US5821063A - Methods for sequencing polymers using mass spectrometry - Google Patents
Methods for sequencing polymers using mass spectrometry Download PDFInfo
- Publication number
- US5821063A US5821063A US08/844,462 US84446297A US5821063A US 5821063 A US5821063 A US 5821063A US 84446297 A US84446297 A US 84446297A US 5821063 A US5821063 A US 5821063A
- Authority
- US
- United States
- Prior art keywords
- polymer
- agent
- mass
- sequence
- series
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Lifetime
Links
Images
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6803—General methods of protein analysis not limited to specific proteins or families of proteins
- G01N33/6848—Methods of protein analysis involving mass spectrometry
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K1/00—General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length
- C07K1/12—General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length by hydrolysis, i.e. solvolysis in general
- C07K1/128—General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length by hydrolysis, i.e. solvolysis in general sequencing
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/001—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof by chemical synthesis
- C07K14/003—Peptide-nucleic acids (PNAs)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P21/00—Preparation of peptides or proteins
- C12P21/06—Preparation of peptides or proteins produced by the hydrolysis of a peptide bond, e.g. hydrolysate products
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/34—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase
-
- H—ELECTRICITY
- H01—ELECTRIC ELEMENTS
- H01J—ELECTRIC DISCHARGE TUBES OR DISCHARGE LAMPS
- H01J49/00—Particle spectrometers or separator tubes
- H01J49/02—Details
- H01J49/04—Arrangements for introducing or extracting samples to be analysed, e.g. vacuum locks; Arrangements for external adjustment of electron- or ion-optical components
- H01J49/0409—Sample holders or containers
- H01J49/0418—Sample holders or containers for laser desorption, e.g. matrix-assisted laser desorption/ionisation [MALDI] plates or surface enhanced laser desorption/ionisation [SELDI] plates
-
- H—ELECTRICITY
- H01—ELECTRIC ELEMENTS
- H01J—ELECTRIC DISCHARGE TUBES OR DISCHARGE LAMPS
- H01J49/00—Particle spectrometers or separator tubes
Definitions
- the present invention relates generally to methods and apparatus for sequencing polymers, especially biopolymers, using mass spectrometry.
- Biochemists frequently depend on reliable and fast determinations of the sequences of biological polymers. For example, sequence information is crucial in the research and development of peptide screens, genetic probes, gene mapping, and drug modeling, as well as for quality control of biological polymers when manufactured for diagnostic and/or therapeutic applications.
- Various methods are known for sequencing polymers composed of two essential biological building-blocks, amino acids, carbohydrates and nucleotides.
- existing methods for peptide sequence determination include the N-terminal chemistry of the Edman degradation, N- and C-terminal enzymatic methods, and C-terminal chemical methods.
- Existing methods for sequencing oligonucleotides include the Maxam-Gilbert base-specific chemical cleavage method and the enzymatic ladder synthesis with dideoxy base-specific termination method. Each method possesses inherent limitations that preclude it being used exclusively for complete primary structure identification.
- Edman sequencing and adaptations thereof are the most widely used tools for sequencing certain protein and peptides residue by residue, while the enzymatic synthesis method is preferred for sequencing oligonucleotides.
- oligonucleotides In the case of both peptides and oligonucleotides, an alternate approach to chemical sequencing is enzymatic cleavage sequencing. In the case of oligonucleotides, over 150 different enzymes have been isolated and found suitable for preparing oligonucleotide fragments. In the case of peptides, serine carboxypeptidases have proven popular over the last two decades because they offer a simple approach by which amino acids can be sequentially cleaved residue by residue from the C-terminus of a protein or a peptide. Carboxypeptidase Y (CPY), in particular, is an attractive enzyme because it non-specifically cleaves all residues from the C-terminus, including proline. (See, e.g., Breddam et al. (1987) Carlsburg Res. Commun. 52: 55-63.)
- Sequencing of peptides by carboxypeptidase digestion has traditionally been performed by a laborious, direct analysis of the released amino acids, residue by residue. Not only is this approach labor-intensive, but it is complicated by amino acid contaminants in the enzyme and protein/peptide solutions, as well as by enzyme autolysis. A further hindrance to any sequencing effort of this type is the absolute requirement for good kinetic information concerning the hydrolysis and liberation of each individual residue by the particular enzyme used.
- MALDI-TOF matrix-assisted laser desorption ionization time-of-flight
- carboxypeptidase digestion of peptides can be combined with MALDI-TOF to analyze the resulting mixture of truncated peptide. For example, eight consecutive amino acids have been sequenced from the C-terminus of human parathyroid hormone 1-34 fragment (Schar et al. (1991) Chimia 45: 123-126). Additionally, carboxypeptidase digestion of peptides has been combined with other mass spectrometry methods such as plasma desorption (Wang et al. (1992) Techniques Protein Chemistry III (ed., R. H. Angeletti; Academic Press, N.Y.) pp. 503-515).
- the invention involves a novel form of sample holder for a mass spectrometer.
- the sample holder comprises a reaction surface with spatially separate areas having differing ratios of polymer and hydrolyzing agent. After a suitable incubation period during which the hydrolyzing agent hydrolyzes inter-monomer bonds within the polymer in each area, a plurality, typically all, of the areas containing hydrolyzed polymer fragments are ionized, typically serially, in the mass spectrometer and data representative of the mass to charge ratios of these fragments are obtained. One or more of the areas will have ratios of hydrolyzing agent to polymer suitable for more or less optimal generation of useful ladder elements or other polymer fragments.
- Some areas on the sample holder may have overly hydrolyzed polymer fragments useless for deriving sequence information. Other areas may contain substantially unhydrolyzed polymer.
- mass spectrometry analysis of all areas at least some mass to charge ratio data obtained from fragments generated in one or more areas which will contain useful data from which sequence information can be derived.
- the method of the invention obviates the necessity to empirically prepare samples to ascertain the appropriate ratio of hydrolyzing agent to polymer, as well as optimal reaction time and carefully controlled reaction temperature, heretofore required.
- hydrolyzing agents can be used in different series of areas on the sample holder so as to further generate useful hydrolyzed fragments, and the data from these may also be integrated to improve the sequencing process. If data analysis is implemented by a computer program, the whole process can be completed minutes after completion of the above-described incubation.
- the present invention provides a method of obtaining sequence information about a polymer comprising a series of different monomers which involves: on a reaction surface, providing at least one amount of a hydrolyzing agent which hydrolyzes said polymer and breaks inter-monomer bonds, and a sample of polymer to form differing ratios of agent to polymer; incubating the same for a time sufficient to obtain a plurality of series of hydrolyzed polymer fragments; performing mass spectrometry on a plurality of the series to obtain mass-to-charge ratio data for hydrolyzed polymer fragments contained in the series; and integrating data from a plurality of the series to obtain sequence information characteristic of the polymer sample.
- the instant invention contemplates both naturally-occurring and synthetic moieties characterized by a series of different monomers.
- the polymer is modified as described herein.
- the method of the instant invention contemplates certain embodiments having hydrolyzing agents capable of hydrolyzing a polymer to form sequence-defining ladders, as well as certain other embodiments having hydrolyzing agents capable of forming polymer maps.
- the instant invention provides for hydrolyzing the polymer with combinations of such agents.
- the instant method contemplates embodiments involving enzymatic as well as non-enzymatic hydrolyzing agents.
- the method provides that the hydrolyzing agent is disposed on the reaction surface in an array of discrete separate zones.
- the hydrolyzing agent is disposed as a gradient.
- the agent is disposed on the reaction surface in a constant amount.
- polymer is similarly disposed on the reaction surface.
- differing agent to polymer ratios are disposed upon the reaction surface and incubated to obtain a plurality of series of hydrolyzed polymer fragments. The various manners in which such differing ratios can be accomplished will be obvious to the skilled practioner.
- the method provides combining the agent and polymer with other useful moieties.
- moieties which selectively shift the mass of hydrolyzed fragments prior to mass spectrometry analysis are included.
- moieties capable of improving ionization of hydrolyzed fragments are included.
- the method provides for including a light-absorbent matrix. The instant method also contemplates embodiments in which any one or more of the above-described moieties are combined with the agent and polymer prior to mass spectrometry analysis.
- reaction surface is fabricated from a variety of substrates and assumes a variety of configurations suitable for use with a mass spectrometer.
- the method of the instant invention can be adapted to all manner of ion formation and all modes of mass analysis.
- the present invention provides a mass spectrometer sample holder having a planar solid surface with at least one amount of a hydrolyzing agent capable of hydrolyzing a polymer disposed thereon.
- the hydrolyzing agent is disposed on the reaction surface in a dehydrated form.
- the hydrolyzing agent is immobilized on the reaction surface.
- the hydrolyzing agent is disposed on the reaction surface in the form of a liquid or gel which is resistant to physical dislocation.
- a light-absorbent matrix is disposed on the surface of the sample holder.
- any one or more of such embodiments of the sample holder may further have microreaction vessels on their surface.
- Other embodiments of the sample holder of the instant invention are disposable.
- sample holder of the present invention are useful to adapt a mass spectrometry apparatus for obtaining sequence information about a polymer comprising a series of different monomers.
- the method of obtaining sequence information in accordance with the instant invention solves problems encountered with conventional polymer sequence methodologies.
- the overall polymer sequencing effort is superior to the prior art time-dependent digestions in terms of: inherent simplicity of the method and elimination of laborious optimization requirements; reduced loss of sample due to transfer from reaction vessel to reaction surface; reduced amounts of enzyme and peptide used; and, particularly important for large-scale application, ease of use/automation.
- the mass spectrometry sample holder of the instant invention provides advantages heretofore unavailable to the skilled practitioner.
- the sample holder minimizes reagent handling and greatly facilitates sample processing.
- the skilled practitioner need only provide a sample of polymer. Virtually all other experimental parameters are pre-optimized.
- FIG. 1 depicts a sample plate known in the prior art which can be adapted for MALDI-TOF analysis of polymer sequences by practicing the methods of the present invention and disposing hydrolyzing agent thereon to achieve differing ratios of agent to polymer in each well.
- FIGS. 2A, 2B, and 2C depict several MALDI Spectra from a time-dependent CPY digestion of ACTH 7-38 fragment PheArgTrpGlyLysProValGlyLysLysArgArgProValLysValTyrProAsnGlyAlaGluAspGluSerAlaGluAlaPheProLeuGlu! (SEQ. ID. NO: 22), at 1 min (2A), 5 min (2B) and 25 min (2C).
- FIG. 3 is a MALDI mass spectrum representing pooled 15 s, 105 s, 6 min and 25 min quenched aliquots.
- FIGS. 4A and 4B depict various MALDI spectra from on-plate digestions of ACTH 7-38 fragment at various concentrations of Carboxypeptidase Y (CPY): 6.10. ⁇ 10 -4 U/ ⁇ l (4A); 1.53 ⁇ 10 -3 /U ⁇ l (4B).
