US7550138B1 - Plasmodium mutant and vaccines including the mutant - Google Patents
Plasmodium mutant and vaccines including the mutant Download PDFInfo
- Publication number
- US7550138B1 US7550138B1 US11/838,343 US83834307A US7550138B1 US 7550138 B1 US7550138 B1 US 7550138B1 US 83834307 A US83834307 A US 83834307A US 7550138 B1 US7550138 B1 US 7550138B1
- Authority
- US
- United States
- Prior art keywords
- sporozoites
- mutant
- plasmodium
- parasites
- parasite
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/44—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from protozoa
- C07K14/445—Plasmodium
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/52—Bacterial cells; Fungal cells; Protozoal cells
- A61K2039/522—Bacterial cells; Fungal cells; Protozoal cells avirulent or attenuated
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/52—Bacterial cells; Fungal cells; Protozoal cells
- A61K2039/523—Bacterial cells; Fungal cells; Protozoal cells expressing foreign proteins
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Definitions
- the invention relates to the field of immunology, especially to the field of the use of vaccines against infectious diseases, more in particular malaria.
- Malaria is the scourge of many developing countries, particularly those in sub-Saharan Africa, claiming several million lives each year. Malaria is caused by mosquito-borne hematoprotozoan parasites belonging to the genus Plasmodium .
- Four species of Plasmodium protozoa P. falciparum, P. vivax, P. ovale and P. malariae ) are responsible for the disease in humans; many others cause disease in animals, such as P. yoelii and P. berghei.
- P. falciparum accounts for the majority of lethal infections in humans.
- researchers have struggled for decades to make a successful subunit or attenuated whole-organism vaccine but with limited success.
- Factors that have hampered the development of a subunit vaccine include the complexity of the malaria life cycle, the wide variety of immune response induced by the malaria parasite, and an incomplete knowledge of protective immunity. In contrast, attenuated whole-organism vaccines are better understood and in principle should provide full protective immunity.
- the infectious sporozoite of Plasmodium Upon introduction into the bloodstream by the female Anopheline mosquito during blood feeding, the infectious sporozoite of Plasmodium invades and multiplies within the hepatocyte. Recognition and invasion of a hepatocyte is a complex process involving traversal through macrophage-like Kupffer cells (1) and several hepatocytes (2) before forming a parasitophorous vacuole (PV) in the final hepatocyte.
- PV parasitophorous vacuole
- CS circumsporozoite protein
- TRIP thrombospondin-related anonymous protein
- SPECT1 microneme proteins essential for cell traversal
- SPECT2 microneme proteins essential for cell traversal
- CelTOS microneme proteins essential for cell traversal
- PbIMC1a PbIMC1a, which variously are involved in motility of sporozoites, recognition of surface receptors on host cells, and traversal and invasion of host cells (3-10).
- the sporozoite transforms and grows (trophozoite stage) and multiplies (schizont stage) for a period of a few days, resulting in the generation and release of thousands of merozoites that invade red blood cells.
- GAS genetically attenuated sporozoites
- the present invention comprises a mutant of Plasmodium wherein expression of the protein P36p has been disrupted, preferably wherein said disruption has been achieved by complete or partial deletion of the gene coding for said protein P36p.
- the Plasmodium mutant of the invention is preferably a mutant of and species of Plasmodium that might serve as a vaccine in humans or act as a model system for the grater elucidation of the interface between the parasite and the host immune system.
- Examples of the immediately desired species in which the mutant might be generated and their different applications are: Plasmodium falciparum (human vaccination) Plasmodium berghei or Plasmodium yoelii model); Plasmodium knowlesi (human vaccination/model).
- the invention comprises an immunological composition comprising the mutant of the invention.
- Yet another embodiment of the invention is a vaccine for prevention or treatment of malaria comprising the mutant of the invention and a pharmaceutically acceptable carrier and optionally an adjuvant.
- Also part of the invention is a method for preventing or treating malaria wherein the immunological composition of the invention or the vaccine of the invention is administered to a subject, which subject is preferably human.
- mutant of the invention is the use of the mutant of the invention as a delivery system for heterologous vaccination against other diseases and other stages of the malaria parasite.
- FIG. 1 Generation of the p36p ⁇ parasite lines.
- A Schematic representation of the p36p ⁇ locus on chromosome 10 (containing p36 and the paralogue p36p) (20) and the replacement vector MI4. Correct integration of the construct results in the disrupted p36p gene as shown. Open box, untranslated regions; black box, pb36p and pb36 coding regions; gray box, tgdhfr/ts SC.
- B Disruption of p36p was shown by PCR (Right) and by Southern analysis of separated chromosomes (Left).
- PCR on DNA of WT and p36p ⁇ clones results in the amplification of a 1.2-kb WT fragment and a 1.0-kb disrupted fragment.
- Chromosomes hybridized to a P. berghei pb
- dhfr/ts 3′ UTR region DT-3′
- specific probe detect the endogenous dhfr/ts copy on chromosome 7 and the integrated construct on chromosome 10.
- C The absence of p36p transcripts in p36p ⁇ parasites as shown by RT-PCR on RNA from WT and p36p ⁇ sporozoites with (+) or without ( ⁇ ) reverse transcriptase.
- PCR on DNA of WT and p36p ⁇ gfp parasites results in the amplification of a 3-kb WT fragment, a 3-kb fragment of the disrupted cssu, and a 1-kb fragment of the disrupted p36p locus.
- Separated chromosomes were hybridized to the DT-3′-probe, detecting pbdhfr/ts on chromosome 7, the gfp construct on chromosome 5, and the MI4 construct on chromosome 10.
- FIG. 2 Development of WT, RAS, and p36p ⁇ sporozoites in hepatocytes in vitro.
- Cells were stained by using anti-PbEXP-1 to detect the PVM, anti-HSP90, or HSP70 to visualize the parasite cytoplasm and DAPI to stain the nuclei (blue fluorescence).
- A Visualization of the PVM (green, anti-PbEXP-1) in trophozoites of WT and p36p ⁇ parasites (red, anti-HSP90) at 15 and 24 h after infection, respectively.
- FIG. 3 Apoptosis is increased in p36p ⁇ parasitized liver cells.
- A Apoptosis rates represent the percentage of parasite-invaded cells that undergo apoptosis 6 h after infection of HepG2 cells with WT, RAS, or p36p ⁇ sporozoites. Non. Inf. indicates noninfected HepG2 cell cultures. Error bars represent SD.
