US5863727A - Energy transfer dyes with enhanced fluorescence - Google Patents
Energy transfer dyes with enhanced fluorescence Download PDFInfo
- Publication number
- US5863727A US5863727A US08/642,330 US64233096A US5863727A US 5863727 A US5863727 A US 5863727A US 64233096 A US64233096 A US 64233096A US 5863727 A US5863727 A US 5863727A
- Authority
- US
- United States
- Prior art keywords
- dye
- group
- acceptor
- donor
- energy transfer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Lifetime
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
- C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C09—DYES; PAINTS; POLISHES; NATURAL RESINS; ADHESIVES; COMPOSITIONS NOT OTHERWISE PROVIDED FOR; APPLICATIONS OF MATERIALS NOT OTHERWISE PROVIDED FOR
- C09B—ORGANIC DYES OR CLOSELY-RELATED COMPOUNDS FOR PRODUCING DYES, e.g. PIGMENTS; MORDANTS; LAKES
- C09B11/00—Diaryl- or thriarylmethane dyes
- C09B11/04—Diaryl- or thriarylmethane dyes derived from triarylmethanes, i.e. central C-atom is substituted by amino, cyano, alkyl
-
- C—CHEMISTRY; METALLURGY
- C09—DYES; PAINTS; POLISHES; NATURAL RESINS; ADHESIVES; COMPOSITIONS NOT OTHERWISE PROVIDED FOR; APPLICATIONS OF MATERIALS NOT OTHERWISE PROVIDED FOR
- C09B—ORGANIC DYES OR CLOSELY-RELATED COMPOUNDS FOR PRODUCING DYES, e.g. PIGMENTS; MORDANTS; LAKES
- C09B11/00—Diaryl- or thriarylmethane dyes
- C09B11/04—Diaryl- or thriarylmethane dyes derived from triarylmethanes, i.e. central C-atom is substituted by amino, cyano, alkyl
- C09B11/10—Amino derivatives of triarylmethanes
- C09B11/24—Phthaleins containing amino groups ; Phthalanes; Fluoranes; Phthalides; Rhodamine dyes; Phthaleins having heterocyclic aryl rings; Lactone or lactame forms of triarylmethane dyes
-
- C—CHEMISTRY; METALLURGY
- C09—DYES; PAINTS; POLISHES; NATURAL RESINS; ADHESIVES; COMPOSITIONS NOT OTHERWISE PROVIDED FOR; APPLICATIONS OF MATERIALS NOT OTHERWISE PROVIDED FOR
- C09B—ORGANIC DYES OR CLOSELY-RELATED COMPOUNDS FOR PRODUCING DYES, e.g. PIGMENTS; MORDANTS; LAKES
- C09B23/00—Methine or polymethine dyes, e.g. cyanine dyes
- C09B23/02—Methine or polymethine dyes, e.g. cyanine dyes the polymethine chain containing an odd number of >CH- or >C[alkyl]- groups
- C09B23/08—Methine or polymethine dyes, e.g. cyanine dyes the polymethine chain containing an odd number of >CH- or >C[alkyl]- groups more than three >CH- groups, e.g. polycarbocyanines
- C09B23/083—Methine or polymethine dyes, e.g. cyanine dyes the polymethine chain containing an odd number of >CH- or >C[alkyl]- groups more than three >CH- groups, e.g. polycarbocyanines five >CH- groups
-
- C—CHEMISTRY; METALLURGY
- C09—DYES; PAINTS; POLISHES; NATURAL RESINS; ADHESIVES; COMPOSITIONS NOT OTHERWISE PROVIDED FOR; APPLICATIONS OF MATERIALS NOT OTHERWISE PROVIDED FOR
- C09B—ORGANIC DYES OR CLOSELY-RELATED COMPOUNDS FOR PRODUCING DYES, e.g. PIGMENTS; MORDANTS; LAKES
- C09B69/00—Dyes not provided for by a single group of this subclass
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
Definitions
- the present invention relates to fluorescent dyes and, more specifically, energy transfer fluorescent dyes and their use.
- fluorescent dyes have been developed for labelling and detecting components in a sample.
- fluorescent dyes preferably have a high quantum yield and a large extinction coefficient so that the dye may be used to detect small quantities of the component being detected.
- Fluorescent dyes also preferably have a large Stokes shift (i.e., the difference between the wavelength at which the dye has maximum absorbance and the wavelength at which the dye has maximum emission) so that the fluorescent emission is readily distinguished from the light source used to excite the dye.
- energy transfer fluorescent dyes include a donor fluorophore and an acceptor fluorophore.
- donor fluorophore When the donor and acceptor fluorophores are positioned in proximity with each other and with the proper orientation relative to each other, the energy emission from the donor fluorophore is absorbed by the acceptor fluorophore and causes the acceptor fluorophore to fluoresce. It is therefore important that the excited donor fluorophore be able to efficiently absorb the excitation energy of the donor fluorophore and efficiently transfer the energy to the acceptor fluorophore.
- the use of multiple spectrally resolvable fluorescent dyes reduces the number of reaction tubes that are needed, thereby simplifying the experimental protocols and facilitating the manufacturing of application-specific kits.
- the use of multiple spectrally resolvable fluorescent dyes allows for the analysis of all four bases in a single lane thereby increasing throughput over single-color methods and eliminating uncertainties associated with inter-lane electrophoretic mobility variations.
- each dye in the set must be spectrally resolvable from the other dyes. It is difficult to find a collection of dyes whose emission spectra are spectrally resolved, since the typical emission band half-width for organic fluorescent dyes is about 40-80 nanometers (nm) and the width of the available spectrum is limited by the excitation light source.
- spectral resolution in reference to a set of dyes means that the fluorescent emission bands of the dyes are sufficiently distinct, i.e., sufficiently non-overlapping, that reagents to which the respective dyes are attached, e.g. polynucleotides, can be distinguished on the basis of the fluorescent signal generated by the respective dyes using standard photodetection systems, e.g. employing a system of band pass filters and photomultiplier tubes, charged-coupled devices and spectrographs, or the like, as exemplified by the systems described in U.S. Pat. Nos. 4,230,558, 4,811,218, or in Wheeless et al, pgs. 21-76, in Flow Cytometry: Instrumentation and Data Analysis (Academic Press, N.Y., 1985).
- the fluorescent signal of each of the dyes must also be sufficiently strong so that each component can be detected with sufficient sensitivity.
- increased sample loading can not compensate for low fluorescence efficiencies, Pringle et al., DNA Core Facilities Newsletter, 1 15-21 (1988).
- the fluorescent signal generated by a dye is generally greatest when the dye is excited at its absorbance maximum. It is therefore preferred that each dye be excited at about its absorbance maximum.
- a further difficulty associated with the use of a set of dyes is that the dyes generally do not have the same absorbance maximum.
- a trade off is created between the higher cost associated with providing multiple light sources to excite each dye at its absorbance maximum, and the lower sensitivity arising from each dye not being excited at its absorbance maximum.
- the fluorescent dyes must also be compatible with the chemistry used to create or manipulate the fragments, e.g., DNA synthesis solvents and reagents, buffers, polymerase enzymes, ligase enzymes, and the like.
- Energy transfer fluorescent dyes possess several features which make them attractive for use in the simultaneous detection of multiple target substances in a sample, such as in DNA sequencing.
- a single donor fluorophore can be used in a set of energy transfer fluorescent dyes so that each dye has strong absorption at a common wavelength. Then, by varying the acceptor fluorophore in the energy transfer dye, a series of energy transfer dyes having spectrally resolvable fluorescence emissions can be generated.
- Energy transfer fluorescent dyes also provide a larger effective Stokes shift than non-energy transfer fluorescent dyes. This is because the Stokes shift for an energy transfer fluorescent dye is based on the difference between the wavelength at which the donor fluorophore maximally absorbs light and the wavelength at which the acceptor fluorophore maximally emits light. In general, a need exists for fluorescent dyes having larger Stokes shifts.
- the sensitivity of any assay using a fluorescent dye is dependent on the strength of the fluorescent signal generated by the fluorescent dye.
- the fluorescence signal strength of these dyes is dependent on how efficiently the acceptor fluorophore absorbs the energy emission of the donor fluorophore. This, in turn, depends on a variety of variables, including the proximity of the donor fluorophore to the acceptor fluorophore and the orientation of the donor fluorophore relative to the acceptor fluorophore.
- the present invention relates to energy transfer fluorescent dyes having enhanced fluorescence which include a donor dye which absorbs light at a first wavelength and emits excitation energy in response, an acceptor dye which is capable of absorbing the excitation energy emitted by the donor dye and fluorescing at a second wavelength in response, and a linker which attaches the donor dye to the acceptor dye.
- the donor dye has the following xanthene ring structure with a 4' ring position ##STR1## where Y 1 and Y 2 taken separately are either hydroxyl, oxygen, iminium or amine, the iminium and amine preferably being a tertiary iminium or amine.
- R 11 -R 17 may be any substituent which is compatible with the energy transfer dyes of the present invention, it being noted that the R 11 -R 17 may be widely varied in order to alter the spectral and mobility properties of the dyes.
- the energy transfer dye also includes an acceptor dye which absorbs the excitation energy emitted by the donor dye and fluoresces at a second wavelength in response.
- the energy transfer dye also includes a linker which attaches the donor dye to the acceptor dye, the linker having a 4' end which includes a R 1 XC(O)R 2 group where R 1 is a C 1-5 alkyl attached to the 4' ring position of the donor dye, C(O) is a carbonyl group, X is either NH, sulfur or oxygen, and R 2 includes an alkene, diene, alkyne, a five and six membered ring having at least one unsaturated bond or a fused ring structure which is attached to the carbonyl carbon.
- the donor dye may optionally be a member of the class of dyes where R 17 is a phenyl or substituted phenyl.
- R 17 is a phenyl or substituted phenyl.
- the dye is a member of the fluorescein class of dyes.
- the acceptor dye may optionally be a member of the xanthene, cyanine, phthalocyanine and squaraine classes of dyes.
- the energy transfer fluorescent dyes include a donor dye which is a member of the xanthene class of dyes, an acceptor dye which is a member of the xanthene, cyanine, phthalocyanine and squaraine classes of dyes which is capable of absorbing the excitation energy emitted by the donor dye and fluorescing at a second wavelength in response, and a linker attaching the donor dye to the acceptor dye.
- the acceptor has an emission maximum that is greater than about 600 nm or at least about 100 nm greater than the absorbance maximum of the donor dye.
- the linker is attached to the donor dye at the 4' ring position of the xanthene ring structure.
- the linker includes a R 3 X group where R 3 is a C 1-5 alkyl attached to the 4' ring position of the donor xanthene ring structure and X is either NH, sulfur or oxygen.
- the linker includes a R 3 XC(O)R 4 N group where R 3 is a C 1-5 alkyl attached to the donor dye at the 4' xanthene ring position, X is either NH, sulfur or oxygen, C(O) is a carbonyl group, and R 4 has a carbon backbone such that C(O)R 4 N forms an amino acid subunit.
- the energy transfer fluorescent dyes have donor and acceptor dyes with the general structure ##STR2## where Y 1 and Y 2 taken separately are either hydroxyl, oxygen, iminium or amine, the iminium and amine preferably being a tertiary iminium or amine and R 11 -R 17 are any substituents which are compatible with the energy transfer dyes of the present invention.
- the linker is the X 3 substituent of the donor and acceptor dyes.
- the linker is preferably short and/or rigid as this has been found to enhance the transfer of energy between the donor and acceptor dyes.
- the present invention also relates to fluorescent reagents containing the energy transfer fluorescent dyes.
- these reagents include any molecule or material to which the energy transfer dyes of the invention can be attached and used to detect the presence of the reagent based on the fluorescence of the energy transfer dye.
- a fluorescent reagent is provided which includes a nucleoside or a mono-, di- or triphosphate nucletotide labelled with an energy transfer fluorescent dye.
- the nucleotide may be a deoxynucleotide which may be used for example, in the preparation of dye labelled oligonucleotides.
- the nucleotide may also be a dideoxynucleoside which may be used, for example, in dye terminator sequencing.
- the fluorescent reagent includes an oligonucleotide labelled with an energy transfer fluorescent dye. These reagents may be used, for example, in dye primer sequencing.
- the present invention also relates to methods which use the energy transfer fluorescent dyes and reagents of the present invention.
- the method includes forming a series of different sized oligonucleotides labelled with an energy transfer fluorescent dye of the present invention, separating the series of labelled oligonucleotides based on size, detecting the separated labelled oligonucleotides based on the fluorescence of the energy transfer dye.
- a mixture of extended labelled primers is formed by hybridizing a nucleic acid sequence with an oligonucleotide primer in the presence of deoxynucleotide triphosphates, and at least one dye labelled dideoxynucleotide triphosphate and a DNA polymerase.
- the DNA polymerase serves to extend the primer with the deoxynucleotide triphosphates until a dideoxynucleotide triphosphate is incorporated which terminates extension of the primer.
- the mixture of extended primers are separated and detected based on the fluorescence of the dye on the dideoxynucleoside.
- dideoxynucleotide triphosphates four different fluorescently labelled dideoxynucleotide triphosphates are used, i.e., a fluorescently labelled dideoxycytosine triphosphate, a fluorescently labelled dideoxyadenosine triphosphate, a fluorescently labelled dideoxyguanosine triphosphate, and a fluorescently labelled dideoxythymidine triphosphate.
- the oligonucleotide primer is fluorescently labelled as opposed to the deoxynucleotide triphosphate.
- the present invention also relates to kits containing the dyes and reagents for performing DNA sequencing using the dyes and reagents of present invention.
- FIG. 1 illustrates the modification of a carboxy substituent on a energy transfer dye to an activated N-hydroxysuccinimidyl (NHS) ester which is then reacted with an aminohexyl-oligomer to form a dye labelled oligonucleotide primer.
- NHS N-hydroxysuccinimidyl
- FIG. 2 compares the fluorescence emission strength of a series of energy transfer dyes of the present invention to other energy transfer dyes and the acceptor dye alone.
- FIG. 3 illustrates a set of four dyes (3-carboxy-R110, 5-carboxy-R6G, 5TMR-B-CF and 5ROX-CF) which are spectrally resolvable from each other.
- FIG. 4 illustrates a set of four dyes (3-carboxy-R110, 5-carboxy-R6G, 5ROX-CF and Cy5-CF) which are spectrally resolvable from each other.
- FIG. 5 is a plot of a mixture of labelled oligonucleotides generated during dye primer sequencing using 5TMR-CF and 5TMR-B-CF labelled primers.
- FIG. 6 is a four color plot of dye primer sequencing using a four dye set including 3-carboxy-R110, 5-carboxy-R6G, 5TMR-CF and 5TMR-B-CF.
- the present invention relates to novel energy transfer fluorescent dyes which exhibit enhanced fluorescence intensity.
- the present invention also relates to reagents which include the energy transfer dyes of the present invention, methods for using the dyes and reagents, and kits within which the dyes and reagents are included.
- the energy transfer dyes of the present invention include a donor dye which absorbs light at a first wavelength and emits excitation energy in response, an acceptor dye which is capable of absorbing the excitation energy emitted by the donor dye and fluorescing at a second wavelength in response, and a linker which attaches the donor dye to the acceptor dye.
- a donor dye which absorbs light at a first wavelength and emits excitation energy in response
- an acceptor dye which is capable of absorbing the excitation energy emitted by the donor dye and fluorescing at a second wavelength in response
- a linker which attaches the donor dye to the acceptor dye.
- xanthene dyes include all molecules having the general structure ##STR3## where Y 1 and Y 2 taken separately are either hydroxyl, oxygen, iminium or amine, the iminium and amine preferably being a tertiary iminium or amine.
- Y 1 is hydroxyl and Y 2 is oxygen
- R 17 is a phenyl or substituted phenyl
- the dye is a member of the fluorescein class of dyes.
- Y 1 is amine and Y 2 is iminium
- R 17 is a phenyl or substituted phenyl
- the dye is a member of the rhodamine class of dyes.
- R 11 -R 17 may be any substituent which is compatible with the energy transfer dyes of the present invention, it being noted that the R 11 -R 17 may be widely varied in order to alter the spectral and mobility properties of the dyes.
- the number indicated in the ring structure indicates the 4' position on the xanthene ring structure.
- the R 14 substituent corresponds to the linker.
- R 11 -R 17 substituents include, but not limited to hydrogen, fluorine, chlorine, bromine, iodine, carboxyl, alkyl, alkene, alkyne, sulfonate, amino, ammonium, amido, nitrile, alkoxy, phenyl, substituted phenyl, where adjacent substituents are taken together to form a ring, and combinations thereof.
- R 15 and R 16 are taken together to form a substituted or unsubstituted benzene ring.
- This class of xanthene dyes are referred to herein as asymmetric benzoxanthene dyes and are described in U.S. application Ser. No. 08/626,085, filed Apr. 1, 1996, entitled Asymmetric Benzoxanthene Dyes, by Scott C. Benson, et al. which is incorporated herein by reference.
- R 17 is a phenyl or substituted phenyl having the general formula ##STR4##
- Substituents X 1 -X 5 on the phenyl ring can include hydrogen, fluorine, chlorine, bromine, iodine, carboxyl, alkyl, alkene, alkyne, sulfonate, amino, ammonium, amido, nitrile, alkoxy, where adjacent substituents are taken together to form a ring, and combinations thereof.
- alkyl denotes straight-chain and branched hydrocarbon moieties, i.e., methyl, ethyl, propyl, isopropyl, tert-butyl, isobutyl, sec-butyl, neopentyl, tert-pentyl, and the like.
- Substituted alkyl denotes an alkyl moiety substituted with any one of a variety of substituents, including, but not limited to hydroxy, amino, thio, cyano, nitro, sulfo, and the like.
- Haloalkyl denotes a substituted alkyl with one or more halogen atom substituents, usually fluoro, chloro, bromo, or iodo.
- Alkene denotes a hydocarbon wherein one or more of the carbon-carbon bonds are double bonds, and the non-double bonded carbons are alkyl or substituted alkyl.
- Alkyne denotes a hydrocarbon where one or more of the carbons are bonded with a triple bond and where the non-triple bonded carbons are alkyl or substituted alkyl moieties.
- Sulfonate refers to moieties including a sulfur atom bonded to 3 oxygen atoms, including mono- and di-salts thereof, e.g., sodium sulfonate, potassium sulfonate, disodium sulfonate, and the like.
- Amino refers to moieties including a nitrogen atom bonded to 2 hydrogen atoms, alkyl moieties, or any combination thereof.
- Amido refers to moieties including a carbon atom double bonded to an oxygen atom and single bonded to an amino moiety.
- Nitrile refers to moieties including a carbon atom triple bonded to a nitrogen atom.
- Alkoxy refers to a moiety including an alkyl moiety single bonded to an oxygen atom.
- Aryl refers to single or multiple phenyl or substituted phenyl, e.g., benzene, naphthalene, anthracene, biphenyl, and the like.
- R 11 -R 17 may also each independently be a linking moiety which may be used to attach the energy transfer dye to a reagent, such as a nucleotide, nucleoside or oligonucleotide.
- linking moieties include isothiocyanate, sulfonyl chloride, 4,6-dichlorotriazinylamine, succinimidyl ester, or other active carboxylate whenever the complementary functionality is amine.
- the linking group is maleimide, halo acetyl, or iodoacetamide whenever the complementary functionality is sulfhydryl. See R. Haugland, Molecular Probes Handbook of Fluorescent Probes and Research Chemicals, Molecular probes, Inc.
- the linking group is an activated NHS ester formed from a carboxyl group on either the donor or acceptor dye which can be reacted with an aminohexyl-oligomer to form a dye labelled oligonucleotide primer.
- the energy transfer fluorescent dyes of this embodiment also include an acceptor dye which is capable of absorbing the excitation energy emitted by the donor dye and fluorescing at a second wavelength in response, and a linker which attaches the donor dye to the acceptor dye.
- the linker has a 4' end which includes a R 1 XC(O)R 2 group where R 1 is a C 1-5 alkyl which is attached to the 4' ring position of the donor xanthene dye, X is either NH, sulfur or oxygen, C(O) is a carbonyl group, and R 2 includes an alkene, diene, alkyne, a five and six membered ring having at least one unsaturated bond or a fused ring structure which is attached to the carbonyl carbon.
- Examples of five or six membered ring include, but are not limited to cyclopentene, cyclohexene, cyclopentadiene, cyclohexadiene, furan, thiofuran, pyrrole, isopyrole, isoazole, pyrazole, isoimidazole, pyran, pyrone, benzene, pyridine, pyridazine, pyrimidine, pyrazine and oxazine.
- Examples of fused ring structures include, but are not limited to indene, benzofuran, thionaphthene, indole and naphthalene.
- This class of energy transfer dyes exhibit enhanced fluorescent strength as compared to the acceptor fluorophore itself and energy transfer fluorescent dyes having the same donor-acceptor pair where the linkage between the donor-acceptor pair is different.
- the present invention also relates to a second class of energy transfer fluorescent dyes in which the donor dye is a member of the xanthene class of dyes and the acceptor dye is a member of the xanthene, cyanine, phthalocyanine and squaraine classes of dyes.
