US5814507A - κ/μ-like protein tyrosine phosphatase, PTP λ - Google Patents

κ/μ-like protein tyrosine phosphatase, PTP λ Download PDF

Info

Publication number
US5814507A
US5814507A US08/652,971 US65297196A US5814507A US 5814507 A US5814507 A US 5814507A US 65297196 A US65297196 A US 65297196A US 5814507 A US5814507 A US 5814507A
Authority
US
United States
Prior art keywords
ptp
polypeptide
sequence
polypeptides
cells
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Lifetime
Application number
US08/652,971
Inventor
Jill Cheng
Laurence A. Lasky
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Genentech Inc
Original Assignee
Genentech Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Genentech Inc filed Critical Genentech Inc
Assigned to GENENTECH, INC. reassignment GENENTECH, INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: CHENG, JILL, LASKY, LAURENCE A.
Priority to US08/652,971 priority Critical patent/US5814507A/en
Assigned to GENENTECH, INC. reassignment GENENTECH, INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: CHENG, JILL, LASKY, LAURENCE A.
Priority to US08/769,399 priority patent/US5976852A/en
Priority to AT97927799T priority patent/ATE323764T1/en
Priority to AU32171/97A priority patent/AU722949B2/en
Priority to ES97927799T priority patent/ES2263177T3/en
Priority to EP97927799A priority patent/EP0912733B1/en
Priority to JP54289997A priority patent/JP3587857B2/en
Priority to PCT/US1997/009056 priority patent/WO1997044458A1/en
Priority to PT97927799T priority patent/PT912733E/en
Priority to DK97927799T priority patent/DK0912733T3/en
Priority to DE69735716T priority patent/DE69735716T2/en
Priority to CA002253431A priority patent/CA2253431A1/en
Priority to IL12710897A priority patent/IL127108A0/en
Priority to ZA9704526A priority patent/ZA974526B/en
Priority to US08/991,953 priority patent/US6083748A/en
Priority to US08/991,258 priority patent/US5928887A/en
Publication of US5814507A publication Critical patent/US5814507A/en
Application granted granted Critical
Anticipated expiration legal-status Critical
Expired - Lifetime legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants

Definitions

  • This present invention concerns novel receptor protein tyrosine phosphatase polypeptides. More particularly, the present invention concerns a novel receptor protein tyrosine phosphatase designated herein as PTP ⁇ .
  • Tyrosine phosphorylation is induced by a plethora of receptor-like molecules as well as by a wide range of intracellular enzymes. The effects of tyrosine phosphorylation are numerous, and they modulate a range of developmental as well as other cellular operations. Of course, the importance of tyrosine phosphorylation is underlined by the need for mechanisms which carefully regulate the levels of these events.
  • protein tyrosine kinases represent positive mediators of tyrosine phosphorylation
  • protein tyrosine phosphatases (PTPs) induce the removal of phosphate from tyrosine.
  • Non-receptor PTPs represent a growing family of enzymes that are found in both receptor as well as non-receptor forms (Tonks, Semin. Cell. Biol. 4:373-453 (1993), Walton et al., Ann. Rev. Biochem. 62:101-120 (1993) and Sun et al., Trends Biochem. Sci. 19(11):480-485 (1994)).
  • Non-receptor PTPs are a highly diverse kindred, and they contain a number of motifs, in addition to the enzymatically active PTP domain, that serve to regulate the region of the cell occupied by these proteins as well as the substrate specificity of these enzymes.
  • the receptor PTPs are also a highly diverse group that are unified by the inclusion of a transmembrane domain which disposes them to the plasma membrane of the cell. Recently, the receptor PTPs have been subdivided into 8 types based upon their domain content (Brady-Kalnay et al., Curr. Opin. Cell. Biol. 7(5):650-657 (1995)).
  • PTPase domains all contain one or two PTPase domains on their cytoplasmic sides, with a variety of extracellular motifs including heavily O-glycosylated mucin-like domains (for example, CD45), chondroitin sulfate domains (for example, PTP ⁇ ) and short, highly glycosylated segments (for example, PTP ⁇ ).
  • the largest family of PTPs is the family which contains various motifs related to those found in adhesion molecules. These motifs include immunoglobulin-like (IgG) domains and fibronectin type III (FnIII) regions similar to those found in cell adhesion molecules such as ICAM, N-CAM and Ng-CAM (Rao et al., J. Cell. Biol.
  • adhesion-like PTPs including the PTPs ⁇ and ⁇ , contain a third domain termed the MAM, for meprin/A5/PTP ⁇ , motif (Beckman et al., Trends Biochem. Sci. 18:40-41 (1993)).
  • MAM meprin/A5/PTP ⁇ , motif
  • the MAM motif has been previously shown to be involved with cell-cell recognition in neurons (Jiang et al., J. Biol. Chem. 267:9185-9193 (1992), Takagi et al., Neuron 7:295-307 (1991) and Hirata et al., Neurosci. Res. 17:159-169 (1993)).
  • PTPs ⁇ and ⁇ are the receptors that are most well characterized as adhesion molecules (Brady-Kalnay et al., supra, Jiang et al., Mol. Cell. Biol., 13:2942-2951 (1993) and Gebbink et al., Febs. Lett. 290(1-2):123-130 (1991)). Both of these PTPs have been demonstrated to mediate homotypic adhesion. Thus, a diversity of assays, including cell- as well as molecule-based, have demonstrated that the extracellular domain of these enzymes can bind with high specificity in a homophilic manner (Brady-Kalnay et al., J. Cell. Biol.
  • Tonks and colleagues have recently demonstrated that the receptor PTP ⁇ specifically associates with the catenin/cadherin complex of homotypic cell adhesion molecules (Brady-Kalnay et al., J. Cell. Biol. 130(4):977-986 (1995)). They also demonstrated that treatment of cells with the PTP inhibitor pervanadate resulted in the upregulation of tyrosine phosphorylation of cadherins and catenins, a result which suggested a role for a PTP, potentially PTP ⁇ , in the maintenance of the cadherin/catenin complex in an underphosphorylated state.
  • PTP ⁇ and ⁇ mediated homotypic adhesion together with the somewhat restricted tissue distribution of these PTPs (Jiang et al., (1993) supra and Gebbink et al., (1991) supra), has suggested that additional members of this family of adhesive enzymes might exist.
  • PTP ⁇ the third member of this receptor PTP family
  • the PTP ⁇ polypeptide reported here contains structural motifs that are very similar to those found in PTP ⁇ and ⁇ .
  • this novel PTP ⁇ receptor reveals a tissue distribution that is divergent from that previously described for the other members of this family.
  • PTP ⁇ Unlike other known receptor PTP polypeptides, PTP ⁇ is predominantly expressed in mammalian adult brain, lung and kidney tissues but predominantly lacks expression in mammalian adult liver tissue.
  • the present invention concerns an isolated receptor protein tyrosine phosphatase polypeptide (PTP) ⁇ , which
  • polypeptide is capable of dephosphorylating phosphorylated tyrosine residues.
  • the present invention also concerns derivatives of these novel PTP polypeptides which substantially retain the ability to dephosphorylate phosphorylated tyrosine residues.
  • a preferred group of the PTP polypeptides of the present invention includes a polypeptide comprising the amino acid sequence shown in FIG. 1 (SEQ ID NO:2); a further mammalian homologue of amino acid sequence shown in FIG. 1 and a derivative of any of the above polypeptides which substantially retain the ability to dephosphorylate tyrosine residues.
  • the present invention is directed to agonists and antagonists of the above novel PTP polypeptides.
  • the present invention concerns isolated nucleic acid molecules encoding the novel PTP polypeptides disclosed herein.
  • the invention concerns vectors comprising nucleic acid encoding the novel PTP polypeptides herein, operably linked to control sequences recognized by a host cell transformed with the vector, and to cells transformed with such vectors.
  • antibodies capable of specific binding to the novel PTP polypeptides of this invention, and hybridoma cell lines producing such antibodies.
  • the antibodies may be agonist antibodies, which stimulate the ability of the novel PTP polypeptides of the present invention to dephosphorylate tyrosines, or antagonist antibodies, which block this activity.
  • methods for producing the PTP polypeptides of the present invention comprising transforming a host cell with nucleic acid encoding said polypeptide, culturing the transformed cell and recovering said polypeptide from the cell culture.
