US6265171B1 - Method of detection of methylated nucleic acid using agents which modify unmethylated cytosine and distinguish modified methylated and non-methylated nucleic acids - Google Patents

Method of detection of methylated nucleic acid using agents which modify unmethylated cytosine and distinguish modified methylated and non-methylated nucleic acids Download PDF

Info

Publication number
US6265171B1
US6265171B1 US09/490,558 US49055800A US6265171B1 US 6265171 B1 US6265171 B1 US 6265171B1 US 49055800 A US49055800 A US 49055800A US 6265171 B1 US6265171 B1 US 6265171B1
Authority
US
United States
Prior art keywords
nucleic acid
base pairs
methylated
single linear
dna
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Lifetime
Application number
US09/490,558
Inventor
James G. Herman
Stephen B. Baylin
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Johns Hopkins University
Original Assignee
Johns Hopkins University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US08/656,716 external-priority patent/US5786146A/en
Application filed by Johns Hopkins University filed Critical Johns Hopkins University
Priority to US09/490,558 priority Critical patent/US6265171B1/en
Application granted granted Critical
Publication of US6265171B1 publication Critical patent/US6265171B1/en
Anticipated expiration legal-status Critical
Expired - Lifetime legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6827Hybridisation assays for detection of mutation or polymorphism
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/154Methylation markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers

Definitions

  • the present invention relates generally to regulation of gene expression, and more specifically to a method of determining the DNA methylation status of CpG sites in a given locus.
  • DNA is methylated only at cytosines located 5′ to guanosine in the CpG dinucleotide. This modification has important regulatory effects on gene expression, especially when involving CpG rich areas, known as CpG islands, located in the promoter regions of many genes. While almost all gene-associated islands are protected from methylation on autosomal chromosomes, extensive methylation of CpG islands has been associated with transcriptional inactivation of selected imprinted genes and genes on the inactive X-chromosome of females. Abberant methylation of normally unmethylated CpG islands has been described as a frequent event in immortalized and transformed cells, and has been associated with transcriptional inactivation of defined tumor suppressor genes in human cancers.
  • Human cancer cells typically contain somatically altered genomes, characterized by mutation, amplification, or deletion of critical genes.
  • the DNA template from human cancer cells often displays somatic changes in DNA methylation (E. R. Fearon, et al., Cell , 61:759, 1990; P. A. Jones, et al., Cancer Res ., 46:461, 1986; R. Holliday, Science , 238:163, 1987; A. De Bustros, et al., Proc. Natl. Acad. Sci., USA , 85:5693, 1988); P. A. Jones, et al., Adv. Cancer Res ., 54:1, 1990; S. B.
  • Mammalian cells possess a different methylase that exclusively methylates cytosine residues on the DNA, that are 5′ neighbors of guanine (CpG).
  • This methylation has been shown by several lines of evidence to play a role in gene activity, cell differentiation, tumorigenesis, X-chromosome inactivation, genomic imprinting and other major biological processes (Razin, A., H., and Riggs, R. D. eds. in DNA Methylation Biochemistry and Biological Significance, Springer-Verlag, New York, 1984).
  • CpG island A CpG rich region, or “CpG island”, has recently been identified at 17p13.3, which is aberrantly hypermethylated in multiple common types of human cancers (Makos, M., et al., Proc. Natl. Acad. Sci. USA , 89:1929, 1992; Makos, M., et al., Cancer Res ., 53:2715, 1993; Makos, M., et al., Cancer Res . 53:2719, 1993). This hypermethylation coincides with timing and frequency of 17p losses and p53 mutations in brain, colon, and renal cancers.
  • methylation of cytosine residues that are immediately 5′ to a guanosine occurs predominantly in CG poor regions (Bird, A., Nature , 321:209, 1986).
  • CpG islands discrete regions of CG dinucleotides called CpG islands remain unmethylated in normal cells, except during X-chromosome inactivation (Migeon, et al., supra) and parental specific imprinting (Li, et al., Nature , 366:362, 1993) where methylation of 5′ regulatory regions can lead to transcriptional repression.
  • a tumor suppressor gene can also be abolished by de novo DNA methylation of a normally unmethylated 5′ CpG island (Issa, et al., Nature Genet ., 7:536, 1994; Herman, et al., supra; Merlo, et al., Nature Med ., 1:686, 1995; Herman, et al., Cancer Res ., 56:722, 1996; Graff, et al., Cancer Res ., 55:5195, 1995; Herman, et al., Cancer Res ., 55:4525, 1995).
  • methylation-sensitive enzymes suffers from the disadvantage that it is not of general applicability, since only a limited proportion of potentially methylated sites in the genome can be analyzed.
  • Genomic sequencing protocols which identify a 5-MeC residue in genomic DNA as a site that is not cleaved by any of the Maxam Gilbert sequencing reactions, are a substantial improvement on the original genomic sequencing method, but still suffer disadvantages such as the requirement for large amount of genomic DNA and the difficulty in detecting a gap in a sequencing ladder which may contain bands of varying intensity.
  • Mapping of methylated regions in DNA has relied primarily on Southern hybridization approaches, based on the inability of methylation-sensitive restriction enzymes to cleave sequences which contain one or more methylated CpG sites.
  • This method provides an assessment of the overall methylation status of CpG islands, including some quantitative analysis, but is relatively insensitive, requires large amounts of high molecular weight DNA and can only provide information about those CpG sites found within sequences recognized by methylation-sensitive restriction enzymes.
  • a more sensitive method of detecting methylation patterns combines the use of methylation-sensitive enzymes and the polymerase chain reaction (PCR). After digestion of DNA with the enzyme, PCR will amplify from primers flanking the restriction site only if DNA cleavage was prevented by methylation.
  • Another method that avoids the use of restriction endonucleases utilizes bisulfite treatment of DNA to convert all unmethylated cytosines to uracil.
  • the altered DNA is amplified and sequenced to show the methylation status of all CpG sites.
  • this method is technically difficult, labor intensive and without cloning amplified products, it is less sensitive than Southern analysis, requiring approximately 10% of the alleles to be methylated for detection.
  • the precise mapping of DNA methylation patterns in CpG islands has become essential for understanding diverse biological processes such as the regulation of imprinted genes, X-chromosome inactivation, and tumor suppressor gene silencing in human cancer.
  • the present invention provides a method for rapid assessment of the methylation status of any group of CpG sites within a CpG island, independent of the use of methylation-sensitive restriction enzymes.
  • PCR and the use of bisulfite modification independently, until the present invention, no one had prepared primers that were specific for the bisulfite reaction such that the PCR reaction itself was used to distinguish between the chemically modified methylated and unmethylated DNA.
  • the method of the invention includes modification of DNA by sodium bisulfite or a comparable agent which converts all unmethylated but not methylated cytosines to uracil, and subsequent amplification with primers specific for methylated versus unmethylated DNA.
  • This method of “methylation specific PCR” or MSP requires only small amounts of DNA, is sensitive to 0.1% of methylated alleles of a given CpG island locus, and can be performed on DNA extracted from paraffin-embedded samples, for example. MSP eliminates the false positive results inherent to previous PCR-based approaches which relied on differential restriction enzyme cleavage to distinguish methylated from unmethylated DNA.
  • MSP is useful for identifying promoter region hypermethylation changes associated with transcriptional inactivation in tumor suppressor genes, for example, p16, p15, E-cadherin and VHL, in human neoplasia.
  • tumor suppressor genes for example, p16, p15, E-cadherin and VHL
  • Other genes that are shown to be methylated include the estrogen receptor, MDGI, GST-pi, calcitonin, HIC-1, endothelin B receptor, TIMP-2, 06-MGMT, MLH1, MSH2, and GFAP.
  • the estrogen receptor, MDGI, GST-pi, calcitonin, HIC-1, endothelin B receptor, TIMP-2, 06-MGMT, and MLH1 were shown by MSP to be hypennethylated in neoplastic tissue as compared with normal tissue.
  • MSP hypennethylated in neoplastic tissue as compared with normal tissue.
  • TIMP-2 a tissue inhibitor of metalloproteinases
  • FIG. 1 shows genomic sequencing of p16.
  • the sequence shown has the most 5′ region at the bottom of the gel, beginning at +175 in relation to a major transcriptional start site (Hara, et al., Mol. Cell Biol ., 16:859, 1996). All cytosines in the unmethylated cell line H249 have been converted to thymidine, while all C's in CpG dinucleotides in the methylated cell H157 remains as C, indicating methylation.] enclosed a BstUI site which is at ⁇ 59 in relation to the transnational start site in Genbank sequence U12818 (Hussussian, et al., Nat. Genet ., 8:15, 1994), but which is incorrectly identified as CGCA in sequence X94154 (Hara, et al., supra). This CGCG site represents the 3′ location of the sense primer used for p16 MSP.
  • FIGS. 2A-2E show polyacrylamide gels with the Methylation Specific PCR products of p16.
  • Primer sets used for amplification are designated as unmethylated (U), methylated (M), or unmodified/wild-type (W).* designates the molecular weight marker pBR322-MspI digest.
  • Panel A shows amplification of bisulfite-treated DNA from cancer cell lines and normal lymphocytes, and untreated DNA (from cell line H249).
  • Panel B shows mixing of various amount of H157 DNA with 1 ⁇ g of H249 DNA prior to bisulfite treatment to assess the detection sensitivity of MSP for methylated alleles. Modified DNA from a primary lung cancer sample and normal lung are also shown.
  • Panel C shows amplification with the p16-U2(U) primers, and p16-M2(M) described in Table 1.
  • Panel D shows the amplified p16 products of panel C restricted with BstUI(+) or not restricted ( ⁇ ).
  • Panel E shows results of testing for regional methylation of CpG islands with MSP, using sense primers p16-U2(U) and p16-M2(M), which are methylation specific, and an antisense primer which is not methylation specific.
  • FIGS. 3A-3E show polyacrylamide gels of MSP products from analysis of several genes. Primer sets used for amplification are not designated as unmnethylated (U), methylated (M), or unmodified/wild-type (W). * designates the molecular weight marker pBR322-MspI digest and ** designates the 123 bp molecular weight marker. All DNA samples were bisulfite treated except those designated untreated.
  • Panel A shows the results from MSP for p15.
  • Panel B shows the p15 products restricted with BstUI(+) or not restricted ( ⁇ ).
  • Panel C shows the products of MSP for VHL.
  • Panel D shows the VHL products restricted with BstUI(+) or not restricted ( ⁇ ).
  • Panel E shows the products of MSP for E-cadherin.
  • the present invention provides methylation specific PCR (MSP) for identification of DNA methylation patterns.
  • MSP uses the PCR reaction itself to distinguish between modified methylated and unmethylated DNA, which adds an improved sensitivity of methylation detection.
  • MSP primers themselves are specifically designed to recognize CpG sites to take advantage of the differences in methylation to amplify specific products to be identified by the invention assay.
  • MSP provides significant advantages over previous PCR and other methods used for assaying methylation.
  • MSP is markedly more sensitive than Southern analyses, facilitating detection of low numbers of methylated alleles and the study of DNA from small samples.
  • MSP allows the study of paraffin-embedded materials, which could not previously be analyzed by Southern analysis.
  • MSP also allows examination of all CpG sites, not just those within sequences recognized by methylation-sensitive restriction enzymes. This markedly increases the number of such sites which can be assessed and will allow rapid, fine mapping of methylation patterns throughout CpG rich regions.
  • MSP also eliminates the frequent false positive results due to partial digestion of methylation-sensitive enzymes inherent in previous PCR methods for detecting methylation.
  • MSP can provide similar information and has the following advantages.
  • MSP is much simpler and requires less than genomic sequencing, with a typical PCR and gel analysis taking 4-6 hours. In contrast, genomic sequencing, amplification, cloning, and subsequent sequencing may take days. MSP also avoids the use of expensive sequencing reagents and the use of radioactivity. Both of these factors make MSP better suited for the analysis of large numbers of samples.
  • the use of PCR as the step to distinguish methylated from unmethylated DNA in MSP allows for significant increase in the sensitivity of methylation detection.
  • the invention provides a method for detecting a methylated CpG-containing nucleic acid, the method including contacting a nucleic acid-containing specimen with an agent that modifies unmethylated cytosine, amplifying the CpG-containing nucleic acid in the specimen by means of CpG-specific oligonucleotide primers, wherein the oligonucleotide primers distinguish between modified methylated and non-methylated nucleic acid and detecting the methylated nucleic acid.
  • the amplification step is optional, it is desirable in the preferred method of the invention.
  • the method of the invention relies on the PCR reaction itself to distinguish between modified (e.g., chemically modified) methylated and unmethylated DNA.
  • modified means the conversion of an unmethylated cytosine to another nucleotide which will distinguish the unmethylated from the methylated cytosine.
  • the agent modifies unmethylated cytosine to uracil.
  • the agent used for modifying unmethylated cytosine is sodium bisulfite, however, other agents that similarly modify unmethylated cytosine, but not methylated cytosine can also be used in the method of the invention. Sodiun bisulfite (NaHSO 3 ) reacts readily with the 5,6-double bond of cytosine, but poorly with methylated cytosine.
  • Cytosine reacts with the bisulfite ion to form a sulfonated cytosine reaction intermediate which is susceptible to deamination, giving rise to a sulfonated uracil.
  • the sulfonate group can be removed under alkaline conditions, resulting in the formation of uracil.
  • Uracil is recognized as a thymine by Taq polymerase and therefore upon PCR, the resultant product contains cytosine only at the position where 5-methylcytosine occurs in the starting template DNA.
  • MSP primers for the non-methylated DNA preferably have a T in the 3′ CG pair to distinguish it from the C retained in methylated DNA, and the compliment is designed for the antisense primer.
  • MSP primers usually contain relatively few Cs or Gs in the sequence since the Cs will be absent in the sense primer and the Gs absent in the antisense primer (C becomes modified to U(uracil) which is amplified as T(thymidine) in the amplification product).
  • the primers of the invention embrace oligonucleotides of sufficient length and appropriate sequence so as to provide specific initiation of polymerization on a significant number of nucleic acids in the polymorphic locus.
  • the term “primer” as used herein refers to a sequence comprising two or more deoxyribonucleotides or ribonucleotides, preferably more than three, and most preferably more than 8, which sequence is capable of initiating synthesis of a primer extension product, which is substantially complementary to a polymorphic locus strand.
  • Environmental conditions conducive to synthesis include the presence of nucleoside triphosphates and an agent for polymerization, such as DNA polymerase, and a suitable temperature and pH.
  • the primer is preferably single stranded for maximum efficiency in amplification, but may be double stranded. If double stranded, the primer is first treated to separate its strands before being used to prepare extension products.
  • the primer is an oligodeoxy ribonucleotide.
  • the primer must be sufficiently long to prime the synthesis of extension products in the presence of the inducing agent for polymerization. The exact length of primer will depend on many factors, including temperature, buffer, and nucleotide composition.
  • the oligonucleotide primer typically contains 12-20 or more nucleotides, although it may contain fewer nucleotides.
  • Primers of the invention are designed to be “substantially” complementary to each strand of the genomic locus to be amplified and include the appropriate G or C nucleotides as discussed above. This means that the primers must be sufficiently complementary to hybridize with their respective strands under conditions which allow the agent for polymerization to perform. In other words, the primers should have sufficient complementarity with the 5′ and 3′ flanking sequences to hybridize therewith and permit amplification of the genomic locus. While exemplary primers are provided in SEQ ID NO: 105-208, it is understood that any primer that hybridizes with the target sequences in SEQ ID NO: 1-104 is included in the invention and is useful in the method of the invention for detecting methylated nucleic acid, as described.
  • Oligonucleotide primers of the invention are employed in the amplification process which is an enzymatic chain reaction that produces exponential quantities of target locus relative to the number of reaction steps involved.
  • one primer is complementary to the negative ( ⁇ ) strand of the locus and the other is complementary to the positive (+) strand.
  • Annealing the primers to denatured nucleic acid followed by extension with an enzyme, such as the large fragment of DNA Polymerase I (Klenow) and nucleotides results in newly synthesized + and ⁇ strands containing the target locus sequence.
  • the product of the chain reaction is a discrete nucleic acid duplex with termini corresponding to the ends of the specific primers employed.
  • oligonucleotide primers of the invention may be prepared using any suitable method, such as conventional phosphotriester and phosphodiester methods or automated embodiments thereof.
  • diethylphosphoramidites are used as starting materials and may be synthesized as described by Beaucage, et al. ( Tetrahedron Letters , 22:1859-1862, 1981).
  • Beaucage, et al. Tetrahedron Letters , 22:1859-1862, 1981.
  • One method for synthesizing oligonucleotides on a modified solid support is described in U.S. Pat. No. 4,458,066.
  • nucleic acid specimen in purified or nonpurified form, can be utilized as the starting nucleic acid or acids, provided it contains, or is suspected of containing, the specific nucleic acid sequence containing the target locus (e.g., CpG).
  • the process may employ, for example, DNA or RNA, including messenger RNA, wherein DNA or RNA may be single stranded or double stranded.
  • RNA is to be used as a template
  • enzymes, and/or conditions optimal for reverse transcribing the template to DNA would be utilized.
  • a DNA-RNA hybrid which contains one strand of each may be utilized.
  • a mixture of nucleic acids may also be employed, or the nucleic acids produced in a previous amplification reaction herein, using the same or different primers may be so utilized.
  • the specific nucleic acid sequence to be amplified i.e., the target locus, may be a fraction of a larger molecule or can be present initially as a discrete molecule, so that the specific sequence constitutes the entire nucleic acid. It is not necessary that the sequence to be amplified be present initially in a pure form; it may be a minor fraction of a complex mixture, such as contained in whole human DNA.
  • the nucleic acid-containing specimen used for detection of methylated CpG may be from any source including brain, colon, urogenital, hematopoietic, thymus, testis, ovarian, uterine, prostate, breast, colon, lung and renal tissue and may be extracted by a variety of techniques such as that described by Maniatis, et al. ( Molecular Cloning: A Laboratory Manual , Cold Spring Harbor, N.Y., pp 280, 281, 1982).
  • the extracted sample is impure (e.g., plasma, serum, stool, ejaculate, sputum, saliva, cerebrospinal fluid or blood or a sample embedded in parrafin), it may be treated before amplification with an amount of a reagent effective to open the cells, fluids, tissues, or animal cell membranes of the sample, and to expose and/or separate the strand(s) of the nucleic acid(s).
  • a reagent effective to open the cells, fluids, tissues, or animal cell membranes of the sample, and to expose and/or separate the strand(s) of the nucleic acid(s). This lysing and nucleic acid denaturing step to expose and separate the strands will allow amplification to occur much more readily.
  • Strand separation can be effected either as a separate step or simultaneously with the synthesis of the primer extension products. This strand separation can be accomplished using various suitable denaturing conditions, including physical, chemical, or enzymatic means, the word “denaturing” includes all such means.
  • One physical method of separating nucleic acid strands involves heating the nucleic acid until it is denatured. Typical heat denaturation may involve temperatures ranging from about 80° to 105° C. for times ranging from about 1 to 10 minutes.
  • Strand separation may also be induced by an enzyme from the class of enzymes known as helicases or by the enzyme RecA, which has helicase activity, and in the presence of riboATP, is known to denature DNA.
  • an enzyme from the class of enzymes known as helicases or by the enzyme RecA which has helicase activity, and in the presence of riboATP, is known to denature DNA.
  • the reaction conditions suitable for strand separation of nucleic acids with helicases are described by Kuhn Hoffinann-Berling (CSH-Quantitative Biology, 43:63, 1978) and techniques for using RecA are reviewed in C. Radding ( Ann. Rev. Genetics , 16:405-437, 1982).
  • the separated strands are ready to be used as a template for the synthesis of additional nucleic acid strands.
  • This synthesis is performed under conditions allowing hybridization of primers to templates to occur. Generally synthesis occurs in a buffered aqueous solution, preferably at a pH of 7-9, most preferably about 8.
  • a molar excess for genomic nucleic acid, usually about 10 8 :1 primer:template
  • a molar excess for genomic nucleic acid, usually about 10 8 :1 primer:template
  • the amount of complementary strand may not be known if the process of the invention is used for diagnostic applications, so that the amount of primer relative to the amount of complementary strand cannot be determined with certainty.
  • the amount of primer added will generally be in molar excess over the amount of complementary strand (template) when the sequence to be amplified is contained in a mixture of complicated lona-chain nucleic acid strands. A large molar excess is preferred to improve the efficiency of the process.
  • the deoxyribonucleoside triphosphates dATP, dCTP, dGTP, and dTTP are added to the synthesis mixture, either separately or together with the primers, in adequate amounts and the resulting solution is heated to about 90°-100° C. from about 1 to 10 minutes, preferably from 1 to 4 minutes. After this heating period, the solution is allowed to cool to room temperature, which is preferable for the primer hybridization. To the cooled mixture is added an appropriate agent for effecting the primer extension reaction (called herein “agent for polymerization”), and the reaction is allowed to occur under conditions known in the art.
  • agent for polymerization may also be added together with the other reagents if it is heat stable.
  • This synthesis (or amplification) reaction may occur at room temperature up to a temperature above which the agent for polymerization no longer functions.
  • the temperature is generally no greater than about 40° C. Most conveniently the reaction occurs at room temperature.
  • the agent for polymerization may be any compound or system which will function to accomplish the synthesis of primer extension products, including enzymes.
  • Suitable enzymes for this purpose include, for example, E. coli DNA polymerase I, Klenow fragment of E.coli DNA polymerase I, T4 DNA polymerase, other available DNA polymerases, polymerase muteins, reverse transcriptase, and other enzymes, including heat-stable enzymes (i.e., those enzymes which perform primer extension after being subjected to temperatures sufficiently elevated to cause denaturation).
  • Suitable enzymes will facilitate combination of the nucleotides in the proper manner to form the primer extension products which are complementary to each locus nucleic acid strand.
  • the synthesis will be initiated at the 3′ end of each primer and proceed in the 5′ direction along the template strand, until synthesis terminates, producing molecules of different lengths.
  • nucleic acid hybridization reactions the conditions used to achieve a particular level of stringency will vary, depending on the nature of the nucleic acids being hybridized. For example, the length, degree of complementarity, nucleotide sequence composition (e.g., GC v. AT content), and nucleic acid type (e.g., RNA v. DNA) of the hybridizing regions of the nucleic acids can be considered in selecting hybridization conditions. An additional consideration is whether one of the nucleic acids is immobilized, for example, on a filter.
  • An example of progressively higher stringency conditions is as follows: 2 ⁇ SSC/0.1% SDS at about room temperature (hybridization conditions); 0.2 ⁇ SSC/0.1% SDS at about room temperature (low stringency conditions); 0.2 ⁇ SSC/0.1% SDS at about 42° C. (moderate stringency conditions); and 0.1 ⁇ SSC at about 68° C. (high stringency conditions). Washing can be carried out using only one of these conditions, e.g., high stringency conditions, or each of the conditions can be used, e.g., for 10-15 minutes each, in the order listed above, repeating any or all of the steps listed. However, as mentioned above, optimal conditions will vary, depending on the particular hybridization reaction involved, and can be determined empirically.
  • the method of amplifying is by PCR, as described herein and as is commonly used by those of ordinary skill in the art.
  • Alternative methods of amplification have been described and can also be employed as long as the methylated and non-methylated loci amplified by PCR using the primers of the invention is similarly amplified by the alternative means.
  • the amplified products are preferably identified as methylated or non-methylated by sequencing. Sequences amplified by the methods of the invention can be further evaluated, detected, cloned, sequenced, and the like, either in solution or after binding to a solid support, by any method usually applied to the detection of a specific DNA sequence such as PCR, oligomer restriction (Saiki, et al., Bio/Technology , 3:1008-1012, 1985), allele-specific oligonucleotide (ASO) probe analysis (Conner, et al., Proc. Natl. Acad. Sci.
  • ASO allele-specific oligonucleotide
  • OLAs oligonucleotide ligation assays
  • the methylation pattern of the nucleic acid can be confirmed by restriction enzyme digestion and Southern blot analysis.
  • methylation sensitive restriction endonucleases which can be used to detect 5′CpG methylation include SmaI, SacII, EagI, MspI, HpaII, BstUI and BssHII, for example.
  • the invention provides a method for detecting a cell having a methylated CpG island or a cell proliferative disorder associated with methylated CpG in a tissue or biological fluid of a subject, comprising contacting a target cellular component suspected of expressing a gene having a methylated CpG or having a CpG-associated disorder, with an agent which binds to the component.
  • the target cell component can be nucleic acid, such as DNA or RNA, or protein.
  • the reagent is a nucleic acid probe or PCR primer.
  • the reagent is an antibody probe.
  • the probes can be detectably labeled, for example, with a radioisotope, a fluorescent compound, a bioluminescent compound, a chemiluminescent compound, a metal chelator, or an enzyme.
  • a radioisotope for example, with a fluorescent compound, a bioluminescent compound, a chemiluminescent compound, a metal chelator, or an enzyme.
  • Those of ordinary skill in the art will know of other suitable labels for binding to the antibody, or will be able to ascertain such, using routine experimentation.
  • Actively transcribed genes generally contain fewer methylated CGs than the average number in DNA. Hypermethylation can be detected by restriction endonuclease treatment and Southern blot analysis. Therefore, in a method of the invention, when the cellular component detected is DNA, restriction endonuclease analysis is preferable to detect hypermethylation of the promoter for example. Any restriction endonuclease that includes CG as part of its recognition site and that is inhibited when the C is methylated, can be utilized.
  • the methylation sensitive restriction endonuclease is BssHII, MspI, or HpaII, used alone or in combination. Other methylation sensitive restriction endonucleases will be known to those of skill in the art.
  • an antibody or nucleic acid probe specific for a gene or gene product may be used to detect the presence of methylation either by detecting the level of polypeptide (using antibody) or methylation of the polynucleotide (using nucleic acid probe) in biological fluids or tissues.
  • the level of the polypeptide is compared with the level of polypeptide found in a corresponding “normal” tissue.
  • Oligonucleotide primers based on any coding sequence region of the promoter in the TIMP-2, estrogen receptor, GST-pi, calcitonin, HIC-1 or MLH1 sequence, for example, are useful for amplifying DNA, for example by PCR. These genes are merely listed as examples and are not meant to be limiting. Any specimen containing a detectable amount of polynucleotide or antigen can be used. Preferably the subject is human.
  • the present invention provides the finding that TIMP-2 is methylated in cancer tissue as compared to normal tissue.
  • TIMP-2 was found to be methylated in colon cancer tissue but not in normal colon tissue.
  • the method for detecting a cell expressing a gene such as TIMP-2, or a cell proliferative disorder associated with methylation of CpG containing TIMP-2, or any gene including those described above can be utilized for detection of residual cancer or other malignancies in a subject in a state of clinical remission.
  • the method for detecting polypeptide in cells is useful for detecting a cell proliferative disorder by measuring the level of polypeptide in cells expressing the polypeptide, in a suspect tissue in comparison with the polypeptide expressed in normal cells or tissue.
  • any gene such as TIMP-2
  • the appropriate course of treatment can be employed (e.g., sense gene therapy or drug therapy).
  • the expression pattern of the gene e.g., TIMP-2
  • a sample such as breast or colon tissue can be screened with a panel of gene or gene product specific reagents (i.e., nucleic acid probes or antibodies) to detect gene expression, e.g., TIMP-2, and diagnose the stage of malignancy of the cell.
  • Monoclonal antibodies can be used in the method of the invention, for example, in immunoassays in liquid phase or bound to a solid phase carrier.
  • the monoclonal antibodies in these immunoassays can be detectably labeled in various ways.
  • types of immunoassays which can utilize monoclonal antibodies of the invention are competitive and non-competitive immunoassays in either a direct or indirect format.
  • examples of such inimunoassays are the radioimmunoassay (RIA) and the sandwich (immunometric) assay.
  • Detection of the antigens using the monoclonal antibodies of the invention can be done utilizing immunoassays which are run in either the forward, reverse, or simultaneous modes, including immunohistochemical assays on physiological samples. Those of skill in the art will know, or can readily discern, other immunoassay formats without undue experimentation.
  • immunometric assay or “sandwich immunoassay”, includes simultaneous sandwich, forward sandwich and reverse sandwich immunoassays. These terms are well understood by those skilled in the art. Those of skill will also appreciate that antibodies according to the present invention will be useful in other variations and forms of assays which are presently known or which may be developed in the future. These are intended to be included within the scope of the present invention.
  • Monoclonal antibodies can be bound to many different carriers and used to detect the presence of TIMP-2.
  • carriers include glass, polystyrene, polypropylene, polyethylene, dextran, nylon, amylases, natural and modified celluloses, polyacrylamides, agaroses and magnetite.
  • the nature of the carrier can be either soluble or insoluble for purposes of the invention. Those skilled in the art will know of other suitable carriers for binding monoclonal antibodies, or will be able to ascertain such using routine experimentation.
  • TIMP-2 may be detected by the monoclonal antibodies when present in biological fluids and tissues. Any sample containing a detectable amount of TIMP-2 can be used.
  • a sample can be a liquid such as ejaculate, urine, saliva, cerebrospinal fluid, blood, serum and the like, or a solid or semi-solid such as tissues, feces, and the like, or, alternatively, a solid tissue such as those commonly used in histological diagnosis.
  • blockingers In performing the assays it may be desirable to include certain “blockers” in the incubation medium (usually added with the labeled soluble antibody).
  • the “blockers” are added to assure that non-specific proteins, proteases, or anti-heterophilic immunoglobulins to anti-TIMP-2 immunoglobulins present in the experimental sample do not cross-link or destroy the antibodies on the solid phase support, or the radiolabeled indicator antibody, to yield false positive or false negative results.
  • the selection of “blockers” therefore may add substantially to the specificity of the assays described in the present invention.
  • the detectably labeled monoclona I antibody is given in a dose which is diagnostically effective.
  • diagnostically effective means that the amount of detectably labeled monoclonal antibody is administered in sufficient quantity to enable detection of the site having the TIMP-2 antigen for which the monoclonal antibodies are specific.
  • the concentration of detectably labeled monoclonal antibody which is administered should be sufficient such that the binding to those cells having TIMP-2 is detectable compared to the background. Further, it is desirable that the detectably labeled monoclonal antibody be rapidly cleared from the circulatory system in order to give the best target-to-background signal ratio.
  • the dosage of detectably labeled monoclonal antibody for in vivo diagnosis will vary depending on such factors as age, sex, and extent of disease of the individual.
  • the dosage of monoclonal antibody can vary from about 0.001 mg/m 2 to about 500 mg/m 2 , preferably 0.1 mg/m 2 to about 200 mg/m 2 , most preferably about 0.1 mg/m 2 to about 10 mg/m 2 .
  • Such dosages may vary, for example, depending on whether multiple injections are given, tumor burden, and other factors known to those of skill in the art.
  • the type of detection instrument available is a major factor in selecting a given radioisotope.
  • the radioisotope chosen must have a type of decay which is detectable for a given type of instrument.
  • Still another important factor in selecting a radioisotope for in vivo diagnosis is that the half-life of the radioisotope be long enough so that it is still detectable at the time of maximum uptake by the target, but short enough so that deleterious radiation with respect to the host is minimized.
  • a radioisotope used for in vivo imaging will lack a particle emission, but produce a large number of photons in the 140-250 keV range, which may be readily detected by conventional gamma cameras.
  • a monoclonal antibody usefuil in the method of the invention can also be labeled with a paramagnetic isotope for purposes of in vivo diagnosis, as in magnetic resonance imaging (MRI) or electron spin resonance (ESR).
  • MRI magnetic resonance imaging
  • ESR electron spin resonance
  • any conventional method for visualizing diagnostic imaging can be utilized.
  • gamma and positron emitting radioisotopes are used for camera imaging and paramagnetic isotopes for MRI.
  • Elements which are particularly useful in such techniques include 157 Gd, 55 Mn, 162 Dry, 52 Cr, and 56 Fe.
  • Monoclonal antibodies used in the method of the invention can be used to monitor the course of amelioration of TIMP-2 associated cell proliferative disorder.
  • TIMP-2 associated cell proliferative disorder By measuring the increase or decrease in the number of cells expressing TIMP-2 or changes in TIMP-2 present in various body fluids, it would be possible to determine whether a particular therapeutic regiment aimed at ameliorating the disorder is effective.
  • the term “modulate” envisions the suppression of methylation of TIMP-2 (e.g., promoter) or augmentation of TIMP-2 gene expression when TIMP-2 is under-expressed.
  • TIMP-2 e.g., promoter
  • methylation suppressive reagents as 5-azacytadine can be introduced to a cell.
  • a sense polynucleotide sequence the DNA coding strand
  • TIMP-2 polypeptide can be introduced into the cell.
  • the present invention also provides gene therapy for the treatment of cell proliferative disorders which are mediated by TIMP-2.
  • Such therapy would achieve its therapeutic effect by introduction of the appropriate TIMP-2 polynucleotide which contains either a normal TIMP-2 promoter region alone or in combination with a TIMP-2 structural gene (sense), into cells of subjects having the proliferative disorder.
  • the TIMP-2 structural gene could be introduced operably linked to a heterologous promoter. Delivery of sense TIMP-2 promoter polynucleotide constructs can be achieved using a recombinant expression vector such as a chimeric virus or a colloidal dispersion system.
  • the promoter polynucleotide sequences used in the method of the invention may be the native, unmethylated sequence or, alternatively, may be a sequence in which a nonmethylatable analog is substituted within the sequence.
  • the analog is a nonmethylatable analog of cytidine, such as 5-azacytadine.
  • Other analogs will be known to those of skill in the art.
  • such nonmethylatable analogs could be administered to a subject as drug therapy, alone or simultaneously with a sense promoter for TIMP-2 or a sense promoter operably linked with the structural gene for the corresponding gene (e.g., TIMP-2 promoter with TIMP-2 structural gene).
  • the invention also relates to a medicament or pharmaceutical composition
  • a medicament or pharmaceutical composition comprising a TIMP-2 promoter polynucleotide or a TIMP-2 promoter polynucleotide operably linked to the TIMP-2 structural gene, respectively, in a pharmaceutically acceptable excipient or medium wherein the medicament is used for therapy of TIMP-2 associated cell proliferative disorders.
  • MSP can be used to detect methylation of DNA in the nucleus of an intact cell.
  • a tissue section, a cell or population of cells is placed or immobilized on a solid support (e.g., a slide) and MSP primers used directly on the cell for amplification of the appropriate sequences.
  • the primers are typically detectably labeled with a reporter means, e.g., fluorescent label.
  • a probe that detects or hybridizes with the MSP amplified sequences is used to detect amplification of methylated sequences.
  • MSP In situ methylation analysis using MSP is useful, for example, in detecting nucleic acid having a mutant nucleotide sequence associated with a primary tumor in the adjacent histopathologic surgical margins and more distant tissues, such as regional lymph nodes, which are apparently “normal” when examined by standard histological techniques.
  • MSP it is possible to detect target nucleic acids from cells previously associated with a large number of disease states which are present in tissue that appears normal.
  • MSP in situ can be used as an adjunct to cytopathology, to screen high-risk populations and to monitor high risk patients undergoing chemoprevention or chemotherapy.
  • Exemplary target polynucleotide sequences to which the primer of the invention hybridizes have a sequence as listed below.
  • Exemplary primer pairs included in the invention that hybridize to the above sequences include:
  • the CpG-containing nucleic acid is in the region of the promoter of a structural gene.
  • the promoter region of tumor suppressor genes have been identified as containing methylated CpG island.
  • the promoter region of tumor suppressor genes including p16, p15, VHL and E-cadherin, are typically the sequence amplified by PCR in the method of the invention.
  • Other genes that have been shown by MSP as containing methylated CpG neoplastic versus normal tissue include estrogen receptor, MDGI, GST-pi, calcitonin, HIC-1, endothelin B receptor, TIMP-2, 06-MGMT, and MLH1.
  • Genes that were found by MSP to be methylated also include the androgen receptor (e.g., methylated as X chromosome inactivation), GFAP (methylated in some glioma cell lines but also in normal tissue), and MSH2.
  • androgen receptor e.g., methylated as X chromosome inactivation
  • GFAP methylated in some glioma cell lines but also in normal tissue
  • MSH2 Other genes in which MSP primer were shown to distinguish between normal unmethylated and methylated DNA include TGF- ⁇ 1, TGF- ⁇ 2, p130, BRCA2, NF1, NF2, and TSG101.
  • Detection and identification of methylated CpG-containing nucleic acid in the specimen may be indicative of a cell proliferative disorder or neoplasia.
  • Such disorders include but are not limited to low grade astrocytoma, anaplastic astrocytoma, glioblastoma, medulloblastoma, colon cancer, lung cancer, renal cancer, leukemia, breast cancer, prostate cancer, endometrial cancer and neuroblastoma.
  • Identification of methylated CpG status is also useful for detection and diagnosis of genomic imprinting, fragile X syndrome and X-chromosome inactivation.
  • the TIMP-2 gene was identified as associated with or methylated in neoplastic versus normal tissues.
  • the method of the invention now provides the basis for a kit useful for the detection of a methylated CpG-containing nucleic acid.
  • the kit includes a carrier means being compartmentalized to receive in close confinement therein one or more containers.
  • a first container contains a reagent which modifies unmethylated cytosine, such as sodium bisulfite.
  • a second container contains primers for amplification of the CpG-containing nucleic acid, for example, primers listed above as SEQ ID NO:105-208.
  • the invention also provides a kit for the detection of a methylated CpG-containing nucleic acid, wherein the kit includes: a) a reagent that modifies unmethylated cytosine nucleotides; b) control nucleic acid; c) primers for the amplification of unmethylated CpG-containing nucleic acid; d) primers for the amplification of methylated CpG-containing nucleic acid; and e) primers for the amplification of control nucleic acid.
  • the kit may further include nucleic acid amplification buffer.
  • the reagent that modifies unmethylated cytosine is bisulfite.
  • the kit of the invention is intended to provide the reagents necessary to perform chemical modification and PCR amplification of DNA samples to determine their methylation status.
  • the primer sets included in the kit include a set that anneals to unmethylated DNA that has undergone a chemical modification; a set that anneals to methylated DNA that has undergone a chemical modification; and a primer set that serves as a control for the efficiency of chemical modification.
  • the control primer set should anneal to any DNA (unmethylated or methylated) that has not undergone chemical methylation. In the case of incomplete chemical modification (up to about 50%), data interpretation can still proceed.
  • Genomic DNA was obtained from cell lines, primary tumors and normal tissue as described (Merlo, et al., Nature Medicine , 1:686, 1995; Herman, et al., Cancer Research , 56:722, 1996; Graff, et al., Cancer Research , 55:5195, 1995).
  • the renal carcinoma cell line was kindly provided by Dr. Michael Lehrman of the National Cancer Institute, Bethesda, Md.
  • Genomic Sequencing Genomic sequencing of bisulfite modified DNA was accomplished using the solid-phase DNA sequencing approach (Myohanen, et al., DNA Seq., 5:1, 1994). 100 ng of bisulfite modified DNA was amplified with p16 gene specific primer 5′-TTTTTAGAGGATTTGAGGGATAGG-3′ (sense) (SEQ ID NO:209) and 5′-CTACCTAATTCCAATTCCCCTACA-3′ (anti-sense) (SEQ ID NO:210). PCR conditions were as follows: 96° C. for 3 minutes, 80° C. for 3 minutes, 1 U of Taq polymerase (BRL) was added, followed by 35 cycles of 96° C. for 20 seconds, 56° C.
  • the PCR mixture contained 1 ⁇ buffer (BRL) with 1.5 mM MgCl 2 , 20 pmols of each primer and 0.2 mM dNTPs.
  • BBL buffer
  • a second round of PCR was performed with 5 pmols of nested primers.
  • the sense primer the primer for sequencing
  • 5′-GTTTTCCCAGTCACGACAGTATTAGGAGGAAGAAAGAGGAG-3′ contains M13-40 sequence (underlined) introduced as a site to initiate sequencing, and the anti-sense primer
  • 5′-TCCAATTCCCCTACAAACTTC-3′′ (SEQ ID NO:212) is biotinylated to facilitate purification of the product prior to sequencing.
  • PCR was performed as above, for 32 cycles with 2.5 mm MgCl 2 . All primers for genomic sequencing were designed to avoid any CpGs in the sequence.
  • Biotinylated PCR products were purified using streptavidin coated magnetic beads (Dynal AB, Norway), and sequencing reactions performed with SequenaseTM and M13-40 sequencing primer under conditions specified by the manufacturer (USB).
  • PCR Amplification Primer pairs described in Table 1 were purchased from Life Technologies.
  • the PCR mixture contained 1 ⁇ PCR buffer (16.6 mM ammonium sulfate, 67 mM TRIS pH 8.8, 6.7 mM MgCl 2 , and 10 mM ⁇ -mercaptoethanol), dNTPs (each at 1.25 mM), primers (300 ng/reaction each), and bisulfite-modified DNA ( ⁇ 50 ng) or unmodified DNA (50-110 ng) in a final volume of 50 ⁇ L.
  • PCR specific for unmodified DNA also included 5% dimethylsulfoxide. Reactions were hot started at 95° C.
  • Taq polymerase BRL
  • Amplification was carried out on a Hybaid OmniGene temperature cycler for 35 cycles (30 seconds at 95° C., 30 seconds at the annealing temperature listed in Table 1, and 30 seconds at 72° C.), followed by a final 4 minute extension at 72° C. Controls without DNA were performed for each set of PCR reactions. 10 ⁇ L of each PCR reaction was directly loaded onto non-denaturing 6-8% polyacrylamide gels, stained with ethidium bromide, and directly visualized under UV illumination.
  • FIG. 1 shows genomic sequencing of p16.
  • the sequence shown has the most 5′ region at the bottom of the gel, beginning at +175 in relation to a major transcriptional start site (Hara, et al., Mol. Cell Biol ., 16:859, 1996). All cytosines in the unmethylated cell line H249 have been converted to thymidine, while all C's in CpG dinucleotides in the methylated cell H157 remains as C, indicating methylation.] enclosed a BstUI site which is at ⁇ 59 in relation to the transnational start site in Genbank sequence U12818 (Hussussian, et al., Nat. Genet ., 8:15, 1994), but which is incorrectly identified as CGCA in sequence X94154 (Hara, et al., supra). This CGCG site represents the 3′ location of the sense primer used for p16 MSP.
  • Primers were designed to discriminate between methylated and unmethylated alleles following bisulfite treatment, and to discriminate between DNA modified by bisulfite and that which had not been modified. To accomplish this, primer sequences were chosen for regions containing frequent cytosines (to distinguish unmodified from modified DNA), and CpG pairs near the 3′ end of the primers (to provide maximal discrimination in the PCR reaction between methylated and unmethylated DNA). Since the two strands of DNA are no longer complementary after bisulfite treatment, primers can be designed for either modified strand. For convenience, primers were designed for the sense strand.
  • the fragment of DNA to be amplified was intentionally small, to allow the assessment of methylation patterns in a limited region and to facilitate the application of this technique to samples, such as paraffin blocks, where amplification of larger fragments is not possible.
  • Table 1 primer sequences are shown for all genes tested, emphasizing the differences in sequence between the three types of DNA which are exploited for the specificity of MSP. The multiple mismatches in these primers which are specific for these different types of DNA suggest that each primer set should provide amplification only from the intended template.
  • the primers designed for p16 were tested with DNA from cancer cell lines and normal tissues for which the methylation status had previously been defined by Southern analysis (Merlo, et al., supra; Herman, et al., supra).
  • FIG. 2 panels A-D, show polyacrylamide gels with the Methylation Specific PCR products of p16.
  • Primer sets used for amplification are designated as unmethylated (U), methylated (M), or unmodified/wild-type (W).
  • * designates the molecular weight marker pBR322-MspI digest.
  • Panel A shows amplification of bisulfite-treated DNA from cancer cell lines and normal lymphocytes, and untreated DNA (from cell line H249).
  • Panel B shows mixing of various amount of H157 DNA with 1 ⁇ g of H249 DNA prior to bisulfite treatment to assess the detection sensitivity of MSP for methylated alleles. Modified DNA from a primary lung cancer sample and normal lung are also shown.
  • Panel C shows amplification with the p16-U2 (U) primers, and p16-M2 (M) described in Table 1.
  • Panel D shows the amplified p16 products of panel C restricted with BstUI(+) or not restricted (
  • the primer set used confirmed the methylation status determined by Southern analysis.
  • lung cancer cell lines U1752 and H157, as well other cell lines methylated at p16 amplified only with the methylated primers (FIG. 2, panel A).
  • DNA not treated with bisulfite (unmodified) failed to amplify with either set of methylated or unmethylated specific primers, but readily amplified with primers specific for the sequence prior to modification (FIG. 2, panel A).
  • DNA from the cell line H157 after bisulfite treatment also produced a weaker amplification with unmodified primers, suggesting an incomplete bisulfite reaction.
  • this unmodified DNA unlike partially restricted DNA in previous PCR assays relying on methylation sensitive restriction enzymes, is not recognized by the primers specific for methylated DNA. It therefore does not provide a false positive result or interfere with the ability to distinguish methylated from unmethylated alleles.
  • the sensitivity of MSP for detection of methylated p16 alleles was assessed. DNA from methylated cell lines was mixed with unmethylated DNA prior to bisulfite treatment. 0.1% of methylated DNA (approximately 50 pg) was consistently detected in an otherwise unmethylated sample (FIG. 2, panel B). The sensitivity limit for the amount of input DNA was determined to be as little as 1 ng of human DNA, mixed with salmon sperm DNA as a carrier detectable by MSP.
  • both the upper (sense) and lower (antisense) primers contained CpG sites which could produce methylation-dependent sequence differences after bisulfite treatment.
  • MSP might be employed to examine more regional aspects of CpG island methylation. To examine this, methylation-dependent differences in the sequence of just one primer was tested to determine whether it would still allow discrimination between unmethylated and methylated p16 alleles.
  • the antisense primer used for genomic sequencing 5′-CTACCTAATTCCAATTCCCCTACA-3′ (SEQ ID NO:213), was also used as the antisense primer, since the region recognized by the primer contains no CpG sites, and was paired with either a methylated or unmethylated sense primer (Table 1). Amplification of the 313 bp PCR product only occurred with the unmethylated sense primer in H209 and H249 (unmethylated by Southern) and the methylated sense primer in H157 and U1752 (methylated by Southern), indicating that methylation of CpG sites within a defined region can be recognized by specific primers and distinguish between methylated and unmethylated alleles (FIG. 2, panel E).
  • Panel E shows results of testing for regional methylation of CpG islands with MSP, using sense primers p16-U2 (U) and p16-M2 (M), which are methylation specific, and an antisense primer which is not methylation specific.
  • FIG. 3 panels A-E, show polyacrylamide gels of MSP products from analysis of several genes. Primer sets used for amplification are not designated as unmethylated (U), methylated (M), or unmodified/wild-type (W). * designates the molecular weight marker pBR322-MspI digest and ** designates the 123 bp molecular weight marker. All DNA samples were bisulfite treated except those designated untreated.
  • Panel A shows the results from MSP for p15.
  • Panel B shows the p15 products restricted with BstUI (+) or not restricted ( ⁇ ).
  • Panel C shows the products of MSP for VHL.
  • Panel D shows the VHL products restricted with BstUI(+) or not restricted ( ⁇ ).
  • Panel E shows the products of MSP for E-cadherin.
  • the cyclin-dependent kinase inhibitor p15 is aberrantly methylated in many leukemic cell lines and primary leukemias (Herman, et al., supra).
  • MSP again verified the methylation status determined by Southern analysis.
  • normal lymphocytes and cancer cell lines SW48 and U1752 all unmethylated by Southern analysis (Herman, et al., supra), only amplified with the unmethylated set of primers, while the lung cancer cell line H1618 and leukemia cell line KG1A amplified only with the methylated set of primers (FIG. 3, panel A), consistent with previous Southern analysis results (Herman, et al., supra).
  • the cell line Raji produced a strong PCR product with methylated primers and a weaker band with unmethylated primers. This was the same result for methylation obtained previously by Southern analysis (Herman, et al., supra).
  • Non-cultured leukemia samples like the primary tumors studied for p16, had amplification with the methylated primer set as well as the unmethylated set. This heterogeneity also matched Southern analysis (Herman, et al., supra).
  • differential modification of BstUI restriction sites in the amplified product of p15 was used to verify the specific amplification by MSP (FIG. 3, panel B).
  • VHL tumor suppressor gene Aberrant CpG island promoter region methylation is associated with inactivation of the VHL tumor suppressor gene in approximately 20% of clear renal carcinomas (Herman, et al., Proc. Natl. Acad. Sci. USA , 91:9700, 1994). This event, like mutations for VHL (Gnarra, et al., Nature Genetics , 7:85, 1994), is restricted to clear renal cancers (Herman, et al., supra). Primers designed for the VHL sequence were used to study DNA from the renal cell cancer line RFX393 which is methylated at VHL by Southern analysis, and the lung cancer cell line U1752 which is unmethylated at this locus (Herman, et al., supra). In each case, the methylation status of VHL determined by MSP confirmed that found by Southern analysis (FIG. 3, panel C), and BstUI restriction site analysis validated the PCR product specificity (FIG. 3, panel D).
  • E-cadherin The expression of the invasion/metastasis suppressor gene, E-cadherin, is often silenced by aberrant methylation of the 5′ promoter in breast, prostate, and many other carcinomas (Graff, et al., supra; Yoshira, et al., Proc. Natl. Acad. Sci. USA , 92:7416, 1995). Primers were designed for the E-cadherin promoter region to test the use of MSP for this gene. In each case, MSP analysis paralleled Southern blot analysis for the methylation status of the gene (Graff, et al., supra).
  • BstUI restriction analysis again confirmed the specificity of the PCR amplification.
  • Genomic position is the location of the 5′ nucleotide of the sense primer in relation to the major transcriptional start site defined in the following references and Genbank accession numbers: p16(most 3′ site) X94154 (E. Hara, et al., Mol. Cell Biol., 16 : 859 1996), p15 S75756 (J. Jen, et al., Cancer Res., 54 : 6353 1994), VHL U19763 (I. Kuzmin, et al., Oncogene, 10 : 2185 1995), and E-cadherin # L34545 (M. J. Bussemakers, et al., Biochem. Biophys. Res. Commun., 203 : 1284 1994).
  • ⁇ W represents unmodified, or wild-type primers
  • M represents methylated-specific primers
  • U unmethylted-specific primers.
  • U57623 1134 Un 5′ttttttattttgggagttgggggt 5′aaacatacaaaactccaacaaca 113 bp 60° C.
  • U57623 1131 GST Me 5′ttcggggtgtagcggtcgtc 5′gccccaatactaaaatcacgacg 91 bp 60° C.
  • X08058 1082 Un 5′gatgtttggggtgtagtggttgtt 5′ccaccccaatactaaaatcacaaca 97 bp 60° C.
  • X08058 1078 Calci- Me 5′cgggaataagagtagtcgttggc 5′caaaaccctataaaaacgacgacg 84 bp 60° C.
  • U26559 218 Un 5′ttttgatgtagatgttttattagggttgt 5′accacctcatcataactacccaca 124 bp 60° C.
  • U26559 213 MLH1-b ME 5′ttttggcgttaaaatgtcgttc 5′taaataacttccccgccg 91 bp 60° C.
  • U26559 920 Un 5′ggttttttggtgttaaaatgttgttt 5′ccactaaataacttcccccaccacca 99 bp 60° C.
  • U41206 128 Un 5′ggttgttgtggttggatgttgttt 5′caactacaacatctccttcaactacacca 143 60° C.
  • M67446 2092 Un 5′tgttgttaggggtatttgggtatt 5′tcccctaaaaaacataaaaacaaca 143 bp 60° C. M67446 2091 TGF ⁇ 1 Me 5′tgggttcgtttggtagttcgc 5′cctcctaaccgccgcg 124 bp 57° C.
  • U51139 1223 Un 5′ggttgggtttgttggtagtttgt 5′cccacctcctaaccaccaca 131 bp 57° C.
  • U51139 1220 TGF ⁇ 2 Me 5′cgacgatattttcgcgc 5′aaaccgacgaacgcg 97 bp 57° C.
  • U52240 72 Un 5′gtatggagtgatgatattttgtgt 5′acctaaaaaccaacaaacaca 111 bp 57° C.
  • U53220 2076 Un 5′tgggtgtttgtaggtggttagtgtt 5′aacataacacacccctaaacaacca 145 bp 55° C.
  • U53220 2072 BRCA2 Me 5′gcggtagaggcggagtc 5′cgaaataaactaacaaaaccg 136 bp 55° C.
  • X95151 292 Un 5′attaggtggtagaggtggagtggagtt 5′ccaaaataaactaacaaaacca 142 bp 55° C.
  • U17084 3336 Un 5′gagttttatggtgttgagggatgttt 5′aaaaaaaaaacaacctaccacacataca 134 bp 60° C.
  • U17084 3331 NF2 Me 5′gtttcgggtttgagtttcgc 5′ataataacgatcctcacgataaacg 109 bp 55° C.
  • L27131 38 Un 5′gggttttgggtttgagttttgt 5′ccataataacaatcctcacaataaaca 113 bp 55° C.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Immunology (AREA)
  • Analytical Chemistry (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Pathology (AREA)
  • Oncology (AREA)
  • Hospice & Palliative Care (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Investigating Or Analyzing Materials By The Use Of Fluid Adsorption Or Reactions (AREA)
  • Photoreceptors In Electrophotography (AREA)

