US7087416B2 - Detection of transmembrane potentials by optical methods - Google Patents

Detection of transmembrane potentials by optical methods Download PDF

Info

Publication number
US7087416B2
US7087416B2 US10/335,517 US33551702A US7087416B2 US 7087416 B2 US7087416 B2 US 7087416B2 US 33551702 A US33551702 A US 33551702A US 7087416 B2 US7087416 B2 US 7087416B2
Authority
US
United States
Prior art keywords
membrane
fluorescent
cells
reagent
oxonol
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
US10/335,517
Other languages
English (en)
Other versions
US20030207248A1 (en
Inventor
Roger Y. Tsien
Jesus E. Gonzalez, III
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of California
Original Assignee
University of California
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US08/481,977 external-priority patent/US5661035A/en
Application filed by University of California filed Critical University of California
Priority to US10/335,517 priority Critical patent/US7087416B2/en
Publication of US20030207248A1 publication Critical patent/US20030207248A1/en
Application granted granted Critical
Publication of US7087416B2 publication Critical patent/US7087416B2/en
Assigned to NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF HEALTH AND HUMAN SERVICES (DHHS), U.S. GOVERNMENT reassignment NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF HEALTH AND HUMAN SERVICES (DHHS), U.S. GOVERNMENT CONFIRMATORY LICENSE (SEE DOCUMENT FOR DETAILS). Assignors: UNIVERSITY OF CALIFORNIA SAN DIEGO
Anticipated expiration legal-status Critical
Expired - Fee Related legal-status Critical Current

Links

Images

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/502—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D209/00—Heterocyclic compounds containing five-membered rings, condensed with other rings, with one nitrogen atom as the only ring hetero atom
    • C07D209/02—Heterocyclic compounds containing five-membered rings, condensed with other rings, with one nitrogen atom as the only ring hetero atom condensed with one carbocyclic ring
    • C07D209/04—Indoles; Hydrogenated indoles
    • C07D209/08—Indoles; Hydrogenated indoles with only hydrogen atoms or radicals containing only hydrogen and carbon atoms, directly attached to carbon atoms of the hetero ring
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D215/00—Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems
    • C07D215/02—Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen atoms or carbon atoms directly attached to the ring nitrogen atom
    • C07D215/16—Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen atoms or carbon atoms directly attached to the ring nitrogen atom with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D215/20—Oxygen atoms
    • C07D215/22—Oxygen atoms attached in position 2 or 4
    • C07D215/227—Oxygen atoms attached in position 2 or 4 only one oxygen atom which is attached in position 2
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D239/00—Heterocyclic compounds containing 1,3-diazine or hydrogenated 1,3-diazine rings
    • C07D239/02—Heterocyclic compounds containing 1,3-diazine or hydrogenated 1,3-diazine rings not condensed with other rings
    • C07D239/24—Heterocyclic compounds containing 1,3-diazine or hydrogenated 1,3-diazine rings not condensed with other rings having three or more double bonds between ring members or between ring members and non-ring members
    • C07D239/28—Heterocyclic compounds containing 1,3-diazine or hydrogenated 1,3-diazine rings not condensed with other rings having three or more double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, directly attached to ring carbon atoms
    • C07D239/46—Two or more oxygen, sulphur or nitrogen atoms
    • C07D239/60—Three or more oxygen or sulfur atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D239/00—Heterocyclic compounds containing 1,3-diazine or hydrogenated 1,3-diazine rings
    • C07D239/02—Heterocyclic compounds containing 1,3-diazine or hydrogenated 1,3-diazine rings not condensed with other rings
    • C07D239/24—Heterocyclic compounds containing 1,3-diazine or hydrogenated 1,3-diazine rings not condensed with other rings having three or more double bonds between ring members or between ring members and non-ring members
    • C07D239/28—Heterocyclic compounds containing 1,3-diazine or hydrogenated 1,3-diazine rings not condensed with other rings having three or more double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, directly attached to ring carbon atoms
    • C07D239/46—Two or more oxygen, sulphur or nitrogen atoms
    • C07D239/60—Three or more oxygen or sulfur atoms
    • C07D239/62—Barbituric acids
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D239/00—Heterocyclic compounds containing 1,3-diazine or hydrogenated 1,3-diazine rings
    • C07D239/02—Heterocyclic compounds containing 1,3-diazine or hydrogenated 1,3-diazine rings not condensed with other rings
    • C07D239/24—Heterocyclic compounds containing 1,3-diazine or hydrogenated 1,3-diazine rings not condensed with other rings having three or more double bonds between ring members or between ring members and non-ring members
    • C07D239/28—Heterocyclic compounds containing 1,3-diazine or hydrogenated 1,3-diazine rings not condensed with other rings having three or more double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, directly attached to ring carbon atoms
    • C07D239/46—Two or more oxygen, sulphur or nitrogen atoms
    • C07D239/60—Three or more oxygen or sulfur atoms
    • C07D239/66—Thiobarbituric acids
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D239/00—Heterocyclic compounds containing 1,3-diazine or hydrogenated 1,3-diazine rings
    • C07D239/70—Heterocyclic compounds containing 1,3-diazine or hydrogenated 1,3-diazine rings condensed with carbocyclic rings or ring systems
    • C07D239/72—Quinazolines; Hydrogenated quinazolines
    • C07D239/78—Quinazolines; Hydrogenated quinazolines with hetero atoms directly attached in position 2
    • C07D239/80—Oxygen atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D241/00—Heterocyclic compounds containing 1,4-diazine or hydrogenated 1,4-diazine rings
    • C07D241/36—Heterocyclic compounds containing 1,4-diazine or hydrogenated 1,4-diazine rings condensed with carbocyclic rings or ring systems
    • C07D241/38—Heterocyclic compounds containing 1,4-diazine or hydrogenated 1,4-diazine rings condensed with carbocyclic rings or ring systems with only hydrogen or carbon atoms directly attached to the ring nitrogen atoms
    • C07D241/40—Benzopyrazines
    • C07D241/44—Benzopyrazines with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to carbon atoms of the hetero ring
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D265/00—Heterocyclic compounds containing six-membered rings having one nitrogen atom and one oxygen atom as the only ring hetero atoms
    • C07D265/28—1,4-Oxazines; Hydrogenated 1,4-oxazines
    • C07D265/34—1,4-Oxazines; Hydrogenated 1,4-oxazines condensed with carbocyclic rings
    • C07D265/36—1,4-Oxazines; Hydrogenated 1,4-oxazines condensed with carbocyclic rings condensed with one six-membered ring
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D279/00—Heterocyclic compounds containing six-membered rings having one nitrogen atom and one sulfur atom as the only ring hetero atoms
    • C07D279/10—1,4-Thiazines; Hydrogenated 1,4-thiazines
    • C07D279/14—1,4-Thiazines; Hydrogenated 1,4-thiazines condensed with carbocyclic rings or ring systems
    • C07D279/16—1,4-Thiazines; Hydrogenated 1,4-thiazines condensed with carbocyclic rings or ring systems condensed with one six-membered ring
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D311/00—Heterocyclic compounds containing six-membered rings having one oxygen atom as the only hetero atom, condensed with other rings
    • C07D311/02—Heterocyclic compounds containing six-membered rings having one oxygen atom as the only hetero atom, condensed with other rings ortho- or peri-condensed with carbocyclic rings or ring systems
    • C07D311/04—Benzo[b]pyrans, not hydrogenated in the carbocyclic ring
    • C07D311/06—Benzo[b]pyrans, not hydrogenated in the carbocyclic ring with oxygen or sulfur atoms directly attached in position 2
    • C07D311/08—Benzo[b]pyrans, not hydrogenated in the carbocyclic ring with oxygen or sulfur atoms directly attached in position 2 not hydrogenated in the hetero ring
    • C07D311/16—Benzo[b]pyrans, not hydrogenated in the carbocyclic ring with oxygen or sulfur atoms directly attached in position 2 not hydrogenated in the hetero ring substituted in position 7
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D487/00—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, not provided for by groups C07D451/00 - C07D477/00
    • C07D487/02—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, not provided for by groups C07D451/00 - C07D477/00 in which the condensed system contains two hetero rings
    • C07D487/04—Ortho-condensed systems
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07F—ACYCLIC, CARBOCYCLIC OR HETEROCYCLIC COMPOUNDS CONTAINING ELEMENTS OTHER THAN CARBON, HYDROGEN, HALOGEN, OXYGEN, NITROGEN, SULFUR, SELENIUM OR TELLURIUM
    • C07F5/00—Compounds containing elements of Groups 3 or 13 of the Periodic System
    • C07F5/003—Compounds containing elements of Groups 3 or 13 of the Periodic System without C-Metal linkages
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07F—ACYCLIC, CARBOCYCLIC OR HETEROCYCLIC COMPOUNDS CONTAINING ELEMENTS OTHER THAN CARBON, HYDROGEN, HALOGEN, OXYGEN, NITROGEN, SULFUR, SELENIUM OR TELLURIUM
    • C07F5/00—Compounds containing elements of Groups 3 or 13 of the Periodic System
    • C07F5/02—Boron compounds
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07F—ACYCLIC, CARBOCYCLIC OR HETEROCYCLIC COMPOUNDS CONTAINING ELEMENTS OTHER THAN CARBON, HYDROGEN, HALOGEN, OXYGEN, NITROGEN, SULFUR, SELENIUM OR TELLURIUM
    • C07F5/00—Compounds containing elements of Groups 3 or 13 of the Periodic System
    • C07F5/02—Boron compounds
    • C07F5/027—Organoboranes and organoborohydrides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07F—ACYCLIC, CARBOCYCLIC OR HETEROCYCLIC COMPOUNDS CONTAINING ELEMENTS OTHER THAN CARBON, HYDROGEN, HALOGEN, OXYGEN, NITROGEN, SULFUR, SELENIUM OR TELLURIUM
    • C07F9/00—Compounds containing elements of Groups 5 or 15 of the Periodic System
    • C07F9/02—Phosphorus compounds
    • C07F9/06—Phosphorus compounds without P—C bonds
    • C07F9/08—Esters of oxyacids of phosphorus
    • C07F9/09—Esters of phosphoric acids
    • C07F9/10—Phosphatides, e.g. lecithin
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07F—ACYCLIC, CARBOCYCLIC OR HETEROCYCLIC COMPOUNDS CONTAINING ELEMENTS OTHER THAN CARBON, HYDROGEN, HALOGEN, OXYGEN, NITROGEN, SULFUR, SELENIUM OR TELLURIUM
    • C07F9/00—Compounds containing elements of Groups 5 or 15 of the Periodic System
    • C07F9/02—Phosphorus compounds
    • C07F9/547—Heterocyclic compounds, e.g. containing phosphorus as a ring hetero atom
    • C07F9/553—Heterocyclic compounds, e.g. containing phosphorus as a ring hetero atom having one nitrogen atom as the only ring hetero atom
    • C07F9/572—Five-membered rings
    • C07F9/5728—Five-membered rings condensed with carbocyclic rings or carbocyclic ring systems
    • C—CHEMISTRY; METALLURGY
    • C09—DYES; PAINTS; POLISHES; NATURAL RESINS; ADHESIVES; COMPOSITIONS NOT OTHERWISE PROVIDED FOR; APPLICATIONS OF MATERIALS NOT OTHERWISE PROVIDED FOR
    • C09B—ORGANIC DYES OR CLOSELY-RELATED COMPOUNDS FOR PRODUCING DYES, e.g. PIGMENTS; MORDANTS; LAKES
    • C09B23/00—Methine or polymethine dyes, e.g. cyanine dyes
    • C09B23/02—Methine or polymethine dyes, e.g. cyanine dyes the polymethine chain containing an odd number of >CH- or >C[alkyl]- groups
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5044—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5044—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
    • G01N33/5058—Neurological cells
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5044—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
    • G01N33/5061—Muscle cells
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5076—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving cell organelles, e.g. Golgi complex, endoplasmic reticulum
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/52—Use of compounds or compositions for colorimetric, spectrophotometric or fluorometric investigation, e.g. use of reagent paper and including single- and multilayer analytical elements
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/536—Immunoassay; Biospecific binding assay; Materials therefor with immune complex formed in liquid phase
    • G01N33/542—Immunoassay; Biospecific binding assay; Materials therefor with immune complex formed in liquid phase with steric inhibition or signal modification, e.g. fluorescent quenching
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/58—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving labelled substances
    • G01N33/582—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving labelled substances with fluorescent label
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6872—Intracellular protein regulatory factors and their receptors, e.g. including ion channels
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/92—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving lipids, e.g. cholesterol, lipoproteins, or their receptors
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/033—Fusion polypeptide containing a localisation/targetting motif containing a motif for targeting to the internal surface of the plasma membrane, e.g. containing a myristoylation motif
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2405/00—Assays, e.g. immunoassays or enzyme assays, involving lipids
    • G01N2405/04—Phospholipids, i.e. phosphoglycerides
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00—Screening for compounds of potential therapeutic value
    • G01N2500/10—Screening for compounds of potential therapeutic value involving cells
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10—TECHNICAL SUBJECTS COVERED BY FORMER USPC
    • Y10S—TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10S436/00—Chemistry: analytical and immunological testing
    • Y10S436/80—Fluorescent dyes, e.g. rhodamine
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10—TECHNICAL SUBJECTS COVERED BY FORMER USPC
    • Y10S—TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10S436/00—Chemistry: analytical and immunological testing
    • Y10S436/805—Optical property

