US6649378B1 - Self-contained device integrating nucleic acid extraction, amplification and detection - Google Patents

Self-contained device integrating nucleic acid extraction, amplification and detection Download PDF

Info

Publication number
US6649378B1
US6649378B1 US09/705,043 US70504300A US6649378B1 US 6649378 B1 US6649378 B1 US 6649378B1 US 70504300 A US70504300 A US 70504300A US 6649378 B1 US6649378 B1 US 6649378B1
Authority
US
United States
Prior art keywords
nucleic acid
amplification
target
label
chamber
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Lifetime, expires
Application number
US09/705,043
Inventor
Diane L. Kozwich
John C. Gerdes
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Applied Biosystems LLC
Original Assignee
Xtrana Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US08/679,522 external-priority patent/US5955351A/en
Priority claimed from US09/061,757 external-priority patent/US6291166B1/en
Priority to US09/705,043 priority Critical patent/US6649378B1/en
Application filed by Xtrana Inc filed Critical Xtrana Inc
Priority to US10/413,433 priority patent/US20040110167A1/en
Publication of US6649378B1 publication Critical patent/US6649378B1/en
Application granted granted Critical
Assigned to APPLERA CORPORATION reassignment APPLERA CORPORATION ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: XTRANA, INC.
Assigned to BANK OF AMERICA, N.A, AS COLLATERAL AGENT reassignment BANK OF AMERICA, N.A, AS COLLATERAL AGENT SECURITY AGREEMENT Assignors: APPLIED BIOSYSTEMS, LLC
Assigned to APPLIED BIOSYSTEMS, LLC reassignment APPLIED BIOSYSTEMS, LLC MERGER Assignors: APPLIED BIOSYSTEMS INC.
Assigned to APPLIED BIOSYSTEMS INC. reassignment APPLIED BIOSYSTEMS INC. CHANGE OF NAME Assignors: APPLERA CORPORATION
Assigned to APPLIED BIOSYSTEMS, INC. reassignment APPLIED BIOSYSTEMS, INC. LIEN RELEASE Assignors: BANK OF AMERICA, N.A.
Adjusted expiration legal-status Critical
Expired - Lifetime legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/6848Nucleic acid amplification reactions characterised by the means for preventing contamination or increasing the specificity or sensitivity of an amplification reaction
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01LCHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L3/00Containers or dishes for laboratory use, e.g. laboratory glassware; Droppers
    • B01L3/50Containers for the purpose of retaining a material to be analysed, e.g. test tubes
    • B01L3/502Containers for the purpose of retaining a material to be analysed, e.g. test tubes with fluid transport, e.g. in multi-compartment structures
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01LCHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L3/00Containers or dishes for laboratory use, e.g. laboratory glassware; Droppers
    • B01L3/50Containers for the purpose of retaining a material to be analysed, e.g. test tubes
    • B01L3/508Containers for the purpose of retaining a material to be analysed, e.g. test tubes rigid containers not provided for above
    • B01L3/5082Test tubes per se
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/686Polymerase chain reaction [PCR]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/6865Promoter-based amplification, e.g. nucleic acid sequence amplification [NASBA], self-sustained sequence replication [3SR] or transcription-based amplification system [TAS]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/6867Replicase-based amplification, e.g. using Q-beta replicase
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01LCHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L2200/00Solutions for specific problems relating to chemical or physical laboratory apparatus
    • B01L2200/16Reagents, handling or storing thereof
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01LCHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L2300/00Additional constructional details
    • B01L2300/04Closures and closing means
    • B01L2300/046Function or devices integrated in the closure
    • B01L2300/047Additional chamber, reservoir
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01LCHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L2300/00Additional constructional details
    • B01L2300/04Closures and closing means
    • B01L2300/046Function or devices integrated in the closure
    • B01L2300/049Valves integrated in closure
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01LCHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L2300/00Additional constructional details
    • B01L2300/06Auxiliary integrated devices, integrated components
    • B01L2300/0681Filter
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01LCHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L2400/00Moving or stopping fluids
    • B01L2400/06Valves, specific forms thereof
    • B01L2400/0633Valves, specific forms thereof with moving parts
    • B01L2400/0644Valves, specific forms thereof with moving parts rotary valves

