US7371539B2 - Targeted polypeptide degradation - Google Patents

Targeted polypeptide degradation Download PDF

Info

Publication number
US7371539B2
US7371539B2 US11/003,103 US310304A US7371539B2 US 7371539 B2 US7371539 B2 US 7371539B2 US 310304 A US310304 A US 310304A US 7371539 B2 US7371539 B2 US 7371539B2
Authority
US
United States
Prior art keywords
proteasome
degradation
polypeptide
fpr1
tor
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Lifetime
Application number
US11/003,103
Other versions
US20050152888A1 (en
Inventor
George M. Church
Daniel M. Janse
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Harvard University
Original Assignee
Harvard University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Harvard University filed Critical Harvard University
Priority to US11/003,103 priority Critical patent/US7371539B2/en
Publication of US20050152888A1 publication Critical patent/US20050152888A1/en
Assigned to PRESIDENT AND FELLOWS OF HARVARD COLLEGE reassignment PRESIDENT AND FELLOWS OF HARVARD COLLEGE ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: CHURCH, GEORGE M., JANSE, DANIEL M.
Application granted granted Critical
Publication of US7371539B2 publication Critical patent/US7371539B2/en
Assigned to UNITED STATES DEPARTMENT OF ENERGY reassignment UNITED STATES DEPARTMENT OF ENERGY CONFIRMATORY LICENSE (SEE DOCUMENT FOR DETAILS). Assignors: HARVARD UNIVERSITY
Anticipated expiration legal-status Critical
Expired - Lifetime legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62DNA sequences coding for fusion proteins
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/20Fusion polypeptide containing a tag with affinity for a non-protein ligand
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/95Fusion polypeptide containing a motif/fusion for degradation (ubiquitin fusions, PEST sequence)
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00Screening for compounds of potential therapeutic value
    • G01N2500/02Screening involving studying the effect of compounds C on the interaction between interacting molecules A and B (e.g. A = enzyme and B = substrate for A, or A = receptor and B = ligand for the receptor)