Definitions

  • the present invention relates generally to compositions and optical methods for determining transmembrane potentials across biological membranes of living cells.
  • Fluorescence detection and imaging of cellular electrical activity is a technique of great importance and potential (Grinvald, A., Frostig, R. D., Lieke, E., and Hildesheim, R. 1988. Optical imaging of neuronal activity. Physiol. Rev. 68:1285–1366; Salzberg, B. M. 1983. Optical recording of electrical activity in neurons using molecular probes. In Current Methods in Cellular Neurobiology. J. L. Barker, editor. Wiley, New York. 139–187; Cohen, L. B. and S. Lesher. 1985. Optical monitoring of membrane potential: methods of multisite optical measurement. In Optical Methods in Cell Physiology. P. de Weer and B. M. Salzberg, editors. Wiley, New York. 71–99).
  • the permeant ions are sensitive because the ratio of their concentrations between the inside and outside of the cell can change by up to the Nernstian limit of 10-fold for a 60 mV change in transmembrane potential.
  • their responses are slow because to establish new equilibria, ions must diffuse through unstirred layers in each aqueous phase and the low-dielectric-constant interior of the plasma membrane.
  • dyes distribute into all available hydrophobic binding sites indiscriminately. Therefore, selectivity between cell types is difficult.
  • any additions of hydrophobic proteins or reagents to the external solution, or changes in exposure to hydrophobic surfaces are prone to cause artifacts.
  • These indicators also fail to give any shift in fluorescence wavelengths or ratiometric output.
  • Such dual-wavelength readouts are useful in avoiding artifacts due to variations in dye concentration, path length, cell number, source brightness, and detection efficiency.
  • the impermeable dyes can respond very quickly because they need little or no translocation.
  • they are insensitive because they sense the electric field with only a part of a unit charge moving less than the length of the molecule, which in turn is only a small fraction of the distance across the membrane.
  • a significant fraction of the total dye signal comes from molecules that sit on irrelevant membranes or cells and that dilute the signal from the few correctly placed molecules.
  • methods and compositions are needed which are sensitive to small variations in transmembrane potentials and can respond both to rapid, preferably on a millisecond timescale, and sustained membrane potential changes. Also needed are methods and compositions that are less susceptible to the effects of changes in external solution composition, more capable of selectively monitoring membranes of specific cell types, and within intracellular organelles and providing a ratiometric fluorescence signal.
  • One aspect of the detection method comprises;
  • the molecule is a fluorescence resonance energy transfer (FRET) acceptor or donor, or is a quencher and is capable of redistributing within the membrane of a biological membrane in response to changes in the potential across the membrane;
  • FRET fluorescence resonance energy transfer
  • the second reagent can redistribute from the membrane to other sites in response to changes in the potential of the membrane.
  • the second reagent comprises a luminescent or fluorescent component capable of undergoing energy transfer with the first reagent or quenching light emission of the first reagent;
  • the cell is exposed to excitation light at appropriate wavelengths and the degree of energy transfer between the first and second reagents determined.
  • the excitation light is used to confocally illuminate the cell, thereby providing enhanced spatial resolution. In another aspect this is achieved via the use of two photon excitation.
  • the cell is exposed to a luminescent or bioluminescent substrate for the luminescent component resulting in light emission from the luminescent component.
  • the degree of energy transfer between the first and second reagent may then be determined by measuring the emission ratios of the first and second reagents, without the need to provide external illumination.
  • light emission of the first reagent or the second reagent is dependent on the membrane potential across the membrane.
  • the efficiency of energy transfer from the first reagent to the second reagent is dependent on the voltage potential across the membrane.
  • the cell additionally comprises an ion channel, receptor, transporter or membrane pore-forming agent that acts to set the membrane potential to a specific value.
  • Another aspect of the invention involves a method of monitoring subcellular organelle membrane potentials in a living cell comprising;
  • the second reagent is targetable to the subcellular membrane through fusion to a protein or peptide that contains a targeting or localization sequence(s).
  • Preferred localization sequences provide for specific localization of the protein to the defined location, with minimal accumulation of the reagent in other biological membranes.
  • transgenic organisms comprising a first reagent that comprises a charged hydrophobic fluorescent molecule, and a second reagent comprising a bioluminescent or naturally fluorescent protein.
  • the bioluminescent or naturally fluorescent protein is typically expressed within the transgenic organism and targetable to a cellular membrane.
  • a second reagent provided to the transgenic organism undergoes energy transfer with the first reagent or quenches light emission of said first reagent.
  • Another aspect of the invention is a method of screening test chemicals for activity to modulate a target ion channel, involving, providing a living cell comprising a target ion channel, and a membrane potential modulator wherein the membrane potential modulator sets the resting membrane potential to a predefined value between about ⁇ 150 mV and +100 mV. After contact of the living cell with a test chemical, the membrane potential across the cellular membrane is detected.
  • the invention works in one aspect by creating a cell with a defined membrane potential through the expression and regulation of the membrane potential modulator.
  • the invention provides for stable assays for rapidly inactivating ion channels, and provides a simple and convenient method of activating voltage dependent ion channels by appropriate regulation of the activity of the membrane potential modulator.
  • FIGS. 1A and 1B illustrate a scheme of the voltage-sensitive FRET mechanism
  • FIG. 2 illustrates normalized excitation and emission spectra for (A) fluorescein-labeled wheat germ agglutinin (FL-WGA) in Hanks' Balanced Salt Solution (HBSS), (B) (1,3-dihexyl-2-thiobarbiturate)trimethine oxonol [DiSBA-C 6 -(3)] in octanol, and (C) TR-WGA in HBSS;
  • FIG. 3 illustrates displacement currents of 2.3 M DiSBA-C 6 -(3) in L-M(TK ⁇ ) cells at 20 C;
  • FIG. 4 illustrates voltage dependence of DiSBA-C 6 -(3) moved during the displacement and tailcurrents for step voltage changes from a ⁇ 30 mV holding potential
  • FIG. 5 illustrates voltage dependence of DiSBA-C 6 -(3) displacement current time constants in L-M(TK ⁇ )cells for the same data shown in FIG. 4 ;
  • FIG. 6 illustrates simultaneous fluorescence changes of the FL-WGA/DiSBA-C 4 -(3) pair in response to 4 depolarizations from ⁇ 70 mV of 40, 80, 120, and 160 mV in a L-M(TK ⁇ ) cell at 20 C, with the single wavelength fluorescence emission traces of DiSBA-C 4 -(3) and FL-WGA being shown in panels A and B, respectively, and the FL-WGA/DiSBA-C 4 -(3) ratio displayed in (C);
  • FIG. 7 illustrates the time course of the fluorescence change of the FL-WGA/DiSBA-C 10 -(3)pair in response to a 100 mV depolarization from ⁇ 70 mV;
  • FIG. 8 illustrates a single sweep trace of fluorescence ratio changes from the FL-WGA/DiSBA-C 4 -(3) pair in beating neonatal cardiac myocytes, with the top trace (A) showing the FL-WGA channel, (B) the longer wavelength oxonol channel and (C) the FL-WGA/oxonol ratio, in which motion artifacts are significantly reduced; and
  • FIG. 9 illustrates the fluorescence changes of the FL-WGA/DiSBA-C 6 -(3) pair in a voltage clamped astrocytoma cell, the top trace (A) being the DiSBA-C 6 -(3) emission, (B) the FL-WGA fluorescence signal and (C) the FL-WGA/oxonol ratio.
  • FIG. 10 shows the synthesis of a fluorescent tetraaryl borate.
  • FIG. 11 shows a synthesis of an asymmetric oxonol and its linkage to a second reagent.
  • FIG. 12 shows possible linkage points (X) of oxonols to a second reagent.
  • FIG. 13 shows a synthesis of Di-SBA-C 6 -(3).
  • FIG. 14 shows the synthesis of a bifunctional linker.
  • FIGS. 15 and 16 show the synthesis of an asymmetric oxonol with a linker suitable for attachment to a second reagent.
  • FIG. 17 shows FRET between Cou-PE, a conjugate of a 6-chloro-7-hydroxycoumarin to dimyristoylphosphatidylethanolamine, as FRET donor, to a bis-(1,3-dihexyl-2-thiobarbiturate)-trimethineoxonol in an astrocytoma cell.
  • FIG. 18 shows FRET between DMPE-glycine-coumarin (Cou-PE) as FRET donor to a bis-(1,3-dihexyl-2-thiobarbiturate)-trimethineoxonol in L-cells.
  • FIG. 19 shows FRET between DMPE-glycine-coumarin (Cou-PE) as FRET donor to a bis-(1,3-dihexyl-2-thiobarbiturate)-trimethineoxonol in cardiomyocytes measured by ratio output.
  • FIG. 20 shows representative fluorescent phosphatidylethanolamine conjugates that function as FRET donors to the oxonols.
  • the structures on the left depict representative fluorophores and X denotes the site of attachment of the phosphatidylethanolamine (PE).
  • the structure (PE-R) on the right shows a phosphatidylethanolamine where R denotes a fluorophore attached to the amine of the ethanolamine.
  • FIG. 21 shows (A) emission spectrum of the Cou-PE; (B) the excitation spectrum of DiSBA-C 6 -(5); and (C) the emission spectrum of DiSBA-C 6 -(5)
  • FIG. 22 shows the speed of DiSBA-C 6 (5) translocation in response to a 100 mV depolarization step, using FRET from asymmetrically labeled Cou-PE.
  • FIG. 23 shows the spectra of [Tb(Salen) 2 ] ⁇ 1 (top) and [Eu(Salen) 2 ] ⁇ 1 (bottom), both as piperidinium salts dissolved in acetonitrile.
  • FIG. 24A shows a schematic representation of exogenous fluorescent lipid donors bound to the outer membrane of a bimolecular leaflet.
  • B shows the structure of bis-(1,3-dialkyl-2-thiobarbiturate), one of the trimethine oxonol acceptors of the present invention.
  • C shows a schematic view of a possible arrangement of the GFP/oxonol sensor with a GFP donor located on one surface of the biological membrane. Upon depolarization, the oxonol acceptors move to the lower membrane surface resulting in enhanced FRET due to the decrease in mean distance between the donor and acceptor.
  • FIG. 25 Shows an example ratiometric voltage-sensitive FRET signal in a voltage clamped single cell.
  • the cell was held at ⁇ 40 mV and hyperpolarized to ⁇ 80 mV at approximately 300 ms per time point At approximately 1600 ms, the cell was depolarized 100 mV to +20 mV.
  • the oxonol and GFP fluorescence intensities synchronously change in opposite directions. In this case, the direction of the fluorescence changes indicate that the GFP donor resides on the inner plasma membrane leaflet. Note how the calculation of the emission ratio eliminates the noise in the GFP and oxonol signals.
  • the voltage clamp stimulus protocol is shown below.
  • FIG. 26 Shows membrane potential assays using GFP/oxonol FRET voltage sensors performed in a 96 well plate. The additions of buffer containing various potassium concentrations were added using the VIPRTM plate reader between 12 and 15 seconds, as indicated by the arrow to RBL cells expressing the lyn-sapphire GFP fusion protein. (add patent citation). The cells were loaded with 4 uM DiSBAC 6 . The traces show the oxonol to GFP ratio normalized to the starting ratio prior to high K+ stimulus at various extracellular K concentrations.
  • FIG. 27 Shows a dose response of barium on endogenously expressed IRK1 and the high K+ response as determined using RBL cells expressing the lyn-sapphire GFP fusion, and loaded with 10 uM DiSBAC 4 .
  • the high potassium and normal sodium containing buffer controls in the absence of antagonist are shown to the left and right of the curve, respectively.
  • the error bars are +/ ⁇ standard deviation of 5 wells at each concentration.
  • hydrocarbyl shall refer to an organic radical comprised of carbon chains to which hydrogen and other elements are attached.
  • the term includes alkyl, alkenyl, alkynyl and aryl groups, groups which have a mixture of saturated and unsaturated bonds, carbocyclic rings and includes combinations of such groups. It may refer to straight chain, branched-chain, cyclic structures or combinations thereof.
  • alkyl refers to a branched or straight chain acyclic, monovalent saturated hydrocarbon radical of one to twenty carbon atoms.
  • alkenyl refers to an unsaturated hydrocarbon radical which contains at least one carbon-carbon double bond and includes straight chain, branched chain and cyclic radicals.
  • alkynyl refers to an unsaturated hydrocarbon radical which contains at least one carbon-carbon triple bond and includes straight chain, branched chain and cyclic radicals.
  • heteroalkyl refers to a branched or straight chain acyclic, monovalent saturated radical of two to forty atoms in the chain in which at least one of the atoms in the chain is a heteroatom, such as, for example, oxygen or sulfur.
  • lower-alkyl refers to an alkyl radical of one to six carbon atoms. This term is further exemplified by such radicals as methyl, ethyl, n-propyl, isopropyl, isobutyl, sec-butyl, n-butyl and tert-butyl, n-hexyl and 3-methylpentyl
  • cycloalkyl refers to a monovalent saturated carbocyclic radical of three to twelve carbon atoms in the carbocycle.
  • heterocycloalkyl refers to a monovalent saturated cyclic radical of one to twelve atoms in the ring, having at least one heteroatom, such as oxygen or sulfur) within the ring.
  • alkylene refers to a fully saturated, cyclic or acyclic, divalent, branched or straight chain hydrocarbon radical of one to forty carbon atoms This term is further exemplified by radicals such as methylene, ethylene, n-propylene, 1-ethylethylene, and n-heptylene.
  • heteroalkylene refers to an alkylene radical in which at least one of the atoms in the chain is a heteroatom.
  • heterocyclo-diyl refers to a divalent radical containing a heterocyclic ring.
  • the free valences may both be on the heterocyclic ring or one or both may be on alkylene substituents appended onto the ring.
  • lower-alkylene refers to a fully saturated, acyclic, divalent, branched or straight chain hydrocarbon radical of one to six carbon atoms. This term is further exemplified by such radicals as methylene, ethylene, n-propylene, i-propylene, n-butylene, i-butylene (or 2-methylpropylene), isoamylene (or 3,3 dimethylpropylene), pentylene, and n-hexylene.
  • cycloalkyl lower-alkyl refers to a cycloalkyl group appended to a lower-alkyl radical. This term is exemplified by, but not limited to, groups such as cyclopropylmethyl, cyclopentylmethyl, cyclopentylethyl, and cyclopentylpropyl.
  • substituted phenyl refers to a phenyl group which is mono-, di-, tri-, or tetra-substituted, independently, with hydrocarbyl, alkyl, lower-alkyl, cycloalkyl or cycloalkyl lower alkyl.
  • aryl refers to an aromatic monovalent carbocyclic radical having a single ring (e.g., phenyl) or multiple condensed rings (e.g., naphthyl, anthracenyl), which can optionally be mono-, di-, or tri-substituted, independently, with hydrocarbyl, alkyl, lower-alkyl, cycloalkyl or cycloalkyl lower alkyl.
  • arylene refers to an aromatic divalent carbocyclic radical.
  • the open valence positions may be at any position on the ring(s). In the case of a divalent phenyl radical, they may be ortho, meta or para to each other.
  • aralkyl refers to an aryl group appended to a lower-alkyl radical. This term is exemplified by, but not limited to, groups such as benzyl, 2-phenylethyl and 2-(2-naphthylethyl).
  • alkenyl refers to an aryl group appended to a fully conjugated alkenyl radical. This term is exemplified by styrenyl (cis and trans) and 1-phenyl butadienyl and 1-naphthyl butadienyl (including all possible combinations of the Z and E isomers about the double bonds).
  • halo refers to fluoro, bromo, chloro and iodo.
  • lower-alkylthio refers to the group R—S—, where R is lower-alkyl.
  • leaving group means a group capable of being displaced by a nucleophile in a chemical reaction, for example halo, alkyl sulfonates (e.g., methanesulfonate), aryl sulfonates, phosphates, sulfonic acid, sulfonic acid salts, imidazolides, N-hydroxy succinimides and the like.
  • alkyl sulfonates e.g., methanesulfonate
  • aryl sulfonates phosphates, sulfonic acid, sulfonic acid salts
  • imidazolides imidazolides
  • N-hydroxy succinimides and the like.
  • linker refers to any chemically and biologically compatible covalent grouping of atoms which can serve to link together the first and second reagents of this invention.
  • preferred linkers have from 20 to 40 bonds from end to end, preferably 25 to 30 bonds, and may be branched or straight chain or contain rings.
  • the bonds may be carbon-carbon or carbon-heteroatom or heteroatom-heteroatom bonds
  • the linkage can be designed to be hydrophobic or hydrophilic.
  • the linking group can contain single an(Vor double bonds, 0–10 heteroatoms (O, S preferred), and saturated or aromatic rings
  • the linking group may contain groupings such as ester, ether, sulfide, disulfide and the like.
  • amphiphilic refers to a molecule having both a hydrophilic and a hydrophobic portion.
  • bioluminescent protein refers to a protein capable of causing the emission of light through the catalysis of a chemical reaction.
  • the term includes proteins that catalyze bioluminescent or chemiluminescent reactions, such as those causing the oxidation of luciferins.
  • bioluminescent protein includes not only bioluminescent proteins that occur naturally, but also mutants that exhibit altered spectral or physical properties.
  • fluorescent component refers to a component capable of absorbing light and then re-emitting at least some fraction of that energy as light over time
  • the term includes discrete compounds, molecules, naturally fluorescent proteins and marco-molecular complexes or mixtures of fluorescent and non-fluorescent compounds or molecules.
  • fluorescent component also includes components that exhibit long lived fluorescence decay such as lanthamide ions and lanthamide complexes with organic ligand sensitizers, that absorb light and then re-emit the energy over milliseconds.
  • FRET fluorescence resonance energy transfer.
  • FRET refers to energy transfer processes that occur between two fluorescent components, a fluorescent component and a non-fluorescent component, a luminescent component and a fluorescent component and a luminescent component with a non-fluorescent component.
  • transgenic animals having gene knockouts are those in which the target gene has been rendered nonfunctional by an insertion targeted to the gene to be rendered non-functional by homologous recombination.
  • heterologous refers to a nucleic acid sequence that either originates from another species or is modified from either its original form or the form primarily expressed in the cell.
  • homolog refers to two sequences or parts thereof, that are greater than, or equal to 75% identical when optimally aligned using the ALIGN program.
  • Homology or sequence identity refers to the following. Two amino acid sequences are homologous if there is a partial or complete identity between their sequences. For example, 85% homology means that 85% of the amino acids are identical when the two sequences are aligned for maximum matching. Gaps (in either of the two sequences being matched) are allowed in maximizing matching; gap lengths of 5 or less are preferred with 2 or less being more preferred.
  • two protein sequences are homologous, as this term is used herein, if they have an alignment score of more than 5 (in standard deviation units) using the program ALIGN with the mutation data matrix and a gap penalty of 6 or greater. See Dayhoff, M. O., in Atlas of Protein Sequence and Structure, 1972, volume 5, National Biomedical Research Foundation, pp. 101–110, and Supplement 2 to this volume, pp. 1–10.
  • luminescent component refers to a component capable of absorbing energy, such as electrical (e.g. Electro-luminescence), chemical (e.g. chemi-luminescence) or acoustic energy and then emitting at least some fraction of that energy as light over time.
  • component includes discrete compounds, molecules, bioluminescent proteins and marco-molecular complexes or mixtures of luminescent and non-luminescent compounds or molecules that act to cause the emission of light.
  • membrane potential modulator refers to components capable of altering the resting or stimulated membrane potential of a cellular or subcellular compartment.
  • the term includes discrete compounds, ion channels, receptors, pore forming proteins or any combination of these components.
  • naturally fluorescent protein refers to a protein capable of forming a highly fluorescent, intrinsic chromophore either through the cyclization and oxidation of internal amino acids within the protein or via the enzymatic addition of a fluorescent co-factor.
  • the term includes wild-type fluorescent proteins and engineered mutants that exhibit altered spectral or physical properties. The term does not include proteins that exhibit weak fluorescence by virtue only of the fluorescence contribution of non-modified tyrosine, tryptophan, histidine and phenylalanine groups within the protein.
  • Naturally occurring refers to a component produced by cells in the absence of artifical genetic or other modifications of those cells.
  • operably linked refers to a juxtaposition wherein the components so described are in a relationship permitting them to function in their intended manner.
  • a control sequence “operably linked” to a coding sequence is ligated in such a way that expression of the coding sequence is achieved under conditions compatible with the control sequences.
  • targetable refers to a component that has the ability to be localized to a specific location under certain conditions.
  • a protein that can exist at two or more locations that has the ability to translocate to a defined site under some condition(s) is targetable to that site.
  • Common examples include the translocation of protein kinase C to the plasma membrane upon cellular activation, and the binding of SH2 domain containing proteins to phosphorylated tyrosine residues.
  • the term includes components that are persistently associated with one specific location or site, under most conditions.
  • test chemical refers to a chemical to be tested by one or more screening method(s) of the invention as a putative modulator.
  • a test chemical can be any chemical, such as an inorganic chemical, an organic chemical, a protein, a peptide, a carbohydrate, a lipid, or a combination thereof.
  • various predetermined concentrations of test chemicals are used for screening, such as 0.01 micromolar, 1 micromolar and 10 micromolar.
  • Test chemical controls can include the measurement of a signal in the absence of the test compound or comparison to a compound known to modulate the target.
  • transformed refers to a cell into which (or into an ancestor of which) has been introduced, by means of recombinant nucleic acid techniques, a heterologous nucleic acid molecule.
  • transgenic is used to describe an organism that includes exogenous genetic material within all of its cells.
  • the term includes any organism whose genome has been altered by in vitro manipulation of the early embryo or fertilized egg or by any transgenic technology to induce a specific gene knockout.
  • transgene refers any piece of DNA which is inserted by artifice into a cell, and becomes part of the genome of the organism (i.e., either stably integrated or as a stable extrachromosomal element) which develops from that cell.
  • a transgene may include a gene which is partly or entirely heterologous (i.e., foreign) to the transgenic organism, or may represent a gene homologous to an endogenous gene of the organism. Included within this definition is a transgene created by the providing of an RNA sequence that is transcribed into DNA and then incorporated into the genome.
  • the transgenes of the invention include DNA sequences that encode the fluorescent or bioluminescent protein that may be expressed in a transgenic non-human animal.
  • reference sequence is a defined sequence used as a basis for a sequence comparison; a reference sequence may be a subset of a larger sequence, for example, as a segment of a full-length cDNA or gene sequence given in a sequence listing such as a SEQ. ID. NO: 1, or may comprise a complete cDNA or gene sequence. Generally, a reference sequence is at least 20 nucleotides in length, frequently at least 25 nucleotides in length, and often at least 50 nucleotides in length.
  • two polynucleotides may each (1) comprise a sequence (i.e., a portion of the complete polynucleotide sequence) that is similar between the two polynucleotides, and (2) may further comprise a sequence that is divergent between the two polynucleotides
  • sequence comparisons between two (or more) polynucleotides are typically performed by comparing sequences of the two polynucleotides over a “comparison window” to identify and compare local regions of sequence similarity.
  • a “comparison window”, as used herein, refers to a conceptual segment of at least 20 contiguous nucleotide positions wherein a polynucleotide sequence may be compared to a reference sequence of at least 20 contiguous nucleotides and wherein the portion of the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) of 20 percent or less as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences.
  • Optimal alignment of sequences for aligning a comparison window may be conducted by the local homology algorithm of Smith and Waterman (1981) Adv. Appl. Math. 2: 482, by the homology alignment algorithm of Needleman and Wunsch (1970) J.
  • sequence identity means that two polynucleotide sequences are identical (i.e., on a nucleotide-by-nucleotide basis) over the window of comparison.
  • percentage identical to a sequence is calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base (e.g., A, T, C, G, U, or I) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison (i.e., the window size), and multiplying the result by 100 to yield the percentage of sequence identity.
  • the identical nucleic acid base e.g., A, T, C, G, U, or I
