Voltage: 30-35 V; Source Temperature: 80° C.; Desolvation Temperature: 200° C.; Flow injection was via an HP1100; Solvent: 50:50 Acetonitrile: Water+0.1% formic acid; Software: Data were acquired using MassLynx 4.0. Calibration was performed using an MS spectrum of myoglobin and histatin 5.
As noted in FIG. 5, the mass of the predominant peak, representing authentic, recombinant (genetically produced) [Gly2]hGLP-2 has a mass that is 3752.59, which is essentially the same as the theoretical mass of 3751.99.
The recovery of GLP-2 monomer from the multimer can also conveniently be achieved in a “one-pot” reaction using the multimer as reagent and providing the authentic, mature monomer as end-product, without requiring numerous separation of intermediate products and transfer steps.
With reference to the example provided above, the one pot process eliminates the step of cell lysis by 6M guanidine HCl, and first mechanically disrupts the expression host cells using for instance a homogenizer, or a sonicator. After cell disruption, the pH of the suspension is brought down, for instance to pH 1-3, by addition for instance of HCl. As described above, the suspension is then incubated at an appropriate temperature, such as 40-80C e.g., 65C, to complete the acid cleavage of multimer to produce the monomer intermediates bearing the N-terminal peptide linkers. The pH of the reaction mixture is then elevated, for instance using Tris-HCl, to within the pH range suitable for thrombin activity e.g., 7.5-9.0 and preferably about 8.4. The thrombin is then added to cause cleavage of the N-terminal peptide linkers, thereby to generate the mature GLP-2 product bearing authentic termini.
It will be apparent to those skilled in the art that various modifications and variations can be made in the methods and compositions of the present invention without departing from the spirit or scope of the invention. Thus, it is intended that the present invention cover the modifications and variations of this invention provided they come within the scope of the appended claims and their equivalents.

Claims (4)

1. A process for preparing a GLP-2 peptide, comprising:
providing a single-chain protein multimer comprising at least two units of a GLP-2 peptide coupled tandemly by a linker consisting of the amino acid sequence ProValSerGlyProArg (SEQ ID NO: 12),
wherein the single-chain protein multimer comprises an acid cleavage site between the Asp residue at the C-terminus of each internal GLP-2 unit and the N-terminal Pro of the linker,
wherein the linker comprises a thrombin enzyme recognition sequence consisting of the amino acid sequence ValSerGlyProArg (SEQ ID NO: 11) abutting the N-terminus of each internal GLP-2 unit,
wherein the single-chain protein multimer comprises a thrombin enzyme cleavage site between the Arg residue at the C-terminus of the linker and the first residue of the GLP-2 peptide at the N-terminus of each internal GLP-2 unit;
cleaving the peptide bond at the acid cleavage site under conditions, wherein the pH is adjusted to a pH from about 1 to about 3
cleaving the peptide bond at the thrombin enzyme cleavage site with a thrombin enzyme;
thereby liberating said at least two GLP-2 peptide units, wherein each GLP-2 peptide unit has an authentic N- and C-terminal residue; and isolating the resulting GLP-2 peptide units.
2. The process according to claim 1, comprising:
a) first cleaving the peptide bond at the acid cleavage site with acid,
b) isolating the resulting cleaved multimer;
c) cleaving the peptide bond at the thrombin enzyme cleavage site with thrombin enzyme, and
d) isolating the resulting GLP-2 peptide units having authentic termini.
3. The process according to claim 1, wherein the step of cleaving the peptide bond at the acid cleavage site acid is performed at the time of extracting the GLP-2 peptide multimer from a cellular host producing said multimer.
4. The process according to claim 1, wherein the steps of cleaving the peptide bond at the acid cleavage site and cleaving the peptide bond at the thrombin cleavage site are performed without separation of reaction products prior to cleaving the peptide bond at the thrombin enzyme cleavage site with thrombin enzyme.
US10/993,127 2003-11-21 2004-11-22 Production of glucagon-like peptide 2 Expired - Fee Related US7829307B2 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US10/993,127 US7829307B2 (en) 2003-11-21 2004-11-22 Production of glucagon-like peptide 2
US12/895,517 US20110092424A1 (en) 2003-11-21 2010-09-30 Production of glucagon like peptide 2 and analogs

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US52366703P 2003-11-21 2003-11-21
US10/993,127 US7829307B2 (en) 2003-11-21 2004-11-22 Production of glucagon-like peptide 2

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US12/895,517 Division US20110092424A1 (en) 2003-11-21 2010-09-30 Production of glucagon like peptide 2 and analogs

Publications (2)

Publication Number Publication Date
US20050164930A1 US20050164930A1 (en) 2005-07-28
US7829307B2 true US7829307B2 (en) 2010-11-09

Family

ID=34794202

Family Applications (2)

Application Number Title Priority Date Filing Date
US10/993,127 Expired - Fee Related US7829307B2 (en) 2003-11-21 2004-11-22 Production of glucagon-like peptide 2
US12/895,517 Abandoned US20110092424A1 (en) 2003-11-21 2010-09-30 Production of glucagon like peptide 2 and analogs

Family Applications After (1)

Application Number Title Priority Date Filing Date
US12/895,517 Abandoned US20110092424A1 (en) 2003-11-21 2010-09-30 Production of glucagon like peptide 2 and analogs

Country Status (13)

Country Link
US (2) US7829307B2 (en)
EP (1) EP1704234B1 (en)
AT (1) ATE541932T1 (en)
CA (1) CA2546319A1 (en)
DK (1) DK1704234T3 (en)
ES (1) ES2380765T3 (en)
HR (1) HRP20120315T1 (en)
ME (1) ME01366B (en)
PL (1) PL1704234T3 (en)
PT (1) PT1704234E (en)
RS (1) RS52246B (en)
SI (1) SI1704234T1 (en)
WO (1) WO2005067368A2 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018172921A1 (en) 2017-03-20 2018-09-27 Lupin Limited Expression and large-scale production of peptides
US10150803B2 (en) 2016-10-27 2018-12-11 Chunghwa Chemical Synthesis & Biotech Co. Ltd Method of preparing glucagon-like peptide-2 (GLP-2) analog

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101895047B1 (en) 2011-12-30 2018-09-06 한미사이언스 주식회사 A site-specific GLP-2 conjugate using an immunoglobulin fragment
CA3173731A1 (en) 2020-02-28 2021-09-02 Kallyope, Inc. Gpr40 agonists
CN116323608A (en) 2020-05-19 2023-06-23 卡尔优普公司 AMPK activator
EP4172162A4 (en) 2020-06-26 2024-08-07 Kallyope, Inc. AMPK ACTIVATORS