Definitions

  • ATP-dependent protease complexes degrade many unstable cellular proteins. These molecular machines function both generally in protein turnover, and specifically in the regulation of processes such as transcription, apoptosis, antigen presentation and cell cycle progression (Jesenberger et al. (2002) Nat. Rev. Mol. Cell Biol. 3:112). A high degree of conservation is evident among them; the archaebacterial and eukaryotic 20S proteolytic core particles share both sequence and structural homology (Bochtler et al. (1999) Ann. Rev. Biophys. Biomol. Struct. 28:295), while eubacteria have functionally related complexes: ClpYQ, ClpXP and ClpAP (Bochtler et al.
  • the 20S core particle (CP) is composed of four stacked heptameric rings structured in an ⁇ - ⁇ - ⁇ - ⁇ configuration. Access to the proteolytic central chamber is obstructed at both ends of the cylindrical assembly by N-terminal projections of the ⁇ -subunits, thus preventing uncontrolled proteolytic degradation (Groll et al. (1997) Nature 386:463; Whitby et al. (2000) Nature 408:115; Groll et al. (2000) Nat. Struct. Biol. 7:1062).
  • Eukaryotes have evolved an elaborate system that operates in conjunction with the proteasome to facilitate the temporal and specific regulation of intracellular proteolysis.
  • Substrates targeted for degradation by the proteasome pathway are recognized by the E1, E2, and E3 ubiquitin conjugation machinery and tagged with polyubiquitin chains, which are thought to promote the proteolytic process through their binding with the proteasome.
  • These three consecutively acting enzymes are necessary for target recognition, transfer of a ubiquitin moiety to the substrate, and subsequent elongation of the ubiquitin branched chain (Hershko et al. (1998) Ann. Rev. Biochem. 67:425).
  • E2 Ub-conjugating enzymes and E3 Ub-ligases allow for great specificity and flexibility in detecting a diverse range of substrates. Once a protein is polyubiquitinated, it can be recognized and degraded by the 26S proteasome.
  • the polyubiquitin chain is thought to play two possible roles. The first is to target the protein to the proteasome and the second is to initiate the process of degradation.
  • the targeting hypothesis is supported by the identification of several proteasome subunits that either bind or crosslink to ubiquitin chains (Deveraux et al. (1994) J. Biol. Chem. 269:7059; Lam et al. (2002) Nature 416:763). Hypotheses for how ubiquitin-dependent initiation of degradation might occur include: allosteric regulation, channel opening, and assistance in the unfolding of the target (Groll et al. (2003) Int. J. Biochem. Cell Biol. 35:606).
  • the present invention is based in part on the discovery that polypeptide degradation by a proteasome can occur independently of ubiquitination of the polypeptide. Pursuant to this discovery, localization of a substrate to the proteasome is sufficient for degradation to occur.
  • the present invention is further based on the discovery of compounds that can target a polypeptide for degradation by the proteasome by binding both the target polypeptide and the proteasome. It has been discovered that facilitating binding of a target polypeptide to the proteasome (via one or more small molecules that bind the proteasome and/or target polypeptide; dimerizing protein tags or modules; and the like) is sufficient to trigger proteasome-mediated degradation of the target polypeptide.
  • a polypeptide may be selectively targeted for degradation by the proteasome by providing compounds that allow the binding of the target polypeptide to the proteasome.
  • the present invention provides methods by which polypeptides may be localized to the proteasome and degraded independent of ubiquitin binding to the polypeptide. Such methods are useful for treating disorders associated with polypeptide (e.g., protein) expression and/or activity, as well as useful as research tools in the study of protein function, either alone or in the context of systems biology.
  • the present invention provides therapeutic methods and/or pharmaceutical compositions for treating disorders mediated by polypeptides by targeting these polypeptides for degradation.
  • the present invention provides a method and/or composition for therapeutic, targeted polypeptide degradation in a patient having a disorder associated with polypeptide expression and/or activity.
  • one or more proteasome-localizing agents are administered to a patient having a disorder associated with polypeptide (e.g., protein) expression and/or activity.
  • the proteasome-localizing agent binds both the polypeptide and the proteasome and allows degradation of the polypeptide by the proteasome.
  • the resulting degradation of the polypeptide results in the reduction or alteration of one or more symptoms of the disorder.
  • the proteasome-localizing agent is released from the proteasome to target another polypeptide for proteasome-mediated degradation.
  • the present invention also provides methods and/or compositions for selectively inactivating or activating pharmaceutical compounds.
  • the present invention provides a method and/or composition for inactivating a pharmaceutical compound (e.g., a therapeutic polypeptide) in a patient when the pharmaceutical compound is no longer needed by targeting the pharmaceutical compound for degradation by the proteasome.
  • a pharmaceutical compound e.g., a therapeutic polypeptide
  • one or more proteasome-localizing agents are administered to the patient.
  • a proteasome-localizing agent binds both the pharmaceutical compound and the proteasome, and allows degradation of the pharmaceutical compound by the proteasome, resulting in inactivation of the pharmaceutical compound.
  • the present invention provides a method and/or composition for activating a pharmaceutical compound.
  • the pharmaceutical compound in a patient is associated with a target polypeptide and rendered inactive.
  • a proteasome-localizing agent may be administered to the patient when activation of the therapeutic activity of the pharmaceutical compound is desired.
  • one or more proteasome-localizing agents are administered to the patient to bind both the target polypeptide associated with the pharmaceutical compound and the proteasome, thus allowing degradation of the target polypeptide by the proteasome. After degradation of the target polypeptide, the pharmaceutical compound is released from the proteasome in a therapeutically active form.
  • the present invention also provides tools and/or models for identifying compounds that mediate proteasome localization and/or polypeptide degradation.
  • compounds that mediate proteasome localization and/or polypeptide degradation are identified by assaying the ability of these compounds to mediate one or more activities associated with proteasome-mediated polypeptide degradation including, but not limited to: binding a proteasome; binding a polypeptide; binding a proteasome-localizing agent; binding a proteasome-localizing agent module; binding a polypeptide and a proteasome; and allowing proteasome-mediated degradation of a polypeptide independent of polypeptide ubiquitination.
  • another embodiment of the present invention is directed to methods of screening compounds useful for directing one or more of these activities using the screening assays described herein.
  • the present invention is directed to methods of using the tools and models described herein to study protein function, either alone or in the context of systems biology.
  • compounds are screened in vitro using the cell free assays described herein.
  • compounds are screened in vivo using the cells and/or organisms described herein.
  • the present invention further provides cells and/or organisms expressing one or more altered proteasome subunits expressing a proteasome-localizing agent or a portion thereof (e.g., a first module that interacts with a second module).
  • the cell and/or organism expresses a polypeptide that is associated with a proteasome-localizing agent or a portion thereof (e.g., a second module that interacts with a first module).
  • the cell and/or organism expresses both one or more altered proteasome subunits associated with a proteasome-localizing agent or a module thereof and a polypeptide associated with a proteasome-localizing agent or a module thereof.
  • a compound that increases or decreases the ability of two or more modules to interact with one another may be administered to the cell and/or organism to increase or decrease polypeptide degradation by the proteasome.
  • a cell is a eukaryotic cell such as Saccharomyces cerevisiae .
  • the organism is a transgenic animal such as a mouse.
  • FIG. 1 depicts a schematic of the experimental design for testing whether localization to the proteasome is sufficient for degradation.
  • One module of the heterodimerizing pair (Fpr1) is fused to the proteasome subunit.
  • the other module (Tor) is fused to a reporter protein. Heterodimerization of the modules occurs upon addition of the small molecule rapamycin. This brings the reporter protein into close proximity to the proteasome.
  • FIGS. 2A-2B depict fusion constructs.
  • A depicts the heterodimerizing module FPR1 genomically fused immediately downstream of each of the seven proteasome subunits in the strain DY001. Four of the derivative strains were viable.
  • B depicts reporter proteins having an N-terminal fusion of the heterodimerizing module Tor to the selective marker His3.
  • the non-heterodimerizing control reporter has an S1972R mutation in Tor that disrupts binding to the Fpr1-rapamycin complex.
  • FIGS. 3A-3E depict a screen for Fpr1-tagged proteasome strains that exhibit growth deficient phenotypes.
  • A illustrates that the DY001 control strain grows equally well when expressing either Tor-His3 or Tor S1972R -His3 in the presence or absence of rapamycin.
  • B illustrates that strains Rpn2-FPR1 and Rpt5-FPR1 show little or no difference in growth in the presence or absence of rapamycin.
  • D and (E) illustrate that strains Pre10-FPR1 and Rpn10-FPR1 show decreased growth when expressing Tor-His3, and spotted growth on media containing rapamycin.
  • FIGS. 4A-4H depict Tor-His3 degradation in vivo in the presence of rapamycin.
  • A depicts a 90 minute time course in which untagged strains grown in culture demonstrate no difference in degradation rates in the presence or absence of rapamycin.
  • B and (D) demonstrate that control reporter fusions in strains Pre10-FPR1 and Rpn10-FPR1 show no difference in the rate of degradation in the presence or absence of rapamycin.
  • C and E show that Tor-His3 expressed either in strain Pre10-FPR1 or strain Rpn10-FPR1 was rapidly degraded in the presence of rapamycin.
  • FIG. 1 graphically depicts Tor-His3 degradation in the presence or absence of rapamycin in strains Pre10-FPR1 and Rpn10-FPR1.
  • G and H show that addition of the proteasome inhibitor PS-341 prevented Tor-His3 from degrading in strain Pre10-FPR1 (G) and Rpn10-FPR1 (H), even in the presence of rapamycin.
  • PDR5 encodes a multi-drug resistance transporter that was knocked-out in strains Pre10-FPR1 and Rpn10-FPR1 for the purpose of the PS-341 experiments.
  • FIGS. 5A-5B depict Tor-His3 degradation in vitro in the presence of rapamycin.
  • A depicts a 60 minute time course that demonstrates the rapid degradation of purified Tor-His3 when mixed with Rpn10-FPR1-tagged, purified proteasome complexes in the presence of rapamycin. There was no appreciable degradation of the reporter using the mutant construct, untagged proteasome, tagged proteasome in the absence of rapamycin, or tagged proteasome in the presence of rapamycin and a proteasome inhibitor.
  • (B) graphically depicts Tor-His3 degradation in the presence or absence of rapamycin in experiments containing purified Rpn10-FPR1 proteasomes. Tor S1972R -His3 is labeled as S19-HIS3.
  • Embodiments of the present invention are directed to the discovery that localizing a protein to the proteasome independent of polyubiquitin chain addition results in protein degradation by the proteasome. Accordingly, the present invention provides the use of proteasome-localizing agents (e.g., small molecules, heterodimerizing modules and the like) that can localize polypeptides to the proteasome in order to promote their degradation.
  • proteasome-localizing agents e.g., small molecules, heterodimerizing modules and the like
  • protein degradation and “polypeptide degradation” include, but are not limited to, cleavage of a protein or polypeptide, respectively, into fragments or peptide substituents. Protein degradation can be mediated by one or more subunits of a proteasome.
  • polypeptide is intended to include, but is not limited to, peptides that are ten or 100 or more amino acids in length, as well as proteins and portions of proteins.
  • the present invention provides a novel approach to protein therapeutics using targeted protein and/or targeted polypeptide degradation.
  • targeted protein degradation and “targeted polypeptide degradation” are intended to include, but are not limited to, targeting proteins or polypeptides, respectively to the proteasome for degradation.
  • the current paradigm in screening small molecule libraries is to find inhibitors of enzymatic processes that are causal in disease.
  • the number of small molecules that both specifically bind to, and inhibit the function of a polypeptide i.e., via inhibiting one or more active sites is extremely small.
  • compounds that inhibit the active site of a targeted protein and/or polypeptide may also exhibit undesirable cross-reactivity with active sites of one or more non-targeted proteins and/or polypeptides.
  • Compounds that target proteins and/or polypeptides to the proteasome could help limit the degree of this kind of cross-reactivity.
  • Targeted protein and/or polypeptide degradation is also useful for developing catalytic therapeutic agents.
  • a therapeutic agent of the present invention targets a specific polypeptide to the proteasome for degradation. After degradation, the agent is released and available to target another polypeptide to the proteasome for degradation. This could allow for lower doses of the agent to be used therapeutically, resulting in lower costs and less side effects.
  • the present invention also provides methods and compositions for modulating (i.e., increasing or decreasing) one or more activities of the polypeptides, compounds and/or proteasome-localizing agents described herein.
  • the present invention provides methods and compositions for controlling selective degradation of therapeutic polypeptides (e.g., protein-based therapeutic compositions) when they are no longer needed for therapy, and for activating therapeutic compounds via proteasome-mediated degradation.
  • a modulatory method of the invention involves contacting a cell with an agent that promotes targeting to the proteasome and/or promotes polypeptide degradation.
  • Methods of modulating targeting to the proteasome and/or polypeptide degradation can be performed in vitro (e.g., by culturing a cell with the agent or using a cell-free proteasome assay) or, alternatively, in vivo (e.g., by administering the agent to a subject, such as a transgenic animal described herein).
  • the present invention provides methods of treating an individual afflicted with a polypeptide-associated disease or disorder.
  • the method involves administering an agent (e.g., an agent identified by a screening assay described herein), or combination of agents that promotes targeting to the proteasome and/or polypeptide degradation.
  • Another embodiment of the present invention is directed to a method for treatment of a disease or disorder associated with the expression and/or activity of one or more polypeptides which includes the step of administering a therapeutically effective amount of an agent which increases degradation of the polypeptide(s) and/or targeting to the proteasome.
  • a therapeutically effective amount of agent i.e., an effective dosage
  • treatment of a subject with a therapeutically effective amount of an agent can include a single treatment or, preferably, can include a series of treatments. It will also be appreciated that the effective dosage of in used for treatment may increase or decrease over the course of a particular treatment. Changes in dosage may result from the results of diagnostic assays as described herein.
  • a disorder associated with the expression and/or activity of a polypeptide includes a disorder, disease or condition which is caused or characterized by a misregulation (e.g., upregulation) of a polypeptide.
  • Polypeptide-associated disorders can detrimentally affect cellular functions including, but not limited to, cellular proliferation, growth, differentiation, or migration, inter- or intra-cellular communication, tissue function, systemic responses in an organism, susceptibility to pathogenic infections, immune responses, and protection of cells from toxic compounds (e.g., carcinogens, toxins, or mutagens).
  • the proteasome-localizing agents disclosed herein can be used in the treatment of polypeptide-associated disorders such as cellular proliferative disorders, (e.g., cancer). Treatment of cellular proliferative disorders is intended to include inhibition of proliferation including rapid proliferation.
  • cellular proliferative disorder includes disorders characterized by undesirable or inappropriate proliferation of one or more subset(s) of cells in a multicellular organism.
  • cancer refers to various types of malignant neoplasms, most of which can invade surrounding tissues, and may metastasize to different sites (see, for example, PDR Medical Dictionary 1st edition (1995)).
  • abnormal tissue refers to an abnormal tissue that grows by cellular proliferation more rapidly than normal and continues to grow after the stimuli that initiated proliferation is removed (see, for example, PDR Medical Dictionary 1st edition (1995)).
  • abnormal tissue shows partial or complete lack of structural organization and functional coordination with the normal tissue which may be either benign (i.e., benign tumor) or malignant (i.e., malignant tumor).
  • treatment of cellular proliferative disorders is intended to include the prevention of the growth of neoplasms in a subject or a reduction in the growth of pre-existing neoplasms in a subject.
  • the inhibition also can be the inhibition of the metastasis of a neoplasm from one site to another.
  • Cellular proliferative disorders can further include disorders associated with hyperproliferation of vascular smooth muscle cells such as proliferative cardiovascular disorders, e.g., atherosclerosis and restinosis.
  • Cellular proliferation disorders can also include disorders such as proliferative skin disorders, e.g., X-linked ichthyosis, psoriasis, atopic dermatitis, allergic contact dermatitis, epidermolytic hyperkeratosis, and seborrheic dermatitis.
  • Cellular proliferative disorders can further include disorders such as autosomal dominant polycystic kidney disease (ADPKD), mastocystosis, and cellular proliferation disorders caused by infectious agents such as viruses.
  • ADPKD autosomal dominant polycystic kidney disease
  • mastocystosis cellular proliferation disorders caused by infectious agents such as viruses.
  • the proteasome-localizing agents disclosed herein can be used in the treatment of disorders associated with pathogen infection.
  • Disorders associated with infection by pathogens include, but are not limited to, infection by viruses (DNA viruses, RNA viruses, animal viruses, and the like), bacteria (e.g., gram positive bacteria, gram negative bacteria, acid-fast bacteria, and the like), fungi, parasitic microbes and the like.
  • Proteasome-localizing agents disclosed herein are also useful for treating disorders associated with aberrant peptide folding and/or aberrant peptide degradation.
  • disorders include, but are not limited to, cellular proliferation disorders, prion diseases (e.g., scrapie, Creutzfeldt-Jakob disease, Gerstmann-Strassler Scheinker disease, bovine spongiform encephalopathy and the like) Alzheimer's disease, Parkinson's disease, Huntington's disease, type II diabetes, cystic fibrosis, emphysema, spinocerebellar ataxia, ⁇ -1-antitrypsin deficiency, and the like.
  • prion diseases e.g., scrapie, Creutzfeldt-Jakob disease, Gerstmann-Strassler Scheinker disease, bovine spongiform encephalopathy and the like
  • Alzheimer's disease Parkinson's disease, Huntington's disease, type II diabetes, cystic fibrosis
  • Agents and/or compounds that affect proteasome targeting and/or polypeptide degradation can be incorporated into pharmaceutical compositions suitable for administration.
  • Such compositions typically comprise the modulatory agent(s) and a pharmaceutically acceptable carrier.
  • pharmaceutically acceptable carrier is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration.
  • the use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the compositions is contemplated. Supplementary active compounds can also be incorporated into the compositions.
  • solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide.
  • the parenteral preparation can be enclosed in ampules, disposable syringes or multiple dose vials made of glass or plastic.
  • compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion.
  • suitable carriers include physiological saline, bacteriostatic water, CREMOPHOR ELTM (BASF, Parsippany, N.J.), or phosphate buffered saline (PBS).
  • the composition must be sterile and should be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi.
  • the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyetheylene glycol, and the like), and suitable mixtures thereof.
  • the proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
  • Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like.
  • isotonic agents for example, sugars, polyalcohols such as manitol, sorbitol, sodium chloride in the composition.
  • Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.
  • Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization.
  • dispersions are prepared by incorporating the active compound into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above.
  • the preferred methods of preparation are vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
  • Oral compositions generally include an inert diluent or an edible carrier. They can be enclosed in gelatin capsules or compressed into tablets. For the purpose of oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules. Oral compositions can also be prepared using a fluid carrier for use as a mouthwash, wherein the compound in the fluid carrier is applied orally and swished and expectorated or swallowed. Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of the composition.
  • the tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.
  • a binder such as microcrystalline cellulose, gum tragacanth or gelatin
  • an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch
  • a lubricant such as magnesium stearate or Sterotes
  • a glidant such as colloidal silicon dioxide
  • the active compounds are prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems.
  • a controlled release formulation including implants and microencapsulated delivery systems.
  • Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art. The materials can also be obtained commercially from Alza Corporation and Nova Pharmaceuticals, Inc.
  • Liposomal suspensions (including liposomes targeted to infected cells with monoclonal antibodies to viral antigens) can also be used as pharmaceutically acceptable carriers. These may be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811.
  • the invention provides a method (also referred to herein as a “screening assay”) for identifying modulators of proteasome targeting and/or polypeptide degradation, i.e., candidate or test compounds or agents (e.g., peptides, cyclic peptides, peptidomimetics, small molecules, small organic molecules, or other drugs) which promote targeting to the proteasome and/or the degradation of a target polypeptide (e.g., polypeptides that contribute to disease, therapeutic polypeptides and the like).
  • candidate or test compounds or agents e.g., peptides, cyclic peptides, peptidomimetics, small molecules, small organic molecules, or other drugs
  • a target polypeptide e.g., polypeptides that contribute to disease, therapeutic polypeptides and the like.
  • Candidate or test compounds or agents that promote targeting to the proteasome and/or degradation of a polypeptide include, but are not limited to, proteasome-localizing agents.
  • Proteasome-localizing agents may comprise two or more modules that interact (e.g., modules that form dimers, trimers, tetramers and the like) to target a polypeptide to a proteasome, or may comprise individual agents or compounds that target a polypeptide to a proteasome.
  • bind As used herein, the terms “bind,” “binding,” “interact,” “interacting,” “associated with” are intended to include, but are not limited to, covalent and noncovalent interactions.
  • a covalent interaction is a chemical linkage between two atoms or radicals formed by the sharing of a pair of electrons (i.e., a single bond), two pairs of electrons (i.e., a double bond) or three pairs of electrons (i.e., a triple bond).
  • Covalent interactions are also known in the art as electron pair interactions or electron pair bonds. Noncovalent interactions are much weaker than covalent interactions, but play a major role in determining the three-dimensional structure of macromolecular structures.
  • Noncovalent interactions include, but are not limited to, van der Waals interactions, hydrogen bonds, weak chemical bonds (i.e., via short-range noncovalent forces), hydrophobic interactions, ionic bonds and the like.
  • van der Waals interactions hydrogen bonds
  • weak chemical bonds i.e., via short-range noncovalent forces
  • hydrophobic interactions ionic bonds and the like.
  • small organic molecule refers to an organic molecule, either naturally occurring or synthetic, that has a molecular weight of more than about 25 daltons and less than about 3000 daltons, preferably less than about 2500 daltons, more preferably less than about 2000 daltons, preferably between about 100 to about 1000 daltons, more preferably between about 200 to about 500 daltons.
  • the invention provides assays for screening candidate or test compounds which modulate polypeptide degradation via the proteasome.
  • the test compounds of the present invention can be obtained using any of the numerous approaches in combinatorial library methods known in the art, including: biological libraries; spatially addressable parallel solid phase or solution phase libraries; synthetic library methods requiring deconvolution; the “one-bead one-compound” library method; and synthetic library methods using affinity chromatography selection.
  • the biological library approach is limited to peptide libraries, while the other four approaches are applicable to peptide, non-peptide oligomer or small molecule libraries of compounds (Lam, K. S. (1997) Anticancer Drug Des. 12:145).
  • test compounds of the invention include dimerizing modules comprising a first module and a second module that bind to one another to form a dimeric (e.g., heterodimeric) compound.
  • a first module binds a polypeptide to be targeted to the proteasome and second module binds the proteasome.
  • the targeted polypeptide is degraded by the proteasome.
  • modules that bind to proteasomes include, but are not limited to: proteasome binding molecules that do not inhibit the proteasome; analogs of the Ubiquitin/Ubl helix motif that bind to the proteasome (Mueller et al. (2003) EMBO J. 22:4634); and the like.
  • modules are screened separately.
  • a module that binds a proteasome can be chemically crosslinked to a module that binds a target polypeptide to form a heterodimeric compound that localizes the target polypeptide to the proteasome.
  • crosslinking compounds can be used to increase the screening efficiency by increasing the effective search space for small molecule dimerizers by the square of the size of the library, which for a 10,000 member screen, is approximately 1 ⁇ 10 5 -fold.
  • Crosslinkers are well known in the art and are commercially available from companies such as Pierce Biotechnology, Inc. (Rockford, Ill.).
  • an organism-based assay provides an organism for screening compounds that target polypeptides to the proteasome for degradation to identify novel therapeutic compounds.
  • Useful organisms include yeast such as Saccharomyces cerevisiae , and mammals such as non-human primates, rabbits, rats, mice, and the like and transgenic species thereof. Polypeptide degradation can be assayed using a variety of techniques known to those of skill in the art.
  • an organism-based screening assay provides an organism that expresses one or more target proteins and/or polypeptides expressing a tag that binds to a proteasome.
  • the tag i.e., an epitope tag such as hemagglutinin (HA), c-myc or TAP
  • HA hemagglutinin
  • c-myc or TAP hemagglutinin
  • TAP hemagglutinin
  • compounds that bind both to the tag and the proteasome can be used.
  • the target protein and/or polypeptide is bound to a monoclonal antibody conjugated to a compound that binds a proteasome.
  • this assay is useful for designing modulated compounds or tags (i.e., increasing or decreasing the ability of the compound or tag to direct protein and/or polypeptide degradation and/or changing the protein and/or polypeptide binding specificity of the compound or tag).
  • transgenic non-humans animals can be produced which contain selected systems which allow for regulated expression of the transgene.
  • a system is the cre/loxP recombinase system of bacteriophage P1.
  • cre/loxP recombinase system of bacteriophage P1.
  • a recombinase system is the FLP recombinase system of S. cerevisiae (O'Gorman et al. (1991) Science 251:1351).
  • mice containing transgenes encoding both the Cre recombinase and a selected protein are required.
  • Such animals can be provided through the construction of “double” transgenic animals, e.g., by mating two transgenic animals, one containing a transgene encoding a selected protein and the other containing a transgene encoding a recombinase.
  • the present invention also provides cell-based screening assays for screening compounds that target polypeptides to the proteasome for degradation to identify novel therapeutic compounds.
  • a cell for use in a cell-based screening assay can be derived from the animal models described herein.
  • cells of the present invention are eukaryotic cells such as S. cerevisiae cells, insect cells, Xenopus cells, or mammalian cells (such as Chinese hamster ovary cells (CHO), African green monkey kidney cells (COS), fetal human cells (293T) and the like). Other suitable host cells are known to those skilled in the art.
  • the present invention further provides cell-free assays in which a proteasome and a target protein, polypeptide or biologically active portion thereof, is contacted with a test compound, and the ability of the test compound to modulate proteasome binding and/or degradation of the target protein, polypeptide or biologically active portion thereof, is determined.
  • This invention further pertains to novel agents identified by the above-described screening assays. Accordingly, it is within the scope of this invention to further use an agent identified as described herein in an appropriate animal model as described herein. For example, an agent identified as described herein can be used in an animal model to determine the efficacy, toxicity, or side effects of treatment with such an agent. Alternatively, an agent identified as described herein can be used in an animal model to determine the mechanism of action of such an agent. Furthermore, this invention pertains to uses of novel agents identified by the above-described screening assays for treatments of disorders associated with protein and/or polypeptide expression.
  • the present invention further provides systems for elucidating polypeptide function.
  • the assays and compounds described herein are used to target a specific polypeptide in a cell or in an organism to the proteasome for degradation.
  • the function(s) of the protein and/or polypeptide may then be determined by assaying responses of the cell or the organism to the absence of the polypeptide.
  • the assays described herein are advantageous over many knockout systems known in the art because they allow a high degree of regulation. For example, the target polypeptide may be degraded at various time points during development.
  • the target polypeptide may also be degraded to various degrees ranging from 100% of the polypeptide degraded, to 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5% or less of the polypeptide degraded.
  • Multiple polypeptides may also be degraded in a single cell or organism at the same time or at various time points. Multiple polypeptides may further be degraded in a single cell or organism to various degrees relative to one another.
  • the present invention provides organism-based assays for determining the function of a polypeptide in vivo.
  • the invention provides an organism that expresses a proteasome fused to a first module (i.e., a first portion of a dimerizing module), and a target protein and/or polypeptide fused to a second module (i.e., a second portion of a dimerizing module), wherein the first and second modules interact upon exposure to a particular compound (i.e., a heterodimerizer) to form a dimeric module.
  • the first and second modules may interact to form a dimer without exposure to a particular compound (i.e., a heterodimerizer).
  • Module-module interactions can direct localization of the target polypeptide to a proteasome as well as the proteasome-mediated degradation of the target polypeptide. In another embodiment, only the proteasome or the target polypeptide is fused to a module. In one aspect, the organism-based assays and/or compounds described herein can be used to mediate targeted polypeptide degradation to determine the function of a polypeptide in vivo.
  • heterodimerizers include, but are not limited to: FK-506 (Ho et al. (1996) Nature 382:822); FK-506-cyclosporin A (Belshaw et al. (1996) Proc. Natl. Acad. Sci. USA 93:4604); aptamers (Colas et al. (2000) Proc. Natl. Acad. Sci. USA 97:13720); coumermycin (Farrar et al. (1996) Nature 383:178); bismethotrexate (2000) Chem. and Biol. 7:313); dexamethasone-methotrexate (Lin et al. (2000) J. Am. Chem. Soc.
  • RNA-protein binder Hardvey et al. (2002) Proc. Natl. Acad. Sci. U.S.A. 99:1882); rapamycin derivatives (Liberles et al. (1997) Proc. Natl. Acad. Sci. U.S.A. 94:7825); and the like. These references are incorporated herein by reference in their entirety.
  • a host cell of the invention is a fertilized oocyte or an embryonic stem cell into which a modified proteasome sequence and/or proteasome-targeted protein or polypeptide has been introduced.
  • host cells can then be used to create non-human transgenic animals in which exogenous proteasome, protein and/or polypeptide sequences have been introduced into their genome.
  • Such animals are useful for studying proteasome targeting and for identifying and/or evaluating compounds that target polypeptides and/or proteins to the proteasome.
  • a “transgenic animal” is a non-human animal, e.g., a mammal such as a rodent, for example, a rat or mouse, in which one or more of the cells of the animal includes a transgene.
  • Other examples of transgenic animals include non-human primates, sheep, dogs, cows, goats, chickens, amphibians, etc.
  • a transgene is exogenous DNA which is integrated into the genome of a cell from which a transgenic animal develops and which remains in the genome of the mature animal, thereby directing the expression of an encoded gene product in one or more cell types or tissues of the transgenic animal.
  • a “homologous recombinant animal” is a non-human animal, e.g., a mammal such as a mouse, in which an endogenous gene has been altered by homologous recombination between the endogenous gene and an exogenous DNA molecule introduced into a cell of the animal, e.g., an embryonic cell of the animal, prior to development of the animal.
  • a transgenic animal of the invention can be created by introducing a nucleic acid (i.e., a transgene) encoding a proteasome or a portion thereof, a protein of interest or a polypeptide of interest into the male pronuclei of a fertilized oocyte, e.g., by microinjection, retroviral infection, and allowing the oocyte to develop in a pseudopregnant female foster animal.
  • Intronic sequences and polyadenylation signals can also be included in the transgene to increase the efficiency of expression of the transgene.
  • a tissue-specific regulatory sequence(s) can be operably linked to a detectable translation product transgene to direct expression of a detectable translation product to particular cells.
  • transgenic founder animal can be identified based upon the presence of a detectable translation product transgene in its genome and/or expression of detectable translation product mRNA in tissues or cells of the animals. A transgenic founder animal can then be used to breed additional animals carrying the transgene. Moreover, transgenic animals carrying a transgene encoding a detectable translation product can further be bred to other transgenic animals carrying other transgenes.
  • a vector which contains at least a portion of a transgene.
  • the vector is designed such that, upon homologous recombination, the endogenous gene is functionally disrupted (i.e., no longer encodes a functional protein; also referred to as a “knock out” vector).
  • the vector can be designed such that, upon homologous recombination, the endogenous gene is mutated or otherwise altered but still encodes functional protein (e.g., the upstream regulatory region can be altered to thereby alter the expression of the endogenous protein).
  • the altered portion of the gene is flanked at its 5′ and 3′ ends by additional nucleic acid sequence of the gene to allow for homologous recombination to occur between the exogenous gene carried by the vector and an endogenous gene in an embryonic stem cell.
  • the additional flanking nucleic acid sequence is of sufficient length for successful homologous recombination with the endogenous gene.
  • flanking DNA both at the 5′ and 3′ ends
  • cells 51:503 for a description of homologous recombination vectors.
  • the vector is introduced into an embryonic stem cell line (e.g., by electroporation) and cells in which the introduced gene has homologously recombined with the endogenous gene are selected (see e.g., Li, E. et al. (1992) Cell 69:915).
  • the selected cells are then injected into a blastocyst of an animal (e.g., a mouse) to form aggregation chimeras (see e.g., Bradley, A. in Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, E. J. Robertson, ed. (IRL, Oxford, 1987) pp. 113-152).
  • a chimeric embryo can then be implanted into a suitable pseudopregnant female foster animal and the embryo brought to term.
  • Progeny harboring the homologously recombined DNA in their germ cells can be used to breed animals in which all cells of the animal contain the homologously recombined DNA by germline transmission of the transgene.
  • Methods for constructing homologous recombination vectors and homologous recombinant animals are described further in Bradley, A.
  • Clones of the non-human transgenic animals described herein can also be produced according to the methods described in Wilmut, I. et al. (1997) Nature 385:810.
  • a cell e.g., a somatic cell
  • a cell e.g., an embryonic stem cell
  • a cell e.g., a somatic cell
  • cell culture line can be transformed with a preferred transgene and induced to exit the growth cycle and enter G 0 phase.
  • the cell can then be fused, e.g., through the use of electrical pulses, to an enucleated mammalian oocyte.
  • the reconstructed oocyte is then cultured such that it develops to morula or blastocyst and then transferred to pseudopregnant female foster animal.
  • the offspring borne of this female foster animal will be a clone of the animal from which the nuclear donor cell, e.g., the somatic cell, is isolated.
  • Vector DNA can be introduced into cells via conventional transformation or transfection techniques.
  • transformation and “transfection” are intended to refer to a variety of art-recognized techniques for introducing foreign nucleic acid (e.g., DNA) into a host cell, including calcium phosphate or calcium chloride co-precipitation, DEAE-dextran-mediated transfection, lipofection, or electroporation. Suitable methods for transforming or transfecting host cells can be found in Sambrook, et al. (Molecular Cloning: A Laboratory Manual. 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989), and other laboratory manuals.
  • a gene that encodes a selectable marker (e.g., resistance to antibiotics) is generally introduced into the host cells along with the gene of interest.
  • selectable markers include those which confer resistance to drugs, such as G418, hygromycin and methotrexate.
  • Nucleic acid encoding a selectable marker can be introduced into a host cell on the same vector as that encoding a detectable translation product or can be introduced on a separate vector. Cells stably transfected with the introduced nucleic acid can be identified by drug selection (e.g., cells that have incorporated the selectable marker gene will survive, while the other cells die).
  • Chemical inducers of dimerization are a class of reagents that facilitate the regulated association of any two polypeptides. They have been used in a number of applications such as localization of proteins to subcellular domains, triggering of signal transduction cascades, and control of gene expression (Kopytek et al. (2000) Chem. Biol. 7:313; Spencer et al. (1993) Science 262:1019; Ho et al. (1996) Nature 382:822; Farrar et al. (1996) Nature 383:178; Belshaw et al. (1996) Proc. Natl. Acad. Sci. U.S.A. 93:4604; Rivera et al. (1996) Nat. Med. 2:1028).
  • strain subunit-FPR1 FPR1-tagged Rpt2, Rpn6 and Rpn11 subunits
  • a gradient growth assay was used to screen the viable strains containing Fpr1-tagged proteasome subunits to identify degradation-through-localization (DTL) candidates.
  • the auxotrophic marker HIS3 encodes a protein involved in histidine biosynthesis, and is necessary for growth on histidine-dropout media.
  • Each Fpr1-tagged strain used in this assay had its chromosomal copy of HIS3 deleted and, therefore, required expression of exogenous functional His3 for growth.
  • Two reporter constructs were designed for use in the screen.
  • the reporter Tor-His3 is an amino-terminal fusion of the heterodimerizing module Tor with full length His3 ( FIG. 2B ).
  • the control reporter Tor S1972R -His3 replaced wild-type Tor with a missense mutant protein that has a decreased affinity for the rapamycin-Fpr1 complex (Heitman et al. (1991) Science 253:905).
  • the aforementioned growth assay was a convenient tool for isolating strains to further explore DTL. Use of the growth assay on its own did not prove that localization was sufficient for degradation since His3 function could have been compromised in a rapamycin-dependent, but degradation-independent manner. To address this point, degradation of the reporters was directly measured.
  • Strains Pre10-FPR1 and Rpn10-FPR1 were singly transformed with plasmids that expressed hemagglutinin (HA) epitope-tagged versions of Tor-His3 and Tor S1972R -His3. The transformants were grown in liquid culture to early log phase, whereupon cycloheximide was added to halt protein translation.
  • HA hemagglutinin
  • FIGS. 4A-4H Each culture was then split in two and rapamycin was added to one. Samples were collected at various times and whole-cell protein extracts were generated and used for Western analysis ( FIGS. 4A-4H ). Both strains Pre10-FPR1 and Rpn10-FPR1 displayed an increase in the rate of degradation of the reporter Tor-His3 when rapamycin was added to the cultures, with half-lives of approximately 20-30 minutes ( FIG. 4B ). No difference in the rate of degradation was observed with Fpr1-tagged strains expressing the mutant reporter Tor S1972R -His3. To demonstrate that degradation of the reporter was mediated by the proteasome and not processed through other pathways, the experiments were repeated with the addition of the proteasome inhibitor PS-341 ( FIG.
  • the system presented herein will be converted into a generalized method for the facile construction of conditional protein knockdowns in S. cerevisiae .
  • Fusing the Tor module to endogenous proteins of choice in an Rpn10-FPR1 background will permit rapamycin-dependent control of degradation.
  • the estimated 20-30 minutes half-lives of the target proteins will compare favorably with established high-throughput knockdown methods such as RNA interference and promoter shutoff assays (Fire et al. (1988) Nature 391:806; Baron et al. (2000) Methods Enzymol. 327:401).
  • RNA interference and promoter shutoff assays seere et al. (1988) Nature 391:806; Baron et al. (2000) Methods Enzymol. 327:401.
  • One advantage of the present system over both technologies is that the system described herein will directly target proteins and/or polypeptides for degradation, whereas the other systems affect RNA levels and are therefore dependent on the targets' natural half-live
  • a mouse model will be used to develop an adaptor molecule that is capable of binding to the proteasome in mammalian systems as well as a protein and/or peptide of interest. This molecule will thus target the peptide and/or protein for degradation without the need for modification of the proteasome.
  • Such a model will be useful for screening for compounds that increase target protein localization to the proteasome and/or degradation and, accordingly, will be useful for the development of therapeutic compounds for treating disorders associated with protein expression and/or activity (e.g., promote localization to the proteasome).
  • protein-based and/or polypeptide-based drugs whose activity can be regulated in a temporal-specific manner (e.g., activated or deactivated when it is desirable to do so) by means of localization to the proteasome and/or degradation. It will also be useful as a research tool for the study of protein function in the context of systems biology.
  • Tagging of proteasome subunits was performed both by homologous recombination of linear fragments containing 40 bp of flanking homology to the target site[i] and by two-step integration with a non-replicating plasmid[ii].
  • FPR1 was amplified by PCR from the strain FY4 (Winston et al. (1995) Yeast 11:53) and subcloned into the plasmid pUG-spHIS5 (Wach et al. (1997) Yeast 13:1065) with a C-terminal HA-tag, forming FPR1-HA-pUG-spHIS5. Integration primers pairs were designed for tagging each of the four proteasome subunits (PRE10, RPN2, RPN6, RPN11).
  • one primer contained 40 bp of genomic homology to the 3′ end of the proteasome subunit, excluding the stop codon, and 20 bp of homology to the 5′ of FPR1 on pUG-spHIS5, excluding ATG.
  • the second primer contained 40 bp of genomic homology approximately 50 bp downstream of the proteasome subunit gene stop codon and 20 bp of homology to pUG-spHIS5 immediately downstream of the spHIS5 marker flanked by loxP sites.
  • Two confirmatory primers were also designed that flanked the integration site of each proteasome subunit.
  • Strain DY001 was transformed with pSH47, a plasmid with a galactose-inducible cre gene and a URA3 selection marker (Guldener et al. (1996) Nucleic Acids Res. 24:2519).
  • a 2 kb linear fragment from FPR1-HA-pUG-spHIS5 was amplified using each integration primer pair to generate linear 2 kb fragments suitable for genomic integration. 15 ⁇ g of each fragment was transformed into DY001 carrying pSH47 and selection was performed on SC-URA-HIS. Colonies were then picked and streaked onto SC-URA GAL to induce cre and to select for the loopout of the spHIS5 marker. Colonies were finally streaked onto a 5-fluoroorotic acid containing plate to remove pSH47. All tagged subunits were verified by sequencing.
  • ⁇ pdr5 strains were generated by recombination of a URA3 marker flanked by 40 bp homologous to sequence immediately 5′ and 3′ to genomic PDR5.
  • TOR1(S1972R) is an allele of TOR1 that has a severely impaired binding affinity to FPR1-rapamycin (Heitman et al. (1991) Science 253:905).
  • the sequence corresponding to amino acids 1883-2078 for both Tor1 and Tor1 (S1972R) were amplified and inserted into the vector pRS415 along with HIS3 amplified from strain FY4.
  • HA-tagged versions of the reporters had the hemagglutinin epitope fused C-terminal to His3.
  • rapamycin was added to a final concentration of 1 ⁇ M
  • cycloheximide was added to a final concentration of 30 ng/ml
  • PS-341 was added to a final concentration of 200 ⁇ M.
  • samples were extracted at fixed time intervals (0, 30, 60, 90 minutes) and whole cell extracts were made. 25 ⁇ g of total protein was used from each sample, resolved by SDS-PAGE and transferred to PVDF membranes.
  • Membranes were blocked with 10% powdered nonfat milk in PBST overnight at 4° C. and incubated with anti-HA (3F10) primary antibody (Roche Diagnostics, Indianapolis, Ind.), then HP-conjugated anti-rat secondary antibody. Visualization was done using the ECL Western Blotting system (Amersham Biosciences, Piscataway, N.J.).
  • 26S proteasomes were affinity purified from strains Pre10-FPR1 and Rpn10 FPR1 using the Rpn11-TEV-ProA tag described previously (Leggett et al. (2002) Mol. Cell 10:495). Cells were grown in YPD, harvested, resuspended in 50 mM Tris-HCl [pH 8], 1 mM EDTA and lysed by French press. Lysates was centrifuged at 15,000 ⁇ g for 25 minutes, filtered and incubated with IgG resin (ICN) for 1 hr at 4° C.
  • ICN IgG resin
  • Resin was collected in a column, washed with 100 bed volumes of 50 mM Tris-HCl [pH 8], 50 mM NaCl, 1 mM EDTA buffer and equilibrated with TEV-protease buffer (50 mM Tris-HCl [pH 7.5], 1 mM EDTA, 1 mM DTT). Elution was performed by incubating the resin in 1.5 bed volumes of TEV-protease buffer containing 50 U of 6 His-TEV-protease per ml of resin, at 30° C. for 1 hour. One single homogeneous fraction was collected and aliquoted for each prep. The integrity of the 26S complexes and presence of Pre10-FPR1 and Rpn10-FPR1 tagged subunits was analyzed by Coomassie staining, SDS-PAGE and immunodetection.
  • HA-tagged TOR-HIS3 and TOR S1972R -HIS3 were cut out of their respective pRS415 vectors, inserted into PROTet.133 and transformed into DH5 ⁇ PRO cells (BD Biosciences).
  • a 10 ml overnight culture was used to inoculate 1 L of media, which was subsequently growth for 4 hours at 37° C.
  • the fusion protein production was induced with 100 ng/ml of anhydrotetracycline and the culture was growth for four hours at 30° C. Isolation of purified protein was done according to the manufacturers instructions, using a bead bed volume of 250 ⁇ l.
  • Plasmid pUG-spHIS5-FPR1HA was used to create strain Pre10-FPR1 by double homologous recombination of a linear amplified PCR product. Plasmid pRS306-Rpn10-FPR1 was cut with KasI and used to create strain Rpn10-FPR1 by two-step integration.
  • P415-TOR-HIS3 TCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGA (SEQ ID NO:1) GACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAG GGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCAT CAGAGCAGATTGTACTGAGAGTGCACCATATCGACTACGTCGTAAGGCCGTT TCTGACAGAGTAAAATTCTTGAGGGAACTTTCACCATTATGGGAAATGGTTC AAGAAGGTATTGACTTAAACTCCATCAAATGGTCAGGTCATTGAGTGTTTTTTTTTTTT ATTTGTTGTATTTTTTTTTTTTTAGAGAAAATCCTCCAATATCAAATTAGGAAT CGTAGTTTCATGATTTTCTGTTACACCTAACTTTTTGTGTGGTGCCCTCCTCCT TGTCAATATTAATGTTAAAGTGCAATTCTTTCTGTTACACCTAACTTTTTGTGTGGTGCC
  • TOR-link-HIS3HA was excised from p415-TOR-link-HIS3HA using BamHI and PvuI, and then cloned into PROTet.e133.

