US5852183A - Dog-mouse heterohybridoma and gene fragment coding for constant region of canine immunoglobulins - Google Patents

Dog-mouse heterohybridoma and gene fragment coding for constant region of canine immunoglobulins Download PDF

Info

Publication number
US5852183A
US5852183A US08/646,981 US64698196A US5852183A US 5852183 A US5852183 A US 5852183A US 64698196 A US64698196 A US 64698196A US 5852183 A US5852183 A US 5852183A
Authority
US
United States
Prior art keywords
amino acid
canine
acid sequence
constant region
chain
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
US08/646,981
Inventor
Hiroaki Maeda
Yasuyuki Eda
Kazuhiko Kimachi
Yoichi Ono
Sachio Tokiyoshi
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Chemo Sero Therapeutic Research Institute Kaketsuken
Original Assignee
Chemo Sero Therapeutic Research Institute Kaketsuken
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from JP1219889A external-priority patent/JP2811089B2/en
Priority claimed from JP25542589A external-priority patent/JP2811096B2/en
Priority claimed from JP2150673A external-priority patent/JP2837240B2/en
Application filed by Chemo Sero Therapeutic Research Institute Kaketsuken filed Critical Chemo Sero Therapeutic Research Institute Kaketsuken
Priority to US08/646,981 priority Critical patent/US5852183A/en
Application granted granted Critical
Publication of US5852183A publication Critical patent/US5852183A/en
Anticipated expiration legal-status Critical
Expired - Fee Related legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/46Hybrid immunoglobulins
    • C07K16/461Igs containing Ig-regions, -domains or -residues form different species
    • C07K16/462Igs containing a variable region (Fv) from one specie and a constant region (Fc) from another
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/20Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/24Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered

Definitions

  • FIG. 17A and 17B show a nucleotide sequence (SEQ ID NO:25) coding for the constant region of canine immunoglobulin gamma chain present in a DNA fragment DB31gamma cloned by the present invention
  • FIG. 20 shows a nucleotide and an amino acid sequence (SEQ ID NO:9) of a V region gene JP2gL4ll isolated from anti-CPV mouse monoclonal antibody-producing cells;
  • FIG. 21 shows a construction of a gene (pSV2-EPLDCk) expressing an L chain of an anti-CPV mouse-dog chimeric antibody.
  • Kappa chain of immunoglobulin has also already been found in human and mouse P. A. Hieter et al., Cell, 22, p197 (1980); H. Sakano et al., Nature 280, p288-294 (1979)! and also reported for other animal species such as rabbit L. Emorine et al., Proc. Natl. Acad. Sci. USA, 80, p5709-5713 (1983)!.
  • canine kappa chain of the present invention an amino acid thereof and a nucleotide sequence coding therefor.
  • amino acid sequences of these regions cloned by the present invention have the following sequences (B') (SEQ ID NO:12) and (C') (SEQ ID NO:13) which are each one of the preferable examples of specific amino acid sequences present in the constant region of canine immunoglobulin gamma chain:
  • Preferable examples of the constant region of canine immunoglobulin gamma chain containing these amino acid sequences have an amino acid sequence as shown in FIG. 18. Such amino acid sequences and nucleotide sequences coding therefor have never been reported until the present invention.
  • the thus prepared gene coding for the constant region of canine immunoglobulin of the present invention allows for preparation of the canine chimeric antibody using the conventional process for preparing the chimeric antibody for example, Watanabe et al., Cancer Research, 47, p999-1005 (1987); Japanese Patent First Publication No. 20255/1988!. That is, the chimeric gene can basically be constructed by linking two kinds of gene fragments, i. e. the V region gene and the C region gene, to each other. Since the gene can be classified into mainly two categories depending on a way of isolation, the chimeric antibody can be constructed by using either a combination of V and C region genes isolated from a chromosomal DNA or a combination of V and C region genes isolated from cDNA. The chimeric antibody can be expressed in any expression system such as an animal cell expression system, an E. coli expression system, yeast expression system, etc. using different expression vectors.
  • the gene fragment coding for canine immunoglobulin provided by the present invention discloses the specific amino acid sequence or DNA sequence in the constant region of canine immunoglobulin, and hence, allows for isolating those genes coding for the constant regions belonging to different sub-classes or allotypes.
  • the canine chimeric antibody can firstly be prepared.
  • the canine chimeric antibody prepared according to the present invention can be used as agents for diagnosis, prevention and treatment of canine diseases which have hitherto never been developed.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Medicinal Preparation (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

A gene fragment which comprises a DNA sequence coding for an amino acid sequence of a constant region of canine immunoglobulin lambda chain; a gene fragment which comprises a DNA sequence coding for an amino acid sequence of a constant region of canine immunoglobulin kappa chain; a gene fragment which comprises a DNA sequence coding for the constant region of canine immunoglobulin gamma chain; a recombinant DNA molecule coding for an amino acid sequence of a mouse-dog chimeric antibody which comprises a gene fragment coding for an amino acid sequence of a variable region of a mouse immunoglobulin and a gene fragment coding for an amino acid sequence of a constant region of a canine immunoglobulin wherein the latter gene fragment; a polypeptide of a mouse-dog chimeric antibody which is expressed from a cell transformed with an expression vector for cells wherein said recombinant DNA molecule cording for an amino acid sequence of the mouse-dog chimeric antibody is incorporated; a dog-mouse heterohybridoma which produces canine immunoglobulin; and a process for preparing a canine immunoglobulin gene.

