US5863782A - Synthetic mammalian sulphamidase and genetic sequences encoding same - Google Patents

Synthetic mammalian sulphamidase and genetic sequences encoding same Download PDF

Info

Publication number
US5863782A
US5863782A US08/424,881 US42488195A US5863782A US 5863782 A US5863782 A US 5863782A US 42488195 A US42488195 A US 42488195A US 5863782 A US5863782 A US 5863782A
Authority
US
United States
Prior art keywords
sulphamidase
sequence
nucleic acid
acid molecule
isolated nucleic
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Lifetime
Application number
US08/424,881
Inventor
John Joseph Hopwood
Hamish Steele Scott
Craig Geoffrey Freeman
Charles Phillip Morris
Liane Cheryl Blanch
Xiao-Nui Guo
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Womens and Childrens Hospital Adelaide
Original Assignee
Womens and Childrens Hospital Adelaide
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Womens and Childrens Hospital Adelaide filed Critical Womens and Childrens Hospital Adelaide
Priority to US08/424,881 priority Critical patent/US5863782A/en
Assigned to WOMEN'S AND CHILDREN'S HOSPITAL reassignment WOMEN'S AND CHILDREN'S HOSPITAL ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: FREEMAN, CRAIG GEOFFREY, BLANCH, LIANE CHARYLE, GUO, Xiao-hui, HOPWOOD, JOHN JOSEPH, MORRIS, CHARLES PHILLIP, SCOTT, HAMISH STEELE
Assigned to WOMEN'S AND CHILDREN'S HOSPITAL reassignment WOMEN'S AND CHILDREN'S HOSPITAL TO CORRECT ASSIGNMENT RECORDAL (TO CORRECT SPELLIN Assignors: FREEMAN, CRAIG GEOFFREY, BLANCH, LIANE CHERYLE, GUO, Xiao-hui, HOPWOOD, JOHN JOSEPH, MORRIS, CHARLES PHILLIP, SCOTT, HAMISH STEELE
Priority to US08/874,763 priority patent/US5972333A/en
Application granted granted Critical
Publication of US5863782A publication Critical patent/US5863782A/en
Priority to US09/370,867 priority patent/US6200563B1/en
Priority to US09/729,472 priority patent/US6458579B2/en
Priority to US09/729,499 priority patent/US6491913B2/en
Anticipated expiration legal-status Critical
Expired - Lifetime legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention relates generally to mammalian sulphamidase and to genetic sequences encoding same and to the use of these in the investigation, diagnosis and treatment of subjects suspected of or suffering from sulphamidase deficiency.
  • lysosomal enzymes An important lysosomal enzyme is sulphamidase (sulphamate sulphohydrolase EC 3.10.11). This enzyme acts as a exosulphatase in lysosomes to hydrolyse the sulphate ester bond in 2-sulphaminoglucosamine residues present in heparan sulphate and heparin (Hopwood, 1989).
  • sulphamidase sulphamate sulphohydrolase EC 3.10.11
  • This enzyme acts as a exosulphatase in lysosomes to hydrolyse the sulphate ester bond in 2-sulphaminoglucosamine residues present in heparan sulphate and heparin (Hopwood, 1989).
  • a deficiency in this lysosomal hydrolase is responsible for the pathogenesis of Sanfilippo A (Mucopolysaccharidosis type IIIA MPS-IIIA
  • One aspect of the invention provides an isolated nucleic acid molecule comprising a sequence of nucleotides which encodes or is complementary to a sequence which encodes a mammalian sulphamidase or fragment or derivative thereof.
  • Another aspect of the invention is directed to an isolated nucleic acid molecule having a nucleotide sequence substantially as set forth in SEQ ID NO:1 or having at least 40% similarity to all or part thereof.
  • Yet another aspect of the present invention contemplates a recombinant mammalian sulphamidase or fragment or derivative thereof.
  • Still yet another aspect of the present invention provides a nucleic acid molecule comprising a sequence of nucleotides encoding or complementary to a sequence encoding a polypeptide capable of hydrolysing the sulphate ester bond in 2-sulphaminoglucosamine residues and wherein said nucleotide sequence is capable of hybridising under low stringency conditions to the nucleotide sequence set forth in FIG. 2 (SEQ ID NO:1).
  • Still another aspect of the present invention is directed to a polypeptide comprising a sequence of amino acids corresponding to the amino sequence set forth in FIG. 2 (SEQ ID NO:2) or having at least 40% similarity thereto, more preferably at least 60% similarity thereto and still more preferably at least 80% or 85-90% similarity thereto or encoded by the nucleotide sequence set forth in FIG. 2 (SEQ ID NO:1) or a nucleotide sequence capable of hybridising to SEQ ID NO:1 under low, preferably under medium and more preferably under high stringent conditions.
  • a method for treating a patient suffering from sulphamidase deficiency comprising administering to said patient an effective amount of recombinant mammalian sulphamidase or an active fragment or derivative thereof.
  • Another aspect of the present invention is directed to a pharmaceutical composition
  • a pharmaceutical composition comprising a recombinant mammalian sulphamidase or an active fragment or derivative thereof and one or more pharmaceutically acceptable carriers and/or diluents.
  • FIG. 1 is a photographic representation of sulphamidase purified from liver, kidney and placenta following SDS/PAGE. Lane 1: M r standards (kDa); Lanes 2, 3 and 5: Purified sulphamidase from human liver, kidney and placenta, respectively; Lane 4: 16.
  • FIG. 2 is a representation of the nucleotide sequence and corresponding amino acid sequence in single letter code of human sulphamidase. * potential N-glycosylation site; ⁇ probable site of signal peptide peptidase cleavage between amino acids 20 and 21.
  • the present invention provides an isolated nucleic acid molecule comprising a sequence of nucleotides which encodes, or are complementary to a sequence which encodes, a mammalian sulphamidase or fragment or derivative thereof or its like molecule.
  • the mammal is a human, livestock animal, companion animal, wild animal or laboratory test animal (e.g. rabbit, rat, mouse or guinea pig). Most preferably, the mammal is a human.
  • the sulphamidase is isolatable from the liver, kidney or placenta.
  • the present invention extends to all mammalian sulphamidase enzymes and from any anatomical or cellular source and/or any biological fluid source, such as but not limited to plasma, serum, cell extract or lymph fluid.
  • a preferred embodiment of the present invention contemplates the use of human sulphamidase or genomic or recombinant (e.g. cDNA) genetic sequences encoding same in the investigation, diagnosis and/or treatment of human subjects (i.e. homologous system), one skilled in the art will appreciate that the enzyme or genetic sequences encoding same from a non-human animal may also be useful. Such a heterologous system is encompassed by the present invention.
  • nucleic acid molecule of the present invention may be RNA or DNA (e.g. cDNA), single or double stranded and linear or covalently closed.
  • the nucleic acid molecule may also be genomic DNA corresponding to the entire gene or a substantial portion thereof or to fragments and derivatives thereof.
  • the nucleotide sequence may correspond to the naturally occurring nucleotide sequence or may contain single or multiple nucleotide substitutions, deletions and/or additions. All such modifications encode the sulphamidase-like molecules contemplated by the present invention.
  • the length of the nucleotide sequence may vary from a few bases, such as in nucleic acid probes or primers, to a full length sequence.
  • the nucleic acid molecule of the present invention may constitute solely the nucleotide sequence encoding sulphamidase or like molecule or may be part of a larger nucleic acid molecule and extends to the genomic clone of sulphamidase.
  • the non-sulphamidase encoding sequences in a larger nucleic acid molecule may include vector, promoter, terminator, enhancer, replication or signal sequences or non-coding regions of a genomic clone.
  • the present invention is particularly directed to the nucleic acid in cDNA form and particularly when inserted into an expression vector.
  • the expression vector may be replicable in a eukaryotic or prokaryotic cell and may either produce mRNA or the mRNA may be subsequently translated into sulphamidase or like molecule.
  • Particularly preferred eukaryotic cells include CHO cells but may be in any other suitable mammalian cells or cell lines or non-mammalian cells such as yeast or insect cells.
  • the present invention is further directed to synthetic sulphamidase or like molecule.
  • synthetic includes recombinant forms and molecules produced by the sequential addition of amino acid residues, or groups of amino acid residues, in defined order.
  • the invention relates to recombinant sulphamidase or like molecule encoded by or expressed from the nucleic acid molecules as hereinbefore described.
  • the synthetic or recombinant sulphamidase may comprise an amino acid sequence corresponding to the naturally occurring amino acid sequence or may contain single or multiple amino acid substitutions, deletions and/or additions.
  • the length of the amino acid sequence may range from a few residues to a full length molecule.
  • this aspect of the present invention contemplates a proteinaceous molecule comprising an amino acid sequence corresponding to the full length mammalian sulphamidase enzyme or to a like molecule.
  • the like molecule therefore, comprises parts, derivatives and/or portions of the sulphamidase enzyme whether functional or not.
  • the mammal is human but may be of non-human origin as contemplated above.
  • the recombinant sulphamidase is a biologically pure preparation meaning that it has undergone some purification away for other proteins and/or non-proteinacous material.
  • the purity of the preparation may be represented as at least 40% of the enzyme, preferably at least 60%, more preferably at least 75%, even more preferably at least 85% and still more preferably at least 95% relative to non-sulphamidase material as determined by weight, activity, amino acid homology or similarity, antibody reactivity or other convenient means.
  • Amino acid insertional derivatives of sulphamidase of the present invention include amino and/or carboxyl terminal fusions as well as intra-sequence insertions of single or multiple amino acids.
  • Insertional amino acid sequence variants are those in which one or more amino acid residues are introduced into a predetermined site in the protein although random insertion is also possible with suitable screening of the resulting product.
  • Deletional variants are characterised by the removal of one or more amino acids from the sequence.
  • Substitutional amino acid variants are those in which at least one residue in the sequence has been removed and a different residue inserted in its place. Typical substitutions are those made in accordance with the following Table 1:
  • amino acids are generally replaced by other amino acids having like properties such as hydrophobicity, hydrophilicity, electronegativity, bulky side chains and the like.
  • Amino acid substitutions are typically of single residues.
  • Amino acid insertions will usually be in the order of about 1-10 amino acid residues and deletions will range from about 1-20 residues.
  • deletions or insertions are made in adjacent pairs, i.e. a deletion of two residues or insertion of two residues.
  • amino acid variants referred to above may readily be made using peptide synthetic techniques well known in the art, such as solid phase peptide synthesis (Merrifield synthesis) and the like, or by recombinant DNA manipulations. Techniques for making substitution mutations at predetermined sites in DNA having known or partially known sequence are well known and include, for example, M13 mutagenesis. The manipulation of DNA sequence to produce variant proteins which manifest as substitutional, insertional or deletional variants are conveniently elsewhere described such as Sambrook et al, 1989 Molecular Cloning: A Laboratory Manual Cold Spring Harbor Laboratories, Cold Spring Harbor, N.Y.
  • the derivatives or like molecules include single or multiple substitutions, deletions and/or additions of any component(s) naturally or artificially associated with the sulphamidase enzyme such as carbohydrate, lipid and/or other proteinaceous moieties.
  • the present invention extends to glycosylated and non-glycosylated forms of the molecule. All such molecules are encompassed by the expression "mutants”, “derivatives”, “fragments”, “portions” and “like” molecules. These molecules may be active or non-active and may contain specific regions, such as a catalytic region.
  • preferred derivative molecules include those with altered glycosylation patterns relative to the naturally occurring molecule. Even more particularly, the recombinant molecule is more highly glycosylated than the naturally occurring molecule. Such higly glycosylated derivatives may have improved take-up properties and enhanced half-lives.
  • the present invention also extends to synthetic sulphamidase or like molecules when fused to other proteinaceous molecules.
  • the latter may include another enzyme, reporter molecule, purification site or an amino acid sequence which facilitates transport of the molecule out of a cell, such as a signal sequence.
  • the present invention has an amino acid or corresponding sulphamidase cDNA nucleotide sequence substantially as setforth in FIG. 2 having at least 40% similarity, preferably at least 60% similarity thereto or more preferably at least 80% or 85-90% similarity thereto.
  • the present invention provides a nucleic acid molecule comprising a sequence of nucleotides encoding or complementary to a sequence encoding a polypeptide capable of hydrolysing the sulphate ester bond in 2-sulphaminoglucosamine residues and wherein said nucleotide sequence is capable of hybridising under low stringency conditions to the nucleotide sequence set forth in FIG. 2 (SEQ ID NO:1).
  • hybridisation is possible under medium stringent conditions, more preferably, hybridisation is possible under high stringent conditions.
  • a low stringency is defined herein as being in 4-6 ⁇ SSC/0.1-0.5% w/v SDS at 37°-45° C. for 2-3 hours.
  • alternative conditions of stringency may be employed such as medium stringent conditions which are considered herein to be 1-4 ⁇ SSC/0.25-0.5% w/v SDS at ⁇ 45° C. for 2-3 hours or high stringent conditions considered herein to be 0.1-1 ⁇ SSC/0.1% w/v SDS at 60° C. for 1-3 hours.
  • the present invention contemplates a polypeptide comprising a sequence of amino acids corresponding to the amino sequence set forth in FIG. 2 (SEQ ID NO:2) or having at least 40% similarity thereto, more preferably at least 60% similarity thereto and still more preferably at least 80% or 85-90% similarity thereof or encoded by the nucleotide sequence set forth in FIG. 2 (SEQ ID NO:1) or a nucleotide sequence capable of hybridising to SEQ ID NO:1 under low, preferably under medium and more preferably under high stringent conditions.
  • the present invention extends to post-translational modifications to the sulphamidase enzyme.
  • the modifications may be made to the naturally occurring enzyme or following synthesis by recombinant techniques.
  • the modifications may be at the structural level or at, for example, the electrochemical level such as modifying net charge or structural conformation of the enzyme.
  • Such modification may be important to facilitate entry or penetration of the enzyme into selected tissues such as cartilage or blood brain barriers or to increase circulation half-life.
  • Analogues of sulphamidase contemplated herein include, but are not limited to, modifications to side chains, incorporation of unnatural amino acids and/or their derivatives during peptide synthesis and the use of crosslinkers and other methods which impose conformational constraints on the enzyme.