Definitions

  • This invention relates to the general fields of molecular biology and medical science, and specifically to a method of extracting nucleic acid, amplifying specific target sequences, and detecting amplified nucleic acid sequences in a self-contained device.
  • This application thus describes a self-contained device capable of rapid and accurate detection of target nucleic acid sequences.
  • nucleic acid probe tests based on hybridization in routine clinical laboratory procedures is hindered by lack of sensitivity.
  • the ability to amplify nucleic acids from clinical samples has greatly advanced nucleic acid probe technology, providing the sensitivity lacking in earlier versions of non-isotopic assays.
  • Sensitivity afforded by oligonucleotide probe tests utilizing nucleic acid amplification now exceeds that of any other method.
  • Nucleic acid amplification procedures can detect a single copy of a specific nucleic acid sequence. Routine detection and identification of specific gene sequences has extremely broad applications in a number of settings and industries.
  • the first step extraction of nucleic acids
  • chromatographic purification such as purification on silica membranes (WO 95/01359, specifically incorporated herein) and ultracentrifugation (Maniatis, et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. (1982) specifically incorporated herein by reference).
  • Phenol is a well-established health hazard and requires special handling for waste removal.
  • the extraction method is also tedious and labor intensive. Ultracentrifugation often requires the use of expensive and hazardous chemicals as well as the use of sophisticated and costly equipment. The process often requires long run times, sometimes involving one or more days of centrifugation. The easiest and fastest method is separation using chromatography purification.
  • the second step employs a variety of enzymes known as polymerases and ligases.
  • Polymerase chain reaction PCR is the most commonly used amplification technique.
  • the general principles and conditions for amplification of nucleic acids using PCR are quite well known in the art, the details of which are provided in numerous references including U.S. Pat. No. 4,683,195, U.S. Pat. No. 4,683,202 and U.S. Pat. No. 4,965,188, all to Mullis, et al., and all of which are specifically incorporated herein by reference. Thus, the details of PCR technology are not included herein.
  • Other approaches include ligase chain reaction, Q ⁇ replicase, strand displacement assay (SDA), transcription mediated iso CR cycling probe technology, nucleic acid sequence-based amplification (NASBA) and cascade rolling circle amplification (CRCA).
  • a current protein detection technology for antigen-antibody assays involves the use of microparticles. Furthermore, a variety of microparticle strategies for dip-stick detection in antigen-antibody assays are currently available, for example, a currently marketed at-home pregnancy test (U.S. Pat. No. 5,141,850 to Cole et al., specifically incorporated herein by reference). Such tests use dyed particles that form a visible line following a specific antigen-antibody reaction.
  • the third and final step, detection of amplified nucleic acid for clinical use relies largely on hybridization of the amplified product and detection with a probe labeled with a variety of enzymes and luminescent reagents.
  • U.S. Pat. No. 5,374,524 to Miller which is specifically incorporated herein by reference, describes a nucleic acid probe assay that combines nucleic acid amplification and solution hybridization using capture and reporter probes. These techniques require multiple reagents, several washing steps, and specialized equipment for detection of the target nucleic acid. Moreover, these techniques are labor intensive and require technicians with expertise in molecular biology.
  • nucleic acids modified with biotin U.S. Pat. No. 4,687,732 to Ward et al.; European Patent No. 063879; both of which are specifically incorporated herein by reference
  • digoxigenin European Patent No. 173251, which is specifically incorporated herein
  • other haptens U.S. Pat. No. 5,344,757 to Graf, which is specifically incorporated herein by reference, uses a nucleic acid probe containing at least one hapten as a label for hybridization with a complementary target nucleic acid bound to a solid membrane.
  • the sensitivity and specificity of these assays is based on the incorporation of a single label in the amplification reaction which can be detected using an antibody specific to the label.
  • the usual case involves an antibody conjugated to an enzyme.
  • the addition of substrate generates a colorimetric or fluorescent change which can be detected with an instrument.
  • Nucleic acid probe technology has developed rapidly in recent years as the scientific community has discovered its value for detection of various diseases, organisms or genetic abnormalities. Amplification techniques have provided the sensitivity to qualitatively determine the presence of even minute quantities of nucleic acid. The drawback to wide spread use of this technology is the possibility of cross contamination of samples since the test is so sensitive. The cost of nucleic acid based testing is high as it requires highly skilled technicians and sophisticated equipment. Automated approaches eliminate the need for specially trained personnel, however, the cost of the equipment is very high and the possibility of contamination still exists since many samples will be processed by the same equipment.
  • the present invention is applicable to all nucleic acids and derivatives thereof.
  • a self-contained device of this invention comprises a first hollow elongated cylinder with a single closed end and a plurality of chambers therein, and a second hollow elongated cylinder positioned contiguously inside the first cylinder and capable of relative rotation.
  • a sample which may contain the target nucleic acid is introduced into the second cylinder for extraction.
  • the extracted nucleic acid binds to a solid phase contained in the second cylinder, and therefore is not eluted from the solid phase by the addition of wash buffer.
  • Amplification and labeling takes place in the second cylinder.
  • the labeled, amplified product is introduced into a detection chamber in the first cylinder, where it reacts with microparticles conjugated with receptor-specific ligands for detection of the target nucleic acid.
  • the self-contained device comprises four separate chambers: an extraction chamber, a waste chamber, an amplification chamber, and a detection chamber.
  • the sample which may contain the target nucleic acid is extracted, amplified and detected in separate and sequential chambers.
  • yet another embodiment of this invention comprises a self-contained device for the extraction, amplification and detection of nucleic acid sequences, which comprises a first cylinder or PCR tube having a matrix cylinder or tube disposed contiguously therein.
  • This embodiment may have a reagent cell that is inserted on top of the matrix tube, or alternatively the reagents may be adhered directly to the interior of the matrix tube.
  • a detection result stick is inserted through an aperture into the device after the completion of the reaction or reactions.
  • the present invention provides a method of detecting nucleic acids using the self-contained devices of this invention.
  • the amplification methodologies used in the self-contained devices of this invention produce bifunctionally labeled nucleic acids comprising two different labels.
  • the amplification methodology produces non-labeled nucleic acid which hybridizes to a bifunctionally labeled probe.
  • the amplification methodology produces a singly labeled nucleic acid which hybridizes to a singly labeled probe.
  • the detection method used in the self-contained devices relies on microparticle detection technology, wherein receptors on the microparticles bind to a label on the nucleic acid or probe.
  • FIG. 1 is a perspective view of a self-contained device integrating nucleic acid extraction, amplification and detection, illustrating each of the three device rotational positions: A) closed; B) open; and C) elute.
  • FIG. 2 is a schematic of the preferred sealing mechanism, illustrating each of the three device rotational positions: A) closed; B) open; and C) elute, which are enlargements of the encircled portions of positions A, B, and C as shown in FIG. 1 .
  • FIG. 3 is a top plan view of the device shown in FIG. 1, position A along line 3 — 3 , showing the hinged cover in the open position.
  • FIG. 4 is a side cross-sectional view of the hinged cover in the closed position and the reaction bead contained within a reaction bead chamber having an integral knife-edge.
  • FIG. 5 is a top cross-sectional view of the aperture section of the second hollow elongated cylinder.
  • FIG. 6 depicts the relative position of the absorbent pad and membrane strip having microparticles and capture zones.
  • FIG. 7 depicts a sequential operating sequence of the self-contained device.
  • FIG. 8 illustrates the reagents and their respective interactions in the amplification chamber of the device in a strand displacement assay (SDA) strategy.
  • SDA strand displacement assay
  • FIG. 9 depicts reagents and their respective interactions in an alternate strand displacement assay (SDA).
  • FIG. 10 depicts the reagents and their respective interactions in a cycling probe assay.
  • FIG. 11 illustrates the detection results of isothermal amplification and detection with bifunctionally labeled amplified target sequence using strand displacement assay.
  • FIG. 12 shows the detection results of a lateral flow assay using cycling probe technology.
  • FIG. 13 shows the detection results of an alternate lateral flow assay.
  • FIG. 14 depicts a nucleic acid sequenced-based amplification (NASBA) strategy.
  • NASBA nucleic acid sequenced-based amplification
  • FIG. 15 shows the results of detection by amplification with a single labeled primer followed by hybridization with a probe containing a single label.
  • FIG. 16 depicts a side cross-sectional view of the reagent cell of an alternate embodiment of the invention, having a plurality of pouches.
  • FIG. 17 is a side cross-sectional view of the matrix tube of an alternate embodiment of the invention having a solid phase matrix sandwiched between an upper and lower screen.
  • FIG. 18 depicts a side cross-sectional view of the PCR tube of an alternate embodiment of the invention, said tube having a specially designed lid.
  • FIG. 19 is a side view of the result stick of an alternate embodiment of the invention.
  • FIG. 20 is side cross-sectional view of the alternate embodiment of the instant invention with the matrix tube inserted inside of the PCR tube with the cap in the opened position.
  • FIG. 21 is a side cross-sectional view of the alternate embodiment of the instant invention with the matrix tube inserted within the PCR tube and the cap in the closed position, and a top plan view of the lid of the alternate embodiment of the invention.
  • FIG. 22 is a side cross-sectional view of the alternate embodiment of the invention, showing detection via a result stick.
  • FIG. 23 shows the results of CRCA methodology use for the detection of nucleic acid target sequences in terms of lateral flow detection strips versus gel electrophoresis.
  • the present invention provides novel self-contained devices for detecting a target nucleic acid sequence that is present in a sample.
  • the self-contained devices disclosed herein eliminate the possibility of cross-contamination from one sample to another by integrating nucleic acid extraction, amplification, and detection strategies in completely enclosed, disposable devices.
  • Samples may include biological samples derived from agriculture sources, bacterial and viral sources, and from human or other animal sources, as well as other samples such as waste or drinking water, agricultural products, processed foodstuff, air, etc.
  • biological samples include blood, stool, sputum, mucus, serum, urine, saliva, teardrop, tissues such as biopsy samples, histological tissue samples, and tissue culture products, agricultural products, waste or drinking water, foodstuff, air, etc.
  • the present invention is useful for the detection of specific nucleic acid sequences corresponding to certain diseases or conditions such as genetic defects, as well as monitoring efficacy in the treatment of contagious diseases, but is not intended to be limited to these uses.
  • target nucleic acid molecule refers to the nucleic acid molecule that may be amplified or non-amplified for use with the presented methods.
  • the “target” molecule can be purified, partially purified, or present in an unpurified state in the sample.
  • amplification refers to a “template-dependent process” that results in an increase in the concentration of a nucleic acid sequence relative to its initial concentration.
  • Preferred amplification methodologies for use in this invention include polymerase chain reaction (PCR), and isothermal reactions such as NASBA (U.S. Pat. No. 5,130,238, specifically incorporated herein) or strand displacement assay (SDA) (Walker, et al., PNAS 89:392, (1992) which is specifically incorporated herein by reference).
  • a “template-dependent process” is defined as a process that involves the “template-dependent extension” of a “primer” molecule.
  • a “primer” molecule refers to a sequence of nucleic acid that is complementary to a portion of the target or control sequence and may or may not be labeled with a hapten.
  • a “template dependent extension” refers to nucleic acid synthesis of RNA or DNA wherein the sequence of the newly synthesized strand of nucleic acid is dictated by the rules of complementary base pairing of the target nucleic acid and the primers.
  • a self-contained device of this invention comprises a plurality of separate, sequential chambers, for example, an extraction chamber, a waste chamber, an amplification chamber, and a detection chamber, wherein a sample which may contain the target nucleic acid to be detected is extracted, amplified and detected in separate and sequential chambers.
  • a sample containing target nucleic acid and control nucleic acid is introduced into an extraction chamber for extraction of nucleic acid.
  • the extraction chamber incorporates a nucleic acid extraction/solid phase nucleic acid binding protocol providing a rapid method of nucleic acid purification.
  • the preferred extraction method makes use of chaotropic agents such as guanidine thiocyanate (GuSCN) to disrupt the cell membranes and extract the nucleic acid. Proteins are degraded by proteinases. The extracted nucleic acid binds to a solid phase membrane in the extraction chamber. The design of a fitting between the solid phase membrane and a seal located directly below the solid phase prevents waste from entering the amplification chamber.
  • chaotropic agents such as guanidine thiocyanate (GuSCN)
  • a supply assembly unit locks onto the top of a processor assembly unit by connecting a first and a second fitting.
  • the first of four plungers is depressed. Air in a compartment forces the extraction mixture past the solid phase membrane binding the nucleic acid. The filtrate is collected in a waste chamber. Depression of a second plunger forces a wash buffer stored in a wash buffer compartment across the solid phase membrane and filtrate passes to the waste chamber. The seal located directly below the solid phase membrane is disposed at an angle to aid in efficient collection of the waste. Depression of a third plunger forces air stored in a compartment across the solid phase membrane, insuring that all of the wash buffer is removed.
  • the processor assembly unit twists, simultaneously breaking the seal and closing off a waste chamber conduit. Depression of a fourth plunger delivers an elution buffer stored in a compartment for elution of the nucleic acid from the solid phase and delivers a volume of nucleic acid into an amplification chamber.
  • the amplification chamber contains the reagents for amplification and hybridization.
  • reagents for amplification and hybridization are in separate chambers.
  • the amplification/hybridization process is characterized in that the sample is treated, after extraction, with two distinct labeled oligonucleotides primers.
  • the sequence of the first primer is complementary to a partial sequence of the target nucleic acid and is labeled with hapten, for example, biotin.
  • the sequence of the second primer is complementary to a partial sequence of the control nucleic acid and labeled with a second hapten, for example, digoxigenin.
  • Either primer may contain a promoter region.
  • amplification results in hapten labeled target nucleic acid sequences and hapten control nucleic acid sequences.
  • the labeled, amplified nucleic acid sequences hybridize to oligonucleotides which are conjugated to microparticles of suitable color and diameter for detection.
  • the microparticles are conjugated either with an oligonucleotide specific for binding a nucleic acid sequence on the target or with an oligonucleotide specific for binding a nucleic acid sequence on the control nucleic acid.
  • the resulting microparticles, bound by hybridization to the amplicons are detected in the detection chamber.
  • FIG. 1 One embodiment of a self-contained device of the present invention, generally illustrated in FIG. 1, comprises a first hollow elongated cylinder with a single closed end and a plurality of chambers therein, and a second hollow elongated cylinder positioned contiguously inside the first cylinder and capable of relative rotation.
  • the extraction and amplification of nucleic acids take place in the second cylinder (the reaction chamber) of the self-contained device
  • detection takes place in a detection chamber of the first cylinder
  • collection of waste occurs in a waste chamber of the first cylinder.
  • the chambers of the self-contained device of FIG. 1 are functionally distinct, sequential and compact. The chambers deliver precise volumes, dispense reagents and collect waste. All of the steps of nucleic acid extraction, amplification and detection occur in the completely self-contained device with simple, fool-proof directions for use as described below.
  • one embodiment of a self-contained device of this invention comprises a first hollow elongated cylinder 1 having one closed end and an integrally-molded cover 3 hinged to the opposing, opened end, and a second hollow elongated cylinder 2 that is positioned contiguously inside the first cylinder 1 and is capable of relative rotation.
  • the preferred embodiment of the second cylinder 2 is a tapered cylinder terminating with an aperture 13 having a sealing lip 15 as shown in FIG. 2 .
  • the first cylinder 1 further consists of two chambers: a reservoir or waste chamber 16 and a detection chamber 20 , the detection chamber further comprising a pad 9 and a strip 10 .
  • the first hollow elongated cylinder 1 contains the detection chamber 20 having a means for detection and reservoir 16 for collecting the lysis buffer used in the extraction process and other buffers used in subsequent washes.
  • the second cylinder 2 rotates relative to the first cylinder 1 and locks into position A, position B or position C.
  • an aperture 13 having a sealing lip 15 enables the second cylinder 2 to engage with either the detection chamber 20 or reservoir 16 of the first cylinder 1 .
  • the hinged cover 3 has one indexing pin 6 (shown in FIG. 1, position A) used for locking the second cylinder 2 in positions A, B and C.
  • the second cylinder 2 contains three notches 7 , 7 ′ and 7 ′′ for indexing with the indexing pin 6 and locking the relative rotation of cylinders 1 and 2 .
  • the second cylinder 2 is closed to the reservoir 16 in the closed position A.
  • the second cylinder 2 In position A, the second cylinder 2 is sealed, allowing for the extraction step and the amplification step to take place.
  • the method of using the self-contained device of FIG. 1 will be discussed with respect to amplification methods that produce bifunctionally labeled, amplified nucleic acids.
  • other amplification methods such as those that produce singly-labeled nucleic acids or unlabeled nucleic acids, may be used in the self-contained device of FIG. 1, as discussed below in detail.
  • the amplification produces a bifunctionally labeled target nucleic acid having a hapten A on one end and a hapten B on the other end of the amplified target nucleic acid.
  • Amplification also produces a bifunctionally labeled control nucleic acid having a hapten C on one end and a hapten D on the other end.
  • open position B the second cylinder 2 is such that the opening 13 in the second cylinder 2 is not sealed and is over the reservoir 16 .
  • open position B the second cylinder 2 allows flow to the reservoir 16 .
  • elute position C the second cylinder 2 is rotated such that the second cylinder 2 is not sealed and the opening 13 is over an absorbent pad 9 located in the detection chamber 20 .
  • amplified nucleic acid target and control are able to wick into the detection chamber 20 .
  • the absorbent pad 9 collects the amplified product and wicks the product onto a strip 10 of nylon, nitrocellulose or other suitable material.
  • the strip 10 contains colored microparticles 24 and capture zones 25 and 26 for the target and the control sequences, respectively (FIG. 6 ).
  • the detection chamber 20 contains a transparent viewing window 21 for observing the results of the reaction.
  • FIG. 2 which shows enlargements of the encircled portions of FIG. 1, illustrates the preferred embodiment of the sealing mechanism of the self-contained device of FIG. 1 .
  • closed position A the second cylinder 2 is sealed by a sealing lip 15 at the bottom of cylinder 2 .
  • the sealing lip 15 is composed of a flexible material that can be compressed when in contact with a solid surface 17 (FIG. 3) at the top of the first cylinder 1 .
  • FIG. 5 shows enlargements of the encircled portions of FIG. 1 .
  • the sealing lip 15 is extended beyond the plane of compression and allows fluid to flow into the reservoir 16 .
  • the second cylinder 2 can also be rotated relative to the first cylinder 1 into elute position C. In this position, the sealing lip 15 is again extended beyond the plane of compression and allows amplified nucleic acid and control nucleic acid to wick onto an absorbent pad 9 and a strip 10 of membrane used for the detection step.
  • FIG. 3 A top plan view of the self-contained device of FIG. 1 and the hinged cover 3 in the open position is illustrated in FIG. 3 .
  • the index pin 6 is located on the hinged cover 3 .
  • Three index notches 7 , 7 ′, and 7 ′′ are located on the second cylinder 2 .
  • the hinged cover 3 contains a reaction bead 11 within a reaction bead chamber 12 (FIG. 4 ). This bead 11 contains the reaction enzymes and other reagents required for the amplification step.
  • the hinged cover 3 may also contain a knife-edge 18 , which when sufficient pressure is applied punctures a foil membrane 19 (FIG. 4 ), releasing the reaction bead 11 into the second cylinder 2 .
  • FIG. 5 A cross-section of the bottom of the second cylinder 2 is illustrated in FIG. 5 .
  • the sealing lip 15 contains a solid phase 22 (e.g., a porous membrane) that binds the extracted nucleic acids or a solid phase 22 that holds a silica slurry (not shown) in the second cylinder 2 .
  • a solid phase 22 e.g., a porous membrane
  • detection takes place in detection chamber 20 .
  • the detection method is a lateral flow assay.
  • the specific reagents in the detection chamber will depend on the type of amplified product produced, that is whether the amplification produces a bifunctionally labeled, singly labeled, or unlabeled nucleic acid.
  • detection chamber 20 of the first cylinder 1 contains a pad 9 and a strip 10 .
  • FIG. 6 illustrates strip 10 containing a region with immobilized colored microparticles 24 and two capture zones 25 and 26 .
  • the microparticles 24 are coated either with a receptor A′ that is specific to hapten A the target nucleic acid, or with a receptor C′ that is specific to hapten C on the control nucleic acid.
  • the target sequence capture zone 25 contains receptors B′ that are specific for hapten B on the target sequence
  • control sequence capture zone 26 contains receptors D′ that are specific for hapten D on the control sequence.
  • FIG. 7 depicts the sequence of steps for the extraction, amplification and detection of nucleic acid sequences using the embodiment of the self-contained device illustrated in FIG. 1 .
  • a sample containing a control nucleic acid and the target nucleic acid to be detected is introduced into the second cylinder 2 .
  • second cylinder 2 has a capacity of 0.001 to 25 mL.
  • the second cylinder 2 contains dry lysing reagents for extraction of nucleic acids.
  • the sample provides the liquid that resuspends the lysing reagents.
  • the second cylinder 2 is rotated into open position B.
  • the extracted nucleic acid remains bound to the solid phase 22 or the silica slurry (not shown) in the second cylinder 2 , while the liquid flows into the reservoir 16 .
  • open position B several washes with buffer or water follow.
  • the second cylinder 2 is rotated into closed position A 3 such that the second cylinder 2 is sealed.
  • Water is added to the second cylinder 2 and the hinged cover 3 is closed (position A 4 ).
  • foil membrane 19 is punctured by knife-edge 18 (FIG. 4 ), and the reaction bead 11 is released from the reaction bead chamber 12 into the second cylinder 2 .
  • the reaction bead 11 carries the enzymes necessary for amplification, which are resuspended in the water. Amplification takes place on the solid phase 22 (FIG.
  • silica slurry (not shown) containing the bound, extracted nucleic acids and produces bifunctionally labeled amplified target nucleic acid labeled with haptens A and B, and bifunctionally labeled control nucleic acid labeled with haptens C and D.
  • the second cylinder 2 is rotated relative to the first cylinder 1 into elute position C.
  • the amplification reaction mixture is able to enter the detection chamber 20 as it is absorbed onto the pad 9 .
  • the pad 9 absorbs a sufficient amount of liquid, the reaction mixture is wicked onto the membrane strip 10 .
  • receptors A′ on colored microparticles 24 bind to haptens A on the amplified target, and receptors C′ on microparticles 24 bind to haptens C on the control nucleic acids, and microparticle-bound nucleic acids travel to the capture zones 24 and 25 on the membrane strip 10 .
  • the target capture zone 25 contains receptors B′ specific for haptens B on the target sequence
  • control capture zone 26 contains receptors D′ specific for haptens D on the control sequence.
  • a visible line of detection forms at capture zone 25 if the target sequence is present and at capture zone 24 for the control sequence. The lines of detection are viewed from the transparent viewing window 21 (FIG. 1 ).
  • the bulk of the device shown in FIG. 1 is composed of a material that does not facilitate binding of nucleic acids and proteins.
  • the preferred material is heat and cold resistant material which is light weight, rigid and sturdy.
  • the preferred size is compact enough to fit into conventional size heat blocks, however, the size may be scaled up or down, accordingly.
  • the self-contained device of FIG. 1 is inserted into a constant temperature environment such as a heat block, allowing the reactions to proceed at the preferred conditions of constant temperature.
  • Self-contained device comprising a matrix tube
  • FIG. 20 Yet another embodiment of a self-contained device of the invention is illustrated in FIG. 20 and includes a self-contained integrated particle assay device for use with polymerase chain reaction (PCR).