- B and C Visualization of p36p ⁇ sporozoite (green, anti-HSP70) infected hepatocytes displaying typical apoptotic signs as detected by DAPI staining (blue) in vitro (B) as well as in vivo (C). Active caspase-3 (red) detection was also performed in B. (Original magnification, ⁇ 1,260.)
- FIG. 4 Inhibition of liver stage development of wild type Plasmodium berghei in mice immunized with g-irradiated or with p36p ⁇ sporozoites. Inhibition of development was determined by real-time PCR quantification of A-type 18S ribosomal RNA copies in liver stage parasites 40 h after the invasion of wild-type parasites. Groups of four BALB/c mice (for each condition) were immunized with 10 5 p36p ⁇ or 10 5 g-irradiated sporozoites (Irrad) or with PBS and challenged with 5 ⁇ 10 4 wild-type (WT) sporozoites 10 days later. Error bars represent standard deviations.
- P36p is a sporozoite-specific protein (18 and 19), which is a member of a small family of 10 Plasmodium surface proteins, the P48/45 family, that include other promising vaccine candidate antigens, such as P48/45 and P230, that are expressed on the surface of gametes (20-22).
- P36p has no function in sporozoite motility and invasion of both salivary glands and hepatocytes, and instead plays an essential role during development of the liver trophozoite. Thus, it is one of many essential genes of Plasmodium.
- p36p ⁇ sporozoites like uis4 ⁇ GAS, albeit at a lower frequency, initiated a delayed blood stage infection in some mice, but only when p36p ⁇ sporozoites are inoculated i.v.
- RAS sporozoites Like GAS, RAS sporozoites invade liver cells and transform into the rounded trophozoite stage, but do not enter the process of schizogony. However, trophozoite development of RAS arrests at a later stage and produces a visible PV compared to p36p ⁇ sporozoites. Moreover, RAS-infected hepatocytes persist in culture longer than their GAS-infected counterparts, which, in the case of p36p ⁇ parasites, results from their failure to prevent the host cell from entering apoptosis. Although RAS populations provoke apoptosis to a greater degree than WT sporozoites, they do so to a significantly lower degree than p36p ⁇ sporozoites.
- Immune responses against RAS are complex and involve both cell-mediated and humoral immunity (13-15).
- the differing biological characteristics of RAS and GAS described here suggest that the immune responses elicited by RAS and GAS could be different.
- cell death by apoptosis was originally described to occur in the absence of inflammation.
- apoptosis is being redefined based on a number of studies demonstrating that apoptotic death of host cells after pathogen infection can trigger powerful innate and adaptive immune responses.
- apoptosis-induced inflammation is actively being investigated as a way of enhancing vaccine function improving accessibility of the effector cells of the immune system to the site of infection (41, 42).
- HGF hepatocyte growth factor
- P36p may be essential for intracellular survival/development through being involved in an essential preceding step affecting gene-expression through signalling; therefore, the absence of P36p results in the lack of the necessary parasite mediators that control parasite survival, formation and/or maintenance of an effective PV, and direct involvement in the regulation of the host cells apoptotic machinery.
- P36p is anticipated to be a GPI-anchored membrane protein and, therefore, may play a role in the interactions between the developing trophozoite and its host cell.
- Plasmodium berghei mutants have been shown to induce protective immunity in a rodent model of malaria. Since Plasmodium berghei and Plasmodium falciparum , which is the causative agent for malaria in humans, are very similar in genetic and morphologic structure, and since the infection by P. berghei in mice and P. falciparum in humans share many features and results with RAS are comparable, it is postulated that p36p ⁇ mutants of P. falciparum are equally able to provide long-lasting protective immune responses in humans.
- Plasmodium also contains a close paralogue gene p36. This gene is located directly adjacent to p36p in the parasite genome, and it appears that it is also expressed in sporozoites.
- the P36 protein is not able to replace the full function of the P36p protein, since otherwise normal infection by the p36p ⁇ mutant would take place.
- the presence of P36 might explain the difference in host immune response to P36p ⁇ GAS.
- a spontaneous mutation would occur in the p36p ⁇ mutants, which would cause full complementation by the P36 protein (or the expression of a functional P36p protein), as a result of which the mutant would again be able to cause malaria.
- the mutant of the invention preferably comprises one or more further mutations in the genome.
- Such a mutation could be the knock-out of the p36 gene-expression, or the knock-out of expression of any of the “upregulated in infective sporozoites” (UIS) genes, preferably UIS3 or UIS4.
- UIS upregulated in infective sporozoites
- Said knock-outs may be produced in an analogous manner to the p36p ⁇ mutant, i.e. by deleting or replacing (part of) the gene.
- the person skilled in the art may know other ways of inhibiting expression of the p36p, p36, UIS3 and UIS4 genes, although the application in Plasmodium of commonly practiced alternatives such as anti-sense expression or RNAi remains controversial.
- the mutants may also be used as a carrier (vector) for heterologous antigens.
- the genetic information coding for one or more heterologous antigens may be inserted in the mutant parasites of the invention by conventional genetic engineering techniques. It is, for example, possible to insert a gene coding for an antigen in the place of the p36p gene, or, alternatively, the gene coding for the antigen may be inserted at any other place in the Plasmodium genome.
- the gene encoding a heterologous antigen is placed after a promoter which ensures expression during the sporozoite phase.
- mutants of the invention can also be used as carriers for antigens of Plasmodium , which normally would only be exposed during the later life cycle of the parasite, e.g. that are specific for the trophozoite stage.
- the mutants of the invention may be comprised in an immunological composition, i.e. a composition which is able to trigger the immune system of the subject to which it is administered.
- an immunological composition is a vaccine.
- the invention pertains to a vaccine composition comprising a mutant according to the invention.
- This mutant is intended to be delivered as a live but attenuated organism with no adjuvant.
- Previous work with RAS indicates that irradiated sporozoites that receive sufficient irradiation to kill not disable the infectivity of the parasite no longer induce protective immune responses.
- a vaccine composition comprises an immunologically and pharmaceutically acceptable carrier, vehicle and/or adjuvant.
- An effective vaccine wherein a protein of the invention is recognized by the animal, will in an animal model be able to prolong survival times and/or diminish weight loss after challenge with a malarial parasite, compared to non-vaccinated animals.
- mutants of the invention as described above may be formulated together with carriers, such as, for example, liposomes, oil in water emulsions, and or metallic salts, including aluminium salts (such as aluminium hydroxide).
- carriers such as, for example, liposomes, oil in water emulsions, and or metallic salts, including aluminium salts (such as aluminium hydroxide).
