US5888742A - Human phospholipid binding proteins - Google Patents
Human phospholipid binding proteins Download PDFInfo
- Publication number
- US5888742A US5888742A US08/958,820 US95882097A US5888742A US 5888742 A US5888742 A US 5888742A US 95882097 A US95882097 A US 95882097A US 5888742 A US5888742 A US 5888742A
- Authority
- US
- United States
- Prior art keywords
- plbp
- sequence
- sequences
- polynucleotide
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4721—Lipocortins
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y10—TECHNICAL SUBJECTS COVERED BY FORMER USPC
- Y10S—TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y10S530/00—Chemistry: natural resins or derivatives; peptides or proteins; lignins or reaction products thereof
- Y10S530/827—Proteins from mammals or birds
- Y10S530/848—Lungs
Definitions
- This invention relates to nucleic acid and amino acid sequences of two human phospholipid binding proteins and to the use of these sequences in the diagnosis, prevention, and treatment of disorders associated with fetal development, reproduction, cell proliferation, and the immune response.
- Membrane biogenesis is essential for cell growth and differentiation. During membrane biogenesis in eukaryotic cells, newly synthesized phospholipids must be transported from their sites of synthesis to their sites of function. Vesicular traffic in eukaryotic cells is characterized by two steps of membrane rearrangement, the formation of vesicles from donor membranes and their fusion with acceptor membranes. With respect to vesicle formation, several of the cytosolic proteins implicated in budding and fission have been identified. These proteins stimulate the formation of constitutive secretory vesicles and immature secretory granules from the trans-Golgi network.
- PC-TP Phosphatidylcholine transfer protein
- cytosolic lipid transfer proteins which are distinguished by their ability to transfer phospholipids between membranes in vitro (Wirtz, K. W. A. (1991) Ann. Rev. Biochem. 60:73-99).
- PC-TPs purified from bovine and rat liver are 213 amino acids in length and have molecular masses of about 28 kDa.
- the cDNAs which encode full-length bovine PC-TP and fragments of rat and mouse PC-TPs were recently isolated (Geijtenbeek, T. B. H. et al. (1996) Biochem. J. 316:49-55).
- PC-TP RNA In adult mice, levels of PC-TP RNA are highest in liver, kidney and testis, lower in lung, heart, and gastrointestinal tissues, and nearly undetectable in brain and thymus. PC-TP RNA is present in all stages of mouse embryo development, which suggests a role for PC-TP in cell growth and differentiation (Geijtenbeek et al., supra).
- Pulmonary surfactant is a lipid-rich material that prevents lung collapse by lowering surface tension at the air-liquid interface in the lung alveoli. It is composed primarily of the phospholipids PC and phosphatidylglycerol and lesser amounts of cholesterol and surfactant-associated proteins. Levels of PC-TP in fetal rat lung are greatest just prior to term and parallel the levels of surfactant production and of the enzymes required for PC synthesis (Teerlink, T. et al. (1982) Biochim. Biophys. Acta 713:61-67).
- PC-TP is proposed to contribute to PC secretion by transporting PC from its site of synthesis in the endoplasmic reticulum to the inner leaflet of the canalicular membrane, possibly in concert with the class III metabolic P-glycoprotein encoded by the Mdr2 gene (Smit, J. J. M. et al. (1993) Cell 75:451-462; Geijtenbeek et al., supra).
- PC-TP may play an essential role in membrane biogenesis by delivering PC to sites of growth. Furthermore, PC-TP may also play a role in the signal transduction pathway by delivering PC from intracellular stores to sites of enzymatic hydrolysis where the PC-specific phospholipases C and D convert PC into lipid mediators such as phosphatidic acid, diacylglyerol and arachidonic acid (Exton, J. H. (1994) Biochim. Biophys. Acta 1212:26-42; Geijtenbeek et al., supra).
- lipid mediators such as phosphatidic acid, diacylglyerol and arachidonic acid
- PE Phosphatidylethanotamine
- Phosphatidylethanotamine comprises a portion of the lipid pool of many organisms, including bacteria, lower metazoa, fish, amphibia, reptiles, birds, and mammals.
- PE is synthesized from ethanolamine and diacylglycerol by a number of mitochondrial or endoplasmic reticular enzymes.
- PE is a source of fatty acid anions and diacylglycerol.
- Intracellular phospholipase C metabolizes PE to produce diacylglycerol, a component of the protein kinase C-stimulating second messenger pathway.
- PE is an important intracellular component of the intracellular fatty acid synthesis and of the cell cycle.
- biochemically modified PE may mediate hippocampal long term potentiation and some of the symptoms associated with Sjogren-Larsson syndrome (Pavlinova, L. I. et al. (1997) Neurosci. Behav. Physiol. 27:234-239; James, P. F. and Zoeller, R. A. (1997) J. Biol. Chem. 272:23532-23539).
- PE-BPs PE-binding proteins
- PE-BPs Similar putative PE-BPs have been identified in the parasitic nematode Onchocerca volvulus. Erttmann, K. D. and Gallin, M. Y. (1996; Gene 174:203-207) speculated that the nematode PE-BPs might play a role in odorant response, a process essential in development, feeding, and mating.
- the invention features two substantially purified polypeptides, human phospholipid binding proteins (designated collectively as PLBP and individually as PLBP I and PLBP2), having the amino acid sequence shown in SEQ ID NO:1 or SEQ ID NO:3 or fragments thereof.
- the invention further provides an isolated and substantially purified polynucleotide sequence encoding the polypeptide comprising the amino acid sequence of SEQ ID NO:1 or fragments thereof and a composition comprising said polynucleotide sequence.
- the invention also provides a polynucleotide sequence which hybridizes under stringent conditions to the polynucleotide sequence encoding the amino acid sequence SEQ ID NO:1, or fragments of said polynucleotide sequence.
- the invention further provides a polynucleotide sequence comprising the complement of the polynucleotide sequence encoding the amino acid sequence of SEQ ID NO:1, or fragments or variants of said polynucleotide sequence.
- the invention also provides an isolated and purified sequence comprising SEQ ID NO:2 or variants thereof.
- the invention provides a polynucleotide sequence which hybridizes under stringent conditions to the polynucleotide sequence of SEQ ID NO:2.
- the invention also provides a polynucleotide sequence comprising the complement of SEQ ID NO:2, or fragments or variants thereof.
- the present invention further provides an expression vector containing at least a fragment of any of the claimed polynucleotide sequences.
- the expression vector containing the polynucleotide sequence is contained within a host cell.
- the invention also provides a method for producing a polypeptide comprising the amino acid sequence of SEQ ID NO:1 or a fragment thereof, the method comprising the steps of: a) culturing the host cell containing an expression vector containing at least a fragment of the polynucleotide sequence encoding PLBP1 under conditions suitable for the expression of the polypeptide; and b) recovering the polypeptide from the host cell culture.
- the invention also provides a pharmaceutical composition
- a pharmaceutical composition comprising a substantially purified PLBP1 having the amino acid sequence of SEQ ID NO:1 in conjunction with a suitable pharmaceutical carrier.
- the invention also provides a purified antagonist of the polypeptide of SEQ ID NO:1.
- the invention provides a purified antibody which binds to a polypeptide comprising the amino acid sequence of SEQ ID NO:1.
- the invention provides a purified agonist of the polypeptide of SEQ ID NO:1.
- the invention also provides a method for treating or preventing a disorder associated with fetal development comprising administering to a subject in need of such treatment an effective amount of a pharmaceutical composition comprising purified PLBP1.
- the invention also provides a method for treating or preventing a disorder associated with reproduction comprising administering to a subject in need of such treatment an effective amount of a pharmaceutical composition comprising purified PLBP1.
- the invention also provides a method for treating or preventing a disorder associated with cell proliferation comprising administering to a subject in need of such treatment an effective amount of an antagonist to PLBP1.
- the invention also provides a method for treating or preventing a disorder associated with the immune response comprising administering to a subject in need of such treatment an effective amount of an antagonist to PLBP1.
- the invention also provides a method for detecting a polynucleotide which encodes PLBP in a biological sample comprising the steps of: a) hybridizing the complement of the polynucleotide sequence which encodes SEQ ID NO:1 to nucleic acid material of a biological sample, thereby forming a hybridization complex; and b) detecting the hybridization complex, wherein the presence of the complex correlates with the presence of a polynucleotide encoding PLBP1 in the biological sample.
- the nucleic acid material of the biological sample is amplified by the polymerase chain reaction prior to hybridization.
- the invention further provides an isolated and substantially purified polynucleotide sequence encoding the polypeptide comprising the amino acid sequence of SEQ ID NO:3 or fragments thereof and a composition comprising said polynucleotide sequence.
- the invention also provides a polynucleotide sequence which hybridizes under stringent conditions to the polynucleotide sequence encoding the amino acid sequence SEQ ID NO:3, or fragments of said polynucleotide sequence.
- the invention further provides a polynucleotide sequence comprising the complement of the polynucleotide sequence encoding the amino acid sequence of SEQ ID NO:3, or fragments or variants of said polynucleotide sequence.
- the invention also provides an isolated and purified sequence comprising SEQ ID NO:4 or variants thereof.
- the invention provides a polynucleotide sequence which hybridizes under stringent conditions to the polynucleotide sequence of SEQ ID NO:4.
- the invention also provides a polynucleotide sequence comprising the complement of SEQ ID NO:4, or fragments or variants thereof.
- the present invention further provides an expression vector containing at least a fragment of any of the claimed polynucleotide sequences.
- the expression vector containing the polynucleotide sequence is contained within a host cell.
- the invention also provides a method for producing a polypeptide comprising the amino acid sequence of SEQ ID NO:3 or a fragment thereof, the method comprising the steps of: a) culturing the host cell containing an expression vector containing at least a fragment of the polynucleotide sequence encoding PLBP2 under conditions suitable for the expression of the polypeptide; and b) recovering the polypeptide from the host cell culture.
- the invention also provides a pharmaceutical composition
- a pharmaceutical composition comprising a substantially purified PLBP2 having the amino acid sequence of SEQ ID NO:3 in conjunction with a suitable pharmaceutical carrier.
- the invention also provides a purified antagonist of the polypeptide of SEQ ID NO:3.
- the invention provides a purified antibody which binds to a polypeptide comprising the amino acid sequence of SEQ ID NO:3.
- the invention provides a purified agonist of the polypeptide of SEQ ID NO:3.
- the invention also provides a method for treating or preventing a disorder associated with fetal development comprising administering to a subject in need of such treatment an effective amount of a pharmaceutical composition comprising purified PLBP2.
- the invention also provides a method for treating or preventing a disorder associated with reproduction comprising administering to a subject in need of such treatment an effective amount of a pharmaceutical composition comprising purified PLBP1.
- the invention also provides a method for treating or preventing a disorder associated with cell proliferation comprising administering to a subject in need of such treatment an effective amount of an antagonist to PLBP2.
- the invention also provides a method for treating or preventing a disorder associated with the immune response comprising administering to a subject in need of such treatment an effective amount of an antagonist to PLBP2.
- the invention also provides a method for detecting a polynucleotide which encodes PLBP2 in a biological sample comprising the steps of: a) hybridizing the complement of the polynucleotide sequence which encodes SEQ ID NO:3 to nucleic acid material of a biological sample, thereby forming a hybridization complex; and b) detecting the hybridization complex, wherein the presence of the complex correlates with the presence of a polynucleotide encoding PLBP2 in the biological sample.
- the nucleic acid material of the biological sample is amplified by the polymerase chain reaction prior to hybridization.
- FIGS. 1A, 1B, 1C, 1D, and 1E show the amino acid sequence (SEQ ID NO:1) and nucleic acid sequence (SEQ ID NO:2) of PLBP1.
- the alignment was produced using MACDNASIS PRO software (Hitachi Software Engineering Co. Ltd. San Bruno, Calif.).
- FIGS. 2A, 2B, and 2C show the amino acid sequence (SEQ ID NO:3) and nucleic acid sequence (SEQ ID NO:4) of PLBP2.
- the alignment was produced using MACDNASIS PRO software (Hitachi Software Engineering Co. Ltd. San Bruno, Calif.).
- FIG. 3 shows the amino acid sequence alignments between PLBP1 (3014759; SEQ ID NO:1) and bovine PC-TP (GI 897693; SEQ ID NO:5) produced using the multisequence alignment program of DNASTAR software (DNASTAR Inc, Madison Wis.).
- FIG. 4 shows the amino acid sequence alignments between PLBP2 (3126479; SEQ ID NO:3) and Onchocerca volvulus PE-BP D1 (GI 1143527; SEQ ID NO:6) produced using the multisequence alignment program of DNASTAR software (DNASTAR Inc, Madison Wis.).
- FIGS. 5A and 5B show the hydrophobicity plots for PLBP1 (SEQ ID NO:1) and bovine PC-TP (SEQ ID NO:5), respectively; the positive X axis reflects amino acid position, and the negative Y axis, hydrophobicity (MACDNASIS PRO software).
- PLBP refers to the amino acid sequences of substantially purified PLBP obtained from any species, particularly mammalian, including bovine, ovine, porcine, murine, equine, and preferably human, from any source whether natural, synthetic, semi-synthetic, or recombinant.
- agonist refers to a molecule which, when bound to PLBP, increases or prolongs the duration of the effect of PLBP.
- Agonists may include proteins, nucleic acids, carbohydrates, or any other molecules which bind to and modulate the effect of PLBP.
- alleles are an alternative form of the gene encoding PLBP. Alleles may result from at least one mutation in the nucleic acid sequence and may result in altered mRNAs or polypeptides whose structure or function may or may not be altered. Any given natural or recombinant gene may have none, one, or many allelic forms. Common mutational changes which give rise to alleles are generally ascribed to natural deletions, additions, or substitutions of nucleotides. Each of these types of changes may occur alone, or in combination with the others, one or more times in a given sequence.
- altered nucleic acid sequences encoding PLBP include those with deletions, insertions, or substitutions of different nucleotides resulting in a polynucleotide that encodes the same or a functionally equivalent PLBP. Included within this definition are polymorphisms which may or may not be readily detectable using a particular oligonucleotide probe of the polynucleotide encoding PLBP, and improper or unexpected hybridization to alleles, with a locus other than the normal chromosomal locus for the polynucleotide sequence encoding PLBP.
- the encoded protein may also be "altered” and contain deletions, insertions, or substitutions of amino acid residues which produce a silent change and result in a functionally equivalent PLBP.
- Deliberate amino acid substitutions may be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, and/or the amphipathic nature of the residues as long as the biological or immunological activity of PLBP is retained.
- negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; and amino acids with uncharged polar head groups having similar hydrophilicity values may include leucine, isoleucine, and valine, glycine and alanine, asparagine and glutamine, serine and threonine, and phenylalanine and tyrosine.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide, or protein sequence, and fragment thereof, and to naturally occurring or synthetic molecules. Fragments of PI,BP are preferably about 5 to about 15 amino acids in length and retain the biological activity or the immunological activity of PLBP. Where "amino acid sequence” is recited herein to refer to an amino acid sequence of a naturally occurring protein molecule, amino acid sequence, and like terms; are not meant to limit the amino acid sequence to the complete, native amino acid sequence associated with the recited protein molecule.
- PCR polymerase chain reaction
- Antagonist refers to a molecule which, when bound to PLBP, decreases the amount or the duration of the effect of the biological or immunological activity of PLBP.
- Antagonists may include proteins, nucleic acids, carbohydrates, antibodies or any other molecules which decrease the effect of PLBP.
- the term "antibody” refers to intact molecules as well as fragments thereof, such as Fa, F(ab') 2 , and Fv, which are capable of binding the epitopic determinant.
- Antibodies that bind PLBP polypeptides can be prepared using intact polypeptides or fragments containing small peptides of interest as the immunizing antigen.
- the polypeptide or oligopeptide used to immunize an animal can be derived from the translation of RNA or synthesized chemically and can be conjugated to a carrier protein, if desired. Commonly used carriers that are chemically coupled to peptides include bovine serum albumin and thyroglobulin, keyhole limpet hemocyanin. The coupled peptide is then used to immunize the animal (e.g., a mouse, a rat, or a rabbit).
- antigenic determinant refers to that fragment of a molecule (i.e., an epitope) that makes contact with a particular antibody.
- an antigenic determinant may compete with the intact antigen (i.e., the immunogen used to elicit the immune response) for binding to an antibody.
- antisense refers to any composition containing nucleotide sequences which are complementary to a specific DNA or RNA sequence.
- antisense strand is used in reference to a nucleic acid strand that is complementary to the "sense” strand.
- Antisense molecules include peptide nucleic acids and may be produced by any method including synthesis or transcription. Once introduced into a cell, the complementary nucleotides combine with natural sequences produced by the cell to form duplexes and block either transcription or translation. The designation “negative” is sometimes used in reference to the antisense strand, and “positive” is sometimes used in reference to the sense strand.
- biologically active refers to a protein having structural, regulatory, or biochemical functions of a naturally occurring molecule.
- immunologically active refers to the capability of the natural, recombinant, or synthetic PLBP, or any oligopeptide thereof, to induce a specific immune response in appropriate animals or cells and to bind with specific antibodies.
- complementarity refers to the natural binding of polynucleotides under permissive salt and temperature conditions by base-pairing.
- sequence "A-G-T” binds to the complementary sequence "T-C-A”.
- Complementarity between two single-stranded molecules may be "partial", in which only some of the nucleic acids bind, or it may be complete when total complementarity exists between the single stranded molecules.
- the degree of complementarity between nucleic acid strands has significant effects on the efficiency and strength of hybridization between nucleic acid strands. This is of particular importance in amplification reactions, which depend upon binding between nucleic acids strands and in the design and use of PNA molecules.
- composition comprising a given polynucleotide sequence refers broadly to any composition containing the given polynucleotide sequence.
- the composition may comprise a dry formulation or an aqueous solution.
- Compositions comprising polynucleotide sequences encoding PLBP (SEQ ID NO:1, SEQ ID NO:3) or fragments thereof (e.g., SEQ ID NO:2 or SEQ ID NO:4 and fragments thereof) may be employed as hybridization probes.
- the probes may be stored in freeze-dried form and may be associated with a stabilizing agent such as a carbohydrate.
- the probe may be deployed in an aqueous solution containing salts (e.g., NaCl), detergents (e.g., SDS) and other components (e.g., Denhardt's solution, dry milk, salmon sperm DNA, etc.).
- salts e.g., NaCl
- detergents e.g., SDS
- other components e.g., Denhardt's solution, dry milk, salmon sperm DNA, etc.
- Consensus refers to a nucleic acid sequence which has been resequenced to resolve uncalled bases, has been extended using XL-PCR (Perkin Elmer, Norwalk, Conn.) in the 5' and/or the 3' direction and resequenced, or has been assembled from the overlapping sequences of more than one Incyte Clone using a computer program for fragment assembly (e.g., GELVIEW Fragment Assembly system, GCG, Madison, Wis.). Some sequences have been both extended and assembled to produce the consensus sequence.
- correlates with expression of a polynucleotide indicates that the detection of the presence of ribonucleic acid that is similar to SEQ ID NO:2, or SEQ ID NO:4, by northern analysis is indicative of the presence of mRNA encoding PLBP in a sample and thereby correlates with expression of the transcript from the polynucleotide encoding the protein.
- a “deletion”, as used herein, refers to a change in the amino acid or nucleotide sequence and results in the absence of one or more amino acid residues or nucleotides.
- derivative refers to the chemical modification of a nucleic acid encoding or complementary to PLBP or the encoded PLBP. Such modifications include, for example, replacement of hydrogen by an alkyl, acyl, or amino group.
- a nucleic acid derivative encodes a polypeptide which retains the biological or immunological function of the natural molecule.
- a derivative polypeptide is one which is modified by glycosylation, pegylation, or any similar process which retains the biological or immunological function of the polypeptide from which it was derived.
- low stringency conditions are such that non-specific binding is permitted; low stringency conditions require that the binding of two sequences to one another be a specific (i.e., selective) interaction.
- the absence of non-specific binding may be tested by the use of a second target sequence which lacks even a partial degree of complementarity (e.g., less than about 30% identity). In the absence of non-specific binding, the probe will not hybridize to the second non-complementary target sequence.
- HACs Human artificial chromosomes
- HACs are linear microchromosomes which may contain DNA sequences of 10K to 10M in size and contain all of the elements required for stable mitotic chromosome segregation and maintenance (Harrington, J. J. et al. (1997) Nat Genet. 15:345-355).
- humanized antibody refers to antibody molecules in which amino acids have been replaced in the non-antigen binding regions in order to more closely resemble a human antibody, while still retaining the original binding ability.
- hybridization refers to any process by which a strand of nucleic acid binds with a complementary strand through base pairing.
- hybridization complex refers to a complex formed between two nucleic acid sequences by virtue of the formation of hydrogen bonds between complementary G and C bases and between complementary A and T bases; these hydrogen bonds may be further stabilized by base stacking interactions.
- the two complementary nucleic acid sequences hydrogen bond in an antiparallel configuration.
- a hybridization complex may be formed in solution (e.g., C 0 t or R 0 t analysis) or between one nucleic acid sequence present in solution and another nucleic acid sequence immobilized on a solid support (e.g., paper, membranes, filters, chips, pins or glass slides, or any other appropriate substrate to which cells or their nucleic acids have been fixed).
- insertion refers to a change in an amino acid or nucleotide sequence resulting in the addition of one or more amino acid residues or nucleotides, respectively, as compared to the naturally occurring molecule.
- Microarray refers to an array of distinct polynucleotides or oligonucleotides synthesized on a substrate, such as paper, nylon or other type of membrane, filter, chip, glass slide, or any other suitable solid support.
- modulate refers to a change in the activity of PLBP. For example, modulation may cause an increase or a decrease in protein activity, binding characteristics, or any other biological, functional or immunological properties of PLBP.
- Nucleic acid sequence refers to an oligonucleotide, nucleotide, or polynucleotide, and fragments thereof, and to DNA or RNA of genomic or synthetic origin which may be single- or double-stranded, and represent the sense or antisense strand.
- “Fragments” are those nucleic acid sequences which are greater than 60 nucleotides in length, and most preferably includes fragments that are at least 100 nucleotides or at least 1000 nucleotides, and at least 10,000 nucleotides in length.
- oligonucleotide refers to a nucleic acid sequence of at least about 6 nucleotides to about 60 nucleotides, preferably about 15 to 30 nucleotides, and more preferably about 20 to 25 nucleotides, which can be used in PCR amplification or a hybridization assay, or a microarray. As used herein, oligonucleotide is substantially equivalent to the terms “amplimers”, “primers”, “oligomers”, and “probes”, as commonly defined in the art.
- PNA protein nucleic acid
- PNA refers to an antisense molecule or anti-gene agent which comprises an oligonucleotide of at least five nucleotides in length linked to a peptide backbone of amino acid residues which ends in lysine. The terminal lysine confers solubility to the composition.
- PNAs may be pegylated to extend their lifespan in the cell where they preferentially bind complementary single stranded DNA and RNA and stop transcript elongation (Nielsen, P. E. et al. (1993) Anticancer Drug Des. 8:53-63).
- portion refers to fragments of that protein.
- the fragments may range in size from five amino acid residues to the entire amino acid sequence minus one amino acid.
- a protein "comprising at least a portion of the amino acid sequence of SEQ ID NO:1" encompasses the full-length PLBP and fragments thereof.
- sample is used in its broadest sense.
- a biological sample suspected of containing nucleic acid encoding PLBP, or fragments thereof, or PLBP itself may comprise a bodily fluid, extract from a cell, chromosome, organelle, or membrane isolated from a cell, a cell, genomic DNA, RNA, or cDNA (in solution or bound to a solid support, a tissue, a tissue print, and the like).
- binding refers to that interaction between a protein or peptide and an agonist, an antibody and an antagonist. The interaction is dependent upon the presence of a particular structure (i.e., the antigenic determinant or epitope) of the protein recognized by the binding molecule. For example, if an antibody is specific for epitope "A", the presence of a protein containing epitope A (or free, unlabeled A) in a reaction containing labeled "A" and the antibody will reduce the amount of labeled A bound to the antibody.
- stringent conditions refer to the conditions for hybridization as defined by the nucleic acid, salt, and temperature. These conditions are well known in the art and may be altered in order to identify or detect identical or related polynucleotide sequences. Numerous equivalent conditions comprising either low or high stringency depend on factors such as the length and nature of the sequence (DNA, RNA, base composition), nature of the target (DNA, RNA, base composition), milieu (in solution or immobilized on a solid substrate), concentration of salts and other components (e.g., formamide, dextran sulfate and/or polyethylene glycol), and temperature of the reactions (within a range from about 5° C. below the melting temperature of the probe to about 20° C. to 25° C. below the melting temperature). One or more factors be may be varied to generate conditions of either low or high stringency different from, but equivalent to, the above listed conditions.
- substantially purified refers to nucleic or amino acid sequences that are removed from their natural environment, isolated or separated, and are at least 60% free, preferably 75% free, and most preferably 90% free from other components with which they are naturally associated.
- substitution refers to the replacement of one or more amino acids or nucleotides by different amino acids or nucleotides, respectively.
- Transformation describes a process by which exogenous DNA enters and changes a recipient cell. It may occur under natural or artificial conditions using various methods well known in the art. Transformation may rely on any known method for the insertion of foreign nucleic acid sequences into a prokaryotic or eukaryotic host cell. The method is selected based on the type of host cell being transformed and may include, but is not limited to, viral infection, electroporation, heat shock, lipofection, and particle bombardment.
- Such "transformed” cells include stably transformed cells in which the inserted DNA is capable of replication either as an autonomously replicating plasmid or as part of the host chromosome. They also include cells which transiently express the inserted DNA or RNA for limited periods of time.
- a “variant" of PLBP refers to an amino acid sequence that is altered by one or more amino acids.
- the variant may have "conservative" changes, wherein a substituted amino acid has similar structural or chemical properties, e.g., replacement of leucine with isoleucine. More rarely, a variant may have "nonconservative" changes, e.g., replacement of a glycine with a tryptophan.
- the invention is based on the discovery of two new human phospholipid binding proteins (collectively referred to as "PLBP” and, individually, as “PLBP1” and “PLBP2”), the polynucleotides encoding PLBP, and the use of these compositions for the diagnosis, prevention, or treatment of disorders associated with fetal development, reproduction, cell proliferation, and the immune response.
- PLBP human phospholipid binding proteins
- Nucleic acids encoding the PLBP1 of the present invention were first identified in Incyte Clone 3014759 from the forearm muscle tissue cDNA library (MUSCNOT07) using a computer search for amino acid sequence alignments.
- a consensus sequence, SEQ ID NO:2 was derived from the following overlapping and/or extended nucleic acid sequences: Incyte Clones 1308719 (COLNFET02), 1628536 (COLNPOT01), 2922782 (SININOT04), 3014759 (MUSCNOT07), 069945 (HUVESTB01), 1216577 (BRSTTUT01), 340858 (NEUTFMT01), 1628536 (COLNPOT 01), and 812951 (LUNGNOT04).
- the invention encompasses a polypeptide comprising the amino acid sequence of SEQ ID NO:1, as shown in FIGS. 1A, 1B, 1C, 1D, and 1E.
- PLBP1 is 214 amino acids in length and has a potential protein kinase A or G phosphorylation site at residue S-169, two potential casein kinase II phosphorylation sites at S-7 and S-110, one potential protein kinase C phosphorylation site at residue S-110, and an isoelectric point of 5.51.
- PLBP1 has chemical and structural homology with bovine PC-TP (GI 897693; SEQ ID NO:5).
- PLBP1 and bovine PC-TP share 81% amino acid sequence identity, one potential protein kinase A or G phosphorylation site, one potential casein kinase II phosphorylation site, and one potential protein kinase C phosphorylation site.
- FIGS. 5A and 5B PLBP1 and bovine PC-TP have rather similar hydrophobicity plots.
- Northern analysis shows the expression of this sequence in various libraries, at least 55% of which are immortalized or cancerous and at least 29% of which involve immune response.
- PLBP1 in lung, gastrointestinal, breast, and prostate tissues; and in fetal, hematopoietic, and tumor tissues.
- Nucleic acids encoding the PLBP2 of the present invention were first identified in Incyte Clone 3126479 from the lung cDNA library (LUNGTUT 12) using a computer search for amino acid sequence alignments.
- a consensus sequence, SEQ ID NO:4 was derived from the following overlapping and/or extended nucleic acid sequences: Incyte Clones 3126479 (LUNGTUT12), 198504 (LUNGAST01), 1603350 (LUNGNOT15), 1375574 (LUNGNOT10), and 1359626 (LUNGNOT12).
- the invention encompasses a polypeptide comprising the amino acid sequence of SEQ ID NO:3, as shown in FIGS. 2A, 2B, and 2C.
- PLBP2 is 227 amino acids in length and has a potential N-glycosylation site at residue N-169, three potential casein kinase II phosphorylation sites at residues T-21, S-73, and S-101, two potential protein kinase C phosphorylation sites at residues T-4 and S-174, one potential tyrosine kinase phosphorylation site at residue Y-67, a potential signal peptide between residues M-1 and T-21, and an isoelectric point of 5.9. As shown in FIG.
- PLBP2 has chemical and structural homology with Onchocerca PE-BP D1 (GI 1143527; SEQ ID NO:6).
- PLBP2 and Onchocerca PLBP share 30% amino acid sequence identity.
- Northern analysis shows the expression of this sequence in various libraries, at least 52% of which are immortalized or cancerous and at least 11% of which involve immune response.
- PLBP2 in lung, prostate, heart tissues; and in fetal and tumor tissues.
- the invention also encompasses PLBP variants.
- a preferred PLBP variant is one having at least 80%, and more preferably at least 90%, amino acid sequence identity to the PLBP amino acid sequence (SEQ ID NO:1) and which retains at least one biological, immunological or other functional characteristic or activity of PLBP.
- a most preferred PLBP variant is one having at least 95% amino acid sequence identity to SEQ ID NO:1.
- the invention also encompasses polynucleotides which encode PLBP. Accordingly, any nucleic acid sequence which encodes the amino acid sequence of PLBP can be used to produce recombinant molecules which express PLBP.
- the invention encompasses the polynucleotide comprising the nucleic acid sequence of SEQ ID NO:2 as shown in FIGS. 1A, 1B, 1C, 1D, and 1E.
- the invention encompasses the polynucleotide comprising the nucleic acid sequence of SEQ ID NO:4 as shown in FIGS. 2A, 2B, and 2C.
- nucleotide sequences encoding PLBP may be produced.
- the invention contemplates each and every possible variation of nucleotide sequence that could be made by selecting combinations based on possible codon choices. These combinations are made in accordance with the standard triplet genetic code as applied to the nucleotide sequence of naturally occurring PLBP, and all such variations are to be considered as being specifically disclosed.
- nucleotide sequences which encode PLBP and its variants are preferably capable of hybridizing to the nucleotide sequence of the naturally occurring PLBP under appropriately selected conditions of stringency, it may be advantageous to produce nucleotide sequences encoding PLBP or its derivatives possessing a substantially different codon usage. Codons may be selected to increase the rate at which expression of the peptide occurs in a particular prokaryotic or eukaryotic host in accordance with the frequency with which particular codons are utilized by the host.
- RNA transcripts having more desirable properties such as a greater half-life, than transcripts produced from the naturally occurring sequence.
