US5821063A - Methods for sequencing polymers using mass spectrometry - Google Patents

Methods for sequencing polymers using mass spectrometry Download PDF

Info

Publication number
US5821063A
US5821063A US08/844,462 US84446297A US5821063A US 5821063 A US5821063 A US 5821063A US 84446297 A US84446297 A US 84446297A US 5821063 A US5821063 A US 5821063A
Authority
US
United States
Prior art keywords
polymer
agent
mass
sequence
series
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Lifetime
Application number
US08/844,462
Inventor
Dale H. Patterson
George E. Tarr
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Nordion Inc
Applied Biosystems LLC
Original Assignee
PerSeptive Biosystems Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by PerSeptive Biosystems Inc filed Critical PerSeptive Biosystems Inc
Priority to US08/844,462 priority Critical patent/US5821063A/en
Application granted granted Critical
Publication of US5821063A publication Critical patent/US5821063A/en
Assigned to MDS INC. (THROUGH ITS MDS SCIEX DIVISION) reassignment MDS INC. (THROUGH ITS MDS SCIEX DIVISION) ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: PERSPECTIVE BIOSYSTEMS, INC.
Assigned to BANK OF AMERICA, N.A., AS COLLATERAL AGENT reassignment BANK OF AMERICA, N.A., AS COLLATERAL AGENT SECURITY AGREEMENT Assignors: PERSEPTIVE BIOSYSTEMS, INC.
Assigned to APPLIED BIOSYSTEMS, LLC. reassignment APPLIED BIOSYSTEMS, LLC. MERGER (SEE DOCUMENT FOR DETAILS). Assignors: PERSEPTIVE BIOSYSTEMS, INC.
Assigned to APPLIED BIOSYSTEMS, LLC reassignment APPLIED BIOSYSTEMS, LLC RELEASE BY SECURED PARTY (SEE DOCUMENT FOR DETAILS). Assignors: BANK OF AMERICA, N.A.
Assigned to APPLIED BIOSYSTEMS, INC. reassignment APPLIED BIOSYSTEMS, INC. LIEN RELEASE Assignors: BANK OF AMERICA, N.A.
Anticipated expiration legal-status Critical
Assigned to APPLIED BIOSYSTEMS, LLC reassignment APPLIED BIOSYSTEMS, LLC CORRECTIVE ASSIGNMENT TO CORRECT THE RECEIVING PARTY NAME PREVIOUSLY RECORDED AT REEL: 030182 FRAME: 0677. ASSIGNOR(S) HEREBY CONFIRMS THE RELEASE OF SECURITY INTEREST. Assignors: BANK OF AMERICA, N.A.
Expired - Lifetime legal-status Critical Current

Links

Images

Classifications

    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6803General methods of protein analysis not limited to specific proteins or families of proteins
    • G01N33/6848Methods of protein analysis involving mass spectrometry
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K1/00General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length
    • C07K1/12General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length by hydrolysis, i.e. solvolysis in general
    • C07K1/128General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length by hydrolysis, i.e. solvolysis in general sequencing
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/001Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof by chemical synthesis
    • C07K14/003Peptide-nucleic acids (PNAs)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P21/00Preparation of peptides or proteins
    • C12P21/06Preparation of peptides or proteins produced by the hydrolysis of a peptide bond, e.g. hydrolysate products
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/34Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase
    • HELECTRICITY
    • H01ELECTRIC ELEMENTS
    • H01JELECTRIC DISCHARGE TUBES OR DISCHARGE LAMPS
    • H01J49/00Particle spectrometers or separator tubes
    • H01J49/02Details
    • H01J49/04Arrangements for introducing or extracting samples to be analysed, e.g. vacuum locks; Arrangements for external adjustment of electron- or ion-optical components
    • H01J49/0409Sample holders or containers
    • H01J49/0418Sample holders or containers for laser desorption, e.g. matrix-assisted laser desorption/ionisation [MALDI] plates or surface enhanced laser desorption/ionisation [SELDI] plates
    • HELECTRICITY
    • H01ELECTRIC ELEMENTS
    • H01JELECTRIC DISCHARGE TUBES OR DISCHARGE LAMPS
    • H01J49/00Particle spectrometers or separator tubes