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Peptides Or Proteins (AREA)

Abstract

This invention pertains to compositions, methods, cells and organisms useful for selectively localizing polypeptides to the proteasome for degradation. Therapeutic methods and pharmaceutical compositions for treating disorders associated with the expression and/or activity of a polypeptide by targeting these polypeptides for degradation, as well as methods for targeting therapeutic polypeptides for degradation and/or activating therapeutic polypeptides by degradation are provided. The invention provides methods for identifying compounds that mediate proteasome localization and/or polypeptide degradation. The invention also provides research tools for the study of protein function.

Description

RELATED U.S. APPLICATION
This application claims priority to U.S. Provisional Patent Application No. 60/526,490 filed on Dec. 3, 2003, hereby incorporated by reference in its entirety for all purposes.
STATEMENT OF GOVERNMENT INTERESTS
This invention was made with government support under grant numbers DE-FG02-87ER-60565 from the Department of Energy and NIH U01HL066678 from the National Institutes of Health. The Government has certain rights in the invention.
BACKGROUND OF THE INVENTION
ATP-dependent protease complexes degrade many unstable cellular proteins. These molecular machines function both generally in protein turnover, and specifically in the regulation of processes such as transcription, apoptosis, antigen presentation and cell cycle progression (Jesenberger et al. (2002) Nat. Rev. Mol. Cell Biol. 3:112). A high degree of conservation is evident among them; the archaebacterial and eukaryotic 20S proteolytic core particles share both sequence and structural homology (Bochtler et al. (1999) Ann. Rev. Biophys. Biomol. Struct. 28:295), while eubacteria have functionally related complexes: ClpYQ, ClpXP and ClpAP (Bochtler et al. (2000) Nature 403:800; Bochtler et al. (1997) Proc. Natl. Acad. Sci. U.S.A. 94:6070; Groll et al. (1997) Nature 386:463). The 20S core particle (CP) is composed of four stacked heptameric rings structured in an α-β-β-α configuration. Access to the proteolytic central chamber is obstructed at both ends of the cylindrical assembly by N-terminal projections of the α-subunits, thus preventing uncontrolled proteolytic degradation (Groll et al. (1997) Nature 386:463; Whitby et al. (2000) Nature 408:115; Groll et al. (2000) Nat. Struct. Biol. 7:1062). In eukaryotes, docking with the 19S regulatory particle (RP) to form the complete 26S proteasome is sufficient to relieve this block, opening a channel into the core (Groll et al. (2000) Nat. Struct. Biol. 7:1062; Kohler et al. (2001) Mol. Cell 7:1143).
Eukaryotes have evolved an elaborate system that operates in conjunction with the proteasome to facilitate the temporal and specific regulation of intracellular proteolysis. Substrates targeted for degradation by the proteasome pathway are recognized by the E1, E2, and E3 ubiquitin conjugation machinery and tagged with polyubiquitin chains, which are thought to promote the proteolytic process through their binding with the proteasome. These three consecutively acting enzymes are necessary for target recognition, transfer of a ubiquitin moiety to the substrate, and subsequent elongation of the ubiquitin branched chain (Hershko et al. (1998) Ann. Rev. Biochem. 67:425). Modularity and the large number of E2 Ub-conjugating enzymes and E3 Ub-ligases allow for great specificity and flexibility in detecting a diverse range of substrates. Once a protein is polyubiquitinated, it can be recognized and degraded by the 26S proteasome.
The polyubiquitin chain is thought to play two possible roles. The first is to target the protein to the proteasome and the second is to initiate the process of degradation. The targeting hypothesis is supported by the identification of several proteasome subunits that either bind or crosslink to ubiquitin chains (Deveraux et al. (1994) J. Biol. Chem. 269:7059; Lam et al. (2002) Nature 416:763). Hypotheses for how ubiquitin-dependent initiation of degradation might occur include: allosteric regulation, channel opening, and assistance in the unfolding of the target (Groll et al. (2003) Int. J. Biochem. Cell Biol. 35:606).
SUMMARY OF THE INVENTION
The present invention is based in part on the discovery that polypeptide degradation by a proteasome can occur independently of ubiquitination of the polypeptide. Pursuant to this discovery, localization of a substrate to the proteasome is sufficient for degradation to occur. The present invention is further based on the discovery of compounds that can target a polypeptide for degradation by the proteasome by binding both the target polypeptide and the proteasome. It has been discovered that facilitating binding of a target polypeptide to the proteasome (via one or more small molecules that bind the proteasome and/or target polypeptide; dimerizing protein tags or modules; and the like) is sufficient to trigger proteasome-mediated degradation of the target polypeptide. Thus, a polypeptide may be selectively targeted for degradation by the proteasome by providing compounds that allow the binding of the target polypeptide to the proteasome. Accordingly, the present invention provides methods by which polypeptides may be localized to the proteasome and degraded independent of ubiquitin binding to the polypeptide. Such methods are useful for treating disorders associated with polypeptide (e.g., protein) expression and/or activity, as well as useful as research tools in the study of protein function, either alone or in the context of systems biology.
The present invention provides therapeutic methods and/or pharmaceutical compositions for treating disorders mediated by polypeptides by targeting these polypeptides for degradation. In one embodiment, the present invention provides a method and/or composition for therapeutic, targeted polypeptide degradation in a patient having a disorder associated with polypeptide expression and/or activity. In one aspect, one or more proteasome-localizing agents are administered to a patient having a disorder associated with polypeptide (e.g., protein) expression and/or activity. The proteasome-localizing agent binds both the polypeptide and the proteasome and allows degradation of the polypeptide by the proteasome. The resulting degradation of the polypeptide results in the reduction or alteration of one or more symptoms of the disorder. In one aspect, the proteasome-localizing agent is released from the proteasome to target another polypeptide for proteasome-mediated degradation.
The present invention also provides methods and/or compositions for selectively inactivating or activating pharmaceutical compounds. In one embodiment, the present invention provides a method and/or composition for inactivating a pharmaceutical compound (e.g., a therapeutic polypeptide) in a patient when the pharmaceutical compound is no longer needed by targeting the pharmaceutical compound for degradation by the proteasome. In one aspect, one or more proteasome-localizing agents are administered to the patient. A proteasome-localizing agent binds both the pharmaceutical compound and the proteasome, and allows degradation of the pharmaceutical compound by the proteasome, resulting in inactivation of the pharmaceutical compound. In another embodiment, the present invention provides a method and/or composition for activating a pharmaceutical compound. In one aspect, the pharmaceutical compound in a patient is associated with a target polypeptide and rendered inactive. A proteasome-localizing agent may be administered to the patient when activation of the therapeutic activity of the pharmaceutical compound is desired. In one aspect, one or more proteasome-localizing agents are administered to the patient to bind both the target polypeptide associated with the pharmaceutical compound and the proteasome, thus allowing degradation of the target polypeptide by the proteasome. After degradation of the target polypeptide, the pharmaceutical compound is released from the proteasome in a therapeutically active form.
The present invention also provides tools and/or models for identifying compounds that mediate proteasome localization and/or polypeptide degradation. In one aspect, compounds that mediate proteasome localization and/or polypeptide degradation are identified by assaying the ability of these compounds to mediate one or more activities associated with proteasome-mediated polypeptide degradation including, but not limited to: binding a proteasome; binding a polypeptide; binding a proteasome-localizing agent; binding a proteasome-localizing agent module; binding a polypeptide and a proteasome; and allowing proteasome-mediated degradation of a polypeptide independent of polypeptide ubiquitination. Accordingly, another embodiment of the present invention is directed to methods of screening compounds useful for directing one or more of these activities using the screening assays described herein. In yet another embodiment, the present invention is directed to methods of using the tools and models described herein to study protein function, either alone or in the context of systems biology. In certain aspects, compounds are screened in vitro using the cell free assays described herein. In other aspects compounds are screened in vivo using the cells and/or organisms described herein.
The present invention further provides cells and/or organisms expressing one or more altered proteasome subunits expressing a proteasome-localizing agent or a portion thereof (e.g., a first module that interacts with a second module). In certain embodiments, the cell and/or organism expresses a polypeptide that is associated with a proteasome-localizing agent or a portion thereof (e.g., a second module that interacts with a first module). In other embodiments, the cell and/or organism expresses both one or more altered proteasome subunits associated with a proteasome-localizing agent or a module thereof and a polypeptide associated with a proteasome-localizing agent or a module thereof. In certain aspects, a compound that increases or decreases the ability of two or more modules to interact with one another (e.g., dimerize) may be administered to the cell and/or organism to increase or decrease polypeptide degradation by the proteasome. In one aspect, a cell is a eukaryotic cell such as Saccharomyces cerevisiae. In another aspect, the organism is a transgenic animal such as a mouse.
BRIEF DESCRIPTION OF THE DRAWINGS
The foregoing and other features and advantages of the present invention will be more fully understood from the following detailed description of illustrative embodiments taken in conjunction with the accompanying drawings in which:
FIG. 1 depicts a schematic of the experimental design for testing whether localization to the proteasome is sufficient for degradation. One module of the heterodimerizing pair (Fpr1) is fused to the proteasome subunit. The other module (Tor) is fused to a reporter protein. Heterodimerization of the modules occurs upon addition of the small molecule rapamycin. This brings the reporter protein into close proximity to the proteasome.
FIGS. 2A-2B depict fusion constructs. (A) depicts the heterodimerizing module FPR1 genomically fused immediately downstream of each of the seven proteasome subunits in the strain DY001. Four of the derivative strains were viable. (B) depicts reporter proteins having an N-terminal fusion of the heterodimerizing module Tor to the selective marker His3. The non-heterodimerizing control reporter has an S1972R mutation in Tor that disrupts binding to the Fpr1-rapamycin complex.
FIGS. 3A-3E depict a screen for Fpr1-tagged proteasome strains that exhibit growth deficient phenotypes. (A) illustrates that the DY001 control strain grows equally well when expressing either Tor-His3 or TorS1972R-His3 in the presence or absence of rapamycin. (B) and (C) illustrate that strains Rpn2-FPR1 and Rpt5-FPR1 show little or no difference in growth in the presence or absence of rapamycin. (D) and (E) illustrate that strains Pre10-FPR1 and Rpn10-FPR1 show decreased growth when expressing Tor-His3, and spotted growth on media containing rapamycin.
FIGS. 4A-4H depict Tor-His3 degradation in vivo in the presence of rapamycin. (A) depicts a 90 minute time course in which untagged strains grown in culture demonstrate no difference in degradation rates in the presence or absence of rapamycin. (B) and (D) demonstrate that control reporter fusions in strains Pre10-FPR1 and Rpn10-FPR1 show no difference in the rate of degradation in the presence or absence of rapamycin. C and E show that Tor-His3 expressed either in strain Pre10-FPR1 or strain Rpn10-FPR1 was rapidly degraded in the presence of rapamycin. (F) graphically depicts Tor-His3 degradation in the presence or absence of rapamycin in strains Pre10-FPR1 and Rpn10-FPR1. (G) and (H) show that addition of the proteasome inhibitor PS-341 prevented Tor-His3 from degrading in strain Pre10-FPR1 (G) and Rpn10-FPR1 (H), even in the presence of rapamycin. PDR5 encodes a multi-drug resistance transporter that was knocked-out in strains Pre10-FPR1 and Rpn10-FPR1 for the purpose of the PS-341 experiments.
FIGS. 5A-5B depict Tor-His3 degradation in vitro in the presence of rapamycin. (A) depicts a 60 minute time course that demonstrates the rapid degradation of purified Tor-His3 when mixed with Rpn10-FPR1-tagged, purified proteasome complexes in the presence of rapamycin. There was no appreciable degradation of the reporter using the mutant construct, untagged proteasome, tagged proteasome in the absence of rapamycin, or tagged proteasome in the presence of rapamycin and a proteasome inhibitor. (B) graphically depicts Tor-His3 degradation in the presence or absence of rapamycin in experiments containing purified Rpn10-FPR1 proteasomes. TorS1972R-His3 is labeled as S19-HIS3.
DETAILED DESCRIPTION
Embodiments of the present invention are directed to the discovery that localizing a protein to the proteasome independent of polyubiquitin chain addition results in protein degradation by the proteasome. Accordingly, the present invention provides the use of proteasome-localizing agents (e.g., small molecules, heterodimerizing modules and the like) that can localize polypeptides to the proteasome in order to promote their degradation. As used herein, the terms “protein degradation” and “polypeptide degradation” include, but are not limited to, cleavage of a protein or polypeptide, respectively, into fragments or peptide substituents. Protein degradation can be mediated by one or more subunits of a proteasome. As used herein, the term “polypeptide” is intended to include, but is not limited to, peptides that are ten or 100 or more amino acids in length, as well as proteins and portions of proteins.
Therapeutic Methods
The present invention provides a novel approach to protein therapeutics using targeted protein and/or targeted polypeptide degradation. As used herein, the terms “targeted protein degradation” and “targeted polypeptide degradation” are intended to include, but are not limited to, targeting proteins or polypeptides, respectively to the proteasome for degradation. The current paradigm in screening small molecule libraries is to find inhibitors of enzymatic processes that are causal in disease. However, the number of small molecules that both specifically bind to, and inhibit the function of a polypeptide (i.e., via inhibiting one or more active sites) is extremely small. Furthermore, as active sites tend to be highly conserved or convergent, compounds that inhibit the active site of a targeted protein and/or polypeptide may also exhibit undesirable cross-reactivity with active sites of one or more non-targeted proteins and/or polypeptides. Compounds that target proteins and/or polypeptides to the proteasome could help limit the degree of this kind of cross-reactivity.
Targeted protein and/or polypeptide degradation is also useful for developing catalytic therapeutic agents. For example, a therapeutic agent of the present invention targets a specific polypeptide to the proteasome for degradation. After degradation, the agent is released and available to target another polypeptide to the proteasome for degradation. This could allow for lower doses of the agent to be used therapeutically, resulting in lower costs and less side effects.
The present invention also provides methods and compositions for modulating (i.e., increasing or decreasing) one or more activities of the polypeptides, compounds and/or proteasome-localizing agents described herein. In one aspect, the present invention provides methods and compositions for controlling selective degradation of therapeutic polypeptides (e.g., protein-based therapeutic compositions) when they are no longer needed for therapy, and for activating therapeutic compounds via proteasome-mediated degradation.
Accordingly, in one embodiment, a modulatory method of the invention involves contacting a cell with an agent that promotes targeting to the proteasome and/or promotes polypeptide degradation. Methods of modulating targeting to the proteasome and/or polypeptide degradation can be performed in vitro (e.g., by culturing a cell with the agent or using a cell-free proteasome assay) or, alternatively, in vivo (e.g., by administering the agent to a subject, such as a transgenic animal described herein). As such, the present invention provides methods of treating an individual afflicted with a polypeptide-associated disease or disorder. In one embodiment, the method involves administering an agent (e.g., an agent identified by a screening assay described herein), or combination of agents that promotes targeting to the proteasome and/or polypeptide degradation.
Another embodiment of the present invention is directed to a method for treatment of a disease or disorder associated with the expression and/or activity of one or more polypeptides which includes the step of administering a therapeutically effective amount of an agent which increases degradation of the polypeptide(s) and/or targeting to the proteasome. As defined herein, a therapeutically effective amount of agent (i.e., an effective dosage) ranges from about 0.001 to 30 mg/kg body weight, preferably about 0.01 to 25 mg/kg body weight, more preferably about 0.1 to 20 mg/kg body weight, and even more preferably about 1 to 10 mg/kg, 2 to 9 mg/kg, 3 to 8 mg/kg, 4 to 7 mg/kg, or 5 to 6 mg/kg body weight. The skilled artisan will appreciate that certain factors may influence the dosage required to effectively treat a subject, including but not limited to the severity of the disease or disorder, previous treatments, the general health and/or age of the subject, and other diseases present. Moreover, treatment of a subject with a therapeutically effective amount of an agent can include a single treatment or, preferably, can include a series of treatments. It will also be appreciated that the effective dosage of in used for treatment may increase or decrease over the course of a particular treatment. Changes in dosage may result from the results of diagnostic assays as described herein.
As used herein, a disorder associated with the expression and/or activity of a polypeptide (i.e., “a polypeptide-associated disorder”) includes a disorder, disease or condition which is caused or characterized by a misregulation (e.g., upregulation) of a polypeptide. Polypeptide-associated disorders can detrimentally affect cellular functions including, but not limited to, cellular proliferation, growth, differentiation, or migration, inter- or intra-cellular communication, tissue function, systemic responses in an organism, susceptibility to pathogenic infections, immune responses, and protection of cells from toxic compounds (e.g., carcinogens, toxins, or mutagens).
In at least certain examples, the proteasome-localizing agents disclosed herein can be used in the treatment of polypeptide-associated disorders such as cellular proliferative disorders, (e.g., cancer). Treatment of cellular proliferative disorders is intended to include inhibition of proliferation including rapid proliferation. As used herein, the term “cellular proliferative disorder” includes disorders characterized by undesirable or inappropriate proliferation of one or more subset(s) of cells in a multicellular organism. The term “cancer” refers to various types of malignant neoplasms, most of which can invade surrounding tissues, and may metastasize to different sites (see, for example, PDR Medical Dictionary 1st edition (1995)). The terms “neoplasm” and “tumor” refer to an abnormal tissue that grows by cellular proliferation more rapidly than normal and continues to grow after the stimuli that initiated proliferation is removed (see, for example, PDR Medical Dictionary 1st edition (1995)). Such abnormal tissue shows partial or complete lack of structural organization and functional coordination with the normal tissue which may be either benign (i.e., benign tumor) or malignant (i.e., malignant tumor).
The language “treatment of cellular proliferative disorders” is intended to include the prevention of the growth of neoplasms in a subject or a reduction in the growth of pre-existing neoplasms in a subject. The inhibition also can be the inhibition of the metastasis of a neoplasm from one site to another. Examples of the types of neoplasms intended to be encompassed by the present invention include but are not limited to those neoplasms associated with cancers of the breast, skin, bone, prostate, ovaries, uterus, cervix, liver, lung, brain, larynx, gallbladder, pancreas, rectum, parathyroid, thyroid, adrenal gland, immune system, neural tissue, head and neck, colon, stomach, bronchi, and/or kidneys.
Cellular proliferative disorders can further include disorders associated with hyperproliferation of vascular smooth muscle cells such as proliferative cardiovascular disorders, e.g., atherosclerosis and restinosis. Cellular proliferation disorders can also include disorders such as proliferative skin disorders, e.g., X-linked ichthyosis, psoriasis, atopic dermatitis, allergic contact dermatitis, epidermolytic hyperkeratosis, and seborrheic dermatitis. Cellular proliferative disorders can further include disorders such as autosomal dominant polycystic kidney disease (ADPKD), mastocystosis, and cellular proliferation disorders caused by infectious agents such as viruses.
In at least certain examples, the proteasome-localizing agents disclosed herein can be used in the treatment of disorders associated with pathogen infection. Disorders associated with infection by pathogens include, but are not limited to, infection by viruses (DNA viruses, RNA viruses, animal viruses, and the like), bacteria (e.g., gram positive bacteria, gram negative bacteria, acid-fast bacteria, and the like), fungi, parasitic microbes and the like.
Proteasome-localizing agents disclosed herein are also useful for treating disorders associated with aberrant peptide folding and/or aberrant peptide degradation. Such disorders include, but are not limited to, cellular proliferation disorders, prion diseases (e.g., scrapie, Creutzfeldt-Jakob disease, Gerstmann-Strassler Scheinker disease, bovine spongiform encephalopathy and the like) Alzheimer's disease, Parkinson's disease, Huntington's disease, type II diabetes, cystic fibrosis, emphysema, spinocerebellar ataxia, α-1-antitrypsin deficiency, and the like.
Pharmaceutical Compositions
Agents and/or compounds that affect proteasome targeting and/or polypeptide degradation (e.g., modulating agents such as proteasome-localizing agents) can be incorporated into pharmaceutical compositions suitable for administration. Such compositions typically comprise the modulatory agent(s) and a pharmaceutically acceptable carrier. As used herein the term “pharmaceutically acceptable carrier” is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the compositions is contemplated. Supplementary active compounds can also be incorporated into the compositions.
A pharmaceutical composition of the invention is formulated to be compatible with its intended route of administration. For example, solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be enclosed in ampules, disposable syringes or multiple dose vials made of glass or plastic.
Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, CREMOPHOR EL™ (BASF, Parsippany, N.J.), or phosphate buffered saline (PBS). In all cases, the composition must be sterile and should be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyetheylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as manitol, sorbitol, sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.
Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