Abstract

The present invention provides a method for detecting a methylated CpG-containing nucleic acid present in a specimen by contacting the specimen with an agent that modifies unmethylated cytosine and amplifying the CpG-containing nucleic acid using CpG-specific oligonucleotide primers. The present invention provides an improved method of methylation detection by facilitating the rapid identification of DNA methylation patterns in a CpG-containing nucleic acid.

Description

This application is a continuation of U.S. application Ser. No. 08/835,728, filed Apr. 11, 1997, issued on Jan. 25, 2000 as U.S. Pat. No. 6,017,704; which is a continuation-in-part of U.S. application Ser. No. 08/656,716, filed Jun. 3, 1996, issued on Jul. 28, 1998 as U.S. Pat. No. 5,786,146; the entire contents of which are hereby incorporated herein by reference.
FIELD OF THE INVENTION
The present invention relates generally to regulation of gene expression, and more specifically to a method of determining the DNA methylation status of CpG sites in a given locus.
BACKGROUND OF THE INVENTION
In higher order eukaryotes DNA is methylated only at cytosines located 5′ to guanosine in the CpG dinucleotide. This modification has important regulatory effects on gene expression, especially when involving CpG rich areas, known as CpG islands, located in the promoter regions of many genes. While almost all gene-associated islands are protected from methylation on autosomal chromosomes, extensive methylation of CpG islands has been associated with transcriptional inactivation of selected imprinted genes and genes on the inactive X-chromosome of females. Abberant methylation of normally unmethylated CpG islands has been described as a frequent event in immortalized and transformed cells, and has been associated with transcriptional inactivation of defined tumor suppressor genes in human cancers.
Human cancer cells typically contain somatically altered genomes, characterized by mutation, amplification, or deletion of critical genes. In addition, the DNA template from human cancer cells often displays somatic changes in DNA methylation (E. R. Fearon, et al., Cell, 61:759, 1990; P. A. Jones, et al., Cancer Res., 46:461, 1986; R. Holliday, Science, 238:163, 1987; A. De Bustros, et al., Proc. Natl. Acad. Sci., USA, 85:5693, 1988); P. A. Jones, et al., Adv. Cancer Res., 54:1, 1990; S. B. Baylin, et al., Cancer Cells, 3:383, 1991; M. Makos, et al., Proc. Natl. Acad Sci., USA, 89:1929, 1992; N. Ohtani-Fujita, et al., Oncogene, 8:1063, 1993). However, the precise role of abnormal DNA methylation in human tumorigenesis has not been established. DNA methylases transfer methyl groups from the universal methyl donor S-adenosyl methionine to specific sites on the DNA. Several biological functions have been attributed to the methylated bases in DNA. The most established biological function is the protection of the DNA from digestion by cognate restriction enzymes. The restriction modification phenomenon has, so far, been observed only in bacteria. Mammalian cells, however, possess a different methylase that exclusively methylates cytosine residues on the DNA, that are 5′ neighbors of guanine (CpG). This methylation has been shown by several lines of evidence to play a role in gene activity, cell differentiation, tumorigenesis, X-chromosome inactivation, genomic imprinting and other major biological processes (Razin, A., H., and Riggs, R. D. eds. in DNA Methylation Biochemistry and Biological Significance, Springer-Verlag, New York, 1984).
A CpG rich region, or “CpG island”, has recently been identified at 17p13.3, which is aberrantly hypermethylated in multiple common types of human cancers (Makos, M., et al., Proc. Natl. Acad. Sci. USA, 89:1929, 1992; Makos, M., et al., Cancer Res., 53:2715, 1993; Makos, M., et al., Cancer Res. 53:2719, 1993). This hypermethylation coincides with timing and frequency of 17p losses and p53 mutations in brain, colon, and renal cancers. Silenced gene transcription associated with hypermethylation of the normally unmethylated promoter region CpG islands has been implicated as an alternative mechanism to mutations of coding regions for inactivation of tumor suppressor genes (Baylin, S. B., et al., Cancer Cells, 3:383, 1991; Jones, P. A. and Buckley, J. D., Adv. Cancer Res., 54:1-23, 1990). This change has now been associated with the loss of expression of VHL, a renal cancer tumor suppressor gene on 3p (J. G. Herman, et al., Proc. Natl. Acad. Sci. USA, 91:9700-9704, 1994), the estrogen receptor gene on 6q (Ottaviano, Y. L., et al., Cancer Res., 54:2552, 1994) and the H19 gene on 11p (Steernan, M. J. C., et al., Nature Genetics, 7:433, 1994).
In eukaryotic cells, methylation of cytosine residues that are immediately 5′ to a guanosine, occurs predominantly in CG poor regions (Bird, A., Nature, 321:209, 1986). In contrast, discrete regions of CG dinucleotides called CpG islands remain unmethylated in normal cells, except during X-chromosome inactivation (Migeon, et al., supra) and parental specific imprinting (Li, et al., Nature, 366:362, 1993) where methylation of 5′ regulatory regions can lead to transcriptional repression. De novo methylation of the Rb gene has been demonstrated in a small fraction of retinoblastomas (Sakai, et al, Am. J. Hum. Genet., 48:880, 1991), and recently, a more detailed analysis of the VHL gene showed aberrant methylation in a subset of sporadic renal cell carcinomas (Herman, et al., Proc. Natl. Acad. Sci., U.S.A., 91:9700, 1994). Expression of a tumor suppressor gene can also be abolished by de novo DNA methylation of a normally unmethylated 5′ CpG island (Issa, et al., Nature Genet., 7:536, 1994; Herman, et al., supra; Merlo, et al., Nature Med., 1:686, 1995; Herman, et al., Cancer Res., 56:722, 1996; Graff, et al., Cancer Res., 55:5195, 1995; Herman, et al., Cancer Res., 55:4525, 1995).
Most of the methods developed to date for detection of methylated cytosine depend upon cleavage of the phosphodiester bond alongside cytosine residues, using either methylation-sensitive restriction enzymes or reactive chemicals such as hydrazine which differentiate between cytosine and its 5-methyl derivative. The use of methylation-sensitive enzymes suffers from the disadvantage that it is not of general applicability, since only a limited proportion of potentially methylated sites in the genome can be analyzed. Genomic sequencing protocols which identify a 5-MeC residue in genomic DNA as a site that is not cleaved by any of the Maxam Gilbert sequencing reactions, are a substantial improvement on the original genomic sequencing method, but still suffer disadvantages such as the requirement for large amount of genomic DNA and the difficulty in detecting a gap in a sequencing ladder which may contain bands of varying intensity.
Mapping of methylated regions in DNA has relied primarily on Southern hybridization approaches, based on the inability of methylation-sensitive restriction enzymes to cleave sequences which contain one or more methylated CpG sites. This method provides an assessment of the overall methylation status of CpG islands, including some quantitative analysis, but is relatively insensitive, requires large amounts of high molecular weight DNA and can only provide information about those CpG sites found within sequences recognized by methylation-sensitive restriction enzymes. A more sensitive method of detecting methylation patterns combines the use of methylation-sensitive enzymes and the polymerase chain reaction (PCR). After digestion of DNA with the enzyme, PCR will amplify from primers flanking the restriction site only if DNA cleavage was prevented by methylation. Like Southern-based approaches, this method can only monitor CpG methylation in methylation-sensitive restriction sites. Moreover, the restriction of unmethylated DNA must be complete, since any uncleaved DNA will be amplified by PCR yielding a false positive result for methylation. This approach has been useful in studying samples where a high percentage of alleles of interest are methylated, such as the study of imprinted genes and X-chromosome inactivated genes. However, difficulties in distinguishing between incomplete restriction and low numbers of methylated alleles make this approach unreliable for detection of tumor suppressor gene hypermethylation in small samples where methylated alleles represent a small fraction of the population.
Another method that avoids the use of restriction endonucleases utilizes bisulfite treatment of DNA to convert all unmethylated cytosines to uracil. The altered DNA is amplified and sequenced to show the methylation status of all CpG sites. However, this method is technically difficult, labor intensive and without cloning amplified products, it is less sensitive than Southern analysis, requiring approximately 10% of the alleles to be methylated for detection.
Identification of the earliest genetic changes in tumorigenesis is a major focus in molecular cancer research. Diagnostic approaches based on identification of these changes are likely to allow implementation of early detection strategies and novel therapeutic approaches targeting these early changes might lead to more effective cancer treatment.
SUMMARY OF THE INVENTION
The precise mapping of DNA methylation patterns in CpG islands has become essential for understanding diverse biological processes such as the regulation of imprinted genes, X-chromosome inactivation, and tumor suppressor gene silencing in human cancer. The present invention provides a method for rapid assessment of the methylation status of any group of CpG sites within a CpG island, independent of the use of methylation-sensitive restriction enzymes. Despite the knowledge of those of skill in the art regarding the use of PCR and the use of bisulfite modification, independently, until the present invention, no one had prepared primers that were specific for the bisulfite reaction such that the PCR reaction itself was used to distinguish between the chemically modified methylated and unmethylated DNA.
The method of the invention includes modification of DNA by sodium bisulfite or a comparable agent which converts all unmethylated but not methylated cytosines to uracil, and subsequent amplification with primers specific for methylated versus unmethylated DNA. This method of “methylation specific PCR” or MSP, requires only small amounts of DNA, is sensitive to 0.1% of methylated alleles of a given CpG island locus, and can be performed on DNA extracted from paraffin-embedded samples, for example. MSP eliminates the false positive results inherent to previous PCR-based approaches which relied on differential restriction enzyme cleavage to distinguish methylated from unmethylated DNA.
In a particular aspect of the invention, MSP is useful for identifying promoter region hypermethylation changes associated with transcriptional inactivation in tumor suppressor genes, for example, p16, p15, E-cadherin and VHL, in human neoplasia. Other genes that are shown to be methylated include the estrogen receptor, MDGI, GST-pi, calcitonin, HIC-1, endothelin B receptor, TIMP-2, 06-MGMT, MLH1, MSH2, and GFAP. Of those, the estrogen receptor, MDGI, GST-pi, calcitonin, HIC-1, endothelin B receptor, TIMP-2, 06-MGMT, and MLH1 were shown by MSP to be hypennethylated in neoplastic tissue as compared with normal tissue. For the first time, the invention provides evidence that TIMP-2, a tissue inhibitor of metalloproteinases, is hypermethylated in neoplastic tissue as compared with normal tissue.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 shows genomic sequencing of p16. The sequence shown has the most 5′ region at the bottom of the gel, beginning at +175 in relation to a major transcriptional start site (Hara, et al., Mol. Cell Biol., 16:859, 1996). All cytosines in the unmethylated cell line H249 have been converted to thymidine, while all C's in CpG dinucleotides in the methylated cell H157 remains as C, indicating methylation.] enclosed a BstUI site which is at −59 in relation to the transnational start site in Genbank sequence U12818 (Hussussian, et al., Nat. Genet., 8:15, 1994), but which is incorrectly identified as CGCA in sequence X94154 (Hara, et al., supra). This CGCG site represents the 3′ location of the sense primer used for p16 MSP.
FIGS. 2A-2E show polyacrylamide gels with the Methylation Specific PCR products of p16. Primer sets used for amplification are designated as unmethylated (U), methylated (M), or unmodified/wild-type (W).* designates the molecular weight marker pBR322-MspI digest. Panel A shows amplification of bisulfite-treated DNA from cancer cell lines and normal lymphocytes, and untreated DNA (from cell line H249). Panel B shows mixing of various amount of H157 DNA with 1 μg of H249 DNA prior to bisulfite treatment to assess the detection sensitivity of MSP for methylated alleles. Modified DNA from a primary lung cancer sample and normal lung are also shown. Panel C shows amplification with the p16-U2(U) primers, and p16-M2(M) described in Table 1. Panel D shows the amplified p16 products of panel C restricted with BstUI(+) or not restricted (−). Panel E shows results of testing for regional methylation of CpG islands with MSP, using sense primers p16-U2(U) and p16-M2(M), which are methylation specific, and an antisense primer which is not methylation specific.
FIGS. 3A-3E show polyacrylamide gels of MSP products from analysis of several genes. Primer sets used for amplification are not designated as unmnethylated (U), methylated (M), or unmodified/wild-type (W). * designates the molecular weight marker pBR322-MspI digest and ** designates the 123 bp molecular weight marker. All DNA samples were bisulfite treated except those designated untreated. Panel A shows the results from MSP for p15. Panel B shows the p15 products restricted with BstUI(+) or not restricted (−). Panel C shows the products of MSP for VHL. Panel D shows the VHL products restricted with BstUI(+) or not restricted (−). Panel E shows the products of MSP for E-cadherin.
DESCRIPTION OF THE PREFERRED EMBODIMENTS
The present invention provides methylation specific PCR (MSP) for identification of DNA methylation patterns. MSP uses the PCR reaction itself to distinguish between modified methylated and unmethylated DNA, which adds an improved sensitivity of methylation detection.
Unlike previous genomic sequencing methods for methylation identification which utilizes amplification primers which are specifically designed to avoid the CpG sequences, MSP primers themselves are specifically designed to recognize CpG sites to take advantage of the differences in methylation to amplify specific products to be identified by the invention assay.
As illustrated in the Examples below, MSP provides significant advantages over previous PCR and other methods used for assaying methylation. MSP is markedly more sensitive than Southern analyses, facilitating detection of low numbers of methylated alleles and the study of DNA from small samples. MSP allows the study of paraffin-embedded materials, which could not previously be analyzed by Southern analysis. MSP also allows examination of all CpG sites, not just those within sequences recognized by methylation-sensitive restriction enzymes. This markedly increases the number of such sites which can be assessed and will allow rapid, fine mapping of methylation patterns throughout CpG rich regions. MSP also eliminates the frequent false positive results due to partial digestion of methylation-sensitive enzymes inherent in previous PCR methods for detecting methylation. Furthermore, with MSP, simultaneous detection of unmethylated and methylated products in a single sample confirms the integrity of DNA as a template for PCR and allows a semi-quantitative assessment of allele types which correlates with results of Southern analysis. Finally, the ability to validate the amplified product by differential restriction patterns is an additional advantage.
The only technique that can provide more direct analysis than MSP for most CpG sites within a defined region is genomic sequencing. However, MSP can provide similar information and has the following advantages. First, MSP is much simpler and requires less than genomic sequencing, with a typical PCR and gel analysis taking 4-6 hours. In contrast, genomic sequencing, amplification, cloning, and subsequent sequencing may take days. MSP also avoids the use of expensive sequencing reagents and the use of radioactivity. Both of these factors make MSP better suited for the analysis of large numbers of samples. Third, the use of PCR as the step to distinguish methylated from unmethylated DNA in MSP allows for significant increase in the sensitivity of methylation detection. For example, if cloning is not used prior to genomic sequencing of the DNA, less than 10% methylated DNA in a background of unmethylated DNA cannot be seen (Myohanen, et al., supra). The use of PCR and cloning does allow sensitive detection of methylation patterns in very small amounts of DNA by genomic sequencing (Frommer, et al., Proc. Natl. Acad. Sci. USA, 89:1827, 1992; Clark, et al., Nucleic Acids Research, 22:2990, 1994). However, this means in practice that it would require sequencing analysis of 10 clones to detect 10% methylation, 100 clones to detect 1% methylation, and to reach the level of sensitivity we have demonstrated with MSP (1:1000), one would have to sequence 1000 individual clones.
In a first embodiment, the invention provides a method for detecting a methylated CpG-containing nucleic acid, the method including contacting a nucleic acid-containing specimen with an agent that modifies unmethylated cytosine, amplifying the CpG-containing nucleic acid in the specimen by means of CpG-specific oligonucleotide primers, wherein the oligonucleotide primers distinguish between modified methylated and non-methylated nucleic acid and detecting the methylated nucleic acid. It is understood that while the amplification step is optional, it is desirable in the preferred method of the invention. The method of the invention relies on the PCR reaction itself to distinguish between modified (e.g., chemically modified) methylated and unmethylated DNA.
The term “modifies” as used herein means the conversion of an unmethylated cytosine to another nucleotide which will distinguish the unmethylated from the methylated cytosine. Preferably, the agent modifies unmethylated cytosine to uracil. Preferably, the agent used for modifying unmethylated cytosine is sodium bisulfite, however, other agents that similarly modify unmethylated cytosine, but not methylated cytosine can also be used in the method of the invention. Sodiun bisulfite (NaHSO3) reacts readily with the 5,6-double bond of cytosine, but poorly with methylated cytosine. Cytosine reacts with the bisulfite ion to form a sulfonated cytosine reaction intermediate which is susceptible to deamination, giving rise to a sulfonated uracil. The sulfonate group can be removed under alkaline conditions, resulting in the formation of uracil. Uracil is recognized as a thymine by Taq polymerase and therefore upon PCR, the resultant product contains cytosine only at the position where 5-methylcytosine occurs in the starting template DNA.
The primers used in the invention for amplification of the CpG-containing nucleic acid in the specimen, after bisulfite modification, specifically distinguish between untreated or unmodified DNA, methylated, and non-methylated DNA. MSP primers for the non-methylated DNA preferably have a T in the 3′ CG pair to distinguish it from the C retained in methylated DNA, and the compliment is designed for the antisense primer. MSP primers usually contain relatively few Cs or Gs in the sequence since the Cs will be absent in the sense primer and the Gs absent in the antisense primer (C becomes modified to U(uracil) which is amplified as T(thymidine) in the amplification product).
The primers of the invention embrace oligonucleotides of sufficient length and appropriate sequence so as to provide specific initiation of polymerization on a significant number of nucleic acids in the polymorphic locus. Specifically, the term “primer” as used herein refers to a sequence comprising two or more deoxyribonucleotides or ribonucleotides, preferably more than three, and most preferably more than 8, which sequence is capable of initiating synthesis of a primer extension product, which is substantially complementary to a polymorphic locus strand. Environmental conditions conducive to synthesis include the presence of nucleoside triphosphates and an agent for polymerization, such as DNA polymerase, and a suitable temperature and pH. The primer is preferably single stranded for maximum efficiency in amplification, but may be double stranded. If double stranded, the primer is first treated to separate its strands before being used to prepare extension products. Preferably, the primer is an oligodeoxy ribonucleotide. The primer must be sufficiently long to prime the synthesis of extension products in the presence of the inducing agent for polymerization. The exact length of primer will depend on many factors, including temperature, buffer, and nucleotide composition. The oligonucleotide primer typically contains 12-20 or more nucleotides, although it may contain fewer nucleotides.
Primers of the invention are designed to be “substantially” complementary to each strand of the genomic locus to be amplified and include the appropriate G or C nucleotides as discussed above. This means that the primers must be sufficiently complementary to hybridize with their respective strands under conditions which allow the agent for polymerization to perform. In other words, the primers should have sufficient complementarity with the 5′ and 3′ flanking sequences to hybridize therewith and permit amplification of the genomic locus. While exemplary primers are provided in SEQ ID NO: 105-208, it is understood that any primer that hybridizes with the target sequences in SEQ ID NO: 1-104 is included in the invention and is useful in the method of the invention for detecting methylated nucleic acid, as described.
Oligonucleotide primers of the invention are employed in the amplification process which is an enzymatic chain reaction that produces exponential quantities of target locus relative to the number of reaction steps involved. Typically, one primer is complementary to the negative (−) strand of the locus and the other is complementary to the positive (+) strand. Annealing the primers to denatured nucleic acid followed by extension with an enzyme, such as the large fragment of DNA Polymerase I (Klenow) and nucleotides, results in newly synthesized + and − strands containing the target locus sequence. Because these newly synthesized sequences are also templates, repeated cycles of denaturing, primer annealing, and extension results in exponential production of the region (i.e., the target locus sequence) defined by the primer. The product of the chain reaction is a discrete nucleic acid duplex with termini corresponding to the ends of the specific primers employed.
The oligonucleotide primers of the invention may be prepared using any suitable method, such as conventional phosphotriester and phosphodiester methods or automated embodiments thereof. In one such automated embodiment, diethylphosphoramidites are used as starting materials and may be synthesized as described by Beaucage, et al. (Tetrahedron Letters, 22:1859-1862, 1981). One method for synthesizing oligonucleotides on a modified solid support is described in U.S. Pat. No. 4,458,066.
Any nucleic acid specimen, in purified or nonpurified form, can be utilized as the starting nucleic acid or acids, provided it contains, or is suspected of containing, the specific nucleic acid sequence containing the target locus (e.g., CpG). Thus, the process may employ, for example, DNA or RNA, including messenger RNA, wherein DNA or RNA may be single stranded or double stranded. In the event that RNA is to be used as a template, enzymes, and/or conditions optimal for reverse transcribing the template to DNA would be utilized. In addition, a DNA-RNA hybrid which contains one strand of each may be utilized. A mixture of nucleic acids may also be employed, or the nucleic acids produced in a previous amplification reaction herein, using the same or different primers may be so utilized. The specific nucleic acid sequence to be amplified, i.e., the target locus, may be a fraction of a larger molecule or can be present initially as a discrete molecule, so that the specific sequence constitutes the entire nucleic acid. It is not necessary that the sequence to be amplified be present initially in a pure form; it may be a minor fraction of a complex mixture, such as contained in whole human DNA.
The nucleic acid-containing specimen used for detection of methylated CpG may be from any source including brain, colon, urogenital, hematopoietic, thymus, testis, ovarian, uterine, prostate, breast, colon, lung and renal tissue and may be extracted by a variety of techniques such as that described by Maniatis, et al. (Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, N.Y., pp 280, 281, 1982).
If the extracted sample is impure (e.g., plasma, serum, stool, ejaculate, sputum, saliva, cerebrospinal fluid or blood or a sample embedded in parrafin), it may be treated before amplification with an amount of a reagent effective to open the cells, fluids, tissues, or animal cell membranes of the sample, and to expose and/or separate the strand(s) of the nucleic acid(s). This lysing and nucleic acid denaturing step to expose and separate the strands will allow amplification to occur much more readily.
Where the target nucleic acid sequence of the sample contains two strands, it is necessary to separate the strands of the nucleic acid before it can be used as the template. Strand separation can be effected either as a separate step or simultaneously with the synthesis of the primer extension products. This strand separation can be accomplished using various suitable denaturing conditions, including physical, chemical, or enzymatic means, the word “denaturing” includes all such means. One physical method of separating nucleic acid strands involves heating the nucleic acid until it is denatured. Typical heat denaturation may involve temperatures ranging from about 80° to 105° C. for times ranging from about 1 to 10 minutes. Strand separation may also be induced by an enzyme from the class of enzymes known as helicases or by the enzyme RecA, which has helicase activity, and in the presence of riboATP, is known to denature DNA. The reaction conditions suitable for strand separation of nucleic acids with helicases are described by Kuhn Hoffinann-Berling (CSH-Quantitative Biology, 43:63, 1978) and techniques for using RecA are reviewed in C. Radding (Ann. Rev. Genetics, 16:405-437, 1982).
When complementary strands of nucleic acid or acids are separated, regardless of whether the nucleic acid was originally double or single stranded, the separated strands are ready to be used as a template for the synthesis of additional nucleic acid strands. This synthesis is performed under conditions allowing hybridization of primers to templates to occur. Generally synthesis occurs in a buffered aqueous solution, preferably at a pH of 7-9, most preferably about 8. Preferably, a molar excess (for genomic nucleic acid, usually about 108:1 primer:template) of the two oligonucleotide primers is added to the buffer containing the separated template strands. It is understood, however, that the amount of complementary strand may not be known if the process of the invention is used for diagnostic applications, so that the amount of primer relative to the amount of complementary strand cannot be determined with certainty. As a practical matter, however, the amount of primer added will generally be in molar excess over the amount of complementary strand (template) when the sequence to be amplified is contained in a mixture of complicated lona-chain nucleic acid strands. A large molar excess is preferred to improve the efficiency of the process.
The deoxyribonucleoside triphosphates dATP, dCTP, dGTP, and dTTP are added to the synthesis mixture, either separately or together with the primers, in adequate amounts and the resulting solution is heated to about 90°-100° C. from about 1 to 10 minutes, preferably from 1 to 4 minutes. After this heating period, the solution is allowed to cool to room temperature, which is preferable for the primer hybridization. To the cooled mixture is added an appropriate agent for effecting the primer extension reaction (called herein “agent for polymerization”), and the reaction is allowed to occur under conditions known in the art. The agent for polymerization may also be added together with the other reagents if it is heat stable. This synthesis (or amplification) reaction may occur at room temperature up to a temperature above which the agent for polymerization no longer functions. Thus, for example, if DNA polymerase is used as the agent, the temperature is generally no greater than about 40° C. Most conveniently the reaction occurs at room temperature.
The agent for polymerization may be any compound or system which will function to accomplish the synthesis of primer extension products, including enzymes. Suitable enzymes for this purpose include, for example, E. coli DNA polymerase I, Klenow fragment of E.coli DNA polymerase I, T4 DNA polymerase, other available DNA polymerases, polymerase muteins, reverse transcriptase, and other enzymes, including heat-stable enzymes (i.e., those enzymes which perform primer extension after being subjected to temperatures sufficiently elevated to cause denaturation). Suitable enzymes will facilitate combination of the nucleotides in the proper manner to form the primer extension products which are complementary to each locus nucleic acid strand. Generally, the synthesis will be initiated at the 3′ end of each primer and proceed in the 5′ direction along the template strand, until synthesis terminates, producing molecules of different lengths. There may be agents for polymerization, however, which initiate synthesis at the 5′ end and proceed in the other direction, using the same process as described above.
In nucleic acid hybridization reactions, the conditions used to achieve a particular level of stringency will vary, depending on the nature of the nucleic acids being hybridized. For example, the length, degree of complementarity, nucleotide sequence composition (e.g., GC v. AT content), and nucleic acid type (e.g., RNA v. DNA) of the hybridizing regions of the nucleic acids can be considered in selecting hybridization conditions. An additional consideration is whether one of the nucleic acids is immobilized, for example, on a filter.
An example of progressively higher stringency conditions is as follows: 2×SSC/0.1% SDS at about room temperature (hybridization conditions); 0.2×SSC/0.1% SDS at about room temperature (low stringency conditions); 0.2×SSC/0.1% SDS at about 42° C. (moderate stringency conditions); and 0.1×SSC at about 68° C. (high stringency conditions). Washing can be carried out using only one of these conditions, e.g., high stringency conditions, or each of the conditions can be used, e.g., for 10-15 minutes each, in the order listed above, repeating any or all of the steps listed. However, as mentioned above, optimal conditions will vary, depending on the particular hybridization reaction involved, and can be determined empirically.
Preferably, the method of amplifying is by PCR, as described herein and as is commonly used by those of ordinary skill in the art. Alternative methods of amplification have been described and can also be employed as long as the methylated and non-methylated loci amplified by PCR using the primers of the invention is similarly amplified by the alternative means.
The amplified products are preferably identified as methylated or non-methylated by sequencing. Sequences amplified by the methods of the invention can be further evaluated, detected, cloned, sequenced, and the like, either in solution or after binding to a solid support, by any method usually applied to the detection of a specific DNA sequence such as PCR, oligomer restriction (Saiki, et al., Bio/Technology, 3:1008-1012, 1985), allele-specific oligonucleotide (ASO) probe analysis (Conner, et al., Proc. Natl. Acad. Sci. USA, 80:278, 1983), oligonucleotide ligation assays (OLAs) (Landegren, et al., Science, 241:1077, 1988), and the like. Molecular techniques for DNA analysis have been reviewed (Landegren, et al., Science, 242:229-237, 1988).
Optionally, the methylation pattern of the nucleic acid can be confirmed by restriction enzyme digestion and Southern blot analysis. Examples of methylation sensitive restriction endonucleases which can be used to detect 5′CpG methylation include SmaI, SacII, EagI, MspI, HpaII, BstUI and BssHII, for example.
The invention provides a method for detecting a cell having a methylated CpG island or a cell proliferative disorder associated with methylated CpG in a tissue or biological fluid of a subject, comprising contacting a target cellular component suspected of expressing a gene having a methylated CpG or having a CpG-associated disorder, with an agent which binds to the component. The target cell component can be nucleic acid, such as DNA or RNA, or protein. When the component is nucleic acid, the reagent is a nucleic acid probe or PCR primer. When the cell component is protein, the reagent is an antibody probe. The probes can be detectably labeled, for example, with a radioisotope, a fluorescent compound, a bioluminescent compound, a chemiluminescent compound, a metal chelator, or an enzyme. Those of ordinary skill in the art will know of other suitable labels for binding to the antibody, or will be able to ascertain such, using routine experimentation.