- the donor is preferably a member of the fluorescein class of dyes and the acceptor preferably has an emission maximum that is greater than about 600 nm and/or preferably has an emission maximum that is at least about 100 nm greater than the absorbance maximum of the donor dye.
- the second class of energy transfer dyes of the present invention exhibit unusually large Stoke shifts, as measured by the difference between the absorbance of the donor and the emission of the acceptor. In addition, these dyes exhibit efficient energy transfer in that minimal donor fluorescence is observed.
- This class of energy transfer dyes also includes a linker which attaches the donor dye to the acceptor dye.
- the linker is attached to the 4' position of the donor dye's xanthene ring structure and preferably includes a R 3 X group where R 3 is a C 1-5 alkyl attached to the 4' ring position and X is either NH, sulfur or oxygen.
- the acceptor dye is a member of the xanthene class of dyes
- the linker is preferably attached to acceptor at the 5 position of the xanthene ring structure.
- the present invention also relates to a third class of energy transfer fluorescent dyes in which the donor and acceptor dyes each have the general structure ##STR6## where Y 1 , Y 2 , R 11 -R 16 and X1-X 5 are as specified above.
- the X 3 substituent for both the donor and acceptor dyes correspond to a linker which attaches the two dyes.
- the linker attaching the donor to the acceptor dye is preferably short and/or rigid as this has been found to enhance the transfer of energy between the donor and acceptor dyes.
- the first class of energy transfer dyes according to the present invention includes a donor dye which is a member of the xanthene class of dyes and hence has a xanthene ring structure with a 4' ring position.
- the acceptor dye is a dye which is capable of absorbing the excitation energy emitted by the donor dye and fluorescing at a second wavelength in response.
- the donor may be a member of the fluorescein, rhodamine or asymmetric benzoxanthene classes of dyes, these dyes each being members of the broader xanthene class of dyes.
- acceptor dyes which may be used in the energy transfer fluorescent dye of this embodiment include, but are not limited to, xanthene dyes, cyanine dyes, phthalocyanine and squaraine dyes. Also illustrated in Table 1 are the general ring structures for these dyes.
- Table 1 Illustrated in Table 1 are the general structural formulas for the xanthene (including fluorescein, rhodamine and asymmetric benzoxanthene dyes), cyanine, phthalocyanine and squaraine classes of dyes.
- substituents illustrated on these dyes may be selected from wide variety of substituents which may be incorporated onto these different classes of dyes since all dyes having the general xanthene, fluorescein, rhodamine, asymmetric benzoxanthene, cyanine, phthalocyanine and squaraine ring structures are intended to fall within the scope of this invention.
- donor dyes which may be used in this embodiment include, but are not limited to fluorescein, 5-carboxyfluorescein, 5-carboxy-HEX, NAN, Cl-FLAN, TET, JOE, ZOE, rhodamine, 5-carboxyrhodamine, 3-carboxy R110, 5-carboxy R6G, 4,7-dichlorofluoresceins (See U.S. Pat. No. 5,188,934), asymmetric benzoxanthene dyes (See U.S. application Ser. No. 08/626,085, filed Apr. 1, 1996), and N,N,N',N'-tetramethyl 5-carboxyrhodamine (TAMRA).
- acceptor dyes which may be used in this embodiment include, but are not limited to 5-carboxyfluorescein, 4,7-dichlorofluoresceins, asymmetric benzoxanthene dyes, 5-carboxy-HEX, NAN, Cl-FLAN, TET, JOE, ZOE, rhodamine, 5-carboxyrhodamine, 3-carboxy R110, 5-carboxy R6G, N,N,N',N'-tetramethyl 5-carboxyrhodamine (TAMRA), 5-carboxy-X-rhodamine (ROX) and Cy5. Illustrated in Table 2 are the structures of these dyes.
- the linker includes a 4' end which is attached to the donor dye at the 4' position of the xanthene ring structure.
- the 4' end of the linker includes a R 1 XC(O)R 2 group where R 1 is a C 1-5 alkyl attached to the 4' ring position of the donor xanthene dye, X is either NH, sulfur or oxygen, C(O) is a carbonyl group, and R 2 includes a an alkene, diene, alkyne, a five and six membered ring having at least one unsaturated bond or a fused ring structure which is attached to the carbonyl carbon.
- Examples of five or six membered ring include, but are not limited to cyclopentene, cyclohexene, cyclopentadiene, cyclohexadiene, furan, thiofuran, pyrrole, isopyrole, isoazole, pyrazole, isoimidazole, pyran, pyrone, benzene, pyridine, pyridazine, pyrimidine, pyrazine and oxazine.
- Examples of fused ring structures include, but are not limited to indene, benzofuran, thionaphthene, indole and naphthalene.
- Table 3 illustrates examples of C(O)R 2 groups which may be used in the first class of dyes.
- energy transfer dyes such as 5-TMR-B-CF, which include a donor, acceptor and linker as specified above exhibit enhanced fluorescence as compared to the acceptor itself and energy transfer fluorescent dyes having the same donor-acceptor pair where the linker between the donor-acceptor pair is different.
- the enhanced fluorescence intensity observed is believed to be due to an improved energy transfer orientation between the donor and acceptor dye which is achieved and maintained by the relatively rigid R 2 portion of the linker.
- the energy transfer fluorescent dyes of the present invention exhibit enhanced fluorescent strength as compared to the acceptor fluorophore itself and energy transfer fluorescent dyes having the same donor-acceptor pair where the linkage between the donor-acceptor pair is different. The enhanced fluorescent strength of these dyes is particularly evident in the presence of 8M urea which serves to reduce dye stacking.
- the 4' end of the linker includes a R 1 XC(O)R 2 N group where R 1 is a C 1-5 alkyl attached to the 4' ring position of the donor xanthene dye, X is either NH, sulfur or oxygen, C(O) is a carbonyl group, and R 2 has a carbon backbone such that C(O)R 2 N forms an amino acid subunit, the carbonyl carbon being attached to X to form either an amide, ester or thioester linkage. ##STR27##
- the acceptor is a member of the xanthene class of dyes having the general structure ##STR28## where Y 1 , Y 2 , R 11 -R 16 and X 1 -X 5 are as specified above.
- the X 3 substituent of the acceptor xanthene dye include the linker and the donor dye attached thereto, as illustrated below. ##STR29##
- the end of the linker attached to the acceptor preferably includes a carbonyl group which forms part of an ester, ketone, amide or thioester functional group, the linker being attached to the acceptor by the carbon of the carbonyl group.
- Table 4 provides examples of the above-described energy transfer dyes according to this embodiment of the invention. It is noted that although the dyes illustrated in Table 4 include a 5-carboxyfluorescein donor dye and a TAMRA acceptor dye, it should be understood that a wide variety of other xanthene dyes can be readily substituted as the donor dye. It should also be understood that a wide variety of other xanthene dyes, as well as cyanine, phthalocyanine and squaraine dyes can be readily substituted for the TAMRA acceptor dye, as has been described above, all of these variations with regard to the donor and acceptor dyes falling within the scope of the invention.
- the present invention also relates to a second class of energy transfer fluorescent dyes in which the donor dye is a member of the xanthene class of dyes, and the acceptor dye is a member of the xanthene, cyanine, phthalocyanine or squaraine classes of dyes.
- the donor be a member of the fluorescein class of dyes and the acceptor dye have an emission maximum that is greater than about 600 nm and/or an emission maximum that is at least about 100 nm greater than the absorbance maximum of the donor dye.
- the second class of dyes of the present invention exhibit unusually large Stoke shifts, as measured by the difference between the absorbance of the donor and the emission of the acceptor. In addition, these dyes exhibit efficient energy transfer in that minimal donor fluorescence is observed.
- acceptor dyes which may be used in this embodiment include, but are not limited to 5-carboxy-X-rhodamine (ROX) and Cy5.
- the energy transfer dyes of this embodiment also include a linker which attaches the donor to the acceptor.
- the linker is attached to the donor dye at the 4' position of the xanthene ring structure.
- the 4' end of the linker may include a R 3 X group where R 3 is a C 1-5 alkyl attached to the 4' ring position and X is either NH, sulfur or oxygen.
- the 4' end of the linker may include a R 3 XC(O)R 4 N group where R 3 is a C 1-5 alkyl attached to the donor dye at the 4' position of the xanthene ring structure, X is either NH, sulfur or oxygen, C(O) is a carbonyl group, and R 4 has a carbon backbone such that C(O)R 4 N forms an amino acid subunit.
- R 4 may be selected such that the amino acid subunit formed by C(O)R 4 N corresponds to one of the 20 naturally occurring amino acids.
- R 4 may be selected such that the amino acid subunit formed by C(O)R 4 N does not correspond to any of the 20 naturally occurring amino acids.
- R 4 includes an alkene, diene, alkyne, a five and six membered ring having at least one unsaturated bond or a fused ring structure which is attached to the carbonyl carbon.
- five or six membered ring include, but are not limited to cyclopentene, cyclohexene, cyclopentadiene, cyclohexadiene, furan, thiofuran, pyrrole, isopyrole, isoazole, pyrazole, isoimidazole, pyran, pyrone, benzene, pyridine, pyridazine, pyrimidine, pyrazine and oxazine.
- fused ring structures include, but are not limited to indene, benzofuran, thionaphthene, indole and naphthalene.
- the acceptor is a member of the xanthene class of dyes having the general structure ##STR39## where Y 1 , Y 2 , R 11 -R 16 and X 1 -X 5 are as specified above.
- the X 3 substituent of the acceptor xanthene dye include the linker and the donor dye attached thereto, as illustrated below.
- the end of the linker attached to the acceptor preferably includes a carbonyl group which forms part of an ester, ketone, amide or thioester functional group, the linker being attached to the acceptor by the carbon of the carbonyl group.
- Table 5 provides examples of the above-described energy transfer dyes according to the present invention. It is noted that although the dyes illustrated in Table 5 include a 5-carboxyfluorescein donor dye it should be understood that a wide variety of other xanthene dyes can be readily substituted as the donor dye. It should also be understood that a wide variety of other xanthene dyes, as well as cyanine, phthalocyanine and squaraine dyes can be readily substituted for the 5-carboxy ROX and Cy5 acceptor dyes, as has been described above, all of these variations with regard to the donor and acceptor dyes falling within the scope of the invention.
- FIGS. 3 and 4 illustrate two sets of four dyes which are spectrally resolvable from each other.
- 5ROX-CF is a dye falling within the scope of the second class of dyes described above.
- FIG. 4 includes 5ROX-CF and Cy5-CF which both fall within the scope of the second class of dyes described above.
- the present invention also relates to a third class of energy transfer fluorescent dyes, illustrated below, in which the donor dye and acceptor each are members of the xanthene class of dyes having the general structure ##STR42## where Y 1 , Y 2 , R 11 -R 16 and X 1 -X 5 are as specified above.
- the X 3 substituent for both the donor and acceptor dyes corresponds to a linker which attaches the two dyes, as illustrated below.
- the linker is preferably short and/or rigid as this has been found to enhance the transfer of energy between the donor and acceptor dyes.
- the linker preferably has a backbone attaching the donor to the acceptor which is less than 9 atoms in length.
- the linker includes a functional group which gives the linker some degree of structural rigidity, such as an alkene, diene, an alkyne, a five and six membered ring having at least one unsaturated bond or a fused ring structure.
- the linker has the general formula --R 5 XC(O)R 6 XC(O)-- or --R 7 XC(O)-- where R 5 , R 6 and R 7 are each selected from the group of C 1-4 alkyl, C(O) is a carbonyl group, and each X is either NH, O or S.
- donor dyes which may be used in this embodiment include, but are not limited to fluorescein, 5-carboxyfluorescein, 5-carboxy-HEX, NAN, Cl-FLAN, TET, JOE, ZOE, 4,7-dichlorofluoresceins, asymmetric benzoxanthene dyes, rhodamine, 5-carboxyrhodamine, 5-carboxy-R 110 , 5 -carboxy-R6G and N,N,N',N'-tetramethyl 5-carboxyrhodamine (TAMRA), and 5-carboxy-X-rhodamine (ROX). Illustrated in Table 2 are the structures of these dyes.
- the linker includes a R 5 XC(O) group where R 5 is a C 1-5 alkyl attached to the donor dye, C(O) is a carbonyl group, and X is either NH, sulfur or oxygen.
- the end of the linker attached to the acceptor includes a carbonyl group which forms part of an ester, ketone, amide or thioester functional group, the linker being attached to the acceptor by the carbon of the carbonyl group.
- Table 6 provides examples of the third class of energy transfer dyes according to the present invention. It is noted that although the dyes illustrated in Table 6 include a 5-aminomethylfluorescein donor dye, it should be understood that a wide variety of other xanthene dyes can be readily substituted as the donor dye. It should also be understood that a wide variety of other xanthene dyes, as well as cyanine, phthalocyanine and squaraine dyes can be readily substituted for the TAMRA acceptor dye, as has been described above, all of these variations with regard to the donor and acceptor dyes falling within the scope of the invention.
- the present invention also relates to fluorescent reagents which incorporate an energy transfer fluorescent dye according to the present invention. As described in greater detail in Section III, these reagents may be used in a wide variety of methods for detecting the presence of a component in a sample.
- the fluorescent reagents of the present invention include any molecule or material to which the energy transfer dyes of the invention can be attached and used to detect the presence of the reagent based on the fluorescence of the energy transfer dye.
- Types of molecules and materials to which the dyes of the present invention may be attached to form a reagent include, but are not limited to proteins, polypeptides, polysaccharides, nucleotides, nucleosides, oligonucleotides, lipids, solid supports, organic and inorganic polymers, and combinations and assemblages thereof, such as chromosomes, nuclei, living cells, such as bacteria, other microorganisms, mammalian cells, and tissues.
- Preferred classes of reagents of the present invention are nucleotides, nucleosides and oligonucleotides which include an energy transfer dye of the invention.
- Examples of uses for nucleotide and nucleoside reagents include, but are not limited to, labeling oligonucleotides formed by enzymatic synthesis, e.g., nucleotide triphosphates used in the context of PCR amplification, Sanger-type oligonucleotide sequencing, and nick-translation reactions.
- Examples of uses for oligonucleotide reagents include, but are not limited to, as DNA sequencing primers, PCR primers, oligonucleotide hybridization probes, and the like.
- nucleosides such as cytosine, adenosine, guanosine, and thymidine
- cytosine such as cytosine, adenosine, guanosine, and thymidine
- energy transfer fluorescent dye of the present invention labelled with an energy transfer fluorescent dye of the present invention.
- reagents may be used in a wide variety of methods involving oligonucleotide synthesis.
- nucleotides e.g., mono-, di- and triphosphate nucleoside phosphate esters.
- reagents include, in particular, deoxynucleotide triphosphates (dNTP), such as deoxycytosine triphosphate, deoxyadenosine triphosphate, deoxyguanosine triphosphate, and deoxythymidine triphosphate, labelled with an energy transfer fluorescent dye of the present invention.
- dNTP deoxynucleotide triphosphates
- These reagents may be used, for example, as polymerase substrates in the preparation of dye labelled oligonucleotides.
- reagents also include labelled dideoxynucleotide triphosphates (ddNTP), such as dideoxycytosine triphosphate, dideoxyadenosine triphosphate, dideoxyguanosine triphosphate, and dideoxythymidine triphosphate, labelled with an energy transfer fluorescent dye of the present invention.
- ddNTP dideoxynucleotide triphosphates
- These reagents may be used, for example, in dye termination sequencing.
- reagents are oligonucleotides which includes an energy transfer fluorescent dye of the present invention. These reagents may be used, for example, in dye primer sequencing.
- nucleoside refers to a compound consisting of a purine, deazapurine, or pyrimidine nucleoside base, e.g., adenine, guanine, cytosine, uracil, thymine, deazaadenine, deazaguanosine, and the like, linked to a pentose at the 1' position, including 2'-deoxy and 2'-hydroxyl forms, e.g. as described in Kornberg and Baker, DNA Replication, 2nd Ed. (Freeman, San Francisco, 1992).
- adenine, guanine, cytosine, uracil, thymine, deazaadenine, deazaguanosine, and the like linked to a pentose at the 1' position, including 2'-deoxy and 2'-hydroxyl forms, e.g. as described in Kornberg and Baker, DNA Replication, 2nd Ed. (Freeman, San Francisco, 1992).
- nucleotide refers to a phosphate ester of a nucleoside, e.g., mono, di and triphosphate esters, wherein the most common site of esterification is the hydroxyl group attached to the C-5 position of the pentose.
- "Analogs" in reference to nucleosides include synthetic nucleosides having modified base moieties and/or modified sugar moieties, e.g. described generally by Scheit, Nucleotide Analogs (John Wiley, N.Y., 1980).
- labeleled nucleoside and labeleled nucleotide refer to nucleosides and nucleotides which are covalently attached to an energy transfer dye through a linkage.
- oligonucleotide refers to linear polymers of natural or modified nucleoside monomers, including double and single stranded deoxyribonucleosides, ribonucleosides, ⁇ -anomeric forms thereof, and the like.
- nucleoside monomers are linked by phosphodiester linkages, where as used herein, the term “phosphodiester linkage” refers to phosphodiester bonds or analogs thereof including phosphorothioate, phosphorodithioate, phosphoroselenoate, phosphorodiselenoate, phosphoroanilothioate, phosphoranilidate, phosphoramidate, and the like, including associated counterions, e.g., H, NH 4 , Na, and the like if such counterions are present.
- the oligonucleotides range in size form a few monomeric units, e.g. 8-40, to several thousands of monomeric units.
- oligonucleotide is represented by a sequence of letters, such as "ATGCCTG,” it will be understood that the nucleotides are in 5' ⁇ 3' order from left to right and that "A” denotes deoxyadenosine, “C” denotes deoxycytidine, “G” denotes deoxyguanosine, and “T” denotes thymidine, unless otherwise noted.
- Nucleoside labeling can be accomplished using any of a large number of known nucleoside labeling techniques using known linkages, linking groups, and associated complementary functionalities.
- the linkage linking the dye and nucleoside should (i) be stable to oligonucleotide synthesis conditions, (ii) not interfere with oligonucleotide-target hybridization, (iii) be compatible with relevant enzymes, e.g., polymerases, ligases, and the like, and (iv) not quench the fluorescence of the dye.
- the dyes are covalently linked to the 5-carbon of pyrimidine bases and to the 7-carbon of 7-deazapurine bases.
- suitable base labeling procedures have been reported that can be used with the invention, e.g. Gibson et al, Nucleic Acids Research, 15 6455-6467 (1987); Gebeyehu et al, Nucleic Acids Research, 15 4513-4535 (1987); Haralambidis et al, Nucleic Acids Research, 15 4856-4876 (1987); Nelson et al., Nucleosides and Nucleotides, 5(3) 233-241 (1986); Bergstrom, et al., JACS, 111 374-375 (1989); U.S. Pat. Nos. 4,855,225, 5,231,191, and 5,449,767, each of which is incorporated herein by reference.
- the linkages are acetylenic amido or alkenic amido linkages, the linkage between the dye and the nucleotide base being formed by reacting an activated N-hydroxysuccinimide (NHS) ester of the dye with an alkynylamino- or alkenylamino-derivatized base of a nucleotide. More preferably, the resulting linkage is 3-(carboxy)amino-1-propynyl or 3-amino-1-propyn-1-yl.
- NHS N-hydroxysuccinimide
- alkynylamino-derivatized nucleosides are taught by Hobbs et al. in European Patent Application No. 87305844.0, and Hobbs et al., J. Org. Chem., 54 3420 (1989), which is incorporated herein by reference. Briefly, the alkynylamino-derivatized nucleotides are formed by placing the appropriate halodideoxynucleoside (usually 5-iodopyrimidine and 7-iodo-7-deazapurine dideoxynucleosides as taught by Hobbs et al.
- halodideoxynucleoside usually 5-iodopyrimidine and 7-iodo-7-deazapurine dideoxynucleosides as taught by Hobbs et al.
- the alkynylamino-nucleoside can be isolated by concentrating the reaction mixture and chromatographing on silica gel using an eluting solvent which contains ammonium hydroxide to neutralize the hydrohalide generated in the coupling reaction.
- methanol/methylene chloride can be added to the reaction mixture, followed by the bicarbonate form of a strongly basic anion exchange resin.
- the slurry can then be stirred for about 45 minutes, filtered, and the resin rinsed with additional methanol/methylene chloride.
- the combined filtrates can be concentrated and purified by flash-chromatography on silica gel using a methanol-methylene chloride gradient.
- the triphosphates are obtained by standard techniques.
- oligonucleotides labelled with an energy transfer dye of the present invention can be accomplished using any of a large number of known oligonucleotide labeling techniques using known linkages, linking groups, and associated complementary functionalities.
- labeled oligonucleotides may be synthesized enzymatically, e.g., using a DNA polymerase or ligase, e.g., Stryer, Biochemistry, Chapter 24, W.H. Freeman and Company (1981), or by chemical synthesis, e.g., by a phosphoramidite method, a phosphitetriester method, and the like, e.g., Gait, Oligonucleotide Synthesis, IRL Press (1990).