  • the present invention further concerns an assay for identifying an antagonist or an agonist of a novel PTP polypeptide of the present invention, which comprises contacting a phosphatase domain of the PTP polypeptide with a candidate antagonist or agonist, and monitoring the ability of the phosphatase domain to dephosphorylate tyrosine residues.
  • FIGS. 1A-1I The file of this patent contains at least one drawing executed in color. Copies of this patent with color drawings will be provided by the Patent and Trademark Office upon request and payment of the necessary fee.
  • the cDNA and derived protein sequence of PTP ⁇ Illustrated is the cDNA (SEQ ID NO:1) and derived protein sequence (SEQ ID NO:2) of the full length PTP ⁇ clone homologous to a small PCR fragment derived from hematopoietic progenitor cells using consensus PTP primers. Amino acids are presented by their standard one-letter designations.
  • FIGS. 2A-2E Homology between PTP ⁇ , PTP ⁇ and PTP ⁇ . Illustrated as boxed residues are the amino acid homologies between the PTP ⁇ (ptplambda) (SEQ ID NO:2), PTP ⁇ (ptpkappa) (SEQ ID NO:3) and PTP ⁇ (ptpmu) (SEQ ID NO:4) polypeptides. Amino acids are presented by their standard one-letter designations. Also shown above the amino acid sequences are the domains predicted previously from PTP ⁇ and PTP ⁇ .
  • These domains include the signal sequence (SS), the MAM (mePrin, A5, PTP ⁇ ), immunoglobulin-like (IgG), fibronectin type III-like (FnIII), transmembrane domain (TMD), cadherin-like (Cadherin) and dual phosphatase domains (PTPase I and PTPase II).
  • SS signal sequence
  • MAM mePrin, A5
  • PTP ⁇ immunoglobulin-like
  • IgG immunoglobulin-like
  • FnIII fibronectin type III-like
  • TMD transmembrane domain
  • Cadherin cadherin-like domain
  • PTPase I and PTPase II dual phosphatase domains
  • FIG. 3 Comparative domain structures of PTP ⁇ , PTP ⁇ and PTP ⁇ . Illustrated are the percent amino acid homologies between the various domains of the PTP ⁇ , PTP ⁇ and PTP ⁇ polypeptides. These domains include the signal sequence (SS), the MAM (meprin, A5, PTP ⁇ ), immunoglobulin-like (IgG), fibronectin type III-like (FnIII), transmembrane domain (TMD), cadherin-like (Cadherin) and dual phosphatase domains (PTPase I and PTPase II).
  • SS signal sequence
  • MAM meprin, A5
  • IgG immunoglobulin-like
  • FnIII fibronectin type III-like
  • TMD transmembrane domain
  • Cadherin cadherin-like
  • dual phosphatase domains PTPase I and PTPase II.
  • FIG. 4 Tyrosine phosphatase activity of PTP ⁇ immunoprecipitates from PC 12 cells. Lysates of PC 12 cells were immunoprecipitated with either preimmune antibody (Pre-immune) or antibody directed against the cytoplasmic domain of the PTP ⁇ polypeptide (AntiPTP ⁇ ). The immunoprecipitates were incubated with two different immobilized tyrosine phosphorylated peptides (PPS1 and PPS2) using a commercially available tyrosine phosphatase assay kit. Immunoprecipitates were done either in the absence or presence of the tyrosine phosphatase inhibitor vanadate. Tyrosine phosphatase activity was determined by examining the residual binding of an anti-phosphotyrosine antibody to the immobilized peptide, so that a decreased OD 405 correlates with tyrosine phosphatase activity.
  • Pre-immune preimmune antibody
  • AntiPTP ⁇ antibody directed against the cytoplasm
  • FIG. 5 Northern blot analysis of PTP ⁇ expression.
  • Commercially available northern blots were probed with a 32 P-labeled fragment of PTP ⁇ using standard hybridization conditions.
  • the blot on the left illustrates the PTP ⁇ transcript in RNA obtained from murine embryos at the developmental day shown in the figure.
  • the blot on the right illustrates an analysis of the PTP ⁇ transcript in RNA from a. heart, b. brain, c. spleen, d. lung, e. liver, f. skeletal muscle, g. kidney and h. testis.
  • FIGS. 6A-6I PTP ⁇ mRNA Expression In the E15.5 Rat Embryo.
  • Emulsion autoradiographs of a sagittal embryo section (A), and higher magnifications of embryonic midbrain (C), spinal cord (D), kidney (F), and lung hybridized with a 33 P-UTP labeled PTP ⁇ antisense probe are shown.
  • Opposed to the darkfield autoradiographs are the corresponding lightfield images of the sagittal embryo section (B), kidney (G), and lung (I).
  • Hybridization using a PTP ⁇ sense strand control probe is shown in an E15.5 embryonic spinal cord section (E).
  • Hybridization using a PTP ⁇ sense strand control probe is shown in an adult coronal section at the level of the substantia nigra (F).
  • FIG. 8 Expression of PTP ⁇ in PC 12 cells. Illustrated is the PTP ⁇ transcript observed in RNA of PC 12 cells either untreated (-) or treated (+) with 10 ng/ml of nerve growth factor (NGF) for the days shown at the top of the figure. The lower blot shows the ⁇ -actin signal obtained for each of the RNAs.
  • NGF nerve growth factor
  • FIG. 9A-9D Immunofluorescence analysis of PTP ⁇ expression in PC 12 cells.
  • PC 12 cells were either left untreated or treated with 10 ng/ml nerve growth factor (NGF) for 7 days to induce neurite formation. At the end of this time, the cells were permeabilized and stained with either pre-immune serum or antibodies directed against the intracellular domain of PTP ⁇ . Cells were washed and observed by confocal fluorescence microscopy.
  • Panel A shows the results without NGF and with pre-immune serum.
  • Panel B shows the results without NGF and with anti-PTP ⁇ serum.
  • Panel C shows the results with NGF and anti-PTP ⁇ serum.
  • Panel D shows the results obtained with NGF and anti-PTP ⁇ serum at a higher magnification than in Panel C.
  • the arrows show positively stained extended neurites.
  • receptor protein tyrosine phosphatase ⁇ protein tyrosine phosphatase ⁇
  • PTP ⁇ protein tyrosine phosphatase ⁇
  • receptor protein tyrosine phosphatase ⁇ protein tyrosine phosphatase ⁇
  • PTP ⁇ protein tyrosine phosphatase ⁇
  • receptor protein tyrosine phosphatase ⁇ protein tyrosine phosphatase ⁇
  • PTP ⁇ protein tyrosine phosphatase ⁇
  • the above terms are also intended to encompass functional derivatives of such native tyrosine phosphatases.
  • Native tyrosine phosphatase in this context refers to a naturally occurring tyrosine phosphatase polypeptide, having the described properties, of any human or non-human animal species, with or without the initiating methionine, whether purified from the native source, synthesized, produced by recombinant DNA technology or by any combination of these and/or other methods.
  • Native PTP ⁇ specifically includes the native murine PTP ⁇ protein shown in FIG. 1 (SEQ ID NO:2).
  • a “functional derivative" of a polypeptide is a compound having a qualitative biological activity in common with the native polypeptide.
  • a functional derivative of a native PTP ⁇ polypeptide is a compound that has a qualitative biological activity in common with a native PTP ⁇ polypeptide, for example, as being capable of dephosphorylating phosphorylated tyrosine residues.
  • “Functional derivatives” include, but are not limited to, fragments of native polypeptides from any animal species (including humans), derivatives of native (human and non-human) polypeptides and their fragments, glycosylation variants of a native polypeptide, and peptide and non-peptide analogs of native polypeptides, provided that they have a biological activity in common with a respective native polypeptide.
  • “Fragments” comprise regions within the sequence of a mature native polypeptide.
  • the term “derivative” is used to define amino acid sequence variants, and covalent modifications of a native polypeptide.
  • “Non-peptide analogs” are organic compounds which display substantially the same surface as peptide analogs of the native polypeptides.
  • the non-peptide analogs of the native PTP ⁇ of the present invention are organic compounds which display substantially the same surface as peptide analogs of the native PTP ⁇ . Such compounds interact with other molecules in a similar fashion as the peptide analogs, and mimic a biological activity of a native PTP ⁇ of the present invention.