  • This embodiment is defined by a matrix tube 37 (FIG. 17 ), a PCR tube 43 (FIG. 18 ), a reagent or reagents 29 which may be contained in a reagent cell 27 (FIG. 16 ), and a result stick 46 (FIG. 19 ).
  • the reagent cell 27 (FIG. 16) is further defined by two pouches or chambers: a first pouch 30 containing liquid 28 such as water or other appropriate diluent, and a second pouch containing lyophilized PCR reagents 29 .
  • the second pouch may contain a lyophilized reagent bead or beads.
  • PCR reagents 29 include, for example, specific primers for target nucleic acid and control nucleic acid, enzymes, stabilizers, and buffers useful for PCR amplification of target and control molecules. At least two of the target specific primers are labeled with distinct haptens A and B, and at least two of the primers for the control nucleic acid sequence are labeled with distinct haptens C and D. These haptens are incorporated into the target and control amplification products—bifunctional haptenization—during the amplification reaction.
  • matrix tube 37 (FIG. 17) comprises an upper screen 34 and lower screen 35 between which a solid phase matrix 36 specific for nucleic acid binding is sandwiched.
  • the solid phase matrix 36 is directly adhered or bound directly to the interior wall of the matrix tube.
  • the solid phase matrix 36 comprises, for example, aluminum oxide or silicon dioxide.
  • the top of the matrix tube 37 may snap fit with a mating and locking connection mechanism, such as a Luer-lock type.
  • the matrix tube 37 is constructed from any material suitable for facilitating thermo-regulation and fluid transfer, such as thin wall or porous plastic.
  • the general shape of matrix tube 37 is that of what is generally known as either a PCR or Eppendorf tube, i.e., a conical-shaped tube having a closing top portion and configured in size such that it is able to be contiguously disposed within the PCR tube 43 of the instant device.
  • the PCR tube 43 is a tube generally accepted in the art as a PCR tube and further contains a foil, plastic, rubber or other elastomer patch 47 disposed on the interior of its lid 48 .
  • This patch 47 seals the area through which the result stick 46 (FIG. 19) passes upon its introduction therethrough, after the PCR reaction is complete.
  • the lid 48 may contain a sharp knife-like piercing feature 118 able to pierce all three of the foil seals 31 , 32 , and 33 of the reagent cell 27 (FIGS. 16 and 20 ), thus resuspending the reagents 29 in the liquid 28 .
  • the PCR tube 43 further contains a locking and/or sealing means 38 within lid 48 that, in turn, seals the entry aperture created upon introduction of the result stick 46 into to the PCR tube 43 .
  • the locking or sealing means may include foil, plastic, rubber or other elastomer.
  • the result stick 46 consists of an elongated transparent body 41 , for example plastic or polycarbonate, having a top portion intended for handling the result stick 46 and a bottom portion intended for detection.
  • a snap fit type seal 42 locks the result stick 46 into the PCR tube 43 .
  • an absorbent sample pad 39 Moving from the bottom to top portion of the result stick 46 , there is disposed thereon an absorbent sample pad 39 , a solid phase matrix 58 , for example a porous membrane, and a waste pad 40 , respectively.
  • the absorbent sample pad 39 is comprised of any generally accepted material suitable for lateral flow and dip stick type assays.
  • the pad 39 is fabricated to contain microparticles conjugated with a receptor specific for hapten A, as well as microparticles conjugated with a receptor specific for hapten C.
  • the microparticles may be on the porous membrane 58 itself.
  • the porous membrane 58 further carries a control indicator line 44 and a sample detection indicator line 45 that have been strategically applied and dried thereon.
  • the sample detection indicator line 45 consists of a receptor specific for hapten B.
  • the control detection indicator line 44 consists of a receptor specific for hapten D.
  • the operating sequence of the embodiment of the self-contained device illustrated in FIGS. 16-22 entails adding a sample containing the target nucleic acid (if present) and a control nucleic acid in lysis buffer to the matrix tube 37 directly or through a suitable vessel.
  • a suitable vessel may include, for example, a syringe that snap fits onto the matrix tube 37 via a mating and locking connection system. After denaturization, the sample passes through the matrix tube 37 into a waste area, and the target and control nucleic acids bind specifically to the solid phase matrix 36 .
  • the sample passes through the tube via, for example, gravity flow or any suitably adaptable method, such as vacuum controlled flow.
  • the matrix-bound nucleic acids are washed with suitable buffer and the matrix tube 37 is placed into the PCR tube 43 (FIG. 20 ).
  • the reagent cell 27 is inserted into the PCR tube 43 as illustrated in FIG. 20 .
  • the foil seals 31 , 32 (not shown) and 33 of reaction cell 27 are pierced, thus causing reagent 29 (not shown) to be resuspended in liquid 28 (not shown).
  • the liquid resuspension drops to the bottom of the matrix tube 37 and PCR tube 43 as shown by arrow 50 in FIG. 21 and enters the solid phase matrix 36 .
  • Reaction volume is calculated to be sufficient such that the solid phase matrix 36 lies below the meniscus created by the reaction reagents.
  • the PCR tube 43 (FIG. 21) containing the matrix tube 37 , resuspended reagents 29 and nucleic acid bound to the solid phase matrix 36 is then inserted into a thermocycler for amplification of the target and control sequences.
  • the amplification produces bifunctionally labeled target nucleic acids labeled with haptens A and B, and bifunctionally labeled control nucleic acids labeled with haptens C and D.
  • the device Upon completion of the PCR event, the device is removed from the thermocycler and the result stick 46 is inserted into the PCR tube 43 through the foil patch 47 in the lid 48 (FIG. 22 ).
  • the absorbent sample pad 39 of the result stick 46 comes into contact with the aqueous reaction mixture containing amplified target nucleic acid (if target was present in the sample) and amplified control nucleic acid. The mixture soaks into or wicks up the absorbent sample pad 39 where the microparticles coated with either receptors A′ or C′ bind to their respective haptens.
  • microparticles coated with receptors A′ bind to haptens A on target nucleic acids
  • microparticles coated with receptors C′ bind to haptens C on control nucleic acids.
  • the reaction mixture and the nucleic acid-bound microparticles wick up the porous membrane 58 via capillary flow toward the control and sample detection indicator lines 44 and 45 , respectively. Wicking is facilitated by the presence of the waste pad 40 .
  • hapten B on the microparticle-bound target nucleic acid binds to a receptor B′ contained in the target detection indicator line 45 , forming a visible line of detection.
  • haptens D on the microparticle-bound control sequences bind to receptors D′ contained in the control detection indicator line 44 , forming a visible line.
  • the detection results are viewed through the transparent body 41 of the result stick 46 .
  • the preferred microparticles utilized in this invention are composed of polymeric materials such as latex, polyethylene, polypropylene, poly(methyl methacrylate) or polystyrene.
  • the preferred microparticle in the present invention is composed of latex containing a colored dye.
  • a variety of other synthetic or natural materials may also be used in the preparation of the microparticles, for example, silicates, paramagnetic particles and colloidal gold.
  • the usual form of microparticles possesses surface sulfate charge groups that can be modified by the introduction of functional groups such as hydroxyl, carboxyl, amine and carboxylate groups. The functional groups are used to bind a wide variety of ligands and receptors to the microparticles.
  • These groups are selected on the basis of their ability to facilitate binding with the selected member of the ligand-receptor pair.
  • Conjugation of the receptors to the microparticle is accomplished by covalent binding or, in appropriate cases, by adsorption of the receptor onto the surface of the microparticle. Techniques for the adsorption or covalent binding of receptors to microparticles are well know in the art and require no further explanation. The preferred method of attachment of the receptor to the microparticles is covalent binding.
  • microparticle-bound receptors are specific for discrete haptens located on the ends of amplified, labeled nucleic acid sequences.
  • the receptors must be capable of binding to their specific binding partner (hapten).
  • the size of the microparticles used in this invention is selected to optimize the binding and detection of the labeled amplified nucleic acids (amplicons).
  • Microparticles are available in a size range of 0.01 to 10.0 ⁇ m in diameter and preferably 0.01 to 1.0 ⁇ m in diameter, specifically not excluding the use of either larger or smaller microparticles as appropriately determined.
  • the microparticles are activated with a suitable receptor for binding to the target ligand.
  • the microparticles are anti-digoxigenin Fab-coated microparticles.
  • 0.25 to 1.0 mg/mL of anti-digoxigenin Fab is incubated with a suspension containing a final concentration of 1.0% microparticles/mL.
  • the microparticles and digoxigenin Fab are allowed to react for 15 minutes prior to treatment with an activating agent such as EDAC (1-ethyl-3-(3-dimethylaminopropyl) carbodiimide) for covalent binding.
  • EDAC electroactive acid
  • the microparticles are treated with EDAC at a final concentration of 0.0 to 2.5 mM.
  • the Fab and microparticles are mixed and incubated at room temperature for one hour. Unbound Fab is removed by successive washes and the coated microparticles are resuspended in storage buffer.
  • the present invention employs a variety of different enzymes, such as polymerases and ligases, to accomplish amplification of target nucleic acid sequences.
  • Polymerases are defined by their function of incorporating nucleoside triphosphates to extend a 3′ hydroxyl terminus of a “primer molecule.”
  • a “primer” is an oligonucleotide that, when hybridized to a target nucleic acid molecule, possesses a 3′ hydroxyl terminus that can be extended by a polymerase and a hapten label at or near the 5′ terminus.
  • polymerases that can be used in accordance with the methods described herein include, but are not limited to, E. coli DNA polymerase I, which is the large proteolytic fragment of E. coli polymerase I and is commonly known as “Klenow” polymerase, Taq-polymerase, T7 polymerase, T4 polymerase, T5 polymerase and reverse transcriptase.
  • E. coli DNA polymerase I which is the large proteolytic fragment of E. coli polymerase I and is commonly known as “Klenow” polymerase
  • Taq-polymerase Taq-polymerase
  • T7 polymerase T4 polymerase
  • T5 polymerase T5 polymerase
  • reverse transcriptase reverse transcriptase
  • the preferred amplification methodologies for use in the self-contained devices of this invention include isothermal reactions such as nucleic acid sequence-based assay (NASBA) disclosed in U.S. Pat. No. 5,130,238, which is specifically incorporated herein, and strand displacement assay (SDA) disclosed by Walker, et al., PNAS 89:392 (1992), which is specifically incorporated herein by reference.
  • NASBA nucleic acid sequence-based assay
  • SDA strand displacement assay
  • Walker, et al., PNAS 89:392 (1992) which is specifically incorporated herein by reference.
  • Another amplification methodology for use in this invention includes polymerase chain reaction (PCR).
  • a positive control a control nucleic acid with primer recognition sequences attached to a totally irrelevant nucleic acid sequence—is incorporated in the amplification step.
  • This positive control primer is a component of the nucleic acid extraction reagents, thus controlling for sample extraction and delivery as well as detecting amplification failure.
  • the preferred embodiment of the positive control is a lambda DNA sequence. The control nucleic acid is extracted and amplified along with the target nucleic acid and is detected by a line of immobile, coated microparticles on the detection membrane.
  • the target oligonucleotide primer and the control oligonucleotide primer used in the amplification steps of this invention contain at least one hapten as a label which does not participate in the priming reaction.
  • the hapten is bound to at least one position of the nucleic acid primer.
  • various methods can be employed. See, Sambrook supra.
  • the incorporation of the hapten can take place enzymatically, chemically or photochemically.
  • the hapten can be derivatized directly to the 5′ end of the primer or contain a bridge 1 to 30 atoms long. In the preferred embodiment, the bridge is linear.
  • the bridge consists of a branched chain with a hapten molecule on at least one of the chain ends.
  • a hapten molecule on at least one of the chain ends.
  • the preferred haptens for the present invention are biotin and digoxigenin, however, other haptens having a receptor as specific binding agent available are suitable, for example, steroids, halogens and 2,4-dinitrophenyl.
  • the self-contained devices disclosed herein provide for extremely rapid, economical nucleic acid detection. Further, the self-contained devices significantly reduces the risk of cross contamination in that neither amplification reagents nor amplicons are manipulated. Elimination of cross contamination opens the door to mass screening including automation.
  • the self-contained devices of the present invention can be used in the diagnoses of infectious diseases of genetic, bacterial or viral origin.
  • the high sensitivity of analysis using the self-contained devices of this invention allows for the early detection of disease and an opportunity for early treatment.
  • Analysis by this invention may monitor the efficacy of treatment, for example, to monitor HIV virus in the plasma of patients undergoing therapy.
  • the low complexity of the device lends itself to “point of care” testing in clinics and physician's offices.
  • the portability of the device provides for “on site” analysis to detect nucleic acid sequences in the areas of forensics, agriculture, environment and the food industry.
  • the cost of nucleic acid analysis using the self-contained devices of this invention is significantly less than other methods currently in use to detect amplified nucleic acids.
  • the time frame for detecting an amplified sequence is reduced drastically. There is no danger from potentially hazardous chemicals.
  • the analysis does not require special waste disposal procedures. The requirements of many washes in an immunometric or hybridization approach are eliminated.
  • the self-contained device does not require special equipment, other than a standard, constant temperature heat block.
  • NASBA nucleic acid sequence-based assay
  • the primary product of the NASBA reaction is single strand RNA.
  • the NASBA reaction utilizes a primer containing a T7 polymerase promoter. Following T7 transcription, up to 100 copies of target RNA are produced. These copies are the same sequence as the original target RNA. They serve as templates, thus starting the cycle again and resulting in up to a billion fold amplification of the original template.
  • NASBA In order to incorporate NASBA into the devices disclosed herein, probes that allow the formation of a bifunctionally haptenized amplification product have been designed.
  • NASBA there are two possible strategies: 1) design amplification primers that are haptenized; and 2) use two haptenized capture oligonucleotides which bind to the product RNA.
  • the model system chosen is to the HIV POL gene.
  • the first strategy using NASBA haptenization i.e., the design of amplification primers that are haptenized, is illustrated in FIG. 14, steps A-D.
  • a T7 NASFAM haptenization primer containing a T7 transcriptase promoter and an attached fluorescein, binds to the target RNA (FIG. 14, step A).
  • a reverse transcriptase transcribes a DNA copy of the RNA, as illustrated in step B of FIG. 14 .
  • the original RNA strand is digested by RNase H.
  • a reverse haptenization primer, P2 NASBIO with attached biotin binds to the antisense DNA (FIG. 14, step C) and is extended by the DNA polymerase activity of the reverse transcriptase.
  • the haptenized primers are as follows:
  • T7 NASFAM T7-promoter primer
  • step D of FIG. 14 The resulting double-stranded bi-haptenized DNA intermediate, containing a biotin label at one end and a fluorescein label at the other end, is illustrated in step D of FIG. 14 .
  • This complex gives signal in lateral flow or slide agglutination assays.
  • the second strategy for using NASBA in this invention i.e., the use of two haptenized oligonucleotides which bind to the product RNA, is illustrated in FIG. 14, steps E-F.
  • T7 RNA polymerase binds to the promoter region (step E) to manufacture many copies of a minus-sense RNA, as shown in steps E and F of FIG. 14 .
  • This RNA contributes to the manufacture of the DNA intermediate by similar means.
  • Two capture oligonucleotides, each having one hapten of either fluorescein or biotin bind to the minus-sense RNAs (FIG. 14, step F) giving bifunctional haptenized complexes. These complexes give signal in lateral flow or slide agglutination.
  • the haptenized capture oligonucleotides, designed to bind to the minus-sense RNA product are:
  • the instant strand displacement assay is another example of an isothermal amplification methodology that can be detected in the self-contained devices of this invention by using microparticles and bifunctionally labeled product.
  • SDA technology is described in U.S. Pat. No. 5,455,166 which is specifically incorporated herein.
  • SDA is isothermal amplification based on the ability of a restriction enzyme to nick the unmodified strand of a hemiphosphorothioate from its recognition site and the ability of DNA polymerase to initiate replication at the nick and displace the downstream non-template strand.
  • Primers containing recognition sites for the nicking restriction enzyme bind to opposite strands of target DNA at positions flanking the sequence to be amplified.
  • the target fragment is exponentially amplified by coupling sense and antisense reactions in which strands displaced from the sense reaction serve as a target for the antisense reaction and vice versa.
  • the reaction is set up per the thermophilic Strand Displacement Amplification (tSDA) protocol developed by Becton Dickinson and Co.
  • the target organism is Mycobacterium tuberculosis.
  • tSDA thermophilic Strand Displacement Amplification
  • an artificial target template consisting of the 91 nt sequence of the M. tuberculosis genome, defined by the Becton Dickinson outer (bumper) primers, is used.
  • Amplification conditions used are identical to those used by Becton Dickinson for tSDA.
  • the membrane used for this procedure is nitrocellulose, purchased from Millipore Corporation, Bedford, Mass.
  • a stripe of streptavidin at a concentration of 1 mg/mL is applied at a rate of 1 ⁇ L/cm via a linear reagent striper (IVEK Corporation, No. Springfield, Vt.) 1 cm from the bottom edge of the membrane.
  • the membrane is allowed to dry and then blocked for non-specific binding by 0.5% casein in 100 mM Tris, pH 7.4.
  • the membrane is washed twice with water (ddH 2 O) and allowed to dry.
  • 3 ⁇ L of anti-S1 extension primer (complementary to S1 without the biotin label) and/or S2 extension primer (complementary to S2 without the dig or fam label) is spotted onto a second membrane.
  • the second membrane is then sandwiched onto the first membrane in order to capture free primers that compete with the product for the microparticles or streptavidin capture zone.
  • coated microparticles are prepared as described above by incubating either anti-digoxigenin Fab or anti-fam monoclonal IgG with a suspension of microparticles.
  • the coated microparticles are diluted 1:2 with a 35% sucrose solution, and 3 ⁇ L or the solution is applied directly to the membrane and dried.
  • the bifunctionally labeled reaction product (10 ⁇ L) is added to 45 ⁇ l SDA buffer, then applied (50 ⁇ L) to the previously striped membrane.
  • Application of the sample requires the bifunctionally labeled product and the competing primers to pass through the anti-primer coated membrane and the dried microparticles.
  • the target When the target is present, there is a visible line on the membrane. When the target is not present, there is absence of a visible line.
  • the results of one such experiment are shown in FIG. 11 .
  • Cycling probe technology involves a nucleic acid probe that incorporates DNA-RNA-DNA sequences designed to hybridize with the target sequences. See, for example, FIG. 10 .
  • the probe is bifunctionally labeled with biotin and fam. If the probe hybridizes with the target generating double stranded nucleic acid, RNase H in the reaction buffer cleaves the probe. This cleavage results in loss of signal when applied to a membrane containing a capture zone of streptavidin and anti-fam coated colored microparticles. If the target is not present, there is a visible line on the membrane.
  • the specific probe and target employed in the instant example have been designed by ID Biomedical Corporation for use in detecting Mycobacterium tuberculosis.
  • the probe (SEQ ID NO: 10) is a chimeric construct containing both DNA and RNA sequences with labels on the 5′ (fam) and the 3′ (biotin) ends of the DNA portion of the probe.
  • the binding of the probe to a single strand of target generates double stranded nucleic acid which is cleaved with RNase H, thus eliminating the bifunctionality of the probe.
  • the sequence of the probe is described below:
  • the reaction is completed following the protocol provided by ID Biomedical Corporation.
  • the membrane used for this procedure is nitrocellulose, purchased from Millipore Corporation, Bedford, Mass.
  • a stripe of streptavidin at a concentration of 1 mg/mL is applied at a rate of 1 ⁇ L/cm via a linear reagent striper (IVEK Corporation, No. Springfield, Vt.) 1 cm from the bottom edge of the membrane.
  • the membrane is allowed to dry and then blocked for non-specific binding by 0.5% casein in 100 mM Tris, pH 7.4.
  • the membrane is washed twice with water (ddH 2 O) and allowed to dry.
  • the microparticles used are anti-fam coated microparticles prepared as described above using anti-fam monoclonal IgG.
  • the reaction product (10 ⁇ L) is added to 5 ⁇ l of 0.1% anti-fam coated microparticles (0.1%) and 35 ⁇ L of water, then applied (50 ⁇ L) to the previously striped membrane.
  • the target is present, the absence of a visible line on the membrane exists.
  • the bifunctionally labeled probe is able to bind the anti-fam coated microparticles and the streptavidin bound to the membrane, resulting in a visible line.
  • the results of one such experiment are shown in FIG. 12 .
  • the membrane used for this procedure is nitrocellulose, purchased from Millipore Corporation, Bedford, Mass.
  • a stripe of streptavidin at a concentration of 1 mg/ml is applied at a rate of 1 ⁇ L/cm via a linear reagent striper (IVEK Corporation, No. Springfield, Vt.) 1 cm from the bottom edge of the membrane.
  • the membrane is allowed to dry and then blocked for non-specific binding by 0.5% casein in 100 mM Tris, pH 7.4.
  • the membrane is washed twice with water (ddH 2 O) and allowed to dry.
  • the amplification product is added to the membrane with colored receptor coated beads at dilutions of 0.001-1.0% microparticles/mL. This mixture is allowed to wick up the membrane. Positive reactions result in a colored line where the capture material is applied. Amplification reactions without the target sequence added to the reaction serve as negative controls. The results of this lateral flow assay are illustrated in FIG. 13 .
  • the receptor-bound microparticles interact with hapten(s) to capture the amplified nucleic acid.
  • the result is a line of dyed particles visible on the membrane for the target and a line for the control nucleic acids. If the target is not present, the dyed particles for the target are not captured and are not visible.
  • the control nucleic acid sequences must be visible indicating that the extraction and amplification were performed correctly.
  • the target nucleic acid sequence is amplified by PCR using 200-1000 mM primer concentration, GeneAmp EZ rTth RNA PCR kit (Perkin Elmer Corp., Alameda, Calif.) and 10 6 copies/mL of the target HIV RNA sequence. Forty PCR cycles, each cycle being 60° C. for 15 minutes, 95° C. for 15 seconds, and 55° C. for 60 seconds, are run.
  • sequences of the primers are as follows:
  • the SK38 Dig—SK39 amplicon (5 ⁇ l) is incubated with 5 ⁇ L of 25 ⁇ M (125 pmol) SK39 biotin at 95° C. for 1 minute, and then at 55° C. for 1 minute.
  • the amplicon binds to the anti-digoxigenin-coated microparticles and wicks through the membrane to the streptavidin line where it is captured by the interaction of biotin and streptavidin. The result is a visible line of colored microparticles.
  • a column was constructed using Ansys 0.4 mm membrane as a filter to contain the silicon dioxide and a syringe apparatus to pull buffer through the column in approximately 15 seconds.
  • 50 ⁇ l serum, 2 ⁇ l SiO 2 (0.5 mg/ml), and 450 ⁇ l guanidine thiocyanate (GuSCN) lysis buffer are mixed by vortexing and then incubated at room temperature for 10 minutes.
  • the specific lysis buffer for the instant set of experiments contains 14.71 g GuSCN (4M final), 0.6 ml TRITON X-100TM, 5.5 ml 0.2 M EDTA pH 8.0 and is q.s. to 31.11 mL with 0.1M Tris-HCl to pH 6.4.
  • the silicon dioxide is washed twice with 500 ul 70% EtOH.
  • the filter with SiO 2 is removed from the column and the SiO 2 is washed off of the membrane using 20 ⁇ L water (ddH 2 O). 5 ⁇ L of the silicon dioxide slurry is added to a PCR reaction using standard protocol for HIV model system, as detailed supra in Example 5.
  • CRCA cascade rolling circle amplification
  • labeled primers for detection of target nucleic acid sequences
  • FIG. 23 The target sequence was amplified 6 individual times at 10 minute increments. That is, amplification was performed for 10, 20, 30, 40, 50 and 60 minutes, respectively.
  • FIG. 23 shows that the results of agarose gel electrophoresis show no visible results except for the target that was amplified for 60 minutes.
  • Lateral flow chromatography detection strips demonstrate visual detection after 40 minutes of target amplification and a strong visual signal for both the 50 and 60 minute amplifications.
  • the instant invention provides a rapid, simple and accurate method of detecting amplified target nucleic acid sequences with a self-contained device. Sensitivity and specificity of the assay are based on labeling of the target, by incorporating a label or by subsequent hybridization of a labeled probe during the amplification process. The method does not require costly and sophisticated equipment or specially trained personnel, nor does it pose any health hazard.
  • DNA artificial sequence primer 1 aattctaata cgactcacta tagggtgcta tgtcacttcc ccttggttct ct 52 2 29 DNA artificial sequence primer 2 agtgggggga catcaagcag ccatgcaaa 29 3 20 DNA artificial sequence capture probe 3 tggcctggtg caataggccc 20 4 20 DNA artificial sequence capture probe 4 cccattctgc agcttcctca 20 5 15 DNA artificial sequence primer 5 cgatcgagca agcca 15 6 15 DNA Artificial Sequence primer 6 cgagccgctc gctga 15 7 40 DNA artificial sequence primer 7 accgcatcga atgcatgtct cgggtaaggc gtactcgacc 40 8 40 DNA artificial sequence primer 8 cgattccgct ccagacttct cgggtgtact gagatccc