- Labels may be introduced during enzymatic synthesis utilizing labeled nucleotide triphosphate monomers, or introduced during chemical synthesis using labeled non-nucleotide or nucleotide phosphoramidites, or may be introduced subsequent to synthesis.
- the labeled oligonucleotide is made using enzymatic synthesis, the following procedure may be used.
- a template DNA is denatured and an oligonucleotide primer is annealed to the template DNA.
- a mixture of deoxynucleotide triphosphates is added to the reaction including dGTP, dATP, dCTP, and dTTP where at least a fraction of one of the deoxynucleotides is labeled with a dye compound of the invention as described above.
- a polymerase enzyme is added under conditions where the polymerase enzyme is active.
- a labeled polynucleotide is formed by the incorporation of the labeled deoxynucleotides during polymerase strand synthesis.
- two primers are used instead of one, one primer complementary to the+strand and the other complementary to the - strand of the target, the polymerase is a thermostable polymerase, and the reaction temperature is cycled between a denaturation temperature and an extension temperature, thereby exponentially synthesizing a labeled complement to the target sequence by PCR, e.g., PCR Protocols, Innis et al. eds., Academic Press (1990).
- the labeled oligonucleotide is made using a chemical synthesis, it is preferred that a phosphoramidite method be used.
- Phosphoramidite compounds and the phosphoramidite method of polynucleotide synthesis are preferred in synthesizing oligonucleotides because of the efficient and rapid coupling and the stability of the starting materials.
- the synthesis is performed with the growing oligonucleotide chain attached to a solid support, so that excess reagents, which are in the liquid phase, can be easily removed by filtration, thereby eliminating the need for purification steps between cycles.
- the present invention also relates to phosphoramidite compounds which include an energy transfer dye of the present invention.
- a solid support including a protected nucleotide monomer is treated with acid, e.g., trichloroacetic acid, to remove a 5'-hydroxyl protecting group, freeing the hydroxyl for a subsequent coupling reaction.
- acid e.g., trichloroacetic acid
- An activated intermediate is then formed by simultaneously adding a protected phosphoramidite nucleoside monomer and a weak acid, e.g., tetrazole, to the reaction.
- the weak acid protonates the nitrogen of the phosphoramidite forming a reactive intermediate. Nucleoside addition is complete within 30 s.
- a capping step is performed which terminates any polynucleotide chains that did not undergo nucleoside addition.
- Capping is preferably done with acetic anhydride and 1-methylimidazole.
- the internucleotide linkage is then converted from the phosphite to the more stable phosphotriester by oxidation using iodine as the preferred oxidizing agent and water as the oxygen donor.
- the hydroxyl protecting group is removed with a protic acid, e.g., trichloroacetic acid or dichloroacetic acid, and the cycle is repeated until chain elongation is complete.
- the polynucleotide chain is cleaved from the support using a base, e.g., ammonium hydroxide or t-butyl amine.
- a base e.g., ammonium hydroxide or t-butyl amine.
- the cleavage reaction also removes any phosphate protecting groups, e.g., cyanoethyl.
- the protecting groups on the exocyclic amines of the bases and the hydroxyl protecting groups on the dyes are removed by treating the polynucleotide solution in base at an elevated temperature, e.g., 55° C.
- any of the phosphoramidite nucleoside monomers may be dye-labeled phosphoramidites. If the 5'-terminal position of the nucleotide is labeled, a labeled non-nucleotidic phosphoramidite of the invention may be used during the final condensation step. If an internal position of the oligonucleotide is to be labeled, a labeled nucleotidic phosphoramidite of the invention may be used during any of the condensation steps.
- oligonucleotides may be labeled at a number of positions including the 5'-terminus. See Oligonucleotides and Analogs, Eckstein ed., Chapter 8, IRL Press (1991) and Orgel et al., Nucleic Acids Research 11(18) 6513 (1983); U.S. Pat. No. 5,118,800, each of which are incorporated by reference Oligonucleotides may also be labeled on their phosphodiester backbone (Oligonucleotides and Analogs, Eckstein ed., Chapter 9) or at the 3'-terminus (Nelson, Nucleic Acids Research 20(23) 6253-6259, and U.S. Pat.
- an oligonucleotide is labeled as follows.
- a dye including a carboxy linking group is converted to the n-hydroxysuccinimide ester by reacting with approximately 1 equivalent of 1,3-dicyclohexylcarbodiimide and approximately 3 equivalents of n-hydroxysuccinimide in dry ethyl acetate for 3 hours at room temperature.
- the reaction mixture is washed with 5 % HCl, dried over magnesium sulfate, filtered, and concentrated to a solid which is resuspended in DMSO.
- the DMSO dye stock is then added in excess (10-20 ⁇ ) to an aminohexyl derivatized oligonucleotide in 0.25M bicarbonate/carbonate buffer at pH 9.4 and allowed to react for 6 hours, e.g., U.S. Pat. No. 4,757,141.
- the dye labeled oligonucleotide is separated from unreacted dye by passage through a size-exclusion chromatography column eluting with buffer, e.g., 0.1 molar triethylamine acetate (TEAA).
- buffer e.g., 0.1 molar triethylamine acetate (TEAA).
- the fraction containing the crude labeled oligonucleotide is further purified by reverse phase HPLC employing gradient elution.
- the energy transfer dyes and reagents of the present invention may be used in a wide variety of methods for detecting the presence of a component in a sample by labelling the component in the sample with a reagent containing the dye.
- the energy transfer dyes and reagents of the present invention are well suited for use in methods which combine separation and fluorescent detection techniques, particularly methods requiring the simultaneous detection of multiple spatially-overlapping analytes.
- the dyes and reagents are particularly well suited for identifying classes of oligonucleotides that have been subjected to a biochemical separation procedure, such as electrophoresis, where a series of bands or spots of target substances having similar physiochemical properties, e.g.
- bands includes any spatial grouping or aggregation of analytes on the basis of similar or identical physiochemical properties. Usually bands arise in the separation of dye-oligonucleotide conjugates by electrophoresis.
- Classes of oligonucleotides can arise in a variety of contexts.
- fragment analysis or “genetic analysis” methods
- labeled oligonucleotide fragments are generated through template-directed enzymatic synthesis using labeled primers or nucleotides, e.g., by ligation or polymerase directed primer extension; the fragments are subjected to a size-dependent separation process, e.g., electrophoresis or chromatography; and, the separated fragments are detected subsequent to the separation, e.g., by laser-induced fluorescence.
- a size-dependent separation process e.g., electrophoresis or chromatography
- the separated fragments are detected subsequent to the separation, e.g., by laser-induced fluorescence.
- multiple classes of oligonucleotides are separated simultaneously and the different classes are distinguished by spectrally resolvable labels.
- amplified fragment length polymorphisim detection is amplified fragment length polymorphisim detection (AmpFLP) and is based on amplified fragment length polymorphisms, i.e., restriction fragment length polymorphisms that are amplified by PCR. These amplified fragments of varying size serve as linked markers for following mutant genes through families. The closer the amplified fragment is to the mutant gene on the chromosome, the higher the linkage correlation. Because genes for many genetic disorders have not been identified, these linkage markers serve to help evaluate disease risk or paternity.
- the polynucleotides may be labeled by using a labeled oligonucleotide PCR primer, or by utilizing labeled nucleotide triphosphates in the PCR.
- nick translation involves a reaction to replace unlabeled nucleotide triphosphates in a double-stranded DNA molecule with labeled ones. Free 3'-hydroxyl groups are created within the unlabeled DNA by "nicks" caused by deoxyribonuclease I (DNAase I) treatment. DNA polymerase I then catalyzes the addition of a labeled nucleotide to the 3'-hydroxyl terminus of the nick. At the same time, the 5' to 3'-exonuclease activity of this enzyme eliminates the nucleotide unit from the 5'-phosphoryl terminus of the nick.
- DNAase I deoxyribonuclease I
- a new nucleotide with a free 3'-OH group is incorporated at the position of the original excised nucleotide, and the nick is shifted along by one nucleotide unit in the 3' direction. This 3' shift will result in the sequential addition of new labeled nucleotides to the DNA with the removal of existing unlabeled nucleotides.
- the nick-translated polynucleotide is then analyzed using a separation process, e.g., electrophoresis.
- VNTRs are regions of double-stranded DNA that contain adjacent multiple copies of a particular sequence, with the number of repeating units being variable. Examples of VNTR loci are pYNZ22, pMCT118, and Apo B.
- a subset of VNTR methods are those methods based on the detection of microsatellite repeats, or short tandem repeats (STRs), i.e., tandem repeats of DNA characterized by a short (2-4 bases) repeated sequence.
- STRs short tandem repeats
- DNA sequencing involves an extension/termination reaction of an oligonucleotide primer. Included in the reaction mixture are deoxynucleotide triphosphates (dNTPs) which are used to extend the primer. Also included in the reaction mixture is at least one dideoxynucleotide triphosphate (ddNTP) which when incorporated onto the extended primer prevents the further extension of the primer.
- dNTPs deoxynucleotide triphosphates
- ddNTP dideoxynucleotide triphosphate
- Fluorescent DNA sequencing may generally be divided into two categories, “dye primer sequencing” and “dye terminator sequencing”.
- dye primer sequencing a fluorescent dye is incorporated onto the primer being extended.
- Four separate extension/termination reactions are then run in parallel, each extension reaction containing a different dideoxynucleotide triphosphate (ddNTP) to terminate the extension reaction.
- ddNTP dideoxynucleotide triphosphate
- the reaction products are separated by gel electrophoresis and analyzed. See, for example, Ansorge et al., Nucleic Acids Res. 15 4593-4602 (1987).
- dye primer sequencing different primers are used in the four separate extension/termination reactions, each primer containing a different spectrally resolvable dye. After termination, the reaction products from the four extension/termination reactions are pooled, electrophoretically separated, and detected in a single lane. See, for example, Smith et al., Nature 321 674-679 (1986).
- primers containing a set of spectrally resolvable dyes products from more than one extension/termination reactions can be simultaneously detected.
- a fluorescent dye is attached to each of the dideoxynucleotide triphosphates.
- An extension/termination reaction is then conducted where a primer is extended using deoxynucleotide triphosphates until the labelled dideoxynucleotide triphosphate is incorporated into the extended primer to prevent further extension of the primer.
- the reaction products for each dideoxynucleotide triphosphate are separated and detected.
- separate extension/termination reactions are conducted for each of the four dideoxynucleotide triphosphates.
- a single extension/termination reaction is conducted which contains the four dideoxynucleotide triphosphates, each labelled with a different, spectrally resolvable fluorescent dye.
- a method for conducting dye primer sequencing using one or more oligonucleotide reagents of the present invention.
- a mixture of extended labelled Primers are formed by hybridizing a nucleic acid sequence with a fluorescently labelled oligonucleotide primer in the presence of deoxynucleotide triphosphates, at least one dideoxynucleotide triphosphate and a DNA polymerase.
- the fluorescently labelled oligonucleotide primer includes an oligonucleotide sequence complementary to a portion of the nucleic acid sequence being sequenced, and an energy transfer fluorescent dye attached to the oligonucleotide.
- the DNA polymerase extends the primer with the deoxynucleotide triphosphates until a dideoxynucleotide triphosphate is incorporated which terminates extension of the primer. After termination, the mixture of extended primers are separated. The sequence of the nucleic acid sequence is then determined by fluorescently detecting the mixture of extended primers formed.
- each primer sequencing reaction including a different fluorescently labelled oligonucleotide primer and a different dideoxynucleotide triphosphate (ddATP, ddCTP, ddGTP and ddTTP).
- ddATP dideoxynucleotide triphosphate
- the resulting mixtures of extended primers may be pooled.
- the mixture of extended primers may then be separated, for example by electrophoresis and the fluorescent signal from each of the four different fluorescently labelled oligonucleotide primers detected in order to determine the sequence of the nucleic acid sequence.
- a method for conducting dye terminator sequencing using one or more dideoxynucleotide triphosphates labelled with an energy transfer dye of the present invention.
- a mixture of extended primers are formed by hybridizing a nucleic acid sequence with an oligonucleotide primer in the presence of deoxynucleotide triphosphates, at least one fluorescently labelled dideoxynucleotide triphosphate and a DNA polymerase.
- the fluorescently labelled dideoxynucleotide triphosphate includes a dideoxynucleotide triphosphate labelled with an energy transfer fluorescent dye of the present invention.
- the DNA polymerase extends the primer with the deoxynucleotide triphosphates until a fluorescently labelled dideoxynucleotide triphosphate is incorporated into the extended primer. After termination, the mixture of extended primers are separated. The sequence of the nucleic acid sequence is then determined by detecting the fluorescently labelled dideoxynucleoside attached to the extended primer.
- the step of forming a mixture of extended primers includes hybridizing the nucleic acid sequence with four different fluorescently labelled dideoxynucleotide triphosphates, i.e., a fluorescently labelled dideoxycytosine triphosphate, a fluorescently labelled dideoxyadenosine triphosphate, a fluorescently labelled dideoxyguanosine triphosphate, and a fluorescently labelled dideoxythymidine triphosphate.
- a fluorescently labelled dideoxynucleotide triphosphates i.e., a fluorescently labelled dideoxycytosine triphosphate, a fluorescently labelled dideoxyadenosine triphosphate, a fluorescently labelled dideoxyguanosine triphosphate, and a fluorescently labelled dideoxythymidine triphosphate.
- the labeled oligonucleotides are preferably separated by electrophoretic procedures, e.g. Gould and Matthews, cited above; Rickwood and Hames, Eds., Gel Electrophoresis of Nucleic Acids: A Practical Approach, (IRL Press Limited, London, 1981); or Osterman, Methods of Protein and Nucleic Acid Research, Vol. 1 Springer-Verlag, Berlin, 1984).
- the type of electrophoretic matrix is crosslinked or uncrosslinked polyacrylamide having a concentration (weight to volume) of between about 2-20 weight percent. More preferably, the polyacrylamide concentration is between about 4-8 percent.
- the electrophoresis matrix includes a strand separating, or denaturing, agent, e.g., urea, formamide, and the like.
- a strand separating, or denaturing, agent e.g., urea, formamide, and the like.
- Detailed procedures for constructing such matrices are given by Maniatis et al., "Fractionation of Low Molecular Weight DNA and RNA in Polyacrylamide Gels Containing 98% Formamide or 7M Urea," in Methods in Enzymology, 65 299-305 (1980); Maniatis et al., “Chain Length Determination of Small Double and Single-Stranded DNA Molecules by Polyacrylamide Gel Electrophoresis,"Biochemistry, 14 3787-3794 (1975); Maniatis et al., Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory, N.Y., 1982), pgs.
- oligonucleotides having sizes in the range of between about 20-300 bases have been separated and detected in accordance with the invention in the following matrix: 6 percent polyacrylamide made from 19 parts to 1 part acrylamide to bis-acrylamide, formed in a Tris-borate EDTA buffer at pH 8.3.
- the dye-oligonucleotide conjugates are detected by measuring the fluorescence emission from the dye labeled polynucleotides.
- the labeled polynucleotides are illuminated by standard means, e.g. high intensity mercury vapor lamps, lasers, or the like.
- the illumination means is a laser having an illumination beam at a wavelength between 488 and 550 nm.
- the dye-polynucleotides are illuminated by laser light generated by an argon ion laser, particularly the 488 and 514 nm emission lines of an argon ion laser, or an the 532 emission line of a neodymium solid-state YAG laser.
- argon ion lasers are available commercially which lase simultaneously at these lines, e.g. Cyonics, Ltd. (Sunnyvale, Calif.) Model 2001, or the like.
- the fluorescence is then detected by a light-sensitive detector, e.g., a photomultiplier tube, a charged coupled device, or the like.
- kits having combinations of energy transfer fluorescent dyes and/or reagents.
- the kit includes at least two spectrally resolvable energy transfer dyes according to the present invention.
- the energy transfer dyes preferably include the same donor dye so that a single light source is needed to excite the dyes.
- the kit includes dideoxycytosine triphosphate, dideoxyadenosine triphosphate, dideoxyguanosine triphosphate, and dideoxythymidine triphosphate, each dideoxynucleotide triphosphate labelled with an energy transfer dye according to the present invention.
- each energy transfer dye is spectrally resolvable from the other energy transfer dyes attached to the other dideoxynucleotide triphosphates.
- the energy transfer dyes preferably include the same first xanthene dye.
- the kit includes at least two oligonucleotides, each oligonucleotide including an energy transfer dye according to the present invention.
- each oligonucleotide contains an energy transfer dye which is spectrally resolvable from the energy transfer dyes attached to the other oligonucleotides.
- the kit includes at least four oligonucleotides which each contain a spectrally resolvable energy transfer dye.
- 5TMR-B-CF was synthesized from 5TMR NHS and 4'-aminomethyl-5-carboxyfluorescein according to the reaction sequences described in Examples 1A-C. 5TMR-B-CF was then converted to 5TMR-B-CF-NHS according to the reaction sequence described in 1D so that the dye could be coupled to a nucleoside, nucleotide or oligonucleotide primer.
- the insoluble 5TMR-B was separated by centrifugation, washed with 5% HCl (2 ⁇ 1 mL) and dried in a vacuum centrifuge. The product was dissolved in DMF (200 ⁇ L) and used to prepare 5TMR-B-NHS.
- the solid was dissolved in DMF (100 ⁇ L). The yield was determined by diluting an aliquot into pH 9 buffer and measuring the absorbance at 552 nm. Using an extinction coefficient of 50,000 cm -1 M -1 , the concentration of 5TMR-B-NHS was 4.8 mM. Yield from 5TMR NHS was 8%.
- the reaction was diluted with 5% HCl (1 mL) and the product separated by centrifugation, leaving the unreacted CF in the aqueous phase.
- the solid was washed with 5% HCl (4 ⁇ 1 mL), dried in a vacuum centrifuge and taken up in DMF (300 ⁇ L). The yield was quantitative.
- the following example compares the fluorescence emission strength of a series of energy transfer dyes according to the present invention.
- Dye solutions of 5TMR, 6TMR-CF, 5TMR-gly-CF, 5TMR-CF, 5TMR-B-CF, 5TMR-gly-5AMF, 5TMR-5AMF and 5TMR-lys-5FAM were measured in 1 ⁇ TBE/8M urea. Each dye solution had an optical density of 0.1 at 560 nm and was excited at 488 nm.
- FIG. 2 provides a bar graph of the relative fluorescence of each of these dyes.
- energy transfer dyes where the linker is attached to the acceptor at the 5 ring position were found to exhibit significantly stronger fluorescence than the acceptor dye itself or when the acceptor dye is linked at the 6 ring position (6TMR-CF).
- energy transfer dyes where the linker has the formula R 1 XC(O)R 2 where R 2 is benzene were found to have significantly enhanced fluorescence as compared to the dye where the linker has the formula --CH 2 NHCO-- (5TMR-CF) or --CH 2 NHCOCH 2 NHCO-- (5TMR-gly-5AMF).
- dye primer sequencing was performed on M13 (SEQ. ID. NO.: 1) in order to compare the relative brightness of 5TMR-CF and 5TMR-B-CF labelled oligonucelotides.
- dye primer sequencing was performed according to the ABl PRISMTM377 DNA Sequencer User's Manual, Rev. B, January 1995, Chapter 2 (p/n 402114, The Perkin-Elmer Corporation, Foster City, Calif.).
- 5TMR-CF and 5TMR-B-CF were each attached to the 5' end of M13-21 primer (SEQ. ID. NO.:2). Equimolar solutions of each primer were mixed with the M13 (SEQ. ID.
- oligonucleotides labelled with 5TMR-B-CF are brighter than oligonucleotides labelled with 5TMR-CF.
- the mobility of oligonucleotides labelled with 5TMR-B-CF are about one nucleotide slower than the oligonucleotides labelled with 5TMR-CF.
- Dye primer sequencing was performed on the M13 (SEQ. ID. NO.: 1) using a set of four dyes attached to the M13-21 primer (SEQ. ID. NO. 2) as described in Example 5.
- FIG. 6 is a four color plot of the dye labelled oligonucleotides produced from the sequencing.
- the peak for cytosine corresponds to the fluorescence of 5-carboxy-R110.
- the peak for adenosine corresponds to the fluorescence of 5-carboxy-R6G.
- the peak for guanosine corresponds to the fluorescence of TMR-B-CF.
- the peak for thymidine corresponds to the fluorescence of ROX-CF.
- each of the dye labelled oligonucleotides exhibit significant fluorescence intensity.
- the different dye labelled oligonucleotides exhibit sufficiently similar mobility so that good resolution of the series of peaks is achieved.