  • substantially identical denotes a characteristic of a polynucleotide sequence, wherein the polynucleotide comprises a sequence that has at least 30 percent sequence identity, preferably at least 50 to 60 percent sequence identity, more usually at least 60 percent sequence identity as compared to a reference sequence over a comparison window of at least 20 nucleotide positions, frequently over a window of at least 25–50 nucleotides, wherein the percentage of sequence identity is calculated by comparing the reference sequence to the polynucleotide sequence which may include deletions or additions which total 20 percent or less of the reference sequence over the window of comparison.
  • the term “substantial identity” means that two peptide sequences, when optimally aligned, such as by the programs GAP or BESTFIT using default gap weights, share at least 30 percent sequence identity, preferably at least 40 percent sequence identity, more preferably at least 50 percent sequence identity, and most preferably at least 60 percent sequence identity
  • residue positions which are not identical differ by conservative amino acid substitutions.
  • Conservative amino acid substitutions refer to the interchangeability of residues having similar side chains.
  • a group of amino acids having aliphatic side chains is glycine, alanine, valine, leucine, and isoleucine; a group of amino acids having aliphatic-hydroxyl side chains is serine and threonine; a group of amino acids having amide-containing side chains is asparagine and glutamine; a group of amino acids having aromatic side chains is phenylalanine, tyrosine, and tryptophan; a group of amino acids having basic side chains is lysine, arginine, and histidine; and a group of amino acids having sulfur-containing side chains is cysteine and methionine.
  • Preferred conservative amino acids substitution groups are: valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, glutamic-aspartic, and asparagine-glutamine,
  • any undefined terms shall be construed to have the same meaning as is commonly understood by one of skill in the art to which this invention belongs.
  • the singular forms “a”, “an” and “the” include plural referents unless the context clearly dictates otherwise.
  • reference to a “restriction enzyme” or a “high fidelity enzyme” may include mixtures of such enzymes and any other enzymes fitting the stated criteria, or reference to the method includes reference to one or more methods for obtaining cDNA sequences which will be known to those skilled in the art or will become known to them upon reading this specification.
  • compositions used in the methods of the invention typically comprise two reagents.
  • the first reagent comprises a mobile hydrophobic molecule that rapidly redistributes within the biological membrane in response to changes in transmembrane potential.
  • the first reagent is charged and preferably positively charged under the physiological conditions within a living cell. This species is referred to as the mobile or hydrophobic molecule.
  • the second reagent comprises a luminescent or fluorescent component that is capable of undergoing energy transfer with the first reagent, typically by donating excited state energy to the mobile fluorescent molecule. In the case where the second reagent is a fluorescent component, it may also be capable accepting excited state energy from the mobile fluorescent molecule.
  • the first and second reagents are spectroscopically complementary to each other, by which is meant that their spectral characteristics are such that excited state energy transfer can occur between them.
  • Either reagent can function as the donor or the acceptor, in which case the other reagent is the corresponding complement, i.e., the acceptor or donor respectively.
  • Both FRET and quenching are highly sensitive to the distance between the two species. For example, the nonradiative Forster-type quenching observed in FRET varies inversely with the sixth power of the distance between the donor and acceptor species. Therefore, when the membrane potential changes and the hydrophobic fluorescent molecule moves either further away from or closer to the second reagent, FRET between the two reagents is either reduced or enhanced significantly.
  • Other mechanisms such as electron-transfer, Dexter exchange interaction, paramagnetic quenching, and promoted intersystem crossing are even shorter-range and require the two reagents to collide or at least come within 1 nm of each other.
  • the present invention includes voltage assays that derive at least some part of the measurable signal from non-FRET derived changes in light emission from either the first or second reagent. Such changes in light emission can occur as a direct or indirect effect of the transmembrane potential on the fluorescent or luminescent properties of first or second reagent. For example, translocation of a fluorescent dye into or out of the lipid bilayer can cause significant alterations in the molar extinction coefficient and quantum yield of the dye that can be exploited to significantly amplify a FRET signal.
  • Naturally fluorescent proteins have been successfully fused to a range of proteins and in some cases these have been demonstrated to provide conformation sensitive changes in the fluorescent properties of the fluorescent protein (for example see PCT publication WO 98/30715). Such changes in protein conformation can result in alterations in the optical properties of the fluorescent or bioluminescent protein that can be used to measure a membrane potential change. Significantly larger and more specific signal changes in response to a given transmembrane change may further be provided by combining the approach with the use of FRET to a second fluorophore.
  • One aspect of the present invention provides highly fluorescent anionic dyes which translocate across the membrane at much faster rates, with exponential time constants typically less than about 10 ms, frequently less than 5 ms, most frequently from about 1 to 3 ms and most preferably less than 1 ms time scale (e.g., 0.1 to 1 ms). These translocation rates are independent of the presence of the second reagent on the extracellular surface of the membrane.
  • Response times of ⁇ 1 ms are necessary for accurate measurement of single action potentials in individual neurons and are obtained with some of the dyes described herein (e.g., hexyl-substituted pentamethineoxonol, diSBA-C 6 -(5)).
  • Other dyes described herein have response times in the 2–5 ms range, which are fast enough to monitor voltage changes in heart and smooth muscle, many synaptic potentials in single neurons, and the average firing activity in populations of neurons (for example, mapping the electrical responses of different regions of the central nervous system to sensory inputs).
  • the indicators of the present invention are able to follow both rapid and slower voltage changes over a time scale of seconds to minutes.
  • the first reagent comprises a hydrophobic ion (fluorescence donor, acceptor, or quencher) which serves as a voltage sensor and moves within the membrane in response to changes in the transmembrane potential.
  • a hydrophobic ion fluorescence donor, acceptor, or quencher
  • the distribution of hydrophobic ions between the two membrane-aqueous interfaces is determined by the membrane potential. Cations will tend to congregate at the negatively charged membrane interface and correspondingly, anions will move to the positively charged interface.
  • the inherent sensitivity of the invention is based on the large interfacial concentration changes of the mobile ion at physiologically relevant changes in membrane potentials.
  • a 60 mV change produces 10-fold change in the ratio of the anion concentrations at the respective interfaces.
  • the methods of this invention couple this change in interfacial concentration to an efficient fluorescent readout thus providing a sensitive method of detecting changes in transmembrane potential.
  • the speed of the fluorescence change is dependent on the membrane translocation rate of the hydrophobic ion.
  • the mobile ions that translocate across the biological membrane are hydrophobic in order to bind strongly to the membrane and translocate rapidly across it in response to changes in transmembrane potential.
  • the ion will have a single charge which will be delocalized across a significant portion of the dye, preferably the entire dye. Delocalization of the charge reduces the Born charging energy (inversely proportional to anion radius) required to move a charged molecule from a hydrophilic to a hydrophobic environment and facilitates rapid translocation of ions (Benz, R. 1988. “Structural requirement for the rapid movement of charged molecules across membranes”, Biophys. J. 54:25–33).
  • hydrophobicity minimizes release of the bound dye from the plasma membrane and buries the ion deeper into the membrane, which decreases the electrostatic activation energy for translocation.
  • Polar groups on the ion should be kept to a minimum and shielded as much as possible to disfavor solvation in the headgroup region of the bilayer
  • hydrophobicity cannot be increased without limit, because some aqueous solubility is required to permit cellular loading.
  • dyes may be loaded with the aid of amphiphilic solubilizing reagents such as beta-cyclodextrin, Pluronics such as Pluronic F-127, or polyethylene glycols such as PEG400, which help solubilize the hydrophobic ions in aqueous solution.
  • hydrophobic when used in the context of the hydrophobic ion refers to a species whose partition coefficient between a physiological saline solution (e.g. HBSS) and octanol is preferably at least about 50, and more preferably at least about 1000. Its adsorption coefficient to a phospholipid bilayer (such as for example a membrane derived from a human red blood cell is at least about 100 nm, preferably at least about 300 nm (where the membrane is 3 nm). Methods of determining partition coefficients and adsorption coefficients are known to those of skill in the art.
  • a physiological saline solution e.g. HBSS
  • octanol preferably at least about 50, and more preferably at least about 1000. Its adsorption coefficient to a phospholipid bilayer (such as for example a membrane derived from a human red blood cell is at least about 100 nm, preferably at least about 300 nm (where the membrane is 3
  • the hydrophobic dye be an anionic species. Ester groups of biological membranes generate a sizable dipole potential within the hydrocarbon core of the membrane. This potential aids anion translocation through the hydrophobic layer but hinders cations. Therefore, where membrane translocation is concerned, anions have a tremendous inherent speed advantage over cations For example, it is known that for the isostructural ions tetraphenylphosphonium cation and tetraphenylborate anion, the anion is much more permeable than the cation (Flewelling, R. F. and Hubbell, W. L. 1986. “The membrane dipole potential in a total membrane potential model”, Biophys. J. 49:541–552).
  • the anions should be strongly fluorescent when adsorbed to the membrane, whereas they should have minimal fluorescence when free in aqueous solution
  • the anionic fluorophores should be at least four times, and more preferably at least about eight times, brighter when adsorbed to the membrane. In the case of the thiobarbiturate oxonols described herein, their fluorescence is about 20 fold greater in the membrane than in water.
  • the first reagent In principle, if the dye bound extremely tightly to the membrane one would not need a high ratio of fluorescence when bound to the membrane to that when free in aqueous solution; however, because in reality the volume of the membrane is tiny relative to the aqueous solution and some water solubility is necessary for loading of the dye into cells and tissue, it is desirable for the first reagent to be at least about four times more strongly fluorescent in a membrane than in aqueous solution.
  • the anions also should not act as ionophores, especially protonophores, since such behavior may generate sustained leakage currents. Therefore, the protonation pKa of the anion is typically well below 7, preferably below 5, more preferably below 3. Red to infra-red wavelengths of excitation and emission are preferred to avoid tissue scattering and heme absorbances. Photodynamic damage should be kept as low as possible, probably best by minimizing triplet state formation and the resulting generation of singlet oxygen.
  • Fluorescent hydrophobic ions include polymethine oxonols, tetraaryl borates conjugated to fluorophores and fluorescent complexes of rare earth and transition metals.
  • polymethine oxonol refers to molecules comprising two potentially acidic groups linked via a polymethine chain and possessing a single negative charge delocalized between the two acidic groups.
  • the preferred acidic groups are barbiturates or thiobarbiturates.
  • each of the two (thio)barbiturates may be the same or different
  • the symmetric (thio)barbiturate oxonols are described by the conventional shorthand DiBA-C n -(x) and DiSBA-C n -(x), where DiBA refers to the presence of two barbiturates, DiSBA refers to the presence of two thilobarbiturates, C n represents alkyl substituents having n carbon atoms on the nitrogen atoms of the (thio)barbiturates, and x denotes the number of carbon atoms in the polymethine chain linking the (thio)barbiturates.
  • oxonols with long chain alkyl substituents e.g. C n greater than hexyl, especially decyl in the pentamethine oxonols
  • Oxonol compounds used in this invention have a general structure of Formula I.
  • R is independently selected from the group consisting of H, hydrocarbyl and heteroalkyl
  • X is independently oxygen or sulfur
  • n is an integer from 1 to 3;
  • the oxonol anions are usually loaded as salts with the cation typically being H + , alkali metal, substituted ammonium, or pyridinium.
  • X is sulfur, i.e., the hydrophobic anion is a bis-(1,3-dialkyl-2-thiobarbiturate)-polymethine oxonol or a derivative thereof.
  • R is a hydrocarbyl group
  • it can be independently selected from the group consisting of alkyl, aryl, aralkyl, cycloalkyl and cycloalkyl lower-alkyl. Typically these groups have from about 2 to about 40 carbon atoms, more preferably, about 5 to about 20 carbon atoms.
  • Aryl groups can be substituted with hydrocarbyl, alkyl, lower alkyl, heteroalkyl and halogen groups. Oxonols in which the R groups on a particular (thio)barbiturate moiety are different to each other are specifically contemplated by this invention and can be prepared from unsymmetrical urea derivatives.
  • R is a hydrocarbyl group of the formula: —(CH 2 ) p (CH ⁇ CH—CH 2 ) q (CH 2 ) r CH 3 wherein:
  • p is an integer from 1 to about 20 (preferably about 1 to 2);
  • q is an integer from 1 to about 6, preferably 1 to 2;
  • stereochemistry of the double bond(s) may be cis or trans, cis being preferred;
  • r is an integer from 1 to about 20 (preferably about 1 to 3), and p+3q+r+1 40, preferably from about 4 to 20, more preferably about 6 to 10.
  • R is a heteroalkyl group of the formula: —(CH 2 ) x A y (CH 2 ) z CH 3 , wherein:
  • R is a phenyl group independently substituted with up to four substituents selected from the group consisting of hydrocarbyl, heteroalkyl, halogen and H.
  • one of the four R groups incorporates a linker to the second reagent, as described below.
  • An oxonol's negative charge is distributed over the entire the chromophore.
  • An oxonol where R n-hexyl, DiSBA-C 6 -(3), translocates with a time constant ( ) ⁇ 3 ms in voltage clamped mammalian cells.
  • the corresponding decyl compound, DiSBA-C 10 -(3) translocates with a time constant ⁇ 2 ms.
  • Another useful class of fluorescent hydrophobic anions are tetraaryl borates having a general structure of Formula II. [(Ar 1 ) 3 B—Ar 2 —Y-FLU]- Formula II wherein:
  • Ar 1 is an aryl group
  • Ar 2 is a bifunctional arylene group
  • B is boron
  • Y is oxygen or sulfur
  • FLU is a neutral fluorophore
  • Ar 1 is substituted with one or two electron withdrawing groups, such as but not limited to CF 3 .
  • Ar 1 and Ar 2 are optionally substituted phenyl groups as shown below for the structure of Formula III.
  • each R′ is independently H, hydrocarbyl, halogen, CF 3 or a linker group
  • n is an integer from 0 to 5;
  • each X is independently H, halogen or CF 3 ;
  • n is an integer from 0 to 4.
  • Y is oxygen or sulfur
  • FLU is a neutral fluorophore
  • R′ When R′ is hydrocarbyl, it is typically from 1 to about 40 carbon atoms, preferably 3 to about 20 carbon atoms, more preferably about 5 to 15 carbon atoms.
  • R′ is a lower alkyl group, more preferably (for ease of synthesis) all the R's are H.
  • X is typically electron-withdrawing to prevent photoinduced electron transfer from the tetraaryl borate to the fluorophore, which quenches the latter.
  • FIG. 10 A general synthesis of fluorescent tetraaryl borate anions has been developed and is shown in FIG. 10 for an exemplary fluorescent bimane tetraaryl borate conjugate (identified as Bormane, compound IV in FIG. 10 ).
  • a triaryl borane is reacted with a protected phenoxy or thiophenoxy organometallic reagent, such as, for example, an organolithium derivative.
  • the protecting group is subsequently removed and the unmasked phenol (or thiophenol) is reacted with a fluorophore bearing a leaving group.
  • Nucleophilic displacement of the leaving group followed by conventional purification of the crude reaction product furnishes the tetraaryl borate anion conjugated to the fluorophore.
  • Substituents R′ and X are varied by appropriate choice of the starting triaryl borane and the phenoxy (or thiophenoxy) organometallic. Suitable starting materials can be obtained from Aldrich Chemical Co.
  • the fluorophore conjugated to the tetraaryl borate be a neutral species.
  • a neutral fluorophore may be defined as a fluorescent molecule which does not contain charged functional groups.
  • Representative fluorescent molecules bearing leaving groups and suitable for conjugation are available from Molecular Probes (Portland, Oreg.), Eastman Kodak (Huntington, Tenn.), Pierce Chemical Co. (Rockville, Md.) and other commercial suppliers known to those of skill In the art.
  • leaving groups can be introduced into fluorescent molecules using methods known to those of skill in the art.
  • neutral fluorophores which can be conjugated to the tetraaryl borates for use in accordance with the present invention include, but are not limited to, the following: bimanes; bodipys; and coumarins
  • Bodipys i.e., difluoroboradiazaindacenes
  • Formula IV may be represented by a general structure of Formula IV.
  • each R 1 which may be the same or different, is independently selected from the group consisting of H, lower alkyl, aryl, heteroaromatic, aralkenyl and an alkylene attachment point;
  • each R 2 which may be the same or different, is independently selected from the group consisting of H, lower alkyl, phenyl and an alkylene attachment point.
  • alkylene attachment point refers to the group —(CH 2 ) t — or —(CH 2 ) t —C(O)— wherein, t is an integer from 1 to 10, and one valence bond is attached to the fluorophore and the other valence bond is attached to the tetraaryl borate.
  • t is an integer from 1 to 10
  • one valence bond is attached to the fluorophore and the other valence bond is attached to the tetraaryl borate.
  • t 1, i.e. the alkylene attachment point is a methylene group.
  • all fluorophores will possess one attachment point at which they will be conjugated to the tetraaryl borate.
  • the precursor molecule used to conjugate the fluorophore to the tetraaryl borate will carry a leaving group at the attachment point. Reaction of this precursor with an appropriate nucleophile on the tetraaryl borate (e.g., an amine, hydroxy or thiol), will provide a fluorophore-tetraaryl borate conjugate linked together at the attachment point.
  • an appropriate nucleophile on the tetraaryl borate e.g., an amine, hydroxy or thiol
  • the term “attachment point” refers more broadly to a chemical grouping which is appropriate to react with either a fluorophore or a bifunctional linker to form the fluorescent conjugates and/or linked first and second reagents as disclosed herein.
  • these attachment points will carry leaving groups, e g., alkyl tosylates, activated esters (anhydrides, N-hydroxysuccinimidyl esters and the like) which can react with a nucleophile on the species to be conjugated.
  • leaving groups e g., alkyl tosylates, activated esters (anhydrides, N-hydroxysuccinimidyl esters and the like) which can react with a nucleophile on the species to be conjugated.
  • leaving groups e g., alkyl tosylates, activated esters (anhydrides, N-hydroxysuccinimidyl esters and the like) which can react with a nucleophile on the species to be conjugated.
  • each R 3 which may be the same or different, is independently selected from the group consisting of H, halogen, lower alkyl, CN, CF 3 , COOR 5 , CON(R 5 ) 2 , OR 5 , and an attachment point;
  • R 4 is selected from the group consisting of OR 5 and N(R 5 ) 2 ;
  • Z is O, S or NR 5 ;
  • each R 5 which may be the same or different, is independently selected from the group consisting of H, lower alkyl and an alkylene attachment point.
  • Bimanes may be represented by a structure of general Formula VII.
  • each R 5 which may be the same or different, is independently H, lower alkyl or an alkylene attachment point
  • Fluorescent tetraaryl borates with coumarins and bimanes attached have been prepared These fluorescent borates translocate with ⁇ 3 ms in voltage clamped fibroblasts. Synthesis of an exemplary fluorescent tetraryl borate is described in Example V.
  • Lanthamide ions such as, for example, Tb 3+ and Eu 3+ , luminesce in the green and red regions of the visible spectrum with millisecond lifetimes.
  • the emission is composed of several sharp bands that are indicative of the atomic origin of the excited states.
  • Direct excitation of the ions can be accomplished using deep UV light
  • Excitation of the lanthamide ions at longer wavelengths is possible when the ions are chelated by absorbing ligands that can transfer excitation energy to the ions, which then can luminesce with their characteristic emission as if they had been excited directly.
  • Lanthamide complexes of Tb 3+ and Eu 3+ with absorbing ligands that contribute 4 negative charges, resulting a net charge of ⁇ 1, may function as mobile ions for the voltage-sensitive FRET mechanism.
  • the lifetimes of Tb 3+ and Eu 3+ are still sufficiently fast to measure millisecond voltage changes.
  • This invention also provides such complexes which can function the fluorescent hydrophobic anion (as FRET donors) in the first reagent.
  • FRET donors fluorescent hydrophobic anion
  • ligand bis-(salicylaldehyde)ethylenediamine (Salen) 2 ⁇ [Tb(Salen) 2 ] ⁇ 1 and [Eu(Salen) 2 ] ⁇ 1 have been made.
  • These complexes absorb maximally at 350 nm with significant absorbance up to 380 nm and luminesce with the characteristic atomic emission, FIG. 10 .
  • lanthamide complexes as donors offers several unique advantages Scattering, cellular autofluorescence, and emission from directly excited acceptors have nanosecond or shorter lifetimes and may be rejected by time gating of the emission acquisition (See for example Marriott, G., Heidecker, M., Diamandis, E. P., Yan-Marriott, Y. 1994. Time-resolved delayed luminescence image microscopy using an europium ion chelate complex Biophys. J. 67: 957–965).
  • Lanthamide chelates can also be used as asymmetrically labeled donors to mobile acceptors such as the tri and pentamethine oxonols, with the same advantages as discussed above.
  • Ln Tb, Eu, or Sm
  • R is independently H, C1–C8 alkyl, C1–C8 cycloalkyl or C1–C4 perfluoroalkyl;
  • X and Y are independently H, F, Cl, Br, I, NO 2 , CF 3 , lower (C1–C4) alkyl, CN, Ph, O-(lower alkyl), or OPh; or X and Y together are —CH ⁇ CH—; and
  • Z 1,2-ethanediyl, 1,3-propanediyl, 2,3-butanediyl, 1,2-cyclohexanediyl, 1,2-cyclopentanedlyl, 1,2-cycloheptanediyl, 1,2-phenylenediyl, 3-oxa-1,5-pentanediyl, 3-aza-3-(lower alkyl)-1,5-pentanediyl pyridine-2,6-bis(methylene) or tetrahydrofuran-2,5-bis(methylene).
  • the second reagent is a luminescent or fluorescent donor, acceptor, or quencher, complementary to the first reagent, the hydrophobic molecule, and is targetable to either the extracellular or intracellular face of the biological membrane.
  • the presence of the second reagent on one or the other face of the membrane desymmetrizes the membrane.
  • energy transfer between the first and second reagent provides an optical readout read out which changes in response to movement of the hydrophobic within the biological membrane.
  • the luminescent or fluorescent component As would be immediately apparent to those skilled in the field, there are numerous molecular species that could function as the luminescent or fluorescent component and serve as the active desymmetrizing agent.
  • the primary characteristics for this component are that it is located on one face of the biological membrane and function in a complementary manner (i.e., as a fluorescent donor, acceptor, or quencher) to the hydrophobic ion which shuttles back forth across the membrane as the transmembrane potential changes.
  • Exemplary fluorescent second reagents include fluorescent lectins, fluorescent lipids, fluorescent carbohydrates with hydrophobic substituents, naturally fluorescent proteins or homologs thereof, fluorescently labelled antibodies against surface membrane constituents, or xanthenes, cyanines and coumarins with hydrophobic and hydrophilic substituents to promote binding to membranes and to prevent permeation through membranes.
  • Exemplary luminescent second reagents include chemi-luminescent, electro-luminescent and bioluminescent compounds.
  • Preferred bioluminescent compounds include bioluminescent proteins such as firefly, bacterial or click beetle luciferases, acquorins and other photoproteins, such as Cypridina luciferase.
  • lectins carrying a fluorescent label are lectins carrying a fluorescent label.
  • a lectin may be defined as a sugar binding protein which binds to glycoproteins and glycolipids on the extracellular face of the plasma membrane See, Roth, J, “The Lectins: Molecular Probes in Cell Biology and Membrane Research,” Exp. Patholo . (Supp.
  • Lectins include Concavalin A; various agglutinins (pea agglutinin, peanut agglutinin, wheat germ agglutinin, and the like); Ricin, A chain and the like A variety of lectins are available from Sigma Chemical Co., St. Louis, Mo.
  • Suitable fluorescent labels for use in fluorescent lectins include, but are not limited to, the following: xanthenes (including fluoresceins, rhodamines and rhodols); bodipys, cyanines, and luminescent transition metal complexes. It will be recognized that the fluorescent labels described below can be used not merely with lectins but with the other second reagents described herein. To date, the best results with lectins have been obtained with fluorescein labeled wheat germ agglutinin (FL-WGA).