- CPY Carboxypeptidase Y
- FIGS. 5A, 5B, and 5C depict various MALDI spectra of the following three selected peptides: osteocalcin 7-19 fragment GlyAlaProValProTyrProAspProLeuGluProArg! (SEQ. ID. NO:13) (5A), angiotensin 1 AspArgValTyrIleHisProPheHisLeu! (SEQ. ID. NO:8) (5B), and bradykinin ArgProProGlyPheSerProPheArg! (SEQ. ID. NO:5) (5C).
- FIGS. 6A-6E depict various MALDI spectra of exonuclease hydrolysis of a nucleic acid polymer (SEQ. ID. No. 23) at various concentrations of Phosphodiesterase I (Phos I): 0.002 ⁇ U/ ⁇ l (6A); 0.005 ⁇ U/ ⁇ l (6B); 0.01 ⁇ U/ ⁇ l (6C); 0.02 ⁇ U/ ⁇ l (6D); 0.05 ⁇ U/ ⁇ l (6E).
- Phos I Phosphodiesterase I
- FIG. 7 depicts a MALDI spectrum of a hydrolyzed nucleic acid polymer (SEQ. ID. NO:13) combined with a light-absorbent matrix.
- the instant invention relates to methods and apparatus for sequencing polymers using mass spectrometry.
- the methods and apparatus utilize polymers and hydrolyzing agents disposed upon a reaction surface.
- the hydrolyzing agents are enzymatic or non-enzymatic.
- the hydrolyzing agents react with the polymer to produce sequence-defining polymer ladders or polymer maps.
- the methods of this invention further involve the step of obtaining mass spectrometry data relating to hydrolyzed polymer series and integrating the data from a plurality of polymer series to determine the polymer sequence.
- the mass spectrometry method of this invention is applicable to all manner of ion formation and all modes of mass analysis.
- the apparatus of this invention relates to a mass spectrometer sample holder for adapting a mass spectrometer to obtain sequence information about a polymer in accordance with the method of the instant invention.
- the apparatus has disposed thereon hydrolyzing agent, in dehydrated, immobilized, liquid and/or gel form, and/or a light-absorbent matrix.
- the apparatus of the instant invention is disposable.
- a "polymer” is intended to mean any moiety comprising a series of different monomers suitable for use in the method of the instant invention. That is, any moiety comprising a series of different monomers whose intermonomer bonds are susceptible to hydrolysis are suitable for use in the method disclosed herein.
- a peptide is a polymer made up of particular monomers, i.e., amino acids, which can be hydrolyzed by either enzymatic or chemical agents.
- a DNA is a polymer made up of other monomers, i.e., bases, which can be hydrolyzed by a variety of agents.
- a polymer can be a naturally-occurring moiety as well as a synthetically-produced moiety.
- the polymer is a biopolymer selected from, but not limited to, the following group: proteins, peptides, DNAs, RNAs, PNAs (peptide nucleic acids), carbohydrates, and modified versions thereof.
- Sequence information as used herein is intended to mean any information relating to the primary arrangement of the series of different monomers within the polymer, or within portions thereof. Sequence information includes information relating to the chemical identity of the different monomers, as well as their particular position within the polymer. Polymers with known primary sequences, as well as polymers with unknown primary sequences, are suitable for use in the methods of the instant invention. It is contemplated that sequence information relating to terminal monomers as well as internal monomers can be obtained using the methods disclosed herein. In certain applications, sequence information can be obtained using a sample of an intact, complete polymer. In other applications, sequence information can be obtained using a sample containing less than the intact complete polymer, for example, polymer fragments.
- polymer fragments can be naturally-occurring, artifacts of isolation and purification, and/or generated in vitro by the skilled artisan. Additionally, polymer fragments can be initially derived from and prepared by a variety of fractionation and separation methods, such as high performance liquid chromatography, prior to use with the methods of the instant invention.
- reaction surface of the instant method includes any surface suitable for hydrolyzing the subject polymer with the subject agent.
- the reaction surface can be fabricated from a variety of substrates, such as but not limited to: metals, foils, plastics, ceramics, and waxes. All reaction surfaces must be suitable for use with a mass spectrometer apparatus.
- the reaction surface of the instant invention can assume any configuration suitable for use with a particular mass spectrometer apparatus.
- the reaction surface can be a planar solid surface.
- the surface may have microreaction vessels disposed thereon.
- the reaction surface can assume the configuration of a probe suitable for use with certain mass spectrometer apparatus.
- the skilled artisan will appreciate that the reaction surface can be activated and/or derivatized to enhance or facilitate polymer sequencing in accordance with the instant invention.
- hydrolyzing agent is intended to mean any agent capable of disrupting inter-monomer bonds within a particular polymer. That is, any agent which can interrupt the primary sequence of a polymer is suitable for use in the methods disclosed herein. Hydrolyzing agents can act by liberating monomers at either termini of the polymer, or by breaking internal bonds thereby generating fragments or portions of the subject polymer. Generally, a preferred hydrolyzing agent interrupts the primary sequence by cleaving before or after a specific monomer(s); that is, the agent specifically interacts with the polymer at a particular monomer or particular sequence of monomers recognized by the agent as the preferred hydrolysis site within the polymer. All of the currently preferred hydrolyzing agents described herein are commercially available from reagent suppliers such as Sigma Chemicals (St. Louis, Mo.).
- an excipient is added to, and used in conjunction with, the hydrolyzing agent.
- the excipients contemplated herein facilitate lyophilization and/or dissolution of the hydrolyzing agent.
- fucose and other sugars suitable for use with the instant invention are contemplated. Suitable for use is intended to mean that no interference with mass spectrometry is encountered by the use thereof.
- Other excipients useful in the instant invention are pH modifiers, such as ammonium acetate.
- Still other excipients suitable for use in the methods and apparatus disclosed herein are those which act as stabilizers of the integrity of the hydrolyzing agent. With respect to excipients, the identity of those suitable will be obvious to the skilled artisan using only routine experimentation. While certain preferred excipients are described above, identification of suitable equivalents is within the skill of the ordinary artisan.
- the hydrolyzing agent is a hydrolase enzyme.
- Some hydrolases are endohydrolases, others are exohydrolases.
- the particular hydrolase used is determined by the nature of the polymer and/or the type of sequence information desired. Its identity can be readily determined by the skilled artisan using no more than routine experimentation.
- currently preferred endohydrolases include but are not limited to: endonucleases, endopeptidases, endoglycosidases, trypsin, chymotrypisin, endoproteinase Lys-C, endoproteinase Arg-C, and thermolysin.
- exohydrolases include but are not limited to: exonucleaes, exoglycosidases, and exopeptidases.
- the currently preferred exonucleases include, but are not limited to: phosphodiesterase types I and II, exonuclease VII, ⁇ -exonuclease, T7 gene 1 exonuclease, exonuclease III, BAL-31, exonuclease I, exonuclease V, exonuclease II, and DNA polymerase III.
- exoglycosidases include, but are not limited to: ⁇ -mannosidase I, ⁇ -mannosidase, ⁇ -hexosaminidase, ⁇ -galactosidase, ⁇ -fucosidase I, ⁇ -fucosidase II, ⁇ -galactosidase, ⁇ -neuraminidase, ⁇ -glucosidase I and ⁇ -glucosidase II.
- exopeptidases include, but are not limited to: carboxypeptidase Y, carboxypeptidase A, carboxypepetidase B, carboxypeptidase P, aminopeptidase 1, leucine amino peptidase, proline aminodipeptidase, and cathepsin C.
- the hydrolyzing agent is an agent other than an enzyme.
- an agent can be a chemical, such as an acid.
- preferred agents other than an enzyme include but are not limited to: cyanogen bromide, hydrochloric acid, sulfuric acid, and pentafluoroproprionic fluorohydride.
- hydrolysis can be accomplished using partial acid hydrolysis in accordance with the methods disclosed herein. Again, the identity of a hydrolyzing agent other than an enzyme will be determined by the nature of the polymer and the type of sequence information desired. It is within the skilled practitioner's ability to identify a suitable agent, as well as the circumstances under which such an agent is preferred.
- the instant method further provides for use of combinations of the above-described individual hydrolyzing agents.
- combinations of enzymes can be used in the claimed invention.
- Combinations of hydrolyzing agents other than enzymes can also be used.
- combinations of enzymes with agents other than enzymes can also be used in the instant method. Again, the exact combination and the circumstances under which such a combination is appropriate will depend upon the nature of the polymer and the sequence information desired. The skilled practitioner will know when combinations of hydrolyzing agents are suitable for use in the methods disclosed herein.
- hydrolyzing agent/polymer sequence-specific interactions are well known in the art.
- polymers such as proteins and DNAs specifically interact with proteinases and nucleases, respectively.
- Certain of the preferred proteinases specifically recognize the C-terminus (carboxypeptidase Y) or the N-terminus (amino peptidase 1) of a protein's amino acid sequence.
- Certain of the preferred nucleases specifically recognize the 5' or the 3' terminus of a polynucleotide's base sequence. Some nucleases recognize single-stranded polynucleotides; others recognize double-stranded polynucleotides while still others recognize both.
- such exohydrolases generate a series of hydrolyzed fragments comprising a sequence-defining "ladder" of the polymer. That is, these agents generate a series of hydrolyzed fragments, each hydrolyzed fragment within the series being a "ladder element,” which collectively comprise a sequence-defining "ladder” of the polymer.
- Ladder elements represent hydrolyzed fragments from which monomers have been consecutively and/or progressively liberated by the exohydrolase acting at one or the other of the polymer's termini. Accordingly, ladder elements are truncated hydrolyzed polymer fragments, and ladders per se are concatenations of these collective truncated hydrolyzed polymer fragments.
- sequence information relating to the amino acid sequence of a protein can be obtained using carboxypeptidase Y, an agent which acts at the carboxy terminus.
- hydrolyzing agents other than exohydrolases which also act at one or the other of a polymer's termini generate ladder elements which collectively comprise a series of sequence-defining ladders.
- the well-known Edman degradation technique and associated reagents can be adapted for use with the methods of the instant invention for this purpose.
- the above-described subtractive-type sequencing method through which repetitive removal of successive amino-terminal residues from a protein polymer can occur, can also be accomplished with hydrolyzing agents other than enzymes as disclosed herein.
- sequence information can also be obtained using hydrolyzing agents which act to disrupt internal inter-monomer bonds.
- an endohydrolase can generate a series of hydrolyzed fragments useful ultimately in constructing a "map" of the polymer. That is, this agent generates a series of related hydrolyzed fragments which collectively contribute information to a sequence-defining "map" of the polymer.
- peptide maps can be generated by using trypsin endohydrolysis in tandem with cyanogen bromide endohydrolysis to obtain hydrolyzed fragments with overlapping amino acid sequences. Such overlapping fragments are useful for reconstructing ultimately the entire amino acid sequence of the intact polymer.
- this combination of hydrolyzing agents generates a useful plurality of series of hydrolyzed fragments because trypsin specifically catalyzes hydrolysis of only those peptide bonds in which the carboxyl group is contributed by either a lysine or an arginine monomer, while cyanogen bromide cleaves only those peptide bonds in which the carbonyl group is contributed by methionine monomers.
- trypsin and cyangogen bromide hydrolysis in tandem, one can obtain two different series of hydrolyzed "mapping" fragments.