  • the polypeptide functional derivatives of the native PTP ⁇ of the present invention preferably have at least about 65%, more preferably at least about 75%, even more preferably at least about 85%, most preferably at least about 95% overall sequence homology with the amino acid sequence shown in FIG. 1 (SEQ ID NO:2) and substantially retain the ability to dephosphorylate phosphorylated tyrosine residues.
  • biological activity in the context of the definition of functional derivatives is defined as the possession of at least one adhesive, regulatory or effector function qualitatively in common with a native polypeptide (e.g. PTP ⁇ ).
  • the functional derivatives of the native PTP ⁇ of the present invention are unified by their qualitative ability to dephosphorylate phosphorylated tyrosine residues.
  • the functional derivatives of the native PTP ⁇ polypeptides of the present invention qualitatively retain at least one of the following biological properties of the native molecules: mediation of cell adhesion, and involvement in neural pathfinding.
  • covalent modification and “covalent derivatives” are used interchangeably and include, but are not limited to, modifications of a native polypeptide or a fragment thereof with an organic proteinaceous or non-proteinaceous derivatizing agent, fusions to heterologous polypeptide sequences, and post-translational modifications.
  • Covalent modifications are traditionally introduced by reacting targeted amino acid residues with an organic derivatizing agent that is capable of reacting with selected sides or terminal residues, or by harnessing mechanisms of post-translational modifications that function in selected recombinant host cells. Certain post-translational modifications are the result of the action of recombinant host cells on the expressed polypeptide.
  • Glutaminyl and asparaginyl residues are frequently post-translationally deamidated to the corresponding glutamyl and aspartyl residues. Alternatively, these residues are deamidated under mildly acidic conditions.
  • Other post-translational modifications include hydroxylation of proline and lysine, phosphorylation of hydroxyl groups of seryl, tyrosine or threonyl residues, methylation of the ⁇ -amino groups of lysine, arginine, and histidine side chains T.
  • Covalent derivatives/modifications specifically include fusion proteins comprising native PTP ⁇ sequences of the present invention and their amino acid sequence variants, such as immunoadhesins, and N-terminal fusions to heterologous signal sequences.
  • Predominantly expressed is defined as a level of expression of a nucleic acid encoding an amino acid sequence which is easily detectable using northern blot analysis under stringent conditions.
  • Identity or “homology” with respect to a native polypeptide and its functional derivative is defined herein as the percentage of amino acid residues in the candidate sequence that are identical with the residues of a corresponding native polypeptide, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent homology, and not considering any conservative substitutions as part of the sequence identity. Neither N- or C-terminal extensions nor insertions shall be construed as reducing identity or homology. Methods and computer programs for the alignment are well known in the art.
  • agonist is used to refer to peptide and non-peptide analogs of the native PTP ⁇ of the present invention and to antibodies specifically binding native PTP ⁇ provided that they retain at least one biological activity of a native PTP ⁇ .
  • the agonists of the present invention retain the qualitative ability to dephosphorylate phosphorylated tyrosine residues.
  • antagonist is used to refer to a molecule inhibiting a biological activity of a native PTP ⁇ of the present invention.
  • the antagonists herein inhibit the ability of the PTP ⁇ of the present invention to dephosphorylate tyrosines.
  • Preferred antagonists essentially completely block tyrosine dephosphorylation caused by PTP ⁇ .
  • amino acid and “amino acids” refer to all naturally occurring L- ⁇ -amino acids.
  • D-amino acids may be present in the polypeptides or peptides of the present invention in order to facilitate conformational restriction.
  • a D amino acid cysteine may be provided at one or both termini of a peptide functional derivative or peptide antagonist of the native PTP ⁇ of the present invention.
  • the amino acids are identified by either the single-letter or three-letter designations:
  • amino acids may be classified according to the chemical composition and properties of their side chains. They are broadly classified into two groups, charged and uncharged. Each of these groups is divided into subgroups to classify the amino acids more accurately:
  • Acidic Residues aspartic acid, glutamic acid
  • Hydrophilic Residues serine, threonine, asparagine, glutamine
  • Aromatic Residues phenylalanine, tyrosine, tryptophan
  • amino acid sequence variant refers to molecules with some differences in their amino acid sequences as compared to a native amino acid sequence.
  • Substitutional variants are those that have at least one amino acid residue in a native sequence removed and a different amino acid inserted in its place at the same position.
  • the substitutions may be single, where only one amino acid in the molecule has been substituted, or they may be multiple, where two or more amino acids have been substituted in the same molecule.
  • Insertional variants are those with one or more amino acids inserted immediately adjacent to an amino acid at a particular position in a native sequence. Immediately adjacent to an amino acid means connected to either the ⁇ -carboxy or ⁇ -amino functional group of the amino acid.
  • Deletional variants are those with one or more amino acids in the native amino acid sequence removed. Ordinarily, deletional variants will have one or two amino acids deleted in a particular region of the molecule.
  • Antibodies (Abs) and “immunoglobulins (Igs)” are glycoproteins having the same structural characteristics. While antibodies exhibit binding specificity to a specific antigen, immunoglobulins include both antibodies and other antibody-like molecules which lack antigen specificity. Polypeptides of the latter kind are, for example, produced at low levels by the lymph system and at increased levels by myelomas.
  • Native antibodies and immunoglobulins are usually heterotetrameric glycoproteins of about 150,000 daltons, composed of two identical light (L) chains and two identical heavy (H) chains. Each light chain is linked to a heavy chain by one covalent disulfide bond, while the number of disulfide linkages varies between the heavy chains of different immunoglobulin isotypes. Each heavy and light chain also has regularly spaced intrachain disulfide bridges. Each heavy chain has at one end a variable domain (V H ) followed by a number of constant domains.
  • V H variable domain
  • Each light chain has a variable domain at one and (V L ) and a constant domain at its other end; the constant domain of the light chain is aligned with the first constant domain of the heavy chain, and the light chain variable domain is aligned with the variable domain of the heavy chain.
  • Particular amino acid residues are believed to form an interface between the light and heavy chain variable domains (Clothia et al., J. Mol. Biol. 186, 651-663 1985!; Novotny and Haber, Proc. Natl. Acad. Sci. USA 82, 4592-4596 1985!).
  • variable refers to the fact that certain portions of the variable domains differ extensively in sequence among antibodies and are used in the binding and specificity of each particular antibody for its particular antigen. However, the variability is not evenly distributed through the variable domains of antibodies. It is concentrated in three segments called complementarity determining regions (CDRs) or hypervariable regions both in the light chain and the heavy chain variable domains. The more highly conserved portions of variable domains are called the framework (FR).
  • CDRs complementarity determining regions
  • FR framework
  • the variable domains of native heavy and light chains each comprise four FR regions, largely adopting a ⁇ -sheet configuration, connected by three CDRs, which form loops connecting, and in some cases forming part of, the ⁇ -sheet structure.
  • the CDRs in each chain are held together in close proximity by the FR regions and, with the CDRs from the other chain, contribute to the formation of the antigen binding site of antibodies (see Kabat, E. A. et al., Sequences of Proteins of Immunological Interest, National Institute of Health, Bethesda, MD 1991!).
  • the constant domains are not involved directly in binding an antibody to an antigen, but exhibit various effector functions, such as participation of the antibody in antibody-dependent cellular toxicity.
  • Papain digestion of antibodies produces two identical antigen binding fragments, called Fab fragments, each with a single antigen binding site, and a residual "Fc" fragment, whose name reflects its ability to crystallize readily. Pepsin treatment yields an F(ab') 2 fragment that has two antigen combining sites and is still capable of cross-linking antigen.
  • Fv is the minimum antibody fragment which contains a complete antigen recognition and binding site. This region consists of a dimer of one heavy and one light chain variable domain in tight, non-covalent association. It is in this configuration that the three CDRs of each variable domain interact to define an antigen binding site on the surface of the V H -V L dimer. Collectively, the six CDRs confer antigen binding specificity to the antibody. However, even a single variable domain (or half of an Fv comprising only three CDRs specific for an antigen) has the ability to recognize and bind antigen, although at a lower affinity than the entire binding site.
  • the Fab fragment also contains the constant domain of the light chain and the first constant domain (CH1) of the heavy chain.
  • Fab' fragments differ from Fab fragments by the addition of a few residues at the carboxy terminus of the heavy chain CH1 domain including one or more cysteines from the antibody hinge region.