Description

This application is a divisional of application Ser. No. 08/306,520, filed on Sep. 15, 1994 now U.S. Pat. No. 5,593,861, which is a Continuation of U.S. Ser. No. 08/046,903 filed Apr. 15, 1993 now abandoned, which is a Continuation of U.S. Ser. No. 07/571,215 filed Aug. 23, 1990, now abandoned.
FIELD OF THE INVENTION
The present invention relates to a novel canine monoclonal antibody which is expected to be useful for diagnosis, treatment and prevention of canine diseases, especially canine infectious diseases. More particularly, the present invention relates to a novel dog-mouse heterohybridoma capable of producing a canine immunoglobulin, a gene fragment coding for a constant region of canine immunoglobulin and a canine chimeric antibody produced by utilizing said gene fragment.
TECHNICAL BACKGROUND OF THE INVENTION
From ancient times, dogs have been favorably treated as pets by human. In modern Europe and America, they are called "Companion species" and are now becoming a members of human society. On the other hand, dogs have hitherto been used as an experimental animal in various fields including medicine, pharmacy, animal husbandry, veterinary, psychology etc. They are also used as a SPF dog in recent years in tests for the determination of the effect and safety of drugs, and hence, the usefulness thereof for human is becoming greater and greater. In any case, it is earnestly desired to establish a method for more certain diagnosis, treatment and prevention of canine diseases, especially canine infectious diseases in order to maintain healthy conditions thereof.
There are many canine viral diseases, and among them, those caused by canine distemper virus, canine parvovirus, infectious canine hepatitis, etc. are acute diseases having a very high mortality rate. Although vaccines for the prevention of these diseases have been developed, only symptomatic therapy such as antibiotics and sulfonamides which prevents secondary bacterial infections has been available for treating those dogs infected and attacked with these diseases, and hence, the conventional methods for treating these diseases are still insufficient.
Hitherto, a hyperimmune serum and an immunoglobulin derived from serum have been utilized for treatment of these diseases and confirmed to be effective. However, with the popularity of the idea for the kind treatment of animals, canine serum materials have become hard to obtain, and hence, this treatment can not be used nowadays. Therefore, development of a monoclonal antibody capable of neutralizing the infected viruses in place of the conventional hyperimmune serum will greatly contribute to the treatment of these viral diseases.
As mentioned above, a monoclonal antibody having a neutralizing activity against viruses can be used as an alternative to the hyperimmune serum. Hitherto, basic techniques of preparing monoclonal antibodies have been established mainly for a mouse monoclonal antibody.
Monoclonal antibodies produced by cells such as hybridomas can advantageously be obtained in a large amount and semipermanently and dissolve the problem of material insufficiency. However, the monoclonal antibody in this case should be a canine monoclonal antibody instead of the conventional mouse monoclonal antibody in order to eliminate side effects such as anaphylatic shock, serum disease, etc. caused by the use in dogs of the mouse monoclonal antibody which acts as a heteroprotein to dogs.
Methods for preparing such canine monoclonal antibody as a drug for treating the canine viral diseases include:
(1) a method using a dog-dog hybridoma;
(2) a method using a canine lymphocyte transformed with some viral or chemical agent;
(3) a method using a dog-mouse heterohybridoma;
(4) a method using a dog-(dog-mouse) hybridoma derived from a dog-mouse heterohybridoma; and
(5) a method by gene recombination techniques of a mouse (V)-dog(C) chimeric monoclonal antibody wherein a variable (V) region which binds to an antigen is derived from a mouse monoclonal antibody having neutralizing activity against viruses and a constant (C) region which is responsible for antigenicity, immunogenicity and physiological activity is derived from a canine monoclonal antibody.
However, none of the above methods have hitherto been reported to be effectively used.
In the method (1), a fusion efficiency is quite low and no appropriate myeloma strain is available. In case of the method (2), there are no appropriate virus corresponding to EB virus in the case of humans and no appropriate chemical agents. The methods (3) and (4) will have much difficulty (for example, a stability problem etc.) in obtaining the desired canine monoclonal antibody with high efficiency in view of the case of preparation of a human monoclonal antibody. Therefore, it is expected that the method (5) using the chimeric monoclonal antibody is the most realizable method among these five methods.
The chimeric monoclonal antibody is prepared by incorporating a plasmid vector containing a mouse (V)-dog (C) chimeric antibody gene into an animal host cell (e. g. mouse myeloma cell), expressing said gene in the host cell and collecting the monoclonal antibody from a supernatant of the culture, wherein said mouse (V)-dog (C) chimeric antibody gene is such that a V (variable) gene is cloned from a mouse-mouse hybridoma capable of producing a mouse monoclonal antibody as a source of a gene coding for a V region, a C (constant) gene is cloned from a canine cell such as a canine antibody-producing cell capable of producing a canine monoclonal antibody as a source of a gene coding for a C region and said V gene and said C gene are linked to each other. Several reports are found as to human chimeric antibodies (Japanese Patent First Publication Nos. 155132/1985 and 47500/1986).
As mentioned above, a gene coding for an amino acid sequence in a variable (V) region of an antibody molecule capable of binding to a desired antigen and a gene coding for an amino acid sequence in a constant (C) region of a canine immunoglobulin are require for preparing the canine chimeric antibody. The gene coding for the variable (V) region of the chimeric antibody is derived from a cell capable of producing a mouse monoclonal antibody having a neutralizing activity against the above mentioned various canine viruses and said cell can be prepared rather easily by the conventional mouse-mouse hybridoma producing procedures. However, the gene coding for the constant (C) region of the chimeric antibody, i. e. the gene coding for the constant (C) region of the canine immunoglobulin is still unknown in its structure and has never been cloned. Therefore, in order to prepare the canine chimeric antibody, it is inevitably required to find the gene coding for the amino acid sequence of the constant (C) region of the canine immunoglobulin.
In addition, although there is much difficulty for obtaining the monoclonal antibody showing a desired specificity in case of the methods (1) to (4), materials (cell strains) effective for preparing the chimeric antibody can effectively be provided in the case of the method (5) since any cell which produces the canine immunoglobulin regardless of its specificity can preferably be employed as materials for providing a gene coding for the C region of the canine immunoglobulin for preparing the chimeric antibody.
SUMMARY OF THE INVENTION
Under the circumstances, the present inventors have succeeded in preparing dog-mouse hybridomas which produce the canine immunoglobulin, by isolating a gene coding for the amino acid sequence in the constant (C) region of the canine immunoglobulin using said hybridoma cells and canine cells, and in preparing a canine chimeric antibody using the gene fragment coding for the constant (C) region of the canine immunoglobulin.
An object of the invention is to provide a hitherto unreported dog-mouse heterohybridoma capable of producing the canine immunoglobulin and a hitherto genetically unanalyzed DNA fragment coding for an amino acid sequence in the constant (C) region of the canine immunoglobulin. Another object of the invention is to provide a process for preparing the canine chimeric antibody using said DNA fragment coding for the amino acid sequence in the constant (C) region of the canine immunoglobulin, said chimeric antibody being useful as agents for diagnosis, treatment and prevention of canine diseases, especially infectious canine disease, without showing side effects. These and other objects and advantages of the invention will be apparent to those skilled in the art from the following description.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1A, 1B and 1C shows the results of EIA using an anti-canine antibody proving that IgG produced by the dog-mouse hybridomas prepared by the present invention is a canine monoclonal antibody;
FIG. 2 shows the results of Western blot analysis using an anti-canine antibody proving that IgG produced by the dog-mouse hybridomas prepared by the present invention is a canine monoclonal antibody;
FIG. 3 shows a restriction enzyme map of a DNA fragment (S6-61) coding for the constant region of canine immunoglobulin lambda chain cloned by the present invention and the regions (→) in which a nucleotide sequence was analyzed;
FIG. 4 shows the results of Southern hybridization analysis where a DNA fragment (S6-61) coding for the constant region of canine immunoglobulin lambda chain cloned by the present invention is hybridized with a chromosomal DNA (EcoRI digestion) of canine hepatocytes;
FIG. 5 shows the results of Northern hybridization analysis where a DNA fragment (S6-61) coding for the constant region of canine immunoglobulin lambda chain cloned by the present invention is hybridized with poly A+RNA of CM-S6 cells (lane 1) or CM-S1 (lane 2);
FIG. 6 shows a nucleotide sequence (SEQ ID NO:4) coding for the constant region of canine immunoglobulin lambda chain present in the DNA fragment (S6-61) cloned by the present invention;
FIG. 7 shows a whole amino acid sequence (SEQ ID NO:3of the constant region of canine immunoglobulin lambda chain coded in the DNA fragment (S6-61) cloned by the present invention;
FIG. 8 shows the results of Southern hybridization analysis where a chromosomal DNA of canine hepatocytes is hybridized with 32 P!-labeled probe containing human C kappa chain region;
FIG. 9 shows the results of Northern hybridization analysis where poly A+RNA extracted from canine spleen cells is hybridized with a 32p!-labeled DEk5a probe;
FIG. 10 shows a restriction enzyme map of a DNA fragment (DEk5a) coding for the constant region of canine immunoglobulin kappa chain cloned by the present invention and the regions (→) in which a nucleotide sequence was analyzed;
FIG. 11 shows a nucleotide sequence (SEQ ID NO:7) coding for the constant region of canine immunoglobulin kappa chain present in the DNA fragment DEk5a cloned by the present invention;
FIG. 12 shows a whole amino acid sequence (SEQ ID NO:6) of the constant region of canine immunoglobulin kappa chain code in the DNA fragment DEk5a cloned by the present invention;
FIG. 13 shows the results of Southern hybridization analysis where a chromosomal DNA of canine hepatocytes is hybridized with a 32 P!-labeled probe containing the human C gamma 1 chain region;
FIG. 14A and 14B show a restriction enzyme map of the chromosomal DNA fragment (DE94gamma,DB31gamma) coding for the constant region of canine immunoglobulin gamma chain cloned by the present invention;
FIG. 15 shows the result of Northern hybridization analysis where poly A+RNA extracted from canine, mouse or feline spleen cells is hybridized with a 32 P!-labeled DE94gamma or DB31gamma probe;
FIG. 16 shows a nucleotide sequence (SEQ ID NO:14) coding for the constant region of canine immunoglobulin gamma chain present in a DNA fragment DE94gamma cloned by the present invention;
FIG. 17A and 17B show a nucleotide sequence (SEQ ID NO:25) coding for the constant region of canine immunoglobulin gamma chain present in a DNA fragment DB31gamma cloned by the present invention;
FIG. 18 shows whole amino acid sequences (SEQ ID NOS:16-17) of the constant region of canine immunoglobulin gamma chain coded in a DNA fragment DE94gamma and DB31gamma cloned by the present invention;
FIG. 19 shows a restriction enzyme map of a clone JP2g L4ll containing V kappa region gene isolated from anti-CPV mouse monoclonal antibody-producing cells;
FIG. 20 shows a nucleotide and an amino acid sequence (SEQ ID NO:9) of a V region gene JP2gL4ll isolated from anti-CPV mouse monoclonal antibody-producing cells; and
FIG. 21 shows a construction of a gene (pSV2-EPLDCk) expressing an L chain of an anti-CPV mouse-dog chimeric antibody.
DETAILED DESCRIPTION OF THE INVENTION
There are two approaches for isolating the gene coding for the amino acid sequence in the constant (C) region of the canine immunoglobulin. That is, the first is to construct a library from a chromosomal DNA in canine cells and then to clone the gene coding for the amino acid sequence in C region according to the conventional procedure for example, see T. Maniatis "Molecular Cloning" Cold Spring Harbor Lab.(1982)!, and the second is to construct a library by synthesizing cDNA from a messenger RNA (mRNA) of canine cells and then to clone the C region gene according to the conventional procedure for example, see "DNA cloning Vol. I" ed. by D. M. Glover, IRL press (1985)!.
For the screening procedure, there can be used mainly four processes; i. e. (a) a process which comprises purifying the antibody protein produced by the canine antibody-producing cell, analyzing the amino acid sequence of said protein, and synthesizing a nucleotide sequence corresponding to said amino acid sequence, and then using said nucleotide sequence as a probe for screening (hybridization); (b) a process by cross-hybridization using a probe synthesized by referring to a gene fragment of mouse and human immunoglobulin genes or nucleotide sequences thereof previously reported for example, Sakano et al., Nature, 286, p676 (1980); E. E. Max et al., J. Biol. Chem., 256, p5116 (1981); J. W. Ellison et al., Nuc. Acids. Res., 10, p4071 (1982); and P. A. Heiter et al., Cell, 22, p197 (1980)!; (c) a process which comprises synthesizing a primer based on a nucleotide sequence on the analogy of an amino acid sequence of a canine antibody protein or a nucleotide sequence on the analogy of the mouse and human immunoglobulin genes previously reported and then screening based on the primer using the PCR procedure R. Orlandi et al., Proc. Natl. Acad. Sci. USA, 86, p3833 (1989)! and (d) a process which comprises expressing the canine antibody gene incorporated into an expression vector (e. g. Lambda gtll) in E. coli or in an animal cell and screening the expression product by using an antiserum (or a monoclonal antibody) directed to the canine antibody protein.
In any case, the screening process using the canine antibody protein-producing cells is preferable in view of the cloning efficiency and is essential in the case of the above second process for isolating the gene using the cDNA synthesized from messenger RNA. Although it is possible to use polyclonal cells such as spleen cells or lymphonodes cells as the antibody-producing cells, monoclonal cells are preferable in view of the easiness of genetic analysis.
There are several methods for establishing the monoclonal antibody-producing cells as cited above (1) to (5). However, the methods (1) and (2) are extremely difficult to practice and the method (4) requires the dog-mouse heterohybridomas of the method (3). In conclusion, it is the most important to obtain the dog-mouse heterohybridomas of the method (3).
The dog-mouse heterohybridomas can be prepared by the several methods previously disclosed. According to these methods, the present inventors have established dog-mouse heterohybridomas CM-S1, -S2, S6 which produce the canine monoclonal antibody. Among these dog-mouse heterohybridomas, CM-S6 are the most preferable cells for preparing the gene of the present invention and has been deposited at the Fermentation Research Institute Agency of Industrial Science and Technology, Japan under Budapest Treaty under the accession number FERM BP-2946.
As mentioned above, the present inventors have cloned several kinds of gene fragments coding for the constant region of immunoglobulin from canine cells. The cloned gene fragments coding for the C region of canine immunoglobulin of the present invention were analyzed by comparing an amino acid sequence deduced from the nucleotide sequence thereof with the corresponding sequences of the C region genes of immunoglobulin from other animal species, and as a result, it has been found that each gene fragment of the present invention contains gene fragments coding for lambda chain, kappa chain and gamma chain, respectively.
Lambda chain of immunoglobulin has already been found in human P. A. Hieter et al., Nature, 294, p536 (1981); G. F. Hollis et al., Nature 296, p321 (1982)! and in mouse B. Blomberg et al., Proc. Natl. Acad. Sci. USA, 79, p530 (1982); J. Miller et al., Nature, 295, p428 (1982)! and has also been reported for other animal species such as rabbit Duvoisin, MR. M. et al., J. Immunol., 136, p4297-4302 (1986)!. However, there has never been reported the canine lambda chain of the present invention, the amino acid sequence thereof and the nucleotide sequence coding therefor.
The cDNA fragment coding for the constant region of canine immunoglobulin lambda chain prepared as mentioned above has been analyzed for its nucleotide sequence. Then, the amino acid sequence of said constant region has been deduced from the nucleotide sequence and compared with the amino acid sequences of the constant region of immunoglobulin lambda chain derived from human, mouse, rabbit, etc. previously reported. As a result, it has been found that the constant region of canine immunoglobulin lambda chain has a specific amino acid sequence at the N-terminal region of the polypeptide of said lambda chain constant region which has the following amino acid sequence (SEQ ID NO:1) (A) at the N-terminal region of the first cysteine counted from the N-terminus of said polypeptide:
-Gly-Ala-xxx-xxx-xxx-xxx-xxx-xxx-Cys-                      (A)
wherein xxx mean an optional amino acid residue.
From a comparison among the amino acid sequence of the constant region of canine immunoglobulin lambda chain analyzed in accordance with the present invention, the amino acid sequence of the constant region of feline immunoglobulin lambda chain-separately analyzed by the present inventors and various amino acid sequences of the constant region of immunoglobulin lambda chain derived from several animal species, it has been found that the region -Gly-Ala- present at the N-terminus of the above cysteine is a region whose amino acid sequence varies with animal species such dog, mouse, human, etc. In addition, it has been found that this region is quite well preserved among sub-classes, for example, as an amino acid sequence of the constant region of human lambda chain, and the above sequence (A) is supposed to be specific for the constant region of canine immunoglobulin lambda chain region cloned by the present invention has the following amino acid sequence (SEQ ID NO:2) (A') which is one example of the preferable specific amino acid sequences present in the constant region of canine immunoglobulin lambda chain.
-Gly-Ala-Asn-Lys-Ala-Thr-Leu-Val-Cys-                      (A')
The dog-mouse heterohybridoma of the present invention produces canine immunoglobulin containing a peptide of a lambda chain C region having the above amino acid sequence (A) or (A'). The gene fragment coding for the constant region of canine immunoglobulin lambda chain of the presents invention also contains a DNA fragment coding for the above amino acid sequence (A) or (A'). Such amino acid sequence contained in the above lambda chain is believed to be an important amino acid sequence for determining the C region of canine immunoglobulin lambda chain and is first disclosed by the present invention. In the constant region polypeptide of canine lambda chain, the 11th-9th amino acid sequence at the N-terminal region from the second cystein residue counted from the C-terminus is deemed to be the region whose amino acid sequence varies with species such as dog, cat, human, mouse, etc. as mentioned above, and it is found that the constant region of canine immunoglobulin lambda chain of the present invention has the corresponding specific sequence of -Pro-Asp-Lys-. One preferable example of the gene coding for the constant region canine immunoglobulin lambda chain is a gene fragment coding for the amino acid sequence as shown in FIG. 7 (SEQ ID NO:3) and one example of the nucleotide sequence of said gene is as shown in FIG. 6 (SEQ ID NO:4).
On the analogy of the case of human and mouse P. A. Hieter et al., Nature, 294, p536 (1981); G. F. Hollis et al., Nature, 296, p321 (1982); B. Blomberg et al., Proc. Natl. Acad. Sci. USA, 79, p530 (1982); J. Miller et al., Nature, 295, p428 (1982)!, there is expected an existence of several subclasses in canine lambda chain. In fact, Southern hybridization using the lambda chain gene of the present invention shows an existence of C lambda region genes of several subclasses belonging to the same canine lambda chain gene in addition to the lambda chain of the present invention (FIG. 4). That is, there exists genes of different subclasses having a quite similar sequence to that of the gene fragment coding for the constant region of canine immunoglobulin lambda chain of the present invention. The canine lambda chain gene of the present invention is believed to have sequences which cover also such gene fragments coding for amino acid sequences of different subclasses. Therefore, such gene fragments coding for different subclasses can also be used as the canine lambda chain gene as far as they have a substantially the same sequences as that of the gene of the present invention. Cloning of such C genes of different subclasses can be carried out by using a part of the nucleotide sequence disclosed in the present invention as a probe. Alternatively, a chromosomal gene coding for the canine lambda chain can also be cloned from canine cells using the canine immunoglobulin lambda chain of the present invention as a probe.