- mapping fragments are then examined by mass spectrometry to identify specific hydrolysates from the second cyanogen bromide hydrolysis whose amino acid sequences establish continuity with and/or overlaps between the specific hydrolysates from the first hydrolysis with trypsin. Overlapping sequences from the second hydrolysis provide information about the correct order of the hydrolyzed fragments produced by the first trypsin hydrolysis. While these general principles of peptide mapping are well-known in the prior art, utilizing these principles to obtain sequence information by mass spectrometry as disclosed herein has heretofore been unknown in the art.
- a sample of polymer includes biological fluids containing (or suspected to contain) the polymer of interest.
- a sample of polymer is also intended to include isolated and purified polymer. Additionally, a sample of polymer can be aqueous or non-aqueous.
- Adding a sample of polymer to the reaction surface can be accomplished in a variety of ways.
- the sample can be introduced as individual aliquots, or the sample can be introduced in a continuous mode such as sample eluting from a preparative or qualitative column. In both cases, the sample can be introduced manually or by automated means.
- the instant method Upon adding a sample of polymer and hydrolyzing agent to the reaction surface, the instant method provides that differing concentrations of agent or ratios of agent to polymer are formed on said reaction surface. For example, if the polymer sample contains a uniform amount of polymer, then the method contemplates that differing amounts of agent be disposed on the reaction surface. This would produce differing agent to polymer ratios.
- the differing amounts of agent can be in the form of discrete separate zones to which a constant amount of polymer is added. Alternatively, the differing amounts of agent can be in the form of a non-discrete gradient of agent ranging from low to high amounts of agent, perhaps in the form of strip of appropriate length and width.
- differing agent to polymer ratios are produced.
- the agent and polymer can assume any configuration and be present in any amount(s); all that is required is that the combination of agent and polymer results in differing ratios of the same disposed on the reaction surface.
- differing ratios of agent to polymer can also be accomplished by disposing a constant amount of agent on the reaction surface and adding varying amounts of polymer, e.g., a polymer gradient or discrete separate zones of differing amounts of polymer or polymer solution.
- polymer gradient polymer eluted from a column in the form of a gaussian-distributed gradient is currently preferred.
- the instant method further provides for incubating the above-described agent to polymer ratios for a time required to obtain the requisite plurality of series of hydrolyzed polymer fragments.
- Incubating can proceed under any conditions suitable for hydrolyzing the polymer and for any amount of time required to obtain a plurality of series of hydrolyzed fragments.
- the disclosed methods permit sequencing information to be obtained in relatively short time periods, for example, in less than 1 hour.
- the incubation time can be shortened or lengthened depending upon the nature of the polymer and/or hydrolyzing agent(s). It will be obvious to one skilled in the art how to identify appropriate incubation times and optimize the same. Incubation reactions can be terminated by evaporation.
- a "plurality of series" of hydrolyzed polymer fragments is intended to mean that hydrolyzed fragments are produced by at least two different agent:polymer ratios, and that each agent:polymer ratio generates a series of hydrolyzed fragments. For example, if a constant amount of polymer is added to two separate zones of agent containing different amounts of agent, each zone represents one agent:polymer ratio and each zone produces one series of hydrolyzed fragments. When taken together, the two zones are a plurality which collectively contain a plurality of series of hydrolyzed polymer fragments.
- the method disclosed herein teaches obtaining sequence information by performing mass spectrometry on a plurality of series of hydrolyzed fragments to obtain mass-to-charge ratio data for hydrolyzed polymer fragments contained therein. As already discussed, this contemplates that at least two different agent:polymer ratios be provided and analyzed by mass spectrometry.
- any manner of ion formation can be adapted for obtaining mass-to-charge ratio data, including but not limited to: matrix-assisted laser desorption ionization, plasma desorption ionization, electrospray ionization, thermospray ionization, and fast atom bombardment ionization.
- any mode of mass analysis is suitable for use with the instant invention including but not limited to: time-of-flight, quadrapole, ion trap, and sector analysis.
- a currently preferred mass spectrometer instrument is an improved time-of-flight instrument which allows independent control of potential on sample and extraction elements, as described in copending U.S. Ser. No. 08/446,544 (Atty. Docket No. SYP-111) filed on even date herewith now U.S. Pat. No. 5,625,184 and which is herein incorporated by reference.
- mass-to-charge ratio data are obtained using a plurality of series of hydrolyzed fragments.
- hydrolyzed fragments from at least two different agent:polymer ratios are provided to obtain mass-to-charge ratios by mass spectrometry.
- the mass-to-charge ratio data from at least two different agent:polymer ratios are integrated to obtain the sequence information characteristic of the polymer.
- integrating data in accordance with the instant invention to obtain sequence information is more accurate, efficient, and rapid than sequence methods heretofore known in the art.
- the method of the instant invention also provides for including moieties useful in mass spectrometry.
- a light-absorbent matrix can be introduced at any point prior to performing mass spectrometry analysis by laser desorption.
- Light-absorbent matrices are particularly useful for analysis of biopolymers.
- Matrix-assisted laser desorption ionization techniques, as well as various matrices suitable therefor, are well known in the art and have been described, for example, in U.S. Pat. No. 5,288,644 (issued Feb. 22, 1994) and U.S. Ser No. 08/156,316 (Atty. Docket No. Vestec-14-2, allowed Apr. 18, 1995 now U.S. Pat. No. 5,453,247), the disclosures of which are herein incorporated by reference.
- moieties useful in the instant method include those capable of selectively shifting the mass of certain hydrolyzed fragments. These, too, can be added at any point prior to mass spectrometry analysis.
- mass-shifting moieties include, but are not limited to, those moieties which produce reaction products such as: alkyl, aryl, alkenyl, acyl, thioacyl, oxycarbonyl, carbamyl, thiocarbamyl, sulfonyl, imino, guanyl, ureido, and silyl reaction products. Attachment of such moieties to hydrolyzed polymers is achieved using art-recognized attachment chemistries. The particular moiety best suited to a particular sequence determination will depend upon the nature of the polymer and the hydrolyzed fragments. The skilled artisan will be able to determine which moiety to use, if any.
- moieties suitable for use with the instant method are those which can improve ionization of hydrolyzed fragments. Such moieties can be introduced at any time prior to mass spectrometry analysis.
- ionization-improving moieties include, but are not limited to, those moieties which produce reaction products such as: amino, quarternary amino, pyridino, imidino, guanidino, oxonium, and sulfonium reaction products. Preparation and/or use of such moieties are well known in the art.
- the instant invention provides a mass spectrometer sample holder.
- the instant sample holder is useful for adapting any mass spectrometer apparatus for obtaining sequence information in accordance with the disclosed methods.
- the sample holder has a planar solid surface on which is disposed hydrolyzing agent.
- the sample holder has the form of a probe useful in certain mass spectrometer apparatus.
- the agent can be in dehydrated, immobilized, liquid and/or gel form.
- the agent is resistant to physical dislocation and is chemically stable for at least about one to two months, thereby facilitating both transport and storage.
- the agent can be disposed in separate discrete zones of differing amounts, or in a non-discrete gradient.
- the agent can be disposed in a constant amount on the surface of the sample holder.
- the sample holder has a light-absorbent matrix disposed on its surface; this can be with or without hydrolyzing agent.
- the sample holder can also have microreaction vessels arranged on its surface. In one embodiment, these vessels can be depressions on the holder's surface resulting from chemical-etching or similar techniques.
- the sample holder can be fabricated from a variety of substrates including but not limited to: metals, foils, plastics, ceramics, and waxes.
- the sample holder is disposable.
- the sample holder disclosed herein is a component of a kit useful for sequencing polymers by mass spectrometry, such as that disclosed in co-pending U.S. Ser. No. 08/447,175 (Atty. Docket No.: SYP-114) filed on even date herewith and herein incorporated by reference.
- the instant invention also relates to a method of data analysis of the mass-to-charge ratios obtained by mass spectrometry.
- the method provides a set of fragments, created by hydrolysis of the polymer, each set differing by one or more monomers. The difference between the mass-to-charge ratio of at least one pair of fragments is determined.
- One then asserts a mean mass-to-charge ratio which corresponds to the known mass-to-charge ratio of one or more different monomers.
- the asserted mean is compared with the measured mean to determine if the two values are statistically different with a desired confidence level. If there is a statistical difference, then the asserted mean difference is not assignable to the actual measured difference. In some embodiments, additional measurements of the difference between a pair of fragments are taken, to increase the accuracy of the measured mean difference. The steps of the method are repeated until one has asserted all desired mean differences for a single difference between one pair of fragments. The method is repeated for additional pairs of fragments and the mass-to-charge ratio data from a plurality of parallel mass spectra are integrated until the desired sequence information is obtained.
- Aliquots of 1 ⁇ L were taken from the reaction vial at reaction times of 15 s, 60 s, 75 s, 105 s, 2 min, 135 s, 4 min, 5 min, 6 min, 7 min, 8 min, 9 min, 10 min, 15 min and 25 min. At 25 min, 15 ⁇ L of 5 ⁇ 10 -3 units/ ⁇ L CPY was added to the reaction vial.
- a pooled peptide solution was prepared by combining 2 ⁇ L of the 15 s, 105 s, 6 min and 25 min aliquots. Into individual ⁇ L wells on the MALDI sample plate, 1 ⁇ L of each aliquot solution was placed and allowed to evaporate to dryness before insertion into the mass spectrometer.
- All on-plate digestions were performed by pipetting 0.5 ⁇ L of the peptide at a concentration of 1 pmol/ ⁇ L into each of ten 1 ⁇ L wells across one row of a sample plate configured similarly to the sample plate manufactured and supplied by PerSeptive BioSystems, Inc. of Framingham, Mass. and adapted for use with their trademarked mass spectrometry apparatus known as VoyagerTM. All peptides listed in Table 1 were purchased from Sigma and were of the highest purity offered. To initiate the reaction in the first well, 0.5 ⁇ L of 0.0122 units/ ⁇ L CPY was added.
- MALDI-TOF mass analysis was performed using the VoyagerTM BiospectrometryTM Workstation (PerSeptive Biosystems, Cambridge, Mass.). A 28.125 KV potential gradient was applied across the source containing the sample plate and an ion optic accelerator plate in order to introduce the positively charged ions to the 1.2 m linear flight tube for mass analysis.
- a low mass gate was used to prevent the matrix ions from striking the detector plate.
- the guide wire was pulsed for a brief period deflecting the low mass ions (approximately ⁇ 1000 daltons). All other spectra were recorded with the low mass gate off.
- the statistical protocol disclosed herein uses the equation for the two-tailed t-test: ##EQU1## where x is the average experimental mean, ⁇ is the asserted mean, n is the number of replicates and S is the experimental standard deviation.
- x is the average experimental mean
- ⁇ is the asserted mean
- n is the number of replicates
- S is the experimental standard deviation.
- FIG. 2 illustrates the MALDI spectra of the 1 min, 5 min and 25 min time aliquots that were removed from a solution-phase time-dependent CPY digestion of ACTH 7-38 fragment.
- the nomenclature of the peak labels denotes the peptide populations resulting from the loss of the indicated amino acids. Peaks representing the loss of 19 amino acids from the C-terminus are observed.