  • Fab'-SH is the designation herein for Fab' in which the cysteine residue(s) of the constant domains bear a free thiol group.
  • F(ab') 2 antibody fragments originally were produced as pairs of Fab' fragments which have hinge cysteines between them. Other, chemical couplings of antibody fragments are also known.
  • the light chains of antibodies (immunoglobulins) from any vertebrate species can be assigned to one of two clearly distinct types, called kappa ( ⁇ ) and lambda ( ⁇ ), based on the amino acid sequences of their constant domains.
  • immunoglobulins can be assigned to different classes. There are five major classes of immunoglobulins: IgA, IgD, IgE, IgG and IgM, and several of these may be further divided into subclasses (isotypes), e.g. IgG-1, IgG-2, IgG-3, and IgG-4; IgA-1 and IgA-2.
  • the heavy chain constant domains that correspond to the different classes of immunoglobulins are called ⁇ , delta, epsilon, ⁇ , and ⁇ , respectively.
  • the subunit structures and three-dimensional configurations of different classes of immunoglobulins are well known.
  • antibody is used in the broadest sense and specifically covers single monoclonal antibodies (including agonist and antagonist antibodies), antibody compositions with polyepitopic specificity, as well as antibody fragments (e.g., Fab, F(ab') 2 , and Fv), so long as they exhibit the desired biological activity.
  • the term "monoclonal antibody” as used herein refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical except for possible naturally occurring mutations that may be present in minor amounts. Monoclonal antibodies are highly specific, being directed against a single antigenic site. Furthermore, in contrast to conventional (polyclonal) antibody preparations which typically include different antibodies directed against different determinants (epitopes), each monoclonal antibody is directed against a single determinant on the antigen. In addition to their specificity, the monoclonal antibodies are advantageous in that they are synthesized by the hybridoma culture, uncontaminated by other immunoglobulins.
  • the monoclonal antibodies herein specifically include "chimeric" antibodies (immunoglobulins) in which a portion of the heavy and/or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain(s) is identical with or homologous to corresponding sequences in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies, so long as they exhibit the desired biological activity (U.S. Pat. No. 4,816,567 (Cabilly et al.; Morrison et al., Proc. Natl. Acad. Sci. USA 81, 6851-6855 1984!).
  • chimeric antibodies immunoglobulins in which a portion of the heavy and/or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain(s) is identical with or
  • Humanized forms of non-human (e.g. murine) antibodies are chimeric immunoglobulins, immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab', F(ab') 2 or other antigen-binding subsequences of antibodies) which contain minimal sequence derived from non-human immunoglobulin.
  • humanized antibodies are human immunoglobulins (recipient antibody) in which residues from a complementary determining region (CDR) of the recipient are replaced by residues from a CDR of a non-human species (donor antibody) such as mouse, rat or rabbit having the desired specificity, affinity and capacity.
  • CDR complementary determining region
  • humanized antibody may comprise residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences. These modifications are made to further refine and optimize antibody performance.
  • the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or substantially all of the FR regions are those of a human immunoglobulin consensus sequence.
  • the humanized antibody optimally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin.
  • Fc immunoglobulin constant region
  • progeny in the context of the present invention the expressions "cell”, “cell line”, and “cell culture” are used interchangeably, and all such designations include progeny. It is also understood that all progeny may not be precisely identical in DNA content, due to deliberate or inadvertent mutations. Mutant progeny that have the same function or biological property, as screened for in the originally transformed cell, are included.
  • replicable expression vector and "expression vector” refer to a piece of DNA, usually double-stranded, which may have inserted into it a piece of foreign DNA.
  • Foreign DNA is defined as heterologous DNA, which is DNA not naturally found in the host cell.
  • the vector is used to transport the foreign or heterologous DNA into a suitable host cell. Once in the host cell, the vector can replicate independently of the host chromosomal DNA, and several copies of the vector and its inserted (foreign) DNA may be generated.
  • the vector contains the necessary elements that permit translating the foreign DNA into a polypeptide. Many molecules of the polypeptide encoded by the foreign DNA can thus be rapidly synthesized.
  • control sequences refers to DNA sequences necessary for the expression of an operably linked coding sequence in a particular host organism.
  • the control sequences that are suitable for prokaryotes include a promoter, optionally an operator sequence, a ribosome binding site, and possibly, other as yet poorly understood sequences.
  • Eukaryotic cells are known to utilize promoters, polyadenylation signals, and enhancers.
  • Nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence.
  • DNA for a presequence or a secretory leader is operably linked to DNA for a polypeptide if it is expressed as a preprotein that participates in the secretion of the polypeptide;
  • a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence; or
  • a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation.
  • "operably linked” means that the DNA sequences being linked are contiguous and, in the case of a secretory leader, contiguous and in reading phase. However, enhancers do not have to be contiguous. Linking is accomplished by ligation at convenient restriction sites. If such sites do not exist, then synthetic oligonucleotide adaptors or linkers are used in accord with conventional practice.
  • Immunoadhesins or "PTP ⁇ --immunoglobulin chimeras” are chimeric antibody-like molecules that combine the functional domain(s) of a binding protein (usually a receptor, a cell-adhesion molecule or a ligand) with the an immunoglobulin sequence.
  • a binding protein usually a receptor, a cell-adhesion molecule or a ligand
  • the most common example of this type of fusion protein combines the hinge and Fc regions of an immunoglobulin (Ig) with domains of a cell-surface receptor that recognizes a specific ligand.
  • This type of molecule is called an "immunoadhesin", because it combines “immune” and “adhesion” functions; other frequently used names are "Ig-chimera”, “Ig-” or “Fc-fusion protein”, or "receptor-globulin.”
  • Oligonucleotides are short-length, single- or double-stranded polydeoxynucleotides that are chemically synthesized by known methods such as phosphotriester, phosphite, or phosphoramidite chemistry, using solid phase techniques such as those described in EP 266,032, published 4 May 1988, or via deoxynucleoside H-phosphonate intermediates as described by Froehler et al., Nucl. Acids Res. 14, 5399 (1986). They are then purified on polyacrylamide gels.
  • Hybridization is preferably performed under "stringent conditions" which means (1) employing low ionic strength and high temperature for washing, for example, 0.01 5 sodium chloride/0.0015M sodium citrate/0.1% sodium dodecyl sulfate at 50° C., or (2) employing during hybridization a denaturing agent, such as formamide, for example, 50% (vol/vol) formamide with 0.1% bovine serum albumin/0.1% Ficoll/0.1% polyvinylpyrrolidone/50 nM sodium phosphate buffer at pH 6.5 with 750 mM sodium chloride, 75 mM sodium citrate at 42° C.
  • stringent conditions means (1) employing low ionic strength and high temperature for washing, for example, 0.01 5 sodium chloride/0.0015M sodium citrate/0.1% sodium dodecyl sulfate at 50° C., or (2) employing during hybridization a denaturing agent, such as formamide, for example, 50% (vol/vol) formamide with 0.1% bovine serum albumin/0.1
  • Another example is use of 50% formamide, 5 ⁇ SSC (0.75M NaCl, 0.075M sodium citrate), 50 mM sodium phosphate (pH 6/8), 0.1% sodium pyrophosphate, 5 ⁇ Denhardt's solution, sonicated salmon sperm DNA (50 ⁇ g/ml), 0.1% SDS, and 10% dextran sulfate at 42° C., with washes at 42° C. in 0.2 ⁇ SSC and 0.1% SDS.
  • Yet another example is hybridization using a buffer of 10% dextran sulfate, 2 ⁇ SSC (sodium chloride/sodium citrate) and 50% formamide at 55° C., followed by a high-stringency wash consisting of 0.1 ⁇ SSC containing EDTA at 55° C.
  • Transformation means introducing DNA into an organism so that the DNA is replicable, either as an extrachromosomal element or by chromosomal integration. Depending on the host cell used, transformation is done using standard techniques appropriate to such cells.
  • the calcium treatment employing calcium chloride as described by Cohen, S. N., Proc. Natl. Acad. Sci. (USA), 69, 2110 (1972) and Mandel et al. J. Mol. Biol. 53, 154 (1970), is generally used for prokaryotes or other cells that contain substantial cell-wall barriers.
  • the calcium phosphate precipitation method of Graham, F. and van der Eb, A., Virology, 52, 456-457 (1978) is preferred.