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating Or Analysing Materials By The Use Of Chemical Reactions (AREA)
- Nitrogen Condensed Heterocyclic Rings (AREA)
- Pyrane Compounds (AREA)
- Plural Heterocyclic Compounds (AREA)
Abstract
Description
TABLE 1 __________________________________________________________________________ ##STR7## ##STR8## ##STR9## ##STR10## ##STR11## __________________________________________________________________________
TABLE 2 __________________________________________________________________________ ##STR12## ##STR13## ##STR14## ##STR15## ##STR16## ##STR17## ##STR18## ##STR19## ##STR20## __________________________________________________________________________
TABLE 3 ______________________________________ ##STR21## ##STR22## ##STR23## ##STR24## ##STR25## ##STR26## ______________________________________
TABLE 4 ______________________________________ ##STR30## ##STR31## ##STR32## ##STR33## ##STR34## ##STR35## ##STR36## ______________________________________
TABLE 5 ______________________________________ ##STR40## ##STR41## ______________________________________
TABLE 6 ______________________________________ ##STR44## ##STR45## ______________________________________
TABLE 7 __________________________________________________________________________ ##STR54## ##STR55## ##STR56## ##STR57## ##STR58## __________________________________________________________________________
__________________________________________________________________________ SEQUENCE LISTING (1) GENERAL INFORMATION: (iii) NUMBER OF SEQUENCES: 2 (2) INFORMATION FOR SEQ ID NO: 1: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1217 nucleotides (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1: GCCAAGCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCC40 CGGGTACCGAGCTCGAATTCGTAATCATGGTCATAGCTGT80 TTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAA120 CATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCC160 TAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCAC200 TGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCA240 TTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGT280 ATTGGGCGCCAGGGTGGTTTTTCTTTTCACCAGTGAGACG320 GGCAACAGCTGATTGCCCTTCACCGCCTGGCCCTGAGAGA360 GTTGCAGCAAGCGGTCCACGCTGGTTTGCCCCAGCAGGCG400 AAAATCCTGTTTGATGGTGGTTCCGAAATCGGCAAAATCC440 CTTATAAATCAAAAGAATAGCCCGAGATAGGGTTGAGTGT480 TGTTCCAGTTTGGAACAAGAGTCCACTATTAAAGAACGTG520 GACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGGGCG560 ATGGCCCACTACGTGAACCATCACCCAAATCAAGTTTTTT600 GGGGTCGAGGTGCCGTAAAGCACTAAATCGGAACCCTAAA640 GGGAGCCCCCGATTTAGAGCTTGACGGGGAAAGCCGGCGA680 ACGTGGCGAGAAAGGAAGGGAAGAAAGCGAAAGGAGCGGG720 CGCTAGGGCGCTGGCAAGTGTAGCGGTCACGCTGCGCGTA760 ACCACCACACCCGCCGCGCTTAATGCGCCGCTACAGGGCG800 CGTACTATGGTTGCTTTGACGAGCACGTATAACGTGCTTT840 CCTCGTTGGAATCAGAGCGGGAGCTAAACAGGAGGCCGAT880 TAAAGGGATTTTAGACAGGAACGGTACGCCAGAATCTTGA920 GAAGTGTTTTTATAATCAGTGAGGCCACCGAGTAAAAGAG960 TCTGTCCATCACGCAAATTAACCGTTGTAGCAATACTTCT1000 TTGATTAGTAATAACATCACTTGCCTGAGTAGAAGAACTC1040 AAACTATCGGCCTTGCTGGTAATATCCAGAACAATATTAC1080 CGCCAGCCATTGCAACAGGAAAAACGCTCATGGAAATACC1120 TACATTTTGACGCTCAATCGTCTGAAATGGATTATTTACA1160 TTGGCAGATTCACCAGTCACACGACCAGTAATAAAAGGGA1200 CATTCTGGCCAACAGAG1217 (2) INFORMATION FOR SEQ ID NO: 2: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 18 nucleotides (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2: TGTAAAACGACGGCCAGT18 __________________________________________________________________________
Claims (59)
Priority Applications (37)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US08/642,330 US5863727A (en) | 1996-05-03 | 1996-05-03 | Energy transfer dyes with enhanced fluorescence |
| US08/726,462 US5800996A (en) | 1996-05-03 | 1996-10-04 | Energy transfer dyes with enchanced fluorescence |
| CA002203494A CA2203494C (en) | 1996-05-03 | 1997-04-23 | Energy transfer dyes with enhanced fluorescence |
| CA2297589A CA2297589C (en) | 1996-05-03 | 1997-04-23 | Energy transfer dyes with enhanced fluorescence |
| AT99201120T ATE335051T1 (en) | 1996-05-03 | 1997-05-02 | ENERGY TRANSFER DYES WITH IMPROVED FLUORESCENCE |
| AU19995/97A AU691143C (en) | 1996-05-03 | 1997-05-02 | Energy transfer dyes with enhanced fluorescence |
| DE69700935T DE69700935T2 (en) | 1996-05-03 | 1997-05-02 | Energy transfer dyes with improved fluorescence |
| EP97303039A EP0805190B1 (en) | 1996-05-03 | 1997-05-02 | Energy transfer dyes with enhanced fluorescence |
| DE69736434T DE69736434T2 (en) | 1996-05-03 | 1997-05-02 | Energy transfer dyes with improved fluorescence |
| EP99201120A EP0940450B1 (en) | 1996-05-03 | 1997-05-02 | Energy transfer dyes with enhanced fluorescence |
| AT97303039T ATE187752T1 (en) | 1996-05-03 | 1997-05-02 | ENERGY TRANSFER DYES WITH IMPROVED FLUORESCENCE |
| JP09115920A JP3090626B2 (en) | 1996-05-03 | 1997-05-06 | Energy transfer dyes with enhanced fluorescence |
| US09/046,203 US5945526A (en) | 1996-05-03 | 1998-03-23 | Energy transfer dyes with enhanced fluorescence |
| US09/272,097 US6335440B1 (en) | 1996-05-03 | 1999-03-18 | Method for detecting oligonucleotides using energy transfer dyes with long stoke shift |
| JP2000010932A JP2000187036A (en) | 1996-05-03 | 2000-01-19 | Energy transfer pigment with long stokes shift |
| JP2000010933A JP3592173B2 (en) | 1996-05-03 | 2000-01-19 | Cyanine energy transfer dye |
| JP2000010931A JP2000154381A (en) | 1996-05-03 | 2000-01-19 | Energy transition pigment having a hard linker |
| US10/014,743 US6849745B2 (en) | 1996-05-03 | 2001-10-29 | Energy transfer dyes with enhanced fluorescence |
| JP2003028821A JP3499238B2 (en) | 1996-05-03 | 2003-02-05 | Methods for sequencing nucleic acid sequences |
| JP2003288286A JP2004068023A (en) | 1996-05-03 | 2003-08-06 | Energy transfer pigment containing hard linker |
| JP2003288285A JP2004043819A (en) | 1996-05-03 | 2003-08-06 | Energy transfer pigment containing hard linker |
| US10/788,836 US7169939B2 (en) | 1996-05-03 | 2004-02-26 | Energy transfer dyes with enhanced fluorescence |
| JP2004136932A JP2004250713A (en) | 1996-05-03 | 2004-04-30 | Energy transfer pigment having hard linker |
| US11/617,665 US7388092B2 (en) | 1996-05-03 | 2006-12-28 | Oligonucleotides and analogs labeled with energy transfer dyes |
| US11/617,667 US7423140B2 (en) | 1996-05-03 | 2006-12-28 | Oligonucleotides and analogs labeled with energy transfer dyes |
| US11/617,660 US7399854B2 (en) | 1996-05-03 | 2006-12-28 | Regents labeled with energy transfer dyes |
| US11/617,650 US20100280246A1 (en) | 1996-05-03 | 2006-12-28 | Energy transfer dyes with enhanced fluorescence |
| US11/618,688 US7449149B2 (en) | 1996-05-03 | 2006-12-29 | Kits useful for sequencing nucleic acids |
| US11/618,683 US7452672B2 (en) | 1996-05-03 | 2006-12-29 | Methods of analyzing polynucleotides employing energy transfer dyes |
| US11/618,679 US7449298B2 (en) | 1996-05-03 | 2006-12-29 | Methods of analyzing polynucleotides employing energy transfer dyes |
| US11/618,693 US20070154927A1 (en) | 1996-05-03 | 2006-12-29 | Energy transfer dyes with enhanced fluorescence |
| US11/618,663 US7432058B2 (en) | 1996-05-03 | 2006-12-29 | Methods of labeling nucleic acids with energy transfer dyes |
| US11/618,667 US7595162B2 (en) | 1996-05-03 | 2006-12-29 | Methods of labeling polynucleotides with energy transfer dyes |
| US12/205,817 US20090118485A1 (en) | 1996-05-03 | 2008-09-05 | Oligonucleotides and analogs labeled with energy transfer dyes |
| JP2008241854A JP2009046685A (en) | 1996-05-03 | 2008-09-19 | Energy transfer pigment having hard linker |
| US12/554,845 US7825237B2 (en) | 1996-05-03 | 2009-09-04 | Oligonucleotides and analogs labeled with energy transfer dyes |
| US12/882,034 US20120172583A1 (en) | 1996-05-03 | 2010-09-14 | Oligonucleotides and Analogs Labeled with Energy Transfer Dyes |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US08/642,330 US5863727A (en) | 1996-05-03 | 1996-05-03 | Energy transfer dyes with enhanced fluorescence |
Related Parent Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US08/672,196 Continuation-In-Part US5847162A (en) | 1996-05-03 | 1996-06-27 | 4, 7-Dichlororhodamine dyes |
Related Child Applications (3)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US08/672,196 Continuation-In-Part US5847162A (en) | 1996-05-03 | 1996-06-27 | 4, 7-Dichlororhodamine dyes |
| US08/726,462 Continuation-In-Part US5800996A (en) | 1996-05-03 | 1996-10-04 | Energy transfer dyes with enchanced fluorescence |
| US09/046,203 Continuation-In-Part US5945526A (en) | 1996-05-03 | 1998-03-23 | Energy transfer dyes with enhanced fluorescence |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| US5863727A true US5863727A (en) | 1999-01-26 |
Family
ID=24576139
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US08/642,330 Expired - Lifetime US5863727A (en) | 1996-05-03 | 1996-05-03 | Energy transfer dyes with enhanced fluorescence |
Country Status (2)
| Country | Link |
|---|---|
| US (1) | US5863727A (en) |
| JP (1) | JP2009046685A (en) |
Cited By (153)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2000063296A3 (en) * | 1999-04-19 | 2001-02-15 | Nen Life Science Prod Inc | Cyanine dyes and synthesis methods thereof |
| US6191278B1 (en) | 1999-11-03 | 2001-02-20 | Pe Corporation | Water-soluble rhodamine dyes and conjugates thereof |
| US6221604B1 (en) | 2000-02-07 | 2001-04-24 | Pe Corporation | Electron-deficient nitrogen heterocycle-substituted fluorescein dyes |
| US6232075B1 (en) | 1998-12-14 | 2001-05-15 | Li-Cor, Inc. | Heterogeneous assay for pyrophosphate detection |
| US6245514B1 (en) * | 1996-06-04 | 2001-06-12 | University Of Utah Research Foundation | Fluorescent donor-acceptor pair with low spectral overlap |
| US6346384B1 (en) | 2000-03-27 | 2002-02-12 | Dade Behring Inc. | Real-time monitoring of PCR using LOCI |
| US6348596B1 (en) | 1998-01-23 | 2002-02-19 | Pe Corporation (Ny) | Non-fluorescent asymmetric cyanine dye compounds useful for quenching reporter dyes |
| US6372907B1 (en) | 1999-11-03 | 2002-04-16 | Apptera Corporation | Water-soluble rhodamine dye peptide conjugates |
| US20020119455A1 (en) * | 1997-02-12 | 2002-08-29 | Chan Eugene Y. | Methods and products for analyzing polymers |
| US6482938B1 (en) * | 1997-07-11 | 2002-11-19 | Wako Pure Chemical Industries, Ltd. | Compounds having energy transfer function and method for DNA base sequencing by using the same |
| US6548251B1 (en) | 2000-09-05 | 2003-04-15 | Fidelity Systems, Inc. | Inhibition of molecular and biological processes using modified oligonucleotides |
| US20030152995A1 (en) * | 2001-08-27 | 2003-08-14 | Hannah Eric C. | Electron induced fluorescent method for nucleic acid sequencing |
| US20030157727A1 (en) * | 2000-02-28 | 2003-08-21 | Tetsuo Nagano | Measuring method using long life fluorescence of excitation type |
| US6649769B2 (en) | 2000-11-01 | 2003-11-18 | Applera Corporation | Atropisomers of asymmetric xanthene fluorescent dyes and methods of DNA sequencing and fragment analysis |
| US20040038215A1 (en) * | 2002-08-23 | 2004-02-26 | Shiv Kumar | Oligonucleotide tagged nucleoside triphosphates (OTNTPs) for genetic analysis |
| US20040038306A1 (en) * | 2002-05-03 | 2004-02-26 | Brian Agnew | Compositions and methods for detection and isolation of phosphorylated molecules |
| US6716994B1 (en) | 2000-01-04 | 2004-04-06 | Applera Corporation | Mobility-Modifying Cyanine Dyes |
| US20040072167A1 (en) * | 2002-10-15 | 2004-04-15 | Perry Kathleen M. | Method for drying dye-terminator sequencing reagents |
| US20040096978A1 (en) * | 2000-12-20 | 2004-05-20 | Martin Vladimir V. | Crown ether derivatives |
| US20040126763A1 (en) * | 2002-12-20 | 2004-07-01 | Satyam Nampalli | Heterocyclic FRETdye cassettes for labeling biological molecules and their use in DNA sequencing |
| US20040171034A1 (en) * | 2002-05-03 | 2004-09-02 | Brian Agnew | Compositions and methods for detection and isolation of phosphorylated molecules |
| US20040209282A1 (en) * | 2002-10-30 | 2004-10-21 | Dana Ault-Riche | Methods for producing polypeptide-tagged collections and capture systems containing the tagged polypeptides |
| US20040225037A1 (en) * | 2003-05-09 | 2004-11-11 | Lam Joe Y.L. | Fluorescent polymeric materials containing lipid soluble rhodamine dyes |
| US20040242902A1 (en) * | 2003-05-09 | 2004-12-02 | Lam Joe Y.L. | Phenyl xanthene dyes |
| US20040241748A1 (en) * | 2003-02-10 | 2004-12-02 | Dana Ault-Riche | Self-assembling arrays and uses thereof |
| US20050014197A1 (en) * | 2002-05-03 | 2005-01-20 | Brian Agnew | Compositions and methods for detection and isolation of phosphorylated molecules |
| US20050037332A1 (en) * | 2003-03-28 | 2005-02-17 | Tetsuo Nagano | Fluorescent probe for zinc |
| WO2005016874A2 (en) | 2000-12-20 | 2005-02-24 | Molecular Probes, Inc. | Crown ether derivatives |
| US20050054573A1 (en) * | 2003-07-29 | 2005-03-10 | Werner Elizabeth A. | Kinase and phosphatase assays |
| US6869764B2 (en) | 2000-06-07 | 2005-03-22 | L--Cor, Inc. | Nucleic acid sequencing using charge-switch nucleotides |
| US20050064485A1 (en) * | 2003-09-12 | 2005-03-24 | Kurt Vogel | Multiplex binding and activity assays |
| US20050069912A1 (en) * | 1996-05-03 | 2005-03-31 | Lee Linda G. | Energy transfer dyes with enhanced fluorescence |
| US6887690B2 (en) | 2001-06-22 | 2005-05-03 | Pe Corporation | Dye-labeled ribonucleotide triphosphates |
| US20050095648A1 (en) * | 2003-10-30 | 2005-05-05 | Mario Geysen | Method for designing linear epitopes and algorithm therefor and polypeptide epitopes |
| US20050134791A1 (en) * | 2003-12-17 | 2005-06-23 | Seiko Epson Corporation | Liquid crystal display device manufacturing method, liquid crystal display device manufactured with the liquid crystal display device manufacturing method, and liquid-crystal-display-device-mounted electronic device |
| US20050149994A1 (en) * | 2001-12-19 | 2005-07-07 | The University Of Chicago | Rapidly maturing fluorescent proteins and methods for using the same |
| US20050170442A1 (en) * | 2003-07-29 | 2005-08-04 | Kupcho Kevin R. | Bimolecular optical probes |
| US20050182253A1 (en) * | 2004-01-09 | 2005-08-18 | Shigenobu Yano | Fluorescent zinc ion sensor |
| US20050186606A1 (en) * | 2004-02-11 | 2005-08-25 | Schroeder Benjamin G. | Methods and compositions for detecting nucleic acids |
| US6936702B2 (en) | 2000-06-07 | 2005-08-30 | Li-Cor, Inc. | Charge-switch nucleotides |
| US20050191643A1 (en) * | 2003-08-11 | 2005-09-01 | Rosaria Haugland | Cyanine compounds and their application as quenching compounds |
| US20050208534A1 (en) * | 2003-12-05 | 2005-09-22 | Dallwig Jason A | Methine-substituted cyanine dye compounds |
| US20050227254A1 (en) * | 2003-11-20 | 2005-10-13 | Christian Lomholt | Quencher compositions comprising anthraquinone moieties |
| US20050250214A1 (en) * | 2004-05-05 | 2005-11-10 | Gee Kyle R | Zinc binding compounds and their method of use |
| US20050255485A1 (en) * | 2004-05-14 | 2005-11-17 | Livak Kenneth J | Detection of gene duplications |
| US20050260593A1 (en) * | 2002-09-25 | 2005-11-24 | Shiv Kumar | Fluorescent labeling reagents with multiple donors and acceptors |
| EP1546391A4 (en) * | 2002-09-25 | 2006-01-04 | Amersham Biosciences Corp | Energy transfer dyes, terminators and use thereof |
| US20060008878A1 (en) * | 2004-04-07 | 2006-01-12 | The University Of Chicago | Monomeric red fluorescent proteins |
| US20060014191A1 (en) * | 2004-06-30 | 2006-01-19 | Lao Kai Q | Analog probe complexes |
| US20060018911A1 (en) * | 2004-01-12 | 2006-01-26 | Dana Ault-Riche | Design of therapeutics and therapeutics |
| US20060024831A1 (en) * | 2003-09-19 | 2006-02-02 | Kao H P | Normalization of data using controls |
| US20060029948A1 (en) * | 2003-09-19 | 2006-02-09 | Gary Lim | Sealing cover and dye compatibility selection |
| US20060030054A1 (en) * | 2002-07-08 | 2006-02-09 | Tetsuo Nagano | Fluorescent probe |
| US20060141487A1 (en) * | 2004-01-26 | 2006-06-29 | Applera Corporation | Methods, compositions, and kits for amplifying and sequencing polynucleotides |
| US20060166238A1 (en) * | 2004-12-22 | 2006-07-27 | Ramsing Niels B | Probes, libraries and kits for analysis of mixtures of nucleic acids and methods for constructing the same |
| US20060211122A1 (en) * | 2002-10-16 | 2006-09-21 | Tetsuo Nagano | Reagents for the measurement of peroxynitrites |
| US20060228726A1 (en) * | 2005-01-06 | 2006-10-12 | Martin Patrick K | Polypeptides having nucleic acid binding activity and compositions and methods for nucleic acid amplification |
| US20060252079A1 (en) * | 2005-05-03 | 2006-11-09 | Applera Corporation | Fluorescent detection system and dye set for use therewith |
| US20060263767A1 (en) * | 2005-04-20 | 2006-11-23 | The Board Of Regents Of The University Of Texas System | Ultrasensitive detection of prions by automated protein misfolding cyclic amplification |
| US20060292586A1 (en) * | 2004-12-17 | 2006-12-28 | Schroth Gary P | ID-tag complexes, arrays, and methods of use thereof |
| US20070043212A1 (en) * | 2000-12-20 | 2007-02-22 | Molecular Probes, Inc. | Crown ether derivatives |
| US20070059787A1 (en) * | 2003-07-29 | 2007-03-15 | Invitrogen Corporation | Kinase and phosphatase assays |
| US20070077588A1 (en) * | 2005-10-05 | 2007-04-05 | Roche Molecular Systems, Inc | Non-fluorescent energy transfer |
| US20070087360A1 (en) * | 2005-06-20 | 2007-04-19 | Boyd Victoria L | Methods and compositions for detecting nucleotides |
| US20070105196A1 (en) * | 2005-11-04 | 2007-05-10 | Evrogen Joint Stock Company | Modified green fluorescent proteins and methods for using same |
| US20070154926A1 (en) * | 1996-05-03 | 2007-07-05 | Applera Corporation | Methods of analyzing polynucleotides employing energy transfer dyes |