- aluminium salts such as aluminium hydroxide
- the vaccines are administered in a manner compatible with the dosage formulation, and in such amount as will be therapeutically effective and immunogenic.
- the quantity to be administered depends on the subject to be treated, including, e.g., the capacity of the individual's immune system to mount an immune response, and the degree of protection desired.
- Suitable dosage ranges are of the order of several hundred micrograms active ingredient (mutant parasite) per vaccination with a preferred range from about 10 3 -10 7 , but preferably 10 4 -10 5 sporozoites per vaccination dose, when administered intravenously(12).
- Suitable regimens for initial administration and booster shots are also variable but are typified by an initial administration followed by subsequent inoculations or other administrations.
- vaccines can be administered to prevent an infection with malaria and/or to treat established malarial infection.
- the vaccine is given prophylactically, before definitive clinical signs or symptoms of an infection are present. Protocols have been established for the administration of attenuated sporozoite vaccines (summarized in Luke and Hoffman ibid) and would serve as a preliminary platform for the further definition of the ideal dose administration, size and frequency.
- the invention also pertains to a method for immunizing an animal, including a human being, against malaria caused by e.g. P. falciparum , comprising administering to the animal the mutant of the invention, or a vaccine composition of the invention as described above.
- the invention also pertains to a method for producing an immunologic composition according to the invention, the method comprising preparing, synthesising or isolating a mutant according to the invention, and solubilizing or dispersing said mutant in a medium for a vaccine, and optionally adding other antigens and/or a carrier, vehicle and/or adjuvant substance.
- a p36p replacement vector was constructed in vector b3D.D T . ⁇ H. ⁇ D i , containing the pyrimethamine-resistant Toxoplasma gondii (tg) dhfr/ts gene.
- tg pyrimethamine-resistant Toxoplasma gondii
- tg pyrimethamine-resistant Toxoplasma gondii
- tg pyrimethamine-resistant Toxoplasma gondii
- a p36p replacement vector was constructed in vector b3D.D T . ⁇ H. ⁇ D b containing the pyrimethamine resistant Toxoplasma gondii (tg) dhfr/ts gene.
- P36p targeting sequences flanking the selection cassette were amplified by PCR from Plasmodium berghei genomic DNA by using primers L903 (5′-CGATCGATGAATAATAGTAAATGATGAAACGTCG-3 (SEQ ID NO:1) and L904 (5′-CCCAAGCTTAATTACGTCCCCTGGATATGC-3 (SEQ ID NO:2), and primers L905 (5′-GGATATCTAGTGATGAGGATGAATCG-3 (SEQ ID NO:3) and L906 (5′-CGCGGATCCAATGCTTGAATACATGTGG-3 (SEQ ID NO:4). PCR fragments were inserted up- and downstream of the SC, resulting in MI4. The fragment used for disruption of p36p was obtained after digestion of MI4 with ClaI/BamHI.
- a vector was constructed with the human (h) dhfr selectable marker and gfp under control of the constitutive pbef-1aa promoter (23) and a fragment of 2 kb of the d-type small subunit (dssu) rRNA gene of P. berghei (23).
- the pbef-1a promoter region (pE(A)b.luc. ⁇ D) (24) was subcloned as a 0.6-kb HindIII/NdeI fragment in pBluescript II KS (HindIII/SmaI).
- the promoter was cloned (HindIII/BamHI) into pD b .D h . ⁇ D b (25) to create pDEF.
- Primers L972 (5′-GTACCCTCGAGGCTAGCGATATCTGATCACCCGGGGCGGCCGCG-3) (SEQ ID. NO:5) and L973 (5-AATTCGCGGCCGCCCCGGGTGATCAGATATCGCTATCGCTAGCCTCGAGG-3) (SEQ ID NO:6) were annealed and cloned in the EcoRI and Asp718 sites of pDEF to obtain pDEF-EA.
- the hdhfr was PCR amplified using primers L886 (5′GGAAGATCTATGGTTGGTTCGCTAAACTGCATCG3 (SEQ ID. NO:7) and L887 (5′GGAAGATCTTTAATCATTCTTCTCATATACTTC3′) (SEQ ID. NO:8) and cloned in pDEF-EA (BamHI). Finally, the tgdhfr/ts SC of PbGFPcon (23) was replaced by the hdhfr SC of pDEFhD-EA to create pl0019.
- the linearised vector can integrate in c- and/or dssu.
- P. berghei wild-type (WT) parasites (clone 15cyl; ANKA strain) were used to generate p36p ⁇ parasites. Transfection, selection, and cloning of p36p ⁇ parasites was performed as described (27). Two independent transfection experiments were performed, and two clones (KO1 and KO2) were selected for further analysis. p36p ⁇ parasites (KO1) were transfected with the gfp vector to create p36p ⁇ mutants expressing gfp constitutively throughout the life cycle. Selection of transformed parasites was performed by treating infected animals with WR99210 (16 mg/kg bodyweight) as has been described (25).
- KGFP One parasite clone in which the gfp was integrated into the cssu was selected for further analysis. Correct integration of constructs into the genome of transformed parasites was analyzed by RT-PCR and Southern analysis of restricted DNA or separated chromosomes by field inversion gel electrophoresis (27).
- PCR on DNA of WT and p36p ⁇ parasites was performed by using primers specific for the WT (L1362 5′-CCGCTCGAGACCTTAGGACACTTTGAAATTTG-3′ (SEQ ID NO:9) and L1363 5′-CCGCTCGAGCTACTCATAATAAGAAGAAGAGGTAC-3′ (SEQ ID NO:10); amplifying a fragment of 1.2 kb) and disrupted (L1389 5′-ATTTTGCAACAATTTTATTCTTGG-3′ (SEQ ID NO:11) and L313 5′-ACGCATTATATGAGTTCATTTTAC-3′ (SEQ ID NO:12); amplifying a fragment of 1.0 kb) locus.
- PCR on DNA of WT and p36p ⁇ :gfp parasites was performed by using primers specific for WT (L270 5′-GTGTAGTAACATCAGTTATTGTGTG-3′ (SEQ ID NO:13) and L271 5′-CTTAGTGTTTTGTATTAATGACGATTTG-3′ (SEQ ID NO:14), amplifying a fragment of 3 kb) and disrupted cssu (L270 and L635 5′-TTTCCCAGTCACGACGTTG-3′ (SEQ ID NO:15), amplifying a fragment of 3 kb).
- Primers 1389 and 313 amplified the expected fragment of 1.0 kb of the disrupted p36p locus in KOGFP parasites.