Citations (70)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0036259A2 (en) 1980-03-10 1981-09-23 Cetus Corporation Method,vectors and organisms for transported cloned heterologous gene products in bacillus subtilis and E.coli
EP0036776A2 (en) 1980-03-24 1981-09-30 Genentech, Inc. A method of creating an expression plasmid
US4336336A (en) 1979-01-12 1982-06-22 President And Fellows Of Harvard College Fused gene and method of making and using same
EP0060057A1 (en) 1981-02-25 1982-09-15 Genentech, Inc. Expression of polypeptides in yeast
EP0063953A2 (en) 1981-04-29 1982-11-03 Biogen N.V. Bacillus cloning vectors, recombinant DNA molecules, bacillus hosts transformed with them and methods for expressing foreign DNA sequences and producing polypeptides coded thereby
EP0121775A1 (en) 1983-03-09 1984-10-17 Teruhiko Beppu Novel expression plasmids and their use in the method for expressing prochymosin coding gene in E. coli
EP0127839A2 (en) 1983-05-27 1984-12-12 THE TEXAS A&M UNIVERSITY SYSTEM Method for producing a recombinant baculovirus expression vector
EP0136829A2 (en) 1983-09-02 1985-04-10 SUNTORY KABUSHIKI KAISHA, also known as SUNTORY LTD. Improved expression vector and use thereof
EP0136907A2 (en) 1983-10-03 1985-04-10 Genentech, Inc. A xenogeneic expression control system, a method of using it, expression vectors containing it, cells transformed thereby and heterologous proteins produced therefrom
EP0155476A1 (en) 1984-01-31 1985-09-25 Idaho Research Foundation, Inc. Production of polypeptides in insect cells
US4551433A (en) 1981-05-18 1985-11-05 Genentech, Inc. Microbial hybrid promoters
EP0164556A2 (en) 1984-05-11 1985-12-18 Chiron Corporation Enhanced yeast transcription employing hybrid promoter region constructs
US4588684A (en) 1983-04-26 1986-05-13 Chiron Corporation a-Factor and its processing signals
US4689406A (en) 1983-08-10 1987-08-25 Amgen Enhancement of microbial expression of polypeptides
US4738921A (en) 1984-09-27 1988-04-19 Eli Lilly And Company Derivative of the tryptophan operon for expression of fused gene products
US4745056A (en) 1984-10-23 1988-05-17 Biotechnica International, Inc. Streptomyces secretion vector
EP0267851A2 (en) 1986-11-11 1988-05-18 Mitsubishi Kasei Corporation Hybrid promoter, expression controlling DNA sequence and expression vector
EP0284044A1 (en) 1987-03-23 1988-09-28 Zymogenetics, Inc. High level expression in yeast
US4837148A (en) 1984-10-30 1989-06-06 Phillips Petroleum Company Autonomous replication sequences for yeast strains of the genus pichia
EP0329203A1 (en) 1983-02-22 1989-08-23 Chiron Corporation Yeast expression systems with vectors having PyK promoters, and synthesis of foreign protein
US4870023A (en) 1987-03-16 1989-09-26 American Biogenetic Sciences, Inc. Recombinant baculovirus occlusion bodies in vaccines and biological insecticides
US4873192A (en) 1987-02-17 1989-10-10 The United States Of America As Represented By The Department Of Health And Human Services Process for site specific mutagenesis without phenotypic selection
US4876197A (en) 1983-02-22 1989-10-24 Chiron Corporation Eukaryotic regulatable transcription
US4880734A (en) 1984-05-11 1989-11-14 Chiron Corporation Eukaryotic regulatable transcription
US4929555A (en) 1987-10-19 1990-05-29 Phillips Petroleum Company Pichia transformation
EP0473128A2 (en) 1990-08-28 1992-03-04 Sumitomo Electric Industries, Ltd. Monoclonal antibody specifically reactive with human perforin
US5110729A (en) 1985-11-14 1992-05-05 Daiichi Seiyaku Co., Ltd. Method of producing peptides using baculovirus vectors in cultured cells
WO1993017110A2 (en) 1992-02-21 1993-09-02 The Wellcome Foundation Limited A recombinant hepatitis c virus polypeptide
US5352771A (en) 1992-08-31 1994-10-04 Iowa State University Research Foundation Inc. Hydrolysis of peptide bonds using Pt (II) and Pd (II) complexes
US5393924A (en) 1992-10-02 1995-02-28 Hoechst Celanese Corporation Method for the preparation of arylalkanolamineacylates
US5416007A (en) 1987-03-20 1995-05-16 Creative Biomolecules, Inc. Enhanced proteolytic cleavage of recombinant fusion proteins
US5420242A (en) 1986-10-22 1995-05-30 Kaare M. Gautvik Production of human parathyroid hormone from microorganisms
WO1995017510A1 (en) 1993-12-23 1995-06-29 Novo Nordisk A/S A method of producing glucagon-like peptide 1
US5457066A (en) 1986-10-14 1995-10-10 Eli Lilly And Company Process for transforming a human insulin precursor to human insulin
WO1996017941A2 (en) 1994-12-07 1996-06-13 Bionebraska, Inc. Production of c-terminal amidated peptides from recombinant protein constructs
US5580751A (en) 1990-09-14 1996-12-03 Carlsberg A/S Process for the preparation of C-terminally amidated peptides
US5595887A (en) 1990-07-16 1997-01-21 Bionebraska, Inc. Purification directed cloning of peptides using carbonic anhydrase as the affinity binding segment
US5602034A (en) 1987-12-30 1997-02-11 Chiron Corporation Expression and secretion of heterologous proteins in yeast employing truncated alpha-factor leader sequences
US5629205A (en) 1995-05-19 1997-05-13 Allelix Biopharmaceuticals Inc. Promoters for gene expression
US5707826A (en) 1993-07-20 1998-01-13 Bionebraska, Incorporated Enzymatic method for modification of recombinant polypeptides
WO1998003664A1 (en) 1996-07-19 1998-01-29 Monsanto Company DEFORMYLATION OF f-MET PEPTIDES IN BACTERIAL EXPRESSION SYSTEMS
US5728543A (en) 1990-09-05 1998-03-17 Hoechst Aktiengesellschaft Clostripain catalyzed hydrolysis of preproinsulin analogs into corresponding insulins
US5789379A (en) 1995-04-14 1998-08-04 Allelix Biopharmaceutical Inc. Glucagon-like peptide-2 analogs
US5814603A (en) 1992-06-12 1998-09-29 Affymax Technologies N.V. Compounds with PTH activity
US5851810A (en) 1995-06-05 1998-12-22 Albert Einstein College Of Medicine Of Yeshiva University, A Division Of Yeshiva University Nucleic acid encoding rhodococcus phenylalanine dehydrogenase
US5853976A (en) 1994-12-22 1998-12-29 Boehringer Mannheim Gmbh Recombinant proteinase from clostridium histolyticum and its use for isolating cells and groups of cells
US5912229A (en) * 1996-03-01 1999-06-15 Novo Nordisk Als Use of a pharmaceutical composition comprising an appetite-suppressing peptide
WO1999064611A1 (en) 1998-06-09 1999-12-16 Samyang Genex Corporation Mass production method of antimicrobial peptide and dna construct and expression system thereof
EP0978565A1 (en) 1998-01-30 2000-02-09 Suntory Limited Process for producing peptide with the use of accessory peptide
WO2000006763A1 (en) 1998-07-31 2000-02-10 Pierce Chemical Company Fusion products containing insoluble proteinaceous tag
WO2000026418A1 (en) 1998-11-05 2000-05-11 The Board Of Trustees Of Leland Stanford Junior University Human pan-hcv human monoclonal antibodies
WO2000028067A1 (en) 1998-11-06 2000-05-18 Bionebraska, Inc. Enzymatic amidation of peptides
US6130063A (en) 1985-08-29 2000-10-10 Genencor International, Inc. DNA sequences, vectors, and fusion polypeptides to increase secretion of desired polypeptides from filamentous fungi
US6171823B1 (en) 1994-12-09 2001-01-09 Novo Nordisk A/S Process for producing extracellular proteins in bacteria
US6184201B1 (en) 1995-04-14 2001-02-06 Nps Allelix Corp. Intestinotrophic glucagon-like peptide-2 analogs
WO2001049314A2 (en) 1999-12-30 2001-07-12 Nps Allelix Corp. Glp-2 formulations
US6313092B1 (en) 1995-06-06 2001-11-06 Alza Corporation Method for increasing the electrotransport flux of polypeptides
US6316224B1 (en) 1997-03-21 2001-11-13 Bionebraska, Inc. Chlorella virus promoters
WO2002061105A2 (en) 2001-02-02 2002-08-08 Institut Pasteur Chimeric molecules containing a module able to target specific cells and a module regulating the apoptogenic function of the permeability transition pore complex (ptpc)
WO2003099848A2 (en) 2002-05-24 2003-12-04 Restoragen Inc. Method for universal enzymatic production of bioactive peptides
WO2003100022A2 (en) 2002-05-24 2003-12-04 Restoragen, Inc. Methods and dna constructs for high yield production of polypeptides
WO2003099854A2 (en) 2002-05-24 2003-12-04 Nps Allelix Corp. Method for enzymatic production of glp-2(1-33) and glp-2-(1-34) peptides
US6660763B2 (en) 1996-11-13 2003-12-09 Sugen, Inc. Bis-indolylquinone compounds
US6660758B1 (en) 1996-12-13 2003-12-09 The Scripps Research Institute Epothilone analogs
WO2004011599A2 (en) 2002-05-24 2004-02-05 Restoragen, Inc. Polypeptide cleavage process
US6703484B2 (en) 1997-01-08 2004-03-09 Invitrogen Corporation Methods for production of proteins
US20050221444A1 (en) 2002-05-24 2005-10-06 Williams James A Methods and DNA constructs for high yield production of polypeptides
US20050227313A1 (en) 2002-05-24 2005-10-13 Seo Jin S Polypeptide cleavage process
US20050260701A1 (en) 2002-05-24 2005-11-24 Wagner Fred W Method for enzymatic production of GLP-1 (7-36) amide peptides
US20050287632A1 (en) 2002-05-24 2005-12-29 Barton Holmquist Peptide amidation process