Definitions

  • the present invention relates generally to methods and apparatus for sequencing polymers, especially biopolymers, using mass spectrometry.
  • Biochemists frequently depend on reliable and fast determinations of the sequences of biological polymers. For example, sequence information is crucial in the research and development of peptide screens, genetic probes, gene mapping, and drug modeling, as well as for quality control of biological polymers when manufactured for diagnostic and/or therapeutic applications.
  • Various methods are known for sequencing polymers composed of two essential biological building-blocks, amino acids, carbohydrates and nucleotides.
  • existing methods for peptide sequence determination include the N-terminal chemistry of the Edman degradation, N- and C-terminal enzymatic methods, and C-terminal chemical methods.
  • Existing methods for sequencing oligonucleotides include the Maxam-Gilbert base-specific chemical cleavage method and the enzymatic ladder synthesis with dideoxy base-specific termination method. Each method possesses inherent limitations that preclude it being used exclusively for complete primary structure identification.
  • Edman sequencing and adaptations thereof are the most widely used tools for sequencing certain protein and peptides residue by residue, while the enzymatic synthesis method is preferred for sequencing oligonucleotides.
  • oligonucleotides In the case of both peptides and oligonucleotides, an alternate approach to chemical sequencing is enzymatic cleavage sequencing. In the case of oligonucleotides, over 150 different enzymes have been isolated and found suitable for preparing oligonucleotide fragments. In the case of peptides, serine carboxypeptidases have proven popular over the last two decades because they offer a simple approach by which amino acids can be sequentially cleaved residue by residue from the C-terminus of a protein or a peptide. Carboxypeptidase Y (CPY), in particular, is an attractive enzyme because it non-specifically cleaves all residues from the C-terminus, including proline. (See, e.g., Breddam et al. (1987) Carlsburg Res. Commun. 52: 55-63.)
  • Sequencing of peptides by carboxypeptidase digestion has traditionally been performed by a laborious, direct analysis of the released amino acids, residue by residue. Not only is this approach labor-intensive, but it is complicated by amino acid contaminants in the enzyme and protein/peptide solutions, as well as by enzyme autolysis. A further hindrance to any sequencing effort of this type is the absolute requirement for good kinetic information concerning the hydrolysis and liberation of each individual residue by the particular enzyme used.
  • MALDI-TOF matrix-assisted laser desorption ionization time-of-flight
  • carboxypeptidase digestion of peptides can be combined with MALDI-TOF to analyze the resulting mixture of truncated peptide. For example, eight consecutive amino acids have been sequenced from the C-terminus of human parathyroid hormone 1-34 fragment (Schar et al. (1991) Chimia 45: 123-126). Additionally, carboxypeptidase digestion of peptides has been combined with other mass spectrometry methods such as plasma desorption (Wang et al. (1992) Techniques Protein Chemistry III (ed., R. H. Angeletti; Academic Press, N.Y.) pp. 503-515).
  • the invention involves a novel form of sample holder for a mass spectrometer.
  • the sample holder comprises a reaction surface with spatially separate areas having differing ratios of polymer and hydrolyzing agent. After a suitable incubation period during which the hydrolyzing agent hydrolyzes inter-monomer bonds within the polymer in each area, a plurality, typically all, of the areas containing hydrolyzed polymer fragments are ionized, typically serially, in the mass spectrometer and data representative of the mass to charge ratios of these fragments are obtained. One or more of the areas will have ratios of hydrolyzing agent to polymer suitable for more or less optimal generation of useful ladder elements or other polymer fragments.
  • Some areas on the sample holder may have overly hydrolyzed polymer fragments useless for deriving sequence information. Other areas may contain substantially unhydrolyzed polymer.
  • mass spectrometry analysis of all areas at least some mass to charge ratio data obtained from fragments generated in one or more areas which will contain useful data from which sequence information can be derived.
  • the method of the invention obviates the necessity to empirically prepare samples to ascertain the appropriate ratio of hydrolyzing agent to polymer, as well as optimal reaction time and carefully controlled reaction temperature, heretofore required.
  • hydrolyzing agents can be used in different series of areas on the sample holder so as to further generate useful hydrolyzed fragments, and the data from these may also be integrated to improve the sequencing process. If data analysis is implemented by a computer program, the whole process can be completed minutes after completion of the above-described incubation.
  • the present invention provides a method of obtaining sequence information about a polymer comprising a series of different monomers which involves: on a reaction surface, providing at least one amount of a hydrolyzing agent which hydrolyzes said polymer and breaks inter-monomer bonds, and a sample of polymer to form differing ratios of agent to polymer; incubating the same for a time sufficient to obtain a plurality of series of hydrolyzed polymer fragments; performing mass spectrometry on a plurality of the series to obtain mass-to-charge ratio data for hydrolyzed polymer fragments contained in the series; and integrating data from a plurality of the series to obtain sequence information characteristic of the polymer sample.
  • the instant invention contemplates both naturally-occurring and synthetic moieties characterized by a series of different monomers.
  • the polymer is modified as described herein.
  • the method of the instant invention contemplates certain embodiments having hydrolyzing agents capable of hydrolyzing a polymer to form sequence-defining ladders, as well as certain other embodiments having hydrolyzing agents capable of forming polymer maps.
  • the instant invention provides for hydrolyzing the polymer with combinations of such agents.
  • the instant method contemplates embodiments involving enzymatic as well as non-enzymatic hydrolyzing agents.
  • the method provides that the hydrolyzing agent is disposed on the reaction surface in an array of discrete separate zones.
  • the hydrolyzing agent is disposed as a gradient.
  • the agent is disposed on the reaction surface in a constant amount.
  • polymer is similarly disposed on the reaction surface.
  • differing agent to polymer ratios are disposed upon the reaction surface and incubated to obtain a plurality of series of hydrolyzed polymer fragments. The various manners in which such differing ratios can be accomplished will be obvious to the skilled practioner.
  • the method provides combining the agent and polymer with other useful moieties.
  • moieties which selectively shift the mass of hydrolyzed fragments prior to mass spectrometry analysis are included.
  • moieties capable of improving ionization of hydrolyzed fragments are included.
  • the method provides for including a light-absorbent matrix. The instant method also contemplates embodiments in which any one or more of the above-described moieties are combined with the agent and polymer prior to mass spectrometry analysis.
  • reaction surface is fabricated from a variety of substrates and assumes a variety of configurations suitable for use with a mass spectrometer.
  • the method of the instant invention can be adapted to all manner of ion formation and all modes of mass analysis.
  • the present invention provides a mass spectrometer sample holder having a planar solid surface with at least one amount of a hydrolyzing agent capable of hydrolyzing a polymer disposed thereon.
  • the hydrolyzing agent is disposed on the reaction surface in a dehydrated form.
  • the hydrolyzing agent is immobilized on the reaction surface.
  • the hydrolyzing agent is disposed on the reaction surface in the form of a liquid or gel which is resistant to physical dislocation.
  • a light-absorbent matrix is disposed on the surface of the sample holder.
  • any one or more of such embodiments of the sample holder may further have microreaction vessels on their surface.
  • Other embodiments of the sample holder of the instant invention are disposable.
  • sample holder of the present invention are useful to adapt a mass spectrometry apparatus for obtaining sequence information about a polymer comprising a series of different monomers.
  • the method of obtaining sequence information in accordance with the instant invention solves problems encountered with conventional polymer sequence methodologies.
  • the overall polymer sequencing effort is superior to the prior art time-dependent digestions in terms of: inherent simplicity of the method and elimination of laborious optimization requirements; reduced loss of sample due to transfer from reaction vessel to reaction surface; reduced amounts of enzyme and peptide used; and, particularly important for large-scale application, ease of use/automation.
  • the mass spectrometry sample holder of the instant invention provides advantages heretofore unavailable to the skilled practitioner.
  • the sample holder minimizes reagent handling and greatly facilitates sample processing.
  • the skilled practitioner need only provide a sample of polymer. Virtually all other experimental parameters are pre-optimized.
  • FIG. 1 depicts a sample plate known in the prior art which can be adapted for MALDI-TOF analysis of polymer sequences by practicing the methods of the present invention and disposing hydrolyzing agent thereon to achieve differing ratios of agent to polymer in each well.
  • FIGS. 2A, 2B, and 2C depict several MALDI Spectra from a time-dependent CPY digestion of ACTH 7-38 fragment PheArgTrpGlyLysProValGlyLysLysArgArgProValLysValTyrProAsnGlyAlaGluAspGluSerAlaGluAlaPheProLeuGlu! (SEQ. ID. NO: 22), at 1 min (2A), 5 min (2B) and 25 min (2C).
  • FIG. 3 is a MALDI mass spectrum representing pooled 15 s, 105 s, 6 min and 25 min quenched aliquots.
  • FIGS. 4A and 4B depict various MALDI spectra from on-plate digestions of ACTH 7-38 fragment at various concentrations of Carboxypeptidase Y (CPY): 6.10. ⁇ 10 -4 U/ ⁇ l (4A); 1.53 ⁇ 10 -3 /U ⁇ l (4B).
  • CPY Carboxypeptidase Y
  • FIGS. 5A, 5B, and 5C depict various MALDI spectra of the following three selected peptides: osteocalcin 7-19 fragment GlyAlaProValProTyrProAspProLeuGluProArg! (SEQ. ID. NO:13) (5A), angiotensin 1 AspArgValTyrIleHisProPheHisLeu! (SEQ. ID. NO:8) (5B), and bradykinin ArgProProGlyPheSerProPheArg! (SEQ. ID. NO:5) (5C).
  • FIGS. 6A-6E depict various MALDI spectra of exonuclease hydrolysis of a nucleic acid polymer (SEQ. ID. No. 23) at various concentrations of Phosphodiesterase I (Phos I): 0.002 ⁇ U/ ⁇ l (6A); 0.005 ⁇ U/ ⁇ l (6B); 0.01 ⁇ U/ ⁇ l (6C); 0.02 ⁇ U/ ⁇ l (6D); 0.05 ⁇ U/ ⁇ l (6E).
  • Phos I Phosphodiesterase I
  • FIG. 7 depicts a MALDI spectrum of a hydrolyzed nucleic acid polymer (SEQ. ID. NO:13) combined with a light-absorbent matrix.
  • the instant invention relates to methods and apparatus for sequencing polymers using mass spectrometry.
  • the methods and apparatus utilize polymers and hydrolyzing agents disposed upon a reaction surface.
  • the hydrolyzing agents are enzymatic or non-enzymatic.
  • the hydrolyzing agents react with the polymer to produce sequence-defining polymer ladders or polymer maps.
  • the methods of this invention further involve the step of obtaining mass spectrometry data relating to hydrolyzed polymer series and integrating the data from a plurality of polymer series to determine the polymer sequence.
  • the mass spectrometry method of this invention is applicable to all manner of ion formation and all modes of mass analysis.
  • the apparatus of this invention relates to a mass spectrometer sample holder for adapting a mass spectrometer to obtain sequence information about a polymer in accordance with the method of the instant invention.
  • the apparatus has disposed thereon hydrolyzing agent, in dehydrated, immobilized, liquid and/or gel form, and/or a light-absorbent matrix.
  • the apparatus of the instant invention is disposable.
  • a "polymer” is intended to mean any moiety comprising a series of different monomers suitable for use in the method of the instant invention. That is, any moiety comprising a series of different monomers whose intermonomer bonds are susceptible to hydrolysis are suitable for use in the method disclosed herein.
  • a peptide is a polymer made up of particular monomers, i.e., amino acids, which can be hydrolyzed by either enzymatic or chemical agents.
  • a DNA is a polymer made up of other monomers, i.e., bases, which can be hydrolyzed by a variety of agents.
  • a polymer can be a naturally-occurring moiety as well as a synthetically-produced moiety.
  • the polymer is a biopolymer selected from, but not limited to, the following group: proteins, peptides, DNAs, RNAs, PNAs (peptide nucleic acids), carbohydrates, and modified versions thereof.
  • Sequence information as used herein is intended to mean any information relating to the primary arrangement of the series of different monomers within the polymer, or within portions thereof. Sequence information includes information relating to the chemical identity of the different monomers, as well as their particular position within the polymer. Polymers with known primary sequences, as well as polymers with unknown primary sequences, are suitable for use in the methods of the instant invention. It is contemplated that sequence information relating to terminal monomers as well as internal monomers can be obtained using the methods disclosed herein. In certain applications, sequence information can be obtained using a sample of an intact, complete polymer. In other applications, sequence information can be obtained using a sample containing less than the intact complete polymer, for example, polymer fragments.
  • polymer fragments can be naturally-occurring, artifacts of isolation and purification, and/or generated in vitro by the skilled artisan. Additionally, polymer fragments can be initially derived from and prepared by a variety of fractionation and separation methods, such as high performance liquid chromatography, prior to use with the methods of the instant invention.
  • reaction surface of the instant method includes any surface suitable for hydrolyzing the subject polymer with the subject agent.
  • the reaction surface can be fabricated from a variety of substrates, such as but not limited to: metals, foils, plastics, ceramics, and waxes. All reaction surfaces must be suitable for use with a mass spectrometer apparatus.
  • the reaction surface of the instant invention can assume any configuration suitable for use with a particular mass spectrometer apparatus.
  • the reaction surface can be a planar solid surface.
  • the surface may have microreaction vessels disposed thereon.
  • the reaction surface can assume the configuration of a probe suitable for use with certain mass spectrometer apparatus.
  • the skilled artisan will appreciate that the reaction surface can be activated and/or derivatized to enhance or facilitate polymer sequencing in accordance with the instant invention.
  • hydrolyzing agent is intended to mean any agent capable of disrupting inter-monomer bonds within a particular polymer. That is, any agent which can interrupt the primary sequence of a polymer is suitable for use in the methods disclosed herein. Hydrolyzing agents can act by liberating monomers at either termini of the polymer, or by breaking internal bonds thereby generating fragments or portions of the subject polymer. Generally, a preferred hydrolyzing agent interrupts the primary sequence by cleaving before or after a specific monomer(s); that is, the agent specifically interacts with the polymer at a particular monomer or particular sequence of monomers recognized by the agent as the preferred hydrolysis site within the polymer. All of the currently preferred hydrolyzing agents described herein are commercially available from reagent suppliers such as Sigma Chemicals (St. Louis, Mo.).
  • an excipient is added to, and used in conjunction with, the hydrolyzing agent.
  • the excipients contemplated herein facilitate lyophilization and/or dissolution of the hydrolyzing agent.
  • fucose and other sugars suitable for use with the instant invention are contemplated. Suitable for use is intended to mean that no interference with mass spectrometry is encountered by the use thereof.
  • Other excipients useful in the instant invention are pH modifiers, such as ammonium acetate.
  • Still other excipients suitable for use in the methods and apparatus disclosed herein are those which act as stabilizers of the integrity of the hydrolyzing agent. With respect to excipients, the identity of those suitable will be obvious to the skilled artisan using only routine experimentation. While certain preferred excipients are described above, identification of suitable equivalents is within the skill of the ordinary artisan.
  • the hydrolyzing agent is a hydrolase enzyme.
  • Some hydrolases are endohydrolases, others are exohydrolases.
  • the particular hydrolase used is determined by the nature of the polymer and/or the type of sequence information desired. Its identity can be readily determined by the skilled artisan using no more than routine experimentation.
  • currently preferred endohydrolases include but are not limited to: endonucleases, endopeptidases, endoglycosidases, trypsin, chymotrypisin, endoproteinase Lys-C, endoproteinase Arg-C, and thermolysin.
  • exohydrolases include but are not limited to: exonucleaes, exoglycosidases, and exopeptidases.
  • the currently preferred exonucleases include, but are not limited to: phosphodiesterase types I and II, exonuclease VII, ⁇ -exonuclease, T7 gene 1 exonuclease, exonuclease III, BAL-31, exonuclease I, exonuclease V, exonuclease II, and DNA polymerase III.
  • exoglycosidases include, but are not limited to: ⁇ -mannosidase I, ⁇ -mannosidase, ⁇ -hexosaminidase, ⁇ -galactosidase, ⁇ -fucosidase I, ⁇ -fucosidase II, ⁇ -galactosidase, ⁇ -neuraminidase, ⁇ -glucosidase I and ⁇ -glucosidase II.
  • exopeptidases include, but are not limited to: carboxypeptidase Y, carboxypeptidase A, carboxypepetidase B, carboxypeptidase P, aminopeptidase 1, leucine amino peptidase, proline aminodipeptidase, and cathepsin C.
  • the hydrolyzing agent is an agent other than an enzyme.
  • an agent can be a chemical, such as an acid.
  • preferred agents other than an enzyme include but are not limited to: cyanogen bromide, hydrochloric acid, sulfuric acid, and pentafluoroproprionic fluorohydride.
  • hydrolysis can be accomplished using partial acid hydrolysis in accordance with the methods disclosed herein. Again, the identity of a hydrolyzing agent other than an enzyme will be determined by the nature of the polymer and the type of sequence information desired. It is within the skilled practitioner's ability to identify a suitable agent, as well as the circumstances under which such an agent is preferred.
  • the instant method further provides for use of combinations of the above-described individual hydrolyzing agents.
  • combinations of enzymes can be used in the claimed invention.
  • Combinations of hydrolyzing agents other than enzymes can also be used.
  • combinations of enzymes with agents other than enzymes can also be used in the instant method. Again, the exact combination and the circumstances under which such a combination is appropriate will depend upon the nature of the polymer and the sequence information desired. The skilled practitioner will know when combinations of hydrolyzing agents are suitable for use in the methods disclosed herein.
  • hydrolyzing agent/polymer sequence-specific interactions are well known in the art.
  • polymers such as proteins and DNAs specifically interact with proteinases and nucleases, respectively.
  • Certain of the preferred proteinases specifically recognize the C-terminus (carboxypeptidase Y) or the N-terminus (amino peptidase 1) of a protein's amino acid sequence.
  • Certain of the preferred nucleases specifically recognize the 5' or the 3' terminus of a polynucleotide's base sequence. Some nucleases recognize single-stranded polynucleotides; others recognize double-stranded polynucleotides while still others recognize both.
  • such exohydrolases generate a series of hydrolyzed fragments comprising a sequence-defining "ladder" of the polymer. That is, these agents generate a series of hydrolyzed fragments, each hydrolyzed fragment within the series being a "ladder element,” which collectively comprise a sequence-defining "ladder” of the polymer.
  • Ladder elements represent hydrolyzed fragments from which monomers have been consecutively and/or progressively liberated by the exohydrolase acting at one or the other of the polymer's termini. Accordingly, ladder elements are truncated hydrolyzed polymer fragments, and ladders per se are concatenations of these collective truncated hydrolyzed polymer fragments.
  • sequence information relating to the amino acid sequence of a protein can be obtained using carboxypeptidase Y, an agent which acts at the carboxy terminus.
  • hydrolyzing agents other than exohydrolases which also act at one or the other of a polymer's termini generate ladder elements which collectively comprise a series of sequence-defining ladders.
  • the well-known Edman degradation technique and associated reagents can be adapted for use with the methods of the instant invention for this purpose.
  • the above-described subtractive-type sequencing method through which repetitive removal of successive amino-terminal residues from a protein polymer can occur, can also be accomplished with hydrolyzing agents other than enzymes as disclosed herein.
  • sequence information can also be obtained using hydrolyzing agents which act to disrupt internal inter-monomer bonds.
  • an endohydrolase can generate a series of hydrolyzed fragments useful ultimately in constructing a "map" of the polymer. That is, this agent generates a series of related hydrolyzed fragments which collectively contribute information to a sequence-defining "map" of the polymer.
  • peptide maps can be generated by using trypsin endohydrolysis in tandem with cyanogen bromide endohydrolysis to obtain hydrolyzed fragments with overlapping amino acid sequences. Such overlapping fragments are useful for reconstructing ultimately the entire amino acid sequence of the intact polymer.
  • this combination of hydrolyzing agents generates a useful plurality of series of hydrolyzed fragments because trypsin specifically catalyzes hydrolysis of only those peptide bonds in which the carboxyl group is contributed by either a lysine or an arginine monomer, while cyanogen bromide cleaves only those peptide bonds in which the carbonyl group is contributed by methionine monomers.
  • trypsin and cyangogen bromide hydrolysis in tandem, one can obtain two different series of hydrolyzed "mapping" fragments.
  • mapping fragments are then examined by mass spectrometry to identify specific hydrolysates from the second cyanogen bromide hydrolysis whose amino acid sequences establish continuity with and/or overlaps between the specific hydrolysates from the first hydrolysis with trypsin. Overlapping sequences from the second hydrolysis provide information about the correct order of the hydrolyzed fragments produced by the first trypsin hydrolysis. While these general principles of peptide mapping are well-known in the prior art, utilizing these principles to obtain sequence information by mass spectrometry as disclosed herein has heretofore been unknown in the art.
  • a sample of polymer includes biological fluids containing (or suspected to contain) the polymer of interest.
  • a sample of polymer is also intended to include isolated and purified polymer. Additionally, a sample of polymer can be aqueous or non-aqueous.
  • Adding a sample of polymer to the reaction surface can be accomplished in a variety of ways.
  • the sample can be introduced as individual aliquots, or the sample can be introduced in a continuous mode such as sample eluting from a preparative or qualitative column. In both cases, the sample can be introduced manually or by automated means.