- RT-PCR was performed on RNA isolated from WT and p36p ⁇ sporozoites as described by Invitrogen.
- primers L1425 (5′-GAAATGAATATGTCGGTACTATG-3′) (SEQ ID NO:16) and L1363 (5′-CCGCTCGAGCTACTCATAATAAGAAGAAGAGGTAC-3′) (SEQ ID NO:17), amplifying a fragment of 0.5 kb
- L1502 (5′-AGTCAACAGATTATTGCCGATG-3′) (SEQ ID NO:18) and L1503 (5′-TACAAATCCTAATGAATTGCTTAC-3′) (SEQ ID NO:19)
- amplifying a 0.8-kb fragment were used, respectively.
- the phenotype of blood stage development was analyzed in asynchronous infections in Swiss mice and during standardized synchronized development in vivo and in vitro as described (28). Gamete formation, fertilization and ookinete production were studied in vitro as described (20). Oocyst formation and sporozoite development were investigated by using Anopheles stephensi and standard methodologies (29). The number of sporozoites per salivary gland was determined by mixing the salivary glands of 10 infected mosquitoes in 300 ⁇ l of PBS and counting the numbers of sporozoites in duplicate in a cell counter.
- mice female BALB/c and C57BL6, 15-20 g
- mice female BALB/c and C57BL6, 15-20 g
- i.v. injection 5 ⁇ 10 4 purified sporozoites, dissected from infected mosquito salivary glands (30), per mouse.
- Twenty to 40 infected mosquitoes were allowed to feed on each mouse 20 days after the infectious blood meal.
- Blood stage infections were monitored in Giemsa-stained bloodsmears or by FACS analysis of tail blood when p36p ⁇ :gfp parasites were used (23) on days 4-14 after infection.
- Infection with WT sporozoites results in a 1-10% parasitemia at day 4-6 after mosquito feeding and a 0.5-5% parasitemia on day 4 or 5 after i.v. injection.
- Gliding motility of sporozoites was analyzed by counting the average number of circles performed by single sporozoites (31). Sporozoites (4 ⁇ 10 4 ) were spun for 10 min at 1,800 ⁇ g onto glass coverslips previously coated with 0.02% gelatin in water, followed by incubation for 2 h at 37° C. and staining with anti-CS 3D11 antibody (Ab) for sporozoite and trail visualization. Quantification was performed by counting the average number of circles performed by 100 sporozoites in three independent coverslips. Hepatocyte invasion and traversal were studied in vitro by adding purified sporozoites to confluent monolayers of HepG2 cells in supplemented MEM medium as described (32).
- Cell traversal was quantified by counting parasite-wounded hepatocytes using a cell-impermeant fluorescent tracer macromolecule, rhodamine-dextran (1 mg/ml) (2). Hepatocyte invasion was determined by counting the percentage of sporozoites inside dextran-negative cells as described (33). Sporozoite development within HepG2 cells in vitro was determined by staining cells using different Abs: anti-PbEXP-1, detecting a PVM-resident protein (V.H., unpublished results); and anti-HSP90 (V.H., unpublished results) or anti-HSP70 (2), detecting the parasite cytoplasmic heat shock protein 90 or 70, respectively. Cells were stained with DAPI to visualize the nuclei. Trophozoite development was quantified by counting the numbers of trophozoites 24 h after invasion of sporozoites in a whole coverslip.
- mice Groups of BALB/c and C57BL6 mice were immunized by i.v. injection of p36p ⁇ sporozoites or RAS (35) or PBS and monitored for blood stage parasitaemia in Giemsa-stained bloodsmears. Mice were challenged with different doses of WT sporozoites on different time points. Animals were either monitored for blood stage parasitemia in bloodsmears every other day starting from day 3 to 3 weeks after challenge or killed 40 h after challenge for liver extraction and quantification of infection by real-time PCR quantification of A-type 18S ribosomal RNA copies (36). For each set of experiments, groups of na ⁇ ve mice were included to verify infectivity of the sporozoite challenge dose.
- All three p36p ⁇ lines show no phenotype that is different from WT parasites during blood stage development (results not shown) and development in the mosquito.
- the characteristics of fertilization and zygote development as well as oocyst and sporozoite production in the mosquito were not affected in the independent p36p ⁇ lines (Table 1).
- mice ⁇ Mean number (and range) of oocysts in mosquitoes at day 10 after feeding on infected mice and mean number of sporozoites per salivary gland in glands dissected from mosquitoes at day 20 after the infectious blood meal. ⁇ Number of mice that became positive after feeding of 20-40 infected mosquitoes at day 20 after the infectious blood meal. The total number of mice that were exposed to mosquito infection are shown in parentheses. In experiments using WT parasites, all mice became positive with a parasitemia of 1-10% on day 4 or 5 after infection. ⁇ Number of mice that became positive after i.v. injection of 5 ⁇ 104 sporozoites. The total number of mice that were injected with sporozoites are shown in parentheses.
- mice In experiments using WT sporozoites, all mice became positive with a parasitemia of 0.5-5% on day 4 or 5 after infection.
- the gliding motility of sporozoites is defined as the average number of circles performed by a single sporozoite.
- the capacity of sporozoites to traverse hepatocytes is defined as the percentage of dextran positive hepatocytes in vitro 2 h after adding sporozoites to hepatocytes. **Hepatocyte invasion was determined by counting the number dextran-negative hepatocytes containing sporozoites, 2 h after adding sporozoites to hepatocytes in vitro.
- ⁇ Parasite development in hepatocytes was determined by counting trophozoites present at 24 h after invasion of sporozoites into hepatocytes in vitro.
- P36p is Essential for Sporozoite Development within the Hepatocyte.
- mice The infectivity of p36p ⁇ sporozoites to the host (BALB/c and C57BL6 mice) was strongly affected, as was shown by the complete absence of a blood stage infection after infection through the bite of mosquitoes or after i.v. inoculation of purified salivary gland sporozoites (Table 1). However, occasionally, some mice from both host strains (10% C57BL6, i.e., 5 of 48 mice; 4% BALB/c, i.e., 1 of 26 mice) did develop a 7-day delayed blood stage infection upon i.v. injection of p36p ⁇ sporozoites in a parasite dose-independent fashion (data not shown). Interestingly, blood stage infections were never observed when p36p ⁇ sporozoites were transmitted naturally through mosquito bites. The resulting blood stage parasites still contained the knockout genotype, as analyzed by PCR (data not shown).