  • One preferred class of fluorescent labels comprise xanthene chromophores having a structure of general Formula VIII or IX.
  • R 6 is independently selected from the group consisting of H, halogen, lower alkyl, SO 3 H and an alkylene attachment point;
  • R 7 is selected from the group consisting of H, lower alkyl, an alkylene attachment point, and R 8 , wherein R 8 is selected from the group consisting of
  • T is selected from the group consisting of O, S, C(CH 3 ) 2 and NR 9 ;
  • M is selected from the group consisting of O and NR 9 R 9 ;
  • each R 9 which may be the same or different, is independently H or hydrocarbyl.
  • Another preferred class of fluorescent labels are cyanine dyes having a structure of general Formula X.
  • T′ is selected from the group consisting of O, S, C(CH 3 ) 2 , —CH ⁇ CH—, and NR 17 , where R 17 is H or hydrocarbyl; and n is an integer from 1 to 6.
  • amphipathic lipids in particular phospholipids, have also been successfully employed.
  • an amphipathic lipid may be defined as a molecule with both hydrophobic and hydrophilic groups that bind to but do not readily cross the cell membrane. Fluorescently labelled phospholipids are of particular value as second reagent.
  • phospholipids include phosphatidic acid (PA), and phosphatidyl glycerols (PG), phosphatidylcholines (PC), phosphatidylethanolamines (PE), phospatidylinositols (PI), phosphatidylserines (PS), and phosphatidyl-choline, serine, inositol, ethanolamine lipid derivatives such as egg phosphatidylcholine (EPC), dilauroylphosphatidylethanolamine, dimyristoylphosphatidylethanolamine, dipalmitoyl-phosphatidylethanolamine, distearoylphosphatidylethanolamine, dioleoyl-phosphatidylethanolamine, distearoyl-phosphatidylserine, dilinolcoyl phosphatidylinositol, and mixtures thereof.
  • PA phosphatidic acid
  • PG phosphatidyl g
  • lipids may be unsaturated lipids and may be naturally occurring or synthetic.
  • the individual phosphatidic acid components may be symmtrical, i.e. both acyl residues are the same, or they may be unsymmetrical, i.e., the acyl residues may be different.
  • Fluorescent and luminescent lipids constitute an important class of molecules that function as immobile second reagents. They can serve as FRET donors, FRET acceptors, fluorescence quenchers and fluorophores that can be quenched by voltage-sensitive first reagents. Well characterized embodiments include their use as FRET donors to voltage-sensitive oxonols. Specific examples include coumarin labeled phospholipids, such as structures A (CC1-DMPE) and B (CC2-DMPE). A generic structure is shown in structure C. Other examples of fluorescent phospholipid that function as second reagents include: fluorescein labeled phosphatidylethanolamine (PE), NBD labeled PE, and AMCA-S labeled PE.
  • PE fluorescein labeled phosphatidylethanolamine
  • NBD labeled PE NBD labeled PE
  • AMCA-S labeled PE AMCA-S labeled PE.
  • Coumarin labeled single chain lipids that contain a permanent positive charge including structure D1 have also been shown to be useful.
  • the positively charged lipid may have electrostatic advantages with negatively charged second reagents.
  • An electrostatic attraction between the two reagents may enable the probes to associate in the membrane and result in enhanced voltage-sensitive FRET.
  • these probes have been found to allow longer recording of optical FRET signals in leech ganglia.
  • a generic structure of fluorescently labeled quartenary ammonium lipid is shown in structure D2.
  • the use of fluorescent lipids as FRET acceptors has also been demonstrated, for example using an oxonol donor and a Cy5-labeled PE acceptor.
  • the preferred lipid based second reagents comprise 1) a hydrophobic lipid anchor, 2) a charged, polar, or zwitterionic headgroup, and 3) a fluorescent component that is anchored to the membrane surface.
  • the hydrophobic lipid anchor should be sufficiently long to result in strong binding to the membrane (preferably 14–35 carbon or methylene units in length). Alternatively it can be composed of several proportionately (equivalent) smaller segments (i.e. one C 20 chain or two C 10 chains). This is desirable to minimize leakage of dye from the membrane location, which could effect the voltage-sensitivity and increase fluorescence background.
  • the headgroup should preferably comprise a permanently charged, polar, or zwitterionic group within the normal physiological pH range (pH 6.5 to 7.5) so that the molecule does not significantly translocate to the inner membrane leaflet on the timescale of about an hour.
  • the charged headgroup prevents the fluorophore and whole molecule from diffusing across the low dielectric interior of the membrane. Significant membrane translocation will increase background fluorescence and decrease voltage-sensitivity due to the loss of asymmetry across the membrane.
  • Preferred are charged and polar headgroups including phosphate, sulfates, quatennary ammonium groups, sugars and amines.
  • the fluorophore should be attached to the lipid headgroup and be located at the membrane-water interface region to maximize the distance changes between donor and acceptor when the mobile reagent 1 is on the intracellular leaflet.
  • the fluorophore is preferably water-soluble.
  • Preferred fluorophores include coumarins, fluoresceins, bodipys, carbocyanines, indocarbocyanines and styryl dyes.
  • PE lipid scaffold that contains the appropriate membrane anchoring hydrophobicity and charged headgroup, and then chemically attach various fluorescent groups to the headgroup.
  • the phosphate group provides the permanent charge that inhibits membrane translocation.
  • PE has a reactive amino group at the end of the headgroup, one could react any amino reactive fluorescent labeling reagent (e.g. any of those described in the Molecular Probes catalog) with PE to produce appropriate second reagents.
  • Amino reactive reagents could also be prepared from chromophores not listed in the Molecular Probes catalog using standard synthetic chemical protocols.
  • the quaternary ammonium lipid in structure D could be prepared in such a manner to contain a terminal amino group that could then be reacted with the aforementioned amino reactive groups.
  • a second approach to prepare appropriate lipids would be to synthesize a fluorescent charged headgroup that could then be reacted with a variety of hydrophobic anchors. The three components: fluorophore, headgroup, and lipid anchor can be assembled in any order to produce the same final product.
  • reagents for fluorescently labeling thiol, alcohol, aldehyde, ketone, caboxylic acid functional groups are readily available and could be reacted with a lipid scaffold that meets the charge and membrane anchor criteria and also have these functional groups.
  • fluorophore modifications that maintain fluorescence of the chromophore would also produce molecules that can function as second reagents.
  • the appropriate chromophore modification are known to those skilled in the art and have been described in part in for example in U.S. Pat. No. 5,741,657 issued Apr. 21, 1998 to Tsien et al.
  • Long-lived (>100 ns) light-emitting lipids can also function as the stationary second reagent.
  • One example class includes lipids with a charged headgroup capable of chelating metal ions and undergoing photo-induced long-lived emission. These molecules may be enhanced with an organic sensitizer covalently attached.
  • Example of metal ions that may be appropriate include: Eu 3+ , Tb 3+ , Sm 3+ , Dy 3+ , Ru 2+/3+ , and Rh 2+ .
  • Antibodies directed against surface antigens such as glycolipids or membrane proteins can also be fluorescently labeled and used as second reagents.
  • FITC-labeled antibodies against the glycolipid GD3 stain the outer surface of the melanoma cell line M21 and give ratio changes up to 10%/100 mV using DiSBA-C 6 -(3) as the mobile fluorescent anion.
  • Specificity for particular cell types is likely to be easier to achieve with antibodies than with lectins because antibodies can be raised against nearly any surface marker.
  • microinjected antibodies could label sites on the cytoplasmic face of the plasma membrane, where carbohydrate binding sites for lectins are absent.
  • Cytochrome c used as a second reagent has also been found to function as a quencher that binds to the outer plasma membrane surface. Accordingly, another suitable class of second reagent comprises cytochrome c or apocytochrome c, with or without a fluorescent group as previously described in connection with other second reagents.
  • Yet another preferred class of embodiments of the second reagent includes fluorescently labeled, amphipathic carbohydrates, e.g., cyclodextrins that selectively and tightly bind to the extracellular plasma membrane surface.
  • the carbohydrates are functionalized with a hydrophobic tail to facilitate intercalation into the membrane and tight membrane binding.
  • the cyclic sugar imparts good water solubility for cellular loading and prohibits membrane translocation.
  • Another added benefit is that the cyclodextrins aid the loading of the oxonol.
  • Yet another preferred class of embodiments of the second reagent includes fluorescently labeled, amphipathic peptides.
  • peptides typically contain several basic residues such as lysines and arginines to bind electrostatically to negatively charged phospholipid head groups, plus several hydrophobic residues to anchor the peptide to the membrane.
  • long-chain alkyl substituents such as N-myristoyl, N-palmitoyl, S-palmitoyl, or C-terminal prenyl groups may provide hydrophobicity.
  • the fluorescent label is typically attached via lysine epsilon-amino groups or cysteine sulfhydryl groups.
  • Another preferred class of embodiments of the second reagent includes naturally fluorescent proteins such as the Green Fluorescent Protein (GFP) of Aequorea Victoria (Cubitt, A. B. et al. 1995. Understanding, improving, and using green fluorescent proteins. Trends Biochem. Sci. 20: 448–455; Chalfie, M., and Prasher, D. C. U.S. Pat. No. 5,491,084).
  • GFP Green Fluorescent Protein
  • voltage sensors comprising such proteins as the second reagent provide the ability to monitor membrane potential changes within defined cell populations, tissues or in an entire transgenic organism, where other reagents could not penetrate or be specifically localized.
  • cell type specific promoters and subcellular targeting motifs it is possible to selectively target the second reagent to a discrete location to enable highly spatially defined measurements.
  • Endogenously fluorescent proteins have been isolated and cloned from a number of marine species including the sea pansies Renilla reniformis, R. kollikeri and R. mullerei and from the sea pens Ptilosarcus, Stylatula and Acanthoptilum, as well as from the Pacific Northwest jellyfish, Aequorea victoria ; Szent-Gyorgyi et al. (SPIE conference 1999), D. C. Prasher et al., Gene, 111:229–233 (1992) and several species of coral (Matz et al., Nature Biotechnology 17 969–973 (1999). These proteins are capable of forming a highly fluorescent, intrinsic chromophore through the cyclization and oxidation of internal amino acids within the protein that can be spectrally resolved from weakly fluorescent amino acids such as tryptophan and tyrosine.
  • fluorescent proteins have also been observed in other organisms, although in most cases these require the addition of some exogenous factor to enable fluorescence development.
  • yellow fluorescent protein from Vibrio fischeri strain Y-1 has been described by T. O. Baldwin et al., Biochemistry (1990) 29:5509–15. This protein requires flavins as fluorescent co-factors.
  • Peridinin-chlorophyll a binding protein from the dinoflagellate Symbiodinium sp. was described by B. J. Morris et al., Plant Molecular Biology, (1994) 24:673:77.
  • One useful aspect of this protein is that it fluoresces in red.
  • the cloning of phycobiliproteins from marine cyanobacteria such as Synechococcus, e.g., phycoerythrin and phycocyanin is described in S. M. Wilbanks et al., J. Biol. Chem. (1993) 268:1226–35. These proteins require phycobilins as fluorescent co-factors, whose insertion into the proteins involves auxiliary enzymes. The proteins fluoresce at yellow to red wavelengths.
  • Non Aequorea fluorescent proteins for example Anthozoan fluorescent proteins, and functional engineered mutants thereof, are also suitable for use in the present invention including those shown in Table 2 below.
  • Preferred luminescent components include chemi-luminescent, electro-luminescent and bioluminescent compounds.
  • Preferred bioluminescent components include bioluminescent proteins such as firefly, bacterial or click beetle luciferases, aequorins and other photoproteins, for example as described in U.S. Pat. No. 5,221,623, issued Jun. 22, 1989 to Thompson et al., and U.S. Pat. No. 5,683,888 issued Nov. 4, 1997 to Campbell, U.S. Pat. No. 5,674,713 issued Sep. 7, 1997 to DeLuca et al., U.S. Pat. No. 5,650,289 issued Jul. 22, 1997 to Wood and U.S. Pat. No. 5,843,746 issued Dec. 1, 1998 to Tatsumi et al.
  • bioluminescent proteins isolated from the ostracod Cypridina (or Vargula ) hilgendorfii. (Johnson and Shimomura, (1978) Methods Enzymol 57 331–364, Thompson, Nagata & Tsuji (1989) Proc. Natl. Acad. Sci. USA 86, 6567–6571).
  • luciferases bioluminescent proteins isolated directly from the light organs of beetles
  • cDNAS encoding luciferases of several beetle species (including, among others, the luciferase of P. pyralis (firefly), the four luciferase isozymes of P. plagiophthalamus (click beetle), the luciferase of L. cruciata (firefly) and the luciferase of L. lateralis )(deWet et al., Molec. Cell. Biol.
  • Bioluminescent light-emitting systems have been known and isolated from many luminescent organisms, including certain bacteria, protozoa, coelenterates, molluscs, fish, millipedes, flies, fungi, worms, crustaceans, and beetles, particularly the fireflies of the genera Photinus, Photuris, and Luciola and click beetles of genus Pyrophorus.
  • enzymatically catalyzed oxido-reductions take place in which the free energy change is utilized to excite a molecule to a high energy state. Then, when the excited molecule spontaneously returns to the ground state, visible light is emitted. This emitted light is called “bioluminescence.” Typically one quantum of light is emitted for each molecule of substrate oxidized (which is generically referred to as a luciferin).
  • the electronically excited state of the oxidized substrate is a state that is characteristic of the luciferase-luciferin reaction of a bioluminescent protein; the color (and, therefore, the energy) of the light emitted upon return of the oxidized substrate to the ground state is determined by the enzyme (or luciferase).
  • bioluminescent proteins are those derived from the ostracod Cypridina (or Vargula ) hilgendorfii .
  • the Cypridina luciferase (GenBank accession no. U89490) uses no cofactors other than water and oxygen, and its luminescent reaction proceeds optimally at pH 7.2 and physiological salt concentrations, (Shimomura, O., Johnson, F. H. and Saiga, Y. (1961) J. Cell. Comp. Physiol. 58 113–124).
  • firefly luciferase has optimal activity at low ionic strength, alkaline pH and reducing conditions, that are typically quite different to those usually found within mammalian cells.
  • Cypridina luciferase has a turnover number of 1600 min ⁇ 1 and a quantum yield of 0.29, (Shimomura, O. & Johnson, F. H. and Masugi, T. (1969) Science 164 1299–1300;Shimomura. O. & Johnson, F. H. (1970) Photochem. Photobiol. 12 291–295), the Cypridina luciferase produces a specific photon flux exceeding that of the optimized firefly system by a factor of at least 50(Miesenbock and Rothman, Proc. Natl. Acad. Sci. USA (1997) 94 3402–3407.
  • bioluminescent proteins can provide highly specific and sensitive voltage measurements.
  • the fluorescent and bioluminescent components additionally comprise a localization or targeting sequence to direct or sort the component to a particular face of a biological membrane or subcellular organelle.
  • Preferred localization sequences provide for highly specific localization of the protein, with minimal accumulation in other biological membranes.
  • Example localization sequences that direct proteins to specific subcellular structures are shown below in Table 3.
  • SEQ.ID.NO. Orientation Nuclear (Import) PP KKKRK V SEQ.ID.N0. 8 N-terminal Endoplasmic reticulum MSFVS LLLVGILFWA TGAENLTK SEQ.ID.NO. 9 N-terminal (Import) CEVFN Endoplasmic reticulum KDEL SEQ.ID.NO. 10 C-terminal, (Retention) KKAA SEQ.ID.NO. 11 Peroxisome (Import) SKL SEQ.ID.NO. 12 C-terminal Mitochondrial MLSLRNSIRFFKPATRTLCSSRYLL SEQ.ID.NO.
  • Localization sequences in general can be located almost anywhere in the amino acid sequence of the protein. In some cases the localization sequence can be split into two blocks separated from each other by a variable number of amino acids. The creation of such constructs via standard recombinant DNA approaches is well known in the art, as for example described in Maniatis, et al., Molecular Cloning A Laboratory Manual , Cold Spring Harbor Laboratory, N.Y., 1989).
  • Localization of the second reagent can also be achieved by fusion to a protein with a defined pattern of spatial distribution in a given cell type. In this case, the specific localization sequences need not be defined. Because such fusions to fluorescent or bioluminescent proteins can be directly visualized by microscopy it is possible to routinely test previously unknown sequences and determine their utility in the assay.
  • Another class of localization sequences includes targetable sequences that enable conditional binding via an interaction domain to a specific location in the cell.
  • Examples of include protein-protein interaction domains such as SH2, SH3, PDZ, 14,3,3 and PTB domains, protein-DNA domains such as zinc finger motifs, and protein-lipid interaction domains such as PH, Ca 2+ /lipid binding domains.
  • Other interaction domains are described in for example, the database of interacting proteins available on the web at http://www doe-mbi.ucla.edu.
  • An advantage of this approach is that extremely specific patterns of localization can be achieved that correspond in vivo to the functional compartmentation of proteins within a cell. Such functional compartmentation of proteins can play significant roles in specialized cell types such as neurons that have unique cellular architectures.
  • the addition of the domain to the naturally fluorescent or luminescent protein provides for the potential regulation of binding to the subcellular site in response to a defined activation signal. In certain circumstances this can be used to enhance the sensitivity and or specificity of the fluorescence changes if cellular activation also regulates membrane potential.
  • creation of a fusion protein comprising the bioluminescent or fluorescent protein to a receptor or ion channel directly coupled to the voltage change could augment the fluorescence response if stimulation of the cell also resulted in a change in the cellular location of the fusion protein.
  • Nucleic acids used to transfect cells with sequences coding for expression of the polypeptide of interest generally will typically be in the form of an expression vector including expression control sequences operatively linked to a nucleotide sequence coding for expression of the polypeptide.
  • expression control sequences operatively linked to a nucleotide sequence coding for expression of the polypeptide.
  • nucleotide sequence coding for expression of a polypeptide refers to a sequence that, upon transcription and translation of mRNA, produces the polypeptide. This can include sequences containing, e.g., introns.
  • expression control sequences refers to nucleic acid sequences that regulate the expression of a nucleic acid sequence to which it is operatively linked.
  • Expression control sequences are operatively linked to a nucleic acid sequence when the expression control sequences control and regulate the transcription and, as appropriate, translation of the nucleic acid sequence.
  • expression control sequences can include appropriate promoters, enhancers, transcription terminators, a start codon (i.e., ATG) in front of a protein-encoding gene, splicing signals for introns, maintenance of the correct reading frame of that gene to permit proper translation of the mRNA, and stop codons.
  • a contemplated version of the method is to use inducible controlling nucleotide sequences to produce a sudden increase in the expression of bioluminescent or fluorescent protein e.g., by inducing expression of the construct.
  • Example inducible systems include the tetracycline inducible system first described by Bujard and colleagues (Gossen and Bujard (1992) Proc. Natl. Acad. Sci USA 89 5547–5551, Gossen et al. (1995) Science 268 1766–1769) and described in U.S. Pat. No. 5,464,758.
  • Transformation of a host cell with recombinant DNA may be carried out by conventional techniques as are well known to those skilled in the art.
  • the host is prokaryotic, such as E. coli
  • competent cells that are capable of DNA uptake can be prepared from cells harvested after exponential growth phase and subsequently treated by the CaCl 2 method by procedures well known in the art.
  • CaCl 2 or RbCl can be used. Transformation can also be performed after forming a protoplast of the host cell or by electroporation.
  • Eukaryotic cells can also be co-transfected with DNA sequences encoding the fusion polypeptide of the invention, and a second foreign DNA molecule encoding a selectable phenotype, such as the herpes simplex thymidine kinase gene.
  • Another method is to use a eukaryotic viral vector, such as simian virus 40 (SV40) or bovine papilloma virus, to transiently infect or transform eukaryotic cells and express the protein.
  • a eukaryotic viral vector such as simian virus 40 (SV40) or bovine papilloma virus
  • SV40 simian virus 40
  • bovine papilloma virus bovine papilloma virus
  • the invention provides a transgenic non-human organism that expresses a nucleic acid sequence that encodes a bioluminescent or fluorescent protein. Because bio-luminescent and naturally fluorescent proteins can be specifically expressed within intact living cells, voltage sensors comprising such proteins as the second reagent provide the ability to monitor membrane potential changes within defined cell populations, tissues or in an entire transgenic organism.
  • non-human organisms include vertebrates such as rodents, fish such as Zebrafish, non-human primates and reptiles as well as invertebrates such as insects, C. elegans etc.
  • Preferred non-human organisms are selected from the rodent family including rat and mouse, most preferably mouse.
  • the transgenic non-human organisms of the invention are produced by introducing transgenes into the germline of the non-human organism, Embryonic target cells at various developmental stages can be used to introduce transgenes. Different methods are used depending on the organism and stage of development of the embryonic target cell. In vertebrates, the zygote is the best target for microinjection.
  • the male pronucleus reaches the size of approximately 20 micrometers in diameter which allows reproducible injection of 1–2 pl of DNA solution.
  • the use of zygotes as a target for gene transfer has a major advantage in that in most cases the injected DNA will be incorporated into the host gene before the first cleavage (Brinster et al., Proc. Natl. Acad. Sci. USA 82:4438–4442, 1985). As a consequence, all cells of the transgenic non-human animal will carry the incorporated transgene. This will in general also be reflected in the efficient transmission of the transgene to offspring of the founder since 50% of the germ cells will harbor the transgene. Microinjection of zygotes is the preferred method for incorporating transgenes in practicing the invention.
  • a transgenic organism can be produced by cross-breeding two chimeric organisms which include exogenous genetic material within cells used in reproduction. Twenty-five percent of the resulting offspring will be transgenic i.e., organisms that include the exogenous genetic material within all of their cells in both alleles. 50% of the resulting organisms will include the exogenous genetic material within one allele and 25% will include no exogenous genetic material.
  • Retroviral infection can also be used to introduce transgene into a non-human organism.
  • the developing non-human embryo can be cultured in vitro to the blastocyst stage.
  • the blastomeres can be targets for retro viral infection (Jaenich, R., Proc. Natl. Acad. Sci USA 73:1260–1264, 1976).
  • Efficient infection of the blastomeres is obtained by enzymatic treatment to remove the zona pellucida (Hogan, et al. (1986) in Manipulating the Mouse Embryo, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y).
  • the viral vector system used to introduce the transgene is typically a replication-defective retro virus carrying the transgene (Jahner, et al., Proc. Natl. Acad. Sci. USA 82:6927–6931, 1985; Van der Putten, et al., Proc. Natl. Acad. Sci USA 82:6148–6152, 1985). Transfection is easily and efficiently obtained by culturing the blastomeres on a monolayer of virus-producing cells (Van der Putten, supra; Stewart, et al., EMBO J. 6:383–388, 1987).
  • infection can be performed at a later stage.
  • Virus or virus-producing cells can be injected into the blastocoele (D. Jahner et al., Nature 298:623–628, 1982).
  • Most of the founders will be mosaic for the transgene since incorporation occurs only in a subset of the cells that formed the transgenic nonhuman animal. Further, the founder may contain various retro viral insertions of the transgene at different positions in the genome that generally will segregate in the offspring.
  • ES cells are obtained from pre-implantation embryos cultured in vitro and fused with embryos (M. J. Evans et al. Nature 292:154–156, 1981; M. O. Bradley et al., Nature 309: 255–258, 1984; Gossler, et al., Proc. Natl. Acad. Sci USA 83: 9065–9069, 1986; and Robertson et al., Nature 322:445–448, 1986).
  • Transgenes can be efficiently introduced into the ES cells by DNA transfection or by retro virus-mediated transduction.
  • Such transformed ES cells can thereafter be combined with blastocysts from a nonhuman animal.
  • the ES cells thereafter colonize the embryo and contribute to the germ line of the resulting chimeric animal.
  • first and second reagents can be used as first and second reagents.