Oral compositions generally include an inert diluent or an edible carrier. They can be enclosed in gelatin capsules or compressed into tablets. For the purpose of oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules. Oral compositions can also be prepared using a fluid carrier for use as a mouthwash, wherein the compound in the fluid carrier is applied orally and swished and expectorated or swallowed. Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of the composition. The tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.
In one embodiment, the active compounds are prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art. The materials can also be obtained commercially from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions (including liposomes targeted to infected cells with monoclonal antibodies to viral antigens) can also be used as pharmaceutically acceptable carriers. These may be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811.
Screening Assays
The invention provides a method (also referred to herein as a “screening assay”) for identifying modulators of proteasome targeting and/or polypeptide degradation, i.e., candidate or test compounds or agents (e.g., peptides, cyclic peptides, peptidomimetics, small molecules, small organic molecules, or other drugs) which promote targeting to the proteasome and/or the degradation of a target polypeptide (e.g., polypeptides that contribute to disease, therapeutic polypeptides and the like). Candidate or test compounds or agents that promote targeting to the proteasome and/or degradation of a polypeptide include, but are not limited to, proteasome-localizing agents. Proteasome-localizing agents may comprise two or more modules that interact (e.g., modules that form dimers, trimers, tetramers and the like) to target a polypeptide to a proteasome, or may comprise individual agents or compounds that target a polypeptide to a proteasome.
As used herein, the terms “bind,” “binding,” “interact,” “interacting,” “associated with” are intended to include, but are not limited to, covalent and noncovalent interactions. A covalent interaction is a chemical linkage between two atoms or radicals formed by the sharing of a pair of electrons (i.e., a single bond), two pairs of electrons (i.e., a double bond) or three pairs of electrons (i.e., a triple bond). Covalent interactions are also known in the art as electron pair interactions or electron pair bonds. Noncovalent interactions are much weaker than covalent interactions, but play a major role in determining the three-dimensional structure of macromolecular structures. Noncovalent interactions include, but are not limited to, van der Waals interactions, hydrogen bonds, weak chemical bonds (i.e., via short-range noncovalent forces), hydrophobic interactions, ionic bonds and the like. A review of noncovalent interactions can be found in Alberts et al., in Molecular Biology of the Cell, 3d edition, Garland Publishing, 1994.
As used herein, the term “small organic molecule” refers to an organic molecule, either naturally occurring or synthetic, that has a molecular weight of more than about 25 daltons and less than about 3000 daltons, preferably less than about 2500 daltons, more preferably less than about 2000 daltons, preferably between about 100 to about 1000 daltons, more preferably between about 200 to about 500 daltons.
In one embodiment, the invention provides assays for screening candidate or test compounds which modulate polypeptide degradation via the proteasome. The test compounds of the present invention can be obtained using any of the numerous approaches in combinatorial library methods known in the art, including: biological libraries; spatially addressable parallel solid phase or solution phase libraries; synthetic library methods requiring deconvolution; the “one-bead one-compound” library method; and synthetic library methods using affinity chromatography selection. The biological library approach is limited to peptide libraries, while the other four approaches are applicable to peptide, non-peptide oligomer or small molecule libraries of compounds (Lam, K. S. (1997) Anticancer Drug Des. 12:145).
Examples of methods for the synthesis of molecular libraries can be found in the art, for example in: DeWitt et al. (1993) Proc. Natl. Acad. Sci. USA 90:6909; Erb et al. (1994) Proc. Natl. Acad. Sci. USA 91:11422; Zuckermann et al. (1994) J. Med Chem. 37:2678; Cho et al. (1993) Science 261:1303; Carrell et al. (1994) Angew. Chem. Int. Ed. Engl. 33:2059; Carell et al. (1994) Angew. Chem. Int. Ed. Engl. 33:2061; and in Gallop et al. (1994) J. Med. Chem. 37:1233.
Libraries of compounds may be presented in solution (e.g., Houghten (1992) Biotechniques 13:412), or on beads (Lam (1991) Nature 354:82), chips (Fodor (1993) Nature 364:555), bacteria (Ladner U.S. Pat. No. 5,223,409), spores (Ladner U.S. Pat. No. 5,223,409), plasmids (Cull et al. (1992) Proc. Natl. Acad. Sci. USA 89:1865) or on phage (Scott and Smith (1990) Science 249:386); (Devlin (1990) Science 249:404); (Cwirla et al. (1990) Proc. Natl. Acad. Sci. USA 87:6378); (Felici (1991) J. Mol. Biol. 222:301); (Ladner supra).
In one embodiment, test compounds of the invention (e.g., proteasome-localizing agents) include dimerizing modules comprising a first module and a second module that bind to one another to form a dimeric (e.g., heterodimeric) compound. In one aspect, a first module binds a polypeptide to be targeted to the proteasome and second module binds the proteasome. Upon binding of the first and second modules to form a dimeric (e.g., heterodimeric) compound, the targeted polypeptide is degraded by the proteasome. Examples of modules that bind to proteasomes include, but are not limited to: proteasome binding molecules that do not inhibit the proteasome; analogs of the Ubiquitin/Ubl helix motif that bind to the proteasome (Mueller et al. (2003) EMBO J. 22:4634); and the like.
In one embodiment, modules are screened separately. A module that binds a proteasome can be chemically crosslinked to a module that binds a target polypeptide to form a heterodimeric compound that localizes the target polypeptide to the proteasome. In one aspect of the invention, crosslinking compounds can be used to increase the screening efficiency by increasing the effective search space for small molecule dimerizers by the square of the size of the library, which for a 10,000 member screen, is approximately 1×105-fold. Crosslinkers are well known in the art and are commercially available from companies such as Pierce Biotechnology, Inc. (Rockford, Ill.).
Certain embodiments of the present invention provide organism-based screening assays. In one embodiment, an organism-based assay provides an organism for screening compounds that target polypeptides to the proteasome for degradation to identify novel therapeutic compounds. Useful organisms include yeast such as Saccharomyces cerevisiae, and mammals such as non-human primates, rabbits, rats, mice, and the like and transgenic species thereof. Polypeptide degradation can be assayed using a variety of techniques known to those of skill in the art.
In another embodiment, an organism-based screening assay provides an organism that expresses one or more target proteins and/or polypeptides expressing a tag that binds to a proteasome. In one aspect, the tag (i.e., an epitope tag such as hemagglutinin (HA), c-myc or TAP) does not directly bind the proteasome but is instead conjugated to a compound (e.g., a small molecule or a heterodimerizer) that binds the proteasome. Alternatively, compounds that bind both to the tag and the proteasome can be used. In another aspect, the target protein and/or polypeptide is bound to a monoclonal antibody conjugated to a compound that binds a proteasome. In one aspect of the invention, this assay is useful for designing modulated compounds or tags (i.e., increasing or decreasing the ability of the compound or tag to direct protein and/or polypeptide degradation and/or changing the protein and/or polypeptide binding specificity of the compound or tag).
In another embodiment, transgenic non-humans animals can be produced which contain selected systems which allow for regulated expression of the transgene. One example of such a system is the cre/loxP recombinase system of bacteriophage P1. For a description of the cre/loxP recombinase system, see, e.g., Lakso et al. (1992) Proc. Natl. Acad. Sci. U.S.A. 89:6232. Another example of a recombinase system is the FLP recombinase system of S. cerevisiae (O'Gorman et al. (1991) Science 251:1351). If a cre/loxP recombinase system is used to regulate expression of the transgene, animals containing transgenes encoding both the Cre recombinase and a selected protein are required. Such animals can be provided through the construction of “double” transgenic animals, e.g., by mating two transgenic animals, one containing a transgene encoding a selected protein and the other containing a transgene encoding a recombinase.
The present invention also provides cell-based screening assays for screening compounds that target polypeptides to the proteasome for degradation to identify novel therapeutic compounds. In one aspect, a cell for use in a cell-based screening assay can be derived from the animal models described herein. In one aspect, cells of the present invention are eukaryotic cells such as S. cerevisiae cells, insect cells, Xenopus cells, or mammalian cells (such as Chinese hamster ovary cells (CHO), African green monkey kidney cells (COS), fetal human cells (293T) and the like). Other suitable host cells are known to those skilled in the art.
The present invention further provides cell-free assays in which a proteasome and a target protein, polypeptide or biologically active portion thereof, is contacted with a test compound, and the ability of the test compound to modulate proteasome binding and/or degradation of the target protein, polypeptide or biologically active portion thereof, is determined.
This invention further pertains to novel agents identified by the above-described screening assays. Accordingly, it is within the scope of this invention to further use an agent identified as described herein in an appropriate animal model as described herein. For example, an agent identified as described herein can be used in an animal model to determine the efficacy, toxicity, or side effects of treatment with such an agent. Alternatively, an agent identified as described herein can be used in an animal model to determine the mechanism of action of such an agent. Furthermore, this invention pertains to uses of novel agents identified by the above-described screening assays for treatments of disorders associated with protein and/or polypeptide expression.
Functional Assays
The present invention further provides systems for elucidating polypeptide function. In one embodiment, the assays and compounds described herein are used to target a specific polypeptide in a cell or in an organism to the proteasome for degradation. The function(s) of the protein and/or polypeptide may then be determined by assaying responses of the cell or the organism to the absence of the polypeptide. The assays described herein are advantageous over many knockout systems known in the art because they allow a high degree of regulation. For example, the target polypeptide may be degraded at various time points during development. The target polypeptide may also be degraded to various degrees ranging from 100% of the polypeptide degraded, to 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5% or less of the polypeptide degraded. Multiple polypeptides may also be degraded in a single cell or organism at the same time or at various time points. Multiple polypeptides may further be degraded in a single cell or organism to various degrees relative to one another.
In one embodiment, the present invention provides organism-based assays for determining the function of a polypeptide in vivo. In one aspect, the invention provides an organism that expresses a proteasome fused to a first module (i.e., a first portion of a dimerizing module), and a target protein and/or polypeptide fused to a second module (i.e., a second portion of a dimerizing module), wherein the first and second modules interact upon exposure to a particular compound (i.e., a heterodimerizer) to form a dimeric module. In another aspect, the first and second modules may interact to form a dimer without exposure to a particular compound (i.e., a heterodimerizer). Module-module interactions can direct localization of the target polypeptide to a proteasome as well as the proteasome-mediated degradation of the target polypeptide. In another embodiment, only the proteasome or the target polypeptide is fused to a module. In one aspect, the organism-based assays and/or compounds described herein can be used to mediate targeted polypeptide degradation to determine the function of a polypeptide in vivo.
Examples of heterodimerizers include, but are not limited to: FK-506 (Ho et al. (1996) Nature 382:822); FK-506-cyclosporin A (Belshaw et al. (1996) Proc. Natl. Acad. Sci. USA 93:4604); aptamers (Colas et al. (2000) Proc. Natl. Acad. Sci. USA 97:13720); coumermycin (Farrar et al. (1996) Nature 383:178); bismethotrexate (2000) Chem. and Biol. 7:313); dexamethasone-methotrexate (Lin et al. (2000) J. Am. Chem. Soc. 122:4247); RNA-protein binder (Harvey et al. (2002) Proc. Natl. Acad. Sci. U.S.A. 99:1882); rapamycin derivatives (Liberles et al. (1997) Proc. Natl. Acad. Sci. U.S.A. 94:7825); and the like. These references are incorporated herein by reference in their entirety.
Animals and Cells
Assays described herein (e.g., screening assays) may be carried out using non-human transgenic animals. For example, in one embodiment, a host cell of the invention is a fertilized oocyte or an embryonic stem cell into which a modified proteasome sequence and/or proteasome-targeted protein or polypeptide has been introduced. Such host cells can then be used to create non-human transgenic animals in which exogenous proteasome, protein and/or polypeptide sequences have been introduced into their genome. Such animals are useful for studying proteasome targeting and for identifying and/or evaluating compounds that target polypeptides and/or proteins to the proteasome. As used herein, a “transgenic animal” is a non-human animal, e.g., a mammal such as a rodent, for example, a rat or mouse, in which one or more of the cells of the animal includes a transgene. Other examples of transgenic animals include non-human primates, sheep, dogs, cows, goats, chickens, amphibians, etc. A transgene is exogenous DNA which is integrated into the genome of a cell from which a transgenic animal develops and which remains in the genome of the mature animal, thereby directing the expression of an encoded gene product in one or more cell types or tissues of the transgenic animal. As used herein, a “homologous recombinant animal” is a non-human animal, e.g., a mammal such as a mouse, in which an endogenous gene has been altered by homologous recombination between the endogenous gene and an exogenous DNA molecule introduced into a cell of the animal, e.g., an embryonic cell of the animal, prior to development of the animal.
A transgenic animal of the invention can be created by introducing a nucleic acid (i.e., a transgene) encoding a proteasome or a portion thereof, a protein of interest or a polypeptide of interest into the male pronuclei of a fertilized oocyte, e.g., by microinjection, retroviral infection, and allowing the oocyte to develop in a pseudopregnant female foster animal. Intronic sequences and polyadenylation signals can also be included in the transgene to increase the efficiency of expression of the transgene. A tissue-specific regulatory sequence(s) can be operably linked to a detectable translation product transgene to direct expression of a detectable translation product to particular cells. Methods for generating transgenic animals via embryo manipulation and microinjection, particularly animals such as mice, have become conventional in the art and are described, for example, in U.S. Pat. Nos. 4,736,866 and 4,870,009, both by Leder et al., U.S. Pat. No. 4,873,191 by Wagner et al., and in Hogan, B., Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1986). Similar methods are used for production of other transgenic animals. A transgenic founder animal can be identified based upon the presence of a detectable translation product transgene in its genome and/or expression of detectable translation product mRNA in tissues or cells of the animals. A transgenic founder animal can then be used to breed additional animals carrying the transgene. Moreover, transgenic animals carrying a transgene encoding a detectable translation product can further be bred to other transgenic animals carrying other transgenes.
To create a homologous recombinant animal, a vector is prepared which contains at least a portion of a transgene. In one embodiment, the vector is designed such that, upon homologous recombination, the endogenous gene is functionally disrupted (i.e., no longer encodes a functional protein; also referred to as a “knock out” vector). Alternatively, the vector can be designed such that, upon homologous recombination, the endogenous gene is mutated or otherwise altered but still encodes functional protein (e.g., the upstream regulatory region can be altered to thereby alter the expression of the endogenous protein). In the homologous recombination vector, the altered portion of the gene is flanked at its 5′ and 3′ ends by additional nucleic acid sequence of the gene to allow for homologous recombination to occur between the exogenous gene carried by the vector and an endogenous gene in an embryonic stem cell. The additional flanking nucleic acid sequence is of sufficient length for successful homologous recombination with the endogenous gene. Typically, several kilobases of flanking DNA (both at the 5′ and 3′ ends) are included in the vector (see e.g., Thomas, K. R. and Capecchi, M. R. (1987) Cell 51:503 for a description of homologous recombination vectors). The vector is introduced into an embryonic stem cell line (e.g., by electroporation) and cells in which the introduced gene has homologously recombined with the endogenous gene are selected (see e.g., Li, E. et al. (1992) Cell 69:915). The selected cells are then injected into a blastocyst of an animal (e.g., a mouse) to form aggregation chimeras (see e.g., Bradley, A. in Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, E. J. Robertson, ed. (IRL, Oxford, 1987) pp. 113-152). A chimeric embryo can then be implanted into a suitable pseudopregnant female foster animal and the embryo brought to term. Progeny harboring the homologously recombined DNA in their germ cells can be used to breed animals in which all cells of the animal contain the homologously recombined DNA by germline transmission of the transgene. Methods for constructing homologous recombination vectors and homologous recombinant animals are described further in Bradley, A. (1991) Current Opinion in Biotechnology 2:823 and in PCT International Publication Nos.: WO 90/11354 by Le Mouellec et al.; WO 91/01140 by Smithies et al.; WO 92/0968 by Zijlstra et al.; and WO 93/04169 by Berns et al.
Clones of the non-human transgenic animals described herein can also be produced according to the methods described in Wilmut, I. et al. (1997) Nature 385:810. In brief, a cell, e.g., a somatic cell, from the transgenic animal can be isolated and induced to exit the growth cycle and enter G0 phase. Alternatively, a cell, e.g., an embryonic stem cell, from the inner cell mass of a developing embryo can be transformed with a preferred transgene. Alternatively, a cell, e.g., a somatic cell, from cell culture line can be transformed with a preferred transgene and induced to exit the growth cycle and enter G0 phase. The cell can then be fused, e.g., through the use of electrical pulses, to an enucleated mammalian oocyte. The reconstructed oocyte is then cultured such that it develops to morula or blastocyst and then transferred to pseudopregnant female foster animal. The offspring borne of this female foster animal will be a clone of the animal from which the nuclear donor cell, e.g., the somatic cell, is isolated.
Vector DNA can be introduced into cells via conventional transformation or transfection techniques. As used herein, the terms “transformation” and “transfection” are intended to refer to a variety of art-recognized techniques for introducing foreign nucleic acid (e.g., DNA) into a host cell, including calcium phosphate or calcium chloride co-precipitation, DEAE-dextran-mediated transfection, lipofection, or electroporation. Suitable methods for transforming or transfecting host cells can be found in Sambrook, et al. (Molecular Cloning: A Laboratory Manual. 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989), and other laboratory manuals.
For stable transfection of mammalian cells, it is known that, depending upon the expression vector and transfection technique used, only a small fraction of cells may integrate the foreign DNA into their genome. In order to identify and select these integrants, a gene that encodes a selectable marker (e.g., resistance to antibiotics) is generally introduced into the host cells along with the gene of interest. Selectable markers include those which confer resistance to drugs, such as G418, hygromycin and methotrexate. Nucleic acid encoding a selectable marker can be introduced into a host cell on the same vector as that encoding a detectable translation product or can be introduced on a separate vector. Cells stably transfected with the introduced nucleic acid can be identified by drug selection (e.g., cells that have incorporated the selectable marker gene will survive, while the other cells die).
The following examples are provided for exemplification purposes only and are not intended to limit the scope of the invention that has been described in broad terms above.
EXAMPLE I Proteasome Degradation System
Chemical inducers of dimerization are a class of reagents that facilitate the regulated association of any two polypeptides. They have been used in a number of applications such as localization of proteins to subcellular domains, triggering of signal transduction cascades, and control of gene expression (Kopytek et al. (2000) Chem. Biol. 7:313; Spencer et al. (1993) Science 262:1019; Ho et al. (1996) Nature 382:822; Farrar et al. (1996) Nature 383:178; Belshaw et al. (1996) Proc. Natl. Acad. Sci. U.S.A. 93:4604; Rivera et al. (1996) Nat. Med. 2:1028). To determine whether localization to the proteasome was sufficient for degradation, such a system was modified and utilized in S. cerevisiae. A first heterodimerizing module was fused to the proteasome, and a second heterodimerizing module was fused to the reporter to be tested for degradation. Addition of a chemical dimerizer brought the two modules together, thus localizing the reporter to the site of the proteasome. Degradation occurred as a result of the drug-induced association could be monitored with the appropriate assay (FIG. 1).
In S. cerevisiae, the lipophilic macrolide rapamycin has been shown to bind with high affinity to the protein Fpr1, and this complex in turn binds to the ligand-binding domain of Tor1 (Tor11883-2078, or hereafter Tor) (Lorenz et al. (1995) J. Biol. Chem. 270:27531). Seven proteasome subunits (Rpn2, Rpt2, Rpt5, Rpn6 Pre10, Rpn10, Rpn11) that ranged in distance from the 20S proteolytic core were each C-terminally fused with Fpr1 (FIG. 2A). Strains bearing FPR1-tagged Rpt2, Rpn6 and Rpn11 subunits could not be recovered, which, without intending to be bound by theory, was due to their lethality. DY001 strains expressing Rpn2, Rpt5, Pre10 and Rpn10 FPR1-tagged subunits (henceforth referred to as strain subunit-FPR1) were viable, contained correct integrated fragments as determined by PCR, and exhibited wild-type expression levels as determined by Western blotting.
EXAMPLE II Screen for Growth Deficient Phenotypes
A gradient growth assay was used to screen the viable strains containing Fpr1-tagged proteasome subunits to identify degradation-through-localization (DTL) candidates. The auxotrophic marker HIS3 encodes a protein involved in histidine biosynthesis, and is necessary for growth on histidine-dropout media. Each Fpr1-tagged strain used in this assay had its chromosomal copy of HIS3 deleted and, therefore, required expression of exogenous functional His3 for growth. Two reporter constructs were designed for use in the screen. The reporter Tor-His3 is an amino-terminal fusion of the heterodimerizing module Tor with full length His3 (FIG. 2B). The control reporter TorS1972R-His3 replaced wild-type Tor with a missense mutant protein that has a decreased affinity for the rapamycin-Fpr1 complex (Heitman et al. (1991) Science 253:905).