| US20070161112A1 (en) * | 2006-01-12 | 2007-07-12 | Invitrogen Corporation | Heavy metal binding compounds and their method of use |
| US20070172819A1 (en) * | 2000-12-01 | 2007-07-26 | Hardin Susan H | Enzymatic nucleic acid synthesis: compositions including pyrophosphorolysis inhibitors |
| WO2007085923A2 (en) | 2006-01-25 | 2007-08-02 | Evrogen, Ip | Novel fluorescent proteins and methods for using same |
| WO2007106690A2 (en) | 2006-03-15 | 2007-09-20 | Siemens Healthcare Diagnostics Inc. | Degenerate nucleobase analogs |
| US20080026951A1 (en) * | 2004-05-28 | 2008-01-31 | David Brown | Methods and Compositions Involving microRNA |
| US20080032415A1 (en) * | 2004-06-22 | 2008-02-07 | Junji Nishigaki | Fluorescence Detection Method |
| US20080050744A1 (en) * | 2004-11-12 | 2008-02-28 | David Brown | Methods and compositions involving mirna and mirna inhibitor molecules |
| US20080118938A1 (en) * | 2006-09-06 | 2008-05-22 | Lisbell Estrada | Methods and Compositions for the Detection of Protein Folding Disorders |
| US20080131878A1 (en) * | 2006-12-05 | 2008-06-05 | Asuragen, Inc. | Compositions and Methods for the Detection of Small RNA |
| US7446202B2 (en) | 2003-12-05 | 2008-11-04 | Molecular Probes, Inc. | Cyanine dye compounds |
| US20080274458A1 (en) * | 2007-05-01 | 2008-11-06 | Latham Gary J | Nucleic acid quantitation methods |
| US20090004753A1 (en) * | 2007-01-30 | 2009-01-01 | Invitrogen Corporation | Labeling reagents and methods of their use |
| US20090031506A1 (en) * | 1999-08-27 | 2009-02-05 | Applera Corporation | UV Excitable Fluorescent Energy Transfer Dyes |
| US20090068751A1 (en) * | 1997-11-25 | 2009-03-12 | Applied Biosystems Inc. | Methods of Labelling Polynucleotides with Dibenzorhodamine Dyes |
| US20090092986A1 (en) * | 2000-10-11 | 2009-04-09 | Applied Biosystems Inc. | Fluorescent Nucleobase Conjugates Having Anionic Linkers |
| US20090092974A1 (en) * | 2006-12-08 | 2009-04-09 | Asuragen, Inc. | Micrornas differentially expressed in leukemia and uses thereof |
| US20090131356A1 (en) * | 2006-09-19 | 2009-05-21 | Asuragen, Inc. | miR-15, miR-26, miR-31, miR-145, miR-147, miR-188, miR-215, miR-216, miR-331, mmu-miR-292-3P REGULATED GENES AND PATHWAYS AS TARGETS FOR THERAPEUTIC INTERVENTION |
| US20090163434A1 (en) * | 2006-12-08 | 2009-06-25 | Bader Andreas G | miR-20 Regulated Genes and Pathways as Targets for Therapeutic Intervention |
| US20090163430A1 (en) * | 2006-12-08 | 2009-06-25 | Johnson Charles D | Functions and targets of let-7 micro rnas |
| US20090171078A1 (en) * | 2007-11-20 | 2009-07-02 | Applied Biosystems Inc. | Method of sequencing nucleic acids using elaborated nucleotide phosphorotiolate compounds |
| US20090175827A1 (en) * | 2006-12-29 | 2009-07-09 | Byrom Mike W | miR-16 REGULATED GENES AND PATHWAYS AS TARGETS FOR THERAPEUTIC INTERVENTION |
| US20090186015A1 (en) * | 2007-10-18 | 2009-07-23 | Latham Gary J | Micrornas differentially expressed in lung diseases and uses thereof |
| US20090186348A1 (en) * | 2007-09-14 | 2009-07-23 | Asuragen, Inc. | Micrornas differentially expressed in cervical cancer and uses thereof |
| US20090192111A1 (en) * | 2007-12-01 | 2009-07-30 | Asuragen, Inc. | miR-124 Regulated Genes and Pathways as Targets for Therapeutic Intervention |
| US20090192114A1 (en) * | 2007-12-21 | 2009-07-30 | Dmitriy Ovcharenko | miR-10 Regulated Genes and Pathways as Targets for Therapeutic Intervention |
| US20090192102A1 (en) * | 2006-12-08 | 2009-07-30 | Bader Andreas G | miR-21 REGULATED GENES AND PATHWAYS AS TARGETS FOR THERAPEUTIC INTERVENTION |
| US20090227533A1 (en) * | 2007-06-08 | 2009-09-10 | Bader Andreas G | miR-34 Regulated Genes and Pathways as Targets for Therapeutic Intervention |
| EP2100958A1 (en) | 2002-11-12 | 2009-09-16 | Zakrytoe Aktsionernoe Obschestvo 'Evrogen' | Fluorescent proteins and chromoproteins from non-aequorea hydrozoa species and methods for using same |
| US20090232893A1 (en) * | 2007-05-22 | 2009-09-17 | Bader Andreas G | miR-143 REGULATED GENES AND PATHWAYS AS TARGETS FOR THERAPEUTIC INTERVENTION |
| US7598390B2 (en) | 2005-05-11 | 2009-10-06 | Life Technologies Corporation | Fluorescent chemical compounds having high selectivity for double stranded DNA, and methods for their use |
| US20090253780A1 (en) * | 2008-03-26 | 2009-10-08 | Fumitaka Takeshita | COMPOSITIONS AND METHODS RELATED TO miR-16 AND THERAPY OF PROSTATE CANCER |
| US20090258928A1 (en) * | 2008-04-08 | 2009-10-15 | Asuragen, Inc. | Methods and compositions for diagnosing and modulating human papillomavirus (hpv) |
| US20090263797A1 (en) * | 2007-11-20 | 2009-10-22 | Applied Biosystems Inc. | Reversible di-nucleotide terminator sequencing |
| US20090263803A1 (en) * | 2008-02-08 | 2009-10-22 | Sylvie Beaudenon | Mirnas differentially expressed in lymph nodes from cancer patients |
| US20090281167A1 (en) * | 2008-05-08 | 2009-11-12 | Jikui Shen | Compositions and methods related to mirna modulation of neovascularization or angiogenesis |
| US20100029923A1 (en) * | 1996-05-03 | 2010-02-04 | Life Technologies Corporation | Oligonucleotides and analogs labeled with energy transfer dyes |
| US7678893B2 (en) | 2002-12-26 | 2010-03-16 | Zakrytoe Aktsionernoe Obschestvo “Evrogen” | Fluorescent proteins from Copepoda species and methods for using same |
| US20100075382A1 (en) * | 2005-09-09 | 2010-03-25 | Invitrogen Corporation | Ssb-polymerase fusion proteins |
| EP2186908A1 (en) | 2004-09-21 | 2010-05-19 | Applied Biosystems, LLC | Two-color real-time/end-point quantitation of microRNAs (miRNAs) |
| EP2196544A1 (en) | 2001-11-21 | 2010-06-16 | Applied Biosystems, LLC | Kit for ligation detection assays using codeable labels |
| US20100159452A1 (en) * | 2008-12-22 | 2010-06-24 | Roche Molecular Systems, Inc. | Method For Detecting a Target Nucleic Acid in a Sample |
| US20100168396A1 (en) * | 2006-09-22 | 2010-07-01 | Arcady Mushegian | Novel Branchiostoma Derived Fluorescent Proteins |
| US20100179213A1 (en) * | 2008-11-11 | 2010-07-15 | Mirna Therapeutics, Inc. | Methods and Compositions Involving miRNAs In Cancer Stem Cells |
| US20100203564A1 (en) * | 2007-05-30 | 2010-08-12 | Life Technologies Corporation | Fluorescent Phospholipase A2 Indicators |
| US20100235105A1 (en) * | 2001-07-09 | 2010-09-16 | Life Technologies Corporation | Method for analyzing dynamic detectable events at the single molecule level |
| US20100255488A1 (en) * | 2009-03-30 | 2010-10-07 | Pacific Biosciences Of California, Inc. | Fret-labeled compounds and uses therefor |
| US20100311959A1 (en) * | 1997-03-12 | 2010-12-09 | Life Technologies Corporation | DNA Polymerases Having Improved Labeled Nucleotide Incorporation Properties |
| US20110020784A1 (en) * | 2007-11-01 | 2011-01-27 | Glick Benjamin S | Red fluorescent proteins with enhanced bacterial expression, increased brightness and reduced aggregation |
| EP2308974A2 (en) | 1999-10-14 | 2011-04-13 | Clontech Laboratories Inc. | Anthozoa derived chromo/fluoroproteins and methods for using the same |
| US20110118142A1 (en) * | 2008-05-16 | 2011-05-19 | Life Technologies Corporation | Dual labeling methods for measuring cellular proliferation |
| US20110159517A1 (en) * | 2003-05-05 | 2011-06-30 | Life Technologies Corporation | Zinc binding compounds and their method of use |
| EP2371927A1 (en) | 2004-09-16 | 2011-10-05 | Life Technologies Corporation | Fluorescent dye compounds, conjugates and uses thereof |
| US8040619B2 (en) | 2003-09-19 | 2011-10-18 | Applied Biosystems, Llc | Optical camera alignment |
| WO2012058633A1 (en) | 2010-10-29 | 2012-05-03 | Latham Gary J | mPCR METHODS FOR ANALYZING REPEAT SEQUENCES |
| WO2012159025A2 (en) | 2011-05-18 | 2012-11-22 | Life Technologies Corporation | Chromosome conformation analysis |
| US8318450B2 (en) | 2004-01-21 | 2012-11-27 | Life Technologies Corporation | Optically-detectable enzyme substrates and their method of use |
| WO2013039883A1 (en) | 2011-09-12 | 2013-03-21 | Abbvie Biotherapeutics Inc. | Artificial nk cells and uses thereof |
| WO2013056841A1 (en) | 2011-10-19 | 2013-04-25 | Inra (Institut National De La Recherche Agronomique) | A method for diagnosing tse |
| JP2013522419A (en) * | 2010-03-15 | 2013-06-13 | パーデュー・リサーチ・ファウンデーション | Higher-order structured dyes with improved optical properties |
| EP2634266A1 (en) | 2009-05-22 | 2013-09-04 | Asuragen, INC. | Mirna biomarkers of prostate disease |
| EP2636755A1 (en) | 2006-05-26 | 2013-09-11 | AltheaDx Incorporated | Biochemical analysis of partitioned cells |
| US8563703B2 (en) | 2006-01-25 | 2013-10-22 | Evrogen IP Joint Stock Company | Fluorescent proteins and methods for using same |
| WO2013180811A1 (en) * | 2012-05-30 | 2013-12-05 | Life Technologies Corporation | FLUOROGENIC pH-SENSITIVE DYES AND THEIR METHODS OF USE |
| US20130345391A1 (en) * | 2009-12-28 | 2013-12-26 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Serv | Composite Probes and Use Thereof in Super Resolution Methods |
| EP2775300A2 (en) | 2009-08-28 | 2014-09-10 | Asuragen, INC. | miRNA Biomarkers of Lung Disease |
| US8845760B2 (en) | 2011-08-30 | 2014-09-30 | Fujifilm Corporation | Compound having multimer structure of xanthene derivative, coloring composition, ink for inkjet recording, method of inkjet recording, color filter, and color toner |
| US8883486B2 (en) | 2004-05-04 | 2014-11-11 | Universite De Montreal | Arrestin biosensor |
| US9110075B2 (en) | 2001-05-21 | 2015-08-18 | Monogram Biosciences, Inc. | Compositions for analyzing proteins |
| WO2016027162A2 (en) | 2014-08-19 | 2016-02-25 | Tataa Biocenter Ab | Methods and compositions for nucleic acid detection |
| US9372181B2 (en) | 2004-07-27 | 2016-06-21 | Life Technologies Corporation | Fluorescent metal ion indicators with large stokes shifts |
| WO2016177774A1 (en) | 2015-05-04 | 2016-11-10 | Academisch Medisch Centrum | Method of quantifying mirnas using normalization |
| WO2017015543A1 (en) | 2015-07-23 | 2017-01-26 | Asuragen, Inc. | Methods, compositions, kits, and uses for analysis of nucleic acids comprising repeating a/t-rich segments |
| US9575069B2 (en) | 2005-03-15 | 2017-02-21 | Applied Biosystems, Llc | Use of antibody-surrogate antigen systems for detection of analytes |
| US9587264B2 (en) | 2001-09-14 | 2017-03-07 | Applied Biosystems, Llc | Thermus scotoductus nucleic acid polymerases |
| US9631182B2 (en) | 2001-11-30 | 2017-04-25 | Applied Biosystems, Llc | Thermus brockianus nucleic acid polymerases |
| US9644241B2 (en) | 2011-09-13 | 2017-05-09 | Interpace Diagnostics, Llc | Methods and compositions involving miR-135B for distinguishing pancreatic cancer from benign pancreatic disease |
| WO2018045162A1 (en) | 2016-09-01 | 2018-03-08 | Biogen Ma Inc. | Biomarkers predictive of primary progressive multiple sclerosis and uses thereof |
| EP3425066A1 (en) | 2014-01-05 | 2019-01-09 | Biomirna Holdings Ltd. | Lung cancer determinations using mirna |
| US10619210B2 (en) | 2014-02-07 | 2020-04-14 | The Johns Hopkins University | Predicting response to epigenetic drug therapy |
| WO2020132487A1 (en) | 2018-12-20 | 2020-06-25 | Life Technologies Corporation | Modified rhodamine dye and use thereof in biological assays |
| WO2020132607A1 (en) | 2018-12-20 | 2020-06-25 | Life Technologies Corporation | Asymmetric rhodamine dye and use thereof in biological assays |
| EP3719144A1 (en) | 2019-04-05 | 2020-10-07 | Fundación para la Investigación Biomédica del Hospital Universitario de la Paz (FIBHULP) | Mir-151a-3p as an universal endogenous control for exosome cargo normalization |
| WO2021013592A1 (en) | 2019-07-19 | 2021-01-28 | Fundación Para La Investigación Biomédica Del Hospital Universitario La Paz (Fibhulp) | Method for determining the response to treatment of a patient affected by non-small cell lung carcinoma (nsclc) |
| WO2022020731A2 (en) | 2020-07-23 | 2022-01-27 | Life Technologies Corporation | Compositions, systems and methods for biological analysis involving energy transfer dye conjugates and analytes comprising the same |
| WO2022020723A1 (en) | 2020-07-23 | 2022-01-27 | Life Technologies Corporation | Energy transfer dye conjugates for use in biological assays |
| EP4089098A1 (en) * | 2021-05-10 | 2022-11-16 | Miltenyi Biotec B.V. & Co. KG | Fret dye labeled reversible nucleotide terminators and their use in sequencing of dna |
| US11621080B2 (en) | 2014-12-08 | 2023-04-04 | 20/20 GeneSystems | Methods and machine learning systems for predicting the likelihood or risk of having cancer |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR102029336B1 (en) | 2012-08-21 | 2019-10-07 | 제일모직 주식회사 | Compound for organic optoelectronic device, organic light emitting diode including the same and display including the organic light emitting diode |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0201751A2 (en) * | 1985-05-08 | 1986-11-20 | Abbott Laboratories | 4'-aminomethyfluorescein derivatives for use in fluorescence polarization immunoassys |
| US4996143A (en) * | 1985-12-23 | 1991-02-26 | Syngene, Inc. | Fluorescent stokes shift probes for polynucleotide hybridization |
| EP0229943B1 (en) * | 1985-12-23 | 1991-09-04 | Molecular Biosystems, Inc. | Fluorescent stokes shift probes for polynucleotide hybridization assays |
| US5188934A (en) * | 1989-11-14 | 1993-02-23 | Applied Biosystems, Inc. | 4,7-dichlorofluorescein dyes as molecular probes |
| WO1993013224A1 (en) * | 1991-12-23 | 1993-07-08 | Chiron Corporation | Process for immobilizing nucleic acid probes on polystyrene surfaces |
| EP0601889A2 (en) * | 1992-12-10 | 1994-06-15 | Maine Medical Center Research Institute | Nucleic acid probes |
| WO1995021266A1 (en) * | 1994-02-01 | 1995-08-10 | The Regents Of The University Of California | Probes labelled with energy transfer coupled dyes |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6008373A (en) * | 1995-06-07 | 1999-12-28 | Carnegie Mellon University | Fluorescent labeling complexes with large stokes shift formed by coupling together cyanine and other fluorochromes capable of resonance energy transfer |
| US5800996A (en) * | 1996-05-03 | 1998-09-01 | The Perkin Elmer Corporation | Energy transfer dyes with enchanced fluorescence |
-
1996
- 1996-05-03 US US08/642,330 patent/US5863727A/en not_active Expired - Lifetime
-
2008
- 2008-09-19 JP JP2008241854A patent/JP2009046685A/en not_active Withdrawn
Patent Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0201751A2 (en) * | 1985-05-08 | 1986-11-20 | Abbott Laboratories | 4'-aminomethyfluorescein derivatives for use in fluorescence polarization immunoassys |
| US4996143A (en) * | 1985-12-23 | 1991-02-26 | Syngene, Inc. | Fluorescent stokes shift probes for polynucleotide hybridization |
| EP0229943B1 (en) * | 1985-12-23 | 1991-09-04 | Molecular Biosystems, Inc. | Fluorescent stokes shift probes for polynucleotide hybridization assays |
| US5188934A (en) * | 1989-11-14 | 1993-02-23 | Applied Biosystems, Inc. | 4,7-dichlorofluorescein dyes as molecular probes |
| WO1993013224A1 (en) * | 1991-12-23 | 1993-07-08 | Chiron Corporation | Process for immobilizing nucleic acid probes on polystyrene surfaces |
| EP0601889A2 (en) * | 1992-12-10 | 1994-06-15 | Maine Medical Center Research Institute | Nucleic acid probes |
| US5607834A (en) * | 1992-12-10 | 1997-03-04 | Maine Medical Center Research Institute | Fluorescent imperfect hairpin nucleic acid probes |
| WO1995021266A1 (en) * | 1994-02-01 | 1995-08-10 | The Regents Of The University Of California | Probes labelled with energy transfer coupled dyes |
Non-Patent Citations (30)
| Title |
|---|
| Cardullo, et al. "Detection of nucleic acid hybridization by nonradiative fluorescence resonance energy transfer", Proc. Nat. Acad. Sci., vol. 85, pp. 8790-8794 (Dec. 1988). |
| Cardullo, et al. Detection of nucleic acid hybridization by nonradiative fluorescence resonance energy transfer , Proc. Nat. Acad. Sci., vol. 85, pp. 8790 8794 (Dec. 1988). * |
| Clegg, "Fluorescence Resonance Energy Transfer and Nucleic Acids", Methods in Enzymology, vol. 211, pp. 353-388 (1992). |
| Clegg, Fluorescence Resonance Energy Transfer and Nucleic Acids , Methods in Enzymology, vol. 211, pp. 353 388 (1992). * |
| Cooper, et al., Biochemistry, vol. 29, pp. 9261 9268 (1990). * |
| Cooper, et al., Biochemistry, vol. 29, pp. 9261-9268 (1990). |
| Drake, et al., Science, vol. 251, pp. 1574 1579 (1991). * |
| Drake, et al., Science, vol. 251, pp. 1574-1579 (1991). |
| Ju, et al., PNAS USA 92 4347 4351 (1995). * |
| Ju, et al., PNAS USA 92 4347-4351 (1995). |
| Jue, et al., "Design and Synthesis of Fluorescence Energy Transfer Dye-Labeled Primer and Their Application for DNA Sequencing and Analysis", Analytical Biochemistry, vol. 231, pp. 131-140 (1995). |
| Jue, et al., "Fluorescnce energy transfer dye-labledd primers for DNA sequencing and analysis", Proc. Natl. Acad. Sci., vol. 92, pp. 4347-4351 (1995). |
| Jue, et al., Design and Synthesis of Fluorescence Energy Transfer Dye Labeled Primer and Their Application for DNA Sequencing and Analysis , Analytical Biochemistry, vol. 231, pp. 131 140 (1995). * |
| Jue, et al., Fluorescnce energy transfer dye labledd primers for DNA sequencing and analysis , Proc. Natl. Acad. Sci., vol. 92, pp. 4347 4351 (1995). * |
| Lee et al., Nucleic Acids Res. 20(10):2471 2483, 1992. * |
| Lee et al., Nucleic Acids Res. 20(10):2471-2483, 1992. |
| Lee, et al., "Allelic discrimination by nick-translation PCR with fluorogenic probes", Nucleic Acids Research, vol. 21, No. 16, pp. 3761-3766 (1993). |
| Lee, et al., Allelic discrimination by nick translation PCR with fluorogenic probes , Nucleic Acids Research, vol. 21, No. 16, pp. 3761 3766 (1993). * |
| Llvak, et al., "Oligonucleotides with Fluorescent Dyes at Opposite Ends Provide a Quenched Probe System Useful for Detecting PCR Produces and Nucleic Acid Hybridization", PCR Methods and Applications, pp. 357-362 (1995). |