  • Transformations into yeast are typically carried out according to the method of Van Solingen, P., et al. J. Bact., 130, 946 (1977) and Hsiao, C. L., et al. Proc. Natl. Acad. Sci. (USA) 76, 3829 (1979).
  • other methods for introducing DNA into cells such as by nuclear injection, electroporation or by protoplast fusion may also be used.
  • Recovery or “isolation” of a given fragment of DNA from a restriction digest means separation of the digest on polyacrylamide or agarose gel by electrophoresis, identification of the fragment of interest by comparison of its mobility versus that of marker DNA fragments of known molecular weight, removal of the gel section containing the desired fragment, and separation of the gel from DNA.
  • This procedure is known generally. For example, see R. Lawn et al., Nucleic Acids Res. 9, 6103-6114 (1981) and D. Goeddel et al., Nucleic Acids Res. 8, 4057 (1980).
  • Ligase refers to the process of forming phosphodiester bonds between two double stranded nucleic acid fragments (T. Maniatis et al. 1982, supra, p. 146). Unless otherwise provided, ligation may be accomplished using known buffers and conditions with 10 units of T4 DNA ligase ("ligase”) per 0.5 mg of approximately equimolar amounts of the DNA fragments to be ligated.
  • ligase T4 DNA ligase
  • Preparation of DNA from transformants means isolating plasmid DNA from microbial culture. Unless otherwise provided, the alkaline/SDS method of Maniatis et al. 1982, supra, p. 90, may be used.
  • the native PTP ⁇ proteins of the present invention may be isolated from cDNA or genomic libraries.
  • a suitable cDNA library can be constructed by obtaining polyadenylated mRNA from cells known to express the desired PTP ⁇ protein, and using the mRNA as a template to synthesize double stranded cDNA.
  • Suitable sources of the mRNA are murine primitive hematopoietic cells and PC12 cells.
  • mRNA encoding the native PTP ⁇ of the present invention is expressed, for example, in tissues derived from adult brain, lung, kidney, heart, skeletal muscle and testis.
  • the gene encoding the novel PTP ⁇ polypeptide of the present invention can also be obtained from a genomic library, such as a human genomic cosmid library, or a mouse-derived embryonic cell (ES) genomic library.
  • a genomic library such as a human genomic cosmid library, or a mouse-derived embryonic cell (ES) genomic library.
  • probes designed to identify the gene of interest or the protein encoded by it.
  • suitable probes include monoclonal and polyclonal antibodies that recognize and specifically bind to a PTP ⁇ polypeptide.
  • suitable probes include carefully selected oligonucleotide probes (usually of about 20-80 bases in length) that encode known or suspected portions of a PTP ⁇ polypeptide from the same or different species, and/or complementary or homologous cDNAs or fragments thereof that encode the same or a similar gene.
  • Appropriate probes for screening genomic DNA libraries include, without limitation, oligonucleotides, cDNAs, or fragments thereof that encode the same or a similar gene, and/or homologous genomic DNAs or fragments thereof. Screening the cDNA or genomic library with the selected probe may be conducted using standard procedures as described in Chapters 10-12 of Sambrook et al., Molecular Cloning: A Laboratory Manual, New York, Cold Spring Harbor Laboratory Press, 1989.
  • the oligonucleotide must be labeled such that it can be detected upon hybridization to DNA in the library being screened.
  • the preferred method of labeling is to use ATP (e.g., ⁇ 32 P) and polynucleotide kinase to radiolabel the 5' end of the oligonucleotide.
  • ATP e.g., ⁇ 32 P
  • polynucleotide kinase to radiolabel the 5' end of the oligonucleotide.
  • other methods may be used to label the oligonucleotide, including, but not limited to, biotinylation or enzyme labeling.
  • cDNAs encoding PTP ⁇ can also be identified and isolated by other known techniques of recombinant DNA technology, such as by direct expression cloning, or by using the polymerase chain reaction (PCR) as described in U.S. Pat. No. 4,683,195, issued 28 Jul. 1987, in section 14 of Sambrook et al., supra, or in Chapter 15 of Current Protocols in Molecular Biology, Ausubel et al. eds., Greene Publishing Associates and Wiley-lnterscience 1991.
  • the use of the PCR technique for obtaining cDNA encoding murine PTP ⁇ is also illustrated in the examples.
  • cDNAs from other species can also be obtained by cross-species hybridization.
  • human or other mammalian cDNA or genomic libraries are probed by labeled oligonucleotide sequences selected from known PTP ⁇ sequences (such as murine PTP ⁇ ) in accord with known criteria, among which is that the sequence should be sufficient in length and sufficiently unambiguous that false positives are minimized.
  • oligonucleotide sequences selected from known PTP ⁇ sequences (such as murine PTP ⁇ ) in accord with known criteria, among which is that the sequence should be sufficient in length and sufficiently unambiguous that false positives are minimized.
  • a 32 P-labeled oligonucleotide having about 30 to 50 bases is sufficient, particularly if the oligonucleotide contains one or more codons for methionine or tryptophan.
  • Isolated nucleic acid will be DNA that is identified and separated from contaminant nucleic acid encoding other polypeptides from the source
  • the gene encoding a particular PTP ⁇ polypeptide can also be obtained by chemical synthesis, following one of the methods described in Engels and Uhlmann, Agnew. Chem. Int. Ed. Engl. 28, 716 (1989). These methods include triester, phosphite, phosphoramidite and H-phosphonate methods, PCR and other autoprimer methods, and oligonucleotide syntheses on solid supports.
  • nucleic acid encoding PTP ⁇ is available, it is generally ligated into a replicable expression vector for further cloning (amplification of the DNA), or for expression.
  • Expression and cloning vectors are well known in the art and contain a nucleic acid sequence that enables the vector to replicate in one or more selected host cells. The selection of the appropriate vector will depend on 1) whether it is to be used for DNA amplification or for DNA expression, 2) the size of the DNA to be inserted into the vector, and 3) the host cell to be transformed with the vector. Each vector contains various components depending on its function (amplification of DNA of expression of DNA) and the host cell for which it is compatible.
  • the vector components generally include, but are not limited to, one or more of the following: a signal sequence, an origin of replication, one or more marker genes, an enhancer element, a promoter, and a transcription termination sequence.
  • Plasmids from the transformants are prepared, analyzed by restriction endonuclease digestion, and/or sequenced by the method of Messing et al., Nucleic Acids Res. 9, 309 (1981) or by the method of Maxam et al., Methods in Enzymology 65, 499 (1980).
  • the polypeptides of the present invention may be expressed in a variety of prokaryotic and eukaryotic host cells.
  • Suitable prokaryotes include gram negative or gram positive organisms, for example E. coli or bacilli.
  • a preferred cloning host is E. coli 294 (ATCC 31,446) although other gram negative or gram positive prokaryotes such as E. coli B, E. coli X1776 (ATCC 31,537), E. coli W3110 (ATCC 27,325), Pseudomonas species, or Serratia Marcesans are suitable.
  • eukaryotic microbes such as filamentous fungi or yeast are suitable hosts for vectors herein.
  • Saccharomyces cerevisiae, or common baker's yeast is the most commonly used among lower eukaryotic host microorganisms.
  • a number of other genera, species and strains are commonly available and useful herein, such as S. pombe Beach and Nurse, Nature 290, 140 (1981)!, Kluyveromyces lactis Louvencourt et al., J.
  • Suitable host cells may also derive from multicellular organisms. Such host cells are capable of complex processing and glycosylation activities. In principle, any higher eukaryotic cell culture is workable, whether from vertebrate or invertebrate culture, although cells from mammals such as humans are preferred. Examples of invertebrate cells include plants and insect cells. Numerous baculoviral strains and variants and corresponding permissive insect host cells from hosts such as Spodoptera frugiperda (caterpillar), Aedes aegypti (mosquito), Aedes albopictus (mosquito), Drosophila melanogaster (fruitfly), and Bombyx mori host cells have been identified. See, e.g.
  • Plant cell cultures of cotton, corn, potato, soybean, petunia, tomato, and tobacco can be utilized as hosts.
  • plant cells are transfected by incubation with certain strains of the bacterium Agrobacterium tumefaciens, which has been previously manipulated to contain the PTP ⁇ DNA.