  • the instant method Upon adding a sample of polymer and hydrolyzing agent to the reaction surface, the instant method provides that differing concentrations of agent or ratios of agent to polymer are formed on said reaction surface. For example, if the polymer sample contains a uniform amount of polymer, then the method contemplates that differing amounts of agent be disposed on the reaction surface. This would produce differing agent to polymer ratios.
  • the differing amounts of agent can be in the form of discrete separate zones to which a constant amount of polymer is added. Alternatively, the differing amounts of agent can be in the form of a non-discrete gradient of agent ranging from low to high amounts of agent, perhaps in the form of strip of appropriate length and width.
  • differing agent to polymer ratios are produced.
  • the agent and polymer can assume any configuration and be present in any amount(s); all that is required is that the combination of agent and polymer results in differing ratios of the same disposed on the reaction surface.
  • differing ratios of agent to polymer can also be accomplished by disposing a constant amount of agent on the reaction surface and adding varying amounts of polymer, e.g., a polymer gradient or discrete separate zones of differing amounts of polymer or polymer solution.
  • polymer gradient polymer eluted from a column in the form of a gaussian-distributed gradient is currently preferred.
  • the instant method further provides for incubating the above-described agent to polymer ratios for a time required to obtain the requisite plurality of series of hydrolyzed polymer fragments.
  • Incubating can proceed under any conditions suitable for hydrolyzing the polymer and for any amount of time required to obtain a plurality of series of hydrolyzed fragments.
  • the disclosed methods permit sequencing information to be obtained in relatively short time periods, for example, in less than 1 hour.
  • the incubation time can be shortened or lengthened depending upon the nature of the polymer and/or hydrolyzing agent(s). It will be obvious to one skilled in the art how to identify appropriate incubation times and optimize the same. Incubation reactions can be terminated by evaporation.
  • a "plurality of series" of hydrolyzed polymer fragments is intended to mean that hydrolyzed fragments are produced by at least two different agent:polymer ratios, and that each agent:polymer ratio generates a series of hydrolyzed fragments. For example, if a constant amount of polymer is added to two separate zones of agent containing different amounts of agent, each zone represents one agent:polymer ratio and each zone produces one series of hydrolyzed fragments. When taken together, the two zones are a plurality which collectively contain a plurality of series of hydrolyzed polymer fragments.
  • the method disclosed herein teaches obtaining sequence information by performing mass spectrometry on a plurality of series of hydrolyzed fragments to obtain mass-to-charge ratio data for hydrolyzed polymer fragments contained therein. As already discussed, this contemplates that at least two different agent:polymer ratios be provided and analyzed by mass spectrometry.
  • any manner of ion formation can be adapted for obtaining mass-to-charge ratio data, including but not limited to: matrix-assisted laser desorption ionization, plasma desorption ionization, electrospray ionization, thermospray ionization, and fast atom bombardment ionization.
  • any mode of mass analysis is suitable for use with the instant invention including but not limited to: time-of-flight, quadrapole, ion trap, and sector analysis.
  • a currently preferred mass spectrometer instrument is an improved time-of-flight instrument which allows independent control of potential on sample and extraction elements, as described in copending U.S. Ser. No. 08/446,544 (Atty. Docket No. SYP-111) filed on even date herewith now U.S. Pat. No. 5,625,184 and which is herein incorporated by reference.
  • mass-to-charge ratio data are obtained using a plurality of series of hydrolyzed fragments.
  • hydrolyzed fragments from at least two different agent:polymer ratios are provided to obtain mass-to-charge ratios by mass spectrometry.
  • the mass-to-charge ratio data from at least two different agent:polymer ratios are integrated to obtain the sequence information characteristic of the polymer.
  • integrating data in accordance with the instant invention to obtain sequence information is more accurate, efficient, and rapid than sequence methods heretofore known in the art.
  • the method of the instant invention also provides for including moieties useful in mass spectrometry.
  • a light-absorbent matrix can be introduced at any point prior to performing mass spectrometry analysis by laser desorption.
  • Light-absorbent matrices are particularly useful for analysis of biopolymers.
  • Matrix-assisted laser desorption ionization techniques, as well as various matrices suitable therefor, are well known in the art and have been described, for example, in U.S. Pat. No. 5,288,644 (issued Feb. 22, 1994) and U.S. Ser No. 08/156,316 (Atty. Docket No. Vestec-14-2, allowed Apr. 18, 1995 now U.S. Pat. No. 5,453,247), the disclosures of which are herein incorporated by reference.
  • moieties useful in the instant method include those capable of selectively shifting the mass of certain hydrolyzed fragments. These, too, can be added at any point prior to mass spectrometry analysis.
  • mass-shifting moieties include, but are not limited to, those moieties which produce reaction products such as: alkyl, aryl, alkenyl, acyl, thioacyl, oxycarbonyl, carbamyl, thiocarbamyl, sulfonyl, imino, guanyl, ureido, and silyl reaction products. Attachment of such moieties to hydrolyzed polymers is achieved using art-recognized attachment chemistries. The particular moiety best suited to a particular sequence determination will depend upon the nature of the polymer and the hydrolyzed fragments. The skilled artisan will be able to determine which moiety to use, if any.
  • moieties suitable for use with the instant method are those which can improve ionization of hydrolyzed fragments. Such moieties can be introduced at any time prior to mass spectrometry analysis.
  • ionization-improving moieties include, but are not limited to, those moieties which produce reaction products such as: amino, quarternary amino, pyridino, imidino, guanidino, oxonium, and sulfonium reaction products. Preparation and/or use of such moieties are well known in the art.
  • the instant invention provides a mass spectrometer sample holder.
  • the instant sample holder is useful for adapting any mass spectrometer apparatus for obtaining sequence information in accordance with the disclosed methods.
  • the sample holder has a planar solid surface on which is disposed hydrolyzing agent.
  • the sample holder has the form of a probe useful in certain mass spectrometer apparatus.
  • the agent can be in dehydrated, immobilized, liquid and/or gel form.
  • the agent is resistant to physical dislocation and is chemically stable for at least about one to two months, thereby facilitating both transport and storage.
  • the agent can be disposed in separate discrete zones of differing amounts, or in a non-discrete gradient.
  • the agent can be disposed in a constant amount on the surface of the sample holder.
  • the sample holder has a light-absorbent matrix disposed on its surface; this can be with or without hydrolyzing agent.
  • the sample holder can also have microreaction vessels arranged on its surface. In one embodiment, these vessels can be depressions on the holder's surface resulting from chemical-etching or similar techniques.
  • the sample holder can be fabricated from a variety of substrates including but not limited to: metals, foils, plastics, ceramics, and waxes.
  • the sample holder is disposable.
  • the sample holder disclosed herein is a component of a kit useful for sequencing polymers by mass spectrometry, such as that disclosed in co-pending U.S. Ser. No. 08/447,175 (Atty. Docket No.: SYP-114) filed on even date herewith and herein incorporated by reference.
  • the instant invention also relates to a method of data analysis of the mass-to-charge ratios obtained by mass spectrometry.
  • the method provides a set of fragments, created by hydrolysis of the polymer, each set differing by one or more monomers. The difference between the mass-to-charge ratio of at least one pair of fragments is determined.
  • One then asserts a mean mass-to-charge ratio which corresponds to the known mass-to-charge ratio of one or more different monomers.
  • the asserted mean is compared with the measured mean to determine if the two values are statistically different with a desired confidence level. If there is a statistical difference, then the asserted mean difference is not assignable to the actual measured difference. In some embodiments, additional measurements of the difference between a pair of fragments are taken, to increase the accuracy of the measured mean difference. The steps of the method are repeated until one has asserted all desired mean differences for a single difference between one pair of fragments. The method is repeated for additional pairs of fragments and the mass-to-charge ratio data from a plurality of parallel mass spectra are integrated until the desired sequence information is obtained.
  • Aliquots of 1 ⁇ L were taken from the reaction vial at reaction times of 15 s, 60 s, 75 s, 105 s, 2 min, 135 s, 4 min, 5 min, 6 min, 7 min, 8 min, 9 min, 10 min, 15 min and 25 min. At 25 min, 15 ⁇ L of 5 ⁇ 10 -3 units/ ⁇ L CPY was added to the reaction vial.
  • a pooled peptide solution was prepared by combining 2 ⁇ L of the 15 s, 105 s, 6 min and 25 min aliquots. Into individual ⁇ L wells on the MALDI sample plate, 1 ⁇ L of each aliquot solution was placed and allowed to evaporate to dryness before insertion into the mass spectrometer.
  • All on-plate digestions were performed by pipetting 0.5 ⁇ L of the peptide at a concentration of 1 pmol/ ⁇ L into each of ten 1 ⁇ L wells across one row of a sample plate configured similarly to the sample plate manufactured and supplied by PerSeptive BioSystems, Inc. of Framingham, Mass. and adapted for use with their trademarked mass spectrometry apparatus known as VoyagerTM. All peptides listed in Table 1 were purchased from Sigma and were of the highest purity offered. To initiate the reaction in the first well, 0.5 ⁇ L of 0.0122 units/ ⁇ L CPY was added.
  • MALDI-TOF mass analysis was performed using the VoyagerTM BiospectrometryTM Workstation (PerSeptive Biosystems, Cambridge, Mass.). A 28.125 KV potential gradient was applied across the source containing the sample plate and an ion optic accelerator plate in order to introduce the positively charged ions to the 1.2 m linear flight tube for mass analysis.
  • a low mass gate was used to prevent the matrix ions from striking the detector plate.
  • the guide wire was pulsed for a brief period deflecting the low mass ions (approximately ⁇ 1000 daltons). All other spectra were recorded with the low mass gate off.
  • the statistical protocol disclosed herein uses the equation for the two-tailed t-test: ##EQU1## where x is the average experimental mean, ⁇ is the asserted mean, n is the number of replicates and S is the experimental standard deviation.
  • x is the average experimental mean
  • is the asserted mean
  • n is the number of replicates
  • S is the experimental standard deviation.
  • FIG. 2 illustrates the MALDI spectra of the 1 min, 5 min and 25 min time aliquots that were removed from a solution-phase time-dependent CPY digestion of ACTH 7-38 fragment.
  • the nomenclature of the peak labels denotes the peptide populations resulting from the loss of the indicated amino acids. Peaks representing the loss of 19 amino acids from the C-terminus are observed.
  • FIG. 2A shows that 9 detectable peptide populations exist including the intact ACTH 7-38 fragment and peptides representing the loss of the first 8 amino acids from the C-terminus.
  • the 5 min aliquot shows that the peptide populations representing the loss of Ala(32) and Ser(31) have become much more predominant than the 1 min aliquot. Amino acid losses of 11 residues, Ala(32) through Val(22), are present at this digestion time.
  • FIG. 2C shows the final detected amino acids of Lys(21) and Val(20) as 4 major peptide populations are detected.
  • the prior-art time-dependent method presented herein is the result of extensive method optimization and is optimized for obtaining the maximum sequence information in the shortest amount of time. For this particular optimized case, detectable amounts of all populations were observed over 25 min in the three selected time aliquots. This was not the case for numerous preliminary solution-phase digestions that were performed during the method optimization that led to the choice of these optimized conditions. At higher concentrations of CPY the peaks representing the loss of Glu(28) and Pro(24) were often not observed, indicating that CPY cleaves these residues very readily when alanine and tyrosine are at the penultimate positions, respectively.
  • MALDI analysis shows that a peptide ladder is formed that contains peaks that represent the loss of almost all amino acids from the C-terminus (FIG. 3). All amino acid losses are observed except for those of Glu(28), Asn(25), and Pro(24) which were present as small peaks in the 6 min aliquot and subsequently diluted to undetectable concentrations in this pooled fraction.
  • a sequence gap is observed here as the peptide populations representing the loss of Glu(28), Asn(25) and Pro(24) exist below a signal-to-noise ratio of 3. These populations were observed as small peaks in the 6 min aliquot mass spectrum but, upon the 4-fold dilution with the other aliquots, exist in too small a concentration to be detected. This emphasizes the necessity of recording individual mass spectra for each time aliquot. The less time-demanding procedure of recording a single spectrum representing pooled results not only created sequence gaps, but lost the time-dependent history of the digestion.
  • solution-phase digestion suffers from a number of disadvantages.
  • a large amount of time, enzyme and peptide is required for method optimization in order to obtain significant digestion in a short amount of time while preserving all possible sequence information.
  • For each peptide from which sequence information is to be derived some time-consuming method development must be performed since a set of optimum conditions for one peptide is not likely to be useful for another peptide given the composition-dependent hydrolysis rates of CPY.
  • An alternative strategy is to perform the concentration-dependent hydrolysis on the MALDI sample surface as described below.
  • FIG. 1 depicts a VoyagerTM sample plate for MALDI analysis comprised of a 10 ⁇ 10 matrix of 1 ⁇ L wells etched into the stainless steel base. These wells serve as micro-reaction vessels in which on-plate digestions may be performed. The physical dimensions of the plate are 57 ⁇ 57 mm and the wells are 2.54 mm in diameter.
  • MALDI spectra corresponding to the on-plate concentration dependent digestions of the ACTH 7-38 fragment for CPY concentrations of 6.10 ⁇ 10 -4 , and 1.53 ⁇ 10 -3 units/ ⁇ L, respectively, are illustrated in panels A and B of FIG. 4.
  • Panel A and B show the spectra obtained from digests using CPY concentrations of 6.10 ⁇ 10 -4 and 1.53 ⁇ 10 -3 units/ ⁇ L, respectively.
  • Laser powers significantly above threshold were used to improve the signal-to-noise ratio of the smaller peaks in the spectrum at the expense of peak resolution.
  • the symbol * indicates doubly charged ions and # indicates an unidentified peak at m/z-2517.6 daltons.
  • the lower concentration digestion yielded 12 significant peaks representing the loss of 11 amino acids from the C-terminus.
  • the digestion from the higher concentration of CPY showed some overlap of the peptide populations present at the lower concentration as well as peptide populations representing the loss of amino acids through the Val(20).
  • the concentration of the peptides representing the loss of the first few amino acids have decreased to undetectable levels (approximately ⁇ 10 fmol) with the exception of the Leu(37) peak.
  • FIG. 4 represents 2 of the 9 CPY concentrations that were performed simultaneously.
  • the method optimization in this case, was inherent in the strategy.
  • the total time of method development (optimal digestion conditions), digestion, data collection and data analysis was under 30 min using this on-plate approach.
  • the bolded amino acids indicate that a peak representing the loss of that residue was observed in one or more of the MALDI spectra taken across the row of digestions. In order to be able to identify a residue, the peak representing the loss of that amino acid and the preceding amino acid must be present.
  • the residues that are enclosed in parenthesis are those for which the sequence order could not be deduced.
  • CPY offered some sequence information from the C-terminus for most of the peptides digested, lending no sequence information in only three of the 22 cases. In two of these three cases, the C-terminus was a lysine followed by an acidic residue at the penultimate position. CPY has been reported to possess reduced activity towards basic residues at the C-terminus, and the presence of the neighboring acidic residue seems to further reduce its activity. In the case of the lutenizing hormone releasing hormone (LH-RH), the C-terminal amidated glycine followed by proline at the penultimate position inhibited CPY activity which agrees with reports of CPY slowing at both proline and glycine residues (Hayashi et al.
  • CPY is known to hydrolyze amidated C-terminal residues of dipeptides and is shown here to cleave those of physalaemin, kassinin, subtance P, bomesin, and ⁇ -MSH.
  • CPY was able to derive sequence information from all of the peptides, except LH-RH, that possess blocked N-terminal residues (physalaemin, bombesin and ⁇ -MSH). This is significant as these peptides would lend no information to the Edman approach. A number of the peptides were sequenced until the detection of the truncated peptide peaks were impaired by the presence of CHCA matrix ions ( ⁇ 600 daltons). The sequencing of the other peptides did not go as far as a combination of residues at the C-terminus and penultimate position that inhibited CPY activity were encountered.
  • FIG. 5 shows selected on-plate digestions of osteocalin 7-19 fragment, angiotensin 1 and bradykinin resulting from on-plate digestions using CPY concentrations of 3.05 ⁇ 10 -3 , 3.05 ⁇ 10 -4 , and 6.10 ⁇ 10 -4 units/ ⁇ L, respectively.
  • Na denotes a sodium adduct peak
  • # denotes a matrix peak at m/z-568.5 daltons.
  • Bradykinin is shown to sequence until the matrix begins to interfere with peak detection. For all three of the selected peptides, the total sequence information obtained for the overall 9 well digestion is represented in the single digestion shown. For many other peptides this was not the case. The total sequence information is often derived from 2 or more of the wells as is the case with ACTH 7-38 fragment given in FIG. 4.
  • the interpretation of data utilized an automated process of acquiring and interpreting the data using software feedback control.
  • the data interpretation software controls the number of acquisitions (minimum of 2) that are required to statistically differentiate multiple candidates for an amino acid assignment.
  • the operator has control of specifying to what minimum statistical level of confidence the assignment(s) should meet.
  • Table 2 represents a comparison of the actual average masses of the sequenced residues of the ACTH 7-38 fragment and the experimental mass differences with associated standard deviations and 95% confidence intervals calculated for the time-dependent digestion.
  • the number of replicates indicate the number of spectra that possessed the detectable adjacent peaks required for the mass difference measurement of that particular residue.
  • the need for a significant number of measurements in order to estimate the mean is obvious from the table as the 95% confidence level decreases as the square root of the number of measurements.
  • the actual mass fell within ⁇ 3 ⁇ the experimental mass distribution. Calculated t-values for each case were less than the tabulated t-value for the 95% confidence interval signifying that the experimental mass is not significantly different than the actual known mass.
  • a calculated t-value for each possible amino acid must be compared with the tabulated value.
  • Table 3 represents calculated t-values for 19 sequenced amino acid experimental means in the ACTH 7-38 fragment given the asserted means of 20 common unmodified amino acids. The table value is given at the end of each column. A t calculated ⁇ t table indicates that the experimental mean is not significantly different that the mean of the asserted amino acid at 95% confidence interval. Each t calculated for which this is the case is indicated in bold.
  • Table 4 summarizes the results of the statistical amino acid assignments for the 19 amino acids sequenced from the C-terminus of ACTH 7-38 fragment using the prior art time-dependent strategy.
  • the masses of the listed amino acids could not be statistically differentiated from the experimentally derived mass difference at the given confidence levels.
  • the amino acids indicated in bold are the known residues existing at the given positions.
  • the confidence intervals indicated are the highest levels at which all amino acid masses other than those indicated are statistically different from the experimental mean.
  • Table 3 shows that, for this residue, the asserted amino acid mass that resulted in the smallest t calculated was that of methionine. Using a confidence interval of 80%, the correct assignment of Glu is deemed statistically improbable. Likewise, the assignment of residue 38 was made as Gln/Lys/Glu at a confidence level of 95%, but the correct assignment (Glu) is again statistically improbable at an 80% level.
  • mass shift reagents used to move peptide populations out of the interfering matrix are a possible chemical means for improving experimental error relating to peptides appearing in the low mass ( ⁇ 600 daltons) region.
  • the use of reflectron and/or extended flight tube geometries are also expected to be instrumental methods suitable for reducing this error.
  • the protocol disclosed herein for statistical assignment of residues using the on-plate strategy involves multiple sampling from each well in which digestion is performed.
  • the number of replicates required depends on the amino acid(s) that is(are) being sequenced at any one CPY concentration. For example, more replicates are required for mass differences around 113-115 daltons (Ile/Leu, Asn and Asp) and 128-129 daltons (Gln/Lys/Glu) than for mass differences around 163 (Tyr) or 57 (Gly) in order to be able to assure that all but one assignment are statistically unlikely.
  • the experimental errors for this method appear to be as random (multiple replicates per sample) as for the time-dependent digestion (one replicate per sample).
  • the method disclosed herein has also been used to obtain sequence information about a nucleic acid polymer containing 40 bases. Hydrolysis using an exonuclease specific for the 3' terminus was conducted using different concentrations of Phos I (phosphodiesterase I) ranging from 0.002 ⁇ U/ ⁇ l to 0.05 ⁇ U/ ⁇ l. Hydrolysis was allowed to proceed for 3 minutes. Spectra of hydrolyzed sequences using MALDI-TOF are depicted in FIGS. 6A-6E. Data integration as disclosed herein confirmed the sequence to be:
  • this strategy can be applied to the sequencing of any natural biopolymer such as proteins, peptides, nucleic acids, carbohydrates, and modified versions thereof.
  • the ladders can be created enzymatically using exohydrolases, endohydrolases or the Sanger method and/or chemically by truncation synthesis or failure sequencing.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • General Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Urology & Nephrology (AREA)
  • Biomedical Technology (AREA)
  • Hematology (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Pathology (AREA)
  • Cell Biology (AREA)
  • Spectroscopy & Molecular Physics (AREA)
  • Food Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Optics & Photonics (AREA)
  • Other Investigation Or Analysis Of Materials By Electrical Means (AREA)