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ATE138102T1 (en) 1991-02-19 1996-06-15 Takeda Chemical Industries Ltd METHOD FOR PRODUCING CYSTEIN-FREE PEPTIDES
US5629005A (en) * 1992-05-01 1997-05-13 British United Shoe Machinery Limited Absorbent material and a method of making same
FR2827818B1 (en) 2001-07-25 2003-10-24 Inergy Automotive Systems Man BLINDING SYSTEM FOR FUEL TANK FILLING TUBE AND METHOD FOR OPENING SAME

Patent Citations (74)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4336336A (en) 1979-01-12 1982-06-22 President And Fellows Of Harvard College Fused gene and method of making and using same
EP0036259A2 (en) 1980-03-10 1981-09-23 Cetus Corporation Method,vectors and organisms for transported cloned heterologous gene products in bacillus subtilis and E.coli
EP0036776A2 (en) 1980-03-24 1981-09-30 Genentech, Inc. A method of creating an expression plasmid
EP0060057A1 (en) 1981-02-25 1982-09-15 Genentech, Inc. Expression of polypeptides in yeast
EP0063953A2 (en) 1981-04-29 1982-11-03 Biogen N.V. Bacillus cloning vectors, recombinant DNA molecules, bacillus hosts transformed with them and methods for expressing foreign DNA sequences and producing polypeptides coded thereby
US4551433A (en) 1981-05-18 1985-11-05 Genentech, Inc. Microbial hybrid promoters
US4876197A (en) 1983-02-22 1989-10-24 Chiron Corporation Eukaryotic regulatable transcription
EP0329203A1 (en) 1983-02-22 1989-08-23 Chiron Corporation Yeast expression systems with vectors having PyK promoters, and synthesis of foreign protein
EP0121775A1 (en) 1983-03-09 1984-10-17 Teruhiko Beppu Novel expression plasmids and their use in the method for expressing prochymosin coding gene in E. coli
US4588684A (en) 1983-04-26 1986-05-13 Chiron Corporation a-Factor and its processing signals
EP0127839A2 (en) 1983-05-27 1984-12-12 THE TEXAS A&M UNIVERSITY SYSTEM Method for producing a recombinant baculovirus expression vector
US4689406A (en) 1983-08-10 1987-08-25 Amgen Enhancement of microbial expression of polypeptides
EP0136829A2 (en) 1983-09-02 1985-04-10 SUNTORY KABUSHIKI KAISHA, also known as SUNTORY LTD. Improved expression vector and use thereof
EP0136907A2 (en) 1983-10-03 1985-04-10 Genentech, Inc. A xenogeneic expression control system, a method of using it, expression vectors containing it, cells transformed thereby and heterologous proteins produced therefrom
EP0155476A1 (en) 1984-01-31 1985-09-25 Idaho Research Foundation, Inc. Production of polypeptides in insect cells
EP0164556A2 (en) 1984-05-11 1985-12-18 Chiron Corporation Enhanced yeast transcription employing hybrid promoter region constructs
US4880734A (en) 1984-05-11 1989-11-14 Chiron Corporation Eukaryotic regulatable transcription
US4738921A (en) 1984-09-27 1988-04-19 Eli Lilly And Company Derivative of the tryptophan operon for expression of fused gene products
US4745056A (en) 1984-10-23 1988-05-17 Biotechnica International, Inc. Streptomyces secretion vector
US4837148A (en) 1984-10-30 1989-06-06 Phillips Petroleum Company Autonomous replication sequences for yeast strains of the genus pichia
US6130063A (en) 1985-08-29 2000-10-10 Genencor International, Inc. DNA sequences, vectors, and fusion polypeptides to increase secretion of desired polypeptides from filamentous fungi
US5110729A (en) 1985-11-14 1992-05-05 Daiichi Seiyaku Co., Ltd. Method of producing peptides using baculovirus vectors in cultured cells
US5457066A (en) 1986-10-14 1995-10-10 Eli Lilly And Company Process for transforming a human insulin precursor to human insulin
US5420242A (en) 1986-10-22 1995-05-30 Kaare M. Gautvik Production of human parathyroid hormone from microorganisms
EP0267851A2 (en) 1986-11-11 1988-05-18 Mitsubishi Kasei Corporation Hybrid promoter, expression controlling DNA sequence and expression vector
US4873192A (en) 1987-02-17 1989-10-10 The United States Of America As Represented By The Department Of Health And Human Services Process for site specific mutagenesis without phenotypic selection
US4870023A (en) 1987-03-16 1989-09-26 American Biogenetic Sciences, Inc. Recombinant baculovirus occlusion bodies in vaccines and biological insecticides
US5416007A (en) 1987-03-20 1995-05-16 Creative Biomolecules, Inc. Enhanced proteolytic cleavage of recombinant fusion proteins
EP0284044A1 (en) 1987-03-23 1988-09-28 Zymogenetics, Inc. High level expression in yeast
US4929555A (en) 1987-10-19 1990-05-29 Phillips Petroleum Company Pichia transformation
US5602034A (en) 1987-12-30 1997-02-11 Chiron Corporation Expression and secretion of heterologous proteins in yeast employing truncated alpha-factor leader sequences
US5595887A (en) 1990-07-16 1997-01-21 Bionebraska, Inc. Purification directed cloning of peptides using carbonic anhydrase as the affinity binding segment
EP0473128A2 (en) 1990-08-28 1992-03-04 Sumitomo Electric Industries, Ltd. Monoclonal antibody specifically reactive with human perforin