Actively transcribed genes generally contain fewer methylated CGs than the average number in DNA. Hypermethylation can be detected by restriction endonuclease treatment and Southern blot analysis. Therefore, in a method of the invention, when the cellular component detected is DNA, restriction endonuclease analysis is preferable to detect hypermethylation of the promoter for example. Any restriction endonuclease that includes CG as part of its recognition site and that is inhibited when the C is methylated, can be utilized. Preferably, the methylation sensitive restriction endonuclease is BssHII, MspI, or HpaII, used alone or in combination. Other methylation sensitive restriction endonucleases will be known to those of skill in the art.
For purposes of the invention, an antibody or nucleic acid probe specific for a gene or gene product may be used to detect the presence of methylation either by detecting the level of polypeptide (using antibody) or methylation of the polynucleotide (using nucleic acid probe) in biological fluids or tissues. For antibody based detection, the level of the polypeptide is compared with the level of polypeptide found in a corresponding “normal” tissue. Oligonucleotide primers based on any coding sequence region of the promoter in the TIMP-2, estrogen receptor, GST-pi, calcitonin, HIC-1 or MLH1 sequence, for example, are useful for amplifying DNA, for example by PCR. These genes are merely listed as examples and are not meant to be limiting. Any specimen containing a detectable amount of polynucleotide or antigen can be used. Preferably the subject is human.
The present invention provides the finding that TIMP-2 is methylated in cancer tissue as compared to normal tissue. For example, TIMP-2 was found to be methylated in colon cancer tissue but not in normal colon tissue. The method for detecting a cell expressing a gene such as TIMP-2, or a cell proliferative disorder associated with methylation of CpG containing TIMP-2, or any gene including those described above, can be utilized for detection of residual cancer or other malignancies in a subject in a state of clinical remission. Additionally, the method for detecting polypeptide in cells is useful for detecting a cell proliferative disorder by measuring the level of polypeptide in cells expressing the polypeptide, in a suspect tissue in comparison with the polypeptide expressed in normal cells or tissue. Using the method of the invention, expression of any gene, such as TIMP-2, can be identified in a cell and the appropriate course of treatment can be employed (e.g., sense gene therapy or drug therapy). The expression pattern of the gene, e.g., TIMP-2, may vary with the stage of malignancy of a cell, therefore, a sample such as breast or colon tissue can be screened with a panel of gene or gene product specific reagents (i.e., nucleic acid probes or antibodies) to detect gene expression, e.g., TIMP-2, and diagnose the stage of malignancy of the cell.
Monoclonal antibodies can be used in the method of the invention, for example, in immunoassays in liquid phase or bound to a solid phase carrier. In addition, the monoclonal antibodies in these immunoassays can be detectably labeled in various ways. Examples of types of immunoassays which can utilize monoclonal antibodies of the invention are competitive and non-competitive immunoassays in either a direct or indirect format. Examples of such inimunoassays are the radioimmunoassay (RIA) and the sandwich (immunometric) assay. Detection of the antigens using the monoclonal antibodies of the invention can be done utilizing immunoassays which are run in either the forward, reverse, or simultaneous modes, including immunohistochemical assays on physiological samples. Those of skill in the art will know, or can readily discern, other immunoassay formats without undue experimentation.
The term “immunometric assay” or “sandwich immunoassay”, includes simultaneous sandwich, forward sandwich and reverse sandwich immunoassays. These terms are well understood by those skilled in the art. Those of skill will also appreciate that antibodies according to the present invention will be useful in other variations and forms of assays which are presently known or which may be developed in the future. These are intended to be included within the scope of the present invention.
Monoclonal antibodies can be bound to many different carriers and used to detect the presence of TIMP-2. Examples of well-known carriers include glass, polystyrene, polypropylene, polyethylene, dextran, nylon, amylases, natural and modified celluloses, polyacrylamides, agaroses and magnetite. The nature of the carrier can be either soluble or insoluble for purposes of the invention. Those skilled in the art will know of other suitable carriers for binding monoclonal antibodies, or will be able to ascertain such using routine experimentation.
For purposes of the invention, TIMP-2 may be detected by the monoclonal antibodies when present in biological fluids and tissues. Any sample containing a detectable amount of TIMP-2 can be used. A sample can be a liquid such as ejaculate, urine, saliva, cerebrospinal fluid, blood, serum and the like, or a solid or semi-solid such as tissues, feces, and the like, or, alternatively, a solid tissue such as those commonly used in histological diagnosis.
In performing the assays it may be desirable to include certain “blockers” in the incubation medium (usually added with the labeled soluble antibody). The “blockers” are added to assure that non-specific proteins, proteases, or anti-heterophilic immunoglobulins to anti-TIMP-2 immunoglobulins present in the experimental sample do not cross-link or destroy the antibodies on the solid phase support, or the radiolabeled indicator antibody, to yield false positive or false negative results. The selection of “blockers” therefore may add substantially to the specificity of the assays described in the present invention.
In using a monoclonal antibody for the in vivo detection of antigen, the detectably labeled monoclona I antibody is given in a dose which is diagnostically effective. The term “diagnostically effective” means that the amount of detectably labeled monoclonal antibody is administered in sufficient quantity to enable detection of the site having the TIMP-2 antigen for which the monoclonal antibodies are specific.
The concentration of detectably labeled monoclonal antibody which is administered should be sufficient such that the binding to those cells having TIMP-2 is detectable compared to the background. Further, it is desirable that the detectably labeled monoclonal antibody be rapidly cleared from the circulatory system in order to give the best target-to-background signal ratio.
As a rule, the dosage of detectably labeled monoclonal antibody for in vivo diagnosis will vary depending on such factors as age, sex, and extent of disease of the individual. The dosage of monoclonal antibody can vary from about 0.001 mg/m2 to about 500 mg/m2, preferably 0.1 mg/m2 to about 200 mg/m2, most preferably about 0.1 mg/m2 to about 10 mg/m2. Such dosages may vary, for example, depending on whether multiple injections are given, tumor burden, and other factors known to those of skill in the art.
For in vivo diagnostic imaging, the type of detection instrument available is a major factor in selecting a given radioisotope. The radioisotope chosen must have a type of decay which is detectable for a given type of instrument. Still another important factor in selecting a radioisotope for in vivo diagnosis is that the half-life of the radioisotope be long enough so that it is still detectable at the time of maximum uptake by the target, but short enough so that deleterious radiation with respect to the host is minimized. Ideally, a radioisotope used for in vivo imaging will lack a particle emission, but produce a large number of photons in the 140-250 keV range, which may be readily detected by conventional gamma cameras.
A monoclonal antibody usefuil in the method of the invention can also be labeled with a paramagnetic isotope for purposes of in vivo diagnosis, as in magnetic resonance imaging (MRI) or electron spin resonance (ESR). In general, any conventional method for visualizing diagnostic imaging can be utilized. Usually gamma and positron emitting radioisotopes are used for camera imaging and paramagnetic isotopes for MRI. Elements which are particularly useful in such techniques include 157Gd, 55Mn, 162Dry, 52Cr, and 56Fe.
Monoclonal antibodies used in the method of the invention can be used to monitor the course of amelioration of TIMP-2 associated cell proliferative disorder. Thus, by measuring the increase or decrease in the number of cells expressing TIMP-2 or changes in TIMP-2 present in various body fluids, it would be possible to determine whether a particular therapeutic regiment aimed at ameliorating the disorder is effective.
The term “modulate” envisions the suppression of methylation of TIMP-2 (e.g., promoter) or augmentation of TIMP-2 gene expression when TIMP-2 is under-expressed. When a cell proliferative disorder is associated with TIMP-2 expression, such methylation suppressive reagents as 5-azacytadine can be introduced to a cell. Alternatively, when a cell proliferative disorder is associated with under-expression of TIMP-2 polypeptide, a sense polynucleotide sequence (the DNA coding strand) encoding the promoter region or the promoter operably linked to the structural gene, or TIMP-2 polypeptide can be introduced into the cell.
The present invention also provides gene therapy for the treatment of cell proliferative disorders which are mediated by TIMP-2. Such therapy would achieve its therapeutic effect by introduction of the appropriate TIMP-2 polynucleotide which contains either a normal TIMP-2 promoter region alone or in combination with a TIMP-2 structural gene (sense), into cells of subjects having the proliferative disorder. Alternatively, the TIMP-2 structural gene could be introduced operably linked to a heterologous promoter. Delivery of sense TIMP-2 promoter polynucleotide constructs can be achieved using a recombinant expression vector such as a chimeric virus or a colloidal dispersion system.
The promoter polynucleotide sequences used in the method of the invention may be the native, unmethylated sequence or, alternatively, may be a sequence in which a nonmethylatable analog is substituted within the sequence. Preferably, the analog is a nonmethylatable analog of cytidine, such as 5-azacytadine. Other analogs will be known to those of skill in the art. Alternatively, such nonmethylatable analogs could be administered to a subject as drug therapy, alone or simultaneously with a sense promoter for TIMP-2 or a sense promoter operably linked with the structural gene for the corresponding gene (e.g., TIMP-2 promoter with TIMP-2 structural gene).
The invention also relates to a medicament or pharmaceutical composition comprising a TIMP-2 promoter polynucleotide or a TIMP-2 promoter polynucleotide operably linked to the TIMP-2 structural gene, respectively, in a pharmaceutically acceptable excipient or medium wherein the medicament is used for therapy of TIMP-2 associated cell proliferative disorders.
The invention also provides the use of MSP for in situ methylation analysis. For example, MSP can be used to detect methylation of DNA in the nucleus of an intact cell. A tissue section, a cell or population of cells is placed or immobilized on a solid support (e.g., a slide) and MSP primers used directly on the cell for amplification of the appropriate sequences. The primers are typically detectably labeled with a reporter means, e.g., fluorescent label. Alternatively, a probe that detects or hybridizes with the MSP amplified sequences is used to detect amplification of methylated sequences. In situ methylation analysis using MSP is useful, for example, in detecting nucleic acid having a mutant nucleotide sequence associated with a primary tumor in the adjacent histopathologic surgical margins and more distant tissues, such as regional lymph nodes, which are apparently “normal” when examined by standard histological techniques. Using MSP, it is possible to detect target nucleic acids from cells previously associated with a large number of disease states which are present in tissue that appears normal. MSP in situ can be used as an adjunct to cytopathology, to screen high-risk populations and to monitor high risk patients undergoing chemoprevention or chemotherapy.
Exemplary target polynucleotide sequences to which the primer of the invention hybridizes have a sequence as listed below.
SEQ ID NO
Wild type p16 5′-GCGGTCCGCCCCACCCTCTG-3′; 1
5′-CCACGGCCGCGGCCCG-3′; 2
Methylated p16-1* 5′-GCGATCCGCCCCACCCTCTAATAA-3′; 3
5′-TTACGGTCGCGGTTCGGGGTC-3′; 4
Unmethylated p16-1 5′-ACAATCCACCCCACCCTCTAATAA-3′; 5
5′-TTATGGTTGTGGTTTGGGGTTG-3′; 6
Methylated p16-2 5′-GCGATCCGCCCCACCCTCTAATAA-3′; 7
5′-CGGTCGGAGGTCGATTTAGGTGG-3′; 8
Unmethylated p16-2 5′-ACAATCCACCCCACCCTCTAATAA-3′; 9
5′-TGGTTGGAGGTTGATTTAGGTGG-3′; 10
Wild type p15 5′-TCTGGCCGCAGGGTGCG-3′; 11
5′-CCGGCCGCTCGGCCACT-3′; 12
Methylated p15 5′-AACCGCAAAATACGAACGC-3′; 13
5′-TCGGTCGTTCGGTTATTGTACG-3′; 14
Unmethylated p15 5′-AACCACAAAATACAAACACATCACA-3′; 15
5′-TTGGTTGTTTGGTTATTGTATGG-3′; 16
Methylated VHL 5′-GCGTACGCAAAAAAATCCTCCA-3′; 17
5′-TTCGCGGCGTTCGGTTC-3′; 18
Unmethylated VHL 5′-ACATACACAAAAAAATCCTCCAAC-3′; 19
5′-TTTGTGGTGTTTGGTTTGGG-3′; 20
Methylated E-cadherin 5′-ACGCGATAACCCTCTAACCTAA-3′; 21
5′-GTCGGTAGGTGAATTTTTAGTTA-3′; 22
Unmethylated E-cadherin 5′-ACAATAACCCTCTAACCTAAAATTA-3′; 23
5′-TGTGTTGTTGATTGGTTGTG-3′; 24
Methylated Androgen Receptor 5′-GCGACCTCTAAATACCTAAAACCC-3′; 25
5′-CGTAGAGGTTTTATAGGTTATTTGGA-3′; 26
Unmethylated Androgen Receptor 5′-ACAACCTCTAAATACCTAAAACCC-3′; 27
5′-TGTAGAGGTTTTATAGGTTATTTGGT-3′; 28
Methylated Estrogen Receptor 5′-GACGAACTTACTACTATCCAAATACAC-3′; 29
5′-TTTACGGTTAGATCGGTTTTTTTTACG-3′; 30
Unmethylated Estrogen Receptor 5′-AACAAACTTACTACTATCCAAATACACC-3′; 31
5′-TGGTTAGATTGGTTTTTTTTATGG-3′; 32
Methylated MDGI 5′-GCCCCCGACTCCCGAAATAAA-3′; 33
5′-CGTCGTCGGAGTTTTTGTACGTT-3′; 34
Unmethylated MDGI 5′-ACCCCCAACTCCCAAAATAAAAAA-3′; 35
5′-TGTTGTTGGAGTTTTTGTATGTTT-3′; 36
Methylated GSTp 5′-GACGACCGCTACACCCCGAA-3′; 37
5′-CGTCGTGATTTTAGTATTGGGGC-3′; 38
Unmethylated GSTp 5′-AACAACCACTACACCCCAAACATC-3′; 39
5′-TGTTGTGATTTTAGTATTGGGGTGG-3′; 40
Methylated Calcitonin 5′-GCCAACGACTACTCTTATTCCCG-3′; 41
5′-CGTCGTCGTTTTTATAGGGTTTTG-3′; 42
Unmethylated Calcitonin 5′-ACCAACAACTACTCTTATTCCCACC-3′; 43
5′-TGTTGTTGTTTTTATAGGGTTTTGG-3′; 44
Methylated HIC-1 5′-GACGCACAACCGACTACGAC-3′; 45
5′-TGGTGTTAGGGTGGGTATTGTG-3′; 46
Unmethylated HIC-1 5′-AACACACAACCAACTACAACCC-3′; 47
5′-TGGTGTTAGGGTGGGTATTGTG-3′; 48
Methylated Endothelin 5′-GCGTAACCAAAAAAAATAATAATATAC-3′; 49
5′-CGCGTTGGTGAGTTATGA-3′; 50
Unmethylated Endothelin 5′-ACATAACCAAAAAAAATAAATAATATACAA-3′; 51
5′-TGTGTTGGTGAGTTATGAGTGTTAAG-3′; 52
Methylated TIMP-2 5′-GACCGCGCTACCTTCTACGAATAT-3′; 53
5′-CGCGGGAGGGGTTCGTT-3′; 54
Unmethylated TIMP-2 5′-AACCACACTACCTTCTACAAATATATTTACTA-3′; 55
5′-TGTGGGAGGGGTTTGTTTTG-3′; 56
Methylated MLH1-a 5′-GCGACCCTAATAAAACGTCTACGT-3′; 57
5′-CGCGGGTAGTTACGATGAGG-3′; 58
Unmethylated MLH1-a 5′-ACAACCCTAATAAAACATCTACATCAAAA-3′; 59
5′-TGTGGGTAGTTATGATGAGGTGGT-3′; 60
Methylated MLH1-b 5′-GAACGACATTTTAACGCCAAAAA-3′; 61
5′-CGGCGGGGGAAGTTATTTA-3′; 62
Unmethylated MLH1-b 5′-AAACAACATTTTAACACCAAAAAAACC-3′; 63
5′-TGGTGGGGGAAGTTATTTAGTGG-3′; 64
Methylated MSH2 5′-GAACGACGTCCGACCACGA-3′; 65
5′-CGGTGTAGTCGAAGGAGACGTTG-3′; 66
Unmethylated MSH2 5′-AAACAACATCCAACCACAACAACC-3′; 67
5′-TGGTGTAGTTGAAGGAGATGTTGTAGTTG-3′; 68
Methylated GFAP 5′-GATACCCGAATACCCCTAACAAC-3′; 69
5′-CGTCGTTTTTACGTTTTTTTAGGG-3′; 70
Unmethylated GFAP 5′-AATACCCAAATACCCCTAACAACA-3′; 71
5′-TGTTGTTTTTATGTTTTTTTAGGGGA-3′; 72
Methylated TGFb1 5′-GCGAACTACCAAACGAACCCA-3′; 73
5′-CGCGGCGGTTAGGGAGG-3′; 74
Unmethylated TGFb1 5′-ACAAACTACCAAACAAACCCAACC-3′; 75
5′-TGTGGTGGTTAGGGAGGTGGG-3′; 76
Methylated TGFb2 5′-GCGCGAAAATATCGTCG-3′; 77
5′-CGCGTTTCGTCGGTTT-3′; 78
Unmethylated TGFb2 5′-ACACAAAAATATCATCACTCCATAC-3′; 79
5′-TGTGTTTTGTTGGTTTTTAGGT-3′; 80
Methylated p130 5′-GACGCTAACCGCCTACAAACA-3′; 81
5′-CGGTCGTTTAGGGGTGCGT-3′; 82
Unmethylated p130 5′-AACACTAACCACCTACAAACACCCA-3′; 83
5′-TGGTTGTTTAGGGGTGTGTTATGTT-3′; 84
Methylated BRCA2 5′-GACTCCGCCTCTACCGC-3′; 85
5′-CGGTTTTTGTTAGTTTATTTCG-3′; 86
Unmethylated BRCA2 5′-AACTCCACCTCTACCACCTAAT-3′; 87
5′-TGGTTTTTGTTAGTTTATTTTGG-3′; 88
Methylated O6-MGMT 5′-GCGCGAAAACGAAACCGA-3′; 89
5′-CGCGTTTCGGATATGTTGGG-3′; 90
Unmethylated O6-MGMT 5′-ACACAAAAACAAAACCAAAACAC-3′; 91
5′-TGTGTTTTGGATATGTTGGGA-3′; 92
Methylated NF1 5′-GAACGTCCCTCAACGCCGTAA-3′; 93
5′-CGTATGCGCGGTAGGTCGTTT-3′; 94
Unmethylated NF1 5′-AAACATCCCTCAACACCATAAAACTC-3′; 95
5′-TGTATGTGTGGTAGGTTGTTTTTTTTTTT3′; 96
Methylated NF2 5′-GCGAAACTCAAACCCGAAAC-3′; 97
5′-CGTTTATCGTGAGGATCGTTATTAT-3′; 98
Unmethylated NF2 5′-ACAAAACTCAAACCCAAAACCC-3′; 99
5′-TGTTTATTGTGAGGATTGTTATTATGG-3′; 100
Methylated TSG101 5′-GCTACTAAACTACCCCAAACCGTC-3′; 101
5′-CGGTCGTTATGGCGGTGTC-3′; 102
Unmethylated TSG101 5′-ACTACTAAACTACCCCAAACCATCC-3′; 103
5′-TGGTTGTTATGGTGGTGTTGGAG-3′; 104
Exemplary primer pairs included in the invention that hybridize to the above sequences include:
SEQ
ID NO:
5′-CAGAGGGTGGGGCGGACCGC-3′ and 105
5′-CGGGCCGCGGCCGTGG-3′; 106
5′-TTATTAGAGGGTGGGGCGGATCGC-3′ and 107
5′-GACCCCGAACCGCGACCGTAA-3′; 108
5′-TTATTAGAGGGTGGGGTGGATTGT-3′ and 109
5′-CAACCCCAAACCACAACCATAA-3′; 110
5′-TACCTTATTAGAGGGTGGGGCGGATCGC-3′ and 111
5′-CCACCTAAATCGACCTTCGACCG-3′; 112
5′-TTATTAGAGGGTGGGGTGGATTGT-3′ and 113
5′-CCACCTAAATCAACCTCCAACCA-3′; 114
5′-CGCACCCTGCGGCCAGA-3′ and 115
5′-AGTGGCCGAGCGGCCGG-3′; 116
5′-GCGTTCGTATTTTGCGGTT-3′;and 117
5′-CGTACAATAACCGAACGACCGA-3′; 118
5′-TGTGATGTGTTTGTATTTTGTGGTT-3′ and 119
5′-CCATACAATAACCAAACAACCAA-3′; 120
5′-TGGAGGATTTTTTTGCGTACGC-3′ and 121
5′-GAACCGAACGCCGCGAA-3′; 122
5′-GTTGGAGGATTTTTTTGTGTATGT-3′ and 123
5′-CCCAAACCAAACACCACAAA-3′; 124
5′-TTAGGTTAGAGGGTTATCGCGT-3′ and 125
5′-TAACTAAAAATTCACCTACCGAC-3′; 126
5′-TAATTTTAGGTTAGAGGGTTATTGT-3′ and 127
5′-CACAACCAATCAACAACACA-3′ 128
5′GGGTTTTAGGTATTTAGAGGTCGC-3′ and 129
5′ACCAAATAACCTATAAAACCTCTACG-3′ 130
5′GGGTTTTAGGTATTTAGAGGTTGT-3′ and 131
5′ACCAAATAACCTATAAAACCTCTACA-3′ 132
5′GTGTATTTGGATAGTAGTAAGTTCGTC-3′ and 133
5′CGTAAAAAAAACCGATCTAACCGTAAA-3′ 134
5′GGTGTATTTGGATAGTAGTAAGTTTGTT-3′ and 135
5′CCATAAAAAAAACCAATCTAACCA-3′ 136
5′TTTATTTCGGGAGTCGGGGGC-3′ and 137
5′AACGTACAAAAACTCCGACGACG-3′ 138
5′TTTTTTATTTTGGGAGTTGGGGGT-3′ 139
5′AAACATACAAAAACTCCAACAACA-3′ 140
5′TTCGGGGTGTAGCGGTCGTC-3′ and 141
5′GCCCCAATACTAAAATCACGACG-3′ 142
5′GATGTTGGGGTGTAGTGGTTGTT-3′ and 143
5′CCACCCCAATACTAAAATCACAACA-3′ 144
5′CGGGAATAAGAGTAGTCGTTGGC-3′ and 145
5′CAAAACCCTATAAAAACGACGACG-3′ 146
5′GGTGGGAATAAGAGTAGTTGTTGGT-3′ and 147
5′CCAAAACCCTATAAAAACAACAACA-3′ 148
5′GTCGTAGTCGGTTGTGCGTC-3′ and 149
5′GATACCCGCCCTAACGCCG-3 150
5′GGGTTGTAGTTGGTTGTGTGTT-3′ and 151
5′CACAATACCCACCCTAACACCA-3′ 152
5′GTATATTATTTATTTTTTTTGGTTACGC-3′ and 153
5′TCATAACTCGCCAACGCG-3′ 154
5′TTGTATATTATTTATTTTTTTTGGTTATGT-3′ and 155
5′CTTAACACTCATAACTCACCAACACA-3′ 156
5′ATATTCGTAGAAGGTAGCGCGGTC-3′ and 157
5′AACGAACCCCTCCCGCG-3′ 158
5′TAGTAAATATATTTGTAGAAGGTAGTGTGGTT-3′ and 159
5′CAAAACAAACCCCTCCCACA-3′ 160
5′ACGTAGACGTTTTTATTAGGGTCGC-3′ and 161
5′CCTCATCGTAACTACCCGCG-3′ 162
5′TTTTGATGTAGATGTTTTATTAGGGTTGT-3′ and 163
5′ACCACCTCATCATAACTACCCACA-3′ 164
5′TTTTTGGCGTTAAAATGTCGTTC-3′ and 165
5′TAAATAACTTCCCCCGCCG-3′ 166
5′GGTTTTTTTGGTGTTAAAATGTTGTTT-3′ and 167
5′CCACTAAATAACTTCCCCCACCA-3′ 168
5′TCGTGGTCGGACGTCGTTC-3′ and 169
5′CAACGTCTCCTTCGACTACACCG-3′ 170
5′GGTTGTTGTGGTTGGATGTTGTTT-3′ and 171
5′CAACTACAACATCTCCTTCAACTACACCA-3′ 172
5′GTTGTTAGGGGTATTCGGGTATC-3′ and 173
5′CCCTAAAAAAACGTAAAAACGACG-3′ 174
5′TGTTGTTAGGGGTATTTGGGTATT-3′ and 175
5′TCCCCTAAAAAAACATAAAAACAACA-3′ 176
5′TGGGTTCGTTTGGTAGTTCGC-3′ and 177
5′CCTCCCTAACCGCCGCG-3′ 178
5′GGTTGGGTTTGTTTGGTAGTTTGT-3′ and 179
5′CCCACCTCCCTAACCACCACA-3′ 180
5′CGACGATATTTTCGCGC-3′ and 181
5′AAACCGACGAAACGCG-3′ 182
5′GTATGGAGTGATGATATTTTTGTGT-3′ and 183
5′ACCTAAAAACCAACAAAACACA-3′ 184
5′TGTTTGTAGGCGGTTAGCGTC-3′ and 185
5′ACGCACCCCTAAACGACCG-3′ 186
5′TGGGTGTTTGTAGGTGGTTAGTGTT 187
5′AACATAACACACCCCTAAACAACCA-3′ 188
5′GCGGTAGAGGCGGAGTC-3′ and 189
5′CGAAATAAACTAACAAAAACCG-3′ 190
5′ATTAGGTGGTAGAGGTGGAGTT-3′ and 191
5′CCAAAATAAACTAACAAAAACCA-3′ 192
5′TCGGTTTCGTTTTCGCGC-3′ and 193
5′CCCAACATATCCGAAACGCG-3 194
5′GTGTTTTGGTTTTGTTTTTGTGT-3′ and 195
5′TCCCAACATATCCAAAACACA-3′ 196
5′TTACGGCGTTGAGGGACGTTC-3′ and 197
5′AAACGACCTACCGCGCATACG-3′ 198
5′GAGTTTTATGGTGTTGAGGGATGTTT-3′ and 199
5′AAAAAAAAAAACAACCTACCACACATACA-3′ 200
5′GTTTCGGGTTTGAGTTTCGC-3′ and 201
5′ATAATAACGATCCTCACGATAAACG-3′ 202
5′GGGTTTTGGGTTGAGTTTTGT-3′ and 203
5′CCATAATAACAATCCTCACAATAAACA-3′ 204
5′GACGTTTGGGGTAGTTTAGTAGC-3′ and 205
5′GACACCGCCATAACGACCG-3′ 206
5′GGATGGTTTGGGGTAGTTTAGTAGT-3′ and 207
5′CTCCAACACCACCATAACAACCA-3′ 208
*lso included are modifications of the above sequences, including SEQ ID NO:107 having the sequence TCAC at the 5′ end (SEQ ID NO:214); SEQ ID NO:107 having the sequence CC added at the 5′ end (SEQ ID NO:215); SEQ ID NO:107 having the sequence 5′-TTATTAGAGGGTGGGGCGGATCGC-3′; SEQ ID NO:108 having the sequence 5′-GACCCCGAACCGCGACCGTAA-3′;SEQ ID NO:110 having the sequence TGG added at the 5′ end (SEQ ID NO:216); and SEQ ID. All of these modified primers anneal at 65° C.
Typically, the CpG-containing nucleic acid is in the region of the promoter of a structural gene. For example, the promoter region of tumor suppressor genes have been identified as containing methylated CpG island. The promoter region of tumor suppressor genes, including p16, p15, VHL and E-cadherin, are typically the sequence amplified by PCR in the method of the invention. Other genes that have been shown by MSP as containing methylated CpG neoplastic versus normal tissue include estrogen receptor, MDGI, GST-pi, calcitonin, HIC-1, endothelin B receptor, TIMP-2, 06-MGMT, and MLH1. Genes that were found by MSP to be methylated also include the androgen receptor (e.g., methylated as X chromosome inactivation), GFAP (methylated in some glioma cell lines but also in normal tissue), and MSH2. Other genes in which MSP primer were shown to distinguish between normal unmethylated and methylated DNA include TGF-β1, TGF-β2, p130, BRCA2, NF1, NF2, and TSG101.
Detection and identification of methylated CpG-containing nucleic acid in the specimen may be indicative of a cell proliferative disorder or neoplasia. Such disorders include but are not limited to low grade astrocytoma, anaplastic astrocytoma, glioblastoma, medulloblastoma, colon cancer, lung cancer, renal cancer, leukemia, breast cancer, prostate cancer, endometrial cancer and neuroblastoma. Identification of methylated CpG status is also useful for detection and diagnosis of genomic imprinting, fragile X syndrome and X-chromosome inactivation.
Using the method of the invention, the TIMP-2 gene was identified as associated with or methylated in neoplastic versus normal tissues.
The method of the invention now provides the basis for a kit useful for the detection of a methylated CpG-containing nucleic acid. The kit includes a carrier means being compartmentalized to receive in close confinement therein one or more containers. For example, a first container contains a reagent which modifies unmethylated cytosine, such as sodium bisulfite. A second container contains primers for amplification of the CpG-containing nucleic acid, for example, primers listed above as SEQ ID NO:105-208.
The invention also provides a kit for the detection of a methylated CpG-containing nucleic acid, wherein the kit includes: a) a reagent that modifies unmethylated cytosine nucleotides; b) control nucleic acid; c) primers for the amplification of unmethylated CpG-containing nucleic acid; d) primers for the amplification of methylated CpG-containing nucleic acid; and e) primers for the amplification of control nucleic acid. The kit may further include nucleic acid amplification buffer. Preferably, the reagent that modifies unmethylated cytosine is bisulfite.
The kit of the invention is intended to provide the reagents necessary to perform chemical modification and PCR amplification of DNA samples to determine their methylation status. The primer sets included in the kit include a set that anneals to unmethylated DNA that has undergone a chemical modification; a set that anneals to methylated DNA that has undergone a chemical modification; and a primer set that serves as a control for the efficiency of chemical modification. The control primer set should anneal to any DNA (unmethylated or methylated) that has not undergone chemical methylation. In the case of incomplete chemical modification (up to about 50%), data interpretation can still proceed.
The above disclosure generally describes the present invention. A more complete understanding can be obtained by reference to the following specific examples which are provided herein for purposes of illustration only and are not intended to limit the scope of the invention.
EXAMPLE 1
DNA and Cell Lines. Genomic DNA was obtained from cell lines, primary tumors and normal tissue as described (Merlo, et al., Nature Medicine, 1:686, 1995; Herman, et al., Cancer Research, 56:722, 1996; Graff, et al., Cancer Research, 55:5195, 1995). The renal carcinoma cell line was kindly provided by Dr. Michael Lehrman of the National Cancer Institute, Bethesda, Md.
Bisulfite Modification. 1 μg of DNA in a volume of 50 μl was denatured by NaOH (final 0.2M) for 10 minutes at 37° C. For samples with nanogram quantities of human DNA, 1 μg of salmon sperm DNA (Sigma) was added as carrier prior to modification. 30 μL of 10 mM hydroquinone (Sigma) and 520 μL of 3 M sodium bisulfite (Sigma) pH5, both freshly prepared, were added, mixed, and samples were incubated under mineral oil at 50° C. for 16 hours. Modified DNA was purified using the Wizard™ DNA purification resin according to the manufacturer (Promega), and eluted into 50 μL of water. Modification was completed by NaOH (final 0.3M) treatment for 5 minutes at room temperature, followed by ethanol precipitation.
Genomic Sequencing. Genomic sequencing of bisulfite modified DNA was accomplished using the solid-phase DNA sequencing approach (Myohanen, et al., DNA Seq., 5:1, 1994). 100 ng of bisulfite modified DNA was amplified with p16 gene specific primer 5′-TTTTTAGAGGATTTGAGGGATAGG-3′ (sense) (SEQ ID NO:209) and 5′-CTACCTAATTCCAATTCCCCTACA-3′ (anti-sense) (SEQ ID NO:210). PCR conditions were as follows: 96° C. for 3 minutes, 80° C. for 3 minutes, 1 U of Taq polymerase (BRL) was added, followed by 35 cycles of 96° C. for 20 seconds, 56° C. for 20 seconds, 72° C. for 90 seconds, followed by 5 minutes at 72° C. The PCR mixture contained 1× buffer (BRL) with 1.5 mM MgCl2, 20 pmols of each primer and 0.2 mM dNTPs. To obtain products for sequencing, a second round of PCR was performed with 5 pmols of nested primers. In this reaction, the sense primer,
5′-GTTTTCCCAGTCACGACAGTATTAGGAGGAAGAAAGAGGAG-3′ (SEQ ID NO:211), contains M13-40 sequence (underlined) introduced as a site to initiate sequencing, and the anti-sense primer
5′-TCCAATTCCCCTACAAACTTC-3″ (SEQ ID NO:212) is biotinylated to facilitate purification of the product prior to sequencing. PCR was performed as above, for 32 cycles with 2.5 mm MgCl2. All primers for genomic sequencing were designed to avoid any CpGs in the sequence. Biotinylated PCR products were purified using streptavidin coated magnetic beads (Dynal AB, Norway), and sequencing reactions performed with Sequenase™ and M13-40 sequencing primer under conditions specified by the manufacturer (USB).
PCR Amplification. Primer pairs described in Table 1 were purchased from Life Technologies. The PCR mixture contained 1× PCR buffer (16.6 mM ammonium sulfate, 67 mM TRIS pH 8.8, 6.7 mM MgCl2, and 10 mM β-mercaptoethanol), dNTPs (each at 1.25 mM), primers (300 ng/reaction each), and bisulfite-modified DNA (˜50 ng) or unmodified DNA (50-110 ng) in a final volume of 50 μL. PCR specific for unmodified DNA also included 5% dimethylsulfoxide. Reactions were hot started at 95° C. for 5 minutes prior to the addition of 1.25 units of Taq polymerase (BRL). Amplification was carried out on a Hybaid OmniGene temperature cycler for 35 cycles (30 seconds at 95° C., 30 seconds at the annealing temperature listed in Table 1, and 30 seconds at 72° C.), followed by a final 4 minute extension at 72° C. Controls without DNA were performed for each set of PCR reactions. 10 μL of each PCR reaction was directly loaded onto non-denaturing 6-8% polyacrylamide gels, stained with ethidium bromide, and directly visualized under UV illumination.
Restriction Analysis. 10 μL of the 50 μL PCR reaction was digested with 10 units of BstUI (New England Biolabs) for 4 hours according to conditions specified by the manufacturer. Restriction digests were ethanol precipitated prior to gel analysis.
EXAMPLE 2
An initial study was required to validate the strategy for MSP for providing assessment of the methylation status of CpG islands. The p16 tumor suppressor (Merlo, et al., supra; Herman, et al., Cancer Research, 55:4525, 1995; Gonzalez-Zulueta, et al., Cancer Res., 55:4531, 1995,27) which has been documented to have hypermethylation of a 5′ CpG island is associated with complete loss of gene expression in many cancer types, was used as an exemplary gene to determine whether the density of methylation, in key regions to be tested, was great enough to facilitate the primer design disclosed herein. Other than for CpG sites located in recognition sequences for methylation-sensitive enzymes, the density of methylation and its correlation to transcriptional silencing had not yet been established. The genomic sequencing technique was therefore employed to explore this relationship.
FIG. 1 shows genomic sequencing of p16. The sequence shown has the most 5′ region at the bottom of the gel, beginning at +175 in relation to a major transcriptional start site (Hara, et al., Mol. Cell Biol., 16:859, 1996). All cytosines in the unmethylated cell line H249 have been converted to thymidine, while all C's in CpG dinucleotides in the methylated cell H157 remains as C, indicating methylation.] enclosed a BstUI site which is at −59 in relation to the transnational start site in Genbank sequence U12818 (Hussussian, et al., Nat. Genet., 8:15, 1994), but which is incorrectly identified as CGCA in sequence X94154 (Hara, et al., supra). This CGCG site represents the 3′ location of the sense primer used for p16 MSP.
As has been found for other CpG islands examined in this manner (Myohanen, et al., supra; Park, et al., Mol. Cell Biol., 14:7975, 1994; Reeben, et al., Gene, 157:325, 1995), the CpG island of p16 was completely unmethylated in those cell lines and normal tissues previously found to be unmethylated by Southern analysis (FIG. 1)(Merlo, et al., supra; Herman, et al., supra). However, it was extensively methylated in cancer cell lines shown to be methylated by Southern analysis (FIG. 1). In fact, all cytosines within CpG dinucloetides in this region were completely methylated in the cancers lacking p16 transcription. This marked difference in sequence following bisulfite treatment suggested that the method of the invention for specific amplification of either methylated or unmethylated alleles was useful for identification of methylation patterns in a DNA sample.
Primers were designed to discriminate between methylated and unmethylated alleles following bisulfite treatment, and to discriminate between DNA modified by bisulfite and that which had not been modified. To accomplish this, primer sequences were chosen for regions containing frequent cytosines (to distinguish unmodified from modified DNA), and CpG pairs near the 3′ end of the primers (to provide maximal discrimination in the PCR reaction between methylated and unmethylated DNA). Since the two strands of DNA are no longer complementary after bisulfite treatment, primers can be designed for either modified strand. For convenience, primers were designed for the sense strand. The fragment of DNA to be amplified was intentionally small, to allow the assessment of methylation patterns in a limited region and to facilitate the application of this technique to samples, such as paraffin blocks, where amplification of larger fragments is not possible. In Table 1, primer sequences are shown for all genes tested, emphasizing the differences in sequence between the three types of DNA which are exploited for the specificity of MSP. The multiple mismatches in these primers which are specific for these different types of DNA suggest that each primer set should provide amplification only from the intended template.
The primers designed for p16 were tested with DNA from cancer cell lines and normal tissues for which the methylation status had previously been defined by Southern analysis (Merlo, et al., supra; Herman, et al., supra).
FIG. 2, panels A-D, show polyacrylamide gels with the Methylation Specific PCR products of p16. Primer sets used for amplification are designated as unmethylated (U), methylated (M), or unmodified/wild-type (W). * designates the molecular weight marker pBR322-MspI digest. Panel A shows amplification of bisulfite-treated DNA from cancer cell lines and normal lymphocytes, and untreated DNA (from cell line H249). Panel B shows mixing of various amount of H157 DNA with 1 μg of H249 DNA prior to bisulfite treatment to assess the detection sensitivity of MSP for methylated alleles. Modified DNA from a primary lung cancer sample and normal lung are also shown. Panel C shows amplification with the p16-U2 (U) primers, and p16-M2 (M) described in Table 1. Panel D shows the amplified p16 products of panel C restricted with BstUI(+) or not restricted (−).