- FIG. 2A shows that 9 detectable peptide populations exist including the intact ACTH 7-38 fragment and peptides representing the loss of the first 8 amino acids from the C-terminus.
- the 5 min aliquot shows that the peptide populations representing the loss of Ala(32) and Ser(31) have become much more predominant than the 1 min aliquot. Amino acid losses of 11 residues, Ala(32) through Val(22), are present at this digestion time.
- FIG. 2C shows the final detected amino acids of Lys(21) and Val(20) as 4 major peptide populations are detected.
- the prior-art time-dependent method presented herein is the result of extensive method optimization and is optimized for obtaining the maximum sequence information in the shortest amount of time. For this particular optimized case, detectable amounts of all populations were observed over 25 min in the three selected time aliquots. This was not the case for numerous preliminary solution-phase digestions that were performed during the method optimization that led to the choice of these optimized conditions. At higher concentrations of CPY the peaks representing the loss of Glu(28) and Pro(24) were often not observed, indicating that CPY cleaves these residues very readily when alanine and tyrosine are at the penultimate positions, respectively.
- MALDI analysis shows that a peptide ladder is formed that contains peaks that represent the loss of almost all amino acids from the C-terminus (FIG. 3). All amino acid losses are observed except for those of Glu(28), Asn(25), and Pro(24) which were present as small peaks in the 6 min aliquot and subsequently diluted to undetectable concentrations in this pooled fraction.
- a sequence gap is observed here as the peptide populations representing the loss of Glu(28), Asn(25) and Pro(24) exist below a signal-to-noise ratio of 3. These populations were observed as small peaks in the 6 min aliquot mass spectrum but, upon the 4-fold dilution with the other aliquots, exist in too small a concentration to be detected. This emphasizes the necessity of recording individual mass spectra for each time aliquot. The less time-demanding procedure of recording a single spectrum representing pooled results not only created sequence gaps, but lost the time-dependent history of the digestion.
- solution-phase digestion suffers from a number of disadvantages.
- a large amount of time, enzyme and peptide is required for method optimization in order to obtain significant digestion in a short amount of time while preserving all possible sequence information.
- For each peptide from which sequence information is to be derived some time-consuming method development must be performed since a set of optimum conditions for one peptide is not likely to be useful for another peptide given the composition-dependent hydrolysis rates of CPY.
- An alternative strategy is to perform the concentration-dependent hydrolysis on the MALDI sample surface as described below.
- FIG. 1 depicts a VoyagerTM sample plate for MALDI analysis comprised of a 10 ⁇ 10 matrix of 1 ⁇ L wells etched into the stainless steel base. These wells serve as micro-reaction vessels in which on-plate digestions may be performed. The physical dimensions of the plate are 57 ⁇ 57 mm and the wells are 2.54 mm in diameter.
- MALDI spectra corresponding to the on-plate concentration dependent digestions of the ACTH 7-38 fragment for CPY concentrations of 6.10 ⁇ 10 -4 , and 1.53 ⁇ 10 -3 units/ ⁇ L, respectively, are illustrated in panels A and B of FIG. 4.
- Panel A and B show the spectra obtained from digests using CPY concentrations of 6.10 ⁇ 10 -4 and 1.53 ⁇ 10 -3 units/ ⁇ L, respectively.
- Laser powers significantly above threshold were used to improve the signal-to-noise ratio of the smaller peaks in the spectrum at the expense of peak resolution.
- the symbol * indicates doubly charged ions and # indicates an unidentified peak at m/z-2517.6 daltons.
- the lower concentration digestion yielded 12 significant peaks representing the loss of 11 amino acids from the C-terminus.
- the digestion from the higher concentration of CPY showed some overlap of the peptide populations present at the lower concentration as well as peptide populations representing the loss of amino acids through the Val(20).
- the concentration of the peptides representing the loss of the first few amino acids have decreased to undetectable levels (approximately ⁇ 10 fmol) with the exception of the Leu(37) peak.
- FIG. 4 represents 2 of the 9 CPY concentrations that were performed simultaneously.
- the method optimization in this case, was inherent in the strategy.
- the total time of method development (optimal digestion conditions), digestion, data collection and data analysis was under 30 min using this on-plate approach.
- the bolded amino acids indicate that a peak representing the loss of that residue was observed in one or more of the MALDI spectra taken across the row of digestions. In order to be able to identify a residue, the peak representing the loss of that amino acid and the preceding amino acid must be present.
- the residues that are enclosed in parenthesis are those for which the sequence order could not be deduced.
- CPY offered some sequence information from the C-terminus for most of the peptides digested, lending no sequence information in only three of the 22 cases. In two of these three cases, the C-terminus was a lysine followed by an acidic residue at the penultimate position. CPY has been reported to possess reduced activity towards basic residues at the C-terminus, and the presence of the neighboring acidic residue seems to further reduce its activity. In the case of the lutenizing hormone releasing hormone (LH-RH), the C-terminal amidated glycine followed by proline at the penultimate position inhibited CPY activity which agrees with reports of CPY slowing at both proline and glycine residues (Hayashi et al.
- CPY is known to hydrolyze amidated C-terminal residues of dipeptides and is shown here to cleave those of physalaemin, kassinin, subtance P, bomesin, and ⁇ -MSH.
- CPY was able to derive sequence information from all of the peptides, except LH-RH, that possess blocked N-terminal residues (physalaemin, bombesin and ⁇ -MSH). This is significant as these peptides would lend no information to the Edman approach. A number of the peptides were sequenced until the detection of the truncated peptide peaks were impaired by the presence of CHCA matrix ions ( ⁇ 600 daltons). The sequencing of the other peptides did not go as far as a combination of residues at the C-terminus and penultimate position that inhibited CPY activity were encountered.
- FIG. 5 shows selected on-plate digestions of osteocalin 7-19 fragment, angiotensin 1 and bradykinin resulting from on-plate digestions using CPY concentrations of 3.05 ⁇ 10 -3 , 3.05 ⁇ 10 -4 , and 6.10 ⁇ 10 -4 units/ ⁇ L, respectively.
- Na denotes a sodium adduct peak
- # denotes a matrix peak at m/z-568.5 daltons.
- Bradykinin is shown to sequence until the matrix begins to interfere with peak detection. For all three of the selected peptides, the total sequence information obtained for the overall 9 well digestion is represented in the single digestion shown. For many other peptides this was not the case. The total sequence information is often derived from 2 or more of the wells as is the case with ACTH 7-38 fragment given in FIG. 4.
- the interpretation of data utilized an automated process of acquiring and interpreting the data using software feedback control.
- the data interpretation software controls the number of acquisitions (minimum of 2) that are required to statistically differentiate multiple candidates for an amino acid assignment.
- the operator has control of specifying to what minimum statistical level of confidence the assignment(s) should meet.
- Table 2 represents a comparison of the actual average masses of the sequenced residues of the ACTH 7-38 fragment and the experimental mass differences with associated standard deviations and 95% confidence intervals calculated for the time-dependent digestion.
- the number of replicates indicate the number of spectra that possessed the detectable adjacent peaks required for the mass difference measurement of that particular residue.
- the need for a significant number of measurements in order to estimate the mean is obvious from the table as the 95% confidence level decreases as the square root of the number of measurements.
- the actual mass fell within ⁇ 3 ⁇ the experimental mass distribution. Calculated t-values for each case were less than the tabulated t-value for the 95% confidence interval signifying that the experimental mass is not significantly different than the actual known mass.
- a calculated t-value for each possible amino acid must be compared with the tabulated value.
- Table 3 represents calculated t-values for 19 sequenced amino acid experimental means in the ACTH 7-38 fragment given the asserted means of 20 common unmodified amino acids. The table value is given at the end of each column. A t calculated ⁇ t table indicates that the experimental mean is not significantly different that the mean of the asserted amino acid at 95% confidence interval. Each t calculated for which this is the case is indicated in bold.
- Table 4 summarizes the results of the statistical amino acid assignments for the 19 amino acids sequenced from the C-terminus of ACTH 7-38 fragment using the prior art time-dependent strategy.
- the masses of the listed amino acids could not be statistically differentiated from the experimentally derived mass difference at the given confidence levels.
- the amino acids indicated in bold are the known residues existing at the given positions.
- the confidence intervals indicated are the highest levels at which all amino acid masses other than those indicated are statistically different from the experimental mean.
- Table 3 shows that, for this residue, the asserted amino acid mass that resulted in the smallest t calculated was that of methionine. Using a confidence interval of 80%, the correct assignment of Glu is deemed statistically improbable. Likewise, the assignment of residue 38 was made as Gln/Lys/Glu at a confidence level of 95%, but the correct assignment (Glu) is again statistically improbable at an 80% level.
- mass shift reagents used to move peptide populations out of the interfering matrix are a possible chemical means for improving experimental error relating to peptides appearing in the low mass ( ⁇ 600 daltons) region.
- the use of reflectron and/or extended flight tube geometries are also expected to be instrumental methods suitable for reducing this error.
- the protocol disclosed herein for statistical assignment of residues using the on-plate strategy involves multiple sampling from each well in which digestion is performed.
- the number of replicates required depends on the amino acid(s) that is(are) being sequenced at any one CPY concentration. For example, more replicates are required for mass differences around 113-115 daltons (Ile/Leu, Asn and Asp) and 128-129 daltons (Gln/Lys/Glu) than for mass differences around 163 (Tyr) or 57 (Gly) in order to be able to assure that all but one assignment are statistically unlikely.
- the experimental errors for this method appear to be as random (multiple replicates per sample) as for the time-dependent digestion (one replicate per sample).
- the method disclosed herein has also been used to obtain sequence information about a nucleic acid polymer containing 40 bases. Hydrolysis using an exonuclease specific for the 3' terminus was conducted using different concentrations of Phos I (phosphodiesterase I) ranging from 0.002 ⁇ U/ ⁇ l to 0.05 ⁇ U/ ⁇ l. Hydrolysis was allowed to proceed for 3 minutes. Spectra of hydrolyzed sequences using MALDI-TOF are depicted in FIGS. 6A-6E. Data integration as disclosed herein confirmed the sequence to be:
- this strategy can be applied to the sequencing of any natural biopolymer such as proteins, peptides, nucleic acids, carbohydrates, and modified versions thereof.