Identification of DTL candidates was based on the comparative growth of strains on histidine-dropout solid media, with or without rapamycin. Fpr1-tagged strains that expressed the control reporter TorS1972R-His3 were not expected to show any difference in growth between the two plates; the fusion protein would not bind rapamycin and therefore should not be directed to the proteasome. Tor-His3 binds rapamycin and, therefore, can have an increased association with the proteasome in the presence of the drug. Without intending to be bound by theory, if this association were sufficient for degradation, Tor-His3 containing strains would be expected to display a growth deficient phenotype on the histidine-dropout plates with rapamycin.
The untagged DY001 parental and the four viable Fpr1-tagged strains were individually transformed with the experimental and control reporter constructs. All strains grew equally well on control plates containing histidine. Each transformant was then spotted as a 10-fold dilution series (103-105) on two sets of experimental plates: histidine-dropout media either containing or lacking rapamycin (FIGS. 3A-3E). Strain Rpn10-FPR1 displayed the most striking rapamycin-dependent phenotype. Strain Pre10-FPR1 had a milder growth deficient phenotype that was still significant and reproducible. Strains Rpn2-FPR1 and Rpt5-FPR1 did not show comparative growth phenotypes consistent with degradation of the reporter constructs.
EXAMPLE III Western Assays Confirm DTL
The aforementioned growth assay was a convenient tool for isolating strains to further explore DTL. Use of the growth assay on its own did not prove that localization was sufficient for degradation since His3 function could have been compromised in a rapamycin-dependent, but degradation-independent manner. To address this point, degradation of the reporters was directly measured. Strains Pre10-FPR1 and Rpn10-FPR1 were singly transformed with plasmids that expressed hemagglutinin (HA) epitope-tagged versions of Tor-His3 and TorS1972R-His3. The transformants were grown in liquid culture to early log phase, whereupon cycloheximide was added to halt protein translation. Each culture was then split in two and rapamycin was added to one. Samples were collected at various times and whole-cell protein extracts were generated and used for Western analysis (FIGS. 4A-4H). Both strains Pre10-FPR1 and Rpn10-FPR1 displayed an increase in the rate of degradation of the reporter Tor-His3 when rapamycin was added to the cultures, with half-lives of approximately 20-30 minutes (FIG. 4B). No difference in the rate of degradation was observed with Fpr1-tagged strains expressing the mutant reporter TorS1972R-His3. To demonstrate that degradation of the reporter was mediated by the proteasome and not processed through other pathways, the experiments were repeated with the addition of the proteasome inhibitor PS-341 (FIG. 4C) (Palombella et al. (1998) Proc. Natl. Acad. Sci. U.S.A. 95:15671). As expected, addition of PS-341 halted degradation of Tor-His3, even in the presence of rapamycin. These experiments confirm that the growth deficient phenotype seen on histidine-dropout media was due to the degradation of the Tor-His3 reporter and that the 26S proteasome is necessary for this to occur.
EXAMPLE IV Purified Proteasomes are Sufficient for DTL
To demonstrate ubiquitin-independence and that the 26S proteasome is not only necessary but also sufficient for DTL, in vitro experiments were performed where the only degradation components used were purified proteasomes and reporter proteins. Whole, functional 26S proteasomes have been previously affinity-purified for use in biochemical assays (Leggett et al. (2002) Mol. Cell 10:495). The same procedure was used to isolate proteasomes from strain Rpn10-FPR1. HA epitope-tagged versions of Tor-His3 and TorS1972R-His3 were purified from a bacterial expression system and then mixed with the proteasomes, with or without rapamycin. Samples were extracted at regular intervals and reporter degradation was monitored by Western analysis (FIG. 5A). The in vitro results mirrored what was seen with the in vivo Westerns blots. All experiments using purified TorS1972R-His3 demonstrated no degradation. Degradation of Tor-His3 was only observed in the presence of rapamycin and proteasomes isolated from strain Rpn10-FPR1. The half-life of the reporter was on the order of 15 minutes (FIG. 5B), comparable to that which was observed in vivo. Once again, proteolysis of Tor-His3 could be halted upon the addition of the proteasome inhibitor PS-341. These results, in combination with the in vivo experiments, demonstrate that localization to the proteasome is sufficient for the initiation of degradation.
EXAMPLE V Conditional Protein Knockdown
The system presented herein will be converted into a generalized method for the facile construction of conditional protein knockdowns in S. cerevisiae. Fusing the Tor module to endogenous proteins of choice in an Rpn10-FPR1 background will permit rapamycin-dependent control of degradation. The estimated 20-30 minutes half-lives of the target proteins will compare favorably with established high-throughput knockdown methods such as RNA interference and promoter shutoff assays (Fire et al. (1988) Nature 391:806; Baron et al. (2000) Methods Enzymol. 327:401). One advantage of the present system over both technologies is that the system described herein will directly target proteins and/or polypeptides for degradation, whereas the other systems affect RNA levels and are therefore dependent on the targets' natural half-lives for functional knockdowns.
EXAMPLE VI Murine Model
A mouse model will be used to develop an adaptor molecule that is capable of binding to the proteasome in mammalian systems as well as a protein and/or peptide of interest. This molecule will thus target the peptide and/or protein for degradation without the need for modification of the proteasome. Such a model will be useful for screening for compounds that increase target protein localization to the proteasome and/or degradation and, accordingly, will be useful for the development of therapeutic compounds for treating disorders associated with protein expression and/or activity (e.g., promote localization to the proteasome). It will, additionally, be useful in the formulation of protein-based and/or polypeptide-based drugs whose activity can be regulated in a temporal-specific manner (e.g., activated or deactivated when it is desirable to do so) by means of localization to the proteasome and/or degradation. It will also be useful as a research tool for the study of protein function in the context of systems biology.
EXAMPLE VII Methods
Construction of Parental Strain DY001
Primer and plasmid sequence information is set forth below. All experiments were performed in derivatives of strain DY001 to ensure that the components of the heterodimerization system would minimally interact with endogenous proteins, thus preventing cell cycle arrest and mislocalization of the reporter upon the addition of rapamycin (Heitman et al. (1991) Science 253:905). The Fpr1-rapamycin binding domain (nucleotides 5656-6243) of the dominant allele TOR1-2 was amplified from strain JHY17-9C (Lorenz et al. (1995) J. Biol. Chem. 270:27531) and subcloned into the integrating plasmid pRS306 (Sikorski et al. (1989) Genetics 122:19). This vector was then digested with HindIII to cut once within TOR1-2 and transformed into the strain BY4742 Δfpr1::kanr (Research Genetics). Integration and subsequent loop-out was selected for on the appropriate plates. The correct strain was verified by PCR and sequencing.
Genomic Tagging of Proteasome Subunits
Tagging of proteasome subunits was performed both by homologous recombination of linear fragments containing 40 bp of flanking homology to the target site[i] and by two-step integration with a non-replicating plasmid[ii].
[i] FPR1 was amplified by PCR from the strain FY4 (Winston et al. (1995) Yeast 11:53) and subcloned into the plasmid pUG-spHIS5 (Wach et al. (1997) Yeast 13:1065) with a C-terminal HA-tag, forming FPR1-HA-pUG-spHIS5. Integration primers pairs were designed for tagging each of the four proteasome subunits (PRE10, RPN2, RPN6, RPN11). For each pair, one primer contained 40 bp of genomic homology to the 3′ end of the proteasome subunit, excluding the stop codon, and 20 bp of homology to the 5′ of FPR1 on pUG-spHIS5, excluding ATG. The second primer contained 40 bp of genomic homology approximately 50 bp downstream of the proteasome subunit gene stop codon and 20 bp of homology to pUG-spHIS5 immediately downstream of the spHIS5 marker flanked by loxP sites. Two confirmatory primers were also designed that flanked the integration site of each proteasome subunit. Strain DY001 was transformed with pSH47, a plasmid with a galactose-inducible cre gene and a URA3 selection marker (Guldener et al. (1996) Nucleic Acids Res. 24:2519). A 2 kb linear fragment from FPR1-HA-pUG-spHIS5 was amplified using each integration primer pair to generate linear 2 kb fragments suitable for genomic integration. 15 μg of each fragment was transformed into DY001 carrying pSH47 and selection was performed on SC-URA-HIS. Colonies were then picked and streaked onto SC-URA GAL to induce cre and to select for the loopout of the spHIS5 marker. Colonies were finally streaked onto a 5-fluoroorotic acid containing plate to remove pSH47. All tagged subunits were verified by sequencing.
[ii] Approximately 400-500 bp of the carboxy-terminal end (without the stop codon) and 3′ untranslated region of proteasome subunits RPT2, RPT5, and RPN10 were amplified from strain FY4. Each pair was subcloned into the integration plasmid pRS306 (Sikorski et al. (1989) Genetics 122:19) along with FPR1 so that the final structure at the cloning site was 5′-proteasome subunit C-term—FPR1—proteasome subunit UTR. Each derivative of pRS306 was cut at a unique site within the carboxy-terminus of the proteasome subunit and transformed into DY001. Selection for integration was done on SC-URA, loopout of the marker was on 5-fluoroorotic acid containing plates. All tagged subunits were verified by sequencing.
Δpdr5 strains were generated by recombination of a URA3 marker flanked by 40 bp homologous to sequence immediately 5′ and 3′ to genomic PDR5.
Preparation of Reporter Plasmids
All versions of the reporters were derivatives of the vector pRS415 (Sikorski et al. (1989) Genetics 122:19). TOR1(S1972R) is an allele of TOR1 that has a severely impaired binding affinity to FPR1-rapamycin (Heitman et al. (1991) Science 253:905). The sequence corresponding to amino acids 1883-2078 for both Tor1 and Tor1 (S1972R) were amplified and inserted into the vector pRS415 along with HIS3 amplified from strain FY4. HA-tagged versions of the reporters had the hemagglutinin epitope fused C-terminal to His3.
Screen and Western Assays
In both assays, rapamycin was added to a final concentration of 1 μM, cycloheximide was added to a final concentration of 30 ng/ml and PS-341 was added to a final concentration of 200 μM. For liquid cultures, samples were extracted at fixed time intervals (0, 30, 60, 90 minutes) and whole cell extracts were made. 25 μg of total protein was used from each sample, resolved by SDS-PAGE and transferred to PVDF membranes. Membranes were blocked with 10% powdered nonfat milk in PBST overnight at 4° C. and incubated with anti-HA (3F10) primary antibody (Roche Diagnostics, Indianapolis, Ind.), then HP-conjugated anti-rat secondary antibody. Visualization was done using the ECL Western Blotting system (Amersham Biosciences, Piscataway, N.J.).
Purification of the Proteasome
26S proteasomes were affinity purified from strains Pre10-FPR1 and Rpn10 FPR1 using the Rpn11-TEV-ProA tag described previously (Leggett et al. (2002) Mol. Cell 10:495). Cells were grown in YPD, harvested, resuspended in 50 mM Tris-HCl [pH 8], 1 mM EDTA and lysed by French press. Lysates was centrifuged at 15,000×g for 25 minutes, filtered and incubated with IgG resin (ICN) for 1 hr at 4° C. Resin was collected in a column, washed with 100 bed volumes of 50 mM Tris-HCl [pH 8], 50 mM NaCl, 1 mM EDTA buffer and equilibrated with TEV-protease buffer (50 mM Tris-HCl [pH 7.5], 1 mM EDTA, 1 mM DTT). Elution was performed by incubating the resin in 1.5 bed volumes of TEV-protease buffer containing 50 U of 6 His-TEV-protease per ml of resin, at 30° C. for 1 hour. One single homogeneous fraction was collected and aliquoted for each prep. The integrity of the 26S complexes and presence of Pre10-FPR1 and Rpn10-FPR1 tagged subunits was analyzed by Coomassie staining, SDS-PAGE and immunodetection.
In Vitro Assay
HA-tagged TOR-HIS3 and TORS1972R-HIS3 were cut out of their respective pRS415 vectors, inserted into PROTet.133 and transformed into DH5αPRO cells (BD Biosciences). A 10 ml overnight culture was used to inoculate 1 L of media, which was subsequently growth for 4 hours at 37° C. The fusion protein production was induced with 100 ng/ml of anhydrotetracycline and the culture was growth for four hours at 30° C. Isolation of purified protein was done according to the manufacturers instructions, using a bead bed volume of 250 μl. 1.5 ml of the eluate was dialyzed against 50 mM Tris-HCl [pH 7.5], 1 mM EDTA and concentrated to approximately 1 mg/ml. The assays were performed in activity buffer (50 mM Tris-HCl [pH 7.5], 5 mM MgCl2, 1 mM EDTA, 5 mM ATP) containing 4 μg of proteasome and 1.6 μg of Tor-His3 or TorS1972R-His3, in an initial volume of 100 μl, at 30° C. Heterodimerization was induced with 1 μM rapamycin and proteasome activity was inhibited with 100 μM PS-341. Time course fractions were obtained by extraction of equal volumes from the reaction tub in regular intervals.
Plasmids
Plasmid pUG-spHIS5-FPR1HA was used to create strain Pre10-FPR1 by double homologous recombination of a linear amplified PCR product. Plasmid pRS306-Rpn10-FPR1 was cut with KasI and used to create strain Rpn10-FPR1 by two-step integration.
P415-TOR-HIS3:
TCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGA (SEQ ID NO:1)
GACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAG
GGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCAT
CAGAGCAGATTGTACTGAGAGTGCACCATATCGACTACGTCGTAAGGCCGTT
TCTGACAGAGTAAAATTCTTGAGGGAACTTTCACCATTATGGGAAATGGTTC
AAGAAGGTATTGACTTAAACTCCATCAAATGGTCAGGTCATTGAGTGTTTTTT
ATTTGTTGTATTTTTTTTTTTTTAGAGAAAATCCTCCAATATCAAATTAGGAAT
CGTAGTTTCATGATTTTCTGTTACACCTAACTTTTTGTGTGGTGCCCTCCTCCT
TGTCAATATTAATGTTAAAGTGCAATTCTTTTTCCTTATCACGTTGAGCCATTA
GTATCAATTTGCTTACCTGTATTCCTTTACTATCCTCCTTTTTCTCCTTCTTGAT
AAATGTATGTAGATTGCGTATATAGTTTCGTCTACCCTATGAACATATTCCAT
TTTGTAATTTCGTGTCGTTTCTATTATGAATTTCATTTATAAAGTTTATGTACA
AATATCATAAAAAAAGAGAATCTTTTTAAGCAAGGATTTTCTTAACTTCTTCG
GCGACAGCATCACCGACTTCGGTGGTACTGTTGGAACCACCTAAATCACCAG
TTCTGATACCTGCATCCAAAACCTTTTTAACTGCATCTTCAATGGCCTTACCTT
CTTCAGGCAAGTTCAATGACAATTTCAACATCATTGCAGCAGACAAGATAGT
GGCGATAGGGTCAACCTTATTCTTTGGCAAATCTGGAGCAGAACCGTGGCAT
GGTTCGTACAAACCAAATGCGGTGTTCTTGTCTGGCAAAGAGGCCAAGGACG
CAGATGGCAACAAACCCAAGGAACCTGGGATAACGGAGGCTTCATCGGAGA
TGATATCACCAAACATGTTGCTGGTGATTATAATACCATTTAGGTGGGTTGGG
TTCTTAACTAGGATCATGGCGGCAGAATCAATCAATTGATGTTGAACCTTCAA
TGTAGGGAATTCGTTCTTGATGGTTTCCTCCACAGTTTTTCTCCATAATCTTGA
AGAGGCCAAAACATTAGCTTTATCCAAGGACCAAATAGGCAATGGTGGCTCA
TGTTGTAGGGCCATGAAAGCGGCCATTCTTGTGATTCTTTGCACTTCTGGAAC
GGTGTATTGTTCACTATCCCAAGCGACACCATCACCATCGTCTTCCTTTCTCTT
ACCAAAGTAAATACCTCCCACTAATTCTCTGACAACAACGAAGTCAGTACCT
TTAGCAAATTGTGGCTTGATTGGAGATAAGTCTAAAAGAGAGTCGGATGCAA
AGTTACATGGTCTTAAGTTGGCGTACAATTGAAGTTCTTTACGGATTTTTAGT
AAACCTTGTTCAGGTCTAACACTACCGGTACCCCATTTAGGACCACCCACAG
CACCTAACAAAACGGCATCAACCTTCTTGGAGGCTTCCAGCGCCTCATCTGG
AAGTGGGACACCTGTAGCATCGATAGCAGCACCACCAATTAAATGATTTTCG
AAATCGAACTTGACATTGGAACGAACATCAGAAATAGCTTTAAGAACCTTAA
TGGCTTCGGCTGTGATTTCTTGACCAACGTGGTCACCTGGCAAAACGACGATC
TTCTTAGGGGCAGACATAGGGGCAGACATTAGAATGGTATATCCTTGAAATA
TATATATATATTGCTGAAATGTAAAAGGTAAGAAAAGTTAGAAAGTAAGACG
ATTGCTAACCACCTATTGGAAAAAACAATAGGTCCTTAAATAATATTGTCAA
CTTCAAGTATTGTGATGCAAGCATTTAGTCATGAACGCTTCTCTATTCTATAT
GAAAAGCCGGTTCCGGCCTCTCACCTTTCCTTTTTCTCCCAATTTTTCAGTTGA
AAAAGGTATATGCGTCAGGCGACCTCTGAAATTAACAAAAAATTTCCAGTCA
TCGAATTTGATTCTGTGCGATAGCGCCCCTGTGTGTTCTCGTTATGTTGAGGA
AAAAAATAATGGTTGCTAAGAGATTCGAACTCTTGCATCTTACGATACCTGA
GTATTCCCACAGTTAACTGCGGTCAAGATATTTCTTGAATCAGGCGCCTTAGA
CCGCTCGGCCAAACAACCAATTACTTGTTGAGAAATAGAGTATAATTATCCT
ATAAATATAACGTTTTTGAACACACATGAACAAGGAAGTACAGGACAATTGA
TTTTGAAGAGAATGTGGATTTTGATGTAATTGTTGGGATTCCATTTTTAATAA
GGCAATAATATTAGGTATGTGGATATACTAGAAGTTCTCCTCGACCGTCGATA
TGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGA
AATTGTAAACGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCA
GCTCATTTTTTAACCAATAGGCCGAAATCGGCAAAATCCCTTATAAATCAAA
AGAATAGACCGAGATAGGGTTGAGTGTTGTTCCAGTTTGGAACAAGAGTCCA
CTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGG
GCGATGGCCCACTACGTGAACCATCACCCTAATCAAGTTTTTTGGGGTCGAG
GTGCCGTAAAGCACTAAATCGGAACCCTAAAGGGAGCCCCCGATTTAGAGCT
TGACGGGGAAAGCCGGCGAACGTGGCGAGAAAGGAAGGGAAGAAAGCGAA
AGGAGCGGGCGCTAGGGCGCTGGCAAGTGTAGCGGTCACGCTGCGCGTAAC
CACCACACCCGCCGCGCTTAATGCGCCGCTACAGGGCGCGTCGCGCCATTCG
CCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGC
TATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGT
AACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAGCGC
GCGTAATACGACTCACTATAGGGCGAATTGGGTACCGGTACCGGCCGCAAAT
TAAAGCCTTCGAGCGTCCCAAAACCTTCTCAAGCAAGGTTTTCAGTATAATGT
TACATGCGTACACGCGTCTGTACAGAAAAAAAAGAAAAATTTGAAATATAAA
TAACGTTCTTAATACTAACATAACTATAAAAAAATAAATAGGGACCTAGACT
TCAGGTTGTCTAACTCCTTCCTTTTCGGTTAGAGCGGATGTGGGGGGAGGGCG
TGAATGTAAGCGTGACATAACTAATTACATGACCTCGAGGTCGACGGTATCG
ATAAGCTTGATATCGAATTCCTGCAGCCCGGGGGATCCCTACATAAGAACAC
CTTTGGTGGAGGGAACATCGTTGGTACCATTGGGCGAGGTGGCTTCTCTTATG
GCAACCGCAAGAGCCTTGAACGCACTCTCACTACGGTGATGATCATTCTTGC
CTCGCAGACAATCAACGTGGAGGGTAATTCTGCTAGCCTCTGCAAAGCTTTC
AAGAAAATGCGGGATCATCTCGCAAGAGAGATCTCCTACTTTCTCCCTTTGCA
AACCAAGTTCGACAACTGCGTACGGCCTGTTCGAAAGATCTACCACCGCTCT
GGAAAGTGCCTCATCCAAAGGCGCAAATCCTGATCCAAACCTTTTTACTCCA
CGCACGGCCCCTAGGGCCTCTTTAAAAGCTTGACCGAGAGCAATCCCGCAGT
CTTCAGTGGTGTGATGGTCGTCTATGTGTAAGTCACCAATGCACTCAACGATT
AGCGACCAGCCGGAATGCTTGGCCAGAGCATGTATCATATGGTCCAGAAACC
CTATACCTGTGTGGACGTTAATCACTTGCGATTGTGTGGCCTGTTCTGCTACT
GCTTCTGCCTCTTTTTCTGGGAAGATCGAGTGCTCTATCGCTAGGGGACCACC
CTTTAAAGAGATCGCAATCTGAATCTTGGTTTCATTTGTAATACGCTTTACTA
GGGCTTTCTGCTCTGTGGCTCGAGCAGGAACAGCCAATTCGAGATCATGAGT
AGCCAGAAGCTGGGGAGAAACATGCTGTAAGTCTAAGGTTTGTAACTGTGGT
ATTTGACGTGTTATTTTTCTGAAGACGTTATAATAAATATCCCAAGCTTGGTT
CAAATTATTGATGTCTTTTGACTTTTTGTAGTTATTCAACCATTCGTAGGCATC
GTTCAAATCTCTACCAAATGATTTCTGAAACGATACCTCACTTAACGTTTGAG
GCTCATTGCCTAAGTGTTTATGTAAAGGTTCTAAAGTAGAAAACATTTTTTCT
ATGTTATTCAACGAAAAATTGGCGGCTCGCATCTTCCAGTCCTTCATACCA
TAATTCGTGCCATAGAACGGCTACTCTGATCAACTCGTGACTAACTAATTCTG
CCTGGTTTACCAGGACTGGACTATGAATCCTAATTTTCTCTATTATTGAAAGA
GCCGCTTTTTGTCTTGAAACAGATTCAGACTTGATCGCGACAGTTAAAGGATA
CACGAGAGCTTGTGGATGAGCTTTCCCTAAATCAGAAAGCAACGACAAAAGG
GAATTACTCACCGTAGGATCTGGCTGATGTATCATGGATCCACTAGTTCTAGA
GCGGCCAGCTTGGAGTTGATTGTATGCTTGGTATAGCTTGAAATATTGTGCAG
AAAAAGAAACAAGGAAGAAAGGGAACGAGAACAATGACGAGGAAACAAAA
GATTAATAATTGCAGGTCTATTTATACTTGATAGCAAAGCGGCAAACTTTTTT
TATTTCAAATTCAAGTAACTGGAAGGAAGGCCGTATACCGTTGCTCATTAGA
GAGTAGTGTGCGTGAATGAAGGAAGGAAAAAGTTTCGTGTGTTCGAAGATAC
CCCTCATCAGCTCTGGAACAACGACATCTGTTGGTGCTGTCTTTGTCGTTAAT
TTTTTCCTTTAGTGTCTTCCATCATTTTTTTTGTCATTGCGGATATGGTGAGAC
AACAACGGGGGAGAGAGAAAAGAAAAAAAAAGAAAAGAAGTTGCATGCGC
CTATTATTACTTCAATAGATGGCAAATGGAAAAAGGGTAGTGAAACTTCGAT
ATGATGATGGCTATCAAGTCTAGGGCTACAGTATTAGTTCGTTATGTACCACC
ATCAATGAGGCAGTGTAATTGGTGTAGTCTTGTTTAGCCCATTATGTCTTGTC
TGGTATCTGTTCTATTGTATATCTCCCCTCCGCCACCTACATGTTAGGGAGAC
CAACGAAGGTATTATAGGAATCCCGATGTATGGGTTTGGTTGCCAGAAAAGA
GGAAGTCCATATTGTACACCCGGAAACAACAAAAGGATATCCGAAATATTCC
ACGGTTTAGAAAAAAATCGGAAAAGAGCGCGGAGGGGTGTTACCCCCCTTCT
CTACTAGCATTGGACTTTAATTAATATATGTGCATAGGAGAAGTGTAAAGTTC
CCTTCCATATTGTAACATAATAAAGTGCACACCCAAATGAATTGAAAGCGTA
CTCAAACAGACAACCATTTCCAGTGTTGTATGTACCTGTCTATTTATACTGGT
AGCAACCCTATTGCTGTTTCCTCTTCAAAGTACTCTAGCGGTTATGCGCGTCT
CACCTTCAAGGTCATGGTCGCTCTATTGTTCGCACCACCGGCAAACTCGCGTC
TCGCAAGTCTTGGCTCATTCTTCTAGTATACTCATGTTGCAAATGCACTCAGG
TTCTTTCGGCAACTTAAATAATGACACCAGTTGTCGTGGTCGTCATCATCGCA
ACCCCAACCGGCATTCTTATTGCTTCTCCAATCTCGCCCCTTAGCGCAGGGTA
AACCTTGGAAAATGCAGGCGCAAAAAACTCCGCCGGGCACAGCCTCACGCCC
AGCGTTATCGCCGGGCCGGCAAGAGCGCGGGTCCGCCACAGAGTCAGCATG
ATTGTGCAATTGCGTAAACTCGTTTTTTCGGCGCCGCAAAGCCAAATACATCA
TATCAACACTTTTCACTTTATTTTTCGTTCGACCCTTATATTTGTCTTTTGCCTT
CATGCTCCTTGATTTCCTATTTCATTTACCATCATTTCTTGAGCTCCAGCTTTT
GTTCCCTTTAGTGAGGGTTAATTGCGCGCTTGGCGTAATCATGGTCATAGCTG
TTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATAGGAGCCGG
AAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGGTAACTCACATTA
ATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCT
GCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGC
TCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCG
AGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGG
GATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAAC
CGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGA
GCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACT
ATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTC
CGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTG
GCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCG
CTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCC
TTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCC
ACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGT
GCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAG
TATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGT
AGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTG
CAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATC
TTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTT
GGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAAT
GAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTAC
CAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATC
CATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTA
CCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTC
CAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTG
GTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCT
AGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTAC
AGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTT
CCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGT
TAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTAT
CACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTA
AGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTG
TATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCG
CCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGC
GAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACT
CGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTG
AGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACAC
GGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATC
AGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAA
ACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGGGTCCTTTT
CATCACGTGCTATAAAAATAATTATAATTTAAATTTTTTAATATAAATATATA
AATTAAAAATAGAAAGTAAAAAAAGAAATTAAAGAAAAAATAGTTTTTGTTT
TCCGAAGATGTAAAAGACTCTAGGGGGATCGCCAACAAATACTACCTTTTAT
CTTGCTCTTCCTGCTCTCAGGTATTAATGCCGAATTGTTTCATCTTGTCTGTGT
AGAAGACCACACACGAAAATCCTGTGATTTTACATTTTACTTATCGTTAATCG
AATGTATATCTATTTAATCTGCTTTTCTTGTCTAATAAATATATATGTAAAGTA
CGCTTTTTGTTGAAATTTTTTAAACCTTTGTTTATTTTTTTTTCTTCATTCCGTA
ACTCTTCTACCTTCTTTATTTACTTTCTAAAATCCAAATACAAAACATAAAAA
TAAATAAACACAGAGTAAATTCCCAAATTATTCCATCATTAAAAGATACGAG
GCGCGTGTAAGTTACAGGCAAGCGATCCGTCCTAAGAAACCATTATTATCAT
GACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTC
P415-TOR-link-HIS3HA:
TCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGA (SEQ ID NO:2)
GACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAG
GGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCAT
CAGAGCAGATTGTACTGAGAGTGCACCATATCGACTACGTCGTAAGGCCGTT
TCTGACAGAGTAAAATTCTTGAGGGAACTTTCACCATTATGGGAAATGGTTC
AAGAAGGTATTGACTTAAACTCCATCAAATGGTCAGGTCATTGAGTGTTTTTT
ATTTGTTGTATTTTTTTTTTTTTAGAGAAAATCCTCCAATATCAAATTAGGAAT
CGTAGTTTCATGATTTTCTGTTACACCTAACTTTTTGTGTGGTGCCCTCCTCCT
TGTCAATATTAATGTTAAAGTGCAATTCTTTTTCCTTATCACGTTGAGCCATTA
GTATCAATTTGCTTACCTGTATTCCTTTACTATCCTCCTTTTTCTCCTTCTTGAT
AAATGTATGTAGATTGCGTATATAGTTTCGTCTACCCTATGAACATATTCCAT
TTTGTAATTTCGTGTCGTTTCTATTATGAATTTCATTTATAAAGTTTATGTACA
AATATCATAAAAAAAGAGAATCTTTTTAAGCAAGGATTTTCTTAACTTCTTCG
GCGACAGCATCACCGACTTCGGTGGTACTGTTGGAACCACCTAAATCACCAG
TTCTGATACCTGCATCCAAAACCTTTTTAACTGCATCTTCAATGGCCTTACCTT
CTTCAGGCAAGTTCAATGACAATTTCAACATCATTGCAGCAGACAAGATAGT
GGCGATAGGGTCAACCTTATTCTTTGGCAAATCTGGAGCAGAACCGTGGCAT
GGTTCGTACAAACCAAATGCGGTGTTCTTGTCTGGCAAAGAGGCCAAGGACG
CAGATGGCAACAAACCCAAGGAACCTGGGATAACGGAGGCTTCATCGGAGA
TGATATCACCAAACATGTTGCTGGTGATTATAATACCATTTAGGTGGGTTGGG
TTCTTAACTAGGATCATGGCGGCAGAATCAATCAATTGATGTTGAACCTTCAA
TGTAGGGAATTCGTTCTTGATGGTTTCCTCCACAGTTTTTCTCCATAATCTTGA
AGAGGCCAAAACATTAGCTTTATCCAAGGACCAAATAGGCAATGGTGGCTCA
TGTTGTAGGGCCATGAAAGCGGCCATTCTTGTGATTCTTTGCACTTCTGGAAC
GGTGTATTGTTCACTATCCCAAGCGACACCATCACCATCGTCTTCCTTTCTCTT
ACCAAAGTAAATACCTCCCACTAATTCTCTGACAACAACGAAGTCAGTACCT
TTAGCAAATTGTGGCTTGATTGGAGATAAGTCTAAAAGAGAGTCGGATGCAA
AGTTACATGGTCTTAAGTTGGCGTACAATTGAAGTTCTTTACGGATTTTTAGT
AAACCTTGTTCAGGTCTAACACTACCGGTACCCCATTTAGGACCACCCACAG
CACCTAACAAAACGGCATCAACCTTCTTGGAGGCTTCCAGCGCCTCATCTGG
AAGTGGGACACCTGTAGCATCGATAGCAGCACCACCAATTAAATGATTTTCG
AAATCGAACTTGACATTGGAACGAACATCAGAAATAGCTTTAAGAACCTTAA
TGGCTTCGGCTGTGATTTCTTGACCAACGTGGTCACCTGGCAAAACGACGATC
TTCTTAGGGGCAGACATAGGGGCAGACATTAGAATGGTATATCCTTGAAATA