US5728543A (en) 1990-09-05 1998-03-17 Hoechst Aktiengesellschaft Clostripain catalyzed hydrolysis of preproinsulin analogs into corresponding insulins
US5580751A (en) 1990-09-14 1996-12-03 Carlsberg A/S Process for the preparation of C-terminally amidated peptides
WO1993017110A2 (en) 1992-02-21 1993-09-02 The Wellcome Foundation Limited A recombinant hepatitis c virus polypeptide
US5814603A (en) 1992-06-12 1998-09-29 Affymax Technologies N.V. Compounds with PTH activity
US5352771A (en) 1992-08-31 1994-10-04 Iowa State University Research Foundation Inc. Hydrolysis of peptide bonds using Pt (II) and Pd (II) complexes
US5393924A (en) 1992-10-02 1995-02-28 Hoechst Celanese Corporation Method for the preparation of arylalkanolamineacylates
US5707826A (en) 1993-07-20 1998-01-13 Bionebraska, Incorporated Enzymatic method for modification of recombinant polypeptides
WO1995017510A1 (en) 1993-12-23 1995-06-29 Novo Nordisk A/S A method of producing glucagon-like peptide 1
WO1996017941A2 (en) 1994-12-07 1996-06-13 Bionebraska, Inc. Production of c-terminal amidated peptides from recombinant protein constructs
US6171823B1 (en) 1994-12-09 2001-01-09 Novo Nordisk A/S Process for producing extracellular proteins in bacteria
US5853976A (en) 1994-12-22 1998-12-29 Boehringer Mannheim Gmbh Recombinant proteinase from clostridium histolyticum and its use for isolating cells and groups of cells
US5789379A (en) 1995-04-14 1998-08-04 Allelix Biopharmaceutical Inc. Glucagon-like peptide-2 analogs
US6184201B1 (en) 1995-04-14 2001-02-06 Nps Allelix Corp. Intestinotrophic glucagon-like peptide-2 analogs
US5629205A (en) 1995-05-19 1997-05-13 Allelix Biopharmaceuticals Inc. Promoters for gene expression
US5851810A (en) 1995-06-05 1998-12-22 Albert Einstein College Of Medicine Of Yeshiva University, A Division Of Yeshiva University Nucleic acid encoding rhodococcus phenylalanine dehydrogenase
US6313092B1 (en) 1995-06-06 2001-11-06 Alza Corporation Method for increasing the electrotransport flux of polypeptides
US5912229A (en) * 1996-03-01 1999-06-15 Novo Nordisk Als Use of a pharmaceutical composition comprising an appetite-suppressing peptide
WO1998003664A1 (en) 1996-07-19 1998-01-29 Monsanto Company DEFORMYLATION OF f-MET PEPTIDES IN BACTERIAL EXPRESSION SYSTEMS
US6660763B2 (en) 1996-11-13 2003-12-09 Sugen, Inc. Bis-indolylquinone compounds
US6660758B1 (en) 1996-12-13 2003-12-09 The Scripps Research Institute Epothilone analogs
US6703484B2 (en) 1997-01-08 2004-03-09 Invitrogen Corporation Methods for production of proteins
US6316224B1 (en) 1997-03-21 2001-11-13 Bionebraska, Inc. Chlorella virus promoters
EP0978565A1 (en) 1998-01-30 2000-02-09 Suntory Limited Process for producing peptide with the use of accessory peptide
WO1999064611A1 (en) 1998-06-09 1999-12-16 Samyang Genex Corporation Mass production method of antimicrobial peptide and dna construct and expression system thereof
WO2000006763A1 (en) 1998-07-31 2000-02-10 Pierce Chemical Company Fusion products containing insoluble proteinaceous tag
WO2000026418A1 (en) 1998-11-05 2000-05-11 The Board Of Trustees Of Leland Stanford Junior University Human pan-hcv human monoclonal antibodies
US6461834B1 (en) 1998-11-06 2002-10-08 Bionebraska, Inc. Clostripain catalyzed amidation of peptides
WO2000028067A1 (en) 1998-11-06 2000-05-18 Bionebraska, Inc. Enzymatic amidation of peptides
WO2001049314A2 (en) 1999-12-30 2001-07-12 Nps Allelix Corp. Glp-2 formulations
WO2002061105A2 (en) 2001-02-02 2002-08-08 Institut Pasteur Chimeric molecules containing a module able to target specific cells and a module regulating the apoptogenic function of the permeability transition pore complex (ptpc)
WO2003099854A2 (en) 2002-05-24 2003-12-04 Nps Allelix Corp. Method for enzymatic production of glp-2(1-33) and glp-2-(1-34) peptides
WO2003100022A2 (en) 2002-05-24 2003-12-04 Restoragen, Inc. Methods and dna constructs for high yield production of polypeptides
WO2004011599A2 (en) 2002-05-24 2004-02-05 Restoragen, Inc. Polypeptide cleavage process
WO2003099848A2 (en) 2002-05-24 2003-12-04 Restoragen Inc. Method for universal enzymatic production of bioactive peptides
US20050221444A1 (en) 2002-05-24 2005-10-06 Williams James A Methods and DNA constructs for high yield production of polypeptides
US20050227313A1 (en) 2002-05-24 2005-10-13 Seo Jin S Polypeptide cleavage process
US20050260701A1 (en) 2002-05-24 2005-11-24 Wagner Fred W Method for enzymatic production of GLP-1 (7-36) amide peptides
US20050287632A1 (en) 2002-05-24 2005-12-29 Barton Holmquist Peptide amidation process
US20060008870A1 (en) 2002-05-24 2006-01-12 Wagner Fred W Method for universal enzymatic production of bioactive peptides
US20060024778A1 (en) * 2002-05-24 2006-02-02 Wagner Fred W Method for enzymatic production of GLP-2(1-33) and GLP-2(1-34) peptides
US7335486B2 (en) 2002-05-24 2008-02-26 Restoragen, Inc. Method for universal enzymatic production of bioactive peptides

Non-Patent Citations (173)