- the ladders can be created enzymatically using exohydrolases, endohydrolases or the Sanger method and/or chemically by truncation synthesis or failure sequencing.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Medicinal Chemistry (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Urology & Nephrology (AREA)
- General Chemical & Material Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Bioinformatics & Computational Biology (AREA)
- Hematology (AREA)
- Biomedical Technology (AREA)
- Cell Biology (AREA)
- Spectroscopy & Molecular Physics (AREA)
- Gastroenterology & Hepatology (AREA)
- Food Science & Technology (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Optics & Photonics (AREA)
- Other Investigation Or Analysis Of Materials By Electrical Means (AREA)
Abstract
Description
TABLE 1
__________________________________________________________________________
SEQ ID Average
Peptide Nos. Sequence Mass Charge
Polarity
__________________________________________________________________________
Sleep Inducing
1 TrpAlaGlyGlyAspAlaSerGlyGlu 848.8
-2.0 polar
Peptide
Amino Terminal Region
2 ValHisLeuThrProValGluLys 922.1
+0.5 mid
of Hbs β chain.sup.3
Interleukin-1β 163-171
3 ValGlnGlyGluGluSerAsnAspLys 1005.0
-2.0 polar
Fragment.sup.3
TRH Precursor
4 LysArgGlnHisProGlyLysArg 1006.2
+4.5 very
Bradykinin 5 ArgProProGlyPheSerProPheArg 1061.2
+2.0 mid
Lutenizing Hormone
6 pyro.GluHisTrpSerTyrGlyLeuArgProGly.amide
1182.3
+1.5 mid
Releasing Hormone.sup.3
Physalaemin 7 pyro.GluAlaAspProAsnLysPheTyrGlyLeuMet.amide
1265.4
0 mid
Angiotensin 1
8 AspArgValTyrIleHisProPheHisLeu 1295.5
+1.0 non
Renin Inhibitor
9 ProHisProPheHisPhePheValTyrLys 1318.5
+2.0 non
Kassinin 10 AspValProLysSerAspGlnPheValGlyLeuMet.amide
1334.5
-2.0 non
Substance P 11 ArgProLysProGlnGlnPhePheGlyLeuMet.amide
1347.6
+3.0 mid
T-Antigen Homolog
12 CysGlyTyrGlyProLysLysLysArgLysValGlyGly
1377.7
+5.0 polar
Osteocalcin 7-19
13 GlyAlaProValProTyrProAspProLeuGluProArg
1407.6
-1.0 mid
Fragment
Fibrinopeptide A
14 AlaAspSerGlyGluGlyAspPheLeuAlaGluGlyGlyGlyValArg
1536.6
-3.0 mid
Thymopoietin II 29-41
15 GlyGluGlnArgLysAspValTyrValGlnLeuTyrLeu
1610.8
0 polar
Fragment
Bombesin 16 pyro.GluGlnArgLeuGlyAsnGlnTrp(AlaValGlyHis)LeuMet.amide
1619.9
+1.5 mid
ACTH 11-24 Fragment
17 LysProValGlyLysLysArgArgProValLysValTyrPro
1652.1
+6.0 mid
α-Melanocyte
18 acetyl.SerThrSerMetGluHisPheArgTrpGlyLysProVal.amide
1664.9
+1.5 mid
Stimulating Hormone
Angiotensinogen 1-14
19 AspArgValTyrIleHisProPheHisLeuLeuValTyrSer
1759.0
+1.0 non
Fragment
Angiogenin 20 GluAsnGlyLeuProValHisLeuAspGlnSerIle(PheArg)Arg
1781.0
+0.5 mid
Glucagon 21 HisSerGln . . . AspSerArgArgAlaGlnAspPheValGlnTrp(LeuMetA
sn)Thr 3482.8
+1.0 polar
ACTH7-38 Fragment
22 PheArgTrp . . . ArgArgProValLysValTryProAsnGlyAlaGluAspGl
uSer 3659.15
+2.0 polar
AlaGluAlaPheProLeuGlu
__________________________________________________________________________
.sup.1 calculated
.sup.2 at pH 6.5
.sup.3 no sequence information was obtained
TABLE 2
______________________________________
Amino Acid
Actual
(position)
Mass.sup.1 Experimental Mass.sup.1,2
Replicates
______________________________________
val (20) 99.13 98.97 ± 0.52
(1.29)
3
lys (21) 128.17 128.15 ± 0.48
(0.44)
7
val (22) 99.13 99.20 ± 0.35
(0.27)
9
tyr (23) 163.17 162.43 ± 0.11
(0.99)
2
pro (24) 97.12 97.49 ± 0.14
(1.25)
2
asn (25) 114.10 114.21 ± 0.82
(0.69)
8
gly (26) 57.05 57.22 ± 0.88
(0.68)
9
ala (27) 71.07 70.19 ± 0.49
(4.40)
2
glu (28) 129.12 130.22 ± 0.47
(4.22)
2
asp (29) 115.09 114.81 ± 0.58
(0.41)
10
glu (30) 129.12 129.27 ± 0.61
(0.39)
12
ser (31) 87.08 87.14 ± 0.47
(0.30)
12
ala (32) 71.07 80.94 ± 0.49
(0.51)
6
glu (33) 129.12 129.39 ± 0.42
(0.44)
6
ala (34) 71.07 71.09 ± 0.30
(0.28)
7
phe (35) 147.18 147.03 ± .73
(0.77)
6
pro (36) 97.12 96.83 ± 0.64
(1.18)
4
leu (37) 113.16 113.63 ± 0.54
(1.34)
3
glu (38) 129.12 128.40 ± 0.52
(1.29)
3
______________________________________
.sup.1 the masses given are average masses and in units of daltons
.sup.1,2 the uncertainties of the experimental mass measurements are give
as standard deviations (those in the parenthesis are 95% confidence
intervals of the mean)
TABLE 3 __________________________________________________________________________ ACTH 7-38 FragmentAmino Acid Position 20 21 22 23 24 25 26 27 28 29 __________________________________________________________________________ Gly 0.58 37.9 Ala 47.2 2.54 Ser 105 48.7 Pro 6.16 17.8 3.74 Val 0.53 0.60 16.6 Thr 7.09 16.3 Cys Leu/ 3.62 Ile Asn 0.38 3.87 Asp 72.0 3.04 45.5 1.53 Gln 0.11 6.29 72.6 Lys 0.11 6.17 Glu 5.35 3.31 Met 2.95 His 20.8 Phe Arg 80.4 Tyr 9.64 Trp 305 'table.sup.1 4.30 2.45 2.31 12.7 12.7 2.37 2.31 12.7 12.7 2.26 __________________________________________________________________________ 30 31 32 33 34 35 36 37 38 __________________________________________________________________________ Gly 69.4 123 Ala 118 0.65 0.18 Ser 0.44 80.7 141 30.5 Pro 73.6 0.91 Val 7.19 Thr Cys 33.6 Leu/ 1.51 Ile Asn 1.51 Asp 4.68 44.3 Gln 0.90 Lys 6.25 7.12 0.77 Glu 0.85 1.57 2.40 Met 11.0 10.6 9.33 His 33.2 Phe 0.50 Arg 30.7 Tyr Trp 'table.sup.1 2.20 2.20 2.57 2.57 2.45 2.57 3.18 4.30 4.30 __________________________________________________________________________ .sup.1 the tabulated t value associated with an area of 0.025 in one tail of the tdistribution corresponding to the appropriate degrees of freedom, ν, where ν = n - 1.
TABLE 4
______________________________________
ACTH 7-38 Fragment
Amino Acid
Amino Acid position
Assignments.sup.1
Confidence Interval (c.i.)
______________________________________
20 Val 95% < c.i < 98%
21 Gln/Lys c.i. > 99.8%
22 Val c.i > 99.8%
23 Tyr 99% < c.i. < 99.8%
24 Pro 95% < c.i. < 98%
25 Asn 98% < c.i. < 99%
26 Gly c.i. > 99.8%
27 Ala 98% < c.i. < 99%
28 Gln/Lys/Glu/Met
95% < c.i. < 98%
28 Met 80% < c.i. < 90%
29 Asp 99% < c.i. < 99.8%
30 Glu c.i. > 99.8%
31 Ser c.i. > 99.8%
32 Ala c.i. > 99.8%
33 Glu c.i. > 99.8%
34 Ala c.i. > 99.8%
35 Phe c.i. > 99.8%
36 Pro 99% < c.i. < 99.8%
37 Leu(Ile)/Asn 95% < c.i. < 98%
38 Gln/Lys/Glu 98% < c.i. < 99%
38 Gln/Lys 80% < c.i. < 90%
______________________________________
.sup.1 assuming that only the 20 common unmodified amino acids are
probable candidates
__________________________________________________________________________ CGC TCT CCC TTA TGC GAC TCC TGC ATT AGG AAG CAG CCC A (SEQ. ID. NO: __________________________________________________________________________ 2).