- the invention also encompasses production of DNA sequences, or fragments thereof, which encode PLBP and its derivatives, entirely by synthetic chemistry.
- the synthetic sequence may be inserted into any of the many available expression vectors and cell systems using reagents that are well known in the art.
- synthetic chemistry may be used to introduce mutations into a sequence encoding PLBP or any fragment thereof.
- polynucleotide sequences that are capable of hybridizing to the claimed nucleotide sequences, and in particular, those shown in SEQ ID NO:2, or SEQ ID NO:4, under various conditions of stringency as taught in Wahl, G. M. and S. L. Berger (1987; Methods Enzymol. 152:399-407) and Kimmel, A. R. (1987; Methods Enzymol. 152:507-511).
- Methods for DNA sequencing are well known and generally available in the art and may be used to practice any of the embodiments of the invention.
- the methods may employ such enzymes as the Klenow fragment of DNA polymerase I, SEQUENASE (U.S. Biochemical Corp, Cleveland, Ohio), Taq polymerase (Perkin Elmer), thermostable T7 polymerase (Amersham, Chicago, Ill.), or combinations of polymerases and proofreading exonucleases such as those found in the ELONGASE Amplification System marketed by Gibco/BRL (Gaithersburg, Md.).
- the process is automated with machines such as the Hamilton Micro Lab 2200 (Hamilton, Reno, Nev.), Peltier Thermal Cycler (PTC200; MJ Research, Watertown, Mass.) and the ABI Catalyst and 373 and 377 DNA Sequencers (Perkin Elmer).
- machines such as the Hamilton Micro Lab 2200 (Hamilton, Reno, Nev.), Peltier Thermal Cycler (PTC200; MJ Research, Watertown, Mass.) and the ABI Catalyst and 373 and 377 DNA Sequencers (Perkin Elmer).
- the nucleic acid sequences encoding PLBP may be extended utilizing a partial nucleotide sequence and employing various methods known in the art to detect upstream sequences such as promoters and regulatory elements.
- one method which may be employed, "restriction-site" PCR uses universal primers to retrieve unknown sequence adjacent to a known locus (Sarkar, G. (1993) PCR Methods Applic. 2:318-322).
- genomic DNA is first amplified in the presence of primer to a linker sequence and a primer specific to the known region.
- the amplified sequences are then subjected to a second round of PCR with the same linker primer and another specific primer internal to the first one.
- Products of each round of PCR are transcribed with an appropriate RNA polymerase and sequenced using reverse transcriptase.
- Inverse PCR may also be used to amplify or extend sequences using divergent primers based on a known region (Triglia, T. et al. (1988) Nucleic Acids Res. 16:8186).
- the primers may be designed using commercially available software such as OLIGO 4.06 Primer Analysis software (National Biosciences Inc., Madison, Minn.), or another appropriate program, to be 22-30 nucleotides in length, to have a GC content of 50% or more, and to anneal to the target sequence at temperatures about 68°-72° C.
- the method uses several restriction enzymes to generate a suitable fragment in the known region of a gene. The fragment is then circularized by intramolecular ligation and used as a PCR template.
- capture PCR involves PCR amplification of DNA fragments adjacent to a known sequence in human and yeast artificial chromosome DNA (Lagerstrom, M. et al. (1991) PCR Methods Applic. 1:111-119).
- multiple restriction enzyme digestions and ligations may also be used to place an engineered double-stranded sequence into an unknown fragment of the DNA molecule before performing PCR.
- Another method which may be used to retrieve unknown sequences is that of Parker, J. D. et al. (1991; Nucleic Acids Res. 19:3055-3060). Additionally, one may use PCR, nested primers, and PROMOTERFINDER libraries to walk genomic DNA (Clontech, Palo Alto, Calif.). This process avoids the need to screen libraries and is useful in finding intron/exon junctions.
- libraries that have been size-selected to include larger cDNAs.
- random-primed libraries are preferable, in that they will contain more sequences which contain the 5' regions of genes. Use of a randomly primed library may be especially preferable for situations in which an oligo d(T) library does not yield a full-length cDNA.
- Genomic libraries may be useful for extension of sequence into 5' non-transcribed regulatory regions.
- Capillary electrophoresis systems which are commercially available may be used to analyze the size or confirm the nucleotide sequence of sequencing or PCR products.
- capillary sequencing may employ flowable polymers for electrophoretic separation, four different fluorescent dyes (one for each nucleotide) which are laser activated, and detection of the emitted wavelengths by a charge coupled device camera.
- Output/light intensity may be converted to electrical signal using appropriate software (e.g. GENOTYPER and SEQUENCE NAVIGATOR, Perkin Elmer) and the entire process from loading of samples to computer analysis and electronic data display may be computer controlled.
- Capillary electrophoresis is especially preferable for the sequencing of small pieces of DNA which might be present in limited amounts in a particular sample.
- polynucleotide sequences or fragments thereof which encode PLBP may be used in recombinant DNA molecules to direct expression of PLBP, fragments or functional equivalents thereof, in appropriate host cells. Due to the inherent degeneracy of the genetic code, other DNA sequences which encode substantially the same or a functionally equivalent amino acid sequence may be produced, and these sequences may be used to clone and express PLBP.
- codons preferred by a particular prokaryotic or eukaryotic host can be selected to increase the rate of protein expression or to produce an RNA transcript having desirable properties, such as a half-life which is longer than that of a transcript generated from the naturally occurring sequence.
- nucleotide sequences of the present invention can be engineered using methods generally known in the art in order to alter PLBP encoding sequences for a variety of reasons, including but not limited to, alterations which modify the cloning, processing, and/or expression of the gene product.
- DNA shuffling by random fragmentation and PCR reassembly of gene fragments and synthetic oligonucleotides may be used to engineer the nucleotide sequences.
- site-directed mutagenesis may be used to insert new restriction sites, alter glycosylation patterns, change codon preference, produce splice variants, introduce mutations, and so forth.
- natural, modified, or recombinant nucleic acid sequences encoding PLBP may be ligated to a heterologous sequence to encode a fusion protein.
- a heterologous sequence to encode a fusion protein.
- a fusion protein may also be engineered to contain a cleavage site located between the PLBP encoding sequence and the heterologous protein sequence, so that PLBP may be cleaved and purified away from the heterologous moiety.
- sequences encoding PLBP may be synthesized, in whole or in part, using chemical methods well known in the art (see Caruthers, M. H. et al. (1980) Nucl. Acids Res. Symp. Ser. 215-223, Horn, T. et al. (1980) Nucl. Acids Res. Symp. Ser. 225-232).
- the protein itself may be produced using chemical methods to synthesize the amino acid sequence of PLBP, or a fragment thereof.
- peptide synthesis can be performed using various solid-phase techniques (Roberge, J. Y. et al. (1995) Science 269:202-204) and automated synthesis may be achieved, for example, using the ABI 431A Peptide Synthesizer (Perkin Elmer).
- the newly synthesized peptide may be substantially purified by preparative high performance liquid chromatography (e.g., Creighton, T. (1983) Proteins, Structures and Molecular Principles, WH Freeman and Co., New York, N.Y.).
- the composition of the synthetic peptides may be confirmed by amino acid analysis or sequencing (e.g., the Edman degradation procedure; Creighton, supra).
- the amino acid sequence of PLBP, or any part thereof may be altered during direct synthesis and/or combined using chemical methods with sequences from other proteins, or any part thereof, to produce a variant polypeptide.
- nucleotide sequences encoding PLBP or functional equivalents may be inserted into appropriate expression vector, i.e., a vector which contains the necessary elements for the transcription and translation of the inserted coding sequence.
- a variety of expression vector/host systems may be utilized to contain and express sequences encoding PLBP. These include, but are not limited to, microorganisms such as bacteria transformed with recombinant bacteriophage, plasmid, or cosmid DNA expression vectors; yeast transformed with yeast expression vectors; insect cell systems infected with virus expression vectors (e.g., baculovirus); plant cell systems transformed with virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or with bacterial expression vectors (e.g., Ti or pBR322 plasmids); or animal cell systems.
- the invention is not limited by the host cell employed.
- control elements are those non-translated regions of the vector--enhancers, promoters, 5' and 3' untranslated regions--which interact with host cellular proteins to carry out transcription and translation. Such elements may vary in their strength and specificity. Depending on the vector system and host utilized, any number of suitable transcription and translation elements, including constitutive and inducible promoters, may be used. For example, when cloning in bacterial systems, inducible promoters such as the hybrid lacZ promoter of the BLUESCRIPT phagemid (Stratagene, LaJolla, Calif.) or PSPORT1 plasmid (Gibco BRL) and the like may be used.
- inducible promoters such as the hybrid lacZ promoter of the BLUESCRIPT phagemid (Stratagene, LaJolla, Calif.) or PSPORT1 plasmid (Gibco BRL) and the like may be used.
- the baculovirus polyhedrin promoter may be used in insect cells. Promoters or enhancers derived from the genomes of plant cells (e.g., heat shock, RUBISCO; and storage protein genes) or from plant viruses (e.g., viral promoters or leader sequences) may be cloned into the vector. In mammalian cell systems, promoters from mammalian genes or from mammalian viruses are preferable. If it is necessary to generate a cell line that contains multiple copies of the sequence encoding PLBP, vectors based on SV40 or EBV may be used with an appropriate selectable marker.
- Promoters or enhancers derived from the genomes of plant cells e.g., heat shock, RUBISCO; and storage protein genes
- plant viruses e.g., viral promoters or leader sequences
- a number of expression vectors may be selected depending upon the use intended for PLBP.
- vectors which direct high level expression of fusion proteins that are readily purified may be used.
- Such vectors include, but are not limited to, the multifunctional E. coli cloning and expression vectors such as BLUESCRIPT (Stratagene), in which the sequence encoding PLBP may be ligated into the vector in frame with sequences for the amino-terminal Met and the subsequent 7 residues of ⁇ -galactosidase so that a hybrid protein is produced; pIN vectors (Van Heeke, G. and S. M. Schuster (1989) J. Biol. Chem.
- pGEX vectors may also be used to express foreign polypeptides as fusion proteins with glutathione S-transferase (GST).
- GST glutathione S-transferase
- fusion proteins are soluble and can easily be purified from lysed cells by adsorption to glutathione-agarose beads followed by elution in the presence of free glutathione.
- Proteins made in such systems may be designed to include heparin, thrombin, or factor XA protease cleavage sites so that the cloned polypeptide of interest can be released from the GST moiety at will.
- yeast Saccharomvces cerevisiae
- a number of vectors containing constitutive or inducible promoters such as alpha factor, alcohol oxidase, and PGH may be used.
- constitutive or inducible promoters such as alpha factor, alcohol oxidase, and PGH
- sequences encoding PLBP may be driven by any of a number of promoters.
- viral promoters such as the 35S and 19S promoters of CaMV may be used alone or in combination with the omega leader sequence from TMV (Takamatsu, N. (1987) EMBO J. 3:1271-1680; Broglie, R. et al. (1984) Science 224:838-843; and Winter, J. et al. (1 991) Results Probl. Cell Differ.
- constructs can be introduced into plant cells by direct DNA transformation or pathogen-mediated transfection.
- pathogen-mediated transfection Such techniques are described in a number of generally available reviews (see, for example, Hobbs, S. or Murry, L. E. in McGraw Hill Yearbook of Science and Technology (1992) McGraw Hill, New York, N.Y.; pp. 191-196).
- An insect system may also be used to express PLBP.
- Autographa californica nuclear polyhedrosis virus (AcNPV) is used as a vector to express foreign genes in Spodoptera frugiperda cells or in Trichoplusia larvae.
- the sequences encoding PLBP may be cloned into a non-essential region of the virus, such as the polyhedrin gene, and placed under control of the polyhedrin promoter.
- Successful insertion of PLBP will render the polyhedrin gene inactive and produce recombinant virus lacking coat protein.
- the recombinant viruses may then be used to infect, for example, S. frugiperda cells or Trichoplusia larvae in which PLBP may be expressed (Engelhard, E. K. et al. (1 994) Proc. Nat. Acad. Sci. 91:3224-3227).
- a number of viral-based expression systems may be utilized.
- sequences encoding PLBP may be ligated into an adenovirus transcription/translation complex consisting of the late promoter and tripartite leader sequence. Insertion in a non-essential E1 or E3 region of the viral genome may be used to obtain a viable virus which is capable of expressing PLBP in infected host cells (Logan, J. and Shenk, T. (1984) Proc. Natl. Acad. Sci. 81:3655-3659).
- transcription enhancers such as the Rous sarcoma virus (RSV) enhancer, may be used to increase expression in mammalian host cells.
- RSV Rous sarcoma virus
- HACs Human artificial chromosomes
- HACs may also be employed to deliver larger fragments of DNA than can be contained and expressed in a plasmid.
- HACs of 6 to 10M are constructed and delivered via conventional delivery methods (liposomes, polycationic amino polymers, or vesicles) for therapeutic purposes.
- Specific initiation signals may also be used to achieve more efficient translation of sequences encoding PLBP. Such signals include the ATG initiation codon and adjacent sequences. In cases where sequences encoding PLBP, its initiation codon, and upstream sequences are inserted into the appropriate expression vector, no additional transcriptional or translational control signals may be needed. However, in cases where only coding sequence, or a fragment thereof, is inserted, exogenous translational control signals including the ATG initiation codon should be provided. Furthermore, the initiation codon should be in the correct reading frame to ensure translation of the entire insert. Exogenous translational elements and initiation codons may be of various origins, both natural and synthetic. The efficiency of expression may be enhanced by the inclusion of enhancers which are appropriate for the particular cell system which is used, such as those described in the literature (Scharf, D. et al. (1994) Results Probl. Cell Differ. 20:125-162).
- a host cell strain may be chosen for its ability to modulate the expression of the inserted sequences or to process the expressed protein in the desired fashion.
- modifications of the polypeptide include, but are not limited to, acetylation, carboxylation, glycosylation, phosphorylation, lipidation, and acylation.
- Post-translational processing which cleaves a "prepro" form of the protein may also be used to facilitate correct insertion, folding and/or function.
- Different host cells which have specific cellular machinery and characteristic mechanisms for post-translational activities (e.g., CHO, HeLa, MDCK, HEK293, and WI38), are available from the American Type Culture Collection (ATCC; 10801 University Boulevard, Manassas Va. 20110-2209) and may be chosen to ensure the correct modification and processing of the foreign protein.
- ATCC American Type Culture Collection
- cell lines which stably express PLBP may be transformed using expression vectors which may contain viral origins of replication and/or endogenous expression elements and a selectable marker gene on the same or on a separate vector. Following the introduction of the vector, cells may be allowed to grow for 1-2 days in an enriched media before they are switched to selective media.
- the purpose of the selectable marker is to confer resistance to selection, and its presence allows growth and recovery of cells which successfully express the introduced sequences.
- Resistant clones of stably transformed cells may be proliferated using tissue culture techniques appropriate to the cell type.
- any number of selection systems may be used to recover transformed cell lines. These include, but are not limited to, the herpes simplex virus thymidine kinase (Wigler, M. et al. (1977) Cell 11:223-32) and adenine phosphoribosyltransferase (Lowy, I. et al. (1980) Cell 22:817-23) genes which can be employed in tk - or aprt - cells, respectively. Also, antimetabolite, antibiotic or herbicide resistance can be used as the basis for selection; for example, dhfr which confers resistance to methotrexate (Wigler, M. et al. (1980) Proc. Natl. Acad. Sci.
- npt which confers resistance to the aminoglycosides, neomycin and G-418 (Colbere-Garapin, F. et al (1981) J. Mol. Biol. 150:1-14); and als or pat, which confer resistance to chlorsulfuron and phosphinotricin acetyltransferase, respectively (Murry, supra). Additional selectable genes have been described, for example, trpB, which allows cells to utilize indole in place of tryptophan, or hisD, which allows cells to utilize histinol in place of histidine (Hartman, S. C. and R. C. Mulligan (1988) Proc. Natl. Acad. Sci.
- marker gene expression suggests that the gene of interest is also present, its presence and expression may need to be confirmed.
- sequence encoding PLBP is inserted within a marker gene sequence
- transformed cells containing sequences encoding PLBP can be identified by the absence of marker gene function.
- a marker gene can be placed in tandem with a sequence encoding PLBP under the control of a single promoter. Expression of the marker gene in response to induction or selection usually indicates expression of the tandem gene as well.
- host cells which contain the nucleic acid sequence encoding PLBP and express PLBP may be identified by a variety of procedures known to those of skill in the art. These procedures include, but are not limited to, DNA-DNA or DNA-RNA hybridizations and protein bioassay or immunoassay techniques which include membrane, solution, or chip based technologies for the detection and/or quantification of nucleic acid or protein.
- polynucleotide sequences encoding PLBP can be detected by DNA--DNA or DNA-RNA hybridization or amplification using probes or fragments or fragments of polynucleotides encoding PLBP.
- Nucleic acid amplification based assays involve the use of oligonucleotides or oligomers based on the sequences encoding PLBP to detect transformants containing DNA or RNA encoding PLBP.
- a variety of protocols for detecting and measuring the expression of PLBP, using either polyclonal or monoclonal antibodies specific for the protein are known in the art. Examples include enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), and fluorescence activated cell sorting (FACS).
- ELISA enzyme-linked immunosorbent assay
- RIA radioimmunoassay
- FACS fluorescence activated cell sorting
- a two-site, monoclonal-based immunoassay utilizing monoclonal antibodies reactive to two non-interfering epitopes on PLBP is preferred, but a competitive binding assay may be employed. These and other assays are described, among other places, in Hampton, R. et al. (1990; Serological Methods, a Laboratory Manual, APS Press, St Paul, Minn.) and Maddox, D. E. et al. (1983; J. Exp. Med. 158:1211-1216).
- Means for producing labeled hybridization or PCR probes for detecting sequences related to polynucleotides encoding PLBP include oligolabeling, nick translation, end-labeling or PCR amplification using a labeled nucleotide.
- sequences encoding PLBP, or any fragments thereof may be cloned into a vector for the production of an mRNA probe.
- RNA polymerase such as T7, T3, or SP6 and labeled nucleotides.
- T7, T3, or SP6 RNA polymerase
- Suitable reporter molecules or labels include radionuclides, enzymes, fluorescent, chemiluminescent, or chromogenic agents as well as substrates, cofactors, inhibitors, magnetic particles, and the like.
- Host cells transformed with nucleotide sequences encoding PLBP may be cultured under conditions suitable for the expression and recovery of the protein from cell culture.
- the protein produced by a transformed cell may be secreted or contained intracellularly depending on the sequence and/or the vector used.
- expression vectors containing polynucleotides which encode PLBP may be designed to contain signal sequences which direct secretion of PLBP through a prokaryotic or eukaryotic cell membrane.
- Other constructions may be used to join sequences encoding PLBP to nucleotide sequence encoding a polypeptide domain which will facilitate purification of soluble proteins.
- Such purification facilitating domains include, but are not limited to, metal chelating peptides such as histidine-tryptophan modules that allow purification on immobilized metals, protein A domains that allow purification on immobilized immunoglobulin, and the domain utilized in the FLAGS extension/affinity purification system (Immunex Corp., Seattle, Wash.).
- metal chelating peptides such as histidine-tryptophan modules that allow purification on immobilized metals
- protein A domains that allow purification on immobilized immunoglobulin
- FLAGS extension/affinity purification system Immunex Corp., Seattle, Wash.
- cleavable linker sequences such as those specific for Factor XA or enterokinase (Invitrogen, San Diego, Calif.) between the purification domain and PLBP may be used to facilitate purification.
- One such expression vector provides for expression of a fusion protein containing PLBP and a nucleic acid encoding 6 histidine residues preceding a thioredoxin or an enterokinase cleavage site.
- the histidine residues facilitate purification on IMAC (immobilized metal ion affinity chromatography) as described in Porath, J. et al. (1992, Prot. Exp. Purif. 3: 263-281) while the enterokinase cleavage site provides a means for purifying PLBP from the fusion protein.
- IMAC immobilized metal ion affinity chromatography
- fragments of PLBP may be produced by direct peptide synthesis using solid-phase techniques (Merrifield J. (1963) J. Am. Chem. Soc. 85:2149-2154). Protein synthesis may be performed using manual techniques or by automation. Automated synthesis may be achieved, for example, using Applied Biosystems 431A Peptide Synthesizer (Perkin Elmer). Various fragments of PLBP may be chemically synthesized separately and combined using chemical methods to produce the full length molecule.
- PLBP1 Chemical and structural homology exists between PLBP1 and bovine PC-TP (GI 897693).
- PLBP1 is expressed in lung, gastrointestinal, breast, and prostate tissues; and in fetal, hematopoietic, and tumor tissues. Therefore, PLBP1 appears to play a role in disorders associated with fetal development, reproduction, cell proliferation, and the immune response.
- PLBP2 Onchocerca PE-BP (GI 1143527) and human PE-BP (GI 406290).
- PLBP2 is expressed in lung, prostate, and heart tissues; and in fetal and tumor tissues. Therefore, PLBP2 appears to play a role in disorders associated with fetal development, reproduction, cell proliferation, and the immune response.
- PLBP or a fragment or derivative thereof may be administered to a subject to treat or prevent a disorder associated with fetal development.
- disorder associated with fetal development refers to any disorder associated with development or function of a tissue, organ, or system of a subject (such as the brain, adrenal gland, kidney, skeletal or reproductive system).
- Such disorders include, but are not limited to, renal tubular acidosis, anemia, Cushing's syndrome, achondroplastic dwarfism, Duchenne and Becker muscular dystrophy, epilepsy, gonadal dysgenesis, WAGR syndrome, myelodysplastic syndrome, hereditary mucoepithelial dysplasia, hereditary keratodermas, hereditary neuropathies such as Charcot-Marie-Tooth disease and neurofibromatosis, hypothyroidism, hydrocephalus, seizure disorders such as Syndenham's chorea and cerebral palsy, spinal bifida, congenital glaucoma, cataract, and sensorineural hearing loss.
- renal tubular acidosis anemia
- Cushing's syndrome achondroplastic dwarfism
- Duchenne and Becker muscular dystrophy epilepsy
- gonadal dysgenesis WAGR syndrome
- myelodysplastic syndrome hereditary mucoepithelial dysplasia
- a vector capable of expressing PLBP, or a fragment or a derivative thereof may also be administered to a subject to treat or prevent a disorder of fetal development including, but not limited to, those described above.
- an agonist which modulates the activity of PLBP may also be administered to a subject to treat or prevent a disorder of fetal development including, but not limited to, those described above.
- PLBP or a fragment or derivative thereof may be administered to a subject to treat or prevent a disorder associated with reproduction.
- disorders of prolactin production include, but are not limited to, disorders of prolactin production; infertility, including tubal disease, ovulatory defects, and endometriosis; disruptions of the estrous cycle, disruptions of the menstrual cycle, polycystic ovary syndrome, ovarian hyperstimulation syndrome, endometrial and ovarian tumors, autoimmune disorders, ectopic pregnancy, and teratogenesis; cancer of the breast, fibrocystic breast disease, and galactorrhea; disruptions of spermatogenesis, abnormal sperm physiology, cancer of the testis, cancer of the prostate, benign prostatic hyperplasia, and prostatitis; and carcinoma of the male breast and gynecomastia.
- a vector capable of expressing PLBP, or a fragment or a derivative thereof may also be administered to a subject to treat or prevent a disorder of reproduction including, but not limited to, those described above.
- an agonist which modulates the activity of PLBP may also be administered to a subject to treat or prevent disorders of reproduction including, but not limited to, those described above.
- an antagonist of PLBP may be administered to a subject to prevent or treat a disorders associated with cell proliferation.
- Such disorders may include, but are not limited to, cancers including adenocarcinoma, leukemia, lymphoma, melanoma, myeloma, sarcoma, and teratocarcinoma, and particularly cancers of the adrenal gland, bladder, bone, bone marrow, brain, breast, cervix, gall bladder, ganglia, gastrointestinal tract, heart, kidney, liver, lung, muscle, ovary, pancreas, paratbyroid, penis, prostate, salivary glands, skin, spleen, testis, thymus, thyroid, and uterus.
- an antibody which specifically binds PLBP may be used directly as an antagonist or indirectly as a targeting or delivery mechanism for bringing a pharmaceutical agent to cells or tissue which express PLBP.
- a vector expressing the complement of the polynucleotide encoding PLBP may be administered to a subject to treat or prevent a disorder associated with cell proliferation including, but not limited to, those described above.
- an antagonist of PLBP may be administered to a subject to prevent or treat a disorder associated with the immune response.
- disorders may include, but are not limited to, AIDS, Addison's disease, adult respiratory distress syndrome, allergies, anemia, asthma, arteriosclerosis, atherosclerosis, bronchitis, bursitis, cholecystitis, cirrhosis, Crohn's disease, ulcerative colitis, atopic dermatitis, dermatomyositis, diabetes mellitus, emphysema, erythema nodosum, atrophic gastritis, glomerulonephritis, gout, Graves' disease, hypereosinophilia, irritable bowel syndrome, lupus erythematosus, mixed connective tissue disease, multiple sclerosis, myasthenia gravis, myelofibrosis, myocardial or pericardial inflammation, osteoarthritis, osteoporos
- a vector expressing the complement of the polynucleotide encoding PLBP may be administered to a subject to treat or prevent a disorders associated with the immune response including, but not limited to, those described above.
- any of the proteins, antagonists, antibodies, agonists, complementary sequences or vectors of the invention may be administered in combination with other appropriate therapeutic agents. Selection of the appropriate agents for use in combination therapy may be made by one of ordinary skill in the art, according to conventional pharmaceutical principles.
- the combination of therapeutic agents may act synergistically to effect the treatment or prevention of the various disorders described above. Using this approach, one may be able to achieve therapeutic efficacy with lower dosages of each agent, thus reducing the potential for adverse side effects.
- An antagonist of PLBP may be produced using methods which are generally known in the art.
- purified PLBP may be used to produce antibodies or to screen libraries of pharmaceutical agents to identify those which specifically bind PLBP.
- Antibodies to PLBP may be generated using methods that are well known in the art. Such antibodies may include, but are not limited to, polyclonal, monoclonal, chimeric, single chain, Fab fragments, and fragments produced by a Fab expression library. Neutralizing antibodies, (i.e., those which inhibit dimer formation) are especially preferred for therapeutic use.
- various hosts including goats, rabbits, rats, mice, humans, and others, may be immunized by injection with PLBP or any fragment or oligopeptide thereof which has immunogenic properties.
- various adjuvants may be used to increase immunological response.
- adjuvants include, but are not limited to, Freund's, mineral gels such as aluminum hydroxide, and surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides; oil emulsions, keyhole limpet hemocyanin, and dinitrophenol.
- BCG Bacilli Calmette-Guerin
- Corynebacterium parvum are especially preferable.
- the oligopeptides, peptides, or fragments used to induce antibodies to PLBP have an amino acid sequence consisting of at least five amino acids and more preferably at least 10 amino acids. It is also preferable that they are identical to a portion of the amino acid sequence of the natural protein, and they may contain the entire amino acid sequence of a small, naturally occurring molecule. Short stretches of PLBP amino acids may be fused with those of another protein such as keyhole limpet hemocyanin and antibody produced against the chimeric molecule.
- Monoclonal antibodies to PLBP may be prepared using any technique which provides for the production of antibody molecules by continuous cell lines in culture. These include, but are not limited to, the hybridoma technique, the human B-cell hybridoma technique, and the EBV-hybridoma technique (Kohler, G. et al. (1975) Nature 256:495-497; Kozbor, D. et al. (1985) J. Immunol. Methods 81:31-42; Cote, R. J. et al. (1983) Proc. Natl. Acad. Sci. 80:2026-2030; Cole, S. P. et al. (1984) Mol. Cell Biol. 62:109-120).
- chimeric antibodies the splicing of mouse antibody genes to human antibody genes to obtain a molecule with appropriate antigen specificity and biological activity can be used (Morrison, S. L. et al. (1984) Proc. Natl. Acad. Sci. 81:6851-6855; Neuberger, M. S. et al. (1984) Nature 312:604-608; Takeda, S. et al. (1985) Nature 314:452-454).
- techniques described for the production of single chain antibodies may be adapted, using methods known in the art, to produce PLBP-specific single chain antibodies.
- Antibodies with related specificity, but of distinct idiotypic composition may be generated by chain shuffling from random combinatorial immunoglobulin libraries (Burton D. R. (1991) Proc. Natl. Acad. Sci. 88:11120-3).
- Antibodies may also be produced by inducing, in vivo production in the lymphocyte population or by screening immunoglobulin libraries or panels of highly specific binding reagents as disclosed in the literature (Orlandi, R. et al. (1989) Proc. Natl. Acad. Sci. 86: 3833-3837; Winter, G. et al. (1991) Nature 349:293-299).
- Antibody fragments which contain specific binding sites for PLBP may also be generated.
- such fragments include, but are not limited to, the F(ab')2 fragments which can be produced by pepsin digestion of the antibody molecule and the Fab fragments which can be generated by reducing the disulfide bridges of the F(ab')2 fragments.
- Fab expression libraries may be constructed to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity (Huse, W. D. et al. (1989) Science 254:1275-1281).
- immunoassays may be used for screening to identify antibodies having the desired specificity.
- Numerous protocols for competitive binding or immunoradiometric assays using either polyclonal or monoclonal antibodies with established specificities are well known in the art.
- Such immunoassays typically involve the measurement of complex formation between PLBP and its specific antibody.
- a two-site, monoclonal-based immunoassay utilizing monoclonal antibodies reactive to two non-interfering PLBP epitopes is preferred, but a competitive binding assay may also be employed (Maddox, supra).
- the polynucleotides encoding PLBP may be used for therapeutic purposes.
- the complement of the polynucleotide encoding PLBP may be used in situations in which it would be desirable to block the transcription of the mRNA.
- cells may be transformed with sequences complementary to polynucleotides encoding PLBP.
- complementary molecules or fragments may be used to modulate PLBP activity, or to achieve regulation of gene function.
- sense or antisense oligonucleotides or larger fragments can be designed from various locations along the coding or control regions of sequences encoding PLBP.
- Expression vectors derived from retroviruses, adenovirus, herpes or vaccinia viruses, or from various bacterial plasmids may be used for delivery of nucleotide sequences to the targeted organ, tissue or cell population. Methods which are well known to those skilled in the art can be used to construct vectors which will express nucleic acid sequence which is complementary to the polynucleotides of the gene encoding PLBP. These techniques are described both in Sambrook et al. (supra) and in Ausubel et al. (supra).
- Genes encoding PLBP can be turned off by transforming a cell or tissue with expression vectors which express high levels of a polynucleotide or fragment thereof which encodes PLBP. Such constructs may be used to introduce untranslatable sense or antisense sequences into a cell. Even in the absence of integration into the DNA, such vectors may continue to transcribe RNA molecules until they are disabled by endogenous nucleases. Transient expression may last for a month or more with a non-replicating vector and even longer if appropriate replication elements are part of the vector system.