  • side chain modifications contemplated by the present invention include modifications of amino groups such as by reductive alkylation by reaction with an aldehyde followed by reduction with NaBH 4 ; amidination with methylacetimidate; acylation with acetic anhydride; carbamoylation of amino groups with cyanate; trinitrobenzylation of amino groups with 2,4,6-trinitrobenzene sulphonic acid (TNBS); acylation of amino groups with succinic anhydride and tetrahydrophthalic anhydride; and pyridoxylation of lysine with pyridoxal-5'-phosphate followed by reduction with NaBH 4 .
  • amino groups such as by reductive alkylation by reaction with an aldehyde followed by reduction with NaBH 4 ; amidination with methylacetimidate; acylation with acetic anhydride; carbamoylation of amino groups with cyanate; trinitrobenzylation of amino groups with 2,4,6-trinitrobenzene sulphonic acid (TNBS
  • the guanidino group of arginine residues may be modified by the formation of heterocyclic condensation products with reagents such as 2,3-butanedione, phenylglyoxal and glyoxal.
  • the carboxyl group may be modified by carbodiimide activation via O-acylisourea formation followed by subsequent derivatisation, for example, to a corresponding amide.
  • Sulphydryl groups may be modified by methods such as carboxymethylation with iodoacetic acid or iodoacetamide; performic acid oxidation to cysteic acid; formation of a mixed disulphides with other thiol compounds; reaction with maleimide, maleic anhydride or other substituted maleimide; formation of mercurial derivatives using 4-chloromercuribenzoate, 4-chloromercuriphenylsulphonic acid, phenylmercury chloride, 2-chloromercuric-4-nitrophenol and other mercurials; carbamoylation with cyanate at alkaline pH.
  • Tryptophan residues may be modified by, for example, oxidation with N-bromosuccinimide or alkylation of the indole ring with 2-hydroxy-5-nitrobenzyl bromide or sulphenyl halides.
  • Tyrosine residues on the other hand, may be altered by nitration with tetranitromethane to form a 3-nitrotyrosine derivative.
  • Modification of the imidazole ring of a histidine residue may be accomplished by alkylation with iodoacetic acid derivatives or N-carbethoxylation with diethylpyrocarbonate.
  • Examples of incorporating unnatural amino acids and derivatives during peptide synthesis include, but are not limited to, use of norleucine, 4-amino butyric acid, 4-amino-3-hydroxy-5-phenylpentanoic acid, 6-aminohexanoic acid, t-butylglycine, norvaline, phenylglycine, ornithine, sarcosine, 4-amino-3-hydroxy-6-methylheptanoic acid, 2-thienyl alanine and/or D-isomers of amino acids.
  • the enzyme could be conformationally constrained by, for example, incorporation of C.sub. ⁇ and N.sub. ⁇ -methylamino acids, introduction of double bonds between C.sub. ⁇ and C.sub. ⁇ atoms of amino acids and the formation of cyclic peptides or analogues by introducing covalent bonds such as forming an amide bond between the N and C termini, between two side chains or between a side chain and the N or C terminus.
  • Electrochemical modifications of sulphamidase include interaction with polylysine or polyethylene glycol or other agent which effects an overall change to the net charge of the enzyme.
  • the present invention further contemplates antibodies to sulphamidase and preferably synthetic sulphamidase or like molecule.
  • the antibodies may be polyclonal or monoclonal, naturally occurring or synthetic (including recombinant, fragment or fusion forms). Such antibodies will be useful in developing immunoassays for sulphamidase.
  • a further aspect of the present invention contemplates a method of screening for abberations in the sulphamidase gene.
  • a method may be accomplished in a number of ways including isolating a source of DNA to be tested or mRNA therefrom and hybridising thereto a nucleic acid molecule as hereinbefore described.
  • the nucleic acid is probe or primer size and polymerase chain reaction is a convenient means by which to analyse the RNA or DNA.
  • Other suitable assays include the ligation chain reaction and the strand displacement amplification methods.
  • the sulphamidase sequence can also be determined and compared to the naturally occurring sequence. Such methods may be useful in adults and children and may be adapted for a pre-natal test.
  • the DNA to be tested includes a genomic sample carrying the sulphamidase gene, a cDNA clone and/or amplification product.
  • a method for screening for abberations in the sulphamidase gene including the absence of such a gene or a portion or a substantial portion thereof comprising isolating a sample of DNA or mRNA corresponding to a region of said DNA and contacting same with an oligonucleotide probe capable of hybridising to one or more complementary sequences within the sulphamidase gene and then detecting the hybridisation, the extent of hybridisation or the absence of hybridisation.
  • the probe is a primer and capable of directing amplification of one or more regions of said sulphamidase gene and the amplification products and/or profile of amplification products is compared to an individual carrying the full gene or to a reference date base.
  • the amplification products are sequenced to determine the presence or absence of the full gene.
  • the present invention further extends to a method of treating patients suffering from sulphamidase deficiency, such as in MPS-IIIA, said method comprising administering to said patient an effective amount of sulphamidase or active like form thereof.
  • the sulphamidase is in recombinant form.
  • enzyme therapy can be employed including introducing an active gene (i.e. a nucleic acid molecule as hereinbefore described) or to parts of the gene or other sequences which facilitate expression of a naturally occurring sulphamidase gene.
  • Administration of the sulphamidase for enzyme therapy may be by oral, intravenous, suppository, intraperitoneal, intramuscular, intranasal, intradermal or subcutaneous administration or by infusion or implantation.
  • the sulphamidase is preferably as hereinbefore described including active mutants or derivatives thereof and glycosylation variants thereof.
  • Administration may also be by way of gene therapy including expression of the gene by inclusion of the gene in viral vectors which are introduced into the animal (e.g. human) host to be treated. Alternatively, the gene may be expressed in a bacterial host which is then introduced and becomes part of the bacterial flora in the animal to be tested.
  • Still yet another aspect of the present invention is directed to a pharmaceutical composition
  • a pharmaceutical composition comprising synthetic (e.g. recombinant) sulphamidase or like molecule, including active derivatives and fragments thereof, alone or in combination with other active molecules.
  • Such other molecules may act synergistically with the enzyme or facilitates its entry to a target cell.
  • the composition will also contain one or more pharmaceutically acceptable carriers and/or diluents.
  • the composition may alternatively comprise a genetic component useful in gene therapy.
  • the active ingredients of the pharmaceutical composition comprising the synthetic or recombinant sulphamidase or mutants or fragments or derivatives thereof are contemplated to exhibit excellent activity in treating patients with a deficiency in the enzyme when administered in an amount which depends on the particular case.
  • the variation depends, for example, on the patient and the sulphamidase used.
  • from about 0.5 ug to about 20 mg of enzyme per animal body or, depending on the animal and other factors, per kilogram of body weight may be administered.
  • Dosage procedures may be adjusted to provide the optimum therapeutic response. For example, several divided doses may be administered daily, weekly, monthly or in other suitable time intervals or the dose may be proportionally reduced as indicated by the exigencies of the situation.
  • alternative dosages in the order of 1.0 ⁇ g to 15 mg, 2.0 ⁇ g to 10 mg or 10 ⁇ g to 5 mg may be administered in a single or as part of multiple doses.
  • the active compound may be administered in a convenient manner such as by the oral, intravenous (where water soluble), intramuscular, subcutaneous, intranasal, intradermal or suppository routes or implanting (eg using slow release molecules).
  • the active ingredients which comprise a synthetic (e.g. recombinant) sulphamidase or fragments, derivatives or mutants thereof may be required to be coated in a material to protect same from the action of enzymes, acids and other natural conditions which may inactivate said ingredients.
  • the low lipophilicity of sulphamidase will allow it to be destroyed in the gastrointestinal tract by enzymes capable of cleaving peptide bonds and in the stomach by acid hydrolysis.
  • the enzyme will be coated by, or administered with, a material to prevent its inactivation.
  • the enzyme may be administered in an adjuvant, co-administered with enzyme inhibitors or in liposomes.
  • Adjuvant is used in its broadest sense and includes any immune stimulating compound such as interferon.
  • Adjuvants contemplated herein include resorcinols, non-ionic surfactants such as polyoxyethylene oleyl ether and n-hexadecyl polyethylene ether.
  • the adjuvant is Freund's Complete or Incomplete Adjuvant.
  • Enzyme inhibitors include pancreatic trypsin inhibitor, diisopropylfluorophosphate (DEP) and trasylol.
  • Liposomes include water-in-oil-in-water emulsions as well as conventional liposomes.
  • the active compound may also be administered in dispersions prepared in glycerol, liquid polyethylene glycols, and/or mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.
  • the pharmaceutical forms suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion.
  • the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi.
  • the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils.
  • the proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of superfactants.
  • the prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thirmerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.
  • Sterile injectable solutions are prepared by incorporating the active compound in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filtered sterilization.
  • dispersions are prepared by incorporating the various sterilized active ingredient(s) into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above.
  • the preferred methods of preparation are vacuum drying and the freeze-drying technique which yield a powder of the active ingredient plus any additional desired ingredient from previously sterile-filtered solution thereof.
  • the composition may be orally administered, for example, with an inert diluent or with an assimilable edible carrier, or it may be enclosed in hard or soft shell gelatin capsule, or it may be compressed into tablets, or it may be incorporated directly with the food of the diet.
  • the active compound may be incorporated with excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like.
  • Such compositions and preparations should contain at least 1% by weight of active compound.
  • compositions and preparations may, of course, be varied and may conveniently be between about 5 to about 80% of the weight of the unit.
  • the amount of active compound in the vaccine compositions is such that a suitable dosage will be obtained.
  • Preferred compositions or preparations according to the present invention are prepared, so that an oral dosage unit form contains between about 0.5 ug and 20 mg of active compound.
  • the tablets, troches, pills, capsules and the like may also contain the following: a binder such as gum gragacanth, acacia, corn starch or gelatin; excipients such as dicalcium phosphate; a disintegrating agent such as corn starch, potato starch, alginic acid and the like; a lubricant such as magnesium stearate; and a sweetening agent such a sucrose, lactose or saccharin may be added or a flavoring agent such as peppermint, oil of wintergreen, or cherry flavouring.
  • a binder such as gum gragacanth, acacia, corn starch or gelatin
  • excipients such as dicalcium phosphate
  • a disintegrating agent such as corn starch, potato starch, alginic acid and the like
  • a lubricant such as magnesium stearate
  • a sweetening agent such as sucrose, lactose or saccharin may be added or a flavoring agent such as peppermint
  • tablets, pills, or capsules may be coated with shellac, sugar or both.
  • a syrup or elixir may contain the active compound, sucrose as a sweetening agent, methyl and propylparabens as preservatives, a dye and flavoring such as cherry or orange flavor.
  • any material used in preparing any dosage unit form should be pharmaceutically pure and substantially non-toxic in the amounts employed.
  • the active compound may be incorporated into sustained-release reparations and formulations.
  • pharmaceutically acceptable carriers and/or diluents include any and all solvents, dispersion media, aqueous solutions, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like.
  • the use of such media and agents for pharmaceutical active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredient, use thereof in the pharmaceutical compositions is contemplated. Supplementary active ingredients can also be incorporated into the compositions.
  • the present invention further relates to the use of sulphamidase or active fragment, mutant or derivative thereof in the manufacture of a medicament for the treatment of patients suffering from a deficiency in the naturally occurring enzyme (e.g. MPS-IIIA).
  • sulphamidase or active fragment, mutant or derivative thereof in the manufacture of a medicament for the treatment of patients suffering from a deficiency in the naturally occurring enzyme (e.g. MPS-IIIA).
  • Sulphamidases were purified according to the method described in Freeman and Hopwood (1986). Enzymes were purified to homogenicity from human liver, kidney and placenta. Evidence of purity is shown following SDS/PAGE which is represented in FIG. 1. All samples were reduced with dithiothreitol prior to electrophoresis.
  • Results presented in FIG. 1 show a subunit of about M r 56,000 from sulphamidase purified from human liver, kidney and placenta.
  • the native M r is about 100,000 to 120,000.
  • N-terminal amino acid sequence was determined using the methods of Clements et al (1989) and Wilson et al (1990).
  • the amino acid sequence is shown in Table 2.
  • the N-terminal amino acid sequence (Example 3) was used to generate oligonucleotides and primers to screen a human kidney cDNA library. An approximately 2.7 kbp cDNA clone was then isolated encoding the entire sequence of human sulphamidase.
  • the nucleotide sequence (SEQ ID NO:1) and corresponding amino acid sequence (SEQ ID NO:2) are shown in FIG. 2.
  • the amino acid sequence is shown in single letter code above the cDNA sequence. Nucleotide and amino acid numbers are in the right margin. The probable site of signal peptide peptidase cleavage between amino acids 20 and 21 is shown by an arrow. Amino acids colinear with the amino-terminal peptide data is underlined. The five potential N-glycosylation sites are asterisked above the peptide sequence. The open reading frame is 1506 nucleotides long and encodes a 502 amino acid protein. The predicted molecular mass of the mature protein (minus the 20 amino acid signal peptide) is about 54,679 kilo daltons.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Hematology (AREA)
  • Obesity (AREA)
  • Diabetes (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The present invention relates generally to mammalian sulphamidase and to genetic sequences encoding same and to the use of these in the investigation, diagnosis and treatment of subjects suspected of or suffering from sulphamidase deficiency.