  • Agrobacterium tumefaciens the DNA encoding a PTP ⁇ polypeptide is transferred to the plant cell host such that it is transfected, and will, under appropriate conditions, express the PTP ⁇ DNA.
  • regulatory and signal sequences compatible with plant cells are available, such as the nopaline synthase promoter and polyadenylation signal sequences. Depicker et al., J.
  • DNA segments isolated from the upstream region of the T-DNA 780 gene are capable of activating or increasing transcription levels of plant-expressible genes in recombinant DNA-containing plant tissue. See EP 321,196 published 21 Jun. 1989.
  • Preferred host cells are human embryonic kidney 293 and Chinese hamster ovary cells.
  • transient expression involves the use of an expression vector that is able to replicate efficiently in a host cell, such that the host cell accumulates many copies of the expression vector and, in turn, synthesizes high levels of a desired polypeptide encoded by the expression vector.
  • Transient systems comprising a suitable expression vector and a host cell, allow for the convenient positive identification of polypeptides encoded by clones DNAs, as well as for the rapid screening of such polypeptides for desired biological or physiological properties.
  • transient expression systems are particularly useful in the invention for purposes of identifying analogs and variants of a PTP ⁇ polypeptide.
  • PTP ⁇ polypeptides in recombinant vertebrate cell culture are described in Getting et al., Nature 293, 620-625 (1981); Mantel et al., Nature 281, 40-46 (1979); Levinson et al.; EP 117,060 and EP 117,058.
  • Particularly useful plasmids for mammalian cell culture expression of the PTP ⁇ polypeptides are pRK5 (EP 307,247) or pSVI6B (PCT Publication No. WO 91/08291).
  • PTP ⁇ polypeptides of the present invention in a variety of host cells are, for example, described in EP 457,758 published 27 Nov. 1991.
  • a large variety of expression vectors are now commercially available.
  • An exemplary commercial yeast expression vector is pPIC.9 (Invitrogen), while an commercially available expression vector suitable for transformation of E. coli cells is PET15b (Novagen).
  • Prokaryote cells used to produced the PTP ⁇ polypeptides of this invention are cultured in suitable media as describe generally in Sambrook et al., supra.
  • Mammalian cells can be cultured in a variety of media.
  • Commercially available media such as Ham's F10 (Sigma), Minimal Essential Medium (MEM, Sigma), RPMI-1640 (Sigma), and Dulbecco's Modified Eagle's Medium (DMEM, Sigma) are suitable for culturing the host cells.
  • 30,985 may be used as culture media for the host cells. Any of these media may be supplemented as necessary with hormones and/or other growth factors (such as insulin, transferrin, or epidermal growth factor), salts (such as sodium chloride, calcium, magnesium, and phosphate), buffers (such as HEPES), nucleosides (such as adenosine and thymidine), antibiotics (such as GentamycinTM drug) trace elements (defined as inorganic compounds usually present at final concentrations in the micromolar range), and glucose or an equivalent energy source. Any other necessary supplements may also be included at appropriate concentrations that would be known to those skilled in the art.
  • the culture conditions such as temperature, pH and the like, suitably are those previously used with the host cell selected for cloning or expression, as the case may be, and will be apparent to the ordinary artisan.
  • the host cells referred to in this disclosure encompass cells in in vitro cell culture as well as cells that are within a host animal or plant.
  • the PTP ⁇ polypeptides of this invention may be produced by homologous recombination, or with recombinant production methods utilizing control elements introduced into cells already containing DNA encoding the particular PTP ⁇ polypeptide.
  • Gene amplification and/or expression may be measured in a sample directly, for example, by conventional Southern blotting, Northern blotting to quantitate the transcription of mRNA Thomas, Proc. Natl. Acad. Sci. USA 77, 5201-5205 (1980)!, dot blotting (DNA analysis), or in situ hybridization, using an appropriately labeled probe, based on the sequences provided herein.
  • Various labels may be employed, most commonly radioisotopes, particularly 32 P.
  • other techniques may also be employed, such as using biotin-modified nucleotides for introduction into a polynucleotide.
  • the biotin then serves as a site for binding to avidin or antibodies, which may be labeled with a wide variety of labels, such as radionuclides, fluorescers, enzymes, or the like.
  • antibodies may be employed that can recognize specific duplexes, including DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes or DNA-protein duplexes.
  • the antibodies in turn may be labeled and the assay may be carried out where the duplex is bound to the surface, so that upon the formation of duplex on the surface, the presence of antibody bound to the duplex can be detected.
  • Gene expression may be measured by immunological methods, such as immunohistochemical staining of tissue sections and assay of cell culture or body fluids, to quantitate directly the expression of gene product.
  • immunohistochemical staining techniques a cell sample is prepared, typically by dehydration and fixation, followed by reaction with labeled antibodies specific for the gene product coupled, where the labels are usually visually detectable, such as enzymatic labels, fluorescent labels, luminescent labels, and the like.
  • a particularly sensitive staining technique suitable for use in the present invention is described by Hse et al., Am. J. Clin. Pharm. 75, 734-738 (1980).
  • Antibodies useful for immunohistochemical staining and/or assay of sample fluids may be either monoclonal or polyclonal, and may be prepared in any animal. Conveniently, the antibodies may be prepared against a native PTP ⁇ polypeptide, or against a synthetic peptide based on the DNA sequence provided herein as described further hereinbelow.
  • Amino acid sequence variants of native PTP ⁇ polypeptides are prepared by methods known in the art by introducing appropriate nucleotide changes into a PTP ⁇ DNA, or by in vitro synthesis of the desired polypeptide. There are two principal variables in the construction of amino acid sequence variants: the location of the mutation site and the nature of the mutation. With the exception of naturally-occurring alleles, which do not require the manipulation of the DNA sequence encoding the PTP ⁇ polypeptide, the amino acid sequence variants of PTP ⁇ polypeptides are preferably constructed by mutating the DNA, either to arrive at an allele or an amino acid sequence variant that does not occur in nature.
  • PTPasel and/or PTPasell phosphatase domains
  • PTPasel and/or PTPasell phosphatase domains
  • amino acid alterations within these domains are expected to result in marked changes in the enzymatic properties of the native proteins.
  • Non-conservative substitutions might ultimately result in PTP ⁇ variants which lose the ability to dephosphatase tyrosines and will, therefore, be useful as antagonists of native PTP ⁇ .
  • PTP ⁇ variants mutated to enhance the enzymatic activity of the native proteins may also be obtained, and will find use, for example, as potent mediators of cell adhesion.
  • amino acid alterations in the MAM or IgG domains of the native PTP ⁇ proteins are expected to affect the ability of these receptors to mediate homotypic cell adhesion, and the specificity of the homophilic interaction mediated.
  • amino acid alterations can be made at sites that differ in PTP ⁇ proteins from various species, or in highly conserved regions, depending on the goal to be achieved. Sites at such locations will typically be modified in series, e.g. by (1) substituting first with conservative choices and then with more radical selections depending upon the results achieved, (2) deleting the target residue or residues, or (3) inserting residues of the same or different class adjacent to the located site, or combinations of options 1-3.
  • One helpful technique is called “alanine scanning” (Cunningham and Wells, Science 244, 1081-1085 1989!).
  • sequence motifs within the MAM, IgG, FNIII or PTPase domains of the native PTP ⁇ proteins of the present invention by sequences from native PTP ⁇ and/or PTP ⁇ receptors is expected to result in variants having altered specificities.
  • one or more of the functionally less significant domains may be deleted or inactivated.
  • the deletion or inactivation of the transmembrane domain yields soluble variants of the native protein.
  • the cytoplasmic domain may be deleted, truncated or otherwise altered.
  • Naturally-occurring amino acids are divided into groups based on common side chain properties:
  • hydrophobic norleucine, met, ala, val, leu, ile
  • substitutions involve exchanging a member within one group for another member within the same group, whereas non-conservative substitutions will entail exchanging a member of one of these classes for another.
  • Substantial changes in function or immunological identity are made by selecting substitutions that are less conservative, i.e. differ more significantly in their effect on maintaining (a) the structure of the polypeptide backbone in the area of substitution, for example as a sheet or helical conformation, (b) the charge or hydrophobicity of the molecule at the target site or (c) the bulk of the side chain.
  • substitutions which in general are expected to produce the greatest changes in the properties of the novel native PTP ⁇ polypeptides of the present invention will be those in which (a) a hydrophilic residue, e.g.