Abstract

The methods and apparatus disclosed herein are useful for sequencing polymers using mass spectrometry. The methods involve differing ratios of hydrolyzing agent to polymer disposed upon a reaction surface adapted for use with a mass spectrometer. The methods further involve integrating data obtained from mass spectrometry analysis of a plurality of series of hydrolyzed polymer fragments, and optionally provide statistical interpretation paradigms and computer software therefor. The apparatus involves a mass spectrometer sample holder, having hydrolyzing agent disposed thereon, which is useful for adapting any mass spectrometer for polymer sequencing.

Description

This is a divisional of U.S. Ser. No. 08/796,598 filed on Feb. 7, 1997, now allowed, which is a continuation of U.S. Ser. No. 08/446,055 filed May 19, 1995, now abandoned.
FIELD OF THE INVENTION
The present invention relates generally to methods and apparatus for sequencing polymers, especially biopolymers, using mass spectrometry.
BACKGROUND OF THE INVENTION
Biochemists frequently depend on reliable and fast determinations of the sequences of biological polymers. For example, sequence information is crucial in the research and development of peptide screens, genetic probes, gene mapping, and drug modeling, as well as for quality control of biological polymers when manufactured for diagnostic and/or therapeutic applications.
Various methods are known for sequencing polymers composed of two essential biological building-blocks, amino acids, carbohydrates and nucleotides. For example, existing methods for peptide sequence determination include the N-terminal chemistry of the Edman degradation, N- and C-terminal enzymatic methods, and C-terminal chemical methods. Existing methods for sequencing oligonucleotides include the Maxam-Gilbert base-specific chemical cleavage method and the enzymatic ladder synthesis with dideoxy base-specific termination method. Each method possesses inherent limitations that preclude it being used exclusively for complete primary structure identification. To date, Edman sequencing and adaptations thereof are the most widely used tools for sequencing certain protein and peptides residue by residue, while the enzymatic synthesis method is preferred for sequencing oligonucleotides.
In the case of protein and peptide sequencing, C-terminal sequencing via chemical methods has proven particularly difficult while being only marginally effective, at best. (See, e.g., Spiess, J. (1986) Methods of Protein Characterization: A Practical Handbook (Shively, J. E. ed., Humana Press, N.J.) pp. 363-377; Tsugita et al. (1994) J. Protein Chemistry 13: 476-479). Consequently, the C-terminus remains a region often not analyzed because of lack of a dependable method.
In the case of both peptides and oligonucleotides, an alternate approach to chemical sequencing is enzymatic cleavage sequencing. In the case of oligonucleotides, over 150 different enzymes have been isolated and found suitable for preparing oligonucleotide fragments. In the case of peptides, serine carboxypeptidases have proven popular over the last two decades because they offer a simple approach by which amino acids can be sequentially cleaved residue by residue from the C-terminus of a protein or a peptide. Carboxypeptidase Y (CPY), in particular, is an attractive enzyme because it non-specifically cleaves all residues from the C-terminus, including proline. (See, e.g., Breddam et al. (1987) Carlsburg Res. Commun. 52: 55-63.)
Sequencing of peptides by carboxypeptidase digestion has traditionally been performed by a laborious, direct analysis of the released amino acids, residue by residue. Not only is this approach labor-intensive, but it is complicated by amino acid contaminants in the enzyme and protein/peptide solutions, as well as by enzyme autolysis. A further hindrance to any sequencing effort of this type is the absolute requirement for good kinetic information concerning the hydrolysis and liberation of each individual residue by the particular enzyme used.
With the advancement of mass spectrometric techniques capable of high mass analysis such as field desorption (Hong et al. (1983) Biomed. Mass Spectrom. 10: 450-457), electrospray (Smith et al. (1993) 4 Techniques Protein Chem. 463-470), and thermospray (Stachowiak et al. (1988) J. Am. Chem. Soc. 110: 1758-1765), it is possible to perform direct mass analysis on large biopolymers such as the peptide fragments resulting from CPY digestion in which the sequence order is preserved, circumventing the need for residue by residue amino acid analysis of the liberated amino acids. In this "ladder" sequencing approach, a sequence can be deduced, in the correct order, by simply calculating the mass differences between adjacent peptide peaks, the measured differences representing the loss of a particular amino acid residue.
More recently, matrix-assisted laser desorption ionization time-of-flight (MALDI-TOF) mass spectrometry also was shown to be suitable for ladder sequence analysis due to its high sensitivity, resolution, and mass accuracy. Chait et al. ((1993) 262 Science 89-92) exploited these assets of MALDI-TOF in the ladder sequencing of N-terminal ladders formed from partial blockage at each step of chemical digestion by the Edman degradation method. This approach, however, still suffers from the same limitations of traditional Edman chemistry including the complexity of the process, the time-consuming nature of the process, and the lack of C-terminal information, however, it confirms the utility of MALDI-TOF for sequencing peptides using the peptide ladder scenario. Other researchers have also illustrated that carboxypeptidase digestion of peptides can be combined with MALDI-TOF to analyze the resulting mixture of truncated peptide. For example, eight consecutive amino acids have been sequenced from the C-terminus of human parathyroid hormone 1-34 fragment (Schar et al. (1991) Chimia 45: 123-126). Additionally, carboxypeptidase digestion of peptides has been combined with other mass spectrometry methods such as plasma desorption (Wang et al. (1992) Techniques Protein Chemistry III (ed., R. H. Angeletti; Academic Press, N.Y.) pp. 503-515).
All of the above-described sequencing approaches, however, require preliminary optimization steps which are both tedious and time-consuming. Additionally, such preliminary optimization steps unnecessarily consume reagents as well as samples of polymer, usually available in limited quantities. Furthermore, the above-described sequencing approaches ultimately rely on a single mass spectrum and single mass-to-charge ratio data point, which can result in a statistically insufficient basis for determining a final polymer sequence.
It is an object of the present invention to provide methods and apparatus for sequencing polymers, particularly biopolymers, using mass spectrometry and time-independent/concentration-dependent hydrolysis of the polymer. It is an object of the present invention to also provide a rapid method for obtaining sequence information by circumventing the time-consuming optimization and method enhancement required by prior art methods. It is a further object of the present invention to provide sequence information using reduced quantities of total polymer by combining the sensitivity of mass spectrometry with elimination of sample loss by closely integrating hydrolysis with mass spectrometry analysis. It is another object of the present invention to provide a method for obtaining sequence information that incorporates a data interpretation strategy based on integrating mass-to-charge ratio data obtained from a plurality of parallel mass spectra.
SUMMARY OF THE INVENTION
The invention involves a novel form of sample holder for a mass spectrometer. The sample holder comprises a reaction surface with spatially separate areas having differing ratios of polymer and hydrolyzing agent. After a suitable incubation period during which the hydrolyzing agent hydrolyzes inter-monomer bonds within the polymer in each area, a plurality, typically all, of the areas containing hydrolyzed polymer fragments are ionized, typically serially, in the mass spectrometer and data representative of the mass to charge ratios of these fragments are obtained. One or more of the areas will have ratios of hydrolyzing agent to polymer suitable for more or less optimal generation of useful ladder elements or other polymer fragments. Some areas on the sample holder may have overly hydrolyzed polymer fragments useless for deriving sequence information. Other areas may contain substantially unhydrolyzed polymer. By mass spectrometry analysis of all areas, however, at least some mass to charge ratio data obtained from fragments generated in one or more areas which will contain useful data from which sequence information can be derived. Thus, by integrating the data from different areas, the method of the invention obviates the necessity to empirically prepare samples to ascertain the appropriate ratio of hydrolyzing agent to polymer, as well as optimal reaction time and carefully controlled reaction temperature, heretofore required. Furthermore, different hydrolyzing agents can be used in different series of areas on the sample holder so as to further generate useful hydrolyzed fragments, and the data from these may also be integrated to improve the sequencing process. If data analysis is implemented by a computer program, the whole process can be completed minutes after completion of the above-described incubation.
In one aspect, the present invention provides a method of obtaining sequence information about a polymer comprising a series of different monomers which involves: on a reaction surface, providing at least one amount of a hydrolyzing agent which hydrolyzes said polymer and breaks inter-monomer bonds, and a sample of polymer to form differing ratios of agent to polymer; incubating the same for a time sufficient to obtain a plurality of series of hydrolyzed polymer fragments; performing mass spectrometry on a plurality of the series to obtain mass-to-charge ratio data for hydrolyzed polymer fragments contained in the series; and integrating data from a plurality of the series to obtain sequence information characteristic of the polymer sample.
With regard to the aforementioned polymer, the instant invention contemplates both naturally-occurring and synthetic moieties characterized by a series of different monomers. In certain embodiments, the polymer is modified as described herein.
The method of the instant invention contemplates certain embodiments having hydrolyzing agents capable of hydrolyzing a polymer to form sequence-defining ladders, as well as certain other embodiments having hydrolyzing agents capable of forming polymer maps. In yet other embodiments, the instant invention provides for hydrolyzing the polymer with combinations of such agents. The instant method contemplates embodiments involving enzymatic as well as non-enzymatic hydrolyzing agents.
In one embodiment, the method provides that the hydrolyzing agent is disposed on the reaction surface in an array of discrete separate zones. In another embodiment, the hydrolyzing agent is disposed as a gradient. In yet another embodiment, the agent is disposed on the reaction surface in a constant amount. In other embodiments, polymer is similarly disposed on the reaction surface. In all embodiments, differing agent to polymer ratios are disposed upon the reaction surface and incubated to obtain a plurality of series of hydrolyzed polymer fragments. The various manners in which such differing ratios can be accomplished will be obvious to the skilled practioner.
In certain embodiments, the method provides combining the agent and polymer with other useful moieties. In one embodiment, moieties which selectively shift the mass of hydrolyzed fragments prior to mass spectrometry analysis are included. In another embodiment, moieties capable of improving ionization of hydrolyzed fragments are included. In yet another embodiment, the method provides for including a light-absorbent matrix. The instant method also contemplates embodiments in which any one or more of the above-described moieties are combined with the agent and polymer prior to mass spectrometry analysis.
It is further contemplated that the reaction surface is fabricated from a variety of substrates and assumes a variety of configurations suitable for use with a mass spectrometer. When practiced as disclosed herein, the method of the instant invention can be adapted to all manner of ion formation and all modes of mass analysis.
In another aspect, the present invention provides a mass spectrometer sample holder having a planar solid surface with at least one amount of a hydrolyzing agent capable of hydrolyzing a polymer disposed thereon. In one embodiment, the hydrolyzing agent is disposed on the reaction surface in a dehydrated form. In another embodiment, the hydrolyzing agent is immobilized on the reaction surface. In yet another embodiment, the hydrolyzing agent is disposed on the reaction surface in the form of a liquid or gel which is resistant to physical dislocation. In other embodiments, a light-absorbent matrix is disposed on the surface of the sample holder. Additionally, any one or more of such embodiments of the sample holder may further have microreaction vessels on their surface. Other embodiments of the sample holder of the instant invention are disposable.
As disclosed herein, all embodiments of the sample holder of the present invention are useful to adapt a mass spectrometry apparatus for obtaining sequence information about a polymer comprising a series of different monomers.
The method of obtaining sequence information in accordance with the instant invention solves problems encountered with conventional polymer sequence methodologies. For example, when conducting exopeptidase digestions in accordance with the instant method, the overall polymer sequencing effort is superior to the prior art time-dependent digestions in terms of: inherent simplicity of the method and elimination of laborious optimization requirements; reduced loss of sample due to transfer from reaction vessel to reaction surface; reduced amounts of enzyme and peptide used; and, particularly important for large-scale application, ease of use/automation.
Similarly, the mass spectrometry sample holder of the instant invention provides advantages heretofore unavailable to the skilled practitioner. For example, the sample holder minimizes reagent handling and greatly facilitates sample processing. The skilled practitioner need only provide a sample of polymer. Virtually all other experimental parameters are pre-optimized.
The foregoing and other objects, features and advantages of the present invention will be made more apparent from the following detailed description of preferred embodiments of the invention.
BRIEF DESCRIPTION OF THE DRAWINGS
The foregoing and other objects, features and advantages of the present invention, as well as the invention itself, will be more fully understood from the following description of preferred embodiments, when read together with the accompanying drawings, in which:
FIG. 1 depicts a sample plate known in the prior art which can be adapted for MALDI-TOF analysis of polymer sequences by practicing the methods of the present invention and disposing hydrolyzing agent thereon to achieve differing ratios of agent to polymer in each well.
FIGS. 2A, 2B, and 2C depict several MALDI Spectra from a time-dependent CPY digestion of ACTH 7-38 fragment PheArgTrpGlyLysProValGlyLysLysArgArgProValLysValTyrProAsnGlyAlaGluAspGluSerAlaGluAlaPheProLeuGlu! (SEQ. ID. NO: 22), at 1 min (2A), 5 min (2B) and 25 min (2C).
FIG. 3 is a MALDI mass spectrum representing pooled 15 s, 105 s, 6 min and 25 min quenched aliquots.
FIGS. 4A and 4B depict various MALDI spectra from on-plate digestions of ACTH 7-38 fragment at various concentrations of Carboxypeptidase Y (CPY): 6.10.×10-4 U/μl (4A); 1.53×10-3 /Uμl (4B).
FIGS. 5A, 5B, and 5C depict various MALDI spectra of the following three selected peptides: osteocalcin 7-19 fragment GlyAlaProValProTyrProAspProLeuGluProArg! (SEQ. ID. NO:13) (5A), angiotensin 1 AspArgValTyrIleHisProPheHisLeu! (SEQ. ID. NO:8) (5B), and bradykinin ArgProProGlyPheSerProPheArg! (SEQ. ID. NO:5) (5C).
FIGS. 6A-6E depict various MALDI spectra of exonuclease hydrolysis of a nucleic acid polymer (SEQ. ID. No. 23) at various concentrations of Phosphodiesterase I (Phos I): 0.002 μU/μl (6A); 0.005 μU/μl (6B); 0.01 μU/μl (6C); 0.02 μU/μl (6D); 0.05 μU/μl (6E).
FIG. 7 depicts a MALDI spectrum of a hydrolyzed nucleic acid polymer (SEQ. ID. NO:13) combined with a light-absorbent matrix.
DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS
As will be described below in greater detail, the instant invention relates to methods and apparatus for sequencing polymers using mass spectrometry. Specifically, the methods and apparatus utilize polymers and hydrolyzing agents disposed upon a reaction surface. The hydrolyzing agents are enzymatic or non-enzymatic. The hydrolyzing agents react with the polymer to produce sequence-defining polymer ladders or polymer maps. The methods of this invention further involve the step of obtaining mass spectrometry data relating to hydrolyzed polymer series and integrating the data from a plurality of polymer series to determine the polymer sequence. The mass spectrometry method of this invention is applicable to all manner of ion formation and all modes of mass analysis. The apparatus of this invention relates to a mass spectrometer sample holder for adapting a mass spectrometer to obtain sequence information about a polymer in accordance with the method of the instant invention. Specifically, the apparatus has disposed thereon hydrolyzing agent, in dehydrated, immobilized, liquid and/or gel form, and/or a light-absorbent matrix. Optionally, the apparatus of the instant invention is disposable.
As used herein, a "polymer" is intended to mean any moiety comprising a series of different monomers suitable for use in the method of the instant invention. That is, any moiety comprising a series of different monomers whose intermonomer bonds are susceptible to hydrolysis are suitable for use in the method disclosed herein. For example, a peptide is a polymer made up of particular monomers, i.e., amino acids, which can be hydrolyzed by either enzymatic or chemical agents. Similarly, a DNA is a polymer made up of other monomers, i.e., bases, which can be hydrolyzed by a variety of agents.
A polymer can be a naturally-occurring moiety as well as a synthetically-produced moiety. In a currently preferred embodiment, the polymer is a biopolymer selected from, but not limited to, the following group: proteins, peptides, DNAs, RNAs, PNAs (peptide nucleic acids), carbohydrates, and modified versions thereof.
"Sequence information" as used herein is intended to mean any information relating to the primary arrangement of the series of different monomers within the polymer, or within portions thereof. Sequence information includes information relating to the chemical identity of the different monomers, as well as their particular position within the polymer. Polymers with known primary sequences, as well as polymers with unknown primary sequences, are suitable for use in the methods of the instant invention. It is contemplated that sequence information relating to terminal monomers as well as internal monomers can be obtained using the methods disclosed herein. In certain applications, sequence information can be obtained using a sample of an intact, complete polymer. In other applications, sequence information can be obtained using a sample containing less than the intact complete polymer, for example, polymer fragments. Such fragments can be naturally-occurring, artifacts of isolation and purification, and/or generated in vitro by the skilled artisan. Additionally, polymer fragments can be initially derived from and prepared by a variety of fractionation and separation methods, such as high performance liquid chromatography, prior to use with the methods of the instant invention.
The "reaction surface" of the instant method includes any surface suitable for hydrolyzing the subject polymer with the subject agent. The reaction surface can be fabricated from a variety of substrates, such as but not limited to: metals, foils, plastics, ceramics, and waxes. All reaction surfaces must be suitable for use with a mass spectrometer apparatus. The reaction surface of the instant invention can assume any configuration suitable for use with a particular mass spectrometer apparatus. For example, the reaction surface can be a planar solid surface. Alternatively, the surface may have microreaction vessels disposed thereon. In yet another embodiment, the reaction surface can assume the configuration of a probe suitable for use with certain mass spectrometer apparatus. In some embodiments, the skilled artisan will appreciate that the reaction surface can be activated and/or derivatized to enhance or facilitate polymer sequencing in accordance with the instant invention.
As used herein, the term "hydrolyzing agent" is intended to mean any agent capable of disrupting inter-monomer bonds within a particular polymer. That is, any agent which can interrupt the primary sequence of a polymer is suitable for use in the methods disclosed herein. Hydrolyzing agents can act by liberating monomers at either termini of the polymer, or by breaking internal bonds thereby generating fragments or portions of the subject polymer. Generally, a preferred hydrolyzing agent interrupts the primary sequence by cleaving before or after a specific monomer(s); that is, the agent specifically interacts with the polymer at a particular monomer or particular sequence of monomers recognized by the agent as the preferred hydrolysis site within the polymer. All of the currently preferred hydrolyzing agents described herein are commercially available from reagent suppliers such as Sigma Chemicals (St. Louis, Mo.).
In some preferred embodiments, an excipient is added to, and used in conjunction with, the hydrolyzing agent. The excipients contemplated herein facilitate lyophilization and/or dissolution of the hydrolyzing agent. For example, fucose and other sugars suitable for use with the instant invention are contemplated. Suitable for use is intended to mean that no interference with mass spectrometry is encountered by the use thereof. Other excipients useful in the instant invention are pH modifiers, such as ammonium acetate. Still other excipients suitable for use in the methods and apparatus disclosed herein are those which act as stabilizers of the integrity of the hydrolyzing agent. With respect to excipients, the identity of those suitable will be obvious to the skilled artisan using only routine experimentation. While certain preferred excipients are described above, identification of suitable equivalents is within the skill of the ordinary artisan.
In one currently preferred embodiment, the hydrolyzing agent is a hydrolase enzyme. Some hydrolases are endohydrolases, others are exohydrolases. The particular hydrolase used is determined by the nature of the polymer and/or the type of sequence information desired. Its identity can be readily determined by the skilled artisan using no more than routine experimentation. For example, currently preferred endohydrolases include but are not limited to: endonucleases, endopeptidases, endoglycosidases, trypsin, chymotrypisin, endoproteinase Lys-C, endoproteinase Arg-C, and thermolysin. Currently preferred exohydrolases include but are not limited to: exonucleaes, exoglycosidases, and exopeptidases. The currently preferred exonucleases include, but are not limited to: phosphodiesterase types I and II, exonuclease VII, λ-exonuclease, T7 gene 1 exonuclease, exonuclease III, BAL-31, exonuclease I, exonuclease V, exonuclease II, and DNA polymerase III. The currently preferred exoglycosidases include, but are not limited to: α-mannosidase I, α-mannosidase, β-hexosaminidase, β-galactosidase, α-fucosidase I, α-fucosidase II, α-galactosidase, α-neuraminidase, α-glucosidase I and α-glucosidase II. The currently preferred exopeptidases include, but are not limited to: carboxypeptidase Y, carboxypeptidase A, carboxypepetidase B, carboxypeptidase P, aminopeptidase 1, leucine amino peptidase, proline aminodipeptidase, and cathepsin C.
In certain other embodiments, the hydrolyzing agent is an agent other than an enzyme. For example, such an agent can be a chemical, such as an acid. Currently preferred agents other than an enzyme include but are not limited to: cyanogen bromide, hydrochloric acid, sulfuric acid, and pentafluoroproprionic fluorohydride. In some embodiments, hydrolysis can be accomplished using partial acid hydrolysis in accordance with the methods disclosed herein. Again, the identity of a hydrolyzing agent other than an enzyme will be determined by the nature of the polymer and the type of sequence information desired. It is within the skilled practitioner's ability to identify a suitable agent, as well as the circumstances under which such an agent is preferred.
The instant method further provides for use of combinations of the above-described individual hydrolyzing agents. For example, combinations of enzymes can be used in the claimed invention. Combinations of hydrolyzing agents other than enzymes can also be used. Furthermore, combinations of enzymes with agents other than enzymes can also be used in the instant method. Again, the exact combination and the circumstances under which such a combination is appropriate will depend upon the nature of the polymer and the sequence information desired. The skilled practitioner will know when combinations of hydrolyzing agents are suitable for use in the methods disclosed herein.
Numerous examples of hydrolyzing agent/polymer sequence-specific interactions are well known in the art. For example, as described above, currently preferred polymers such as proteins and DNAs specifically interact with proteinases and nucleases, respectively. Certain of the preferred proteinases specifically recognize the C-terminus (carboxypeptidase Y) or the N-terminus (amino peptidase 1) of a protein's amino acid sequence. Certain of the preferred nucleases specifically recognize the 5' or the 3' terminus of a polynucleotide's base sequence. Some nucleases recognize single-stranded polynucleotides; others recognize double-stranded polynucleotides while still others recognize both.
In accordance with the instant invention, such exohydrolases generate a series of hydrolyzed fragments comprising a sequence-defining "ladder" of the polymer. That is, these agents generate a series of hydrolyzed fragments, each hydrolyzed fragment within the series being a "ladder element," which collectively comprise a sequence-defining "ladder" of the polymer. Ladder elements represent hydrolyzed fragments from which monomers have been consecutively and/or progressively liberated by the exohydrolase acting at one or the other of the polymer's termini. Accordingly, ladder elements are truncated hydrolyzed polymer fragments, and ladders per se are concatenations of these collective truncated hydrolyzed polymer fragments. In this manner, for example, sequence information relating to the amino acid sequence of a protein can be obtained using carboxypeptidase Y, an agent which acts at the carboxy terminus. By using the methods disclosed herein to generate a series of protein hydrolysates related one to the other by consecutive, repetitive liberation of amino acid residues, the skilled artisan can reconstruct the primary sequence of the intact protein polymer as described in further detail below.
Similarly, hydrolyzing agents other than exohydrolases which also act at one or the other of a polymer's termini generate ladder elements which collectively comprise a series of sequence-defining ladders. For example, the well-known Edman degradation technique and associated reagents can be adapted for use with the methods of the instant invention for this purpose. Thus the above-described subtractive-type sequencing method, through which repetitive removal of successive amino-terminal residues from a protein polymer can occur, can also be accomplished with hydrolyzing agents other than enzymes as disclosed herein.
As previously described, sequence information can also be obtained using hydrolyzing agents which act to disrupt internal inter-monomer bonds. For example, an endohydrolase can generate a series of hydrolyzed fragments useful ultimately in constructing a "map" of the polymer. That is, this agent generates a series of related hydrolyzed fragments which collectively contribute information to a sequence-defining "map" of the polymer. For example, peptide maps can be generated by using trypsin endohydrolysis in tandem with cyanogen bromide endohydrolysis to obtain hydrolyzed fragments with overlapping amino acid sequences. Such overlapping fragments are useful for reconstructing ultimately the entire amino acid sequence of the intact polymer. For example, this combination of hydrolyzing agents generates a useful plurality of series of hydrolyzed fragments because trypsin specifically catalyzes hydrolysis of only those peptide bonds in which the carboxyl group is contributed by either a lysine or an arginine monomer, while cyanogen bromide cleaves only those peptide bonds in which the carbonyl group is contributed by methionine monomers. Thus, by using trypsin and cyangogen bromide hydrolysis in tandem, one can obtain two different series of hydrolyzed "mapping" fragments. These series of mapping fragments are then examined by mass spectrometry to identify specific hydrolysates from the second cyanogen bromide hydrolysis whose amino acid sequences establish continuity with and/or overlaps between the specific hydrolysates from the first hydrolysis with trypsin. Overlapping sequences from the second hydrolysis provide information about the correct order of the hydrolyzed fragments produced by the first trypsin hydrolysis. While these general principles of peptide mapping are well-known in the prior art, utilizing these principles to obtain sequence information by mass spectrometry as disclosed herein has heretofore been unknown in the art.
It will be obvious to the skilled artisan that certain sequencing determinations will be best accomplished using the above-described ladder scenario, while others will be better suited to the mapping scenario. In some situations, a combination of the ladder and mapping sequencing methodologies taught herein will provide optimum sequence information. Using only routine experimentation, the skilled artisan will be able to obtain optimum sequence information using the ladder and/or mapping methods in conjunction with mass spectrometry analysis of a plurality of the series of hydrolyzed polymer fragments.
As contemplated by the instant method, a sample of polymer includes biological fluids containing (or suspected to contain) the polymer of interest. As used herein, a sample of polymer is also intended to include isolated and purified polymer. Additionally, a sample of polymer can be aqueous or non-aqueous.
Adding a sample of polymer to the reaction surface can be accomplished in a variety of ways. For example, the sample can be introduced as individual aliquots, or the sample can be introduced in a continuous mode such as sample eluting from a preparative or qualitative column. In both cases, the sample can be introduced manually or by automated means.
Upon adding a sample of polymer and hydrolyzing agent to the reaction surface, the instant method provides that differing concentrations of agent or ratios of agent to polymer are formed on said reaction surface. For example, if the polymer sample contains a uniform amount of polymer, then the method contemplates that differing amounts of agent be disposed on the reaction surface. This would produce differing agent to polymer ratios. The differing amounts of agent can be in the form of discrete separate zones to which a constant amount of polymer is added. Alternatively, the differing amounts of agent can be in the form of a non-discrete gradient of agent ranging from low to high amounts of agent, perhaps in the form of strip of appropriate length and width. By introducing a strip of polymer of equal length and width which contains a constant amount of polymer, differing agent to polymer ratios are produced. As contemplated herein, the agent and polymer can assume any configuration and be present in any amount(s); all that is required is that the combination of agent and polymer results in differing ratios of the same disposed on the reaction surface. It will be obvious to the skilled artisan that differing ratios of agent to polymer can also be accomplished by disposing a constant amount of agent on the reaction surface and adding varying amounts of polymer, e.g., a polymer gradient or discrete separate zones of differing amounts of polymer or polymer solution. In the case of a polymer gradient, polymer eluted from a column in the form of a gaussian-distributed gradient is currently preferred.
The instant method further provides for incubating the above-described agent to polymer ratios for a time required to obtain the requisite plurality of series of hydrolyzed polymer fragments. Incubating can proceed under any conditions suitable for hydrolyzing the polymer and for any amount of time required to obtain a plurality of series of hydrolyzed fragments. Generally speaking, the disclosed methods permit sequencing information to be obtained in relatively short time periods, for example, in less than 1 hour. The incubation time, however, can be shortened or lengthened depending upon the nature of the polymer and/or hydrolyzing agent(s). It will be obvious to one skilled in the art how to identify appropriate incubation times and optimize the same. Incubation reactions can be terminated by evaporation.
As used herein, a "plurality of series" of hydrolyzed polymer fragments is intended to mean that hydrolyzed fragments are produced by at least two different agent:polymer ratios, and that each agent:polymer ratio generates a series of hydrolyzed fragments. For example, if a constant amount of polymer is added to two separate zones of agent containing different amounts of agent, each zone represents one agent:polymer ratio and each zone produces one series of hydrolyzed fragments. When taken together, the two zones are a plurality which collectively contain a plurality of series of hydrolyzed polymer fragments.
The method disclosed herein teaches obtaining sequence information by performing mass spectrometry on a plurality of series of hydrolyzed fragments to obtain mass-to-charge ratio data for hydrolyzed polymer fragments contained therein. As already discussed, this contemplates that at least two different agent:polymer ratios be provided and analyzed by mass spectrometry.
Any manner of ion formation can be adapted for obtaining mass-to-charge ratio data, including but not limited to: matrix-assisted laser desorption ionization, plasma desorption ionization, electrospray ionization, thermospray ionization, and fast atom bombardment ionization. Additionally, any mode of mass analysis is suitable for use with the instant invention including but not limited to: time-of-flight, quadrapole, ion trap, and sector analysis. A currently preferred mass spectrometer instrument is an improved time-of-flight instrument which allows independent control of potential on sample and extraction elements, as described in copending U.S. Ser. No. 08/446,544 (Atty. Docket No. SYP-111) filed on even date herewith now U.S. Pat. No. 5,625,184 and which is herein incorporated by reference.