  • Particularly preferred combinations include, but are not limited to, the following, in which the first-named fluorophore is the donor and the second is the acceptor: fluorescein/bis-thiobarbiturate tri methineoxonol; Naturally Fluorescent Protein/bis-thiobarbiturate trimethineoxonol; Naturally Fluorescent Protein/bis-thiobarbiturate pentamethineoxonol; coumarin/bis-thiobarbiturate trimethineoxonol; coumarin/bis-thiobarbiturate pentamethineoxonol; bis-thiobarbiturate trimethineoxonol/Texas Red; bis-thiobarbiturate trimethineoxonol/resorufin; bis-thiobarbiturate trime
  • a linker group is employed between the first and second fluorophores.
  • the linker group maintains a certain minimum proximity between the first and second fluorophores and ensures efficient energy transfer between the donor and acceptor (or fluorophore and quencher) when they are on the same side of the membrane, even at low concentrations.
  • the good energy transfer allows one to separate the donor emission further from the acceptor absorbance and thus decrease the spectral crosstalk that contributes to the reduction of the voltage-sensitive ratio change from theoretical values.
  • Another major advantage of a linker is that it converts the system into a unimolecular phenomenon.
  • the linker group is long enough to span the entire membrane.
  • linker group shall mean the “chemical arm” between the first and second reagent.
  • Linker group shall mean the “chemical arm” between the first and second reagent.
  • Representative combinations of such groups are amino with carboxyl to form amide linkages, or carboxy with hydroxy to form ester linkages or amino with alkyl halides to form alkylamino linkages, or thiols with thiols to form disulfides, or thiols with maleimides or alkyl halides to form thioethers.
  • hydroxyl, carboxyl, amino and other functionalities, where not present may be introduced by known methods.
  • a wide variety of linking groups may be employed.
  • the structure of the linkage should be a stable covalent linkage formed to attach the two species to each other.
  • the portions of the linker closest to the second reagent may be hydrophilic, whereas the portions of the linker closest to the mobile fluorescent molecule should be hydrophobic to permit insertion into the membrane and to avoid retarding the voltage-dependent translocation of the anion.
  • the covalent linkages should be stable relative to the solution conditions under which the cells are loaded.
  • Generally preferred linking groups will comprise 20–40 bonds from one end to the other and 0–10 heteroatoms (NH, O, S) and may be branched or straight chain. Without limiting the foregoing, it should be evident to one skilled in the art that only combinations of atoms which are chemically compatible comprise the linking group.
  • amide, ester, thioether, thioester, keto, hydroxyl, carboxyl, ether groups in combinations with carbon-carbon bonds are acceptable examples of chemically compatible linking groups.
  • Other chemically compatible linkers may be found in U.S. Pat. No. 5,470,997 (col. 2 and col. 4–7) and U.S. Pat. No. 5,470,843 (cols. 11–13).
  • Asymmetric 1,3-substituted thioureas have been prepared for use in synthesizing oxonols with N-substituted linkers containing terminal reactive groups capable of conjugating to appropriate second reagent fluorophores/quenchers.
  • one of the oxonol substituents is a pentyl chain (C 5 ) with a terminal bromide or tosylate group.
  • Thiobarbiturates have been synthesized from these thiotireas and diethylmalonate in ethoxide/ethanol.
  • linkers includes bi-functionalized polyalkylene glycol oligomers (polyethyleneglycol, polypropyleneglycol, polybutyleneglycol, etc.) of an appropriate length to span the plasma membrane (25–30 carbon equivalents), for example 8–10 PEG units.
  • the oxygen or sulfur, in the corresponding thio-analogs thereof) modulates the hydrophobicity and hence translocation rate and loading
  • Compounds joined by such linker groups have the general formula X—(CH 2 ) m -Z q -(CH 2 ) m -Z′ q -(CH 2 ) m′′ -Z′′ q′′ -Y wherein:
  • X is a hydrophobic fluorescent anion
  • Y is a fluorescent second reagent
  • Z, Z′, Z′′ are independently O, S, SS, CO, COO;
  • n, m′ and m′′ are integers from 0 to about 32;
  • q, q′, and q′′ are independently 0 or 1;
  • m+q+m′+q′+m′′+q′′ is from about 20 to 40 (preferably between 25 and 35).
  • linkers includes functionalized alkyl chains with terminal thiol groups that form a central disulfide linkage.
  • the disulfide functions as a hydrophobic swivel in the center of the membrane.
  • X is a hydrophobic fluorescent anion
  • Y is a fluorescent second reagent
  • n and n′ are integers from 0 to about 32 wherein n+n′ is less than or equal to 33.
  • linker groups may be reacted with appropriately substituted or functionalized first and second fluorophores using conventional coupling chemistries. Further, it is evident that the linker group may be attached to a fluorophore at a variety of different positions. Important locations (X) for attachment of the linker in exemplary classes of oxonols are illustrated in FIG. 12 .
  • the hydrophobic ion fluorescence on one face of the membrane is quenched by a mechanism other than FRET.
  • FRET has the advantages of working over relatively long distances (compared to the thickness of a typical biological membrane), which minimizes the necessary concentration of acceptors to give a ratiometric output at two emission wavelengths. However, if FRET is too efficient over distances greater than the thickness of the membrane, it can fail to provide good discrimination between acceptors on the same vs. opposite sides of the membrane.
  • the second fluorophore/quencher or luminescent component can be located on either the intracellular or the extracellular face, as long as it is specific to one or the other. In the specific examples reported herein, the extracellular surface was targeted for convenience.
  • FRET or fluorescence quenching is can be detected by emission ratioing that can distinguish the two populations of the mobile fluorophore, i.e., those bound to the extracellular vs. those bound to the intracellular face of the membrane.
  • FRET using a fluorescent acceptor and a fluorescent donor provides an emission ratio change that is well suited to laser scanning confocal microscopy and internally corrects for variations in donor loading, cell thickness and position (including motion artifacts), and excitation intensity.
  • Emission ratios usually change by larger percentages than either emission wavelength signal alone, because the donor and acceptor emissions should change in opposite directions, which reinforce each other when ratioed. If emission ratioing is not desirable or possible, either wavelength can still be used alone, or the change in donor excited-state lifetime monitored.
  • Emission ratios are measured either by changing the passband of a wavelength-selective filter in front of a single detector, or preferably by splitting the emitted light with a dichroic mirror and measuring two wavelength bands simultaneously with two detectors, which may each be preceded by additional wavelength-selecting filters.
  • the wavelength-selective filters may be two or more interference filters with different passbands alternately placed in front of the detector, or they may be a continuously tunable monochromator which is repeatedly scanned over a wavelength range.
  • the advantage of the first method is that only one detector is used, which economizes on detectors and avoids the problem of precisely matching two detectors.
  • the advantages of the second method, using a dichroic mirror and two separate detectors, are that the two emissions may be measured truly simultaneously rather than sequentially, and that it makes more efficient use of the photons emitted from the sample.
  • FRET between a luminescent component and fluorescent component may be preferred in certain circumstances. Because this approach does not require light irradiation of the sample, phototoxicity and autofluorescence of the sample are significantly reduced. Because light emission is exclusively produced from the luminescent component, the approach typically exhibits improved specificity and sensitivity. However because the luminescent component typically creates significantly less light output than is achieved using traditional fluorescent approaches it is often necessary to use more sensitive detectors, and to collect and integrate light emission over time compared to fluorescent emission ratioing.
  • Another preferred detection method involves the use of time resolved fluorescence approaches. These methods combine many of the advantages of the use of fluorescence, with the enhanced specificity and freedom from autofluorescence, of luminescence based measurements.
  • the methods generally encompass the use of a long-lived fluorescent component to provide sustained light emission in the absence of illumination.
  • Typical components include lanthamides such as terbium or europium chelates covalently joined to a polynuclear heterocyclic aromatic sensitizer (for example described in U.S. Patent application U.S. Pat. No. 5,622,821, issued Apr. 22, 1997) as the first or second reagent.
  • lanthamides such as terbium or europium chelates covalently joined to a polynuclear heterocyclic aromatic sensitizer (for example described in U.S. Patent application U.S. Pat. No. 5,622,821, issued Apr. 22, 1997) as the first or second reagent.
  • These reagents are preferred because they are relatively easy to synthesize and attach to macromolecules, are highly fluorescent, chemically stable and good resonance energy transfer donors.
  • the time resolved analysis requires a pulsed excitation source and gated detectors to enable the transient illumination of the sample and decay of sample autofluorescence
  • the assay method typically exhibits significantly improved signal to noise ratios compared to traditional fluorescence based approaches.
  • Instrumentation for conducting time resolved analysis is commercially available from a number of sources including Hewlett-Packard, LKB, and LJL.
  • Molecular specificity for particular cell types in a mixed population may be further improved by the use of targetable reagents.
  • cell-specific antibodies or lectins as the carriers of the extracellular fluorescent label, or by using naturally fluorescent, or bioluminescent proteins specifically expressed in a given cell type as the intra- or extracellular label
  • Specifically labeled cells can also reduce background staining and therefor provide larger fluorescence changes, particularly in complex tissues, where not all the cells may respond to a given stimulus.
  • the voltage sensor i.e., the hydrophobic anion of the first reagent
  • the voltage sensor translocates at least a full unit charge nearly all the way through the membrane.
  • the lipid-soluble non-fluorescent anion of dipicrylamine (2,2′,4,4′,6,6′-hexanitrodiphenylamine) produces displacement currents in excitable tissue with submillisecond kinetics, comparable in speed to sodium channel gating currents [Benz, R. and Conti, F. 1981.
  • FRET fluorescence quenching between the translocating ion and a fluorophore or quencher (i.e., the second reagent) fixed to just one face of the membrane is employed. Most conveniently, the extracellular face is employed.
  • the translocating ions are anionic fluorescent acceptors which absorb at wavelengths that overlap with the emission spectrum of the extracellularly fixed donor fluorophores is schematically shown in FIG. 1 .
  • permeable oxonols have a high concentration at the extracellular surface of the plasma membrane and energy transfer from the extracellularly bound FL-WGA (fluorescein-wheat germ agglutinin) is favored. FRET is symbolized by the straight arrow from lectin to oxonol.
  • the anions are located primarily on the intracellular surface of the membrane and energy transfer is greatly reduced because of their increased mean distance from the donors on the extracellular surface.
  • the speed of the voltage-sensitive fluorescence response depends on the translocation rate of the fluorophore from one site to the other.
  • the speed of response for DiSBA-C 6 -(3) is shown in FIG. 5 and follows the general equations (1) and (2) As this equation indicates, fluorescent ions which jump across the membrane on a millisecond timescale in response to biologically significant changes in transmembrane potential are needed to follow rapid polarization/depolorization kinetics. Slower-jumping ions would not be useful, for example, in following fast electrical signals in neuronal tissue (a primary application of the compositions and methods of the present invention). The development and discovery of such molecules with the added constraint of being fluorescent is not trivial.
  • the mobile hydrophobic anions can be donors rather than acceptors.
  • Each of the alternatives has its own advantages.
  • An example with the hydrophobic ion being the FRET donor is the DiSBA-C 6 -(3)/Texas Red WGA combination.
  • a primary advantage of this arrangement is that it minimizes the concentration of the hydrophobic dye molecule in the membrane; this reduces toxicity and cellular perturbations resulting from the displacement current and any photodynamic effects
  • Another advantage is the generally higher quantum yields of fluorophores bound in membranes relative to those on proteins or water; this gives better FRET at a given distance.
  • Bis-(1,3-dialkyl-2-thiobarbiturate)-trimethineoxonols where alkyl is n-hexyl and n-decyl (DISBA C 6 -(3) and DISBA-C 10 -(3) respectively) have been shown herein to function as donors to Texas Red labeled wheat germ agglutinin (TR-WGA) and as acceptors from fluorescein labeled lectin (FL-WGA).
  • TR-WGA Texas Red labeled wheat germ agglutinin
  • FL-WGA fluorescein labeled lectin
  • Fluorescence ratio changes of between 4–34% were observed for a 100 mV depolarization in fibroblasts, astrocytoma cells, beating cardiac myocytes, and B104 neuroblastoma cells.
  • the large fluorescence changes allowed high speed confocal imaging.
  • membrane potentials in membranes of isolated cells, tissues and intact transgenic organisms can be detected and monitored.
  • the method finds greatest utility with plasma membranes, especially the outermost plasma membrane of mammalian cells.
  • Representative membranes include, but are not limited to, subcellular organelles, membranes of the endoplasmic reticulum, secretory granules, mitochondria, microsomes and secretory vesicles.
  • Cell types which can be used include but are not limited to, neurons, cardiac cells, lymphocytes (T and B lymphocytes, nerve cells, muscle cells and the like.
  • the invention also provides methods for screening test samples such as potential therapeutic drugs that affect membrane potentials in biological cells. These methods involve measuring membrane potentials as described above in the presence and absence (control measurement) of the test sample. Control measurements are usually performed with a sample containing all components of the test sample except for the putative drug. Detection of a change in membrane potential in the presence of the test agent relative to the control indicates that the test agent is active. Membrane potentials can be also be determined in the presence or absence of a pharmacologic agent of known activity (i.e., a standard agent) or putative activity (i.e., a test agent). A difference in membrane potentials as detected by the methods disclosed herein allows one to compare the activity of the test agent to that of the standard agent.
  • a pharmacologic agent of known activity i.e., a standard agent
  • putative activity i.e., a test agent
  • the invention offers a method of identifying a compound which modulates activity of an ion channel, pump, or exchanger in a membrane, comprising:
  • the invention offers a method of screening test samples to identify a compound which modulates the activity of an ion channel, pump or exchanger in a membrane, comprising:
  • the method includes the use of a membrane potential modulator to set the resting, or stimulated membrane potential to a predefined value. At this predefined value the cell is unable to rapidly reset the membrane potential in response to the transient activation of the target ion channel.
  • a membrane potential modulator to set the resting, or stimulated membrane potential to a predefined value.
  • the cell is unable to rapidly reset the membrane potential in response to the transient activation of the target ion channel.
  • This method enables the detection of very transient ion channel currents, which are normally difficult to measure in a convenient format.
  • Such channels include rapidly inactivating sodium channels, T-type calcium channels and ligand-gated channels.
  • the membrane potential modulator comprises a ligand dependent ion channel.
  • Activation of the ligand gated ion channel causes a voltage change in the cell that provides the stimulus to activate a voltage-dependent channel target.
  • the ligand can be added directly or released via UV flash uncaging to enable rapidly inactivating voltage dependent ion channels to be monitored.
  • Ion channels of interest include, but are not limited to, sodium, calcium, potassium, nonspecific cation, and chloride ion channels, each of which may be constitutively open, voltage-gated, ligand gated, or controlled by intracellilar signaling pathways.
  • Biological cells which can be screened include, but are not limited to primary cultures of mammalian cells, transgenic organisms and mammalian tissue. Cells in screening assays may be dissociated either immediately or after primary culture. Cell types include, but are not limited to white blood cells (e.g. leukocytes), hepatocytes, pancreatic beta-cells, neurons, smooth muscle cells, intestinal epithelial cells, cardiac myocytes, glial cells, and the like.
  • the invention also includes the use of recombinant cells into which ion transporters, ion channels, pumps and exchangers have been inserted and expressed by genetic engineering. Many cDNA sequences for such transporters have been cloned (see U.S. Pat. No.
  • 5,380,836 for a cloned sodium channel and methods for their expression in cell lines of interest is within the knowledge of one of skill in the art (see, U.S. Pat. No. 5,436,128).
  • Representative cultured cell lines derived from humans and other mammals include LM (TK ⁇ ) cells, HEK293 (human embryonic kidney cells), 3T3 fibroblasts, COS cells, CHO cells, RAT1 and HLHepG2 cells.
  • the screening methods described herein can be made on cells growing in or deposited on solid surfaces.
  • a common technique is to use a microtiter plate well wherein the fluorescence measurements are made by commercially available fluorescent plate readers.
  • the invention includes high throughput screening in both automated and semiautomated systems, such as described in PCT publication No. WO 98/52047, and U.S. patent application Ser. No. 09/122,544 filed Jul. 24, 1999 entitled “Detector and Screening Device for Ion Channels.”
  • One such method is to use cells in Costar 96 well microtiter plates (flat with a clear bottom) and measure fluorescent signal with CytoFluor multiwell plate reader (Perseptive Biosystems, Inc., MA) using two emission wavelengths to record fluorescent emission ratios.
  • DiSBA-C 4 -(3) was synthesized based on the procedure for the ethyl derivative [British Patent 1,231,884].
  • 1,3-di-butyl-thiobarbiturate 500 mg, 2 mmol was dissolved in 700 ⁇ L of pyridine.
  • a mixture of 181 ⁇ L (1.1 mmol) of malonaldehyde bis(dimethyl acetal) and 100 ⁇ L of 1 M HCl was added.
  • the solution immediately turned red. After 3 h, half of the reaction mixture was removed and 2 equiv. of the protected malonaldehyde was added every hour for 4 h to the remaining mixture.
  • a toluene solution of O-benzylglycine [prepared by extraction of 3.4 g (10 mMol) benzylglycine tosyl salt with ethyl acetate-toluene-saturated aqueous bicarbonate-water (1:1:1:1, 250 ml), drying of the organic phase with anhydrous sodium sulfate and reduction of the solvent volume to 5 ml] was added dropwise to the coumarin solution. The reaction was kept at room temperature for 20 hours after which the precipitate was removed by filtration and washed extensively with ethylacetate and acetone.
  • 7-Butyryloxy-3-carboxymethylaminocarbonyl-6-chlorocoumarin was prepared as follows. 920 mg (2 mMol) 7-butyryloxy-3-benzyloxycarbonylmethylaminocarbonyl-6-chlorocoumarin were dissolved in 50 ml dioxane. 100 mg palladium on carbon (10%) and 100 microliters acetic acid were added to the solution and the suspension stirred vigorously in a hydrogen atmosphere at ambient pressure. After the uptake of hydrogen seized the suspension was filtered. The product containing carbon was extracted five times with 25 ml boiling dioxane. The combined dioxane solutions were let to cool upon which the product precipitated as a white powder.
  • 6-chloro-7-(n-butyryloxy)coumarin-3-carboxamidoacetic acid (26.2 mg, 100 mmol) was dissolved in 2 mL of 1:1 CHCl 3 /dioxane.
  • Isobutylchloroformate (14.3 mL, 110 mmol) was added under Argon at 4° C. and left stirring for 30 min.
  • DMPE dimyristoylphosphatidylethanolamine
  • DIEA diisopropylethylamine
  • the mixed anhydride solution was then pipetted into the phospholipid solution. After 2 h, the solvent was removed under vacuum. The residue was dissolved in 3 mL of MeOH and mixed with 3 mL of 0.25 M NaHCO 3 . The solution almost immediately turn yellow and was stirred for 15 min. The solution was then extracted 3–5 times with CHCl 3 . A bad emulsion is formed. The extracts were combined and concentrated. The residue was dissolved in 1 mL 1:1 MeOH/H 2 O and purified on a C 18 reverse phase column (1.7 ⁇ 7 cm). Eluting with the same solvent, a fluorescent band passed through the column, followed by a slower one.
  • Cy5-PE:DMPE (1.0 mg, 1.6 mmol) was dissolved in 650 mL of (12:1) CHCl 3 /MeOH and DIEA (1 mL, 5.7 mmol) was added.
  • Cy5-OSu (Amersham; Arlington Heights, Ill.)
  • the N-hydroxysuccinimide ester of N-ethyl-N′-(5-carboxypentyl)-5,5′-disulfoindodicarbocyanine (0.8 mg, 1 mmol) was dissolved in 150 mL of (2:1) CHCl 3 /MeOH and added to the phospholipid solution. After 3 h, the solvent was removed under vacuum.
  • 12-p-methoxybenzylthio-1-bromododecane (2) (1) (500 mg, 1.48 mmol) was mixed with carbon tetrabromide (611 mg, 1.85 mmol) in 2.5 mL CH 2 Cl 2 and cooled in an ice bath until solid began to come out of solution. The ice bath was removed and triphenylphosphine (348 mg, 2.22 mmol) was added to the reaction. The solution immediately turned yellowish. The starting material had been consumed after 30 min according to TLC (EtOAc/Hex, 1:1). The solvent was removed and 50 mL of hexane was added to the solid residue. After stirring overnight, the solution was filtered and concentrated to a solid.
  • the paste-like reaction mixture was transferred to a 500 mL separatory funnel dissolved in equal volumes of EtOAc/Hex (1:1) and the acetic acid solution. The organic layer was separated. The aqueous layer was then extracted two more times. The combine extracts were concentrated yielding 740.3 mg (1.34 mmol) of crude product. The excess acetic acid was removed as a toluene azeotrope. The solid was crystallized from isopropyl ether giving 483 mg (71%). TLC and NMR show an impurity believed to be a disulfide side product.
  • FL-WGA was purchased from Sigma Chemical Co. (St. Louis, Mo.).
  • TR-WGA was prepared from WGA and Texas Red (Molecular Probes; Eugene, Oreg.) in a 100 mM bicine buffer at pH 8.5. A 73 ⁇ M solution of WGA was reacted with a 6-fold excess of Texas Red for 1 h at room temperature. The protein conjugate was purified on a G-25 Sephadex column.
  • L-M(TK ⁇ ) cells were grown in Dulbecco's Modified Eagle Media (Gibco; Grand Island, N.Y.) with 10% fetal bovine serum (FBS) and 1% penicillin streptomycin (PS) (Gemini; Calabasas, CA).
  • B 104 cells were differentiated with 1 ⁇ M retinoic acid for 5 days prior to use. The cells were plated on glass coverslips at least one day before use. The adherent cells were washed and maintained in 2.5–3.0 mL of HBSS with 1 g/L glucose and 20 mM HEPES at pH 7.4.
  • a freshly prepared 75 ⁇ M aqueous solution of the appropriate oxonol was made prior to an experiment from a DMSO stock solution.
  • the cells were stained by mixing 100 ⁇ L of the oxonol solution with 750 ⁇ L of the bath and then adding the diluted solution to the cells.
  • the dye was left for 30–40 minutes at a bath concentration of 2.3 M 1.5 mM ⁇ -cyclodextrin in the bath solution was necessary for cell loading of DiSBA-C 6 -(3).
  • the butyl and ethyl derivatives were water-soluble enough to load cells with omit ⁇ -cyclodextrin complexation.
  • DiSBA-C 10 -(3) was loaded in a pH 7.4 solution containing 290 mM sucrose and 10 mM HEPES, 364 mOsm, for 10 min at a bath concentration of 10 M.
  • DISBA-C 10 -(3) labeling was quenched by replacing the bath with HBSS solution.
  • the cells were stained with 15 g/mL of F-WGA for 15 minutes.
  • the B104 cells required a 125 g/mL bath concentration to give satisfactory lectin staining. The excess dyes were removed with repeated washes with HBSS.
  • the cardiac myocytes [Henderson, S. A., Spencer, M., Sen, A., Kumar, C., Siddiqui, M. A. Q., and Chien, K. R. 1989. Structure organization, and expression of the rat cardiac myosin light chain-2 gene. J. Biol. Chem. 264:18142–18146] were a gift of Professor Kenneth Chien, UCSD.
  • the Jurkat lymphocyte suspensions were grown in RPMI media with 5% heat inactivated FBS and 1% PS. 15–20 mL aliquots of the cellular suspension were washed three times before and after dye staining by centrifugation at 100 ⁇ g for 4 minutes followed by additions of fresh HBSS.
  • the fluorescently labeled cells were excited with light from a 75 W xenon lamp passed through 450–490 nm excitation interference filters. The light was reflected onto the sample using a 505 nm dichroic. The emitted light was collected with a 63 ⁇ Zeiss (1.25 or 1.4 numerical aperture) lens, passed through a 505 nm long pass filter and directed to a G-1B 550 nm dichroic (Omega; Brattleboro, Vt.). The reflected light from this second dichroic was passed through a 515 DF35 bandpass filter and made up the FL-WGA signal. The transmitted light was passed through a 560 or 570 LP filter and comprised the oxonol signal.
  • the 1–2 KHz single wavelength data was acquired with an Axobasic program that used the TTL. pulse counting routine LEVOKE.
  • Confocal images were acquired using a home built high speed confocal microscope [Tsien, R. Y. and B. J. Bacskai. 1994. Video-rate confocal microscopy. In Handbook of Biological Confocal Microscopy J. B. Pawley, editor. Plenum Press, New York].
  • the cell was voltage-clamped at a holding potential of ⁇ 70 mV. After a 200 ms delay, the cell was given a 200 ms depolarizing square voltage pulse to 50 mV.