  • seryl or threonyl is substituted for (or by) a hydrophobic residue, e.g. leucyl, isoleucyl, phenylalanyl, valyl or alanyl; (b) a cysteine or proline is substituted for (or by) any other residue; (c) a residue having an electropositive side chain, e.g.
  • lysyl, arginyl, or histidyl is substituted for (or by) an electronegative residue, e.g., glutamyl or aspartyl; or (d) a residue having a bulky side chain, e.g., phenylalanine, is substituted for (or by) one not having a side chain, e.g. glycine.
  • Amino acid sequence deletions generally range from about 1 to 30 residues, more preferably about 1 to 10 residues, and typically are contiguous. Typically, the transmembrane and cytoplasmic domains, or only the cytoplasmic domains are deleted. However, deletion from the C-terminal to any other suitable N-terminal to the transmembrane region which preserves the biological activity or immunological cross-reactivity of a native PTP ⁇ is suitable.
  • a preferred class of substitutional and/or deletional variants of the present invention are those involving a transmembrane region of a novel PTP ⁇ molecule.
  • Transmembrane regions are highly hydrophobic or lipophilic domains that are the proper size to span the lipid bilayer of the cellular membrane. They are believed to anchor the PTP ⁇ protein in the cell membrane and allow for homotypic complex formation. Inactivation of the transmembrane domain, typically by deletion or substitution of transmembrane domain hydroxylation residues, will facilitate recovery and formulation by reducing its cellular or membrane lipid affinity and improving its aqueous solubility.
  • transmembrane and cytoplasmic domains are deleted one avoids the introduction of potentially immunogenic epitopes, whether by exposure of otherwise intracellular polypeptides that might be recognized by the body as foreign or by insertion of heterologous polypeptides that are potentially immunogenic. Inactivation of the membrane binding function is accomplished by deletion of sufficient residues to produce a substantially hydrophilic hydropathy profile at this site or by substituting with heterologous residues which accomplish the same result.
  • transmembrane inactivated variants of the PTP ⁇ polypeptides of the present invention may be secreted into the culture medium of recombinant hosts.
  • These variants are soluble in body fluids such as blood and do not have an appreciable affinity for cell membrane lipids, thus considerably simplifying their recovery from recombinant cell culture.
  • such soluble variants will not have a functional transmembrane domain and preferably will not have a functional cytoplasmic domain.
  • the transmembrane domain may be substituted by any amino acid sequence, e.g.
  • Amino acid insertions include amino- and/or carboxyl-terminal fusions ranging in length from one residue to polypeptides containing a hundred or more residues, as well as intrasequence insertions of single or multiple amino acid residues.
  • Intrasequence insertions i.e. insertions within the PTP ⁇ protein amino acid sequence
  • terminal insertions include PTP ⁇ polypeptides with an N-terminal methionyl residue, an artifact of its direct expression in bacterial recombinant cell culture, and fusion of a heterologous N-terminal signal sequence to the N-terminus of the PTP ⁇ molecule to facilitate the secretion of the mature PTP ⁇ from recombinant host cells.
  • signal sequences will generally be obtained from, and thus homologous to, the intended host cell species. Suitable sequences include STII or Ipp for E. coli, alpha factor for yeast, and viral signals such as herpes gD for mammalian cells.
  • insertional variants of the native PTP ⁇ molecules include the fusion of the N- or C-terminus of the PTP ⁇ molecule to immunogenic polypeptides, e.g. bacterial polypeptides such as beta-lactamase or an enzyme encoded by the E. coli trp locus, or yeast protein, and C-terminal fusions with proteins having a long half-life such as immunoglobulin regions (preferably immunoglobulin constant regions), albumin, or ferritin, as described in WO 89/02922 published on 6 Apr. 1989.
  • immunogenic polypeptides e.g. bacterial polypeptides such as beta-lactamase or an enzyme encoded by the E. coli trp locus, or yeast protein
  • C-terminal fusions with proteins having a long half-life such as immunoglobulin regions (preferably immunoglobulin constant regions), albumin, or ferritin, as described in WO 89/02922 published on 6 Apr. 1989.
  • immunologically active derivatives of the novel PTP ⁇ polypeptides which comprise the PTP polypeptide and a polypeptide containing an epitope of an immunologically competent extraneous polypeptide, i.e. a polypeptide which is capable of eliciting an immune response in the animal to which the fusion is to be administered or which is capable of being bound by an antibody raised against an extraneous polypeptide.
  • immunologically competent polypeptides are allergens, autoimmune epitopes, or other potent immunogens or antigens recognized by pre-existing antibodies in the fusion recipient, including bacterial polypeptides such as trpLE, ⁇ -galactosidase, viral polypeptides such as herpes gD protein, and the like.
  • Immunogenic fusions are produced by cross-linking in vitro or by recombinant cell culture transformed with DNA encoding an immunogenic polypeptide. It is preferable that the immunogenic fusion be one in which the immunogenic sequence is joined to or inserted into a novel PTP ⁇ molecule or fragment thereof by (a) peptide bond(s). These products therefore consist of a linear polypeptide chain containing the PTP ⁇ epitope and at least one epitope foreign to the PTP ⁇ polypeptide. It will be understood that it is within the scope of this invention to introduce the epitopes anywhere within a PTP ⁇ molecule of the present invention or a fragment thereof.
  • immunogenic insertions are particularly useful when formulated into a pharmacologically acceptable carrier and administered to a subject in order to raise antibodies against the PTP ⁇ molecule, which antibodies in turn are useful as diagnostics, in tissue-typing, or in purification of the novel PTP ⁇ polypeptides by immunoaffinity techniques known per se.
  • binding partners for the fused extraneous polypeptide e.g. antibodies, receptors or ligands, are used to adsorb the fusion from impure admixtures, after which the fusion is eluted and, if desired, the novel PTP ⁇ is recovered from the fusion, e.g. by enzymatic cleavage.
  • the gene encoding a PTP ⁇ variant can, for example, be obtained by chemical synthesis as hereinabove described. More preferably, DNA encoding a PTP ⁇ amino acid sequence variant is prepared by site-directed mutagenesis of DNA that encodes an earlier prepared variant or a nonvariant version of the PTP ⁇ . Site-directed (site-specific) mutagenesis allows the production of PTP ⁇ variants through the use of specific oligonucleotide sequences that encode the DNA sequence of the desired mutation, as well as a sufficient number of adjacent nucleotides, to provide a primer sequence of sufficient size and sequence complexity to form a stable duplex on both sides of the deletion junction being traversed.
  • a primer of about 20 to 25 nucleotides in length is preferred, with about 5 to 10 residues on both sides of the junction of the sequence being altered.
  • site-specific mutagenesis is well known in the art, as exemplified by publications such as, Edelman et al., DNA 2, 183 (1983).
  • the site-specific mutagenesis technique typically employs a phage vector that exists in both a single-stranded and double-stranded form.
  • Typical vectors useful in site-directed mutagenesis include vectors such as the M13 phage, for example, as disclosed by Messing et al., Third Cleveland Symposium on Macromolecules and Recombinant DNA, A.
  • phage vectors are commercially available and their use is well known to those skilled in the art.
  • a versatile and efficient procedure for the construction of oligodeoxyribonucleotide directed site-specific mutations in DNA fragments using M13-derived vectors was published by Zoller, M. J. and Smith, M., Nucleic Acids Res. 10, 6487-6500 1982!).
  • plasmid vectors that contain a single-stranded phage origin of replication may be employed to obtain single-stranded DNA.
  • nucleotide substitutions are introduced by synthesizing the appropriate DNA fragment in vitro, and amplifying it by PCR procedures known in the art.
  • PCR technique may also be used in creating amino acid sequence variants of a PTP ⁇ polypeptide.
  • template plasmid DNA (1 ⁇ g) is linearized by digestion with a restriction endonuclease that has a unique recognition site in the plasmid DNA outside of the region to be amplified.
  • 100 ng is added to a PCR mixture containing PCR buffer, which contains the four deoxynucleotide triphosphates and is included in the GeneAmp R kits (obtained from Perkin-Elmer Cetus, Norwalk, Conn. and Emeryville, Calif.), and 25 pmole of each oligonucleotide primer, to a final volume of 50 ⁇ l.
  • the reaction mixture is overlayered with 35 ⁇ l mineral oil.