Description

FIELD OF INVENTION
The present invention relates generally to mammalian sulphamidase and to genetic sequences encoding same and to the use of these in the investigation, diagnosis and treatment of subjects suspected of or suffering from sulphamidase deficiency.
Bibliographic details of the publications referred to by author in this specification are collected at the end of the description. Sequence Identity Numbers (SEQ ID NOs.) for the nucleotide and amino acid sequences referred to in the specification are defined following the bibliography.
Throughout this specification, unless the context requires otherwise, the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element or integer or group of elements or integers but not the exclusion of any other element or integer or group of elements or integers.
BACKGROUND TO THE INVENTION
The increasing sophistication of recombinant DNA technology is greatly facilitating the efficacy of many commercially important industries including areas of medical and pharmaceutical research and development. The ability to purify native proteins and subsequently clone genetic sequences encoding these proteins is an important first step in the development of a range of therapeutic and diagnostic procedures. However, practitioners have faced many difficulties in purifying target molecules to an extent sufficient to determine amino acid sequences to permit the development of oligonucleotide probes to assist in the cloning of genetic sequences encoding the target molecules.
Such difficulties have been particularly faced in the research and development of lysosomal enzymes. An important lysosomal enzyme is sulphamidase (sulphamate sulphohydrolase EC 3.10.11). This enzyme acts as a exosulphatase in lysosomes to hydrolyse the sulphate ester bond in 2-sulphaminoglucosamine residues present in heparan sulphate and heparin (Hopwood, 1989). A deficiency in this lysosomal hydrolase is responsible for the pathogenesis of Sanfilippo A (Mucopolysaccharidosis type IIIA MPS-IIIA3!) syndrome (Kresse, 1973; Matalon and Dorfman, 1974). This is an autosomal recessive disorder of glycosaminoglycan catabolism leading to storage and excretion of excessive amounts of heparan sulphate and a variety of clinical phenotypes, but classically presenting with progressive mental retardation in conjunction with skeletal deformities (McKusick and Neufeld, 1983).
There is a need, therefore, to purify sulphamidase and to clone genetic sequences encoding same to permit development of a range of therapeutic and diagnostic procedures to assist in the diagnosis and treatment of disease conditions arising from sulphamidase deficiency.
SUMMARY OF THE INVENTION
One aspect of the invention provides an isolated nucleic acid molecule comprising a sequence of nucleotides which encodes or is complementary to a sequence which encodes a mammalian sulphamidase or fragment or derivative thereof.
Another aspect of the invention is directed to an isolated nucleic acid molecule having a nucleotide sequence substantially as set forth in SEQ ID NO:1 or having at least 40% similarity to all or part thereof.
Yet another aspect of the present invention contemplates a recombinant mammalian sulphamidase or fragment or derivative thereof.
Still yet another aspect of the present invention provides a nucleic acid molecule comprising a sequence of nucleotides encoding or complementary to a sequence encoding a polypeptide capable of hydrolysing the sulphate ester bond in 2-sulphaminoglucosamine residues and wherein said nucleotide sequence is capable of hybridising under low stringency conditions to the nucleotide sequence set forth in FIG. 2 (SEQ ID NO:1).
Still another aspect of the present invention is directed to a polypeptide comprising a sequence of amino acids corresponding to the amino sequence set forth in FIG. 2 (SEQ ID NO:2) or having at least 40% similarity thereto, more preferably at least 60% similarity thereto and still more preferably at least 80% or 85-90% similarity thereto or encoded by the nucleotide sequence set forth in FIG. 2 (SEQ ID NO:1) or a nucleotide sequence capable of hybridising to SEQ ID NO:1 under low, preferably under medium and more preferably under high stringent conditions.
In still yet another aspect of the present invention there is contemplated a method for treating a patient suffering from sulphamidase deficiency said method comprising administering to said patient an effective amount of recombinant mammalian sulphamidase or an active fragment or derivative thereof.
Another aspect of the present invention is directed to a pharmaceutical composition comprising a recombinant mammalian sulphamidase or an active fragment or derivative thereof and one or more pharmaceutically acceptable carriers and/or diluents.
BRIEF DESCRIPTION OF THE FIGURES
FIG. 1 is a photographic representation of sulphamidase purified from liver, kidney and placenta following SDS/PAGE. Lane 1: Mr standards (kDa); Lanes 2, 3 and 5: Purified sulphamidase from human liver, kidney and placenta, respectively; Lane 4: 16.
FIG. 2 is a representation of the nucleotide sequence and corresponding amino acid sequence in single letter code of human sulphamidase. * potential N-glycosylation site; ▾ probable site of signal peptide peptidase cleavage between amino acids 20 and 21.
The following single and three letter abbreviations are used for amino acid residues:
______________________________________
               Three-letter
                         One-letter
Amino Acid     Abbreviation
                         Symbol
______________________________________
Alanine        Ala       A
Arginine       Arg       R
Asparagine     Asn       N
Aspartic acid  Asp       D
Cysteine       Cys       C
Glutamine      Gln       Q
Glutamic acid  Glu       E
Glycine        Gly       G
Histidine      His       H
Isoleucine     Ile       I
Leucine        Leu       L
Lysine         Lys       K
Methionine     Met       M
Phenylalanine  Phe       F
Proline        Pro       P
Serine         Ser       S
Threonine      Thr       T
Tryptophan     Trp       W
Tyrosine       Tyr       Y
Valine         Val       V
Any residue    Xaa       X
______________________________________
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
The present invention provides an isolated nucleic acid molecule comprising a sequence of nucleotides which encodes, or are complementary to a sequence which encodes, a mammalian sulphamidase or fragment or derivative thereof or its like molecule.
Preferably, the mammal is a human, livestock animal, companion animal, wild animal or laboratory test animal (e.g. rabbit, rat, mouse or guinea pig). Most preferably, the mammal is a human. Conveniently, the sulphamidase is isolatable from the liver, kidney or placenta. However, the present invention extends to all mammalian sulphamidase enzymes and from any anatomical or cellular source and/or any biological fluid source, such as but not limited to plasma, serum, cell extract or lymph fluid.
Although a preferred embodiment of the present invention contemplates the use of human sulphamidase or genomic or recombinant (e.g. cDNA) genetic sequences encoding same in the investigation, diagnosis and/or treatment of human subjects (i.e. homologous system), one skilled in the art will appreciate that the enzyme or genetic sequences encoding same from a non-human animal may also be useful. Such a heterologous system is encompassed by the present invention.
The "nucleic acid molecule" of the present invention may be RNA or DNA (e.g. cDNA), single or double stranded and linear or covalently closed. The nucleic acid molecule may also be genomic DNA corresponding to the entire gene or a substantial portion thereof or to fragments and derivatives thereof. The nucleotide sequence may correspond to the naturally occurring nucleotide sequence or may contain single or multiple nucleotide substitutions, deletions and/or additions. All such modifications encode the sulphamidase-like molecules contemplated by the present invention. The length of the nucleotide sequence may vary from a few bases, such as in nucleic acid probes or primers, to a full length sequence.
The nucleic acid molecule of the present invention may constitute solely the nucleotide sequence encoding sulphamidase or like molecule or may be part of a larger nucleic acid molecule and extends to the genomic clone of sulphamidase. The non-sulphamidase encoding sequences in a larger nucleic acid molecule may include vector, promoter, terminator, enhancer, replication or signal sequences or non-coding regions of a genomic clone.
The present invention is particularly directed to the nucleic acid in cDNA form and particularly when inserted into an expression vector. The expression vector may be replicable in a eukaryotic or prokaryotic cell and may either produce mRNA or the mRNA may be subsequently translated into sulphamidase or like molecule. Particularly preferred eukaryotic cells include CHO cells but may be in any other suitable mammalian cells or cell lines or non-mammalian cells such as yeast or insect cells.
The present invention is further directed to synthetic sulphamidase or like molecule. The term "synthetic" includes recombinant forms and molecules produced by the sequential addition of amino acid residues, or groups of amino acid residues, in defined order. In a most preferred embodiment, the invention relates to recombinant sulphamidase or like molecule encoded by or expressed from the nucleic acid molecules as hereinbefore described.
The synthetic or recombinant sulphamidase may comprise an amino acid sequence corresponding to the naturally occurring amino acid sequence or may contain single or multiple amino acid substitutions, deletions and/or additions. The length of the amino acid sequence may range from a few residues to a full length molecule. Accordingly, this aspect of the present invention contemplates a proteinaceous molecule comprising an amino acid sequence corresponding to the full length mammalian sulphamidase enzyme or to a like molecule. The like molecule, therefore, comprises parts, derivatives and/or portions of the sulphamidase enzyme whether functional or not. Preferably, the mammal is human but may be of non-human origin as contemplated above.
Advantageously, the recombinant sulphamidase is a biologically pure preparation meaning that it has undergone some purification away for other proteins and/or non-proteinacous material. The purity of the preparation may be represented as at least 40% of the enzyme, preferably at least 60%, more preferably at least 75%, even more preferably at least 85% and still more preferably at least 95% relative to non-sulphamidase material as determined by weight, activity, amino acid homology or similarity, antibody reactivity or other convenient means.