In all cases, the primer set used confirmed the methylation status determined by Southern analysis. For example, lung cancer cell lines U1752 and H157, as well other cell lines methylated at p16, amplified only with the methylated primers (FIG. 2, panel A). DNA from normal tissues (lymphocytes, lung, kidney, breast, and colon) and the unmethylated lung cancer cell lines H209 and H249, amplified only with unmethylated primers (examples in FIG. 2, panel A). PCR with these primers could be performed with or without 5% DMSO. DNA not treated with bisulfite (unmodified) failed to amplify with either set of methylated or unmethylated specific primers, but readily amplified with primers specific for the sequence prior to modification (FIG. 2, panel A). DNA from the cell line H157 after bisulfite treatment also produced a weaker amplification with unmodified primers, suggesting an incomplete bisulfite reaction. However, this unmodified DNA, unlike partially restricted DNA in previous PCR assays relying on methylation sensitive restriction enzymes, is not recognized by the primers specific for methylated DNA. It therefore does not provide a false positive result or interfere with the ability to distinguish methylated from unmethylated alleles.
The sensitivity of MSP for detection of methylated p16 alleles was assessed. DNA from methylated cell lines was mixed with unmethylated DNA prior to bisulfite treatment. 0.1% of methylated DNA (approximately 50 pg) was consistently detected in an otherwise unmethylated sample (FIG. 2, panel B). The sensitivity limit for the amount of input DNA was determined to be as little as 1 ng of human DNA, mixed with salmon sperm DNA as a carrier detectable by MSP.
Fresh human tumor samples often contain normal and tumor tissue, making the detection of changes specific for the tumor difficult. However, the sensitivity of MSP suggests it would be useful for primary tumors as well, allowing for detection of aberrantly methylated alleles even if they contribute relatively little to the overall DNA in a sample. In each case, while normal tissues were completely unmethylated, tumors determined to be methylated at p16 by Southern analysis also contained methylated DNA detected by MSP, in addition to some unmethylated alleles (examples in FIG. 2, panel B). DNA from paraffin-embedded tumors was also used, and allowed the detection of methylated and unmethylated alleles in these samples (FIG. 2, panel B). To confirm that these results were not unique to this primer set, a second downstream primer for p16 was used which would amplify a slightly larger fragment (Table 1). This second set of primers reproduced the results described above (FIG. 2, panel C), confirming the methylation status defined by Southern blot analysis.
To further verify the specificity of the primers for the methylated alleles and to check specific cytosines for methylation within the region amplified, the differences in sequence between methylated/modified DNA and unmethylated/modified DNA were utilized. Specifically, the BstUI recognition site, CGCG, will remain CGCG if both C's are methylated after bisulfite treatment and amplification, but will become TGTG if unmethylated. Digestion of the amplified products with BstUI distinguishes these two products. Restriction of p16 amplified products illustrates this. Only unmodified products and methylated/modified products, both of which retain the CGCG site, were cleaved by BstUI, while products amplified with unmethylated/modified primers failed to be cleaved (FIG. 2, panel D).
The primer sets discussed above were designed to discriminate heavily methylated CpG islands from unmethylated alleles. To do this, both the upper (sense) and lower (antisense) primers contained CpG sites which could produce methylation-dependent sequence differences after bisulfite treatment. MSP might be employed to examine more regional aspects of CpG island methylation. To examine this, methylation-dependent differences in the sequence of just one primer was tested to determine whether it would still allow discrimination between unmethylated and methylated p16 alleles. The antisense primer used for genomic sequencing, 5′-CTACCTAATTCCAATTCCCCTACA-3′ (SEQ ID NO:213), was also used as the antisense primer, since the region recognized by the primer contains no CpG sites, and was paired with either a methylated or unmethylated sense primer (Table 1). Amplification of the 313 bp PCR product only occurred with the unmethylated sense primer in H209 and H249 (unmethylated by Southern) and the methylated sense primer in H157 and U1752 (methylated by Southern), indicating that methylation of CpG sites within a defined region can be recognized by specific primers and distinguish between methylated and unmethylated alleles (FIG. 2, panel E). Panel E shows results of testing for regional methylation of CpG islands with MSP, using sense primers p16-U2 (U) and p16-M2 (M), which are methylation specific, and an antisense primer which is not methylation specific.
EXAMPLE 3
The above experiments with p16 were extended to include 3 other genes transcriptionally silenced in human cancers by aberrant hypermethylation of 5′ CpG islands.
FIG. 3, panels A-E, show polyacrylamide gels of MSP products from analysis of several genes. Primer sets used for amplification are not designated as unmethylated (U), methylated (M), or unmodified/wild-type (W). * designates the molecular weight marker pBR322-MspI digest and ** designates the 123 bp molecular weight marker. All DNA samples were bisulfite treated except those designated untreated. Panel A shows the results from MSP for p15. Panel B shows the p15 products restricted with BstUI (+) or not restricted (−). Panel C shows the products of MSP for VHL. Panel D shows the VHL products restricted with BstUI(+) or not restricted (−). Panel E shows the products of MSP for E-cadherin.
The cyclin-dependent kinase inhibitor p15 is aberrantly methylated in many leukemic cell lines and primary leukemias (Herman, et al., supra). For p15, MSP again verified the methylation status determined by Southern analysis. Thus, normal lymphocytes and cancer cell lines SW48 and U1752, all unmethylated by Southern analysis (Herman, et al., supra), only amplified with the unmethylated set of primers, while the lung cancer cell line H1618 and leukemia cell line KG1A amplified only with the methylated set of primers (FIG. 3, panel A), consistent with previous Southern analysis results (Herman, et al., supra). The cell line Raji produced a strong PCR product with methylated primers and a weaker band with unmethylated primers. This was the same result for methylation obtained previously by Southern analysis (Herman, et al., supra). Non-cultured leukemia samples, like the primary tumors studied for p16, had amplification with the methylated primer set as well as the unmethylated set. This heterogeneity also matched Southern analysis (Herman, et al., supra). Again, as for p16, differential modification of BstUI restriction sites in the amplified product of p15 was used to verify the specific amplification by MSP (FIG. 3, panel B). Amplified products using methylated primer sets from cell lines H1618 and Raji or unmodified primer sets, were completely cleaved by BstUI, while unmethylated amplified products did not cleave. Primary AML samples, which again only demonstrated cleavage in the methylated product, had less complete cleavage. This suggests a heterogeneity in methylation, arising because in some alleles, many CpG sites within the primer sequences area are methylated enough to allow the methylation specific primers to amplify this region, while other CpG sites are not completely methylated.
Aberrant CpG island promoter region methylation is associated with inactivation of the VHL tumor suppressor gene in approximately 20% of clear renal carcinomas (Herman, et al., Proc. Natl. Acad. Sci. USA, 91:9700, 1994). This event, like mutations for VHL (Gnarra, et al., Nature Genetics, 7:85, 1994), is restricted to clear renal cancers (Herman, et al., supra). Primers designed for the VHL sequence were used to study DNA from the renal cell cancer line RFX393 which is methylated at VHL by Southern analysis, and the lung cancer cell line U1752 which is unmethylated at this locus (Herman, et al., supra). In each case, the methylation status of VHL determined by MSP confirmed that found by Southern analysis (FIG. 3, panel C), and BstUI restriction site analysis validated the PCR product specificity (FIG. 3, panel D).
The expression of the invasion/metastasis suppressor gene, E-cadherin, is often silenced by aberrant methylation of the 5′ promoter in breast, prostate, and many other carcinomas (Graff, et al., supra; Yoshira, et al., Proc. Natl. Acad. Sci. USA, 92:7416, 1995). Primers were designed for the E-cadherin promoter region to test the use of MSP for this gene. In each case, MSP analysis paralleled Southern blot analysis for the methylation status of the gene (Graff, et al., supra). The breast cancer cell lines MDA-MB-231, HS578t, and the prostate cancer cell lines DuPro and TSUPrI, all heavily methylated by Southern, displayed prominent methylation. MCF7, T47D, PC-3, and LNCaP, all unmethylated by Southern, showed no evidence for methylation in the sensitive MSP assay (FIG. 3, panel E). MSP analysis revealed the presence of unmethylated alleles in Hs578t, TSUPrI and DuPro consistent with a low percentage of unmethylated alleles in these cell lines previously detected by Southern analysis (Graff, et al., supra). BstUI restriction analysis again confirmed the specificity of the PCR amplification.
TABLE 1
PCR primers used for Methylation Specific PCR
Primer Sense primer* Antisense primer* Size Anneal Genomic
Set (5′-3′) (5′-3′) (bp) temp. Position†
p16-W†      CAGAGGGTGGGGCGACCGC         CGGGCCGCGGCCGTGG 140 65° C. +171
p16-M TTATTAGAGGGTGGGGCGGATCGC    GACCCCG AACCGCGACCGTAA 150 65° C. +167
p16-U TTATTAGAGGGTGGGG T GGAT T G T   C A ACCCC A AACC A C A ACC A TAA 151 65° C. +167
p16-M2 TTATTAGAGGGTGGGGCGGATCGC  CCACCTAAATCG ACCTCCGACCG 234 65° C. +167
p16-U2 TTATTAGAGGGTGGGG T GGAT T G T  CCACCTAAATC A ACCTCC A ACC A 234 60° C. +167
p15-W        CGCACCCTGCGGCCAGA       AGTGGCCGAGCGGCCGG 137 65° C. +46
p15-M      GCGTT CGTATTTTGCGGTT  CGTACAATAACCGAACGACCG A 148 60° C. +40
p15-U TG T GA T GTGTT T GTATTTTG T GGTT CC A TACAATAACC A AAC A ACC A A 154 60° C. +34
VHL-M    TGGAGGATTTTTTTGCGTACGC      G AACCG AACGCCGCG AA 158 60° C. −116
VHL-U  GTTGGAGGATTTTTTTG T GTA T G T    CCC A AACC A AAC A CC A C A AA 165 60° C. −118
Ecad-M    TTAGGTTAGAGGGTTAT CGCGT TAACTAAAAATTCACCTACCG AC 116 57° C. +205
0
Ecad-U TAATTTTAGGTTAGAGGGTTAT TG T   CACAACCAATCAACAAC A C A 97 53° C. −210
*Sequence differences between modified primers and unmodified DNA are boldface, and differences between methylated/modified and unmethylated/modified are underlined.
†Primers were placed near the transcriptional strat site. Genomic position is the location of the 5′ nucleotide of the sense primer in relation to the major transcriptional start site defined in the following references and Genbank accession numbers: p16(most 3′ site) X94154 (E. Hara, et al., Mol. Cell Biol., 16: 859 1996), p15 S75756 (J. Jen, et al., Cancer Res., 54: 6353 1994), VHL U19763 (I. Kuzmin, et al., Oncogene, 10: 2185 1995), and E-cadherin
# L34545 (M. J. Bussemakers, et al., Biochem. Biophys. Res. Commun., 203: 1284 1994).
†W represents unmodified, or wild-type primers, M represents methylated-specific primers, and U represents unmethylted-specific primers.
(SEQ ID NO:105-128)
TABLE 2
Gene Sense Primer Antisense Primer PCR Product Temp Genbank # Position
Androgen Me 5′gggttttaggtatttagaggtcgc 5′accaaataacctataaaacctctacg ˜210 bp  55° C. M27423  189
Receptor Un 5′gggttttaggtatttagaggttgt 5′accaaataacctataaaacctctaca ˜210 bp  55° C. M27423  189
Estrogen Me 5′gtgtatttggatagtagtaagttcgtc 5′cgtaaaaaaaaccgatctaaccgtaaa 118 bp 57° C. X62462 3127
Receptor Un 5′ggtgtatttggatagtagtaagtttgtt 5′ccataaaaaaaaccaatctaacca 120 bp 57° C. X62462 3126
MDGI Me 5′tttatttcgggagtcgggggc 5′aacgtacaaaaatccgacgacg 105 bp 60° C. U57623 1134
Un 5′ttttttattttgggagttgggggt 5′aaacatacaaaaactccaacaaca 113 bp 60° C. U57623 1131
GST Me 5′ttcggggtgtagcggtcgtc 5′gccccaatactaaaatcacgacg  91 bp 60° C. X08058 1082
Un 5′gatgtttggggtgtagtggttgtt 5′ccaccccaatactaaaatcacaaca  97 bp 60° C. X08058 1078
Calci- Me 5′cgggaataagagtagtcgttggc 5′caaaaccctataaaaaacgacgacg  84 bp 60° C. X15943 1801
tonin UN 5′ggtgggaataagagtagttgttggt 5′ccaaaaccctataaaaacaacaaca  87 bp 60° C. X15943 1799
HIC-1 Me 5′gtcgtagtcggttgtgcgtc 5′gatacccgccctaacgccg 259 bp 60° C.
Un 5′gggttgtagttggttgtgtgtt 5′cacaataccaccctaacacca 264 bp 60° C.
Endo- Me 5′gtatattatttattttttttggttacgc 5′tcataactcgccaacgcg  92 bp 55° C. D13162  969
thelin Un 5′ttgtatattatttattttttttggttatgt 5′cttaacactcataactcaccaacaca 102 bp 55° C. D13162  967
TIMP-2 Me 5′atattcgtagaaggtagcgcggtc 5′aacgaacccctccgcg 190 bp 59° C. U44381 2254
Un 5′tagtaaatatatttgtagaaggtagtgtggtt 5′caaaacaaacccctcccaca 201 bp 59° C. U44381 2246
MLH1-a Me 5′acgtagacgttttattagggtcgc 5′cctcatcgtaactacccgcg 115 bp 60° C. U26559  218
Un 5′ttttgatgtagatgttttattagggttgt 5′accacctcatcataactacccaca 124 bp 60° C. U26559  213
MLH1-b ME 5′ttttggcgttaaaatgtcgttc 5′taaataacttcccccgccg  91 bp 60° C. U26559  920
Un 5′ggttttttggtgttaaaatgttgttt 5′ccactaaataacttcccccacca  99 bp 60° C. U26559  916
MSH2 Me 5′tcgtggtcggacgtcgttc 5′caacgtctccttcgactacaccg 132 60° C. U41206  128
Un 5′ggttgttgtggttggatgttgttt 5′caactacaacatctccttcaactacacca 143 60° C. U41206  123
GFAP Me 5′gttgttaggggtattcgggtatc 5′ccctaaaaaaacgtaaaaacgacg 140 bp 60° C. M67446 2092
Un 5′tgttgttaggggtatttgggtatt 5′tcccctaaaaaaacataaaaacaaca 143 bp 60° C. M67446 2091
TGFβ1 Me 5′tgggttcgtttggtagttcgc 5′cctccctaaccgccgcg 124 bp 57° C. U51139 1223
Un 5′ggttgggtttgtttggtagtttgt 5′cccacctcctaaccaccaca 131 bp 57° C. U51139 1220
TGFβ2 Me 5′cgacgatattttcgcgc 5′aaaccgacgaaacgcg  97 bp 57° C. U52240  72
Un 5′gtatggagtgatgatattttgtgt 5′acctaaaaaccaacaaaacaca 111 bp 57° C. U52240  64
p130 Me 5′tgtttgtaggcggttagcgtc 5′acgcacccctaaacgaccg 135 bp 55° C. U53220 2076
Un 5′tgggtgtttgtaggtggttagtgtt 5′aacataacacacccctaaacaacca 145 bp 55° C. U53220 2072
BRCA2 Me 5′gcggtagaggcggagtc 5′cgaaataaactaacaaaaaccg 136 bp 55° C. X95151  292
Un 5′attaggtggtagaggtggagtt 5′ccaaaataaactaacaaaaacca 142 bp 55° C. X95151  287
O6 Me 5′tcggtttcgttttcgcgc 5′cccaacatatccgaaacgcg 125 bp 60° C. S52289  114
MGMT Un 5′gtgttttggttttgtttttgtgt 5′tcccaacatatccaaaacaca 131 bp 60° C. S52289  109
NF1 Me 5′ttacggcgttgagggacgttc 5′aaacgacctaccgcgcatacg 121 bp 60° C. U17084 3336
Un 5′gagttttatggtgttgagggatgttt 5′aaaaaaaaaaacaacctaccacacataca 134 bp 60° C. U17084 3331
NF2 Me 5′gtttcgggtttgagtttcgc 5′ataataacgatcctcacgataaacg 109 bp 55° C. L27131  38
Un 5′gggttttgggtttgagttttgt 5′ccataataacaatcctcacaataaaca 113 bp 55° C. L27131  36
TSG101 Me 5′gacggtttggggtagtttagtagc 5′gacaccgccataacgaccg  80 bp 60° C. U82130  23
Un 5′ggatggtttggggtagtttagtagt 5′ctccaacaccaccataacaacca  85 bp 60° C. U82130  22
(SEQ ID NO: 25-104)
Although the invention has been described with reference to the presently preferred embodiments, it should be understood that various modifications can be made without departing from the spirit of the invention. Accordingly, the invention is limited only by the following claims.
216 20 base pairs nucleic acid single linear DNA not provided 1 GCGGTCCGCC CCACCCTCTG 20 16 base pairs nucleic acid single linear DNA not provided 2 CCACGGCCGC GGCCCG 16 24 base pairs nucleic acid single linear DNA not provided 3 GCGATCCGCC CCACCCTCTA ATAA 24 21 base pairs nucleic acid single linear DNA not provided 4 TTACGGTCGC GGTTCGGGGT C 21 24 base pairs nucleic acid single linear DNA not provided 5 ACAATCCACC CCACCCTCTA ATAA 24 22 base pairs nucleic acid single linear DNA not provided 6 TTATGGTTGT GGTTTGGGGT TG 22 24 base pairs nucleic acid single linear DNA not provided 7 GCGATCCGCC CCACCCTCTA ATAA 24 23 base pairs nucleic acid single linear DNA not provided 8 CGGTCGGAGG TCGATTTAGG TGG 23 24 base pairs nucleic acid single linear DNA not provided 9 ACAATCCACC CCACCCTCTA ATAA 24 23 base pairs nucleic acid single linear DNA not provided 10 TGGTTGGAGG TTGATTTAGG TGG 23 17 base pairs nucleic acid single linear DNA not provided 11 TCTGGCCGCA GGGTGCG 17 17 base pairs nucleic acid single linear DNA not provided 12 CCGGCCGCTC GGCCACT 17 19 base pairs nucleic acid single linear DNA not provided 13 AACCGCAAAA TACGAACGC 19 22 base pairs nucleic acid single linear DNA not provided 14 TCGGTCGTTC GGTTATTGTA CG 22 25 base pairs nucleic acid single linear DNA not provided 15 AACCACAAAA TACAAACACA TCACA 25 23 base pairs nucleic acid single linear DNA not provided 16 TTGGTTGTTT GGTTATTGTA TGG 23 22 base pairs nucleic acid single linear DNA not provided 17 GCGTACGCAA AAAAATCCTC CA 22 17 base pairs nucleic acid single linear DNA not provided 18 TTCGCGGCGT TCGGTTC 17 24 base pairs nucleic acid single linear DNA not provided 19 ACATACACAA AAAAATCCTC CAAC 24 20 base pairs nucleic acid single linear DNA not provided 20 TTTGTGGTGT TTGGTTTGGG 20 22 base pairs nucleic acid single linear DNA not provided 21 ACGCGATAAC CCTCTAACCT AA 22 23 base pairs nucleic acid single linear DNA not provided 22 GTCGGTAGGT GAATTTTTAG TTA 23 25 base pairs nucleic acid single linear DNA not provided 23 ACAATAACCC TCTAACCTAA AATTA 25 20 base pairs nucleic acid single linear DNA not provided 24 TGTGTTGTTG ATTGGTTGTG 20 24 base pairs nucleic acid single linear DNA not provided 25 GCGACCTCTA AATACCTAAA ACCC 24 26 base pairs nucleic acid single linear DNA not provided 26 CGTAGAGGTT TTATAGGTTA TTTGGA 26 24 base pairs nucleic acid single linear DNA not provided 27 ACAACCTCTA AATACCTAAA ACCC 24 26 base pairs nucleic acid single linear DNA not provided 28 TGTAGAGGTT TTATAGGTTA TTTGGT 26 27 base pairs nucleic acid single linear DNA not provided 29 GACGAACTTA CTACTATCCA AATACAC 27 27 base pairs nucleic acid single linear DNA not provided 30 TTTACGGTTA GATCGGTTTT TTTTACG 27 28 base pairs nucleic acid single linear DNA not provided 31 AACAAACTTA CTACTATCCA AATACACC 28 24 base pairs nucleic acid single linear DNA not provided 32 TGGTTAGATT GGTTTTTTTT ATGG 24 21 base pairs nucleic acid single linear DNA not provided 33 GCCCCCGACT CCCGAAATAA A 21 23 base pairs nucleic acid single linear DNA not provided 34 CGTCGTCGGA GTTTTTGTAC GTT 23 24 base pairs nucleic acid single linear DNA not provided 35 ACCCCCAACT CCCAAAATAA AAAA 24 24 base pairs nucleic acid single linear DNA not provided 36 TGTTGTTGGA GTTTTTGTAT GTTT 24 20 base pairs nucleic acid single linear DNA not provided 37 GACGACCGCT ACACCCCGAA 20 23 base pairs nucleic acid single linear DNA not provided 38 CGTCGTGATT TTAGTATTGG GGC 23 24 base pairs nucleic acid single linear DNA not provided 39 AACAACCACT ACACCCCAAA CATC 24 25 base pairs nucleic acid single linear DNA not provided 40 TGTTGTGATT TTAGTATTGG GGTGG 25 23 base pairs nucleic acid single linear DNA not provided 41 GCCAACGACT ACTCTTATTC CCG 23 24 base pairs nucleic acid single linear DNA not provided 42 CGTCGTCGTT TTTATAGGGT TTTG 24 25 base pairs nucleic acid single linear DNA not provided 43 ACCAACAACT ACTCTTATTC CCACC 25 25 base pairs nucleic acid single linear DNA not provided 44 TGTTGTTGTT TTTATAGGGT TTTGG 25 20 base pairs nucleic acid single linear DNA not provided 45 GACGCACAAC CGACTACGAC 20 19 base pairs nucleic acid single linear DNA not provided 46 CGGCGTTAGG GCGGGTATC 19 22 base pairs nucleic acid single linear DNA not provided 47 AACACACAAC CAACTACAAC CC 22 22 base pairs nucleic acid single linear DNA not provided 48 TGGTGTTAGG GTGGGTATTG TG 22 28 base pairs nucleic acid single linear DNA not provided 49 GCGTAACCAA AAAAAATAAA TAATATAC 28 18 base pairs nucleic acid single linear DNA not provided 50 CGCGTTGGTG AGTTATGA 18 30 base pairs nucleic acid single linear DNA not provided 51 ACATAACCAA AAAAAATAAA TAATATACAA 30 26 base pairs nucleic acid single linear DNA not provided 52 TGTGTTGGTG AGTTATGAGT GTTAAG 26 24 base pairs nucleic acid single linear DNA not provided 53 GACCGCGCTA CCTTCTACGA ATAT 24 17 base pairs nucleic acid single linear DNA not provided 54 CGCGGGAGGG GTTCGTT 17 32 base pairs nucleic acid single linear DNA not provided 55 AACCACACTA CCTTCTACAA ATATATTTAC TA 32 20 base pairs nucleic acid single linear DNA not provided 56 TGTGGGAGGG GTTTGTTTTG 20 24 base pairs nucleic acid single linear DNA not provided 57 GCGACCCTAA TAAAACGTCT ACGT 24 20 base pairs nucleic acid single linear DNA not provided 58 CGCGGGTAGT TACGATGAGG 20 29 base pairs nucleic acid single linear DNA not provided 59 ACAACCCTAA TAAAACATCT ACATCAAAA 29 24 base pairs nucleic acid single linear DNA not provided 60 TGTGGGTAGT TATGATGAGG TGGT 24 23 base pairs nucleic acid single linear DNA not provided 61 GAACGACATT TTAACGCCAA AAA 23 19 base pairs nucleic acid single linear DNA not provided 62 CGGCGGGGGA AGTTATTTA 19 27 base pairs nucleic acid single linear DNA not provided 63 AAACAACATT TTAACACCAA AAAAACC 27 23 base pairs nucleic acid single linear DNA not provided 64 TGGTGGGGGA AGTTATTTAG TGG 23 19 base pairs nucleic acid single linear DNA not provided 65 GAACGACGTC CGACCACGA 19 23 base pairs nucleic acid single linear DNA not provided 66 CGGTGTAGTC GAAGGAGACG TTG 23 24 base pairs nucleic acid single linear DNA not provided 67 AAACAACATC CAACCACAAC AACC 24 29 base pairs nucleic acid single linear DNA not provided 68 TGGTGTAGTT GAAGGAGATG TTGTAGTTG 29 23 base pairs nucleic acid single linear DNA not provided 69 GATACCCGAA TACCCCTAAC AAC 23 24 base pairs nucleic acid single linear DNA not provided 70 CGTCGTTTTT ACGTTTTTTT AGGG 24 24 base pairs nucleic acid single linear DNA not provided 71 AATACCCAAA TACCCCTAAC AACA 24 26 base pairs nucleic acid single linear DNA not provided 72 TGTTGTTTTT ATGTTTTTTT AGGGGA 26 21 base pairs nucleic acid single linear DNA not provided 73 GCGAACTACC AAACGAACCC A 21 17 base pairs nucleic acid single linear DNA not provided 74 CGCGGCGGTT AGGGAGG 17 24 base pairs nucleic acid single linear DNA not provided 75 ACAAACTACC AAACAAACCC AACC 24 21 base pairs nucleic acid single linear DNA not provided 76 TGTGGTGGTT AGGGAGGTGG G 21 17 base pairs nucleic acid single linear DNA not provided 77 GCGCGAAAAT ATCGTCG 17 16 base pairs nucleic acid single linear DNA not provided 78 CGCGTTTCGT CGGTTT 16 25 base pairs nucleic acid single linear DNA not provided 79 ACACAAAAAT ATCATCACTC CATAC 25 22 base pairs nucleic acid single linear DNA not provided 80 TGTGTTTTGT TGGTTTTTAG GT 22 21 base pairs nucleic acid single linear DNA not provided 81 GACGCTAACC GCCTACAAAC A 21 19 base pairs nucleic acid single linear DNA not provided 82 CGGTCGTTTA GGGGTGCGT 19 25 base pairs nucleic acid single linear DNA not provided 83 AACACTAACC ACCTACAAAC ACCCA 25 25 base pairs nucleic acid single linear DNA not provided 84 TGGTTGTTTA GGGGTGTGTT ATGTT 25 17 base pairs nucleic acid single linear DNA not provided 85 GACTCCGCCT CTACCGC 17 22 base pairs nucleic acid single linear DNA not provided 86 CGGTTTTTGT TAGTTTATTT CG 22 22 base pairs nucleic acid single linear DNA not provided 87 AACTCCACCT CTACCACCTA AT 22 23 base pairs nucleic acid single linear DNA not provided 88 TGGTTTTTGT TAGTTTATTT TGG 23 18 base pairs nucleic acid single linear DNA not provided 89 GCGCGAAAAC GAAACCGA 18 20 base pairs nucleic acid single linear DNA not provided 90 CGCGTTTCGG ATATGTTGGG 20 23 base pairs nucleic acid single linear DNA not provided 91 ACACAAAAAC AAAACCAAAA CAC 23 21 base pairs nucleic acid single linear DNA not provided 92 TGTGTTTTGG ATATGTTGGG A 21 21 base pairs nucleic acid single linear DNA not provided 93 GAACGTCCCT CAACGCCGTA A 21 21 base pairs nucleic acid single linear DNA not provided 94 CGTATGCGCG GTAGGTCGTT T 21 26 base pairs nucleic acid single linear DNA not provided 95 AAACATCCCT CAACACCATA AAACTC 26 29 base pairs nucleic acid single linear DNA not provided 96 TGTATGTGTG GTAGGTTGTT TTTTTTTTT 29 20 base pairs nucleic acid single linear DNA not provided 97 GCGAAACTCA AACCCGAAAC 20 25 base pairs nucleic acid single linear DNA not provided 98 CGTTTATCGT GAGGATCGTT ATTAT 25 22 base pairs nucleic acid single linear DNA not provided 99 ACAAAACTCA AACCCAAAAC CC 22 27 base pairs nucleic acid single linear DNA not provided 100 TGTTTATTGT GAGGATTGTT ATTATGG 27 24 base pairs nucleic acid single linear DNA not provided 101 GCTACTAAAC TACCCCAAAC CGTC 24 19 base pairs nucleic acid single linear DNA not provided 102 CGGTCGTTAT GGCGGTGTC 19 25 base pairs nucleic acid single linear DNA not provided 103 ACTACTAAAC TACCCCAAAC CATCC 25 23 base pairs nucleic acid single linear DNA not provided 104 TGGTTGTTAT GGTGGTGTTG GAG 23 20 base pairs nucleic acid single linear DNA not provided 105 CAGAGGGTGG GGCGGACCGC 20 16 base pairs nucleic acid single linear DNA not provided 106 CGGGCCGCGG CCGTGG 16 24 base pairs nucleic acid single linear DNA not provided 107 TTATTAGAGG GTGGGGCGGA TCGC 24 21 base pairs nucleic acid single linear DNA not provided 108 GACCCCGAAC CGCGACCGTA A 21 24 base pairs nucleic acid single linear DNA not provided 109 TTATTAGAGG GTGGGGTGGA TTGT 24 22 base pairs nucleic acid single linear DNA not provided 110 CAACCCCAAA CCACAACCAT AA 22 27 base pairs nucleic acid single linear DNA not provided 111 TACTTATTAG AGGGTGGGGC GGATCGC 27 23 base pairs nucleic acid single linear DNA not provided 112 CCACCTAAAT CGACCTCCGA CCG 23 24 base pairs nucleic acid single linear DNA not provided 113 TTATTAGAGG GTGGGGTGGA TTGT 24 23 base pairs nucleic acid single linear DNA not provided 114 CCACCTAAAT CAACCTCCAA CCA 23 17 base pairs nucleic acid single linear DNA not provided 115 CGCACCCTGC GGCCAGA 17 17 base pairs nucleic acid single linear DNA not provided 116 AGTGGCCGAGC GGCCGG 17 19 base pairs nucleic acid single linear DNA not provided 117 GCGTTCGTAT TTTGCGGTT 19 22 base pairs nucleic acid single linear DNA not provided 118 CGTACAATAA CCGAACGACC GA 22 25 base pairs nucleic acid single linear DNA not provided 119 TGTGATGTGT TTGTATTTTG TGGTT 25 23 base pairs nucleic acid single linear DNA not provided 120 CCATACAATA ACCAAACAAC CAA 23 22 base pairs nucleic acid single linear DNA not provided 121 TGGAGGATTT TTTTGCGTAC GC 22 17 base pairs nucleic acid single linear DNA not provided 122 GAACCGAACG CCGCGAA 17 24 base pairs nucleic acid single linear DNA not provided 123 GTTGGAGGAT TTTTTTGTGT ATGT 24 20 base pairs nucleic acid single linear DNA not provided 124 CCCAAACCAA ACACCACAAA 20 22 base pairs nucleic acid single linear DNA not provided 125 TTAGGTTAGA GGGTTATCGC GT 22 23 base pairs nucleic acid single linear DNA not provided 126 TAACTAAAAA TTCACCTACC GAC 23 25 base pairs nucleic acid single linear DNA not provided 127 TAATTTTAGG TTAGAGGGTT ATTGT 25 20 base pairs nucleic acid single linear DNA not provided 128 CACAACCAAT CAACAACACA 20 24 base pairs nucleic acid single linear DNA not provided 129 GGGTTTTAGG TATTTAGAGG TCGC 24 26 base pairs nucleic acid single linear DNA not provided 130 ACCAAATAAC CTATAAAACC TCTACG 26 24 base pairs nucleic acid single linear DNA not provided 131 GGGTTTTAGG TATTTAGAGG TTGT 24 26 base pairs nucleic acid single linear DNA not provided 132 ACCAAATAAC CTATAAAACC TCTACA 26 27 base pairs nucleic acid single linear DNA not provided 133 GTGTATTTGG ATAGTAGTAA GTTCGTC 27 27 base pairs nucleic acid single linear DNA not provided 134 CGTAAAAAAA ACCGATCTAA CCGTAAA 27 28 base pairs nucleic acid single linear DNA not provided 135 GGTGTATTTG GATAGTAGTA AGTTTGTT 28 24 base pairs nucleic acid single linear DNA not provided 136 CCATAAAAAA AACCAATCTA ACCA 24 21 base pairs nucleic acid single linear DNA not provided 137 TTTATTTCGG GAGTCGGGGG C 21 23 base pairs nucleic acid single linear DNA not provided 138 AACGTACAAA AACTCCGACG ACG 23 24 base pairs nucleic acid single linear DNA not provided 139 TTTTTTATTT TGGGAGTTGG GGGT 24 24 base pairs nucleic acid single linear DNA not provided 140 AAACATACAA AAACTCCAAC AACA 24 20 base pairs nucleic acid single linear DNA not provided 141 TTCGGGGTGT AGCGGTCGTC 20 23 base pairs nucleic acid single linear DNA not provided 142 GCCCCAATAC TAAAATCACG ACG 23 24 base pairs nucleic acid single linear DNA not provided 143 GATGTTTGGG GTGTAGTGGT TGTT 24 25 base pairs nucleic acid single linear DNA not provided 144 CCACCCCAAT ACTAAAATCA CAACA 25 23 base pairs nucleic acid single linear DNA not provided 145 CGGGAATAAG AGTAGTCGTT GGC 23 24 base pairs nucleic acid single linear DNA not provided 146 CAAAACCCTA TAAAAACGAC GACG 24 25 base pairs nucleic acid single linear DNA not provided 147 GGTGGGAATA AGAGTAGTTG TTGGT 25 25 base pairs nucleic acid single linear DNA not provided 148 CCAAAACCCT ATAAAAACAA CAACA 25 20 base pairs nucleic acid single linear DNA not provided 149 GTCGTAGTCG GTTGTGCGTC 20 19 base pairs nucleic acid single linear DNA not provided 150 GATACCCGCC CTAACGCCG 19 22 base pairs nucleic acid single linear DNA not provided 151 GGGTTGTAGT TGGTTGTGTG TT 22 22 base pairs nucleic acid single linear DNA not provided 152 CACAATACCC ACCCTAACAC CA 22 28 base pairs nucleic acid single linear DNA not provided 153 GTATATTATT TATTTTTTTT GGTTACGC 28 18 base pairs nucleic acid single linear DNA not provided 154 TCATAACTCG CCAACGCG 18 30 base pairs nucleic acid single linear DNA not provided 155 TTGTATATTA TTTATTTTTT TTGGTTATGT 30 26 base pairs nucleic acid single linear DNA not provided 156 CTTAACACTC ATAACTCACC AACACA 26 24 base pairs nucleic acid single linear DNA not provided 157 ATATTCGTAG AAGGTAGCGC GGTC 24 17 base pairs nucleic acid single linear DNA not provided 158 AACGAACCCC TCCCGCG 17 32 base pairs nucleic acid single linear DNA not provided 159 TAGTAAATAT ATTTGTAGAA GGTAGTGTGG TT 32 20 base pairs nucleic acid single linear DNA not provided 160 CAAAACAAAC CCCTCCCACA 20 24 base pairs nucleic acid single linear DNA not provided 161 ACGTAGACGT TTTATTAGGG TCGC 24 20 base pairs nucleic acid single linear DNA not provided 162 CCTCATCGTA ACTACCCGCG 20 29 base pairs nucleic acid single linear DNA not provided 163 TTTTGATGTA GATGTTTTAT TAGGGTTGT 29 24 base pairs nucleic acid single linear DNA not provided 164 ACCACCTCAT CATAACTACC CACA 24 23 base pairs nucleic acid single linear DNA not provided 165 TTTTTGGCGT TAAAATGTCG TTC 23 19 base pairs nucleic acid single linear DNA not provided 166 TAAATAACTT CCCCCGCCG 19 27 base pairs nucleic acid single linear DNA not provided 167 GGTTTTTTTG GTGTTAAAAT GTTGTTT 27 23 base pairs nucleic acid single linear DNA not provided 168 CCACTAAATA ACTTCCCCCA CCA 23 19 base pairs nucleic acid single linear DNA not provided 169 TCGTGGTCGG ACGTCGTTC 19 23 base pairs nucleic acid single linear DNA not provided 170 CAACGTCTCC TTCGACTACA CCG 23 24 base pairs nucleic acid single linear DNA not provided 171 GGTTGTTGTG GTTGGATGTT GTTT 24 29 base pairs nucleic acid single linear DNA not provided 172 CAACTACAAC ATCTCCTTCA ACTACACCA 29 23 base pairs nucleic acid single linear DNA not provided 173 GTTGTTAGGG GTATTCGGGT ATC 23 24 base pairs nucleic acid single linear DNA not provided 174 CCCTAAAAAA ACGTAAAAAC GACG 24 24 base pairs nucleic acid single linear DNA not provided 175 TGTTGTTAGG GGTATTTGGG TATT 24 26 base pairs nucleic acid single linear DNA not provided 176 TCCCCTAAAA AAACATAAAA ACAACA 26 21 base pairs nucleic acid single linear DNA not provided 177 TGGGTTCGTT TGGTAGTTCG C 21 17 base pairs nucleic acid single linear DNA not provided 178 CCTCCCTAAC CGCCGCG 17 24 base pairs nucleic acid single linear DNA not provided 179 GGTTGGGTTT GTTTGGTAGT TTGT 24 21 base pairs nucleic acid single linear DNA not provided 180 CCCACCTCCC TAACCACCAC A 21 17 base pairs nucleic acid single linear DNA not provided 181 CGACGATATT TTCGCGC 17 16 base pairs nucleic acid single linear DNA not provided 182 AAACCGACGA AACGCG 16 25 base pairs nucleic acid single linear DNA not provided 183 GTATGGAGTG ATGATATTTT TGTGT 25 22 base pairs nucleic acid single linear DNA not provided 184 ACCTAAAAAC CAACAAAACA CA 22 21 base pairs nucleic acid single linear DNA not provided 185 TGTTTGTAGG CGGTTAGCGT C 21 19 base pairs nucleic acid single linear DNA not provided 186 ACGCACCCCT AAACGACCG 19 25 base pairs nucleic acid single linear DNA not provided 187 TGGGTGTTTG TAGGTGGTTA GTGTT 25 25 base pairs nucleic acid single linear DNA not provided 188 AACATAACAC ACCCCTAAAC AACCA 25 17 base pairs nucleic acid single linear DNA not provided 189 GCGGTAGAGG CGGAGTC 17 22 base pairs nucleic acid single linear DNA not provided 190 CGAAATAAAC TAACAAAAAC CG 22 22 base pairs nucleic acid single linear DNA not provided 191 ATTAGGTGGT AGAGGTGGAG TT 22 23 base pairs nucleic acid single linear DNA not provided 192 CCAAAATAAA CTAACAAAAA CCA 23 18 base pairs nucleic acid single linear DNA not provided 193 TCGGTTTCGT TTTCGCGC 18 20 base pairs nucleic acid single linear DNA not provided 194 CCCAACATAT CCGAAACGCG 20 23 base pairs nucleic acid single linear DNA not provided 195 GTGTTTTGGT TTTGTTTTTG TGT 23 21 base pairs nucleic acid single linear DNA not provided 196 TCCCAACATA TCCAAAACAC A 21 21 base pairs nucleic acid single linear DNA not provided 197 TTACGGCGTT GAGGGACGTT C 21 21 base pairs nucleic acid single linear DNA not provided 198 AAACGACCTA CCGCGCATAC G 21 26 base pairs nucleic acid single linear DNA not provided 199 GAGTTTTATG GTGTTGAGGG ATGTTT 26 29 base pairs nucleic acid single linear DNA not provided 200 AAAAAAAAAA ACAACCTACC ACACATACA 29 20 base pairs nucleic acid single linear DNA not provided 201 GTTTCGGGTT TGAGTTTCGC 20 25 base pairs nucleic acid single linear DNA not provided 202 ATAATAACGA TCCTCACGAT AAACG 25 22 base pairs nucleic acid single linear DNA not provided 203 GGGTTTTGGG TTTGAGTTTT GT 22 27 base pairs nucleic acid single linear DNA not provided 204 CCATAATAAC AATCCTCACA ATAAACA 27 24 base pairs nucleic acid single linear DNA not provided 205 GACGGTTTGG GGTAGTTTAG TAGC 24 19 base pairs nucleic acid single linear DNA not provided 206 GACACCGCCA TAACGACCG 19 25 base pairs nucleic acid single linear DNA not provided 207 GGATGGTTTG GGGTAGTTTA GTAGT 25 23 base pairs nucleic acid single linear DNA not provided 208 CTCCAACACC ACCATAACAA CCA 23 24 base pairs nucleic acid single linear DNA not provided 209 TTTTTAGAGG ATTTGAGGGA TAGG 24 24 base pairs nucleic acid single linear DNA not provided 210 CTACCTAATT CCAATTCCCC TACA 24 41 base pairs nucleic acid single linear DNA not provided 211 GTTTTCCCAG TCACGACAGT ATTAGGAGGA AGAAAGAGGA G 41 21 base pairs nucleic acid single linear DNA not provided 212 TCCAATTCCC CTACAAACTT C 21 24 base pairs nucleic acid single linear DNA not provided 213 CTACCTAATT CCAATTCCCC TACA 24 24 base pairs nucleic acid single linear DNA not provided 214 TCATTAGAGG GTGGGGCGGA TCGC 24 26 base pairs nucleic acid single linear DNA not provided 215 CCTTATTAGA GGGTGGGGCG GATCGC 26 25 base pairs nucleic acid single linear DNA not provided 216 TGGCAACCCC AAACCACAAC CATAA 25