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Zoology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Genetics & Genomics (AREA)
  • Hematology (AREA)
  • Clinical Laboratory Science (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Apparatus Associated With Microorganisms And Enzymes (AREA)
  • Investigating Or Analysing Biological Materials (AREA)

Abstract

Self-contained devices are described that integrate nucleic acid extraction, specific target amplification and detection into a single device. This integration permits rapid and accurate nucleic acid sequence detection. The invention may be used, for example, in the screening for nucleic acid sequences which may be indicative of genetic defects or contagious diseases, as well as for monitoring efficacy in the treatment of contagious diseases.

Description

RELATED APPLICATIONS
This application is a Continuation of U.S. patent application Ser. No. 09/141,401, filed Aug. 27, 1998, now issued as U.S. Pat. No. 6,153,425, which is a Continuation-in-Part of U.S. patent application Ser. No. 08/679,522, filed Jul. 12, 1996, now issued as U.S. Pat. No. 5,955,351, which claims priority to Provisional Patent Application Serial No. 60/000,885, filed Jul. 13, 1995, now abandoned; this application is also a Continuation-in-Part of U.S. patent application Ser. No. 09/061,757, filed Apr. 16, 1998, which claims priority to Provisional Patent Application Serial No. 60/041,999, filed Apr. 16, 1997, now abandoned. Applicants hereby claim the earliest filing date, Jul. 13, 1995, for the instant application.
BACKGROUND OF THE INVENTION
1. Field of the Invention
This invention relates to the general fields of molecular biology and medical science, and specifically to a method of extracting nucleic acid, amplifying specific target sequences, and detecting amplified nucleic acid sequences in a self-contained device. This application thus describes a self-contained device capable of rapid and accurate detection of target nucleic acid sequences.
2. Description of the State of the Art
The use of nucleic acid probe tests based on hybridization in routine clinical laboratory procedures is hindered by lack of sensitivity. The ability to amplify nucleic acids from clinical samples has greatly advanced nucleic acid probe technology, providing the sensitivity lacking in earlier versions of non-isotopic assays. Sensitivity afforded by oligonucleotide probe tests utilizing nucleic acid amplification now exceeds that of any other method. Nucleic acid amplification procedures can detect a single copy of a specific nucleic acid sequence. Routine detection and identification of specific gene sequences has extremely broad applications in a number of settings and industries.
The major barrier for the transfer of technology to routine field testing is the absence of an economical and easy-to-use system or apparatus. In order to compete in today's cost conscious environment, genetic based testing must provide for high throughput while incorporating adequate controls and safeguards to prevent false positive results due to sample cross-contamination.
Current technology involves several steps, although recent developments are directed toward automating systems for detection of the amplified target sequence. The first step, extraction of nucleic acids, is accomplished in a variety of ways, for example, phenol extraction, chaotropic reagent extraction, chromatographic purification such as purification on silica membranes (WO 95/01359, specifically incorporated herein) and ultracentrifugation (Maniatis, et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. (1982) specifically incorporated herein by reference). Phenol is a well-established health hazard and requires special handling for waste removal. The extraction method is also tedious and labor intensive. Ultracentrifugation often requires the use of expensive and hazardous chemicals as well as the use of sophisticated and costly equipment. The process often requires long run times, sometimes involving one or more days of centrifugation. The easiest and fastest method is separation using chromatography purification.
The second step, the amplification of the target nucleic acid, employs a variety of enzymes known as polymerases and ligases. Polymerase chain reaction (PCR) is the most commonly used amplification technique. The general principles and conditions for amplification of nucleic acids using PCR are quite well known in the art, the details of which are provided in numerous references including U.S. Pat. No. 4,683,195, U.S. Pat. No. 4,683,202 and U.S. Pat. No. 4,965,188, all to Mullis, et al., and all of which are specifically incorporated herein by reference. Thus, the details of PCR technology are not included herein. Other approaches include ligase chain reaction, Qβ replicase, strand displacement assay (SDA), transcription mediated iso CR cycling probe technology, nucleic acid sequence-based amplification (NASBA) and cascade rolling circle amplification (CRCA).
A current protein detection technology for antigen-antibody assays involves the use of microparticles. Furthermore, a variety of microparticle strategies for dip-stick detection in antigen-antibody assays are currently available, for example, a currently marketed at-home pregnancy test (U.S. Pat. No. 5,141,850 to Cole et al., specifically incorporated herein by reference). Such tests use dyed particles that form a visible line following a specific antigen-antibody reaction.
The third and final step, detection of amplified nucleic acid for clinical use relies largely on hybridization of the amplified product and detection with a probe labeled with a variety of enzymes and luminescent reagents. U.S. Pat. No. 5,374,524 to Miller, which is specifically incorporated herein by reference, describes a nucleic acid probe assay that combines nucleic acid amplification and solution hybridization using capture and reporter probes. These techniques require multiple reagents, several washing steps, and specialized equipment for detection of the target nucleic acid. Moreover, these techniques are labor intensive and require technicians with expertise in molecular biology.
The use of probes comprised of oligonucleotide sequences bound to microparticles is well known and illustrated in the prior art. The mechanism for attachment of oligonucleotides to microparticles in hybridization assays and for the purification of nucleic acids is also well known. European Patent No. 200133, which is specifically incorporated herein, describes the attachment of oligonucleotides to water-insoluble particles less than 50 micrometers in diameter used in hybridization assays for the capture of target nucleotides. U.S. Pat. No. 5,387,512 to Wu, which is specifically incorporated herein by reference, describes the use of oligonucleotide sequences covalently bound to microparticles as probes for capturing PCR amplified nucleic acids. U.S. Pat. No. 5,328,825 to Findlay, which is specifically incorporated herein by reference, also describes an oligonucleotide linked by way of a protein or carbohydrate to a water-insoluble particle. The oligonucleotide probe is covalently coupled to the microparticle or other solid support. The sensitivity and specificity of all of the above-reference patents is based on hybridization of the oligonucleotide probe to the target nucleic acid.
The use of incorporated non-radioactive labels into amplification reactions for the detection of nucleic acids is also well known in the art. Nucleic acids modified with biotin (U.S. Pat. No. 4,687,732 to Ward et al.; European Patent No. 063879; both of which are specifically incorporated herein by reference), digoxigenin (European Patent No. 173251, which is specifically incorporated herein) and other haptens have also been used. For example, U.S. Pat. No. 5,344,757 to Graf, which is specifically incorporated herein by reference, uses a nucleic acid probe containing at least one hapten as a label for hybridization with a complementary target nucleic acid bound to a solid membrane. The sensitivity and specificity of these assays is based on the incorporation of a single label in the amplification reaction which can be detected using an antibody specific to the label. The usual case involves an antibody conjugated to an enzyme. Furthermore, the addition of substrate generates a colorimetric or fluorescent change which can be detected with an instrument.
Still, the above-described approaches are labor intensive with many steps and washes; require special and costly equipment for the detection of the target nucleic acid; require trained staff; and take several hours to complete. Several patents have issued which deal with automation of the processes of amplification and subsequent detection of the amplicon. These patents use specialized equipment and are still based on the principle of hybridization and immunoassay technology. For example, European Patent No. 320308, which is specifically incorporated herein by reference, describes a system detecting target nucleic acids amplified by the ligase chain reaction.
Nucleic acid probe technology has developed rapidly in recent years as the scientific community has discovered its value for detection of various diseases, organisms or genetic abnormalities. Amplification techniques have provided the sensitivity to qualitatively determine the presence of even minute quantities of nucleic acid. The drawback to wide spread use of this technology is the possibility of cross contamination of samples since the test is so sensitive. The cost of nucleic acid based testing is high as it requires highly skilled technicians and sophisticated equipment. Automated approaches eliminate the need for specially trained personnel, however, the cost of the equipment is very high and the possibility of contamination still exists since many samples will be processed by the same equipment.
There is still a need, therefore, for a method and device which provides for the rapid and accurate detection of amplified nucleic acid sequences which significantly decreases the possibility of cross-contamination of samples while further being both simple and economical to use.
SUMMARY OF THE INVENTION
It is an object of the present invention to provide novel, self-contained devices that integrate nucleic acid extraction, specific target amplification and detection methodologies into a single device, permitting rapid and accurate nucleic acid sequence detection. The present invention is applicable to all nucleic acids and derivatives thereof.
It is a further object of the present invention to provide methods of detecting nucleic acids using the self-contained devices of this invention.
To achieve the foregoing and other objects and in accordance with the purposes of the present invention, as embodied and broadly described therein, one embodiment of a self-contained device of this invention comprises a first hollow elongated cylinder with a single closed end and a plurality of chambers therein, and a second hollow elongated cylinder positioned contiguously inside the first cylinder and capable of relative rotation. A sample which may contain the target nucleic acid is introduced into the second cylinder for extraction. The extracted nucleic acid binds to a solid phase contained in the second cylinder, and therefore is not eluted from the solid phase by the addition of wash buffer. Amplification and labeling takes place in the second cylinder. Finally, the labeled, amplified product is introduced into a detection chamber in the first cylinder, where it reacts with microparticles conjugated with receptor-specific ligands for detection of the target nucleic acid.
To further achieve the foregoing, and in accordance with the purposes of the present invention, as embodied and broadly described therein, another embodiment of the invention, the self-contained device comprises four separate chambers: an extraction chamber, a waste chamber, an amplification chamber, and a detection chamber. In this embodiment, the sample which may contain the target nucleic acid is extracted, amplified and detected in separate and sequential chambers.
To further achieve the foregoing, and in accordance with the purposes of the present invention, as embodied and broadly described therein, yet another embodiment of this invention comprises a self-contained device for the extraction, amplification and detection of nucleic acid sequences, which comprises a first cylinder or PCR tube having a matrix cylinder or tube disposed contiguously therein. This embodiment may have a reagent cell that is inserted on top of the matrix tube, or alternatively the reagents may be adhered directly to the interior of the matrix tube. A detection result stick is inserted through an aperture into the device after the completion of the reaction or reactions.
To further achieve the foregoing, and in accordance with the purposes of the present invention, as embodied and broadly described therein, the present invention provides a method of detecting nucleic acids using the self-contained devices of this invention. In one embodiment, the amplification methodologies used in the self-contained devices of this invention produce bifunctionally labeled nucleic acids comprising two different labels. In another embodiment, the amplification methodology produces non-labeled nucleic acid which hybridizes to a bifunctionally labeled probe. In yet another embodiment, the amplification methodology produces a singly labeled nucleic acid which hybridizes to a singly labeled probe. The detection method used in the self-contained devices relies on microparticle detection technology, wherein receptors on the microparticles bind to a label on the nucleic acid or probe.
Other features and advantages of the present invention will become apparent from the following detailed description, taken in conjunction with the accompanying figures, that illustrate by way of example, the principles of the instant invention.
BRIEF DESCRIPTION OF THE FIGURES
The file of this patent contains at least one drawing executed in color. Copies of this patent with color drawings will be provided by the Patent and Trademark Office upon request and payment of the necessary fee.
FIG. 1 is a perspective view of a self-contained device integrating nucleic acid extraction, amplification and detection, illustrating each of the three device rotational positions: A) closed; B) open; and C) elute.
FIG. 2 is a schematic of the preferred sealing mechanism, illustrating each of the three device rotational positions: A) closed; B) open; and C) elute, which are enlargements of the encircled portions of positions A, B, and C as shown in FIG. 1.
FIG. 3 is a top plan view of the device shown in FIG. 1, position A along line 33, showing the hinged cover in the open position.
FIG. 4 is a side cross-sectional view of the hinged cover in the closed position and the reaction bead contained within a reaction bead chamber having an integral knife-edge.
FIG. 5 is a top cross-sectional view of the aperture section of the second hollow elongated cylinder.
FIG. 6 depicts the relative position of the absorbent pad and membrane strip having microparticles and capture zones.
FIG. 7 depicts a sequential operating sequence of the self-contained device.
FIG. 8 illustrates the reagents and their respective interactions in the amplification chamber of the device in a strand displacement assay (SDA) strategy.
FIG. 9 depicts reagents and their respective interactions in an alternate strand displacement assay (SDA).
FIG. 10 depicts the reagents and their respective interactions in a cycling probe assay.
FIG. 11 illustrates the detection results of isothermal amplification and detection with bifunctionally labeled amplified target sequence using strand displacement assay.
FIG. 12 shows the detection results of a lateral flow assay using cycling probe technology.
FIG. 13 shows the detection results of an alternate lateral flow assay.
FIG. 14 depicts a nucleic acid sequenced-based amplification (NASBA) strategy.
FIG. 15 shows the results of detection by amplification with a single labeled primer followed by hybridization with a probe containing a single label.
FIG. 16 depicts a side cross-sectional view of the reagent cell of an alternate embodiment of the invention, having a plurality of pouches.
FIG. 17 is a side cross-sectional view of the matrix tube of an alternate embodiment of the invention having a solid phase matrix sandwiched between an upper and lower screen.
FIG. 18 depicts a side cross-sectional view of the PCR tube of an alternate embodiment of the invention, said tube having a specially designed lid.
FIG. 19 is a side view of the result stick of an alternate embodiment of the invention.
FIG. 20 is side cross-sectional view of the alternate embodiment of the instant invention with the matrix tube inserted inside of the PCR tube with the cap in the opened position.
FIG. 21 is a side cross-sectional view of the alternate embodiment of the instant invention with the matrix tube inserted within the PCR tube and the cap in the closed position, and a top plan view of the lid of the alternate embodiment of the invention.
FIG. 22 is a side cross-sectional view of the alternate embodiment of the invention, showing detection via a result stick.
FIG. 23 shows the results of CRCA methodology use for the detection of nucleic acid target sequences in terms of lateral flow detection strips versus gel electrophoresis.
REFERENCE NUMERALS IN DRAWINGS
 1 First hollow elongated cylinder
 2 Second hollow elongated cylinder
 6 Index pin
 7 Index notch
7′ Index notch
 7″ Index notch
 9 Absorbent pad
10 Membrane Strip
11 Reaction bead
12 Reaction bead chamber
13 Aperture
15 Sealing lip
16 Reservoir
17 Solid surface
18 Knife-edge
19 Foil or foil/polymer membrane
20 Detection chamber
21 Transparent viewing window
22 Solid phase
24 Colored microparticles
25 Capture zone for target sequence
26 Capture zone for control sequence
27 Reagent cell
28 Pouch
29 Reagent
30 Liquid
31 Upper seal
32 Middle seal
33 Lower Seal
34 Upper screen
35 Lower screen
36 Solid phase matrix
37 Matrix tube
38 Locking/sealing means
39 Absorbent sample pad
40 Waste pad
41 Transparent body
42 Seal
43 PCR tube
44 Control indicator
45 Detection indicator
46 Result stick
47 Foil patch
48 Cap
50 Arrow
58 Porous membrane
118  Knife edge
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT
The present invention provides novel self-contained devices for detecting a target nucleic acid sequence that is present in a sample. The self-contained devices disclosed herein eliminate the possibility of cross-contamination from one sample to another by integrating nucleic acid extraction, amplification, and detection strategies in completely enclosed, disposable devices.
It will be recognized by those skilled in the art that assays for a broad range of target nucleic acid sequences that may be present in a sample may be performed in accordance with the present invention. Samples may include biological samples derived from agriculture sources, bacterial and viral sources, and from human or other animal sources, as well as other samples such as waste or drinking water, agricultural products, processed foodstuff, air, etc. Examples of biological samples include blood, stool, sputum, mucus, serum, urine, saliva, teardrop, tissues such as biopsy samples, histological tissue samples, and tissue culture products, agricultural products, waste or drinking water, foodstuff, air, etc. The present invention is useful for the detection of specific nucleic acid sequences corresponding to certain diseases or conditions such as genetic defects, as well as monitoring efficacy in the treatment of contagious diseases, but is not intended to be limited to these uses.
The following definitions will be helpful in understanding the specification and claims. The definitions provided herein should be borne in mind when these terms are used in the following examples and throughout the instant application.
As used herein, the term “target” nucleic acid molecule refers to the nucleic acid molecule that may be amplified or non-amplified for use with the presented methods. The “target” molecule can be purified, partially purified, or present in an unpurified state in the sample.
As used in this invention, the term “amplification” refers to a “template-dependent process” that results in an increase in the concentration of a nucleic acid sequence relative to its initial concentration. Preferred amplification methodologies for use in this invention include polymerase chain reaction (PCR), and isothermal reactions such as NASBA (U.S. Pat. No. 5,130,238, specifically incorporated herein) or strand displacement assay (SDA) (Walker, et al., PNAS 89:392, (1992) which is specifically incorporated herein by reference).
A “template-dependent process” is defined as a process that involves the “template-dependent extension” of a “primer” molecule. A “primer” molecule refers to a sequence of nucleic acid that is complementary to a portion of the target or control sequence and may or may not be labeled with a hapten. A “template dependent extension” refers to nucleic acid synthesis of RNA or DNA wherein the sequence of the newly synthesized strand of nucleic acid is dictated by the rules of complementary base pairing of the target nucleic acid and the primers.
In general, a self-contained device of this invention comprises a plurality of separate, sequential chambers, for example, an extraction chamber, a waste chamber, an amplification chamber, and a detection chamber, wherein a sample which may contain the target nucleic acid to be detected is extracted, amplified and detected in separate and sequential chambers. To use a multi-chambered self-contained device of this invention, a sample containing target nucleic acid and control nucleic acid is introduced into an extraction chamber for extraction of nucleic acid. The extraction chamber incorporates a nucleic acid extraction/solid phase nucleic acid binding protocol providing a rapid method of nucleic acid purification. The preferred extraction method makes use of chaotropic agents such as guanidine thiocyanate (GuSCN) to disrupt the cell membranes and extract the nucleic acid. Proteins are degraded by proteinases. The extracted nucleic acid binds to a solid phase membrane in the extraction chamber. The design of a fitting between the solid phase membrane and a seal located directly below the solid phase prevents waste from entering the amplification chamber.
In one embodiment, after the sample has been added to the extraction chamber, a supply assembly unit locks onto the top of a processor assembly unit by connecting a first and a second fitting. Following a 10-15 minute incubation allowing for nucleic acid extraction, the first of four plungers is depressed. Air in a compartment forces the extraction mixture past the solid phase membrane binding the nucleic acid. The filtrate is collected in a waste chamber. Depression of a second plunger forces a wash buffer stored in a wash buffer compartment across the solid phase membrane and filtrate passes to the waste chamber. The seal located directly below the solid phase membrane is disposed at an angle to aid in efficient collection of the waste. Depression of a third plunger forces air stored in a compartment across the solid phase membrane, insuring that all of the wash buffer is removed. The processor assembly unit twists, simultaneously breaking the seal and closing off a waste chamber conduit. Depression of a fourth plunger delivers an elution buffer stored in a compartment for elution of the nucleic acid from the solid phase and delivers a volume of nucleic acid into an amplification chamber.
The amplification chamber contains the reagents for amplification and hybridization. In an alternative embodiment, reagents for amplification and hybridization are in separate chambers. The amplification/hybridization process is characterized in that the sample is treated, after extraction, with two distinct labeled oligonucleotides primers. The sequence of the first primer is complementary to a partial sequence of the target nucleic acid and is labeled with hapten, for example, biotin. The sequence of the second primer is complementary to a partial sequence of the control nucleic acid and labeled with a second hapten, for example, digoxigenin. Either primer may contain a promoter region. Subjecting the mixture to amplification, preferably isothermal amplification, results in hapten labeled target nucleic acid sequences and hapten control nucleic acid sequences. The labeled, amplified nucleic acid sequences hybridize to oligonucleotides which are conjugated to microparticles of suitable color and diameter for detection. The microparticles are conjugated either with an oligonucleotide specific for binding a nucleic acid sequence on the target or with an oligonucleotide specific for binding a nucleic acid sequence on the control nucleic acid. The resulting microparticles, bound by hybridization to the amplicons, are detected in the detection chamber.
1. Three-chambered self-contained device
One embodiment of a self-contained device of the present invention, generally illustrated in FIG. 1, comprises a first hollow elongated cylinder with a single closed end and a plurality of chambers therein, and a second hollow elongated cylinder positioned contiguously inside the first cylinder and capable of relative rotation. In this embodiment, the extraction and amplification of nucleic acids take place in the second cylinder (the reaction chamber) of the self-contained device, detection takes place in a detection chamber of the first cylinder, and collection of waste occurs in a waste chamber of the first cylinder. The chambers of the self-contained device of FIG. 1 are functionally distinct, sequential and compact. The chambers deliver precise volumes, dispense reagents and collect waste. All of the steps of nucleic acid extraction, amplification and detection occur in the completely self-contained device with simple, fool-proof directions for use as described below.
With continued reference to FIG. 1, one embodiment of a self-contained device of this invention comprises a first hollow elongated cylinder 1 having one closed end and an integrally-molded cover 3 hinged to the opposing, opened end, and a second hollow elongated cylinder 2 that is positioned contiguously inside the first cylinder 1 and is capable of relative rotation. The preferred embodiment of the second cylinder 2 is a tapered cylinder terminating with an aperture 13 having a sealing lip 15 as shown in FIG. 2. The first cylinder 1 further consists of two chambers: a reservoir or waste chamber 16 and a detection chamber 20, the detection chamber further comprising a pad 9 and a strip 10. When sample is introduced into the device, nucleic acid extraction and amplification takes place in the second cylinder 2. The first hollow elongated cylinder 1 contains the detection chamber 20 having a means for detection and reservoir 16 for collecting the lysis buffer used in the extraction process and other buffers used in subsequent washes.
The second cylinder 2 rotates relative to the first cylinder 1 and locks into position A, position B or position C. At the tapered end of the second cylinder 2, an aperture 13 having a sealing lip 15 enables the second cylinder 2 to engage with either the detection chamber 20 or reservoir 16 of the first cylinder 1. The hinged cover 3 has one indexing pin 6 (shown in FIG. 1, position A) used for locking the second cylinder 2 in positions A, B and C. The second cylinder 2 contains three notches 7, 7′ and 7″ for indexing with the indexing pin 6 and locking the relative rotation of cylinders 1 and 2. The second cylinder 2 is closed to the reservoir 16 in the closed position A. In position A, the second cylinder 2 is sealed, allowing for the extraction step and the amplification step to take place. For purposes of illustration only, the method of using the self-contained device of FIG. 1 will be discussed with respect to amplification methods that produce bifunctionally labeled, amplified nucleic acids. However, it will be understood that other amplification methods, such as those that produce singly-labeled nucleic acids or unlabeled nucleic acids, may be used in the self-contained device of FIG. 1, as discussed below in detail. Thus, in one embodiment, the amplification produces a bifunctionally labeled target nucleic acid having a hapten A on one end and a hapten B on the other end of the amplified target nucleic acid. Amplification also produces a bifunctionally labeled control nucleic acid having a hapten C on one end and a hapten D on the other end.
In open position B, the second cylinder 2 is such that the opening 13 in the second cylinder 2 is not sealed and is over the reservoir 16. In open position B, the second cylinder 2 allows flow to the reservoir 16.
In elute position C, the second cylinder 2 is rotated such that the second cylinder 2 is not sealed and the opening 13 is over an absorbent pad 9 located in the detection chamber 20. In elute position C, amplified nucleic acid target and control are able to wick into the detection chamber 20. The absorbent pad 9 collects the amplified product and wicks the product onto a strip 10 of nylon, nitrocellulose or other suitable material. The strip 10 contains colored microparticles 24 and capture zones 25 and 26 for the target and the control sequences, respectively (FIG. 6). The detection chamber 20 contains a transparent viewing window 21 for observing the results of the reaction.
FIG. 2, which shows enlargements of the encircled portions of FIG. 1, illustrates the preferred embodiment of the sealing mechanism of the self-contained device of FIG. 1. In closed position A, the second cylinder 2 is sealed by a sealing lip 15 at the bottom of cylinder 2. The sealing lip 15 is composed of a flexible material that can be compressed when in contact with a solid surface 17 (FIG. 3) at the top of the first cylinder 1. With continued reference to FIG. 2, in open position B, rotation of the second cylinder 2 relative to the first cylinder 1 allows the contents of the second cylinder 2 to flow into the reservoir 16 through a solid phase 22 (FIG. 5), for example a porous membrane, in the bottom of the second cylinder 2. In this position, the sealing lip 15 is extended beyond the plane of compression and allows fluid to flow into the reservoir 16. The second cylinder 2 can also be rotated relative to the first cylinder 1 into elute position C. In this position, the sealing lip 15 is again extended beyond the plane of compression and allows amplified nucleic acid and control nucleic acid to wick onto an absorbent pad 9 and a strip 10 of membrane used for the detection step.
A top plan view of the self-contained device of FIG. 1 and the hinged cover 3 in the open position is illustrated in FIG. 3. The index pin 6 is located on the hinged cover 3. Three index notches 7, 7′, and 7″ are located on the second cylinder 2. The hinged cover 3 contains a reaction bead 11 within a reaction bead chamber 12 (FIG. 4). This bead 11 contains the reaction enzymes and other reagents required for the amplification step. The hinged cover 3 may also contain a knife-edge 18, which when sufficient pressure is applied punctures a foil membrane 19 (FIG. 4), releasing the reaction bead 11 into the second cylinder 2.
A cross-section of the bottom of the second cylinder 2 is illustrated in FIG. 5. The sealing lip 15 contains a solid phase 22 (e.g., a porous membrane) that binds the extracted nucleic acids or a solid phase 22 that holds a silica slurry (not shown) in the second cylinder 2.
As stated above, detection takes place in detection chamber 20. Preferably the detection method is a lateral flow assay. The specific reagents in the detection chamber will depend on the type of amplified product produced, that is whether the amplification produces a bifunctionally labeled, singly labeled, or unlabeled nucleic acid. In one embodiment, detection chamber 20 of the first cylinder 1 contains a pad 9 and a strip 10. FIG. 6 illustrates strip 10 containing a region with immobilized colored microparticles 24 and two capture zones 25 and 26. In this embodiment, the microparticles 24 are coated either with a receptor A′ that is specific to hapten A the target nucleic acid, or with a receptor C′ that is specific to hapten C on the control nucleic acid. Additionally, the target sequence capture zone 25 contains receptors B′ that are specific for hapten B on the target sequence, and control sequence capture zone 26 contains receptors D′ that are specific for hapten D on the control sequence.
FIG. 7 depicts the sequence of steps for the extraction, amplification and detection of nucleic acid sequences using the embodiment of the self-contained device illustrated in FIG. 1. In the closed position A1, a sample containing a control nucleic acid and the target nucleic acid to be detected (if present) is introduced into the second cylinder 2. Preferably, second cylinder 2 has a capacity of 0.001 to 25 mL. The second cylinder 2 contains dry lysing reagents for extraction of nucleic acids. The sample provides the liquid that resuspends the lysing reagents. After a brief incubation period with the cover 3 closed (position A2), the second cylinder 2 is rotated into open position B. The extracted nucleic acid remains bound to the solid phase 22 or the silica slurry (not shown) in the second cylinder 2, while the liquid flows into the reservoir 16. In open position B, several washes with buffer or water follow.
Next, the second cylinder 2 is rotated into closed position A3 such that the second cylinder 2 is sealed. Water is added to the second cylinder 2 and the hinged cover 3 is closed (position A4). When sufficient pressure is applied to the hinged cover 3 as shown in position A4, foil membrane 19 is punctured by knife-edge 18 (FIG. 4), and the reaction bead 11 is released from the reaction bead chamber 12 into the second cylinder 2. The reaction bead 11 carries the enzymes necessary for amplification, which are resuspended in the water. Amplification takes place on the solid phase 22 (FIG. 5) or silica slurry (not shown) containing the bound, extracted nucleic acids and produces bifunctionally labeled amplified target nucleic acid labeled with haptens A and B, and bifunctionally labeled control nucleic acid labeled with haptens C and D.