- modifications of gene expression can be obtained by designing complementary sequences or antisense molecules (DNA, RNA, or PNA) to the control, 5' or regulatory regions of the gene encoding PLBP (signal sequence, promoters, enhancers, and introns). Oligonucleotides derived from the transcription initiation site, e.g., between positions -10 and +10 from the start site, are preferred. Similarly, inhibition can be achieved using "triple helix" base-pairing methodology. Triple helix pairing is useful because it causes inhibition of the ability of the double helix to open sufficiently for the binding of polymcrases, transcription factors, or regulatory molecules. Recent therapeutic advances using triplex DNA have been described in the literature (Gee, J. E. et al.
- the complementary sequence or antisense molecule may also be designed to block translation of mRNA by preventing the transcript from binding to ribosomes.
- Ribozymes enzymatic RNA molecules
- Ribozymes may also be used to catalyze the specific cleavage of RNA.
- the mechanism of ribozyme action involves sequence-specific hybridization of the ribozyme molecule to complementary target RNA, followed by endonucleolytic cleavage. Examples which may be used include engineered hammerhead motif ribozyme molecules that can specifically and efficiently catalyze endonucleolytic cleavage of sequences encoding PLBP.
- ribozyme cleavage sites within any potential RNA target are initially identified by scanning the target molecule for ribozyme cleavage sites which include the following sequences: GUA, GUU, and GUC. Once identified, short RNA sequences of between 15 and 20 ribonucleotides corresponding to the region of the target gene containing to the cleavage site may be evaluated for secondary structural features which may render the oligonucleotide inoperable. The suitability of candidate targets may also be evaluated by testing accessibility to hybridization with complementary oligonucleotides using ribonuclease protection assays.
- RNA molecules and ribozymes of the invention may be prepared by any method known in the art for the synthesis of nucleic acid molecules. These include techniques for chemically synthesizing oligonucleotides such as solid phase phosphoramidite chemical synthesis. Alternatively, RNA molecules may be generated by in vitro and in vivo transcription of DNA sequences encoding PLBP. Such DNA sequences may be incorporated into a wide variety of vectors with suitable RNA polymerase promoters such as T7 or SP6. Alternatively, these cDNA constructs that synthesize complementary RNA constitutively or inducibly can be introduced into cell lines, cells, or tissues.
- RNA molecules may be modified to increase intracellular stability and half-life. Possible modifications include, but are not limited to, the addition of flanking sequences at the 5' and/or 3' ends of the molecule or the use of phosphorothioate or 2' O-methyl rather than phosphodiesterase linkages within the backbone of the molecule.
- vectors may be introduced into stem cells taken from the patient and clonally propagated for autologous transplant back into that same patient. Delivery by transfection, by liposome injections or polycationic amino polymers (Goldman, C. K. et al. (1997) Nature Biotechnology 15:462-66; incorporated herein by reference) may be achieved using methods which are well known in the art.
- any of the therapeutic methods described above may be applied to any subject in need of such therapy, including, for example, mammals such as dogs, cats, cows, horses, rabbits, monkeys, and most preferably, humans.
- compositions may consist of PLBP, antibodies to PLBP, mimetics, agonists, antagonists, or inhibitors of PLBP.
- the compositions may be administered alone or in combination with at least one other agent, such as stabilizing compound, which may be administered in any sterile, biocompatible pharmaceutical carrier, including, but not limited to, saline, buffered saline, dextrose, and water.
- the compositions may be administered to a patient alone, or in combination with other agents, drugs or hormones.
- compositions utilized in this invention may be administered by any number of routes including, but not limited to, oral, intravenous, intramuscular, intra-arterial, intramedullary, intrathecal, intraventricular, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual, or rectal means.
- these pharmaceutical compositions may contain suitable pharmaceutically-acceptable carriers comprising excipients and auxiliaries which facilitate processing of the active compounds into preparations which can be used pharmaceutically. Further details on techniques for formulation and administration may be found in the latest edition of Remington's Pharmaceutical Sciences (Maack Publishing Co., Easton, Pa.).
- compositions for oral administration can be formulated using pharmaceutically acceptable carriers well known in the art in dosages suitable for oral administration.
- Such carriers enable the pharmaceutical compositions to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for ingestion by the patient.
- compositions for oral use can be obtained through combination of active compounds with solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores.
- Suitable excipients are carbohydrate or protein fillers, such as sugars, including lactose, sucrose, mannitol, or sorbitol; starch from corn, wheat, rice, potato, or other plants; cellulose, such as methyl cellulose, hydroxypropylmethyl-cellulose, or sodium carboxymethylcellulose; gums including arabic and tragacanth; and proteins such as gelatin and collagen.
- disintegrating or solubilizing agents may be added, such as the cross-linked polyvinyl pyrrolidone, agar, alginic acid, or a salt thereof, such as sodium alginate.
- Dragee cores may be used in conjunction with suitable coatings, such as concentrated sugar solutions, which may also contain gum arabic, talc, polyvinylpyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures.
- suitable coatings such as concentrated sugar solutions, which may also contain gum arabic, talc, polyvinylpyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures.
- Dyestuffs or pigments may be added to the tablets or dragee coatings for product identification or to characterize the quantity of active compound, i.e., dosage.
- compositions which can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a coating, such as glycerol or sorbitol.
- Push-fit capsules can contain active ingredients mixed with a filler or binders, such as lactose or starches, lubricants, such as talc or magnesium stearate, and, optionally, stabilizers.
- the active compounds may be dissolved or suspended in suitable liquids, such as fatty oils, liquid, or liquid polyethylene glycol with or without stabilizers.
- compositions suitable for parenteral administration may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hanks' solution, Ringer's solution, or physiologically buffered saline.
- Aqueous injection suspensions may contain substances which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran.
- suspensions of the active compounds may be prepared as appropriate oily injection suspensions.
- Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes.
- Non-lipid polycationic amino polymers may also be used for delivery.
- the suspension may also contain suitable stabilizers or agents which increase the solubility of the compounds to allow for the preparation of highly concentrated solutions.
- penetrants appropriate to the particular barrier to be permeated are used in the formulation.
- penetrants are generally known in the art.
- compositions of the present invention may be manufactured in a manner that is known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping, or lyophilizing processes.
- the pharmaceutical composition may be provided as a salt and can be formed with many acids, including but not limited to, hydrochloric, sulfuric, acetic, lactic, tartaric, malic, succinic, etc. Salts tend to be more soluble in aqueous or other protonic solvents than are the corresponding free base forms.
- the preferred preparation may be a lyophilized powder which may contain any or all of the following: 1-50 mM histidine, 0.1%-2% sucrose, and 2-7% mannitol, at a pH range of 4.5 to 5.5, that is combined with buffer prior to use.
- compositions After pharmaceutical compositions have been prepared, they can be placed in an appropriate container and labeled for treatment of an indicated condition.
- labeling would include amount, frequency, and method of administration.
- compositions suitable for use in the invention include compositions wherein the active ingredients are contained in an effective amount to achieve the intended purpose.
- the determination of an effective dose is well within the capability of those skilled in the art.
- the therapeutically effective dose can be estimated initially either in cell culture assays, e.g., of neoplastic cells, or in animal models, usually mice, rabbits, dogs, or pigs.
- the animal model may also be used to determine the appropriate concentration range and route of administration. Such information can then be used to determine useful doses and routes for administration in humans.
- a therapeutically effective dose refers to that amount of active ingredient, for example PLBP or fragments thereof, antibodies of PLBP, agonists, antagonists or inhibitors of PLBP, which ameliorates the symptoms or condition.
- Therapeutic efficacy and toxicity may be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., ED50 (the dose therapeutically effective in 50% of the population) and LD50 (the dose lethal to 50% of the population).
- the dose ratio of toxic to therapeutic effects is the therapeutic index, and it can be expressed as the ratio, LD50/ED50.
- Pharmaceutical compositions which exhibit large therapeutic indices are preferred.
- the data obtained from cell culture assays and animal studies is used in formulating a range of dosage for human use.
- the dosage contained in such compositions is preferably within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage varies within this range depending upon the dosage form employed, sensitivity of the patient, and the route of administration.
- the exact dosage will be determined by the practitioner, in light of factors related to the subject that requires treatment. Dosage and administration are adjusted to provide sufficient levels of the active moiety or to maintain the desired effect. Factors which may be taken into account include the severity of the disease state, general health of the subject, age, weight, and gender of the subject, diet, time and frequency of administration, drug combination(s), reaction sensitivities, and tolerance/response to therapy. Long-acting pharmaceutical compositions may be administered every 3 to 4 days, every week, or once every two weeks depending on half-life and clearance rate of the particular formulation.
- Normal dosage amounts may vary from 0.1 to 100,000 micrograms, up to a total dose of about 1 g, depending upon the route of administration.
- Guidance as to particular dosages and methods of delivery is provided in the literature and generally available to practitioners in the art. Those skilled in the art will employ different formulations for nucleotides than for proteins or their inhibitors. Similarly, delivery of polynucleotides or polypeptides will be specific to particular cells, conditions, locations, etc.
- antibodies which specifically bind PLBP may be used for the diagnosis of conditions or diseases characterized by expression of PLBP, or in assays to monitor patients being treated with PLBP, agonists, antagonists or inhibitors.
- the antibodies useful for diagnostic purposes may be prepared in the same manner as those described above for therapeutics. Diagnostic assays for PLBP include methods which utilize the antibody and a label to detect PLBP in human body fluids or extracts of cells or tissues.
- the antibodies may be used with or without modification, and may be labeled by joining them, either covalently or non-covalently, with a reporter molecule.
- a wide variety of reporter molecules which are known in the art may be used, several of which are described above.
- a variety of protocols including ELISA, RIA, and FACS for measuring PLBP are known in the art and provide a basis for diagnosing altered or abnormal levels of PLBP expression.
- Normal or standard values for PLBP expression are established by combining body fluids or cell extracts taken from normal mammalian subjects, preferably human, with antibody to PLBP under conditions suitable for complex formation. The amount of standard complex formation may be quantified by various methods, but preferably by photometri, means. Quantities of PLBP expressed in subject samples, control and disease, from biopsied tissues are compared with the standard values. Deviation between standard and subject values establishes the parameters for diagnosing disease.
- the polynucleotides encoding PLBP may be used for diagnostic purposes.
- the polynucleotides which may be used include oligonucleotide sequences, complementary RNA and DNA molecules, and PNAs.
- the polynucleotides may be used to detect and quantitate gene expression in biopsied tissues in which expression of PLBP may be correlated with disease.
- the diagnostic assay may be used to distinguish between absence, presence, and excess expression of PLBP, and to monitor regulation of PLBP levels during therapeutic intervention.
- hybridization with PCR probes which are capable of detecting polynucleotide sequences, including genomic sequences, encoding PLBP or closely related molecules, may be used to identify nucleic acid sequences which encode PLBP.
- the specificity of the probe whether it is made from a highly specific region, e.g., 10 unique nucleotides in the 5' regulatory region, or a less specific region, e.g., especially in the 3' coding region, and the stringency of the hybridization or amplification (maximal, high, intermediate, or low) will determine whether the probe identifies only naturally occurring sequences encoding PLBP, alleles, or related sequences.
- Probes may also be used for the detection of related sequences, and should preferably contain at least 50% of the nucleotides from any of the PLBP encoding sequences.
- the hybridization probes of the subject invention may be DNA or RNA and derived from the nucleotide sequence of SEQ ID NO:2 or SEQ ID NO:4 or from genomic sequence including promoter, enhancer elements, and introns of the naturally occurring PLBP.
- Means for producing specific hybridization probes for DNAs encoding PLBP include the cloning of nucleic acid sequences encoding PLBP or PLBP derivatives into vectors for the production of mRNA probes.
- Such vectors are known in the art, commercially available, and may be used to synthesize RNA probes in vitro by means of the addition of the appropriate RNA polymerases and the appropriate labeled nucleotides.
- Hybridization probes may be labeled by a variety of reporter groups, for example, radionuclides such as 32P or 35S, or enzymatic labels, such as alkaline phosphatase coupled to the probe via avidin/biotin coupling systems, and the like.
- Polynucleotide sequences encoding PLBP may be used for the diagnosis of conditions or disorders which are associated with expression of PLBP.
- conditions or disorders include a disorder associated with fetal development such as renal tubular acidosis, anemia, Cushing's syndrome, achondroplastic dwarfism, Duchenne and Becker muscular dystrophy, epilepsy, gonadal dysgenesis, WAGR syndrome, myelodysplastic syndrome, hereditary mucoepithelial dysplasia, hereditary keratodermas, hereditary neuropathies such as Charcot-Marie-Tooth disease and neurofibromatosis, hypothyroidism, hydrocephalus, seizure disorders such as Syndenham's chorea and cerebral palsy, spinal bifida, congenital glaucoma, cataract, and sensorineural hearing loss; with reproduction such as disorders of prolactin production; infertility, including tubal disease, ovulatory defects, and endometriosis; disruptions of
- polynucleotide sequences encoding PLBP may be used in Southern or northern analysis, dot blot, or other membrane-based technologies; in PCR technologies; or in dipstick, pin, ELISA assays or microarrays utilizing fluids or tissues from patient biopsies to detect altered PLBP expression. Such qualitative or quantitative methods are well known in the art.
- the nucleotide sequences encoding PLBP may be useful in assays that detect activation or induction of various cancers, particularly those mentioned above.
- the nucleotide sequences encoding PLBP may be labeled by standard methods, and added to a fluid or tissue sample from a patient under conditions suitable for the formation of hybridization complexes. After a suitable incubation period, the sample is washed and the signal is quantitated and compared with a standard value.
- nucleotide sequences have hybridized with nucleotide sequences in the sample, and the presence of altered levels of nucleotide sequences encoding PLBP in the sample indicates the presence of the associated disease.
- assays may also be used to evaluate the efficacy of a particular therapeutic treatment regimen in animal studies, in clinical trials, or in monitoring the treatment of an individual patient.
- a normal or standard profile for expression is established. This may be accomplished by combining body fluids or cell extracts taken from normal subjects, either animal or human, with a sequence, or a fragment thereof, which encodes PLBP, under conditions suitable for hybridization or amplification. Standard hybridization may be quantified by comparing the values obtained from normal subjects with those from an experiment where a known amount of a substantially purified polynucleotide is used. Standard values obtained from normal samples may be compared with values obtained from samples from patients who are symptomatic for disease. Deviation between standard and subject values is used to establish the presence of disease.
- hybridization assays may be repeated on a regular basis to evaluate whether the level of expression in the patient begins to approximate that which is observed in the normal patient.
- the results obtained from successive assays may be used to show the efficacy of treatment over a period ranging from several days to months.
- the presence of a relatively high amount of transcript in biopsied tissue from an individual may indicate a predisposition for the development of the disease, or may provide a means for detecting the disease prior to the appearance of actual clinical symptoms.
- a more definitive diagnosis of this type may allow health professionals to employ preventative measures or aggressive treatment earlier thereby preventing the development or further progression of the cancer.
- oligonucleotides designed from the sequences encoding PLBP may involve the use of PCR. Such oligomers may be chemically synthesized, generated enzymatically, or produced in vitro. Oligomers will preferably consist of two nucleotide sequences, one with sense orientation (5' ⁇ 3') and another with antisense (3' ⁇ 5'), employed under optimized conditions for identification of a specific gene or condition. The same two oligomers, nested sets of oligomers, or even a degenerate pool of oligomers may be employed under less stringent conditions for detection and/or quantitation of closely related DNA or RNA sequences.
- Methods which may also be used to quantitate the expression of PLBP include radiolabeling or biotinylating nucleotides, coamplification of a control nucleic acid, and standard curves onto which the experimental results are interpolated (Melby, P. C. et al. (1 993) J. Immunol. Methods, 159:235-244; Duplaa, C. et al. (1993) Anal. Biochem. 229-236).
- the speed of quantitation of multiple samples may be accelerated by running the assay in an ELISA format where the oligomer of interest is presented in various dilutions and a spectrophotometric or colorimetric response gives rapid quantitation.
- an oligonucleotide derived from any of the polynucleotide sequences described herein may be used as a target in a microarray.
- the microarray can be used to monitor the expression level of large numbers of genes simultaneously (to produce a transcript image), and to identify genetic variants, mutations and polymorphisms. This information will be useful in determining gene function, understanding the genetic basis of disease, diagnosing disease, and in developing and monitoring the activity of therapeutic agents (Heller, R. et al. (1997) Proc. Natl. Acad. Sci. 94:2150-55).
- the microarray is prepared and used according to the methods described in PCT application WO95/11995 (Chee et al.), Lockhart, D. J. et al. (1996; Nat. Biotech. 14: 1675-1680) and Schena, M. et al. (1996; Proc. Natl. Acad. Sci. 93: 10614-10619), all of which are incorporated herein in their entirety by reference.
- the microarray is preferably composed of a large number of unique, single-stranded nucleic acid sequences, usually either synthetic antisense oligonucleotides or fragments of cDNAs, fixed to a solid support.
- the oligonucleotides are preferably about 6-60 nucleotides in length, more preferably 15-30 nucleotides in length, and most preferably about 20-25 nucleotides in length. For a certain type of microarray, it may be preferable to use oligonucleotides which are only 7-10 nucleotides in length.
- the microarray may contain oligonucleotides which cover the known 5', or 3', sequence, sequential oligonucleotides which cover the full length sequence; or unique oligonucleotides selected from particular areas along the length of the sequence.
- Polynucleotides used in the microarray may be oligonucleotides that are specific to a gene or genes of interest in which at least a fragment of the sequence is known or that are specific to one or more unidentified cDNAs which are common to a particular cell type, developmental or disease state.
- oligonucleotides In order to produce oligonucleotides to a known sequence for a microarray, the gene of interest is examined using a computer algorithm which starts at the 5' or more preferably at the 3' end of the nucleotide sequence.
- the algorithm identifies oligomers of defined length that are unique to the gene, have a GC content within a range suitable for hybridization, and lack predicted secondary structure that may interfere with hybridization. In certain situations it may be appropriate to use pairs of oligonucleotides on a microarray.
- the "pairs" will be identical, except for one nucleotide which preferably is located in the center of the sequence.
- the second oligonucleotide in the pair serves as a control.
- the number of oligonucleotide pairs may range from two to one million.
- the oligomers are synthesized at designated areas on a substrate using a light-directed chemical process.
- the substrate may be paper, nylon or other type of membrane, filter, chip, glass slide or any other suitable solid support.
- an oligonucleotide may be synthesized on the surface of the substrate by using a chemical coupling procedure and an ink jet application apparatus, as described in PCT application WO95/25 1116 (Baldeschweiler et al.) which is incorporated herein in its entirety by reference.
- a "gridded" array analogous to a dot (or slot) blot may be used to arrange and link cDNA fragments or oligonucleotides to the surface of a substrate using a vacuum system, thermal, UV, mechanical or chemical bonding procedures.
- An array such as those described above, may be produced by hand or by using available devices (slot blot or dot blot apparatus), materials (any suitable solid support), and machines (including robotic instruments), and may contain 8, 24, 96, 384, 1536 or 6144 oligonucleotides, or any other number between two and one million which lends itself to the efficient use of commercially available instrumentation.
- RNA or DNA from a biological sample is made into hybridization probes.
- the mRNA is isolated, and cDNA is produced and used as a template to make antisense RNA (aRNA).
- aRNA is amplified in the presence of fluorescent nucleotides, and labeled probes are incubated with the microarray so that the probe sequences hybridize to complementary oligonucleotides of the microarray. Incubation conditions are adjusted so that hybridization occurs with precise complementary matches or with various degrees of less complementarity. After removal of nonhybridized probes, a scanner is used to determine the levels and patterns of fluorescence.
- the scanned images are examined to determine degree of complementarity and the relative abundance of each oligonucleotide sequence on the microarray.
- the biological samples may be obtained from any bodily fluids (such as blood, urine, saliva, phlegm, gastric juices, etc.), cultured cells, biopsies, or other tissue preparations.
- a detection system may be used to measure the absence, presence, and amount of hybridization for all of the distinct sequences simultaneously. This data may be used for large scale correlation studies on the sequences, mutations, variants, or polymorphisms among samples.
- the nucleic acid sequences which encode PLBP may also be used to generate hybridization probes which are useful for mapping the naturally occurring genomic sequence.
- the sequences may be mapped to a particular chromosome, to a specific region of a chromosome or to artificial chromosome constructions, such as human artificial chromosomes (HACs), yeast artificial chromosomes (YACs), bacterial artificial chromosomes (BACs), bacterial P1 constructions or single chromosome cDNA libraries as reviewed in Price, C. M. (1993) Blood Rev. 7:127-134, and Trask, B. J. (1991) Trends Genet. 7:149-154.
- HACs human artificial chromosomes
- YACs yeast artificial chromosomes
- BACs bacterial artificial chromosomes
- bacterial P1 constructions or single chromosome cDNA libraries as reviewed in Price, C. M. (1993) Blood Rev. 7:127-134, and Trask, B
- Fluorescent in situ hybridization may be correlated with other physical chromosome mapping techniques and genetic map data. Examples of genetic map data can be found in various scientific journals or at Online Mendelian Inheritance in Man (OMIM). Correlation between the location of the gene encoding PLBP on a physical chromosomal map and a specific disease, or predisposition to a specific disease, may help delimit the region of DNA associated with that genetic disease.
- the nucleotide sequences of the subject invention may be used to detect differences in gene sequences between normal, carrier, or affected individuals.
- In situ hybridization of chromosomal preparations and physical mapping techniques such as linkage analysis using established chromosomal markers may be used for extending genetic maps. Often the placement of a gene on the chromosome of another mammalian species, such as mouse, may reveal associated markers even if the number or arm of a particular human chromosome is not known. New sequences can be assigned to chromosomal arms, or parts thereof, by physical mapping. This provides valuable information to investigators searching for disease genes using positional cloning or other gene discovery techniques. Once the disease or syndrome has been crudely localized by genetic linkage to a particular genomic region, for example, AT to 11q22-23 (Gatti, R. A. et al.
- any sequences mapping to that area may represent associated or regulatory genes for further investigation.
- the nucleotide sequence of the subject invention may also be used to detect differences in the chromosomal location due to translocation, inversion, etc. among normal, carrier, or affected individuals.
- PLBP its catalytic or immunogenic fragments or oligopeptides thereof
- PLBP can be used for screening libraries of compounds in any of a variety of drug screening techniques.
- the fragment employed in such screening may be free in solution, affixed to a solid support, borne on a cell surface, or located intracellularly.
- the formation of binding complexes, between PLBP and the agent being tested, may be measured.
- Another technique for drug screening provides for high throughput screening of compounds having suitable binding affinity to the protein of interest as described in published PCT application WO84/03564.
- a solid substrate such as plastic pins or some other surface.
- the test compounds are reacted with PLBP, or fragments thereof, and washed.
- Bound PLBP is then detected by methods well known in the art.
- Purified PLBP can also be coated directly onto plates for use in the aforementioned drug screening techniques.
- non-neutralizing antibodies can be used to capture the peptide and immobilize it on a solid support.
- nucleotide sequences which encode PLBP may be used in any molecular biology techniques that have yet to be developed, provided the new techniques rely on properties of nucleotide sequences that are currently known, including, but not limited to, such properties as the triplet genetic code and specific base pair interactions.
- the MUSCNOT07 cDNA library was constructed from microscopically normal human forearm muscle tissue (specimen #0660B) obtained from a 38-year-old Caucasian female during a soft tissue excision. Pathology for the non-tumorous tissues indicated that the surgical margins of re-excision were free of tumor involvement. Pathology for the right forearm indicated intramuscular hemangioma, with a second excision confirming the diagnosis. Family history included malignant breast neoplasm in the mother; and benign hypertension, cerebrovascular disease, malignant colon neoplasm, and diabetes in a grandparent.
- the frozen tissue was homogenized and lysed using a Brinkmann Homogenizer Polytron PT-3000 (Brinkmann Instruments, Westbury, N.Y.) in guanidinium isothiocyanate solution.
- the lysate was centrifuged over a 5.7M CsCl cushion using a Beckman SW28 rotor in a Beckman L8-70M Ultracentrifuge (Beckman Instruments) for 18 hours at 25,000 rpm at ambient temperature.
- the mRNA was extracted with acid phenol pH 4.7, precipitated using 0.3M sodium acetate and 2.5 volumes of ethanol, resuspended in RNAse-free water, and DNase treated at 37° C. Extraction and precipitation were repeated as before.
- the mRNA was then isolated using the Qiagen OLIGOTEX kit (QIAGEN, Inc., Chatsworth, Calif.) and used to construct the cDNA library.
- the LUNGTUT12 cDNA library was constructed from cancerous lung tissue (specimen #0319A) obtained from a 70-year-old Caucasian female during a lung lobectomy. Pathology for the left upper lobe lung tissue indicated grade 3 (or 4) adenocarcinoma, forming a mass which abuts but does not involve the pleura. Vascular invasion was present. The lobectomy specimen contained no residual carcinoma. The bronchial margin was free of involvement. Multiple (9) intrapulmonary peribronchial lymph nodes were negative for tumor. Pathology for the left lower lobe lung tissue indicated lung parenchyma with focal subpleural fibrosis.
- the frozen tissues were homogenized and lysed in Trizol reagent (1 g tissue/10 ml Trizol; Cat. #10296-028; GIBCO-BRL), a monoplastic solution of phenol and guanidine isothiocyanate, using a Brinkmann Homogenizer Polytron PT-3000 (Brinkmann Instruments, Westbury, N.Y.). After a brief incubation on ice, chloroform was added (1:5 v/v) and the lysate was centrifuged. The upper chloroform layer was removed to a fresh tube and the RNA extracted with isopropanol, resuspended in DEPC-treated water, and DNase treated for 25 min at 37° C.
- RNA was re-extracted once with acid phenol-chloroform pH 4.7 and precipitated using 0.3M sodium acetate and 2.5 volumes ethanol.
- the mRNA was then isolated using the Qiagen OLIGOTEX kit (QIAGEN, Inc., Chatsworth, Calif.) and used to construct the cDNA library.
- mRNA for both libraries was handled according to the recommended protocols in the SuperScript plasmid system (Cat. #18248-013, GIBCO-BRL).
- cDNA synthesis was initiated with a Notl-oligo d(T) primer. Double stranded cDNA was blunted, ligated to EcoRl adaptors, digested with NotI, fractionated on a SEPHAROSE CL4B column (Cat. #275105-01; Pharmacia), and those cDNAs exceeding 400 bp were ligated into the Notl and EcoRI sites of the pINCY I vector (Incyte).
- the plasmid pINCY 1 was subsequently transformed into DH5 ⁇ competent cells (Cat. #18258-012; GIBCO-BRL).
- Plasmid DNA was released from the cells and purified using the REAL Prep 96 plasmid kit (Catalog #26173; QIAGEN, Inc.). The recommended protocol was employed except for the following changes: 1) the bacteria were cultured in 1 ml of sterile Terrific Broth (Catalog #22711, GIBCO-BRL) with carbenicillin at 25 mg/L and glycerol at 0.4%; 2) after inoculation, the cultures were incubated for 19 hours and at the end of incubation, the cells were lysed with 0.3 ml of lysis buffer; and 3) following isopropanol precipitation, the plasmid DNA pellet was resuspended in 0.1 ml of distilled water. After the last step in the protocol, samples were transferred to a 96-well block for storage at 4° C.
- the cDNAs were sequenced by the method of Sanger et al. (1975, J. Mol. Biol. 94:441f), using a Hamilton Micro Lab 2200 (Hamilton, Reno, Nev.) in combination with Peltier Thermal Cyclers (PTC200 from MJ Research, Watertown, Mass.) and Applied Biosystems 377 DNA Sequencing Systems, and the reading frame determined.
- nucleotide sequences and/or amino acid sequences of the Sequence Listing were used to query sequences in the GenBank, SwissProt, BLOCKS, and Pima II databases. These databases, which contain previously identified and annotated sequences, were searched for regions of homology using BLAST, which stands for Basic Local Alignment Search Tool (Altschul, S. F. (1993) J. Mol. Evol 36:290-300; Altschul, et al. (1990) J. Mol. Biol. 215:403-410).
- BLAST stands for Basic Local Alignment Search Tool
- BLAST produced alignments of both nucleotide and amino acid sequences to determine sequence similarity. Because of the local nature of the alignments, BLAST was especially useful in determining exact matches or in identifying homologs which may be of prokaryotic (bacterial) or eukaryotic (animal, fungal, or plant) origin. Other algorithms such as the one described in Smith, T. et al. (1992, Protein Engineering 5:35-51), incorporated herein by reference, could have been used when dealing with primary sequence patterns and secondary structure gap penalties. The sequences disclosed in this application have lengths of at least 49 nucleotides, and no more than 12% uncalled bases (where N is recorded rather than A, C, G, or T).
- BLAST The BLAST approach searched for matches between a query sequence and a database sequence. BLAST evaluated the statistical significance of any matches found, and reported only those matches that satisfy the user-selected threshold of significance. In this application, hreshold was set at 10 -25 for nucleotides and 10 -14 for peptides.
- Incyte nucleotide sequences were searched against the GenBank databases for primate (pri), rodent (rod), and other mammalian sequences (mam); and deduced amino acid sequences from the same clones were then searched against GenBank functional protein databases, mammalian (mamp), vertebrate (vrtp), and eukaryote (eukp) for homology.
- Northern analysis is a laboratory technique used to detect the presence of a transcript of a gene and involves the hybridization of a labeled nucleotide sequence to a membrane on which RNAs from a particular cell type or tissue have been bound (Sambrook et al., supra).
- the basis of the search is the product score which is defined as: ##EQU1##
- the product score takes into account both the degree of similarity between two sequences and the length of the sequence match. For example, with a product score of 40, the match will be exact within a 1-2% error; and at 70, the match will be exact. Homologous molecules are usually identified by selecting those which show product scores between 15 and 40, although lower scores may identify related molecules.
- the nucleic acid sequence of the Incyte Clones 3014759 or 3126479 was used to design oligonucleotide primers for extending a partial nucleotide sequence to full length.
- One primer was synthesized to initiate extension in the antisense direction, and the other was synthesized to extend sequence in the sense direction.
- Primers were used to facilitate the extension of the known sequence "outward" generating amplicons containing new, unknown nucleotide sequence for the region of interest.
- the initial primers were designed from the cDNA using OLIGO 4.06 (National Biosciences), or another appropriate program, to be about 22 to about 30 nucleotides in length, to have a GC content of 50% or more, and to anneal to the target sequence at temperatures of about 68° to about 72° C. Any stretch of nucleotides which would result in hairpin structures and primer-primer dimerizations was avoided.
- High fidelity amplification was obtained by following the instructions for the XL-PCR kit (Perkin Elmer) and thoroughly mixing the enzyme and reaction mix. Beginning with 40 pmol of each primer and the recommended concentrations of all other components of the kit, PCR was performed using the Peltier Thermal Cycler (PTC200; M. J. Research, Watertown, Mass.) and the following parameters:
- Step 1 94° C. for 1 min (initial denaturation)
- Step 3 68° C. for 6 min
- Step 4 94° C. for 15 sec
- Step 7 Repeat step 4-6 for 15 additional cycles
- Step 8 94° C. for 15 sec
- Step 10 68° C. for 7:15 min
- Step 11 Repeat step 8-10 for 12 cycles
- PCR amplification For PCR amplification, 18 ⁇ l of concentrated PCR reaction mix (3.3 ⁇ ) containing 4 units of rTth DNA polymerase, a vector primer, and one or both of the gene specific primers used for the extension reaction were added to each well. Amplification was performed using the following conditions:
- Step 1 94° C. for 60 sec
- Step 2 94° C. for 20 sec
- Step 3 55° C. for 30 sec
- Step 5 Repeat steps 2-4 for an additional 29 cycles
- Step 7 4° C. (and holding)
- nucleotide sequence of SEQ ID NO:2 or SEQ ID NO:4 is used to obtain 5' regulatory sequences using the procedure above, oligonucleotides designed for 5'extension, and an appropriate genomic library.