Kappa chain of immunoglobulin has also already been found in human and mouse P. A. Hieter et al., Cell, 22, p197 (1980); H. Sakano et al., Nature 280, p288-294 (1979)! and also reported for other animal species such as rabbit L. Emorine et al., Proc. Natl. Acad. Sci. USA, 80, p5709-5713 (1983)!. However, there has never been reported for the canine kappa chain of the present invention, an amino acid thereof and a nucleotide sequence coding therefor.
The present inventors have obtained a chromosomal DNA fragment which will code for the constant region of canine immunoglobulin kappa chain by the above-mentioned procedure. The present inventors have also analyzed the nucleotide sequence of the chromosomal DNA fragment and have determined an amino acid sequence of the kappa constant region. As a result of a comparison of the amino acid sequence with those of the constant region of immunoglobulin kappa chain derived from human, mouse, rabbit, etc., it has been found that the gene fragment of the present invention is a gene fragment coding for the constant region of immunoglobulin kappa chain.
The gene fragment coding for the constant region of canine immunoglobulin kappa chain of the present invention is a DNA sequence coding for a peptide comprising 109 amino acids and characterized in that four amino acids at the C-terminus thereof is -Cys-Gln-Arg-Arg-Asp (SEQ ID NO:5). It is known that the C-terminus of the amino acid sequence of human or mouse kappa chain constant region is Cys (cystein) residue as previously reported. It is very rare that the amino acid sequence of the constant region contains additional four amino acids subsequent to the Cys residue present at the C-terminus like in the gene of the present invention coding for the constant region of canine immunoglobulin kappa chain which is characteristic to the constant region of canine immunoglobulin kappa chain of the present invention. The gene coding for the constant region of canine immunoglobulin kappa chain of the present invention contains the gene fragment as shown by the restriction enzyme map of FIG. 10.
Among the genes coding for the constant region of canine immunoglobulin kappa chain of the present invention, one of the preferable examples is the gene fragment coding for the amino acid sequence as shown in FIG. 12 (SEQ ID NO:6). Such an amino acid sequence coding therefor has hitherto never been reported.
One example of the nucleotide sequence of the gene coding for the C region of canine immunoglobulin kappa chain of the present invention is as shown in FIG. 11 (SEQ ID NO:7). cDNA coding for the C region of immunoglobulin kappa chain can be cloned from a cDNA library of canine antibody-producing cells using the canine immunoglobulin kappa chain of the present invention as a probe.
Gamma chain of immunoglobulin has also already been found in human and mouse e. g. A. Shimizu et al., Cell, 29, p121 (1982); N. Takahashi et al., Cell, 29, p671 (1982)! and also reported for other animal species such as rabbit C. L. Martens et al., Proc. Natl. Acad. Sci. USA, 79, p6018 (1982)! and bovine K. L. Knight et al., J. immunol, 140, p3654 (1988)!. However, there has never been any report concerning the canine immunoglobulin gamma chain.
The present inventors have obtained two chromosomal gene fragments (DE94gamma and DB31gamma )which will code for the constant region of canine immunoglobulin gamma chain by the aforementioned procedure. The cloned gene fragments have genetically been analyzed by comparing an amino acid sequence deduced from the nucleotide sequence of this gene fragment with those of the genes derived from other animal species coding for the C region of immunoglobulin, and as a result, it has been found that the gene fragments obtained by the present invention are a gene fragment coding for the constant region of different subclass of the immunoglobulin gamma chain. The amino acid sequences of each canine gamma chain have been compared with previously reported amino acid sequences of the constant region of immunoglobulin gamma chain derived from human, mouse, rabbit, etc. As a result, it has been found that the amino acid sequence specific for the constant region of canine immunoglobulin gamma chain includes the following amino acid sequence (B) in the vicinity of the second cysteine residue counted from the C-terminus of CHl domain of the constant region of the gamma chain:
-Ala-Cys-xxx-xxx-Ser-(SEQ ID NO:10)                        (B)
wherein xxx represent an optional amino acid.
The present inventors have found that an amino acid sequence of the above region -Ala-Cys-xxx-xxx-Ser- (SEQ ID NO:10) present in the vicinity of the above-mentioned cysteine varies with animal species such as dog, cat, mouse, human, etc. by comparing the amino acid sequence of the constant region of canine immunoglobulin gamma chain analyzed by the present invention with the previously analyzed amino acid sequences of the constant region of immunoglobulin gamma chain derived from various animals. The present inventors have also found that this region is quite well preserved among subclasses(DE94 gamma and DB31gamma) of canine gamma chain and also preserved among those of human, rabbit and mouse. The above sequence (B) is believed to be specific for the constant region of canine immunoglobulin gamma chain.
Similar sequences specific for the constant region of canine immunoglobulin gamma chain have also been found in the vicinity of cystein at the N-terminal region of CH3 domain (C) (SEQ ID NO:11):
-Cys-xxx-Ile-xxx-Asp-xxx-Phe-xxx-Pro-                      (C)
wherein xxx represents an optional amino acid.
The amino acid sequences of these regions cloned by the present invention have the following sequences (B') (SEQ ID NO:12) and (C') (SEQ ID NO:13) which are each one of the preferable examples of specific amino acid sequences present in the constant region of canine immunoglobulin gamma chain:
-Ala-Cys-Leu-Val-Ser-                                      (B')
-Cys-Leu-Ile-Lys-Asp-Phe-Phe-Pro-Pro-                      (C')
The gene fragments coding for the constant region of canine immunoglobulin gamma chain of the present invention are characterized by that it contains a DNA sequence coding for the above amino acid sequence (B), (C), (B') or (C') (SEQ ID NO:10-13). These amino acid sequences contained in the gamma chain, which are quite important for determining the C region of canine immunoglobulin gamma chain, have been found by the present inventors for the first time.
Preferable examples of the constant region of canine immunoglobulin gamma chain containing these amino acid sequences have an amino acid sequence as shown in FIG. 18. Such amino acid sequences and nucleotide sequences coding therefor have never been reported until the present invention.
An example of the nucleotide sequences of the gene coding for the C region of canine immunoglobulin gamma chain of the present invention include the sequences as shown in FIG. 16 and FIG. 17 (SEQ ID NO:14-14). On the analogy of the human and mouse cases for example, A. Shimizu et al., Cell, 29, p121 (1982); N. Takahashi et al., Cell, 29, p671 (1982)!, the canine gamma chain is also expected to have several subclasses. It is known that there are at least four subclasses of canine gamma chain J. S. Johnson et al., J. Immunol., 98, p923 (1966)!, the genes of the present invention appear to code for two of these four subclasses. In fact, Southern hybridization using the genes of the present invention and a canine chromosomal DNA showed an existence of several genes coding for the C regions of other subclasses of canine gamma chain in addition to the gamma chains of the present invention. That is, there are genes coding for different subclasses having extremely similar sequences to that of the gene of the present invention. In fact, DE94gamma and Db31gamma chain share striking homology with each other, except for those of the hinge regions. It is believed that the canine gamma chain genes of the present invention have sequences which cover also such gene fragments coding for amino acid sequences of different subclasses. Therefore, such gene fragments coding for amino acid sequences of different subclasses can also be used as canine gamma chain gene as far as they have substantially the same sequence as that of the gene of the present invention. Such genes coding for C regions of different subclasses can be cloned by using a part of the nucleotide sequence of the present invention as a probe.
As far as the constant region of immunoglobulin is concerned, it is also reported that a genetic analysis of immunoglobulins derived from human, rabbit, etc. showed an existence of an allotype which differs in one to several amino acids within the same class or subclass. Therefore, the gene coding for the constant region of canine immunoglobulin lambda chain, kappa chain or gamma chain of the present invention is not limited to the gene fragments coding for the above-mentioned amino acid sequences but includes those genes coding for the constant region of different allotypes which have almost the same sequence as the above sequences though containing a partial substitution of an amino acid.
The thus prepared gene coding for the constant region of canine immunoglobulin of the present invention allows for preparation of the canine chimeric antibody using the conventional process for preparing the chimeric antibody for example, Watanabe et al., Cancer Research, 47, p999-1005 (1987); Japanese Patent First Publication No. 20255/1988!. That is, the chimeric gene can basically be constructed by linking two kinds of gene fragments, i. e. the V region gene and the C region gene, to each other. Since the gene can be classified into mainly two categories depending on a way of isolation, the chimeric antibody can be constructed by using either a combination of V and C region genes isolated from a chromosomal DNA or a combination of V and C region genes isolated from cDNA. The chimeric antibody can be expressed in any expression system such as an animal cell expression system, an E. coli expression system, yeast expression system, etc. using different expression vectors.
In a combination of the V region and the constant region for preparing the chimeric antibody, a preferable combination is the VH region with the constant region derived from canine H chain such as gamma chain, the V kappa region with the constant region of canine kappa chain, and the V lamba region with the constant region of canine lambda chain, but another combination can also be used. There can be used any V region including those derived from mouse, dog, or other animals, and CDR graft V region M. Verhoeyen, C. Milstein, G. Winter, Science, 239, p1539 (1987)!, as far as it is effective for treating canine diseases (e. g. viral canine diseases, etc.). Thus, although it is described as to the mouse-dog chimeric antibody against canine parvovirus to exemplify the canine chimeric antibody of the present invention, the V region is not limited to that used therein.
The gene fragment coding for canine immunoglobulin provided by the present invention discloses the specific amino acid sequence or DNA sequence in the constant region of canine immunoglobulin, and hence, allows for isolating those genes coding for the constant regions belonging to different sub-classes or allotypes. By using the gene coding for the constant region of canine immunoglobulin of the present invention, the canine chimeric antibody can firstly be prepared. The canine chimeric antibody prepared according to the present invention can be used as agents for diagnosis, prevention and treatment of canine diseases which have hitherto never been developed.
The present invention is illustrated by the following Examples in more detail but should not be construed to be limited thereto.
Example 1
Preparation of Canine Monoclonal Antibody-Producing Cells:
(1) Immunization and Preparation of Canine Lymphocytes:
In order to efficiently obtain activated canine B cells, a complete Freund's adjuvant (CFAa: manufactured by Difco)(5ml) was injected to dogs subcutaneously and intraperitoneally for several times at an interval of 2 to 3 weeks for nonspecific immunization. Two to three weeks after the final immunization, spleen and lymphonode were taken out and a suspension of canine lymphcytes was obtained by crushing with a pincette and pipetting. One dog gave 1 to 3×109 cells from spleen and 1 to 3×108 from lymphonode. These lymphocytes were suspended in a complete medium of RPMI 1640 plus 10% fetal calf serum (manufactured by Flow Laboratories) supplemented with L-glutamine (manufactured by Flow Laboratories) at a concentration of 5 to 10×105 cells/ml and thereto was added poke-weed mitogen (PWM: manufactured by Gibco)(2.5 μg/ml), followed by culturing the cells in the presence of 5% CO2 at 37° C for 2 to 5 days for activation.
(2) Preparation of Mouse Myeloma Cells:
The myeloma cells employed in the present invention are those derived from mouse Balb/c as described in Koller et. al., Nature 256, p459 (1975) and Eur. J. Immunol., 6, p292 (1976), especially substrains X63-Ag8-6.5.3 and P3-X63-Ag8-U1, SP2/OAg12. These cells were cultured and grown in a complete medium of RPMI 1640 plus 10% fetal calf serum supplemented with glutamine. They were collected just before cell fusion, washed twice with RPMI 1640 medium and resuspended in the same medium for use in cell fusion.
(3) Cell Fusion of the Canine Lymphocytes and the Mouse Myeloma Cells:
The above canine lymphocytes and mouse myeloma cells were mixed at a ratio of 10:1 or 5:1 (canine lymphocytes myeloma cells; canine lymphocytes =1×108 cells) and centrifuged at 1,500 rpm for 5 minutes. To the obtained cell pellet was added a 45% polyethylene glycol solution diluted with RPMI 1640 (manufactured by Sigma, pH 7.6, MW 3,650, or manufactured by Celba, pH 7.6, MW 4,000)(1 ml) at room temperature over 1 minute. After the mixture was allowed to stand at 37° C. for 5 to 10 minutes, the cells were resuspended by adding RPMI 1640 (40 ml) to the mixture over 6 minutes to quench the cell fusion. The cells were then centrifuged at 1,000 rpm for 10 minutes, the supernatant was removed by suction, the resulting cell pellet was resuspended in RPMI 1640+10% fetal calf serum+HAT (H: hypoxanthine 13.0 μg/ml, A: aminopterin 0.18 μg/ml, T: thymidine 3.87 μg/ml; all manufactured by Sigma)supplemented with glutamine at a concentration of 2 to 10×105 lymphocytes/ml. The suspension was poured into each well of a 96-well microtiter plate at 200 μl/well and was cultured in the presence of 5% CO2 at 37° C. After 5 to 7 days, 50% of the medium was exchanged with the same fresh medium and thereafter the medium exchange was repeated for 5 to 6 times after 10 to 28 days from the cell fusion. By this procedure, only hybridoma were grown, and there-after the cell culture was continued until the screening assay.
(4) Screening Assay and Cloning of Hybridoma:
Screening assay was conducted to detect a clone which produce a canine IgG antibody using enzyme immunoassay (EIA). A 96-well plate was coated with a goat anti-canine IgG antibody (manufactured by Cappel) and treated with bovine serum albumin (manufactured by Sigma) to block non-specific adsorption, to each well was added the culture supernatant (50 μl) from each well of the hybridoma culture plate. After incubating the plate at 37° C. for 1 to 2 hours, washing was carried out with PBS-T {0.01% Tween manufactured by Katayama Kagaku K. K., 0.01M phosphate buffer, pH 7.2, 0.15M NaCl} four times, a peroxydase-labelled goat anti-canine IgG antibody (manufactured by Cappel, 10,000 fold dilution)(50 μl) was added to each well and plate was incubated at 37° C. for 1 hour. After washing with PBS-T five times, TMBZ substrate solution (TMBZ: manufactured by Dojin Kagaku K. K., 0.4 mg/ml, hydrogen peroxide: manufactured by Mitsubisi Gasu Kagaku K. K., 0.006%)(50 μl) was added to develope color. After 10 to 15 minutes, 0.3N H2 SO4 (manufactured by Katayama Kagaku K. K.)(50 μl) was added to each well to quench the reaction and each color development was quantitated with a spectrophotometer (wavelength: 450nm). The hybridomas in the thus selected canine IgG-producing well were then monoclonalized (cloned) by a limiting dilution procedure. After growth of the clones in each well of the 96-well plate, the above enzyme immunoassay (EIA) was repeated to detect the canine IgG-producing clone. This cloning procedure was repeated at least 3 times to give the dog-mouse hybridoma clone which stably produce canine IgG. This hybridoma clone was successively subject to an extensive culture and was kept in the frozen state with a cell-freezing medium of RPMI 1640+HAT+10% DMSO supplemented with glutamine in liquid nitrogen.
(5) Characterization of the Established Hybridoma Clone and Canine IgG Monoclonal Antibody Produced Therefrom:
Measurement with an EIA procedure of an amount of the produced canine antibody confirmed that the established dog-mouse hybridomas were capable of stably producing the canine IgG monoclonal antibody in an amount of 1.0 to 3.0 μg/ml for a long time of 1 year or more and any abnormality was not observed in their ability of producing the antibody.
The canine monoclonal antibody produced by the established dog-mouse hybridoma was proven to be canine IgG by an immunoprecipitation method {cf. "Meneki Jikken Sosaho (Immunological Experimentation)" ed. Jap. Soc. Immunol.}. This antibody was found to be canine IgG antibody since it did not form precipitates with goat anti-mouse IgG serum and goat anti-human IgG serum but did form precipitate with goat anti-canine IgG serum. EIA further proved that the monoclonal antibody was canine IgG antibody since it specifically reacts with only the anti-canine IgG antibody but react with neither the anti-human IgG antibody nor the anti-mouse IgG antibody (FIG. 1). Furthermore, Western blotting assay proved that both heavy chain (H chain) fragment and light chain (L chain) fragment of the monoclonal antibody specifically react only with the anti-canine IgG antibody but did not react with the anti-human IgG antibody or anti-mouse IgG antibody and that the H chain fragment and L chain fragment of the monoclonal antibody were identical to those fragment of standard canine IgG antibody in view of molecular weight, showing that the monoclonal antibody is a complete canine IgG monoclonal antibody having both H chain and L chain fragment of the canine IgG antibody (FIG. 2).
In addition, cytoplasmic synthesis of canine IgG antibody was studied by fluorescent antibody dying assay of the hybridoma clone. As a result, each clone was intracytoplasmically dyed specifically only with the anti-canine IgG antibody but was not dyed with the anti-human IgG antibody and the anti-mouse IgG antibody, proving that the hybridoma clones intracytoplasmically synthesized a complete canine IgG monoclonal antibody.
The dog mouse heterohybridoma CM-S6 cells producing such canine monoclonal antibody have been deposited under accession number BP-2946 as mentioned hereinbefore. The CM-S6 cells were used in the following Experiment to isolate the constant region of canine immunoglobulin.
Example 2
Cloning of the Gene Coding for the Constant Region of Canine Immunoglobulin Lambda Chain
(1) Construction of a cDNA Library:
Total RNA was separate from the heterohybridoma CM-S6 using a guanidium@tricyanate method {J. M. Ghingwin et al., Biochemistry, 18, p5294 (1979)) and further purified into poly A+RNA using an oligo dT column (Pharmacia). cDNA of the CM-S6 cells was synthesized from the purified poly A+RNA using a cDNA synthesis system Plus (Amersham). EcoRI sites of the synthesized cDNA were methylated with EcoRI methylase (manufactured by Takara Shuzo Co. Ltd., the reagents used hereinafter are manufactured by Takara Shuzo Co. Ltd., or Toyobo Co. Ltd., unless otherwise mentioned) and then EcoRI linker was added to the cDNA with T4DNA ligase. This cDNA was completely digested with the restriction enzyme EcoRI and cDNA having an addition of EcoRI linker was purified with a Bio Gel A50m column (Bio-Rad). The obtained cDNA was ligated to an EcoRI arm of λgt11 vector DNA (Stratagene) with T4DNA ligase and then an in vitro packaging was carried out using kits manufactured by Stratagene to give a cDNA library of the CM-S6 cells.
(2) Screening of the Canine Immunoglobulin Gene with Anti-Canine Antibody:
Using the cDNA library of CM-S6 cells constructed as mentioned above, E. coli Y1090 strain cells infected with the phage λgt11 were poured onto an LB plate {laboratory dish of No.2.square manufactured by Eiken Kizai charged with 1.5% Bacto-agar manufactured by Gifco, 1% Bacto-tryptone manufactured by Gifco 0.5% Bacto-yeast extract manufactured by Gifco, 0.25% NaCl manufactured by Wako Pure Chemical Industries, pH 7.5} so that 50,000 plaques per plate of the λgt11 phage were formed and cultured at 42° C. for 3 hours. After covering a nitrocellulose filter (NC filter: Code BA85 manufactured by S&S) soaked with 10 mM IPTG (manufactured by Wako Pure Chemical Industries) on the plate, the Culture was continued at 37° C. for additional 4 hours. The NC filter was peeled off the plate, washed with a W buffer (WB: 7 mM Tris buffer, pH 7.2, 150 mM NaCl, 0.005% Tween 20} and immersed in BLOTTO {5% skim milk, 10 μl/100ml Antiform A} at 4° C. over night. Then the BLOTTO was exchanged with a BLOTTO containing an anti-canine IgG antibody {manufactured by Cappel; 10 μg/ml; treated with a 1% E. coli lysate (manufactured by Bio-Rad) at 4° C. overnight} and the reaction was conducted at room temperature for 2 hours. After washing the NC filter with WB five times, the NC filter was immersed in an incubation buffer {PBS, pH 7.2, 0.005% Tween 20, 1% BSA} containing a peroxydase-labelled goat IgG antibody {manufactured by Cappel; treated with a 1% E. coli lysate(manufactured by Bio-Rad) at 4° C. overnight and the reaction was conducted at room temperature for 2 hours. After washing the NC filter with WB five times, the NC filter was immersed in a color development solution containing 5 % HRP color development reagent (manufactured by Bio-Rad) and 0.5% H2 O2 (manufactured by Wako Pure Chemical Industries) to proceed color development. After selection of the color development on the NC filter, the phage was further cloned. The clone was selected in this way which react with the anti-canine IgG antibody and finally a clone S6-61 was obtained. This clone had a 0.7 kb size and seemed to be a gene coding for the lambda chain in accordance with the nucleotide sequence analysis as described hereinafter. FIG. 3 shows a restriction enzyme map of this clone.
(3) Southern Blotting and Northern Blotting Analysis Using S6-61:
Southern blotting analysis was carried out using S6-61. A chromosomal DNA (10 μg) from canine, feline and mouse hepatocytes was digested with the restriction enzyme EcoRI and the obtained DNA fragments were subjected to electrophoresis using 0.7% agarose gel. After transfer to nylon membrane filter (Gene Screen Plus, NEN Research Product), the southern hybridization was carried out with a {32 P}-labeled S6-61 probe containing the constant region of canine lambda chain. The southern hybridization was carried out in accordance with a protocol of manual attached to the Gene Screen Plus. The molecular size was calculated based on the marker DNA which was prepared by digesting the λ phage DNA with Hind III. As shown FIG. 4, several bands having various sizes from about 2 to about 20 kb were detected. This suggests that the gene coding for the C region of canine lambda chain has more subclass, which can also be estimated on the analogy of the cases of human and mouse {P. A. Hieter et al., Nature, 294, p536 (1981); G.F. Hollis et al., Nature, 296, p321 (1982); B. Blomberg et al., Proc. Natl. Acad. Sci. USA, 79, p53 (1982); J. Miller et al., Nature, 295, p428 (1982)}. Since it is known that the gene coding for the C lambda region is amplified in wild mice (C. L. Scott et al., Nature, 300, p757 (1982)}, the gene coding for the C region of canine lambda chain can also presumably be subjected to amplification.
Northern blotting was then conducted. The RNA for use in the hybridization was prepared by screening a whole RNA from CM-S1 and CM-S6 cells using a guanidium thiocyanate method {J. M. Ghingwin et al., Biochemistry, 18, p5294 (1979)} and purifying the whole RNA into a poly A+RNA with oligo dT column (Pharmacia). The RNA (2 μg) was electrophoresed using 0.75% agarose gel containing 3% formaldehyde. After transfer to nylon membrane filter (Gene Screen Plus), a northern hybridization was carried out in accordance with a protocol of a manual attached to the Gene Screen Plus. As a result, this probe detected a band at about 1.3 kb in both mRNA (FIG. 5). This size is almost the same as that of the gene coding for immunoglobulin lambda chain known in mouse and human.
From the above two results, the S6-61 gene was presumed to be an active gene coding for a functional canine C lambda region.
(4) Nucleotide Sequence and Amino Acid Sequence of S6-61:
In order to determine a nucleotide sequence of S6-61, small DNA fragments EcoRI-SacI, SacI-AccII, AccII-EcoRI, StuI-EcoRI and EcoRI-Hhal were prepared (FIG. 3). These small fragments were blunt-ended with T4-DNA polymerize and inserted into a SmaI site of a M13mp19 vector using a Takara ligation kit. Competent cells of JM109 were prepared in accordance with a Toyobo Instruct Manual and transformed with M13mp19 DNA wherein the C lambda gene was inserted DNA. A determined using a Takara M13 Sequencing kit and Fuji Genser Gel System. The direction of determination of the nucleotide sequence is shown in FIG. 3. As a result of the determination of the nucleotide sequence, it was confirmed that the canine lambda chain gene consisted of V, J and C region (FIG. 6) (SEQ ID NO:4). FIG. 7 (SEQ ID NO:3) shows the results thereof amino acid sequence suggested that the gene is in an open reading frame and is not a pseudogene.
The homology of the nucleotide sequence of S6-61 was searched on data base, LASL and EMBL, using software for genetic analysis (Genetyx Ver.6 manufactured by Software Kaihatsu, K. K.). As a result, the highest homology was shown with that of human immunoglobulin lambda chain gene but no homology was shown with that the immunoglobulin lambda@chain gene. Homological comparison of the C lambda region of the S6-61 gene with those of mouse and human showed 75.2% homology with mouse and 84.8% homology with human in the nucleic acid level and 73.1% homology with mouse and 84.6% homology with human in the amino acid level.
As is clear from the above results, the S6-61 gene is surely a gene coding for the canine lambda chain which can be used for the preparation of the chimeric antibody.
Example 3
Cloning of the Gene Coding for Constant Region of Canine Kappa Chain:
(1) Conditions of Crosshybridization:
The L chain of canine immunoglobulin is known to mainly consist of lambda chain {L. Hood et al., Cold Spring Harbor Symp. Quant. Biol. 32, p133 (1967)}, and hence, it is foreseeable that only quite a few lymphocytes express kappa chain. In fact, the dog-mouse heterohybridoma as described above were lambda chain producing cells. Therefore, the present inventors have considered that it would be very difficult to obtain the desired gene from mRNAs of polyclonal antibody-producing cells by a cDNA cloning procedure, and hence, have tried to isolate the desired gene fragment for the constant region of canine immunoglobulin kappa chain from a chromosomal DNA of canine hepatocytes under crosshybridization conditions using the constant region of human kappa chain (human C kappa) as a probe.
For cloning of the canine kappa chain gene by a crosshybridization procedure, conditions of crosshybridization with human kappa chain were studied. The gene coding for the human C kappa region used for the crosshybridization was a gene cloned from a human culture cell ARH77 strain {ATCC CRT 1621} which is available from professor Takesi Watanabe, Department of Molecular Immunology, Medical Institute of Bioregulation, Kyushyu University {cf. Kudo et al., Gene, 33, p181, (1985); Nishimura et al., Cancer Res., 47, p999 (1987)}. From this human C kappa gene, an EcoRI-EcoRI fragment containing C kappa exon was obtained and used as a probe.
Chromosomal DNAs were isolated from canine hepatocytes according to N. Blin and D. W. Stafford Nuc. Acids. Res., 3, p2303 (1976)! and each 10 μg of the chromosomal DNA was digested with the restriction enzyme EcoRI. DNA fragments obtained by the restriction enzyme digestion were subjected to electrophoresis using 0.7% agarose gel. The developed DNAs were transferred to a nitrocellulose membrane filter (BA85 manufactured by S&S) and then southern hybridization was carried out with a 32 P!-labeled DNA probe containing human C kappa region gene. The southern hybridization was carried out in a solution of 6×SSC 0.09M Na3 C6 H5 O7 E2H2 O, 0.9M NaCl!, 10 mM EDTA! manufactured by Dojin Kagaku! and 0.5% SDS manufactured by Bio-Rad! at 65° C. overnight. The final washing of the filter was conducted with a solution of 0.1×SSC and 0.1% SDS at 45° C. for 15 minutes. Autoradiography of this filter showed a band at about 5 kb as shown in FIG. 8. The molecular size was calculated from a marker DNA prepared by digesting λ phage DNA with HindIII. This DNA fragment of 5 kb appears to contain the gene coding for canine kappa chain and is used for cloning.
(2) Isolation of the Gene Coding for Canine Kappa Chain:
A chromosomal DNA (100 μg) from canine hepatocytes was completely digested with EcoRI and DNA fragments of 5 kb were prepared by a sucrose density gradient centrifugation sucrose 10 to 40% (wt/vol), 26,000 rpm, 18 hours, 15° C.!. The obtained DNA fragments were then ligated to an EcoRI arm of λgt11 vector DNA (manufactured by Stratagene) with T4 DNA ligase and an in vitro packaging was carried out using a kit available from Stratagene to give a kappa chain gene library of canine hepatocytes. Plaque hybridization W. D. Benton, R. W. Davis, Science, 196, p180 (1977)! was conducted using a human C kappa probe under the same conditions as those of the above crosshybridization and a clone DEk5a containing a canine C kappa chain exon was selected from the library. FIG. 10 shows a restriction enzyme map of this clone.
(3) Southern Blotting and Northern Blotting Analysis Using DEk5a:
A chromosomal DNA (10 μg) from canine hepatocytes was digested with the restriction enzyme EcoRI and the Southern blotting analysis was conducted using the clone DEk5a in the same manner as described in Example 2 (3). A pattern of the detected bands was compared with that from crosshybridization using a human C kappa chain probe previously conducted, and as a result, a band was observed at the same position (about 5 kb). This result presumably showed that the canine C kappa region gene consists of a single gene without any other subtypes. This is also suggested by the cases of human and mouse P. A. Hieter er al., Cell, 22, p197 (1989); E. E. Max et al., Proc. Natl. Acad. Sci. USA, 76, p3450 (1979)!.
Northern blotting analysis was then carried out using the DEk5a clone in the same manner as described in Example 2 (3). As a result, the probe detected a band at about 1.3 kb with mRNA from canine spleen cells (FIG. 9). This is almost the same size as known in the mouse and human immunoglobulin kappa chain gene but the signal of the band is weaker than the case of lambda. This shows that only a few lymphocytes express kappa light chain.
These two results presumably showed that the DEk5a is an active gene containing a gene coding for a functional canine C kappa region.
(4) Nucleic Acid and Amino Acid Sequences of the DEk5a:
In order to determine a nucleic acid sequence of the gene coding for the canine C kappa region, a DNA fragment (PstI--PstI fragment) of about 2.0 kb containing the C kappa region was isolated from the clone DEk5a and recloned into a PstI site of pUC18 vector. This plasmid (pDEK5aPst) was prepared in a large amount in accordance with the conventional method for example, T. Maniatis "Molecular Cloning " Cold Spring Harbor Lab. (1982)! and from the PstI--PstI fragments were prepared small DNA fragments (PstI--PstI, HaeIII-RsaI, RsaI--RsaI, RsaI-HaeIII, HaeIII-PstI). These small DNA fragments were blunt-ended with T4-DNA polymerase and then inserted into a SmaI site of M13mp19 vector using a Takara Ligation Kit. The nucleotide sequence was determined in the same manner as described in Example 2 (4). A direction of determination of the nucleotide sequence is shown in FIG. 10. As a result of the determination of the nucleic acid base sequence, the C kappa gene comprising a single exon was confirmed. FIG. 11 (SEQ ID NO:7) shows the results thereof. An amino acid sequence deduced from the nucleotide sequence showed that the gene is in an open reading frame and is not a pseudogene (FIG. 12) (SEQ ID NO:6).
The homology of the nucleotide sequence of DEK5a was searched on data bases, LASL and EMBL, using a software of genetic analysis (Genetyx manufactured by Software Kaihatsu, K. K.). As a result, a high homology was shown with gene coding for human and mouse immunoglobulins kappa chain but no homology was shown with genes other than the immunoglobulin kappa chain gene. Homological comparison of the C kappa region of the DEk5a gene with the mouse and human C kappa regions showed 70.0% homology with mouse and 70.1% homology with human in the nucleic acid level and 59.0% homology with mouse and 59.6% homology with human in the amino acid level.
As is clear from the above results, the DEk5a gene is surely a gene coding for the canine kappa chain which can be used for the preparation of the dog-mouse chimeric antibody.
Example 4
Cloning of the Gene Coding for Constant Region of Canine Gamma Chain:
(1) Conditions of Crosshybridization:
The present inventors then tried to isolate the canine gamma chain gene by cloning using a crosshybridization procedure as in the case of kappa chain gene.
In the same manner as in Example 3 (1), crosshybridization was carried out using a chromosomal DNA (10 μg) from canine hepatocytes digested with the restriction enzyme BamHI, EcoRI and HindIII and a human C gamma 1 chain as a probe. The gene coding for the human C gamma 1 region used for the crosshybridization was a gene cloned from a human culture cell ARH77 strain ATCC CRL 1621! which is available from professor Takeshi Watanabe, Kyushu University, Seitai Bogyo Igaku Kenkyuusho Kudo et al., Gene, 33, p181 (1985); Nishimura et al.,Cancer Res., 47, p999 (1987)!. Computerized analysis of homology between mouse, human and rabbit gamma chains showed a extremely high homology especially at the region containing a CH2-CH3 exon. Therefore, a PstI-SphI fragment containing the CH2-CH3 exon was obtained from the human C gamma 1 gene and used as a probe. The result of autoradiography showed four bands at about 2.0, 1.9, 1.3 and 1.05 kb as shown in FIG. 13 (BamHI digested). These bands were targeted for cloning.
(2) Isolation of the Canine Gamma Chain Gene:
A chromosomal DNA (100 μg) from canine hepatocytes was partially digested with MboI and then DNA fragments corresponding to the above 20 kb and 25 kb were prepared by a sucrose density gradient centrifugation sucrose 10 to 40% (wt/vol), 26,000 rpm, 18 hours, 15° C.!. Then, the obtained DNA fragments were ligated to a BamHI-digested DNA of λEMBL3 vector DNA (manufactured by Nippon Gene) with T4 DNA ligase and an in vitro packaging was carried out using a kit available from Stratagene. P2392 E. coli (Stratagene) was then infected with the resultant recombinant DNA and a gamma chain gene library of canine hepatocytes was obtained. Plaque hybridization W. D. Benton, R. W. Davis, Science, 196, p180 (1977)! was conducted under the same conditions as those of the above described crosshybridization. Six different clones were obteined after screening 2.0×106 recombinant phages. Southern blot analysis and restriction cleavage mapping have revealed that these clones are classified into two different canine gamma genes. The restriction maps of two canine gamma gene clones, DE94gamma and a DB31gamma, are shown in FIG. 14. BamHI fragment (2.0 kbp) of DE94gamma and BamHI fragment (1.3kbp) of DB31gamma contain the canine C gamma chain exon. These BamHI fragments were used in the following Examples.
(3) Southern and Northern Blotting Analysis Using DE94Gamma and DB31Gamma:
A chromosomal DNA (10 μg) from canine hepatocytes was digested with the restriction enzyme BamHI and Southern blotting analysis was conducted using the DE94gamma and DB31gamma clones in the same manner as described in Example 2 (3). Comparison of a pattern of detected bands with that of crosshybridization previously conducted using the human C gamma 1 chain probe showed a band at the same position (the same results as in FIG. 13). This result showed an existence of several C gamma region genes of different subclasses belonging to the same canine gamma chain in addition to the DE94gamma and DB31gamma.
The existence of several subclasses in the canine gamma chain is also suggested on the analogy of the cases of human and mouse for example, A. Shimizu et al., Cell, 29, p121 (1982); N. Takahashi et al., Cell, 29, p671 (1982)!. It is known that serologically at least four subclasses exist for the canine gamma chain J. S. Johnson, J. Immunol., 98, p923 (1966)! and the DE94gamma and DB31gamma genes seem to code for two sub-classes of the four canine IgG.
Then, Northern blotting analysis was carried out using the DE94gamma(a) and DB31gamma(b) clones in the same manner described in Example 2 (3). As a result, the probes specifically detected a band at about 1.8 kb with mRNAs from dog (FIG. 15). This is almost the same size as known in mouse and human immunoglobulin gamma chain genes.
These two results presumably showed that the DE94gamma and DB31gamma clones are active genes containing a gene coding for a functional canine C gamma region.
(4) Nucleic Acid and Amino Acid Sequences of the DE94Gamma and DB31Gamma:
The nucleotide sequence was determined in the same manner as described in Example 2 (4). A direction of determination of the nucleotide sequence is shown in FIG. 14. As a result of the determination of the nucleic acid sequence, these C gamma genes share striking homology with each other. FIG. 16 and 17 (SEQ ID NOS:14-15) shows the results thereof. An amino acid sequence deduced from the nucleotide sequence showed that the gene is in an open reading frame and is not a pseudogene (FIG. 18) (SEQ ID NOS:16-17).
The homology of the nucleotide sequence of DE94gamma and DB31gamma were searched on data bases, LASL and EMBL, using software for genetic analysis (Genetyx manufactured by Software Kaihatsu, K. K.). As a result, a high homology was shown with gene coding for human and mouse immunoglobulins gamma chain but no homology was shown with genes other than the immunoglobulin gamma chain gene. Homological comparison of the C gamma region of the DE94gamma gene with the mouse and human C gamma 1 regions showed 61.0% homology with mouse, 70.4% homology with human and 80.7% homology with DB31gamma in the amino acid level. On the other hand, DB31gamma gene showed 64.7% homology with mouse and 67.6% homology with human in the amino acid level.
As is clear from the above results, the DE94gamma and DB31gamma genes are surely a gene coding for the canine gamma chain which can be used for the preparation of the dog-mouse chimeric antibody.
Example 5
Preparation of Mouse-Dog Chimeric Antibody:
(1)Isolation of Gene Coding for Mouse Immunoglobulin Kappa Chain Variable (V Kappa) region:
In order to show the usefulness of the thus isolated gene coding for the constant region of canine immunoglobulin in the preparation of the chimeric antibody, a chimeric antibody comprising said gene and a gene coding for the variable region of mouse antibody JP-2 having a neutralization activity against canine parvovirus (CPV) was prepared.
The gene coding for the V kappa region of JP-2 antibody was firstly isolated. A chromosomal DNA (100 μg) isolated from hybridoma JP-2 (gamma 1,kappa) producing an anti-CPV antibody was digested with the restricted enzyme HindIII. These DNA fragments were then ligated to λL47 vector DNA (Amersham) with T4 DNA ligase and a chromosomal DNA library of JP-2 cells was obtained. A clone JP-2gL411 containing the V kappa region gene of the anti-CPV antibody was selected from the library by plaque hybridization procedure W. D. Benton, R. W. Davis, Science, 196, p180 (1977)! using a mouse J kappa region E. E. Max et al., J. Biol. Chem., 256, p5116 (1981)!. FIG. 19 shows a restriction enzyme map thereof. From this gene fragment there was prepared a BamHI-HindIII fragment containing a V kappa exon part and the fragment was subjected to Northern hybridization with mRNA of JP-2 and its mother strain P3X63Ag8.U1 to detect a Jp-2 specific band at 1.3 kbp. A nucleotide sequence was determined (FIG. 20) (SEQ ID NO:8) by a DNA sequencing which was made at a direction of an arrow as shown in FIG. 19. An amino acid sequence deduced from the nucleotide sequence was in an open reading frame (FIG. 20) (SEQ ID NO:8), and hence, the gene was shown to code for a functional immunoglobulin V kappa. Based on these results, this V kappa gene was used for preparing a gene coding for an L chain of mouse-dog chimeric antibody.
(3) Preparation of Gene Coding for L Chain of Mouse-Dog Chimeric Antibody (pSV2-EPLDCk):
The plasmid pDEk5aPst prepared in Example 3 (2) was digested with HindIII and EcoRI to prepare a HindIII DNA fragment of 2 kbp containing a gene coding for canine immunoglobulin C kappa. On the other hand, a plasmid pJP2gL411 containing the gene coding for mouse immunoglobulin V kappa chain prepared in Example 5 (1) was digested with BamHI and HindIII to prepare a gene of 4.4 kbp coding for a mouse immunoglobulin V kappa -J kappa region. These genes were ligated to each other together with pSV2-neo vector P. J. Southern et al., J. mol. Appl. Genet., 1, p327 (1982)! which was digested with EcoRI and BamHI using a Takara Ligation Kit to prepare a plasmid pSV2-PLDCk. The human heavy chain enhancer element was inserted into the HpaI site of this plasmid to prepare a plasmid pSV2-EPLDCk (FIG. 21).
(5) Expression of Mouse-Dog Chimeric Antibody:
The constructed plasmid pSV2-EPLDCk was introduced into a mouse B lymphoma strain Sp2/0-Ag12 (ATCC CRT 1581) in accordance with a method previously reported by Maeda et al. Japanese Patent First Publication No. 20255/1988! using a DEAE-dextran method. The cells were transformed with the plasmid pSV2-EPLDCk to prepare cells which produce the desired L chain of the mouse-dog chimeric antibody.
As mentioned above, only use of the gene coding for the constant region of canine immunoglobulin as cloned by the present inventors makes it possible to prepare the canine chimeric antibody. The thus prepared canine chimeric antibody can be used as agents for diagnosis, prevention and treatment of canine disease, especially canine infectious disease.
__________________________________________________________________________
SEQUENCE LISTING                                                          
(1) GENERAL INFORMATION:                                                  
(iii) NUMBER OF SEQUENCES: 17                                             