| Llvak, et al., Oligonucleotides with Fluorescent Dyes at Opposite Ends Provide a Quenched Probe System Useful for Detecting PCR Produces and Nucleic Acid Hybridization , PCR Methods and Applications, pp. 357 362 (1995). * |
| Shipchandler, et al., "4'- Aminomethyl! fluorescein and Its N-Alkyl Derivatives: Useful Reagents in Immunodiagnostic Techniques", Analytical Biochemistry, vol. 162, pp. 89-101 (1987). |
| Shipchandler, et al., 4 Aminomethyl fluorescein and Its N Alkyl Derivatives: Useful Reagents in Immunodiagnostic Techniques , Analytical Biochemistry, vol. 162, pp. 89 101 (1987). * |
| Stenzel et al., Clin. Chem. 39(11):228 2232, 1992. * |
| Stenzel et al., Clin. Chem. 39(11):228-2232, 1992. |
| Stryer, et al., "Energy Transfer: A Spectroscopic Ruler", Proc. Nat'l Acad. Sci., pp. 719-726 (1967). |
| Stryer, et al., Energy Transfer: A Spectroscopic Ruler , Proc. Nat l Acad. Sci., pp. 719 726 (1967). * |
| Tyagi, et al., Nature Biotechnology, vol. 14, pp. 303 308 (1966). * |
| Tyagi, et al., Nature Biotechnology, vol. 14, pp. 303-308 (1966). |
| Wu, et al., "Resonance Energy Transfer:Methods and Applications", Analytical Biochemsitry, vol., 218, pp. 1-13 (1994). |
| Wu, et al., Resonance Energy Transfer:Methods and Applications , Analytical Biochemsitry, vol., 218, pp. 1 13 (1994). * |
Cited By (353)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20070161026A1 (en) * | 1996-05-03 | 2007-07-12 | Applera Corporation | Regents labeled with energy transfer dyes |
| US7169939B2 (en) * | 1996-05-03 | 2007-01-30 | Applera Corporation | Energy transfer dyes with enhanced fluorescence |
| US20050069912A1 (en) * | 1996-05-03 | 2005-03-31 | Lee Linda G. | Energy transfer dyes with enhanced fluorescence |
| US7595162B2 (en) | 1996-05-03 | 2009-09-29 | Applied Biosystems, Llc | Methods of labeling polynucleotides with energy transfer dyes |
| US20070154925A1 (en) * | 1996-05-03 | 2007-07-05 | Applera Corporation | Methods of analyzing polynucleotides employing energy transfer dyes |
| US7388092B2 (en) | 1996-05-03 | 2008-06-17 | Applera Corporation | Oligonucleotides and analogs labeled with energy transfer dyes |
| US7452672B2 (en) | 1996-05-03 | 2008-11-18 | Applied Biosystems Inc. | Methods of analyzing polynucleotides employing energy transfer dyes |
| US20070161027A1 (en) * | 1996-05-03 | 2007-07-12 | Applera Corporation | Oligonucleotides and analogs labeled with energy transfer dyes |
| US7399854B2 (en) | 1996-05-03 | 2008-07-15 | Applera Corporation | Regents labeled with energy transfer dyes |
| US7449149B2 (en) | 1996-05-03 | 2008-11-11 | Applied Biosystems Inc. | Kits useful for sequencing nucleic acids |
| US20070207477A1 (en) * | 1996-05-03 | 2007-09-06 | Applera Corporation | Kits useful for sequencing nucleic acids |
| US7432058B2 (en) | 1996-05-03 | 2008-10-07 | Applera Corporation | Methods of labeling nucleic acids with energy transfer dyes |
| US20090118485A1 (en) * | 1996-05-03 | 2009-05-07 | Applied Biosystems Inc. | Oligonucleotides and analogs labeled with energy transfer dyes |
| US20100280246A1 (en) * | 1996-05-03 | 2010-11-04 | Applera Corporation | Energy transfer dyes with enhanced fluorescence |
| US7449298B2 (en) | 1996-05-03 | 2008-11-11 | Applied Biosystems Inc. | Methods of analyzing polynucleotides employing energy transfer dyes |
| US7825237B2 (en) | 1996-05-03 | 2010-11-02 | Applied Biosystems, Llc | Oligonucleotides and analogs labeled with energy transfer dyes |
| US20100029923A1 (en) * | 1996-05-03 | 2010-02-04 | Life Technologies Corporation | Oligonucleotides and analogs labeled with energy transfer dyes |
| US7423140B2 (en) | 1996-05-03 | 2008-09-09 | Applied Biosystems Inc. | Oligonucleotides and analogs labeled with energy transfer dyes |
| US20080268509A1 (en) * | 1996-05-03 | 2008-10-30 | Applera Corporation | Methods of labeling polynucleotides with energy transfer dyes |
| US20070154926A1 (en) * | 1996-05-03 | 2007-07-05 | Applera Corporation | Methods of analyzing polynucleotides employing energy transfer dyes |
| US20070154924A1 (en) * | 1996-05-03 | 2007-07-05 | Applera Corporation | Oligonucleotides and analogs labeled with energy transfer dyes |
| US6245514B1 (en) * | 1996-06-04 | 2001-06-12 | University Of Utah Research Foundation | Fluorescent donor-acceptor pair with low spectral overlap |
| US8168380B2 (en) | 1997-02-12 | 2012-05-01 | Life Technologies Corporation | Methods and products for analyzing polymers |
| US20020119455A1 (en) * | 1997-02-12 | 2002-08-29 | Chan Eugene Y. | Methods and products for analyzing polymers |
| US20100311959A1 (en) * | 1997-03-12 | 2010-12-09 | Life Technologies Corporation | DNA Polymerases Having Improved Labeled Nucleotide Incorporation Properties |
| US7897738B2 (en) | 1997-03-12 | 2011-03-01 | Applied Biosystems, Llc | DNA polymerases having improved labeled nucleotide incorporation properties |
| US6482938B1 (en) * | 1997-07-11 | 2002-11-19 | Wako Pure Chemical Industries, Ltd. | Compounds having energy transfer function and method for DNA base sequencing by using the same |
| US20090068751A1 (en) * | 1997-11-25 | 2009-03-12 | Applied Biosystems Inc. | Methods of Labelling Polynucleotides with Dibenzorhodamine Dyes |
| US7833756B2 (en) | 1997-11-25 | 2010-11-16 | Applied Biosystems, Llc | Methods of labelling polynucleotides with dibenzorhodamine dyes |
| US20110124510A1 (en) * | 1997-11-25 | 2011-05-26 | Life Technologies Corporation | Methods of labeling polynucleotide with dibenzorhodamine dyes |
| US6348596B1 (en) | 1998-01-23 | 2002-02-19 | Pe Corporation (Ny) | Non-fluorescent asymmetric cyanine dye compounds useful for quenching reporter dyes |
| US6306607B2 (en) | 1998-12-14 | 2001-10-23 | Li-Cor, Inc. | Heterogeneous assay for pyrophosphate |
| US6232075B1 (en) | 1998-12-14 | 2001-05-15 | Li-Cor, Inc. | Heterogeneous assay for pyrophosphate detection |
| WO2000063296A3 (en) * | 1999-04-19 | 2001-02-15 | Nen Life Science Prod Inc | Cyanine dyes and synthesis methods thereof |
| US20090031506A1 (en) * | 1999-08-27 | 2009-02-05 | Applera Corporation | UV Excitable Fluorescent Energy Transfer Dyes |
| US8129529B2 (en) * | 1999-08-27 | 2012-03-06 | Applied Biosystems, Llc | UV excitable fluorescent energy transfer dyes |
| US8604186B2 (en) | 1999-08-27 | 2013-12-10 | Applied Biosystems, Llc | UV excitable fluorescent energy transfer dyes |
| US7888507B2 (en) * | 1999-08-27 | 2011-02-15 | Lee Linda G | UV excitable fluorescent energy transfer dyes |
| US20110077415A1 (en) * | 1999-08-27 | 2011-03-31 | Life Technologies Corporation | UV Excitable Fluorescent Energy Transfer Dyes |
| EP2308974A2 (en) | 1999-10-14 | 2011-04-13 | Clontech Laboratories Inc. | Anthozoa derived chromo/fluoroproteins and methods for using the same |
| US6372907B1 (en) | 1999-11-03 | 2002-04-16 | Apptera Corporation | Water-soluble rhodamine dye peptide conjugates |
| US20050153355A1 (en) * | 1999-11-03 | 2005-07-14 | Applera Corporation | Water-soluble rhodamine dye conjugates |
| US8030096B2 (en) | 1999-11-03 | 2011-10-04 | Applied Biosystems Llc | Water-soluble rhodamine dyes conjugates |
| US6191278B1 (en) | 1999-11-03 | 2001-02-20 | Pe Corporation | Water-soluble rhodamine dyes and conjugates thereof |
| US20090305433A1 (en) * | 1999-11-03 | 2009-12-10 | Applied Biosystems Inc. | Water-Soluble Rhodamine Dye Conjugates |
| US7504496B2 (en) | 1999-11-03 | 2009-03-17 | Lee Linda G | Water-soluble rhodamine dye conjugates |
| US20110081688A1 (en) * | 1999-11-03 | 2011-04-07 | Life Technologies Corporation | Water-Soluble Rhodamine Dyes Conjugates |
| US7795042B2 (en) | 1999-11-03 | 2010-09-14 | Applied Biosystems, Llc | Water-soluble rhodamine dye conjugates |
| US6716994B1 (en) | 2000-01-04 | 2004-04-06 | Applera Corporation | Mobility-Modifying Cyanine Dyes |
| US20050107617A1 (en) * | 2000-01-04 | 2005-05-19 | Applera Corporation | Mobility-modifying cyanine dyes |
| US6221604B1 (en) | 2000-02-07 | 2001-04-24 | Pe Corporation | Electron-deficient nitrogen heterocycle-substituted fluorescein dyes |
| USRE39663E1 (en) | 2000-02-07 | 2007-05-29 | Applera Corporation | Electron-deficient nitrogen heterocycle-substituted fluorescein dyes |
| US20030157727A1 (en) * | 2000-02-28 | 2003-08-21 | Tetsuo Nagano | Measuring method using long life fluorescence of excitation type |
| AU2001235996B2 (en) * | 2000-02-28 | 2004-12-02 | Daiichi Pure Chemicals Co., Ltd | Measuring method using long life fluorescence of excitation type |
| US6346384B1 (en) | 2000-03-27 | 2002-02-12 | Dade Behring Inc. | Real-time monitoring of PCR using LOCI |
| US6936702B2 (en) | 2000-06-07 | 2005-08-30 | Li-Cor, Inc. | Charge-switch nucleotides |
| US8148516B2 (en) | 2000-06-07 | 2012-04-03 | Pacific Biosciences Of California, Inc. | Flowcell systems for single molecule detection |
| US7659070B2 (en) | 2000-06-07 | 2010-02-09 | Pacific Biosciences Of California, Inc. | Charge switch nucleotides |
| US20080206764A1 (en) * | 2000-06-07 | 2008-08-28 | Pacific Biosciences | Flowcell system for single molecule detection |
| US20080153095A1 (en) * | 2000-06-07 | 2008-06-26 | Pacific Biosciences | Charge switch nucleotides |
| US7625701B2 (en) | 2000-06-07 | 2009-12-01 | Pacific Biosciences Of California, Inc. | Charge switch nucleotides |
| US6869764B2 (en) | 2000-06-07 | 2005-03-22 | L--Cor, Inc. | Nucleic acid sequencing using charge-switch nucleotides |
| US20060063173A1 (en) * | 2000-06-07 | 2006-03-23 | Li-Cor, Inc. | Charge switch nucleotides |
| US20110039266A1 (en) * | 2000-06-07 | 2011-02-17 | Pacific Biosciences Of California, Inc. | Flowcell systems for single molecule detection |
| US6548251B1 (en) | 2000-09-05 | 2003-04-15 | Fidelity Systems, Inc. | Inhibition of molecular and biological processes using modified oligonucleotides |
| US20090092986A1 (en) * | 2000-10-11 | 2009-04-09 | Applied Biosystems Inc. | Fluorescent Nucleobase Conjugates Having Anionic Linkers |
| US7687236B2 (en) | 2000-10-11 | 2010-03-30 | Applied Biosystems, Llc | Fluorescent nucleobase conjugates having anionic linkers |
| US6649769B2 (en) | 2000-11-01 | 2003-11-18 | Applera Corporation | Atropisomers of asymmetric xanthene fluorescent dyes and methods of DNA sequencing and fragment analysis |
| US20070172860A1 (en) * | 2000-12-01 | 2007-07-26 | Hardin Susan H | Enzymatic nucleic acid synthesis: compositions and methods |
| US20070172819A1 (en) * | 2000-12-01 | 2007-07-26 | Hardin Susan H | Enzymatic nucleic acid synthesis: compositions including pyrophosphorolysis inhibitors |
| US20100255464A1 (en) * | 2000-12-01 | 2010-10-07 | Hardin Susan H | Enzymatic nucleic acid synthesis: compositions and methods for inhibiting pyrophosphorolysis |
| US8314216B2 (en) | 2000-12-01 | 2012-11-20 | Life Technologies Corporation | Enzymatic nucleic acid synthesis: compositions and methods for inhibiting pyrophosphorolysis |
| US8648179B2 (en) | 2000-12-01 | 2014-02-11 | Life Technologies Corporation | Enzymatic nucleic acid synthesis: compositions and methods for inhibiting pyrophosphorolysis |
| US9845500B2 (en) | 2000-12-01 | 2017-12-19 | Life Technologies Corporation | Enzymatic nucleic acid synthesis: compositions and methods for inhibiting pyrophosphorolysis |
| US20100216122A1 (en) * | 2000-12-01 | 2010-08-26 | Life Technologies Corporation | Enzymatic nucleic acid synthesis: methods for direct detection of tagged monomers |
| US20110184163A1 (en) * | 2000-12-01 | 2011-07-28 | Life Technologies Corporation | Enzymatic Nucleic Acid Synthesis: Compositions and Methods for Inhibiting Pyrophosphorolysis |
| US9243284B2 (en) | 2000-12-01 | 2016-01-26 | Life Technologies Corporation | Enzymatic nucleic acid synthesis: compositions and methods for inhibiting pyrophosphorolysis |
| US7129346B2 (en) | 2000-12-20 | 2006-10-31 | Molecular Probes, Inc. | Crown ether derivatives |
| US20070043212A1 (en) * | 2000-12-20 | 2007-02-22 | Molecular Probes, Inc. | Crown ether derivatives |
| WO2005016874A2 (en) | 2000-12-20 | 2005-02-24 | Molecular Probes, Inc. | Crown ether derivatives |
| US7989617B2 (en) | 2000-12-20 | 2011-08-02 | Life Technologies Corporation | Crown ether derivatives |
| US7579463B2 (en) | 2000-12-20 | 2009-08-25 | Life Technologies Corporation | Crown ether derivatives |
| US20040096978A1 (en) * | 2000-12-20 | 2004-05-20 | Martin Vladimir V. | Crown ether derivatives |
| US9110075B2 (en) | 2001-05-21 | 2015-08-18 | Monogram Biosciences, Inc. | Compositions for analyzing proteins |
| US9939447B2 (en) | 2001-05-21 | 2018-04-10 | Monogram Biosciences, Inc. | Methods and compositions for analyzing proteins |
| US20100292457A1 (en) * | 2001-06-22 | 2010-11-18 | Applied Biosystems, Llc | Dye-labeled ribonucleotide triphosphates |
| US20070293662A1 (en) * | 2001-06-22 | 2007-12-20 | Applera Corporation | Dye-labeled ribonucleotide triphosphates |
| US7678892B2 (en) | 2001-06-22 | 2010-03-16 | Applied Biosystems, Llc | Dye-labeled ribonucleotide triphosphates |
| US8003769B2 (en) | 2001-06-22 | 2011-08-23 | Applied Biosystems, Llc | Dye-labeled ribonucleotide triphosphates |
| US20050100948A1 (en) * | 2001-06-22 | 2005-05-12 | Pe Corporation | Dye-labeled ribonucleotide triphosphates |
| US6887690B2 (en) | 2001-06-22 | 2005-05-03 | Pe Corporation | Dye-labeled ribonucleotide triphosphates |
| US7262029B2 (en) | 2001-06-22 | 2007-08-28 | Applera Corporation | Dye-labeled ribonucleotide triphosphates |
| US20100235105A1 (en) * | 2001-07-09 | 2010-09-16 | Life Technologies Corporation | Method for analyzing dynamic detectable events at the single molecule level |
| US20050019800A1 (en) * | 2001-08-27 | 2005-01-27 | Hannah Eric C. | Electron induced fluorescence for nucleic acid sequencing |
| US20030152995A1 (en) * | 2001-08-27 | 2003-08-14 | Hannah Eric C. | Electron induced fluorescent method for nucleic acid sequencing |
| US20030165964A1 (en) * | 2001-08-27 | 2003-09-04 | Hannah Eric C. | Electron induced fluorescent method for nucleic acid sequencing |
| US7157230B2 (en) * | 2001-08-27 | 2007-01-02 | Intel Corporation | Electron induced fluorescent method for nucleic acid sequencing |
| US9587264B2 (en) | 2001-09-14 | 2017-03-07 | Applied Biosystems, Llc | Thermus scotoductus nucleic acid polymerases |
| EP2196544A1 (en) | 2001-11-21 | 2010-06-16 | Applied Biosystems, LLC | Kit for ligation detection assays using codeable labels |
| US9631182B2 (en) | 2001-11-30 | 2017-04-25 | Applied Biosystems, Llc | Thermus brockianus nucleic acid polymerases |
| US8664471B2 (en) | 2001-12-19 | 2014-03-04 | The University Of Chicago | Rapidly maturing fluorescent proteins and methods for using the same |
| US20050149994A1 (en) * | 2001-12-19 | 2005-07-07 | The University Of Chicago | Rapidly maturing fluorescent proteins and methods for using the same |
| US7445894B2 (en) | 2002-05-03 | 2008-11-04 | Molecular Probes, Inc. | Compositions and methods for detection and isolation of phosphorylated molecules |
| US20040171034A1 (en) * | 2002-05-03 | 2004-09-02 | Brian Agnew | Compositions and methods for detection and isolation of phosphorylated molecules |
| US7776533B2 (en) | 2002-05-03 | 2010-08-17 | Life Technologies Corporation | Compositions and methods for detection and isolation of phosphorylated molecules |
| US20040038306A1 (en) * | 2002-05-03 | 2004-02-26 | Brian Agnew | Compositions and methods for detection and isolation of phosphorylated molecules |
| US20070054304A1 (en) * | 2002-05-03 | 2007-03-08 | Invitrogen Corporation | Compositions and methods for detection and isolation of phosphorylated molecules |
| US20050014197A1 (en) * | 2002-05-03 | 2005-01-20 | Brian Agnew | Compositions and methods for detection and isolation of phosphorylated molecules |
| US7102005B2 (en) | 2002-05-03 | 2006-09-05 | Molecular Probes, Inc. | Compositions and methods for detection and isolation of phosphorylated molecules |
| US7524974B2 (en) | 2002-07-08 | 2009-04-28 | Tetsuo Nagano | Fluorescent probe |
| US20060030054A1 (en) * | 2002-07-08 | 2006-02-09 | Tetsuo Nagano | Fluorescent probe |
| US20040038215A1 (en) * | 2002-08-23 | 2004-02-26 | Shiv Kumar | Oligonucleotide tagged nucleoside triphosphates (OTNTPs) for genetic analysis |
| US7109316B2 (en) | 2002-08-23 | 2006-09-19 | Ce Healthcare Bio-Sciences Corp. | Oligonucleotide tagged nucleoside triphosphates (OTNTPs) for genetic analysis |
| WO2004018712A1 (en) * | 2002-08-23 | 2004-03-04 | Amersham Biosciences Corp | OLIGONUCLEOTIDE TAGGED NUCLEOSIDE TRIPHOSPHATES (OTNTPs) FOR GENETIC ANALYSIS |
| US20050260593A1 (en) * | 2002-09-25 | 2005-11-24 | Shiv Kumar | Fluorescent labeling reagents with multiple donors and acceptors |
| EP1546391A4 (en) * | 2002-09-25 | 2006-01-04 | Amersham Biosciences Corp | Energy transfer dyes, terminators and use thereof |
| EP1546125A4 (en) * | 2002-09-25 | 2006-01-04 | Amersham Biosciences Corp | FLUORESCENT MARKING REAGENTS WITH DONORS AND MULTIPLE ACCEPTORS |
| US20040072167A1 (en) * | 2002-10-15 | 2004-04-15 | Perry Kathleen M. | Method for drying dye-terminator sequencing reagents |
| US7407747B2 (en) | 2002-10-15 | 2008-08-05 | Applera Corporation | Method for drying dye-terminator sequencing reagents |
| US20060211122A1 (en) * | 2002-10-16 | 2006-09-21 | Tetsuo Nagano | Reagents for the measurement of peroxynitrites |
| US20050042623A1 (en) * | 2002-10-30 | 2005-02-24 | Dana Ault-Riche | Systems for capture and analysis of biological particles and methods using the systems |
| US20040209282A1 (en) * | 2002-10-30 | 2004-10-21 | Dana Ault-Riche | Methods for producing polypeptide-tagged collections and capture systems containing the tagged polypeptides |
| EP2100958A1 (en) | 2002-11-12 | 2009-09-16 | Zakrytoe Aktsionernoe Obschestvo 'Evrogen' | Fluorescent proteins and chromoproteins from non-aequorea hydrozoa species and methods for using same |