After an appropriate incubation period, the second cylinder 2 is rotated relative to the first cylinder 1 into elute position C. The amplification reaction mixture is able to enter the detection chamber 20 as it is absorbed onto the pad 9. When the pad 9 absorbs a sufficient amount of liquid, the reaction mixture is wicked onto the membrane strip 10. On the membrane strip 10, receptors A′ on colored microparticles 24 bind to haptens A on the amplified target, and receptors C′ on microparticles 24 bind to haptens C on the control nucleic acids, and microparticle-bound nucleic acids travel to the capture zones 24 and 25 on the membrane strip 10. The target capture zone 25 contains receptors B′ specific for haptens B on the target sequence, and control capture zone 26 contains receptors D′ specific for haptens D on the control sequence. A visible line of detection forms at capture zone 25 if the target sequence is present and at capture zone 24 for the control sequence. The lines of detection are viewed from the transparent viewing window 21 (FIG. 1).
The bulk of the device shown in FIG. 1 is composed of a material that does not facilitate binding of nucleic acids and proteins. The preferred material is heat and cold resistant material which is light weight, rigid and sturdy. The preferred size is compact enough to fit into conventional size heat blocks, however, the size may be scaled up or down, accordingly. In a preferred embodiment, the self-contained device of FIG. 1 is inserted into a constant temperature environment such as a heat block, allowing the reactions to proceed at the preferred conditions of constant temperature.
2. Self-contained device comprising a matrix tube
Yet another embodiment of a self-contained device of the invention is illustrated in FIG. 20 and includes a self-contained integrated particle assay device for use with polymerase chain reaction (PCR). This embodiment is defined by a matrix tube 37 (FIG. 17), a PCR tube 43 (FIG. 18), a reagent or reagents 29 which may be contained in a reagent cell 27 (FIG. 16), and a result stick 46 (FIG. 19). The reagent cell 27 (FIG. 16) is further defined by two pouches or chambers: a first pouch 30 containing liquid 28 such as water or other appropriate diluent, and a second pouch containing lyophilized PCR reagents 29. Alternatively, the second pouch may contain a lyophilized reagent bead or beads. Three foil seals, an upper 31, middle 32 and a lower 33 (FIG. 16), are disposed and positioned within the reagent cell 27 such that they separate and contain the liquid 28 and the PCR reagents 29.
PCR reagents 29 include, for example, specific primers for target nucleic acid and control nucleic acid, enzymes, stabilizers, and buffers useful for PCR amplification of target and control molecules. At least two of the target specific primers are labeled with distinct haptens A and B, and at least two of the primers for the control nucleic acid sequence are labeled with distinct haptens C and D. These haptens are incorporated into the target and control amplification products—bifunctional haptenization—during the amplification reaction.
In one embodiment of the self-contained device of FIG. 20, matrix tube 37 (FIG. 17) comprises an upper screen 34 and lower screen 35 between which a solid phase matrix 36 specific for nucleic acid binding is sandwiched. In an alternate embodiment (not shown) of the self-contained device of FIG. 20, the solid phase matrix 36 is directly adhered or bound directly to the interior wall of the matrix tube. Thus, it is not a necessary or defining facet of the instant invention that the solid phase matrix 36 be sandwiched between an upper screen 34 and a lower screen 35 as shown in FIG. 17. The solid phase matrix 36 comprises, for example, aluminum oxide or silicon dioxide. The top of the matrix tube 37 may snap fit with a mating and locking connection mechanism, such as a Luer-lock type. The matrix tube 37 is constructed from any material suitable for facilitating thermo-regulation and fluid transfer, such as thin wall or porous plastic. The general shape of matrix tube 37 is that of what is generally known as either a PCR or Eppendorf tube, i.e., a conical-shaped tube having a closing top portion and configured in size such that it is able to be contiguously disposed within the PCR tube 43 of the instant device.
Moving now to FIG. 18, the PCR tube 43 is a tube generally accepted in the art as a PCR tube and further contains a foil, plastic, rubber or other elastomer patch 47 disposed on the interior of its lid 48. This patch 47 seals the area through which the result stick 46 (FIG. 19) passes upon its introduction therethrough, after the PCR reaction is complete. The lid 48 may contain a sharp knife-like piercing feature 118 able to pierce all three of the foil seals 31, 32, and 33 of the reagent cell 27 (FIGS. 16 and 20), thus resuspending the reagents 29 in the liquid 28. The PCR tube 43 further contains a locking and/or sealing means 38 within lid 48 that, in turn, seals the entry aperture created upon introduction of the result stick 46 into to the PCR tube 43. For example, the locking or sealing means may include foil, plastic, rubber or other elastomer.
Referring now to FIG. 19, the result stick 46 consists of an elongated transparent body 41, for example plastic or polycarbonate, having a top portion intended for handling the result stick 46 and a bottom portion intended for detection. A snap fit type seal 42 locks the result stick 46 into the PCR tube 43. Moving from the bottom to top portion of the result stick 46, there is disposed thereon an absorbent sample pad 39, a solid phase matrix 58, for example a porous membrane, and a waste pad 40, respectively. The absorbent sample pad 39 is comprised of any generally accepted material suitable for lateral flow and dip stick type assays. The pad 39 is fabricated to contain microparticles conjugated with a receptor specific for hapten A, as well as microparticles conjugated with a receptor specific for hapten C. Alternatively, the microparticles may be on the porous membrane 58 itself. The porous membrane 58 further carries a control indicator line 44 and a sample detection indicator line 45 that have been strategically applied and dried thereon. The sample detection indicator line 45 consists of a receptor specific for hapten B. The control detection indicator line 44 consists of a receptor specific for hapten D.
The operating sequence of the embodiment of the self-contained device illustrated in FIGS. 16-22 entails adding a sample containing the target nucleic acid (if present) and a control nucleic acid in lysis buffer to the matrix tube 37 directly or through a suitable vessel. A suitable vessel may include, for example, a syringe that snap fits onto the matrix tube 37 via a mating and locking connection system. After denaturization, the sample passes through the matrix tube 37 into a waste area, and the target and control nucleic acids bind specifically to the solid phase matrix 36. The sample passes through the tube via, for example, gravity flow or any suitably adaptable method, such as vacuum controlled flow. Next, the matrix-bound nucleic acids are washed with suitable buffer and the matrix tube 37 is placed into the PCR tube 43 (FIG. 20). The reagent cell 27 is inserted into the PCR tube 43 as illustrated in FIG. 20. By pushing firmly on the cap 48 of the PCR tube 43 the foil seals 31, 32 (not shown) and 33 of reaction cell 27 are pierced, thus causing reagent 29 (not shown) to be resuspended in liquid 28 (not shown). The liquid resuspension drops to the bottom of the matrix tube 37 and PCR tube 43 as shown by arrow 50 in FIG. 21 and enters the solid phase matrix 36. Reaction volume is calculated to be sufficient such that the solid phase matrix 36 lies below the meniscus created by the reaction reagents. The PCR tube 43 (FIG. 21) containing the matrix tube 37, resuspended reagents 29 and nucleic acid bound to the solid phase matrix 36 is then inserted into a thermocycler for amplification of the target and control sequences. In one embodiment, the amplification produces bifunctionally labeled target nucleic acids labeled with haptens A and B, and bifunctionally labeled control nucleic acids labeled with haptens C and D.
Upon completion of the PCR event, the device is removed from the thermocycler and the result stick 46 is inserted into the PCR tube 43 through the foil patch 47 in the lid 48 (FIG. 22). The absorbent sample pad 39 of the result stick 46 comes into contact with the aqueous reaction mixture containing amplified target nucleic acid (if target was present in the sample) and amplified control nucleic acid. The mixture soaks into or wicks up the absorbent sample pad 39 where the microparticles coated with either receptors A′ or C′ bind to their respective haptens. That is, microparticles coated with receptors A′ bind to haptens A on target nucleic acids, and microparticles coated with receptors C′ bind to haptens C on control nucleic acids. Once the absorbent pad 39 is saturated, the reaction mixture and the nucleic acid-bound microparticles wick up the porous membrane 58 via capillary flow toward the control and sample detection indicator lines 44 and 45, respectively. Wicking is facilitated by the presence of the waste pad 40. If the target nucleic acid is present, hapten B on the microparticle-bound target nucleic acid binds to a receptor B′ contained in the target detection indicator line 45, forming a visible line of detection. Also, haptens D on the microparticle-bound control sequences bind to receptors D′ contained in the control detection indicator line 44, forming a visible line. The detection results are viewed through the transparent body 41 of the result stick 46.
3. Microparticle Selection
The preferred microparticles utilized in this invention are composed of polymeric materials such as latex, polyethylene, polypropylene, poly(methyl methacrylate) or polystyrene. The preferred microparticle in the present invention is composed of latex containing a colored dye. However, a variety of other synthetic or natural materials may also be used in the preparation of the microparticles, for example, silicates, paramagnetic particles and colloidal gold. The usual form of microparticles possesses surface sulfate charge groups that can be modified by the introduction of functional groups such as hydroxyl, carboxyl, amine and carboxylate groups. The functional groups are used to bind a wide variety of ligands and receptors to the microparticles. These groups are selected on the basis of their ability to facilitate binding with the selected member of the ligand-receptor pair. Conjugation of the receptors to the microparticle is accomplished by covalent binding or, in appropriate cases, by adsorption of the receptor onto the surface of the microparticle. Techniques for the adsorption or covalent binding of receptors to microparticles are well know in the art and require no further explanation. The preferred method of attachment of the receptor to the microparticles is covalent binding.
In the present invention, microparticle-bound receptors are specific for discrete haptens located on the ends of amplified, labeled nucleic acid sequences. The receptors must be capable of binding to their specific binding partner (hapten).
The size of the microparticles used in this invention is selected to optimize the binding and detection of the labeled amplified nucleic acids (amplicons). Microparticles are available in a size range of 0.01 to 10.0 μm in diameter and preferably 0.01 to 1.0 μm in diameter, specifically not excluding the use of either larger or smaller microparticles as appropriately determined. The microparticles are activated with a suitable receptor for binding to the target ligand.
In one embodiment, the microparticles are anti-digoxigenin Fab-coated microparticles. To prepare the anti-digoxigenin-coated microparticles, 0.25 to 1.0 mg/mL of anti-digoxigenin Fab is incubated with a suspension containing a final concentration of 1.0% microparticles/mL. The microparticles and digoxigenin Fab are allowed to react for 15 minutes prior to treatment with an activating agent such as EDAC (1-ethyl-3-(3-dimethylaminopropyl) carbodiimide) for covalent binding. The microparticles are treated with EDAC at a final concentration of 0.0 to 2.5 mM. The Fab and microparticles are mixed and incubated at room temperature for one hour. Unbound Fab is removed by successive washes and the coated microparticles are resuspended in storage buffer.
4. Amplification
The present invention employs a variety of different enzymes, such as polymerases and ligases, to accomplish amplification of target nucleic acid sequences. Polymerases are defined by their function of incorporating nucleoside triphosphates to extend a 3′ hydroxyl terminus of a “primer molecule.” As used herein, a “primer” is an oligonucleotide that, when hybridized to a target nucleic acid molecule, possesses a 3′ hydroxyl terminus that can be extended by a polymerase and a hapten label at or near the 5′ terminus. For a general discussion concerning polymerases, see Watson, J. D., et al., Molecular Biology of the Gene, 4th Ed., (1987) W. A. Benjamin, Inc., Menlo Park, Calif. Examples of polymerases that can be used in accordance with the methods described herein include, but are not limited to, E. coli DNA polymerase I, which is the large proteolytic fragment of E. coli polymerase I and is commonly known as “Klenow” polymerase, Taq-polymerase, T7 polymerase, T4 polymerase, T5 polymerase and reverse transcriptase. The general principles and conditions for amplification of nucleic acids using polymerase chain reaction are well known in the art.
The preferred amplification methodologies for use in the self-contained devices of this invention include isothermal reactions such as nucleic acid sequence-based assay (NASBA) disclosed in U.S. Pat. No. 5,130,238, which is specifically incorporated herein, and strand displacement assay (SDA) disclosed by Walker, et al., PNAS 89:392 (1992), which is specifically incorporated herein by reference. Another amplification methodology for use in this invention includes polymerase chain reaction (PCR).
With amplification, certain specimens are inhibitory to the amplification reaction, providing false-negative results. To avoid this problem, a positive control—a control nucleic acid with primer recognition sequences attached to a totally irrelevant nucleic acid sequence—is incorporated in the amplification step. This positive control primer is a component of the nucleic acid extraction reagents, thus controlling for sample extraction and delivery as well as detecting amplification failure. The preferred embodiment of the positive control is a lambda DNA sequence. The control nucleic acid is extracted and amplified along with the target nucleic acid and is detected by a line of immobile, coated microparticles on the detection membrane.
The target oligonucleotide primer and the control oligonucleotide primer used in the amplification steps of this invention contain at least one hapten as a label which does not participate in the priming reaction. The hapten is bound to at least one position of the nucleic acid primer. For the derivatization of nucleic acid primers, various methods can be employed. See, Sambrook supra. The incorporation of the hapten can take place enzymatically, chemically or photochemically. The hapten can be derivatized directly to the 5′ end of the primer or contain a bridge 1 to 30 atoms long. In the preferred embodiment, the bridge is linear. However, in an alternate embodiment, the bridge consists of a branched chain with a hapten molecule on at least one of the chain ends. By means of the presence of several hapten molecules on the ends of a branched chain, the detection sensitivity is increased. The preferred haptens for the present invention are biotin and digoxigenin, however, other haptens having a receptor as specific binding agent available are suitable, for example, steroids, halogens and 2,4-dinitrophenyl.
The self-contained devices disclosed herein provide for extremely rapid, economical nucleic acid detection. Further, the self-contained devices significantly reduces the risk of cross contamination in that neither amplification reagents nor amplicons are manipulated. Elimination of cross contamination opens the door to mass screening including automation.
The self-contained devices of the present invention can be used in the diagnoses of infectious diseases of genetic, bacterial or viral origin. The high sensitivity of analysis using the self-contained devices of this invention allows for the early detection of disease and an opportunity for early treatment. Analysis by this invention may monitor the efficacy of treatment, for example, to monitor HIV virus in the plasma of patients undergoing therapy. The low complexity of the device lends itself to “point of care” testing in clinics and physician's offices. The portability of the device provides for “on site” analysis to detect nucleic acid sequences in the areas of forensics, agriculture, environment and the food industry.
The cost of nucleic acid analysis using the self-contained devices of this invention is significantly less than other methods currently in use to detect amplified nucleic acids. The time frame for detecting an amplified sequence is reduced drastically. There is no danger from potentially hazardous chemicals. The analysis does not require special waste disposal procedures. The requirements of many washes in an immunometric or hybridization approach are eliminated. The self-contained device does not require special equipment, other than a standard, constant temperature heat block.
The following examples serve to explain and illustrate the present invention. The examples are not to be construed as limiting of the invention in anyway. Various modifications are possible within the scope of the invention.
EXAMPLE 1 Isothermal Amplification Approach to Detection with Labeled Amplified Target Sequence Using NASBA
One preferred amplification methodology for use in this invention is an isothermal reaction such as nucleic acid sequence-based assay (NASBA). The primary product of the NASBA reaction is single strand RNA. The NASBA reaction utilizes a primer containing a T7 polymerase promoter. Following T7 transcription, up to 100 copies of target RNA are produced. These copies are the same sequence as the original target RNA. They serve as templates, thus starting the cycle again and resulting in up to a billion fold amplification of the original template.
In order to incorporate NASBA into the devices disclosed herein, probes that allow the formation of a bifunctionally haptenized amplification product have been designed. For NASBA there are two possible strategies: 1) design amplification primers that are haptenized; and 2) use two haptenized capture oligonucleotides which bind to the product RNA. The model system chosen is to the HIV POL gene.
The first strategy using NASBA haptenization, i.e., the design of amplification primers that are haptenized, is illustrated in FIG. 14, steps A-D. A T7 NASFAM haptenization primer, containing a T7 transcriptase promoter and an attached fluorescein, binds to the target RNA (FIG. 14, step A). A reverse transcriptase transcribes a DNA copy of the RNA, as illustrated in step B of FIG. 14. The original RNA strand is digested by RNase H. A reverse haptenization primer, P2 NASBIO with attached biotin, binds to the antisense DNA (FIG. 14, step C) and is extended by the DNA polymerase activity of the reverse transcriptase. The haptenized primers are as follows:
T7 NASFAM (T7-promoter primer):
5′-fluorescein-AATTCTAATACGACTCACTATAGGGTGCTATGTCACTTCCCCTTGGTTCTCT-3′  SEQ ID NO: 1
P2 NASBIO (reverse primer):
5′-biotin-AGTGGGGGGACATCAAGCAGCCATGCAAA-3′  SEQ ID NO: 2
The resulting double-stranded bi-haptenized DNA intermediate, containing a biotin label at one end and a fluorescein label at the other end, is illustrated in step D of FIG. 14. This complex gives signal in lateral flow or slide agglutination assays.
The second strategy for using NASBA in this invention, i.e., the use of two haptenized oligonucleotides which bind to the product RNA, is illustrated in FIG. 14, steps E-F. T7 RNA polymerase binds to the promoter region (step E) to manufacture many copies of a minus-sense RNA, as shown in steps E and F of FIG. 14. This RNA contributes to the manufacture of the DNA intermediate by similar means. Two capture oligonucleotides, each having one hapten of either fluorescein or biotin, bind to the minus-sense RNAs (FIG. 14, step F) giving bifunctional haptenized complexes. These complexes give signal in lateral flow or slide agglutination. The haptenized capture oligonucleotides, designed to bind to the minus-sense RNA product are:
5′(−)NASBA CAP FAM:
5′-fluorescein-TGGCCTGGTGCAATAGGCCC-3′  SEQ ID NO: 3
3′(−)NASBA CAP-BIO:
5′-CCCATTCTGCAGCTTCCTCA-biotin-3′  SEQ ID NO: 4
EXAMPLE 2 Isothermal Amplification Approach to Detection with Bifunctionally Labeled Amplified Target Sequence Using Strand Displacement Assay
The instant strand displacement assay (SDA) is another example of an isothermal amplification methodology that can be detected in the self-contained devices of this invention by using microparticles and bifunctionally labeled product.
SDA technology is described in U.S. Pat. No. 5,455,166 which is specifically incorporated herein. SDA is isothermal amplification based on the ability of a restriction enzyme to nick the unmodified strand of a hemiphosphorothioate from its recognition site and the ability of DNA polymerase to initiate replication at the nick and displace the downstream non-template strand. Primers containing recognition sites for the nicking restriction enzyme bind to opposite strands of target DNA at positions flanking the sequence to be amplified. The target fragment is exponentially amplified by coupling sense and antisense reactions in which strands displaced from the sense reaction serve as a target for the antisense reaction and vice versa.
This set of experiments is conducted with composite extension primers that are labeled with biotin, fam or digoxigenin (FIGS. 8 and 9). Bumper primers are the same sequence as provided by Becton Dickinson and Company (Franklin Lakes, N.J.). The sequences of the target, the bumper primer and the composite extension primer are as follows:
Bumper primers:
B1: 5′-CGATCGAGCAAGCCA  SEQ ID NO: 5
B2: 5′-CGAGCCGCTCGCTGA  SEQ ID NO: 6
Composite extension primers:
S1: 5′-fam/dig-ACCGCATCGAATGCATGTCTCGGGTAAGGCGTACTCGACC  SEQ ID NO: 7
S2: 5′-biotin-CGATTCCGCTCCAGACTTCTCGGGTGTACTGAGATCCCCT  SEQ ID NO: 8
Target sequence:
5′-TGGACCCGCCAACAAGAAGGCGTACTCGACCTGAAAGACGTTATCCACCAT ACGGATAGGGGATCTCAGTACACATCGATCCGGTTCAGCG  SEQ ID NO: 9
The reaction is set up per the thermophilic Strand Displacement Amplification (tSDA) protocol developed by Becton Dickinson and Co. The target organism is Mycobacterium tuberculosis. For pilot studies, an artificial target template consisting of the 91 nt sequence of the M. tuberculosis genome, defined by the Becton Dickinson outer (bumper) primers, is used. Amplification conditions used are identical to those used by Becton Dickinson for tSDA.
The membrane used for this procedure is nitrocellulose, purchased from Millipore Corporation, Bedford, Mass. A stripe of streptavidin at a concentration of 1 mg/mL is applied at a rate of 1 μL/cm via a linear reagent striper (IVEK Corporation, No. Springfield, Vt.) 1 cm from the bottom edge of the membrane. After application of the streptavidin, the membrane is allowed to dry and then blocked for non-specific binding by 0.5% casein in 100 mM Tris, pH 7.4. The membrane is washed twice with water (ddH2O) and allowed to dry.
Next, 3 μL of anti-S1 extension primer (complementary to S1 without the biotin label) and/or S2 extension primer (complementary to S2 without the dig or fam label) is spotted onto a second membrane. The second membrane is then sandwiched onto the first membrane in order to capture free primers that compete with the product for the microparticles or streptavidin capture zone.
The coated microparticles are prepared as described above by incubating either anti-digoxigenin Fab or anti-fam monoclonal IgG with a suspension of microparticles. The coated microparticles are diluted 1:2 with a 35% sucrose solution, and 3 μL or the solution is applied directly to the membrane and dried.
The bifunctionally labeled reaction product (10 μL) is added to 45 μl SDA buffer, then applied (50 μL) to the previously striped membrane. Application of the sample requires the bifunctionally labeled product and the competing primers to pass through the anti-primer coated membrane and the dried microparticles. When the target is present, there is a visible line on the membrane. When the target is not present, there is absence of a visible line. The results of one such experiment are shown in FIG. 11.
EXAMPLE 3 Inhibition Assay: Loss of Visible Signal on Lateral Flow Membrane
Cycling probe technology involves a nucleic acid probe that incorporates DNA-RNA-DNA sequences designed to hybridize with the target sequences. See, for example, FIG. 10. The probe is bifunctionally labeled with biotin and fam. If the probe hybridizes with the target generating double stranded nucleic acid, RNase H in the reaction buffer cleaves the probe. This cleavage results in loss of signal when applied to a membrane containing a capture zone of streptavidin and anti-fam coated colored microparticles. If the target is not present, there is a visible line on the membrane.
The specific probe and target employed in the instant example have been designed by ID Biomedical Corporation for use in detecting Mycobacterium tuberculosis. The probe (SEQ ID NO: 10) is a chimeric construct containing both DNA and RNA sequences with labels on the 5′ (fam) and the 3′ (biotin) ends of the DNA portion of the probe. The binding of the probe to a single strand of target generates double stranded nucleic acid which is cleaved with RNase H, thus eliminating the bifunctionality of the probe. The sequence of the probe is described below:
FARK2S3B probe
5′-fam-AAAGATGTagagGGTACAGA-biotin-3′  SEQ ID NO: 10
(lower case indicates ribonucleoside bases)
The sequence of the target is described below:
ARK2-T synthetic target
5′-AATCTGTACCCTCTACATCTTTAA-3′  SEQ ID NO: 11
The reaction is completed following the protocol provided by ID Biomedical Corporation. The membrane used for this procedure is nitrocellulose, purchased from Millipore Corporation, Bedford, Mass. A stripe of streptavidin at a concentration of 1 mg/mL is applied at a rate of 1 μL/cm via a linear reagent striper (IVEK Corporation, No. Springfield, Vt.) 1 cm from the bottom edge of the membrane. After application of the streptavidin, the membrane is allowed to dry and then blocked for non-specific binding by 0.5% casein in 100 mM Tris, pH 7.4. The membrane is washed twice with water (ddH2O) and allowed to dry. The microparticles used are anti-fam coated microparticles prepared as described above using anti-fam monoclonal IgG.
The reaction product (10 μL) is added to 5 μl of 0.1% anti-fam coated microparticles (0.1%) and 35 μL of water, then applied (50 μL) to the previously striped membrane. The binding of the bifunctionally labeled probe to the target, followed by cleavage of the probe by RNase H, results in loss of the bifunctionality of the probe. When the target is present, the absence of a visible line on the membrane exists. When the target is not present, the bifunctionally labeled probe is able to bind the anti-fam coated microparticles and the streptavidin bound to the membrane, resulting in a visible line. The results of one such experiment are shown in FIG. 12.
EXAMPLE 4 Detection of Bifunctionally Labeled Amplified Product
The membrane used for this procedure is nitrocellulose, purchased from Millipore Corporation, Bedford, Mass. A stripe of streptavidin at a concentration of 1 mg/ml is applied at a rate of 1 μL/cm via a linear reagent striper (IVEK Corporation, No. Springfield, Vt.) 1 cm from the bottom edge of the membrane. After application of the streptavidin, the membrane is allowed to dry and then blocked for non-specific binding by 0.5% casein in 100 mM Tris, pH 7.4. The membrane is washed twice with water (ddH2O) and allowed to dry.
The amplification product is added to the membrane with colored receptor coated beads at dilutions of 0.001-1.0% microparticles/mL. This mixture is allowed to wick up the membrane. Positive reactions result in a colored line where the capture material is applied. Amplification reactions without the target sequence added to the reaction serve as negative controls. The results of this lateral flow assay are illustrated in FIG. 13.
If the target and control nucleic acid sequences are present, the receptor-bound microparticles interact with hapten(s) to capture the amplified nucleic acid. The result is a line of dyed particles visible on the membrane for the target and a line for the control nucleic acids. If the target is not present, the dyed particles for the target are not captured and are not visible. When the result of the analysis is negative, the control nucleic acid sequences must be visible indicating that the extraction and amplification were performed correctly.
EXAMPLE 5 Detection by Amplification with a Single Labeled Primer Followed by Hybridization with a Probe That Contains a Single Label
The target nucleic acid sequence is amplified by PCR using 200-1000 mM primer concentration, GeneAmp EZ rTth RNA PCR kit (Perkin Elmer Corp., Alameda, Calif.) and 106 copies/mL of the target HIV RNA sequence. Forty PCR cycles, each cycle being 60° C. for 15 minutes, 95° C. for 15 seconds, and 55° C. for 60 seconds, are run.
The sequences of the primers are as follows:
SK38 Dig Primer:
5′-dig-ATAATCCACCTATCCCAGTAGGAGAAAT-3′  SEQ ID NO: 12
SK39 Primer:
5′-TTTGGTCCTTGTCTTATGTCCAGAATGC-3′  SEQ ID NO: 13
Specific PCR reaction conditions are described below:
Reagent Final conc.
5X EZ Buffer  1X
Mn(OAc)2  3 mM
rTth polymerase  5 U
dntp's 240 μM each
SK38  1 μM
SK39
 1 μM
rTth DNA Polymerase (Perkin Elmer N808-0097)
The SK38 Dig—SK39 amplicon (5 μl) is incubated with 5 μL of 25 μM (125 pmol) SK39 biotin at 95° C. for 1 minute, and then at 55° C. for 1 minute. The amplicon binds to the anti-digoxigenin-coated microparticles and wicks through the membrane to the streptavidin line where it is captured by the interaction of biotin and streptavidin. The result is a visible line of colored microparticles.
In the negative control, the procedure is performed as described above, but without the addition of the target sequence. Without the presence of the target sequence in the amplification reaction, the bifunctionally labeled amplicon is not generated and the visible line of detection is not present. The results of one such experiment are shown in FIG. 15.
EXAMPLE 6 Extraction of Nucleic Acids with Guanidine Thiocyanate onto Glass (Silicon Dioxide) and Subsequent Amplification Without Elution from Silicon Dioxide
A column was constructed using Ansys 0.4 mm membrane as a filter to contain the silicon dioxide and a syringe apparatus to pull buffer through the column in approximately 15 seconds. 50 μl serum, 2 μl SiO2 (0.5 mg/ml), and 450 μl guanidine thiocyanate (GuSCN) lysis buffer are mixed by vortexing and then incubated at room temperature for 10 minutes. The specific lysis buffer for the instant set of experiments contains 14.71 g GuSCN (4M final), 0.6 ml TRITON X-100™, 5.5 ml 0.2 M EDTA pH 8.0 and is q.s. to 31.11 mL with 0.1M Tris-HCl to pH 6.4. The silicon dioxide is washed twice with 500 ul 70% EtOH.
Next, the filter with SiO2 is removed from the column and the SiO2 is washed off of the membrane using 20 μL water (ddH2O). 5 μL of the silicon dioxide slurry is added to a PCR reaction using standard protocol for HIV model system, as detailed supra in Example 5.
EXAMPLE 7 Cascade Rolling Circle Amplification
The use of cascade rolling circle amplification (CRCA) and labeled primers for detection of target nucleic acid sequences was established in collaboration with Dr. David Thomas (Oncormed, Inc.). Amplicon from an HIV DNA plasmid model system was bifunctionally labeled during CRCA using tagged primers and subsequently detected by lateral flow chromatography. See FIG. 23. The target sequence was amplified 6 individual times at 10 minute increments. That is, amplification was performed for 10, 20, 30, 40, 50 and 60 minutes, respectively. FIG. 23 shows that the results of agarose gel electrophoresis show no visible results except for the target that was amplified for 60 minutes. Lateral flow chromatography detection strips demonstrate visual detection after 40 minutes of target amplification and a strong visual signal for both the 50 and 60 minute amplifications. These results support the use of an isothermal amplification platform with the self-contained device disclosed herein.
The instant invention provides a rapid, simple and accurate method of detecting amplified target nucleic acid sequences with a self-contained device. Sensitivity and specificity of the assay are based on labeling of the target, by incorporating a label or by subsequent hybridization of a labeled probe during the amplification process. The method does not require costly and sophisticated equipment or specially trained personnel, nor does it pose any health hazard.
While the above description contains many specificities, these should not be construed as limitations on the scope of the invention, but rather an exemplification of the preferred embodiment thereof. Many other variations are possible, such as amplifying several target samples in the same reaction mixture, isothermal amplification, utilizing newly discovered polymerases and ligases, etc. Thus the scope of the invention should be determined by the appended claims and their legal equivalents, rather than by the example given.
13 1 52 DNA artificial sequence primer 1 aattctaata cgactcacta tagggtgcta tgtcacttcc ccttggttct ct 52 2 29 DNA artificial sequence primer 2 agtgggggga catcaagcag ccatgcaaa 29 3 20 DNA artificial sequence capture probe 3 tggcctggtg caataggccc 20 4 20 DNA artificial sequence capture probe 4 cccattctgc agcttcctca 20 5 15 DNA artificial sequence primer 5 cgatcgagca agcca 15 6 15 DNA Artificial Sequence primer 6 cgagccgctc gctga 15 7 40 DNA artificial sequence primer 7 accgcatcga atgcatgtct cgggtaaggc gtactcgacc 40 8 40 DNA artificial sequence primer 8 cgattccgct ccagacttct cgggtgtact gagatcccct 40 9 91 DNA Mycobacterium tuberculosis 9 tggacccgcc aacaagaagg cgtactcgac ctgaaagacg ttatccacca tacggatagg 60 ggatctcagt acacatcgat ccggttcagc g 91 10 20 DNA artificial sequence primer 10 aaagatgtag agggtacaga 20 11 24 DNA artificial sequence synthetic target 11 aatctgtacc ctctacatct ttaa 24 12 28 DNA artificial sequence primer 12 ataatccacc tatcccagta ggagaaat 28 13 28 DNA artificial sequence primer 13 tttggtcctt gtcttatgtc cagaatgc 28