- Hybridization probes derived from SEQ ID NO:2 or SEQ ID NO:4 are employed to screen cDNAs, genomic DNAs, or mRNAs. Although the labeling of oligonucleotides, consisting of about 20 base-pairs, is specifically described, essentially the same procedure is used with larger nucleotide fragments. Oligonucleotides are designed using state-of-the-art software such as OLIGO 4.06 (National Biosciences), labeled by combining 50 pmol of each oligomer and 250 ⁇ Ci of ⁇ - 32 P! adenosine triphosphate (Amersham) and T4 polynucleotide kinase (DuPont NEN, Boston, Mass.).
- the labeled oligonucleotides are substantially purified with SEPHADEX G-25 superfine resin column (Pharmacia & Upjohn). A aliquot containing 10 7 counts per minute of the labeled probe is used in a typical membrane-based hybridization analysis of human genomic DNA digested with one of the following endonucleases (Ase I, Bg1 II, Eco RI, Pst I, Xba 1, or Pvu II; DuPont NEN).
- the DNA from each digest is fractionated on a 0.7 percent agarose gel and transferred to nylon membranes (Nytran Plus, Schleicher & Schuell, Durham, N.H.). Hybridization is carried out for 16 hours at 40° C. To remove nonspecific signals, blots are sequentially washed at room temperature under increasingly stringent conditions up to 0.1 ⁇ saline sodium citrate and 0.5% sodium dodecyl sulfate. After XOMAT AR film (Kodak, Rochester, N.Y.) is exposed to the blots in a Phosphoimager cassette (Molecular Dynamics, Sunnyvale, Calif.) for several hours, hybridization patterns are compared visually.
- oligonucleotides for a microarray the nucleotide sequence described herein is examined using a computer algorithm which starts at the 3' end of the nucleotide sequence.
- the algorithm identifies oligomers of defined length that are unique to the gene, have a GC content within a range suitable for hybridization, and lack predicted secondary structure that would interfere with hybridization.
- the algorithm identifies 20 sequence-specific oligonucleotides of 20 nucleotides in length (20-mers). A matched set of oligonucleotides is created in which one nucleotide in the center of each sequence is altered.
- a chemical coupling procedure and an ink jet device are used to synthesize oligomers on the surface of a substrate (Baldeschweiler, J. D. et al., PCT/WO95/25116, incorporated herein by reference).
- a "gridded" array analogous to a dot (or slot) blot is used to arrange and link cDNA fragments or oligonucleotides to the surface of a substrate using a vacuum system, thermal, UV, mechanical or chemical bonding procedures.
- An array may be produced by hand or using available materials and machines and contain grids of 8 dots, 24 dots, 96 dots, 384 dots, 1536 dots or 6144 dots.
- the microarray is washed to remove nonhybridized probes, and a scanner is used to determine the levels and patterns of fluorescence. The scanned images are examined to determine degree of complementarity and the relative abundance of each oligonucleotide sequence on the micro-array.
- Sequence complementary to the PLBP-encoding sequence, or any part thereof, is used to decrease or inhibit expression of naturally occurring PLBP.
- oligonucleotides comprising from about 15 to about 30 base-pairs is described, essentially the same procedure is used with smaller or larger sequence fragments.
- Appropriate oligonucleotides are designed using Oligo 4.06 software and the coding sequence of PLBP, SEQ ID NO:1.
- a complementary oligonucleotide is designed from the most unique 5' sequence and used to prevent promoter binding to the coding sequence.
- a complementary oligonucleotide is designed to prevent ribosomal binding to the PLBP-encoding transcript.
- Expression of PLBP is accomplished by subcloning the cDNAs into appropriate vectors and transforming the vectors into host cells.
- the cloning vector is also used to express PLBP in E. coli. Upstream of the cloning site, this vector contains a promoter for ⁇ -galactosidase, followed by sequence containing the amino-terminal Met, and the subsequent seven residues of ⁇ -galactosidase. Immediately following these eight residues is a bacteriophage promoter useful for transcription and a linker containing a number of unique restriction sites.
- Induction of an isolated, transformed bacterial strain with IPTG using standard methods produces a fusion protein which consists of the first eight residues of ⁇ -galactosidase, about 5 to 15 residues of linker, and the full length protein.
- the signal residues direct the secretion of PLBP into the bacterial growth media which can be used directly in the following assay for activity.
- the assay is based on the increase of the pyrene monomer fluorescence intensity as a result of the transfer of pyrenylacyl(Pyr(x))-labeled phospholipid from quenched donor vesicles (2 nmol of total phospholipid) to a 25-fold excess of unquenched acceptor vesicles (Van Paridon, P. A. et al. (1988) Biochemistry 27:6208-6214).
- the donor vesicles consist of Pyr(x)PC or Pyr(x)PE, 2,4,6-trinitrophenyl-phosphatidylethanolamine (TNP-PE), phosphatidic acid (PA), and egg phosphatidylcholine (PC) (10:10:10:70 mol %) and the acceptor vesicles of PA and egg PC (5:95 mol %).
- the reaction is carried out in 2 ml of 20 mM tris-HCl, 5 mM EDTA, 200 mM NaCl (pH 7.4) containing 0.1 mg of BSA at 37° C.
- the reaction is initiated by the addition of fractions (10-50 ⁇ l) containing PLBP.
- the initial slope of the progress curve is taken as an arbitrary unit of transfer activity. Measurements are performed on an SLM-Aminco SPF-500C fluorimeter equipped with a thermostated cuvette holder and a stirring device.
- PLBP that is substantially purified using PAGE electrophoresis (Sambrook, supra), or other purification techniques, is used to immunize rabbits and to produce antibodies using standard protocols.
- the amino acid sequence deduced from SEQ ID NO:2 or SEQ ID NO:4 is analyzed using DNASTAR software (DNASTAR Inc) to determine regions of high immunogenicity and a corresponding oligopeptide is synthesized and used to raise antibodies by means known to those of skill in the art. Selection of appropriate epitopes, such as those near the C-terminus or in hydrophilic regions, is described by Ausubel et al. (supra), and others.
- the oligopeptides are 15 residues in length, synthesized using an Applied Biosystems Peptide Synthesizer Model 431 A using fmoc-chemistry, and coupled to keyhole limpet hemocyanin (KLH, Sigma, St. Louis, Mo.) by reaction with N-maleimidobenzoyl-N-hydroxysuccinimide ester (MBS; Ausubel et al., supra).
- KLH keyhole limpet hemocyanin
- MBS N-maleimidobenzoyl-N-hydroxysuccinimide ester
- Rabbits are immunized with the oligopeptide-KLH complex in complete Freund's adjuvant.
- the resulting antisera are tested for antipeptide activity, for example, by binding the peptide to plastic, blocking with 1% BSA, reacting with rabbit antisera, washing, and reacting with radio iodinated, goat anti-rabbit IgG.
- Naturally occurring or recombinant PLBP is substantially purified by immunoaffinity chromatography using antibodies specific for PLBP.
- An immunoaffinity column is constructed by covalently coupling PLBP antibody to an activated chromatographic resin, such as CNBr-activated SEPHAROSE (Pharmacia & Upjohn). After the coupling, the resin is blocked and washed according to the manufacturer's instructions.
- Media containing PLBP is passed over the immunoaffinity column, and the column is washed under conditions that allow the preferential absorbance of PLBP (e.g., high ionic strength buffers in the presence of detergent).
- the column is eluted under conditions that disrupt antibody/PLBP binding (eg, a buffer of pH 2-3 or a high concentration of a chaotrope, such as urea or thiocyanate ion), and PLBP is collected.
- PLBP or biologically active fragments thereof are labeled with 125 I Bolton-Hunter reagent (Bolton et al. (1973) Biochem. J. 133: 529).
- Candidate molecules previously arrayed in the wells of a multi-well plate are incubated with the labeled PLBP, washed and any wells with labeled PLBP complex are assayed. Data obtained using different concentrations of PLBP are used to calculate values for the number, affinity, and association of PLBP with the candidate molecules.
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Gastroenterology & Hepatology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Toxicology (AREA)
- Peptides Or Proteins (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides two human phospholipid binding proteins (PLBP) and polynucleotides which identify and encode PLBP. The invention also provides expression vectors, host cells, agonists, antibodies and antagonists. The invention also provides methods for treating and preventing disorders associated with expression of PLBP.
Description
This invention relates to nucleic acid and amino acid sequences of two human phospholipid binding proteins and to the use of these sequences in the diagnosis, prevention, and treatment of disorders associated with fetal development, reproduction, cell proliferation, and the immune response.
Membrane biogenesis is essential for cell growth and differentiation. During membrane biogenesis in eukaryotic cells, newly synthesized phospholipids must be transported from their sites of synthesis to their sites of function. Vesicular traffic in eukaryotic cells is characterized by two steps of membrane rearrangement, the formation of vesicles from donor membranes and their fusion with acceptor membranes. With respect to vesicle formation, several of the cytosolic proteins implicated in budding and fission have been identified. These proteins stimulate the formation of constitutive secretory vesicles and immature secretory granules from the trans-Golgi network.
Phosphatidylcholine transfer protein (PC-TP) is a member of a diverse set of cytosolic lipid transfer proteins which are distinguished by their ability to transfer phospholipids between membranes in vitro (Wirtz, K. W. A. (1991) Ann. Rev. Biochem. 60:73-99). PC-TPs purified from bovine and rat liver are 213 amino acids in length and have molecular masses of about 28 kDa. The cDNAs which encode full-length bovine PC-TP and fragments of rat and mouse PC-TPs were recently isolated (Geijtenbeek, T. B. H. et al. (1996) Biochem. J. 316:49-55). In adult mice, levels of PC-TP RNA are highest in liver, kidney and testis, lower in lung, heart, and gastrointestinal tissues, and nearly undetectable in brain and thymus. PC-TP RNA is present in all stages of mouse embryo development, which suggests a role for PC-TP in cell growth and differentiation (Geijtenbeek et al., supra).
Pulmonary surfactant is a lipid-rich material that prevents lung collapse by lowering surface tension at the air-liquid interface in the lung alveoli. It is composed primarily of the phospholipids PC and phosphatidylglycerol and lesser amounts of cholesterol and surfactant-associated proteins. Levels of PC-TP in fetal rat lung are greatest just prior to term and parallel the levels of surfactant production and of the enzymes required for PC synthesis (Teerlink, T. et al. (1982) Biochim. Biophys. Acta 713:61-67).
The liver secretes large amounts of PC into the bile. PC-TP is proposed to contribute to PC secretion by transporting PC from its site of synthesis in the endoplasmic reticulum to the inner leaflet of the canalicular membrane, possibly in concert with the class III metabolic P-glycoprotein encoded by the Mdr2 gene (Smit, J. J. M. et al. (1993) Cell 75:451-462; Geijtenbeek et al., supra).
PC-TP may play an essential role in membrane biogenesis by delivering PC to sites of growth. Furthermore, PC-TP may also play a role in the signal transduction pathway by delivering PC from intracellular stores to sites of enzymatic hydrolysis where the PC-specific phospholipases C and D convert PC into lipid mediators such as phosphatidic acid, diacylglyerol and arachidonic acid (Exton, J. H. (1994) Biochim. Biophys. Acta 1212:26-42; Geijtenbeek et al., supra).
Phosphatidylethanotamine (PE) comprises a portion of the lipid pool of many organisms, including bacteria, lower metazoa, fish, amphibia, reptiles, birds, and mammals. PE is synthesized from ethanolamine and diacylglycerol by a number of mitochondrial or endoplasmic reticular enzymes. PE is a source of fatty acid anions and diacylglycerol. Intracellular phospholipase C metabolizes PE to produce diacylglycerol, a component of the protein kinase C-stimulating second messenger pathway. Thus PE is an important intracellular component of the intracellular fatty acid synthesis and of the cell cycle.
Membranes composed of PE and phosphatidylglycerol, such as found in bacteria, are permeabilized by mammalian defensins (Hristova, K. et al. (1997) J. Biol. Chem. 272:24224-24233). Separately, biochemically modified PE may mediate hippocampal long term potentiation and some of the symptoms associated with Sjogren-Larsson syndrome (Pavlinova, L. I. et al. (1997) Neurosci. Behav. Physiol. 27:234-239; James, P. F. and Zoeller, R. A. (1997) J. Biol. Chem. 272:23532-23539).
A number of putative PE-binding proteins (PE-BPs) have been isolated from human, bovine and rat brain during searches for molecules with differing, but specific, biochemical and pharmacological properties (Hori, N. et al. (1994) Gene 140:293-294). The presence of PE-BPs in cytoplasmic and membrane compartments suggested their possible implication in transport or signal mechanisms between membranes and the cytoplasm. Subsequent tissue expression analysis showed that some of these genes are transcribed in various rodent tissues, such as brain, spleen, lung, liver, skeletal muscle, kidney, and testis. PE-BPs have been implicated as essential for normal spermatogenesis in the rat (Seddiqi, N. et al. (1996) Experimentia 52:101-110).
Similar putative PE-BPs have been identified in the parasitic nematode Onchocerca volvulus. Erttmann, K. D. and Gallin, M. Y. (1996; Gene 174:203-207) speculated that the nematode PE-BPs might play a role in odorant response, a process essential in development, feeding, and mating.
The discovery of two new human phospholipid binding proteins and the polynucleotides encoding them satisfies a need in the art by providing new compositions which are useful in the diagnosis, prevention and treatment of disorders associated with fetal development, reproduction, cell proliferation, and the immune response.
The invention features two substantially purified polypeptides, human phospholipid binding proteins (designated collectively as PLBP and individually as PLBP I and PLBP2), having the amino acid sequence shown in SEQ ID NO:1 or SEQ ID NO:3 or fragments thereof.
The invention further provides an isolated and substantially purified polynucleotide sequence encoding the polypeptide comprising the amino acid sequence of SEQ ID NO:1 or fragments thereof and a composition comprising said polynucleotide sequence. The invention also provides a polynucleotide sequence which hybridizes under stringent conditions to the polynucleotide sequence encoding the amino acid sequence SEQ ID NO:1, or fragments of said polynucleotide sequence. The invention further provides a polynucleotide sequence comprising the complement of the polynucleotide sequence encoding the amino acid sequence of SEQ ID NO:1, or fragments or variants of said polynucleotide sequence.
The invention also provides an isolated and purified sequence comprising SEQ ID NO:2 or variants thereof. In addition, the invention provides a polynucleotide sequence which hybridizes under stringent conditions to the polynucleotide sequence of SEQ ID NO:2. The invention also provides a polynucleotide sequence comprising the complement of SEQ ID NO:2, or fragments or variants thereof.
The present invention further provides an expression vector containing at least a fragment of any of the claimed polynucleotide sequences. In yet another aspect, the expression vector containing the polynucleotide sequence is contained within a host cell.
The invention also provides a method for producing a polypeptide comprising the amino acid sequence of SEQ ID NO:1 or a fragment thereof, the method comprising the steps of: a) culturing the host cell containing an expression vector containing at least a fragment of the polynucleotide sequence encoding PLBP1 under conditions suitable for the expression of the polypeptide; and b) recovering the polypeptide from the host cell culture.
The invention also provides a pharmaceutical composition comprising a substantially purified PLBP1 having the amino acid sequence of SEQ ID NO:1 in conjunction with a suitable pharmaceutical carrier.
The invention also provides a purified antagonist of the polypeptide of SEQ ID NO:1. In one aspect the invention provides a purified antibody which binds to a polypeptide comprising the amino acid sequence of SEQ ID NO:1.
Still further, the invention provides a purified agonist of the polypeptide of SEQ ID NO:1.
The invention also provides a method for treating or preventing a disorder associated with fetal development comprising administering to a subject in need of such treatment an effective amount of a pharmaceutical composition comprising purified PLBP1.
The invention also provides a method for treating or preventing a disorder associated with reproduction comprising administering to a subject in need of such treatment an effective amount of a pharmaceutical composition comprising purified PLBP1.
The invention also provides a method for treating or preventing a disorder associated with cell proliferation comprising administering to a subject in need of such treatment an effective amount of an antagonist to PLBP1.
The invention also provides a method for treating or preventing a disorder associated with the immune response comprising administering to a subject in need of such treatment an effective amount of an antagonist to PLBP1.
The invention also provides a method for detecting a polynucleotide which encodes PLBP in a biological sample comprising the steps of: a) hybridizing the complement of the polynucleotide sequence which encodes SEQ ID NO:1 to nucleic acid material of a biological sample, thereby forming a hybridization complex; and b) detecting the hybridization complex, wherein the presence of the complex correlates with the presence of a polynucleotide encoding PLBP1 in the biological sample. In one aspect the nucleic acid material of the biological sample is amplified by the polymerase chain reaction prior to hybridization.
The invention further provides an isolated and substantially purified polynucleotide sequence encoding the polypeptide comprising the amino acid sequence of SEQ ID NO:3 or fragments thereof and a composition comprising said polynucleotide sequence. The invention also provides a polynucleotide sequence which hybridizes under stringent conditions to the polynucleotide sequence encoding the amino acid sequence SEQ ID NO:3, or fragments of said polynucleotide sequence. The invention further provides a polynucleotide sequence comprising the complement of the polynucleotide sequence encoding the amino acid sequence of SEQ ID NO:3, or fragments or variants of said polynucleotide sequence.
The invention also provides an isolated and purified sequence comprising SEQ ID NO:4 or variants thereof. In addition, the invention provides a polynucleotide sequence which hybridizes under stringent conditions to the polynucleotide sequence of SEQ ID NO:4. The invention also provides a polynucleotide sequence comprising the complement of SEQ ID NO:4, or fragments or variants thereof.
The present invention further provides an expression vector containing at least a fragment of any of the claimed polynucleotide sequences. In yet another aspect, the expression vector containing the polynucleotide sequence is contained within a host cell.
The invention also provides a method for producing a polypeptide comprising the amino acid sequence of SEQ ID NO:3 or a fragment thereof, the method comprising the steps of: a) culturing the host cell containing an expression vector containing at least a fragment of the polynucleotide sequence encoding PLBP2 under conditions suitable for the expression of the polypeptide; and b) recovering the polypeptide from the host cell culture.
The invention also provides a pharmaceutical composition comprising a substantially purified PLBP2 having the amino acid sequence of SEQ ID NO:3 in conjunction with a suitable pharmaceutical carrier.
The invention also provides a purified antagonist of the polypeptide of SEQ ID NO:3. In one aspect the invention provides a purified antibody which binds to a polypeptide comprising the amino acid sequence of SEQ ID NO:3.
Still further, the invention provides a purified agonist of the polypeptide of SEQ ID NO:3.
The invention also provides a method for treating or preventing a disorder associated with fetal development comprising administering to a subject in need of such treatment an effective amount of a pharmaceutical composition comprising purified PLBP2.
The invention also provides a method for treating or preventing a disorder associated with reproduction comprising administering to a subject in need of such treatment an effective amount of a pharmaceutical composition comprising purified PLBP1.
The invention also provides a method for treating or preventing a disorder associated with cell proliferation comprising administering to a subject in need of such treatment an effective amount of an antagonist to PLBP2.
The invention also provides a method for treating or preventing a disorder associated with the immune response comprising administering to a subject in need of such treatment an effective amount of an antagonist to PLBP2.
The invention also provides a method for detecting a polynucleotide which encodes PLBP2 in a biological sample comprising the steps of: a) hybridizing the complement of the polynucleotide sequence which encodes SEQ ID NO:3 to nucleic acid material of a biological sample, thereby forming a hybridization complex; and b) detecting the hybridization complex, wherein the presence of the complex correlates with the presence of a polynucleotide encoding PLBP2 in the biological sample. In one aspect the nucleic acid material of the biological sample is amplified by the polymerase chain reaction prior to hybridization.
FIGS. 1A, 1B, 1C, 1D, and 1E show the amino acid sequence (SEQ ID NO:1) and nucleic acid sequence (SEQ ID NO:2) of PLBP1. The alignment was produced using MACDNASIS PRO software (Hitachi Software Engineering Co. Ltd. San Bruno, Calif.).
FIGS. 2A, 2B, and 2C show the amino acid sequence (SEQ ID NO:3) and nucleic acid sequence (SEQ ID NO:4) of PLBP2. The alignment was produced using MACDNASIS PRO software (Hitachi Software Engineering Co. Ltd. San Bruno, Calif.).
FIG. 3 shows the amino acid sequence alignments between PLBP1 (3014759; SEQ ID NO:1) and bovine PC-TP (GI 897693; SEQ ID NO:5) produced using the multisequence alignment program of DNASTAR software (DNASTAR Inc, Madison Wis.).
FIG. 4 shows the amino acid sequence alignments between PLBP2 (3126479; SEQ ID NO:3) and Onchocerca volvulus PE-BP D1 (GI 1143527; SEQ ID NO:6) produced using the multisequence alignment program of DNASTAR software (DNASTAR Inc, Madison Wis.).
FIGS. 5A and 5B show the hydrophobicity plots for PLBP1 (SEQ ID NO:1) and bovine PC-TP (SEQ ID NO:5), respectively; the positive X axis reflects amino acid position, and the negative Y axis, hydrophobicity (MACDNASIS PRO software).
Before the present proteins, nucleotide sequences, and methods are described, it is understood that this invention is not limited to the particular methodology, protocols, cell lines, vectors, and reagents described, as these may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention which will be limited only by the appended claims.
It must be noted that as used herein and in the appended claims, the singular forms "a","an",and "the" include plural reference unless the context clearly dictates otherwise. Thus, for example, reference to "a host cell" includes a plurality of such host cells, reference to the "antibody" is a reference to one or more antibodies and equivalents thereof known to those skilled in the art, and so forth.
Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods, devices, and materials are now described. All publications mentioned herein are incorporated herein by reference for the purpose of describing and disclosing the cell lines, vectors, and methodologies which are reported in the publications which might be used in connection with the invention. Nothing herein is to be construed as an admission that the invention is not entitled to antedate such disclosure by virtue of prior invention.
PLBP, as used herein, refers to the amino acid sequences of substantially purified PLBP obtained from any species, particularly mammalian, including bovine, ovine, porcine, murine, equine, and preferably human, from any source whether natural, synthetic, semi-synthetic, or recombinant.
The term "agonist", as used herein, refers to a molecule which, when bound to PLBP, increases or prolongs the duration of the effect of PLBP. Agonists may include proteins, nucleic acids, carbohydrates, or any other molecules which bind to and modulate the effect of PLBP.
An "allele" or "allelic sequence", as used herein, is an alternative form of the gene encoding PLBP. Alleles may result from at least one mutation in the nucleic acid sequence and may result in altered mRNAs or polypeptides whose structure or function may or may not be altered. Any given natural or recombinant gene may have none, one, or many allelic forms. Common mutational changes which give rise to alleles are generally ascribed to natural deletions, additions, or substitutions of nucleotides. Each of these types of changes may occur alone, or in combination with the others, one or more times in a given sequence.
"Altered" nucleic acid sequences encoding PLBP as used herein, include those with deletions, insertions, or substitutions of different nucleotides resulting in a polynucleotide that encodes the same or a functionally equivalent PLBP. Included within this definition are polymorphisms which may or may not be readily detectable using a particular oligonucleotide probe of the polynucleotide encoding PLBP, and improper or unexpected hybridization to alleles, with a locus other than the normal chromosomal locus for the polynucleotide sequence encoding PLBP. The encoded protein may also be "altered" and contain deletions, insertions, or substitutions of amino acid residues which produce a silent change and result in a functionally equivalent PLBP. Deliberate amino acid substitutions may be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, and/or the amphipathic nature of the residues as long as the biological or immunological activity of PLBP is retained. For example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; and amino acids with uncharged polar head groups having similar hydrophilicity values may include leucine, isoleucine, and valine, glycine and alanine, asparagine and glutamine, serine and threonine, and phenylalanine and tyrosine.
"Amino acid sequence" as used herein, refers to an oligopeptide, peptide, polypeptide, or protein sequence, and fragment thereof, and to naturally occurring or synthetic molecules. Fragments of PI,BP are preferably about 5 to about 15 amino acids in length and retain the biological activity or the immunological activity of PLBP. Where "amino acid sequence" is recited herein to refer to an amino acid sequence of a naturally occurring protein molecule, amino acid sequence, and like terms; are not meant to limit the amino acid sequence to the complete, native amino acid sequence associated with the recited protein molecule.
"Amplification" as used herein, refers to the production of additional copies of a nucleic acid sequence and is generally carried out using polymerase chain reaction (PCR) technologies well known in the art (Dieffenbach, C. W. and G. S. Dveksler (1995) PCR Primer, a Laboratory Manual, Cold Spring Harbor Press, Plainview, N.Y.).
The term "antagonist" as used herein, refers to a molecule which, when bound to PLBP, decreases the amount or the duration of the effect of the biological or immunological activity of PLBP. Antagonists may include proteins, nucleic acids, carbohydrates, antibodies or any other molecules which decrease the effect of PLBP.
As used herein, the term "antibody" refers to intact molecules as well as fragments thereof, such as Fa, F(ab')2, and Fv, which are capable of binding the epitopic determinant. Antibodies that bind PLBP polypeptides can be prepared using intact polypeptides or fragments containing small peptides of interest as the immunizing antigen. The polypeptide or oligopeptide used to immunize an animal can be derived from the translation of RNA or synthesized chemically and can be conjugated to a carrier protein, if desired. Commonly used carriers that are chemically coupled to peptides include bovine serum albumin and thyroglobulin, keyhole limpet hemocyanin. The coupled peptide is then used to immunize the animal (e.g., a mouse, a rat, or a rabbit).
The term "antigenic determinant", as used herein, refers to that fragment of a molecule (i.e., an epitope) that makes contact with a particular antibody. When a protein or fragment of a protein is used to immunize a host animal, numerous regions of the protein may induce the production of antibodies which bind specifically to a given region or three-dimensional structure on the protein; these regions or structures are referred to as antigenic determinants. An antigenic determinant may compete with the intact antigen (i.e., the immunogen used to elicit the immune response) for binding to an antibody.
The term "antisense", as used herein, refers to any composition containing nucleotide sequences which are complementary to a specific DNA or RNA sequence. The term "antisense strand" is used in reference to a nucleic acid strand that is complementary to the "sense" strand. Antisense molecules include peptide nucleic acids and may be produced by any method including synthesis or transcription. Once introduced into a cell, the complementary nucleotides combine with natural sequences produced by the cell to form duplexes and block either transcription or translation. The designation "negative" is sometimes used in reference to the antisense strand, and "positive" is sometimes used in reference to the sense strand.
The term "biologically active", as used herein, refers to a protein having structural, regulatory, or biochemical functions of a naturally occurring molecule. Likewise, "immunologically active" refers to the capability of the natural, recombinant, or synthetic PLBP, or any oligopeptide thereof, to induce a specific immune response in appropriate animals or cells and to bind with specific antibodies.
The terms "complementary" or "complementarity", as used herein, refer to the natural binding of polynucleotides under permissive salt and temperature conditions by base-pairing. For example, the sequence "A-G-T" binds to the complementary sequence "T-C-A". Complementarity between two single-stranded molecules may be "partial", in which only some of the nucleic acids bind, or it may be complete when total complementarity exists between the single stranded molecules. The degree of complementarity between nucleic acid strands has significant effects on the efficiency and strength of hybridization between nucleic acid strands. This is of particular importance in amplification reactions, which depend upon binding between nucleic acids strands and in the design and use of PNA molecules.
A "composition comprising a given polynucleotide sequence" as used herein refers broadly to any composition containing the given polynucleotide sequence. The composition may comprise a dry formulation or an aqueous solution. Compositions comprising polynucleotide sequences encoding PLBP (SEQ ID NO:1, SEQ ID NO:3) or fragments thereof (e.g., SEQ ID NO:2 or SEQ ID NO:4 and fragments thereof) may be employed as hybridization probes. The probes may be stored in freeze-dried form and may be associated with a stabilizing agent such as a carbohydrate. In hybridizations, the probe may be deployed in an aqueous solution containing salts (e.g., NaCl), detergents (e.g., SDS) and other components (e.g., Denhardt's solution, dry milk, salmon sperm DNA, etc.).
"Consensus", as used herein, refers to a nucleic acid sequence which has been resequenced to resolve uncalled bases, has been extended using XL-PCR (Perkin Elmer, Norwalk, Conn.) in the 5' and/or the 3' direction and resequenced, or has been assembled from the overlapping sequences of more than one Incyte Clone using a computer program for fragment assembly (e.g., GELVIEW Fragment Assembly system, GCG, Madison, Wis.). Some sequences have been both extended and assembled to produce the consensus sequence.
The term "correlates with expression of a polynucleotide", as used herein, indicates that the detection of the presence of ribonucleic acid that is similar to SEQ ID NO:2, or SEQ ID NO:4, by northern analysis is indicative of the presence of mRNA encoding PLBP in a sample and thereby correlates with expression of the transcript from the polynucleotide encoding the protein.
A "deletion", as used herein, refers to a change in the amino acid or nucleotide sequence and results in the absence of one or more amino acid residues or nucleotides.
The term "derivative", as used herein, refers to the chemical modification of a nucleic acid encoding or complementary to PLBP or the encoded PLBP. Such modifications include, for example, replacement of hydrogen by an alkyl, acyl, or amino group. A nucleic acid derivative encodes a polypeptide which retains the biological or immunological function of the natural molecule. A derivative polypeptide is one which is modified by glycosylation, pegylation, or any similar process which retains the biological or immunological function of the polypeptide from which it was derived.
The term "homology", as used herein, refers to a degree of complementarity. There may be partial homology or complete homology (i.e., identity). A partially complementary sequence that at least partially inhibits an identical sequence from hybridizing to a target nucleic acid is referred to using the functional term "substantially homologous." The inhibition of hybridization of the completely complementary sequence to the target sequence may be examined using a hybridization assay (Southern or northern blot, solution hybridization and the like) under conditions of low stringency. A substantially homologous sequence or hybridization probe will compete for and inhibit the binding of a completely homologous sequence to the target sequence under conditions of low stringency. This is not to say that conditions of low stringency are such that non-specific binding is permitted; low stringency conditions require that the binding of two sequences to one another be a specific (i.e., selective) interaction. The absence of non-specific binding may be tested by the use of a second target sequence which lacks even a partial degree of complementarity (e.g., less than about 30% identity). In the absence of non-specific binding, the probe will not hybridize to the second non-complementary target sequence.
Human artificial chromosomes (HACs) are linear microchromosomes which may contain DNA sequences of 10K to 10M in size and contain all of the elements required for stable mitotic chromosome segregation and maintenance (Harrington, J. J. et al. (1997) Nat Genet. 15:345-355).
The term "humanized antibody", as used herein, refers to antibody molecules in which amino acids have been replaced in the non-antigen binding regions in order to more closely resemble a human antibody, while still retaining the original binding ability.