__________________________________________________________________________ SEQUENCE LISTING (1) GENERAL INFORMATION: (iii) NUMBER OF SEQUENCES: 23 (2) INFORMATION FOR SEQ ID NO:1: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 9 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1: TrpAlaGlyGlyAspAlaSerGlyGlu 15 (2) INFORMATION FOR SEQ ID NO:2: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 8 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2: ValHisLeuThrProValGluLys 15 (2) INFORMATION FOR SEQ ID NO:3: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 9 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3: ValGlnGlyGluGluSerAsnAspLys 15 (2) INFORMATION FOR SEQ ID NO:4: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 8 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4: LysArgGlnHisProGlyLysArg 15 (2) INFORMATION FOR SEQ ID NO:5: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 9 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5: ArgProProGlyPheSerProPheArg 15 (2) INFORMATION FOR SEQ ID NO:6: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 10 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6: GluHisTrpSerTyrGlyLeuArgProGly 1510 (2) INFORMATION FOR SEQ ID NO:7: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 11 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7: GluAlaAspProAsnLysPheTyrGlyLeuMet 1510 (2) INFORMATION FOR SEQ ID NO:8: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 10 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8: AspArgValTyrIleHisProPheHisLeu 1510 (2) INFORMATION FOR SEQ ID NO:9: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 10 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9: ProHisProPheHisPhePheValTyrLys 1510 (2) INFORMATION FOR SEQ ID NO:10: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 12 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10: AspValProLysSerAspGlnPheValGlyLeuMet 1510 (2) INFORMATION FOR SEQ ID NO:11: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 11 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:11: ArgProLysProGlnGlnPhePheGlyLeuMet 1510 (2) INFORMATION FOR SEQ ID NO:12: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 13 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12: CysGlyTyrGlyProLysLysLysArgLysValGlyGly 1510 (2) INFORMATION FOR SEQ ID NO:13: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 13 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13: GlyAlaProValProTyrProAspProLeuGluProArg 1510 (2) INFORMATION FOR SEQ ID NO:14: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 16 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14: AlaAspSerGlyGluGlyAspPheLeuAlaGluGlyGlyGlyValArg 151015 (2) INFORMATION FOR SEQ ID NO:15: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 13 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:15: GlyGluGlnArgLysAspValTyrValGlnLeuTyrLeu 1510 (2) INFORMATION FOR SEQ ID NO:16: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 14 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:16: GluGlnArgLeuGlyAsnGlnTrpAlaValGlyHisLeuMet 1510 (2) INFORMATION FOR SEQ ID NO:17: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 14 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:17: LysProValGlyLysLysArgArgProValLysValTyrPro 1510 (2) INFORMATION FOR SEQ ID NO:18: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 13 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:18: SerThrSerMetGluHisPheArgTrpGlyLysProVal 1510 (2) INFORMATION FOR SEQ ID NO:19: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 14 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:19: AspArgValTyrIleHisProPheHisLeuLeuValTyrSer 1510 (2) INFORMATION FOR SEQ ID NO:20: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 15 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:20: GluAsnGlyLeuProValHisLeuAspGlnSerIlePheArgArg 151015 (2) INFORMATION FOR SEQ ID NO:21: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 29 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:21: HisSerGlnGlyThrPheThrSerAspTyrSerLysTyrLeuAspSer 151015 ArgArgAlaGlnAspPheValGlnTrpLeuMetAsnThr 2025 (2) INFORMATION FOR SEQ ID NO:22: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 32 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:22: PheArgTrpGlyLysProValGlyLysLysArgArgProValLysVal 151015 TyrProAsnGlyAlaGluAspGluSerAlaGluAlaPheProLeuGlu 202530 (2) INFORMATION FOR SEQ ID NO:23: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 40 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "NUCLEIC ACID POLYMER" (xi) SEQUENCE DESCRIPTION: SEQ ID NO:23: CGCTCTCCCTTATGCGACTCCTGCATTAGGAAGCAGCCCA40 __________________________________________________________________________
Claims (27)
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US08/844,462 US5821063A (en) | 1995-05-19 | 1997-04-18 | Methods for sequencing polymers using mass spectrometry |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US44605595A | 1995-05-19 | 1995-05-19 | |
| US08/796,598 US5827659A (en) | 1995-05-19 | 1997-02-07 | Methods and apparatus for sequencing polymers using mass spectrometry |
| US08/844,462 US5821063A (en) | 1995-05-19 | 1997-04-18 | Methods for sequencing polymers using mass spectrometry |
Related Parent Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US08/796,598 Division US5827659A (en) | 1995-05-19 | 1997-02-07 | Methods and apparatus for sequencing polymers using mass spectrometry |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| US5821063A true US5821063A (en) | 1998-10-13 |
Family
ID=23771160
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US08/796,598 Expired - Lifetime US5827659A (en) | 1995-05-19 | 1997-02-07 | Methods and apparatus for sequencing polymers using mass spectrometry |
| US08/844,462 Expired - Lifetime US5821063A (en) | 1995-05-19 | 1997-04-18 | Methods for sequencing polymers using mass spectrometry |
Family Applications Before (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US08/796,598 Expired - Lifetime US5827659A (en) | 1995-05-19 | 1997-02-07 | Methods and apparatus for sequencing polymers using mass spectrometry |
Country Status (1)
| Country | Link |
|---|---|
| US (2) | US5827659A (en) |
Cited By (29)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6140053A (en) * | 1996-11-06 | 2000-10-31 | Sequenom, Inc. | DNA sequencing by mass spectrometry via exonuclease degradation |
| US6197498B1 (en) | 1995-03-17 | 2001-03-06 | Sequenom, Inc | DNA diagnostics based on mass spectrometry |
| US20020068366A1 (en) * | 2000-04-13 | 2002-06-06 | Ladine James R. | Proteomic analysis by parallel mass spectrometry |
| US6465776B1 (en) | 2000-06-02 | 2002-10-15 | Board Of Regents, The University Of Texas System | Mass spectrometer apparatus for analyzing multiple fluid samples concurrently |
| US20030032056A1 (en) * | 2001-05-23 | 2003-02-13 | Ronnie Palmgren | Peptide fragmentation |
| US6555813B1 (en) | 1999-04-29 | 2003-04-29 | Ciphergen Biosystems, Inc. | Probes with hydrophobic coatings for gas phase ion spectrometers |
| US6558902B1 (en) | 1998-05-07 | 2003-05-06 | Sequenom, Inc. | Infrared matrix-assisted laser desorption/ionization mass spectrometric analysis of macromolecules |
| US20030153007A1 (en) * | 2001-12-28 | 2003-08-14 | Jian Chen | Automated systems and methods for analysis of protein post-translational modification |
| WO2002008767A3 (en) * | 2000-07-25 | 2003-08-28 | Procter & Gamble | Methods and kits for sequencing polypeptides |
| US20040002121A1 (en) * | 2001-11-06 | 2004-01-01 | Regan Jeffrey F. | High throughput methods and devices for assaying analytes in a fluid sample |
| US6800449B1 (en) | 2001-07-13 | 2004-10-05 | Syngenta Participations Ag | High throughput functional proteomics |
| US20040217278A1 (en) * | 2003-05-02 | 2004-11-04 | Overney Gregor T. | User customizable plate handling for MALDI mass spectrometry |
| US20040229369A1 (en) * | 2003-05-12 | 2004-11-18 | Gary Kruppa | Structural determination of intact proteins using mass spectrometry |
| US20050023454A1 (en) * | 2003-04-10 | 2005-02-03 | Micromass Uk Limited | Mass spectrometer |
| US20050092916A1 (en) * | 2003-10-31 | 2005-05-05 | Vestal Marvin L. | Ion source and methods for MALDI mass spectrometry |
| US6949633B1 (en) | 1995-05-22 | 2005-09-27 | Sequenom, Inc. | Primers useful for sizing nucleic acids |
| US20060014210A1 (en) * | 2004-07-16 | 2006-01-19 | Boyes Barry E | Serial derivatization of peptides for de novo sequencing using tandem mass spectrometry |
| US20060014293A1 (en) * | 2004-07-16 | 2006-01-19 | Joyce Timothy H | Lock mass ions for use with derivatized peptides for de novo sequencing using tandem mass spectrometry |
| US6991903B2 (en) | 1992-11-06 | 2006-01-31 | Sequenom, Inc. | Solid phase sequencing of double-stranded nucleic acids |
| US20060278824A1 (en) * | 2005-06-08 | 2006-12-14 | Jean-Luc Truche | Ion source sample plate illumination system |
| US20070054416A1 (en) * | 1997-06-26 | 2007-03-08 | Regnier Fred E | High density sample holder for analysis of biological samples |
| US20070051899A1 (en) * | 2005-09-08 | 2007-03-08 | Jean-Luc Truche | Maldi sample plate imaging workstation |
| US7198893B1 (en) | 1996-11-06 | 2007-04-03 | Sequenom, Inc. | DNA diagnostics based on mass spectrometry |
| US7635572B2 (en) | 2003-06-09 | 2009-12-22 | Life Technologies Corporation | Methods for conducting assays for enzyme activity on protein microarrays |
| US20100022407A1 (en) * | 1998-02-04 | 2010-01-28 | Life Technologies Corporation | Microarrays and uses therefor |
| US20100148052A1 (en) * | 2005-10-13 | 2010-06-17 | Ibiden Co., Ltd. | Analytical carrier and application thereof |
| US7803529B1 (en) | 1995-04-11 | 2010-09-28 | Sequenom, Inc. | Solid phase sequencing of biopolymers |
| US8399383B2 (en) | 2000-05-04 | 2013-03-19 | Yale University | Protein chips for high throughput screening of protein activity |
| US10690661B2 (en) | 2014-07-11 | 2020-06-23 | Northwestern University | Yeast-based biosensor |
Families Citing this family (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6379971B1 (en) * | 1998-02-24 | 2002-04-30 | Target Discovery, Inc. | Methods for sequencing proteins |
| GB9821393D0 (en) * | 1998-10-01 | 1998-11-25 | Brax Genomics Ltd | Protein profiling 2 |
| US6764817B1 (en) * | 1999-04-20 | 2004-07-20 | Target Discovery, Inc. | Methods for conducting metabolic analyses |
| US6716636B1 (en) * | 1999-04-20 | 2004-04-06 | Target Discovery, Inc. | Methods for sequencing proteins |
| WO2002066952A2 (en) | 2000-10-19 | 2002-08-29 | Target Discovery, Inc | Mass defect labeling for the determination of oligomer sequences |
| US20040198950A1 (en) * | 2001-04-30 | 2004-10-07 | George Jackowski | Biopolymer marker indicative of disease state having a molecular weight of 1518 daltons |
| US6599877B2 (en) | 2001-04-30 | 2003-07-29 | Syn X Pharma, Inc. | Biopolymer marker indicative of disease state having a molecular weight of 1020 daltons |