  • Pseudocolor images showing the ratio of the Fl-WGA to oxonol emissions were collected every 67 ms and clearly showed a change in ratio, localized to the plasma membrane, upon depolarization of the cell to +50 mV.
  • Patch clamp recording were made using an Axopatch 1-D amplifier equipped with a CV-4 headstage from Axon Instruments (Foster City, Calif.). The data were digitized and stored using the PCLAMP software.
  • the pH 7.4 intracellular solution used contained 125 mM potassium gluconate, 1 mM CaCl 2 .2H 2 O, 2 mM MgCl 2 .6H 2 O, 11 mM EGTA, and 10 mM HEPES.
  • 4 mM ATP and 0.5 mM GTP were added.
  • R o was calculated following standard procedures [Wu, P. and Brand, L. 1994. Resonance energy transfer: methods and applications. Anal. Biochem. 218:1–13].
  • the spectra of FL-WGA in HBSS and DiSBA-C 6 -(3) in octanol were used to determine the overlap integral. Values of 1.4 and 0.67 were used for the index of refraction and orientation factor respectively.
  • Symmetrical bis(thiobarbiturate)oxonols were chosen as likely candidates for rapidly translocating fluorescent ions based on the above design criteria.
  • the strong absorbance maximum ( ⁇ 200,000 M ⁇ 1 cm ⁇ 1 ) at 540 nm and good quantum yield (0.40) in membranes makes them desirable for use as a fluorescence donors or acceptors in cells.
  • the fluorescence excitation and emission spectra of DiSBA-C 6 -(3) is shown in FIG. 2 along with those for FL-WGA and TR-WGA. The excitation spectra are the shorter of each pair.
  • Octanol was selected as the oxonol solvent in order to mimic the membrane environment.
  • the translocation rates were studied in L-M(TK ⁇ ) cells using whole-cell voltage clamp recording.
  • the L-M(TK ⁇ ) cells were chosen because they have very low background currents and are easy to patch clamp. These cells have a resting potential of ⁇ 5 mV and no evident voltage activated currents.
  • Displacement currents from DiSBA-C 6 -(3) at 20 C are displayed in FIG. 3 .
  • 12.5 ms long voltage steps at 15 mV increments were applied to the cell, from a holding potential of ⁇ 70 mV.
  • the larger, faster transients due to simple membrane capacitance transient could be minimized using the capacitance and series resistance compensation capabilities of the Axopatch amplifier, allowing the displacement currents to be clearly observed.
  • the currents are due to redistribution of the membrane-bound oxonol in response to 8 depolarizations.
  • the time constant for the displacement current is 2 ms for 120 mV depolarization.
  • FIGS. 4 and 5 show the voltage dependence and time constants for charge translocation in a cell loaded with about 4 times as much oxonol as in the experiment of FIG. 3 .
  • the circles are the data from the on response and the squares from the tail currents.
  • the raw data were fit to a single exponential and the charge moved, the area, was calculated as the product of the current amplitude and the time constant.
  • the experimental data are in reasonable accord with existing models of hydrophobic ion transport between two energy minima near the aqueous interfaces of the lipid bilayer [Ketterer, B., Neumcke, B., and Läuger, P. 1971. Transport mechanism of hydrophobic ions through lipid bilayer membranes. J. Membrane Biol.
  • ⁇ ⁇ ⁇ q ⁇ ( V ) ⁇ ⁇ ⁇ q max ⁇ tanh ⁇ [ q ⁇ ⁇ ⁇ ⁇ ( V - V h ) 2 ⁇ kT ] ( 1 )
  • ⁇ ⁇ ( V ) ⁇ max ⁇ sech ⁇ [ q ⁇ ⁇ ⁇ ⁇ ( V - V h ) 2 ⁇ kT ] ( 2 )
  • V h the membrane potential at which there are equal numbers of ions in each potential energy well, could differ from zero because of membrane asymmetry.
  • ⁇ is the fraction of the externally applied potential effectively felt by the translocating ion;
  • q is the charge on each ion, k and T are Boltzmann's constant and absolute temperature.
  • the oxonol fluorescences at the intracellular and extracellular membrane binding sites is made different. Fluorescence asymmetry is created with the introduction of fluorescently labeled lectins bound to the extracellular membrane surface. Excitation of FL-WGA leads to energy transfer to oxonols located in the extracellular membrane binding site as shown in FIG. 1 .
  • the extinction coefficient and the fluorescence quantum yield of FL-WGA were measured to be 222,000 M ⁇ 1 cm ⁇ 1 ( ⁇ 3 fluorescein/protein) and 0.23, respectively.
  • the oxonol molecules Upon depolarization, the oxonol molecules redistribute such that more are bound to the intracellular site and less to the extracellular one. This change manifests itself with a decrease in the energy transfer, resulting in an increase in the fluorescence of the FL-WGA and a concomitant decrease in the oxonol emission.
  • the fluorescence signals in a voltage clamped L-M(TK ⁇ ) cell labeled with (the DiSBA-C 4 -(3)/FL-WGA pair) and depolarized with four increasing voltage steps are shown in FIG. 6 .
  • the data are the average of 29 sweeps.
  • the FL-WGA emission increases 7–8%, the oxonol fluorescence decreases 10% and the FL-WGA/oxonol emission ratio changes 19% for a 120 mV depolarization.
  • the simultaneous changes in donor and acceptor emissions is consistent with the FRET mechanism outlined in FIG. 1
  • the decrease in oxonol emission with depolarization is opposite to what is observed for the slow voltage-sensitive uptake of oxonols in cells [Rink et al. 1980, supra].
  • the fluorescence changes have time constants of ⁇ 18 ms at 20 C, in agreement with the DiSBA-C 4 -(3) displacement currents. No large fluorescence changes are observed in the absence of FL-WGA.
  • the translocation rate of DiSBA-C 4 -(3) speeds up with increasing temperature.
  • the time constant falls to 7–8 ms at 29 C, corresponding to an activation energy of ⁇ 17 kcal/mol.
  • raising the temperature also increases internalization of the lectin and eventually decreases the fluorescence change.
  • the DiSBA-C 6 -(3)/FL-WGA pair has a time constant of ⁇ 3 ms at 20 C, while the DiSBA-C 10 -(3)/FL-WGA pair, responds with a time constant of 2 ms, as shown in FIG. 7 .
  • the solid curve is a fit to a single exponential with a 2 ms time constant.
  • the data is the average of 3 L-M(TK ⁇ ) cells, at 20 C, acquired at 2 kHz.
  • the response in the figure is slightly slower than the true value because of smoothing.
  • the fluorescence time constants are in agreement with those from the displacement currents, for example in FIG. 3 .
  • a 6-chloro-7-hydroxycoumarin conjugated to dimyristoylphosphatidylethanolamine (DMPE) via a glycine linker, Cou PE, has been prepared and found to function as an excellent voltage-sensitive FRET donor to bis-(1,3-dialkyl-2-thiobarbiturate)-trimethineoxonols.
  • This new FRET pair has given an 80% ratio change for a 100 mV depolarization in an astrocytoma cell, which is the largest voltage-sensitive optical signal observed in a cell, FIG. 17 .
  • the voltage sensitivity of this FRET pair is consistently 2–3 times better than Fl-WGA/trimethineoxonol in a variety of cell types.
  • ratio values between 25–50% are found, with equal percent changes found in both channels, FIG. 18 .
  • 5–30% fluorescence ratio changes were observed for spontaneously generated action potentials. The largest signals are almost 4 times larger than those possible with Fl-WGA/trimethineoxonol.
  • FIG. 19 An example of such a large change from a single cluster of heart cells is given in FIG. 19 .
  • the benefits of a ratio output are evident in the figure.
  • the individual wavelengths, at the top of the figure show a decreasing baseline that is due to fluorophore bleaching.
  • the ratio data shown on the bottom of the figure compensates for the loss of intensity in both channels and results in a flat baseline.
  • Bis-(1,3-dialkyl-2-thiobarbiturate)-pentamethineoxonols have been prepared by condensing 1,3 substituted thiobarbituric acids with glutacondialdehyde dianil monohydrochloride, also known as N-[5-(phenylamino)-2,4-pentadienylidene]benzenamine monohydrochloride.
  • the absorbance and emission are shifted 100 nm to longer wavelengths, compared to the trimethine oxonols This shift is consistent with other polymethine dyes, such as cyanines, where addition of 2 additional methine units results in 100 nm wavelengths shifts to the red.
  • the pentamethines can be loaded into cells in culture in the same manner as the trimethine oxonol.
  • the butyl compound, DiSBAC 4 (5) can be loaded in Hanks' Balanced Salt Solution, while the hexyl compound, DiSBAC 6 (5), requires addition of beta-cyclodextrin to mask the hexyl side chains and solubilize the hydrophobic oxonol.
  • Fluorescent phosphatidylethanolamine conjugates have also been found to function as FRET donors to the pentamethine oxonol.
  • the structures of PE conjugates tested are shown in FIG. 20 .
  • NBD-PE/pentamethineoxonol pair has given 1–10% ratio changes per 100 mV.
  • Cou-PE/pentamethineoxonol has given 15–30% ratio changes in voltage clamped astrocytomas for 100 mV depolarization. This pair is remarkable because the Cou PE emission and DiSBAC 6 (5) absorbance maxima are separated by 213 nm and there is hardly any visible overlap, FIG. 21 .
  • the large extinction at long wavelengths of the pentamethine enable FRET between the coumarin and the pentamethine oxonol.
  • the R o for this pair has been calculated to be 37 ⁇ , using a quantum yield value of 1.0 for the Cou-PE.
  • the membrane translocation rates for the pentamethines are 5–8 times faster than the trimethine analogues.
  • DiSBAC 4 (5) displacement currents in voltage-clamped astrocytoma cells showed that butyl pentamethine oxonol jumps across the plasma membrane with a time constant of ⁇ 2 ms in response to voltage steps of +20–120 mV.
  • the trimethine analogue translocates ⁇ 18 ms under identical conditions.
  • the displacement currents of DiSBAC 6 (5) decay very rapidly and are difficult to separate from the cell capacitance.
  • DiSBAC 6 (5) As a result of the large voltage-dependent signal from the Cou-PE/DiSBAC 6 (5) pair, it was possible to optically measure the speed of voltage response of DiSBAC 6 (5).
  • the time constant for DiSBAC 6 (5) translocation was measured optically at 0.383 ⁇ 0.032 ms in response to a 100 mV depolarization step, using FRET from asymmetrically labeled Cou-PE.
  • the ratio data and the exponential response are shown in FIG. 22 .
  • the enhanced translocation rates result from the greater charge delocalization and slightly more hydrophobicity of the pentamethine oxonols.
  • the rapid voltage response of DiSBAC 6 (5) is the fastest known for a permeant, highly fluorescent molecule.
  • the submillisecond response is fast enough to accurately register action potentials of single neurons.
  • DiSBA-C 6 -(3) functions as a FRET donor to TR-WGA in L-M(TK ⁇ ) cells with the same response time as FL-WGA/DiSBA-C 6 -(3).
  • the spectral overlap of this FRET pair is shown in FIG. 2 .
  • the signal change is only one half that for FL-WGA/DiSBA-C 6 -(3).
  • DiSBAC 6 (3) has been successfully used as a FRET donor to Cy5 labeled PE, in B104 neuroblastoma cells.
  • the ratio changes of 5–15%/100 mV are the largest observed with the mobile ion being the donor.
  • the FL-WGA/DiSBA-C 6 -(3) system was tested in a variety of cell lines. In neonatal cardiac myocytes, the two fluorophores could be loaded without affecting the spontaneous beating. Therefore, the added capacitance from the oxonol displacement current did not prevent generation of action potentials.
  • the periodic 90 mV action potentials [Conforti, L., Tohse, N., and Sperelakis, N. 1991. Influence of sympathetic innervation on the membrane electrical properties of neonatal rat cardiomyocytes in culture. J. Devel. Physiol. 15:237–246] could be observed in a single sweep, FIG. 8C . The ratio change without subtraction of any background fluorescence was 4–8%.
  • the traces are the average of 4 sweeps acquired at 300 Hz, with no smoothing.
  • the time constant for the fluorescence changes is less than 3.3 ms consistent with the displacement currents, such as those in FIG. 3 .
  • a small background signal was subtracted from the starting signal, ⁇ 5% for the oxonol channel and ⁇ 15% for the fluorescein channel.
  • the fluorescence intensities in the fluorescein and oxonol channels increased ⁇ 17% and decreased ⁇ 16% respectively for 100 mV depolarization.
  • the crosstalk between emission channels was decreased and larger changes occurred in the fluorescein signal.
  • the astrocytoma cells gave a 10–20% ratio increase that was localized to the plasma membrane for a 120 mV depolarization.
  • the solid was redissolved in 45 mL of dry CH 2 Cl 2 and mixed with 2.44 mL of N,N-diisopropylethylamine (DIEA) and 3.9 g (17.9 mmol) of di-tert-butyl dicarbonate. After reacting for 1 hour, the mixture was poured into a separatory funnel and washed with 5% sodium bicarbonate. A solid came out of solution and was filtered away ( ⁇ 100 mg). The organic solution was then washed with water and a saturated brine solution. The organic layer was then dried with MgSO 4 and filtered.
  • DIEA N,N-diisopropylethylamine
  • 1-butyl,3-(5-pentanol) thiobarbiturate (7) in dry EtOH, 345 mg (15 mmol) of Na was dissolved. After almost all of the Na had dissolved, diethylmalonate (2.278 mL, 15 mmol) was added under argon. The mixture was then heated to 60° C to dissolve the precipitated sodium malonate. The heat was then removed and N-butyl-N-5-pentanol thiourea (6) (1.310 g, 6 mmol) was added. The reaction mixture was refluxed a 100° C. for 3.5 days. After cooling, the reaction mixture was filtered and washed with EtOH.
  • 1-butyl,3-(5-bromopentane) thiobarbiturate (8) (7) (98 mg, 343 mmol) was dissolve in 600 uL dry CH 2 Cl 2 and mixed with carbon tetrabromide (142 mg, 429 mmol). The solution was cooled on ice and triphenylphosphine (135 mg, 515 mmol) was added. The solution bubbled and turned yellow immediately. After 30 min. the solvent was removed and hexane was added to the solid residue. The mixture was allowed to stir overnight. TLC showed only 1 barbiturate in hexane solution along with triphenylphospine oxide.
  • the impurity was removed by flash silica gel chromatography (2.5 ⁇ 22 cm) packed in EtOAc/MeOH (98:2). The nonpolar impurity was eluted off the column using the packing solvent followed by EtOAc/MeOH (90:10). The desired product was eluted with CHCl 3 /MeOH/AA (93:5:2), yielding 40 mg (115 mmol, 34%).
  • the Aequorea victoria GFP coding sequence (Clontech) was engineered to contain the mutations S72A, Y145F and T203I (Sapphire) (SEQ. ID. NO: 1) ( Green Fluorescent Proteins , Chapter 2, pages 19 to 47, edited Sullivan and Kay, Academic Press).
  • This fluorescent protein has an excitation peak around 395 nm and an emission peak around 512 nm, making it a useful donor with the trimethine oxonol acceptor.
  • the plasma membrane localisation signal form the tyrosine kinase lyn was fused in frame with the Sapphire coding sequence.
  • This sequence which is derived from the first 21 amino acids of lyn, contains a well defined membrane localization domain that serves in vivo to specifically localize lyn to the inner plasma membrane of mammalian cells.
  • a sense primer ATTCCCAAGCTTGCGGCCGCCACCATGGGCTGCATCAAGAGCAAGCGCAAG GACAACCTGAACGACGACGGCGTG, SEQ ID. NO: 20
  • an anti-sense primer CCGGAATTCTTACTTGTACAGCTCGTCCATGCC, SEQ ID. NO: 21
  • a sense primer GACAACCTGAACGACGACGGCGTGGACATGAAGACCATGGTGAGCAAGGGC GAGGAGCTG SEQ ID. NO: 22
  • the anti-sense primer were used.
  • the PCR product was digested with HindIII and EcoRI, and ligated into the mammalian expression vector pcDNA3 (Invitrogen). Additional targeting sequences were made based on this construct To utilize the NcoI sites that flank the Lyn sequence, the Lyn Sapphire insert was subcloned from pcDNA3 into pBluescriptII (Stratagene) using the restriction sites HindIII and EcoRI. Oligonucleotides coding for the additional targeting sequences Lyn D10, D15 and RRR (see Table 4) with their complimentary strands were synthesized, using standard techniques.
  • oligomers were phosphorylated using T4 polynucleotide kinase, hybridized by heating the complimentary strands to 95° C. and then slowly cooling the samples to room temperature. Double stranded oligomers, containing the required targeting sequence, were inserted 5′ of the sapphire GFP coding region after removal of the original Lyn sequence by digestion of the lyn Sapphire DNA with NcoI. The orientation and sequence of the inserts was confirmed by DNA sequencing.
  • oligonucleotides was synthesized and used as an antisense primer in PCR.
  • the ras oligonucleotide contained the antisense sequence of the C-terminal CAAX-box and polybasic region of K-Ras followed by 16 nucleotide bases that overlap into the C terminus of Sapphire GFP.
  • the T3 primer was used as the sense primer.
  • Either Lyn Sapphire or Sapphire alone plasmids were used as template DNA, depending on the constructs required. All inserts were subcloned into the mammalian expression construct pcDNA3 prior to transfection into cells.
  • the first requirement for using GFP as a voltage-sensitive FRET donor is to selectively target it to the desired membrane, in this example the plasma membrane. While many proteins bind to the cell membrane, a large number of these candidate proteins also have high expression levels in other cellular locations. Often fusion of a naturally fluorescent protein to a protein that is expressed at the plasma membrane will result in fluorescence throughout the secretory pathway. Non specific expression patterns are not amenable for use as a FRET donor because a large percentage of the emitted light originates from irrelevant cellular locations and results in a high background, which precludes large signal changes and may even be a source of artifactual fluorescence changes.
  • N-terminal fusion of a ⁇ 20 amino acid plasma membrane targeting sequence from Lyn tyrosine protein kinase (Resh. (1994) Cell 76 (3) 411–3), a member of the Src family of tyrosine protein kinases, and C-terminal fusion of CAAX motifs (Magee and Marshall (1999) Cell 98 9–12) to GFP results in specific fluorescence at the plasma membrane of transfected mammalian cells.
  • the targeted naturally fluorescent protein constructs were transiently transfected into CHO cells using the lipid-mediated transfection reagent Lipofectamine (GibcoBRL) at a 1:12 DNA to lipid ratio.
  • Expression of the membrane targeted sapphire GFP in rat basophilic leukemia (RBL-1) cells was achieved by transfecting wild-type RBL cells with the GFP constructs by electroporation.
  • Cells lines stably expressing the GFP constructs were generated for both RBL-1 and CHO host cells by selecting for geneticin (G418) resistance.
  • Targeted GFP-expressing clones were sorted using a Becton Dickinson FACS Vantage SE cell sorter equipped with a Coherent Innova Krypton 302 laser.
  • Sapphire GFP was excited using the 407 nm line of the krypton laser. Individual cells were sorted into microtiter plates based on fluorescence through a 530/30 nm emission filter.
  • Trimethine oxonol Loading (bis-(1,3-dialkyl-2-tlhiobarbiturate)(DiSBAC x (3)) acceptors, where x refers to the number of carbons in alkyl substituents, were loaded into washed cells by incubation at room temperature for 30 minutes with gentle shaking.
  • RBL cells were harvested from confluent flasks using non-enzymatic cell dissociation buffer (GibcoBRL), pelleted, washed in Bathl buffer (160 mM NaCl, 4.5 mM KCl, 2 mM CaCl 2 , 1 mM MgCl 2 , 10 mM D-glucose, 10 mM HEPES pH 7.4), resuspended to 2 ⁇ 10 6 cells/mL in Bath1 containing oxonol, and incubated at room temperature for 30 minutes with gentle shaking. Oxonol was washed out and cells were plated at 1 ⁇ 10 5 cells per well in poly-L-lysine coated black-wall microtiter plates (Costar).
  • Bathl buffer 160 mM NaCl, 4.5 KCl, 2 mM CaCl 2 , 1 mM MgCl 2 , 10 mM D-glucose, 10 mM HEPES pH 7.4
  • the excitation maximum of S65T mutants the oxonol is ⁇ 15% excited compared its maximum Since the oxonol has a maximal extinction of ⁇ 200,000 M ⁇ 1 cm ⁇ 1 this corresponds to an effective extinction of 30,000 M ⁇ 1 cm ⁇ 1 which is comparable to GFPs Oxonol molecules not located at the plasma membrane are not efficiently excited with 405 nm light, which is ⁇ 130 nm shorter than the oxonol absorbance maximum. Furthermore, oxonols not in membranes are essentially non fluorescent. Taken together, the light emitted from the stained cells is primarily from the plasma membrane where the Sapphire donors are located.
  • the transmitted oxonol emission was measured after passage through a 740 nm dichroic and a 580 ⁇ 35 nm band pass filter
  • the emitted light was simultaneously detected using two PMTs (Hamamatsu) Infrared light 1000 ⁇ 150 nm was used to image the cell for patch clamping.
  • Cells were stained with 6 uM DiSBAC 2 for a minimum of 20 minutes unless otherwise noted
  • All patch clamp experiments were performed at room temperature using an AxoPatch IC amplifier and the pClamp software suite (Axon Instruments, Inc Foster City, Calif.). A ground was created by placing an Ag/AgCl pellet placed directly in the bath. Patch pipettes were made on a Flaming/Brown micropipette puller (Model P-97, Sutter Instruments, Inc. Novato, Calif.) from borosilicate glass with resistances when filled with pipette solution of 3–6 M ⁇ . The pipette solution was composed of 140 mM K-gluconate, 2 mM MgCl 2 , 1 mM CaCl 2 , 10 mM EGTA, 10 mM HEPES and pH 7.2.
  • FIG. 25 An example of a large voltage-sensitive FRET response from a single cell is shown in FIG. 25 .
  • the green donor emission decreases and the oxonol emission increases as predicted for a net oxonol translocation from the outer plasma membrane leaflet to the inner, as depicted in FIG. 24 .
  • These fluorescence changes are in opposite directions to those observed using a coumarin-lipid donor, which binds to the extracellular plasma membrane leaflet (Gonzalez and Tsien, (1997) Chem. Biol. 4 (4) 269–77).
  • the majority of the signal can be manipulated by changing the relative dye staining concentrations.
  • the majority of the signal change is almost always from GFP, probably because of the spill over of the GFP emission into the oxonol signal.
  • Truncations of the Lyn domain were prepared to test whether shortening the targeting sequence would retain membrane binding and if so whether the shorter linker placed the GFP closer to the membrane and resulted in greater FRET, and possibly voltage-sensitive FRET.
  • Two truncations of the targeting sequence were made at aspartic acid residue 10 (D10 Sapphire) and aspartic acid residue 15 (D15 Sapphire).
  • a triple arginine patch present in the N-terminal region of Src tyrosine protein kinase was substituted for the corresponding Lyn residues in the Lyn Sapphire construct (Lyn RRR Sapphire).
  • the constructs were transiently transfected into CHO cells and voltage-sensitivity was determined according to the procedure described above, using a minimum of 5 cells for each construct. Data from 3 separate runs were averaged for the hyperpolarization and depolarization protocol shown in the inset. The measured sensitivities were similar for the two different voltage pulses. Cells with above average brightness and apparent membrane targeting were selected for patch-clamping Cell capacitance values were typically between 10 and 15 pF. The results are summarized in Table 5
  • the temporal response of the GFP/oxonol FRET change is dependent on the oxonol translocation rate and follows the previously observed trend with oxonol acceptors, faster responses with more hydrophobic acceptors.
  • the measured time constants for the ethyl and butyl oxonol acceptors are ⁇ 50 and ⁇ 5 ms respectively in the targeted GFP expressing cells.
  • the FRET response and the electrophysiologically measured displacement currents have identical time constants. The measured response times are 2–4 fold faster than previously reported and may be a property of the cells used or from a slight difference in temperature.
  • the temporal responses of DiSBAC 4 displacement currents in cells expressing GFP and those of the host cells did not show any significant differences.
  • Cells were illuminated with light from a 300 W xenon arc lamp passed through a 400 ⁇ 7 nm band pass excitation filter and fluorescence emission intensities were recorded via two PMTs using a 535 ⁇ 18 nm band pass emission filter to collect sapphire GFP emission and a 580 ⁇ 30 nm band pass filter to collect trimethine oxonol emission.
  • a typical VIPRTM run involved recording fluorescence intensities at the donor and acceptor wavelengths simultaneously for 35 seconds at 1 Hz with liquid addition occurring between 12 and 15 seconds. Data were analyzed by first subtracting background, (intensities from wells without cells) from the sample wells. The fluorescence ratio (oxonol/GFP emission) was then calculated and normalized to the starting ratio of each well before liquid addition. The final ratio was determined using data between 17 and 24 seconds. The fraction of GFP emission that emitted in the wavelength range used for oxonol detection (580 nm ⁇ 30) was determined using cells prior to the addition of the oxonol. The leakage of the GFP emission into the oxonol signal was subtracted prior to data analysis, for oxonol stained cells assuming the same GFP emission profile in the presence of oxonol.
  • the homogeneity of the stable lines enabled us to perform membrane potential assays using an integrated liquid handling and fluorescence plate reader capable of fast simultaneous emission ratioing Cellular assays that test for compounds that block high K + induced depolarizations have been successfully performed in microtiter plates using all the stable Sapphire GFP cell lines with trimethine oxonols FRET acceptors.
  • the RBL-1 cells have an endogenous inward rectifying K + channel, IRK, that sets the membrane potential to the K + equilibrium potential.
  • the data shows very reproducible well-to-well responses, with the time response limited by the liquid addition.
  • the ability to use microtiter plates makes the targetable voltage probes compatible with high-throughput drug screening and allows facile optimization of acceptor concentration for the best ratio response.
  • the utility for compound screening is further demonstrated by incubating the cells with Ba 2+ which blocks IRK and depolarizes the cells. This causes the high K + signal to be blocked since the cells are already depolarized when the high K + solution is added.
  • the Ba 2+ dose-response in the Lyn Sapphire GFP/butyl trimethine oxonol is shown in FIG. 27 . Microtiter wells treated with the IRK antagonists can be clearly identified.
US10/335,517 1995-06-07 2002-12-31 Detection of transmembrane potentials by optical methods Expired - Fee Related US7087416B2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US10/335,517 US7087416B2 (en) 1995-06-07 2002-12-31 Detection of transmembrane potentials by optical methods