The term "hybridization", as used herein, refers to any process by which a strand of nucleic acid binds with a complementary strand through base pairing.
The term "hybridization complex", as used herein, refers to a complex formed between two nucleic acid sequences by virtue of the formation of hydrogen bonds between complementary G and C bases and between complementary A and T bases; these hydrogen bonds may be further stabilized by base stacking interactions. The two complementary nucleic acid sequences hydrogen bond in an antiparallel configuration. A hybridization complex may be formed in solution (e.g., C0 t or R0 t analysis) or between one nucleic acid sequence present in solution and another nucleic acid sequence immobilized on a solid support (e.g., paper, membranes, filters, chips, pins or glass slides, or any other appropriate substrate to which cells or their nucleic acids have been fixed).
An "insertion" or "addition", as used herein, refers to a change in an amino acid or nucleotide sequence resulting in the addition of one or more amino acid residues or nucleotides, respectively, as compared to the naturally occurring molecule.
"Microarray" refers to an array of distinct polynucleotides or oligonucleotides synthesized on a substrate, such as paper, nylon or other type of membrane, filter, chip, glass slide, or any other suitable solid support.
The term "modulate", as used herein, refers to a change in the activity of PLBP. For example, modulation may cause an increase or a decrease in protein activity, binding characteristics, or any other biological, functional or immunological properties of PLBP.
"Nucleic acid sequence" as used herein, refers to an oligonucleotide, nucleotide, or polynucleotide, and fragments thereof, and to DNA or RNA of genomic or synthetic origin which may be single- or double-stranded, and represent the sense or antisense strand. "Fragments" are those nucleic acid sequences which are greater than 60 nucleotides in length, and most preferably includes fragments that are at least 100 nucleotides or at least 1000 nucleotides, and at least 10,000 nucleotides in length.
The term "oligonucleotide" refers to a nucleic acid sequence of at least about 6 nucleotides to about 60 nucleotides, preferably about 15 to 30 nucleotides, and more preferably about 20 to 25 nucleotides, which can be used in PCR amplification or a hybridization assay, or a microarray. As used herein, oligonucleotide is substantially equivalent to the terms "amplimers", "primers", "oligomers", and "probes", as commonly defined in the art.
"Peptide nucleic acid", PNA, as used herein, refers to an antisense molecule or anti-gene agent which comprises an oligonucleotide of at least five nucleotides in length linked to a peptide backbone of amino acid residues which ends in lysine. The terminal lysine confers solubility to the composition. PNAs may be pegylated to extend their lifespan in the cell where they preferentially bind complementary single stranded DNA and RNA and stop transcript elongation (Nielsen, P. E. et al. (1993) Anticancer Drug Des. 8:53-63).
The term "portion", as used herein, with regard to a protein (as in "a portion of a given protein") refers to fragments of that protein. The fragments may range in size from five amino acid residues to the entire amino acid sequence minus one amino acid. Thus, a protein "comprising at least a portion of the amino acid sequence of SEQ ID NO:1" encompasses the full-length PLBP and fragments thereof.
The term "sample", as used herein, is used in its broadest sense. A biological sample suspected of containing nucleic acid encoding PLBP, or fragments thereof, or PLBP itself may comprise a bodily fluid, extract from a cell, chromosome, organelle, or membrane isolated from a cell, a cell, genomic DNA, RNA, or cDNA (in solution or bound to a solid support, a tissue, a tissue print, and the like).
The terms "specific binding" or "specifically binding", as used herein, refers to that interaction between a protein or peptide and an agonist, an antibody and an antagonist. The interaction is dependent upon the presence of a particular structure (i.e., the antigenic determinant or epitope) of the protein recognized by the binding molecule. For example, if an antibody is specific for epitope "A", the presence of a protein containing epitope A (or free, unlabeled A) in a reaction containing labeled "A" and the antibody will reduce the amount of labeled A bound to the antibody.
The terms "stringent conditions" or "stringency", as used herein, refer to the conditions for hybridization as defined by the nucleic acid, salt, and temperature. These conditions are well known in the art and may be altered in order to identify or detect identical or related polynucleotide sequences. Numerous equivalent conditions comprising either low or high stringency depend on factors such as the length and nature of the sequence (DNA, RNA, base composition), nature of the target (DNA, RNA, base composition), milieu (in solution or immobilized on a solid substrate), concentration of salts and other components (e.g., formamide, dextran sulfate and/or polyethylene glycol), and temperature of the reactions (within a range from about 5° C. below the melting temperature of the probe to about 20° C. to 25° C. below the melting temperature). One or more factors be may be varied to generate conditions of either low or high stringency different from, but equivalent to, the above listed conditions.
The term "substantially purified", as used herein, refers to nucleic or amino acid sequences that are removed from their natural environment, isolated or separated, and are at least 60% free, preferably 75% free, and most preferably 90% free from other components with which they are naturally associated.
A "substitution", as used herein, refers to the replacement of one or more amino acids or nucleotides by different amino acids or nucleotides, respectively.
"Transformation", as defined herein, describes a process by which exogenous DNA enters and changes a recipient cell. It may occur under natural or artificial conditions using various methods well known in the art. Transformation may rely on any known method for the insertion of foreign nucleic acid sequences into a prokaryotic or eukaryotic host cell. The method is selected based on the type of host cell being transformed and may include, but is not limited to, viral infection, electroporation, heat shock, lipofection, and particle bombardment. Such "transformed" cells include stably transformed cells in which the inserted DNA is capable of replication either as an autonomously replicating plasmid or as part of the host chromosome. They also include cells which transiently express the inserted DNA or RNA for limited periods of time.
A "variant" of PLBP, as used herein, refers to an amino acid sequence that is altered by one or more amino acids. The variant may have "conservative" changes, wherein a substituted amino acid has similar structural or chemical properties, e.g., replacement of leucine with isoleucine. More rarely, a variant may have "nonconservative" changes, e.g., replacement of a glycine with a tryptophan. Analogous minor variations may also include amino acid deletions or insertions, or both. Guidance in determining which amino acid residues may be substituted, inserted, or deleted without abolishing biological or immunological activity may be found using computer programs well known in the art, for example, DNASTAR software.
The invention is based on the discovery of two new human phospholipid binding proteins (collectively referred to as "PLBP" and, individually, as "PLBP1" and "PLBP2"), the polynucleotides encoding PLBP, and the use of these compositions for the diagnosis, prevention, or treatment of disorders associated with fetal development, reproduction, cell proliferation, and the immune response.
Nucleic acids encoding the PLBP1 of the present invention were first identified in Incyte Clone 3014759 from the forearm muscle tissue cDNA library (MUSCNOT07) using a computer search for amino acid sequence alignments. A consensus sequence, SEQ ID NO:2, was derived from the following overlapping and/or extended nucleic acid sequences: Incyte Clones 1308719 (COLNFET02), 1628536 (COLNPOT01), 2922782 (SININOT04), 3014759 (MUSCNOT07), 069945 (HUVESTB01), 1216577 (BRSTTUT01), 340858 (NEUTFMT01), 1628536 (COLNPOT 01), and 812951 (LUNGNOT04).
In one embodiment, the invention encompasses a polypeptide comprising the amino acid sequence of SEQ ID NO:1, as shown in FIGS. 1A, 1B, 1C, 1D, and 1E. PLBP1 is 214 amino acids in length and has a potential protein kinase A or G phosphorylation site at residue S-169, two potential casein kinase II phosphorylation sites at S-7 and S-110, one potential protein kinase C phosphorylation site at residue S-110, and an isoelectric point of 5.51. As shown in FIG. 3, PLBP1 has chemical and structural homology with bovine PC-TP (GI 897693; SEQ ID NO:5). In particular, PLBP1 and bovine PC-TP share 81% amino acid sequence identity, one potential protein kinase A or G phosphorylation site, one potential casein kinase II phosphorylation site, and one potential protein kinase C phosphorylation site. As illustrated by FIGS. 5A and 5B, PLBP1 and bovine PC-TP have rather similar hydrophobicity plots. Northern analysis shows the expression of this sequence in various libraries, at least 55% of which are immortalized or cancerous and at least 29% of which involve immune response. Of particular note is the expression of PLBP1 in lung, gastrointestinal, breast, and prostate tissues; and in fetal, hematopoietic, and tumor tissues.
Nucleic acids encoding the PLBP2 of the present invention were first identified in Incyte Clone 3126479 from the lung cDNA library (LUNGTUT 12) using a computer search for amino acid sequence alignments. A consensus sequence, SEQ ID NO:4, was derived from the following overlapping and/or extended nucleic acid sequences: Incyte Clones 3126479 (LUNGTUT12), 198504 (LUNGAST01), 1603350 (LUNGNOT15), 1375574 (LUNGNOT10), and 1359626 (LUNGNOT12).
In one embodiment, the invention encompasses a polypeptide comprising the amino acid sequence of SEQ ID NO:3, as shown in FIGS. 2A, 2B, and 2C. PLBP2 is 227 amino acids in length and has a potential N-glycosylation site at residue N-169, three potential casein kinase II phosphorylation sites at residues T-21, S-73, and S-101, two potential protein kinase C phosphorylation sites at residues T-4 and S-174, one potential tyrosine kinase phosphorylation site at residue Y-67, a potential signal peptide between residues M-1 and T-21, and an isoelectric point of 5.9. As shown in FIG. 4, PLBP2 has chemical and structural homology with Onchocerca PE-BP D1 (GI 1143527; SEQ ID NO:6). In particular, PLBP2 and Onchocerca PLBP share 30% amino acid sequence identity. Northern analysis shows the expression of this sequence in various libraries, at least 52% of which are immortalized or cancerous and at least 11% of which involve immune response. Of particular note is the expression of PLBP2 in lung, prostate, heart tissues; and in fetal and tumor tissues.
The invention also encompasses PLBP variants. A preferred PLBP variant is one having at least 80%, and more preferably at least 90%, amino acid sequence identity to the PLBP amino acid sequence (SEQ ID NO:1) and which retains at least one biological, immunological or other functional characteristic or activity of PLBP. A most preferred PLBP variant is one having at least 95% amino acid sequence identity to SEQ ID NO:1.
The invention also encompasses polynucleotides which encode PLBP. Accordingly, any nucleic acid sequence which encodes the amino acid sequence of PLBP can be used to produce recombinant molecules which express PLBP. In a particular embodiment, the invention encompasses the polynucleotide comprising the nucleic acid sequence of SEQ ID NO:2 as shown in FIGS. 1A, 1B, 1C, 1D, and 1E. In another embodiment, the invention encompasses the polynucleotide comprising the nucleic acid sequence of SEQ ID NO:4 as shown in FIGS. 2A, 2B, and 2C.
It will be appreciated by those skilled in the art that as a result of the degeneracy of the genetic code, a multitude of nucleotide sequences encoding PLBP, some bearing minimal homology to the nucleotide sequences of any known and naturally occurring gene, may be produced. Thus, the invention contemplates each and every possible variation of nucleotide sequence that could be made by selecting combinations based on possible codon choices. These combinations are made in accordance with the standard triplet genetic code as applied to the nucleotide sequence of naturally occurring PLBP, and all such variations are to be considered as being specifically disclosed.
Although nucleotide sequences which encode PLBP and its variants are preferably capable of hybridizing to the nucleotide sequence of the naturally occurring PLBP under appropriately selected conditions of stringency, it may be advantageous to produce nucleotide sequences encoding PLBP or its derivatives possessing a substantially different codon usage. Codons may be selected to increase the rate at which expression of the peptide occurs in a particular prokaryotic or eukaryotic host in accordance with the frequency with which particular codons are utilized by the host. Other reasons for substantially altering the nucleotide sequence encoding PLBP and its derivatives without altering the encoded amino acid sequences include the production of RNA transcripts having more desirable properties, such as a greater half-life, than transcripts produced from the naturally occurring sequence.
The invention also encompasses production of DNA sequences, or fragments thereof, which encode PLBP and its derivatives, entirely by synthetic chemistry. After production, the synthetic sequence may be inserted into any of the many available expression vectors and cell systems using reagents that are well known in the art. Moreover, synthetic chemistry may be used to introduce mutations into a sequence encoding PLBP or any fragment thereof.
Also encompassed by the invention are polynucleotide sequences that are capable of hybridizing to the claimed nucleotide sequences, and in particular, those shown in SEQ ID NO:2, or SEQ ID NO:4, under various conditions of stringency as taught in Wahl, G. M. and S. L. Berger (1987; Methods Enzymol. 152:399-407) and Kimmel, A. R. (1987; Methods Enzymol. 152:507-511).
Methods for DNA sequencing are well known and generally available in the art and may be used to practice any of the embodiments of the invention. The methods may employ such enzymes as the Klenow fragment of DNA polymerase I, SEQUENASE (U.S. Biochemical Corp, Cleveland, Ohio), Taq polymerase (Perkin Elmer), thermostable T7 polymerase (Amersham, Chicago, Ill.), or combinations of polymerases and proofreading exonucleases such as those found in the ELONGASE Amplification System marketed by Gibco/BRL (Gaithersburg, Md.). Preferably, the process is automated with machines such as the Hamilton Micro Lab 2200 (Hamilton, Reno, Nev.), Peltier Thermal Cycler (PTC200; MJ Research, Watertown, Mass.) and the ABI Catalyst and 373 and 377 DNA Sequencers (Perkin Elmer).
The nucleic acid sequences encoding PLBP may be extended utilizing a partial nucleotide sequence and employing various methods known in the art to detect upstream sequences such as promoters and regulatory elements. For example, one method which may be employed, "restriction-site" PCR, uses universal primers to retrieve unknown sequence adjacent to a known locus (Sarkar, G. (1993) PCR Methods Applic. 2:318-322). In particular, genomic DNA is first amplified in the presence of primer to a linker sequence and a primer specific to the known region. The amplified sequences are then subjected to a second round of PCR with the same linker primer and another specific primer internal to the first one. Products of each round of PCR are transcribed with an appropriate RNA polymerase and sequenced using reverse transcriptase.
Inverse PCR may also be used to amplify or extend sequences using divergent primers based on a known region (Triglia, T. et al. (1988) Nucleic Acids Res. 16:8186). The primers may be designed using commercially available software such as OLIGO 4.06 Primer Analysis software (National Biosciences Inc., Plymouth, Minn.), or another appropriate program, to be 22-30 nucleotides in length, to have a GC content of 50% or more, and to anneal to the target sequence at temperatures about 68°-72° C. The method uses several restriction enzymes to generate a suitable fragment in the known region of a gene. The fragment is then circularized by intramolecular ligation and used as a PCR template.
Another method which may be used is capture PCR which involves PCR amplification of DNA fragments adjacent to a known sequence in human and yeast artificial chromosome DNA (Lagerstrom, M. et al. (1991) PCR Methods Applic. 1:111-119). In this method, multiple restriction enzyme digestions and ligations may also be used to place an engineered double-stranded sequence into an unknown fragment of the DNA molecule before performing PCR.
Another method which may be used to retrieve unknown sequences is that of Parker, J. D. et al. (1991; Nucleic Acids Res. 19:3055-3060). Additionally, one may use PCR, nested primers, and PROMOTERFINDER libraries to walk genomic DNA (Clontech, Palo Alto, Calif.). This process avoids the need to screen libraries and is useful in finding intron/exon junctions.
When screening for full-length cDNAs, it is preferable to use libraries that have been size-selected to include larger cDNAs. Also, random-primed libraries are preferable, in that they will contain more sequences which contain the 5' regions of genes. Use of a randomly primed library may be especially preferable for situations in which an oligo d(T) library does not yield a full-length cDNA. Genomic libraries may be useful for extension of sequence into 5' non-transcribed regulatory regions.
Capillary electrophoresis systems which are commercially available may be used to analyze the size or confirm the nucleotide sequence of sequencing or PCR products. In particular, capillary sequencing may employ flowable polymers for electrophoretic separation, four different fluorescent dyes (one for each nucleotide) which are laser activated, and detection of the emitted wavelengths by a charge coupled device camera. Output/light intensity may be converted to electrical signal using appropriate software (e.g. GENOTYPER and SEQUENCE NAVIGATOR, Perkin Elmer) and the entire process from loading of samples to computer analysis and electronic data display may be computer controlled. Capillary electrophoresis is especially preferable for the sequencing of small pieces of DNA which might be present in limited amounts in a particular sample.
In another embodiment of the invention, polynucleotide sequences or fragments thereof which encode PLBP may be used in recombinant DNA molecules to direct expression of PLBP, fragments or functional equivalents thereof, in appropriate host cells. Due to the inherent degeneracy of the genetic code, other DNA sequences which encode substantially the same or a functionally equivalent amino acid sequence may be produced, and these sequences may be used to clone and express PLBP.
As will be understood by those of skill in the art, it may be advantageous to produce PLBP-encoding nucleotide sequences possessing non-naturally occurring codons. For example, codons preferred by a particular prokaryotic or eukaryotic host can be selected to increase the rate of protein expression or to produce an RNA transcript having desirable properties, such as a half-life which is longer than that of a transcript generated from the naturally occurring sequence.
The nucleotide sequences of the present invention can be engineered using methods generally known in the art in order to alter PLBP encoding sequences for a variety of reasons, including but not limited to, alterations which modify the cloning, processing, and/or expression of the gene product. DNA shuffling by random fragmentation and PCR reassembly of gene fragments and synthetic oligonucleotides may be used to engineer the nucleotide sequences. For example, site-directed mutagenesis may be used to insert new restriction sites, alter glycosylation patterns, change codon preference, produce splice variants, introduce mutations, and so forth.
In another embodiment of the invention, natural, modified, or recombinant nucleic acid sequences encoding PLBP may be ligated to a heterologous sequence to encode a fusion protein. For example, to screen peptide libraries for inhibitors of PLBP activity, it may be useful to encode a chimeric PLBP protein that can be recognized by a commercially available antibody. A fusion protein may also be engineered to contain a cleavage site located between the PLBP encoding sequence and the heterologous protein sequence, so that PLBP may be cleaved and purified away from the heterologous moiety.
In another embodiment, sequences encoding PLBP may be synthesized, in whole or in part, using chemical methods well known in the art (see Caruthers, M. H. et al. (1980) Nucl. Acids Res. Symp. Ser. 215-223, Horn, T. et al. (1980) Nucl. Acids Res. Symp. Ser. 225-232). Alternatively, the protein itself may be produced using chemical methods to synthesize the amino acid sequence of PLBP, or a fragment thereof. For example, peptide synthesis can be performed using various solid-phase techniques (Roberge, J. Y. et al. (1995) Science 269:202-204) and automated synthesis may be achieved, for example, using the ABI 431A Peptide Synthesizer (Perkin Elmer).
The newly synthesized peptide may be substantially purified by preparative high performance liquid chromatography (e.g., Creighton, T. (1983) Proteins, Structures and Molecular Principles, WH Freeman and Co., New York, N.Y.). The composition of the synthetic peptides may be confirmed by amino acid analysis or sequencing (e.g., the Edman degradation procedure; Creighton, supra). Additionally, the amino acid sequence of PLBP, or any part thereof, may be altered during direct synthesis and/or combined using chemical methods with sequences from other proteins, or any part thereof, to produce a variant polypeptide.
In order to express a biologically active PLBP, the nucleotide sequences encoding PLBP or functional equivalents, may be inserted into appropriate expression vector, i.e., a vector which contains the necessary elements for the transcription and translation of the inserted coding sequence.
Methods which are well known to those skilled in the art may be used to construct expression vectors containing sequences encoding PLBP and appropriate transcriptional and translational control elements. These methods include in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. Such techniques are described in Sambrook, J. et al. (1989) Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, Plainview, N.Y., and Ausubel, F. M. et al. (1989) Current Protocols in Molecular Biology, John Wiley & Sons, New York, N.Y.
A variety of expression vector/host systems may be utilized to contain and express sequences encoding PLBP. These include, but are not limited to, microorganisms such as bacteria transformed with recombinant bacteriophage, plasmid, or cosmid DNA expression vectors; yeast transformed with yeast expression vectors; insect cell systems infected with virus expression vectors (e.g., baculovirus); plant cell systems transformed with virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or with bacterial expression vectors (e.g., Ti or pBR322 plasmids); or animal cell systems. The invention is not limited by the host cell employed.
The "control elements" or "regulatory sequences" are those non-translated regions of the vector--enhancers, promoters, 5' and 3' untranslated regions--which interact with host cellular proteins to carry out transcription and translation. Such elements may vary in their strength and specificity. Depending on the vector system and host utilized, any number of suitable transcription and translation elements, including constitutive and inducible promoters, may be used. For example, when cloning in bacterial systems, inducible promoters such as the hybrid lacZ promoter of the BLUESCRIPT phagemid (Stratagene, LaJolla, Calif.) or PSPORT1 plasmid (Gibco BRL) and the like may be used. The baculovirus polyhedrin promoter may be used in insect cells. Promoters or enhancers derived from the genomes of plant cells (e.g., heat shock, RUBISCO; and storage protein genes) or from plant viruses (e.g., viral promoters or leader sequences) may be cloned into the vector. In mammalian cell systems, promoters from mammalian genes or from mammalian viruses are preferable. If it is necessary to generate a cell line that contains multiple copies of the sequence encoding PLBP, vectors based on SV40 or EBV may be used with an appropriate selectable marker.
In bacterial systems, a number of expression vectors may be selected depending upon the use intended for PLBP. For example, when large quantities of PLBP are needed for the induction of antibodies, vectors which direct high level expression of fusion proteins that are readily purified may be used. Such vectors include, but are not limited to, the multifunctional E. coli cloning and expression vectors such as BLUESCRIPT (Stratagene), in which the sequence encoding PLBP may be ligated into the vector in frame with sequences for the amino-terminal Met and the subsequent 7 residues of β-galactosidase so that a hybrid protein is produced; pIN vectors (Van Heeke, G. and S. M. Schuster (1989) J. Biol. Chem. 264:5503-5509); and the like. pGEX vectors (Promega, Madison, Wis.) may also be used to express foreign polypeptides as fusion proteins with glutathione S-transferase (GST). In general, such fusion proteins are soluble and can easily be purified from lysed cells by adsorption to glutathione-agarose beads followed by elution in the presence of free glutathione. Proteins made in such systems may be designed to include heparin, thrombin, or factor XA protease cleavage sites so that the cloned polypeptide of interest can be released from the GST moiety at will.
In the yeast, Saccharomvces cerevisiae, a number of vectors containing constitutive or inducible promoters such as alpha factor, alcohol oxidase, and PGH may be used. For reviews, see Ausubel et al. (supra) and Grant et al. (1987) Methods Enzymol. 153:516-544.
In cases where plant expression vectors are used, the expression of sequences encoding PLBP may be driven by any of a number of promoters. For example, viral promoters such as the 35S and 19S promoters of CaMV may be used alone or in combination with the omega leader sequence from TMV (Takamatsu, N. (1987) EMBO J. 6:307-311). Alternatively, plant promoters such as the small subunit of RUBISCO or heat shock promoters may be used (Coruzzi, G. et al. (1984) EMBO J. 3:1671-1680; Broglie, R. et al. (1984) Science 224:838-843; and Winter, J. et al. (1 991) Results Probl. Cell Differ. 17:85-105). These constructs can be introduced into plant cells by direct DNA transformation or pathogen-mediated transfection. Such techniques are described in a number of generally available reviews (see, for example, Hobbs, S. or Murry, L. E. in McGraw Hill Yearbook of Science and Technology (1992) McGraw Hill, New York, N.Y.; pp. 191-196).
An insect system may also be used to express PLBP. For example, in one such system, Autographa californica nuclear polyhedrosis virus (AcNPV) is used as a vector to express foreign genes in Spodoptera frugiperda cells or in Trichoplusia larvae. The sequences encoding PLBP may be cloned into a non-essential region of the virus, such as the polyhedrin gene, and placed under control of the polyhedrin promoter. Successful insertion of PLBP will render the polyhedrin gene inactive and produce recombinant virus lacking coat protein. The recombinant viruses may then be used to infect, for example, S. frugiperda cells or Trichoplusia larvae in which PLBP may be expressed (Engelhard, E. K. et al. (1 994) Proc. Nat. Acad. Sci. 91:3224-3227).
In mammalian host cells, a number of viral-based expression systems may be utilized. In cases where an adenovirus is used as an expression vector, sequences encoding PLBP may be ligated into an adenovirus transcription/translation complex consisting of the late promoter and tripartite leader sequence. Insertion in a non-essential E1 or E3 region of the viral genome may be used to obtain a viable virus which is capable of expressing PLBP in infected host cells (Logan, J. and Shenk, T. (1984) Proc. Natl. Acad. Sci. 81:3655-3659). In addition, transcription enhancers, such as the Rous sarcoma virus (RSV) enhancer, may be used to increase expression in mammalian host cells.
Human artificial chromosomes (HACs) may also be employed to deliver larger fragments of DNA than can be contained and expressed in a plasmid. HACs of 6 to 10M are constructed and delivered via conventional delivery methods (liposomes, polycationic amino polymers, or vesicles) for therapeutic purposes.
Specific initiation signals may also be used to achieve more efficient translation of sequences encoding PLBP. Such signals include the ATG initiation codon and adjacent sequences. In cases where sequences encoding PLBP, its initiation codon, and upstream sequences are inserted into the appropriate expression vector, no additional transcriptional or translational control signals may be needed. However, in cases where only coding sequence, or a fragment thereof, is inserted, exogenous translational control signals including the ATG initiation codon should be provided. Furthermore, the initiation codon should be in the correct reading frame to ensure translation of the entire insert. Exogenous translational elements and initiation codons may be of various origins, both natural and synthetic. The efficiency of expression may be enhanced by the inclusion of enhancers which are appropriate for the particular cell system which is used, such as those described in the literature (Scharf, D. et al. (1994) Results Probl. Cell Differ. 20:125-162).
In addition, a host cell strain may be chosen for its ability to modulate the expression of the inserted sequences or to process the expressed protein in the desired fashion. Such modifications of the polypeptide include, but are not limited to, acetylation, carboxylation, glycosylation, phosphorylation, lipidation, and acylation. Post-translational processing which cleaves a "prepro" form of the protein may also be used to facilitate correct insertion, folding and/or function. Different host cells which have specific cellular machinery and characteristic mechanisms for post-translational activities (e.g., CHO, HeLa, MDCK, HEK293, and WI38), are available from the American Type Culture Collection (ATCC; 10801 University Boulevard, Manassas Va. 20110-2209) and may be chosen to ensure the correct modification and processing of the foreign protein.
For long-term, high-yield production of recombinant proteins, stable expression is preferred. For example, cell lines which stably express PLBP may be transformed using expression vectors which may contain viral origins of replication and/or endogenous expression elements and a selectable marker gene on the same or on a separate vector. Following the introduction of the vector, cells may be allowed to grow for 1-2 days in an enriched media before they are switched to selective media. The purpose of the selectable marker is to confer resistance to selection, and its presence allows growth and recovery of cells which successfully express the introduced sequences. Resistant clones of stably transformed cells may be proliferated using tissue culture techniques appropriate to the cell type.
Any number of selection systems may be used to recover transformed cell lines. These include, but are not limited to, the herpes simplex virus thymidine kinase (Wigler, M. et al. (1977) Cell 11:223-32) and adenine phosphoribosyltransferase (Lowy, I. et al. (1980) Cell 22:817-23) genes which can be employed in tk- or aprt- cells, respectively. Also, antimetabolite, antibiotic or herbicide resistance can be used as the basis for selection; for example, dhfr which confers resistance to methotrexate (Wigler, M. et al. (1980) Proc. Natl. Acad. Sci. 77:3567-70); npt, which confers resistance to the aminoglycosides, neomycin and G-418 (Colbere-Garapin, F. et al (1981) J. Mol. Biol. 150:1-14); and als or pat, which confer resistance to chlorsulfuron and phosphinotricin acetyltransferase, respectively (Murry, supra). Additional selectable genes have been described, for example, trpB, which allows cells to utilize indole in place of tryptophan, or hisD, which allows cells to utilize histinol in place of histidine (Hartman, S. C. and R. C. Mulligan (1988) Proc. Natl. Acad. Sci. 85:8047-51). Recently, the use of visible markers has gained popularity with such markers as anthocyanins, β glucuronidase and its substrate GUS, and luciferase and its substrate luciferin, being widely used not only to identify transformants, but also to quantify the amount of transient or stable protein expression attributable to a specific vector system (Rhodes, C. A. et al. (1995) Methods Mol. Biol. 55:121-131).
Although the presence/absence of marker gene expression suggests that the gene of interest is also present, its presence and expression may need to be confirmed. For example, if the sequence encoding PLBP is inserted within a marker gene sequence, transformed cells containing sequences encoding PLBP can be identified by the absence of marker gene function. Alternatively, a marker gene can be placed in tandem with a sequence encoding PLBP under the control of a single promoter. Expression of the marker gene in response to induction or selection usually indicates expression of the tandem gene as well.
Alternatively, host cells which contain the nucleic acid sequence encoding PLBP and express PLBP may be identified by a variety of procedures known to those of skill in the art. These procedures include, but are not limited to, DNA-DNA or DNA-RNA hybridizations and protein bioassay or immunoassay techniques which include membrane, solution, or chip based technologies for the detection and/or quantification of nucleic acid or protein.
The presence of polynucleotide sequences encoding PLBP can be detected by DNA--DNA or DNA-RNA hybridization or amplification using probes or fragments or fragments of polynucleotides encoding PLBP. Nucleic acid amplification based assays involve the use of oligonucleotides or oligomers based on the sequences encoding PLBP to detect transformants containing DNA or RNA encoding PLBP.
A variety of protocols for detecting and measuring the expression of PLBP, using either polyclonal or monoclonal antibodies specific for the protein are known in the art. Examples include enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), and fluorescence activated cell sorting (FACS). A two-site, monoclonal-based immunoassay utilizing monoclonal antibodies reactive to two non-interfering epitopes on PLBP is preferred, but a competitive binding assay may be employed. These and other assays are described, among other places, in Hampton, R. et al. (1990; Serological Methods, a Laboratory Manual, APS Press, St Paul, Minn.) and Maddox, D. E. et al. (1983; J. Exp. Med. 158:1211-1216).
A wide variety of labels and conjugation techniques are known by those skilled in the art and may be used in various nucleic acid and amino acid assays. Means for producing labeled hybridization or PCR probes for detecting sequences related to polynucleotides encoding PLBP include oligolabeling, nick translation, end-labeling or PCR amplification using a labeled nucleotide. Alternatively, the sequences encoding PLBP, or any fragments thereof may be cloned into a vector for the production of an mRNA probe. Such vectors are known in the art, are commercially available, and may be used to synthesize RNA probes in vitro by addition of an appropriate RNA polymerase such as T7, T3, or SP6 and labeled nucleotides. These procedures may be conducted using a variety of commercially available kits (Pharmacia & Upjohn, (Kalamazoo, Mich.); Promega (Madison Wis.); and U.S. Biochemical Corp., (Cleveland, Ohio). Suitable reporter molecules or labels, which may be used for ease of detection, include radionuclides, enzymes, fluorescent, chemiluminescent, or chromogenic agents as well as substrates, cofactors, inhibitors, magnetic particles, and the like.