(2) INFORMATION FOR SEQ ID NO:1:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 9 amino acids                                                 
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:                                   
GlyAlaXaaXaaXaaXaaXaaXaaCys                                               
15                                                                        
(2) INFORMATION FOR SEQ ID NO:2:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 9 amino acids                                                 
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:                                   
GlyAlaAsnLysAlaThrLeuValCys                                               
15                                                                        
(2) INFORMATION FOR SEQ ID NO:3:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 105 amino acids                                               
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:                                   
GlnProLysAlaSerProSerValThrLeuPheProProSerSerGlu                          
151015                                                                    
GluLeuGlyAlaAsnLysAlaThrLeuValCysLeuIleSerAspPhe                          
202530                                                                    
TyrProSerGlyValThrValAlaTrpLysAlaSerGlySerProVal                          
354045                                                                    
ThrGlnGlyValGluThrThrLysProSerLysGlnSerAsnAsnLys                          
505560                                                                    
TyrAlaAlaSerSerTyrLeuSerLeuThrProAspLysTrpLysSer                          
65707580                                                                  
HisSerSerPheSerCysLeuValThrHisGluGlySerThrValGlu                          
859095                                                                    
LysLysValAlaProAlaGluCysSer                                               
100105                                                                    
(2) INFORMATION FOR SEQ ID NO:4:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 318 base pairs                                                
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:                                   
CAGCCCAAGGCCTCCCCCTCGGTCACACTCTTCCCGCCCTCCTCTGAGGAGCTCGGCGCC60            
AACAAGGCCACCCTGGTGTGCCTCATCAGCGACTTCTACCCCAGCGGCGTGACGGTGGCC120           
TGGAAGGCAAGCGGCAGCCCCGTCACCCAGGGCGTGGAGACCACCAAGCCCTCCAAGCAG180           
AGCAACAACAAGTACGCGGCCAGCAGCTACCTGAGCCTGACGCCTGACAAGTGGAAATCT240           
CACAGCAGCTTCAGCTGCCTGGTCACGCACGAGGGGAGCACCGTGGAGAAGAAGGTGGCC300           
CCCGCAGAGTGCTCTTAG318                                                     
(2) INFORMATION FOR SEQ ID NO:5:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 5 amino acids                                                 
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:                                   
CysGlnArgValAsp                                                           
15                                                                        
(2) INFORMATION FOR SEQ ID NO:6:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 109 amino acids                                               
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:                                   
AsnAspAlaGlnProAlaValTyrLeuPheGlnProSerProAspGln                          
151015                                                                    
LeuHisThrGlySerAlaSerValValCysLeuLeuAsnSerPheTyr                          
202530                                                                    
ProLysAspIleAsnValLysTrpLysValAspGlyValIleGlnAsp                          
354045                                                                    
ThrGlyIleGlnGluSerValThrGluGlnAspLysAspSerThrTyr                          
505560                                                                    
SerLeuSerSerThrLeuThrMetSerSerThrGluTyrLeuSerHis                          
65707580                                                                  
GluLeuTyrSerCysGluIleThrHisLysSerLeuProSerThrLeu                          
859095                                                                    
IleLysSerPheGlnArgSerGluCysGlnArgValAsp                                   
100105                                                                    
(2) INFORMATION FOR SEQ ID NO:7:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 330 base pairs                                                
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:                                   
AATGATGCCCAGCCAGCCGTCTATTTGTTCCAACCATCTCCAGACCAGTTACACACAGGA60            
AGTGCCTCTGTTGTGTGTTTGCTGAATAGCTTCTACCCCAAAGACATCAATGTCAAGTGG120           
AAAGTGGATGGTGTCATCCAAGACACAGGCATCCAGGAAAGTGTCACAGAGCAGGACAAG180           
GACAGTACCTACAGCCTCAGCAGCACCCTGACGATGTCCAGTACTGAGTACCTAAGTCAT240           
GAGTTGTACTCCTGTGAGATCACTCACAAGAGCCTGCCCTCCACCCTCATCAAGAGCTTC300           
CAAAGGAGCGAGTGTCAGAGAGTGGACTAA330                                         
(2) INFORMATION FOR SEQ ID NO:8:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 127 amino acids                                               
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:                                   
MetArgValLeuAlaGluLeuLeuGlyLeuLeuLeuPheCysPheLeu                          
151015                                                                    
GlyValArgCysAspIleGlnMetAsnGlnSerProSerSerLeuSer                          
202530                                                                    
AlaSerLeuGlyAspThrIleThrIleThrCysHisAlaSerGlnAsn                          
354045                                                                    
IleAsnValTrpLeuSerTrpTyrGlnGlnLysProGlyAsnIlePro                          
505560                                                                    
LysLeuLeuIleTyrLysAlaSerLysLeuHisThrGlyValProSer                          
65707580                                                                  
ArgPheSerGlySerGlySerGlyThrGlyPheThrLeuThrIleSer                          
859095                                                                    
SerLeuGlnProGluAspIleAlaThrTyrTyrCysGlnHisGlyGln                          
100105110                                                                 
SerTyrProTyrSerPheGlyGlyGlyThrLysLeuGluIleLys                             
115120125                                                                 
(2) INFORMATION FOR SEQ ID NO:9:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 618 base pairs                                                
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:                                   
GGTGGCTCTAGTCATGCATTCCCCTGCTGATTTGCATGTTACCAGAGCACAGCCCACATC60            
TAAGATTTCTTCAGCTGGTGTTTAGGACAATGGCAGAAAGTCACTCTCAGTGAGGATACA120           
CCATCAGCATGAGGGTCCTTGCTGAGCTCCTGGGGCTGCTGCTGTTCTGC170                     
MetArgValLeuAlaGluLeuLeuGlyLeuLeuLeuPheCys                                
1510                                                                      
TTTTTAGGCAGTGAACAGAGTGAAACGTATGTAATGCTGTCTGATTTGTGATGTATC227              
PheLeu                                                                    
15                                                                        
TACAATTGTTCACATGGTATTGTGTATGTTTCCCACCTCAGGTGTGAGATGTGAC282                
GlyValArgCysAsp                                                           
20                                                                        
ATCCAGATGAACCAGTCTCCATCCAGTCTGTCTGCATCCCTTGGAGAC330                       
IleGlnMetAsnGlnSerProSerSerLeuSerAlaSerLeuGlyAsp                          
253035                                                                    
ACAATTACCATCACTTGCCATGCCAGTCAGAACATTAATGTTTGGTTA378                       
ThrIleThrIleThrCysHisAlaSerGlnAsnIleAsnValTrpLeu                          
404550                                                                    
AGCTGGTACCAGCAGAAACCAGGAAATATTCCTAAACTATTGATCTAT426                       
SerTrpTyrGlnGlnLysProGlyAsnIleProLysLeuLeuIleTyr                          
556065                                                                    
AAGGCTTCCAAATTGCACACAGGCGTCCCATCAAGGTTTAGTGGCAGT474                       
LysAlaSerLysLeuHisThrGlyValProSerArgPheSerGlySer                          
70758085                                                                  
GGATCTGGAACAGGTTTCACATTAACCATCAGCAGCCTGCAGCCTGAA522                       
GlySerGlyThrGlyPheThrLeuThrIleSerSerLeuGlnProGlu                          
9095100                                                                   
GACATTGCCACTTACTACTGTCAACACGGTCAAAGTTATCCGTACAGC570                       
AspIleAlaThrTyrTyrCysGlnHisGlyGlnSerTyrProTyrSer                          
105110115                                                                 
TTCGGAGGGGGGACCAAGCTGGAAATAAAACGTAAGTAGTCTTCTCAA618                       
PheGlyGlyGlyThrLysLeuGluIleLys                                            
120125                                                                    
(2) INFORMATION FOR SEQ ID NO:10:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 5 amino acids                                                 
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:                                  
AlaCysXaaXaaSer                                                           
15                                                                        
(2) INFORMATION FOR SEQ ID NO:11:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 9 amino acids                                                 
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:                                  
CysXaaIleXaaAspXaaPheXaaPro                                               
15                                                                        
(2) INFORMATION FOR SEQ ID NO:12:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 5 amino acids                                                 
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:                                  
AlaCysLeuValSer                                                           
15                                                                        
(2) INFORMATION FOR SEQ ID NO:13:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 9 amino acids                                                 
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:                                  
CysLeuIleLysAspPhePheProPro                                               
15                                                                        
(2) INFORMATION FOR SEQ ID NO:14:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 1591 base pairs                                               
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:                                  
TCTTGCAGCCTCCACCACGGCCCCCTCGGTTTTCCCACTGGACCCCAGCTGCGGGTCCAC60            
TTCCGGCTCCACGGTGGCCCTGGCCTGCCTGGTGTCAGGCTACTTCCCCGAGCCTGTAAC120           
TGTGTCCTGGAATTCCGGCTCCTTGACCAGCGGTGTGCACACCTTCCCGTCCGACCTGCA180           
GTCCTCAGGGCTCTACTCCCTCAGCAGCATGGTGACAGTGCCCTCCAGCAGGTGGTCCAG240           
CGAGACCTTCACCTGCAACGTGGCCCACCCGGCCAGCAAAACTAAAGTAGACAAGCCAGG300           
TGAGACGTCGGACTCAGAGAGGGGTCCACTCGGGACAAGCCAGATCAGCTGTCCCTCCCA360           
GACCCACGTCACCGGGGAGTCACCTCAGTGTCCCCGTCCTCAAGGCCTCCCCTTTCTGGG420           
AAGGTGTCCTCTGGGCGTGGCTGCCTGGTCCAGATGACCACAGGCTGCATTCCCCACTGT480           
ATTCCCAGGACCCATTGGTGCCACTGCTCGAGGGTCCCTAAGTCACCCAAGACCTGTGCC540           
ACACCAGGGGGAGTAACCCCCAGTCTGCTCTCTCTGCATTGCCCAAAAGAGAAAATGGAA600           
GAGTTCCTCGCCCACCTGATTGTCCCAAATGCCCAGGTGAGTCAGCAGGGCCCTGCTCTG660           
CATCCCAAGCCGATGGTGCACACCCAGGCACAGCCTGATGGGCTAATGGGTGTTGGAGAA720           
GTCCACCGAAGTGCTACCTCATCCTTGTGTCTTCCATTTTAGCCCCTGAAATGCTGGGAG780           
GGCCTTCGGTCTTCATCTTTCCCCCGAAACCCAAGGACACCCTCTTGATTGCCCGAACAC840           
CTGAGGTCACATGTGTGGTGGTGGATCTGGGACCAGAAGACCCTGAGGTGCAGATCAGCT900           
GGTTCGTGGACGGTAAGCAGATGCAAACAGCCAAGACTCAGCCTCGTGAGGAGCAGTTCA960           
ATGGCACCTACCGTGTGGTCAGTGTCCTCCCCATTGGGCACCAGGACTGGCTCAAGGGGA1020          
AGCAGTTCACGTGCAAAGTCAACAACAAAGCCCTCCCATCCCCGATCGAGAGGACCATCT1080          
CCAAGGCCAGAGGTAGGCAGCAGGGCATAGGGGATGCAGGGAGGGAGAGTTGCCTGTAAA1140          
TTGATACCAGTCCTCCACCCTGATAGTGACCATCTGTGCTGATCCTTTACCCCATAGGGC1200          
AGGCCCATCAGCCCAGTGTGTATGTCCTGCCGCCATCCCGGGAGGAGTTGAGCAAGAACA1260          
CAGTCAGCTTGACATGCCTGATCAAAGACTTCTTCCCACCTGACATTGATGTGGAGTGGC1320          
AGAGCAATGGACAGCAGGAGCCTGAGAGCAAGTACCGCACGACCCCGCCCCAGCTGGACG1380          
AGGACGGGTCCTACTTCCTGTACAGCAAGCTCTCTGTGGACAAGAGCCGCTGGCAGCGGG1440          
GAGACACCTTCATATGTGCGGTGATGCATGAAGCTCTACACAACCACTACACACAGAAAT1500          
CCCTCTCCCATTCTCCGGGTAAATGAGCAACACGCCCGGCACCCAGCAAGCCCCCCACCC1560          
TTGGCTCTCAGGATCCCCGGGTACCGAGCTC1591                                       
(2) INFORMATION FOR SEQ ID NO:15:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 1610 base pairs                                               
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:                                  
CTGAGCCTGGGGGTCTCACAGCCTCCTCTCTTGCAGCCTCCTCCACGGCCCCCTCAGTTT60            
TCCCACTGGCCCCCAGCTGCGGGTCCACTTCCGGCTCCACGGTGACCCTGGCCTGCCTGG120           
TGTCAGGCTACTTCCCCGAGCCTGTAACTGTGTCCTGGAATTCCGGCTCCTTGACCAGCG180           
GTGTGCACACCTTCCCGTCCGTCCTGAAGTCCTCAGGGCTCTACTCCCTCAGCAGCATGG240           
TGACAGTGCCCTCCAGCAGGTTGCCCAGCGAGACCTTCACCTGCAACGTGGTCCACCCGG300           
CCACCAACACTAAAGTAGACAAGCCAGGTGAGACGTCAGACTCAGAGAGGGGTCAGCTCA360           
GGACAGGCCAAATCAGCTGTCTCTCCGGACCCATGGCACCGGGGAATCACCTCAGTGTCC420           
CCGTCCTCAAGGCCTCCCCTTTCTGGGAAGGTGTCCTCTGGGCGTGGCTGCCTGGTCCAG480           
ATGACCACAAGCTGCATTCCCCACTGCATTCCTGGGTCCATTGGGTGCCACTGGTCGGGG540           
ATCCCCTCATGAGCTGGCCTGACCTAAGTTCACCCCATGACCTGTGCCCACCCCAGGCCC600           
CCAATAACCCCTAGTCTGCTCTCTCTGCAGTGCCCAAAGAGTCCACCTGCAAGTGTATAT660           
CCCCATGCCCAGGTGAGTCAGCAGGGCCCTGCTCTGCACCCCAAGCAGATGTTGCACATC720           
CAGGCACAGACTAATGGGGGAATGGGTGATGAAAAGGAAGTCACCCAAATGCTGACCCTA780           
AATGTCTCCCATTCCAGTCCCTGAATCACTGGGAGGGCCTTCGGTCTTCATCTTTCCCCC840           
GTTTCCCAAGGACATCCTCAGGATTACCCGAACACCCGAGGTCACCTGTGTGGTGTTAGA900           
TCTGGGCCGTGAGGACCCTGAGGTGCAGATCAGCTGGTTCGTGGATGGTAAGGAGGTGCA960           
CACAGCCAAGACGCAGCCTCGTGAGCAGCAGTTCAACAGCACCTACCGTGTGGTCAGCGT1020          
CCTCCCCATTGAGCACCAGGACTGGCTCACCGGGAAGGAGTTCAAGTGCAGAGTCAACCA1080          
CATAGGCCTCCCGTCCCCCATCGAGAGGACCATCTCCAAAGCCAGAGGTGGGCAGCAGGG1140          
CAGAGGGGCTGCAGGGAAGGAGATCTCCCCTGTAGGTCCAGTCCTCCACCCTGATAGTGA1200          
CCATCTGTGCTGACCCTTTACCCCACAGGGCAAGCCCATCAGCCCGGTGTGTATGTCCTG1260          
CCACCATCCCCAAAGGAGTTGTCATCCAGTGACACGGTCACCCTGACCTGCCTGATCAAA1320          
GACTTCTTCCCACCTGAGATTGATGTGGAGTGGCAGAGCAATGGACAGCCAGAGCCTGAG1380          
AGCAAGTACCACACGACTGCACCCCAGCTGGACGAGGACGGGTCCTACTTCCTGTACAGC1440          
AAGCTCTCTGTGGACAAGAGCCGCTGGGAGCAGGGAGACCCCTTCACATGTGCGGTGATG1500          
CATGAAGCTCTACAGAACCACTACACAGATCTATCCCTCTCCCATTCTCCGGGTAAATGA1560          
GCAACACGCCCGGCACCCAGCAAGCCCCCCACCCTTGGCTCTCAGGATCC1610                    
(2) INFORMATION FOR SEQ ID NO:16:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 334 amino acids                                               
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:                                  
SerThrThrAlaProSerValPheProLeuAspProSerCysGlySer                          
151015                                                                    
ThrSerGlySerThrValAlaLeuAlaCysLeuValSerGlyTyrPhe                          
202530                                                                    
ProGluProValThrValSerTrpAsnSerGlySerLeuThrSerGly                          
354045                                                                    
ValHisThrPheProSerAspLeuGlnSerSerGlyLeuTyrSerLeu                          
505560                                                                    
SerSerMetValThrValProSerSerArgTrpSerSerGluThrPhe                          
65707580                                                                  
ThrCysAsnValAlaHisProAlaSerLysThrLysValAspLysPro                          
859095                                                                    
ValProLysArgGluAsnGlyArgValProArgProProAspCysPro                          
100105110                                                                 
LysCysProAlaProGluMetLeuGlyGlyProSerValPheIlePhe                          
115120125                                                                 
ProProLysProLysAspThrLeuLeuIleAlaArgThrProGluVal                          
130135140                                                                 
ThrCysValValValAspLeuGlyProGluAspProGluValGlnIle                          
145150155160                                                              
SerTrpPheValAspGlyLysGlnMetGlnThrAlaLysThrGlnPro                          
165170175                                                                 
ArgGluGluGlnPheAsnGlyThrTyrArgValValSerValLeuPro                          
180185190                                                                 
IleGlyHisGlnAspTrpLeuLysGlyLysGlnPheThrCysLysVal                          
195200205                                                                 
AsnAsnLysAlaLeuProSerProIleGluArgThrIleSerLysAla                          
210215220                                                                 
ArgGlyGlnAlaHisGlnProSerValTyrValLeuProProSerArg                          
225230235240                                                              
GluGluLeuSerLysAsnThrValSerLeuThrCysLeuIleLysAsp                          
245250255                                                                 
PhePheProProAspIleAspValGluTrpGlnSerAsnGlyGlnGln                          
260265270                                                                 
GluProGluSerLysTyrArgThrThrProProGlnLeuAspGluAsp                          
275280285                                                                 
GlySerTyrPheLeuTyrSerLysLeuSerValAspLysSerArgTrp                          
290295300                                                                 
GlnArgGlyAspThrPheIleCysAlaValMetHisGluAlaLeuHis                          
305310315320                                                              
AsnHisTyrThrGlnLysSerLeuSerHisSerProGlyLys                                
325330                                                                    
(2) INFORMATION FOR SEQ ID NO:17:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 331 amino acids                                               
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:                                  
SerSerThrAlaProSerValPheProLeuAlaProSerCysGlySer                          
151015                                                                    
ThrSerGlySerThrValThrLeuAlaCysLeuValSerGlyTyrPhe                          
202530                                                                    
ProGluProValThrValSerTrpAsnSerGlySerLeuThrSerGly                          
354045                                                                    
ValHisThrPheProSerValLeuLysSerSerGlyLeuTyrSerLeu                          
505560                                                                    
SerSerMetValThrValProSerSerArgLeuProSerGluThrPhe                          
65707580                                                                  
ThrCysAsnValValHisProAlaThrAsnThrLysValAspLysPro                          
859095                                                                    
GlyValProLysGluSerThrCysLysCysIleSerProCysProVal                          
100105110                                                                 
ProGluSerLeuGlyGlyProSerValPheIlePheProProPhePro                          
115120125                                                                 
LysAspIleLeuArgIleThrArgThrProGluValThrCysValVal                          
130135140                                                                 
LeuAspLeuGlyArgGluAspProGluValGlnIleSerTrpPheVal                          
145150155160                                                              
AspGlyLysGluValHisThrAlaLysThrGlnProArgGluGlnGln                          
165170175                                                                 
PheAsnSerThrTyrArgValValSerValLeuProIleGluHisGln                          
180185190                                                                 
AspTrpLeuThrGlyLysGluPheLysCysArgValAsnHisIleGly                          
195200205                                                                 
LeuProSerProIleGluArgThrIleSerLysAlaArgGlyGlnAla                          
210215220                                                                 
HisGlnProGlyValTyrValLeuProProSerProLysGluLeuSer                          
225230235240                                                              
SerSerAspThrValThrLeuThrCysLeuIleLysAspPhePhePro                          
245250255                                                                 
ProGluIleAspValGluTrpGlnSerAsnGlyGlnProGluProGlu                          
260265270                                                                 
SerLysTyrHisThrThrAlaProGlnLeuAspGluAspGlySerTyr                          
275280285                                                                 
PheLeuTyrSerLysLeuSerValAspLysSerArgTrpGluGlnGly                          
290295300                                                                 
AspProPheThrCysAlaValMetHisGluAlaLeuGlnAsnHisTyr                          
305310315320                                                              
ThrAspLeuSerLeuSerHisSerProGlyLys                                         
325330                                                                    
__________________________________________________________________________