Claims (14)

What is claimed is:
1. A method for detecting a methylated CpG in a 5′ regulatory region of a nucleic acid sequence comprising:
contacting a nucleic acid-containing specimen with an agent that modifies unmethylated cytosine;
amplifying the CpG-containing nucleic acid in the specimen by means of CpG-specific oligonucleotide primers, wherein the oligonucleotide primers distinguish between modified methylated and non-methylated nucleic acid in the 5′ regulatory region; and
detecting the methylated nucleic acid based on the presence of amplification products produced in the amplifying step.
2. The method of claim 1, wherein the agent is bisulfite.
3. The method of claim 1, wherein the amplifying step is by polymerase chain reaction (PCR).
4. The method of claim 1, wherein cytosine is modified to uracil.
5. The method of claim 1, wherein the 5′ regulatory region is in a promoter region.
6. The method of claim 5, wherein the promoter is a tumor suppressor gene promoter.
7. The method of claim 6, wherein the tumor suppressor gene is selected from the group consisting of p16, p15, E-cadherin, and VHL.
8. The method of claim 1, wherein the specimen is from a tissue selected from the group consisting of brain, colon, urogenital, lung, renal, hematopoietic, breast, thymus, testis, ovarian, and uterine.
9. The method of claim 1, further comprising contacting the nucleic acid with a methylation sensitive restriction endonuclease.
10. The method of claim 9, wherein the restriction endonuclease is selected from the group consisting of Mspl, HpaII, BssHII, BstUI and NotI.
11. The method of claim 1, wherein the presence of methylated CpG-in the 5′ regulatory region is indicative of a cell proliferative disorder.
12. The method of claim 11, wherein the disorder is selected from the group consisting of low grade astrocytoma, anaplastic astrocytoma, glioblastoma, medulloblastoma, colon cancer, lung cancer, renal cancer, leukemia, breast cancer, prostate cancer, endometrial cancer and neuroblastoma.
13. The method of claim 1, wherein the primers hybridize with a target polynucleotide sequence having the sequence selected from the group consisting of SEQ ID Nos: 1-24.
14. The method of claim 1, wherein the primers are selected from the group consisting of SEQ ID Nos: 25-48.
US09/490,558 1996-06-03 2000-01-25 Method of detection of methylated nucleic acid using agents which modify unmethylated cytosine and distinguish modified methylated and non-methylated nucleic acids Expired - Lifetime US6265171B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US09/490,558 US6265171B1 (en) 1996-06-03 2000-01-25 Method of detection of methylated nucleic acid using agents which modify unmethylated cytosine and distinguish modified methylated and non-methylated nucleic acids

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US08/656,716 US5786146A (en) 1996-06-03 1996-06-03 Method of detection of methylated nucleic acid using agents which modify unmethylated cytosine and distinguishing modified methylated and non-methylated nucleic acids
US08/835,728 US6017704A (en) 1996-06-03 1997-04-11 Method of detection of methylated nucleic acid using agents which modify unmethylated cytosine and distinguishing modified methylated and non-methylated nucleic acids
US09/490,558 US6265171B1 (en) 1996-06-03 2000-01-25 Method of detection of methylated nucleic acid using agents which modify unmethylated cytosine and distinguish modified methylated and non-methylated nucleic acids

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US08/835,728 Continuation US6017704A (en) 1996-06-03 1997-04-11 Method of detection of methylated nucleic acid using agents which modify unmethylated cytosine and distinguishing modified methylated and non-methylated nucleic acids

Publications (1)

Publication Number Publication Date
US6265171B1 true US6265171B1 (en) 2001-07-24

Family

ID=27097252

Family Applications (2)

Application Number Title Priority Date Filing Date
US08/835,728 Expired - Lifetime US6017704A (en) 1996-06-03 1997-04-11 Method of detection of methylated nucleic acid using agents which modify unmethylated cytosine and distinguishing modified methylated and non-methylated nucleic acids
US09/490,558 Expired - Lifetime US6265171B1 (en) 1996-06-03 2000-01-25 Method of detection of methylated nucleic acid using agents which modify unmethylated cytosine and distinguish modified methylated and non-methylated nucleic acids

Family Applications Before (1)

Application Number Title Priority Date Filing Date
US08/835,728 Expired - Lifetime US6017704A (en) 1996-06-03 1997-04-11 Method of detection of methylated nucleic acid using agents which modify unmethylated cytosine and distinguishing modified methylated and non-methylated nucleic acids

Country Status (11)

Country Link
US (2) US6017704A (en)
EP (2) EP1690948A3 (en)
JP (2) JP3612080B2 (en)
AT (1) ATE326549T1 (en)
CA (1) CA2257104C (en)
DE (1) DE69735894T2 (en)
DK (1) DK0954608T3 (en)
ES (1) ES2264165T3 (en)
IL (1) IL127342A (en)
PT (1) PT954608E (en)
WO (1) WO1997046705A1 (en)