Amino acid insertional derivatives of sulphamidase of the present invention include amino and/or carboxyl terminal fusions as well as intra-sequence insertions of single or multiple amino acids. Insertional amino acid sequence variants are those in which one or more amino acid residues are introduced into a predetermined site in the protein although random insertion is also possible with suitable screening of the resulting product. Deletional variants are characterised by the removal of one or more amino acids from the sequence. Substitutional amino acid variants are those in which at least one residue in the sequence has been removed and a different residue inserted in its place. Typical substitutions are those made in accordance with the following Table 1:
              TABLE 1
______________________________________
Suitable residues for amino acid substitutions
Original Residue  Exemplary Substitutions
______________________________________
Ala               Ser
Arg               Lys
Asn               Gln; His
Asp               Glu
Cys               Ser
Gln               Asn
Glu               Asp
Gly               Pro
His               Asn; Gln
Ile               Leu; Val
Leu               Ile; Val
Lys               Arg; Gln; Glu
Met               Leu; Ile
Phe               Met; Leu; Tyr
Ser               Thr
Thr               Ser
Trp               Tyr
Tyr               Trp; Phe
Val               Ile; Leu
______________________________________
Where the enzyme is dervatised by amino acid substitution, the amino acids are generally replaced by other amino acids having like properties such as hydrophobicity, hydrophilicity, electronegativity, bulky side chains and the like. Amino acid substitutions are typically of single residues. Amino acid insertions will usually be in the order of about 1-10 amino acid residues and deletions will range from about 1-20 residues. Preferably, deletions or insertions are made in adjacent pairs, i.e. a deletion of two residues or insertion of two residues.
The amino acid variants referred to above may readily be made using peptide synthetic techniques well known in the art, such as solid phase peptide synthesis (Merrifield synthesis) and the like, or by recombinant DNA manipulations. Techniques for making substitution mutations at predetermined sites in DNA having known or partially known sequence are well known and include, for example, M13 mutagenesis. The manipulation of DNA sequence to produce variant proteins which manifest as substitutional, insertional or deletional variants are conveniently elsewhere described such as Sambrook et al, 1989 Molecular Cloning: A Laboratory Manual Cold Spring Harbor Laboratories, Cold Spring Harbor, N.Y.
The derivatives or like molecules include single or multiple substitutions, deletions and/or additions of any component(s) naturally or artificially associated with the sulphamidase enzyme such as carbohydrate, lipid and/or other proteinaceous moieties. For example, the present invention extends to glycosylated and non-glycosylated forms of the molecule. All such molecules are encompassed by the expression "mutants", "derivatives", "fragments", "portions" and "like" molecules. These molecules may be active or non-active and may contain specific regions, such as a catalytic region. Particularly, preferred derivative molecules include those with altered glycosylation patterns relative to the naturally occurring molecule. Even more particularly, the recombinant molecule is more highly glycosylated than the naturally occurring molecule. Such higly glycosylated derivatives may have improved take-up properties and enhanced half-lives.
The present invention also extends to synthetic sulphamidase or like molecules when fused to other proteinaceous molecules. The latter may include another enzyme, reporter molecule, purification site or an amino acid sequence which facilitates transport of the molecule out of a cell, such as a signal sequence.
In a most preferred embodiment, the present invention has an amino acid or corresponding sulphamidase cDNA nucleotide sequence substantially as setforth in FIG. 2 having at least 40% similarity, preferably at least 60% similarity thereto or more preferably at least 80% or 85-90% similarity thereto.
In a related embodiment, the present invention provides a nucleic acid molecule comprising a sequence of nucleotides encoding or complementary to a sequence encoding a polypeptide capable of hydrolysing the sulphate ester bond in 2-sulphaminoglucosamine residues and wherein said nucleotide sequence is capable of hybridising under low stringency conditions to the nucleotide sequence set forth in FIG. 2 (SEQ ID NO:1). Preferably, hybridisation is possible under medium stringent conditions, more preferably, hybridisation is possible under high stringent conditions.
For the purposes of defining the level of stringency, reference can conveniently be made to Maniatis et al (1982) at pages 387-389 which is herein incorporated by reference where the washing steps disclosed are considered high stringency. A low stringency is defined herein as being in 4-6× SSC/0.1-0.5% w/v SDS at 37°-45° C. for 2-3 hours. Depending on the source and concentration of nucleic acid involved in the hybridisation, alternative conditions of stringency may be employed such as medium stringent conditions which are considered herein to be 1-4× SSC/0.25-0.5% w/v SDS at ≧45° C. for 2-3 hours or high stringent conditions considered herein to be 0.1-1× SSC/0.1% w/v SDS at 60° C. for 1-3 hours.
In a further related embodiment, the present invention contemplates a polypeptide comprising a sequence of amino acids corresponding to the amino sequence set forth in FIG. 2 (SEQ ID NO:2) or having at least 40% similarity thereto, more preferably at least 60% similarity thereto and still more preferably at least 80% or 85-90% similarity thereof or encoded by the nucleotide sequence set forth in FIG. 2 (SEQ ID NO:1) or a nucleotide sequence capable of hybridising to SEQ ID NO:1 under low, preferably under medium and more preferably under high stringent conditions.
The present invention extends to post-translational modifications to the sulphamidase enzyme. The modifications may be made to the naturally occurring enzyme or following synthesis by recombinant techniques. The modifications may be at the structural level or at, for example, the electrochemical level such as modifying net charge or structural conformation of the enzyme.
Such modification may be important to facilitate entry or penetration of the enzyme into selected tissues such as cartilage or blood brain barriers or to increase circulation half-life.
Such chemically or electrochemically modified ICAM-1-like peptides are referred to herein as "analogues" and are included with the term "derivatives".
Analogues of sulphamidase contemplated herein include, but are not limited to, modifications to side chains, incorporation of unnatural amino acids and/or their derivatives during peptide synthesis and the use of crosslinkers and other methods which impose conformational constraints on the enzyme.
Examples of side chain modifications contemplated by the present invention include modifications of amino groups such as by reductive alkylation by reaction with an aldehyde followed by reduction with NaBH4 ; amidination with methylacetimidate; acylation with acetic anhydride; carbamoylation of amino groups with cyanate; trinitrobenzylation of amino groups with 2,4,6-trinitrobenzene sulphonic acid (TNBS); acylation of amino groups with succinic anhydride and tetrahydrophthalic anhydride; and pyridoxylation of lysine with pyridoxal-5'-phosphate followed by reduction with NaBH4.
The guanidino group of arginine residues may be modified by the formation of heterocyclic condensation products with reagents such as 2,3-butanedione, phenylglyoxal and glyoxal.
The carboxyl group may be modified by carbodiimide activation via O-acylisourea formation followed by subsequent derivatisation, for example, to a corresponding amide.
Sulphydryl groups may be modified by methods such as carboxymethylation with iodoacetic acid or iodoacetamide; performic acid oxidation to cysteic acid; formation of a mixed disulphides with other thiol compounds; reaction with maleimide, maleic anhydride or other substituted maleimide; formation of mercurial derivatives using 4-chloromercuribenzoate, 4-chloromercuriphenylsulphonic acid, phenylmercury chloride, 2-chloromercuric-4-nitrophenol and other mercurials; carbamoylation with cyanate at alkaline pH.
Tryptophan residues may be modified by, for example, oxidation with N-bromosuccinimide or alkylation of the indole ring with 2-hydroxy-5-nitrobenzyl bromide or sulphenyl halides. Tyrosine residues on the other hand, may be altered by nitration with tetranitromethane to form a 3-nitrotyrosine derivative.
Modification of the imidazole ring of a histidine residue may be accomplished by alkylation with iodoacetic acid derivatives or N-carbethoxylation with diethylpyrocarbonate.
Examples of incorporating unnatural amino acids and derivatives during peptide synthesis include, but are not limited to, use of norleucine, 4-amino butyric acid, 4-amino-3-hydroxy-5-phenylpentanoic acid, 6-aminohexanoic acid, t-butylglycine, norvaline, phenylglycine, ornithine, sarcosine, 4-amino-3-hydroxy-6-methylheptanoic acid, 2-thienyl alanine and/or D-isomers of amino acids.
Crosslinkers can be used, for example, to stabilise 3D conformations, using homo-bifunctional crosslinkers such as the bifunctional imido esters having (CH2)n spacer groups with n=1 to n=6, glutaraldehyde, N-hydroxysuccinimide esters and hetero-bifunctional reagents which usually contain an amino-reactive moiety such as N-hydroxysuccinimide and another group specific-reactive moiety such as maleimido or dithio moiety (SH) or carbodiimide (COOH). In addition, the enzyme could be conformationally constrained by, for example, incorporation of C.sub.α and N.sub.α -methylamino acids, introduction of double bonds between C.sub.α and C.sub.β atoms of amino acids and the formation of cyclic peptides or analogues by introducing covalent bonds such as forming an amide bond between the N and C termini, between two side chains or between a side chain and the N or C terminus.