As disclosed herein, mass-to-charge ratio data are obtained using a plurality of series of hydrolyzed fragments. Thus, as discussed earlier, hydrolyzed fragments from at least two different agent:polymer ratios are provided to obtain mass-to-charge ratios by mass spectrometry. Similarly, the mass-to-charge ratio data from at least two different agent:polymer ratios are integrated to obtain the sequence information characteristic of the polymer. As discussed in further detail below, integrating data in accordance with the instant invention to obtain sequence information is more accurate, efficient, and rapid than sequence methods heretofore known in the art.
The method of the instant invention also provides for including moieties useful in mass spectrometry. For example, a light-absorbent matrix can be introduced at any point prior to performing mass spectrometry analysis by laser desorption. Light-absorbent matrices are particularly useful for analysis of biopolymers. Matrix-assisted laser desorption ionization techniques, as well as various matrices suitable therefor, are well known in the art and have been described, for example, in U.S. Pat. No. 5,288,644 (issued Feb. 22, 1994) and U.S. Ser No. 08/156,316 (Atty. Docket No. Vestec-14-2, allowed Apr. 18, 1995 now U.S. Pat. No. 5,453,247), the disclosures of which are herein incorporated by reference.
Other moieties useful in the instant method include those capable of selectively shifting the mass of certain hydrolyzed fragments. These, too, can be added at any point prior to mass spectrometry analysis. Currently preferred mass-shifting moieties include, but are not limited to, those moieties which produce reaction products such as: alkyl, aryl, alkenyl, acyl, thioacyl, oxycarbonyl, carbamyl, thiocarbamyl, sulfonyl, imino, guanyl, ureido, and silyl reaction products. Attachment of such moieties to hydrolyzed polymers is achieved using art-recognized attachment chemistries. The particular moiety best suited to a particular sequence determination will depend upon the nature of the polymer and the hydrolyzed fragments. The skilled artisan will be able to determine which moiety to use, if any.
Another group of moieties suitable for use with the instant method are those which can improve ionization of hydrolyzed fragments. Such moieties can be introduced at any time prior to mass spectrometry analysis. Currently-preferred ionization-improving moieties include, but are not limited to, those moieties which produce reaction products such as: amino, quarternary amino, pyridino, imidino, guanidino, oxonium, and sulfonium reaction products. Preparation and/or use of such moieties are well known in the art.
In another aspect, the instant invention provides a mass spectrometer sample holder. The instant sample holder is useful for adapting any mass spectrometer apparatus for obtaining sequence information in accordance with the disclosed methods. In one currently preferred embodiment, the sample holder has a planar solid surface on which is disposed hydrolyzing agent. In another currently preferred embodiment, the sample holder has the form of a probe useful in certain mass spectrometer apparatus. In all embodiments of the sample holder, the agent can be in dehydrated, immobilized, liquid and/or gel form. In embodiments having agent in liquid or gel form, the agent is resistant to physical dislocation and is chemically stable for at least about one to two months, thereby facilitating both transport and storage. These considerations are particularly useful for commercial applications involving the sample holder of the present invention. Furthermore, the agent can be disposed in separate discrete zones of differing amounts, or in a non-discrete gradient. Alternatively, the agent can be disposed in a constant amount on the surface of the sample holder. In other embodiments, the sample holder has a light-absorbent matrix disposed on its surface; this can be with or without hydrolyzing agent.
The sample holder can also have microreaction vessels arranged on its surface. In one embodiment, these vessels can be depressions on the holder's surface resulting from chemical-etching or similar techniques. The sample holder can be fabricated from a variety of substrates including but not limited to: metals, foils, plastics, ceramics, and waxes. In certain embodiments, the sample holder is disposable. In certain other embodiments, the sample holder disclosed herein is a component of a kit useful for sequencing polymers by mass spectrometry, such as that disclosed in co-pending U.S. Ser. No. 08/447,175 (Atty. Docket No.: SYP-114) filed on even date herewith and herein incorporated by reference.
The instant invention also relates to a method of data analysis of the mass-to-charge ratios obtained by mass spectrometry. As described in further detail below (and in co-pending U.S. Ser. No. 08/447,175, (Atty. Docket No. SYP-114) filed on even date herewith and herein incorporated by reference), the method provides a set of fragments, created by hydrolysis of the polymer, each set differing by one or more monomers. The difference between the mass-to-charge ratio of at least one pair of fragments is determined. One then asserts a mean mass-to-charge ratio which corresponds to the known mass-to-charge ratio of one or more different monomers. The asserted mean is compared with the measured mean to determine if the two values are statistically different with a desired confidence level. If there is a statistical difference, then the asserted mean difference is not assignable to the actual measured difference. In some embodiments, additional measurements of the difference between a pair of fragments are taken, to increase the accuracy of the measured mean difference. The steps of the method are repeated until one has asserted all desired mean differences for a single difference between one pair of fragments. The method is repeated for additional pairs of fragments and the mass-to-charge ratio data from a plurality of parallel mass spectra are integrated until the desired sequence information is obtained.
Practice of the invention will be still more fully understood from the following examples, which are presented herein for illustration only and should not be construed as limiting the invention in any way.
EXAMPLE 1 Materials and Methods
(a) Solution-Phase Digestion of ACTH 7-38 Fragment
For the time course digestion, 500 pmol of synthetic human adrenocorticotropic hormone (ACTH) fragment (7-38) PheArgTrpGlyLysProValGlyLysLysArgArgProValLysValTyrProAsnGlyAlaGluAspGluSerAlaAlaPheProLeuGlu! (Seq. ID No. 22) from Sigma Chemical Company (St. Louis, Mo.), previously dried down in a 0.5 mL eppendorf vial, was resuspended with 33.3 μL of HPLC grade water (J. T. Baker, Phillipsburg, N.J.). In a previously dried down 0.5 mL eppendorf tube, 3.05 units (one unit hydrolyzes 1.0 μmol N-CBZ-phe-ala to N-CBZ-phenylanine+alanine per minute at pH=6.75 and 25° C.) of carboxypeptidase Y from bakers yeast (E.C. 3.416.1), purchased from Sigma, was resuspended with 610 μL of HPLC grade water. To 20 μL of the ACTH 7-38 fragment solution was added 10 μL of the CPY solution to initiate the reaction. The final concentrations were 10 pmol/μL ACTH and 1.67×10-3 units/μL CPY yielding an enzyme-to-substrate ratio of 1.67×108 units CPY/mol ACTH (1:37 molar ratio assuming CPY MW=61,000). Aliquots of 1 μL were taken from the reaction vial at reaction times of 15 s, 60 s, 75 s, 105 s, 2 min, 135 s, 4 min, 5 min, 6 min, 7 min, 8 min, 9 min, 10 min, 15 min and 25 min. At 25 min, 15 μL of 5×10-3 units/μL CPY was added to the reaction vial. Aliquots of 2 μL were removed at total reaction times of 1 hr and 24 hr. The reaction proceeded at room temperature until 2 min when the temperature was elevated to 37° C. All aliquots were added to 9 μL of the MALDI matrix, α-cyano-4-hydroxy cinnamic acid (CHCA) from Sigma, at a concentration of 5 mg/mL in 1:1 acetonitrile (ACN):0.1% trifluoroacetic acid (TFA) with the exception of the 1 hr and 24 hr aliquots were added to 8 μL of the matrix. The final total peptide concentrations of the ACTH digestion aliquots in the matrix solutions were 1 pmol/μL. A pooled peptide solution was prepared by combining 2 μL of the 15 s, 105 s, 6 min and 25 min aliquots. Into individual μL wells on the MALDI sample plate, 1 μL of each aliquot solution was placed and allowed to evaporate to dryness before insertion into the mass spectrometer.
(b) On-Plate Digestions:
All on-plate digestions were performed by pipetting 0.5 μL of the peptide at a concentration of 1 pmol/μL into each of ten 1 μL wells across one row of a sample plate configured similarly to the sample plate manufactured and supplied by PerSeptive BioSystems, Inc. of Framingham, Mass. and adapted for use with their trademarked mass spectrometry apparatus known as Voyager™. All peptides listed in Table 1 were purchased from Sigma and were of the highest purity offered. To initiate the reaction in the first well, 0.5 μL of 0.0122 units/μL CPY was added. To the subsequent 9 wells was added CPY at concentrations of 6.10×10-3, 3.05×10-3, 1.53×10-3, 6.10×10-4, 3.05×10-4, 1.53×10-4, 7.63×10-5, 3.81×10-5 and 0 units/μL, respectively. Mixing was assured in each well by pulling the 1 μL reaction back and forth through the pipet tip. The reaction was allowed to proceed at room temperature until the 1 μL total volume evaporated on the plate (approximately 10 min). At such time, 1 μL of 5 mg/mL CHCA in 1:1 ACN:0.1% TFA was added to each well, with no further mixing, and allowed to evaporate for approximately 10 min before mass analysis.
(c) MALDI-TOF Mass Spectrometry:
MALDI-TOF mass analysis was performed using the Voyager™ Biospectrometry™ Workstation (PerSeptive Biosystems, Cambridge, Mass.). A 28.125 KV potential gradient was applied across the source containing the sample plate and an ion optic accelerator plate in order to introduce the positively charged ions to the 1.2 m linear flight tube for mass analysis. For the data acquisition of the ACTH 7-38 fragment and glucagon digests, a low mass gate was used to prevent the matrix ions from striking the detector plate. For the application of the low mass gate, the guide wire was pulsed for a brief period deflecting the low mass ions (approximately <1000 daltons). All other spectra were recorded with the low mass gate off. To enhance the signal-to-noise ratio, 64-128 single shots from the nitrogen laser (337 nm) were averaged for each mass spectrum. The data presented herein were smoothed using an 11 point Savitsky-Golay second order filter. All data was calibrated using an external calibration standard mixture of bradykinin (MH+ =1061.2) and insulin B-chain, oxididized (MH+ =3496.9) (both purchased from Sigma) at concentrations of 1 pmol/μL in the 5 mg/mL CHCA matrix solution.
(d) Statistical Mass Assignments:
As described in further detail below, the statistical protocol disclosed herein uses the equation for the two-tailed t-test: ##EQU1## where x is the average experimental mean, μ is the asserted mean, n is the number of replicates and S is the experimental standard deviation. For the assignment of residues to experimentally derived Δ masses, a tcalculated for each asserted mean mass (each possible amino acid assignment) was compared to the tabulated value for a given confidence interval. A tcalculated >ttable indicated that the experimental mass came from a population possessing a different mean than the asserted mass at the given confidence level.
EXAMPLE 2 Sequence of Biopolymers
(a) Solution-Phase Sequencing:
FIG. 2 illustrates the MALDI spectra of the 1 min, 5 min and 25 min time aliquots that were removed from a solution-phase time-dependent CPY digestion of ACTH 7-38 fragment. The nomenclature of the peak labels denotes the peptide populations resulting from the loss of the indicated amino acids. Peaks representing the loss of 19 amino acids from the C-terminus are observed. The symbol * indicates doubly charged ions and # indicates an unidentified peak at m/z=2001.0 and 2744.4 daltons.
The lack of phase control of the enzymatic digestion creates the peptide ladders that are observed in this figure. After 1 min of digestion (FIG. 2A), 9 detectable peptide populations exist including the intact ACTH 7-38 fragment and peptides representing the loss of the first 8 amino acids from the C-terminus. The 5 min aliquot (FIG. 2B) shows that the peptide populations representing the loss of Ala(32) and Ser(31) have become much more predominant than the 1 min aliquot. Amino acid losses of 11 residues, Ala(32) through Val(22), are present at this digestion time. FIG. 2C shows the final detected amino acids of Lys(21) and Val(20) as 4 major peptide populations are detected. Upon increasing the enzyme concentration 2-fold at 25 min, no further digestion was observed through 24 h. The digestion proceeded through the Val(20) and stopped at the amino acid run of peptide-LysLysArgArgPro (amino acids 9-13 of Seq. ID No. 22). Although CPY may proceed rapidly through proline (e.g., Pro(24)), the basic residue, arginine, at the penultimate position in this case proved to be a combination refractory to CPY.
The lack of phase control coupled with the varied rates of hydrolysis poses problems unique to enzymatic sequencing. Varying ion intensities for the peaks in FIG. 2 are due primarily to the rates of hydrolysis that vary according to the amino acids at the C-terminus and penultimate position. When a residue is hydrolyzed at a low rate compared to the neighboring residues, the concentration and, therefore, signal of the peptide population representing the loss of that residue will be small relative to that of the preceding amino acid. This is seen in the mass spectra given in FIG. 2. The cleavage of Ala(34) is shown to be slow resulting in the large signal representing the loss of Phe(35). The hydrolysis of glycine and valine are also shown to be slow as the peaks representing the loss of Ala(27) and Tyr(23) are comparatively more intense than those of Gly(26) and Val(22), respectively.
The prior-art time-dependent method presented herein is the result of extensive method optimization and is optimized for obtaining the maximum sequence information in the shortest amount of time. For this particular optimized case, detectable amounts of all populations were observed over 25 min in the three selected time aliquots. This was not the case for numerous preliminary solution-phase digestions that were performed during the method optimization that led to the choice of these optimized conditions. At higher concentrations of CPY the peaks representing the loss of Glu(28) and Pro(24) were often not observed, indicating that CPY cleaves these residues very readily when alanine and tyrosine are at the penultimate positions, respectively. Lower concentrations of CPY allowed for all amino acids to be sequenced but often required long periods of time, e.g., days, for sufficient digestion. In the instance disclosed herein, an enzyme-to-substrate ratio of 1.67×108 units CPY/mole peptide was finally found to offer sufficient sequence information in 25 min of digestion.
Alternatively, upon pooling aliquots from 15 s, 105 s, 6 min, and 25 min of total reaction time, MALDI analysis shows that a peptide ladder is formed that contains peaks that represent the loss of almost all amino acids from the C-terminus (FIG. 3). All amino acid losses are observed except for those of Glu(28), Asn(25), and Pro(24) which were present as small peaks in the 6 min aliquot and subsequently diluted to undetectable concentrations in this pooled fraction.
A sequence gap is observed here as the peptide populations representing the loss of Glu(28), Asn(25) and Pro(24) exist below a signal-to-noise ratio of 3. These populations were observed as small peaks in the 6 min aliquot mass spectrum but, upon the 4-fold dilution with the other aliquots, exist in too small a concentration to be detected. This emphasizes the necessity of recording individual mass spectra for each time aliquot. The less time-demanding procedure of recording a single spectrum representing pooled results not only created sequence gaps, but lost the time-dependent history of the digestion.
As illustrated above, solution-phase digestion suffers from a number of disadvantages. A large amount of time, enzyme and peptide is required for method optimization in order to obtain significant digestion in a short amount of time while preserving all possible sequence information. For each peptide from which sequence information is to be derived, some time-consuming method development must be performed since a set of optimum conditions for one peptide is not likely to be useful for another peptide given the composition-dependent hydrolysis rates of CPY. An alternative strategy is to perform the concentration-dependent hydrolysis on the MALDI sample surface as described below.
(b) On-Plate Sequencing:
FIG. 1 depicts a Voyager™ sample plate for MALDI analysis comprised of a 10×10 matrix of 1 μL wells etched into the stainless steel base. These wells serve as micro-reaction vessels in which on-plate digestions may be performed. The physical dimensions of the plate are 57×57 mm and the wells are 2.54 mm in diameter.
Half-μL amounts of both enzyme and substrate were placed in a well and mixed with the pipet tip. The digestion continued for about 10 min until solvent evaporation terminates the reaction. At this time, the digestion mixture was resuspended by placing 1 μL of the matrix in the well. Since the CHCA matrix is solubilized in 1:1 ACN:0.1% TFA, both hydrophilic and hydrophobic peptide populations from the digest mixture should be resuspended with the low pH prohibiting any further CPY activity. The matrix crystal formation does not appear to be altered (as compared to the time-course experiment) by performing the digestion on-plate. This on-plate strategy significantly decreased the method optimization time by allowing multiple concentration-dependent (time-dependent) digestions to be performed in parallel. Also, sample losses upon transfer(s) from reaction vial to analysis plate were circumvented using the on-plate approach as all digested material is available for mass measurement.
MALDI spectra corresponding to the on-plate concentration dependent digestions of the ACTH 7-38 fragment for CPY concentrations of 6.10×10-4, and 1.53×10-3 units/μL, respectively, are illustrated in panels A and B of FIG. 4. Panel A and B show the spectra obtained from digests using CPY concentrations of 6.10×10-4 and 1.53×10-3 units/μL, respectively. Laser powers significantly above threshold were used to improve the signal-to-noise ratio of the smaller peaks in the spectrum at the expense of peak resolution. The symbol * indicates doubly charged ions and # indicates an unidentified peak at m/z-2517.6 daltons.
The lower concentration digestion yielded 12 significant peaks representing the loss of 11 amino acids from the C-terminus. The digestion from the higher concentration of CPY showed some overlap of the peptide populations present at the lower concentration as well as peptide populations representing the loss of amino acids through the Val(20). The concentration of the peptides representing the loss of the first few amino acids have decreased to undetectable levels (approximately <10 fmol) with the exception of the Leu(37) peak. By integrating the information in both panels, the ACTH 7-38 fragment sequence can be read 19 amino acids from the C-terminus without gaps, stopping at the same amino acid run of peptide-LysLysArgArgPro (amino acids 9-13 of Seq. ID No. 22) as the time-dependent digestion. FIG. 4 represents 2 of the 9 CPY concentrations that were performed simultaneously. The method optimization, in this case, was inherent in the strategy. The total time of method development (optimal digestion conditions), digestion, data collection and data analysis was under 30 min using this on-plate approach. The consumption of both peptide and enzyme was minimal as a total of 5 pmol of total peptide was digested across the 10 well row containing 9 digestions and 1 well with peptide plus water. Also, only 1.97 pmol of CPY (assuming 100 unit/mg and MW=61,000) was required for the entire experiment.
                                  TABLE 1                                 
__________________________________________________________________________
            SEQ ID                              Average                   
Peptide     Nos. Sequence                       Mass Charge               
                                                          Polarity        
__________________________________________________________________________
Sleep Inducing                                                            
            1    TrpAlaGlyGlyAspAlaSerGlyGlu    848.8                     
                                                     -2.0 polar           
Peptide                                                                   
Amino Terminal Region                                                     
            2    ValHisLeuThrProValGluLys       922.1                     
                                                     +0.5 mid             
of Hbs β chain.sup.3                                                 
Interleukin-1β 163-171                                               
            3    ValGlnGlyGluGluSerAsnAspLys    1005.0                    
                                                     -2.0 polar           
Fragment.sup.3                                                            
TRH Precursor                                                             
            4    LysArgGlnHisProGlyLysArg       1006.2                    
                                                     +4.5 very            
Bradykinin  5    ArgProProGlyPheSerProPheArg    1061.2                    
                                                     +2.0 mid             
Lutenizing Hormone                                                        
            6    pyro.GluHisTrpSerTyrGlyLeuArgProGly.amide                
                                                1182.3                    
                                                     +1.5 mid             
Releasing Hormone.sup.3                                                   
Physalaemin 7    pyro.GluAlaAspProAsnLysPheTyrGlyLeuMet.amide             
                                                1265.4                    
                                                     0    mid             
Angiotensin 1                                                             
            8    AspArgValTyrIleHisProPheHisLeu 1295.5                    
                                                     +1.0 non             
Renin Inhibitor                                                           
            9    ProHisProPheHisPhePheValTyrLys 1318.5                    
                                                     +2.0 non             
Kassinin    10   AspValProLysSerAspGlnPheValGlyLeuMet.amide               
                                                1334.5                    
                                                     -2.0 non             
Substance P 11   ArgProLysProGlnGlnPhePheGlyLeuMet.amide                  
                                                1347.6                    
                                                     +3.0 mid             
T-Antigen Homolog                                                         
            12   CysGlyTyrGlyProLysLysLysArgLysValGlyGly                  
                                                1377.7                    
                                                     +5.0 polar           
Osteocalcin 7-19                                                          
            13   GlyAlaProValProTyrProAspProLeuGluProArg                  
                                                1407.6                    
                                                     -1.0 mid             
Fragment                                                                  
Fibrinopeptide A                                                          
            14   AlaAspSerGlyGluGlyAspPheLeuAlaGluGlyGlyGlyValArg         
                                                1536.6                    
                                                     -3.0 mid             
Thymopoietin II 29-41                                                     
            15   GlyGluGlnArgLysAspValTyrValGlnLeuTyrLeu                  
                                                1610.8                    
                                                     0    polar           
Fragment                                                                  
Bombesin    16   pyro.GluGlnArgLeuGlyAsnGlnTrp(AlaValGlyHis)LeuMet.amide  
                                                1619.9                    
                                                     +1.5 mid             
ACTH 11-24 Fragment                                                       
            17   LysProValGlyLysLysArgArgProValLysValTyrPro               
                                                1652.1                    
                                                     +6.0 mid             
α-Melanocyte                                                        
            18   acetyl.SerThrSerMetGluHisPheArgTrpGlyLysProVal.amide     
                                                1664.9                    
                                                     +1.5 mid             
Stimulating Hormone                                                       
Angiotensinogen 1-14                                                      
            19   AspArgValTyrIleHisProPheHisLeuLeuValTyrSer               
                                                1759.0                    
                                                     +1.0 non             
Fragment                                                                  
Angiogenin  20   GluAsnGlyLeuProValHisLeuAspGlnSerIle(PheArg)Arg          
                                                1781.0                    
                                                     +0.5 mid             
Glucagon    21   HisSerGln . . . AspSerArgArgAlaGlnAspPheValGlnTrp(LeuMetA
                 sn)Thr                         3482.8                    
                                                     +1.0 polar           
ACTH7-38 Fragment                                                         
            22   PheArgTrp . . . ArgArgProValLysValTryProAsnGlyAlaGluAspGl
                 uSer                           3659.15                   
                                                     +2.0 polar           
                 AlaGluAlaPheProLeuGlu                                    
__________________________________________________________________________
 .sup.1 calculated                                                        
 .sup.2 at pH 6.5                                                         
 .sup.3 no sequence information was obtained                              
Listed in Table 1 are the peptides that have been digested and analyzed using this novel on-plate strategy. These peptides were selected to represent peptides of varying amino acid composition, size (up to MW=3659.15), charge and polarity. The bolded amino acids indicate that a peak representing the loss of that residue was observed in one or more of the MALDI spectra taken across the row of digestions. In order to be able to identify a residue, the peak representing the loss of that amino acid and the preceding amino acid must be present. The residues that are enclosed in parenthesis are those for which the sequence order could not be deduced. Overall, CPY offered some sequence information from the C-terminus for most of the peptides digested, lending no sequence information in only three of the 22 cases. In two of these three cases, the C-terminus was a lysine followed by an acidic residue at the penultimate position. CPY has been reported to possess reduced activity towards basic residues at the C-terminus, and the presence of the neighboring acidic residue seems to further reduce its activity. In the case of the lutenizing hormone releasing hormone (LH-RH), the C-terminal amidated glycine followed by proline at the penultimate position inhibited CPY activity which agrees with reports of CPY slowing at both proline and glycine residues (Hayashi et al. (1975) J. Biochem. 77: 69-79; Hayashi, R. (1976) Methods Enzymol. 45: 568-587). CPY is known to hydrolyze amidated C-terminal residues of dipeptides and is shown here to cleave those of physalaemin, kassinin, subtance P, bomesin, and α-MSH.
As illustrated by the data in Table 1, CPY was able to derive sequence information from all of the peptides, except LH-RH, that possess blocked N-terminal residues (physalaemin, bombesin and α-MSH). This is significant as these peptides would lend no information to the Edman approach. A number of the peptides were sequenced until the detection of the truncated peptide peaks were impaired by the presence of CHCA matrix ions (<600 daltons). The sequencing of the other peptides did not go as far as a combination of residues at the C-terminus and penultimate position that inhibited CPY activity were encountered. Bombesin, angiogenin and glucagon gave gaps in the sequence as residues that were cleaved slowly were followed by residues hydrolyzed more rapidly, as discussed above. The feasibility of the on-plate CPY digestion/MALDI detection strategy appeared to be independent of the overall polarity and charge of the peptide.
FIG. 5 shows selected on-plate digestions of osteocalin 7-19 fragment, angiotensin 1 and bradykinin resulting from on-plate digestions using CPY concentrations of 3.05×10-3, 3.05×10-4, and 6.10×10-4 units/μL, respectively. The symbol Na denotes a sodium adduct peak and # denotes a matrix peak at m/z-568.5 daltons.
Each spectrum represents the results of one of the digestions that was performed across the row of wells. In the case of the osteocalcin 7-19 fragment, CPY can proceed through proline (Martin, B. (1977) Carlsburg Res. Commun. 42: 99-102; Breddam et al. (1987) Carlsburg Res. Commun. 52: 55-63; Breddam, K. (1986), Carlsburg Res. Commun. 51: 83-128; Hayashi, R. (1977) Methods Enzymol. 74: 84-94; Hayashi et al. (1973) J. Biolog. Chem. 248: 2296-2302); the presence of Asp and His at the respective penultimate positions of the two peptides prohibited further CPY activity. Bradykinin is shown to sequence until the matrix begins to interfere with peak detection. For all three of the selected peptides, the total sequence information obtained for the overall 9 well digestion is represented in the single digestion shown. For many other peptides this was not the case. The total sequence information is often derived from 2 or more of the wells as is the case with ACTH 7-38 fragment given in FIG. 4.
EXAMPLE 3 Statistical Analysis of Ladder Seqeuncing by MALDI
(a) General Principles of Statistical Analysis According to the Instant Invention
As disclosed above, once the truncated ladders have been formed, matrix is added to the well and multiple measurements were taken from the wells in which peaks representing the loss of an amino acid(s) are present. Statistical interpretation involving the use of t-statistics then allowed assignments to be made with an associated confidence interval. The two-tailed test for one experimental mean, ##EQU2## where x is the experimental mean mass difference, μ is the asserted mass difference, N is the number of replicates performed, and S is the experimental standard deviation of the mean, was applied. All conceivable masses (single residue, di-residue, tri-residue, etc., as well as modified residue masses) were used as μ, the asserted mass, to generate a list of tcalculated values that were then compared against tabulated values for given confidence intervals. All masses that did not statistically differ from the asserted mass, tcalculated <ttable, were statistically assigned to that residue(s) at the given level of confidence. This information was used to check hypothesized composition or used to search a database for a sequence. When performing database searching, these levels of confidence can be used in the search algorithm as a tool to aid in obtaining quality "hits."
Additionally, the interpretation of data utilized an automated process of acquiring and interpreting the data using software feedback control. The data interpretation software controls the number of acquisitions (minimum of 2) that are required to statistically differentiate multiple candidates for an amino acid assignment. The operator has control of specifying to what minimum statistical level of confidence the assignment(s) should meet.
(b) Analysis of Experimentally-Obtained Mass-to-Charge Ratio Data: Peptides
The use of MALDI for the analysis of truncated ladders as disclosed herein is critical for obtaining accurate sequence data. In the prior art, the technique has been used almost exclusively to sequence peptides of a defined sequence for which the mass accuracy of the measurement is of little importance. In contrast, the methods disclosed herein are useful for the sequence determination of peptides of unknown sequence. By comparing known molecular masses to the MALDI derived masses for only a few mass measurements, artisans previously have made only general statements of instrumental mass accuracy (e.g., better than 0.1%), but, ascribing this mass accuracy to any individual mass measurement for the purpose of residue assignment holds no statistical validity. Therefore, true residue assignment and direct application to unknowns has heretofore been both difficult and tentative. In order to derive amino acid sequences by ladder sequencing/MALDI strategies, statistical levels of confidence must be placed on residue assignments as disclosed herein.
To place confidence levels on residue assignments, the nature of the experimental errors first must be defined. For systems in which the errors are random, simple t-statistics can be used for amino acid assignment.
To assess the nature of the errors that dominate MALDI analysis of the above-described truncated peptide ladders, the Δ mass differences (i.e., experimental mass difference-actual amino acid mass) for all amino acid assignments made in the 15 aliquots (one spectrum per aliquot) removed from the time-dependent digestion of ACTH 7-38 fragment described above were measured to yield a gaussian distribution with a mean of 0.0089±0.605 (n=107). For this experiment tcalculated (0.152)<ttable (1.99) indicating that the null hypothesis that the average Δ mass difference=0 cannot be rejected at a 95% confidence level. This indicates that the error is random with no statistically significant systematic error. This is expected as any systematic errors that are present in the mass assignment of individual peptide peaks such as incorrect y-intercept values for two-point mass calibration should cancel out when calculating the mass difference of two adjacent peaks. There are possible systematic components of error that would not be canceled such as incorrect computation of the mass center of one of a set of two adjacent peaks due to partial resolution of the isotopes. This phenomenon was circumvented by the use of a smoothing filter such that all peaks were detected at the actual average mass values.