TATATATATATTGCTGAAATGTAAAAGGTAAGAAAAGTTAGAAAGTAAGACG
ATTGCTAACCACCTATTGGAAAAAACAATAGGTCCTTAAATAATATTGTCAA
CTTCAAGTATTGTGATGCAAGCATTTAGTCATGAACGCTTCTCTATTCTATAT
GAAAAGCCGGTTCCGGCCTCTCACCTTTCCTTTTTCTCCCAATTTTTCAGTTGA
AAAAGGTATATGCGTCAGGCGACCTCTGAAATTAACAAAAAATTTCCAGTCA
TCGAATTTGATTCTGTGCGATAGCGCCCCTGTGTGTTCTCGTTATGTTGAGGA
AAAAAATAATGGTTGCTAAGAGATTCGAACTCTTGCATCTTACGATACCTGA
GTATTCCCACAGTTAACTGCGGTCAAGATATTTCTTGAATCAGGCGCCTTAGA
CCGCTCGGCCAAACAACCAATTACTTGTTGAGAAATAGAGTATAATTATCCT
ATAAATATAACGTTTTTGAACACACATGAACAAGGAAGTACAGGACAATTGA
TTTTGAAGAGAATGTGGATTTTGATGTAATTGTTGGGATTCCATTTTTAATAA
GGCAATAATATTAGGTATGTGGATATACTAGAAGTTCTCCTCGACCGTCGATA
TGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGA
AATTGTAAACGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCA
GCTCATTTTTTAACCAATAGGCCGAAATCGGCAAAATCCCTTATAAATCAAA
AGAATAGACCGAGATAGGGTTGAGTGTTGTTCCAGTTTGGAACAAGAGTCCA
CTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGG
GCGATGGCCCACTACGTGAACCATCACCCTAATCAAGTTTTTTGGGGTCGAG
GTGCCGTAAAGCACTAAATCGGAACCCTAAAGGGAGCCCCCGATTTAGAGCT
TGACGGGGAAAGCCGGCGAACGTGGCGAGAAAGGAAGGGAAGAAAGCGAA
AGGAGCGGGCGCTAGGGCGCTGGCAAGTGTAGCGGTCACGCTGCGCGTAAC
CACCACACCCGCCGCGCTTAATGCGCCGCTACAGGGCGCGTCGCGCCATTCG
CCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGC
TATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGT
AACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAGCGC
GCGTAATACGACTCACTATAGGGCGAATTGGGTACCGGTACCGGCCGCAAAT
TAAAGCCTTCGAGCGTCCCAAAACCTTCTCAAGCAAGGTTTTCAGTATAATGT
TACATGCGTACACGCGTCTGTACAGAAAAAAAAGAAAAATTTGAAATATAAA
TAACGTTCTTAATACTAACATAACTATAAAAAAATAAATAGGGACCTAGACT
TCAGGTTGTCTAACTCCTTCCTTTTCGGTTAGAGCGGATGTGGGGGGAGGGCG
TGAATGTAAGCGTGACATAACTAATTACATGACCTCGAGGTCGACTTAAGCG
TAATCTGGAACATCGTATGGGTACTGCAGCATAAGAACACCTTTGGTGGAGG
GAACATCGTTGGTACCATTGGGCGAGGTGGCTTCTCTTATGGCAACCGCAAG
AGCCTTGAACGCACTCTCACTACGGTGATGATCATTCTTGCCTCGCAGACAAT
CAACGTGGAGGGTAATTCTGCTAGCCTCTGCAAAGCTTTCAAGAAAATGCGG
GATCATCTCGCAAGAGAGATCTCCTACTTTCTCCCTTTGCAAACCAAGTTCGA
CAACTGCGTACGGCCTGTTCGAAAGATCTACCACCGCTCTGGAAAGTGCCTC
ATCCAAAGGCGCAAATCCTGATCCAAACCTTTTTACTCCACGCACGGCCCCTA
GGGCCTCTTTAAAAGCTTGACCGAGAGCAATCCCGCAGTCTTCAGTGGTGTG
ATGGTCGTCTATGTGTAAGTCACCAATGCACTCAACGATTAGCGACCAGCCG
GAATGCTTGGCCAGAGCATGTATCATATGGTCCAGAAACCCTATACCTGTGT
GGACGTTAATCACTTGCGATTGTGTGGCCTGTTCTGCTACTGCTTCTGCCTCTT
TTTCTGGGAAGATCGAGTGCTCTATCGCTAGGGGACCACCCTTTAAAGAGAT
CGCAATCTGAATCTTGGTTTCATTTGTAATACGCTTTACTAGGGCTTTCTGCTC
TGTGCGGCCGCTGCCGCCCGTACGGGAACTATGCATCTCTGAGGAATGGTCTT
CTCCTCCAACAAAACACCTAGGAGGAACAGCCAATTCGAGATCATGAGTAGC
CAGAAGCTGGGGAGAAACATGCTGTAAGTCTAAGGTTTGTAACTGTGGTATT
TGACGTGTTATTTTTCTGAAGACGTTATAATAAATATCCCAAGCTTGGTTCAA
ATTATTGATGTCTTTTGACTTTTTGTAGTTATTCAACCATTCGTAGGCATCGTT
CAAATCTCTACCAAATGATTTCTGAAACGATACCTCACTTAACGTTTGAGGCT
CATTGCCTAAGTGTTTATGTAAAGGTTCTAAAGTAGAAAACATTTTTTCTATG
TTATGTTCAACGAAAAATTGGCGGCTCGCATCTTCCAGTCCTTCATACCATAA
TTCGTGCCATAGAACGGCTACTCTGATCAACTCGTGACTAACTAATTCTGCCT
GGTTTACCAGGACTGGACTATGAATCCTAATTTTCTCTATTATTGAAAGAGCC
GCTTTTTGTCTTGAAACAGATTCAGACTTGATCGCGACAGTTAAAGGATACAC
GAGAGCTTGTGGATGAGCTTTCCCTAAATCAGAAAGCAACGACAAAAGGGA
ATTACTCACCGTAGGATCTGGCTGATGTATCATGGATCCACTAGTTCTAGAGC
GGCCAGCTTGGAGTTGATTGTATGCTTGGTATAGCTTGAAATATTGTGCAGAA
AAAGAAACAAGGAAGAAAGGGAACGAGAACAATGACGAGGAAACAAAAGA
TTAATAATTGCAGGTCTATTTATACTTGATAGCAAAGCGGCAAACTTTTTTTA
TTTCAAATTCAAGTAACTGGAAGGAAGGCCGTATACCGTTGCTCATTAGAGA
GTAGTGTGCGTGAATGAAGGAAGGAAAAAGTTTCGTGTGTTCGAAGATACCC
CTCATCAGCTCTGGAACAACGACATCTGTTGGTGCTGTCTTTGTCGTTAATTTT
TTCCTTTAGTGTCTTCCATCATTTTTTTTGTCATTGCGGATATGGTGAGACAAC
AACGGGGGAGAGAGAAAAGAAAAAAAAAGAAAAGAAGTTGCATGCGCCTAT
TATTACTTCAATAGATGGCAAATGGAAAAAGGGTAGTGAAACTTCGATATGA
TGATGGCTATCAAGTCTAGGGCTACAGTATTAGTTCGTTATGTACCACCATCA
ATGAGGCAGTGTAATTGGTGTAGTCTTGTTTAGCCCATTATGTCTTGTCTGGT
ATCTGTTCTATTGTATATCTCCCCTCCGCCACCTACATGTTAGGGAGACCAAC
GAAGGTATTATAGGAATCCCGATGTATGGGTTTGGTTGCCAGAAAAGAGGAA
GTCCATATTGTACACCCGGAAACAACAAAAGGATATCCGAAATATTCCACGG
TTTAGAAAAAAATCGGAAAAGAGCGCGGAGGGGTGTTACCCCCCTTCTCTAC
TAGCATTGGACTTTAATTAATATATGTGCATAGGAGAAGTGTAAAGTTCCCTT
CCATATTGTAACATAATAAAGTGCACACCCAAATGAATTGAAAGCGTACTCA
AACAGACAACCATTTCCAGTGTTGTATGTACCTGTCTATTTATACTGGTAGCA
ACCCTATTGCTGTTTCCTCTTCAAAGTACTCTAGCGGTTATGCGCGTCTCACCT
TCAAGGTCATGGTCGCTCTATTGTTCGCACCACCGGCAAACTCGCGTCTCGCA
AGTCTTGGCTCATTCTTCTAGTATACTCATGTTGCAAATGCACTCAGGTTCTTT
CGGCAACTTAAATAATGACACCAGTTGTCGTGGTCGTCATCATCGCAACCCC
AACCGGCATTCTTATTGCTTCTCCAATCTCGCCCCTTAGCGCAGGGTAAACCT
TGGAAAATGCAGGCGCAAAAAACTCCGCCGGGCACAGCCTCACGCCCAGCG
TTATCGCCGGGCCGGCAAGAGCGCGGGTCCGCCACAGAGTCAGCATGATTGT
GCAATTGCGTAAACTCGTTTTTTCGGCGCCGCAAAGCCAAATACATCATATCA
ACACTTTTCACTTTATTTTTCGTTCGACCCTTATATTTTGTCTTTTGCCTTCATGC
TCCTTGATTTCCTATTTCATTTACCATCATTTCTTGAGCTCCAGCTTTTGTTCCC
TTTAGTGAGGGTTAATTGCGCGCTTGGCGTAATCATGGTCATAGCTGTTTCCT
GTGTGAAATTGTTATCCGCTCACAATTCCACACAACATAGGAGCCGGAAGCA
TAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGGTAACTCACATTAATTGC
GTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATT
AATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTC
CGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGG
TATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAA
CGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAA
AAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATC
ACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAA
GATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACC
CTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCT
TTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCA
AGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCC
GGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGG
CAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTAC
AGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTT
GGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCT
CTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAG
CAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTT
CTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGT
CATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGA
AGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCA
ATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCA
TAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACC
ATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCA
GATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGT
CCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAG
AGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAG
GCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCC
CAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTA
GCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCA
CTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAG
ATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTA
TGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCC
ACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGA
AAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCG
TGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAG
CAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGG
AAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAG
GGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACA
AATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGGGTCCTTTTCAT
CACGTGCTATAAAAATAATTATAATTTAAATTTTTTAATATAAATATATAAAT
TAAAAATAGAAAGTAAAAAAAGAAATTAAAGAAAAAATAGTTTTTGTTTTCC
GAAGATGTAAAAGACTCTAGGGGGATCGCCAACAAATACTACCTTTTATCTT
GCTCTTCCTGCTCTCAGGTATTAATGCCGAATTGTTTCATCTTGTCTGTGTAGA
AGACCACACACGAAAATCCTGTGATTTTACATTTTACTTATCGTTAATCGAAT
GTATATCTATTTAATCTGCTTTTCTTGTCTAATAAATATATATGTAAAGTACGC
TTTTTGTTGAAATTTTTTAAACCTTTGTTTATTTTTTTTTCTTCATTCCGTAACT
CTTCTACCTTCTTTATTTACTTTCTAAAATCCAAATACAAAACATAAAAATAA
ATAAACACAGAGTAAATTCCCAAATTATTCCATCATTAAAAGATACGAGGCG
CGTGTAAGTTACAGGCAAGCGATCCGTCCTAAGAAACCATTATTATCATGAC
ATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTC
pUG-spHIS5-FPR1HA:
GAACGCGGCCGCCAGCTGAAGCTTCGTACGTCTGAAGTAATTGAAGGTAACG (SEQ ID NO:3)
TCAAAATTGACAGAATTTCCCCAGGTGATGGTGCCACCTTCCCAAAGACAGG
TGACTTGGTTACCATTCATTACACCGGTACCTTGGAGAACGGCCAAAAATTCG
ATTCCTCCGTTGACAGGGGCTCTCCATTCCAATGTAACATCGGTGTCGGCCAA
GTCATCAAGGGTTGGGATGTTGGTATTCCAAAGTTGTCTGTTGGTGAAAAAG
CTAGGTTAACCATCCCTGGCCCATATGCTTATGGCCCACGTGGTTTCCCAGGT
TTGATTCCACCAAACAGTACTTTGGTTTTCGACGTCGAATTGTTGAAGGTCAA
CGGATCCTACCCATACGATGTTCCAGATTACGCTTAAGTCGACAACCCTTAAT
ATAACTTCGTATAATGTATGCTATACGAAGTTATTAGGTCTAGAGATCTGTTT
AGCTTGCCTCGTCCCCGCCGGGTCACCCGGCCAGCGACATGGAGGCCCAGAA
TACCCTCCTTGACAGTCTTGACGTGCGCAGCTCAGGGGCATGATGTGACTGTC
GCCCGTACATTTAGCCCATACATCCCCATGTATAATCATTTGCATCCATACAT
TTTGATGGCCGCACGGCGCGAAGCAAAAATTACGGCTCCTCGCTGCAGACCT
GCGAGCAGGGAAACGCTCCCCTCACAGACGCGTTGAATTGTCCCCACGCCGC
GCCCCTGTAGAGAAATATAAAAGGTTAGGATTTGCCACTGAGGTTCTTCTTTC
ATATACTTCCTTTTAAAATCTTGCTAGGATACAGTTCTCACATCACATCCGAA
CATAAACAACCATGGGTAGGAGGGCTTTTGTAGAAAGAAATACGAACGAAA
CGAAAATCAGCGTTGCCATCGCTTTGGACAAAGCTCCCTTACCTGAAGAGTC
GAATTTTATTGATGAACTTATAACTTCCAAGCATGCAAACCAAAAGGGAGAA
CAAGTAATCCAAGTAGACACGGGAATTGGATTCTTGGATCACATGTATCATG
CACTGGCTAAACATGCAGGCTGGAGCTTACGACTTTACTCAAGAGGTGATTT
AATCATCGATGATCATCACACTGCAGAAGATACTGCTATTGCACTTGGTATTG
CATTCAAGCAGGCTATGGGTAACTTTGCCGGCGTTAAAAGATTTGGACATGC
TTATTGTCCACTTGACGAAGCTCTTTCTAGAAGCGTAGTTGACTTGTCGGGAC
GGCCCTATGCTGTTATCGATTTGGGATTAAAGCGTGAAAAGGTTGGGGAATT
GTCCTGTGAAATGATCCCTCACTTACTATATTCCTTTTCGGTAGCAGCTGGAA
TTACTTTGCATGTTACCTGCTTATATGGTAGTAATGACCATCATCGTGCTGAA
AGCGCTTTTAAATCTCTGGCTGTTGCCATGCGCGCGGCTACTAGTCTTACTGG
AAGTTCTGAAGTCCCAAGCACGAAGGGAGTGTTGTAAAGAGTACTGACAATA
AAAAGATTCTTGTTTTCAAGAACTTGTCATTTGTATAGTTTTTTTATATTGTAG
TTGTTCTATTTTAATCAAATGTTAGCGTGATTTATATTTTTTTTCGCCTCGACA
TCATCTGCCCAGATGCGAAGTTAAGTGCGCAGAAAGTAATATCATGCGTCAA
TCGTATGTGAATGCTGGTCGCTATACTGCTGTCGATTCGATACTAACGCCGCC
ATCCAGTTTAAACGAGCTCTCGAGAACCCTTAATATAACTTCGTATAATGTAT
GCTATACGAAGTTATTAGGTGATATCAGATCCACTAGTGGCCTATGCGGCCG
CGGATCTGCCGGTCTCCCTATAGTGAGTCGTATTAATTTCGATAAGCCAGGTT
AACCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTG
GGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTG
CGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAAT
CAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCA
GGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCT
GACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACA
GGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCC
TGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAA
GCGTGGCGCTTTCTCAATGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTC
GTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCT
GCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTA
TCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAG
GCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAG
GACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGA
GTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTT
TGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCT
TTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGG
GATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATT
AAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGA
CAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTC
GTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAG
GGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCAC
CGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCA
GAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGG
GAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCAT
TGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCT
CCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAA
AGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAG
TGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCA
TCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGA
ATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAAT
ACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTT
CGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTA
ACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTT
CTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGG
CGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGC
ATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAA
AAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGAC
GTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCA
CGAGGCCCTTTCGTCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACAC
ATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCA
GACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCT
TAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATGGACATA
TTGTCGTTAGAACGCGGCTACAATTAATACATAACCTTATGTATCATACACAT
ACGATTTAGGTGACACTATA
pRS306-Rpn10-FPR1:
TCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGA (SEQ ID NO:4)
GACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAG
GGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCAT
CAGAGCAGATTGTACTGAGAGTGCACCACGCTTTTCAATTCAATTCATCATTT
TTTTTTTATTCTTTTTTTTGATTTCGGTTTCTTTGAAATTTTTTTGATTCGGTAA
TCTCCGAACAGAAGGAAGAACGAAGGAAGGAGCACAGACTTAGATTGGTAT
ATATACGCATATGTAGTGTTGAAGAAACATGAAATTGCCCAGTATTCTTAACC
CAACTGCACAGAACAAAAACCTGCAGGAAACGAAGATAAATCATGTCGAAA
GCTACATATAAGGAACGTGCTGCTACTCATCCTAGTCCTGTTGCTGCCAAGCT
ATTTAATATCATGCACGAAAAGCAAACAAACTTGTGTGCTTCATTGGATGTTC
GTACCACCAAGGAATTACTGGAGTTAGTTGAAGCATTAGGTCCCAAAATTTG
TTTACTAAAAACACATGTGGATATCTTGACTGATTTTTCCATGGAGGGCACAG
TTAAGCCGCTAAAGGCATTATCCGCCAAGTACAATTTTTTACTCTTCGAAGAC
AGAAAATTTGCTGACATTGGTAATACAGTCAAATTGCAGTACTCTGCGGGTG
TATACAGAATAGCAGAATGGGCAGACATTACGAATGCACACGGTGTGGTGGG
CCCAGGTATTGTTAGCGGTTTGAAGCAGGCGGCAGAAGAAGTAACAAAGGA
ACCTAGAGGCCTTTTGATGTTAGCAGAATTGTCATGCAAGGGCTCCCTATCTA
CTGGAGAATATACTAAGGGTACTGTTGACATTGCGAAGAGCGACAAAGATTT
TGTTATCGGCTTTATTGCTCAAAGAGACATGGGTGGAAGAGATGAAGGTTAC
GATTGGTTGATTATGACACCCGGTGTGGGTTTAGATGACAAGGGAGACGCAT
TGGGTCAACAGTATAGAACCGTGGATGATGTGGTCTCTACAGGATCTGACAT
TATTATTGTTGGAAGAGGACTATTTGCAAAGGGAAGGGATGCTAAGGTAGAG
GGTGAACGTTACAGAAAAGCAGGCTGGGAAGCATATTTGAGAAGATGCGGC
CAGCAAAACTAAAAAACTGTATTATAAGTAAATGCATGTATACTAAACTCAC
AAATTAGAGCTTCAATTTAATTATATCAGTTATTACCCTGCGGTGTGAAATAC
CGCACAGATGCGTAAGGAGAAAATACCGCATCAGGAAATTGTAAACGTTAAT
ATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTTTAACCAA
TAGGCCGAAATCGGCAAAATCCCTTATAAATCAAAAGAATAGACCGAGATAG
GGTTGAGTGTTGTTCCAGTTTGGAACAAGAGTCCACTATTAAAGAACGTGGA
CTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTACGT
GAACCATCACCCTAATCAAGTTTTTTGGGGTCGAGGTGCCGTAAAGCACTAA
ATCGGAACCCTAAAGGGAGCCCCCGATTTAGAGCTTGACGGGGAAAGCCGG
CGAACGTGGCGAGAAAGGAAGGGAAGAAAGCGAAAGGAGCGGGCGCTAGG
GCGCTGGCAAGTGTAGCGGTCACGCTGCGCGTAACCACCACACCCGCCGCGC
TTAATGCGCCGCTACAGGGCGCGTCGCGCCATTCGCCATTCAGGCTGCGCAA
CTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCG
AAGGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCC
AGTCACGACGTTGTAAAACGACGGCCAGTGAATTGTAATACGACTCACTATA
GGGCGAATTGGAGCTCCACCGCGGTGGCGGCCGCAAAGGATTTTCGGTAAGC
GATATTCTAAAGAAGGACTACAAACAATTCAATTTCCAAGGAAAGGGACACA
AAGGGTTAGAGATTGGTCTTTCATCAATAGTAAAAAGAATGTCTTGGCTATTC
AATGAACACGGTGGTGAAGCAGATTTCGTCAACCAATGCAGAAGATTTCAGG
CGGAGAGGGGGCTCGATGTATTGGTTCTGTTGACTTCATGGAGGAAAGCTGG
TGATTCACACAGAGAATTGGTCATATTGGGAGACTCTAACGTGGTACGTGAA
CTCATTGAAAGGGTTAGCGACAAGCTCCAACTTCAATTATTTGGGGGCAATCT
TGATGGAGGTGTGGCGATGTTTAAGCAACTGAACGTCGAGGCCACCAGAAAG
CAAGTCGTCCCCTATTTAGAGGAAGCGTACTCAAACCTGGTTAATTAATTAGT
TGACCTTCAACAATTCGACGTCGAAAACCAAAGTACTGTTTGGTGGAATCAA
ACCTGGGAAACCACGTGGGCCATAAGCATATGGGCCAGGGATGGTTAACCTA
GCTTTTTCACCAACAGACAACTTTGGAATACCAACATCCCAACCCTTGATGAC
TTGGCCGACACCGATGTTACATTGGAATGGAGAGCCCCTGTCAACGGAGGAA
TCGAATTTTTGGCCGTTCTCCAAGGTACCGGTGTAATGAATGGTAACCAAGTC
ACCTGTCTTTGGGAAGGTGGCACCATCACCTGGGGAAATTCTGTCAATTTTGA
CGTTACCTTCAATTACTTCAGACGTACGGGAACTATGCATCTCTGAGGAATGG
TCTTCTCCTCCAACAAAACAGCATGCTTTGTCTTGGTGTTGTTCAGGCTGTTCA
GACTGCTCAGGCTGATCTTGTTGTTGTTGCTGCTGTCTTAACCTTTCCTGTCTT
TGCTGCTCTTCTTCCATAGACAGACGCAAGGCCATTGCCAGTTCTGGGTCCAT
TGATGGGTCTACCCCGAAGTCCATAAATGTGCCATTGGCATCGGAATCACCG
CCAGACCCACCAAAGGCGCCCATACCGGAGGATCCTTCTTCGAGAATTATGG
GTGAAGATGCGATGTTCTCGTACAGCAGTCTGGGGCCAGGCGTCACAGTAAG
CAAATGACTAGTTTCTTCTTGAGGGTTGTTCACTGCAGCTATGAACTCATCCA
AAAGCTCCGTGTTCTGTTCAATCTCTCCAAAATTGATGATGTCCACGGCAACA
TTATTCTTTTTCAGTGTTTTTGCCAATCTGATCAATTCGTCTTCTAGAACTAGT
GGATCCCCCGGGCTGCAGGAATTCGATATCAAGCTTATCGATACCGTCGACC
TCGAGGGGGGGCCCGGTACCCAGCTTTTGTTCCCTTTAGTGAGGGTTAATTCC
GAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGC
TCACAATTCCACACAACATAGGAGCCGGAAGCATAAAGTGTAAAGCCTGGGG
TGCCTAATGAGTGAGGTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTT
TCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGC
GGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACT
CGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGC
GGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTG
AGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGC
GTTTTTCCATAGGCTCGGCCCCCCTGACGAGCATCACAAAAATCGACGCTCA
AGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTCCCCC
CTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATAC
CTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCAATGCTCACGCTG
TAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACG
AACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAG
TCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACA
GGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTG
GCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGA
AGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAAC
CACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAA
AAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAG
TGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGA
TCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGT
ATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCAC
CTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTGCCCGTCG
TGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAAT
GATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAG
CCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCA
TCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAAT
AGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTC
GTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACAT
GATCCCCCATGTTGTGAAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTT
GTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGC
ATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAG
TACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTG
CCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTG
CTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCT
GTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCAT
CTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGC
CGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTC
CTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATA
CATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTT
CCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAA
CCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTC
PROTet.e133-TOR-link-HIS3HA:
TCGAGTCCCTATCAGTGATAGAGATTGACATCCCTATCAGTGATAGAGATACT (SEQ ID NO:5)
GAGCACATCAGCAGGACGCACTGACCGAATTCATTAAAGAGGAGAAAGGTA
CCCATGGGTCATAATCATAATCATAATCATAATCATAATCACAACGGTGGAG
ATGACGATGACAAGGTGGTCGACAAGCTTGGATCCATGATACATCAGCCAGA
TCCTACGGTGAGTAATTCCCTTTTGTCGTTGCTTTCTGATTTAGGGAAAGCTC
ATCCACAAGCTCTCGTGTATCCTTTAACTGTCGCGATCAAGTCTGAATCTGTT
TCAAGACAAAAAGCGGCTCTTTCAATAATAGAGAAAATTAGGATTCATAGTC
CAGTCCTGGTAAACCAGGCAGAATTAGTTAGTCACGAGTTGATCAGAGTAGC
CGTTCTATGGCACGAATTATGGTATGAAGGACTGGAAGATGCGAGCCGCCAA
TTTTTCGTTGAACATAACATAGAAAAAATGTTTTCTACTTTAGAACCTTTACA
TAAACACTTAGGCAATGAGCCTCAAACGTTAAGTGAGGTATCGTTTCAGAAA
TCATTTGGTAGAGATTTGAACGATGCCTACGAATGGTTGAATAACTACAAAA
AGTCAAAAGACATCAATAATTTGAACCAAGCTTGGGATATTTATTATAACGT
CTTCAGAAAAATAACACGTCAAATACCACAGTTACAAACCTTAGACTTACAG
CATGTTTCTCCCCAGCTTCTGGCTACTCATGATCTCGAATTGGCTGTTCCTCCT
AGGTGTTTTGTTGGAGGAGAAGACCATTCCTCAGAGATGCATAGTTCCCGTA
CGGGCGGCAGCGGCCGCACAGAGCAGAAAGCCCTAGTAAAGCGTATTACAA
ATGAAACCAAGATTCAGATTGCGATCTCTTTAAAGGGTGGTCCCCTAGCGAT
AGAGCACTCGATCTTCCCAGAAAAAGAGGCAGAAGCAGTAGCAGAACAGGC
CACACAATCGCAAGTGATTAACGTCCACACAGGTATAGGGTTTCTGGACCAT
ATGATACATGCTCTGGCCAAGCATTCCGGCTGGTCGCTAATCGTTGAGTGCAT
TGGTGACTTACACATAGACGACCATCACACCACTGAAGACTGCGGGATTGCT
CTCGGTCAAGCTTTTAAAGAGGCCCTAGGGGCCGTGCGTGGAGTAAAAAGGT
TTGGATCAGGATTTGCGCCTTTGGATGAGGCACTTTCCAGAGCGGTGGTAGAT
CTTTCGAACAGGCCGTACGCAGTTGTCGAACTTGGTTTGCAAAGGGAGAAAG
TAGGAGATCTCTCTTGCGAGATGATCCCGCATTTTCTTGAAAGCTTTGCAGAG
GCTAGCAGAATTACCCTCCACGTTGATTGTCTGCGAGGCAAGAATGATCATC
ACCGTAGTGAGAGTGCGTTCAAGGCTCTTGCGGTTGCCATAAGAGAAGCCAC
CTCGCCCAATGGTACCAACGATGTTCCCTCCACCAAAGGTGTTCTTATGCTGC
AGTACCCATACGATGTTCCAGATTACGCTTAAGTCGACCTCGAGGTCATGTAA
TTAGTTATGTCACGCTTACATTCACGCCCTCCCCCCACATCCGCTCTAACCGA
AAAGGAAGGAGTTAGACAACCTGAAGTCTAGGTCCCTATTTATTTTTTTATAG
TTATGTTAGTATTAAGAACGTTATTTATATTTCAAATTTTTCTTTTTTTTCTGTA
CAGACGCGTGTACGCATGTAACATTATACTGAAAACCTTGCTTGAGAAGGTT
TTGGGACGCTCGAAGGCTTTAATTTGCGGCCGGTACCGGTACCCAATTCGCCC
TATAGTGAGTCGTATTACGCGCGCTCACTGGCCGTCGTTTTACAACGTCGTGA
CTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTT
TCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGATGCGGCCGCTT
AATTAATTAATCTAGAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACT
GGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACA
AATCCGCCGCCCTAGACCTAGGCGTTCGGCTGCGGCGAGCGGTATCAGCTCA
CTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAA
GAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGC
GTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATC
GACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGG
CGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTT
ACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCAATG
CTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCT
GTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTAT
CGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCA
CTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTT
GAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGC
GCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCG
GCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTGTTTGCAAGCAGCAGATT
ACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGT
CTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGACTAG
TGCTTGGATTCTCACCAATAAAAAACGCCCGGCGGCAACCGAGCGTTCTGAA
CAAATCCAGATGGAGTTCTGAGGTCATTACTGGATCTATCAACAGGAGTCCA
AGCGAGCTCGATATCAAATTACGCCCCGCCCTGCCACTCATCGCAGTACTGTT
GTAATTCATTAAGCATTCTGCCGACATGGAAGCCATCACAGACGGCATGATG
AACCTGAATCGCCAGCGGCATCAGCACCTTGTCGCCTTGCGTATAATATTTGC
CCATGGTGAAAACGGGGGCGAAGAAGTTGTCCATATTGGCCACGTTTAAATC
AAAACTGGTGAAACTCACCCAGGGATTGGCTGAGACGAAAAACATATTCTCA
ATAAACCCTTTAGGGAAATAGGCCAGGTTTTCACCGTAACACGCCACATCTT
GCGAATATATGTGTAGAAACTGCCGGAAATCGTCGTGGTATTCACTCCAGAG
CGATGAAAACGTTTCAGTTTGCTCATGGAAAACGGTGTAACAAGGGTGAACA
CTATCCCATATCACCAGCTCACCGTCTTTCATTGCCATACGAAATTCCGGATG
AGCATTCATCAGGCGGGCAAGAATGTGAATAAAGGCCGGATAAAACTTGTGC
TTATTTTTCTTTACGGTCTTTAAAAAGGCCGTAATATCCAGCTGAACGGTCTG
GTTATAGGTACATTGAGCAACTGACTGAAATGCCTCAAAATGTTCTTTACGAT
GCCATTGGGATATATCAACGGTGGTATATCCAGTGATTTTTTTCTCCATTTTA
GCTTCCTTAGCTCCTGAAAATCTCGATAACTCAAAAAATACGCCCGGTAGTG
ATCTTATTTCATTATGGTGAAAGTTGGAACCTCTTACGTGCCGATCAACGTCT
CATTTTCGCCAGATATCGACGTCTAAGAAACCATTATTATCATGACATTAACC
TATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTTCACC
Primers
All primers used to construct the plasmids described above are set forth below. Construction of the TORS1972R vectors used the same primers as the TOR vectors.
Primers for p415-TOR-HIS3
TOR-BamHI-L: 5′-cagcggggatccATGATACATCAGCCAGATCCTAC-3′ (SEQ ID NO:6)
TOR-XhoI-R: 5′-cagcgactcgagcAGGAACAGCCAATTCGAGAT-3′ (SEQ ID NO:7)
HIS3-XhoI-L: 5′-caggtcctcgagccACAGAGCAGAAAGCCCTAGTA-3′ (SEQ ID NO:8)
HIS3-BamHI-R: 5′-catcgtggatccCTACATAAGAACACCTTTGGT-3′ (SEQ ID NO:9)
Primers for p415-TOR-link-HIS3HA
TOR-BamHI-L: 5′-cagcggggatccATGATACATCAGCCAGATCCTAC-3′ (SEQ ID NO:10)
tor-link-R-AvrII-BsiWI: 5′-cagaaccgtacgGGAACTATGCATCTCTGAGGAATGG TC (SEQ ID NO:11)
TTCTCCTCCAACAAAACAcctaggAGGAACAGCCAATTCGAGAT-3′
HIS3-NotI-L: 5′-caggtcgcggccgcACAGAGCAGAAAGCCCTAGTA-3′ (SEQ ID NO:12)
HIS3-HA-R-PstI-SalI: 5′-cagaacgtcgacTTAAGCGTAATCTGGAACATCGTATGG (SEQ ID NO:13)
GTA ctgcagCATAAGAACACCTTTGGTGGA-3′
BsiWI-NotI-L-II: 5′-gtacgGGCGGCagc-3′ (SEQ ID NO:14)
BsiWI-NotI-R-II: 5′-ggccgctGCCGCCc-3′ (SEQ ID NO:15)
Primers for pUG-spHIS5-FPR1HA
FPR1-BsiWI-L: 5′-tcaactcgtacgTCTGAAGTAATTGAAGGTAACGT-3′ (SEQ ID NO:16)
FPR1-BamHI-R: 5′-cagcggggatccGTTGACCTTCAACAATTCGACGT-3′ (SEQ ID NO:17)
HAtag-BamHI-SalI-for: 5′-gatccTACCCATACGATGTTCCAGATTACGCTTAAg-3′ (SEQ ID NO:18)
HAtag-BamHI-SalI-rev: 5′-tcgacTTAAGCGTAATCTGGAACATCGTATGGGTAg-3′ (SEQ ID NO:19)
Primers for pRS306-Rpn10-FPR1
Rpn10-ORF-L-XbaI: 5′-cagaactctagaAGACGAATTGATCAGATTGGC-3′ (SEQ ID NO:20)
Rpn10-ORF-R-SphI: 5′-cagaacgcatgcTTTGTCTTGGTGTTGTTCAGGCTGT-3′ (SEQ ID NO:21)
Rpn10-UTR-L-PacI: 5′-cagaacttaattaaCCAGGTTTGAGTACGCTTCC-3′ (SEQ ID NO:22)
Rpn10-UTR-R-NotI: 5′-cagaacgcggccgcAAAGGATTTTCGGTAAGCGA-3′ (SEQ ID NO:23)
FPR1-BsiWI-L: 5′-cagaaccgtacgTCTGAAGTAATTGAAGGTAACGT-3′ (SEQ ID NO:24)
FPR1-PacI-R: 5′-cagaacttaattaaTTAGTTGACCTTCAACAATTCGA-3′ (SEQ ID NO:25)
Linker-L-SphI: 5′-cTGTTTTGTTGGAGGAGAAGACCATTCCTCAGAGATGCAT (SEQ ID NO:26)
AGTTCCc-3′
Linker-R-BsiWI-SphI: 5′-gtacgGGAACTATGCATCTCTGAGGAATGGTCTT (SEQ ID NO:27)
CTCCTCCAACAAAACAgtacg-3′
Primers for PROTet.e133-TOR-link-HIS3HA
No primers were used to create this construct. Instead, TOR-link-HIS3HA was excised from p415-TOR-link-HIS3HA using BamHI and PvuI, and then cloned into PROTet.e133.
EQUIVALENTS
Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments and methods described herein. Such equivalents are intended to be encompassed by the scope of the following claims. All publications and patent applications cited above are incorporated by reference in their entirety for all purposes to the same extent as if each individual publication or patent application were specifically and individually indicated to be so incorporated by reference.