Cited By (189)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003014388A2 (en) 2001-08-09 2003-02-20 Epigenomics Ag Method and nucleic acids for the analysis of colon cancer
WO2003035860A1 (en) * 2001-10-24 2003-05-01 The Trustees Of Columbia University In The City Of New York A method for gene identification based on differential dna methylation
US6596493B1 (en) 2000-08-15 2003-07-22 The Johns Hopkins University School Of Medicine Diagnosis and treatment of tumor-suppressor associated disorders
US20030138821A1 (en) * 2000-09-01 2003-07-24 Zhiyong Guo System and method for temperature gradient capillary electrophoresis
WO2003076666A1 (en) * 2002-03-08 2003-09-18 Naxcor Compositions and methods for detecting nucleic acid methylation
US20030180748A1 (en) * 1999-10-13 2003-09-25 Andreas Braun Methods for generating databases and databases for identifying polymorphic genetic markers
WO2003083107A1 (en) * 2002-03-25 2003-10-09 The Board Of Trustees Of The University Of Arkansas Cpg retrieval of dna from formalin-fixed pathology specimen for promoter methylation analysis
US20030203364A1 (en) * 2002-04-24 2003-10-30 Zhaowei Liu Method for determining the presence of DNA variants using peptide nucleic acid probes
US20030207297A1 (en) * 1999-10-13 2003-11-06 Hubert Koster Methods for generating databases and databases for identifying polymorphic genetic markers
US20030215842A1 (en) * 2002-01-30 2003-11-20 Epigenomics Ag Method for the analysis of cytosine methylation patterns
US20040048276A1 (en) * 2000-10-11 2004-03-11 Zhaowei Liu System and method for determining the presence of methylated cytosines in polynucleotides
US20040053304A1 (en) * 2002-06-05 2004-03-18 Case Western Reserve University Methods and compositions for detecting cancers
US20040132048A1 (en) * 2002-06-26 2004-07-08 Robert Martienssen Methods and compositions for determining methylation profiles
US20040178070A1 (en) * 2002-07-16 2004-09-16 Zhaowei Liu Method and system for comparative genomics for organisms using temperature gradient electrophoresis
US20040203004A1 (en) * 2003-04-10 2004-10-14 Bernard Hans Ulrich Diagnostic apparatus and method
US20040219539A1 (en) * 2003-05-02 2004-11-04 Millar Douglas Spencer Treatment of methylated nucleic acid
US20040242510A1 (en) * 2001-10-05 2004-12-02 Markowitz Sanford D. Methods and compositions for detecting colon cancers
WO2004067775A3 (en) * 2003-01-30 2004-12-09 Epigenomics Ag Method for the detection of cytosine methylation patterns with high sensitivity
US20040248090A1 (en) * 1999-12-06 2004-12-09 Alexander Olek Method for the parallel detection of the degree of methylation of genomic dna
US20050003463A1 (en) * 2002-02-27 2005-01-06 Peter Adorjan Method and nucleic acids for the analysis of colorectal cell proliferative disorders
US20050009053A1 (en) * 2003-04-25 2005-01-13 Sebastian Boecker Fragmentation-based methods and systems for de novo sequencing
US20050026183A1 (en) * 2003-05-15 2005-02-03 Jian-Bing Fan Methods and compositions for diagnosing conditions associated with specific DNA methylation patterns
US20050064473A1 (en) * 2003-07-31 2005-03-24 Zhaowei Liu Determination of SNP allelic frequencies using temperature gradient electrophoresis
US20050064400A1 (en) * 2001-10-18 2005-03-24 Zhiyong Guo System and method for temperature gradient capillary electrophoresis
US20050089904A1 (en) * 2003-09-05 2005-04-28 Martin Beaulieu Allele-specific sequence variation analysis
US20050106593A1 (en) * 2003-08-14 2005-05-19 Markowitz Sanford D. Methods and compositions for detecting colon cancers
US20050112590A1 (en) * 2002-11-27 2005-05-26 Boom Dirk V.D. Fragmentation-based methods and systems for sequence variation detection and discovery
US20050123944A1 (en) * 2003-08-01 2005-06-09 U.S. Genomics, Inc. Methods and compositions related to the use of sequence-specific endonucleases for analyzing nucleic acids under non-cleaving conditions
US20050153316A1 (en) * 2003-10-21 2005-07-14 Orion Genomics Llc Methods for quantitative determination of methylation density in a DNA locus
US20050153347A1 (en) * 2003-05-07 2005-07-14 Affymetrix, Inc. Analysis of methylation status using oligonucleotide arrays
US20050164246A1 (en) * 2003-05-15 2005-07-28 Illumina, Inc. Methods and compositions for diagnosing lung cancer with specific DNA methylation patterns
US20050221314A1 (en) * 2002-03-05 2005-10-06 Epigenomics Ag Method and device for determination of tissue specificity of free floating dna in bodily fluids
US20050221329A1 (en) * 1999-02-01 2005-10-06 Epigenomics Ag Use of fluorescent molecular beacons in the detection of methylated nucleic acid
US20050227265A1 (en) * 2004-02-10 2005-10-13 Francis Barany Method for detection of promoter methylation status
WO2005040421A3 (en) * 2003-10-17 2005-10-27 Martin Widschwendter Prognostic and diagnostic markers for cell proliferative disorders of the breast tissues
US20050272070A1 (en) * 2004-03-26 2005-12-08 Sequenom, Inc. Base specific cleavage of methylation-specific amplification products in combination with mass analysis
US20050272065A1 (en) * 2004-03-02 2005-12-08 Orion Genomics Llc Differential enzymatic fragmentation by whole genome amplification
US6977146B1 (en) * 1999-01-29 2005-12-20 Epigenomics Ag Method of identifying cytosine methylation patterns in genomic DNA samples
US20060040288A1 (en) * 2004-06-01 2006-02-23 The Regents Of The University Of Michigan Methods and kits for diagnosing or monitoring autoimmune and chronic inflammatory diseases
US20060073501A1 (en) * 2004-09-10 2006-04-06 Van Den Boom Dirk J Methods for long-range sequence analysis of nucleic acids
US20060100188A1 (en) * 2004-11-09 2006-05-11 Chen Zong Treatment methods
US20060134650A1 (en) * 2004-12-21 2006-06-22 Illumina, Inc. Methylation-sensitive restriction enzyme endonuclease method of whole genome methylation analysis
WO2006088940A2 (en) 2005-02-14 2006-08-24 The Johns Hopkins University Neoplasia screening compositions and methods of use
EP1721992A2 (en) 2005-04-15 2006-11-15 Epigenomics AG Methods and nucleic acids for analyses of cellular proliferative disorders
US20060286577A1 (en) * 2005-06-17 2006-12-21 Xiyu Jia Methods for detection of methylated DNA
US20070015156A1 (en) * 2003-03-17 2007-01-18 Goggins Michael G Aberrantly methylated genes in pancreatic cancer
US20070031863A1 (en) * 2005-06-01 2007-02-08 The Regents Of The University Of Michigan Methods and kits for diagnosing or monitoring autoimmune and chronic inflammatory diseases
US20070037184A1 (en) * 2005-06-16 2007-02-15 Applera Corporation Methods and kits for evaluating dna methylation
US20070042365A1 (en) * 2003-01-24 2007-02-22 Millar Douglas S Assay for detecting methylation changes in nucleic acids using an intercalating nucleic acid
US20070087358A1 (en) * 2005-10-19 2007-04-19 Melanie Ehrlich Methods for diagnosing cancer based on DNA methylation status in NBL2
US20070087360A1 (en) * 2005-06-20 2007-04-19 Boyd Victoria L Methods and compositions for detecting nucleotides
US20070160995A1 (en) * 2004-01-09 2007-07-12 Epigenomics Ag Method for investigating cytosine methylation in dna by means of dna repair enzymes
WO2007084670A2 (en) 2006-01-18 2007-07-26 Merck Patent Gmbh Specific therapy using integrin ligands for treating cancer
US20070178459A1 (en) * 2003-09-04 2007-08-02 Human Genetic Signatures Pty. Ltd. Nucleic acid detection assay
US20070178457A1 (en) * 2003-06-17 2007-08-02 Human Genetic Signatures Pty. Ltd. Methods for genome amplification
US20070184438A1 (en) * 2003-06-23 2007-08-09 Cathy Lofton-Day Methods and nucleic acids for the analysis of colorectal cell proliferative disorders
US20070238117A1 (en) * 2006-03-22 2007-10-11 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Method for retaining methylation pattern in globally amplified dna
US20070264672A1 (en) * 2006-05-09 2007-11-15 Bimalendu Dasmahapatra Development of a novel assay for mgmt (methyl guanine methyl transferase)
US20080003609A1 (en) * 2006-05-10 2008-01-03 The Cleveland Clinic Foundation Method of detecting bladder urothelial carcinoma
US20080050738A1 (en) * 2006-05-31 2008-02-28 Human Genetic Signatures Pty Ltd. Detection of target nucleic acid
US20080064029A1 (en) * 2003-06-23 2008-03-13 Epigenomics Ag Methods and Nucleic Acids for Analyses of Colorectal Cell Proliferative Disorders
US20080085867A1 (en) * 2006-07-14 2008-04-10 The Johns Hopkins University Early detection and prognosis of colon cancers
US20080145852A1 (en) * 2005-03-01 2008-06-19 Shuber Anthony P Methods and compositions for detecting adenoma
US20080171318A1 (en) * 2004-09-30 2008-07-17 Epigenomics Ag Epigenetic Methods and Nucleic Acids for the Detection of Lung Cell Proliferative Disorders
WO2008087025A2 (en) 2007-01-18 2008-07-24 Merck Patent Gmbh Specific therapy and medicament using integrin ligands for treating cancer
WO2008087040A2 (en) 2007-01-19 2008-07-24 Epigenomics Ag Methods and nucleic acids for analyses of cell proliferative disorders
EP1961827A2 (en) 2004-07-18 2008-08-27 Epigenomics AG Epigenetic methods and nucleic acids for the detection of breast cell proliferative disorders
US20080207460A1 (en) * 2002-12-02 2008-08-28 Solexa Limited Determination of methylation of nucleic acid sequences
US20080223695A1 (en) * 2005-10-12 2008-09-18 Scanvaegt International A/S Device for Transfer of Items
US7432342B2 (en) 2002-05-03 2008-10-07 Sequenom, Inc. Kinase anchor protein muteins, peptides thereof and related documents
US20080254470A1 (en) * 2005-10-03 2008-10-16 Epigenomics Ag Methods and Nucleic Acids For the Analysis of Gene Expression Associated With the Prognosis of Cell Proliferative Disorders
US20080254447A1 (en) * 2003-12-11 2008-10-16 Epigenomics Ag Method and Nucleic Acids for the Improved Treatment of Breast Cell Proliferative Disorders
US20080286761A1 (en) * 2003-12-01 2008-11-20 Epigenomics Ag Methods and Nucleic Acids for the Analysis of Gene Expression Associated with the Development of Prostate Cell Proliferative Disorders
US20090005268A1 (en) * 2005-07-18 2009-01-01 Epigenomics Ag Compositions and Methods for Cancer Diagnostics Comprising Pan-Cancer Markers
US20090029346A1 (en) * 2004-12-23 2009-01-29 Human Genetic Signatures Pty., Ltd. Detection of human papilloma virus
US20090042732A1 (en) * 2004-12-03 2009-02-12 Human Genetic Signatures Pty. Ltd. Methods for simplifying microbial nucleic acids by chemical modification of cytosines
US20090042195A1 (en) * 2005-10-07 2009-02-12 Bradford Coffee Methods and systems for screening for and diagnosing dna methylation associated abnormalities and sex chromosome aneuploidies
US20090047666A1 (en) * 2003-06-23 2009-02-19 Epigenomics Ag Methods and nucleic acids for the analysis of colon proliferative disorders
US20090053706A1 (en) * 2005-05-02 2009-02-26 University Of Southern California Dna methylation markers associated with the cpg island methylator phenotype (cimp) in human colorectal cancer
WO2009037633A2 (en) 2007-09-17 2009-03-26 Koninklijke Philips Electronics N.V. Method for the analysis of ovarian cancer disorders
WO2009037635A2 (en) 2007-09-17 2009-03-26 Koninklijke Philips Electronics N. V. Method for the analysis of breast cancer disorders
US20090111707A1 (en) * 2005-09-21 2009-04-30 Epigenomics Ag Markers for the prediction of outcome of anthracycline treatment
US20090130657A1 (en) * 2004-09-10 2009-05-21 Human Genetic Signatures Pty Ltd. Amplification blocker comprising intercalating nucleic acids (ina) containing intercalating pseudonucleotides (ipn)
US20090148842A1 (en) * 2007-02-07 2009-06-11 Niall Gormley Preparation of templates for methylation analysis
US20090197250A1 (en) * 2004-12-02 2009-08-06 Epigenomics Ag Methods and nucleic acids for the analysis of gene expression associated with the prognosis of prostate cell proliferative disorders
US20090203011A1 (en) * 2007-01-19 2009-08-13 Epigenomics Ag Methods and nucleic acids for analyses of cell proliferative disorders
US20090203010A1 (en) * 2008-01-18 2009-08-13 Katholieke Universiteit Leuven, K.U. Leuven R&D MSMB-gene based diagnosis, staging and prognosis of prostate cancer
US7608394B2 (en) 2004-03-26 2009-10-27 Sequenom, Inc. Methods and compositions for phenotype identification based on nucleic acid methylation
US7611869B2 (en) 2000-02-07 2009-11-03 Illumina, Inc. Multiplexed methylation detection methods
WO2009153667A2 (en) 2008-06-17 2009-12-23 Occure Gmbh Method for the detection of ovarian cancer
US20090317810A1 (en) * 2006-04-17 2009-12-24 Epigenomics Ag Methods and nucleic acids for the detection of colorectal cell proliferative disorders
US20100035242A1 (en) * 2004-06-23 2010-02-11 Epigenomics Ag Methods and nucleic acids for the detection of metastasis of colon cell proliferative disorders
US20100041013A1 (en) * 2005-09-14 2010-02-18 Human Genetic Signatures Pty Ltd. Assay for a health state
EP2157191A2 (en) 2002-10-01 2010-02-24 Epigenomics AG Method and nucleic acids for the improved treatment of breast cell proliferative disorders
WO2010048337A2 (en) 2008-10-22 2010-04-29 Illumina, Inc. Preservation of information related to genomic dna methylation
EP2186912A2 (en) 2005-11-08 2010-05-19 Euclid Diagnostics LLC Materials and methods for assaying for methylation of CpG islands associated with genes in the evaluation of cancer
US20100143902A1 (en) * 2006-07-21 2010-06-10 Epigenomics Ag Methods and nucleic acids for analyses of cellular proliferative disorders
WO2010070572A1 (en) 2008-12-18 2010-06-24 Koninklijke Philips Electronics N. V. Method for the detection of dna methylation patterns
US20100221785A1 (en) * 2005-05-26 2010-09-02 Human Genetic Signatures Pty Ltd Isothermal Strand Displacement Amplification Using Primers Containing a Non-Regular Base
WO2010136168A2 (en) 2009-05-25 2010-12-02 Merck Patent Gmbh Continuous administration of integrin ligands for treating cancer
US20100304386A1 (en) * 2007-11-27 2010-12-02 Human Genetic Signatures Pty Ltd. Enzymes for amplification and copying bisulphite modified nucleic acids
WO2010149782A1 (en) 2009-06-26 2010-12-29 Epigenomics Ag Methods and nucleic acids for analysis of bladder cell proliferative disorders
US20110003700A1 (en) * 2007-12-20 2011-01-06 Human Genetic Signatures Pty Ltd. Elimination of contaminants associated with nucleic acid amplification
US20110027789A1 (en) * 2009-08-03 2011-02-03 Epigenomics Ag Methods for preservation of genomic dna sequence complexity
US7901882B2 (en) 2006-03-31 2011-03-08 Affymetrix, Inc. Analysis of methylation using nucleic acid arrays
EP2298932A1 (en) 2005-09-29 2011-03-23 Epigenomics AG Methods and nucleic acids for the analysis of gene expression, in particular methylation of KAAG1, associated with tissue classification
EP2302069A1 (en) 2007-12-11 2011-03-30 Epigenomics AG Methods and nucleic acids for analyses of cell proliferative disorders
WO2011051414A1 (en) 2009-10-28 2011-05-05 Signature Diagnostics Ag Method for the prognosis of ovarian carcinoma
EP2319943A1 (en) 2009-11-05 2011-05-11 Epigenomics AG Methods of predicting therapeutic efficacy of cancer therapy
US20110159499A1 (en) * 2009-11-25 2011-06-30 Quantalife, Inc. Methods and compositions for detecting genetic material
US20110165567A1 (en) * 2009-08-27 2011-07-07 Markowitz Sanford D ABERRANT METHYLATION OF C6Orf150 DNA SEQUENCES IN HUMAN COLORECTAL CANCER
EP2354249A1 (en) 2003-06-23 2011-08-10 Epigenomics AG Methods and nucleic acids for analyses of colorectal cell proliferative disorders
US8003354B2 (en) 2000-02-07 2011-08-23 Illumina, Inc. Multiplex nucleic acid reactions
WO2011137206A1 (en) 2010-04-30 2011-11-03 Novartis Ag Predictive markers useful in the treatment of fragile x syndrome (fxs)
WO2011150075A2 (en) 2010-05-25 2011-12-01 The Johns Hopkins University Compositions and methods for detecting a neoplasia
US8076063B2 (en) 2000-02-07 2011-12-13 Illumina, Inc. Multiplexed methylation detection methods
WO2012007137A1 (en) 2010-07-16 2012-01-19 Merck Patent Gmbh Peptide for use in the treatment of breast cancer and/or bone metastases
EP2409700A1 (en) 2007-05-08 2012-01-25 Schering Corporation Methods of treatment using intravenous formulations comprising temozolomide
US8150627B2 (en) 2003-05-15 2012-04-03 Illumina, Inc. Methods and compositions for diagnosing lung cancer with specific DNA methylation patterns
US8168777B2 (en) 2004-04-29 2012-05-01 Human Genetic Signatures Pty. Ltd. Bisulphite reagent treatment of nucleic acid
EP2479283A1 (en) 2006-04-17 2012-07-25 Epigenomics AG Methods and nucleic acids for the detection of colorectal cell proliferative disorders
EP2508623A1 (en) 2006-11-20 2012-10-10 The Johns Hopkins University DNA methylation markers and methods of use
US8288103B2 (en) 2000-02-07 2012-10-16 Illumina, Inc. Multiplex nucleic acid reactions
WO2012178074A1 (en) 2011-06-23 2012-12-27 Case Western Reserve University Methods and compositions for detecting gastrointestinal and other cancers
WO2013007702A1 (en) 2011-07-08 2013-01-17 Epigenomics Ag Methods and nucleic acids for determining the prognosis of a cancer subject
WO2013096661A1 (en) 2011-12-22 2013-06-27 Illumina, Inc. Methylation biomarkers for ovarian cancer
WO2013131981A1 (en) 2012-03-08 2013-09-12 Novartis Ag Predictive markers useful in the diagnosis and treatment of fragile x syndrome (fxs)
WO2013148147A1 (en) 2012-03-26 2013-10-03 The U.S.A., As Represented By The Secretary Dept. Of Health And Human Services Dna methylation analysis for the diagnosis, prognosis and treatment of adrenal neoplasms
WO2013165748A1 (en) 2012-04-30 2013-11-07 Raindance Technologies, Inc Digital analyte analysis
WO2013174432A1 (en) 2012-05-24 2013-11-28 Fundació Institut D'investigació Biomèdica De Bellvitge (Idibell) Method for the identification of the origin of a cancer of unknown primary origin by methylation analysis
WO2014159652A2 (en) 2013-03-14 2014-10-02 Mayo Foundation For Medical Education And Research Detecting neoplasm
WO2014172288A2 (en) 2013-04-19 2014-10-23 Raindance Technologies, Inc. Digital analyte analysis
US9127312B2 (en) 2011-02-09 2015-09-08 Bio-Rad Laboratories, Inc. Analysis of nucleic acids
WO2015153283A1 (en) 2014-03-31 2015-10-08 Mayo Foundation For Medical Education And Research Detecting colorectal neoplasm
WO2016115530A1 (en) 2015-01-18 2016-07-21 The Regents Of The University Of California Method and system for determining cancer status
EP3048176A2 (en) 2009-04-20 2016-07-27 Erasmus University Medical Center Rotterdam Method of diagnosing bladder cancer
WO2016160454A1 (en) 2015-03-27 2016-10-06 Exact Sciences Corporation Detecting esophageal disorders
WO2017040627A1 (en) 2015-08-31 2017-03-09 Mayo Foundation For Medical Education And Research Detecting gastric neoplasm
EP3184649A1 (en) 2006-11-24 2017-06-28 Epigenomics AG Methods and nucleic acids for the analysis of gene expression associated with the development of prostate cell proliferative disorders
WO2017136482A1 (en) 2016-02-01 2017-08-10 The Board Of Regents Of The University Of Nebraska Method of identifying important methylome features and use thereof
US9732375B2 (en) 2011-09-07 2017-08-15 Human Genetic Signatures Pty. Ltd. Molecular detection assay using direct treatment with a bisulphite reagent
WO2018017740A1 (en) 2016-07-19 2018-01-25 Exact Sciences Development Company, Llc Methylated control dna
WO2018045322A1 (en) 2016-09-02 2018-03-08 Mayo Foundation For Medical Education And Research Detecting hepatocellular carcinoma
US10093986B2 (en) 2016-07-06 2018-10-09 Youhealth Biotech, Limited Leukemia methylation markers and uses thereof
US10202650B2 (en) 2016-05-31 2019-02-12 Youhealth Biotech, Limited Methods for monitoring ELOVL2, KLF14 and PENK gene expression following treatment with vitamin C
EP3441479A1 (en) 2011-02-02 2019-02-13 Exact Sciences Development Company, LLC Digital sequence analysis of dna methylation
WO2019071161A1 (en) 2017-10-06 2019-04-11 Youhealth Biotech, Limited Methylation markers for diagnosing cancer
WO2019108626A1 (en) 2017-11-30 2019-06-06 Mayo Foundation For Medical Education And Research Detecting breast cancer
WO2019143845A1 (en) 2018-01-17 2019-07-25 The Regents Of The University Of California Phenotypic age and dna methylation based biomarkers for life expectancy and morbidity
US10435743B2 (en) 2011-05-20 2019-10-08 The Regents Of The University Of California Method to estimate age of individual based on epigenetic markers in biological sample
US10513739B2 (en) 2017-03-02 2019-12-24 Youhealth Oncotech, Limited Methylation markers for diagnosing hepatocellular carcinoma and lung cancer
EP3589732A1 (en) 2017-02-28 2020-01-08 Mayo Foundation for Medical Education and Research Detecting prostate cancer
US10544467B2 (en) 2016-07-06 2020-01-28 Youhealth Oncotech, Limited Solid tumor methylation markers and uses thereof
WO2020076983A1 (en) 2018-10-10 2020-04-16 The Regents Of The University Of California Dna methylation based biomarkers for life expectancy and morbidity
WO2020150705A1 (en) 2019-01-18 2020-07-23 The Regents Of The University Of California Dna methylation measurement for mammals based on conserved loci
WO2021050962A1 (en) 2019-09-11 2021-03-18 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Cancer detection and classification
EP3798321A1 (en) 2015-12-17 2021-03-31 Illumina, Inc. Distinguishing methylation levels in complex biological samples
US11001898B2 (en) 2019-05-31 2021-05-11 Universal Diagnostics, S.L. Detection of colorectal cancer
WO2021185061A1 (en) 2020-03-20 2021-09-23 Singlera Health Technologies (Shanghai) Ltd. Methods and kits for screening colorectal neoplasm
EP3889611A1 (en) 2014-12-12 2021-10-06 Exact Sciences Development Company, LLC Compositions and methods for performing methylation detection assays
WO2022040306A1 (en) 2020-08-19 2022-02-24 Mayo Foundation For Medical Education And Research Detecting non-hodgkin lymphoma
US11332795B2 (en) 2008-05-14 2022-05-17 Dermtech, Inc. Diagnosis of melanoma and solar lentigo by nucleic acid analysis
US11396678B2 (en) 2016-07-06 2022-07-26 The Regent Of The University Of California Breast and ovarian cancer methylation markers and uses thereof
US11396679B2 (en) 2019-05-31 2022-07-26 Universal Diagnostics, S.L. Detection of colorectal cancer
WO2022165247A1 (en) 2021-01-29 2022-08-04 Mayo Foundation For Medical Education And Research Detecting the presence or absence of multiple types of cancer
US11433075B2 (en) 2017-06-22 2022-09-06 Triact Therapeutics, Inc. Methods of treating glioblastoma
US11530453B2 (en) 2020-06-30 2022-12-20 Universal Diagnostics, S.L. Systems and methods for detection of multiple cancer types
US11578373B2 (en) 2019-03-26 2023-02-14 Dermtech, Inc. Gene classifiers and uses thereof in skin cancers
US20230049979A1 (en) * 2020-02-06 2023-02-16 OncoHost Ltd. Machine learning prediction of therapy response
WO2023052640A1 (en) 2021-09-30 2023-04-06 Tivenix Sa A method for diagnosing and predicting progression of neurodegenerative diseases or disorders
US11628144B2 (en) 2017-09-29 2023-04-18 Triact Therapeutics, Inc. Iniparib formulations and uses thereof
EP4170661A1 (en) 2021-10-19 2023-04-26 Institut National de la Santé et de la Recherche Médicale (INSERM) Methylation profile analysis using smoothing method
WO2023066972A1 (en) 2021-10-19 2023-04-27 INSERM (Institut National de la Santé et de la Recherche Médicale) Dna methylation signature for diagnosing hepatocellular carcinoma
US11702704B2 (en) 2019-10-31 2023-07-18 Mayo Foundation For Medical Education And Research Detecting ovarian cancer
WO2023175019A1 (en) 2022-03-15 2023-09-21 Genknowme S.A. Method determining the difference between the biological age and the chronological age of a subject
EP4299764A1 (en) 2022-06-28 2024-01-03 Universal Diagnostics, S.A. Methods for detecting pancreatic cancer using dna methylation markers
US11898199B2 (en) 2019-11-11 2024-02-13 Universal Diagnostics, S.A. Detection of colorectal cancer and/or advanced adenomas
US11976332B2 (en) 2018-02-14 2024-05-07 Dermtech, Inc. Gene classifiers and uses thereof in non-melanoma skin cancers
WO2024105132A1 (en) 2022-11-16 2024-05-23 Universal Diagnostics, S.A. Methods for stratification and early detection of advanced adenoma and/or colorectal cancer using dna methylation markers
WO2024256726A1 (en) 2023-06-15 2024-12-19 Genknowme S.A. Computer implemented method determining a value of allostatic load of a human being
US12188093B2 (en) 2014-09-26 2025-01-07 Mayo Foundation For Medical Education And Research Detecting cholangiocarcinoma
US12351876B2 (en) 2016-07-06 2025-07-08 Helio Health, Inc. Colon cancer methylation markers and uses thereof
US12359257B2 (en) 2016-07-06 2025-07-15 Helio Health Inc. Liver cancer methylation markers and uses thereof
US12404538B2 (en) 2020-05-27 2025-09-02 Case Western Reserve University Compositions and methods for preserving DNA methylation
US12404540B2 (en) 2018-10-17 2025-09-02 The University Of Queensland Epigenetic biomarker and uses therefor
US12467096B2 (en) 2020-05-15 2025-11-11 Universal Diagnostics, S.A. Methods and systems for identifying methylation biomarkers
US12553089B2 (en) 2019-05-28 2026-02-17 Case Western Reserve University Compositions and methods for preserving DNA methylation
US12584177B2 (en) 2019-01-24 2026-03-24 Mayo Foundation For Medical Education And Research Detecting endometrial cancer
US12606872B2 (en) 2022-11-16 2026-04-21 Universal Diagnostics, S.A. Methods for stratification and early detection of advanced adenoma and/or colorectal cancer using DNA methylation markers