Claims (16)

We claim:
1. A method of detecting a target nucleic acid in a sample, wherein all of said method steps take place within a multi-chambered self-contained device having at least two chambers, said method comprising:
a) extracting said target nucleic acid, wherein said extraction includes binding said target nucleic acid to a solid phase or silica slurry;
b) amplifying said target nucleic acid on said solid phase or silica slurry with a first primer having a first label and a second primer having a second label under conditions that preferentially amplify said target nucleic acid to produce an amplification reaction mixture comprising target amplicons having said first label and said second label, wherein prior to amplification said nucleic acid present in a double-stranded form are rendered single-stranded;
c) transferring said reaction mixture to a detection chamber of said device; and
d) detecting said target amplicons within said detection chamber by a lateral flow assay, wherein said assay comprises wicking said target amplicons onto a membrane, wherein said target amplicons bind to at least a first and second reagent and at least one of said reagents is bound to said membrane, whereby when said at least two reagents are both bound to said target amplicons a visible signal is detected, wherein said amplification and said extraction take place within a first chamber of said device that is in fluid communication with said detection chamber, or said extraction takes place within a first chamber of said device and said amplification takes place in a second chamber of said device that is in fluid communication with both said first chamber and said detection chamber.
2. The method of claim 1, wherein said first reagent comprises colored microparticles having first receptors bound thereto, wherein said first receptors bind specifically to said first label on said target amplicons to form microparticle-bound amplicons and said second reagent comprises membrane-bound second receptors that bind specifically to said second label on said amplicons.
3. The method of claim 1, wherein said amplification methodology is polymerase chain reaction (PCR), ligase chain reaction, Qβ replicase, strand displacement assay (SDA), nucleic acid sequence-based amplification (NASBA), or cascade rolling circle amplification (CRCA).
4. A method of detecting a target nucleic acid in a sample, wherein all of said method steps take place within a multi-chambered self-contained device having at least two chambers, said method comprising:
a) extracting said target nucleic acid, wherein said extraction includes binding said target nucleic acid to a solid phase or silica slurry;
b) amplifying said target nucleic acid on said solid phase or silica slurry with a first primer having a first label and to a second primer under conditions that preferentially amplify said target nucleic acid to produce an amplification reaction mixture comprising singly labeled target amplicons, wherein prior to amplification said nucleic acid present in a double-stranded form are rendered single-stranded;
c) transferring said reaction mixture to a detection chamber of said device; and
d) detecting said target amplicons within said detection chamber by a lateral flow assay, wherein said assay comprises wicking said target amplicons onto a membrane, wherein said singly labeled target amplicons bind to at least a first, a second and a third reagent and at least one of said reagents is bound to said membrane, whereby when said at least three reagents are all bound to said target amplicons a visible signal is detected, wherein said amplification and extraction take place within a first chamber of said device that is in fluid communication with said first chamber, or said extraction takes place within a first chamber of said device and said amplification takes place in a second chamber that is in fluid communication with both said first chamber and said detection chamber.
5. The method of claim 4, wherein said first reagent comprises colored microparticles having first receptors bound thereto, wherein said first receptors bind specifically to said label on said target amplicons, said second reagent comprises a labeled oligonucleotide capable of specifically hybridizing to said target amplicons, and said third reagent comprises receptors bound to said membrane and specific for said label on said oligonucleotide.
6. The method of claim 4, wherein said amplification methodology is polymerase chain reaction (PCR), ligase chain reaction, Qβ replicase, strand displacement assay (SDA), nucleic acid sequence-based amplification (NASBA), or cascade rolling circle amplification (CRCA).
7. A method of detecting a target nucleic acid in a sample, wherein all of said method steps take place within a multi-chambered self-contained device having at least two chambers, said method comprising:
a) extracting said target nucleic acid, wherein said extraction includes binding said target nucleic acid to a solid phase or silica slurry;
b) amplifying said target nucleic acid on said solid phase or silica slurry with first and second complementary primers under conditions that preferentially amplify said target nucleic acid to produce an amplification reaction mixture comprising target amplicons, wherein prior to amplification said nucleic acid present in a double-stranded form are rendered single-stranded;
c) transferring said reaction mixture to a detection chamber of said device; and
d) detecting said target amplicons within said detection chamber by a lateral flow assay, wherein said assay comprises wicking said target amplicons onto a membrane, wherein said target amplicons bond to at least a first reagent, a second reagent, a third reagent, and a fourth reagent, and at least one of said reagents is bound to said membrane, whereby when said at least four reagents area all bound to said target amplicons a visible signal is detected, wherein said amplification and extraction take place within a first chamber of said device that is in fluid communication with said first chamber, or said extraction takes place within a first chamber of said device and said amplification takes place within a second chamber that is in fluid communication with both said first chamber and said detection chamber.
8. The method of claim 7, wherein said first reagent comprises an oligonucleotide comprising a first label and said second reagent comprises a second oligonucleotide comprising a second label, wherein said first and second oligonucleotides are capable of hybridizing to said target amplicon to form hybridized target amplicons comprising said first and second labels, said third reagent comprises first receptors specific for said first label on said hybridized target amplicon and having colored microparticles bound thereto, and said fourth reagent comprises membrane-bound second receptors specific for said second label on said hybridized target amplicon.
9. The method of claim 7, wherein said amplification methodology is polymerase chain reaction (PCR), ligase chain reaction, Qβ replicase, strand displacement assay (SDA), nucleic acid sequence-based amplification (NASBA), or cascade rolling circle amplification (CRCA).
10. A method of detecting a target nucleic acid in a sample, wherein all of said method steps take place within a multi-chambered self-contained device having at least two chambers, said method comprising:
a) extracting said target nucleic acid, wherein said extraction includes binding said target nucleic acid to a solid phase or silica slurry;
b) hybridizing said target nucleic acid to a DNA-RNA-DNA probe having a first label on the 5′ end and a second label on the 3′ end to form a reaction mixture comprising a hybridized product having a first and second label, wherein prior to hybridization said nucleic acid present in a double-stranded form are rendered single-stranded;
c) transferring said reaction mixture to a detection chamber of said device; and
d) detecting said target nucleic acid within said detection chamber by a lateral flow assay, wherein said assay comprises:
i) contacting said hybridized product with colored microparticles having first receptors bound thereto, wherein said first receptors on said microparticles are specific for and bind to said first label;
ii) contacting said microparticle-bound hybridized product with RNase H to form a mixture, wherein said RNase H cleaves said probe only if said probe is hybridized to said target nucleic acid; and
iii) contacting said mixture from step ii) with a membrane having a capture zone, wherein said capture zone comprises second receptors specific for said second label, wherein said mixture wicks along said membrane to said capture zone and a visible line does not form at said capture zone if said target nucleic acid is present in said sample.
11. A method of detecting a target nucleic acid in a sample, comprising:
i) extracting said target nucleic acid, wherein extraction takes place in a first tube comprising a solid phase matrix that binds said target nucleic acid, said matrix tube being positioned inside a second tube having a closed end and an open end and lid for closing the open end, said second tube further containing a reagent cell positioned within said second tube and over said first tube and containing nucleic acid amplification reagents;
ii) amplifying said target nucleic acid bound on said solid phase matrix by releasing said amplification reagents comprising a first primer having a first label and a second primer having a second label from said reagent cell into said first tube under conditions that preferentially amplify said target nucleic acid to produce a reaction mixture comprising target amplicons having said first label and said second label, wherein prior to amplification said nucleic acid present in a double-stranded form are rendered single-stranded;
iii) inserting a result stick comprising a membrane having first and second reagents disposed thereon through a seal in said cap and into said reaction mixture, wherein when said target amplicons bind to both said first and second reagents a visible signal is detected, and wherein said extraction, amplification, and detection occur while said second tube open end is closed by said lid.
12. The method of claim 11, wherein said reagent cell further comprises at least one pouch containing a diluent.
13. The method of claim 11, wherein said first reagent comprises colored microparticles coated with first receptors specific for said first label and said second reagent comprises second receptors specific for said second label.
14. The method of claim 11, wherein said solid phase matrix is aluminum oxide or silica.
15. A method of detecting a target nucleic acid in a sample, wherein all of said method steps take place within a multi-chambered self-contained device having at least two chambers, said method comprising:
a) extracting said target nucleic acid, wherein said extraction includes binding said target nucleic acid to a solid phase or silica slurry;
b) amplifying said target nucleic acid on said solid phase or silica slurry with a first primer having a first label and to a second primer under conditions that preferentially amplify said target nucleic acid to produce an amplification reaction mixture comprising singly labeled target amplicons, wherein prior to hybridization said nucleic acid present in a double-stranded form are rendered single-stranded;
c) transferring said reaction mixture to a detection chamber of said device; and
d) detecting said target amplicons within said detection chamber by a lateral flow assay, wherein said assay comprises wicking said singly labeled target amplicons onto a membrane, wherein said singly labeled target amplicons bind to at least a first and a second reagent and at least one of said reagents is bound to said membrane, whereby when said at least two reagents are all bound to said target amplicons a visible signal is detected, wherein said amplification and extraction take place within a first chamber of said device that is in fluid communication with said first chamber, or said extraction takes place within a first chamber of said device and said amplification takes place in a second chamber that is in fluid communication with both said first chamber and said detection chamber.
16. The method of claim 15, wherein said first reagent comprises an oligonucleotide having a colored microparticle bound thereto and capable of specifically hybridizing to said target amplicon, and said second reagent comprises a receptor bound to said membrane and specific for said label on said target amplicon.
US09/705,043 1995-07-13 2000-11-02 Self-contained device integrating nucleic acid extraction, amplification and detection Expired - Lifetime US6649378B1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US09/705,043 US6649378B1 (en) 1995-07-13 2000-11-02 Self-contained device integrating nucleic acid extraction, amplification and detection
US10/413,433 US20040110167A1 (en) 1995-07-13 2003-04-14 Lateral flow system for nucleic acid detection