- Gliding motility is a feature of Plasmodium sporozoites and associated with invasion of both salivary glands and hepatocytes (4). p36p ⁇ sporozoites are unaffected in their ability to glide (Table 1) and, therefore, the loss of infectivity of these sporozoites is not due to disrupted motility.
- HepG2 human hepatocyte cells
- the level of apoptosis in p36p ⁇ parasitized cells was significantly higher (P ⁇ 0.05) compared to that in RAS-infected cells, which was higher than the level observed in WT-infected cells ( FIG. 3A ).
- the different levels of apoptosis are consistent with the observed longer survival time of RAS in culture (39).
- mice were i.v. immunized with p36p ⁇ sporozoites by using different immunization protocols and subsequently challenged with WT parasites. Protection was determined by using two different detection assays. (i) In three independent experiments, groups of four BALB/c mice were infected with either 10 5 p36p ⁇ sporozoites or 10 5 RAS.
- mice were challenged with 5 ⁇ 10 4 WT sporozoites and assessed for liver stage development by using real-time PCR assays to quantify A-type ribosomal RNA transcripts produced by developing trophozoites (36).
- Mice immunized with RAS and p36p ⁇ sporozoites showed a very strong and comparable reduction (>99%) in liver stage development of WT parasites compared to nonimmunized mice ( FIG. 4 ).
- mice were immunized with a single dose of 10 to 5 ⁇ 10 4 p36p ⁇ sporozoites or multiple times (one to three immunizations) with 5 to 2 ⁇ 10 4 p36p ⁇ sporozoites, respectively, and challenged with different doses of WT sporozoites on different days after immunization (Table 2). Protection was determined by monitoring mice intermittently for blood stage parasitemia in bloodsmears or using FACS analysis from day 3 to 3 weeks after challenge.
- mice were immunized intravenously with one of PBS (control), RAS, or p
- the protective immune response induced by p36p ⁇ sporozoites as well as RAS sporozoites seemed to be parasite stage-specific, because BALB/c mice were not protected from a challenge with parasite-infected red blood cells and developed a normal blood stage infection comparable to the control group (Table 2).
- the protective immune response lasts a long time (at least 6 months from the start of the immunization), which indicates that this mutant is a perfect candidate for prophylactic treatment.
- a DNA construct was made with vector pHTK (ref. 47) such that the gene will be irreversibly disrupted upon integration of the construct by double cross over homologous recombination.
- the 5′ segment of Pfp36p was amplified from genomic DNA of 3D7 parasites with the primers 5′-GACCCCGCGGATGTATGTATTGGTGC-3′ (SEQ ID NO:20) and 5′-GGACCGTTAACACCAAATCACAACCC-3′ (SEQ ID NO:21). This ⁇ 600 bp fragment was introduced 5′ of the hdhfr cassette between the SacII and HpaI sites of pHTK generating the vector pHTKPfp36p5′.
- the 3′ segment of the Pfp36p gene was amplified with the primers 5′-GGACCACCGGTCCTGACCCTTCATCAGATG-3′ (SEQ ID NO:22) and 5′-GGACCGGGCGCCCGGGGCCAGAATGTTCTTGTTCG-3′ (SEQ ID NO:23.
- This ⁇ 600 bp fragment was introduced into the Xma I and AvrII sites of pHTKPfp36p5′ generating the vector pHTKPfp36pko. Similar vectors have been made to disrupt both P36 and to disrupt both genes and generate a double knock-out parasite.
- Plasmodium falciparum asexual stages are maintained (Trager and Jensen, 1976) and sorbitol-synchronised (Lambros and Vanderberg, 1979) by standard procedures.
- 3D7 is a cloned line derived from NF54 and was obtained from Professor David Walliker at Edinburgh University.
- Predominantly ring-stage parasites are transfected with 100 ⁇ g of purified (Qiagen) plasmid DNA as described previously [BioRAD electroporator settings 0.31 kV, 960 ⁇ F used with 0.2-cm cuvettes]. Positive selection is with 10 nM WR99210, an antifolate drug which selects for the presence of the human dhfr gene.
- Transformants are obtained between 15 and 23 days following transfection.
- Drug resistant parasites are cloned by limiting dilution. Expanded clonal cultures at 1% parasitemia are then subjected to negative selection in the presence of the positive selection pressure (WR99210). Parasites are maintained on WR99210.
- the 3D7/pHTK-rh3 parasites are either not treated or treated with 4 ⁇ M ganciclovir for 6 days until parasites re-appear.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Biophysics (AREA)
- Gastroenterology & Hepatology (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Toxicology (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Tropical Medicine & Parasitology (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
Description
| TABLE 1 |
| Mosquito development, gliding motility, hepatocyte traversal, |
| and invasion of p36p− sporozoites |
| Ookinete | Oocyst, no. | Sporozoite no. | Mosquito | Sporozoite | Traversal | Liver | |||
| production in | mean | per salivary | infection, no of | injection: no of | Gliding | through | Hepatocyte | trophozoites at | |
| Parasite | vitro, *% | (range)† | gland† | mice infected‡ | mice infected§ | motility¶ | cells∥** | invasion** | 24 h**†† |
| WT | 78% (60-85) | 165 (8-200) | 114,000 | 4 (4) | 5 (5) | 4.1 ± 1.2 | 38.3 ± 7.6 | 32.4 ± 14.9 | 248 ± 8.1 |
| 174 (21-230) | 72,000 | 4 (4) | 15 (15) | 6.4 ± 2.1 | 26.2 ± 5.6 | 38.5 ± 12.9 | 330 ± 20.1 | ||
| KO1 | 69% (60-75) | 210 (120- | 128,000 | 0 (5) | 0 (3) | 4.3 ± 1.3 | 37.3 ± 15.4 | 30.1 ± 9.2 | 1.3 ± 1.5 |
| 350) | |||||||||
| 183 (112- | 99,000 | 0 (3) | 0 (15) | ||||||
| 240) | |||||||||
| KO2 | 75% (65-80) | 120 (35-160) | 108,000 | 0 (4) | 0 (3) | ||||
| KOGFP | 66% (55-70) | 160 (20-260) | 98,000 | 0 (2) | 0 (20) | 6.1 ± 2.3 | 27.6 ± 1.2 | 39.7 ± 16.3 | 0 |
| *Percentage of female gametocytes that transform into ookinetes in vitro under standard culture conditions as described (19). | |||||||||
| †Mean number (and range) of oocysts in mosquitoes at | |||||||||
| ‡Number of mice that became positive after feeding of 20-40 infected mosquitoes at | |||||||||
| §Number of mice that became positive after i.v. injection of 5 × 104 sporozoites. The total number of mice that were injected with sporozoites are shown in parentheses. In experiments using WT sporozoites, all mice became positive with a parasitemia of 0.5-5% on | |||||||||
| ¶The gliding motility of sporozoites is defined as the average number of circles performed by a single sporozoite. | |||||||||
| ∥The capacity of sporozoites to traverse hepatocytes is defined as the percentage of dextran positive hepatocytes in vitro 2 h after adding sporozoites to hepatocytes. | |||||||||
| **Hepatocyte invasion was determined by counting the number dextran-negative hepatocytes containing sporozoites, 2 h after adding sporozoites to hepatocytes in vitro. | |||||||||
| ††Parasite development in hepatocytes was determined by counting trophozoites present at 24 h after invasion of sporozoites into hepatocytes in vitro. | |||||||||
P36p is Essential for Sporozoite Development within the Hepatocyte.