Host cells transformed with nucleotide sequences encoding PLBP may be cultured under conditions suitable for the expression and recovery of the protein from cell culture. The protein produced by a transformed cell may be secreted or contained intracellularly depending on the sequence and/or the vector used. As will be understood by those of skill in the art, expression vectors containing polynucleotides which encode PLBP may be designed to contain signal sequences which direct secretion of PLBP through a prokaryotic or eukaryotic cell membrane. Other constructions may be used to join sequences encoding PLBP to nucleotide sequence encoding a polypeptide domain which will facilitate purification of soluble proteins. Such purification facilitating domains include, but are not limited to, metal chelating peptides such as histidine-tryptophan modules that allow purification on immobilized metals, protein A domains that allow purification on immobilized immunoglobulin, and the domain utilized in the FLAGS extension/affinity purification system (Immunex Corp., Seattle, Wash.). The inclusion of cleavable linker sequences such as those specific for Factor XA or enterokinase (Invitrogen, San Diego, Calif.) between the purification domain and PLBP may be used to facilitate purification. One such expression vector provides for expression of a fusion protein containing PLBP and a nucleic acid encoding 6 histidine residues preceding a thioredoxin or an enterokinase cleavage site. The histidine residues facilitate purification on IMAC (immobilized metal ion affinity chromatography) as described in Porath, J. et al. (1992, Prot. Exp. Purif. 3: 263-281) while the enterokinase cleavage site provides a means for purifying PLBP from the fusion protein. A discussion of vectors which contain fusion proteins is provided in Kroll, D.J. et al. (1993; DNA Cell Biol. 12:441-453).
In addition to recombinant production, fragments of PLBP may be produced by direct peptide synthesis using solid-phase techniques (Merrifield J. (1963) J. Am. Chem. Soc. 85:2149-2154). Protein synthesis may be performed using manual techniques or by automation. Automated synthesis may be achieved, for example, using Applied Biosystems 431A Peptide Synthesizer (Perkin Elmer). Various fragments of PLBP may be chemically synthesized separately and combined using chemical methods to produce the full length molecule.
Chemical and structural homology exists between PLBP1 and bovine PC-TP (GI 897693). In addition, PLBP1 is expressed in lung, gastrointestinal, breast, and prostate tissues; and in fetal, hematopoietic, and tumor tissues. Therefore, PLBP1 appears to play a role in disorders associated with fetal development, reproduction, cell proliferation, and the immune response.
Chemical and structural homology exists among PLBP2, Onchocerca PE-BP (GI 1143527) and human PE-BP (GI 406290). In addition, PLBP2 is expressed in lung, prostate, and heart tissues; and in fetal and tumor tissues. Therefore, PLBP2 appears to play a role in disorders associated with fetal development, reproduction, cell proliferation, and the immune response.
During fetal development, increased expression of PLBP may cause an increase in cell proliferation and dedifferentiation with no adverse effects to the subject. However, in other situations and in adults, increased expression of PLBP may cause an increase in cell proliferation and dedifferentiation which may have detrimental effects. Therefore, in one embodiment, PLBP or a fragment or derivative thereof may be administered to a subject to treat or prevent a disorder associated with fetal development. The term "disorder associated with fetal development" refers to any disorder associated with development or function of a tissue, organ, or system of a subject (such as the brain, adrenal gland, kidney, skeletal or reproductive system). Such disorders include, but are not limited to, renal tubular acidosis, anemia, Cushing's syndrome, achondroplastic dwarfism, Duchenne and Becker muscular dystrophy, epilepsy, gonadal dysgenesis, WAGR syndrome, myelodysplastic syndrome, hereditary mucoepithelial dysplasia, hereditary keratodermas, hereditary neuropathies such as Charcot-Marie-Tooth disease and neurofibromatosis, hypothyroidism, hydrocephalus, seizure disorders such as Syndenham's chorea and cerebral palsy, spinal bifida, congenital glaucoma, cataract, and sensorineural hearing loss.
In another embodiment, a vector capable of expressing PLBP, or a fragment or a derivative thereof, may also be administered to a subject to treat or prevent a disorder of fetal development including, but not limited to, those described above.
In still another embodiment, an agonist which modulates the activity of PLBP may also be administered to a subject to treat or prevent a disorder of fetal development including, but not limited to, those described above.
During fetal development, decreased expression of PLBP may cause an increase in cell proliferation and dedifferentiation with no adverse effects to the subject. However, in other situations and in adults, decreased expression of PLBP may cause an increase in cell proliferation and dedifferentiation which may have detrimental effects. Therefore, in one embodiment, PLBP or a fragment or derivative thereof may be administered to a subject to treat or prevent a disorder associated with reproduction. Such disorders include, but are not limited to, disorders of prolactin production; infertility, including tubal disease, ovulatory defects, and endometriosis; disruptions of the estrous cycle, disruptions of the menstrual cycle, polycystic ovary syndrome, ovarian hyperstimulation syndrome, endometrial and ovarian tumors, autoimmune disorders, ectopic pregnancy, and teratogenesis; cancer of the breast, fibrocystic breast disease, and galactorrhea; disruptions of spermatogenesis, abnormal sperm physiology, cancer of the testis, cancer of the prostate, benign prostatic hyperplasia, and prostatitis; and carcinoma of the male breast and gynecomastia.
In another embodiment, a vector capable of expressing PLBP, or a fragment or a derivative thereof, may also be administered to a subject to treat or prevent a disorder of reproduction including, but not limited to, those described above.
In still another embodiment, an agonist which modulates the activity of PLBP may also be administered to a subject to treat or prevent disorders of reproduction including, but not limited to, those described above.
During fetal development, increased expression of PLBP may cause an increase in cell proliferation and differentiation with no adverse effects to the subject. However, in other situations and in adults, increased expression of PLBP may cause an increase in cell proliferation and differentiation which may have detrimental effects. In one embodiment, an antagonist of PLBP may be administered to a subject to prevent or treat a disorders associated with cell proliferation. Such disorders may include, but are not limited to, cancers including adenocarcinoma, leukemia, lymphoma, melanoma, myeloma, sarcoma, and teratocarcinoma, and particularly cancers of the adrenal gland, bladder, bone, bone marrow, brain, breast, cervix, gall bladder, ganglia, gastrointestinal tract, heart, kidney, liver, lung, muscle, ovary, pancreas, paratbyroid, penis, prostate, salivary glands, skin, spleen, testis, thymus, thyroid, and uterus. In one aspect, an antibody which specifically binds PLBP may be used directly as an antagonist or indirectly as a targeting or delivery mechanism for bringing a pharmaceutical agent to cells or tissue which express PLBP.
In another embodiment, a vector expressing the complement of the polynucleotide encoding PLBP may be administered to a subject to treat or prevent a disorder associated with cell proliferation including, but not limited to, those described above.
In one embodiment, an antagonist of PLBP may be administered to a subject to prevent or treat a disorder associated with the immune response. Such disorders may include, but are not limited to, AIDS, Addison's disease, adult respiratory distress syndrome, allergies, anemia, asthma, arteriosclerosis, atherosclerosis, bronchitis, bursitis, cholecystitis, cirrhosis, Crohn's disease, ulcerative colitis, atopic dermatitis, dermatomyositis, diabetes mellitus, emphysema, erythema nodosum, atrophic gastritis, glomerulonephritis, gout, Graves' disease, hypereosinophilia, irritable bowel syndrome, lupus erythematosus, mixed connective tissue disease, multiple sclerosis, myasthenia gravis, myelofibrosis, myocardial or pericardial inflammation, osteoarthritis, osteoporosis, pancreatitis, psoriasis, polymyositis, rheumatoid arthritis, scleroderma, Sjogren's syndrome, and autoimmune thyroiditis; complications of cancer, hemodialysis, and extracorporeal circulation; viral, bacterial, fungal, parasitic, protozoal, and helminthic infections; and trauma. In one aspect, an antibody which specifically binds PLBP may be used directly as an antagonist or indirectly as a targeting or delivery mechanism for bringing a pharmaceutical agent to cells or tissue which express PLBP.
In another embodiment, a vector expressing the complement of the polynucleotide encoding PLBP may be administered to a subject to treat or prevent a disorders associated with the immune response including, but not limited to, those described above.
In other embodiments, any of the proteins, antagonists, antibodies, agonists, complementary sequences or vectors of the invention may be administered in combination with other appropriate therapeutic agents. Selection of the appropriate agents for use in combination therapy may be made by one of ordinary skill in the art, according to conventional pharmaceutical principles. The combination of therapeutic agents may act synergistically to effect the treatment or prevention of the various disorders described above. Using this approach, one may be able to achieve therapeutic efficacy with lower dosages of each agent, thus reducing the potential for adverse side effects.
An antagonist of PLBP may be produced using methods which are generally known in the art. In particular, purified PLBP may be used to produce antibodies or to screen libraries of pharmaceutical agents to identify those which specifically bind PLBP.
Antibodies to PLBP may be generated using methods that are well known in the art. Such antibodies may include, but are not limited to, polyclonal, monoclonal, chimeric, single chain, Fab fragments, and fragments produced by a Fab expression library. Neutralizing antibodies, (i.e., those which inhibit dimer formation) are especially preferred for therapeutic use.
For the production of antibodies, various hosts including goats, rabbits, rats, mice, humans, and others, may be immunized by injection with PLBP or any fragment or oligopeptide thereof which has immunogenic properties. Depending on the host species, various adjuvants may be used to increase immunological response. Such adjuvants include, but are not limited to, Freund's, mineral gels such as aluminum hydroxide, and surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides; oil emulsions, keyhole limpet hemocyanin, and dinitrophenol. Among adjuvants used in humans, BCG (bacilli Calmette-Guerin) and Corynebacterium parvum are especially preferable.
It is preferred that the oligopeptides, peptides, or fragments used to induce antibodies to PLBP have an amino acid sequence consisting of at least five amino acids and more preferably at least 10 amino acids. It is also preferable that they are identical to a portion of the amino acid sequence of the natural protein, and they may contain the entire amino acid sequence of a small, naturally occurring molecule. Short stretches of PLBP amino acids may be fused with those of another protein such as keyhole limpet hemocyanin and antibody produced against the chimeric molecule.
Monoclonal antibodies to PLBP may be prepared using any technique which provides for the production of antibody molecules by continuous cell lines in culture. These include, but are not limited to, the hybridoma technique, the human B-cell hybridoma technique, and the EBV-hybridoma technique (Kohler, G. et al. (1975) Nature 256:495-497; Kozbor, D. et al. (1985) J. Immunol. Methods 81:31-42; Cote, R. J. et al. (1983) Proc. Natl. Acad. Sci. 80:2026-2030; Cole, S. P. et al. (1984) Mol. Cell Biol. 62:109-120).
In addition, techniques developed for the production of "chimeric antibodies", the splicing of mouse antibody genes to human antibody genes to obtain a molecule with appropriate antigen specificity and biological activity can be used (Morrison, S. L. et al. (1984) Proc. Natl. Acad. Sci. 81:6851-6855; Neuberger, M. S. et al. (1984) Nature 312:604-608; Takeda, S. et al. (1985) Nature 314:452-454). Alternatively, techniques described for the production of single chain antibodies may be adapted, using methods known in the art, to produce PLBP-specific single chain antibodies. Antibodies with related specificity, but of distinct idiotypic composition, may be generated by chain shuffling from random combinatorial immunoglobulin libraries (Burton D. R. (1991) Proc. Natl. Acad. Sci. 88:11120-3).
Antibodies may also be produced by inducing, in vivo production in the lymphocyte population or by screening immunoglobulin libraries or panels of highly specific binding reagents as disclosed in the literature (Orlandi, R. et al. (1989) Proc. Natl. Acad. Sci. 86: 3833-3837; Winter, G. et al. (1991) Nature 349:293-299).
Antibody fragments which contain specific binding sites for PLBP may also be generated. For example, such fragments include, but are not limited to, the F(ab')2 fragments which can be produced by pepsin digestion of the antibody molecule and the Fab fragments which can be generated by reducing the disulfide bridges of the F(ab')2 fragments. Alternatively, Fab expression libraries may be constructed to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity (Huse, W. D. et al. (1989) Science 254:1275-1281).
Various immunoassays may be used for screening to identify antibodies having the desired specificity. Numerous protocols for competitive binding or immunoradiometric assays using either polyclonal or monoclonal antibodies with established specificities are well known in the art. Such immunoassays typically involve the measurement of complex formation between PLBP and its specific antibody. A two-site, monoclonal-based immunoassay utilizing monoclonal antibodies reactive to two non-interfering PLBP epitopes is preferred, but a competitive binding assay may also be employed (Maddox, supra).
In another embodiment of the invention, the polynucleotides encoding PLBP, or any fragment or complement thereof, may be used for therapeutic purposes. In one aspect, the complement of the polynucleotide encoding PLBP may be used in situations in which it would be desirable to block the transcription of the mRNA. In particular, cells may be transformed with sequences complementary to polynucleotides encoding PLBP. Thus, complementary molecules or fragments may be used to modulate PLBP activity, or to achieve regulation of gene function. Such technology is now well known in the art, and sense or antisense oligonucleotides or larger fragments, can be designed from various locations along the coding or control regions of sequences encoding PLBP.
Expression vectors derived from retroviruses, adenovirus, herpes or vaccinia viruses, or from various bacterial plasmids may be used for delivery of nucleotide sequences to the targeted organ, tissue or cell population. Methods which are well known to those skilled in the art can be used to construct vectors which will express nucleic acid sequence which is complementary to the polynucleotides of the gene encoding PLBP. These techniques are described both in Sambrook et al. (supra) and in Ausubel et al. (supra).
Genes encoding PLBP can be turned off by transforming a cell or tissue with expression vectors which express high levels of a polynucleotide or fragment thereof which encodes PLBP. Such constructs may be used to introduce untranslatable sense or antisense sequences into a cell. Even in the absence of integration into the DNA, such vectors may continue to transcribe RNA molecules until they are disabled by endogenous nucleases. Transient expression may last for a month or more with a non-replicating vector and even longer if appropriate replication elements are part of the vector system.
As mentioned above, modifications of gene expression can be obtained by designing complementary sequences or antisense molecules (DNA, RNA, or PNA) to the control, 5' or regulatory regions of the gene encoding PLBP (signal sequence, promoters, enhancers, and introns). Oligonucleotides derived from the transcription initiation site, e.g., between positions -10 and +10 from the start site, are preferred. Similarly, inhibition can be achieved using "triple helix" base-pairing methodology. Triple helix pairing is useful because it causes inhibition of the ability of the double helix to open sufficiently for the binding of polymcrases, transcription factors, or regulatory molecules. Recent therapeutic advances using triplex DNA have been described in the literature (Gee, J. E. et al. (1994) In: Huber, B. E. and B. I. Carr, Molecular and Immunologic Approaches, Futura Publishing Co., Mt. Kisco, N.Y.). The complementary sequence or antisense molecule may also be designed to block translation of mRNA by preventing the transcript from binding to ribosomes.
Ribozymes, enzymatic RNA molecules, may also be used to catalyze the specific cleavage of RNA. The mechanism of ribozyme action involves sequence-specific hybridization of the ribozyme molecule to complementary target RNA, followed by endonucleolytic cleavage. Examples which may be used include engineered hammerhead motif ribozyme molecules that can specifically and efficiently catalyze endonucleolytic cleavage of sequences encoding PLBP.
Specific ribozyme cleavage sites within any potential RNA target are initially identified by scanning the target molecule for ribozyme cleavage sites which include the following sequences: GUA, GUU, and GUC. Once identified, short RNA sequences of between 15 and 20 ribonucleotides corresponding to the region of the target gene containing to the cleavage site may be evaluated for secondary structural features which may render the oligonucleotide inoperable. The suitability of candidate targets may also be evaluated by testing accessibility to hybridization with complementary oligonucleotides using ribonuclease protection assays.
Complementary ribonucleic acid molecules and ribozymes of the invention may be prepared by any method known in the art for the synthesis of nucleic acid molecules. These include techniques for chemically synthesizing oligonucleotides such as solid phase phosphoramidite chemical synthesis. Alternatively, RNA molecules may be generated by in vitro and in vivo transcription of DNA sequences encoding PLBP. Such DNA sequences may be incorporated into a wide variety of vectors with suitable RNA polymerase promoters such as T7 or SP6. Alternatively, these cDNA constructs that synthesize complementary RNA constitutively or inducibly can be introduced into cell lines, cells, or tissues.
RNA molecules may be modified to increase intracellular stability and half-life. Possible modifications include, but are not limited to, the addition of flanking sequences at the 5' and/or 3' ends of the molecule or the use of phosphorothioate or 2' O-methyl rather than phosphodiesterase linkages within the backbone of the molecule. This concept is inherent in the production of PNAs and can be extended in all of these molecules by the inclusion of nontraditional bases such as inosine, queosine, and wybutosine, as well as acetyl-, methyl-, thio-, and similarly modified forms of adenine, cytidine, guanine, thymine, and uridine which are not as easily recognized by endogenous endonucleases.
Many methods for introducing vectors into cells or tissues are available and equally suitable for use in vivo, in vitro. and ex vivo. For ex vivo therapy, vectors may be introduced into stem cells taken from the patient and clonally propagated for autologous transplant back into that same patient. Delivery by transfection, by liposome injections or polycationic amino polymers (Goldman, C. K. et al. (1997) Nature Biotechnology 15:462-66; incorporated herein by reference) may be achieved using methods which are well known in the art.
Any of the therapeutic methods described above may be applied to any subject in need of such therapy, including, for example, mammals such as dogs, cats, cows, horses, rabbits, monkeys, and most preferably, humans.
An additional embodiment of the invention relates to the administration of a pharmaceutical composition, in conjunction with a pharmaceutically acceptable carrier, for any of the therapeutic effects discussed above. Such pharmaceutical compositions may consist of PLBP, antibodies to PLBP, mimetics, agonists, antagonists, or inhibitors of PLBP. The compositions may be administered alone or in combination with at least one other agent, such as stabilizing compound, which may be administered in any sterile, biocompatible pharmaceutical carrier, including, but not limited to, saline, buffered saline, dextrose, and water. The compositions may be administered to a patient alone, or in combination with other agents, drugs or hormones.
The pharmaceutical compositions utilized in this invention may be administered by any number of routes including, but not limited to, oral, intravenous, intramuscular, intra-arterial, intramedullary, intrathecal, intraventricular, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual, or rectal means.
In addition to the active ingredients, these pharmaceutical compositions may contain suitable pharmaceutically-acceptable carriers comprising excipients and auxiliaries which facilitate processing of the active compounds into preparations which can be used pharmaceutically. Further details on techniques for formulation and administration may be found in the latest edition of Remington's Pharmaceutical Sciences (Maack Publishing Co., Easton, Pa.).
Pharmaceutical compositions for oral administration can be formulated using pharmaceutically acceptable carriers well known in the art in dosages suitable for oral administration. Such carriers enable the pharmaceutical compositions to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for ingestion by the patient.
Pharmaceutical preparations for oral use can be obtained through combination of active compounds with solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores. Suitable excipients are carbohydrate or protein fillers, such as sugars, including lactose, sucrose, mannitol, or sorbitol; starch from corn, wheat, rice, potato, or other plants; cellulose, such as methyl cellulose, hydroxypropylmethyl-cellulose, or sodium carboxymethylcellulose; gums including arabic and tragacanth; and proteins such as gelatin and collagen. If desired, disintegrating or solubilizing agents may be added, such as the cross-linked polyvinyl pyrrolidone, agar, alginic acid, or a salt thereof, such as sodium alginate.
Dragee cores may be used in conjunction with suitable coatings, such as concentrated sugar solutions, which may also contain gum arabic, talc, polyvinylpyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures. Dyestuffs or pigments may be added to the tablets or dragee coatings for product identification or to characterize the quantity of active compound, i.e., dosage.
Pharmaceutical preparations which can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a coating, such as glycerol or sorbitol. Push-fit capsules can contain active ingredients mixed with a filler or binders, such as lactose or starches, lubricants, such as talc or magnesium stearate, and, optionally, stabilizers. In soft capsules, the active compounds may be dissolved or suspended in suitable liquids, such as fatty oils, liquid, or liquid polyethylene glycol with or without stabilizers.
Pharmaceutical formulations suitable for parenteral administration may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hanks' solution, Ringer's solution, or physiologically buffered saline. Aqueous injection suspensions may contain substances which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. Additionally, suspensions of the active compounds may be prepared as appropriate oily injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes. Non-lipid polycationic amino polymers may also be used for delivery. Optionally, the suspension may also contain suitable stabilizers or agents which increase the solubility of the compounds to allow for the preparation of highly concentrated solutions.
For topical or nasal administration, penetrants appropriate to the particular barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
The pharmaceutical compositions of the present invention may be manufactured in a manner that is known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping, or lyophilizing processes.
The pharmaceutical composition may be provided as a salt and can be formed with many acids, including but not limited to, hydrochloric, sulfuric, acetic, lactic, tartaric, malic, succinic, etc. Salts tend to be more soluble in aqueous or other protonic solvents than are the corresponding free base forms. In other cases, the preferred preparation may be a lyophilized powder which may contain any or all of the following: 1-50 mM histidine, 0.1%-2% sucrose, and 2-7% mannitol, at a pH range of 4.5 to 5.5, that is combined with buffer prior to use.
After pharmaceutical compositions have been prepared, they can be placed in an appropriate container and labeled for treatment of an indicated condition. For administration of PLBP, such labeling would include amount, frequency, and method of administration.
Pharmaceutical compositions suitable for use in the invention include compositions wherein the active ingredients are contained in an effective amount to achieve the intended purpose. The determination of an effective dose is well within the capability of those skilled in the art.
For any compound, the therapeutically effective dose can be estimated initially either in cell culture assays, e.g., of neoplastic cells, or in animal models, usually mice, rabbits, dogs, or pigs. The animal model may also be used to determine the appropriate concentration range and route of administration. Such information can then be used to determine useful doses and routes for administration in humans.
A therapeutically effective dose refers to that amount of active ingredient, for example PLBP or fragments thereof, antibodies of PLBP, agonists, antagonists or inhibitors of PLBP, which ameliorates the symptoms or condition. Therapeutic efficacy and toxicity may be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., ED50 (the dose therapeutically effective in 50% of the population) and LD50 (the dose lethal to 50% of the population). The dose ratio of toxic to therapeutic effects is the therapeutic index, and it can be expressed as the ratio, LD50/ED50. Pharmaceutical compositions which exhibit large therapeutic indices are preferred. The data obtained from cell culture assays and animal studies is used in formulating a range of dosage for human use. The dosage contained in such compositions is preferably within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage varies within this range depending upon the dosage form employed, sensitivity of the patient, and the route of administration.
The exact dosage will be determined by the practitioner, in light of factors related to the subject that requires treatment. Dosage and administration are adjusted to provide sufficient levels of the active moiety or to maintain the desired effect. Factors which may be taken into account include the severity of the disease state, general health of the subject, age, weight, and gender of the subject, diet, time and frequency of administration, drug combination(s), reaction sensitivities, and tolerance/response to therapy. Long-acting pharmaceutical compositions may be administered every 3 to 4 days, every week, or once every two weeks depending on half-life and clearance rate of the particular formulation.
Normal dosage amounts may vary from 0.1 to 100,000 micrograms, up to a total dose of about 1 g, depending upon the route of administration. Guidance as to particular dosages and methods of delivery is provided in the literature and generally available to practitioners in the art. Those skilled in the art will employ different formulations for nucleotides than for proteins or their inhibitors. Similarly, delivery of polynucleotides or polypeptides will be specific to particular cells, conditions, locations, etc.
In another embodiment, antibodies which specifically bind PLBP may be used for the diagnosis of conditions or diseases characterized by expression of PLBP, or in assays to monitor patients being treated with PLBP, agonists, antagonists or inhibitors. The antibodies useful for diagnostic purposes may be prepared in the same manner as those described above for therapeutics. Diagnostic assays for PLBP include methods which utilize the antibody and a label to detect PLBP in human body fluids or extracts of cells or tissues. The antibodies may be used with or without modification, and may be labeled by joining them, either covalently or non-covalently, with a reporter molecule. A wide variety of reporter molecules which are known in the art may be used, several of which are described above.
A variety of protocols including ELISA, RIA, and FACS for measuring PLBP are known in the art and provide a basis for diagnosing altered or abnormal levels of PLBP expression. Normal or standard values for PLBP expression are established by combining body fluids or cell extracts taken from normal mammalian subjects, preferably human, with antibody to PLBP under conditions suitable for complex formation. The amount of standard complex formation may be quantified by various methods, but preferably by photometri, means. Quantities of PLBP expressed in subject samples, control and disease, from biopsied tissues are compared with the standard values. Deviation between standard and subject values establishes the parameters for diagnosing disease.
In another embodiment of the invention, the polynucleotides encoding PLBP may be used for diagnostic purposes. The polynucleotides which may be used include oligonucleotide sequences, complementary RNA and DNA molecules, and PNAs. The polynucleotides may be used to detect and quantitate gene expression in biopsied tissues in which expression of PLBP may be correlated with disease. The diagnostic assay may be used to distinguish between absence, presence, and excess expression of PLBP, and to monitor regulation of PLBP levels during therapeutic intervention.
In one aspect, hybridization with PCR probes which are capable of detecting polynucleotide sequences, including genomic sequences, encoding PLBP or closely related molecules, may be used to identify nucleic acid sequences which encode PLBP. The specificity of the probe, whether it is made from a highly specific region, e.g., 10 unique nucleotides in the 5' regulatory region, or a less specific region, e.g., especially in the 3' coding region, and the stringency of the hybridization or amplification (maximal, high, intermediate, or low) will determine whether the probe identifies only naturally occurring sequences encoding PLBP, alleles, or related sequences.
Probes may also be used for the detection of related sequences, and should preferably contain at least 50% of the nucleotides from any of the PLBP encoding sequences. The hybridization probes of the subject invention may be DNA or RNA and derived from the nucleotide sequence of SEQ ID NO:2 or SEQ ID NO:4 or from genomic sequence including promoter, enhancer elements, and introns of the naturally occurring PLBP.
Means for producing specific hybridization probes for DNAs encoding PLBP include the cloning of nucleic acid sequences encoding PLBP or PLBP derivatives into vectors for the production of mRNA probes. Such vectors are known in the art, commercially available, and may be used to synthesize RNA probes in vitro by means of the addition of the appropriate RNA polymerases and the appropriate labeled nucleotides. Hybridization probes may be labeled by a variety of reporter groups, for example, radionuclides such as 32P or 35S, or enzymatic labels, such as alkaline phosphatase coupled to the probe via avidin/biotin coupling systems, and the like.
Polynucleotide sequences encoding PLBP may be used for the diagnosis of conditions or disorders which are associated with expression of PLBP. Examples of such conditions or disorders include a disorder associated with fetal development such as renal tubular acidosis, anemia, Cushing's syndrome, achondroplastic dwarfism, Duchenne and Becker muscular dystrophy, epilepsy, gonadal dysgenesis, WAGR syndrome, myelodysplastic syndrome, hereditary mucoepithelial dysplasia, hereditary keratodermas, hereditary neuropathies such as Charcot-Marie-Tooth disease and neurofibromatosis, hypothyroidism, hydrocephalus, seizure disorders such as Syndenham's chorea and cerebral palsy, spinal bifida, congenital glaucoma, cataract, and sensorineural hearing loss; with reproduction such as disorders of prolactin production; infertility, including tubal disease, ovulatory defects, and endometriosis; disruptions of the estrous cycle, disruptions of the menstrual cycle, polycystic ovary syndrome, ovarian hyperstimulation syndrome, endometrial and ovarian tumors, autoimmune disorders, ectopic pregnancy, and teratogenesis; cancer of the breast, fibrocystic breast disease, and galactorrhea; disruptions of spermatogenesis, abnormal sperm physiology, cancer of the testis, cancer of the prostate, benign prostatic hyperplasia, and prostatitis; and carcinoma of the male breast and gynecomastia; with cell proliferation such as cancers including adenocarcinoma, leukemia, lymphoma, melanoma, myeloma, sarcoma, and teratocarcinoma, and particularly cancers of the adrenal gland, bladder, bone, bone marrow, brain, cervix, gall bladder, ganglia, gastrointestinal tract, heart, kidney, liver, lung, muscle, pancreas, parathyroid, penis, salivary glands, skin, spleen, thymus, thyroid, and uterus; and with the immune response such as AIDS, Addison's disease, adult respiratory distress syndrome, allergies, anemia, asthma, arteriosclerosis, atherosclerosis, bronchitis, bursitis, cholecystitis, cirrhosis, Crohn's disease, ulcerative colitis, atopic dermatitis, dermatomyositis, diabetes mellitus, emphysema, erythema nodosum, atrophic gastritis, glomerulonephritis, gout, Graves' disease, hypereosinophilia, irritable bowel syndrome, lupus erythematosus, mixed connective tissue disease, multiple sclerosis, myasthenia gravis, myelofibrosis, myocardial or pericardial inflammation, osteoarthritis, osteoporosis, pancreatitis, psoriasis, polymyositis, rheumatoid arthritis, scleroderma, Sjogren's syndrome, and autoimmune thyroiditis; complications of cancer, hemodialysis, and extracorporeal circulation; viral, bacterial, fungal, parasitic, protozoal, and helminthic infections; and trauma. The polynucleotide sequences encoding PLBP may be used in Southern or northern analysis, dot blot, or other membrane-based technologies; in PCR technologies; or in dipstick, pin, ELISA assays or microarrays utilizing fluids or tissues from patient biopsies to detect altered PLBP expression. Such qualitative or quantitative methods are well known in the art.
In a particular aspect, the nucleotide sequences encoding PLBP may be useful in assays that detect activation or induction of various cancers, particularly those mentioned above. The nucleotide sequences encoding PLBP may be labeled by standard methods, and added to a fluid or tissue sample from a patient under conditions suitable for the formation of hybridization complexes. After a suitable incubation period, the sample is washed and the signal is quantitated and compared with a standard value. If the amount of signal in the biopsied or extracted sample is significantly altered from that of a comparable control sample, the nucleotide sequences have hybridized with nucleotide sequences in the sample, and the presence of altered levels of nucleotide sequences encoding PLBP in the sample indicates the presence of the associated disease. Such assays may also be used to evaluate the efficacy of a particular therapeutic treatment regimen in animal studies, in clinical trials, or in monitoring the treatment of an individual patient.
In order to provide a basis for the diagnosis of disease associated with expression of PLBP, a normal or standard profile for expression is established. This may be accomplished by combining body fluids or cell extracts taken from normal subjects, either animal or human, with a sequence, or a fragment thereof, which encodes PLBP, under conditions suitable for hybridization or amplification. Standard hybridization may be quantified by comparing the values obtained from normal subjects with those from an experiment where a known amount of a substantially purified polynucleotide is used. Standard values obtained from normal samples may be compared with values obtained from samples from patients who are symptomatic for disease. Deviation between standard and subject values is used to establish the presence of disease.
Once disease is established and a treatment protocol is initiated, hybridization assays may be repeated on a regular basis to evaluate whether the level of expression in the patient begins to approximate that which is observed in the normal patient. The results obtained from successive assays may be used to show the efficacy of treatment over a period ranging from several days to months.
With respect to cancer, the presence of a relatively high amount of transcript in biopsied tissue from an individual may indicate a predisposition for the development of the disease, or may provide a means for detecting the disease prior to the appearance of actual clinical symptoms. A more definitive diagnosis of this type may allow health professionals to employ preventative measures or aggressive treatment earlier thereby preventing the development or further progression of the cancer.