Claims (7)

1. An in vitro method for targeted polypeptide degradation in a ubiquitin-independent manner comprising:
a) providing a proteasome having a first member of a heterodimer pair covalently linked thereto;
b) providing a target polypeptide having a second member of a heterodimer pair covalently linked thereto; and
c) providing a heterodimerizer that binds the first member of the heterodimer pair and causes heterodimerization of the first member of the heterodimer pair and the second member of the heterodimer pair, such that the proteasome degrades the target polypeptide.
2. The method of claim 1, wherein said heterodimerizer is selected from the group consisting of FK-506, FK-506-cyclosporin A, an aptamer, coumermycin, bismethotrexate, dexamethasone-methotrexate, an RNA-protein binder, and a rapamycin derivative.
3. The method of claim 1, wherein said heterodimerizer comprises a first module that binds a proteasome and a second module that binds a target polypeptide.
4. The method of claim 3, wherein said first module is chemically crosslinked to said second module.
5. The method of claim 3, wherein said second module is an epitope tag or an antibody.
6. The method of claim 5, wherein said epitope tag is selected from the group consisting of hemagglutinin, c-myc and TAP.
7. An in vitro method for targeted polypeptide degradation in a ubiquitin-independent manner comprising:
a) providing a proteasome comprising an Fpr1 tag;
b) providing a target polypeptide comprising Tor; and
c) providing rapamycin, such that binding of rapamycin to Tor forms a complex, said complex binding the proteasome comprising the Fpr1 tag, and such that the proteasome degrades the target polypeptide.
US11/003,103 2003-12-03 2004-12-03 Targeted polypeptide degradation Expired - Lifetime US7371539B2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US11/003,103 US7371539B2 (en) 2003-12-03 2004-12-03 Targeted polypeptide degradation

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US52649003P 2003-12-03 2003-12-03
US11/003,103 US7371539B2 (en) 2003-12-03 2004-12-03 Targeted polypeptide degradation

Publications (2)

Publication Number Publication Date
US20050152888A1 US20050152888A1 (en) 2005-07-14
US7371539B2 true US7371539B2 (en) 2008-05-13

Family

ID=34742287

Family Applications (1)

Application Number Title Priority Date Filing Date
US11/003,103 Expired - Lifetime US7371539B2 (en) 2003-12-03 2004-12-03 Targeted polypeptide degradation

Country Status (1)

Country Link
US (1) US7371539B2 (en)