| TABLE 2 |
| Immunization with p36p− sporozoites protects against a |
| subsequent infection with WT sporozoites |
| Challenge | Time of challenge, | No. protected (no. | |||
| Experiment | Mouse | Immunization, * | dose†, WT × | days after final | challenged) |
| no. | strain | RAS/p36p− × 103 | 103 | immunization | | RAS | p36p | − |
| 1 | BALB/c | 100 | 50 | 10 | 0 (10) | ND | 18 | |
| (20) | ||||||||
| 2 | BALB/c | 50 | 25 | 10 | 0 (15) | 15 | 15 | |
| (15) | (15) | |||||||
| 3 | BALB/c | 50 | 10 | 10 | 0 (5) | ND | 5 (5) | |
| 3 | BALB/c | 50 | 10 | 30 | 0 (5) | ND | 5 (5) | |
| 3 | BALB/c | 50 | 10 | 60 | 0 (5) | ND | 5 (5) | |
| 3 | BALB/c | 50 | 10 | 120 | 0 (5) | ND | 5 (5) | |
| 4 | BALB/c | 50 | 1,000 |
10 | 0 (3) | 0 (5) | 0 (4) | |
| 1 | C57BL6 | 50 | 10 | 10 | 0 (3) | 0 (3) | 0 (1) | |
| 1 | C57BL6 | 50/20 | 10 | 10 | 0 (3) | 1 (3) | 1 (4) | |
| 1 | C57BL6 | 50/20/20 | 10 | 10 | 0 (5) | 5 (5) | 4 (4) | |
| 1 | C57BL6 | 50/20/20 | 10 | 30 | 0 (5) | 5 (5) | 5 (5) | |
| *Groups of mice were immunized intravenously with one of PBS (control), RAS, or p36p− sporozoites isolated from different mosquito batches. Multiple immunizations with RAS or p36p− sporozoites were administered at 7-day intervals. | ||||||||
| †Mice were challenged with WT sporozoites or parasite infected red blood cell (iRBC) stages and the prepatent period monitored by either counting Giemsa-stained bloodsmears or FACS analysis. All control, unimmunized mice became positive on |
||||||||
- 1. Frevert, U. (2004) Trends Parasitol. 9, 417-424.
- 2. Mota, M. M., Hafalla, J. C. & Rodriguez, A. (2001) Science 291:141-144.
- 3. Sultan, A. A., Thathy, V., Frevert, U., Robson, K. J., Crisanti, A., Nussenzweig, V., Nussenzweig, R. S. & Menard, R. (1997) Cell 90:511-522.
- 4. Menard, R. (2001) Cell Microbiol. 3:63-73.
- 5. Matuschewski, K., Nunes, A. C., Nussenzweig, V. & Menard, R. (2002) EMBO J. 21:1597-1606.
- 6. Kappe, S. H., Buscaglia, C. A. & Nussenzweig, V. (2004) Annu. Rev. Cell Dev. Biol. 20:29-59.
- 7. Ishino, T., Yano, K., Chinzei, Y. & Yuda, M. (2004) PLoS Biol. 2:77-84.
- 8. Ishino, T., Chinzei, Y. & Yuda, M. (2004) Cell Microbiol. 6:1119-1125.
- 9. Khater, E. I., Sinden, R. E. & Dessens, J. T. (2004) J. Cell Biol. 167:425-432.
- 10. Yuda, M. & Ishino, T. (2004) Cell Microbiol. 6:1119-1125.
- 11. Tsuji, M., Rodrigues, E. G. & Nussenzweig, S. (2001) Biol. Chem. 382:553-570.
- 12. Luke, T. C. & Hoffman, S. L. (2003) J. Exp. Biol. 206:3803-3808.
- 13. Doolan, D. L. & Hoffman, S. L. (1999) J. Immunol. 163:884-892.
- 14. Tsuji, M. & Zavala, F. (2003) Trends Parasitol. 19:88-93.
- 15. Morrot, A. & Zavala, F. (2004) Immunol. Rev. 201:291-303.
- 16. Mueller, A.-K., Labaied, M., Kappe, S. H. I. & Matuschewski, M. (2005) Nature 433:164-167.
- 17. Mueller, A.-K., Camargo, N., Kaiser, K., Andorfer, C., Frevert, U., Matuschewski, K. & Kappe, S. H. (2005) Proc. Natl. Acad. Sci. USA 102:3022-3027.
- 18. Kappe, S. H., Gardner, M. J., Brown, S. M., Ross, J., Matuschewski, K., Ribeiro, J. M., Adams, J. H., Quackenbush, J., Cho, J., Carucci, D. J., et al. (2001) Proc. Natl. Acad. Sci. USA 98:9895-9900.
- 19. Le Roch, K. G., Zhou, Y., Blair, P. L., Grainger, M., Moch, J. K., Haynes, J. D., De La Vega., P, Holder, A. A., Batalov, S., Carucci, D. J. & Winzeler, E. A. (2003) Science 301:1503-1508.
- 20. van Dijk, M. R. Janse, C. J., Thompson, J., Waters, A. P., Braks, J. A., Dodemont, H. J., Stunnenberg, H. G., van Gemert, G.-J., Sauerwein, R. W. & Eling, W. (2001) Cell 104:153-164.
- 21. Thompson, J., Janse, C. J. & Waters, A. P. (2001) Mol. Biochem. Parasitol. 118:147-154.
- 22. Stowers, A. & Carter, R. (2001) Exp. Opin. Biol. Ther. 1:619-628.