Additional diagnostic uses for oligonucleotides designed from the sequences encoding PLBP may involve the use of PCR. Such oligomers may be chemically synthesized, generated enzymatically, or produced in vitro. Oligomers will preferably consist of two nucleotide sequences, one with sense orientation (5'→3') and another with antisense (3'←5'), employed under optimized conditions for identification of a specific gene or condition. The same two oligomers, nested sets of oligomers, or even a degenerate pool of oligomers may be employed under less stringent conditions for detection and/or quantitation of closely related DNA or RNA sequences.
Methods which may also be used to quantitate the expression of PLBP include radiolabeling or biotinylating nucleotides, coamplification of a control nucleic acid, and standard curves onto which the experimental results are interpolated (Melby, P. C. et al. (1 993) J. Immunol. Methods, 159:235-244; Duplaa, C. et al. (1993) Anal. Biochem. 229-236). The speed of quantitation of multiple samples may be accelerated by running the assay in an ELISA format where the oligomer of interest is presented in various dilutions and a spectrophotometric or colorimetric response gives rapid quantitation.
In further embodiments, an oligonucleotide derived from any of the polynucleotide sequences described herein may be used as a target in a microarray. The microarray can be used to monitor the expression level of large numbers of genes simultaneously (to produce a transcript image), and to identify genetic variants, mutations and polymorphisms. This information will be useful in determining gene function, understanding the genetic basis of disease, diagnosing disease, and in developing and monitoring the activity of therapeutic agents (Heller, R. et al. (1997) Proc. Natl. Acad. Sci. 94:2150-55).
In one embodiment, the microarray is prepared and used according to the methods described in PCT application WO95/11995 (Chee et al.), Lockhart, D. J. et al. (1996; Nat. Biotech. 14: 1675-1680) and Schena, M. et al. (1996; Proc. Natl. Acad. Sci. 93: 10614-10619), all of which are incorporated herein in their entirety by reference.
The microarray is preferably composed of a large number of unique, single-stranded nucleic acid sequences, usually either synthetic antisense oligonucleotides or fragments of cDNAs, fixed to a solid support. The oligonucleotides are preferably about 6-60 nucleotides in length, more preferably 15-30 nucleotides in length, and most preferably about 20-25 nucleotides in length. For a certain type of microarray, it may be preferable to use oligonucleotides which are only 7-10 nucleotides in length. The microarray may contain oligonucleotides which cover the known 5', or 3', sequence, sequential oligonucleotides which cover the full length sequence; or unique oligonucleotides selected from particular areas along the length of the sequence. Polynucleotides used in the microarray may be oligonucleotides that are specific to a gene or genes of interest in which at least a fragment of the sequence is known or that are specific to one or more unidentified cDNAs which are common to a particular cell type, developmental or disease state.
In order to produce oligonucleotides to a known sequence for a microarray, the gene of interest is examined using a computer algorithm which starts at the 5' or more preferably at the 3' end of the nucleotide sequence. The algorithm identifies oligomers of defined length that are unique to the gene, have a GC content within a range suitable for hybridization, and lack predicted secondary structure that may interfere with hybridization. In certain situations it may be appropriate to use pairs of oligonucleotides on a microarray. The "pairs" will be identical, except for one nucleotide which preferably is located in the center of the sequence. The second oligonucleotide in the pair (mismatched by one) serves as a control. The number of oligonucleotide pairs may range from two to one million. The oligomers are synthesized at designated areas on a substrate using a light-directed chemical process. The substrate may be paper, nylon or other type of membrane, filter, chip, glass slide or any other suitable solid support.
In another aspect, an oligonucleotide may be synthesized on the surface of the substrate by using a chemical coupling procedure and an ink jet application apparatus, as described in PCT application WO95/25 1116 (Baldeschweiler et al.) which is incorporated herein in its entirety by reference. In another aspect, a "gridded" array analogous to a dot (or slot) blot may be used to arrange and link cDNA fragments or oligonucleotides to the surface of a substrate using a vacuum system, thermal, UV, mechanical or chemical bonding procedures. An array, such as those described above, may be produced by hand or by using available devices (slot blot or dot blot apparatus), materials (any suitable solid support), and machines (including robotic instruments), and may contain 8, 24, 96, 384, 1536 or 6144 oligonucleotides, or any other number between two and one million which lends itself to the efficient use of commercially available instrumentation.
In order to conduct sample analysis using a microarray, the RNA or DNA from a biological sample is made into hybridization probes. The mRNA is isolated, and cDNA is produced and used as a template to make antisense RNA (aRNA). The aRNA is amplified in the presence of fluorescent nucleotides, and labeled probes are incubated with the microarray so that the probe sequences hybridize to complementary oligonucleotides of the microarray. Incubation conditions are adjusted so that hybridization occurs with precise complementary matches or with various degrees of less complementarity. After removal of nonhybridized probes, a scanner is used to determine the levels and patterns of fluorescence. The scanned images are examined to determine degree of complementarity and the relative abundance of each oligonucleotide sequence on the microarray. The biological samples may be obtained from any bodily fluids (such as blood, urine, saliva, phlegm, gastric juices, etc.), cultured cells, biopsies, or other tissue preparations. A detection system may be used to measure the absence, presence, and amount of hybridization for all of the distinct sequences simultaneously. This data may be used for large scale correlation studies on the sequences, mutations, variants, or polymorphisms among samples.
In another embodiment of the invention, the nucleic acid sequences which encode PLBP may also be used to generate hybridization probes which are useful for mapping the naturally occurring genomic sequence. The sequences may be mapped to a particular chromosome, to a specific region of a chromosome or to artificial chromosome constructions, such as human artificial chromosomes (HACs), yeast artificial chromosomes (YACs), bacterial artificial chromosomes (BACs), bacterial P1 constructions or single chromosome cDNA libraries as reviewed in Price, C. M. (1993) Blood Rev. 7:127-134, and Trask, B. J. (1991) Trends Genet. 7:149-154.
Fluorescent in situ hybridization (FISH as described in Verma et al. (1988) Human Chromosomes: A Manual of Basic Techniques, Pergamon Press, New York, N.Y.) may be correlated with other physical chromosome mapping techniques and genetic map data. Examples of genetic map data can be found in various scientific journals or at Online Mendelian Inheritance in Man (OMIM). Correlation between the location of the gene encoding PLBP on a physical chromosomal map and a specific disease, or predisposition to a specific disease, may help delimit the region of DNA associated with that genetic disease. The nucleotide sequences of the subject invention may be used to detect differences in gene sequences between normal, carrier, or affected individuals.
In situ hybridization of chromosomal preparations and physical mapping techniques such as linkage analysis using established chromosomal markers may be used for extending genetic maps. Often the placement of a gene on the chromosome of another mammalian species, such as mouse, may reveal associated markers even if the number or arm of a particular human chromosome is not known. New sequences can be assigned to chromosomal arms, or parts thereof, by physical mapping. This provides valuable information to investigators searching for disease genes using positional cloning or other gene discovery techniques. Once the disease or syndrome has been crudely localized by genetic linkage to a particular genomic region, for example, AT to 11q22-23 (Gatti, R. A. et al. (1988) Nature 336:577-580), any sequences mapping to that area may represent associated or regulatory genes for further investigation. The nucleotide sequence of the subject invention may also be used to detect differences in the chromosomal location due to translocation, inversion, etc. among normal, carrier, or affected individuals.
In another embodiment of the invention, PLBP, its catalytic or immunogenic fragments or oligopeptides thereof, can be used for screening libraries of compounds in any of a variety of drug screening techniques. The fragment employed in such screening may be free in solution, affixed to a solid support, borne on a cell surface, or located intracellularly. The formation of binding complexes, between PLBP and the agent being tested, may be measured.
Another technique for drug screening which may be used provides for high throughput screening of compounds having suitable binding affinity to the protein of interest as described in published PCT application WO84/03564. In this method, as applied to PLBP large numbers of different small test compounds are synthesized on a solid substrate, such as plastic pins or some other surface. The test compounds are reacted with PLBP, or fragments thereof, and washed. Bound PLBP is then detected by methods well known in the art. Purified PLBP can also be coated directly onto plates for use in the aforementioned drug screening techniques. Alternatively, non-neutralizing antibodies can be used to capture the peptide and immobilize it on a solid support.
In another embodiment, one may use competitive drug screening assays in which neutralizing antibodies capable of binding PLBP specifically compete with a test compound for binding PLBP. In this manner, the antibodies can be used to detect the presence of any peptide which shares one or more antigenic determinants with PLBP.
In additional embodiments, the nucleotide sequences which encode PLBP may be used in any molecular biology techniques that have yet to be developed, provided the new techniques rely on properties of nucleotide sequences that are currently known, including, but not limited to, such properties as the triplet genetic code and specific base pair interactions.
The examples below are provided to illustrate the subject invention and are not included for the purpose of limiting the invention.
MUSCNOT07
The MUSCNOT07 cDNA library was constructed from microscopically normal human forearm muscle tissue (specimen #0660B) obtained from a 38-year-old Caucasian female during a soft tissue excision. Pathology for the non-tumorous tissues indicated that the surgical margins of re-excision were free of tumor involvement. Pathology for the right forearm indicated intramuscular hemangioma, with a second excision confirming the diagnosis. Family history included malignant breast neoplasm in the mother; and benign hypertension, cerebrovascular disease, malignant colon neoplasm, and diabetes in a grandparent.
The frozen tissue was homogenized and lysed using a Brinkmann Homogenizer Polytron PT-3000 (Brinkmann Instruments, Westbury, N.Y.) in guanidinium isothiocyanate solution. The lysate was centrifuged over a 5.7M CsCl cushion using a Beckman SW28 rotor in a Beckman L8-70M Ultracentrifuge (Beckman Instruments) for 18 hours at 25,000 rpm at ambient temperature. The mRNA was extracted with acid phenol pH 4.7, precipitated using 0.3M sodium acetate and 2.5 volumes of ethanol, resuspended in RNAse-free water, and DNase treated at 37° C. Extraction and precipitation were repeated as before. The mRNA was then isolated using the Qiagen OLIGOTEX kit (QIAGEN, Inc., Chatsworth, Calif.) and used to construct the cDNA library.
LUNGTUT12
The LUNGTUT12 cDNA library was constructed from cancerous lung tissue (specimen #0319A) obtained from a 70-year-old Caucasian female during a lung lobectomy. Pathology for the left upper lobe lung tissue indicated grade 3 (or 4) adenocarcinoma, forming a mass which abuts but does not involve the pleura. Vascular invasion was present. The lobectomy specimen contained no residual carcinoma. The bronchial margin was free of involvement. Multiple (9) intrapulmonary peribronchial lymph nodes were negative for tumor. Pathology for the left lower lobe lung tissue indicated lung parenchyma with focal subpleural fibrosis. Multiple superior mediastinal (2 left tracheo-bronchial), inferior mediastinal (8 subcarinal; 4 inferior pulmonary ligament), 6 left lower lobe bronchus, and 4 left fissure lymph nodes were negative for tumor. Patient history included tobacco abuse and malignant skin neoplasm. Family history included benign hypertension, cerebrovascular disease, and renal failure in the father; congestive heart failure, and malignant colon neoplasm in the mother; and primary malignant liver neoplasm in a sibling.
The frozen tissues were homogenized and lysed in Trizol reagent (1 g tissue/10 ml Trizol; Cat. #10296-028; GIBCO-BRL), a monoplastic solution of phenol and guanidine isothiocyanate, using a Brinkmann Homogenizer Polytron PT-3000 (Brinkmann Instruments, Westbury, N.Y.). After a brief incubation on ice, chloroform was added (1:5 v/v) and the lysate was centrifuged. The upper chloroform layer was removed to a fresh tube and the RNA extracted with isopropanol, resuspended in DEPC-treated water, and DNase treated for 25 min at 37° C. The RNA was re-extracted once with acid phenol-chloroform pH 4.7 and precipitated using 0.3M sodium acetate and 2.5 volumes ethanol. The mRNA was then isolated using the Qiagen OLIGOTEX kit (QIAGEN, Inc., Chatsworth, Calif.) and used to construct the cDNA library.
The mRNA for both libraries was handled according to the recommended protocols in the SuperScript plasmid system (Cat. #18248-013, GIBCO-BRL). cDNA synthesis was initiated with a Notl-oligo d(T) primer. Double stranded cDNA was blunted, ligated to EcoRl adaptors, digested with NotI, fractionated on a SEPHAROSE CL4B column (Cat. #275105-01; Pharmacia), and those cDNAs exceeding 400 bp were ligated into the Notl and EcoRI sites of the pINCY I vector (Incyte). The plasmid pINCY 1 was subsequently transformed into DH5α competent cells (Cat. #18258-012; GIBCO-BRL).
Plasmid DNA was released from the cells and purified using the REAL Prep 96 plasmid kit (Catalog #26173; QIAGEN, Inc.). The recommended protocol was employed except for the following changes: 1) the bacteria were cultured in 1 ml of sterile Terrific Broth (Catalog #22711, GIBCO-BRL) with carbenicillin at 25 mg/L and glycerol at 0.4%; 2) after inoculation, the cultures were incubated for 19 hours and at the end of incubation, the cells were lysed with 0.3 ml of lysis buffer; and 3) following isopropanol precipitation, the plasmid DNA pellet was resuspended in 0.1 ml of distilled water. After the last step in the protocol, samples were transferred to a 96-well block for storage at 4° C.
The cDNAs were sequenced by the method of Sanger et al. (1975, J. Mol. Biol. 94:441f), using a Hamilton Micro Lab 2200 (Hamilton, Reno, Nev.) in combination with Peltier Thermal Cyclers (PTC200 from MJ Research, Watertown, Mass.) and Applied Biosystems 377 DNA Sequencing Systems, and the reading frame determined.
The nucleotide sequences and/or amino acid sequences of the Sequence Listing were used to query sequences in the GenBank, SwissProt, BLOCKS, and Pima II databases. These databases, which contain previously identified and annotated sequences, were searched for regions of homology using BLAST, which stands for Basic Local Alignment Search Tool (Altschul, S. F. (1993) J. Mol. Evol 36:290-300; Altschul, et al. (1990) J. Mol. Biol. 215:403-410).
BLAST produced alignments of both nucleotide and amino acid sequences to determine sequence similarity. Because of the local nature of the alignments, BLAST was especially useful in determining exact matches or in identifying homologs which may be of prokaryotic (bacterial) or eukaryotic (animal, fungal, or plant) origin. Other algorithms such as the one described in Smith, T. et al. (1992, Protein Engineering 5:35-51), incorporated herein by reference, could have been used when dealing with primary sequence patterns and secondary structure gap penalties. The sequences disclosed in this application have lengths of at least 49 nucleotides, and no more than 12% uncalled bases (where N is recorded rather than A, C, G, or T).
The BLAST approach searched for matches between a query sequence and a database sequence. BLAST evaluated the statistical significance of any matches found, and reported only those matches that satisfy the user-selected threshold of significance. In this application, hreshold was set at 10-25 for nucleotides and 10-14 for peptides.
Incyte nucleotide sequences were searched against the GenBank databases for primate (pri), rodent (rod), and other mammalian sequences (mam); and deduced amino acid sequences from the same clones were then searched against GenBank functional protein databases, mammalian (mamp), vertebrate (vrtp), and eukaryote (eukp) for homology.
Northern analysis is a laboratory technique used to detect the presence of a transcript of a gene and involves the hybridization of a labeled nucleotide sequence to a membrane on which RNAs from a particular cell type or tissue have been bound (Sambrook et al., supra).
Analogous computer techniques using BLAST (Altschul, S. F. (1993) J.Mol.Evol. 36:290-300; Altschul, S. F. et al. (1990) J.Mol.Evol. 215:403-410) are used to search for identical or related molecules in nucleotide databases such as GenBank or the LIFESEQ database (Incyte Pharmaceuticals). This analysis is much faster than multiple, membrane-based hybridizations. In addition, the sensitivity of the computer search can be modified to determine whether any particular match is categorized as exact or homologous.
The basis of the search is the product score which is defined as: ##EQU1## The product score takes into account both the degree of similarity between two sequences and the length of the sequence match. For example, with a product score of 40, the match will be exact within a 1-2% error; and at 70, the match will be exact. Homologous molecules are usually identified by selecting those which show product scores between 15 and 40, although lower scores may identify related molecules.
The results of northern analysis are reported as a list of libraries in which the transcript encoding PLBP occurs. Abundance and percent abundance are also reported. Abundance directly reflects the number of times a particular transcript is represented in a cDNA library, and percent abundance is abundance divided by the total number of sequences examined in the cDNA library.
The nucleic acid sequence of the Incyte Clones 3014759 or 3126479 was used to design oligonucleotide primers for extending a partial nucleotide sequence to full length. One primer was synthesized to initiate extension in the antisense direction, and the other was synthesized to extend sequence in the sense direction. Primers were used to facilitate the extension of the known sequence "outward" generating amplicons containing new, unknown nucleotide sequence for the region of interest. The initial primers were designed from the cDNA using OLIGO 4.06 (National Biosciences), or another appropriate program, to be about 22 to about 30 nucleotides in length, to have a GC content of 50% or more, and to anneal to the target sequence at temperatures of about 68° to about 72° C. Any stretch of nucleotides which would result in hairpin structures and primer-primer dimerizations was avoided.
Selected human cDNA libraries (Gibco/BRL) were used to extend the sequence. If more than one extension is necessary or desired, additional sets of primers are designed to further extend the known region.
High fidelity amplification was obtained by following the instructions for the XL-PCR kit (Perkin Elmer) and thoroughly mixing the enzyme and reaction mix. Beginning with 40 pmol of each primer and the recommended concentrations of all other components of the kit, PCR was performed using the Peltier Thermal Cycler (PTC200; M. J. Research, Watertown, Mass.) and the following parameters:
Step 4 94° C. for 15 sec
Step 6 68° C. for 7 min
Step 7 Repeat step 4-6 for 15 additional cycles
Step 8 94° C. for 15 sec
Step 11 Repeat step 8-10 for 12 cycles
Step 12 72° C. for 8 min
Step 13 4° C. (and holding)
A 5-10 μl aliquot of the reaction mixture was analyzed by electrophoresis on a low concentration (about 0.6-0.8%) agarose mini-gel to determine which reactions were successful in extending the sequence. Bands thought to contain the largest products were excised from the gel, purified using QIAQUICK (QIAGEN Inc., Chatsworth, Calif.), and trimmed of overhangs using Klenow enzyme to facilitate religation and cloning.
After ethanol precipitation, the products were redissolved in 13 μl of ligation buffer, 1 μl T4-DNA ligase (15 units) and 1 μl T4 polynucleotide kinase were added, and the mixture was incubated at room temperature for 2-3 hours or overnight at 16° C. Competent E. coli cells (in 40 μl of appropriate media) were transformed with 3 μl of ligation mixture and cultured in 80 μl of SOC medium (Sambrook et al., supra). After incubation for one hour at 37° C., the E. coli mixture was plated on Luria Bertani (LB)-agar (Sambrook et al., supra) containing 2× Carb. The following day, several colonies were randomly picked from each plate and cultured in 150 μl of liquid LB/2× Carb medium placed in an individual well of an appropriate, commercially-available, sterile 96-well microtiter plate. The following day, 5 μl of each overnight culture was transferred into a non-sterile 96-well plate and after dilution 1:10 with water, 5 μl of each sample was transferred into a PCR array.
For PCR amplification, 18 μl of concentrated PCR reaction mix (3.3×) containing 4 units of rTth DNA polymerase, a vector primer, and one or both of the gene specific primers used for the extension reaction were added to each well. Amplification was performed using the following conditions:
Step 4 72° C. for 90 sec
Step 6 72° C. for 180 sec
Step 7 4° C. (and holding)
Aliquots of the PCR reactions were run on agarose gels together with molecular weight markers. The sizes of the PCR products were compared to the original partial cDNAs, and appropriate clones were selected, ligated into plasmid, and sequenced.
In like manner, the nucleotide sequence of SEQ ID NO:2 or SEQ ID NO:4 is used to obtain 5' regulatory sequences using the procedure above, oligonucleotides designed for 5'extension, and an appropriate genomic library.
Hybridization probes derived from SEQ ID NO:2 or SEQ ID NO:4 are employed to screen cDNAs, genomic DNAs, or mRNAs. Although the labeling of oligonucleotides, consisting of about 20 base-pairs, is specifically described, essentially the same procedure is used with larger nucleotide fragments. Oligonucleotides are designed using state-of-the-art software such as OLIGO 4.06 (National Biosciences), labeled by combining 50 pmol of each oligomer and 250 μCi of γ-32 P! adenosine triphosphate (Amersham) and T4 polynucleotide kinase (DuPont NEN, Boston, Mass.). The labeled oligonucleotides are substantially purified with SEPHADEX G-25 superfine resin column (Pharmacia & Upjohn). A aliquot containing 107 counts per minute of the labeled probe is used in a typical membrane-based hybridization analysis of human genomic DNA digested with one of the following endonucleases (Ase I, Bg1 II, Eco RI, Pst I, Xba 1, or Pvu II; DuPont NEN).
The DNA from each digest is fractionated on a 0.7 percent agarose gel and transferred to nylon membranes (Nytran Plus, Schleicher & Schuell, Durham, N.H.). Hybridization is carried out for 16 hours at 40° C. To remove nonspecific signals, blots are sequentially washed at room temperature under increasingly stringent conditions up to 0.1× saline sodium citrate and 0.5% sodium dodecyl sulfate. After XOMAT AR film (Kodak, Rochester, N.Y.) is exposed to the blots in a Phosphoimager cassette (Molecular Dynamics, Sunnyvale, Calif.) for several hours, hybridization patterns are compared visually.
To produce oligonucleotides for a microarray, the nucleotide sequence described herein is examined using a computer algorithm which starts at the 3' end of the nucleotide sequence. The algorithm identifies oligomers of defined length that are unique to the gene, have a GC content within a range suitable for hybridization, and lack predicted secondary structure that would interfere with hybridization. The algorithm identifies 20 sequence-specific oligonucleotides of 20 nucleotides in length (20-mers). A matched set of oligonucleotides is created in which one nucleotide in the center of each sequence is altered. This process is repeated for each gene in the microarray, and double sets of twenty 20 mers are synthesized and arranged on the surface of the silicon chip using a light-directed chemical process (Chee, M. et al., PCT/WO95/11995, incorporated herein by reference).
In the alternative, a chemical coupling procedure and an ink jet device are used to synthesize oligomers on the surface of a substrate (Baldeschweiler, J. D. et al., PCT/WO95/25116, incorporated herein by reference). In another alternative, a "gridded" array analogous to a dot (or slot) blot is used to arrange and link cDNA fragments or oligonucleotides to the surface of a substrate using a vacuum system, thermal, UV, mechanical or chemical bonding procedures. An array may be produced by hand or using available materials and machines and contain grids of 8 dots, 24 dots, 96 dots, 384 dots, 1536 dots or 6144 dots. After hybridization, the microarray is washed to remove nonhybridized probes, and a scanner is used to determine the levels and patterns of fluorescence. The scanned images are examined to determine degree of complementarity and the relative abundance of each oligonucleotide sequence on the micro-array.
Sequence complementary to the PLBP-encoding sequence, or any part thereof, is used to decrease or inhibit expression of naturally occurring PLBP. Although use of oligonucleotides comprising from about 15 to about 30 base-pairs is described, essentially the same procedure is used with smaller or larger sequence fragments. Appropriate oligonucleotides are designed using Oligo 4.06 software and the coding sequence of PLBP, SEQ ID NO:1. To inhibit transcription, a complementary oligonucleotide is designed from the most unique 5' sequence and used to prevent promoter binding to the coding sequence. To inhibit translation, a complementary oligonucleotide is designed to prevent ribosomal binding to the PLBP-encoding transcript.
Expression of PLBP is accomplished by subcloning the cDNAs into appropriate vectors and transforming the vectors into host cells. In this case, the cloning vector is also used to express PLBP in E. coli. Upstream of the cloning site, this vector contains a promoter for β-galactosidase, followed by sequence containing the amino-terminal Met, and the subsequent seven residues of β-galactosidase. Immediately following these eight residues is a bacteriophage promoter useful for transcription and a linker containing a number of unique restriction sites.
Induction of an isolated, transformed bacterial strain with IPTG using standard methods produces a fusion protein which consists of the first eight residues of β-galactosidase, about 5 to 15 residues of linker, and the full length protein. The signal residues direct the secretion of PLBP into the bacterial growth media which can be used directly in the following assay for activity.
The assay is based on the increase of the pyrene monomer fluorescence intensity as a result of the transfer of pyrenylacyl(Pyr(x))-labeled phospholipid from quenched donor vesicles (2 nmol of total phospholipid) to a 25-fold excess of unquenched acceptor vesicles (Van Paridon, P. A. et al. (1988) Biochemistry 27:6208-6214). The donor vesicles consist of Pyr(x)PC or Pyr(x)PE, 2,4,6-trinitrophenyl-phosphatidylethanolamine (TNP-PE), phosphatidic acid (PA), and egg phosphatidylcholine (PC) (10:10:10:70 mol %) and the acceptor vesicles of PA and egg PC (5:95 mol %). The reaction is carried out in 2 ml of 20 mM tris-HCl, 5 mM EDTA, 200 mM NaCl (pH 7.4) containing 0.1 mg of BSA at 37° C. The reaction is initiated by the addition of fractions (10-50 μl) containing PLBP. The initial slope of the progress curve is taken as an arbitrary unit of transfer activity. Measurements are performed on an SLM-Aminco SPF-500C fluorimeter equipped with a thermostated cuvette holder and a stirring device.
PLBP that is substantially purified using PAGE electrophoresis (Sambrook, supra), or other purification techniques, is used to immunize rabbits and to produce antibodies using standard protocols. The amino acid sequence deduced from SEQ ID NO:2 or SEQ ID NO:4 is analyzed using DNASTAR software (DNASTAR Inc) to determine regions of high immunogenicity and a corresponding oligopeptide is synthesized and used to raise antibodies by means known to those of skill in the art. Selection of appropriate epitopes, such as those near the C-terminus or in hydrophilic regions, is described by Ausubel et al. (supra), and others.
Typically, the oligopeptides are 15 residues in length, synthesized using an Applied Biosystems Peptide Synthesizer Model 431 A using fmoc-chemistry, and coupled to keyhole limpet hemocyanin (KLH, Sigma, St. Louis, Mo.) by reaction with N-maleimidobenzoyl-N-hydroxysuccinimide ester (MBS; Ausubel et al., supra). Rabbits are immunized with the oligopeptide-KLH complex in complete Freund's adjuvant. The resulting antisera are tested for antipeptide activity, for example, by binding the peptide to plastic, blocking with 1% BSA, reacting with rabbit antisera, washing, and reacting with radio iodinated, goat anti-rabbit IgG.
Naturally occurring or recombinant PLBP is substantially purified by immunoaffinity chromatography using antibodies specific for PLBP. An immunoaffinity column is constructed by covalently coupling PLBP antibody to an activated chromatographic resin, such as CNBr-activated SEPHAROSE (Pharmacia & Upjohn). After the coupling, the resin is blocked and washed according to the manufacturer's instructions.
Media containing PLBP is passed over the immunoaffinity column, and the column is washed under conditions that allow the preferential absorbance of PLBP (e.g., high ionic strength buffers in the presence of detergent). The column is eluted under conditions that disrupt antibody/PLBP binding (eg, a buffer of pH 2-3 or a high concentration of a chaotrope, such as urea or thiocyanate ion), and PLBP is collected.
PLBP or biologically active fragments thereof are labeled with 125 I Bolton-Hunter reagent (Bolton et al. (1973) Biochem. J. 133: 529). Candidate molecules previously arrayed in the wells of a multi-well plate are incubated with the labeled PLBP, washed and any wells with labeled PLBP complex are assayed. Data obtained using different concentrations of PLBP are used to calculate values for the number, affinity, and association of PLBP with the candidate molecules.
All publications and patents mentioned in the above specification are herein incorporated by reference. Various modifications and variations of the described method and system of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention which are obvious to those skilled in molecular biology or related fields are intended to be within the scope of the following claims.