Claims (12)

What is claim is:
1. A gene fragment which comprises a DNA sequence coding for an amino acid sequence of a constant region of a canine immunoglobulin lambda chain, wherein the amino acid sequence is selected from the group consisting of an amino acid sequence such that the 8th and 7th amino acid residues at the N-terminal region of the first cysteine counted from the N-terminus of a polypeptide of the constant region of said lamda chain are glycine and alanine, respectively, an amino acid sequence such that the 11th, 10th and 9th amino acid residues at the N-terminal region of the second cysteine counted from the C-terminus of the polypeptide of the constant region of said lambda chain are proline, aspartic acid and lysine, respectively, or both.
2. The gene fragment according to claim 1 wherein the amino acid sequence at the N-terminal region of the first cysteine counted from the N-terminus of polypeptide of the constant region of said lambda chain as follows:
-Gly-Ala-Asn-Lys-Ala-Thr-Leu-Val-Cys-(SEQ ID NO:2).
3. The gene fragment according to claim 1 wherein the constant region comprises a polypeptide having the amino acid sequence of SEQ ID NO: 3.
4. The gene fragment according to claim 3 which contains the DNA sequence of SEO ID NO: 4.
5. A gene fragment which comprises a DNA sequence coding for an amino acid sequence of a constant region of a canine immunoglobulin kappa chain wherein the constant region comprises a polypeptide having 109 amino acids and the amino acid sequence of five amino acids at the C-terminus is SEQ ID NO:5.
6. The gene fragment according to claim 5 wherein the polypeptide of constant region has the amino acid sequence of SEO ID NO: 6.
7. The gene fragment according to claim 6 which comprises the DNA sequence of SEO ID NO: 7.
8. A recombinant DNA molecule coding for an amino acid sequence of an L chain of a mouse-dog chimeric antibody which comprises a gene fragment coding for an amino acid sequence of a variable region of a mouse immunoglobulin L chain and a gene fragment coding for an amino acid sequence of a constant region of canine immunoglobulin L chain wherein the latter gene fragment is linked to 3' site of the former gene fragment, wherein the gene fragment coding for the amino acid sequence of the constant region of canine immunoglobulin L chain is a gene fragment coding for the amino acid sequence of the constant region of a canine immunoglobulin kappa chain which comprises a polypeptide having 109 amino acid and the amino acid sequence of five amino acids at the C-terminus is SEO ID NO:5.
9. The recombinant DNA molecule according to claim 8 wherein the constant region of canine immunoglobulin kappa chain has the amino acid sequence of SEQ ID NO: 6.
10. The recombinant DNA molecule according to claim 9 wherein the gene fragment coding for the amino acid sequence of the constant region of canine immunoglobulin kappa chain has the DNA sequence of SEQ ID NO: 7.
11. The recombinant DNA molecule according to claim 8 wherein the gene fragment coding for the amino acid sequence of the variable region codes for an amino acid sequence which is specifically reactive with canine parvovirus.
12. The recombinant DNA molecule according to claim 11 wherein the gene fragment coding for the amino acid sequence of the variable region codes has the DNA sequence of SEQ ID NO: 8.
US08/646,981 1989-08-25 1996-05-08 Dog-mouse heterohybridoma and gene fragment coding for constant region of canine immunoglobulins Expired - Fee Related US5852183A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US08/646,981 US5852183A (en) 1989-08-25 1996-05-08 Dog-mouse heterohybridoma and gene fragment coding for constant region of canine immunoglobulins