Electrochemical modifications of sulphamidase include interaction with polylysine or polyethylene glycol or other agent which effects an overall change to the net charge of the enzyme.
The present invention further contemplates antibodies to sulphamidase and preferably synthetic sulphamidase or like molecule. The antibodies may be polyclonal or monoclonal, naturally occurring or synthetic (including recombinant, fragment or fusion forms). Such antibodies will be useful in developing immunoassays for sulphamidase.
A further aspect of the present invention contemplates a method of screening for abberations in the sulphamidase gene. Such a method may be accomplished in a number of ways including isolating a source of DNA to be tested or mRNA therefrom and hybridising thereto a nucleic acid molecule as hereinbefore described. Generally, the nucleic acid is probe or primer size and polymerase chain reaction is a convenient means by which to analyse the RNA or DNA. Other suitable assays include the ligation chain reaction and the strand displacement amplification methods. The sulphamidase sequence can also be determined and compared to the naturally occurring sequence. Such methods may be useful in adults and children and may be adapted for a pre-natal test. The DNA to be tested includes a genomic sample carrying the sulphamidase gene, a cDNA clone and/or amplification product.
In accordance with this aspect of the present invention there is provided a method for screening for abberations in the sulphamidase gene including the absence of such a gene or a portion or a substantial portion thereof comprising isolating a sample of DNA or mRNA corresponding to a region of said DNA and contacting same with an oligonucleotide probe capable of hybridising to one or more complementary sequences within the sulphamidase gene and then detecting the hybridisation, the extent of hybridisation or the absence of hybridisation. Alternatively, the probe is a primer and capable of directing amplification of one or more regions of said sulphamidase gene and the amplification products and/or profile of amplification products is compared to an individual carrying the full gene or to a reference date base. Conveniently, the amplification products are sequenced to determine the presence or absence of the full gene.
The present invention further extends to a method of treating patients suffering from sulphamidase deficiency, such as in MPS-IIIA, said method comprising administering to said patient an effective amount of sulphamidase or active like form thereof. Preferably, the sulphamidase is in recombinant form. Such a method is referred to as "enzyme therapy". Alternatively, gene therapy can be employed including introducing an active gene (i.e. a nucleic acid molecule as hereinbefore described) or to parts of the gene or other sequences which facilitate expression of a naturally occurring sulphamidase gene.
Administration of the sulphamidase for enzyme therapy may be by oral, intravenous, suppository, intraperitoneal, intramuscular, intranasal, intradermal or subcutaneous administration or by infusion or implantation. The sulphamidase is preferably as hereinbefore described including active mutants or derivatives thereof and glycosylation variants thereof. Administration may also be by way of gene therapy including expression of the gene by inclusion of the gene in viral vectors which are introduced into the animal (e.g. human) host to be treated. Alternatively, the gene may be expressed in a bacterial host which is then introduced and becomes part of the bacterial flora in the animal to be tested.
Still yet another aspect of the present invention is directed to a pharmaceutical composition comprising synthetic (e.g. recombinant) sulphamidase or like molecule, including active derivatives and fragments thereof, alone or in combination with other active molecules. Such other molecules may act synergistically with the enzyme or facilitates its entry to a target cell. The composition will also contain one or more pharmaceutically acceptable carriers and/or diluents. The composition may alternatively comprise a genetic component useful in gene therapy.
The active ingredients of the pharmaceutical composition comprising the synthetic or recombinant sulphamidase or mutants or fragments or derivatives thereof are contemplated to exhibit excellent activity in treating patients with a deficiency in the enzyme when administered in an amount which depends on the particular case. The variation depends, for example, on the patient and the sulphamidase used. For example, from about 0.5 ug to about 20 mg of enzyme per animal body or, depending on the animal and other factors, per kilogram of body weight may be administered. Dosage regima may be adjusted to provide the optimum therapeutic response. For example, several divided doses may be administered daily, weekly, monthly or in other suitable time intervals or the dose may be proportionally reduced as indicated by the exigencies of the situation. Accordingly, alternative dosages in the order of 1.0 μg to 15 mg, 2.0 μg to 10 mg or 10 μg to 5 mg may be administered in a single or as part of multiple doses. The active compound may be administered in a convenient manner such as by the oral, intravenous (where water soluble), intramuscular, subcutaneous, intranasal, intradermal or suppository routes or implanting (eg using slow release molecules). Depending on the route of administration, the active ingredients which comprise a synthetic (e.g. recombinant) sulphamidase or fragments, derivatives or mutants thereof may be required to be coated in a material to protect same from the action of enzymes, acids and other natural conditions which may inactivate said ingredients. For example, the low lipophilicity of sulphamidase will allow it to be destroyed in the gastrointestinal tract by enzymes capable of cleaving peptide bonds and in the stomach by acid hydrolysis. In order to administer the vaccine by other than parenteral administration, the enzyme will be coated by, or administered with, a material to prevent its inactivation. For example, the enzyme may be administered in an adjuvant, co-administered with enzyme inhibitors or in liposomes. Adjuvant is used in its broadest sense and includes any immune stimulating compound such as interferon. Adjuvants contemplated herein include resorcinols, non-ionic surfactants such as polyoxyethylene oleyl ether and n-hexadecyl polyethylene ether. Conveniently, the adjuvant is Freund's Complete or Incomplete Adjuvant. Enzyme inhibitors include pancreatic trypsin inhibitor, diisopropylfluorophosphate (DEP) and trasylol. Liposomes include water-in-oil-in-water emulsions as well as conventional liposomes.
The active compound may also be administered in dispersions prepared in glycerol, liquid polyethylene glycols, and/or mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.
The pharmaceutical forms suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. In all cases the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of superfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thirmerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.
Sterile injectable solutions are prepared by incorporating the active compound in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the various sterilized active ingredient(s) into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and the freeze-drying technique which yield a powder of the active ingredient plus any additional desired ingredient from previously sterile-filtered solution thereof.
When the sulphamidase of the present invention is suitably protected as described above, the composition may be orally administered, for example, with an inert diluent or with an assimilable edible carrier, or it may be enclosed in hard or soft shell gelatin capsule, or it may be compressed into tablets, or it may be incorporated directly with the food of the diet. For oral therapeutic administration, the active compound may be incorporated with excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like. Such compositions and preparations should contain at least 1% by weight of active compound. The percentage of the compositions and preparations may, of course, be varied and may conveniently be between about 5 to about 80% of the weight of the unit. The amount of active compound in the vaccine compositions is such that a suitable dosage will be obtained. Preferred compositions or preparations according to the present invention are prepared, so that an oral dosage unit form contains between about 0.5 ug and 20 mg of active compound.
The tablets, troches, pills, capsules and the like may also contain the following: a binder such as gum gragacanth, acacia, corn starch or gelatin; excipients such as dicalcium phosphate; a disintegrating agent such as corn starch, potato starch, alginic acid and the like; a lubricant such as magnesium stearate; and a sweetening agent such a sucrose, lactose or saccharin may be added or a flavoring agent such as peppermint, oil of wintergreen, or cherry flavouring. When the dosage unit form is a capsule, it may contain, in addition to materials of the above type, a liquid carrier. Various other materials may be present as coatings or to otherwise modify the physical form of the dosage unit. For instance, tablets, pills, or capsules may be coated with shellac, sugar or both. A syrup or elixir may contain the active compound, sucrose as a sweetening agent, methyl and propylparabens as preservatives, a dye and flavoring such as cherry or orange flavor. Of course, any material used in preparing any dosage unit form should be pharmaceutically pure and substantially non-toxic in the amounts employed. In addition, the active compound may be incorporated into sustained-release reparations and formulations.
As used herein "pharmaceutically acceptable carriers and/or diluents" include any and all solvents, dispersion media, aqueous solutions, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like. The use of such media and agents for pharmaceutical active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredient, use thereof in the pharmaceutical compositions is contemplated. Supplementary active ingredients can also be incorporated into the compositions.
The present invention further relates to the use of sulphamidase or active fragment, mutant or derivative thereof in the manufacture of a medicament for the treatment of patients suffering from a deficiency in the naturally occurring enzyme (e.g. MPS-IIIA).
The present invention is further described with reference to the following non-limiting examples.
EXAMPLE 1 Purification of Sulphamidase