| US20020160423A1 (en) * | 2001-04-30 | 2002-10-31 | George Jackowski | Biopolymer marker indicative of disease state having a molecular weight of 1536 daltons |
| US20040115655A1 (en) * | 2002-12-16 | 2004-06-17 | Ilsley Diane D. | Method for analyzing the nucleotide sequence of nucleic acids |
Citations (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4267457A (en) * | 1977-10-20 | 1981-05-12 | Shionogi & Co., Ltd. | Sample holding element for mass spectrometer |
| US4705616A (en) * | 1986-09-15 | 1987-11-10 | Sepragen Corporation | Electrophoresis-mass spectrometry probe |
| US4774055A (en) * | 1985-06-26 | 1988-09-27 | Japan Tectron Instruments Corporation | Automatic analysis apparatus |
| US4845035A (en) * | 1987-10-06 | 1989-07-04 | The United States Of America As Represented By The Secretary Of Agriculture | Enzyme immobilization with a hydrolyzed polysaccharide graft copolymer |
| US4882127A (en) * | 1984-08-06 | 1989-11-21 | Akademie Der Wissenschaften Der Ddr | Device for solid phase sequencing of nucleic acid fragments |
| US5252485A (en) * | 1990-08-10 | 1993-10-12 | Savant Instruments, Inc. | Unit for hydrolyzing amino-acid containing specimens |
| WO1993024834A1 (en) * | 1992-05-29 | 1993-12-09 | The Rockefeller University | Method and product for the sequence determination of peptides using a mass spectrometer |
| US5288644A (en) * | 1990-04-04 | 1994-02-22 | The Rockefeller University | Instrument and method for the sequencing of genome |
| US5474796A (en) * | 1991-09-04 | 1995-12-12 | Protogene Laboratories, Inc. | Method and apparatus for conducting an array of chemical reactions on a support surface |
| US5607859A (en) * | 1994-03-28 | 1997-03-04 | Massachusetts Institute Of Technology | Methods and products for mass spectrometric molecular weight determination of polyionic analytes employing polyionic reagents |
| US5622824A (en) * | 1993-03-19 | 1997-04-22 | Sequenom, Inc. | DNA sequencing by mass spectrometry via exonuclease degradation |
-
1997
- 1997-02-07 US US08/796,598 patent/US5827659A/en not_active Expired - Lifetime
- 1997-04-18 US US08/844,462 patent/US5821063A/en not_active Expired - Lifetime
Patent Citations (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4267457A (en) * | 1977-10-20 | 1981-05-12 | Shionogi & Co., Ltd. | Sample holding element for mass spectrometer |
| US4882127A (en) * | 1984-08-06 | 1989-11-21 | Akademie Der Wissenschaften Der Ddr | Device for solid phase sequencing of nucleic acid fragments |
| US4774055A (en) * | 1985-06-26 | 1988-09-27 | Japan Tectron Instruments Corporation | Automatic analysis apparatus |
| US4705616A (en) * | 1986-09-15 | 1987-11-10 | Sepragen Corporation | Electrophoresis-mass spectrometry probe |
| US4845035A (en) * | 1987-10-06 | 1989-07-04 | The United States Of America As Represented By The Secretary Of Agriculture | Enzyme immobilization with a hydrolyzed polysaccharide graft copolymer |
| US5288644A (en) * | 1990-04-04 | 1994-02-22 | The Rockefeller University | Instrument and method for the sequencing of genome |
| US5252485A (en) * | 1990-08-10 | 1993-10-12 | Savant Instruments, Inc. | Unit for hydrolyzing amino-acid containing specimens |
| US5474796A (en) * | 1991-09-04 | 1995-12-12 | Protogene Laboratories, Inc. | Method and apparatus for conducting an array of chemical reactions on a support surface |
| WO1993024834A1 (en) * | 1992-05-29 | 1993-12-09 | The Rockefeller University | Method and product for the sequence determination of peptides using a mass spectrometer |
| US5622824A (en) * | 1993-03-19 | 1997-04-22 | Sequenom, Inc. | DNA sequencing by mass spectrometry via exonuclease degradation |
| US5607859A (en) * | 1994-03-28 | 1997-03-04 | Massachusetts Institute Of Technology | Methods and products for mass spectrometric molecular weight determination of polyionic analytes employing polyionic reagents |
Non-Patent Citations (29)
| Title |
|---|
| Aldrich et al. (1994), "Identification of a Tap-Dependent Leader Peptide Recognized by Alloreactive T Cells Specific for a Class 1b Antigen," 79 Cell 649-658. |
| Aldrich et al. (1994), Identification of a Tap Dependent Leader Peptide Recognized by Alloreactive T Cells Specific for a Class 1b Antigen, 79 Cell 649 658. * |
| Chait et al. Science 262:89 92, 1993. * |
| Chait et al. Science 262:89-92, 1993. |
| Jue et al. Biochemistry 24: 162 170, 1985. * |
| Jue et al. Biochemistry 24: 162-170, 1985. |
| Karas et al. (1990), "Principles and Applications of Matrix-Assisted UV-Laser Desorption/Ionization Mass Spectrometry," 241 Analytica Chimica Acta 175-185. |
| Karas et al. (1990), Principles and Applications of Matrix Assisted UV Laser Desorption/Ionization Mass Spectrometry, 241 Analytica Chimica Acta 175 185. * |
| Klarskov et al. (1989), "C-Terminal Sequence Determination of Peptides Degraded with Carboxypeptidases of Different Specificities and Analyzed by 252-Cf Plasma Desorption Mass Spectrometry," 180 Analytical Biochemistry 28-37. |
| Klarskov et al. (1989), C Terminal Sequence Determination of Peptides Degraded with Carboxypeptidases of Different Specificities and Analyzed by 252 Cf Plasma Desorption Mass Spectrometry, 180 Analytical Biochemistry 28 37. * |
| Patterson et al. (1995), "Peptide Sequencing of Carboxypeptidase Digestion Coupled With MALDI-TOF," Abstract of presentation at the 43rd ASMS Conference, Atlanta, Georgia, May 25, 1995. (Applicants have informed Attorney that a computer disk containing the Abstract was mailed on May 9, 1995 by ASMS.) |
| Patterson et al. (1995), Peptide Sequencing of Carboxypeptidase Digestion Coupled With MALDI TOF, Abstract of presentation at the 43rd ASMS Conference, Atlanta, Georgia, May 25, 1995. (Applicants have informed Attorney that a computer disk containing the Abstract was mailed on May 9, 1995 by ASMS.) * |
| PerSeptive Biosystems Product Announcement, 1995. * |
| PerSeptive Biosystems, Inc., Vestec Biospectrometry Products, 1994 "Voyager™ Biospectrometry™ Workstation: High Throughput Accurate Mass Analysis Just Became Routine", Product Brochure. |
| PerSeptive Biosystems, Inc., Vestec Biospectrometry Products, 1994 Voyager Biospectrometry Workstation: High Throughput Accurate Mass Analysis Just Became Routine , Product Brochure. * |
| R.J. Cotter (1992), "Time of Flight Mass Spectrometry for the Structural Analysis of Biological Molecules," 64 Analytical Chemistry 1027A-1039A. |
| R.J. Cotter (1992), Time of Flight Mass Spectrometry for the Structural Analysis of Biological Molecules, 64 Analytical Chemistry 1027A 1039A. * |
| Thiede et al. (1995), "MALDI-MS for C-Terminal Sequence Determination of Peptides and Proteins Degraded by Carboxypeptidase Y and P," 357 Federation of European Biochemical Societies 65-69. |
| Thiede et al. (1995), MALDI MS for C Terminal Sequence Determination of Peptides and Proteins Degraded by Carboxypeptidase Y and P, 357 Federation of European Biochemical Societies 65 69. * |
| Wang et al. (1992), "Determination of the Cleavage Site of the Amyloid Precursor Protein by Plasma Desorption Mass Spectrometry," Techniques in Protein Chemistry III (1992) (ed., R.H. Angeletti; Academic Press, N.Y.); pp. 505-513. |
| Wang et al. (1992), Determination of the Cleavage Site of the Amyloid Precursor Protein by Plasma Desorption Mass Spectrometry, Techniques in Protein Chemistry III (1992) (ed., R.H. Angeletti; Academic Press, N.Y.); pp. 505 513. * |
| Welch et al. (1991), "A Herpesvirus Maturational Proteinase, Assemblin: Identification of Its Gene, Putative Active Site Domain, and Cleavage Site," 88 Proc. Natl. Acad. Sci. USA 10792-10796. |
| Welch et al. (1991), A Herpesvirus Maturational Proteinase, Assemblin: Identification of Its Gene, Putative Active Site Domain, and Cleavage Site, 88 Proc. Natl. Acad. Sci. USA 10792 10796. * |
| Woods et al. (1991), "Enzymatic Digestion on the Sample Foil as a Method for Sequence Determination by Plasma Desorption Mass Spectrometry: The Primary Structure of Porpoise Relaxin," 111 International Journal of Mass Spectrometry and Ion Processes 77-88. |
| Woods et al. (1991), Enzymatic Digestion on the Sample Foil as a Method for Sequence Determination by Plasma Desorption Mass Spectrometry: The Primary Structure of Porpoise Relaxin, 111 International Journal of Mass Spectrometry and Ion Processes 77 88. * |
| Woods et al. (1994), "Protein Processing in Herpes Virus," Time of Flight Mass Spectrometry (1994) (ed., R.J. Cotter, American Chemical Society, Washington, D.C.); pp. 194-210. |
| Woods et al. (1994), Protein Processing in Herpes Virus, Time of Flight Mass Spectrometry (1994) (ed., R.J. Cotter, American Chemical Society, Washington, D.C.); pp. 194 210. * |
| Woods et al. (1995), "Simplified High-Sensitivity Sequencing of a Major Histocompatibility Complex Class I-Associated Immunoreactive Peptide Using Matrix-Assisted Laser Desorption/Ionization Mass Spectrometry," 226 Analytical Bichemistry 15-25. |
| Woods et al. (1995), Simplified High Sensitivity Sequencing of a Major Histocompatibility Complex Class I Associated Immunoreactive Peptide Using Matrix Assisted Laser Desorption/Ionization Mass Spectrometry, 226 Analytical Bichemistry 15 25. * |
Cited By (63)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6991903B2 (en) | 1992-11-06 | 2006-01-31 | Sequenom, Inc. | Solid phase sequencing of double-stranded nucleic acids |
| US6300076B1 (en) | 1995-03-17 | 2001-10-09 | Sequenom, Inc. | DNA diagnostics based on mass spectrometry |
| US7419787B2 (en) | 1995-03-17 | 2008-09-02 | Sequenom, Inc. | Mass spectrometric methods for detecting mutations in a target nucleic acid |
| US6221601B1 (en) | 1995-03-17 | 2001-04-24 | Sequenom, Inc. | DNA diagnostics based on mass spectrometry |
| US6235478B1 (en) | 1995-03-17 | 2001-05-22 | Sequenom, Inc. | DNA diagnostics based on mass spectrometry |
| US6258538B1 (en) | 1995-03-17 | 2001-07-10 | Sequenom, Inc. | DNA diagnostics based on mass spectrometry |
| US6268144B1 (en) | 1995-03-17 | 2001-07-31 | Sequenom, Inc. | DNA diagnostics based on mass spectrometry |
| US6277573B1 (en) | 1995-03-17 | 2001-08-21 | Sequenom, Inc. | DNA diagnostics based on mass spectrometry |
| US6197498B1 (en) | 1995-03-17 | 2001-03-06 | Sequenom, Inc | DNA diagnostics based on mass spectrometry |
| US6221605B1 (en) | 1995-03-17 | 2001-04-24 | Sequenom, Inc. | DNA diagnostics based on mass spectrometry |
| US7074563B2 (en) | 1995-03-17 | 2006-07-11 | Sequenom, Inc. | Mass spectrometric methods for detecting mutations in a target nucleic acid |
| US7759065B2 (en) | 1995-03-17 | 2010-07-20 | Sequenom, Inc. | Mass spectrometric methods for detecting mutations in a target nucleic acid |
| US6602662B1 (en) | 1995-03-17 | 2003-08-05 | Sequenom, Inc. | DNA diagnostics based on mass spectrometry |
| US6589485B2 (en) | 1995-03-17 | 2003-07-08 | Sequenom, Inc. | Solid support for mass spectrometry |
| US6500621B2 (en) | 1995-03-17 | 2002-12-31 | Sequenom, Inc. | DNA diagnostics based on mass spectrometry |
| US8758995B2 (en) | 1995-04-11 | 2014-06-24 | Sequenom, Inc. | Solid phase sequencing of biopolymers |