              TABLE 2                                                     
______________________________________                                    
Amino Acid                                                                
        Actual                                                            
(position)                                                                
        Mass.sup.1 Experimental Mass.sup.1,2                              
                                  Replicates                              
______________________________________                                    
val  (20)   99.13      98.97 ± 0.52                                    
                                (1.29)                                    
                                      3                                   
lys  (21)   128.17     128.15 ± 0.48                                   
                                (0.44)                                    
                                      7                                   
val  (22)   99.13      99.20 ± 0.35                                    
                                (0.27)                                    
                                      9                                   
tyr  (23)   163.17     162.43 ± 0.11                                   
                                (0.99)                                    
                                      2                                   
pro  (24)   97.12      97.49 ± 0.14                                    
                                (1.25)                                    
                                      2                                   
asn  (25)   114.10     114.21 ± 0.82                                   
                                (0.69)                                    
                                      8                                   
gly  (26)   57.05      57.22 ± 0.88                                    
                                (0.68)                                    
                                      9                                   
ala  (27)   71.07      70.19 ± 0.49                                    
                                (4.40)                                    
                                      2                                   
glu  (28)   129.12     130.22 ± 0.47                                   
                                (4.22)                                    
                                      2                                   
asp  (29)   115.09     114.81 ± 0.58                                   
                                (0.41)                                    
                                      10                                  
glu  (30)   129.12     129.27 ± 0.61                                   
                                (0.39)                                    
                                      12                                  
ser  (31)   87.08      87.14 ± 0.47                                    
                                (0.30)                                    
                                      12                                  
ala  (32)   71.07      80.94 ± 0.49                                    
                                (0.51)                                    
                                      6                                   
glu  (33)   129.12     129.39 ± 0.42                                   
                                (0.44)                                    
                                      6                                   
ala  (34)   71.07      71.09 ± 0.30                                    
                                (0.28)                                    
                                      7                                   
phe  (35)   147.18     147.03 ± .73                                    
                                (0.77)                                    
                                      6                                   
pro  (36)   97.12      96.83 ± 0.64                                    
                                (1.18)                                    
                                      4                                   
leu  (37)   113.16     113.63 ± 0.54                                   
                                (1.34)                                    
                                      3                                   
glu  (38)   129.12     128.40 ± 0.52                                   
                                (1.29)                                    
                                      3                                   
______________________________________                                    
 .sup.1 the masses given are average masses and in units of daltons       
 .sup.1,2 the uncertainties of the experimental mass measurements are give
 as standard deviations (those in the parenthesis are 95% confidence      
 intervals of the mean)                                                   
Table 2 represents a comparison of the actual average masses of the sequenced residues of the ACTH 7-38 fragment and the experimental mass differences with associated standard deviations and 95% confidence intervals calculated for the time-dependent digestion. The number of replicates indicate the number of spectra that possessed the detectable adjacent peaks required for the mass difference measurement of that particular residue. The need for a significant number of measurements in order to estimate the mean is obvious from the table as the 95% confidence level decreases as the square root of the number of measurements. For all of the residues sequenced, the actual mass fell within ±3σ the experimental mass distribution. Calculated t-values for each case were less than the tabulated t-value for the 95% confidence interval signifying that the experimental mass is not significantly different than the actual known mass. In order to statistically assign the residues, a calculated t-value for each possible amino acid must be compared with the tabulated value. In other words, the actual masses of all possible amino acids must be used as an asserted mean, μ, and each null hypothesis (i.e., x-μ=0) made such that a calculated t-value for each possible assignment can be compared to the tabulated value.
Assuming that only the 20 common unmodified amino acids are possible, this was done for the prior art time-dependent ACTH 7-38 fragment digestion. A summary of the results is given in Table 3. The bolded values are those which the experimental mean did not significantly differ from the asserted amino acid mean. Again, the need for adequate population sampling is apparent. There were only two measurements observed for the Glu(28) thereby resulting in a 95% confidence interval of 4.22 daltons (Table 2). This translates into an inability to distinguish between Gln, Lys, Glu and Met (Table 3). The 12 trials that were observed for Glu(30) gave a 95% confidence interval of 0.39 daltons, thereby rendering the Gln, Lys and Met statistically improbable amino acid assignments.
Table 3 represents calculated t-values for 19 sequenced amino acid experimental means in the ACTH 7-38 fragment given the asserted means of 20 common unmodified amino acids. The table value is given at the end of each column. A tcalculated <ttable indicates that the experimental mean is not significantly different that the mean of the asserted amino acid at 95% confidence interval. Each tcalculated for which this is the case is indicated in bold.
                                  TABLE 3                                 
__________________________________________________________________________
ACTH 7-38 Fragment Amino Acid Position                                    
    20 21  22 23  24  25 26  27 28  29                                    
__________________________________________________________________________
Gly                      0.58                                             
                             37.9                                         
Ala                      47.2                                             
                             2.54                                         
Ser               105        48.7                                         
Pro 6.16   17.8   3.74                                                    
Val 0.53   0.60   16.6                                                    
Thr 7.09   16.3                                                           
Cys                                                                       
Leu/                  3.62                                                
Ile                                                                       
Asn                   0.38          3.87                                  
Asp    72.0           3.04      45.5                                      
                                    1.53                                  
Gln    0.11                     6.29                                      
                                    72.6                                  
Lys    0.11                     6.17                                      
Glu    5.35                     3.31                                      
Met                             2.95                                      
His                             20.8                                      
Phe                                                                       
Arg           80.4                                                        
Tyr           9.64                                                        
Trp           305                                                         
'table.sup.1                                                              
    4.30                                                                  
       2.45                                                               
           2.31                                                           
              12.7                                                        
                  12.7                                                    
                      2.37                                                
                         2.31                                             
                             12.7                                         
                                12.7                                      
                                    2.26                                  
__________________________________________________________________________
    30 31  32  33  34  35  36  37  38                                     
__________________________________________________________________________
Gly        69.4    123                                                    
Ala    118 0.65    0.18                                                   
Ser    0.44                                                               
           80.7    141     30.5                                           
Pro    73.6                0.91                                           
Val                        7.19                                           
Thr                                                                       
Cys                            33.6                                       
Leu/                           1.51                                       
Ile                                                                       
Asn                            1.51                                       
Asp                            4.68                                       
                                   44.3                                   
Gln                                0.90                                   
Lys 6.25       7.12                0.77                                   
Glu 0.85       1.57                2.40                                   
Met 11.0       10.6                9.33                                   
His                    33.2                                               
Phe                    0.50                                               
Arg                    30.7                                               
Tyr                                                                       
Trp                                                                       
'table.sup.1                                                              
    2.20                                                                  
       2.20                                                               
           2.57                                                           
               2.57                                                       
                   2.45                                                   
                       2.57                                               
                           3.18                                           
                               4.30                                       
                                   4.30                                   
__________________________________________________________________________
 .sup.1 the tabulated t value associated with an area of 0.025 in one tail
 of the tdistribution corresponding to the appropriate degrees of freedom,
 ν, where ν = n - 1.                                                
Table 4 summarizes the results of the statistical amino acid assignments for the 19 amino acids sequenced from the C-terminus of ACTH 7-38 fragment using the prior art time-dependent strategy. The masses of the listed amino acids could not be statistically differentiated from the experimentally derived mass difference at the given confidence levels. The amino acids indicated in bold are the known residues existing at the given positions. The confidence intervals indicated are the highest levels at which all amino acid masses other than those indicated are statistically different from the experimental mean.
              TABLE 4                                                     
______________________________________                                    
ACTH 7-38 Fragment                                                        
             Amino Acid                                                   
Amino Acid position                                                       
             Assignments.sup.1                                            
                          Confidence Interval (c.i.)                      
______________________________________                                    
20           Val          95% < c.i < 98%                                 
21           Gln/Lys      c.i. > 99.8%                                    
22           Val          c.i > 99.8%                                     
23           Tyr          99% < c.i. < 99.8%                              
24           Pro          95% < c.i. < 98%                                
25           Asn          98% < c.i. < 99%                                
26           Gly          c.i. > 99.8%                                    
27           Ala          98% < c.i. < 99%                                
28           Gln/Lys/Glu/Met                                              
                          95% < c.i. < 98%                                
28           Met          80% < c.i. < 90%                                
29           Asp          99% < c.i. < 99.8%                              
30           Glu          c.i. > 99.8%                                    
31           Ser          c.i. > 99.8%                                    
32           Ala          c.i. > 99.8%                                    
33           Glu          c.i. > 99.8%                                    
34           Ala          c.i. > 99.8%                                    
35           Phe          c.i. > 99.8%                                    
36           Pro          99% < c.i. < 99.8%                              
37           Leu(Ile)/Asn 95% < c.i. < 98%                                
38           Gln/Lys/Glu  98% < c.i. < 99%                                
38           Gln/Lys      80% < c.i. < 90%                                
______________________________________                                    
 .sup.1 assuming that only the 20 common unmodified amino acids are       
 probable candidates                                                      
For example, the distinction between Gln and Lys for the amino acid assignment of residue 21 could not be made as the experimental mean (128.15 daltons) exactly bisected the asserted means of Gln (128.13 daltons) and Lys (128.17 daltons). The same phenomenon occurred in the assignment of residue 37. The expeirmental mean (113.63 daltons) bisected the asserted means of Leu(Ile) (113.16 daltons) and Asn (114.10 daltons). The assignments of the amino acids at positions 28 and 38 were difficult due to the small number of replicates taken (2 and 3, respectively). Residue 28 was assigned Gln/Lys/Glu/Met at a confidence interval greater than 95% but less than 98%. Table 3 shows that, for this residue, the asserted amino acid mass that resulted in the smallest tcalculated was that of methionine. Using a confidence interval of 80%, the correct assignment of Glu is deemed statistically improbable. Likewise, the assignment of residue 38 was made as Gln/Lys/Glu at a confidence level of 95%, but the correct assignment (Glu) is again statistically improbable at an 80% level.
Since the errors are randomly distributed, all amino acids can be differentiated (except Leu and Ile) by sufficient population sampling. Approximating the experimental standard deviation to be that given above of s=0.604 for the overall experiment, it is approximated (using ttable =1.960) that >876 measurements would be required to differentiate Gln and Lys (Δ mass=0.04 daltons) at a 95% confidence interval. This number is experimentally impractical, but can be significantly lowered by reducing the standard deviation of the experimental mean. Decreasing the experimental standard deviation is of significant value as the number of samples required for the distinction between two amino acids to be made is proportional to the square of the experimental standard deviation of the mass difference. It is anticipated that mass shift reagents used to move peptide populations out of the interfering matrix are a possible chemical means for improving experimental error relating to peptides appearing in the low mass (<600 daltons) region. The use of reflectron and/or extended flight tube geometries are also expected to be instrumental methods suitable for reducing this error.
The protocol disclosed herein for statistical assignment of residues using the on-plate strategy involves multiple sampling from each well in which digestion is performed. The number of replicates required depends on the amino acid(s) that is(are) being sequenced at any one CPY concentration. For example, more replicates are required for mass differences around 113-115 daltons (Ile/Leu, Asn and Asp) and 128-129 daltons (Gln/Lys/Glu) than for mass differences around 163 (Tyr) or 57 (Gly) in order to be able to assure that all but one assignment are statistically unlikely. The experimental errors for this method appear to be as random (multiple replicates per sample) as for the time-dependent digestion (one replicate per sample).
This general statistical protocol for residue assignment was applied to two adjacent peaks that represent the loss of two or more amino acids. In this case, the asserted means of all dipeptides, tripeptides, etc. can also be used to calculate t-values. The information concerning the order of the residues will be lost but the composition can be deduced. Using only single amino acid and dipeptide masses as asserted means this was done for angiogenin has a sequence gap of Phe-Arg (Table 1). The average experimental mass difference between the peaks representing the loss of Arg(15) and Phe(13) was 303.45±0.328 (n=5). For all single amino acid and dipeptide masses except Phe/Arg, the calculated t-values are greater than the tabulated t-value at a confidence interval of 99.8%. In this particular case, the identity of the amino acids that comprise the gap was determined, but their order remains experimentally unknown. This statistical strategy was also incorporated into a computer algorithm to perform interactive data analysis and interpretation of ladder sequencing/MALDI experiments.
Thus, as illustrated above, the use of CPY digestion coupled with MALDI detection as disclosed herein was effective for obtaining C-terminal sequence information. The ACTH 7-38 fragment yielded sequence information 19 amino acids from the C-terminus without gaps. The on-plate concentration-dependent approach was demonstrated as a useful method for performing multiple digestions in parallel which circumvented the need for time- and reagent-consuming method development. This on-plate strategy required less physical manipulations and less total amounts of enzyme and peptide. Of the 22 peptides attempted using the on-plate approach, all but three were successfully digested to yield some C-terminal sequence information. CPY was also shown to cleave amidated C-terminal residues, but possessed no activity towards certain combinations of residues existing at the C-terminus and penultimate position.
In summary, an integrated strategy for generating residue assignments from "on-plate" C- and N-terminal peptide ladder sequencing experiments was developed. This strategy is based on the logical combination of tasks involving:
1) the creation of peptide ladders from a concentration-dependent exopeptidase digestion strategy that utilizes the μL-wells of the Voyager™ sample plate as microreaction vessels;
2) the use of the Voyager™ MALDI-TOF workstation as a tool to generate masses of the peptide fragment;
3) an interpretation algorithm based on t-statistics that allows elimination of asserted assignment candidates; and,
4) feedback control of the data acquisition software from the interpretation algorithm that governs the number of replicates that are acquired for the statistically-based assignments to be made completely or to a cost effective partial point.
(c) Analysis of Experimentally-Obtained Mass-to-Charge Ratio Data: Nucleic Acids
The method disclosed herein has also been used to obtain sequence information about a nucleic acid polymer containing 40 bases. Hydrolysis using an exonuclease specific for the 3' terminus was conducted using different concentrations of Phos I (phosphodiesterase I) ranging from 0.002 μU/μl to 0.05 μU/μl. Hydrolysis was allowed to proceed for 3 minutes. Spectra of hydrolyzed sequences using MALDI-TOF are depicted in FIGS. 6A-6E. Data integration as disclosed herein confirmed the sequence to be:
__________________________________________________________________________
CGC TCT CCC TTA TGC GAC TCC TGC ATT AGG AAG CAG CCC A (SEQ. ID. NO:       
__________________________________________________________________________
2).                                                                       
In a separate experiment, addition of a light-absorbent matrix CHCA was evaluated. A nucleic acid polymer containing 40 bases (as described above) was mixed with matrix and 0.4 μU/μl of the exonuclease Phos II (phosphodiesterase II) which is specific for the 5' terminus. Hydrolysis in the presence of matrix was allowed to proceed for 10 minutes. The spectrum obtained by MALDI-TOF is depicted in FIG. 7. These data confirm the ability to combine polymer, hydrolyzing agent and matrix prior to mass spectrometry analysis. This reduces handling of reagents and facilitates sample processing. Using data similar to those in FIG. 7, the sequence of the nucleic acid polymer was confirmed to be as described above.
EXAMPLE 4 Other Applications of the Instant Method
As disclosed herein, this strategy can be applied to the sequencing of any natural biopolymer such as proteins, peptides, nucleic acids, carbohydrates, and modified versions thereof. The ladders can be created enzymatically using exohydrolases, endohydrolases or the Sanger method and/or chemically by truncation synthesis or failure sequencing.
It is expected that other approaches can be taken to expand the utility of the CPY/MALDI ladder sequencing methods disclosed herein. For example, by taking advantage of different enzyme specificities, the use of carboxypeptidase mixtures can be implemented using the disclosed on-plate strategy as a means for sequencing through residue combinations that prohibit CPY activity as well as preventing sequence gaps from occurring. Also, by covalently attaching N-terminal and/or C-terminal linkers to small peptides, it is expected that all sequence peaks can be made to fall beyond the low mass matrix region. It is anticipated that peptides can be completely sequenced to the N-terminus without gaps by combining MALDI with the above-described carboxypeptidase mixtures and mass shift reagent modifications.
Equivalents
The invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. The foregoing embodiments are therefore to be considered in a all respects illustrative rather than limiting on the invention described herein. Scope of the invention is thus indicated by the appended claims rather than by the foregoing description, and all changes which come within the meaning and range of equivalency of the claims are therefore intended to be embraced therein.
__________________________________________________________________________
SEQUENCE LISTING                                                          
(1) GENERAL INFORMATION:                                                  
(iii) NUMBER OF SEQUENCES: 23                                             
(2) INFORMATION FOR SEQ ID NO:1:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 9 amino acids                                                 
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:                                   
TrpAlaGlyGlyAspAlaSerGlyGlu                                               
15                                                                        
(2) INFORMATION FOR SEQ ID NO:2:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 8 amino acids                                                 
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:                                   
ValHisLeuThrProValGluLys                                                  
15                                                                        
(2) INFORMATION FOR SEQ ID NO:3:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 9 amino acids                                                 
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:                                   
ValGlnGlyGluGluSerAsnAspLys                                               
15                                                                        
(2) INFORMATION FOR SEQ ID NO:4:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 8 amino acids                                                 
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:                                   
LysArgGlnHisProGlyLysArg                                                  
15                                                                        
(2) INFORMATION FOR SEQ ID NO:5:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 9 amino acids                                                 
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:                                   
ArgProProGlyPheSerProPheArg                                               
15                                                                        
(2) INFORMATION FOR SEQ ID NO:6:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 10 amino acids                                                
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:                                   
GluHisTrpSerTyrGlyLeuArgProGly                                            
1510                                                                      
(2) INFORMATION FOR SEQ ID NO:7:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 11 amino acids                                                
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:                                   
GluAlaAspProAsnLysPheTyrGlyLeuMet                                         
1510                                                                      
(2) INFORMATION FOR SEQ ID NO:8:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 10 amino acids                                                
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:                                   
AspArgValTyrIleHisProPheHisLeu                                            
1510                                                                      
(2) INFORMATION FOR SEQ ID NO:9:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 10 amino acids                                                
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:                                   
ProHisProPheHisPhePheValTyrLys                                            
1510                                                                      
(2) INFORMATION FOR SEQ ID NO:10:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 12 amino acids                                                
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:                                  
AspValProLysSerAspGlnPheValGlyLeuMet                                      
1510                                                                      
(2) INFORMATION FOR SEQ ID NO:11:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 11 amino acids                                                
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:                                  
ArgProLysProGlnGlnPhePheGlyLeuMet                                         
1510                                                                      
(2) INFORMATION FOR SEQ ID NO:12:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 13 amino acids                                                
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:                                  
CysGlyTyrGlyProLysLysLysArgLysValGlyGly                                   
1510                                                                      
(2) INFORMATION FOR SEQ ID NO:13:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 13 amino acids                                                
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:                                  
GlyAlaProValProTyrProAspProLeuGluProArg                                   
1510                                                                      
(2) INFORMATION FOR SEQ ID NO:14:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 16 amino acids                                                
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:                                  
AlaAspSerGlyGluGlyAspPheLeuAlaGluGlyGlyGlyValArg                          
151015                                                                    
(2) INFORMATION FOR SEQ ID NO:15:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 13 amino acids                                                
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:                                  
GlyGluGlnArgLysAspValTyrValGlnLeuTyrLeu                                   
1510                                                                      
(2) INFORMATION FOR SEQ ID NO:16:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 14 amino acids                                                
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:                                  
GluGlnArgLeuGlyAsnGlnTrpAlaValGlyHisLeuMet                                
1510                                                                      
(2) INFORMATION FOR SEQ ID NO:17:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 14 amino acids                                                
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:                                  
LysProValGlyLysLysArgArgProValLysValTyrPro                                
1510                                                                      
(2) INFORMATION FOR SEQ ID NO:18:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 13 amino acids                                                
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:                                  
SerThrSerMetGluHisPheArgTrpGlyLysProVal                                   
1510                                                                      
(2) INFORMATION FOR SEQ ID NO:19:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 14 amino acids                                                
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:19:                                  
AspArgValTyrIleHisProPheHisLeuLeuValTyrSer                                
1510                                                                      
(2) INFORMATION FOR SEQ ID NO:20:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 15 amino acids                                                
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:                                  
GluAsnGlyLeuProValHisLeuAspGlnSerIlePheArgArg                             
151015                                                                    
(2) INFORMATION FOR SEQ ID NO:21:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 29 amino acids                                                
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:                                  
HisSerGlnGlyThrPheThrSerAspTyrSerLysTyrLeuAspSer                          
151015                                                                    
ArgArgAlaGlnAspPheValGlnTrpLeuMetAsnThr                                   
2025                                                                      
(2) INFORMATION FOR SEQ ID NO:22:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 32 amino acids                                                
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: peptide                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:22:                                  
PheArgTrpGlyLysProValGlyLysLysArgArgProValLysVal                          
151015                                                                    
TyrProAsnGlyAlaGluAspGluSerAlaGluAlaPheProLeuGlu                          
202530                                                                    
(2) INFORMATION FOR SEQ ID NO:23:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 40 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: other nucleic acid                                    
(A) DESCRIPTION: /desc = "NUCLEIC ACID POLYMER"                           
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:                                  
CGCTCTCCCTTATGCGACTCCTGCATTAGGAAGCAGCCCA40                                
__________________________________________________________________________