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US88595P 1995-07-13 1995-07-13
US08/679,522 US5955351A (en) 1995-07-13 1996-07-12 Self-contained device integrating nucleic acid extraction amplification and detection
US4199997P 1997-04-16 1997-04-16
US09/061,757 US6291166B1 (en) 1997-04-16 1998-04-16 Nucleic acid archiving
US09/141,401 US6153425A (en) 1995-07-13 1998-08-27 Self-contained device integrating nucleic acid extraction, amplification and detection
US09/705,043 US6649378B1 (en) 1995-07-13 2000-11-02 Self-contained device integrating nucleic acid extraction, amplification and detection

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US09/141,401 Continuation US6153425A (en) 1995-07-13 1998-08-27 Self-contained device integrating nucleic acid extraction, amplification and detection

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US10/413,433 Continuation-In-Part US20040110167A1 (en) 1995-07-13 2003-04-14 Lateral flow system for nucleic acid detection

Publications (1)

Publication Number Publication Date
US6649378B1 true US6649378B1 (en) 2003-11-18

Family

ID=22495541

Family Applications (2)

Application Number Title Priority Date Filing Date
US09/141,401 Expired - Fee Related US6153425A (en) 1995-07-13 1998-08-27 Self-contained device integrating nucleic acid extraction, amplification and detection
US09/705,043 Expired - Lifetime US6649378B1 (en) 1995-07-13 2000-11-02 Self-contained device integrating nucleic acid extraction, amplification and detection

Family Applications Before (1)

Application Number Title Priority Date Filing Date
US09/141,401 Expired - Fee Related US6153425A (en) 1995-07-13 1998-08-27 Self-contained device integrating nucleic acid extraction, amplification and detection

Country Status (8)

Country Link
US (2) US6153425A (en)
EP (1) EP1108006A4 (en)
JP (1) JP2002532059A (en)
CN (1) CN1324397A (en)
AU (1) AU752583B2 (en)
CA (1) CA2341687A1 (en)
IL (1) IL141397A0 (en)
WO (1) WO2000012675A1 (en)

Cited By (49)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050227275A1 (en) * 2004-04-07 2005-10-13 Access Bio, Inc. Nucleic acid detection system
US20060014170A1 (en) * 2004-04-23 2006-01-19 Tobin Hellyer Use of an extraction control in a method of extracting nucleic acids
US20060160078A1 (en) * 2002-07-12 2006-07-20 Cardy Donald L N Lateral flow assay device and method
US20080038740A1 (en) * 2006-06-26 2008-02-14 Blood Cell Storage, Inc. Device and method for extraction and analysis of nucleic acids from biological samples
WO2007116298A3 (en) * 2006-04-10 2008-02-28 Tecra Internat Pty Ltd Nucleic acid detection using lateral flow methods
WO2008047272A2 (en) 2006-10-17 2008-04-24 Koninklijke Philips Electronics N.V. Device for amplification and detection of nucleic acids
WO2008032205A3 (en) * 2006-09-12 2008-08-28 3M Innovative Properties Co Nucleic acid detection using flow through methods
US20090029867A1 (en) * 2005-01-26 2009-01-29 Reed Michael W DNA purification and analysis on nanoengineered surfaces
US20090036325A1 (en) * 2007-05-25 2009-02-05 Applera Corporation Directed assembly of amplicons to enhance read pairing signature with massively parallel short read sequencers
US7569342B2 (en) 1997-12-10 2009-08-04 Sierra Molecular Corp. Removal of molecular assay interferences
US20090215125A1 (en) * 2006-06-26 2009-08-27 Blood Cell Storage, Inc. Devices and processes for nucleic acid extraction
US20100028204A1 (en) * 2006-07-28 2010-02-04 Lee Helen Hwai-An Device, system and method for processing a sample
EP2186908A1 (en) 2004-09-21 2010-05-19 Applied Biosystems, LLC Two-color real-time/end-point quantitation of microRNAs (miRNAs)
US7767447B2 (en) 2007-06-21 2010-08-03 Gen-Probe Incorporated Instruments and methods for exposing a receptacle to multiple thermal zones
WO2011051735A2 (en) 2009-11-02 2011-05-05 The Secretary Of State For Environment, Food & Rural Affairs .. Device and apparatus
US20110143339A1 (en) * 2007-08-17 2011-06-16 Craig Wisniewski Device, System and Method for Processing a Sample
US20110203688A1 (en) * 2008-11-04 2011-08-25 Blood Cell Storage, Inc. Nucleic acid extraction on curved glass surfaces
US8629264B2 (en) 2011-05-19 2014-01-14 Blood Cell Storage, Inc. Gravity flow fluidic device for nucleic acid extraction
US8637250B2 (en) 2008-02-22 2014-01-28 Great Basin Scientific Systems and methods for point-of-care amplification and detection of polynucleotides
WO2014071322A1 (en) 2012-11-02 2014-05-08 Life Technologies Corporation Small RNA Capture, Detection and Quantification
WO2016149021A1 (en) 2015-03-13 2016-09-22 Life Technologies Corporation Methods, compositions and kits for small rna capture, detection and quantification
US9623415B2 (en) 2014-12-31 2017-04-18 Click Diagnostics, Inc. Devices and methods for molecular diagnostic testing
US20170189902A1 (en) * 2014-09-12 2017-07-06 Pinpoint Testing, Llc Ready-to-constitute analytical platforms for chemical analyses and quantification
US9714447B2 (en) * 2013-08-19 2017-07-25 General Electric Company Detection of nucleic acid amplification in a porous substrate
USD800331S1 (en) 2016-06-29 2017-10-17 Click Diagnostics, Inc. Molecular diagnostic device
USD800913S1 (en) 2016-06-30 2017-10-24 Click Diagnostics, Inc. Detection window for molecular diagnostic device
USD800914S1 (en) 2016-06-30 2017-10-24 Click Diagnostics, Inc. Status indicator for molecular diagnostic device
EP3235441A1 (en) * 2016-04-20 2017-10-25 Absolute Liquid Solutions ApS Dispensing unit with predetermined sequence of rotation
US10195610B2 (en) 2014-03-10 2019-02-05 Click Diagnostics, Inc. Cartridge-based thermocycler
AU2014290933B2 (en) * 2013-07-17 2019-02-21 L'oreal Biomolecule extraction device and biomolecule extraction method
US10481158B2 (en) 2015-06-01 2019-11-19 California Institute Of Technology Compositions and methods for screening T cells with antigens for specific populations
US10487301B2 (en) * 2015-05-12 2019-11-26 Xiamen University Reaction tube for nucleic acid amplification capable of controlling liquid circulation path
US10675623B2 (en) 2016-06-29 2020-06-09 Visby Medical, Inc. Devices and methods for the detection of molecules using a flow cell
EP3613840A4 (en) * 2017-04-19 2021-03-17 Yamato-Esulon Co., Ltd. Pcr container, pcr container holding reagent, and reagent cassette
US10987674B2 (en) 2016-04-22 2021-04-27 Visby Medical, Inc. Printed circuit board heater for an amplification module
US11001881B2 (en) 2006-08-24 2021-05-11 California Institute Of Technology Methods for detecting analytes
WO2021089643A1 (en) 2019-11-04 2021-05-14 Mirnax Biosens, S.L. Bivalent reverse primer
EP3901286A1 (en) 2020-04-24 2021-10-27 Mirnax Biosens, S.L. Bivalent reverse primer
US11162130B2 (en) 2017-11-09 2021-11-02 Visby Medical, Inc. Portable molecular diagnostic device and methods for the detection of target viruses
US11193119B2 (en) 2016-05-11 2021-12-07 Visby Medical, Inc. Devices and methods for nucleic acid extraction
US11199527B2 (en) 2017-03-28 2021-12-14 Nec Corporation Microtube
US11360029B2 (en) 2019-03-14 2022-06-14 Insilixa, Inc. Methods and systems for time-gated fluorescent-based detection
US11447816B2 (en) 2006-07-28 2022-09-20 California Institute Of Technology Multiplex Q-PCR arrays
US11485997B2 (en) 2016-03-07 2022-11-01 Insilixa, Inc. Nucleic acid sequence identification using solid-phase cyclic single base extension
US11525156B2 (en) 2006-07-28 2022-12-13 California Institute Of Technology Multiplex Q-PCR arrays
US11560588B2 (en) 2006-08-24 2023-01-24 California Institute Of Technology Multiplex Q-PCR arrays
USD1055307S1 (en) 2021-08-13 2024-12-24 Visby Medical, Inc. Molecular diagnostic device
US12258613B2 (en) 2017-03-08 2025-03-25 California Institute Of Technology Pairing antigen specificity of a T cell with T cell receptor sequences
USD1069156S1 (en) 2023-04-10 2025-04-01 Becton, Dickinson And Company Dispensing device

Families Citing this family (63)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6153425A (en) * 1995-07-13 2000-11-28 Xtrana, Inc. Self-contained device integrating nucleic acid extraction, amplification and detection
US7829313B2 (en) 2000-03-24 2010-11-09 Eppendorf Array Technologies Identification and quantification of a plurality of biological (micro)organisms or their components
US7875442B2 (en) 2000-03-24 2011-01-25 Eppendorf Array Technologies Identification and quantification of a plurality of biological (micro)organisms or their components
US7087414B2 (en) 2000-06-06 2006-08-08 Applera Corporation Methods and devices for multiplexing amplification reactions
US7091034B2 (en) * 2000-12-15 2006-08-15 Burstein Technologies, Inc. Detection system for disk-based laboratory and improved optical bio-disc including same
NZ511680A (en) * 2001-05-14 2004-07-30 Univ Waikato Method for preparing nucleic acid or DNA samples and a DNA extraction process using thermophilic proteases
US6869532B2 (en) 2001-06-04 2005-03-22 Cuno Incorporated Nucleic acid binding matrix
US20030098271A1 (en) * 2001-11-26 2003-05-29 Ralph Somack Capsule and tray systems for combined sample collection, archiving, purification, and PCR
ATE389453T1 (en) * 2001-12-04 2008-04-15 Omx Gmbh EQUIPMENT AND METHODS FOR PROCESSING BIOLOGICAL OR CHEMICAL SUBSTANCES OR THEIR SUBSTANCE MIXTURES
US20040014097A1 (en) * 2002-05-06 2004-01-22 Mcglennen Ronald C. Genetic test apparatus and method
US20040018120A1 (en) * 2002-07-29 2004-01-29 Craig Rappin Sample preparation device and method
US20040018575A1 (en) * 2002-07-29 2004-01-29 Craig Rappin Sample preparation device and method
US20060278242A1 (en) * 2005-03-23 2006-12-14 Mcglennen Ronald C Apparatus and methods for medical testing
US8594948B2 (en) * 2002-09-18 2013-11-26 Ronald C. McGlennen Apparatus and methods for medical testing
EP1576188B1 (en) * 2002-11-21 2008-10-15 Epicentre Technologies Methods for using riboprimers for strand displacement replication of target sequences
WO2004048564A1 (en) * 2002-11-28 2004-06-10 Arkray Inc. Device for pretreating specimen
WO2004051218A2 (en) 2002-12-04 2004-06-17 Applera Corporation Multiplex amplification of polynucleotides
AU2003901671A0 (en) * 2003-04-02 2003-05-01 The University Of Adelaide Comparative genomic hybridization
US20070117092A1 (en) * 2003-04-08 2007-05-24 Daksh Sadarangani Dna analysis system
WO2004101733A1 (en) * 2003-05-01 2004-11-25 Southeast University A pcr amplification device used for multi-steps reaction and a wash-free pcr amplification tube used for direct gene detection
ATE493508T1 (en) * 2003-05-19 2011-01-15 Univ Brandeis METHOD, KITS AND DEVICES FOR PROCESSING NUCLEIC ACIDS
DE10323197B4 (en) * 2003-05-22 2008-10-02 Clondiag Chip Technologies Gmbh Device for holding and detecting substance libraries
EP1661988A4 (en) * 2003-07-30 2006-10-11 Riken NUCLEIC ACID DETECTION KIT
JP4540996B2 (en) * 2003-08-20 2010-09-08 シスメックス株式会社 Nucleic acid detector
EP1783497B1 (en) * 2003-08-20 2016-05-11 Sysmex Corporation Container for a sample analyzer
EP1747271A4 (en) * 2004-05-18 2008-09-03 Fujifilm Corp Method for extracting nucleic acid and nucleic acid-extracting apparatus
WO2005118803A1 (en) * 2004-06-02 2005-12-15 Arkray, Inc. Container for nucleic acid extraction, method of cleaning solid matrix and relevant cleaning mechanism, and method of purifying nucleic acid
SG178651A1 (en) * 2004-06-17 2012-03-29 Zygem Corp Ltd Purification methods and uses thereof
FI20045248L (en) * 2004-06-29 2005-12-30 Wallac Oy Integrated nucleic acid analysis
US7776530B2 (en) * 2004-06-29 2010-08-17 Wallac Oy Integrated nucleic acid analysis
CN2784420Y (en) * 2004-11-10 2006-05-31 北京博奥生物芯片有限责任公司 Nest type PCR reaction tube
EP1788096A1 (en) * 2005-11-18 2007-05-23 Eppendorf Array Technologies SA Lid for PCR vessel comprising probes permitting PCR amplification and detection of the PCR product by hybridisation without opening the PCR vessel
WO2007131999A1 (en) * 2006-05-17 2007-11-22 Eppendorf Array Technologies S.A. Lid for pcr vessel comprising probes permitting pcr amplification and detection of the pcr product by hybridisation without opening the pcr vessel
DE102004061633A1 (en) * 2004-12-17 2006-06-29 Lossau, Harald, Dr. Container with transponder
US20060264714A1 (en) * 2005-03-23 2006-11-23 Mcglennen Ronald C Apparatus and methods for medical testing
US7727473B2 (en) * 2005-10-19 2010-06-01 Progentech Limited Cassette for sample preparation
NZ548731A (en) * 2006-07-24 2008-12-24 Zygem Corp Ltd Isothermal detection methods and uses thereof
CN1888902B (en) * 2006-08-11 2011-05-18 杭州优思达生物技术有限公司 Full closed target nucleic amplifier fast testing device
CN101016510B (en) * 2007-02-16 2010-06-09 博奥生物有限公司 A non-filling nucleic acid extraction device and its preparation method and application
EP2242858A4 (en) * 2008-01-08 2011-01-26 Zygem Corp Ltd Isothermal detection methods and uses thereof
CA2734131A1 (en) * 2008-08-14 2010-02-18 Zygem Corporation Limited Temperature controlled nucleic-acid detection method suitable for practice in a closed-system
US8900875B2 (en) * 2008-12-16 2014-12-02 Shell Oil Company Device for evaluating a heat exchange fluid
JP2013537621A (en) * 2010-07-14 2013-10-03 キアゲン ゲーエムベーハー New liquid processing device
US9221049B2 (en) * 2011-03-24 2015-12-29 Boehringer Ingelheim Microparts Gmbh Device and method for removing a supernatant of a liquid sample, and use of a valve device having a soluble membrane
WO2013113072A1 (en) 2012-02-03 2013-08-08 Axxin Pty Ltd Nucleic acid amplification and detection apparatus and method
EP2641975A1 (en) * 2012-03-21 2013-09-25 Vircell, S.L. Device for detection of analytes in affinity bioassays
DE102012222351A1 (en) 2012-12-05 2014-06-05 Gna Biosolutions Gmbh Reaction vessel with magnetic closure
AU2013202778A1 (en) 2013-03-14 2014-10-02 Gen-Probe Incorporated Systems, methods, and apparatuses for performing automated reagent-based assays
AU2013202805B2 (en) 2013-03-14 2015-07-16 Gen-Probe Incorporated System and method for extending the capabilities of a diagnostic analyzer
JP2014196938A (en) * 2013-03-29 2014-10-16 凸版印刷株式会社 Container-cap and base material for reaction
CN105154314B (en) * 2015-09-22 2017-10-20 广州和实生物技术有限公司 A kind of gene assaying device for collecting extraction, amplification and detection integration
JP6359754B1 (en) * 2017-12-29 2018-07-18 ヤマトエスロン株式会社 PCR containers and PCR containers with reagents
JP6371892B1 (en) * 2017-08-24 2018-08-08 ヤマトエスロン株式会社 Reagent cassette
JP6243566B1 (en) * 2017-04-19 2017-12-06 ヤマトエスロン株式会社 PCR containers and PCR containers with reagents
AU2018340855B2 (en) * 2017-09-27 2023-06-22 Axxin Pty Ltd Diagnostic test system and method
JP2019083706A (en) * 2017-11-02 2019-06-06 東洋製罐グループホールディングス株式会社 Nucleic acid chromatography inspection instrument, kit for nucleic acid chromatography inspection, and use method of nucleic acid chromatography inspection instrument
WO2019174539A1 (en) * 2018-03-13 2019-09-19 武汉医蒂生物科技有限公司 Nucleic acid extraction and purification device and biochemical molecule extraction and purification device
US12239993B2 (en) 2018-09-03 2025-03-04 Visby Medical, Inc. Devices and methods for antibiotic susceptibility testing
US12263478B2 (en) 2019-04-28 2025-04-01 Visby Medical, Inc. Molecular diagnostic devices with digital detection capability and wireless connectivity
EP4085149A4 (en) 2020-01-03 2024-03-06 Visby Medical, Inc. ANTIBIOTIC SUSCEPTIBILITY TESTING DEVICES AND METHODS
WO2021229582A1 (en) * 2020-05-14 2021-11-18 Technion Research And Development Foundation Ltd. Device, systems, kits and methods for rapid and simple detection of pathogens
US20220186327A1 (en) * 2020-12-16 2022-06-16 Inspirotec, Inc. System for rapid on-site testing for airborne and other pathogens
CN115851429A (en) * 2023-03-03 2023-03-28 杭州优思达生物技术股份有限公司 Multifunctional integrated molecular detection tube and application thereof

Citations (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5116576A (en) 1987-12-08 1992-05-26 Scientific Generics Limited Device for analytical determinations
US5141850A (en) 1990-02-07 1992-08-25 Hygeia Sciences, Inc. Porous strip form assay device method
US5230864A (en) 1991-04-10 1993-07-27 Eastman Kodak Company Gravity assisted collection device
US5244635A (en) 1992-06-19 1993-09-14 Cirrus Diagnostics, Inc. Centrifuge vessel with coaxial waste chamber having cap to prevent waste fluid transfer from the chamber into the vessel
US5273882A (en) * 1985-06-13 1993-12-28 Amgen Method and kit for performing nucleic acid hybridization assays
US5310650A (en) 1986-09-29 1994-05-10 Abbott Laboratoires Method and device for improved reaction kinetics in nucleic acid hybridizations
US5415839A (en) 1993-10-21 1995-05-16 Abbott Laboratories Apparatus and method for amplifying and detecting target nucleic acids
US5527673A (en) * 1991-10-04 1996-06-18 Orgenics Ltd. Apparatus and method for transport of nucleic acid sequences by capillary action on a solid support and detection of the nucleic acid sequences
US5639428A (en) 1994-07-19 1997-06-17 Becton Dickinson And Company Method and apparatus for fully automated nucleic acid amplification, nucleic acid assay and immunoassay
US5714380A (en) 1986-10-23 1998-02-03 Amoco Corporation Closed vessel for isolating target molecules and for performing amplification
US5830664A (en) * 1994-07-16 1998-11-03 Boehringer Mannheim Gmbh Method for the detection of target nucleic acid
US5955351A (en) * 1995-07-13 1999-09-21 Gerdes; John C. Self-contained device integrating nucleic acid extraction amplification and detection
US5989813A (en) * 1995-07-13 1999-11-23 Molecular Innovations, Inc. Detection of amplified nucleic acid sequences using bifunctional haptenization and dyed microparticles
US6153425A (en) * 1995-07-13 2000-11-28 Xtrana, Inc. Self-contained device integrating nucleic acid extraction, amplification and detection

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
BE503143A (en) * 1950-05-09
US4458020A (en) * 1982-11-15 1984-07-03 Quidel Integrated single tube plunger immunoassay system having plural reagent chambers
GB9314249D0 (en) * 1993-07-09 1993-08-18 Proofname Ltd Purification method and apparatus
US5714384A (en) * 1994-06-28 1998-02-03 Wilson; John R. Compartmentalized tissue culture bag