| US7803529B1 (en) | 1995-04-11 | 2010-09-28 | Sequenom, Inc. | Solid phase sequencing of biopolymers |
| US6949633B1 (en) | 1995-05-22 | 2005-09-27 | Sequenom, Inc. | Primers useful for sizing nucleic acids |
| US7501251B2 (en) | 1996-11-06 | 2009-03-10 | Sequenom, Inc. | DNA diagnostics based on mass spectrometry |
| US6140053A (en) * | 1996-11-06 | 2000-10-31 | Sequenom, Inc. | DNA sequencing by mass spectrometry via exonuclease degradation |
| US7198893B1 (en) | 1996-11-06 | 2007-04-03 | Sequenom, Inc. | DNA diagnostics based on mass spectrometry |
| US20070054416A1 (en) * | 1997-06-26 | 2007-03-08 | Regnier Fred E | High density sample holder for analysis of biological samples |
| US20100022407A1 (en) * | 1998-02-04 | 2010-01-28 | Life Technologies Corporation | Microarrays and uses therefor |
| US8012703B2 (en) * | 1998-02-04 | 2011-09-06 | Life Technologies Corporation | Microarrays and uses therefor |
| US7794946B1 (en) * | 1998-02-04 | 2010-09-14 | Life Technologies Corporation | Microarray and uses therefor |
| US6558902B1 (en) | 1998-05-07 | 2003-05-06 | Sequenom, Inc. | Infrared matrix-assisted laser desorption/ionization mass spectrometric analysis of macromolecules |
| US6555813B1 (en) | 1999-04-29 | 2003-04-29 | Ciphergen Biosystems, Inc. | Probes with hydrophobic coatings for gas phase ion spectrometers |
| US20020068366A1 (en) * | 2000-04-13 | 2002-06-06 | Ladine James R. | Proteomic analysis by parallel mass spectrometry |
| US8399383B2 (en) | 2000-05-04 | 2013-03-19 | Yale University | Protein chips for high throughput screening of protein activity |
| US6465776B1 (en) | 2000-06-02 | 2002-10-15 | Board Of Regents, The University Of Texas System | Mass spectrometer apparatus for analyzing multiple fluid samples concurrently |
| WO2002008767A3 (en) * | 2000-07-25 | 2003-08-28 | Procter & Gamble | Methods and kits for sequencing polypeptides |
| US20060141632A1 (en) * | 2000-07-25 | 2006-06-29 | The Procter & Gamble Co. | New methods and kits for sequencing polypeptides |
| CN1308690C (en) * | 2000-07-25 | 2007-04-04 | 宝洁公司 | New Methods and Kits for Peptide Sequencing |
| US7074570B2 (en) | 2001-05-23 | 2006-07-11 | Ge Healthcare Bio-Sciences Ab | Peptide fragmentation |
| US20030032056A1 (en) * | 2001-05-23 | 2003-02-13 | Ronnie Palmgren | Peptide fragmentation |
| US20050064513A1 (en) * | 2001-07-13 | 2005-03-24 | Haynes Paul A. | High throughput functional proteomics |
| US6800449B1 (en) | 2001-07-13 | 2004-10-05 | Syngenta Participations Ag | High throughput functional proteomics |
| US20040002121A1 (en) * | 2001-11-06 | 2004-01-01 | Regan Jeffrey F. | High throughput methods and devices for assaying analytes in a fluid sample |
| WO2003057845A3 (en) * | 2001-12-28 | 2004-02-26 | Mds Proteomics Inc | Automated systems and methods for analysis of protein post-translational modification |
| US20030153007A1 (en) * | 2001-12-28 | 2003-08-14 | Jian Chen | Automated systems and methods for analysis of protein post-translational modification |
| US7202473B2 (en) * | 2003-04-10 | 2007-04-10 | Micromass Uk Limited | Mass spectrometer |
| US20050023454A1 (en) * | 2003-04-10 | 2005-02-03 | Micromass Uk Limited | Mass spectrometer |
| US7411183B2 (en) | 2003-05-02 | 2008-08-12 | Agilent Technologies, Inc. | User customizable plate handling for MALDI mass spectrometry |
| US20040217278A1 (en) * | 2003-05-02 | 2004-11-04 | Overney Gregor T. | User customizable plate handling for MALDI mass spectrometry |
| US7138625B2 (en) | 2003-05-02 | 2006-11-21 | Agilent Technologies, Inc. | User customizable plate handling for MALDI mass spectrometry |
| US20050139778A1 (en) * | 2003-05-02 | 2005-06-30 | Overney Gregor T. | User customizable plate handling for MALDI mass spectrometry |
| US20050139779A1 (en) * | 2003-05-02 | 2005-06-30 | Overney Gregor T. | User customizable plate handling for MALDI mass spectrometry |
| US7368290B2 (en) | 2003-05-12 | 2008-05-06 | Sandia National Laboratories | Structural determination of intact proteins using mass spectrometry |
| US20040229369A1 (en) * | 2003-05-12 | 2004-11-18 | Gary Kruppa | Structural determination of intact proteins using mass spectrometry |
| US7635572B2 (en) | 2003-06-09 | 2009-12-22 | Life Technologies Corporation | Methods for conducting assays for enzyme activity on protein microarrays |
| US20050194544A1 (en) * | 2003-10-31 | 2005-09-08 | Vestal Marvin L. | Ion source and methods for maldi mass spectrometry |
| US7109480B2 (en) | 2003-10-31 | 2006-09-19 | Applera Corporation | Ion source and methods for MALDI mass spectrometry |
| US20050092916A1 (en) * | 2003-10-31 | 2005-05-05 | Vestal Marvin L. | Ion source and methods for MALDI mass spectrometry |
| US6953928B2 (en) | 2003-10-31 | 2005-10-11 | Applera Corporation | Ion source and methods for MALDI mass spectrometry |
| US20060014293A1 (en) * | 2004-07-16 | 2006-01-19 | Joyce Timothy H | Lock mass ions for use with derivatized peptides for de novo sequencing using tandem mass spectrometry |
| US7371514B2 (en) | 2004-07-16 | 2008-05-13 | Agilent Technologies, Inc. | Serial derivatization of peptides for de novo sequencing using tandem mass spectrometry |
| US20060014210A1 (en) * | 2004-07-16 | 2006-01-19 | Boyes Barry E | Serial derivatization of peptides for de novo sequencing using tandem mass spectrometry |
| US20060278824A1 (en) * | 2005-06-08 | 2006-12-14 | Jean-Luc Truche | Ion source sample plate illumination system |
| US7435951B2 (en) | 2005-06-08 | 2008-10-14 | Agilent Technologies, Inc. | Ion source sample plate illumination system |
| US7495231B2 (en) | 2005-09-08 | 2009-02-24 | Agilent Technologies, Inc. | MALDI sample plate imaging workstation |
| US20070051899A1 (en) * | 2005-09-08 | 2007-03-08 | Jean-Luc Truche | Maldi sample plate imaging workstation |
| US20100148052A1 (en) * | 2005-10-13 | 2010-06-17 | Ibiden Co., Ltd. | Analytical carrier and application thereof |
| US10690661B2 (en) | 2014-07-11 | 2020-06-23 | Northwestern University | Yeast-based biosensor |
Also Published As
| Publication number | Publication date |
|---|---|
| US5827659A (en) | 1998-10-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US5821063A (en) | Methods for sequencing polymers using mass spectrometry | |
| US5869240A (en) | Methods and apparatus for sequencing polymers with a statistical certainty using mass spectrometry | |
| WO1996036986A1 (en) | Methods and apparatus for sequencing polymers with a statistical certainty using mass spectrometry | |
| AU713720B2 (en) | Methods for producing and analyzing biopolymer ladders | |
| US7183116B2 (en) | Methods for isolation and labeling of sample molecules | |
| Neubauer et al. | Mapping of phosphorylation sites of gel-isolated proteins by nanoelectrospray tandem mass spectrometry: potentials and limitations | |
| US8338122B2 (en) | Method for determining the amino acid sequence of peptides | |
| US6750061B2 (en) | Method and product for the sequence determination of peptides using a mass spectrometer | |
| US9988665B2 (en) | Methods for determining protein binding specificity using peptide libraries | |
| US20030008327A1 (en) | Methods and systems for identifying kinases, phosphatases, and substrates thereof | |
| Wang et al. | Phorbol 12-myristate 13-acetate-induced phosphorylation of Op18 in Jurkat T cells. Identification of phosphorylation sites by matrix-assisted laser desorption ionization mass spectrometry | |
| JP2003521257A (en) | Methods for identifying and / or characterizing (poly) peptides | |
| DK1098991T3 (en) | New methods for identifying ligand and target biomolecules | |
| Labdon et al. | Analysis of phosphoprotein p19 by liquid chromatography/mass spectrometry. Identification of two proline-directed serine phosphorylation sites and a blocked amino terminus. | |
| CA2359163C (en) | Methods and kits for sequencing polypeptides | |
| EP1454143A2 (en) | Methods for protein analysis using protein capture arrays | |
| US6747273B2 (en) | Methods of detecting protein arginine methyltransferase, and uses related thereto | |
| Stults | Peptide sequencing by mass spectrometry | |
| US20100069252A1 (en) | Efficient method for partial sequencing of peptide/protein using acid or base labile xanthates | |
| WO1999005309A1 (en) | Multiple target screening of molecular libraries by mass spectrometry | |
| Babu et al. | Monitoring the neuropeptide metabolites by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry | |
| Redeker et al. | Characterization of posttranslational modifications of proteins by MALDI-TOF MS: Application to the study of tubulin | |
| Geyer et al. | AMINO ACID COMPOSITION AND SEQUENCE ANALYSIS | |
| Clive | Article watch | |
| EP1595889A1 (en) | Method of eliminating phosphate group of peptide and method of analyzing peptide |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| STCF | Information on status: patent grant |
Free format text: PATENTED CASE |
|
| FEPP | Fee payment procedure |
Free format text: PAYOR NUMBER ASSIGNED (ORIGINAL EVENT CODE: ASPN); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY |
|
| FPAY | Fee payment |
Year of fee payment: 4 |
|
| REMI | Maintenance fee reminder mailed | ||
| AS | Assignment |
Owner name: MDS INC. (THROUGH ITS MDS SCIEX DIVISION), CANADA Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:PERSPECTIVE BIOSYSTEMS, INC.;REEL/FRAME:015452/0212 Effective date: 20041022 |
|
| FPAY | Fee payment |
Year of fee payment: 8 |
|
| AS | Assignment |
Owner name: BANK OF AMERICA, N.A., AS COLLATERAL AGENT, WASHIN Free format text: SECURITY AGREEMENT;ASSIGNOR:PERSEPTIVE BIOSYSTEMS, INC.;REEL/FRAME:021976/0160 Effective date: 20081121 |
|
| AS | Assignment |
Owner name: APPLIED BIOSYSTEMS, LLC., CALIFORNIA Free format text: MERGER;ASSIGNOR:PERSEPTIVE BIOSYSTEMS, INC.;REEL/FRAME:023839/0669 Effective date: 20090407 |
|
| AS | Assignment |
Owner name: APPLIED BIOSYSTEMS, LLC,CALIFORNIA Free format text: RELEASE BY SECURED PARTY;ASSIGNOR:BANK OF AMERICA, N.A.;REEL/FRAME:024160/0955 Effective date: 20100129 Owner name: APPLIED BIOSYSTEMS, LLC, CALIFORNIA Free format text: RELEASE BY SECURED PARTY;ASSIGNOR:BANK OF AMERICA, N.A.;REEL/FRAME:024160/0955 Effective date: 20100129 |
|
| FPAY | Fee payment |
Year of fee payment: 12 |
|
| AS | Assignment |
Owner name: APPLIED BIOSYSTEMS, INC., CALIFORNIA Free format text: LIEN RELEASE;ASSIGNOR:BANK OF AMERICA, N.A.;REEL/FRAME:030182/0677 Effective date: 20100528 |
|
| AS | Assignment |
Owner name: APPLIED BIOSYSTEMS, LLC, CALIFORNIA Free format text: CORRECTIVE ASSIGNMENT TO CORRECT THE RECEIVING PARTY NAME PREVIOUSLY RECORDED AT REEL: 030182 FRAME: 0719. ASSIGNOR(S) HEREBY CONFIRMS THE RELEASE OF SECURITY INTEREST;ASSIGNOR:BANK OF AMERICA, N.A.;REEL/FRAME:038038/0356 Effective date: 20100528 Owner name: APPLIED BIOSYSTEMS, LLC, CALIFORNIA Free format text: CORRECTIVE ASSIGNMENT TO CORRECT THE RECEIVING PARTY NAME PREVIOUSLY RECORDED AT REEL: 030182 FRAME: 0677. ASSIGNOR(S) HEREBY CONFIRMS THE RELEASE OF SECURITY INTEREST;ASSIGNOR:BANK OF AMERICA, N.A.;REEL/FRAME:038038/0356 Effective date: 20100528 |