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US08/481,977 US5661035A (en) 1995-06-07 1995-06-07 Voltage sensing by fluorescence resonance energy transfer
PCT/US1996/009652 WO1996041166A2 (en) 1995-06-07 1996-06-06 Detection of transmembrane potentials by optical methods
US08/765,860 US6107066A (en) 1995-06-07 1996-06-06 Detection of transmembrane potentials by optical methods
US09/459,956 US6342379B1 (en) 1995-06-07 1999-12-13 Detection of transmembrane potentials by optical methods
US09/967,772 US7173130B2 (en) 1995-06-07 2001-09-28 Detection of transmembrane potentials by optical methods
US10/335,517 US7087416B2 (en) 1995-06-07 2002-12-31 Detection of transmembrane potentials by optical methods

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US09/967,772 Continuation US7173130B2 (en) 1995-06-07 2001-09-28 Detection of transmembrane potentials by optical methods

Publications (2)

Publication Number Publication Date
US20030207248A1 US20030207248A1 (en) 2003-11-06
US7087416B2 true US7087416B2 (en) 2006-08-08

Family

ID=23826844

Family Applications (4)

Application Number Title Priority Date Filing Date
US09/459,956 Expired - Lifetime US6342379B1 (en) 1995-06-07 1999-12-13 Detection of transmembrane potentials by optical methods
US09/967,772 Expired - Fee Related US7173130B2 (en) 1995-06-07 2001-09-28 Detection of transmembrane potentials by optical methods
US10/335,517 Expired - Fee Related US7087416B2 (en) 1995-06-07 2002-12-31 Detection of transmembrane potentials by optical methods
US10/334,288 Expired - Fee Related US7118899B2 (en) 1995-06-07 2002-12-31 Detection of transmembrane potentials by optical methods

Family Applications Before (2)

Application Number Title Priority Date Filing Date
US09/459,956 Expired - Lifetime US6342379B1 (en) 1995-06-07 1999-12-13 Detection of transmembrane potentials by optical methods
US09/967,772 Expired - Fee Related US7173130B2 (en) 1995-06-07 2001-09-28 Detection of transmembrane potentials by optical methods

Family Applications After (1)

Application Number Title Priority Date Filing Date
US10/334,288 Expired - Fee Related US7118899B2 (en) 1995-06-07 2002-12-31 Detection of transmembrane potentials by optical methods

Country Status (7)

Country Link
US (4) US6342379B1 (US07087416-20060808-C00012.png)
EP (1) EP1409456B1 (US07087416-20060808-C00012.png)
JP (1) JP2003518246A (US07087416-20060808-C00012.png)
AT (1) ATE544747T1 (US07087416-20060808-C00012.png)
AU (1) AU783487B2 (US07087416-20060808-C00012.png)
CA (1) CA2393562C (US07087416-20060808-C00012.png)
WO (1) WO2001042211A2 (US07087416-20060808-C00012.png)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080097222A1 (en) * 2006-10-24 2008-04-24 The Research Foundation Of State University Of New York Composition, method, system, and kit for optical electrophysiology
US20100145024A1 (en) * 1996-08-16 2010-06-10 The State Of Oregon, Acting By And Through The State Board Of Higher Education On Behalf Of The Long wavelength engineered fluorescent proteins