Applications Claiming Priority (10)

Application Number Priority Date Filing Date Title
JP1-219889 1989-08-25
JP1219889A JP2811089B2 (en) 1989-08-25 1989-08-25 Gene fragments encoding the constant regions of canine x mouse heterohybridomas and canine immunoglobulin lambda chains
JP1-255425 1989-09-30
JP25542589A JP2811096B2 (en) 1989-09-30 1989-09-30 Gene fragment encoding constant region of canine immunoglobulin kappa chain and mouse x dog chimeric antibody
JP2150673A JP2837240B2 (en) 1990-06-07 1990-06-07 Gene fragment encoding constant region of canine immunoglobulin gamma chain and mouse x dog chimeric antibody
JP2-150673 1990-06-07
US57121590A 1990-08-23 1990-08-23
US4690393A 1993-04-15 1993-04-15
US08/306,520 US5593861A (en) 1989-08-25 1994-09-15 Dog-mouse heterohybridoma and gene fragment coding for constant region of canine immunoglobulins
US08/646,981 US5852183A (en) 1989-08-25 1996-05-08 Dog-mouse heterohybridoma and gene fragment coding for constant region of canine immunoglobulins

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US08/306,520 Division US5593861A (en) 1989-08-25 1994-09-15 Dog-mouse heterohybridoma and gene fragment coding for constant region of canine immunoglobulins

Publications (1)

Publication Number Publication Date
US5852183A true US5852183A (en) 1998-12-22

Family

ID=27319982

Family Applications (2)

Application Number Title Priority Date Filing Date
US08/306,520 Expired - Fee Related US5593861A (en) 1989-08-25 1994-09-15 Dog-mouse heterohybridoma and gene fragment coding for constant region of canine immunoglobulins
US08/646,981 Expired - Fee Related US5852183A (en) 1989-08-25 1996-05-08 Dog-mouse heterohybridoma and gene fragment coding for constant region of canine immunoglobulins

Family Applications Before (1)

Application Number Title Priority Date Filing Date
US08/306,520 Expired - Fee Related US5593861A (en) 1989-08-25 1994-09-15 Dog-mouse heterohybridoma and gene fragment coding for constant region of canine immunoglobulins

Country Status (8)

Country Link
US (2) US5593861A (en)
EP (1) EP0419858B1 (en)
AT (1) ATE122716T1 (en)
AU (1) AU640397B2 (en)
CA (1) CA2023894C (en)
DE (1) DE69019447T2 (en)
DK (1) DK0419858T3 (en)
ES (1) ES2075099T3 (en)

Cited By (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001077332A3 (en) * 2000-04-07 2002-07-25 Heska Corp Compositions and methods related to canine igg and canine il-13 receptors
US20040181039A1 (en) * 2001-12-21 2004-09-16 Krah Eugene Regis Canine immunoglobulin variable domains, caninized antibodies, and methods for making and using them
US20110002917A1 (en) * 2009-03-25 2011-01-06 Hansen Genevieve Antibody constant domain regions and uses thereof
WO2010117448A3 (en) * 2009-04-05 2011-07-21 Provenance Biopharmaceuticals Corp. Chimeric immunocytokines and methods of use thereof
US20110217304A1 (en) * 2010-03-04 2011-09-08 Hansen Genevieve Monoclonal antibodies directed to cd52
US20110217298A1 (en) * 2010-03-04 2011-09-08 Genevieve Hansen Monoclonal antibodies directed to cd20
WO2012024650A2 (en) 2010-08-19 2012-02-23 Abbott Laboratories Anti-ngf antibodies and their use
WO2012153121A1 (en) 2011-05-06 2012-11-15 Nvip Pty Ltd Anti-nerve growth factor antibodies and methods of preparing and using the same
WO2013030568A1 (en) 2011-08-30 2013-03-07 Nvip Pty Ltd Caninised tumour necrosis factor antibodies and methods of using the same
WO2013124666A1 (en) 2012-02-22 2013-08-29 Nvip Pty Ltd Tumour necrosis factor receptor fusion proteins and methods of using the same
US9617334B2 (en) 2012-06-06 2017-04-11 Zoetis Services Llc Caninized anti-NGF antibodies and methods thereof
KR20190039256A (en) * 2016-08-15 2019-04-10 국립대학법인 홋가이도 다이가쿠 Anti-PD-L1 antibody
US10982002B2 (en) 2018-03-12 2021-04-20 Zoetis Services Llc Anti-NGF antibodies and methods thereof
US11319377B2 (en) 2011-10-26 2022-05-03 Elanco Tiergesundheit Ag Monoclonal antibodies and methods of use
US11492383B2 (en) 2011-06-24 2022-11-08 Stephen D. Gillies Light chain immunoglobulin fusion proteins and methods of use thereof