__________________________________________________________________________ SEQUENCE LISTING (1) GENERAL INFORMATION: (iii) NUMBER OF SEQUENCES: 6 (2) INFORMATION FOR SEQ ID NO:1: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 214 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (vii) IMMEDIATE SOURCE: (A) LIBRARY: MUSCNOT07 (B) CLONE: 3014759 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1: MetGluLeuAlaAlaGlySerPheSerGluGluGlnPheTrpGluAla 151015 CysAlaGluLeuGlnGlnProAlaLeuAlaGlyAlaAspTrpGlnLeu 202530 LeuValGluThrSerGlyIleSerIleTyrArgLeuLeuAspLysLys 354045 ThrGlyLeuTyrGluTyrLysValPheGlyValLeuGluAspCysSer 505560 ProThrLeuLeuAlaAspIleTyrMetAspSerAspTyrArgLysGln 65707580 TrpAspGlnTyrValLysGluLeuTyrGluGlnGluCysAsnGlyGlu 859095 ThrValValTyrTrpGluValLysTyrProPheProMetSerAsnArg 100105110 AspTyrValTyrLeuArgGlnArgArgAspLeuAspMetGluGlyArg 115120125 LysIleHisValIleLeuAlaArgSerThrSerMetProGlnLeuGly 130135140 GluArgSerGlyValIleArgValLysGlnTyrLysGlnSerLeuAla 145150155160 IleGluSerAspGlyLysLysGlySerLysValPheMetTyrTyrPhe 165170175 AspAsnProGlyGlyGlnIleProSerTrpLeuIleAsnTrpAlaAla 180185190 LysAsnGlyValProAsnPheLeuLysAspMetAlaArgAlaCysGln 195200205 AsnTyrLeuLysLysThr 210 (2) INFORMATION FOR SEQ ID NO:2: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 2051 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (vii) IMMEDIATE SOURCE: (A) LIBRARY: MUSCNOT07 (B) CLONE: 3014759 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2: TCAGTTTCCTGCCAATGACGCTGGGGCAGCCGGGGCAGCCGGGGCAGCCCGGTCACCCCG60 CCCCCAGGCCCACACTAAGGGTGTCCGCGGCCTGCCCTCCAGGCGGAGGAGCCCGGACTG120 CGGAAGGATGGAGCTGGCCGCCGGAAGCTTCTCGGAGGAGCAGTTCTGGGAGGCCTGCGC180 CGAGCTCCAGCAGCCCGCTCTGGCCGGGGCCGACTGGCAGCTCCTAGTGGAGACCTCGGG240 CATCAGCATCTACCGGCTGCTGGACAAGAAGACTGGACTTTATGAGTATAAAGTCTTTGG300 TGTTCTGGAGGACTGCTCACCAACTCTACTGGCAGACATCTATATGGACTCAGATTACAG360 AAAACAATGGGACCAGTATGTTAAAGAACTCTATGAACAAGAATGCAACGGAGAGACTGT420 GGTCTACTGGGAAGTGAAGTACCCTTTTCCCATGTCCAACAGAGACTATGTCTACCTTCG480 GCAGCGGCGAGACCTGGACATGGAAGGGAGGAAGATCCATGTGATCCTGGCCCGGAGCAC540 CTCCATGCCTCAGCTTGGCGAGAGGTCTGGGGTGATCCGGGTGAAGCAATACAAGCAGAG600 CCTGGCGATTGAGAGTGACGGCAAGAAGGGGAGCAAAGTTTTCATGTATTACTTCGATAA660 CCCGGGTGGCCAAATTCCGTCCTGGCTCATTAACTGGGCCGCCAAGAATGGAGTTCCTAA720 CTTCTTGAAAGACATGGCAAGAGCCTGTCAGAACTACCTCAAGAAAACCTAAGAAAGAGA780 ACTGGGAACATTGCATCCATGGGTTGATGTCTCTGGAAGTGCAACCACCCAATGTCTCTG840 GAAGTGCCACCTGGAAGTGCCACCTGGAAGTGTCTCTGGAAGAGCACCCACCACTGTTCA900 GCCTTCCCCTGCTGTTTCTGTCTTCAGAGGCCTACACACTACCACATCCTTTCTAAGCAT960 GTTTGCCTGACATCCAGCTCACTCGTCTGCTTCCTTTCTCGCTCCCCCCCATCCTGGGGC1020 TGGGGCTGCCTTCTTCTACAGTTCAATATGGGGCAGACTAGGGAAACCTTTGCTTGCTTA1080 CTATTAGGAGGGGAAGTCTTCAGTAGGGAACACGATCATTCCATTGTGCAATTTTACGGG1140 GATGGGTGGGCGGAGGGACACAACAAAATTTAAGAATGACTATTTGGGCGGGCTGGCTCT1200 TTTGCAGCTTGTGATTTCTTCCAGCTTGGGAGGGGCTGCTGGAAGTGGCATTTCGTTCAG1260 AGCTGACTTTCAGTGCACCCAAACTGGATGACGTGCCAATGTCCATTTGCCTTATGCTTT1320 GTGGAGCTGATTAGGCTGGGATTTGAGGTGATAATCCAGTAAGTCTTTCCTCGTTCCTAC1380 TTGTGGAGGATCAGTAGCTGTTATGATGCCAGACCATTTGGAGAAGTATCAGAGGCCTGA1440 CCGGACACATAATACGACAACCACATTTTTCCTCATCATCCATGAGGAAATGGATGATTT1500 CTCTTTTCCATATGTCACTGGGGGAAAGGCTGCCTGTACCTCTCAAGCTTTGCATTTTAC1560 TGGAAACTGAGGCGTCAAGATGGCTGTGGCCAGCTAGCAAAAGCAAAGATGCTTTGTGCA1620 TAGCCTTGTGAAAAAGTATCTTTCTATGCAATAAGATGAATTTTCCTCCCAGAATATTTA1680 GAAATGTAGAAGGGATAACAGTTCACAGCCAGGTAAAATTTAACTGGTGGCTTAATGACT1740 CTGCACCTTTTTCTCAGGAATTCTGCCTAAGTTGTCTGCCTTTTCTACCACCAAAAAGAC1800 TTTTAGTTTTCTATGCTTTCTCCTGAATTTTGGTAGGGTAAGGTATTTCTATGTCAAAGG1860 CACAGCCTTGATGATCTCAGGGAAAAATTTTAATCACTGTGTATAATGATACTGAACCTT1920 GATTAATAACAGAAATTCAGGATGTAAAGCCACAGAATGGGATTTATTAATGTGGGATAC1980 CTCAGACTGTTTGTTTTCTTTCTGGGAAGAAAAGTGTGTTCTATAATGAATAAATATAGA2040 GTGGTTTTTAA2051 (2) INFORMATION FOR SEQ ID NO:3: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 227 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (vii) IMMEDIATE SOURCE: (A) LIBRARY: LUNGTUT12 (B) CLONE: 3126479 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3: MetGlyTrpThrMetArgLeuValThrAlaAlaLeuLeuLeuGlyLeu 151015 MetMetValValThrGlyAspGluAspGluAsnSerProCysAlaHis 202530 GluAlaLeuLeuAspGluAspThrLeuPheCysGlnGlyLeuGluVal 354045 PheTyrProGluLeuGlyAsnIleGlyCysLysValValProAspCys 505560 AsnAsnTyrArgGlnLysIleThrSerTrpMetGluProIleValLys 65707580 PheProGlyAlaValAspGlyAlaThrTyrIleLeuValMetValAsp 859095 ProAspAlaProSerArgAlaGluProArgGlnArgPheTrpArgHis 100105110 TrpLeuValThrAspIleLysGlyAlaAspLeuLysGluGlyLysIle 115120125 GlnGlyGlnGluLeuSerAlaTyrGlnAlaProSerProProAlaHis 130135140 SerGlyPheHisArgTyrGlnPhePheValTyrLeuGlnGluGlyLys 145150155160 ValIleSerLeuLeuProLysGluAsnLysThrArgGlySerTrpLys 165170175 MetAspArgPheLeuAsnArgPheHisLeuGlyGluProGluAlaSer 180185190 ThrGlnPheMetThrGlnAsnTyrGlnAspSerProThrLeuGlnAla 195200205 ProArgGlyArgAlaSerGluProLysHisLysAsnGlnAlaGluIle 210215220 AlaAlaCys 225 (2) INFORMATION FOR SEQ ID NO:4: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 903 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (vii) IMMEDIATE SOURCE: (A) LIBRARY: LUNGTUT12 (B) CLONE: 3126479 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4: AGTACTTGTGTCCGGGTGGTGGACTGGATTCGCTGCGGAGCCCTGGAAGCTGCCTTTCCT60 TCTCCCTGTGCTTAACCAGAGGTGCCCATGGGTTGGACAATGAGGCTGGTCACAGCAGCA120 CTGTTACTGGGTCTCATGATGGTGGTCACTGGAGACGAGGATGAGAACAGCCCGTGTGCC180 CATGAGGCCCTCTTGGACGAGGACACCCTCTTTTGCCAGGGCCTTGAAGTTTTCTACCCA240 GAGTTGGGGAACATTGGCTGCAAGGTTGTTCCTGATTGTAACAACTACAGACAGAAGATC300 ACCTCCTGGATGGAGCCGATAGTCAAGTTCCCGGGGGCCGTGGACGGCGCAACCTATATC360 CTGGTGATGGTGGATCCAGATGCCCCTAGCAGAGCAGAACCCAGACAGAGATTCTGGAGA420 CATTGGCTGGTAACAGATATCAAGGGCGCCGACCTGAAGGAAGGGAAGATTCAGGGCCAG480 GAGTTATCAGCCTACCAGGCTCCCTCCCCACCGGCACACAGTGGCTTCCATCGCTACCAG540 TTCTTTGTCTATCTTCAGGAAGGAAAAGTCATCTCTCTCCTTCCCAAGGAAAACAAAACT600 CGAGGCTCTTGGAAAATGGACAGATTTCTGAACCGCTTCCACCTGGGCGAACCTGAAGCA660 AGCACCCAGTTCATGACCCAGAACTACCAGGACTCACCAACCCTCCAGGCTCCCAGAGGA720 AGGGCCAGCGAGCCCAAGCACAAAAACCAGGCGGAGATAGCTGCCTGCTAGATAGCCGGC780 TTTGCCATCCGGGCATGTGGCCACACTGCCCACCACCGACGATGTGGGTATGGAACCCCC840 TCTGGATACAGAACCCCTTCTTTTCCAAATAAAAAAAAAATCATCCAGGGCTTGGTGCTT900 TGT903 (2) INFORMATION FOR SEQ ID NO:5: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 213 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (vii) IMMEDIATE SOURCE: (A) LIBRARY: GenBank (B) CLONE: 897693 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5: MetAspProGlyAlaGlyAlaPheSerGluGluGlnPheArgGluAla 151015 CysAlaGluLeuGlnArgProAlaLeuSerGlyAlaAlaTrpGluLeu 202530 LeuValGluThrGlnGlyIleSerValTyrArgLeuLeuAspGlnGln 354045 ThrGlyLeuTyrAlaTyrLysValPheGlyValLeuGluAspCysLeu 505560 ProAspLeuLeuAlaAspValTyrMetAspLeuAlaTyrArgLysGln 65707580 TrpAspGlnTyrValLysGluLeuTyrGluLysGluCysSerGlyGlu 859095 ThrValValTyrTrpGlnValLysTyrProPheProMetSerAsnArg 100105110 AspTyrValTyrValArgGlnArgGlnGluLeuAspPheGluGlyGln 115120125 LysValHisValIleLeuAlaGlnSerThrSerGluProGlnPhePro 130135140 GluLysSerGlyValIleArgValLysHisTyrLysGlnArgLeuAla 145150155160 IleGlnSerAspGlyLysLysGlySerLysValPheMetTyrTyrPhe 165170175 AspAsnProGlyGlyGlnIleProSerTrpValIleAsnTrpAlaAla 180185190 LysAsnGlyValProAsnPheLeuLysAspMetValLysAlaCysGln 195200205 AsnTyrLysLysThr 210 (2) INFORMATION FOR SEQ ID NO:6: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 152 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (vii) IMMEDIATE SOURCE: (A) LIBRARY: GenBank (B) CLONE: 1143527 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6: ValValSerThrSerProThrLysLeuValAsnValSerTyrAsnAsn 151015 LeuThrValAsnLeuGlyAsnGluLeuThrProThrGlnValLysAsn 202530 GlnProThrLysValSerTrpAspAlaGluProGlyAlaLeuTyrThr 354045 LeuValMetThrAspProAspAlaProSerArgLysAsnProValPhe 505560 ArgGluTrpHisHisTrpLeuIleIleAsnIleSerGlyGlnAsnVal 65707580 SerSerGlyThrValLeuSerAspTyrIleGlySerGlyProProLys 859095 GlyThrGlyLeuHisArgTyrValPheLeuValTyrLysGlnProGly 100105110 SerIleThrAspThrGlnHisGlyGlyAsnArgProAsnPheLysVal 115120125 MetAspPheAlaAsnLysHisHisLeuGlyAsnProValAlaGlyAsn 130135140 PhePheGlnAlaLysHisGluAsp 145150 __________________________________________________________________________
Claims (10)
1. An isolated and purified polynucleotide encoding the human phospholipid binding protein-1 comprising SEQ ID NO: 1.
2. A composition comprising the polynucleotide of claim 1 in an aqueous solution.
3. An isolated and purified polynucleotide which is completely complementary to the polynucleotide of claim 1.
4. An isolated and purified polynucleotide comprising SEQ ID NO:2.
5. An isolated and purified polynucleotide which is completely complementary to the polynucleotide of claim 4.
6. An expression vector comprising the polynucleotide of claim 1.
7. A host cell comprising the expression vector of claim 6.
8. A method for producing a polypeptide comprising the amino acid sequence of SEQ ID NO:1, the method comprising the steps of:
a) culturing the host cell of claim 7 under conditions suitable for the expression of the polypeptide; and
b) recovering the polypeptide from the host cell culture.
9. A method for detecting a polynucleotide which encodes human phospholipid binding protein-1 in a biological sample, the method comprising the steps of:
a) hybridizing the polynucleotide of claim 3 to nucleic acid material of a biological sample, thereby forming a hybridization complex; and
b) detecting the hybridization complex, wherein the presence of the hybridization complex correlates with the presence of a polynucleotide encoding human phospholipid binding protein-1 in the biological sample.
10. The method of claim 9 wherein the nucleic acid material is amplified by the polymerase chain reaction prior to hybridization.
Priority Applications (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US08/958,820 US5888742A (en) | 1997-10-28 | 1997-10-28 | Human phospholipid binding proteins |
| US09/208,718 US6063767A (en) | 1997-10-28 | 1998-12-09 | Human phospholipid binding proteins |
| US09/879,401 US20030119730A1 (en) | 1997-10-28 | 2001-06-11 | Human phospholipid binding proteins |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US08/958,820 US5888742A (en) | 1997-10-28 | 1997-10-28 | Human phospholipid binding proteins |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US09/208,718 Division US6063767A (en) | 1997-10-28 | 1998-12-09 | Human phospholipid binding proteins |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| US5888742A true US5888742A (en) | 1999-03-30 |
Family
ID=25501344
Family Applications (3)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US08/958,820 Expired - Fee Related US5888742A (en) | 1997-10-28 | 1997-10-28 | Human phospholipid binding proteins |
| US09/208,718 Expired - Fee Related US6063767A (en) | 1997-10-28 | 1998-12-09 | Human phospholipid binding proteins |
| US09/879,401 Abandoned US20030119730A1 (en) | 1997-10-28 | 2001-06-11 | Human phospholipid binding proteins |
Family Applications After (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US09/208,718 Expired - Fee Related US6063767A (en) | 1997-10-28 | 1998-12-09 | Human phospholipid binding proteins |
| US09/879,401 Abandoned US20030119730A1 (en) | 1997-10-28 | 2001-06-11 | Human phospholipid binding proteins |
Country Status (1)
| Country | Link |
|---|---|
| US (3) | US5888742A (en) |
Cited By (16)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001004828A1 (en) * | 1999-07-13 | 2001-01-18 | Chromavision Medical Systems, Inc. | Automated detection of objects in a biological sample |
| WO2000078802A3 (en) * | 1999-06-23 | 2001-05-03 | Curagen Corp | Secreted polypeptides and corresponding polynucleotides |
| US6423535B1 (en) | 1999-11-24 | 2002-07-23 | Incyte Genomics, Inc. | Normalization control for hybridization reactions |
| US6448013B1 (en) | 1999-11-24 | 2002-09-10 | Incyte Genomics, Inc. | Duplex probes for hybridization reactions |
| US20030032061A1 (en) * | 1998-05-15 | 2003-02-13 | Genentech, Inc. | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US6546123B1 (en) | 1995-11-30 | 2003-04-08 | Chromavision Medical Systems, Inc. | Automated detection of objects in a biological sample |
| US20030120633A1 (en) * | 2001-11-13 | 2003-06-26 | Torre-Bueno Jose De La | System for tracking biological samples |
| US20030231791A1 (en) * | 2002-06-12 | 2003-12-18 | Torre-Bueno Jose De La | Automated system for combining bright field and fluorescent microscopy |
| US20030235859A1 (en) * | 2001-10-23 | 2003-12-25 | Brocia Robert W. | Assay for phospholipid transfer protein (PLTP) activity |
| US20040136581A1 (en) * | 1996-11-27 | 2004-07-15 | Chroma Vision Medical Systems, Inc., A California Corporation | Method and apparatus for automated image analysis of biological specimens |
| US20040202357A1 (en) * | 2003-04-11 | 2004-10-14 | Perz Cynthia B. | Silhouette image acquisition |
| US20050037406A1 (en) * | 2002-06-12 | 2005-02-17 | De La Torre-Bueno Jose | Methods and apparatus for analysis of a biological specimen |
| US20050281484A1 (en) * | 2004-06-17 | 2005-12-22 | Perz Cynthia B | System and method of registering field of view |
| US20060002636A1 (en) * | 2004-06-30 | 2006-01-05 | Torre-Bueno Jose D L | Data structure of an image storage and retrieval system |
| US20070031043A1 (en) * | 2005-08-02 | 2007-02-08 | Perz Cynthia B | System for and method of intelligently directed segmentation analysis for automated microscope systems |
| US8645167B2 (en) | 2008-02-29 | 2014-02-04 | Dakocytomation Denmark A/S | Systems and methods for tracking and providing workflow information |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB0021497D0 (en) * | 2000-09-01 | 2000-10-18 | Novartis Res Foundation | Compounds and their use |
| AU2003249883A1 (en) * | 2002-07-08 | 2004-01-23 | Genova, Ltd. | Secreted polypeptide species associated with cardiovascular disorders |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5225537A (en) * | 1989-12-29 | 1993-07-06 | Zymogenetics, Inc. | Methods for producing hybrid phospholipid-binding proteins |
| US5658877A (en) * | 1995-05-18 | 1997-08-19 | Wisconsin Alumni Research Foundation | Method to treat endotoxin effects by administration of 33 kilodalton phospholipid binding protein |
-
1997
- 1997-10-28 US US08/958,820 patent/US5888742A/en not_active Expired - Fee Related
-
1998
- 1998-12-09 US US09/208,718 patent/US6063767A/en not_active Expired - Fee Related
-
2001
- 2001-06-11 US US09/879,401 patent/US20030119730A1/en not_active Abandoned
Non-Patent Citations (28)
| Title |
|---|
| Cohen, DE and Green, RM, Cloning and characterization of a cDNA encoding the specific phosphatidylcholine transfer protein from bovine liver, Gene, 163:327 328, 1995. * |
| Cohen, DE and Green, RM, Cloning and characterization of a cDNA encoding the specific phosphatidylcholine transfer protein from bovine liver, Gene, 163:327-328, 1995. |
| Erttmann, K.D. et al., "Onchocerca volvulus: identification of cDNAs encoding a putative phosphatidyl-ethanolamine-binding protein and a putative partially processed mRNA precursor", Gene, 174: 203-207 (1996). |
| Erttmann, K.D. et al., (Direct Submission), GenBank Suquence Database (Accession X87991), National Center for Biotechnology Information, National Library of Medicine, Bethesda, Maryland, 20894 (GI 1143527) (Nov. 11, 1996). * |
| Erttmann, K.D. et al., Onchocerca volvulus : identification of cDNAs encoding a putative phosphatidyl ethanolamine binding protein and a putative partially processed mRNA precursor , Gene , 174: 203 207 (1996). * |
| Exton, J.H., "Phosphatidylcholine breakdown and signal transduction", Biochim. Biophys. Acta, 1212: 26-42 (1994). |
| Exton, J.H., Phosphatidylcholine breakdown and signal transduction , Biochim. Biophys. Acta , 1212: 26 42 (1994). * |
| Geijtenbeek, T.B.H. et al., "cDNA cloning and tissue-specific expression of the phosphatidylcholine transfer protein gene", Biochem. J., 316: 49-55 (1996) (GI 897693). |
| Geijtenbeek, T.B.H. et al., cDNA cloning and tissue specific expression of the phosphatidylcholine transfer protein gene , Biochem. J. , 316: 49 55 (1996) (GI 897693). * |
| Hillier, L., et al., GenBank Accession Number g1892206, Aug. 1997. * |
| Hori, N. et al., "A human cDNA sequence homologue of bovine phosphatidylethanolamine-binding protein", Gene, 140: 293-294 (1994). |
| Hori, N. et al., A human cDNA sequence homologue of bovine phosphatidylethanolamine binding protein , Gene , 140: 293 294 (1994). * |
| Hristova, K. et al., "Critical Role of Lipid Composition in Membrane Permeabilization by Rabbit Neutrophil Defensins", J. Biol. Chem., 272: 24224-24233 (1997). |
| Hristova, K. et al., Critical Role of Lipid Composition in Membrane Permeabilization by Rabbit Neutrophil Defensins , J. Biol. Chem. , 272: 24224 24233 (1997). * |
| James, P.F. and R.A. Zoeller, "Isolation of Animal Cell Mutants Defective in Long-chain Fatty Aldehyde Dehydrogenase", J. Biol. Chem., 272: 23532-23529 (1997). |
| James, P.F. and R.A. Zoeller, Isolation of Animal Cell Mutants Defective in Long chain Fatty Aldehyde Dehydrogenase , J. Biol. Chem. , 272: 23532 23529 (1997). * |
| Pavlinova, L.I. et al., "Role Of The Phosphoinositide Signal System And Methylation Of Phosphatidylehtanolamine In The Development Of Long-Term Post-Tetanic Potentiation In Rats", Neurosci. Behav. Physiol. 27: 234-239 (1997). |
| Pavlinova, L.I. et al., Role Of The Phosphoinositide Signal System And Methylation Of Phosphatidylehtanolamine In The Development Of Long Term Post Tetanic Potentiation In Rats , Neurosci. Behav. Physiol. 27: 234 239 (1997). * |
| Smit, J.J.M. et al., "Homozygous Disruption of the Murine mdr2 P-Glycoprotein Gene Leads to a Complete Absence of Phospholipid from Bile and to Liver Disease", Cell, 75: 451-462 (1993). |
| Smit, J.J.M. et al., Homozygous Disruption of the Murine mdr2 P Glycoprotein Gene Leads to a Complete Absence of Phospholipid from Bile and to Liver Disease , Cell , 75: 451 462 (1993). * |
| Suddiqi, N. et al., "Characterization and localization of the rat, mouse and human testicular phosphatidylethanolamine binding protein", Experimentia, 52: 101-110 (1996). |
| Suddiqi, N. et al., Characterization and localization of the rat, mouse and human testicular phosphatidylethanolamine binding protein , Experimentia , 52: 101 110 (1996). * |
| Teerlink, T. et al., "Tissue Distribution And Subcellular Localization Of Phosphatidylcholine Transfer Protein In Rats As Determined By Radioimmunoassay", Biochim. Biophys. Acta, 713: 61-67 (1982). |
| Teerlink, T. et al., Tissue Distribution And Subcellular Localization Of Phosphatidylcholine Transfer Protein In Rats As Determined By Radioimmunoassay , Biochim. Biophys. Acta , 713: 61 67 (1982). * |
| van Paridon, P.A. et al., "Properties of the Binding Sites for the sn-1 and sn-2 Acyl Chains on the Phosphatidylinositol Transfer Protein from Bovine Brain", Biochemistry, 27: 6208-6214 (1988). |
| van Paridon, P.A. et al., Properties of the Binding Sites for the sn 1 and sn 2 Acyl Chains on the Phosphatidylinositol Transfer Protein from Bovine Brain , Biochemistry , 27: 6208 6214 (1988). * |
| Wirtz, K.W.A., "Phospholipid Transfer Proteins", Annu. Rev. Biochem., 60: 73-99 (1991). |
| Wirtz, K.W.A., Phospholipid Transfer Proteins , Annu. Rev. Biochem. , 60: 73 99 (1991). * |
Cited By (44)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20070053569A1 (en) * | 1995-11-30 | 2007-03-08 | Douglass James W | Method and apparatus for automated image analysis of biological specimens |
| US20090060303A1 (en) * | 1995-11-30 | 2009-03-05 | Carl Zeiss Microlmaging Ais, Inc. | Method and apparatus for automated image analysis of biological specimens |
| US7783098B2 (en) | 1995-11-30 | 2010-08-24 | Carl Zeiss Microimaging Gmbh | Method and apparatus for automated image analysis of biological specimens |
| US7558415B2 (en) | 1995-11-30 | 2009-07-07 | Carl Zeiss Microimaging Ais, Inc. | Automated detection of objects in a biological sample |
| US7359548B2 (en) | 1995-11-30 | 2008-04-15 | Carl Zeiss Microimaging Ais, Inc. | Method and apparatus for automated image analysis of biological specimens |
| US7359536B2 (en) | 1995-11-30 | 2008-04-15 | Carl Zeiss Microimaging Ais, Inc. | Automated method for image analysis of residual protein |
| US6546123B1 (en) | 1995-11-30 | 2003-04-08 | Chromavision Medical Systems, Inc. | Automated detection of objects in a biological sample |
| US20070140540A1 (en) * | 1995-11-30 | 2007-06-21 | Mclaren Gina | Automated Detection of Objects in a Biological Sample |
| US20030228038A1 (en) * | 1995-11-30 | 2003-12-11 | Chroma Vision Medical Systems, Inc., A California Corporation | Method and apparatus for automated image analysis of biological specimens |
| US7177454B2 (en) | 1995-11-30 | 2007-02-13 | Clarient, Inc. | Automated detection of objects in a biological sample |
| US7133545B2 (en) | 1995-11-30 | 2006-11-07 | Clarient, Inc. | Method and apparatus for automated image analysis of biological specimens |
| US20040066960A1 (en) * | 1995-11-30 | 2004-04-08 | Chromavision Medical Systems, Inc., A California Corporation | Automated detection of objects in a biological sample |
| US20040120562A1 (en) * | 1995-11-30 | 2004-06-24 | Presley Hays | Automated method for image analysis of residual protein |
| US6920239B2 (en) | 1995-11-30 | 2005-07-19 | Chromavision Medical Systems, Inc. | Method and apparatus for automated image analysis of biological specimens |
| US7190818B2 (en) | 1996-11-27 | 2007-03-13 | Clarient, Inc. | Method and apparatus for automated image analysis of biological specimens |
| US20040136581A1 (en) * | 1996-11-27 | 2004-07-15 | Chroma Vision Medical Systems, Inc., A California Corporation | Method and apparatus for automated image analysis of biological specimens |
| US7428325B2 (en) | 1996-11-27 | 2008-09-23 | Carl Zeiss Microimaging Ais, Inc. | Method and apparatus for automated image analysis of biological specimens |
| US20070206843A1 (en) * | 1996-11-27 | 2007-09-06 | Douglass James W | Method and Apparatus for Automated Image Analysis of Biological Specimens |
| US20030049733A1 (en) * | 1998-05-15 | 2003-03-13 | Genentech, Inc. | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US20030032061A1 (en) * | 1998-05-15 | 2003-02-13 | Genentech, Inc. | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US7241862B2 (en) * | 1998-05-15 | 2007-07-10 | Genentech, Inc. | Polypeptides that induce cell proliferation or induce fetal hemoglobin |
| WO2000078802A3 (en) * | 1999-06-23 | 2001-05-03 | Curagen Corp | Secreted polypeptides and corresponding polynucleotides |
| WO2001004828A1 (en) * | 1999-07-13 | 2001-01-18 | Chromavision Medical Systems, Inc. | Automated detection of objects in a biological sample |
| US6448013B1 (en) | 1999-11-24 | 2002-09-10 | Incyte Genomics, Inc. | Duplex probes for hybridization reactions |
| US6423535B1 (en) | 1999-11-24 | 2002-07-23 | Incyte Genomics, Inc. | Normalization control for hybridization reactions |
| US20030235859A1 (en) * | 2001-10-23 | 2003-12-25 | Brocia Robert W. | Assay for phospholipid transfer protein (PLTP) activity |
| US7618784B2 (en) * | 2001-10-23 | 2009-11-17 | Roar Holding Llc | Assay for phospholipid transfer protein (PLTP) activity |
| US20030120633A1 (en) * | 2001-11-13 | 2003-06-26 | Torre-Bueno Jose De La | System for tracking biological samples |
| US8676509B2 (en) | 2001-11-13 | 2014-03-18 | Dako Denmark A/S | System for tracking biological samples |
| US7272252B2 (en) | 2002-06-12 | 2007-09-18 | Clarient, Inc. | Automated system for combining bright field and fluorescent microscopy |
| US20030231791A1 (en) * | 2002-06-12 | 2003-12-18 | Torre-Bueno Jose De La | Automated system for combining bright field and fluorescent microscopy |
| US20050037406A1 (en) * | 2002-06-12 | 2005-02-17 | De La Torre-Bueno Jose | Methods and apparatus for analysis of a biological specimen |
| US20040202357A1 (en) * | 2003-04-11 | 2004-10-14 | Perz Cynthia B. | Silhouette image acquisition |
| US8369591B2 (en) | 2003-04-11 | 2013-02-05 | Carl Zeiss Microimaging Gmbh | Silhouette image acquisition |
| US20050281484A1 (en) * | 2004-06-17 | 2005-12-22 | Perz Cynthia B | System and method of registering field of view |
| US7653260B2 (en) | 2004-06-17 | 2010-01-26 | Carl Zeis MicroImaging GmbH | System and method of registering field of view |
| US8582924B2 (en) | 2004-06-30 | 2013-11-12 | Carl Zeiss Microimaging Gmbh | Data structure of an image storage and retrieval system |
| US20060002636A1 (en) * | 2004-06-30 | 2006-01-05 | Torre-Bueno Jose D L | Data structure of an image storage and retrieval system |
| US20100040266A1 (en) * | 2005-08-02 | 2010-02-18 | Perz Cynthia B | System for and method of intelligently directed segmentation analysis for automated microscope systems |
| US20070031043A1 (en) * | 2005-08-02 | 2007-02-08 | Perz Cynthia B | System for and method of intelligently directed segmentation analysis for automated microscope systems |
| US8116543B2 (en) | 2005-08-02 | 2012-02-14 | Carl Zeiss Microimaging Gmbh | System for and method of intelligently directed segmentation analysis for automated microscope systems |
| US8645167B2 (en) | 2008-02-29 | 2014-02-04 | Dakocytomation Denmark A/S | Systems and methods for tracking and providing workflow information |
| US9767425B2 (en) | 2008-02-29 | 2017-09-19 | Dako Denmark A/S | Systems and methods for tracking and providing workflow information |
| US10832199B2 (en) | 2008-02-29 | 2020-11-10 | Agilent Technologies, Inc. | Systems and methods for tracking and providing workflow information |
Also Published As
| Publication number | Publication date |
|---|---|
| US6063767A (en) | 2000-05-16 |
| US20030119730A1 (en) | 2003-06-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US5849528A (en) | Polynucleotides encoding a human S100 protein | |
| US5888792A (en) | ATP-dependent RNA helicase protein | |
| US5888742A (en) | Human phospholipid binding proteins | |
| US6080842A (en) | Human ATP binding-cassette transport protein | |
| US6103469A (en) | Human phospholipase A2 protein | |
| US6232440B1 (en) | Annexin binding protein | |
| US6348576B1 (en) | Human cornichon molecule | |
| US5874248A (en) | Glutathione S-transferase homolog | |
| US5871973A (en) | Cell division regulators | |
| US5891674A (en) | Insulin receptor tyrosine kinase substrate | |
| US5892012A (en) | Rab Proteins | |
| WO1999006558A1 (en) | Human longevity-assurance protein homologs | |
| US20030077802A1 (en) | Human PRL1 phosphatase | |
| US5858717A (en) | Human formin binding protein | |
| US6232459B1 (en) | Synaptojanin isoform | |
| US5840537A (en) | cDNA encoding a vesicle transport protein | |
| US5958690A (en) | Human TSC--22 Homolog | |
| US5871971A (en) | Human developmentally regulated GTP-binding protein | |
| US7947804B1 (en) | Vesicle trafficking proteins | |
| US5989818A (en) | DNA encoding human RSEC6 related protein | |
| US6527689B1 (en) | Maternally transcribed protein | |
| US5869311A (en) | Mitochondrial processing peptidase subunit | |
| US5919661A (en) | Polynucleotides encoding cytokine inducible regulatory protein | |
| US5916753A (en) | SH3-containing proteins | |
| US5919659A (en) | Human phosphatidylinositol transfer protein gamma |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AS | Assignment |
Owner name: INCYTE PHARMACEUTICALS, INC., CALIFORNIA Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:LAL, PREETI;HILLMAN, JENNIFER L.;CORLEY, NEIL C.;AND OTHERS;REEL/FRAME:009022/0730;SIGNING DATES FROM 19980217 TO 19980218 |
|
| FPAY | Fee payment |
Year of fee payment: 4 |
|
| REMI | Maintenance fee reminder mailed | ||
| REMI | Maintenance fee reminder mailed | ||
| LAPS | Lapse for failure to pay maintenance fees | ||
| STCH | Information on status: patent discontinuation |
Free format text: PATENT EXPIRED DUE TO NONPAYMENT OF MAINTENANCE FEES UNDER 37 CFR 1.362 |
|
| FP | Lapsed due to failure to pay maintenance fee |
Effective date: 20070330 |