* Cited by examiner, † Cited by third party
Title
"Tertiary Structure", Tertiary Structure Biological Pages, hhtp://users.rcn.com/jkimball.ma.ultranet/biologicalpages/t/tertiarystructure.html (downloaded Aug. 31, 2009) 3 pgs.
Advisory Action issued in U.S. Appl. No. 10/997,697 dated Oct. 1, 2008.
Advisory Action issued in U.S. Appl. No. 10/997,762 dated Jul. 15, 2008.
Aubin, et al. "Highly effective delivery of foreign DNA to adherent cells via polybrene/DMSO-assisted gene transfer", Methods Mol. Biol., 62 (1997), 319-42.
Beach, et al. "Functionally homologous cell cycle control genes in budding and fission yeast", Nature, 300(5894), Dec. 23, 1982, 706-9.
Birnstiel, et al., "Transcription termination and 3' procession: the end is in site!", Cell, 41(2), Jun. 1985, 349-59.
Birnstiel, et al., "Transcription termination and 3′ procession: the end is in site!", Cell, 41(2), Jun. 1985, 349-59.
Buhl et al., J. Biol. Chem., 1988, 263(18):8621.
Catsimpoolas, et al., "Specific cleavage of cystine peptides by cyanide", J. of Biol. Chem., 241(8), Apr. 25, 1996, 1790-6.
Chang, J. (1985) Eur. J. Biochem. 151, 217-224.
Coombs, et al. "Substrate specificity of prostate-specific antigen (PSA)", Chem Biol. 5(9), Sep. 1998, 475-88.
Copending U.S. Appl. No. 10/997,065, filed May 24, 2002, for Method for Enzymatic Production of GLP-2(1-33) Peptides.
Dargatz, et al., "The heterodimeric protease clostripain from Clostridium histolyticum is encoded by a single gene", Molecular and General Genetics, vol. 240, No. 1, Jul. 1, 1993, 140-145.
Database EMBL (online), Jul. 12, 2001, "Glucagon [homo sapiens]", XP002501257 retrieved from NCBI on Apr. 21, 2009, database accession No. AAH05278, the whole document.
Davies, et al., "Plasmid-determined resistance to antimicrobial agents", Anu. Rev. Microbiol. 32, 1978, 469-508.
Dijkema, et al., "Cloning and expression of the chromosomal immune interferon gene of the rat", EMBO J. 4(3), Mar. 1985, 761-7.
Djuran, et al., "Hydrolysis of amide bond in histidine-containing peptides promoted by chelated amino acid palladium(II) complexes: dependence of hydrolytic pathway on the coordination modes of the peptides", Polyhedron 18(27), Sep. 14, 1999, 3611-3616.
Dou, et al., "Preliminary study on the cleavage of fusion protein GST-CMIV with palladate(II) complex", Preparative Biochem. & Biotechnol. 2000, vol. 30, No. 1, 69-78.
Drexler, et al., "Palladium(II) and platinum(II) complexes with 1,5-dithiacycolooctane(dtco): structures of Pd(dtco)C12 and Pd(dtco2)(NO3)2 and kinetics of ligand substitution in [Pd(dtco2)]2+ by bidenate ligands", Inorganic Chemistry, 30, 1991, 1297-1302.
Drexler, et al., "Palladium(II) and platinum(II) complexes with 1,5-dithiacycolooctane(dtco): structures of Pd(dtco)C12 and Pd(dtco2)(NO3)2 and kinetics of ligand substitution in [Pd(dtco2)]2+ by bidenate ligands", Inorganic Chemistry, 30, 1991, 1297-1302.
Dykes, et al., "Expression of atrial natriuretic factor as a cleavable fusion protein with chloramphenicol acetyltransferase in Escherichia coli", Eur. J. Biochem., 174(2), Jun. 1, 1988, 411-6.
Felgner, et al., "Enhanced gene delivery and mechanism studies with a novel series of cationic lipid formulations", J. Biol. Chem. 269(4), Jan. 28, 1994, 2550-61.
Forsberg, et al., "An evaluation of different enzymatic cleavage methods for recombinant fusion proteins, applied on des(1-3)insulin-like growth factor I", J. Protein Chem., 11(2), Apr. 1992, 201-11.
Forsberg, et al., "Comparison of two chemical cleavage methods for preparation of a truncated form of recombinant human insulin-like growth factor I from a secreted fusion protein", Biofactors, 2(2), Dec. 1989, 105-12.
Gluzman, "SV40-Transformed simian cells support the replication of early sv40 mutants", Cell, 23(1), Jan. 1981, 175-182.
Gram, et al., "A novel approach for high level production of a recombinant human parathyroid hormone fragment in Escherichia coli", Bio/Technology, 12(10), Oct. 1994, 1017-23.
Greger, et al., "Poly(A) signals control both transcriptional termination and initiation between the tandem GAL10 and GAL7 genes of Saccharomyces cerevisiae", EMBO J. 17(16), Aug. 17, 1998, 4771-9.
Guo, et al., "Protein tolerance to random amino acid change", 2004, Proc. Natl. Acad. Sci. 101: 9205-9210.
Hill, "Functional analysis of conserved histidines in ADP-Glucose pyrophophorylase from Escherichia coli", 1998, Biochem. Biophys. Res. Comm. 244:573-577.
Hohmann, et al., "Rate and equilibrium data for substitution reactions of diaqua(ethylenediamine)palladium(II) with chloride in aqueous solution", Inorg Chim Acta, 174(1), 1990, 87-92.
Hooft Van Iddekinge, et al., "Nucleotide sequence of the polyhedrin gene of Autographa californica nuclear polyhedrosis virus", Virology, 131, 1983, 561-564.
International Preliminary Examination Report issued in International Application No. PCT/IB2004/004439 dated May 22, 2006.
International Preliminary Examination Report issued in International Application No. PCT/US2003/16468 dated Dec. 16, 2004.
International Preliminary Examination Report issued in International Application No. PCT/US2003/16469 mailed Feb. 9, 2005.
International Preliminary Examination Report issued in International Application No. PCT/US2003/16470 mailed Jul. 6, 2005.
International Preliminary Examination Report issued in International Application No. PCT/US2003/16642 dated Mar. 6, 2006.
International Preliminary Examination Report issued in International Application No. PCT/US2003/16643 dated Aug. 21, 2004.
International Preliminary Examination Report issued in International Application No. PCT/US2003/16645 mailed Nov. 12, 2004.
International Preliminary Examination Report issued in International Application No. PCT/US2003/16647 dated Aug. 23, 2004.
International Preliminary Examination Report issued in International Application No. PCT/US2003/16649 dated May 15, 2007.
International Search Report issued in International Application No. PCT/IB2004/004439 dated Sep. 23, 2005.
International Search Report issued in International Application No. PCT/US2003/16468 dated Jan. 15, 2004.
International Search Report issued in International Application No. PCT/US2003/16469 mailed Oct. 28, 2004.
International Search Report issued in International Application No. PCT/US2003/16470 mailed Jul. 21, 2004.
International Search Report issued in International Application No. PCT/US2003/16642 dated Sep. 3, 2004.
International Search Report issued in International Application No. PCT/US2003/16643 dated Jul. 20, 2004.
International Search Report issued in International Application No. PCT/US2003/16645 mailed May 24, 2004.
International Search Report issued in International Application No. PCT/US2003/16647 dated Jul. 2, 2004.
International Search Report issued in International Application No. PCT/US2003/16649 dated Dec. 11, 2006.
Ito, et al., "Transformation of intact yeast cells treated with alkali cations", J. Bacteriol, 153(1), Jan. 1983, 163-8.
Kaufman et al., "The phosphorylation state of eucaryotic initiation factor 2 alters translational efficiency of specific mRNAs", Mol. Cell Biol., 9(3), Mar. 1989, 946-58.
Knott, et al., "The isolation and characterization of human atrial natriuretic factor produced as a fusion protein in Escherichia coli", Eur. J. Biochem., 174(2), Jun. 1, 1988, 405-10.
Kohrer, et al., "Import of amber and ochre suppressor tRNAs into mammalian cells: a general approach to site-specific insertion of amino acid analogues into proteins", Proc. Natl. Acad. Sci. USA, 98(25), Dec. 4, 2001, 14310-5.