Families Citing this family (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7393529B2 (en) 1998-04-09 2008-07-01 Idexx Laboratories, Inc. Methods and compositions for inhibiting binding of IgE to a high affinity receptor
US6537781B1 (en) 1999-08-10 2003-03-25 Idexx Laboratories, Inc. Methods and compositions concerning canine interleukin 5
US20030163618A1 (en) * 2002-02-27 2003-08-28 Vishal Anand Shared queue for multiple input-streams
CA2730201C (en) 2008-07-10 2019-02-05 Toray Industries, Inc. Anti-cd179b antibody
HUE035804T2 (en) 2008-07-10 2018-05-28 Toray Industries Immunity inducing agent and method for detecting cancer
WO2010027488A2 (en) * 2008-09-04 2010-03-11 Vet Therapeutics, Inc. Monoclonal antibodies
US8313915B2 (en) * 2009-01-21 2012-11-20 Gundersen Lutheran Medical Foundation, Inc. Early detection of canine lyme disease by specific peptides and antibodies
CA2754408A1 (en) * 2009-03-30 2010-10-14 Boehringer Ingelheim International Gmbh Fusion proteins comprising canine fc portions
WO2011057188A1 (en) 2009-11-06 2011-05-12 Idexx Laboratories, Inc. Canine anti-cd20 antibodies
JP6910963B2 (en) * 2016-01-06 2021-07-28 株式会社オーダーメードメディカルリサーチ High affinity anti-VEGF antibody
JP6925981B2 (en) 2016-01-06 2021-08-25 株式会社オーダーメードメディカルリサーチ Antibodies that block the binding of VEGF to NRP1
GB2561352B (en) * 2017-04-10 2023-01-18 Genome Res Ltd Animal models and therapeutic molecules
GB2578867A (en) * 2018-10-09 2020-06-03 Genome Res Ltd Animal models and therapeutic molecules

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0289053A2 (en) * 1987-04-30 1988-11-02 The Wistar Institute Monoclonal antibodies against lymphoma-associated antigens, hybrid cell line producing these antibodies, and use therefore
US4842999A (en) * 1986-08-11 1989-06-27 Adi Diagnostics Inc. Canine heartworm vaccine and diagnostic test

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4842999A (en) * 1986-08-11 1989-06-27 Adi Diagnostics Inc. Canine heartworm vaccine and diagnostic test
EP0289053A2 (en) * 1987-04-30 1988-11-02 The Wistar Institute Monoclonal antibodies against lymphoma-associated antigens, hybrid cell line producing these antibodies, and use therefore

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
Bio Essays, vol. 8, No. 2, Feb./Mar. 1988, pp. 74 78; M. Verhoeven et al., Engineering of Antibodies . *
Bio Essays, vol. 8, No. 2, Feb./Mar. 1988, pp. 74-78; M. Verhoeven et al.,Engineering of Antibodies".
Clinical Chemistry, vol. 34, No. 9, 1988, pp. 1668 1675; S.L. Morrison et al., Production and Characterization of genetically engineered antibody . . . . *
Clinical Chemistry, vol. 34, No. 9, 1988, pp. 1668-1675; S.L. Morrison et al., "Production and Characterization of genetically engineered antibody . . . ".
Fuller et al., Fed. Proceedings 44(4); 1329, 1985 (Abst #5369.
Fuller et al., Fed. Proceedings 44(4); 1329, 1985 (Abst 5369. *
Wasserman et al., Biochemistry 16(14); 3161, 1977. *

Cited By (41)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7378275B2 (en) 2000-04-07 2008-05-27 Heska Corporation Canine IL-13 receptor alpha-1 subunit nucleic acid molecules
US6703360B2 (en) 2000-04-07 2004-03-09 Heska Corporation Compositions and methods related to canine IgG and canine IL-13 receptors
US20040142372A1 (en) * 2000-04-07 2004-07-22 Mccall Catherine A. Compositions and methods related to canine IgG and canine IL-13 receptors
WO2001077332A3 (en) * 2000-04-07 2002-07-25 Heska Corp Compositions and methods related to canine igg and canine il-13 receptors
US20080287665A1 (en) * 2000-04-07 2008-11-20 Mccall Catherine A CANINE IgG NUCLEIC ACID MOLECULES
US7261890B2 (en) 2001-12-21 2007-08-28 Idexx Laboratories, Inc. Methods for using canine immunoglobulin variable domains and caninized antibodies
US20040181039A1 (en) * 2001-12-21 2004-09-16 Krah Eugene Regis Canine immunoglobulin variable domains, caninized antibodies, and methods for making and using them
US20110002917A1 (en) * 2009-03-25 2011-01-06 Hansen Genevieve Antibody constant domain regions and uses thereof
AU2010229337A8 (en) * 2009-03-25 2016-10-20 Vet Therapeutics Inc. Antibody constant domain regions and uses thereof
AU2010229337B2 (en) * 2009-03-25 2016-06-23 Vet Therapeutics Inc. Antibody constant domain regions and uses thereof
US8569460B2 (en) * 2009-03-25 2013-10-29 Vet Therapeutics, Inc. Antibody constant domain regions and uses thereof
WO2010117448A3 (en) * 2009-04-05 2011-07-21 Provenance Biopharmaceuticals Corp. Chimeric immunocytokines and methods of use thereof
US8652470B2 (en) 2010-03-04 2014-02-18 Vet Therapeutics, Inc. Monoclonal antibodies directed to CD52
US20110217304A1 (en) * 2010-03-04 2011-09-08 Hansen Genevieve Monoclonal antibodies directed to cd52
US20110217298A1 (en) * 2010-03-04 2011-09-08 Genevieve Hansen Monoclonal antibodies directed to cd20
US9616120B2 (en) 2010-03-04 2017-04-11 Vet Therapeutics, Inc. Monoclonal antibodies directed to CD20
US9505829B2 (en) 2010-08-19 2016-11-29 Zoetis Belgium S.A. Anti-NGF antibodies and their use
EP4056589A1 (en) 2010-08-19 2022-09-14 Zoetis Belgium S.A. Anti-ngf antibodies and their use
WO2012024650A2 (en) 2010-08-19 2012-02-23 Abbott Laboratories Anti-ngf antibodies and their use
US10093725B2 (en) 2010-08-19 2018-10-09 Zoetis Belgium S.A. Anti-NGF antibodies and their use
US10125192B2 (en) 2010-08-19 2018-11-13 Zoetis Belgium S.A. Caninized anti-NGF antibodies and their use
EP2705057B1 (en) 2011-05-06 2016-08-03 Nexvet Australia Pty Ltd Therapeutic canine immunoglobulins and methods of using the same
WO2012153121A1 (en) 2011-05-06 2012-11-15 Nvip Pty Ltd Anti-nerve growth factor antibodies and methods of preparing and using the same
EP3502137A1 (en) 2011-05-06 2019-06-26 Nexvet Australia Pty Ltd Anti-nerve growth factor antibodies and methods of preparing and using the same
US11492383B2 (en) 2011-06-24 2022-11-08 Stephen D. Gillies Light chain immunoglobulin fusion proteins and methods of use thereof
WO2013030568A1 (en) 2011-08-30 2013-03-07 Nvip Pty Ltd Caninised tumour necrosis factor antibodies and methods of using the same
US12600792B2 (en) 2011-10-26 2026-04-14 Elanco Tiergesundheit Ag Monoclonal antibodies and methods of use
US11319377B2 (en) 2011-10-26 2022-05-03 Elanco Tiergesundheit Ag Monoclonal antibodies and methods of use
WO2013124666A1 (en) 2012-02-22 2013-08-29 Nvip Pty Ltd Tumour necrosis factor receptor fusion proteins and methods of using the same
US9951128B2 (en) 2012-06-06 2018-04-24 Zoetis Services Llc Caninized anti-NGF antibodies and methods thereof
US9617334B2 (en) 2012-06-06 2017-04-11 Zoetis Services Llc Caninized anti-NGF antibodies and methods thereof
US11312773B2 (en) 2016-08-15 2022-04-26 Fuso Pharmaceutical Industries, Ltd. Anti-PD-L1 antibody
KR20190039256A (en) * 2016-08-15 2019-04-10 국립대학법인 홋가이도 다이가쿠 Anti-PD-L1 antibody
US10982002B2 (en) 2018-03-12 2021-04-20 Zoetis Services Llc Anti-NGF antibodies and methods thereof
US12049509B2 (en) 2018-03-12 2024-07-30 Zoetis Services Llc Nucleic acids encoding a canine antibody which binds nerve growth factor and vectors and host cells thereof
US12049508B2 (en) 2018-03-12 2024-07-30 Zoetis Services Llc Canine anti-NGF antibodies and methods of treating pain thereof
US12049507B2 (en) 2018-03-12 2024-07-30 Zoetis Services Llc Felinized anti-NGF antibodies and methods of treating pain
US12084506B2 (en) 2018-03-12 2024-09-10 Zoetis Services Llc Methods of treating a canine and inhibiting NGF activity through use of anti-NGF antibodies
US12084507B2 (en) 2018-03-12 2024-09-10 Zoetis Services Llc Humanized anti-NGF antibodies and methods of treating pain thereof
US12497459B2 (en) 2018-03-12 2025-12-16 Zoetis Services Llc Nucleic acids encoding canine anti-NGF antibodies and methods thereof
US12552871B2 (en) 2018-03-12 2026-02-17 Zoetis Services Llc Nucleic acids encoding humanized anti-NGF antibodies

Also Published As

Publication number Publication date
EP0419858B1 (en) 1995-05-17
DK0419858T3 (en) 1995-07-10
EP0419858A1 (en) 1991-04-03
CA2023894C (en) 2001-09-18
AU640397B2 (en) 1993-08-26
DE69019447D1 (en) 1995-06-22
DE69019447T2 (en) 1995-10-26
ATE122716T1 (en) 1995-06-15
ES2075099T3 (en) 1995-10-01
CA2023894A1 (en) 1991-02-26
AU6120490A (en) 1991-02-28
US5593861A (en) 1997-01-14

Similar Documents

Publication Publication Date Title
US5593861A (en) Dog-mouse heterohybridoma and gene fragment coding for constant region of canine immunoglobulins
US5612458A (en) Antibody to PNA/nucleic acid complexes
US5712120A (en) Method for obtaining modified immunoglobulins with reduced immunogenicity of murine antibody variable domains, compositions containing them
US6214613B1 (en) Expression screening vector
US5880274A (en) Cat-mouse heterohybridoma and gene fragment coding for constant region of feline immunoglobulin
JPH08506481A (en) Humanized antibody to the Fc receptor of immunoglobulin G on human mononuclear phagocytes
WO1992002551A1 (en) Methods for the production of proteins with a desired function
Guigou et al. Ig repertoire of human polyspecific antibodies and B cell ontogeny
Theofilopoulos et al. Monoclonal IgM rheumatoid factors derived from arthritic MRL/Mp-lpr/lpr mice.
Roehrig et al. Isolation and characterization of hybrid cell lines producing monoclonal antibodies directed against the structural proteins of Sindbis virus
JP2000508881A (en) PCR amplification of rearranged genomic variable regions of immunoglobulin genes
Huet et al. Probing yeast RNA polymerase A subunits with monospecific antibodies.
JP2811089B2 (en) Gene fragments encoding the constant regions of canine x mouse heterohybridomas and canine immunoglobulin lambda chains
JP2837240B2 (en) Gene fragment encoding constant region of canine immunoglobulin gamma chain and mouse x dog chimeric antibody
Kelley et al. Monoclonal antibodies: pragmatic application of immunology and cell biology
CN112501273B (en) Nested PCR primer and kit for amplifying horse antibody and application thereof
JP2811086B2 (en) Cat x mouse heterohybridoma and gene fragment encoding the constant region of feline immunoglobulin lambda chain
JP3292727B2 (en) Monoclonal antibody against hepatitis C virus and use thereof
MXPA01002248A (en) High-affinity antibodies.
JP2811096B2 (en) Gene fragment encoding constant region of canine immunoglobulin kappa chain and mouse x dog chimeric antibody
Sikder et al. Amino acid substitutions in VH CDR2 change the idiotype but not the antigen-binding of monoclonal antibodies to alpha (1----6) dextrans.
JP2811102B2 (en) Gene fragment encoding the constant region of feline immunoglobulin gamma chain and mouse x feline chimeric antibody
Tamaki et al. Identification of human blood with hybridoma-derived antibody to human immunoglobulin G
AU665440B2 (en) Rabbit single domain antibody and use thereof
Adib-Conquy et al. Reactivity and structure of a mouse anti-F (ab′) 2 IgM. Comparison of its variable region sequences with those of a structurally close polyreactive natural IgM

Legal Events

Date Code Title Description
FEPP Fee payment procedure

Free format text: PAYOR NUMBER ASSIGNED (ORIGINAL EVENT CODE: ASPN); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

FPAY Fee payment

Year of fee payment: 4

FPAY Fee payment

Year of fee payment: 8

REMI Maintenance fee reminder mailed
LAPS Lapse for failure to pay maintenance fees
STCH Information on status: patent discontinuation

Free format text: PATENT EXPIRED DUE TO NONPAYMENT OF MAINTENANCE FEES UNDER 37 CFR 1.362

FP Lapsed due to failure to pay maintenance fee

Effective date: 20101222