- 23. Franke-Fayard, B., Trueman, H., Ramesar, J., Mendoza, J., van der Keur, M., van der Linden, R., Sinden, R. E., Waters, A. P. & Janse, C. J. (2004) Mol. Biochem. Parasitol. 137:23-33.
- 24. de Koning-Ward, T. F., Speranca, M. A., Waters, A. P. & Janse, C. J. (1999) Mol. Biochem. Parasitol. 100, 141-146.
- 25. de Koning-Ward, T. F., Fidock, D. A., Thathy, V., Menard, R., van Spaendonk, R. M., Waters, A. P. & Janse, C. J. (2000) Mol. Biochem. Parasitol. 106:199-212.
- 26. van Spaendonk, R. M., Ramesar, J., van Wigcheren, A., Eling, W., Beetsma, A. L., van Gemert, G.-J., Hooghof, J., Janse, C. J. & Waters, A. P. (2001) J. Biol. Chem. 276:22638-22647.
- 27. Menard, R. & Janse, C. J. (1997) Methods 13:148-157.
- 28. Janse, C. J. & Waters, A. P. (1997) Parasitol. Today 11:138-143.
- 29. Sinden, R. E. (1997) in Molecular Biology of Insect Diseases Vectors: A Methods Manual, eds. Crampton, J. M., Beard, C. B. & Louis, C (Chapman and Hall, London), pp. 67-91.
- 30. Ozaki, L. S., Gwadz, R. W. & Godson, G. N. (1984) J. Parasitol. 70:831-833.
- 31. Stewart, M. J. & Vanderberg, J. P. (1988) J. Protozool. 35:389-393.
- 32. Carrolo, M., Giordano, S., Cabrita-Santo, S. L., Corso, S., Vigario, A. M., Silva, S., Leiriao, P., Carapau, D., Armas-Portela, R., Comoglio, P. M., et al. (2003) Nat. Med. 9:1363-1369.
- 33. Silvie, O., Rubinstein, E., Franetich, J. F., Prenant, M., Belnoue, E., Renia, L., Hannoun, L., Eling, W., Levy, S., Boucheix, C. & Mazier, D. (2003) Nat. Med. 9:93-96.
- 34. Leiriao, P., Albuquerque, S. S., Corso, S., van Gemert, G.-J., Sauerwein, R. W., Rodriguez, A., Giordano, S. & Mota, M. (2005) Cell Microbiol. 7:603-609.
- 35. Orjih, A. U., Cochrane, A. H. & Nussenzweig, R. S. (1982) Trans. R. Soc. Trop. Med. Hyg. 76:57-61.
- 36. Bruna-Romero, O., Hafalla, J. C., Gonzalez-Aseguinolaza, G., Sano, G., Tsuji, M. & Zavala, F. (2001) Int. J. Parasitol. 31:1499-1502.
- 37. Suhrbier, A., Janse, C., Mons, B., Fleck, S. L., Nicholas, J., Davies, C. & Sinden, R. E. (1987) Trans. R. Soc. Trop. Med. Hyg. 81:907-909.[CrossRef]
- 38. Mota, M. M., Hafalla, J. C. & Rodriguez, A. (2002) Nat. Med. 8:1318-1322.
- 39. Scheller, L. F. & Azad, A. F. (1995) Proc. Natl. Acad. Sci. USA 92:4066-4068.
- 40. Chatterjee, S., Ngonseu, E., Van Overmeir, C., Correwyn, A., Druilhe, P. & Wery, M. (2001) Afr. J. Med. Med. Sci. 30:25-33.
- 41. Restifo, N. P. (2000) Curr. Opin. Immunol. 12:597-603.
- 42. Leitner, W. W., Hwang, L. N., Bergmann-Leitner, E. S., Finkelstein, S. E., Frank, S. & Restifo, N. P. (2004) Vaccine 22:1537-1544.
- 43. Leiriao, P., Mota, M. M. & Rodriguez, A. (2005) J. Infect. Dis. 191:1576-1581.
- 44. Luder, C. G. K., Gross, U. & Lopes, M. F. (2001) Trends Parasitol. 17:480-486.
- 45. Blaho, J. A. (2003) Int. Rev. Immunol. 22:321-326.
- 46. Levine, B. (2005) Cell 120:159-162.
- 47. Duraisingh M T, Triglia T, Cowman A F (2002) Int. J. Parasitol 32:81-89
- 48. Lambros and Vanderberg, (1979) J. Parasitol., 65:418-420
- 49. Trager and Jensen, (1976) Science 193:673-675.
- 50. Fidock and Wellems, (1997) Proc. Natl. Acad. Sci. USA 94:10931-10936.
Claims (8)
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US11/838,343 US7550138B1 (en) | 2006-08-14 | 2007-08-14 | Plasmodium mutant and vaccines including the mutant |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US82229706P | 2006-08-14 | 2006-08-14 | |
| US11/838,343 US7550138B1 (en) | 2006-08-14 | 2007-08-14 | Plasmodium mutant and vaccines including the mutant |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| US7550138B1 true US7550138B1 (en) | 2009-06-23 |
Family
ID=40765886
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US11/838,343 Expired - Fee Related US7550138B1 (en) | 2006-08-14 | 2007-08-14 | Plasmodium mutant and vaccines including the mutant |
Country Status (1)
| Country | Link |
|---|---|
| US (1) | US7550138B1 (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20070169209A1 (en) * | 2002-04-05 | 2007-07-19 | Hoffman Stephen L | Apparatuses and methods for the production of haematophagous organisms and parasites suitable for vaccine production |
| US20100093062A1 (en) * | 2007-03-20 | 2010-04-15 | University Of Maryland Biotechnology Institute | Transfection system for perkinsus species |
| US20110033502A1 (en) * | 2003-12-19 | 2011-02-10 | Kappe Stefan H I | Live genetically attenuated malaria vaccine |
| US8821896B2 (en) | 2009-01-16 | 2014-09-02 | Sanaria Inc. | Purified Plasmodium and vaccine composition |
| US9278125B2 (en) | 2011-05-11 | 2016-03-08 | Sanaria Inc. | Pharmaceutical compositions comprising attenuated Plasmodium sporozoites and glycolipid adjuvants |
| US9764016B2 (en) | 2013-01-25 | 2017-09-19 | Sanaria Inc. | Genetic attenuation of Plasmodium by B9 gene disruption |
-
2007
- 2007-08-14 US US11/838,343 patent/US7550138B1/en not_active Expired - Fee Related
Non-Patent Citations (56)
Cited By (14)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20070169209A1 (en) * | 2002-04-05 | 2007-07-19 | Hoffman Stephen L | Apparatuses and methods for the production of haematophagous organisms and parasites suitable for vaccine production |
| US8802919B2 (en) | 2002-04-05 | 2014-08-12 | Sanaria Inc. | Apparatuses and methods for the production of haematophagous organisms and parasites suitable for vaccine production |
| US20110033502A1 (en) * | 2003-12-19 | 2011-02-10 | Kappe Stefan H I | Live genetically attenuated malaria vaccine |