Sulphamidases were purified according to the method described in Freeman and Hopwood (1986). Enzymes were purified to homogenicity from human liver, kidney and placenta. Evidence of purity is shown following SDS/PAGE which is represented in FIG. 1. All samples were reduced with dithiothreitol prior to electrophoresis.
EXAMPLE 2 Characterisation of Sulphamidase
Results presented in FIG. 1 show a subunit of about Mr 56,000 from sulphamidase purified from human liver, kidney and placenta. The native Mr is about 100,000 to 120,000.
EXAMPLE 3 N-Terminal Amino Acid Sequence Determination
The N-terminal amino acid sequence was determined using the methods of Clements et al (1989) and Wilson et al (1990).
The amino acid sequence is shown in Table 2.
EXAMPLE 4 Cloning of Sulphamidase cDNA
The N-terminal amino acid sequence (Example 3) was used to generate oligonucleotides and primers to screen a human kidney cDNA library. An approximately 2.7 kbp cDNA clone was then isolated encoding the entire sequence of human sulphamidase. The nucleotide sequence (SEQ ID NO:1) and corresponding amino acid sequence (SEQ ID NO:2) are shown in FIG. 2.
The amino acid sequence is shown in single letter code above the cDNA sequence. Nucleotide and amino acid numbers are in the right margin. The probable site of signal peptide peptidase cleavage between amino acids 20 and 21 is shown by an arrow. Amino acids colinear with the amino-terminal peptide data is underlined. The five potential N-glycosylation sites are asterisked above the peptide sequence. The open reading frame is 1506 nucleotides long and encodes a 502 amino acid protein. The predicted molecular mass of the mature protein (minus the 20 amino acid signal peptide) is about 54,679 kilo daltons.
              TABLE 2
______________________________________
N-Terminal amino acid sequence (SEQ ID NO:3) determined from
purified human liver sulphamidase
______________________________________
R P R N A L L L L A D D G G F E S G A Y X.sup.1 N S A I
______________________________________
 X.sup.1 no residue could be identified for this position, indicating that
 this residue could be phosphorylated or glycosylated. It is likely to be
 Nglycosylated because it would be a consensus sequence  N × T(s)!
 for Nglycosylation.
Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications. The invention also includes all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations of any two or more of said steps or features.
REFERENCES
Clements P. R., Brooks D. A., McCourt P. A. G. and Hopwood J. J. (1989) Biochem. J. 259: 199-208.
Freeman C. and Hopwood J. J., (1986) Biochem J. 234: 83-92.
Hopwood J. J. (1989) In: "Heparin: Chemical and Biological Properties, Clinical Applications" (Lane D. W. and Lindahl U., eds.), 190-229, Edward Arnold, London.
Kresse H. (1973) Biochem. Biophys. Res. Commun. 54: 1111-1118.
Matalon R. and Dorfman A. (1974) J. Clin. Invest. 54: 907-912.
McKusick V. and Neufeld E. (1983) In: "The Metabolic Basis of Inherited Disease" (Stanbury J. B., Wyngaarden J. B., Fredrickson D. S., Goldstein J. L. and Brown M. S., eds), 5th Ed., 751-771, McGraw-Hill, New York.
Wilson P. J., Morris C. P., Anson D. S., Occhiodoro T., Bielicki J., Clements P. R. and Hopwood J. J. (1990) Proc. Natl. Acad. Sci. USA 87: 8531-8535.
__________________________________________________________________________
SEQUENCE LISTING
(1) GENERAL INFORMATION:
(iii) NUMBER OF SEQUENCES: 3
(2) INFORMATION FOR SEQ ID NO:1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2657 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 13..1518
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:
GAATTCCGGGCCATGAGCTGCCCCGTGCCCGCCTGCTGCGCGCTGCTG48
MetSerCysProValProAlaCysCysAlaLeuLeu
1510
CTAGTCCTGGGGCTCTGCCGGGCGCGTCCCCGGAACGCACTGCTGCTC96
LeuValLeuGlyLeuCysArgAlaArgProArgAsnAlaLeuLeuLeu
152025
CTCGCGGATGACGGAGGCTTTGAGAGTGGCGCGTACAACAACAGCGCC144
LeuAlaAspAspGlyGlyPheGluSerGlyAlaTyrAsnAsnSerAla
303540
ATCGCCACCCCGCACCTGGACGCCTTGGCCCGCCGCAGCCTCCTCTTT192
IleAlaThrProHisLeuAspAlaLeuAlaArgArgSerLeuLeuPhe
45505560
CGCAATGCCTTCACCTCGGTCAGCAGCTGCTCTCCCAGCCGCGCCAGC240
ArgAsnAlaPheThrSerValSerSerCysSerProSerArgAlaSer
657075
CTCCTCACTGGCCTGCCCCAGCATCAGAATGGGATGTACGGGCTGCAC288
LeuLeuThrGlyLeuProGlnHisGlnAsnGlyMetTyrGlyLeuHis
808590
CAGGACGTGCACCACTTCAACTCCTTCGACAAGGTGCGGAGCCTGCCG336
GlnAspValHisHisPheAsnSerPheAspLysValArgSerLeuPro
95100105
CTGCTGCTCAGCCAAGCTGGTGTGCGCACAGGCATCATCGGGAAGAAG384
LeuLeuLeuSerGlnAlaGlyValArgThrGlyIleIleGlyLysLys
110115120
CACGTGGGGCCGGAGACCGTGTACCCGTTTGACTTTGCGTACACGGAG432
HisValGlyProGluThrValTyrProPheAspPheAlaTyrThrGlu
125130135140
GAGAATGGCTCCGTCCTCCAGGTGGGGCGGAACATCACTAGAATTAAG480
GluAsnGlySerValLeuGlnValGlyArgAsnIleThrArgIleLys
145150155
CTGCTCGTCCGGAAATTCCTGCAGACTCAGGATGACCGGCCTTTCTTC528
LeuLeuValArgLysPheLeuGlnThrGlnAspAspArgProPhePhe
160165170
CTCTACGTCGCCTTCCACGACCCCCACCGCTGTGGGCACTCCCAGCCC576
LeuTyrValAlaPheHisAspProHisArgCysGlyHisSerGlnPro
175180185
CAGTACGGAACCTTCTGTGAGAAGTTTGGCAACGGAGAGAGCGGCATG624
GlnTyrGlyThrPheCysGluLysPheGlyAsnGlyGluSerGlyMet
190195200
GGTCGTATCCCAGACTGGACCCCCCAGGCCTACGACCCACTGGACGTG672
GlyArgIleProAspTrpThrProGlnAlaTyrAspProLeuAspVal
205210215220
CTGGTGCCTTACTTCGTCCCCAACACCCCGGCAGCCCGAGCCGACCTG720
LeuValProTyrPheValProAsnThrProAlaAlaArgAlaAspLeu
225230235
GCCGCTCAGTACACCACCGTCGGCCGCATGGACCAAGGAGTTGGACTG768
AlaAlaGlnTyrThrThrValGlyArgMetAspGlnGlyValGlyLeu
240245250
GTGCTCCAGGAGCTGCGTGACGCCGGTGTCCTGAACGACACACTGGTG816
ValLeuGlnGluLeuArgAspAlaGlyValLeuAsnAspThrLeuVal
255260265
ATCTTCACGTCCGACAACGGGATCCCCTTCCCCAGCGGCAGGACCAAC864
IlePheThrSerAspAsnGlyIleProPheProSerGlyArgThrAsn
270275280
CTGTACTGGCCGGGCACTGCTGAACCCTTACTGGTGTCATCCCCGGAG912
LeuTyrTrpProGlyThrAlaGluProLeuLeuValSerSerProGlu
285290295300
CACCCAAAACGCTGGGGCCAAGTCAGCGAGGCCTACGTGAGCCTCCTA960
HisProLysArgTrpGlyGlnValSerGluAlaTyrValSerLeuLeu
305310315
GACCTCACGCCCACCATCTTGGATTGGTTCTCGATCCCGTACCCCAGC1008
AspLeuThrProThrIleLeuAspTrpPheSerIleProTyrProSer
320325330
TACGCCATCTTTGGCTCGAAGACCATCCACCTCACTGGCCGGTCCCTC1056
TyrAlaIlePheGlySerLysThrIleHisLeuThrGlyArgSerLeu
335340345
CTGCCGGCGCTGGAGGCCGAGCCCCTCTGGGCCACCGTCTTTGGCAGC1104
LeuProAlaLeuGluAlaGluProLeuTrpAlaThrValPheGlySer
350355360
CAGAGCCACCACGAGGTCACCATGTCCTACCCCATGCGCTCCGTGCAG1152
GlnSerHisHisGluValThrMetSerTyrProMetArgSerValGln
365370375380
CACCGGCACTTCCGCCTCGTGCACAACCTCAACTTCAAGATGCCCTTT1200
HisArgHisPheArgLeuValHisAsnLeuAsnPheLysMetProPhe
385390395
CCCATCGACCAGGACTTCTACGTCTCACCCACCTTCCAGGACCTCCTG1248
ProIleAspGlnAspPheTyrValSerProThrPheGlnAspLeuLeu
400405410
AACCGCACCACAGCTGGTCAGCCCACGGGCTGGTACAAGGACCTCCGT1296
AsnArgThrThrAlaGlyGlnProThrGlyTrpTyrLysAspLeuArg
415420425
CATTACTACTACCGGGCGCGCTGGGAGCTCTACGACCGGAGCCGGGAC1344
HisTyrTyrTyrArgAlaArgTrpGluLeuTyrAspArgSerArgAsp
430435440
CCCCACGAGACCCAGAACCTGGCCACCGACCCGCGCTTTGCTCAGCTT1392
ProHisGluThrGlnAsnLeuAlaThrAspProArgPheAlaGlnLeu
445450455460
CTGGAGATGCTTCGGGACCAGCTGGCCAAGTGGCAGTGGGAGACCCAC1440
LeuGluMetLeuArgAspGlnLeuAlaLysTrpGlnTrpGluThrHis
465470475
GACCCCTGGGTGTGCGCCCCCGACGGCGTCCTGGAGGAGAAGCTCTCT1488
AspProTrpValCysAlaProAspGlyValLeuGluGluLysLeuSer
480485490
CCCCAGTGCCAGCCCCTCCACAATGAGCTGTGACCATCCCAGGAGGCCTG1538
ProGlnCysGlnProLeuHisAsnGluLeu
495500
TGCACACATCCCAGGCATGTCCCAGACACATCCCACACGTGTCCGTGTGGCCGGCCAGCC1598
TGGGGAGTAGTGGCAACAGCCCTTCCGTCCACACTCCCATCCAAGGAGGGTTCTTCCTTC1658
CTGTGGGGTCACTCTTGCCATTGCCTGGAGGGGGACCAGAGCATGTGACCAGAGCATGTG1718
CCCAGCCCCTCCACCACCAGGGGCACTGCCGTCATGGCAGGGGACACAGTTGTCCTTGTG1778
TCTGAACCATGTCCCAGCACGGGAATTCTAGACATACGTGGTCTGCGGACAGGGCAGCGC1838
CCCCAGCCCATGACAAGGGAGTCTTGTTTTCTGGCTTGGTTTGGGGACCTGCAAATGGGA1898
GGCCTGAGGCCCTCTTCAGGCTTTGGCAGCCACAGATACTTCTGAACCCTTCACAGAGAG1958
CAGGCAGGGGCTTCGGTGCCGCGTGGGCAGTACGCAGGTCCCACCGACACTCACCTGGGA2018
GCACGGCGCCTGGCTCTTACCAGCGTCTGGCCTAGAGGAAGCCTTTGAGCGACCTTTGGG2078
CAGGTTTCTGCTTCTTCTGTTTTGCCCATGGTCAAGTCCCTGTTCCCCAGGCAGGTTTCA2138
GCTGATTGGCAGCAGGCTCCCTGAGTGATGAGCTTGAACCTGTGGTGTTTCTGGGCAGAA2198
GCTTATCTTTTTTGAGAGTGTCCGAAGATGAAGGCATGGCGATGCCCGTCCTCTGGCTTG2258
GGTTAATTCTTCGGTGACACTGGCATTGCTGGGTGGTGATGCCCGTCCTCTGGCTTGGGT2318
TAATTCTTCGGTGACACTGGCGTTGCTGGGTGGCAATGCCCGTCCTCTGGCTTGGGTTAA2378
TTCTTCGGTGACACTGGCGTTGCTGGGTGGCGATGCCCGTCCTCTGGCTTGGGTTAATTC2438
TTGGATGACGTCGGCGTTGCTGGGAGAATGTGCCGTTCCTGCCCTGCCTCCACCCACCTC2498
GGGAGCAGAAGCCCGGCCTGGACACCCCTCGGCCTGGACACCCCTCGAAGGAGAGGGCGC2558
TTCCTTGAGTAGGTGGGCTCCCCTTGCCCTTCCCTCCCTATCACTCCATACTGGGGTGGG2618
CTGGAGGAGGCCACAGGCCAGCTATTGTAAAAGCTTTTT2657
(2) INFORMATION FOR SEQ ID NO:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 502 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
MetSerCysProValProAlaCysCysAlaLeuLeuLeuValLeuGly
151015
LeuCysArgAlaArgProArgAsnAlaLeuLeuLeuLeuAlaAspAsp
202530
GlyGlyPheGluSerGlyAlaTyrAsnAsnSerAlaIleAlaThrPro
354045
HisLeuAspAlaLeuAlaArgArgSerLeuLeuPheArgAsnAlaPhe
505560
ThrSerValSerSerCysSerProSerArgAlaSerLeuLeuThrGly
65707580
LeuProGlnHisGlnAsnGlyMetTyrGlyLeuHisGlnAspValHis
859095
HisPheAsnSerPheAspLysValArgSerLeuProLeuLeuLeuSer
100105110
GlnAlaGlyValArgThrGlyIleIleGlyLysLysHisValGlyPro
115120125
GluThrValTyrProPheAspPheAlaTyrThrGluGluAsnGlySer
130135140
ValLeuGlnValGlyArgAsnIleThrArgIleLysLeuLeuValArg
145150155160
LysPheLeuGlnThrGlnAspAspArgProPhePheLeuTyrValAla
165170175
PheHisAspProHisArgCysGlyHisSerGlnProGlnTyrGlyThr
180185190
PheCysGluLysPheGlyAsnGlyGluSerGlyMetGlyArgIlePro
195200205
AspTrpThrProGlnAlaTyrAspProLeuAspValLeuValProTyr
210215220
PheValProAsnThrProAlaAlaArgAlaAspLeuAlaAlaGlnTyr
225230235240
ThrThrValGlyArgMetAspGlnGlyValGlyLeuValLeuGlnGlu
245250255
LeuArgAspAlaGlyValLeuAsnAspThrLeuValIlePheThrSer
260265270
AspAsnGlyIleProPheProSerGlyArgThrAsnLeuTyrTrpPro
275280285
GlyThrAlaGluProLeuLeuValSerSerProGluHisProLysArg
290295300
TrpGlyGlnValSerGluAlaTyrValSerLeuLeuAspLeuThrPro
305310315320
ThrIleLeuAspTrpPheSerIleProTyrProSerTyrAlaIlePhe
325330335
GlySerLysThrIleHisLeuThrGlyArgSerLeuLeuProAlaLeu
340345350
GluAlaGluProLeuTrpAlaThrValPheGlySerGlnSerHisHis
355360365
GluValThrMetSerTyrProMetArgSerValGlnHisArgHisPhe
370375380
ArgLeuValHisAsnLeuAsnPheLysMetProPheProIleAspGln
385390395400
AspPheTyrValSerProThrPheGlnAspLeuLeuAsnArgThrThr
405410415
AlaGlyGlnProThrGlyTrpTyrLysAspLeuArgHisTyrTyrTyr
420425430
ArgAlaArgTrpGluLeuTyrAspArgSerArgAspProHisGluThr
435440445
GlnAsnLeuAlaThrAspProArgPheAlaGlnLeuLeuGluMetLeu
450455460
ArgAspGlnLeuAlaLysTrpGlnTrpGluThrHisAspProTrpVal
465470475480
CysAlaProAspGlyValLeuGluGluLysLeuSerProGlnCysGln
485490495
ProLeuHisAsnGluLeu
500
(2) INFORMATION FOR SEQ ID NO:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:
ArgProArgAsnAlaLeuLeuLeuLeuAlaAspAspGlyGlyPheGlu
151015
SerGlyAlaTyrXaaAsnSerAlaIle
2025
__________________________________________________________________________