Kowal, et al., "Twenty-first aminoacyl-tRNA synthetase-suppressor tRNA pairs for possible use in site-specific incorporation of amino acid analogues into proteins in eukaryotes and in eubacteria", Proc.Natl. Acad. Sci. USA 98(5), Feb. 27, 2001, 2268-73.
Kunkel, T.A., "Rapid and efficient site-specific mutagenesis without phenotypic selection", Proc. Natl. Acad. Sci. USA, 82, 1985 488-492.
Kurtz, et al., "Integrative transformation of Candida albicans, using a cloned Candida ADE2 gene", Mol. Cell Biol., 6(1), Jan. 1986, 142-9.
Labouesse, B., "La Clostripaine, Protease De Clostridium Histolyticum II.-Specificite", Bull. Soc. Chim. Biol., 42, 1960, 559-568.
Labouesse, B., "L'Hydrolyse Du Glucagon Par La Clostripaine (*)",Bull. Soc. Chim. Biol., 42, 1960, 1293-304.
Lazar, et al., "Transforming growth factor alpha: mutation of aspartic acid 47 and leucine 48 results in different biological activities", 1988, Mol. Cell Biol. 8:1247-1252.
Lazar, et al., "Transforming growth factor α: mutation of aspartic acid 47 and leucine 48 results in different biological activities", 1988, Mol. Cell Biol. 8:1247-1252.
Lebacq-Verheyden, et al., "Posttranslational processing of endogenous and of baculovirus-expressed human gastrin-releasing peptide precursor", Mol. Cell Biol. 8(8), Aug. 1988 3129-35.
Lee et al., "Enhanced expression of tandem multimers of the antimicrobial peptide buforin II in Escherichia coli by the DEAD-box protein and trxB mutant", Appl. Microbiol. Biotechnol. 58(6), May 2002, 790-6.
Lidell, et al., "An autocatalytic cleavage in the C terminus of the human MUC2 mucin occurs at the low pH of the late secretory pathway", J. Biol. Chem., vol. 278, No. 16, Apr. 18, 2003, 13944-13951.
Maniatis, et al., "Regulation of inducible and tissue-specific gene expression", Science, 236(4806), Jun. 5, 1987, 1237-45.
Marcus, F., "Preferential cleavage at aspartyl-prolyl peptide bonds in dilute acid", Int. J. Pept. Protein Res., 25(5), May 1985, 542-6.
Marczinovits et al., "An alternative purification protocol for producing hepatitis B virus X antigen on a preparative scale in Escherichia coli", J. Biotechnology, 1997, vol. 56, 81-88.
Marumoto, et al., "Hyperproduction of polyhedrin-IGF II infusion protein in silkworm larvae infected with recombinant Bombyx mori nuclear polyhedrosis virus", J. Gen. Virol., 68 (pt10), 1987, 2599-2606.
Masson, et al., "Transformation of Bacillus thuringiensis vegetative cells by electroporation", FEMS Microbiol. Lett., 60(3), Aug. 1989, 273-7.
McCarroll, et al., "Stable insect cell cultures for recombinant protein production", Curr Opin Biotechnol. 8(5), Oct. 1997, 590-4.
Meiwes, et al., "Clostripain: production and use for peptide synthesis", Biomedica Biochimica Acta, 1991, vol. 50, No. 10-11, S80-S83.
Milovic, et al. "Interplay of terminal amino group and coordinating side chains in directing regioselective cleavage of natural peptides and proteins with palladium(II) complexes", Inorganic Chemistry, Dec. 2002, vol. 41, No. 26.
Milovic, et al., "Palladium(II) and platinum(II) complexes as synthetic peptidases", Metal Ions Biol. Syst., 38, 2001, 145-186.
Milovic, et al., "Palladium(II) complexes, as synthetic peptidases, regioselectively cleave the second peptide bond 'upstream' from methionine and histidine side chains", J. Amer. Chem. Soc. 124(17), 2002, 4759-4769.
Mitchell, "Cleavage at arginine residues by clostripain", Methods in Enzymology, Academic Press Inc., vol. 47, Jan. 1977, 165-170.
Mitchell, et al., "Purification and properties of Clostridiopeptidase B (Clostripain)", J. Biol. Chem., vol. 243, No. 18, 1968, 4683-4692.
Miyanohara, et al., "Expression of hepatitis B surface antigen gene in yeast", Proc. Natl. Acad. Sci. USA, 801(1), Jan. 1983, 1-5.
Moks, et al., "Expression of human insulin-like growth factor I in bacteria: use of optimized gene fusion vectors to facilitate protein purification", Biochemistry, 26(17), Aug. 25, 1987, 5239-44.
Nilsson, et al., "Multiple affinity domains for the detection, purification and immobilization of recombinant proteins", J. of Molecular Recognition, 9(5/6), 1996, John Wiley & Sons, Dec. 9, 1996, 585-594.
Notice of Allowance issued in U.S. Appl. No. 10/997,074 dated Sep. 21, 2007.
Notice of Allowance issued in U.S. Appl. No. 10/997,078 dated Oct. 23, 2008.
Notice of Allowance issued in U.S. Appl. No. 10/997,822 dated May 14, 2009.
Notice of Allowance issued in U.S. Appl. No. 11/944,165 dated Oct. 15, 2008.
Office Action (final) issued in U.S. Appl. No. 10/997,078 dated Jul. 23, 2008.
Office Action (final) issued in U.S. Appl. No. 10/997,697 dated Jul. 7, 2008.
Office Action (final) issued in U.S. Appl. No. 10/997,762 dated Apr. 17, 2008.
Office Action (non-final) issued in U.S. Appl. No. 10/997,065 dated Jan. 18, 2008.
Office Action (non-final) issued in U.S. Appl. No. 10/997,065 dated Oct. 21, 2008.
Office Action (non-final) issued in U.S. Appl. No. 10/997,074 dated Dec. 15, 2006.
Office Action (non-final) issued in U.S. Appl. No. 10/997,078 dated Jan. 9, 2008.
Office Action (non-final) issued in U.S. Appl. No. 10/997,078 dated Jul. 25, 2007.
Office Action (non-final) issued in U.S. Appl. No. 10/997,697 dated Mar. 2, 2009.
Office Action (non-final) issued in U.S. Appl. No. 10/997,697 dated Sep. 11, 2007.
Office Action (non-final) issued in U.S. Appl. No. 10/997,700 dated Apr. 7, 2008.
Office Action (non-final) issued in U.S. Appl. No. 10/997,700 dated Oct. 4, 2007.
Office Action (non-final) issued in U.S. Appl. No. 10/997,762 dated Oct. 9, 2007.
Office Action (non-final) issued in U.S. Appl. No. 10/997,822 dated Apr. 30, 2008.
Office Action (non-final) issued in U.S. Appl. No. 10/997,822 dated Nov. 14, 2008.
Office Action (non-final) issued in U.S. Appl. No. 10/997,822 dated Oct. 4, 2007.
Office Action (non-final) issued in U.S. Appl. No. 11/944,165 dated May 30, 2008.
Office Action (non-final) issued in U.S. Appl. No. 11/997,762 dated Apr. 2, 2009.
Office Action (non-final) issued in U.S. Appl. No. 11/997,762 dated Jan. 7, 2009.
Okamoto, et al., "Structural characterization of argingipain, a novel arginine-specific cysteine proteinase as a major periodontal pathogenic factor from Porphyromonas gingivalis", Archives of Biochemistry and Biophysics, 316(2), Feb. 1, 1995, 917-925.
Orskov, et al., "Biological effects and metabolic rates of glucagonlike peptide-1 7-36 amide and glucagonlike peptide-1 7-37 in healthy subjects are indistinguishable", Diabetes, 42(5), May 1993, 658-661.
Parac, et al., "New regioselectivity in the cleavage of histidine-containing peptides by palladium(II) complexes studied by kinetic experiments and molecular dynamics simulations", J. Am. Chem. Soc., 1999, 121:3127-3135.
Park, Sang-Ho, et al., "Role of proline, cysteine and a disulphide bridge in the structure and activity of the anti-microbial peptide gaegurin 5", Biochem. J. 368(Pt 1), 2002, 171-182.
Pearson, "Searching protein sequence libraries: comparison of the sensitivity and selectivity of the Smith-Waterman and FASTA alogorithms", Genomics, 11(3), Nov. 1991, 635-50.
Piers, et al., "Recombinant DNA procedures for producing small antimicrobial cationic peptides in bacteria", Gene, 134(1), Nov. 30, 1993, 7-13.
Pilon, et al., "Ubiquitin fusion technology: bioprocessing of peptides", Biotechnol. Prog., 13(4), Jul.-Aug. 1997, 374-9.