| US20040126763A1 (en) * | 2002-12-20 | 2004-07-01 | Satyam Nampalli | Heterocyclic FRETdye cassettes for labeling biological molecules and their use in DNA sequencing |
| WO2004059011A1 (en) * | 2002-12-20 | 2004-07-15 | Amersham Biosciences Corp | Heterocyclic fret dye cassettes for labeling biological molecules and their use in dna sequencing |
| US6855503B2 (en) | 2002-12-20 | 2005-02-15 | Amersham Biosciences Corp | Heterocyclic FRETdye cassettes for labeling biological molecules and their use in DNA sequencing |
| US7678893B2 (en) | 2002-12-26 | 2010-03-16 | Zakrytoe Aktsionernoe Obschestvo “Evrogen” | Fluorescent proteins from Copepoda species and methods for using same |
| US20040241748A1 (en) * | 2003-02-10 | 2004-12-02 | Dana Ault-Riche | Self-assembling arrays and uses thereof |
| US20050037332A1 (en) * | 2003-03-28 | 2005-02-17 | Tetsuo Nagano | Fluorescent probe for zinc |
| US7696245B2 (en) | 2003-03-28 | 2010-04-13 | Sekisui Medical Co., Ltd. | Fluorescent probe for zinc |
| US20110159517A1 (en) * | 2003-05-05 | 2011-06-30 | Life Technologies Corporation | Zinc binding compounds and their method of use |
| US8445702B2 (en) | 2003-05-05 | 2013-05-21 | Life Technologies Corporation | Zinc binding compounds and their method of use |
| US20090172899A1 (en) * | 2003-05-09 | 2009-07-09 | Applied Biosystems Inc. | Phenyl xanthene dyes |
| US8383841B2 (en) | 2003-05-09 | 2013-02-26 | Applied Biosystems, Llc | Phenyl xanthene dyes |
| US20040225037A1 (en) * | 2003-05-09 | 2004-11-11 | Lam Joe Y.L. | Fluorescent polymeric materials containing lipid soluble rhodamine dyes |
| US20090072197A1 (en) * | 2003-05-09 | 2009-03-19 | Applied Biosystems Inc. | Fluorescent polymeric materials containing lipid soluble rhodamine dyes |
| US9493656B2 (en) | 2003-05-09 | 2016-11-15 | Life Technologies Corporation | Phenyl xanthene dyes |
| US20040242902A1 (en) * | 2003-05-09 | 2004-12-02 | Lam Joe Y.L. | Phenyl xanthene dyes |
| US20110226994A1 (en) * | 2003-05-09 | 2011-09-22 | Life Technologies Corporation | Fluorescent Polymeric Materials Containing Lipid Soluble Rhodamine Dyes |
| US7432298B2 (en) | 2003-05-09 | 2008-10-07 | Applied Biosystems Inc. | Fluorescent polymeric materials containing lipid soluble rhodamine dyes |
| US7491830B2 (en) | 2003-05-09 | 2009-02-17 | Applied Biosystems Inc. | Phenyl xanthene dyes |
| US9090775B2 (en) | 2003-05-09 | 2015-07-28 | Applied Biosystems, Llc | Phenyl xanthene dyes |
| US9034920B2 (en) | 2003-05-09 | 2015-05-19 | Applied Biosystems, Llc | Fluorescent polymeric materials containing lipid soluble rhodamine dyes |
| US8618161B2 (en) | 2003-05-09 | 2013-12-31 | Applied Biosystems, Llc | Fluorescent polymeric materials containing lipid soluble rhodamine dyes |
| US20070059787A1 (en) * | 2003-07-29 | 2007-03-15 | Invitrogen Corporation | Kinase and phosphatase assays |
| US20050170442A1 (en) * | 2003-07-29 | 2005-08-04 | Kupcho Kevin R. | Bimolecular optical probes |
| US7619059B2 (en) | 2003-07-29 | 2009-11-17 | Life Technologies Corporation | Bimolecular optical probes |
| US7727752B2 (en) | 2003-07-29 | 2010-06-01 | Life Technologies Corporation | Kinase and phosphatase assays |
| US8067536B2 (en) | 2003-07-29 | 2011-11-29 | Life Technologies Corporation | Kinase and phosphatase assays |
| US20050054573A1 (en) * | 2003-07-29 | 2005-03-10 | Werner Elizabeth A. | Kinase and phosphatase assays |
| US7582461B2 (en) | 2003-07-29 | 2009-09-01 | Life Technologies Corporation | Kinase and phosphatase assays |
| US20080039630A1 (en) * | 2003-08-11 | 2008-02-14 | Invitrogen Corporation | Cyanine compounds and their application as quenching compounds |
| US7271265B2 (en) | 2003-08-11 | 2007-09-18 | Invitrogen Corporation | Cyanine compounds and their application as quenching compounds |
| US20050191643A1 (en) * | 2003-08-11 | 2005-09-01 | Rosaria Haugland | Cyanine compounds and their application as quenching compounds |
| US20110105362A1 (en) * | 2003-08-11 | 2011-05-05 | Life Technologies Corporation | Cyanine compounds and their application as quenching compounds |
| US9150922B2 (en) | 2003-08-11 | 2015-10-06 | Life Technologies Corporation | Cyanine compounds and their application as quenching compounds |
| US20050064485A1 (en) * | 2003-09-12 | 2005-03-24 | Kurt Vogel | Multiplex binding and activity assays |
| US20060024831A1 (en) * | 2003-09-19 | 2006-02-02 | Kao H P | Normalization of data using controls |
| US8638509B2 (en) | 2003-09-19 | 2014-01-28 | Applied Biosystems, Llc | Optical camera alignment |
| US20060029948A1 (en) * | 2003-09-19 | 2006-02-09 | Gary Lim | Sealing cover and dye compatibility selection |
| US8040619B2 (en) | 2003-09-19 | 2011-10-18 | Applied Biosystems, Llc | Optical camera alignment |
| US20100220321A1 (en) * | 2003-09-19 | 2010-09-02 | Life Technologies Corporation | Normalization of Data |
| US8089623B2 (en) | 2003-09-19 | 2012-01-03 | Applied Biosystems Llc | Normalization of data |
| US7417726B2 (en) | 2003-09-19 | 2008-08-26 | Applied Biosystems Inc. | Normalization of data using controls |
| US20050095648A1 (en) * | 2003-10-30 | 2005-05-05 | Mario Geysen | Method for designing linear epitopes and algorithm therefor and polypeptide epitopes |
| US20050227254A1 (en) * | 2003-11-20 | 2005-10-13 | Christian Lomholt | Quencher compositions comprising anthraquinone moieties |
| US7504495B2 (en) | 2003-11-20 | 2009-03-17 | Exiqon A/S | Quencher compositions comprising anthraquinone moieties |
| US9040561B2 (en) | 2003-12-05 | 2015-05-26 | Life Technologies Corporation | Methine-substituted cyanine dye compounds |
| US9403985B2 (en) | 2003-12-05 | 2016-08-02 | Life Technologies Corporation | Methine-substituted cyanine dye compounds |
| US7446202B2 (en) | 2003-12-05 | 2008-11-04 | Molecular Probes, Inc. | Cyanine dye compounds |
| US8470529B2 (en) | 2003-12-05 | 2013-06-25 | Life Technologies Corporation | Methine-substituted cyanine dye compounds |
| US7776529B2 (en) | 2003-12-05 | 2010-08-17 | Life Technologies Corporation | Methine-substituted cyanine dye compounds |
| US7655409B2 (en) | 2003-12-05 | 2010-02-02 | Life Technologies Corporation | Cyanine dye compounds |
| US20100317543A1 (en) * | 2003-12-05 | 2010-12-16 | Life Technologies Corporation | Methine-substituted cyanine dye compounds |
| US20100120051A1 (en) * | 2003-12-05 | 2010-05-13 | Life Technologies Corporation | Cyanine dye compounds |
| US7842811B2 (en) | 2003-12-05 | 2010-11-30 | Life Technologies Corporation | Cyanine dye compounds |
| US20090047683A1 (en) * | 2003-12-05 | 2009-02-19 | Invitrogen Corporation | Cyanine dye compounds |
| US10005908B2 (en) | 2003-12-05 | 2018-06-26 | Life Technologies Corporation | Methine-substituted cyanine dye compounds |
| US20050208534A1 (en) * | 2003-12-05 | 2005-09-22 | Dallwig Jason A | Methine-substituted cyanine dye compounds |
| US7433013B2 (en) | 2003-12-17 | 2008-10-07 | Seiko Epson Corporation | Liquid crystal display device manufacturing method, liquid crystal display device manufactured with the liquid crystal display device manufacturing method, and liquid-crystal-display-device-mounted electronic device |
| US20050134791A1 (en) * | 2003-12-17 | 2005-06-23 | Seiko Epson Corporation | Liquid crystal display device manufacturing method, liquid crystal display device manufactured with the liquid crystal display device manufacturing method, and liquid-crystal-display-device-mounted electronic device |
| US7541467B2 (en) | 2004-01-09 | 2009-06-02 | Shigenobu Yano | Fluorescent zinc ion sensor |
| US20050182253A1 (en) * | 2004-01-09 | 2005-08-18 | Shigenobu Yano | Fluorescent zinc ion sensor |
| US20060018911A1 (en) * | 2004-01-12 | 2006-01-26 | Dana Ault-Riche | Design of therapeutics and therapeutics |
| US8865891B2 (en) | 2004-01-21 | 2014-10-21 | Life Technologies Corporation | Optically-detectable enzyme substrates and their method of use |
| US8318450B2 (en) | 2004-01-21 | 2012-11-27 | Life Technologies Corporation | Optically-detectable enzyme substrates and their method of use |
| US20060141487A1 (en) * | 2004-01-26 | 2006-06-29 | Applera Corporation | Methods, compositions, and kits for amplifying and sequencing polynucleotides |
| US8486627B2 (en) | 2004-01-26 | 2013-07-16 | Applied Biosystems, Llc | Methods, compositions, and kits for amplifying and sequencing polynucleotides |
| US20110070580A1 (en) * | 2004-01-26 | 2011-03-24 | Life Technologies Corporation | Methods, Compositions, and Kits for Amplifying and Sequencing Polynucleotides |
| US20050186606A1 (en) * | 2004-02-11 | 2005-08-25 | Schroeder Benjamin G. | Methods and compositions for detecting nucleic acids |
| US7671185B2 (en) | 2004-04-07 | 2010-03-02 | The University Of Chicago | Monomeric red fluorescent proteins |
| US20060008878A1 (en) * | 2004-04-07 | 2006-01-12 | The University Of Chicago | Monomeric red fluorescent proteins |
| US20100184954A1 (en) * | 2004-04-07 | 2010-07-22 | The University Of Chicago | Monomeric red fluorescent proteins |
| US7910714B2 (en) | 2004-04-07 | 2011-03-22 | The University Of Chicago | Monomeric red fluorescent proteins |
| US7250298B2 (en) | 2004-04-07 | 2007-07-31 | The University Of Chicago | Monomeric red fluorescent proteins |
| US8883486B2 (en) | 2004-05-04 | 2014-11-11 | Universite De Montreal | Arrestin biosensor |
| US20050250214A1 (en) * | 2004-05-05 | 2005-11-10 | Gee Kyle R | Zinc binding compounds and their method of use |
| US20100203525A1 (en) * | 2004-05-14 | 2010-08-12 | Life Technologies Corporation | Detection of gene duplications |
| US20050255485A1 (en) * | 2004-05-14 | 2005-11-17 | Livak Kenneth J | Detection of gene duplications |
| US20080182245A1 (en) * | 2004-05-28 | 2008-07-31 | David Brown | Methods and Compositions Involving MicroRNA |
| US20080026951A1 (en) * | 2004-05-28 | 2008-01-31 | David Brown | Methods and Compositions Involving microRNA |
| US8465914B2 (en) | 2004-05-28 | 2013-06-18 | Asuragen, Inc. | Method and compositions involving microRNA |
| US7888010B2 (en) | 2004-05-28 | 2011-02-15 | Asuragen, Inc. | Methods and compositions involving microRNA |
| US7919245B2 (en) | 2004-05-28 | 2011-04-05 | Asuragen, Inc. | Methods and compositions involving microRNA |
| US8568971B2 (en) | 2004-05-28 | 2013-10-29 | Asuragen, Inc. | Methods and compositions involving microRNA |
| US20110112173A1 (en) * | 2004-05-28 | 2011-05-12 | David Brown | Methods and compositions involving microrna |
| US8003320B2 (en) | 2004-05-28 | 2011-08-23 | Asuragen, Inc. | Methods and compositions involving MicroRNA |
| US10047388B2 (en) | 2004-05-28 | 2018-08-14 | Asuragen, Inc. | Methods and compositions involving MicroRNA |
| US20080171667A1 (en) * | 2004-05-28 | 2008-07-17 | David Brown | Methods and Compositions Involving microRNA |
| US20080032415A1 (en) * | 2004-06-22 | 2008-02-07 | Junji Nishigaki | Fluorescence Detection Method |
| US20060014191A1 (en) * | 2004-06-30 | 2006-01-19 | Lao Kai Q | Analog probe complexes |
| US9846168B2 (en) | 2004-07-27 | 2017-12-19 | Life Technologies Corporation | Fluorescent metal ion indicators with large stokes shifts |
| US9372181B2 (en) | 2004-07-27 | 2016-06-21 | Life Technologies Corporation | Fluorescent metal ion indicators with large stokes shifts |
| EP2371927A1 (en) | 2004-09-16 | 2011-10-05 | Life Technologies Corporation | Fluorescent dye compounds, conjugates and uses thereof |
| EP2186908A1 (en) | 2004-09-21 | 2010-05-19 | Applied Biosystems, LLC | Two-color real-time/end-point quantitation of microRNAs (miRNAs) |
| US9447414B2 (en) | 2004-11-12 | 2016-09-20 | Asuragen, Inc. | Methods and compositions involving miRNA and miRNA inhibitor molecules |
| US9506061B2 (en) | 2004-11-12 | 2016-11-29 | Asuragen, Inc. | Methods and compositions involving miRNA and miRNA inhibitor molecules |
| US7960359B2 (en) | 2004-11-12 | 2011-06-14 | Asuragen, Inc. | Methods and compositions involving miRNA and miRNA inhibitor molecules |
| US9068219B2 (en) | 2004-11-12 | 2015-06-30 | Asuragen, Inc. | Methods and compositions involving miRNA and miRNA inhibitor molecules |
| US9051571B2 (en) | 2004-11-12 | 2015-06-09 | Asuragen, Inc. | Methods and compositions involving miRNA and miRNA inhibitor molecules |
| US8765709B2 (en) | 2004-11-12 | 2014-07-01 | Asuragen, Inc. | Methods and compositions involving miRNA and miRNA inhibitor molecules |
| US20090176723A1 (en) * | 2004-11-12 | 2009-07-09 | David Brown | Methods and compositions involving miRNA and miRNA inhibitor molecules |
| US8058250B2 (en) | 2004-11-12 | 2011-11-15 | Asuragen, Inc. | Methods and compositions involving miRNA and miRNA inhibitor molecules |
| US9382537B2 (en) | 2004-11-12 | 2016-07-05 | Asuragen, Inc. | Methods and compositions involving miRNA and miRNA inhibitor molecules |
| US8173611B2 (en) | 2004-11-12 | 2012-05-08 | Asuragen Inc. | Methods and compositions involving miRNA and miRNA inhibitor molecules |
| US20080050744A1 (en) * | 2004-11-12 | 2008-02-28 | David Brown | Methods and compositions involving mirna and mirna inhibitor molecules |
| US8563708B2 (en) | 2004-11-12 | 2013-10-22 | Asuragen, Inc. | Methods and compositions involving miRNA and miRNA inhibitor molecules |
| US8946177B2 (en) | 2004-11-12 | 2015-02-03 | Mima Therapeutics, Inc | Methods and compositions involving miRNA and miRNA inhibitor molecules |
| US20060292586A1 (en) * | 2004-12-17 | 2006-12-28 | Schroth Gary P | ID-tag complexes, arrays, and methods of use thereof |
| US20060166238A1 (en) * | 2004-12-22 | 2006-07-27 | Ramsing Niels B | Probes, libraries and kits for analysis of mixtures of nucleic acids and methods for constructing the same |
| EP2208796A2 (en) | 2005-01-06 | 2010-07-21 | Applied Biosystems, LLC | Polypeptides having nucleic acid binding activity and compositions and methods for nucleic acid amplification |
| EP2813581A1 (en) | 2005-01-06 | 2014-12-17 | Applied Biosystems, LLC | Polypeptides having nucleic acid binding activity and compositions and methods for nucleic acid amplification |
| US20060228726A1 (en) * | 2005-01-06 | 2006-10-12 | Martin Patrick K | Polypeptides having nucleic acid binding activity and compositions and methods for nucleic acid amplification |
| US20100159527A1 (en) * | 2005-01-06 | 2010-06-24 | Life Technologies Corporation | Polypeptides Having Nucleic Acid Binding Activity and Compositions and Methods For Nucleic Acid Amplification |
| US9267130B2 (en) | 2005-01-06 | 2016-02-23 | Applied Biosystems, Llc | Polypeptides having nucleic acid binding activity and compositions and methods for nucleic acid amplification |
| US9575069B2 (en) | 2005-03-15 | 2017-02-21 | Applied Biosystems, Llc | Use of antibody-surrogate antigen systems for detection of analytes |
| US20060263767A1 (en) * | 2005-04-20 | 2006-11-23 | The Board Of Regents Of The University Of Texas System | Ultrasensitive detection of prions by automated protein misfolding cyclic amplification |
| EP2312317A2 (en) | 2005-05-03 | 2011-04-20 | Life Technologies Corporation | Fluorescent detection system and dye set for use therewith |
| WO2006119368A3 (en) * | 2005-05-03 | 2007-03-15 | Applera Corp | Fluorescent detection system and dye set for use therewith |
| US20060252079A1 (en) * | 2005-05-03 | 2006-11-09 | Applera Corporation | Fluorescent detection system and dye set for use therewith |
| EP2312317A3 (en) * | 2005-05-03 | 2011-06-08 | Life Technologies Corporation | Fluorescent detection system and dye set for use therewith |
| US8865904B2 (en) | 2005-05-11 | 2014-10-21 | Life Technologies Corporation | Fluorescent chemical compounds having high selectivity for double stranded DNA, and methods for their use |
| US20100143917A1 (en) * | 2005-05-11 | 2010-06-10 | Life Technologies Corporation | Fluorescent chemical compounds having high selectivity for double stranded dna, and methods for their use |
| US9366676B2 (en) | 2005-05-11 | 2016-06-14 | Life Technologies Corporation | Fluorescent chemical compounds having high selectivity for double stranded DNA, and methods for their use |
| US7598390B2 (en) | 2005-05-11 | 2009-10-06 | Life Technologies Corporation | Fluorescent chemical compounds having high selectivity for double stranded DNA, and methods for their use |
| US7943777B2 (en) | 2005-05-11 | 2011-05-17 | Life Technologies Corporation | Fluorescent chemical compounds having high selectivity for double stranded DNA, and methods for their use |
| US20110217699A1 (en) * | 2005-05-11 | 2011-09-08 | Life Technologies Corporation | Fluorescent Chemical Compounds Having High Selectivity for Double Stranded DNA, and Methods for Their Use |
| US9115397B2 (en) | 2005-05-11 | 2015-08-25 | Life Technologies Corporation | Fluorescent chemical compounds having high selectivity for double stranded DNA, and methods for their use |
| US20070087360A1 (en) * | 2005-06-20 | 2007-04-19 | Boyd Victoria L | Methods and compositions for detecting nucleotides |
| US8828700B2 (en) | 2005-09-09 | 2014-09-09 | Life Technologies Corporation | SSB-polymerase fusion proteins |
| US20100075382A1 (en) * | 2005-09-09 | 2010-03-25 | Invitrogen Corporation | Ssb-polymerase fusion proteins |
| US9580743B2 (en) | 2005-09-09 | 2017-02-28 | Life Technologies Corporation | SSB-polymerase fusion proteins |
| US7741467B2 (en) | 2005-10-05 | 2010-06-22 | Roche Molecular Systems, Inc. | Non-fluorescent energy transfer |
| US20070077588A1 (en) * | 2005-10-05 | 2007-04-05 | Roche Molecular Systems, Inc | Non-fluorescent energy transfer |
| US7417131B2 (en) | 2005-11-04 | 2008-08-26 | Evrogen Joint Stock Company | Modified green fluorescent proteins and methods for using same |
| US20070105196A1 (en) * | 2005-11-04 | 2007-05-10 | Evrogen Joint Stock Company | Modified green fluorescent proteins and methods for using same |