Claims (13)

We claim:
1. An isolated nucleic acid molecule comprising a sequence of nucleotides which encodes or is complementary to a sequence which encodes a human sulphamidase wherein said sequence of nucleotides comprises SEQ ID NO:1.
2. The isolated nucleic acid molecule according to claim 1 wherein the nucleotides are deoxyribonucleotides.
3. The isolated nucleic acid molecule according to claim 2 wherein said molecule is cDNA.
4. The isolated nucleic acid molecule according to claim 2 wherein said molecule is a genomic DNA molecule.
5. The isolated nucleic acid according to claim 1 wherein the sulphamidase is of liver, kidney or placenta origin.
6. The isolated nucleic acid molecule according to claim 1 wherein said molecule is carried by a vector capable of replication in a eukaryotic cell or a prokaryotic cell.
7. The isolated nucleic acid molecule according to claim 6 wherein the vector is an expression vector.
8. A method of expressing a recombinant human sulphamidase in a eukaryotic cell comprising introducing the isolated nucleic acid molecule according to claim 7 into said cell and incubating said cell under conditions sufficient for expression to occur.
9. The method according to claim 8 wherein the eukaryotic cell is a mammalian cell.
10. A nucleic acid molecule derived from humans comprising a sequence of nucleotides encoding or complementary to a sequence encoding a polypeptide which hydrolyzes the sulphate ester bond in 2-sulphaminoglucosamine residues and wherein said nucleotide sequence hybridizes under high stringency conditions to the nucleotide sequence set forth in FIG. 2 (SEQ ID NO.1).
11. An isolated nucleic acid molecule having a nucleotide sequence as set forth in SEQ ID NO.1 which encodes human sulphamidase.
12. A replicable expression vector comprising an isolated nucleic acid molecule having a nucleotide sequence as set forth in SEQ ID NO.1.
13. An isolated nucleic acid molecule comprising a sequence of nucleotides which encodes or is complementary to a sequence which encodes a human sulphamidase wherein said sequence of nucleotides hybridizes under high stringency conditions to the nucleotide sequence set forth in FIG. 2 (SEQ ID NO:1).
US08/424,881 1995-04-19 1995-04-19 Synthetic mammalian sulphamidase and genetic sequences encoding same Expired - Lifetime US5863782A (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
US08/424,881 US5863782A (en) 1995-04-19 1995-04-19 Synthetic mammalian sulphamidase and genetic sequences encoding same
US08/874,763 US5972333A (en) 1995-04-19 1997-06-13 Synthetic mammalian sulphamidase and genetic sequences encoding same
US09/370,867 US6200563B1 (en) 1995-04-19 1999-08-09 Synthetic mammalian sulphamidase and genetic sequences encoding same
US09/729,472 US6458579B2 (en) 1995-04-19 2000-12-04 Synthetic mammalian sulphamidase and genetic sequences encoding same
US09/729,499 US6491913B2 (en) 1995-04-19 2000-12-04 Synthetic mammalian sulphamidase and genetic sequences encoding same

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
US08/424,881 US5863782A (en) 1995-04-19 1995-04-19 Synthetic mammalian sulphamidase and genetic sequences encoding same

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US08/874,763 Division US5972333A (en) 1995-04-19 1997-06-13 Synthetic mammalian sulphamidase and genetic sequences encoding same

Publications (1)

Publication Number Publication Date
US5863782A true US5863782A (en) 1999-01-26

Family

ID=23684262

Family Applications (5)

Application Number Title Priority Date Filing Date
US08/424,881 Expired - Lifetime US5863782A (en) 1995-04-19 1995-04-19 Synthetic mammalian sulphamidase and genetic sequences encoding same
US08/874,763 Expired - Lifetime US5972333A (en) 1995-04-19 1997-06-13 Synthetic mammalian sulphamidase and genetic sequences encoding same
US09/370,867 Expired - Lifetime US6200563B1 (en) 1995-04-19 1999-08-09 Synthetic mammalian sulphamidase and genetic sequences encoding same
US09/729,499 Expired - Lifetime US6491913B2 (en) 1995-04-19 2000-12-04 Synthetic mammalian sulphamidase and genetic sequences encoding same
US09/729,472 Expired - Lifetime US6458579B2 (en) 1995-04-19 2000-12-04 Synthetic mammalian sulphamidase and genetic sequences encoding same

Family Applications After (4)

Application Number Title Priority Date Filing Date
US08/874,763 Expired - Lifetime US5972333A (en) 1995-04-19 1997-06-13 Synthetic mammalian sulphamidase and genetic sequences encoding same
US09/370,867 Expired - Lifetime US6200563B1 (en) 1995-04-19 1999-08-09 Synthetic mammalian sulphamidase and genetic sequences encoding same
US09/729,499 Expired - Lifetime US6491913B2 (en) 1995-04-19 2000-12-04 Synthetic mammalian sulphamidase and genetic sequences encoding same
US09/729,472 Expired - Lifetime US6458579B2 (en) 1995-04-19 2000-12-04 Synthetic mammalian sulphamidase and genetic sequences encoding same

Country Status (1)

Country Link
US (5) US5863782A (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070239092A1 (en) * 2004-08-04 2007-10-11 Ross Bradley A Adjustable tissue compression device
WO2012085622A1 (en) * 2010-12-22 2012-06-28 Fondazione Telethon Therapeutic strategies to treat cns pathology in mucopolysaccharidoses
US9982243B2 (en) 2014-04-01 2018-05-29 Swedish Orphan Biovitrum Ab (Publ) Modified sulfamidase and production thereof
US20180193431A1 (en) * 2011-06-08 2018-07-12 Nationwide Children's Hospital, Inc Products and Methods for Delivery of Polynucleotides by Adeno-Associated Virus for Lysosomal Storage Disorders

Families Citing this family (59)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5863782A (en) * 1995-04-19 1999-01-26 Women's And Children's Hospital Synthetic mammalian sulphamidase and genetic sequences encoding same
EP2325301B1 (en) * 2003-02-11 2015-09-02 Shire Human Genetic Therapies, Inc. Diagnosis and treatment of multiple sulfatase deficiency and others using a formylglycine generating enzyme (FGE)
DE602005027461D1 (en) 2004-04-21 2011-05-26 Enobia Pharma Inc CONJUGATES FOR INTRODUCTION TO BONE AND METHOD FOR THEIR USE IN THE INTRODUCTION OF PROTEINS FOR BONE
JP5139800B2 (en) * 2004-06-03 2013-02-06 ノビミューン エスアー Anti-CD3 antibody and method of use thereof
US20070081984A1 (en) 2005-10-11 2007-04-12 Shunji Tomatsu Compositions and methods for treating hypophosphatasia
US8673601B2 (en) * 2007-01-22 2014-03-18 Genomatica, Inc. Methods and organisms for growth-coupled production of 3-hydroxypropionic acid
CN101978042B (en) * 2008-01-22 2017-03-08 基因组股份公司 Processes and organisms utilizing synthesis gas or other gaseous carbon sources and methanol
EP2262901B1 (en) 2008-03-05 2018-11-21 Genomatica, Inc. Primary alcohol producing organisms
CN102066551B (en) 2008-03-27 2013-10-09 基因组股份公司 Microorganisms for the production of adipic acid and other compounds
WO2009135074A2 (en) * 2008-05-01 2009-11-05 Genomatica, Inc. Microorganisms for the production of methacrylic acid
US20100021978A1 (en) * 2008-07-23 2010-01-28 Genomatica, Inc. Methods and organisms for production of 3-hydroxypropionic acid
US20100184173A1 (en) * 2008-11-14 2010-07-22 Genomatica, Inc. Microorganisms for the production of methyl ethyl ketone and 2-butanol
EP2373781A4 (en) * 2008-12-16 2012-10-10 Genomatica Inc Microorganisms and methods for conversion of syngas and other carbon sources to useful products
EP4321615A3 (en) 2009-04-30 2024-02-21 Genomatica, Inc. Organisms for the production of 1,3-butanediol
BRPI1013505A2 (en) 2009-04-30 2018-02-14 Genomatica Inc organisms for the production of isopropanol, n-butanol, and isobutanol
DK2427544T3 (en) 2009-05-07 2019-10-07 Genomatica Inc MICROORGANISMS AND PROCEDURES FOR BIOSYNTHESIS OF ADIPAT, HEXAMETHYLENDIAMINE AND 6-AMINOCAPRONIC ACID
BRPI1012877A2 (en) * 2009-05-15 2016-04-05 Genomatica Inc organism for cyclohexanone production
EP2440669A4 (en) * 2009-06-10 2013-08-28 Genomatica Inc Microorganisms and methods for carbon-efficient biosynthesis of mek and 2-butanol
WO2011017560A1 (en) 2009-08-05 2011-02-10 Genomatica, Inc. Semi-synthetic terephthalic acid via microorganisms that produce muconic acid
EP2933338A3 (en) 2009-09-09 2016-01-06 Genomatica, Inc. Microorganisms and methods for the co-production of isopropanol with primary alcohols, diols and acids
US8377666B2 (en) 2009-10-13 2013-02-19 Genomatica, Inc. Microorganisms for the production of 1,4-butanediol, 4-hydroxybutanal, 4-hydroxybutyryl-coa, putrescine and related compounds, and methods related thereto
KR20180014240A (en) 2009-10-23 2018-02-07 게노마티카 인코포레이티드 Microorganisms for the production of aniline
US8268607B2 (en) * 2009-12-10 2012-09-18 Genomatica, Inc. Methods and organisms for converting synthesis gas or other gaseous carbon sources and methanol to 1,3-butanediol
EP2529011A4 (en) * 2010-01-29 2015-07-15 Genomatica Inc Microorganisms and methods for the biosynthesis of p-toluate and terephthalate
US8637286B2 (en) 2010-02-23 2014-01-28 Genomatica, Inc. Methods for increasing product yields
US8048661B2 (en) 2010-02-23 2011-11-01 Genomatica, Inc. Microbial organisms comprising exogenous nucleic acids encoding reductive TCA pathway enzymes
BR112012027765A2 (en) 2010-04-30 2019-09-24 Enobia Pharma Inc. methods, compositions and kits for treating matrix mineralization disorders.
US9023636B2 (en) 2010-04-30 2015-05-05 Genomatica, Inc. Microorganisms and methods for the biosynthesis of propylene
KR101814648B1 (en) 2010-05-05 2018-01-04 게노마티카 인코포레이티드 Microorganisms and methods for the biosynthsis of butadiene
NZ605873A (en) 2010-06-25 2015-02-27 Shire Human Genetic Therapies Methods and compositions for cns delivery of arylsulfatase a
SMT201600385T1 (en) 2010-06-25 2017-03-08 Shire Human Genetic Therapies Cns delivery of therapeutic agents
RS62620B1 (en) 2010-06-25 2021-12-31 Shire Human Genetic Therapies Methods and compositions for cns delivery of arylsulfatase a
NZ605874A (en) 2010-06-25 2015-02-27 Shire Human Genetic Therapies Methods and compositions for cns delivery of heparan n-sulfatase
BR112013001635A2 (en) 2010-07-26 2016-05-24 Genomatica Inc microorganism and methods for the biosynthesis of aromatics, 2,4-pentadienoate and 1,3-butadiene
JP6055779B2 (en) 2010-12-27 2016-12-27 アレクシオン ファーマシューティカルズ, インコーポレイテッド Composition comprising natriuretic peptide and method of use thereof
US20160145589A1 (en) 2011-06-24 2016-05-26 Green Cross Corporation Composition and formulation comprising recombinant human iduronate-2-sulfatase and preparation method thereof
US20140377244A1 (en) 2011-12-23 2014-12-25 Shire Human Genetic Therapies, Inc. Stable formulations for cns delivery of arylsulfatase a
US10052366B2 (en) 2012-05-21 2018-08-21 Alexion Pharmaceuticsl, Inc. Compositions comprising alkaline phosphatase and/or natriuretic peptide and methods of use thereof
US9150841B2 (en) 2012-06-29 2015-10-06 Shire Human Genetic Therapies, Inc. Cells for producing recombinant iduronate-2-sulfatase
KR101380740B1 (en) 2012-06-29 2014-04-11 쉐어 휴먼 제네텍 세러피스, 인코포레이티드 Purification of iduronate-2-sulfatase
US10822596B2 (en) 2014-07-11 2020-11-03 Alexion Pharmaceuticals, Inc. Compositions and methods for treating craniosynostosis
JP6787894B2 (en) 2014-12-05 2020-11-18 アレクシオン ファーマシューティカルズ, インコーポレイテッド Treatment of seizures with recombinant alkaline phosphatase
JP6868561B2 (en) 2015-01-28 2021-05-12 アレクシオン ファーマシューティカルズ, インコーポレイテッド How to treat subjects with alkaline phosphatase deficiency
JP6993961B2 (en) 2015-08-17 2022-01-14 アレクシオン ファーマシューティカルズ, インコーポレイテッド Production of alkaline phosphatase
EP3355904A4 (en) 2015-09-28 2019-06-12 Alexion Pharmaceuticals, Inc. IDENTIFICATION OF EFFICIENT POSOLOGICAL REGIMES FOR NON-SPECIFIC TISSUE ALKALINE ENZYME PHOSPHATASE REPLACEMENT HYPOPHOSPHATASE (TNSALP) THERAPY
WO2017074466A1 (en) 2015-10-30 2017-05-04 Alexion Pharmaceuticals, Inc. Methods for treating craniosynostosis in a patient
WO2017155569A1 (en) 2016-03-08 2017-09-14 Alexion Pharmaceuticals, Inc. Methods for treating hypophosphatasia in children
US10898549B2 (en) 2016-04-01 2021-01-26 Alexion Pharmaceuticals, Inc. Methods for treating hypophosphatasia in adolescents and adults
KR20240160671A (en) 2016-04-01 2024-11-11 알렉시온 파마슈티칼스, 인코포레이티드 Treating muscle weakness with alkaline phosphatases
EP3464573B1 (en) 2016-06-06 2026-03-04 Alexion Pharmaceuticals, Inc. Metal impact on manufacturing of alkaline phosphatases
EP3500289B1 (en) 2016-08-18 2024-10-09 Alexion Pharmaceuticals, Inc. Asfotase alfa for use in treating tracheobronchomalacia
KR20190129058A (en) 2017-03-31 2019-11-19 알렉시온 파마슈티칼스, 인코포레이티드 How to treat hypophosphatase (HPP) in adults and adolescents
MX2019013528A (en) * 2017-05-12 2020-07-14 The Children´S Hospital Of Philadelphia Sulfamidase (sgsh) variants, vectors, compositions and methods and uses for treating mucopolysaccharidosis type iiia (mps iiia).
US11913039B2 (en) 2018-03-30 2024-02-27 Alexion Pharmaceuticals, Inc. Method for producing recombinant alkaline phosphatase
ES2972119T3 (en) 2018-08-10 2024-06-11 Alexion Pharma Inc Bone healing in implants using alkaline phosphatase
KR20220111693A (en) 2019-12-09 2022-08-09 알렉시온 파마슈티칼스, 인코포레이티드 Alkaline phosphatase polypeptides and methods of using the same
PE20231931A1 (en) 2020-10-14 2023-12-01 Denali Therapeutics Inc FUSION PROTEINS COMPRISING SULFOGLUCOSAMINE SULFOHYDROLASE ENZYMES AND METHODS THEREOF
US12083169B2 (en) 2021-02-12 2024-09-10 Alexion Pharmaceuticals, Inc. Alkaline phosphatase polypeptides and methods of use thereof
CN119095873A (en) 2022-03-14 2024-12-06 拉姆卡普生物伽马股份公司 Bispecific GPC3xCD28 and GPC3xCD3 antibodies and combinations thereof for targeted killing of GPC3-positive malignant cells