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20180179522A1 (en) * 2015-08-06 2018-06-28 Dana-Farber Cancer Institute, Inc. Tunable endogenous protein degradation
US11129903B2 (en) 2015-07-06 2021-09-28 Regeneron Pharmaceuticals, Inc. Multispecific antigen-binding molecules and uses thereof
US11208458B2 (en) 2017-06-07 2021-12-28 Regeneron Pharmaceuticals, Inc. Compositions and methods for internalizing enzymes
US11311609B2 (en) 2017-02-08 2022-04-26 Dana-Farber Cancer Institute, Inc. Regulating chimeric antigen receptors
US11352446B2 (en) 2016-04-28 2022-06-07 Regeneron Pharmaceuticals, Inc. Methods of making multispecific antigen-binding molecules
US11578135B2 (en) 2012-03-14 2023-02-14 Regeneron Pharmaceuticals, Inc. Multispecific antigen-binding molecules binding to a target and an internalizing effector protein that is CD63 and uses thereof
US12037411B2 (en) 2018-04-30 2024-07-16 Regeneron Pharmaceuticals, Inc. Antibodies, and bispecific antigen-binding molecules that bind HER2 and/or APLP2, conjugates, and uses thereof
US12252544B2 (en) 2018-05-17 2025-03-18 Regeneron Pharmaceuticals, Inc. Anti-CD63 antibodies, conjugates, and uses thereof
US12258597B2 (en) 2018-02-07 2025-03-25 Regeneron Pharmaceuticals, Inc. Methods and compositions for therapeutic protein delivery

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103153335A (en) 2010-06-30 2013-06-12 布兰代斯大学 Small-molecule-targeted protein degradation
KR20180021080A (en) * 2015-06-19 2018-02-28 에츠코 미야모토 Protein degradation inducing tags and uses thereof
WO2017079723A1 (en) * 2015-11-07 2017-05-11 Board Of Regents, The University Of Texas System Targeting proteins for degradation
WO2018085208A1 (en) 2016-11-02 2018-05-11 The Research Foundation For The State University Of New York Methods of inhibiting viruses using compositions targeting tsg101-ubiquitin interaction

Citations (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4522811A (en) 1982-07-08 1985-06-11 Syntex (U.S.A.) Inc. Serial injection of muramyldipeptides and liposomes enhances the anti-infective activity of muramyldipeptides
US4736866A (en) 1984-06-22 1988-04-12 President And Fellows Of Harvard College Transgenic non-human mammals
US4870009A (en) 1982-11-22 1989-09-26 The Salk Institute For Biological Studies Method of obtaining gene product through the generation of transgenic animals
US4873191A (en) 1981-06-12 1989-10-10 Ohio University Genetic transformation of zygotes
WO1990011354A1 (en) 1989-03-20 1990-10-04 Institut Pasteur Process for the specific replacement of a copy of a gene present in the receiver genome via the integration of a gene
WO1991001140A1 (en) 1989-07-25 1991-02-07 Cell Genesys, Inc. Homologous recombination for universal donor cells and chimeric mammalian hosts
WO1992000968A1 (en) 1990-07-10 1992-01-23 Smithkline Beecham Corporation Oxamides
WO1993004169A1 (en) 1991-08-20 1993-03-04 Genpharm International, Inc. Gene targeting in animal cells using isogenic dna constructs
US5223409A (en) 1988-09-02 1993-06-29 Protein Engineering Corp. Directed evolution of novel binding proteins
US6217864B1 (en) * 1996-02-23 2001-04-17 The Regents Of The University Of California Method for targeted degradation of intracellular proteins in vivo or ex vivo

Patent Citations (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4873191A (en) 1981-06-12 1989-10-10 Ohio University Genetic transformation of zygotes
US4522811A (en) 1982-07-08 1985-06-11 Syntex (U.S.A.) Inc. Serial injection of muramyldipeptides and liposomes enhances the anti-infective activity of muramyldipeptides
US4870009A (en) 1982-11-22 1989-09-26 The Salk Institute For Biological Studies Method of obtaining gene product through the generation of transgenic animals
US4736866A (en) 1984-06-22 1988-04-12 President And Fellows Of Harvard College Transgenic non-human mammals
US4736866B1 (en) 1984-06-22 1988-04-12 Transgenic non-human mammals
US5223409A (en) 1988-09-02 1993-06-29 Protein Engineering Corp. Directed evolution of novel binding proteins
WO1990011354A1 (en) 1989-03-20 1990-10-04 Institut Pasteur Process for the specific replacement of a copy of a gene present in the receiver genome via the integration of a gene
WO1991001140A1 (en) 1989-07-25 1991-02-07 Cell Genesys, Inc. Homologous recombination for universal donor cells and chimeric mammalian hosts
WO1992000968A1 (en) 1990-07-10 1992-01-23 Smithkline Beecham Corporation Oxamides
WO1993004169A1 (en) 1991-08-20 1993-03-04 Genpharm International, Inc. Gene targeting in animal cells using isogenic dna constructs
US6217864B1 (en) * 1996-02-23 2001-04-17 The Regents Of The University Of California Method for targeted degradation of intracellular proteins in vivo or ex vivo

Non-Patent Citations (74)

* Cited by examiner, † Cited by third party
Title
Alberts et al., "Macromolecules: Structure, Shapes and Information," Molecular Biology of the Cell, Chapter 3, pp. 88-91, 3d edition, Garland Publishing (1994).
Bachmair et al., "In Vivo Half-Life of a Protein Is a Function of its Amino-Terminal Residue," Science, 234:179-186 (1986).
Baron and Bujard, "Tet Repressor-Based System for Regulated Gene Expression in Eukaryotic Cells: Principles and Advances," Methods Enzymol. 327:401-421 (2000).
Belshaw et al., "Controlling protein association and subcellular localization with a synthetic ligand that induces heterodimerization of proteins," Proc. Natl. Acad. Sci. USA, 93:4604-4607 (1996).
Benaroudj et al., "PAN, the proteasome-activating nucleotidase from archaebacteria, is a protein-unfolding molecular chaperone," Nat. Cell Biol., 2:833-839 (2000).
Bochtler et al., "Crystal structure of heat shock locus V (HsIV) from Excherichia coli," Proc. Natl. Acad. Sci. U.S.A. 94:6070-6074 (1997).
Bochtler et al., "The Proteasome," Ann. Rev. Biophys. Biomol. Struct. 28:295-317 (1999).
Bochtler et al., "The structures of HsIU and the ATP-dependent protease HsIU-HsIV," Nature 403:800-805 (2000).
Bradley, "Modifying the mammalian genome by gene targeting," Current Opinion in Biotechnology 2:823-829 (1991).
Bradley, "Production and analysis of chimaeric mice," Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, E. J. Robertson, ed, IRL, Oxford, pp. 113-151 (1987).
Braun et al., "The base of the proteasome regulatory particle exhibits chaperone-like activity," Nat. Cell Biol., 1:221-226 (1999).
Carrell et al., "A Novel Procedure for the Synthesis of Libraries Containing Small Organic Molecules," Angew. Chem. Int. Ed. Engl., 33:2059-2061 (1994).
Carrell et al., "A Solution-Phase Screening Procedure for the Isolation of Active Compounds from a Library of Molecules," Angew. Chem. Int. Ed. Engl., 33:2061-2065 (1994).
Cho et al., "An Unnatural Biopolymer," Science 261:1303-1305 (1993).
Coffino, "Regulation of Cellular Polyamines by Antizyme," Nat. Rev. Mol. Cell Biol., 2:188-194 (2001).
Colas et al., "Targeted modification and transportation of cellular proteins," Proc. Natl. Acad. Sci. USA 97(25):13720-13725 (2000).
Cull et al., "Screening for receptor ligands using large libraries of peptides linked to the C terminus of the lac repressor," Proc. Natl. Acad. Sci. USA, 89:1865-1869 (1992).
Cwirla et al., "Peptides on phage: A vast library of peptides for identifying ligands," Proc. Natl. Acad. Sci., USA 87:6378-6382 (1990).
David et al., "Proteasomal degradation of tau protein," J. Neurochem., 83:176-185 (2002).
Deveraux et al., "A 26 S Protease Subunit that Binds Ubiquitin Conjugates," J. Biol. Chem., 269(10):7059-7061 (1994).
Devlin, "Random Peptide Libraries: A Source of Specific Protein Binding Molecules," Science, 249:404-406 (1990).
DeWitt et al., "'Diversomers': An approach to nonpeptide, nonoligomeric chemical diversity," Proc. Natl. Acad. Sci. USA, 90:6909-6913 (1993).
Dick et al., "Proteolytic Processing Ovalbumin and beta-galactosidase by the Proteasome to Yield Antigenic Peptides," J. Immunol., 152:3884-3894 (1994).
Erb et al., "Recursive deconvoluation of combinatorial chemical libraries," Proc. Natl. Acad. Sci. USA, 91:11422-11426 (1994).
Farrar et al., "Activation of the Raf-1 kinase cascade by coumermycin-induced dimerization," Nature, 383(6596):178-181 (1996).
Felici, "Selection of Antibody Ligands from a Large Library of Oligopeptides Expressed on a Multivalent Exposition Vector," J. Mol. Biol., 222:301-310 (1991).
Fire et al., "Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans," Nature, 391:806-811 (1998).
Fodor, "Multiplexed biochemical assays with biological chips," Nature, 364:555-556 (1993).
Gallop et al., "Applications of Combinatorial Technologies to Drug Discovery, . . . ," J. Med. Chem., 37(9):1233-1251 (1994).
Glaever et al., "Functional profiling of the Saccharomyces cerevisiae geneome," Nature, 418:387-391 (2002).
Groll and Huber, "Substrate access and processing by the 20S proteasome core particle," Int. J. Biochem. Cell Biol., 35:606-616 (2003).
Groll et al., "A gated channel into the proteasome core particle," Nat. Struct. Biol., 7(11):1062-1067 (2000).
Groll et al., "Structure of 20S proteasome from yeast at 2.4Å resolution," Nature, 386:463-471 (1997).
Güldener et al., "A new efficient gene disruption cassette for repeated use in budding yeast," Nucleic Acids Res., 24(13)2519-2524 (1996).
Harvey et al., "Forced engagement of a RNA/protein complex by a chemical inducer of dimerization to modulate gene expression," Proc. Natl. Acad. Sci. U.S.A., 99(4):1882-1887 (2002).
Heitman et al., "Targets for Cell Cycle Arrest by the Immunosuppressant Rapamycin in Yeast," Science, 253:905-909 (1991).
Hershko and Ciechanover, "The Ubiquitin System," Ann. Rev. Biochem., 67:425-479 (1998).
Ho et al., "Dimeric ligands define a role for transcription activation domains in reinitiation," Nature, 382(6594):822-826 (1996).
Houghten, "The Use of Synthetic Peptide Combinatorial Libraries for the Identification of Bioactive Peptides," Biotechniques, 13(3):412-421 (1992).
Jariel-Encontre et al., "Ubiquitinylation Is Not an Absolute Requirement for Degradation of c-Jun Protein by the 26 S Proteasome," J. Biol. Chem., 270(19):11623-11627 (1995).
Jesenberger and Jentsch, "Deadly Encounter: Ubiquitin Meets Apoptosis," Nat. Rev. Mol. Cell Biol., 3:112-121 (2002).
Kisselev et al., "The Sizes of Peptides Generated from Protein by Mammalian 26 and 20 S Proteasomes," J. Biol. Chem., 274(6):3363-3371 (1999).
Köhler et al., "The Axial Channel of the Proteasome Core Particle Is Gated by the Rpt2 ATPase and Controls Both Substrate Entry and Product Release," Mol. Cell, 7:1143-1152 (2001).
Kopytek et al., "Chemically induced dimerization of dihydrofolate reductase by a homobifunctional dimer of methotrexate," Chem. Biol., 7:313-321 (2000).
Lakso et al., "Targeted oncogene activation by site-specific recombination in transgenic mice," Proc. Nat'l Acad. Sci. U.S.A., 89:6232-6236 (1992).
Lam et al., "A proteasomal ATPase subunit recognizes the polybiqutin degradation signal," Nature, 416:763-767 (2002).
Lam, "A new type of synthetic peptide library for identifying ligand-binding activity," Nature, 354:82-84 (1991).
Lam, "Application of combinatorial library methods in cancer research and drug discovery," Anti-Cancer Drug Des., 12:145-167 (1997).
Lee et al., "ATP-Dependent Proteases Degrade their Substrates by Processively Unraveling them from the Degradation Signal," Mol. Cell., 7:627-637 (2001).
Leggett et al., "Multiple Associated Proteins Regulate Proteasome Structure and Function," Mol. Cell, 10:495-507 (2002).
Li et al., "Targeted Mutation of the DNA Methyltransferase Gene Results in Embryonic Lethality," Cell, 69:915-926 (1992).
Liberles et al., "Inducible gene expression and protein translocation using nontoxic ligands identified by a mammalian three-hybrid screen," Proc. Natl. Acad. Sci. U.S.A., 94:7825-7830 (1997).
Lin et al., "Dexamethasone-Methotrexate: an Efficient Chemical Inducer of Protein Dimerization In Vivo, " J. Am. Chem. Soc., 122:4247-4248 (2000).
Lorenz and Heitman, "TOR Mutations Confer Rapamycin Resistance by Preventing Interaction with FKBP12-Rapamycin," J. Biol. Chem., 270(46):27531-27537 (1995).
Matouschek, "Protein unfolding-an important process in vivo?" Curr. Opin. Struct. Biol., 13:98-109 (2003).
Mueller and Feigon, "Structural determinants for the binding of ubiquitin-like domains to the proteasome," Embo J., 22(18):4634-4645 (2003).
O'Gorman et al., "Recombinase-Mediated Gene Activation of Site-Specific Integration in Mammalian Cells," Science, 251(4999):1351-1355 (1991).
Palombella et al., "Role of the proteasome and NF-kB in streptococcal cell wall-induced polyarthritis," Proc. Natl. Acad. Sci. U.S.A., 95:15671-15676 (1998).
Rivera et al., "A humanized system for pharmacologic control of gene expression," Nat. Med., 2(9):1028-1032 (1996).
Sakamoto et al., "Development of Protacs to Target Cancer-Promoting Proteins for Ubiquitination and Degradation," Mol. Cell Proteomics, 2.12:1350-1358 (2003).
Sakamoto et al., "Protacs: Chimeric molecules that target proteins to the Skp1-Cullin-F box complex for ubiquitination and degradation," Proc. Natl. Acad. Sci USA, 98(15):8554-8559 (2001).
Scott and Smith, "Searching for Peptide Ligands with an Epitope Library," Science, 249:386-390 (1990).
Sikorski and Hieter, "A System of Shuttle Vectors and Yeast Host Strains Designed for Efficient Manipulation of DNA in Saccharomyces cerevisiae, " Genetics, 122:19-27 (1989).
Spencer et al., "Controlling Signal Transduction with Synthetic Ligands," Science, 262:1019-1024 (1993).
Strickland et al., "Recognition of Misfolding Proteins by PA700, the Regulatory Subcomplex of the 26 S Proteasome," J. Biol. Chem., 275(8):5565-5572 (2000).
Tarcsa et al., "Ca<SUP>2+</SUP>-free Calmodulin and Calmodulin Damaged by in Vitro Aging Are selectively Degraded by 26 S Proteasomes without Ubiquitination," J. Biol. Chem., 275(27):20295-20301 (2000).
Thomas and Capecchi, "Site-Directed Mutagenesis by Gene Targeting in Mouse Embryo-Derived Stem Cells," Cell, 51:503-512 (1987).
Tofaris et al., "alpha-Synuclein metabolism and aggregation is linked to ubiquitin-independent degradation by the proteasome," FEBS Lett., 509:22-26 (2001).
Wach et al., "Yeast Functional Analysis Reports: Heterologous HIS3 Marker and GFP Reporter Modules for PCR-Targeting in Saccharomyces cerevisiae," Yeast, 13:1065-1075 (1997).
Whitby et al., "Structural basis for the activation of 20S proteasomes by 11S regulators," Nature, 408:115-120 (2000).
Wilmut et al., "Viable offspring derived from fetal and adult mammalian cells," Nature, 385:810-813 (1997).
Winston et al., "Construction of a Set of Convenient Saccharomyces cerevisiae Strains that are Isogenic to S288C," Yeast, 11:53-55 (1995).
Zhang et al., "Determinants of proteasome recognition of ornithine decarboxylase, a ubiquitin-independent substrate," Embo. J., 22(7):1488-1496 (2003).
Zuckermann et al., "Discovery of Nanomolar Ligands for 7-Transmembrane G-Protein-Coupled Receptors from a Divers N-(Substituted)glycine Peptoid Library," J. Med. Chem. 37:2678-2685 (1994).

Cited By (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11578135B2 (en) 2012-03-14 2023-02-14 Regeneron Pharmaceuticals, Inc. Multispecific antigen-binding molecules binding to a target and an internalizing effector protein that is CD63 and uses thereof
US11129903B2 (en) 2015-07-06 2021-09-28 Regeneron Pharmaceuticals, Inc. Multispecific antigen-binding molecules and uses thereof
US11191844B2 (en) 2015-07-06 2021-12-07 Regeneran Pharmaceuticals, Inc. Multispecific antigen-binding molecules and uses thereof
US12297257B2 (en) 2015-07-06 2025-05-13 Regeneron Pharmaceuticals, Inc. Multispecific antigen-binding molecules and uses thereof
US11046954B2 (en) 2015-08-06 2021-06-29 Dana-Farber Cancer Institute, Inc. Targeted protein degradation to attenuate adoptive T-cell therapy associated adverse inflammatory responses
US11293023B2 (en) * 2015-08-06 2022-04-05 Dana-Farber Cancer Institute, Inc. Tunable endogenous protein degradation
US20180179522A1 (en) * 2015-08-06 2018-06-28 Dana-Farber Cancer Institute, Inc. Tunable endogenous protein degradation
US11352446B2 (en) 2016-04-28 2022-06-07 Regeneron Pharmaceuticals, Inc. Methods of making multispecific antigen-binding molecules
US11311609B2 (en) 2017-02-08 2022-04-26 Dana-Farber Cancer Institute, Inc. Regulating chimeric antigen receptors
US12215138B2 (en) 2017-06-07 2025-02-04 Regeneron Pharmaceuticals, Inc. Compositions and methods for internalizing enzymes
US11208458B2 (en) 2017-06-07 2021-12-28 Regeneron Pharmaceuticals, Inc. Compositions and methods for internalizing enzymes
US12258597B2 (en) 2018-02-07 2025-03-25 Regeneron Pharmaceuticals, Inc. Methods and compositions for therapeutic protein delivery
US12037411B2 (en) 2018-04-30 2024-07-16 Regeneron Pharmaceuticals, Inc. Antibodies, and bispecific antigen-binding molecules that bind HER2 and/or APLP2, conjugates, and uses thereof
US12252544B2 (en) 2018-05-17 2025-03-18 Regeneron Pharmaceuticals, Inc. Anti-CD63 antibodies, conjugates, and uses thereof

Also Published As

Publication number Publication date
US20050152888A1 (en) 2005-07-14

Similar Documents

Publication Publication Date Title
US5565352A (en) Deubiquitinating enzyme: compositions and methods
US7371539B2 (en) Targeted polypeptide degradation
Janse et al. Localization to the proteasome is sufficient for degradation
Kim et al. The Png1–Rad23 complex regulates glycoprotein turnover
Armstrong et al. Metaxin is a component of a preprotein import complex in the outer membrane of the mammalian mitochondrion
DeHoratius et al. Nuclear transport defects and nuclear envelope alterations are associated with mutation of the Saccharomyces cerevisiae NPL4 gene.
Griffin et al. Domain interactions within Fzo1 oligomers are essential for mitochondrial fusion
JPH09504176A (en) Antifungal selection method
Hofmann et al. Regulation of homeodomain-interacting protein kinase 2 (HIPK2) effector function through dynamic small ubiquitin-related modifier-1 (SUMO-1) modification
Tung et al. The evolutionarily conserved interaction between LC3 and p62 selectively mediates autophagy-dependent degradation of mutant huntingtin
Fiorani et al. Domain interactions affecting human DNA topoisomerase I catalysis and camptothecin sensitivity
Comeaux et al. Tyrosyl-DNA phosphodiesterase I catalytic mutants reveal an alternative nucleophile that can catalyze substrate cleavage
CN114096565A (en) PIP4K inhibits insulin signaling and enhances immune function through a catalytic-independent mechanism
CA2295322C (en) Methods and compositions for rapid purification of proteasomes and methods of use of components thereof
EP1292668A2 (en) Gene disruption methodologies in fungi for drug target discovery
US6953672B2 (en) Screen for CDC7 inhibitors
JPH09506768A (en) Origin of replication complex genes, proteins and methods
Kuburich et al. Multiple phosphorylation sites on the RegA phosphodiesterase regulate Dictyostelium development
US20040053388A1 (en) Detection of protein conformation using a split ubiquitin reporter system
US6709839B1 (en) SYK-UBP proteins, compositions and methods of use
EP1237916B1 (en) Ing2, an iaps associated cell cycle protein, compositions and methods of use
WO2002066656A2 (en) Detection of protein conformation using a split ubiquitin reporter system
Vontz Regulation of proteasome granule formation by proteasome shuttle factors
US20250262271A1 (en) Ait1 protein and methods of controlling eukaryotic metabolism
US20080090249A1 (en) Ube2g2 Binding Domain in The Ubiquitin Ligase Gp78 And Methods Of Use Thereof

Legal Events

Date Code Title Description
AS Assignment

Owner name: PRESIDENT AND FELLOWS OF HARVARD COLLEGE, MASSACHU

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:CHURCH, GEORGE M.;JANSE, DANIEL M.;REEL/FRAME:017387/0938;SIGNING DATES FROM 20060204 TO 20060206

STCF Information on status: patent grant

Free format text: PATENTED CASE

FEPP Fee payment procedure

Free format text: PAYOR NUMBER ASSIGNED (ORIGINAL EVENT CODE: ASPN); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY

FPAY Fee payment

Year of fee payment: 4

FPAY Fee payment

Year of fee payment: 8

MAFP Maintenance fee payment

Free format text: PAYMENT OF MAINTENANCE FEE, 12TH YR, SMALL ENTITY (ORIGINAL EVENT CODE: M2553); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY

Year of fee payment: 12

AS Assignment

Owner name: UNITED STATES DEPARTMENT OF ENERGY, DISTRICT OF COLUMBIA

Free format text: CONFIRMATORY LICENSE;ASSIGNOR:HARVARD UNIVERSITY;REEL/FRAME:057790/0511

Effective date: 20180925