Pop, et al., "The twin-arginine signal peptide of phoD and the TatAd/Cd proteins Bacillus subtillis from an autonomous tat translocation system", J. Biological Chem., 277(5), American Society of Biochemical Biologists, Birmingham, Feb. 1, 2002, 3268-3273.
Raibaud, et al., "Positive control of transcription initiation in bacteria", Annu. Rev. Genet., 18, 1984, 173-206.
Rau, et al., "Complex formation and ligand substitution reactions of (2-picolylamine)palladium(II) with various biologically relevant ligands. Characterization of (2-picolylamine)(1,1-cyclobutanedicarboxylato)palladium(II)", Inorganic Chemistry, 36, 1997, 1454-1463.
Ray, et al., "Production of recombinant salmon calcitonin by in vitro amidation of an Escherichia coli produced precursor peptide", Bio/Technology 11(1), Jan. 1993, 64-70.
Request for Continued Examination filed in U.S. Appl. No. 10/997,697, filed Nov. 7, 2008.
Request for Continued Examination filed in U.S. Appl. No. 10/997,762, filed Oct. 17, 2008.
Response after final Office Action filed in U.S. Appl. No. 10/997,078, filed Sep. 23, 2008.
Response after final Office Action filed in U.S. Appl. No. 10/997,697, filed Sep. 8, 2008.
Response after final Office Action filed in U.S. Appl. No. 10/997,762, filed Jun. 17, 2008.
Response to Office Action filed in U.S. Appl. No. 10/997,065, filed Apr. 21, 2009.
Response to Office Action filed in U.S. Appl. No. 10/997,065, filed Jul. 18, 2008.
Response to Office Action filed in U.S. Appl. No. 10/997,074, filed Feb. 22, 2007.
Response to Office Action filed in U.S. Appl. No. 10/997,078, filed Apr. 8, 2008.
Response to Office Action filed in U.S. Appl. No. 10/997,078, filed Oct. 25, 2007.
Response to Office Action filed in U.S. Appl. No. 10/997,697, filed Mar. 5, 2008.
Response to Office Action filed in U.S. Appl. No. 10/997,700, filed Jan. 12, 2009.
Response to Office Action filed in U.S. Appl. No. 10/997,700, filed Jan. 4, 2008.
Response to Office Action filed in U.S. Appl. No. 10/997,762, filed Jan. 21, 2009.
Response to Office Action filed in U.S. Appl. No. 10/997,762, filed Jan. 9, 2008.
Response to Office Action filed in U.S. Appl. No. 10/997,822, filed Feb. 17, 2009.
Response to Office Action filed in U.S. Appl. No. 10/997,822, filed Jan. 3, 2008.
Response to Office Action filed in U.S. Appl. No. 10/997,822, filed Jul. 30, 2008.
Response to Office Action filed in U.S. Appl. No. 11/944,165, filed Aug. 29, 2008.
Response to Restriction Requirement filed in U.S. Appl. No. 10/997,065, filed Aug. 8, 2007.
Response to Restriction Requirement filed in U.S. Appl. No. 10/997,074, filed Nov. 27, 2006.
Response to Restriction Requirement filed in U.S. Appl. No. 10/997,078, filed May 2, 2007.
Response to Restriction Requirement filed in U.S. Appl. No. 10/997,697, filed Apr. 5, 2007.
Response to Restriction Requirement filed in U.S. Appl. No. 10/997,700, filed Jul. 30, 2007.
Response to Restriction Requirement filed in U.S. Appl. No. 10/997,762, filed Jul. 17, 2007.
Response to Restriction Requirement filed in U.S. Appl. No. 10/997,822, filed Jul. 25, 2007.
Restriction Requirement issued in U.S. Appl. No. 10/997,065, dated Apr. 10, 2007.
Restriction Requirement issued in U.S. Appl. No. 10/997,074 dated Oct. 26, 2006.
Restriction Requirement issued in U.S. Appl. No. 10/997,078 dated Apr. 2, 2007.
Restriction Requirement issued in U.S. Appl. No. 10/997,697 dated Feb. 21, 2007.
Restriction Requirement issued in U.S. Appl. No. 10/997,700 dated Jul. 3, 2007.
Restriction Requirement issued in U.S. Appl. No. 10/997,762 dated Jun. 18, 2007.
Restriction Requirement issued in U.S. Appl. No. 10/997,822 dated Jun. 25, 2007.
Schellenberger, et al., "Peptide production by a combination of gene expression, chemical synthesis, and protease-catalyzed conversion", Int. J. Pept. Protein Res., 41(4), Apr. 1993, 326-32.
Shen, S.H., "Multiple joined genes prevent product degratation in Escherichia coli", Proc. Natl. Acad. Sci. USA, 81(15), Aug. 1984, 4627-31.
Shimatake, et al., "Purified λ regulatory protein cII positively activates promoters for lysogenic development", Nature, 292(5819), Jul. 9, 1981, 128-32.
Shimizu, et al., "Transfer of cloned human class I major histocompatibility complex genes into HLA mutant human lymphoblastoid cells", Mol. Cell Biol. 6(4), Apr. 1986, 1074-87.
Shine, et al., "Determinant of cistron specificity in bacterial ribosomes", Nature 254(5495), Mar. 6, 1975, 34-8.
Simmonds, et al., "Molecular interactions between Vestigial and Scalloped promote wing formation in Drosophila", Genes Dev. 12(24), Dec. 15, 1998, 3815-20.
Smith, et al. "Surface point mutations that significantly alter the structure and stability of a protein's denatured state", Protein Science, 1996, vol. 5, 2009-2019.
Sprengart, et al., "The downstream box: an efficient and independent translation initiation signal in Escherichia coli", EMBO J., 15(3), Feb. 1, 1996, 665-74.
Supplementary European Search Report issued in EP Application No. 03734172 dated Apr. 17, 2007.
Supplementary European Search Report issued in EP Application No. 03734173 dated Nov. 12, 2008.
Supplementary European Search Report issued in EP Application No. 03734200 dated Feb. 27, 2006.
Supplementary European Search Report issued in EP Application No. 03734201 dated Jul. 4, 2006.
Supplementary European Search Report issued in EP Application No. 03736710 dated Jun. 26, 2007.
Supplementary European Search Report issued in EP Application No. 03755504 dated Mar. 14, 2006.
Supplementary European Search Report issued in EP Application No. 03755506 dated Nov. 7, 2008.
Supplementary European Search Report issued in EP Application No. 03771535 dated Oct. 1, 2008.
Supplementary European Search Report issued in EP Application No. 04821092.6 dated Jun. 28, 2007.
Supplementary Partial European Search Report issued in EP Application No. 04821092.6 dated Jun. 28, 2007.
Taketo, "DNA transfection of Escherichia coli by electroporation" Biochim. Biophys. Acta. 949(3), Mar. 31, 1988, 318-24.
Wang, et al., "Natural transformation in campylobacter species", J. Bacteriol, 171(2), Feb. 1990, 949-55.
Waterman, et al., "Pattern recognition in several sequences: consensus and alignment", Bull Math Biol., 46(4), 1984, 515-27.
Williams, et al., "Control of drosophila wing and haltere development by the nuclear vestigial gene product", Genes Dev., 5(12b), Dec. 1991, 2481-2495.
Witte, et al. "Heterologous expression of the Clostripain gene from slostridium histolyticum in Escherichia coli and bacillus subtillis: maturation of the clostripain precursor is coupled with self-activation", Microbiology, 140, 1994, 1175-1182.
Witte, et al., "Clostripain linker deletion variants yield active enzyme in Escherichia coli: a possible function of the linker peptide as intramolecular inhibitor of clostripain automaturation", Current Microbiology, vol. 22, No. 5, Nov. 1996, 281-286.
Written Opinion issued in International Application No. PCT/IB2004/004439 mailed Sep. 23, 2005.
Zhan, et al., "Structural analysis of regulatory protein domains using GST-fusion proteins", Gene, 281(1-2), Dec. 27, 2001, 1-9.
Zhao, et al., "Formation of mRNA 3′ ends in eukaryotes: mechanism, regulation, and interrelationships with other steps in mRNA synthesis", Microbiol. Mol. Biol. Rev., 63(2), Jun. 1999, 405-45.
Zhu, et al. "Site-specific hydrolytic cleavage of cytochrome c and of its heme undecapeptide, promoted by coordination complexes of palladium(II)", J. Am. Chem. Soc., 116, 1994, 5218-5224.