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5217881A (en) * 1989-04-25 1993-06-08 Immunex Corporation Hyperglycosylated cytokine conjugates
US5863782A (en) * 1995-04-19 1999-01-26 Women's And Children's Hospital Synthetic mammalian sulphamidase and genetic sequences encoding same

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
Alberts, B. et al. Molecular Biology of the Cell, 2nd Ed., published 1989 by Garland Publ. (New York), pp. 258 266, 1989. *
Alberts, B. et al. Molecular Biology of the Cell, 2nd Ed., published 1989 by Garland Publ. (New York), pp. 258-266, 1989.
Coulter, P.M. II et al. (1983) "Identification of cortexin: a novel, neuron-specific, 82-residue membrane protein enriched in rodent cerebral cortex" J. Neurochem. 61:756-759.
Coulter, P.M. II et al. (1983) Identification of cortexin: a novel, neuron specific, 82 residue membrane protein enriched in rodent cerebral cortex J. Neurochem. 61:756 759. *
Freeman, C. et al. (1986) "Human liver sulphamate sulphohydrolase" Biochem. J. 234:83-92, 1983.
Freeman, C. et al. (1986) Human liver sulphamate sulphohydrolase Biochem. J. 234:83 92, 1983. *
Mahuran, D. et al. (1983) "A rapid four column purification of 2-deoxy-D-glucoside-2-sulphamate sulphohydrolase from human liver" Biochim. Biophys. Acta 757:359-365.
Mahuran, D. et al. (1983) A rapid four column purification of 2 deoxy D glucoside 2 sulphamate sulphohydrolase from human liver Biochim. Biophys. Acta 757:359 365. *

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070239092A1 (en) * 2004-08-04 2007-10-11 Ross Bradley A Adjustable tissue compression device
US7780612B2 (en) * 2004-08-04 2010-08-24 Bradley Allan Ross Adjustable tissue compression device
WO2012085622A1 (en) * 2010-12-22 2012-06-28 Fondazione Telethon Therapeutic strategies to treat cns pathology in mucopolysaccharidoses
US9206401B2 (en) 2010-12-22 2015-12-08 Fondazione Telethon Therapeutic strategies to treat CNS pathology in mucopolysaccharidoses
US9487766B2 (en) 2010-12-22 2016-11-08 Fond Azione Telethon Therapeutic strategies to treat CNS pathology in mucopolysaccharidoses
US20180193431A1 (en) * 2011-06-08 2018-07-12 Nationwide Children's Hospital, Inc Products and Methods for Delivery of Polynucleotides by Adeno-Associated Virus for Lysosomal Storage Disorders
US12324829B2 (en) * 2011-06-08 2025-06-10 Nationwide Children's Hospital, Inc. Methods for delivery of polynucleotides by adeno-associated virus for lysosomal storage disorders
US9982243B2 (en) 2014-04-01 2018-05-29 Swedish Orphan Biovitrum Ab (Publ) Modified sulfamidase and production thereof

Also Published As

Publication number Publication date
US6458579B2 (en) 2002-10-01
US5972333A (en) 1999-10-26
US6491913B2 (en) 2002-12-10
US6200563B1 (en) 2001-03-13
US20020106358A1 (en) 2002-08-08
US20010014323A1 (en) 2001-08-16

Similar Documents

Publication Publication Date Title
US5863782A (en) Synthetic mammalian sulphamidase and genetic sequences encoding same
US5179023A (en) Recombinant α-galactosidase a therapy for Fabry disease
US9315790B2 (en) Polynucleotides encoding proteins having acquired α-galactosidase activity
US8668907B2 (en) Highly functional enzyme having α-galactosidase activity
ES2380950T3 (en) Use of the IdeS proteinase (from S, pyogenes) to treat autoimmune diseases and graft rejection
JP2003009889A (en) Interleukin-1β convertase-like apoptotic proteases-3 and 4
CA2189774A1 (en) Recombinant hk2 polypeptide
KR101535791B1 (en) Improved iduronate-2-sulfatase and use thereof
JPH11253186A (en) Novel ornithinecarbamoyl transferase
US6149909A (en) Synthetic α-L-iduronidase and genetic sequences encoding same
AU649897B2 (en) Synthetic alpha-L-iduronidase and genetic sequences encoding same
ES2319828T3 (en) ALFA-N-ACETILGLUCOSAMINIDASA SYNTHETIC OF MAMMALS AND GENETIC SEQUENCES THAT CODIFY IT.
CN101232900B (en) Use of IdeS protease (from Streptococcus pyogenes) in the treatment of autoimmune diseases and transplant rejection
JPH11243969A (en) New MurD
WO1993001830A1 (en) Expression of enzymatically active recombinant human acetylcholinesterase and uses thereof
US6291648B1 (en) Antitumor protein and corresponding gene sequence isolated from matsutake mushrooms
JPH11155582A (en) New GlmU
JPH11235178A (en) New MurB
JPH11285390A (en) Novel alcohol dehydrogenase
JP3577171B2 (en) Glucodextranase gene, recombinant DNA and method for producing glucodextranase
EP3639825A1 (en) Pharmaceutical combination for treatment of fabry disease and use thereof
JPH11332580A (en) New AmpS
JPH11262392A (en) New MurE
JPH11253175A (en) New phoH
JPH11318469A (en) New fol c

Legal Events

Date Code Title Description
AS Assignment

Owner name: WOMEN'S AND CHILDREN'S HOSPITAL, AUSTRALIA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:HOPWOOD, JOHN JOSEPH;SCOTT, HAMISH STEELE;FREEMAN, CRAIG GEOFFREY;AND OTHERS;REEL/FRAME:007523/0927;SIGNING DATES FROM 19950523 TO 19950531

AS Assignment

Owner name: WOMEN'S AND CHILDREN'S HOSPITAL, AUSTRALIA

Free format text: TO CORRECT ASSIGNMENT RECORDAL (TO CORRECT SPELLIN;ASSIGNORS:HOPWOOD, JOHN JOSEPH;SCOTT, HAMISH STEELE;FREEMAN, CRAIG GEOFFREY;AND OTHERS;REEL/FRAME:007785/0060;SIGNING DATES FROM 19950523 TO 19950531

STCF Information on status: patent grant

Free format text: PATENTED CASE

FPAY Fee payment

Year of fee payment: 4

FEPP Fee payment procedure

Free format text: PAT HOLDER NO LONGER CLAIMS SMALL ENTITY STATUS, ENTITY STATUS SET TO UNDISCOUNTED (ORIGINAL EVENT CODE: STOL); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

REFU Refund

Free format text: REFUND - PAYMENT OF MAINTENANCE FEE, 8TH YR, SMALL ENTITY (ORIGINAL EVENT CODE: R2552); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

FPAY Fee payment

Year of fee payment: 8

FPAY Fee payment

Year of fee payment: 12