Claims (27)

What is claimed is:
1. A method of obtaining sequence information about a polymer comprising different monomers, said method comprising the steps of:
(a) on a reaction surface having spatially separate areas, providing
(i) at least one amount of a hydrolyzing agent which hydrolyzes said polymer thereby to break inter-monomer bonds, and
(ii) a sample of said polymer, to form differing ratios of agent to polymer on said reaction surface;
(b) incubating the product of step (a) for a time sufficient to obtain a plurality of series of hydrolyzed polymer fragments;
(c) performing mass spectrometry on said plurality of series to obtain mass-to-charge ratio data for hydrolyzed polymer fragments contained therein; and,
(d) integrating data from said plurality of series to obtain sequence information of said polymer.
2. The method of claim 1 wherein said polymer is selected from the group consisting of: proteins, peptides, DNAs, RNAs, PNAs, carbohydrates, and modified versions thereof.
3. The method of claim 1 wherein said agent is an enzyme.
4. The method of claim 3 wherein said agent is an endohydrolase or an exohydrolase.
5. The method of claim 4 wherein if hydrolyzing with said exohydrolase, said exohydrolase produces a series of fragments comprising a sequence-defining ladder of said polymer.
6. The method of claim 5 wherein said exohydrolase is selected from the group consisting of: exonucleases, exoglycosidases, and exopeptidases.
7. The method of claim 4 wherein if hydrolyzing with said exohydrolase, said exohydrolase produces a series of fragments comprising a sequence-defining map of said polymer.
8. The method of claim 1 wherein said agent is a hydrolyzing agent other than an enzyme.
9. The method of claim 8 wherein said agent is an acid.
10. The method of claim 9 wherein hydrolyzing said polymer is accomplished using partial acid hydrolysis.
11. The method of claim 1 wherein said agent comprises a combination of at least one enzyme and at least one agent other than an enzyme.
12. The method of claim 1 wherein said spatially separate areas comprise differing amounts of said agent.
13. The method of claim 1 wherein said reaction surface comprises continuously increasing amounts of said agent.
14. The method of claim 1 wherein said reaction surface comprises a constant amount of said polymer.
15. The method of claim 1 wherein said spatially separate areas comprise differing amounts of said polymer.
16. The method of claim 1 wherein said reaction surface comprises continuously increasing amounts of said polymer.
17. The method of claim 1 wherein said reaction surface comprises a constant amount of said agent.
18. The method of claim 1 wherein step (c) is conducted by matrix-assisted laser desorption ionization, plasma desorption ionization, or fast atom bombardment ionization.
19. The method of claim 1 wherein step (c) is accomplished using mass analysis modes selected from the group consisting of: time-of-flight, quadrapole, ion trap, and sector.
20. The method of claim 1 wherein said reaction surface comprises a mass spectrometer sample holder having microreaction vessels disposed thereon.
21. The method of claim 1 wherein said reaction surface is in the form of a mass spectrometer sample probe.
22. The method of claim 1 wherein said step (a)(i) is accomplished using a dehydrated hydrolyzing agent on said reaction surface.
23. The method of claim 1 wherein said step (a)(i) is accomplished by immobilizing said agent on said reaction surface.
24. The method of claim 1 wherein step (a)(i) is accomplished using a hydrolyzing agent in liquid or gel form, said liquid or gel form being resistant to physical dislocation.
25. The method of claim 1 comprising the additional step of combining a light-absorbent matrix with said series prior to step (c).
26. The method of claim 1 comprising the additional step of combining said series with moieties for selectively shifting the mass of hydrolyzed sequences prior to step (c).
27. The method of claim 1 comprising the additional step of combining said series with moieties for improving ionization of hydrolyzed sequences prior to step (c).
US08/844,462 1995-05-19 1997-04-18 Methods for sequencing polymers using mass spectrometry Expired - Lifetime US5821063A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US08/844,462 US5821063A (en) 1995-05-19 1997-04-18 Methods for sequencing polymers using mass spectrometry

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US44605595A 1995-05-19 1995-05-19
US08/796,598 US5827659A (en) 1995-05-19 1997-02-07 Methods and apparatus for sequencing polymers using mass spectrometry
US08/844,462 US5821063A (en) 1995-05-19 1997-04-18 Methods for sequencing polymers using mass spectrometry

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US08/796,598 Division US5827659A (en) 1995-05-19 1997-02-07 Methods and apparatus for sequencing polymers using mass spectrometry

Publications (1)

Publication Number Publication Date
US5821063A true US5821063A (en) 1998-10-13

Family

ID=23771160

Family Applications (2)

Application Number Title Priority Date Filing Date
US08/796,598 Expired - Lifetime US5827659A (en) 1995-05-19 1997-02-07 Methods and apparatus for sequencing polymers using mass spectrometry
US08/844,462 Expired - Lifetime US5821063A (en) 1995-05-19 1997-04-18 Methods for sequencing polymers using mass spectrometry

Family Applications Before (1)

Application Number Title Priority Date Filing Date
US08/796,598 Expired - Lifetime US5827659A (en) 1995-05-19 1997-02-07 Methods and apparatus for sequencing polymers using mass spectrometry

Country Status (1)

Country Link
US (2) US5827659A (en)

Cited By (29)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6140053A (en) * 1996-11-06 2000-10-31 Sequenom, Inc. DNA sequencing by mass spectrometry via exonuclease degradation
US6197498B1 (en) 1995-03-17 2001-03-06 Sequenom, Inc DNA diagnostics based on mass spectrometry
US20020068366A1 (en) * 2000-04-13 2002-06-06 Ladine James R. Proteomic analysis by parallel mass spectrometry
US6465776B1 (en) 2000-06-02 2002-10-15 Board Of Regents, The University Of Texas System Mass spectrometer apparatus for analyzing multiple fluid samples concurrently
US20030032056A1 (en) * 2001-05-23 2003-02-13 Ronnie Palmgren Peptide fragmentation
US6555813B1 (en) 1999-04-29 2003-04-29 Ciphergen Biosystems, Inc. Probes with hydrophobic coatings for gas phase ion spectrometers
US6558902B1 (en) 1998-05-07 2003-05-06 Sequenom, Inc. Infrared matrix-assisted laser desorption/ionization mass spectrometric analysis of macromolecules
US20030153007A1 (en) * 2001-12-28 2003-08-14 Jian Chen Automated systems and methods for analysis of protein post-translational modification
WO2002008767A3 (en) * 2000-07-25 2003-08-28 Procter & Gamble Methods and kits for sequencing polypeptides
US20040002121A1 (en) * 2001-11-06 2004-01-01 Regan Jeffrey F. High throughput methods and devices for assaying analytes in a fluid sample
US6800449B1 (en) 2001-07-13 2004-10-05 Syngenta Participations Ag High throughput functional proteomics
US20040217278A1 (en) * 2003-05-02 2004-11-04 Overney Gregor T. User customizable plate handling for MALDI mass spectrometry
US20040229369A1 (en) * 2003-05-12 2004-11-18 Gary Kruppa Structural determination of intact proteins using mass spectrometry
US20050023454A1 (en) * 2003-04-10 2005-02-03 Micromass Uk Limited Mass spectrometer
US20050092916A1 (en) * 2003-10-31 2005-05-05 Vestal Marvin L. Ion source and methods for MALDI mass spectrometry
US6949633B1 (en) 1995-05-22 2005-09-27 Sequenom, Inc. Primers useful for sizing nucleic acids
US20060014293A1 (en) * 2004-07-16 2006-01-19 Joyce Timothy H Lock mass ions for use with derivatized peptides for de novo sequencing using tandem mass spectrometry
US20060014210A1 (en) * 2004-07-16 2006-01-19 Boyes Barry E Serial derivatization of peptides for de novo sequencing using tandem mass spectrometry
US6991903B2 (en) 1992-11-06 2006-01-31 Sequenom, Inc. Solid phase sequencing of double-stranded nucleic acids
US20060278824A1 (en) * 2005-06-08 2006-12-14 Jean-Luc Truche Ion source sample plate illumination system
US20070051899A1 (en) * 2005-09-08 2007-03-08 Jean-Luc Truche Maldi sample plate imaging workstation
US20070054416A1 (en) * 1997-06-26 2007-03-08 Regnier Fred E High density sample holder for analysis of biological samples
US7198893B1 (en) 1996-11-06 2007-04-03 Sequenom, Inc. DNA diagnostics based on mass spectrometry
US7635572B2 (en) 2003-06-09 2009-12-22 Life Technologies Corporation Methods for conducting assays for enzyme activity on protein microarrays
US20100022407A1 (en) * 1998-02-04 2010-01-28 Life Technologies Corporation Microarrays and uses therefor
US20100148052A1 (en) * 2005-10-13 2010-06-17 Ibiden Co., Ltd. Analytical carrier and application thereof
US7803529B1 (en) 1995-04-11 2010-09-28 Sequenom, Inc. Solid phase sequencing of biopolymers
US8399383B2 (en) 2000-05-04 2013-03-19 Yale University Protein chips for high throughput screening of protein activity
US10690661B2 (en) 2014-07-11 2020-06-23 Northwestern University Yeast-based biosensor

Families Citing this family (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6379971B1 (en) * 1998-02-24 2002-04-30 Target Discovery, Inc. Methods for sequencing proteins
GB9821393D0 (en) * 1998-10-01 1998-11-25 Brax Genomics Ltd Protein profiling 2
US6764817B1 (en) * 1999-04-20 2004-07-20 Target Discovery, Inc. Methods for conducting metabolic analyses
US6716636B1 (en) * 1999-04-20 2004-04-06 Target Discovery, Inc. Methods for sequencing proteins
ATE552348T1 (en) * 2000-10-19 2012-04-15 Target Discovery Inc MASS DEFECT LABELING FOR DETERMINATION OF OLIGOMER SEQUENCES
US20020160423A1 (en) * 2001-04-30 2002-10-31 George Jackowski Biopolymer marker indicative of disease state having a molecular weight of 1536 daltons
US20040198950A1 (en) * 2001-04-30 2004-10-07 George Jackowski Biopolymer marker indicative of disease state having a molecular weight of 1518 daltons
US6599877B2 (en) 2001-04-30 2003-07-29 Syn X Pharma, Inc. Biopolymer marker indicative of disease state having a molecular weight of 1020 daltons
US20040115655A1 (en) * 2002-12-16 2004-06-17 Ilsley Diane D. Method for analyzing the nucleotide sequence of nucleic acids

Citations (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4267457A (en) * 1977-10-20 1981-05-12 Shionogi & Co., Ltd. Sample holding element for mass spectrometer
US4705616A (en) * 1986-09-15 1987-11-10 Sepragen Corporation Electrophoresis-mass spectrometry probe
US4774055A (en) * 1985-06-26 1988-09-27 Japan Tectron Instruments Corporation Automatic analysis apparatus
US4845035A (en) * 1987-10-06 1989-07-04 The United States Of America As Represented By The Secretary Of Agriculture Enzyme immobilization with a hydrolyzed polysaccharide graft copolymer
US4882127A (en) * 1984-08-06 1989-11-21 Akademie Der Wissenschaften Der Ddr Device for solid phase sequencing of nucleic acid fragments
US5252485A (en) * 1990-08-10 1993-10-12 Savant Instruments, Inc. Unit for hydrolyzing amino-acid containing specimens
WO1993024834A1 (en) * 1992-05-29 1993-12-09 The Rockefeller University Method and product for the sequence determination of peptides using a mass spectrometer
US5288644A (en) * 1990-04-04 1994-02-22 The Rockefeller University Instrument and method for the sequencing of genome
US5474796A (en) * 1991-09-04 1995-12-12 Protogene Laboratories, Inc. Method and apparatus for conducting an array of chemical reactions on a support surface
US5607859A (en) * 1994-03-28 1997-03-04 Massachusetts Institute Of Technology Methods and products for mass spectrometric molecular weight determination of polyionic analytes employing polyionic reagents
US5622824A (en) * 1993-03-19 1997-04-22 Sequenom, Inc. DNA sequencing by mass spectrometry via exonuclease degradation

Patent Citations (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4267457A (en) * 1977-10-20 1981-05-12 Shionogi & Co., Ltd. Sample holding element for mass spectrometer
US4882127A (en) * 1984-08-06 1989-11-21 Akademie Der Wissenschaften Der Ddr Device for solid phase sequencing of nucleic acid fragments
US4774055A (en) * 1985-06-26 1988-09-27 Japan Tectron Instruments Corporation Automatic analysis apparatus
US4705616A (en) * 1986-09-15 1987-11-10 Sepragen Corporation Electrophoresis-mass spectrometry probe
US4845035A (en) * 1987-10-06 1989-07-04 The United States Of America As Represented By The Secretary Of Agriculture Enzyme immobilization with a hydrolyzed polysaccharide graft copolymer
US5288644A (en) * 1990-04-04 1994-02-22 The Rockefeller University Instrument and method for the sequencing of genome
US5252485A (en) * 1990-08-10 1993-10-12 Savant Instruments, Inc. Unit for hydrolyzing amino-acid containing specimens
US5474796A (en) * 1991-09-04 1995-12-12 Protogene Laboratories, Inc. Method and apparatus for conducting an array of chemical reactions on a support surface
WO1993024834A1 (en) * 1992-05-29 1993-12-09 The Rockefeller University Method and product for the sequence determination of peptides using a mass spectrometer
US5622824A (en) * 1993-03-19 1997-04-22 Sequenom, Inc. DNA sequencing by mass spectrometry via exonuclease degradation
US5607859A (en) * 1994-03-28 1997-03-04 Massachusetts Institute Of Technology Methods and products for mass spectrometric molecular weight determination of polyionic analytes employing polyionic reagents