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10150803B2 (en) 2016-10-27 2018-12-11 Chunghwa Chemical Synthesis & Biotech Co. Ltd Method of preparing glucagon-like peptide-2 (GLP-2) analog
WO2018172921A1 (en) 2017-03-20 2018-09-27 Lupin Limited Expression and large-scale production of peptides

Also Published As

Publication number Publication date
US20110092424A1 (en) 2011-04-21
PL1704234T3 (en) 2012-06-29
SI1704234T1 (en) 2012-08-31
RS52246B (en) 2012-10-31
ES2380765T3 (en) 2012-05-18
WO2005067368A2 (en) 2005-07-28
HRP20120315T1 (en) 2012-05-31
ME01366B (en) 2013-12-20
EP1704234B1 (en) 2012-01-18
PT1704234E (en) 2012-04-26
EP1704234A2 (en) 2006-09-27
DK1704234T3 (en) 2012-05-07
CA2546319A1 (en) 2005-07-28
WO2005067368A3 (en) 2006-03-23
US20050164930A1 (en) 2005-07-28
EP1704234A4 (en) 2007-11-07
ATE541932T1 (en) 2012-02-15

Similar Documents

Publication Publication Date Title
US9200306B2 (en) Methods for production and purification of polypeptides
US20110092424A1 (en) Production of glucagon like peptide 2 and analogs
MX2013001536A (en) Prokaryotic expression construct.
JP7266325B2 (en) Fusion proteins containing fluorescent protein fragments and uses thereof
EP1924601B1 (en) Expression of proteins in e.coli
EP2305815B1 (en) Method for producing a natriuretic peptide with a pI above 8 or below 5
CA2159079C (en) Methods and dna expression systems for over-expression of proteins in host cells
KR100659671B1 (en) Method for preparing recombinant insulin from novel fusion proteins
CN101622269A (en) Expression of proteins in e. coli
JP4314332B1 (en) Fusion protein containing highly expressed secreted insulin precursor, DNA encoding the same, and method for producing insulin
KR100368073B1 (en) Preparation of Peptides by Use of Human Glucagon Sequence as a Fusion Expression Partner
KR101642779B1 (en) Production of disulfide bond-rich peptides by recombinant expression system
US20060286629A1 (en) Processing of Peptides and Proteins
MX2014009979A (en) Method for reduction of 1->3 reading frame shifts.
JPH05317037A (en) Co-expression system containing yeast ERD2 gene and gene encoding endoplasmic reticulum localized protein as its ligand, and method for producing useful polypeptide using the same
KR100818982B1 (en) E. coli producing the blood pressure lowering peptide and mass production method of the blood pressure lowering peptide using the same
WO2024263059A1 (en) Fusion precursor proteins of peptide immunogens as components of a covid-19 vaccine
WO2004007740A1 (en) Biological method for producing t-20 peptide
HK1036637B (en) Method for producing a peptide with a pl above 8 or below 5
HK1097280B (en) Method for producing a peptide with a pl above 8 or below 5
EP2097520A1 (en) A method for producing n-terminal methioine free polypeptides in microbial host cells

Legal Events

Date Code Title Description
AS Assignment

Owner name: NPS ALLELIX CORP., CANADA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:SASKI, KEN;WILLIAMSON, VANESSA JANE;DE ARAUJO, ALBERTO;AND OTHERS;REEL/FRAME:016447/0508;SIGNING DATES FROM 20041202 TO 20041204

AS Assignment

Owner name: NPS PHARMACEUTICALS, INC., NEW JERSEY

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:NPS ALLELIX CORP.;REEL/FRAME:021339/0977

Effective date: 20080728

REMI Maintenance fee reminder mailed
LAPS Lapse for failure to pay maintenance fees
STCH Information on status: patent discontinuation

Free format text: PATENT EXPIRED DUE TO NONPAYMENT OF MAINTENANCE FEES UNDER 37 CFR 1.362

STCH Information on status: patent discontinuation

Free format text: PATENT EXPIRED DUE TO NONPAYMENT OF MAINTENANCE FEES UNDER 37 CFR 1.362

FP Lapsed due to failure to pay maintenance fee

Effective date: 20141109