| US8168166B2 (en) | 2003-12-19 | 2012-05-01 | Seattle Biomedical Research Institute | Live genetically attenuated malaria vaccine |
| US20100093062A1 (en) * | 2007-03-20 | 2010-04-15 | University Of Maryland Biotechnology Institute | Transfection system for perkinsus species |
| US8992944B2 (en) | 2009-01-16 | 2015-03-31 | Sanaria Inc. | Purified Plasmodium and vaccine composition |
| US8821896B2 (en) | 2009-01-16 | 2014-09-02 | Sanaria Inc. | Purified Plasmodium and vaccine composition |
| US9241982B2 (en) | 2009-01-16 | 2016-01-26 | Sanaria Inc. | Purified plasmodium and vaccine compositions |
| US9616115B2 (en) | 2009-01-16 | 2017-04-11 | Sanaria Inc. | Purified plasmodium and vaccine compositions |
| US10272146B2 (en) | 2009-01-16 | 2019-04-30 | Sanaria Inc. | Purified plasmodium and vaccine compositions |
| US9278125B2 (en) | 2011-05-11 | 2016-03-08 | Sanaria Inc. | Pharmaceutical compositions comprising attenuated Plasmodium sporozoites and glycolipid adjuvants |
| US9642909B2 (en) | 2011-05-11 | 2017-05-09 | Sanaria Inc. | Pharmaceutical compositions comprising attenuated Plasmodium sporozoites and glycolipid adjuvants |
| US9764016B2 (en) | 2013-01-25 | 2017-09-19 | Sanaria Inc. | Genetic attenuation of Plasmodium by B9 gene disruption |
| US9931389B2 (en) | 2013-01-25 | 2018-04-03 | Sanaria Inc. | Genetic attenuation of plasmodium by B9 gene disruption |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Doolan et al. | DNA-based vaccines against malaria: status and promise of the Multi-Stage Malaria DNA Vaccine Operation | |
| Vaughan et al. | Genetically engineered, attenuated whole-cell vaccine approaches for malaria | |
| Doolan et al. | Multi-gene vaccination against malaria: a multistage, multi-immune response approach | |
| Annoura et al. | Assessing the adequacy of attenuation of genetically modified malaria parasite vaccine candidates | |
| Van Dijk et al. | Genetically attenuated, P36p-deficient malarial sporozoites induce protective immunity and apoptosis of infected liver cells | |
| Good et al. | Malaria vaccine design: immunological considerations | |
| Doolan et al. | Immune response to pre-erythrocytic stages of malaria parasites | |
| Sinnis et al. | Sporozoite antigens: biology and immunology of the circumsporozoite protein and thrombospondin-related anonymous protein | |
| Pasini et al. | Plasmodium knowlesi: a relevant, versatile experimental malaria model | |
| Friesen et al. | Comparative efficacy of pre-erythrocytic whole organism vaccine strategies against the malaria parasite | |
| Nlinwe et al. | T-cell responses against Malaria: Effect of parasite antigen diversity and relevance for vaccine development | |
| US7122179B2 (en) | Live genetically attenuated malaria vaccine | |
| Cai et al. | Whole-killed blood-stage vaccine: is it worthwhile to further develop it to control malaria? | |
| Doolan et al. | DNA vaccination as an approach to malaria control: current status and strategies | |
| Tsuji | A retrospective evaluation of the role of T cells in the development of malaria vaccine | |
| Tse et al. | Induction and maintenance of protective CD8+ T cells against malaria liver stages: implications for vaccine development | |
| US11529404B2 (en) | Doubly attenuated late liver stage malaria parasites and related compositions and methods | |
| US20110033502A1 (en) | Live genetically attenuated malaria vaccine | |
| Verma et al. | Malaria vaccines: Current developments and immunological insights | |
| US11524060B2 (en) | Attenuation system and use thereof | |
| Ogise et al. | Adjuvants in malaria vaccine development strategies: a review | |
| Sterile | Chemical Attenuation of | |
| Douradinha | Immunization with mutant Plasmodium parasites: How is that achieved? | |
| Scott et al. | Acquired immunity to intracellular protozoa | |
| against Infection et al. | Sporozoites with Plasmodium yoelii |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AS | Assignment |
Owner name: LEIDEN UNIVERSITY MEDICAL CENTER, NETHERLANDS Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:WATERS, ANDREW PAUL;JANSE, CHRISTOFEL JAN;VAN DIJK, MELISSA RUTH;AND OTHERS;REEL/FRAME:020235/0209;SIGNING DATES FROM 20071009 TO 20071130 Owner name: STICHTING KATHOLIEKE UNIVERSITEIT NIJMEGEN, MORE P Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:WATERS, ANDREW PAUL;JANSE, CHRISTOFEL JAN;VAN DIJK, MELISSA RUTH;AND OTHERS;REEL/FRAME:020235/0209;SIGNING DATES FROM 20071009 TO 20071130 |
|
| FEPP | Fee payment procedure |
Free format text: PAYOR NUMBER ASSIGNED (ORIGINAL EVENT CODE: ASPN); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY |
|
| STCF | Information on status: patent grant |
Free format text: PATENTED CASE |
|
| FPAY | Fee payment |
Year of fee payment: 4 |
|
| REMI | Maintenance fee reminder mailed | ||
| FPAY | Fee payment |
Year of fee payment: 8 |
|
| SULP | Surcharge for late payment |
Year of fee payment: 7 |
|
| FEPP | Fee payment procedure |
Free format text: MAINTENANCE FEE REMINDER MAILED (ORIGINAL EVENT CODE: REM.); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY |
|
| LAPS | Lapse for failure to pay maintenance fees |
Free format text: PATENT EXPIRED FOR FAILURE TO PAY MAINTENANCE FEES (ORIGINAL EVENT CODE: EXP.); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY |
|
| STCH | Information on status: patent discontinuation |
Free format text: PATENT EXPIRED DUE TO NONPAYMENT OF MAINTENANCE FEES UNDER 37 CFR 1.362 |
|
| FP | Lapsed due to failure to pay maintenance fee |
Effective date: 20210623 |