Families Citing this family (126)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5871917A (en) 1996-05-31 1999-02-16 North Shore University Hospital Research Corp. Identification of differentially methylated and mutated nucleic acids
US6617434B1 (en) 1996-05-31 2003-09-09 North Shore Long Island Jewish Research Institute Identificiaton of differentially methylated and mutated nucleic acids
US5786146A (en) * 1996-06-03 1998-07-28 The Johns Hopkins University School Of Medicine Method of detection of methylated nucleic acid using agents which modify unmethylated cytosine and distinguishing modified methylated and non-methylated nucleic acids
US6251594B1 (en) * 1997-06-09 2001-06-26 Usc/Norris Comprehensive Cancer Ctr. Cancer diagnostic method based upon DNA methylation differences
US6818404B2 (en) 1997-10-23 2004-11-16 Exact Sciences Corporation Methods for detecting hypermethylated nucleic acid in heterogeneous biological samples
DE19754482A1 (en) * 1997-11-27 1999-07-01 Epigenomics Gmbh Process for making complex DNA methylation fingerprints
AUPP312998A0 (en) * 1998-04-23 1998-05-14 Commonwealth Scientific And Industrial Research Organisation Diagnostic assay
US7700324B1 (en) 1998-11-03 2010-04-20 The Johns Hopkins University School Of Medicine Methylated CpG island amplification (MCA)
US6994991B1 (en) 1998-11-18 2006-02-07 North Shore - Long Island Jewish Research Institute Identification of differentially methylated multiple drug resistance loci
DE19853398C1 (en) * 1998-11-19 2000-03-16 Epigenomics Gmbh Identification of 5-methylcytosine positions in genomic DNA by chemical modification, amplification and heteroduplex formation
US7655443B1 (en) * 1999-05-07 2010-02-02 Siemens Healthcare Diagnostics, Inc. Nucleic acid sequencing with simultaneous quantitation
US6331393B1 (en) * 1999-05-14 2001-12-18 University Of Southern California Process for high-throughput DNA methylation analysis
WO2001026536A2 (en) * 1999-10-13 2001-04-19 The Johns Hopkins University School Of Medicine Methods of diagnosing and treating hepatic cell proliferative disorders
US6709818B1 (en) * 1999-10-13 2004-03-23 The Johns Hopkins University School Of Medicine Methods of diagnosing and treating hepatic cell proliferative disorders
WO2001036669A2 (en) * 1999-11-12 2001-05-25 Epigenomics Ag Method for the controlled implementation of complex pcr amplifications
DE19957827C2 (en) 1999-11-25 2003-06-12 Epigenomics Ag Use of an oligomer array with PNA and / or DNA oligomers on a surface
US20030170649A1 (en) * 1999-12-03 2003-09-11 Haas Oskar A. Method for detecting and evaluating a potentially aberrantly methylated dna region on the x chromosome, or the clonality
GB9929720D0 (en) * 1999-12-17 2000-02-09 Zeneca Ltd Diagnostic method
DE10010282B4 (en) 2000-02-25 2006-11-16 Epigenomics Ag Method for the detection of cytosine methylation in DNA samples
DE10013847A1 (en) * 2000-03-15 2001-09-27 Epigenomics Ag Parallel detection of methylation in genomic DNA where DNA is chemically modified, fragmented, amplified and hybridized to probes, useful to investigate gene expression regulation
WO2001077375A2 (en) 2000-04-06 2001-10-18 Epigenomics Ag Diagnosis of diseases associated with gene regulation
US20040006036A1 (en) * 2000-04-12 2004-01-08 Gmr, A Delaware Corporation Silencing transcription by methylation
DE10029915B4 (en) * 2000-06-19 2005-06-16 Epigenomics Ag Method for the detection of cytosine methylations
WO2002002807A2 (en) * 2000-06-30 2002-01-10 Epigenomics Ag Diagnosis of diseases associated with cell signalling
CA2312051A1 (en) * 2000-07-13 2002-01-13 Quebepharma Inc. Methylated nucleotide regulation of gene expression
DE10038733A1 (en) * 2000-08-02 2002-02-21 Epigenomics Ag Procedure for determining the age of individuals
US7214485B2 (en) * 2000-08-25 2007-05-08 Lovelace Respiratory Research Institute Nested methylation-specific polymerase chain reaction cancer detection method
US6773897B2 (en) * 2000-09-29 2004-08-10 The Johns Hopkins University School Of Medicine Method of predicting the clinical response to chemotherapeutic treatment with alkylating agents
DE10050942B4 (en) * 2000-10-10 2005-11-17 Epigenomics Ag Method for the detection of cytosine methylations
ATE445023T1 (en) * 2000-10-23 2009-10-15 Cancer Rec Tech Ltd NUCLEIC ACID AMPLIFICATION-BASED METHOD FOR DETERMINING METHYLATION PROFILE AND REAGENTS THEREFOR
GB0025913D0 (en) 2000-10-23 2000-12-06 Guldberg Per Materials and methods relating to nucleic acid amplification and profiling
EP1379685A2 (en) * 2000-11-08 2004-01-14 University Of Southern California Assay for the detection and quantitation of hemimethylation
DE10056802B4 (en) * 2000-11-14 2005-06-16 Epigenomics Ag Method for the detection of methylation conditions for toxicological diagnostics
US6756200B2 (en) 2001-01-26 2004-06-29 The Johns Hopkins University School Of Medicine Aberrantly methylated genes as markers of breast malignancy
US6893820B1 (en) * 2001-01-31 2005-05-17 The Ohio State University Research Foundation Detection of methylated CpG rich sequences diagnostic for malignant cells
US20020197639A1 (en) * 2001-06-08 2002-12-26 Shia Michael A. Methods and products for analyzing nucleic acids based on methylation status
DE10128508A1 (en) * 2001-06-14 2003-02-06 Epigenomics Ag Methods and nucleic acids for the differentiation of prostate tumors
DE10128509A1 (en) * 2001-06-14 2003-01-02 Epigenomics Ag Methods and nucleic acids for the differentiation of prostate and kidney carcinomas
WO2003012051A2 (en) * 2001-07-31 2003-02-13 The State Of Oregon Acting By And Through The State Board Of Higher Education On Behalf Of The University Of Oregon Inhibitor of dna methylation
US6927028B2 (en) * 2001-08-31 2005-08-09 Chinese University Of Hong Kong Non-invasive methods for detecting non-host DNA in a host using epigenetic differences between the host and non-host DNA
DE10151055B4 (en) * 2001-10-05 2005-05-25 Epigenomics Ag Method for detecting cytosine methylation in CpG islands
WO2003064682A1 (en) * 2001-10-18 2003-08-07 Lovelace Respiratory Research Institute Cancer monitoring by aberrant promotor methylation of the transcription factor genes pax5 alpha pax5 beta, novel loop helix loop protein, novel gene 2, and beta3 genes
DE10154317B4 (en) 2001-10-26 2005-06-09 Epigenomics Ag Method for the detection of cytosine methylations in immobilized DNA samples
AU2002352745A1 (en) * 2001-11-16 2003-06-10 The Johns Hopkins University School Of Medicine Method of detection of prostate cancer
US20110151438A9 (en) 2001-11-19 2011-06-23 Affymetrix, Inc. Methods of Analysis of Methylation
EP3098231A1 (en) 2001-11-30 2016-11-30 The John Hopkins University Methods for analyzing methylated cpg islands and gc rich regions
DE10201138B4 (en) * 2002-01-08 2005-03-10 Epigenomics Ag Method for the detection of cytosine methylation patterns by exponential ligation of hybridized probe oligonucleotides (MLA)
US7776524B2 (en) * 2002-02-15 2010-08-17 Genzyme Corporation Methods for analysis of molecular events
KR100470221B1 (en) * 2002-02-20 2005-02-05 굿젠 주식회사 Minisequencing type oligonucleotide chip for detecting methylation of promoter CpG islands of multiple genes, method for preparing thereof and method for detecting cancer using the same
AU2003244135A1 (en) * 2002-06-21 2004-01-06 Hinode Co, . Ltd. Device for removing raindrops on umrella and system for promoting installation of the device
WO2004031402A2 (en) * 2002-10-02 2004-04-15 Northwestern University Methylation profile of cancer
US7238518B2 (en) 2002-10-04 2007-07-03 Nisshinbo Industries, Inc. Oligonucleotide-immobilized substrate for detecting methylation
US20040146868A1 (en) * 2003-01-24 2004-07-29 Epigenomics Ag Methods and nucleic acids for the analysis of CpG dinucleotide methylation status associated with the development of peripheral zone prostate cancer
US20070141570A1 (en) * 2003-03-07 2007-06-21 Sequenom, Inc. Association of polymorphic kinase anchor proteins with cardiac phenotypes and related methods
WO2004087957A2 (en) * 2003-04-03 2004-10-14 Oncomethylome Sciences S.A. Hypermethylated genes and cervical cancer
EP1649050A2 (en) * 2003-06-24 2006-04-26 Epigenomics AG Improved heavymethyl assay for the methylation analysis of the gstpi gene
US20060183128A1 (en) * 2003-08-12 2006-08-17 Epigenomics Ag Methods and compositions for differentiating tissues for cell types using epigenetic markers
DE10338308B4 (en) 2003-08-15 2006-10-19 Epigenomics Ag Method for the detection of cytosine methylations in DNA
CN1845991A (en) * 2003-08-29 2006-10-11 田中纪章 Primer for nucleic acid amplification and method for examining colon cancer using the same
US7198900B2 (en) 2003-08-29 2007-04-03 Applera Corporation Multiplex detection compositions, methods, and kits
WO2005111244A2 (en) * 2004-05-10 2005-11-24 Exact Sciences Corporation Methods for detecting a mutant nucleic acid
WO2006026654A2 (en) 2004-08-27 2006-03-09 Exact Sciences Corporation Method for detecting a recombinant event
KR100617649B1 (en) 2004-09-24 2006-09-04 (주)지노믹트리 Cancer diagnostic composition containing methylated promoter of colorectal cancer specific expression reducing gene and use thereof
US9109256B2 (en) 2004-10-27 2015-08-18 Esoterix Genetic Laboratories, Llc Method for monitoring disease progression or recurrence
US20060122162A1 (en) * 2004-12-02 2006-06-08 Schering Corporation Methods of using temozolomide formulation intrathecally in the treatment of cancers
CA2592993C (en) * 2004-12-13 2013-06-18 National University Corporation Okayama University Method for detecting methylation in genes and method for examining neoplasm through detecting methylation in genes
EP2272984B1 (en) 2005-02-01 2012-06-20 John Wayne Cancer Institute Use of ID4 for diagnosis and treatment of cancer
KR100735045B1 (en) 2005-04-07 2007-07-03 (주) 차바이오텍 Method for measuring DNA methylation using B1 sequence of mouse and method for measuring anticancer activity of anticancer agent using same
US9777314B2 (en) * 2005-04-21 2017-10-03 Esoterix Genetic Laboratories, Llc Analysis of heterogeneous nucleic acid samples
US20060292585A1 (en) * 2005-06-24 2006-12-28 Affymetrix, Inc. Analysis of methylation using nucleic acid arrays
JP2009501024A (en) * 2005-07-12 2009-01-15 テンプル・ユニバーシティ−オブ・ザ・コモンウェルス・システム・オブ・ハイアー・エデュケイション Genetic and epigenetic changes in cancer diagnosis and treatment
US20070059753A1 (en) * 2005-09-15 2007-03-15 Tatiana Vener Detecting gene methylation
US8912129B2 (en) * 2005-11-17 2014-12-16 Epigenomics Ag Method for the determination of the DNA methylation level of a CPG position in identical cells within a tissue sample
EP1840224A1 (en) 2006-03-29 2007-10-03 Pangaea Biotech, S.A. Method of predicting survival of a non-small-cell lung cancer patient to a chemotherapeutic treatment
EP2004860A4 (en) * 2006-03-29 2009-12-30 Wayne John Cancer Inst METHYLATION OF ESTROGEN RECEPTOR ALPHA AND USE
US20080081333A1 (en) * 2006-05-26 2008-04-03 University Of Maryland, Baltimore Methylated promoters as biomarkers of colon cancer
KR100761031B1 (en) 2006-05-27 2007-10-04 김연수 Cancer diagnostic kit using DNA methylation
AU2008229628A1 (en) * 2007-03-16 2008-09-25 Human Genetic Signatures Pty Ltd Assay for gene expression
US9290803B2 (en) 2007-04-12 2016-03-22 University Of Southern California DNA methylation analysis by digital bisulfite genomic sequencing and digital methylight
AU2008245546A1 (en) * 2007-04-25 2008-11-06 John Wayne Cancer Institute Use of methylated or unmethylated LINE-I DNA as a cancer marker
US9271455B2 (en) * 2007-05-31 2016-03-01 Monsanto Technology Llc Soybean polymorphisms and methods of genotyping
US8673563B2 (en) 2007-06-08 2014-03-18 Bio-Dixam, Llc Amplification method of methylated or unmethylated nucleic acid
EP2198042B1 (en) 2007-09-17 2016-11-02 MDxHealth SA Novel markers for bladder cancer detection
CA2715774A1 (en) 2008-02-19 2009-08-27 Oncomethylome Sciences Sa Detection and prognosis of lung cancer
EP2626435B1 (en) 2008-03-21 2016-06-01 MDxHealth S.A. Detection and prognosis of cervical cancer
EP2290064A4 (en) * 2008-04-14 2011-10-12 Univ Nihon METHOD OF DETECTING A PROLIFERATIVE DISEASE
EP2210954B1 (en) 2009-01-22 2011-06-22 Heinrich-Heine-Universität Düsseldorf Determining of the DNA methylation level
ES2541178T3 (en) 2009-02-03 2015-07-16 Mdxhealth Sa Colorectal Cancer Screening Method
CA2755358A1 (en) 2009-03-13 2010-09-16 Mdxhealth Sa Novel markers for bladder cancer detection
SG174877A1 (en) 2009-03-17 2011-11-28 Mdxhealth Sa Improved detection of gene expression
WO2011036173A1 (en) 2009-09-24 2011-03-31 Oncomethylome Sciences S.A. Detection and prognosis of cervical cancer
US8399138B2 (en) * 2009-10-14 2013-03-19 GM Global Technology Operations LLC Liquid rechargeable lithium ion battery
WO2011112845A2 (en) * 2010-03-11 2011-09-15 Board Of Regents, The University Of Texas System Methods and compositions related to a multi-methylation assay to predict patient outcome
WO2011135058A2 (en) 2010-04-30 2011-11-03 Mdxhealth Sa Methods for detecting epigenetic modifications
US8916344B2 (en) 2010-11-15 2014-12-23 Exact Sciences Corporation Methylation assay
US8361720B2 (en) 2010-11-15 2013-01-29 Exact Sciences Corporation Real time cleavage assay
WO2013084075A2 (en) 2011-12-06 2013-06-13 Mdxhealth Sa Methods of detecting mutations and epigenetic changes
EP2644705A1 (en) 2012-03-30 2013-10-02 RWTH Aachen Biomarker for bladder cancer
US10059996B2 (en) 2012-06-11 2018-08-28 Medizineische Hochschule Hannover Susceptibility to and stratification for monoaminergic antidepressants
CN105378108A (en) 2013-03-13 2016-03-02 雅培分子公司 Systems and methods for isolating nucleic acids
EP2971171A4 (en) 2013-03-14 2016-11-02 Abbott Molecular Inc Multiplex methylation-specific amplification systems and methods
CN104250663B (en) * 2013-06-27 2017-09-15 北京大学 The high-flux sequence detection method on methylated CpG island
GB201322034D0 (en) 2013-12-12 2014-01-29 Almac Diagnostics Ltd Prostate cancer classification
WO2015124921A1 (en) 2014-02-19 2015-08-27 The University Court Of The University Of Edinburgh Methods and uses for determining the presence of inflammatory bowel disease
EP3140420B1 (en) 2014-05-07 2019-09-11 Universite Libre De Bruxelles Breast cancer epigenetic markers useful in anthracycline treatment prognosis
EP2942401A1 (en) 2014-05-09 2015-11-11 Lifecodexx AG Detection of DNA that originates from a specific cell-type
JP6681841B2 (en) 2014-05-09 2020-04-15 ライフコーデックス アーゲー Detection of DNA from special cell types and related methods
EP2942400A1 (en) 2014-05-09 2015-11-11 Lifecodexx AG Multiplex detection of DNA that originates from a specific cell-type
WO2016193151A1 (en) 2015-05-29 2016-12-08 Vito Nv Epigenetic markers for respiratory allergy
GB201510684D0 (en) 2015-06-17 2015-08-05 Almac Diagnostics Ltd Gene signatures predictive of metastatic disease
EP3162899A1 (en) 2015-10-29 2017-05-03 Rheinisch-Westfälische Technische Hochschule (RWTH) Aachen Biomarker for breast cancer
CN108350485A (en) 2015-10-30 2018-07-31 精密科学发展有限责任公司 Multiplex Amplified Detection Assay and Isolation and Detection of Plasma DNA
HUE050491T2 (en) 2015-11-10 2020-12-28 Eurofins Lifecodexx Gmbh Detection of foetal chromosomal aneuploidies using dna regions that are differentially methylated between the foetus and the pregnant female
CN109563546B (en) 2016-05-05 2022-09-09 精密科学发展有限责任公司 Detecting lung tumors by analyzing methylated DNA
DE102016005947B3 (en) 2016-05-16 2017-06-08 Dimo Dietrich A method for estimating the prognosis and predicting the response to immunotherapy of patients with malignant diseases
US11685955B2 (en) 2016-05-16 2023-06-27 Dimo Dietrich Method for predicting response of patients with malignant diseases to immunotherapy
CN106011278B (en) * 2016-07-18 2020-01-21 宁波大学医学院附属医院 Detection reagent for PIEZO2 gene in human gastrointestinal tumor
HUE059194T2 (en) 2016-12-16 2022-10-28 Eurofins Genomics Europe Sequencing GmbH Epigenetic markers and related methods and means for the detection and management of ovarian cancer
KR102892245B1 (en) 2017-01-27 2025-11-27 이그젝트 싸이언스 디블롭먼트 컴패니, 엘엘씨 Detection of colon neoplasia by analysis of methylated dna
EP3652338A1 (en) 2017-07-14 2020-05-20 Universite Libre De Bruxelles Method for predicting responsiveness to immunotherapy
DE102017125780B3 (en) 2017-11-05 2018-12-13 Dimo Dietrich Method for determining the response of a malignant disease to immunotherapy
WO2019118652A1 (en) 2017-12-12 2019-06-20 Essenlix Corporation Sample manipulation and assay with rapid temperature change
US10648025B2 (en) 2017-12-13 2020-05-12 Exact Sciences Development Company, Llc Multiplex amplification detection assay II
EP3880847B1 (en) 2018-11-16 2025-09-03 Oslo Universitetssykehus HF Methods and compositions for characterizing bladder cancer
WO2020219514A1 (en) * 2019-04-22 2020-10-29 Behavioral Diagnostics, Llc Compositions and methods for correcting for cellular admixture in epigenetic analyses
AU2021302551A1 (en) * 2020-06-29 2023-01-05 Pentabase Aps Detection of methylation status

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5324634A (en) 1992-03-31 1994-06-28 The Research Foundation Of State University Of New York Diagnostic tests measuring gelatinase/inhibitor complexes for detection of aggressive and metastatic cancer
US5595885A (en) 1989-03-21 1997-01-21 The United States Of America As Represented By The Department Of Health And Human Services Matrix metalloproteinase inhibitor peptides

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4458066A (en) 1980-02-29 1984-07-03 University Patents, Inc. Process for preparing polynucleotides
IL108978A (en) * 1994-03-15 1998-02-22 Yissum Res Dev Co Assay for monitoring the progress of cml
US5856094A (en) * 1995-05-12 1999-01-05 The Johns Hopkins University School Of Medicine Method of detection of neoplastic cells
US5871917A (en) * 1996-05-31 1999-02-16 North Shore University Hospital Research Corp. Identification of differentially methylated and mutated nucleic acids

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5595885A (en) 1989-03-21 1997-01-21 The United States Of America As Represented By The Department Of Health And Human Services Matrix metalloproteinase inhibitor peptides
US5324634A (en) 1992-03-31 1994-06-28 The Research Foundation Of State University Of New York Diagnostic tests measuring gelatinase/inhibitor complexes for detection of aggressive and metastatic cancer

Non-Patent Citations (20)

* Cited by examiner, † Cited by third party
Title
Clark, et al., High sensitivity mapping of methylated cytosines, Nucleic Acids Research, 22(15):2990, 1994.
De Clerck et al., Gene 139, 185-191 (1994).*
Frommer et al., "A genomic sequencing protocol that yields a positive display of 5-methylcyltosine residues in individual DNA strands," Proc. Natl. Acad. Sci. USA, Mar. 1992, vol. 89, pp. 1827-1831.
Frommer, et al., A genomic sequencing protocol that yields a positive display of 5-methylcytosine residues in individual DNA strands, Proc. Natl. Acad. Sci. USA, 89:1827, Mar. 1992.
Gonzales-Zulueta et al., Methylation of the 5' CpG Island of the p16/CDKN2 Tumor Suppressor Gene in Normal and Transformed Human Tissues Correlates with Gene Silencing, Cancer Research, 55:4531-4535.
Gonzales-Zulueta et al., Methylation of the 5′ CpG Island of the p16/CDKN2 Tumor Suppressor Gene in Normal and Transformed Human Tissues Correlates with Gene Silencing, Cancer Research, 55:4531-4535.
Graff, et al., E-Cadherin Expression is Silenced by DNA Hypermethylation in Human Breast and Prostate Carcinomas, Cancer Research, 55:5195, Nov. 15, 1995.
Hammani et al., J. Biol. Chem. 271(41), 25498-25505 (Oct. 1996).*
Herman et al., Proc. Natl. Acad. Sci. USA 93, 9821-9826 (Sep. 1996).*
Herman, et al., Inactivation of the CDKN2/p16/MTS1 Gene is Frequently Associated with Aberrant DNA Methylation in All Common Human Cancers, Cancer Research, 55:4525, Oct. 15, 1995.
Herman, et al., MSP: A Novel PCR Assay for Methylation Status of CpG Islands, Biological Sciences:Medical Sciences, pp. 1-12.
Kawaguchi et al., Arch. Dermatol. Res. 288(1), 39-44 (1996)(abstract only).*
Lowe, et al., A computer program for selection of oligonucleotide primers for polymerase chain reactions, Nucleic Acids research, 18(7):1757, Mar. 2, 1990.
Myohanene, et al., Automated fluorescent genomic sequencing as applied to the methylation analysis of the human orthine decarboxylase gene, DNA Sequence-The Journal of Sequencing and Mapping, 5:1, 1994.
Park, et al., CpG island Promoter region Methylation Patterns of the Inactive-X-Chromosome Hypoxanthine Phosporibosyltransferase (Hprt) Gene, Molecular and Cellular Biology, 14(12):7975, Dec. 1994.
Raizis, et al., A Bisulfite Method of 5-Methylcytosine Mapping That Minimizes Template Degradation, Analytical Biochemistry, 226:161, 1995.
Reeben, et al., Sequencing of the rat light neurofilament promoter reveals difference in ethylation between expressing and non-expressing cell lines, but not tissues, Gene, 157:325, 1995.
Stetler-Stevenson et al., "Tissue Inhibitor of Metalloproteinases-2 (TIMP-2) mRNA Expression in Tumor Cell Lines and Human Tumor Tissues," J. Biol. Chem. Aug. 15, 1990, vol. 265, No. 23, pp. 13933-13938.
Tasheva and Roufa, Deoxcytidine Methylation and the Origin of Spontaneous transition Mutations in Mammalian Cells, Samatic Cell and Molecular genetics, 19(3):275, 1993.
Zuccotti et al., Polymerase Chain Reaction for the Detection of Methylation of a Specific CpG Site in the C6pd Gene of Mouse Embryos, Methods in Enzymology 225:557-567.