| US7605230B2 (en) | 2005-11-04 | 2009-10-20 | Evrogen Joint Stock Company | Modified green fluorescent proteins and methods for using same |
| US7888113B2 (en) | 2005-11-04 | 2011-02-15 | Evrogen Joint Stock Company | Modified green fluorescent proteins and methods for using same |
| US20090017535A1 (en) * | 2005-11-04 | 2009-01-15 | Lukyanov Sergey A | Modified green fluorescent proteins and methods for using same |
| US20090117650A1 (en) * | 2005-11-04 | 2009-05-07 | Lukyanov Sergey A | Modified green fluorescent proteins and methods for using same |
| US8680320B2 (en) | 2006-01-12 | 2014-03-25 | Life Technologies Corporation | Heavy metal binding compounds and their method of use |
| US7521577B2 (en) | 2006-01-12 | 2009-04-21 | Molecular Probes, Inc. | Heavy metal binding compounds and their method of use |
| US20070161112A1 (en) * | 2006-01-12 | 2007-07-12 | Invitrogen Corporation | Heavy metal binding compounds and their method of use |
| WO2007085923A2 (en) | 2006-01-25 | 2007-08-02 | Evrogen, Ip | Novel fluorescent proteins and methods for using same |
| US8138320B2 (en) | 2006-01-25 | 2012-03-20 | Evrogen IP Joint Stock Company | Fluorescent proteins and methods for using same |
| US7638615B1 (en) | 2006-01-25 | 2009-12-29 | Evrogen IP Joint Stock Company | Fluorescent proteins and methods for using same |
| US20110070625A1 (en) * | 2006-01-25 | 2011-03-24 | Evrogen IP Joint Stock Company | Novel fluorescent proteins and methods for using same |
| US8563703B2 (en) | 2006-01-25 | 2013-10-22 | Evrogen IP Joint Stock Company | Fluorescent proteins and methods for using same |
| WO2007106690A2 (en) | 2006-03-15 | 2007-09-20 | Siemens Healthcare Diagnostics Inc. | Degenerate nucleobase analogs |
| EP2636755A1 (en) | 2006-05-26 | 2013-09-11 | AltheaDx Incorporated | Biochemical analysis of partitioned cells |
| US20080118938A1 (en) * | 2006-09-06 | 2008-05-22 | Lisbell Estrada | Methods and Compositions for the Detection of Protein Folding Disorders |
| US20090131356A1 (en) * | 2006-09-19 | 2009-05-21 | Asuragen, Inc. | miR-15, miR-26, miR-31, miR-145, miR-147, miR-188, miR-215, miR-216, miR-331, mmu-miR-292-3P REGULATED GENES AND PATHWAYS AS TARGETS FOR THERAPEUTIC INTERVENTION |
| US8680235B2 (en) | 2006-09-22 | 2014-03-25 | Stowers Institute For Medical Research | Branchiostoma derived fluorescent proteins |
| US20100168396A1 (en) * | 2006-09-22 | 2010-07-01 | Arcady Mushegian | Novel Branchiostoma Derived Fluorescent Proteins |
| US20080131878A1 (en) * | 2006-12-05 | 2008-06-05 | Asuragen, Inc. | Compositions and Methods for the Detection of Small RNA |
| US20090092974A1 (en) * | 2006-12-08 | 2009-04-09 | Asuragen, Inc. | Micrornas differentially expressed in leukemia and uses thereof |
| US20090163434A1 (en) * | 2006-12-08 | 2009-06-25 | Bader Andreas G | miR-20 Regulated Genes and Pathways as Targets for Therapeutic Intervention |
| US20090163430A1 (en) * | 2006-12-08 | 2009-06-25 | Johnson Charles D | Functions and targets of let-7 micro rnas |
| US20090192102A1 (en) * | 2006-12-08 | 2009-07-30 | Bader Andreas G | miR-21 REGULATED GENES AND PATHWAYS AS TARGETS FOR THERAPEUTIC INTERVENTION |
| US20090175827A1 (en) * | 2006-12-29 | 2009-07-09 | Byrom Mike W | miR-16 REGULATED GENES AND PATHWAYS AS TARGETS FOR THERAPEUTIC INTERVENTION |
| US9645153B2 (en) | 2007-01-30 | 2017-05-09 | Life Technologies Corporation | Labeling reagents and methods of their use |
| US9140706B2 (en) | 2007-01-30 | 2015-09-22 | Life Technologies Corporation | Labeling reagents and methods of their use |
| US20090004753A1 (en) * | 2007-01-30 | 2009-01-01 | Invitrogen Corporation | Labeling reagents and methods of their use |
| US8586743B2 (en) | 2007-01-30 | 2013-11-19 | Life Technologies Corporation | Labeling reagents and methods of their use |
| US20080274458A1 (en) * | 2007-05-01 | 2008-11-06 | Latham Gary J | Nucleic acid quantitation methods |
| US20090232893A1 (en) * | 2007-05-22 | 2009-09-17 | Bader Andreas G | miR-143 REGULATED GENES AND PATHWAYS AS TARGETS FOR THERAPEUTIC INTERVENTION |
| US20100203564A1 (en) * | 2007-05-30 | 2010-08-12 | Life Technologies Corporation | Fluorescent Phospholipase A2 Indicators |
| US8513451B2 (en) | 2007-05-30 | 2013-08-20 | Hee Chol Kang | Fluorescent phospholipase A2 indicators |
| US20090227533A1 (en) * | 2007-06-08 | 2009-09-10 | Bader Andreas G | miR-34 Regulated Genes and Pathways as Targets for Therapeutic Intervention |
| US8361714B2 (en) | 2007-09-14 | 2013-01-29 | Asuragen, Inc. | Micrornas differentially expressed in cervical cancer and uses thereof |
| US9080215B2 (en) | 2007-09-14 | 2015-07-14 | Asuragen, Inc. | MicroRNAs differentially expressed in cervical cancer and uses thereof |
| US20090186348A1 (en) * | 2007-09-14 | 2009-07-23 | Asuragen, Inc. | Micrornas differentially expressed in cervical cancer and uses thereof |
| US20090186015A1 (en) * | 2007-10-18 | 2009-07-23 | Latham Gary J | Micrornas differentially expressed in lung diseases and uses thereof |
| US20110020784A1 (en) * | 2007-11-01 | 2011-01-27 | Glick Benjamin S | Red fluorescent proteins with enhanced bacterial expression, increased brightness and reduced aggregation |
| US8679749B2 (en) | 2007-11-01 | 2014-03-25 | The University Of Chicago | Red fluorescent proteins with enhanced bacterial expression, increased brightness and reduced aggregation |
| US8017338B2 (en) | 2007-11-20 | 2011-09-13 | Life Technologies Corporation | Reversible di-nucleotide terminator sequencing |
| US20090171078A1 (en) * | 2007-11-20 | 2009-07-02 | Applied Biosystems Inc. | Method of sequencing nucleic acids using elaborated nucleotide phosphorotiolate compounds |
| US8715938B2 (en) | 2007-11-20 | 2014-05-06 | Life Technologies Corporation | Reversible di-nucleotide terminator sequencing |
| US20090263797A1 (en) * | 2007-11-20 | 2009-10-22 | Applied Biosystems Inc. | Reversible di-nucleotide terminator sequencing |
| US8071562B2 (en) | 2007-12-01 | 2011-12-06 | Mirna Therapeutics, Inc. | MiR-124 regulated genes and pathways as targets for therapeutic intervention |
| US20090192111A1 (en) * | 2007-12-01 | 2009-07-30 | Asuragen, Inc. | miR-124 Regulated Genes and Pathways as Targets for Therapeutic Intervention |
| US20090192114A1 (en) * | 2007-12-21 | 2009-07-30 | Dmitriy Ovcharenko | miR-10 Regulated Genes and Pathways as Targets for Therapeutic Intervention |
| US20090263803A1 (en) * | 2008-02-08 | 2009-10-22 | Sylvie Beaudenon | Mirnas differentially expressed in lymph nodes from cancer patients |
| US20090253780A1 (en) * | 2008-03-26 | 2009-10-08 | Fumitaka Takeshita | COMPOSITIONS AND METHODS RELATED TO miR-16 AND THERAPY OF PROSTATE CANCER |
| US20090258928A1 (en) * | 2008-04-08 | 2009-10-15 | Asuragen, Inc. | Methods and compositions for diagnosing and modulating human papillomavirus (hpv) |
| US8258111B2 (en) | 2008-05-08 | 2012-09-04 | The Johns Hopkins University | Compositions and methods related to miRNA modulation of neovascularization or angiogenesis |
| US20090281167A1 (en) * | 2008-05-08 | 2009-11-12 | Jikui Shen | Compositions and methods related to mirna modulation of neovascularization or angiogenesis |
| US9365852B2 (en) | 2008-05-08 | 2016-06-14 | Mirna Therapeutics, Inc. | Compositions and methods related to miRNA modulation of neovascularization or angiogenesis |
| US20110118142A1 (en) * | 2008-05-16 | 2011-05-19 | Life Technologies Corporation | Dual labeling methods for measuring cellular proliferation |
| US10138510B2 (en) | 2008-05-16 | 2018-11-27 | Life Technologies Corporation | Dual labeling methods for measuring cellular proliferation |
| US20100179213A1 (en) * | 2008-11-11 | 2010-07-15 | Mirna Therapeutics, Inc. | Methods and Compositions Involving miRNAs In Cancer Stem Cells |
| US20100159452A1 (en) * | 2008-12-22 | 2010-06-24 | Roche Molecular Systems, Inc. | Method For Detecting a Target Nucleic Acid in a Sample |
| US11807904B2 (en) | 2009-03-30 | 2023-11-07 | Pacific Biosciences Of California, Inc. | FRET-labeled compounds and uses therefor |
| US10066258B2 (en) | 2009-03-30 | 2018-09-04 | Pacific Biosciences Of California, Inc. | FRET-labeled compounds and uses therefor |
| US12448647B2 (en) | 2009-03-30 | 2025-10-21 | Pacific Biosciences Of California, Inc. | Methods of monitoring a reaction |
| US20100255488A1 (en) * | 2009-03-30 | 2010-10-07 | Pacific Biosciences Of California, Inc. | Fret-labeled compounds and uses therefor |
| US9551660B2 (en) | 2009-03-30 | 2017-01-24 | Pacific Biosciences Of California, Inc. | Method for detecting reactants using fluorescent signal intensity |
| US8927212B2 (en) | 2009-03-30 | 2015-01-06 | Pacific Biosciences Of California, Inc. | FRET-labeled compounds and uses therefor |
| US11186870B2 (en) | 2009-03-30 | 2021-11-30 | Pacific Biosciences Of California, Inc. | FRET-labeled compounds and uses therefor |
| US10570445B2 (en) | 2009-03-30 | 2020-02-25 | Pacific Biosciences Of California, Inc. | Fret-labeled compounds and uses therefor |
| EP2634266A1 (en) | 2009-05-22 | 2013-09-04 | Asuragen, INC. | Mirna biomarkers of prostate disease |
| EP2775300A2 (en) | 2009-08-28 | 2014-09-10 | Asuragen, INC. | miRNA Biomarkers of Lung Disease |
| US9273089B2 (en) * | 2009-12-28 | 2016-03-01 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Composite probes and use thereof in super resolution methods |
| US20130345391A1 (en) * | 2009-12-28 | 2013-12-26 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Serv | Composite Probes and Use Thereof in Super Resolution Methods |
| JP2013522419A (en) * | 2010-03-15 | 2013-06-13 | パーデュー・リサーチ・ファウンデーション | Higher-order structured dyes with improved optical properties |
| WO2012058633A1 (en) | 2010-10-29 | 2012-05-03 | Latham Gary J | mPCR METHODS FOR ANALYZING REPEAT SEQUENCES |
| WO2012159025A2 (en) | 2011-05-18 | 2012-11-22 | Life Technologies Corporation | Chromosome conformation analysis |
| US8845760B2 (en) | 2011-08-30 | 2014-09-30 | Fujifilm Corporation | Compound having multimer structure of xanthene derivative, coloring composition, ink for inkjet recording, method of inkjet recording, color filter, and color toner |
| WO2013039883A1 (en) | 2011-09-12 | 2013-03-21 | Abbvie Biotherapeutics Inc. | Artificial nk cells and uses thereof |
| US10655184B2 (en) | 2011-09-13 | 2020-05-19 | Interpace Diagnostics, Llc | Methods and compositions involving miR-135b for distinguishing pancreatic cancer from benign pancreatic disease |
| US9644241B2 (en) | 2011-09-13 | 2017-05-09 | Interpace Diagnostics, Llc | Methods and compositions involving miR-135B for distinguishing pancreatic cancer from benign pancreatic disease |
| WO2013056841A1 (en) | 2011-10-19 | 2013-04-25 | Inra (Institut National De La Recherche Agronomique) | A method for diagnosing tse |
| US9599622B2 (en) | 2012-05-30 | 2017-03-21 | Life Technologies Corporation | Fluorogenic pH-sensitive dyes and their methods of use (II) |
| WO2013180811A1 (en) * | 2012-05-30 | 2013-12-05 | Life Technologies Corporation | FLUOROGENIC pH-SENSITIVE DYES AND THEIR METHODS OF USE |
| CN104470991A (en) * | 2012-05-30 | 2015-03-25 | 生命科技公司 | Fluorogenic pH-sensitive dyes and their methods of use |
| US10253185B2 (en) | 2012-05-30 | 2019-04-09 | Life Technologies Corporation | Fluorogenic pH-sensitive dyes and their methods of use (II) |
| EP3425066A1 (en) | 2014-01-05 | 2019-01-09 | Biomirna Holdings Ltd. | Lung cancer determinations using mirna |
| US10619210B2 (en) | 2014-02-07 | 2020-04-14 | The Johns Hopkins University | Predicting response to epigenetic drug therapy |
| WO2016027162A2 (en) | 2014-08-19 | 2016-02-25 | Tataa Biocenter Ab | Methods and compositions for nucleic acid detection |
| US11621080B2 (en) | 2014-12-08 | 2023-04-04 | 20/20 GeneSystems | Methods and machine learning systems for predicting the likelihood or risk of having cancer |
| US12051509B2 (en) | 2014-12-08 | 2024-07-30 | 20/20 Genesystems Inc. | Methods and machine learning systems for predicting the likelihood or risk of having cancer |
| WO2016177774A1 (en) | 2015-05-04 | 2016-11-10 | Academisch Medisch Centrum | Method of quantifying mirnas using normalization |
| WO2017015543A1 (en) | 2015-07-23 | 2017-01-26 | Asuragen, Inc. | Methods, compositions, kits, and uses for analysis of nucleic acids comprising repeating a/t-rich segments |
| US11214829B2 (en) | 2015-07-23 | 2022-01-04 | Asuragen, Inc. | Methods, compositions, kits, and uses for analysis of nucleic acids comprising repeating A/T-rich segments |
| WO2018045162A1 (en) | 2016-09-01 | 2018-03-08 | Biogen Ma Inc. | Biomarkers predictive of primary progressive multiple sclerosis and uses thereof |
| WO2020132487A1 (en) | 2018-12-20 | 2020-06-25 | Life Technologies Corporation | Modified rhodamine dye and use thereof in biological assays |
| WO2020132607A1 (en) | 2018-12-20 | 2020-06-25 | Life Technologies Corporation | Asymmetric rhodamine dye and use thereof in biological assays |
| EP3719144A1 (en) | 2019-04-05 | 2020-10-07 | Fundación para la Investigación Biomédica del Hospital Universitario de la Paz (FIBHULP) | Mir-151a-3p as an universal endogenous control for exosome cargo normalization |
| WO2020201577A1 (en) | 2019-04-05 | 2020-10-08 | Fundación Para La Investigación Biomédica El Hospital Universitario La Paz (Fibhulp) | Mir-151a-3p as an universal endogenous control for exosome cargo normalization |
| WO2021013592A1 (en) | 2019-07-19 | 2021-01-28 | Fundación Para La Investigación Biomédica Del Hospital Universitario La Paz (Fibhulp) | Method for determining the response to treatment of a patient affected by non-small cell lung carcinoma (nsclc) |
| WO2022020723A1 (en) | 2020-07-23 | 2022-01-27 | Life Technologies Corporation | Energy transfer dye conjugates for use in biological assays |
| WO2022020731A2 (en) | 2020-07-23 | 2022-01-27 | Life Technologies Corporation | Compositions, systems and methods for biological analysis involving energy transfer dye conjugates and analytes comprising the same |
| EP4089098A1 (en) * | 2021-05-10 | 2022-11-16 | Miltenyi Biotec B.V. & Co. KG | Fret dye labeled reversible nucleotide terminators and their use in sequencing of dna |
Also Published As
| Publication number | Publication date |
|---|---|
| JP2009046685A (en) | 2009-03-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US5863727A (en) | Energy transfer dyes with enhanced fluorescence | |
| EP0805190B1 (en) | Energy transfer dyes with enhanced fluorescence | |
| EP1212457B1 (en) | Uv excitable fluorescent energy transfer dyes | |
| US7169939B2 (en) | Energy transfer dyes with enhanced fluorescence | |
| US6218124B1 (en) | Method for detecting oligonucleotides using UV light source | |
| US7388092B2 (en) | Oligonucleotides and analogs labeled with energy transfer dyes | |
| CA2297589C (en) | Energy transfer dyes with enhanced fluorescence | |
| US20120172583A1 (en) | Oligonucleotides and Analogs Labeled with Energy Transfer Dyes |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AS | Assignment |
Owner name: PERKIN-ELMER CORPORATION, THE, CALIFORNIA Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:LEE, LINDA G.;SPURGEON, SANDRA L.;ROSENBLUM, BARNETT;REEL/FRAME:008012/0312 Effective date: 19960613 |
|
| STCF | Information on status: patent grant |
Free format text: PATENTED CASE |
|
| AS | Assignment |
Owner name: PE CORPORATION (NY), CALIFORNIA Free format text: CHANGE OF NAME;ASSIGNOR:PERKIN-ELMER CORPORATION, THE;REEL/FRAME:012676/0767 Effective date: 20000522 |
|
| FPAY | Fee payment |
Year of fee payment: 4 |
|
| REMI | Maintenance fee reminder mailed | ||
| AS | Assignment |
Owner name: APPLERA CORPORATION, CALIFORNIA Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:PE CORPORATION (NY);REEL/FRAME:013563/0534 Effective date: 20020628 |
|
| FPAY | Fee payment |
Year of fee payment: 8 |
|
| AS | Assignment |
Owner name: APPLIED BIOSYSTEMS INC., CALIFORNIA Free format text: CHANGE OF NAME;ASSIGNOR:APPLERA CORPORATION;REEL/FRAME:021450/0845 Effective date: 20080630 |
|
| AS | Assignment |
Owner name: BANK OF AMERICA, N.A, AS COLLATERAL AGENT, WASHING Free format text: SECURITY AGREEMENT;ASSIGNOR:APPLIED BIOSYSTEMS, LLC;REEL/FRAME:021976/0001 Effective date: 20081121 Owner name: BANK OF AMERICA, N.A, AS COLLATERAL AGENT,WASHINGT Free format text: SECURITY AGREEMENT;ASSIGNOR:APPLIED BIOSYSTEMS, LLC;REEL/FRAME:021976/0001 Effective date: 20081121 Owner name: BANK OF AMERICA, N.A, AS COLLATERAL AGENT, WASHINGTON Free format text: SECURITY AGREEMENT;ASSIGNOR:APPLIED BIOSYSTEMS, LLC;REEL/FRAME:021976/0001 Effective date: 20081121 |
|
| AS | Assignment |
Owner name: APPLIED BIOSYSTEMS INC.,CALIFORNIA Free format text: CHANGE OF NAME;ASSIGNOR:APPLERA CORPORATION;REEL/FRAME:023994/0538 Effective date: 20080701 Owner name: APPLIED BIOSYSTEMS, LLC,CALIFORNIA Free format text: MERGER;ASSIGNOR:APPLIED BIOSYSTEMS INC.;REEL/FRAME:023994/0587 Effective date: 20081121 Owner name: APPLIED BIOSYSTEMS, LLC,CALIFORNIA Free format text: MERGER;ASSIGNOR:APPLIED BIOSYSTEMS INC.;REEL/FRAME:023985/0801 Effective date: 20081121 Owner name: APPLIED BIOSYSTEMS, LLC, CALIFORNIA Free format text: MERGER;ASSIGNOR:APPLIED BIOSYSTEMS INC.;REEL/FRAME:023985/0801 Effective date: 20081121 Owner name: APPLIED BIOSYSTEMS INC., CALIFORNIA Free format text: CHANGE OF NAME;ASSIGNOR:APPLERA CORPORATION;REEL/FRAME:023994/0538 Effective date: 20080701 Owner name: APPLIED BIOSYSTEMS, LLC, CALIFORNIA Free format text: MERGER;ASSIGNOR:APPLIED BIOSYSTEMS INC.;REEL/FRAME:023994/0587 Effective date: 20081121 |
|
| FPAY | Fee payment |
Year of fee payment: 12 |
|
| AS | Assignment |
Owner name: APPLIED BIOSYSTEMS, INC., CALIFORNIA Free format text: LIEN RELEASE;ASSIGNOR:BANK OF AMERICA, N.A.;REEL/FRAME:030182/0677 Effective date: 20100528 |