Patent Citations (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5273882A (en) * 1985-06-13 1993-12-28 Amgen Method and kit for performing nucleic acid hybridization assays
US5310650A (en) 1986-09-29 1994-05-10 Abbott Laboratoires Method and device for improved reaction kinetics in nucleic acid hybridizations
US5714380A (en) 1986-10-23 1998-02-03 Amoco Corporation Closed vessel for isolating target molecules and for performing amplification
US5116576A (en) 1987-12-08 1992-05-26 Scientific Generics Limited Device for analytical determinations
US5141850A (en) 1990-02-07 1992-08-25 Hygeia Sciences, Inc. Porous strip form assay device method
US5230864A (en) 1991-04-10 1993-07-27 Eastman Kodak Company Gravity assisted collection device
US5527673A (en) * 1991-10-04 1996-06-18 Orgenics Ltd. Apparatus and method for transport of nucleic acid sequences by capillary action on a solid support and detection of the nucleic acid sequences
US5244635A (en) 1992-06-19 1993-09-14 Cirrus Diagnostics, Inc. Centrifuge vessel with coaxial waste chamber having cap to prevent waste fluid transfer from the chamber into the vessel
US5415839A (en) 1993-10-21 1995-05-16 Abbott Laboratories Apparatus and method for amplifying and detecting target nucleic acids
US5830664A (en) * 1994-07-16 1998-11-03 Boehringer Mannheim Gmbh Method for the detection of target nucleic acid
US5639428A (en) 1994-07-19 1997-06-17 Becton Dickinson And Company Method and apparatus for fully automated nucleic acid amplification, nucleic acid assay and immunoassay
US5955351A (en) * 1995-07-13 1999-09-21 Gerdes; John C. Self-contained device integrating nucleic acid extraction amplification and detection
US5989813A (en) * 1995-07-13 1999-11-23 Molecular Innovations, Inc. Detection of amplified nucleic acid sequences using bifunctional haptenization and dyed microparticles
US6153425A (en) * 1995-07-13 2000-11-28 Xtrana, Inc. Self-contained device integrating nucleic acid extraction, amplification and detection

Cited By (100)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7569342B2 (en) 1997-12-10 2009-08-04 Sierra Molecular Corp. Removal of molecular assay interferences
US20060160078A1 (en) * 2002-07-12 2006-07-20 Cardy Donald L N Lateral flow assay device and method
US20050227275A1 (en) * 2004-04-07 2005-10-13 Access Bio, Inc. Nucleic acid detection system
EP1737985A4 (en) * 2004-04-07 2010-07-07 Access Bio Inc NUCLEIC ACID DETECTION SYSTEM
US7371531B2 (en) * 2004-04-23 2008-05-13 Becton, Dickinson And Company Use of an extraction control in a method of extracting nucleic acids
US8859199B2 (en) * 2004-04-23 2014-10-14 Becton, Dickinson And Company Use of an extraction control in a method of extracting nucleic acids
US20060014170A1 (en) * 2004-04-23 2006-01-19 Tobin Hellyer Use of an extraction control in a method of extracting nucleic acids
US20090149337A1 (en) * 2004-04-23 2009-06-11 Becton, Dickinson And Company Use of an Extraction Control in a Method of Extracting Nucleic Acids
EP2186908A1 (en) 2004-09-21 2010-05-19 Applied Biosystems, LLC Two-color real-time/end-point quantitation of microRNAs (miRNAs)
US20090029867A1 (en) * 2005-01-26 2009-01-29 Reed Michael W DNA purification and analysis on nanoengineered surfaces
WO2007116298A3 (en) * 2006-04-10 2008-02-28 Tecra Internat Pty Ltd Nucleic acid detection using lateral flow methods
US20100136531A1 (en) * 2006-04-10 2010-06-03 Tecra International Pty Ltd Nucleic acid detection using lateral flow methods
US20100047808A1 (en) * 2006-06-26 2010-02-25 Blood Cell Storage, Inc. Device and method for extraction and analysis of nucleic acids from biological samples
US20090215125A1 (en) * 2006-06-26 2009-08-27 Blood Cell Storage, Inc. Devices and processes for nucleic acid extraction
US7608399B2 (en) 2006-06-26 2009-10-27 Blood Cell Storage, Inc. Device and method for extraction and analysis of nucleic acids from biological samples
US8163535B2 (en) 2006-06-26 2012-04-24 Blood Cell Storage, Inc. Devices and processes for nucleic acid extraction
US8148115B2 (en) 2006-06-26 2012-04-03 Blood Cell Storage, Inc. Device and method for extraction and analysis of nucleic acids from biological samples
US20080038740A1 (en) * 2006-06-26 2008-02-14 Blood Cell Storage, Inc. Device and method for extraction and analysis of nucleic acids from biological samples
US8771955B2 (en) 2006-06-26 2014-07-08 Blood Cell Storage, Inc. Device and method for extraction and analysis of nucleic acids from biological samples
US20100028204A1 (en) * 2006-07-28 2010-02-04 Lee Helen Hwai-An Device, system and method for processing a sample
US11525156B2 (en) 2006-07-28 2022-12-13 California Institute Of Technology Multiplex Q-PCR arrays
US9839909B2 (en) 2006-07-28 2017-12-12 Diagnostics For The Real World, Ltd. Device, system and method for processing a sample
US11447816B2 (en) 2006-07-28 2022-09-20 California Institute Of Technology Multiplex Q-PCR arrays
US10315195B2 (en) 2006-07-28 2019-06-11 Diagnostics For The Real World, Ltd. Device, system and method processing a sample
US11001881B2 (en) 2006-08-24 2021-05-11 California Institute Of Technology Methods for detecting analytes
US11560588B2 (en) 2006-08-24 2023-01-24 California Institute Of Technology Multiplex Q-PCR arrays
WO2008032205A3 (en) * 2006-09-12 2008-08-28 3M Innovative Properties Co Nucleic acid detection using flow through methods
US20100173794A1 (en) * 2006-10-17 2010-07-08 Koninklijke Philips Electronics N.V. Device for amplification and detection of nucleic acids
WO2008047272A3 (en) * 2006-10-17 2008-06-12 Koninkl Philips Electronics Nv Device for amplification and detection of nucleic acids
WO2008047272A2 (en) 2006-10-17 2008-04-24 Koninklijke Philips Electronics N.V. Device for amplification and detection of nucleic acids
US20090036325A1 (en) * 2007-05-25 2009-02-05 Applera Corporation Directed assembly of amplicons to enhance read pairing signature with massively parallel short read sequencers
US8784745B2 (en) 2007-06-21 2014-07-22 Gen-Probe Incorporated Methods for manipulating liquid substances in multi-chambered receptacles
US9744506B2 (en) 2007-06-21 2017-08-29 Gen-Probe Incorporated Instruments for mixing the contents of a detection chamber
US10688458B2 (en) 2007-06-21 2020-06-23 Gen-Probe Incorporated System and method of using multi-chambered receptacles
US10744469B2 (en) 2007-06-21 2020-08-18 Gen-Probe Incorporated Multi-chambered receptacles
US8735055B2 (en) 2007-06-21 2014-05-27 Gen-Probe Incorporated Methods of concentrating an analyte
US8765367B2 (en) 2007-06-21 2014-07-01 Gen-Probe Incorporated Methods and instruments for processing a sample in a multi-chambered receptacle
US8491178B2 (en) 2007-06-21 2013-07-23 Gen-Probe Incorporated Instruments and methods for mixing the contents of a detection chamber
US11235295B2 (en) 2007-06-21 2022-02-01 Gen-Probe Incorporated System and method of using multi-chambered receptacles
US8828654B2 (en) 2007-06-21 2014-09-09 Gen-Probe Incorporated Methods for manipulating liquid substances in multi-chambered receptacles
US8480976B2 (en) 2007-06-21 2013-07-09 Gen-Probe Incorporated Instruments and methods for mixing the contents of a detection chamber
US11235294B2 (en) 2007-06-21 2022-02-01 Gen-Probe Incorporated System and method of using multi-chambered receptacles
US7767447B2 (en) 2007-06-21 2010-08-03 Gen-Probe Incorporated Instruments and methods for exposing a receptacle to multiple thermal zones
US7780336B2 (en) 2007-06-21 2010-08-24 Gen-Probe Incorporated Instruments and methods for mixing the contents of a detection chamber
US8048375B2 (en) 2007-06-21 2011-11-01 Gen-Probe Incorporated Gravity-assisted mixing methods
US8052929B2 (en) 2007-06-21 2011-11-08 Gen-Probe Incorporated Gravity-assisted mixing methods
US10661271B2 (en) 2007-08-17 2020-05-26 Diagnostics For The Real World, Ltd. Device, system and method for processing a sample
US9707556B2 (en) 2007-08-17 2017-07-18 Diagnostics For The Real World, Ltd. Device, system and method for processing a sample
US20110143339A1 (en) * 2007-08-17 2011-06-16 Craig Wisniewski Device, System and Method for Processing a Sample
US8637250B2 (en) 2008-02-22 2014-01-28 Great Basin Scientific Systems and methods for point-of-care amplification and detection of polynucleotides
US20110203688A1 (en) * 2008-11-04 2011-08-25 Blood Cell Storage, Inc. Nucleic acid extraction on curved glass surfaces
WO2011051735A2 (en) 2009-11-02 2011-05-05 The Secretary Of State For Environment, Food & Rural Affairs .. Device and apparatus
US8629264B2 (en) 2011-05-19 2014-01-14 Blood Cell Storage, Inc. Gravity flow fluidic device for nucleic acid extraction
EP3628746A1 (en) 2012-11-02 2020-04-01 Life Technologies Corporation Small rna capture, detection and quantification
WO2014071322A1 (en) 2012-11-02 2014-05-08 Life Technologies Corporation Small RNA Capture, Detection and Quantification
US10520404B2 (en) * 2013-07-17 2019-12-31 L'oreal Biomolecule extraction device and biomolecule extraction method
AU2014290933B2 (en) * 2013-07-17 2019-02-21 L'oreal Biomolecule extraction device and biomolecule extraction method
US9714447B2 (en) * 2013-08-19 2017-07-25 General Electric Company Detection of nucleic acid amplification in a porous substrate
US10960399B2 (en) 2014-03-10 2021-03-30 Visby Medical, Inc. Cartridge-based thermocycler
US10195610B2 (en) 2014-03-10 2019-02-05 Click Diagnostics, Inc. Cartridge-based thermocycler
US20170189902A1 (en) * 2014-09-12 2017-07-06 Pinpoint Testing, Llc Ready-to-constitute analytical platforms for chemical analyses and quantification
US10112197B2 (en) 2014-12-31 2018-10-30 Click Diagnostics, Inc. Devices and methods for molecular diagnostic testing
US10052629B2 (en) 2014-12-31 2018-08-21 Click Diagnostics, Inc. Devices and methods for molecular diagnostic testing
US10456783B2 (en) 2014-12-31 2019-10-29 Click Diagnostics, Inc. Devices and methods for molecular diagnostic testing
US10525469B2 (en) 2014-12-31 2020-01-07 Visby Medical, Inc. Devices and methods for molecular diagnostic testing
US10279346B2 (en) 2014-12-31 2019-05-07 Click Diagnostics, Inc. Devices and methods for molecular diagnostic testing
US10124334B2 (en) 2014-12-31 2018-11-13 Click Diagnostics, Inc. Devices and methods for molecular diagnostic testing
US11167285B2 (en) 2014-12-31 2021-11-09 Visby Medical, Inc. Devices and methods for molecular diagnostic testing
US11273443B2 (en) 2014-12-31 2022-03-15 Visby Medical, Inc. Devices and methods for molecular diagnostic testing
US9623415B2 (en) 2014-12-31 2017-04-18 Click Diagnostics, Inc. Devices and methods for molecular diagnostic testing
US10112196B2 (en) 2014-12-31 2018-10-30 Click Diagnostics, Inc. Devices and methods for molecular diagnostic testing
US12138624B2 (en) 2014-12-31 2024-11-12 Visby Medical, Inc. Devices and methods for molecular diagnostic testing
EP3967768A1 (en) 2015-03-13 2022-03-16 Life Technologies Corporation Compositions for small rna capture, detection and quantification
WO2016149021A1 (en) 2015-03-13 2016-09-22 Life Technologies Corporation Methods, compositions and kits for small rna capture, detection and quantification
US10487301B2 (en) * 2015-05-12 2019-11-26 Xiamen University Reaction tube for nucleic acid amplification capable of controlling liquid circulation path
US10481158B2 (en) 2015-06-01 2019-11-19 California Institute Of Technology Compositions and methods for screening T cells with antigens for specific populations
US11485997B2 (en) 2016-03-07 2022-11-01 Insilixa, Inc. Nucleic acid sequence identification using solid-phase cyclic single base extension
EP3235441A1 (en) * 2016-04-20 2017-10-25 Absolute Liquid Solutions ApS Dispensing unit with predetermined sequence of rotation
US10987674B2 (en) 2016-04-22 2021-04-27 Visby Medical, Inc. Printed circuit board heater for an amplification module
US12208394B2 (en) 2016-04-22 2025-01-28 Visby Medical, Inc. Printed circuit board heater for an amplification module
US11529633B2 (en) 2016-04-22 2022-12-20 Visby Medical, Inc. Printed circuit board heater for an amplification module
US11193119B2 (en) 2016-05-11 2021-12-07 Visby Medical, Inc. Devices and methods for nucleic acid extraction
USD800331S1 (en) 2016-06-29 2017-10-17 Click Diagnostics, Inc. Molecular diagnostic device
US10675623B2 (en) 2016-06-29 2020-06-09 Visby Medical, Inc. Devices and methods for the detection of molecules using a flow cell
USD800914S1 (en) 2016-06-30 2017-10-24 Click Diagnostics, Inc. Status indicator for molecular diagnostic device
USD800913S1 (en) 2016-06-30 2017-10-24 Click Diagnostics, Inc. Detection window for molecular diagnostic device
US12258613B2 (en) 2017-03-08 2025-03-25 California Institute Of Technology Pairing antigen specificity of a T cell with T cell receptor sequences
US11199527B2 (en) 2017-03-28 2021-12-14 Nec Corporation Microtube
EP3613840A4 (en) * 2017-04-19 2021-03-17 Yamato-Esulon Co., Ltd. Pcr container, pcr container holding reagent, and reagent cassette
US11746375B2 (en) 2017-04-19 2023-09-05 Yamato-Esulon Co., Ltd. PCR vessel, PCR vessel containing reagent, and reagent cassette
US11168354B2 (en) 2017-11-09 2021-11-09 Visby Medical, Inc. Portable molecular diagnostic device and methods for the detection of target viruses
US12037635B2 (en) 2017-11-09 2024-07-16 Visby Medical, Inc. Portable molecular diagnostic device and methods for the detection of target viruses
US11162130B2 (en) 2017-11-09 2021-11-02 Visby Medical, Inc. Portable molecular diagnostic device and methods for the detection of target viruses
US11360029B2 (en) 2019-03-14 2022-06-14 Insilixa, Inc. Methods and systems for time-gated fluorescent-based detection
WO2021089643A1 (en) 2019-11-04 2021-05-14 Mirnax Biosens, S.L. Bivalent reverse primer
EP3901286A1 (en) 2020-04-24 2021-10-27 Mirnax Biosens, S.L. Bivalent reverse primer
USD1055307S1 (en) 2021-08-13 2024-12-24 Visby Medical, Inc. Molecular diagnostic device
USD1064314S1 (en) 2021-08-13 2025-02-25 Visby Medical, Inc. Molecular diagnostic device
USD1076140S1 (en) 2021-08-13 2025-05-20 Visby Medical, Inc. Molecular diagnostic device
USD1069156S1 (en) 2023-04-10 2025-04-01 Becton, Dickinson And Company Dispensing device

Also Published As

Publication number Publication date
US6153425A (en) 2000-11-28
EP1108006A4 (en) 2006-05-31
CN1324397A (en) 2001-11-28
CA2341687A1 (en) 2000-03-09
AU752583B2 (en) 2002-09-26
JP2002532059A (en) 2002-10-02
WO2000012675A1 (en) 2000-03-09
IL141397A0 (en) 2002-03-10
AU5796999A (en) 2000-03-21
EP1108006A1 (en) 2001-06-20

Similar Documents

Publication Publication Date Title
US6649378B1 (en) Self-contained device integrating nucleic acid extraction, amplification and detection
EP0838025B1 (en) Self-contained device integrating nucleic acid extraction, amplification and detection
US20040110167A1 (en) Lateral flow system for nucleic acid detection
US20240344097A1 (en) Amplicon rescue multiplex polymerase chain reaction for amplification of multiple targets
US6251660B1 (en) Devices and methods for detecting target molecules in biological samples
EP0837946B1 (en) Detection of amplified nucleic acid sequences using bifunctional haptenization and dyed microparticles
EP0730495B1 (en) Method and apparatus for collecting a cell sample from a liquid specimen
US20090061450A1 (en) System and method for diagnosis of infectious diseases
WO2007106552A2 (en) System and method for diagnosis of infectious diseases
CA2960859A1 (en) Hybrid multi-step nucleic acid amplification
US5494797A (en) Method for detecting lyme disease
JPH04248998A (en) Method for administration of dna positioned outside cell of medium
Mifflin et al. Robotic automation performs a nested RT-PCR analysis for HCV without introducing sample contamination
US20230340563A1 (en) Tools & methods useful for detection of lactose intolerance and uses thereof
WO2009149115A1 (en) Cartridge for conducting biochemical assays
WO2022108728A1 (en) Method, system and apparatus for blood processing unit
WO2008053992A1 (en) Efficient method for detecting antigen, virus, cell and microorganism

Legal Events

Date Code Title Description
STCF Information on status: patent grant

Free format text: PATENTED CASE

CC Certificate of correction
AS Assignment

Owner name: APPLERA CORPORATION, CALIFORNIA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:XTRANA, INC.;REEL/FRAME:014734/0198

Effective date: 20040331

FEPP Fee payment procedure

Free format text: PAT HOLDER NO LONGER CLAIMS SMALL ENTITY STATUS, ENTITY STATUS SET TO UNDISCOUNTED (ORIGINAL EVENT CODE: STOL); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

FPAY Fee payment

Year of fee payment: 4

AS Assignment

Owner name: BANK OF AMERICA, N.A, AS COLLATERAL AGENT, WASHING

Free format text: SECURITY AGREEMENT;ASSIGNOR:APPLIED BIOSYSTEMS, LLC;REEL/FRAME:021976/0001

Effective date: 20081121

Owner name: BANK OF AMERICA, N.A, AS COLLATERAL AGENT,WASHINGT

Free format text: SECURITY AGREEMENT;ASSIGNOR:APPLIED BIOSYSTEMS, LLC;REEL/FRAME:021976/0001

Effective date: 20081121

Owner name: BANK OF AMERICA, N.A, AS COLLATERAL AGENT, WASHINGTON

Free format text: SECURITY AGREEMENT;ASSIGNOR:APPLIED BIOSYSTEMS, LLC;REEL/FRAME:021976/0001

Effective date: 20081121

AS Assignment

Owner name: APPLIED BIOSYSTEMS INC.,CALIFORNIA

Free format text: CHANGE OF NAME;ASSIGNOR:APPLERA CORPORATION;REEL/FRAME:023994/0538

Effective date: 20080701

Owner name: APPLIED BIOSYSTEMS, LLC,CALIFORNIA

Free format text: MERGER;ASSIGNOR:APPLIED BIOSYSTEMS INC.;REEL/FRAME:023994/0587

Effective date: 20081121

Owner name: APPLIED BIOSYSTEMS INC., CALIFORNIA

Free format text: CHANGE OF NAME;ASSIGNOR:APPLERA CORPORATION;REEL/FRAME:023994/0538

Effective date: 20080701

Owner name: APPLIED BIOSYSTEMS, LLC, CALIFORNIA

Free format text: MERGER;ASSIGNOR:APPLIED BIOSYSTEMS INC.;REEL/FRAME:023994/0587

Effective date: 20081121

FPAY Fee payment

Year of fee payment: 8

AS Assignment

Owner name: APPLIED BIOSYSTEMS, INC., CALIFORNIA

Free format text: LIEN RELEASE;ASSIGNOR:BANK OF AMERICA, N.A.;REEL/FRAME:030182/0677

Effective date: 20100528

FPAY Fee payment

Year of fee payment: 12