Non-Patent Citations (29)

* Cited by examiner, † Cited by third party
Title
Aldrich et al. (1994), "Identification of a Tap-Dependent Leader Peptide Recognized by Alloreactive T Cells Specific for a Class 1b Antigen," 79 Cell 649-658.
Aldrich et al. (1994), Identification of a Tap Dependent Leader Peptide Recognized by Alloreactive T Cells Specific for a Class 1b Antigen, 79 Cell 649 658. *
Chait et al. Science 262:89 92, 1993. *
Chait et al. Science 262:89-92, 1993.
Jue et al. Biochemistry 24: 162 170, 1985. *
Jue et al. Biochemistry 24: 162-170, 1985.
Karas et al. (1990), "Principles and Applications of Matrix-Assisted UV-Laser Desorption/Ionization Mass Spectrometry," 241 Analytica Chimica Acta 175-185.
Karas et al. (1990), Principles and Applications of Matrix Assisted UV Laser Desorption/Ionization Mass Spectrometry, 241 Analytica Chimica Acta 175 185. *
Klarskov et al. (1989), "C-Terminal Sequence Determination of Peptides Degraded with Carboxypeptidases of Different Specificities and Analyzed by 252-Cf Plasma Desorption Mass Spectrometry," 180 Analytical Biochemistry 28-37.
Klarskov et al. (1989), C Terminal Sequence Determination of Peptides Degraded with Carboxypeptidases of Different Specificities and Analyzed by 252 Cf Plasma Desorption Mass Spectrometry, 180 Analytical Biochemistry 28 37. *
Patterson et al. (1995), "Peptide Sequencing of Carboxypeptidase Digestion Coupled With MALDI-TOF," Abstract of presentation at the 43rd ASMS Conference, Atlanta, Georgia, May 25, 1995. (Applicants have informed Attorney that a computer disk containing the Abstract was mailed on May 9, 1995 by ASMS.)
Patterson et al. (1995), Peptide Sequencing of Carboxypeptidase Digestion Coupled With MALDI TOF, Abstract of presentation at the 43rd ASMS Conference, Atlanta, Georgia, May 25, 1995. (Applicants have informed Attorney that a computer disk containing the Abstract was mailed on May 9, 1995 by ASMS.) *
PerSeptive Biosystems Product Announcement, 1995. *
PerSeptive Biosystems, Inc., Vestec Biospectrometry Products, 1994 "Voyager™ Biospectrometry™ Workstation: High Throughput Accurate Mass Analysis Just Became Routine", Product Brochure.
PerSeptive Biosystems, Inc., Vestec Biospectrometry Products, 1994 Voyager Biospectrometry Workstation: High Throughput Accurate Mass Analysis Just Became Routine , Product Brochure. *
R.J. Cotter (1992), "Time of Flight Mass Spectrometry for the Structural Analysis of Biological Molecules," 64 Analytical Chemistry 1027A-1039A.
R.J. Cotter (1992), Time of Flight Mass Spectrometry for the Structural Analysis of Biological Molecules, 64 Analytical Chemistry 1027A 1039A. *
Thiede et al. (1995), "MALDI-MS for C-Terminal Sequence Determination of Peptides and Proteins Degraded by Carboxypeptidase Y and P," 357 Federation of European Biochemical Societies 65-69.
Thiede et al. (1995), MALDI MS for C Terminal Sequence Determination of Peptides and Proteins Degraded by Carboxypeptidase Y and P, 357 Federation of European Biochemical Societies 65 69. *
Wang et al. (1992), "Determination of the Cleavage Site of the Amyloid Precursor Protein by Plasma Desorption Mass Spectrometry," Techniques in Protein Chemistry III (1992) (ed., R.H. Angeletti; Academic Press, N.Y.); pp. 505-513.
Wang et al. (1992), Determination of the Cleavage Site of the Amyloid Precursor Protein by Plasma Desorption Mass Spectrometry, Techniques in Protein Chemistry III (1992) (ed., R.H. Angeletti; Academic Press, N.Y.); pp. 505 513. *
Welch et al. (1991), "A Herpesvirus Maturational Proteinase, Assemblin: Identification of Its Gene, Putative Active Site Domain, and Cleavage Site," 88 Proc. Natl. Acad. Sci. USA 10792-10796.
Welch et al. (1991), A Herpesvirus Maturational Proteinase, Assemblin: Identification of Its Gene, Putative Active Site Domain, and Cleavage Site, 88 Proc. Natl. Acad. Sci. USA 10792 10796. *
Woods et al. (1991), "Enzymatic Digestion on the Sample Foil as a Method for Sequence Determination by Plasma Desorption Mass Spectrometry: The Primary Structure of Porpoise Relaxin," 111 International Journal of Mass Spectrometry and Ion Processes 77-88.
Woods et al. (1991), Enzymatic Digestion on the Sample Foil as a Method for Sequence Determination by Plasma Desorption Mass Spectrometry: The Primary Structure of Porpoise Relaxin, 111 International Journal of Mass Spectrometry and Ion Processes 77 88. *
Woods et al. (1994), "Protein Processing in Herpes Virus," Time of Flight Mass Spectrometry (1994) (ed., R.J. Cotter, American Chemical Society, Washington, D.C.); pp. 194-210.
Woods et al. (1994), Protein Processing in Herpes Virus, Time of Flight Mass Spectrometry (1994) (ed., R.J. Cotter, American Chemical Society, Washington, D.C.); pp. 194 210. *
Woods et al. (1995), "Simplified High-Sensitivity Sequencing of a Major Histocompatibility Complex Class I-Associated Immunoreactive Peptide Using Matrix-Assisted Laser Desorption/Ionization Mass Spectrometry," 226 Analytical Bichemistry 15-25.
Woods et al. (1995), Simplified High Sensitivity Sequencing of a Major Histocompatibility Complex Class I Associated Immunoreactive Peptide Using Matrix Assisted Laser Desorption/Ionization Mass Spectrometry, 226 Analytical Bichemistry 15 25. *

Cited By (63)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6991903B2 (en) 1992-11-06 2006-01-31 Sequenom, Inc. Solid phase sequencing of double-stranded nucleic acids
US6300076B1 (en) 1995-03-17 2001-10-09 Sequenom, Inc. DNA diagnostics based on mass spectrometry
US7419787B2 (en) 1995-03-17 2008-09-02 Sequenom, Inc. Mass spectrometric methods for detecting mutations in a target nucleic acid
US6221605B1 (en) 1995-03-17 2001-04-24 Sequenom, Inc. DNA diagnostics based on mass spectrometry
US6235478B1 (en) 1995-03-17 2001-05-22 Sequenom, Inc. DNA diagnostics based on mass spectrometry
US6258538B1 (en) 1995-03-17 2001-07-10 Sequenom, Inc. DNA diagnostics based on mass spectrometry
US6268144B1 (en) 1995-03-17 2001-07-31 Sequenom, Inc. DNA diagnostics based on mass spectrometry
US6277573B1 (en) 1995-03-17 2001-08-21 Sequenom, Inc. DNA diagnostics based on mass spectrometry
US6197498B1 (en) 1995-03-17 2001-03-06 Sequenom, Inc DNA diagnostics based on mass spectrometry
US6221601B1 (en) 1995-03-17 2001-04-24 Sequenom, Inc. DNA diagnostics based on mass spectrometry
US7074563B2 (en) 1995-03-17 2006-07-11 Sequenom, Inc. Mass spectrometric methods for detecting mutations in a target nucleic acid
US7759065B2 (en) 1995-03-17 2010-07-20 Sequenom, Inc. Mass spectrometric methods for detecting mutations in a target nucleic acid
US6602662B1 (en) 1995-03-17 2003-08-05 Sequenom, Inc. DNA diagnostics based on mass spectrometry
US6589485B2 (en) 1995-03-17 2003-07-08 Sequenom, Inc. Solid support for mass spectrometry
US6500621B2 (en) 1995-03-17 2002-12-31 Sequenom, Inc. DNA diagnostics based on mass spectrometry
US8758995B2 (en) 1995-04-11 2014-06-24 Sequenom, Inc. Solid phase sequencing of biopolymers
US7803529B1 (en) 1995-04-11 2010-09-28 Sequenom, Inc. Solid phase sequencing of biopolymers
US6949633B1 (en) 1995-05-22 2005-09-27 Sequenom, Inc. Primers useful for sizing nucleic acids
US7501251B2 (en) 1996-11-06 2009-03-10 Sequenom, Inc. DNA diagnostics based on mass spectrometry
US6140053A (en) * 1996-11-06 2000-10-31 Sequenom, Inc. DNA sequencing by mass spectrometry via exonuclease degradation
US7198893B1 (en) 1996-11-06 2007-04-03 Sequenom, Inc. DNA diagnostics based on mass spectrometry
US20070054416A1 (en) * 1997-06-26 2007-03-08 Regnier Fred E High density sample holder for analysis of biological samples
US20100022407A1 (en) * 1998-02-04 2010-01-28 Life Technologies Corporation Microarrays and uses therefor
US8012703B2 (en) * 1998-02-04 2011-09-06 Life Technologies Corporation Microarrays and uses therefor
US7794946B1 (en) * 1998-02-04 2010-09-14 Life Technologies Corporation Microarray and uses therefor
US6558902B1 (en) 1998-05-07 2003-05-06 Sequenom, Inc. Infrared matrix-assisted laser desorption/ionization mass spectrometric analysis of macromolecules
US6555813B1 (en) 1999-04-29 2003-04-29 Ciphergen Biosystems, Inc. Probes with hydrophobic coatings for gas phase ion spectrometers
US20020068366A1 (en) * 2000-04-13 2002-06-06 Ladine James R. Proteomic analysis by parallel mass spectrometry
US8399383B2 (en) 2000-05-04 2013-03-19 Yale University Protein chips for high throughput screening of protein activity
US6465776B1 (en) 2000-06-02 2002-10-15 Board Of Regents, The University Of Texas System Mass spectrometer apparatus for analyzing multiple fluid samples concurrently
WO2002008767A3 (en) * 2000-07-25 2003-08-28 Procter & Gamble Methods and kits for sequencing polypeptides
US20060141632A1 (en) * 2000-07-25 2006-06-29 The Procter & Gamble Co. New methods and kits for sequencing polypeptides
CN1308690C (en) * 2000-07-25 2007-04-04 宝洁公司 New Methods and Kits for Peptide Sequencing
US7074570B2 (en) 2001-05-23 2006-07-11 Ge Healthcare Bio-Sciences Ab Peptide fragmentation
US20030032056A1 (en) * 2001-05-23 2003-02-13 Ronnie Palmgren Peptide fragmentation
US20050064513A1 (en) * 2001-07-13 2005-03-24 Haynes Paul A. High throughput functional proteomics
US6800449B1 (en) 2001-07-13 2004-10-05 Syngenta Participations Ag High throughput functional proteomics
US20040002121A1 (en) * 2001-11-06 2004-01-01 Regan Jeffrey F. High throughput methods and devices for assaying analytes in a fluid sample
WO2003057845A3 (en) * 2001-12-28 2004-02-26 Mds Proteomics Inc Automated systems and methods for analysis of protein post-translational modification
US20030153007A1 (en) * 2001-12-28 2003-08-14 Jian Chen Automated systems and methods for analysis of protein post-translational modification
US7202473B2 (en) * 2003-04-10 2007-04-10 Micromass Uk Limited Mass spectrometer
US20050023454A1 (en) * 2003-04-10 2005-02-03 Micromass Uk Limited Mass spectrometer
US7411183B2 (en) 2003-05-02 2008-08-12 Agilent Technologies, Inc. User customizable plate handling for MALDI mass spectrometry
US20040217278A1 (en) * 2003-05-02 2004-11-04 Overney Gregor T. User customizable plate handling for MALDI mass spectrometry
US7138625B2 (en) 2003-05-02 2006-11-21 Agilent Technologies, Inc. User customizable plate handling for MALDI mass spectrometry
US20050139778A1 (en) * 2003-05-02 2005-06-30 Overney Gregor T. User customizable plate handling for MALDI mass spectrometry
US20050139779A1 (en) * 2003-05-02 2005-06-30 Overney Gregor T. User customizable plate handling for MALDI mass spectrometry
US7368290B2 (en) 2003-05-12 2008-05-06 Sandia National Laboratories Structural determination of intact proteins using mass spectrometry
US20040229369A1 (en) * 2003-05-12 2004-11-18 Gary Kruppa Structural determination of intact proteins using mass spectrometry
US7635572B2 (en) 2003-06-09 2009-12-22 Life Technologies Corporation Methods for conducting assays for enzyme activity on protein microarrays
US20050194544A1 (en) * 2003-10-31 2005-09-08 Vestal Marvin L. Ion source and methods for maldi mass spectrometry
US7109480B2 (en) 2003-10-31 2006-09-19 Applera Corporation Ion source and methods for MALDI mass spectrometry
US20050092916A1 (en) * 2003-10-31 2005-05-05 Vestal Marvin L. Ion source and methods for MALDI mass spectrometry
US6953928B2 (en) 2003-10-31 2005-10-11 Applera Corporation Ion source and methods for MALDI mass spectrometry
US20060014210A1 (en) * 2004-07-16 2006-01-19 Boyes Barry E Serial derivatization of peptides for de novo sequencing using tandem mass spectrometry
US7371514B2 (en) 2004-07-16 2008-05-13 Agilent Technologies, Inc. Serial derivatization of peptides for de novo sequencing using tandem mass spectrometry
US20060014293A1 (en) * 2004-07-16 2006-01-19 Joyce Timothy H Lock mass ions for use with derivatized peptides for de novo sequencing using tandem mass spectrometry
US7435951B2 (en) 2005-06-08 2008-10-14 Agilent Technologies, Inc. Ion source sample plate illumination system
US20060278824A1 (en) * 2005-06-08 2006-12-14 Jean-Luc Truche Ion source sample plate illumination system
US20070051899A1 (en) * 2005-09-08 2007-03-08 Jean-Luc Truche Maldi sample plate imaging workstation
US7495231B2 (en) 2005-09-08 2009-02-24 Agilent Technologies, Inc. MALDI sample plate imaging workstation
US20100148052A1 (en) * 2005-10-13 2010-06-17 Ibiden Co., Ltd. Analytical carrier and application thereof
US10690661B2 (en) 2014-07-11 2020-06-23 Northwestern University Yeast-based biosensor

Also Published As

Publication number Publication date
US5827659A (en) 1998-10-27

Similar Documents

Publication Publication Date Title
US5821063A (en) Methods for sequencing polymers using mass spectrometry
US5869240A (en) Methods and apparatus for sequencing polymers with a statistical certainty using mass spectrometry
EP0827628A1 (en) Methods and apparatus for sequencing polymers with a statistical certainty using mass spectrometry
Patterson et al. C-terminal ladder sequencing via matrix-assisted laser desorption mass spectrometry coupled with carboxypeptidase Y time-dependent and concentration-dependent digestions
AU713720B2 (en) Methods for producing and analyzing biopolymer ladders
Neubauer et al. Mapping of phosphorylation sites of gel-isolated proteins by nanoelectrospray tandem mass spectrometry: potentials and limitations
US20040110186A1 (en) Methods for isolating and labeling sample molecules
US20100311098A1 (en) Method for determining the amino acid sequence of peptides
US9988665B2 (en) Methods for determining protein binding specificity using peptide libraries
US20030008327A1 (en) Methods and systems for identifying kinases, phosphatases, and substrates thereof
NZ509013A (en) Novel methods for the identification of ligand and target biomolecules
AU757356B2 (en) Methods and kits for sequencing polypeptides
Caprioli et al. Determination of Km and Vmax for tryptic peptide hydrolysis using fast atom bombardment mass spectrometry
EP1454143A2 (en) Methods for protein analysis using protein capture arrays
US6747273B2 (en) Methods of detecting protein arginine methyltransferase, and uses related thereto
GB2471015A (en) Mass Spectrometric Endopeptidase Assay
Stults Peptide sequencing by mass spectrometry
Pfeifer et al. A strategy for rapid and efficient sequencing of Lys‐C peptides by matrix‐assisted laser desorption/ionisation time‐of‐flight mass spectrometry post‐source decay
Li et al. C-terminal sequence analysis of peptides using triphenylgermanyl isothiocyanate
Wang et al. Protein ladder sequencing: towards automation
US20100069252A1 (en) Efficient method for partial sequencing of peptide/protein using acid or base labile xanthates
WO1999005309A1 (en) Multiple target screening of molecular libraries by mass spectrometry
Babu et al. Monitoring the neuropeptide metabolites by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry
Redeker et al. Characterization of posttranslational modifications of proteins by MALDI-TOF MS: Application to the study of tubulin
Geyer et al. AMINO ACID COMPOSITION AND SEQUENCE ANALYSIS

Legal Events

Date Code Title Description
STCF Information on status: patent grant

Free format text: PATENTED CASE

FEPP Fee payment procedure

Free format text: PAYOR NUMBER ASSIGNED (ORIGINAL EVENT CODE: ASPN); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

FPAY Fee payment

Year of fee payment: 4

REMI Maintenance fee reminder mailed
AS Assignment

Owner name: MDS INC. (THROUGH ITS MDS SCIEX DIVISION), CANADA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:PERSPECTIVE BIOSYSTEMS, INC.;REEL/FRAME:015452/0212

Effective date: 20041022

FPAY Fee payment

Year of fee payment: 8

AS Assignment

Owner name: BANK OF AMERICA, N.A., AS COLLATERAL AGENT, WASHIN

Free format text: SECURITY AGREEMENT;ASSIGNOR:PERSEPTIVE BIOSYSTEMS, INC.;REEL/FRAME:021976/0160

Effective date: 20081121

AS Assignment

Owner name: APPLIED BIOSYSTEMS, LLC., CALIFORNIA

Free format text: MERGER;ASSIGNOR:PERSEPTIVE BIOSYSTEMS, INC.;REEL/FRAME:023839/0669

Effective date: 20090407

AS Assignment

Owner name: APPLIED BIOSYSTEMS, LLC,CALIFORNIA

Free format text: RELEASE BY SECURED PARTY;ASSIGNOR:BANK OF AMERICA, N.A.;REEL/FRAME:024160/0955

Effective date: 20100129

Owner name: APPLIED BIOSYSTEMS, LLC, CALIFORNIA

Free format text: RELEASE BY SECURED PARTY;ASSIGNOR:BANK OF AMERICA, N.A.;REEL/FRAME:024160/0955

Effective date: 20100129

FPAY Fee payment

Year of fee payment: 12

AS Assignment

Owner name: APPLIED BIOSYSTEMS, INC., CALIFORNIA

Free format text: LIEN RELEASE;ASSIGNOR:BANK OF AMERICA, N.A.;REEL/FRAME:030182/0677

Effective date: 20100528

AS Assignment

Owner name: APPLIED BIOSYSTEMS, LLC, CALIFORNIA

Free format text: CORRECTIVE ASSIGNMENT TO CORRECT THE RECEIVING PARTY NAME PREVIOUSLY RECORDED AT REEL: 030182 FRAME: 0719. ASSIGNOR(S) HEREBY CONFIRMS THE RELEASE OF SECURITY INTEREST;ASSIGNOR:BANK OF AMERICA, N.A.;REEL/FRAME:038038/0356

Effective date: 20100528

Owner name: APPLIED BIOSYSTEMS, LLC, CALIFORNIA

Free format text: CORRECTIVE ASSIGNMENT TO CORRECT THE RECEIVING PARTY NAME PREVIOUSLY RECORDED AT REEL: 030182 FRAME: 0677. ASSIGNOR(S) HEREBY CONFIRMS THE RELEASE OF SECURITY INTEREST;ASSIGNOR:BANK OF AMERICA, N.A.;REEL/FRAME:038038/0356

Effective date: 20100528