Cited By (347)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6977146B1 (en) * 1999-01-29 2005-12-20 Epigenomics Ag Method of identifying cytosine methylation patterns in genomic DNA samples
US20050221329A1 (en) * 1999-02-01 2005-10-06 Epigenomics Ag Use of fluorescent molecular beacons in the detection of methylated nucleic acid
US20030207297A1 (en) * 1999-10-13 2003-11-06 Hubert Koster Methods for generating databases and databases for identifying polymorphic genetic markers
US7332275B2 (en) 1999-10-13 2008-02-19 Sequenom, Inc. Methods for detecting methylated nucleotides
US8229677B2 (en) 1999-10-13 2012-07-24 Sequenom, Inc. Methods for generating databases and databases for identifying polymorphic genetic markers
US7668658B2 (en) 1999-10-13 2010-02-23 Sequenom, Inc. Methods for generating databases and databases for identifying polymorphic genetic markers
US20030180748A1 (en) * 1999-10-13 2003-09-25 Andreas Braun Methods for generating databases and databases for identifying polymorphic genetic markers
US20030190644A1 (en) * 1999-10-13 2003-10-09 Andreas Braun Methods for generating databases and databases for identifying polymorphic genetic markers
US8818735B2 (en) 1999-10-13 2014-08-26 Sequenom, Inc. Methods for generating databases and databases for identifying polymorphic genetic markers
US20040248090A1 (en) * 1999-12-06 2004-12-09 Alexander Olek Method for the parallel detection of the degree of methylation of genomic dna
US8003354B2 (en) 2000-02-07 2011-08-23 Illumina, Inc. Multiplex nucleic acid reactions
US8906626B2 (en) 2000-02-07 2014-12-09 Illumina, Inc. Multiplex nucleic acid reactions
US7611869B2 (en) 2000-02-07 2009-11-03 Illumina, Inc. Multiplexed methylation detection methods
US10837059B2 (en) 2000-02-07 2020-11-17 Illumina, Inc. Multiplex nucleic acid reactions
US8288103B2 (en) 2000-02-07 2012-10-16 Illumina, Inc. Multiplex nucleic acid reactions
US9850536B2 (en) 2000-02-07 2017-12-26 Illumina, Inc. Multiplex nucleic acid reactions
US8076063B2 (en) 2000-02-07 2011-12-13 Illumina, Inc. Multiplexed methylation detection methods
US6596493B1 (en) 2000-08-15 2003-07-22 The Johns Hopkins University School Of Medicine Diagnosis and treatment of tumor-suppressor associated disorders
US7153657B2 (en) 2000-08-15 2006-12-26 The Johns Hopkins University School Of Medicine Diagnosis and treatment of tumor-suppressor associated disorders
US7833712B2 (en) 2000-08-15 2010-11-16 The John Hopkins University School Of Medicine Diagnosis and treatment of tumor-suppressor associated disorders
US20070072224A1 (en) * 2000-08-15 2007-03-29 The Johns Hopkins University School Of Medicine Diagnosis and treatment of tumor-suppressor associated disorders
US7175750B2 (en) 2000-09-01 2007-02-13 Spectrumedix Llc System and method for temperature gradient capillary electrophoresis
US20040076947A1 (en) * 2000-09-01 2004-04-22 Zhaowei Liu System and method for determining known DNA variants with temperature gradient electrophoresis
US20030138821A1 (en) * 2000-09-01 2003-07-24 Zhiyong Guo System and method for temperature gradient capillary electrophoresis
US7282126B2 (en) 2000-09-01 2007-10-16 Spectrumedix Llc System and method for determining known DNA variants with temperature gradient electrophoresis
US20040048276A1 (en) * 2000-10-11 2004-03-11 Zhaowei Liu System and method for determining the presence of methylated cytosines in polynucleotides
US20050064410A1 (en) * 2001-08-09 2005-03-24 Jurgen Distler Method and nucleic acids for the analysis of colon cancer
WO2003014388A2 (en) 2001-08-09 2003-02-20 Epigenomics Ag Method and nucleic acids for the analysis of colon cancer
US20040242510A1 (en) * 2001-10-05 2004-12-02 Markowitz Sanford D. Methods and compositions for detecting colon cancers
US20090061453A1 (en) * 2001-10-05 2009-03-05 Markowitz Sanford D Methods and compositions for detecting colon cancers
US7432050B2 (en) 2001-10-05 2008-10-07 Case Western Reserve University Methods and compositions for detecting colon cancers
US20050064400A1 (en) * 2001-10-18 2005-03-24 Zhiyong Guo System and method for temperature gradient capillary electrophoresis
US20030099997A1 (en) * 2001-10-24 2003-05-29 Bestor Timothy H. Method for gene identification based on differential DNA methylation
WO2003035860A1 (en) * 2001-10-24 2003-05-01 The Trustees Of Columbia University In The City Of New York A method for gene identification based on differential dna methylation
US20030215842A1 (en) * 2002-01-30 2003-11-20 Epigenomics Ag Method for the analysis of cytosine methylation patterns
US8691503B2 (en) 2002-02-27 2014-04-08 Epigenomics Ag Method and nucleic acids for the analysis of colorectal cell proliferative disorders
US20110046005A1 (en) * 2002-02-27 2011-02-24 Epigenomics Ag Method and nucleic acids for the analysis of colon cell proliferative disorders
US9988683B2 (en) 2002-02-27 2018-06-05 Epigenomics Ag Method and nucleic acids for the analysis of colon cell proliferative disorders
US20060234224A1 (en) * 2002-02-27 2006-10-19 Peter Adorjan Method and nucleic acids for the analysis of colon cell proliferative disorders
US20050003463A1 (en) * 2002-02-27 2005-01-06 Peter Adorjan Method and nucleic acids for the analysis of colorectal cell proliferative disorders
US20050221314A1 (en) * 2002-03-05 2005-10-06 Epigenomics Ag Method and device for determination of tissue specificity of free floating dna in bodily fluids
WO2003076666A1 (en) * 2002-03-08 2003-09-18 Naxcor Compositions and methods for detecting nucleic acid methylation
WO2003083107A1 (en) * 2002-03-25 2003-10-09 The Board Of Trustees Of The University Of Arkansas Cpg retrieval of dna from formalin-fixed pathology specimen for promoter methylation analysis
US20030203364A1 (en) * 2002-04-24 2003-10-30 Zhaowei Liu Method for determining the presence of DNA variants using peptide nucleic acid probes
US6872530B2 (en) * 2002-04-24 2005-03-29 Spectrumedix, Llc Method for determining the presence of DNA variants using peptide nucleic acid probes
US7432342B2 (en) 2002-05-03 2008-10-07 Sequenom, Inc. Kinase anchor protein muteins, peptides thereof and related documents
US20040053304A1 (en) * 2002-06-05 2004-03-18 Case Western Reserve University Methods and compositions for detecting cancers
US20070021599A1 (en) * 2002-06-05 2007-01-25 Case Western Reserve University Methods and compositions for detecting cancers
US7741040B2 (en) 2002-06-05 2010-06-22 Case Western Reserve University Methods and compositions for detecting cancers
US8273528B2 (en) 2002-06-26 2012-09-25 Cold Spring Harbor Laboratory Methods and compositions for determining methylation profiles
US20070178506A1 (en) * 2002-06-26 2007-08-02 Cold Spring Harbor Laboratory And Washington University Methods and compositions for determining methylation profiles
US20040132048A1 (en) * 2002-06-26 2004-07-08 Robert Martienssen Methods and compositions for determining methylation profiles
US7186512B2 (en) 2002-06-26 2007-03-06 Cold Spring Harbor Laboratory Methods and compositions for determining methylation profiles
US20040178070A1 (en) * 2002-07-16 2004-09-16 Zhaowei Liu Method and system for comparative genomics for organisms using temperature gradient electrophoresis
EP2157191A2 (en) 2002-10-01 2010-02-24 Epigenomics AG Method and nucleic acids for the improved treatment of breast cell proliferative disorders
US8101359B2 (en) 2002-10-01 2012-01-24 Epigenomics Ag Method for determining risk of relapse of breast cancer following tamoxifen adjuvant therapy
US20050112590A1 (en) * 2002-11-27 2005-05-26 Boom Dirk V.D. Fragmentation-based methods and systems for sequence variation detection and discovery
US7820378B2 (en) 2002-11-27 2010-10-26 Sequenom, Inc. Fragmentation-based methods and systems for sequence variation detection and discovery
US20080207460A1 (en) * 2002-12-02 2008-08-28 Solexa Limited Determination of methylation of nucleic acid sequences
US20070042365A1 (en) * 2003-01-24 2007-02-22 Millar Douglas S Assay for detecting methylation changes in nucleic acids using an intercalating nucleic acid
WO2004067775A3 (en) * 2003-01-30 2004-12-09 Epigenomics Ag Method for the detection of cytosine methylation patterns with high sensitivity
US20060263779A1 (en) * 2003-01-30 2006-11-23 Kurt Berlin Method for the detection of cytosine methylation patterns with high sensitivity
US20110003284A1 (en) * 2003-03-17 2011-01-06 The Johns Hopkins University Aberrantly Methylated Genes in Pancreatic Cancer
US8785614B2 (en) 2003-03-17 2014-07-22 The Johns Hopkins University Aberrantly methylated genes in pancreatic cancer
US7485418B2 (en) 2003-03-17 2009-02-03 The Johns Hopkins University Aberrantly methylated genes in pancreatic cancer
US20070015156A1 (en) * 2003-03-17 2007-01-18 Goggins Michael G Aberrantly methylated genes in pancreatic cancer
US20040203004A1 (en) * 2003-04-10 2004-10-14 Bernard Hans Ulrich Diagnostic apparatus and method
US20050009053A1 (en) * 2003-04-25 2005-01-13 Sebastian Boecker Fragmentation-based methods and systems for de novo sequencing
US7288373B2 (en) 2003-05-02 2007-10-30 Human Genetic Signatures Pty Ltd. Treatment of methylated nucleic acid
US20070020633A1 (en) * 2003-05-02 2007-01-25 Millar Douglas S Treatment of nucleic acid
US20040219539A1 (en) * 2003-05-02 2004-11-04 Millar Douglas Spencer Treatment of methylated nucleic acid
US20050153347A1 (en) * 2003-05-07 2005-07-14 Affymetrix, Inc. Analysis of methylation status using oligonucleotide arrays
US8150627B2 (en) 2003-05-15 2012-04-03 Illumina, Inc. Methods and compositions for diagnosing lung cancer with specific DNA methylation patterns
US8150626B2 (en) 2003-05-15 2012-04-03 Illumina, Inc. Methods and compositions for diagnosing lung cancer with specific DNA methylation patterns
US20050164246A1 (en) * 2003-05-15 2005-07-28 Illumina, Inc. Methods and compositions for diagnosing lung cancer with specific DNA methylation patterns
US20050026183A1 (en) * 2003-05-15 2005-02-03 Jian-Bing Fan Methods and compositions for diagnosing conditions associated with specific DNA methylation patterns
US7799525B2 (en) 2003-06-17 2010-09-21 Human Genetic Signatures Pty Ltd. Methods for genome amplification
US20070178457A1 (en) * 2003-06-17 2007-08-02 Human Genetic Signatures Pty. Ltd. Methods for genome amplification
US20090047666A1 (en) * 2003-06-23 2009-02-19 Epigenomics Ag Methods and nucleic acids for the analysis of colon proliferative disorders
EP2345745A1 (en) 2003-06-23 2011-07-20 Epigenomics AG Methods and nucleic acids for analyses of colorectal cell proliferative disorders
US20080064029A1 (en) * 2003-06-23 2008-03-13 Epigenomics Ag Methods and Nucleic Acids for Analyses of Colorectal Cell Proliferative Disorders
US8163488B2 (en) 2003-06-23 2012-04-24 Epigenomics Ag Methods and nucleic acids for analysis of colon proliferative disorders
EP2354248A1 (en) 2003-06-23 2011-08-10 Epigenomics AG Methods and nucleic acids for analyses of colorectal cell proliferative disorders
EP2354249A1 (en) 2003-06-23 2011-08-10 Epigenomics AG Methods and nucleic acids for analyses of colorectal cell proliferative disorders
EP2354250A1 (en) 2003-06-23 2011-08-10 Epigenomics AG Methods and nucleic acids for analyses of colorectal cell proliferative disorders
US20070184438A1 (en) * 2003-06-23 2007-08-09 Cathy Lofton-Day Methods and nucleic acids for the analysis of colorectal cell proliferative disorders
US7303879B2 (en) 2003-07-31 2007-12-04 Applera Corporation Determination of SNP allelic frequencies using temperature gradient electrophoresis
US20050064473A1 (en) * 2003-07-31 2005-03-24 Zhaowei Liu Determination of SNP allelic frequencies using temperature gradient electrophoresis
US20050123944A1 (en) * 2003-08-01 2005-06-09 U.S. Genomics, Inc. Methods and compositions related to the use of sequence-specific endonucleases for analyzing nucleic acids under non-cleaving conditions
US20100209906A1 (en) * 2003-08-14 2010-08-19 Case Western Reserve University Methods and compositions for detecting colon cancers
US7485420B2 (en) 2003-08-14 2009-02-03 Case Western Reserve University Methods and compositions for detecting colon cancers
US8221977B2 (en) 2003-08-14 2012-07-17 Case Western Reserve University Methods and compositions for detecting colon cancers
US8415100B2 (en) 2003-08-14 2013-04-09 Case Western Reserve University Methods and compositions for detecting gastrointestinal and other cancers
US11136629B2 (en) 2003-08-14 2021-10-05 Case Western Reserve University Methods and compositions for detecting gastrointestinal and other cancers
US7964353B2 (en) 2003-08-14 2011-06-21 Case Western Reserve University Methods and compositions for detecting colon cancers
US9580754B2 (en) 2003-08-14 2017-02-28 Case Western Reserve University Methods and compositions for detecting gastrointestinal and other cancers
US8481707B2 (en) 2003-08-14 2013-07-09 Case Western Reserve University Methods and compositions for detecting colon cancers
US10400286B2 (en) 2003-08-14 2019-09-03 Case Western Reserve University Methods and compositions for detecting gastrointestinal and other cancers
US20100009359A1 (en) * 2003-08-14 2010-01-14 Case Western Reserve University Methods and compositions for detecting colon cancers
US20110217708A1 (en) * 2003-08-14 2011-09-08 Case Western Reserve University Methods and compositions for detecting colon cancers
US10450615B2 (en) 2003-08-14 2019-10-22 Case Western Reserve University Methods and compositions for detecting gastrointestinal and other cancers
US20050106593A1 (en) * 2003-08-14 2005-05-19 Markowitz Sanford D. Methods and compositions for detecting colon cancers
US20070178459A1 (en) * 2003-09-04 2007-08-02 Human Genetic Signatures Pty. Ltd. Nucleic acid detection assay
US7846693B2 (en) 2003-09-04 2010-12-07 Human Genetic Signatures Pty. Ltd. Nucleic acid detection assay
US20050089904A1 (en) * 2003-09-05 2005-04-28 Martin Beaulieu Allele-specific sequence variation analysis
US9394565B2 (en) 2003-09-05 2016-07-19 Agena Bioscience, Inc. Allele-specific sequence variation analysis
WO2005040421A3 (en) * 2003-10-17 2005-10-27 Martin Widschwendter Prognostic and diagnostic markers for cell proliferative disorders of the breast tissues
US20100240064A1 (en) * 2003-10-21 2010-09-23 Orion Genomics Llc Differential enzymatic fragmentation
US8163485B2 (en) 2003-10-21 2012-04-24 Orion Genomics, Llc Differential enzymatic fragmentation
US20050158739A1 (en) * 2003-10-21 2005-07-21 Orion Genomics Llc Differential enzymatic fragmentation
US20050153316A1 (en) * 2003-10-21 2005-07-14 Orion Genomics Llc Methods for quantitative determination of methylation density in a DNA locus
US7901880B2 (en) 2003-10-21 2011-03-08 Orion Genomics Llc Differential enzymatic fragmentation
US7910296B2 (en) 2003-10-21 2011-03-22 Orion Genomics Llc Methods for quantitative determination of methylation density in a DNA locus
US8361719B2 (en) 2003-10-21 2013-01-29 Orion Genomics Llc Methods for quantitative determination of methylation density in a DNA locus
EP3269826A1 (en) 2003-12-01 2018-01-17 Epigenomics AG Methods and nucleic acids for the analysis of gene expression associated with the development of prostate cell proliferative disorders
US9181587B2 (en) 2003-12-01 2015-11-10 Epigenomics Ag Methods and nucleic acids for the analysis of gene expression associated with the development of prostate cell proliferative disorders
US20080286761A1 (en) * 2003-12-01 2008-11-20 Epigenomics Ag Methods and Nucleic Acids for the Analysis of Gene Expression Associated with the Development of Prostate Cell Proliferative Disorders
US9017944B2 (en) 2003-12-11 2015-04-28 Epigenomics Ag Methods for the prognosis of breast cancer
US20080254447A1 (en) * 2003-12-11 2008-10-16 Epigenomics Ag Method and Nucleic Acids for the Improved Treatment of Breast Cell Proliferative Disorders
US20070160995A1 (en) * 2004-01-09 2007-07-12 Epigenomics Ag Method for investigating cytosine methylation in dna by means of dna repair enzymes
US7723026B2 (en) * 2004-01-09 2010-05-25 Epigenomics Ag Method for investigating cytosine methylation in DNA by means of DNA repair enzymes
US20050227265A1 (en) * 2004-02-10 2005-10-13 Francis Barany Method for detection of promoter methylation status
US7358048B2 (en) 2004-02-10 2008-04-15 Cornell Research Foundation, Inc. Method for detection of promoter methylation status
US20110076726A1 (en) * 2004-03-02 2011-03-31 Orion Genomics Llc Differential enzymatic fragmentation by whole genome amplification
US20050272065A1 (en) * 2004-03-02 2005-12-08 Orion Genomics Llc Differential enzymatic fragmentation by whole genome amplification
US8088581B2 (en) 2004-03-02 2012-01-03 Orion Genomics Llc Differential enzymatic fragmentation by whole genome amplification
US7459274B2 (en) 2004-03-02 2008-12-02 Orion Genomics Llc Differential enzymatic fragmentation by whole genome amplification
US7608394B2 (en) 2004-03-26 2009-10-27 Sequenom, Inc. Methods and compositions for phenotype identification based on nucleic acid methylation
US20050272070A1 (en) * 2004-03-26 2005-12-08 Sequenom, Inc. Base specific cleavage of methylation-specific amplification products in combination with mass analysis
US9249456B2 (en) 2004-03-26 2016-02-02 Agena Bioscience, Inc. Base specific cleavage of methylation-specific amplification products in combination with mass analysis
US8168777B2 (en) 2004-04-29 2012-05-01 Human Genetic Signatures Pty. Ltd. Bisulphite reagent treatment of nucleic acid
US20080182247A1 (en) * 2004-06-01 2008-07-31 The Regents Of The University Of Michigan Methods And Kits For Diagnosing Or Monitoring Autoimmune And Chronic Inflammatory Disease
US7279281B2 (en) 2004-06-01 2007-10-09 The Regents Of The University Of Michigan Methods and kits for diagnosing or monitoring autoimmune and chronic inflammatory diseases
US7723037B2 (en) 2004-06-01 2010-05-25 The Regents Of The University Of Michigan Methods and kits for diagnosing or monitoring autoimmune and chronic inflammatory disease
US20060040288A1 (en) * 2004-06-01 2006-02-23 The Regents Of The University Of Michigan Methods and kits for diagnosing or monitoring autoimmune and chronic inflammatory diseases
US20100035242A1 (en) * 2004-06-23 2010-02-11 Epigenomics Ag Methods and nucleic acids for the detection of metastasis of colon cell proliferative disorders
US7943308B2 (en) 2004-06-23 2011-05-17 Epigenomics Ag Methods and nucleic acids for the detection of metastasis of colon cell proliferative disorders
US20110201005A1 (en) * 2004-06-23 2011-08-18 Epigenomics Ag Methods and Nucleic Acids for the Detection of Metastasis of Colon Cell Proliferative Disorders
EP1961827A2 (en) 2004-07-18 2008-08-27 Epigenomics AG Epigenetic methods and nucleic acids for the detection of breast cell proliferative disorders
EP2281902A1 (en) 2004-07-18 2011-02-09 Epigenomics AG Epigenetic methods and nucleic acids for the detection of breast cell proliferative disorders
US20090130657A1 (en) * 2004-09-10 2009-05-21 Human Genetic Signatures Pty Ltd. Amplification blocker comprising intercalating nucleic acids (ina) containing intercalating pseudonucleotides (ipn)
US7803580B2 (en) 2004-09-10 2010-09-28 Human Genetic Signatures Pty. Ltd. Amplification blocker comprising intercalating nucleic acids (INA) containing intercalating pseudonucleotides (IPN)
US20060073501A1 (en) * 2004-09-10 2006-04-06 Van Den Boom Dirk J Methods for long-range sequence analysis of nucleic acids
US20080171318A1 (en) * 2004-09-30 2008-07-17 Epigenomics Ag Epigenetic Methods and Nucleic Acids for the Detection of Lung Cell Proliferative Disorders
US20090247598A1 (en) * 2004-11-09 2009-10-01 Schering Corporation Treatment methods
US20060100188A1 (en) * 2004-11-09 2006-05-11 Chen Zong Treatment methods
US20090197250A1 (en) * 2004-12-02 2009-08-06 Epigenomics Ag Methods and nucleic acids for the analysis of gene expression associated with the prognosis of prostate cell proliferative disorders
EP2284279A1 (en) 2004-12-02 2011-02-16 Epigenomics AG Methods and nucleic acids for the analysis of gene expression associated with the prognosis of prostate cell proliferative disorders
US20090042732A1 (en) * 2004-12-03 2009-02-12 Human Genetic Signatures Pty. Ltd. Methods for simplifying microbial nucleic acids by chemical modification of cytosines
US8598088B2 (en) 2004-12-03 2013-12-03 Human Genetic Signatures Pty. Ltd. Methods for simplifying microbial nucleic acids by chemical modification of cytosines
US7833942B2 (en) 2004-12-03 2010-11-16 Human Genetic Signatures Pty. Ltd. Methods for simplifying microbial nucleic acids by chemical modification of cytosines
US20110136098A1 (en) * 2004-12-03 2011-06-09 Human Genetic Signatures Pty. Ltd. Methods for simplifying microbial nucleic acids by chemical modification of cytosines
US20060134650A1 (en) * 2004-12-21 2006-06-22 Illumina, Inc. Methylation-sensitive restriction enzyme endonuclease method of whole genome methylation analysis
US20090029346A1 (en) * 2004-12-23 2009-01-29 Human Genetic Signatures Pty., Ltd. Detection of human papilloma virus
WO2006088940A2 (en) 2005-02-14 2006-08-24 The Johns Hopkins University Neoplasia screening compositions and methods of use
US20080145852A1 (en) * 2005-03-01 2008-06-19 Shuber Anthony P Methods and compositions for detecting adenoma
US7749702B2 (en) 2005-04-15 2010-07-06 Epigenomics Ag Methods and nucleic acids for the analyses of cellular proliferative disorders
EP1721992A2 (en) 2005-04-15 2006-11-15 Epigenomics AG Methods and nucleic acids for analyses of cellular proliferative disorders
US8900829B2 (en) 2005-04-15 2014-12-02 Epigenomics Ag Methods and nucleic acids for analyses of cellular proliferative disorders
US20110039719A1 (en) * 2005-04-15 2011-02-17 Epigenomics Ag Methods and nucleic acids for the analyses of cellular proliferative disorders
US20060286576A1 (en) * 2005-04-15 2006-12-21 Epigenomics Ag Methods and nucleic acids for the analyses of cellular proliferative disorders
US7951563B2 (en) 2005-04-15 2011-05-31 Epigenomics Ag Methods and nucleic acids for analysis of cellular proliferative disorders
US20090075260A1 (en) * 2005-04-15 2009-03-19 Epigenomics Ag Methods and Nucleic Acids For Analysis of Cellular Proliferative Disorders
US9695478B2 (en) 2005-04-15 2017-07-04 Epigenomics Ag Methods and nucleic acids for the analyses of cellular proliferative disorders
EP2045335A1 (en) 2005-04-15 2009-04-08 Epigenomics AG Methods and nucleic acids for analyses of cellular proliferative disorders
US10385402B2 (en) 2005-04-15 2019-08-20 Epigenomics Ag Methods and nucleic acids for analyses of cellular proliferative disorders
US20090053706A1 (en) * 2005-05-02 2009-02-26 University Of Southern California Dna methylation markers associated with the cpg island methylator phenotype (cimp) in human colorectal cancer
EP2345743A1 (en) 2005-05-02 2011-07-20 University of Southern California DNA methylation markers associated with the CpG island methylator phenotyp (CIMP) in human colorectal cancer
EP2386654A1 (en) 2005-05-02 2011-11-16 University of Southern California DNA Methylation markers associated with the CpG island methylator phenotype (cimp) in human colorectal cancer
US8110361B2 (en) 2005-05-02 2012-02-07 University of Southern California USC Stevens Center for Innovation DNA methylation markers associated with the CpG island methylator phenotype (CIMP) in human colorectal cancer
EP2395101A1 (en) 2005-05-02 2011-12-14 University of Southern California DNA methylation markers associated with the CpG island methylator phenotype (cimp) in human colorectal cancer
US8431347B2 (en) 2005-05-26 2013-04-30 Human Genetic Signatures Pty Ltd Isothermal strand displacement amplification using primers containing a non-regular base
US20100221785A1 (en) * 2005-05-26 2010-09-02 Human Genetic Signatures Pty Ltd Isothermal Strand Displacement Amplification Using Primers Containing a Non-Regular Base
US7439024B2 (en) 2005-06-01 2008-10-21 The United States Of America As Represented By The Department Of Veterans Affairs Methods and kits for diagnosing or monitoring autoimmune and chronic inflammatory diseases
US20070031863A1 (en) * 2005-06-01 2007-02-08 The Regents Of The University Of Michigan Methods and kits for diagnosing or monitoring autoimmune and chronic inflammatory diseases
US7807374B2 (en) 2005-06-01 2010-10-05 The Regents Of The University Of Michigan Methods and kits for diagnosing or monitoring autoimmune and chronic inflammatory diseases
EP1917368A4 (en) * 2005-06-16 2009-12-23 Applera Corp Methods and kits for evaluating dna methylation
US20070037184A1 (en) * 2005-06-16 2007-02-15 Applera Corporation Methods and kits for evaluating dna methylation
US20060286577A1 (en) * 2005-06-17 2006-12-21 Xiyu Jia Methods for detection of methylated DNA
US20070087360A1 (en) * 2005-06-20 2007-04-19 Boyd Victoria L Methods and compositions for detecting nucleotides
US20090005268A1 (en) * 2005-07-18 2009-01-01 Epigenomics Ag Compositions and Methods for Cancer Diagnostics Comprising Pan-Cancer Markers
US20100041013A1 (en) * 2005-09-14 2010-02-18 Human Genetic Signatures Pty Ltd. Assay for a health state
US8343738B2 (en) 2005-09-14 2013-01-01 Human Genetic Signatures Pty. Ltd. Assay for screening for potential cervical cancer
US10053735B2 (en) 2005-09-21 2018-08-21 Therawis Diagnostics Gmbh Markers for the prediction of outcome of anthracycline treatment
US20090111707A1 (en) * 2005-09-21 2009-04-30 Epigenomics Ag Markers for the prediction of outcome of anthracycline treatment
EP2298932A1 (en) 2005-09-29 2011-03-23 Epigenomics AG Methods and nucleic acids for the analysis of gene expression, in particular methylation of KAAG1, associated with tissue classification
US20080254470A1 (en) * 2005-10-03 2008-10-16 Epigenomics Ag Methods and Nucleic Acids For the Analysis of Gene Expression Associated With the Prognosis of Cell Proliferative Disorders
US20090042195A1 (en) * 2005-10-07 2009-02-12 Bradford Coffee Methods and systems for screening for and diagnosing dna methylation associated abnormalities and sex chromosome aneuploidies
US20080223695A1 (en) * 2005-10-12 2008-09-18 Scanvaegt International A/S Device for Transfer of Items
US20070087358A1 (en) * 2005-10-19 2007-04-19 Melanie Ehrlich Methods for diagnosing cancer based on DNA methylation status in NBL2
EP2186912A2 (en) 2005-11-08 2010-05-19 Euclid Diagnostics LLC Materials and methods for assaying for methylation of CpG islands associated with genes in the evaluation of cancer
EP2338518A1 (en) 2006-01-18 2011-06-29 Merck Patent GmbH Specific therapy using integrin ligands for treating cancer
WO2007084670A2 (en) 2006-01-18 2007-07-26 Merck Patent Gmbh Specific therapy using integrin ligands for treating cancer
EP2335733A1 (en) 2006-01-18 2011-06-22 Merck Patent GmbH Specific therapy using integrin ligands for treating cancer
US20070238117A1 (en) * 2006-03-22 2007-10-11 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Method for retaining methylation pattern in globally amplified dna
US7820385B2 (en) 2006-03-22 2010-10-26 The United States Of America As Represented By The Department Of Health And Human Services, Centers For Disease Control And Prevention Method for retaining methylation pattern in globally amplified DNA
US7901882B2 (en) 2006-03-31 2011-03-08 Affymetrix, Inc. Analysis of methylation using nucleic acid arrays
US8709716B2 (en) 2006-03-31 2014-04-29 Affymetrix, Inc. Analysis of methylation using nucleic acid arrays
US9828640B2 (en) 2006-03-31 2017-11-28 Affymetrix, Inc. Analysis of methylation using nucleic acid arrays
US20110166037A1 (en) * 2006-03-31 2011-07-07 Affymetrix, Inc. Analysis of methylation using nucleic acid arrays
US10822659B2 (en) 2006-03-31 2020-11-03 Affymetrix, Inc. Analysis of methylation using nucleic acid arrays
EP2484778A2 (en) 2006-04-17 2012-08-08 Epigenomics AG Methods and nucleic acids for the detection of colorectal cell proliferative disorders
US20090317810A1 (en) * 2006-04-17 2009-12-24 Epigenomics Ag Methods and nucleic acids for the detection of colorectal cell proliferative disorders
EP2479283A1 (en) 2006-04-17 2012-07-25 Epigenomics AG Methods and nucleic acids for the detection of colorectal cell proliferative disorders
US20070264672A1 (en) * 2006-05-09 2007-11-15 Bimalendu Dasmahapatra Development of a novel assay for mgmt (methyl guanine methyl transferase)
US20080003609A1 (en) * 2006-05-10 2008-01-03 The Cleveland Clinic Foundation Method of detecting bladder urothelial carcinoma
US20080050738A1 (en) * 2006-05-31 2008-02-28 Human Genetic Signatures Pty Ltd. Detection of target nucleic acid
US20080085867A1 (en) * 2006-07-14 2008-04-10 The Johns Hopkins University Early detection and prognosis of colon cancers
EP2634265A1 (en) 2006-07-21 2013-09-04 Epigenomics AG Methods and nucleic acids related to the gene GLI3 for analyses of cellular proliferative disorders
US20100143902A1 (en) * 2006-07-21 2010-06-10 Epigenomics Ag Methods and nucleic acids for analyses of cellular proliferative disorders
EP2508623A1 (en) 2006-11-20 2012-10-10 The Johns Hopkins University DNA methylation markers and methods of use
US9850532B2 (en) 2006-11-24 2017-12-26 Epigenomics Ag Methods and nucleic acids for the analysis of gene expression associated with the development of prostate cell proliferative disorders
EP3184649A1 (en) 2006-11-24 2017-06-28 Epigenomics AG Methods and nucleic acids for the analysis of gene expression associated with the development of prostate cell proliferative disorders
WO2008087025A2 (en) 2007-01-18 2008-07-24 Merck Patent Gmbh Specific therapy and medicament using integrin ligands for treating cancer
EP2441464A1 (en) 2007-01-18 2012-04-18 Merck Patent GmbH Specific therapy and medicament using integrin ligands for treating cancer
EP2258871A1 (en) 2007-01-19 2010-12-08 Epigenomics AG Methods and nucleic acids for analyses of cell proliferative disorders
US20090203011A1 (en) * 2007-01-19 2009-08-13 Epigenomics Ag Methods and nucleic acids for analyses of cell proliferative disorders
WO2008087040A2 (en) 2007-01-19 2008-07-24 Epigenomics Ag Methods and nucleic acids for analyses of cell proliferative disorders
US12385085B2 (en) 2007-02-07 2025-08-12 Illumina Cambridge Limited Preparation of templates for methylation analysis
US9868982B2 (en) 2007-02-07 2018-01-16 Illumina Cambridge Limited Preparation of templates for methylation analysis
US11827927B2 (en) 2007-02-07 2023-11-28 Illumina Cambridge Limited Preparation of templates for methylation analysis
US20090148842A1 (en) * 2007-02-07 2009-06-11 Niall Gormley Preparation of templates for methylation analysis
US10954554B2 (en) 2007-02-07 2021-03-23 Illumina Cambridge Limited Preparation of templates for methylation analysis
EP2409700A1 (en) 2007-05-08 2012-01-25 Schering Corporation Methods of treatment using intravenous formulations comprising temozolomide
EP2578225A1 (en) 2007-07-18 2013-04-10 Merck Patent GmbH Specific Therapy and Medicament Using Integrin Ligands for Treating Cancer
WO2009037635A2 (en) 2007-09-17 2009-03-26 Koninklijke Philips Electronics N. V. Method for the analysis of breast cancer disorders
WO2009037633A2 (en) 2007-09-17 2009-03-26 Koninklijke Philips Electronics N.V. Method for the analysis of ovarian cancer disorders
US8652777B2 (en) 2007-09-17 2014-02-18 Koninklijke Philips N.V. Method for the analysis of ovarian cancer disorders
US20100273674A1 (en) * 2007-09-17 2010-10-28 Koninklijke Philips Electronics N.V. Method for the analysis of ovarian cancer disorders
US20100279879A1 (en) * 2007-09-17 2010-11-04 Koninklijke Philips Electronics N.V. Method for the analysis of breast cancer disorders
US8685675B2 (en) 2007-11-27 2014-04-01 Human Genetic Signatures Pty. Ltd. Enzymes for amplification and copying bisulphite modified nucleic acids
US20100304386A1 (en) * 2007-11-27 2010-12-02 Human Genetic Signatures Pty Ltd. Enzymes for amplification and copying bisulphite modified nucleic acids
EP2302069A1 (en) 2007-12-11 2011-03-30 Epigenomics AG Methods and nucleic acids for analyses of cell proliferative disorders
US20110003700A1 (en) * 2007-12-20 2011-01-06 Human Genetic Signatures Pty Ltd. Elimination of contaminants associated with nucleic acid amplification
US20090203010A1 (en) * 2008-01-18 2009-08-13 Katholieke Universiteit Leuven, K.U. Leuven R&D MSMB-gene based diagnosis, staging and prognosis of prostate cancer
US11332795B2 (en) 2008-05-14 2022-05-17 Dermtech, Inc. Diagnosis of melanoma and solar lentigo by nucleic acid analysis
US11753687B2 (en) 2008-05-14 2023-09-12 Dermtech, Inc. Diagnosis of melanoma and solar lentigo by nucleic acid analysis
WO2009153667A2 (en) 2008-06-17 2009-12-23 Occure Gmbh Method for the detection of ovarian cancer
US8541207B2 (en) 2008-10-22 2013-09-24 Illumina, Inc. Preservation of information related to genomic DNA methylation
US8895268B2 (en) 2008-10-22 2014-11-25 Illumina, Inc. Preservation of information related to genomic DNA methylation
WO2010048337A2 (en) 2008-10-22 2010-04-29 Illumina, Inc. Preservation of information related to genomic dna methylation
US10174372B2 (en) 2008-10-22 2019-01-08 Illumina, Inc. Preservation of information related to genomic DNA methylation
US9605311B2 (en) 2008-10-22 2017-03-28 Illumina, Inc. Tandem sequencing top and bottom strands of double stranded nucleic acid using arrays configured for single molecule detection
WO2010070572A1 (en) 2008-12-18 2010-06-24 Koninklijke Philips Electronics N. V. Method for the detection of dna methylation patterns
EP3048176A2 (en) 2009-04-20 2016-07-27 Erasmus University Medical Center Rotterdam Method of diagnosing bladder cancer
US12529110B2 (en) 2009-04-20 2026-01-20 Erasmus University Medical Center Rotterdam Method of diagnosing bladder cancer
EP3620532A2 (en) 2009-04-20 2020-03-11 Erasmus University Medical Center Rotterdam Method of diagnosing bladder cancer
WO2010136168A2 (en) 2009-05-25 2010-12-02 Merck Patent Gmbh Continuous administration of integrin ligands for treating cancer
EP2966181A1 (en) 2009-06-26 2016-01-13 Epigenomics AG Methods and nucleic acids for analysis of bladder cell proliferative disorders
WO2010149782A1 (en) 2009-06-26 2010-12-29 Epigenomics Ag Methods and nucleic acids for analysis of bladder cell proliferative disorders
US20110027789A1 (en) * 2009-08-03 2011-02-03 Epigenomics Ag Methods for preservation of genomic dna sequence complexity
EP2309005A1 (en) 2009-08-03 2011-04-13 Eplgenomics AG Methods for preservation of genomic DNA sequence complexity
US9624530B2 (en) 2009-08-03 2017-04-18 Epigenomics Ag Methods for preservation of genomic DNA sequence complexity
US8642271B2 (en) 2009-08-27 2014-02-04 Case Western Reserve University Aberrant methylation of C6Orf150 DNA sequences in human colorectal cancer
US20110165567A1 (en) * 2009-08-27 2011-07-07 Markowitz Sanford D ABERRANT METHYLATION OF C6Orf150 DNA SEQUENCES IN HUMAN COLORECTAL CANCER
WO2011051414A1 (en) 2009-10-28 2011-05-05 Signature Diagnostics Ag Method for the prognosis of ovarian carcinoma
EP2319943A1 (en) 2009-11-05 2011-05-11 Epigenomics AG Methods of predicting therapeutic efficacy of cancer therapy
US20110159499A1 (en) * 2009-11-25 2011-06-30 Quantalife, Inc. Methods and compositions for detecting genetic material
WO2011137206A1 (en) 2010-04-30 2011-11-03 Novartis Ag Predictive markers useful in the treatment of fragile x syndrome (fxs)
WO2011150075A2 (en) 2010-05-25 2011-12-01 The Johns Hopkins University Compositions and methods for detecting a neoplasia
WO2012007137A1 (en) 2010-07-16 2012-01-19 Merck Patent Gmbh Peptide for use in the treatment of breast cancer and/or bone metastases
EP3795699A1 (en) 2011-02-02 2021-03-24 Exact Sciences Development Company, LLC Digital sequence analysis of dna methylation
EP3441479A1 (en) 2011-02-02 2019-02-13 Exact Sciences Development Company, LLC Digital sequence analysis of dna methylation
US10167509B2 (en) 2011-02-09 2019-01-01 Bio-Rad Laboratories, Inc. Analysis of nucleic acids
US9127312B2 (en) 2011-02-09 2015-09-08 Bio-Rad Laboratories, Inc. Analysis of nucleic acids
US11499181B2 (en) 2011-02-09 2022-11-15 Bio-Rad Laboratories, Inc. Analysis of nucleic acids
US10435743B2 (en) 2011-05-20 2019-10-08 The Regents Of The University Of California Method to estimate age of individual based on epigenetic markers in biological sample
WO2012178074A1 (en) 2011-06-23 2012-12-27 Case Western Reserve University Methods and compositions for detecting gastrointestinal and other cancers
WO2013007702A1 (en) 2011-07-08 2013-01-17 Epigenomics Ag Methods and nucleic acids for determining the prognosis of a cancer subject
US9732375B2 (en) 2011-09-07 2017-08-15 Human Genetic Signatures Pty. Ltd. Molecular detection assay using direct treatment with a bisulphite reagent
WO2013096661A1 (en) 2011-12-22 2013-06-27 Illumina, Inc. Methylation biomarkers for ovarian cancer
WO2013131981A1 (en) 2012-03-08 2013-09-12 Novartis Ag Predictive markers useful in the diagnosis and treatment of fragile x syndrome (fxs)
WO2013148147A1 (en) 2012-03-26 2013-10-03 The U.S.A., As Represented By The Secretary Dept. Of Health And Human Services Dna methylation analysis for the diagnosis, prognosis and treatment of adrenal neoplasms
EP3524693A1 (en) 2012-04-30 2019-08-14 Raindance Technologies, Inc. Digital analyte analysis
WO2013165748A1 (en) 2012-04-30 2013-11-07 Raindance Technologies, Inc Digital analyte analysis
WO2013174432A1 (en) 2012-05-24 2013-11-28 Fundació Institut D'investigació Biomèdica De Bellvitge (Idibell) Method for the identification of the origin of a cancer of unknown primary origin by methylation analysis
EP3878977A1 (en) 2013-03-14 2021-09-15 Mayo Foundation for Medical Education and Research Detecting neoplasm
WO2014159652A2 (en) 2013-03-14 2014-10-02 Mayo Foundation For Medical Education And Research Detecting neoplasm
EP3543360A2 (en) 2013-03-14 2019-09-25 Mayo Foundation for Medical Education and Research Detecting neoplasm
EP4234721A2 (en) 2013-03-14 2023-08-30 Mayo Foundation for Medical Education and Research Detecting neoplasm
US12606873B2 (en) 2013-03-14 2026-04-21 Mayo Foundation For Medical Education And Research Detecting neoplasm
WO2014172288A2 (en) 2013-04-19 2014-10-23 Raindance Technologies, Inc. Digital analyte analysis
EP3839071A1 (en) 2014-03-31 2021-06-23 Mayo Foundation for Medical Education and Research Detecting colorectal neoplasm
WO2015153283A1 (en) 2014-03-31 2015-10-08 Mayo Foundation For Medical Education And Research Detecting colorectal neoplasm
EP4234722A2 (en) 2014-03-31 2023-08-30 Mayo Foundation for Medical Education and Research Detecting colorectal neoplasm
US12188093B2 (en) 2014-09-26 2025-01-07 Mayo Foundation For Medical Education And Research Detecting cholangiocarcinoma
EP3889611A1 (en) 2014-12-12 2021-10-06 Exact Sciences Development Company, LLC Compositions and methods for performing methylation detection assays
US9984201B2 (en) 2015-01-18 2018-05-29 Youhealth Biotech, Limited Method and system for determining cancer status
WO2016115530A1 (en) 2015-01-18 2016-07-21 The Regents Of The University Of California Method and system for determining cancer status
WO2016160454A1 (en) 2015-03-27 2016-10-06 Exact Sciences Corporation Detecting esophageal disorders
US12319969B2 (en) 2015-03-27 2025-06-03 Exact Sciences Corporation Detecting esophageal disorders
EP4715097A2 (en) 2015-03-27 2026-03-25 Exact Sciences Corporation Detecting esophageal disorders
US12601011B2 (en) 2015-08-31 2026-04-14 Mayo Foundation For Medical Education And Research Detecting gastric neoplasm
WO2017040627A1 (en) 2015-08-31 2017-03-09 Mayo Foundation For Medical Education And Research Detecting gastric neoplasm
US11319593B2 (en) 2015-12-17 2022-05-03 Illumina, Inc. Distinguishing methylation levels in complex biological samples
EP3798321A1 (en) 2015-12-17 2021-03-31 Illumina, Inc. Distinguishing methylation levels in complex biological samples
EP4648053A2 (en) 2015-12-17 2025-11-12 Illumina, Inc. Distinguishing methylation levels in complex biological samples
US10913986B2 (en) 2016-02-01 2021-02-09 The Board Of Regents Of The University Of Nebraska Method of identifying important methylome features and use thereof
WO2017136482A1 (en) 2016-02-01 2017-08-10 The Board Of Regents Of The University Of Nebraska Method of identifying important methylome features and use thereof
US11279978B2 (en) 2016-05-31 2022-03-22 The Regents Of The University Of California Methods for evaluating, monitoring, and modulating aging process
US10202650B2 (en) 2016-05-31 2019-02-12 Youhealth Biotech, Limited Methods for monitoring ELOVL2, KLF14 and PENK gene expression following treatment with vitamin C
US10093986B2 (en) 2016-07-06 2018-10-09 Youhealth Biotech, Limited Leukemia methylation markers and uses thereof
US12351876B2 (en) 2016-07-06 2025-07-08 Helio Health, Inc. Colon cancer methylation markers and uses thereof
US11396678B2 (en) 2016-07-06 2022-07-26 The Regent Of The University Of California Breast and ovarian cancer methylation markers and uses thereof
US10829821B2 (en) 2016-07-06 2020-11-10 Youhealth Oncotech, Limited Leukemia methylation markers and uses thereof
US12359257B2 (en) 2016-07-06 2025-07-15 Helio Health Inc. Liver cancer methylation markers and uses thereof
US10544467B2 (en) 2016-07-06 2020-01-28 Youhealth Oncotech, Limited Solid tumor methylation markers and uses thereof
EP3978624A1 (en) 2016-07-19 2022-04-06 Exact Sciences Corporation Methylated control dna
WO2018017740A1 (en) 2016-07-19 2018-01-25 Exact Sciences Development Company, Llc Methylated control dna
US11345949B2 (en) 2016-07-19 2022-05-31 Exact Sciences Corporation Methylated control DNA
EP4293128A2 (en) 2016-09-02 2023-12-20 Mayo Foundation for Medical Education and Research Detecting hepatocellular carcinoma
WO2018045322A1 (en) 2016-09-02 2018-03-08 Mayo Foundation For Medical Education And Research Detecting hepatocellular carcinoma
EP3589732A1 (en) 2017-02-28 2020-01-08 Mayo Foundation for Medical Education and Research Detecting prostate cancer
US10513739B2 (en) 2017-03-02 2019-12-24 Youhealth Oncotech, Limited Methylation markers for diagnosing hepatocellular carcinoma and lung cancer
US11433075B2 (en) 2017-06-22 2022-09-06 Triact Therapeutics, Inc. Methods of treating glioblastoma
US11628144B2 (en) 2017-09-29 2023-04-18 Triact Therapeutics, Inc. Iniparib formulations and uses thereof
WO2019071161A1 (en) 2017-10-06 2019-04-11 Youhealth Biotech, Limited Methylation markers for diagnosing cancer
WO2019108626A1 (en) 2017-11-30 2019-06-06 Mayo Foundation For Medical Education And Research Detecting breast cancer
WO2019143845A1 (en) 2018-01-17 2019-07-25 The Regents Of The University Of California Phenotypic age and dna methylation based biomarkers for life expectancy and morbidity
US11976332B2 (en) 2018-02-14 2024-05-07 Dermtech, Inc. Gene classifiers and uses thereof in non-melanoma skin cancers
WO2020076983A1 (en) 2018-10-10 2020-04-16 The Regents Of The University Of California Dna methylation based biomarkers for life expectancy and morbidity
US12404540B2 (en) 2018-10-17 2025-09-02 The University Of Queensland Epigenetic biomarker and uses therefor
WO2020150705A1 (en) 2019-01-18 2020-07-23 The Regents Of The University Of California Dna methylation measurement for mammals based on conserved loci
US12584177B2 (en) 2019-01-24 2026-03-24 Mayo Foundation For Medical Education And Research Detecting endometrial cancer
US11578373B2 (en) 2019-03-26 2023-02-14 Dermtech, Inc. Gene classifiers and uses thereof in skin cancers
US12553089B2 (en) 2019-05-28 2026-02-17 Case Western Reserve University Compositions and methods for preserving DNA methylation
US11396679B2 (en) 2019-05-31 2022-07-26 Universal Diagnostics, S.L. Detection of colorectal cancer
US11001898B2 (en) 2019-05-31 2021-05-11 Universal Diagnostics, S.L. Detection of colorectal cancer
WO2021050962A1 (en) 2019-09-11 2021-03-18 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Cancer detection and classification
US12442043B2 (en) 2019-10-31 2025-10-14 Mayo Foundation For Medical Education And Research Detecting ovarian cancer
US11702704B2 (en) 2019-10-31 2023-07-18 Mayo Foundation For Medical Education And Research Detecting ovarian cancer
US11898199B2 (en) 2019-11-11 2024-02-13 Universal Diagnostics, S.A. Detection of colorectal cancer and/or advanced adenomas
US20230049979A1 (en) * 2020-02-06 2023-02-16 OncoHost Ltd. Machine learning prediction of therapy response
WO2021185061A1 (en) 2020-03-20 2021-09-23 Singlera Health Technologies (Shanghai) Ltd. Methods and kits for screening colorectal neoplasm
US12467096B2 (en) 2020-05-15 2025-11-11 Universal Diagnostics, S.A. Methods and systems for identifying methylation biomarkers
US12404538B2 (en) 2020-05-27 2025-09-02 Case Western Reserve University Compositions and methods for preserving DNA methylation
US11530453B2 (en) 2020-06-30 2022-12-20 Universal Diagnostics, S.L. Systems and methods for detection of multiple cancer types
WO2022040306A1 (en) 2020-08-19 2022-02-24 Mayo Foundation For Medical Education And Research Detecting non-hodgkin lymphoma
WO2022165247A1 (en) 2021-01-29 2022-08-04 Mayo Foundation For Medical Education And Research Detecting the presence or absence of multiple types of cancer
WO2023052640A1 (en) 2021-09-30 2023-04-06 Tivenix Sa A method for diagnosing and predicting progression of neurodegenerative diseases or disorders
EP4170661A1 (en) 2021-10-19 2023-04-26 Institut National de la Santé et de la Recherche Médicale (INSERM) Methylation profile analysis using smoothing method
WO2023066972A1 (en) 2021-10-19 2023-04-27 INSERM (Institut National de la Santé et de la Recherche Médicale) Dna methylation signature for diagnosing hepatocellular carcinoma
WO2023175019A1 (en) 2022-03-15 2023-09-21 Genknowme S.A. Method determining the difference between the biological age and the chronological age of a subject
EP4299764A1 (en) 2022-06-28 2024-01-03 Universal Diagnostics, S.A. Methods for detecting pancreatic cancer using dna methylation markers
US12606872B2 (en) 2022-11-16 2026-04-21 Universal Diagnostics, S.A. Methods for stratification and early detection of advanced adenoma and/or colorectal cancer using DNA methylation markers
WO2024105132A1 (en) 2022-11-16 2024-05-23 Universal Diagnostics, S.A. Methods for stratification and early detection of advanced adenoma and/or colorectal cancer using dna methylation markers
WO2024256726A1 (en) 2023-06-15 2024-12-19 Genknowme S.A. Computer implemented method determining a value of allostatic load of a human being

Also Published As

Publication number Publication date
EP1690948A3 (en) 2006-11-22
PT954608E (en) 2006-08-31
IL127342A0 (en) 1999-10-28
JP2004290200A (en) 2004-10-21
WO1997046705A1 (en) 1997-12-11
CA2257104A1 (en) 1997-12-11
JP3725535B2 (en) 2005-12-14
DE69735894T2 (en) 2007-04-19
EP0954608B1 (en) 2006-05-17
JP3612080B2 (en) 2005-01-19
IL127342A (en) 2002-07-25
US6017704A (en) 2000-01-25
EP1690948A2 (en) 2006-08-16
EP0954608A1 (en) 1999-11-10
ES2264165T3 (en) 2006-12-16
CA2257104C (en) 2008-01-29
JP2000511776A (en) 2000-09-12
DK0954608T3 (en) 2006-08-21
EP0954608A4 (en) 2003-09-10
DE69735894D1 (en) 2006-06-22
ATE326549T1 (en) 2006-06-15

Similar Documents

Publication Publication Date Title
US6265171B1 (en) Method of detection of methylated nucleic acid using agents which modify unmethylated cytosine and distinguish modified methylated and non-methylated nucleic acids
US6200756B1 (en) Methods for identifying methylation patterns in a CpG-containing nucleic acid
JP7547406B2 (en) Epigenetic markers for colorectal cancer and diagnostic methods using said markers - Patents.com
US8785614B2 (en) Aberrantly methylated genes in pancreatic cancer
EP0672181B1 (en) Methods of detecting mammalian nucleic acids isolated from stool specimen and reagents therefor
US20200172963A1 (en) Dna methylation in colorectal and breast cancer diagnostic methods
JP3522690B2 (en) GST-Pi gene methylation assay
AU2017339984A1 (en) Method for multiplex detection of methylated DNA
CA2872867A1 (en) Diagnostic gene marker panel for colorectal cancer
JP2005204652A (en) Assay for detecting methylation status by methylation specific primer extension (mspe)
US11535897B2 (en) Composite epigenetic biomarkers for accurate screening, diagnosis and prognosis of colorectal cancer
CA2612690C (en) Methylation specific detection
US7611841B2 (en) Method for detecting methylation of promoter using restriction enzyme and DNA chip
CN120989247A (en) Compositions for detecting lung cancer and their uses
CN120138147A (en) Composition for detecting colorectal cancer and use thereof

Legal Events

Date Code Title Description
STCF Information on status: patent grant

Free format text: PATENTED CASE

CC Certificate of correction
FEPP Fee payment procedure

Free format text: PAYOR NUMBER ASSIGNED (ORIGINAL EVENT CODE: ASPN); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY

FPAY Fee payment

Year of fee payment: 4

FPAY Fee payment

Year of fee payment: 8

FPAY Fee payment

Year of fee payment: 12