Families Citing this family (104)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6124128A (en) 1996-08-16 2000-09-26 The Regents Of The University Of California Long wavelength engineered fluorescent proteins
US7745142B2 (en) 1997-09-15 2010-06-29 Molecular Devices Corporation Molecular modification assays
US7338782B2 (en) 1998-12-11 2008-03-04 Clontech Laboratories, Inc. Nucleic acids encoding chromophores/fluorophores and methods for using the same
US9834584B2 (en) * 1998-12-11 2017-12-05 Takara Bio Usa, Inc. Nucleic acids encoding chromophores/fluorophores and methods for using the same
US20030087492A1 (en) 2001-11-02 2003-05-08 Promos Technologies, Inc. Semiconductor device and method of manufacturing the same
AU783191B2 (en) 1999-10-08 2005-10-06 Caliper Life Sciences, Inc. Use of nernstein voltage sensitive dyes in measuring transmembrane voltage
AU783767B2 (en) 1999-10-14 2005-12-01 Takara Bio Usa, Inc. Anthozoa derived chromophores/fluorophores and methods for using the same
GB0012229D0 (en) * 2000-05-19 2000-07-12 Devgen Nv Lipid uptake assays
JP4330338B2 (ja) * 2000-10-12 2009-09-16 クローンテック ラボラトリーズ インク． 大きく赤側にシフトした蛍光タンパク質
WO2002045737A2 (en) * 2000-12-07 2002-06-13 Board Of Regents, The University Of Texas System Methods of treatment involving human mda-7
US6969597B2 (en) 2001-02-21 2005-11-29 Clontech Laboratories, Inc. Nucleic acids encoding non aggregating fluorescent proteins and methods for using the same
WO2002077011A2 (en) * 2001-03-12 2002-10-03 The State Of Oregon Acting By And Through The State Board Of Higher Education On Behalf Of The University Of Oregon Oxidation-reduction sensitive green fluorescent protein variants
US20030194798A1 (en) * 2001-05-24 2003-10-16 Surber Mark W. Minicell compositions and methods
EP1409998A4 (en) * 2001-06-09 2007-07-11 Glsynthesis Inc LIPID STRUCTURES AND ITS USES
EP1409982A4 (en) * 2001-06-14 2006-05-24 Anadys Pharmaceuticals Inc PROCESS FOR SCREENING ON LIGANDS OF TARGET MOLECULES
US6838263B2 (en) * 2001-07-09 2005-01-04 Oklahoma Medical Research Foundation Targeted fusion proteins and methods for the characterization of cellular membrane domains
US6852504B2 (en) 2001-08-08 2005-02-08 Molecular Devices Corporation Method for measuring cellular transmembrane potential changes
US20030082511A1 (en) * 2001-09-25 2003-05-01 Brown Steven J. Identification of modulatory molecules using inducible promoters
TW200406466A (en) * 2001-11-13 2004-05-01 Ciba Sc Holding Ag Compositions comprising at least one oxonol dye and at least one metal complex
JP2005533000A (ja) * 2002-03-05 2005-11-04 ボード　オブ　リージェンツ，　ザ　ユニバーシティ　オブ　テキサス　システム Ｍｄａ−７に関与する免疫誘導を増強する方法
US20030228703A1 (en) * 2002-04-05 2003-12-11 The Regents Of The University Of Michigan Fluorescence resonance energy transfer quantitation and stoichiometry in living cells
US20030228566A1 (en) * 2002-06-11 2003-12-11 Biotechplex Corporation Method of and apparatus for screening for drug candidates
JP4429577B2 (ja) * 2002-09-30 2010-03-10 株式会社ニコン 細胞内反応測定装置および細胞内反応測定方法
US7432036B2 (en) * 2002-10-07 2008-10-07 Fujifilm Corporation Non-resonant two-photon absorbing material, non-resonant two-photon emitting material, and method for inducing absorption or generating emission of non-resonant two photons by using the material
DE03779067T1 (de) * 2002-11-12 2006-06-22 Zakrytoe Aktsionernoe Obschestvo "Evrogen" Fluoreszenzproteine und chromoproteine aus nicht-aequorea-hydrozoa-spezies sowie verfahren zur verwendung davon
US7413874B2 (en) * 2002-12-09 2008-08-19 University Of Miami Nucleic acid encoding fluorescent proteins from aquatic species
WO2004078124A2 (en) * 2003-03-03 2004-09-16 Board Of Regents, The University Of Texas System Methods and compositions involving mda-7
EP1613160A4 (en) 2003-03-27 2008-01-02 Ptc Therapeutics Inc VIEWING ENZYMES OF THE TRNA-SPLICE PATH TO IDENTIFY ANTIFUNGAL AND / OR PROLIFERATION-INHIBITING MOLECULES
CA2520415A1 (en) 2003-03-27 2004-10-14 Ptc Therapeutics, Inc. Methods of identifying compounds that target trna splicing endonuclease and uses of said compounds as anti-proliferative agents
WO2004094597A2 (en) * 2003-04-16 2004-11-04 University Of Miami Anthozoan fluorescent protein genes
JP2004357552A (ja) * 2003-06-03 2004-12-24 Hitachi Ltd 作用物質による効果推定方法及びスクリーニング方法
FR2858177A1 (fr) * 2003-07-28 2005-02-04 Genethon Utilisation du phenomeme fret, detecte par mplsm, pour le suivi in vivo d'evenements biologiques
US20050037364A1 (en) * 2003-08-13 2005-02-17 International Business Machines Corporation Techniques for recording signals
US7125908B2 (en) * 2003-08-29 2006-10-24 Allergan, Inc. Treating pain using selective antagonists of persistent sodium current
US7060723B2 (en) * 2003-08-29 2006-06-13 Allergan, Inc. Treating neurological disorders using selective antagonists of persistent sodium current
WO2005082396A2 (en) * 2003-12-01 2005-09-09 Introgen Therapeutics, Inc. Use of mda-7 to inhibit infection by pathogenic organisms
GB0403616D0 (en) * 2004-02-18 2004-03-24 Univ Cambridge Tech Derivatised phospholipids
US20070281041A1 (en) * 2004-03-02 2007-12-06 Introgen Therapeutics, Inc. Compositions and Methods Involving MDA-7 for the Treatment of Cancer
US20050260609A1 (en) * 2004-05-24 2005-11-24 Lapidus Stanley N Methods and devices for sequencing nucleic acids
GB0414653D0 (en) * 2004-06-30 2004-08-04 Univ Edinburgh Membrane fusion assay
US20060275310A1 (en) * 2004-09-30 2006-12-07 Nano Science Diagnostics, Inc. Method and detection and decontamination of antigens by nanoparticle-raman spectroscopy
TWI364882B (en) 2004-10-15 2012-05-21 Tyco Electronics Corp Connector system for conductive plates
US20070009484A1 (en) * 2005-02-08 2007-01-11 Board Of Regents, The University Of Texas System Compositions and methods involving MDA-7 for the treatment of cancer
US20080281104A1 (en) * 2005-03-04 2008-11-13 The University Of Tokyo Membrane-Anchoring Fluorescent Probe
US9278159B2 (en) 2005-07-22 2016-03-08 The Board Of Trustees Of The Leland Stanford Junior University Light-activated cation channel and uses thereof
US9274099B2 (en) * 2005-07-22 2016-03-01 The Board Of Trustees Of The Leland Stanford Junior University Screening test drugs to identify their effects on cell membrane voltage-gated ion channel
US9238150B2 (en) 2005-07-22 2016-01-19 The Board Of Trustees Of The Leland Stanford Junior University Optical tissue interface method and apparatus for stimulating cells
US20090093403A1 (en) 2007-03-01 2009-04-09 Feng Zhang Systems, methods and compositions for optical stimulation of target cells
US10052497B2 (en) 2005-07-22 2018-08-21 The Board Of Trustees Of The Leland Stanford Junior University System for optical stimulation of target cells
US8926959B2 (en) 2005-07-22 2015-01-06 The Board Of Trustees Of The Leland Stanford Junior University System for optical stimulation of target cells
WO2007047342A1 (en) * 2005-10-12 2007-04-26 Allergan, Inc. Assays of molecular or subcellular interactivity using depolarization after resonance energy transfer (daret)
DE602005013555D1 (de) * 2005-12-20 2009-05-07 Agfa Graphics Nv Kontrastfarbstoffe für Tintenstrahllithographiedruckplatten
US8892200B2 (en) 2006-06-19 2014-11-18 Highland Instruments, Inc. Systems and methods for stimulating tissue using focused energy
US8718758B2 (en) * 2006-06-19 2014-05-06 Highland Instruments, Inc. Interface apparatus for stimulation of biological tissue
US8929979B2 (en) 2006-06-19 2015-01-06 Highland Instruments, Inc. Apparatus and method for stimulation of biological tissue
US9913976B2 (en) 2006-06-19 2018-03-13 Highland Instruments, Inc. Systems and methods for stimulating and monitoring biological tissue
WO2008086470A1 (en) 2007-01-10 2008-07-17 The Board Of Trustees Of The Leland Stanford Junior University System for optical stimulation of target cells
WO2008101128A1 (en) 2007-02-14 2008-08-21 The Board Of Trustees Of The Leland Stanford Junior University System, method and applications involving identification of biological circuits such as neurological characteristics
US7994786B2 (en) * 2007-06-19 2011-08-09 Mary Hitchcock Memorial Hospital System and method for use of nanoparticles in imaging and temperature measurement
WO2009018379A1 (en) * 2007-07-31 2009-02-05 Purdue Pharma L.P. Dielectric spectroscopy assays for screening of ion channel ligands
JP4604187B2 (ja) * 2007-08-14 2010-12-22 独立行政法人産業技術総合研究所 糖鎖を介したルシフェラーゼと有機蛍光色素間のエネルギー移動を利用した可視−近赤外光プローブ
US10035027B2 (en) 2007-10-31 2018-07-31 The Board Of Trustees Of The Leland Stanford Junior University Device and method for ultrasonic neuromodulation via stereotactic frame based technique
US10434327B2 (en) 2007-10-31 2019-10-08 The Board Of Trustees Of The Leland Stanford Junior University Implantable optical stimulators
EP2062944A1 (en) * 2007-11-20 2009-05-27 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. Water-soluble rylene dyes, methods for preparing the same and uses thereof as fluorescent labels for biomolecules
JP5801188B2 (ja) 2008-04-23 2015-10-28 ザ ボード オブ トラスティーズ オブ ザ レランド スタンフォード ジュニア ユニバーシティー 標的細胞を光刺激するためのシステム、方法、および組成物
US8729040B2 (en) 2008-05-29 2014-05-20 The Board Of Trustees Of The Leland Stanford Junior University Cell line, system and method for optical control of secondary messengers
MY162929A (en) 2008-06-17 2017-07-31 Univ Leland Stanford Junior Apparatus and methods for controlling cellular development
CA2728238C (en) 2008-06-17 2019-03-12 M. Bret Schneider Methods, systems and devices for optical stimulation of target cells using an optical transmission element
WO2010006049A1 (en) 2008-07-08 2010-01-14 The Board Of Trustees Of The Leland Stanford Junior University Materials and approaches for optical stimulation of the peripheral nervous system
US20100029017A1 (en) * 2008-07-29 2010-02-04 Becton, Dickinson And Company Mono-chlorinated hydroxycoumarin conjugates
NZ602416A (en) 2008-11-14 2014-08-29 Univ Leland Stanford Junior Optically-based stimulation of target cells and modifications thereto
US8431416B2 (en) * 2009-04-01 2013-04-30 Becton, Dickinson And Company Reactive heterocycle-substituted 7-hydroxycoumarins and their conjugates
US9404160B2 (en) 2009-12-22 2016-08-02 Becton, Dickinson And Company Methods for the detection of microorganisms
WO2011116238A2 (en) 2010-03-17 2011-09-22 The Board Of Trustees Of The Leland Stanford Junior University. Light-sensitive ion-passing molecules
DE102010012857B4 (de) * 2010-03-25 2015-02-19 Tim Liedl Vorrichtung zum Erfassen einer Weggröße
US20140148726A1 (en) 2010-10-21 2014-05-29 Timothy Andrew WAGNER Methods for detecting a condition
EP2635108B1 (en) 2010-11-05 2019-01-23 The Board of Trustees of the Leland Stanford Junior University Light-activated chimeric opsins and methods of using the same
US10086012B2 (en) 2010-11-05 2018-10-02 The Board Of Trustees Of The Leland Stanford Junior University Control and characterization of memory function
CA2817175C (en) * 2010-11-05 2019-09-24 The Board Of Trustees Of The Leland Stanford Junior University Upconversion of light using lanthanide-doped nanoparticles for use in optogenetic methods
AU2011323199B2 (en) 2010-11-05 2016-01-28 The Board Of Trustees Of The Leland Stanford Junior University Stabilized step function opsin proteins and methods of using the same
CN103476456B (zh) 2010-11-05 2017-10-03 斯坦福大学托管董事会 奖赏相关行为的光遗传学控制
CN106106368A (zh) 2010-11-05 2016-11-16 斯坦福大学托管董事会 光控cns功能障碍
US8696722B2 (en) 2010-11-22 2014-04-15 The Board Of Trustees Of The Leland Stanford Junior University Optogenetic magnetic resonance imaging
US8594783B2 (en) 2011-08-24 2013-11-26 Highland Instruments, Inc. Systems and methods for stimulating cellular function in tissue
EP2791333B1 (en) 2011-12-16 2019-03-06 The Board of Trustees of the Leland Stanford Junior University Opsin polypeptides and methods of use thereof
US20140024701A1 (en) 2012-02-21 2014-01-23 Circuit Therapeutics, Inc. Compositions and Methods for Treating Neurogenic Disorders of the Pelvic Floor
WO2013130808A1 (en) 2012-02-29 2013-09-06 D.E. Shaw Research, Llc Methods for screening voltage gated proteins
JP6335187B2 (ja) * 2012-12-11 2018-05-30 ジーイー・ヘルスケア・バイオサイエンス・コーポレイション 色素の光活性化型ケミカルブリーチング
CA2906756A1 (en) 2013-03-15 2014-09-18 The Board Of Trustees Of The Leland Stanford Junior University Optogenetic control of behavioral state
US9636380B2 (en) 2013-03-15 2017-05-02 The Board Of Trustees Of The Leland Stanford Junior University Optogenetic control of inputs to the ventral tegmental area
CA2908864A1 (en) 2013-04-29 2014-11-06 The Board Of Trustees Of The Leland Stanford Junior University Devices, systems and methods for optogenetic modulation of action potentials in target cells
US9410016B2 (en) 2013-07-16 2016-08-09 Dow Global Technologies Llc Aromatic polyacetals and articles comprising them
US8933239B1 (en) 2013-07-16 2015-01-13 Dow Global Technologies Llc Bis(aryl)acetal compounds
US8962779B2 (en) 2013-07-16 2015-02-24 Dow Global Technologies Llc Method of forming polyaryl polymers
US9063420B2 (en) 2013-07-16 2015-06-23 Rohm And Haas Electronic Materials Llc Photoresist composition, coated substrate, and method of forming electronic device
CN105829538A (zh) 2013-08-14 2016-08-03 小利兰·斯坦福大学托管委员会 用于控制疼痛的组合物和方法
CN104101589B (zh) * 2014-07-29 2016-04-27 重庆大学 基于tmrm的细胞静息膜电位和钠钾离子通透性比值检测方法
USD759803S1 (en) 2014-10-28 2016-06-21 Highland Instruments, Inc. Adjustable headpiece with anatomical markers
WO2016205027A1 (en) * 2015-06-15 2016-12-22 Oklahoma Medical Research Foundation Ubiquitin interacting motif peptides as therapeutics
WO2016209654A1 (en) 2015-06-22 2016-12-29 The Board Of Trustees Of The Leland Stanford Junior University Methods and devices for imaging and/or optogenetic control of light-responsive neurons
ES2902775T3 (es) 2017-01-30 2022-03-29 Us Gov Sec Navy Bioconjugado basado en nanopartículas modular y multifuncional para la visualización en tiempo real del potencial de la membrana celular
US11294165B2 (en) 2017-03-30 2022-04-05 The Board Of Trustees Of The Leland Stanford Junior University Modular, electro-optical device for increasing the imaging field of view using time-sequential capture
CN107118127B (zh) * 2017-06-28 2019-01-04 哈尔滨理工大学 氨基酸席夫碱及其合成方法与应用
WO2020083398A1 (zh) * 2018-10-26 2020-04-30 山东大学 细胞特异性光敏效应的实时筛查与测量系统及方法

Citations (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE43619C (de) 1887-06-25 1888-06-23 C. RAAB in Kaiserslautern Calorimetrischer Elektricitätszähler
US3480436A (en) 1966-08-29 1969-11-25 Eastman Kodak Co Antihalation compositions containing pentamethine oxonol dyes in aromatic alcohols
EP0137515A2 (en) 1983-10-13 1985-04-17 The University Of Georgia Research Foundation, Inc. Bioluminescent immunoassays
US4560665A (en) 1983-05-27 1985-12-24 Fujirebio Kabushiki Kaisha Method of measuring membrane fusion
US4861727A (en) 1986-09-08 1989-08-29 C. R. Bard, Inc. Luminescent oxygen sensor based on a lanthanide complex
US4900934A (en) 1987-07-15 1990-02-13 University Of Utah Apparatus for simultaneous visualization and measurement of fluorescence from fluorescent dye-treated cell preparations and solutions
EP0397641A2 (de) 1989-04-25 1990-11-14 AVL Medical Instruments AG Verfahren zur quantitativen Bestimmung zumindest eines chemischen Parameters eines Probenmediums
EP0429907A2 (de) 1989-11-21 1991-06-05 Bayer Ag Optischer Biosensor
EP0520262A1 (de) 1991-06-28 1992-12-30 BASF Aktiengesellschaft Chemischer Sensor
EP0552107A1 (en) 1992-01-17 1993-07-21 The University Of Maryland At Baltimore pH and pCO2, sensing by luminescent lifetimes and energy transfer
US5244813A (en) 1991-01-25 1993-09-14 Trustees Of Tufts College Fiber optic sensor, apparatus, and methods for detecting an organic analyte in a fluid or vapor sample
WO1995008637A1 (en) 1993-09-21 1995-03-30 Washington State University Research Foundation Immunoassay comprising ligand-conjugated, ion channel receptor immobilized in lipid film
WO1995027204A1 (en) 1994-03-31 1995-10-12 British Technology Group Limited Assay for determining biochemical changes at phospholipid bilayer membrane surfaces
WO1996041166A2 (en) 1995-06-07 1996-12-19 The Regents Of The University Of California Detection of transmembrane potentials by optical methods
US5763167A (en) 1992-02-12 1998-06-09 Chromagen Applications of fluorescent N-nucleosides and fluorescent structural analogs of N-nucleosides
WO1998030715A1 (en) 1997-01-07 1998-07-16 California Institute Of Technology Optical sensors of cell signaling

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU4801390A (en) * 1988-11-25 1990-06-26 Richard L. Benner Process and apparatus for the detection of sulfur

Patent Citations (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE43619C (de) 1887-06-25 1888-06-23 C. RAAB in Kaiserslautern Calorimetrischer Elektricitätszähler
US3480436A (en) 1966-08-29 1969-11-25 Eastman Kodak Co Antihalation compositions containing pentamethine oxonol dyes in aromatic alcohols
US4560665A (en) 1983-05-27 1985-12-24 Fujirebio Kabushiki Kaisha Method of measuring membrane fusion
EP0137515A2 (en) 1983-10-13 1985-04-17 The University Of Georgia Research Foundation, Inc. Bioluminescent immunoassays
US4861727A (en) 1986-09-08 1989-08-29 C. R. Bard, Inc. Luminescent oxygen sensor based on a lanthanide complex
US4900934A (en) 1987-07-15 1990-02-13 University Of Utah Apparatus for simultaneous visualization and measurement of fluorescence from fluorescent dye-treated cell preparations and solutions
EP0397641A2 (de) 1989-04-25 1990-11-14 AVL Medical Instruments AG Verfahren zur quantitativen Bestimmung zumindest eines chemischen Parameters eines Probenmediums
EP0429907A2 (de) 1989-11-21 1991-06-05 Bayer Ag Optischer Biosensor
US5244813A (en) 1991-01-25 1993-09-14 Trustees Of Tufts College Fiber optic sensor, apparatus, and methods for detecting an organic analyte in a fluid or vapor sample
EP0520262A1 (de) 1991-06-28 1992-12-30 BASF Aktiengesellschaft Chemischer Sensor
EP0552107A1 (en) 1992-01-17 1993-07-21 The University Of Maryland At Baltimore pH and pCO2, sensing by luminescent lifetimes and energy transfer
US5763167A (en) 1992-02-12 1998-06-09 Chromagen Applications of fluorescent N-nucleosides and fluorescent structural analogs of N-nucleosides
WO1995008637A1 (en) 1993-09-21 1995-03-30 Washington State University Research Foundation Immunoassay comprising ligand-conjugated, ion channel receptor immobilized in lipid film
WO1995027204A1 (en) 1994-03-31 1995-10-12 British Technology Group Limited Assay for determining biochemical changes at phospholipid bilayer membrane surfaces
WO1996041166A2 (en) 1995-06-07 1996-12-19 The Regents Of The University Of California Detection of transmembrane potentials by optical methods
US5661035A (en) * 1995-06-07 1997-08-26 The Regents Of The University Of California Voltage sensing by fluorescence resonance energy transfer
US6107066A (en) 1995-06-07 2000-08-22 The Regents Of The University Of California Detection of transmembrane potentials by optical methods
WO1998030715A1 (en) 1997-01-07 1998-07-16 California Institute Of Technology Optical sensors of cell signaling

Non-Patent Citations (19)

* Cited by examiner, † Cited by third party
Title
Alper, Seth L., et al. "Differential inhibition of AE1 and AE2 anion exchangers by oxonol dyes and by novel polyaminosterol analogs of the shark antibiotic squalamine", Biochemistry and Cell Biology (1998) 76(5):799-806.
Benniston, A., et al. HCAPLUS abstract accession No. 1994: 680062 (1994).
Cacciatore, T.W. et al, "Identification of Neural Circuits by Imaging Coherent Electrical Activity with Fret-Based Dyes," Neuron, (Cambridge, MA, US), 23:3:449-459, the whole document; XP000961663, (Jul. 1999).
Fabian, J., et al. HCAPLUS abstract accession No. 1974: 16415.
Gonzalez and Negulescu, Intracellular Detection Assays for High-Throughput Screening, Curr. Opin. Biotech. vol. 9 No. 6. 624-631, Dec. 1998.
Gonzalez, et al., Biophysical Journal, vol. 69, pp. 1272-1280 (1950).
Gonzalez, et al., Cell Based Arrays and Instrumentation For Screening Ion-Channel Targets. Drug Discovery Today, vol. 4, No. 9, Sep. 1999.
Gonzalez, J. E. et al, "Improved Indicators of Cell Membrane Potential that Use Fluorescence Resonance Energy Transfer," Chemistry and Biology, Current Biology, (London, GB), 4(4):269-277, ISSN: 1074-5521, XP000961796.
Gutierrez-Merino, et al., Biochemistry, vol. 34, pp. 4846-4855, (1995).
Kodak, HCAPLUS abstract accession No. 1960: 853 (1960).
Kohn, J., et al. "Identification and Colormetric Determination of Organic Cyanates in Nanomolar Quantities", Analytical Chemistry (1986) 58:3184-3188.
Kraayenhof, Ruud, et al. "Probing Biomembrane Interfacial Potential and pH Profiles with a New Type of Float-like Fluorophores Positioned at Varying Distance from the Membrane Surface", Biochemistry (1993) 32:10057-10068.
Leventia, Rania, et al., "Intermembrane Lipid-Mixing Assays Using Acyl Chain-Labeled Coumarinyl Phospholipids", Methods in Enzymology (1993) 220:32-42.
Niles et al., "Resonance Energy Transfer Imaging of Phospholipid Vesicle Interaction with a Planar Phospholipid Membrane," J. Gen. Phystol. The Rockefeller University Press vol. 107 Mar. 1996 (pp. 329-351).
Rink, et al.., Biochimica et Biophysica Acta., vol. 595, pp. 15-30, (1980).
Russell, J., et al. "Optical Probe Responses on Sacroplasmic Reticulum", The Journal of Biological Chemistry (1979) 254(6):2047-2052.
Silvius, John R., et al., "Novel Fluorescent Phospholipids for Assays of Lipid Mixing Between Membranes", Biochemistry (1987) 26:4279-4287.
Wilson et al., "Lymphocyte Membrane Potential and Ca<SUP>2+</SUP>-Sensitive Potassium Channels Described by Oxonol Dye Fluorescence Measurements," Journal of Cellular Physiology 125:72-81 (1985).
Wilson et al., "Voltage-Sensitive Cyanine Dye Fluorescence Signals in Lymphocytes: Plasma Membrane and Mitochondrial Components," Journal of Cellular Physiology 125:61-71 (1985).

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100145024A1 (en) * 1996-08-16 2010-06-10 The State Of Oregon, Acting By And Through The State Board Of Higher Education On Behalf Of The Long wavelength engineered fluorescent proteins
US20080097222A1 (en) * 2006-10-24 2008-04-24 The Research Foundation Of State University Of New York Composition, method, system, and kit for optical electrophysiology
US8155730B2 (en) 2006-10-24 2012-04-10 The Research Foundation Of State University Of New York Composition, method, system, and kit for optical electrophysiology
US9636424B2 (en) 2006-10-24 2017-05-02 The Research Foundation Of State University Of New York Composition, method, system and kit for optical electrophysiology

Also Published As

Publication number Publication date
AU783487B2 (en) 2005-11-03
US7173130B2 (en) 2007-02-06
US7118899B2 (en) 2006-10-10
ATE544747T1 (de) 2012-02-15
WO2001042211A2 (en) 2001-06-14
US6342379B1 (en) 2002-01-29
AU2093001A (en) 2001-06-18
EP1409456B1 (en) 2012-02-08
EP1409456A2 (en) 2004-04-21
US20020164577A1 (en) 2002-11-07
CA2393562C (en) 2015-10-27
WO2001042211A3 (en) 2002-01-17
US20040002123A1 (en) 2004-01-01
CA2393562A1 (en) 2001-06-14
US20030207248A1 (en) 2003-11-06
JP2003518246A (ja) 2003-06-03

Similar Documents

Publication Publication Date Title
US7087416B2 (en) Detection of transmembrane potentials by optical methods
US6107066A (en) Detection of transmembrane potentials by optical methods
US7687282B2 (en) Detection of transmembrane potentials by optical methods
US8679776B2 (en) Activatable dyes
Watai et al. Regulation of nuclear import by light-induced activation of caged nuclear localization signal in living cells
AU760738B2 (en) Detection of transmembrane potentials by optical methods
CA2458360C (en) Detection of transmembrane potentials by optical methods
Gruskos Development of Ratiometric Molecular Sensors for the Visualization and Quantification of Free Mg 2+ in Subcellular Compartments, and Their Application in the Study of Mg 2+ Accumulation and Mobilization Patterns in Apoptosis
US20050226816A1 (en) Detection of transmembrane potentials using asymmetric thiobarbituric acid-derived polymethine oxonols
Srikun New Chemical Tools for Fluorescent Detection of Hydrogen Peroxide in Living Cells

Legal Events

Date Code Title Description
AS Assignment

Owner name: NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF

Free format text: CONFIRMATORY LICENSE;ASSIGNOR:UNIVERSITY OF CALIFORNIA SAN DIEGO;REEL/FRAME:022103/0656

Effective date: 20080826

FPAY Fee payment

Year of fee payment: 4

FPAY Fee payment

Year of fee payment: 8

FEPP Fee payment procedure

Free format text: MAINTENANCE FEE REMINDER MAILED (ORIGINAL EVENT CODE: REM.)

LAPS Lapse for failure to pay maintenance fees

Free format text: PATENT EXPIRED FOR FAILURE TO PAY MAINTENANCE FEES (ORIGINAL EVENT CODE: EXP.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

STCH Information on status: patent discontinuation

Free format text: PATENT EXPIRED DUE TO NONPAYMENT OF MAINTENANCE FEES UNDER 37 CFR 1.362

FP Lapsed due to failure to pay maintenance fee

Effective date: 20180808