  • the reaction is denatured for 5 minutes at 100° C., placed briefly on ice, and then 1 ⁇ l Thermus aquaticus (Taq) DNA polymerase (5 units/ul), purchased from Perkin-Elmer Cetus, Norwalk, Conn. and Emeryville, Calif.) is added below the mineral oil layer.
  • the reaction mixture is then inserted into a DNA Thermal Cycler (purchased from Perkin-Elmer Cetus) programmed as follows:
  • reaction vial is removed from the thermal cycler and the aqueous phase transferred to a new vial, extracted with phenol/chloroform (50:50 vol), and ethanol precipitated, and the DNA is recovered by standard procedures. This material is subsequently subjected to appropriate treatments for insertion into a vector.
  • phagemid display method may be useful in making amino acid sequence variants of native or variant PTP ⁇ polypeptides or their fragments.
  • This method involves (a) constructing a replicable expression vector comprising a first gene encoding a receptor to be mutated, a second gene encoding at least a portion of a natural or wild-type phage coat protein wherein the first and second genes are heterologous, and a transcription regulatory element operably linked to the first and second genes, thereby forming a gene fusion encoding a fusion protein; (b) mutating the vector at one or more selected positions within the first gene thereby forming a family of related plasmids; (c) transforming suitable host cells with the plasmids; (d) infecting the transformed host cells with a helper phage having a gene encoding the phage coat protein; (e) culturing the transformed infected host cells under conditions suitable for forming recombinant phagemid particles containing
  • Steps (d) through (g) can be repeated one or more times.
  • the plasmid is under tight control of the transcription regulatory element, and the culturing conditions are adjusted so that the amount or number of phagemid particles displaying more than one copy of the fusion protein on the surface of the particle is less than about 1%.
  • the amount of phagemid particles displaying more than one copy of the fusion protein is less than 10% of the amount of phagemid particles displaying a single copy of the fusion protein. Most preferably, the amount is less than 20%.
  • the expression vector will further contain a secretory signal sequence fused to the DNA encoding each subunit of the polypeptide and the transcription regulatory element will be a promoter system.
  • Preferred promoter systems are selected from lac Z, ⁇ PL , tac, T7 polymerase, tryptophan, and alkaline phosphatase promoters and combinations thereof.
  • the method will employ a helper phage selected from M13K07, M13R408, M13-VCS, and Phi X 174.
  • the preferred helper phage is M13K07, and the preferred coat protein is the M13 Phage gene III coat protein.
  • the preferred host is E. coli, and protease-deficient strains of E. coli.
  • Glycosylation variants are included within the scope of the present invention. They include variants completely lacking in glycosylation (unglycosylated), variants having at least one less glycosylated site than the native form (deglycosylated) as well as variants in which the glycosylation has been changed. Included are deglycosylated and unglycosylated amino acid sequences variants, deglycosylated and unglycosylated native PTP ⁇ , and other glycosylation variants. For example, substitutional or deletional mutagenesis may be employed to eliminate the N- or O-linked glycosylation sites in the a native or variant PTP ⁇ molecule of the present invention, e.g.
  • the asparagine residue may be deleted or substituted for another basic residue such as lysine or histidine.
  • flanking residues making up the glycosylation site may be substituted or deleted, even though the asparagine residues remain unchanged, in order to prevent glycosylation by eliminating the glycosylation recognition site.
  • unglycosylated PTP ⁇ polypeptides which have the glycosylation sites of a native molecule may be produced in recombinant prokaryotic cell culture because prokaryotes are incapable of introducing glycosylation into polypeptides.
  • Covalent modifications of PTP ⁇ polypeptides are included within the scope herein. Such modifications are traditionally introduced by reacting targeted amino acid residues of the PTP ⁇ polypeptides with an organic derivatizing agent that is capable of reacting with selected sides or terminal residues, or by harnessing mechanisms of post-translational modifications that function in selected recombinant host cells.
  • the resultant covalent derivatives are useful in programs directed at identifying residues important for biological activity, for immunoassays of the PTP ⁇ polypeptide, or for the preparation of anti-PTP ⁇ antibodies for immunoaffinity purification of the recombinant.
  • Cysteinyl residues most commonly are reacted with ⁇ -haloacetates (and corresponding amines), such as chloroacetic acid or chloroacetamide, to give carboxymethyl or carboxyamidomethyl derivatives. Cysteinyl residues also are derivatized by reaction with bromotrifluoroacetone, ⁇ -bromo- ⁇ -(5-imidozoyl)propionic acid, chloroacetyl phosphate, N-alkylmaleimides, 3-nitro-2-pyridyl disulfide, methyl 2-pyridyl disulfide, p-chloromercuribenzoate, 2-chloromercuri-4-nitrophenol, or chloro-7-nitrobenzo-2-oxa-1,3-diazole.
  • Lysinyl and amino terminal residues are reacted with succinic or other carboxylic acid anhydrides. Derivatization with these agents has the effect of reversing the charge of the lysinyl residues.
  • Other suitable reagents for derivatizing ⁇ -amino-containing residues include imidoesters such as methyl picolinimidate; pyridoxal phosphate; pyridoxal; chloroborohydride; trinitrobenzenesulfonic acid; O-methylisourea; 2,4-pentanedione; and transaminase-catalyzed reaction with glyoxylate.
  • Arginyl residues are modified by reaction with one or several conventional reagents, among them phenylglyoxal, 2,3-butanedione, 1,2-cyclohexanedione, and ninhydrin. Derivatization of arginine residues requires that the reaction be performed in alkaline conditions because of the high PK a of the guanidine functional group. Furthermore, these reagents may react with the groups of lysine as well as the arginine epsilon-amino group.
  • tyrosyl residues may be made, with particular interest in introducing spectral labels into tyrosyl residues by reaction with aromatic diazonium compounds or tetranitromethane. Most commonly, N-acetylimidizole and tetranitromethane are used to form O-acetyl tyrosyl species and 3-nitro derivatives, respectively.
  • Tyrosyl residues are iodinated using 125 I or 131 I to prepare labeled proteins for use in radioimmunoassay.
  • Carboxyl side groups (aspartyl or glutamyl) are selectively modified by reaction with carbodiimides (R'-N ⁇ C ⁇ N-R') such as 1-cyclohexyl-3-(2-morpholinyl-4-ethyl) carbodiimide or 1-ethyl-3-(4-azonia-4,4-dimethylpentyl) carbodiimide. Furthermore, aspartyl and glutamyl residues are converted to asparaginyl and glutaminyl residues by reaction with ammonium ions.
  • carbodiimides Rosinyl or glutamyl
  • Glutaminyl and asparaginyl residues are frequently deamidated to the corresponding glutamyl and aspartyl residues. Alternatively, these residues are deamidated under mildly acidic conditions. Either form of these residues falls within the scope of this invention.
  • modifications include hydroxylation of proline and lysine, phosphorylation of hydroxyl groups of seryl, threonyl or tyrosyl residues, methylation of the ⁇ -amino groups of lysine, arginine, and histidine side chains (T. E. Creighton, Proteins: Structure and Molecular Properties, W. H. Freeman & Co., San Francisco, pp. 79-86 1983!), acetylation of the N-terminal amine, and amidation of any C-terminal carboxyl group.
  • the molecules may further be covalently linked to nonproteinaceous polymers, e.g.
  • polyethylene glycol, polypropylene glycol or polyoxyalkylenes in the manner set forth in U.S. Ser. No. 07/275,296 or U.S. Pat. Nos. 4,640,835; 4,496,689; 4,301,144; 4,670,417; 4,791,192 or 4,179,337.
  • Derivatization with bifunctional agents is useful for preparing intramolecular aggregates of PTP ⁇ polypeptides with polypeptides as well as for cross-linking the PTP ⁇ polypeptide to a water insoluble support matrix or surface for use in assays or affinity purification.
  • cross-linking agents include 1,1-bis(diazoacetyl)-2-phenylethane, glutaraldehyde, N-hydroxysuccinimide esters, homobifunctional imidoesters, and bifunctional maleimides.
  • Derivatizing agents such as methyl-3- (p-azidophenyl)dithio!propioimidate yield photoactivatable intermediates which are capable of forming cross-links in the presence of light.
  • reactive water insoluble matrices such as cyanogen bromide activated carbohydrates and the systems reactive substrates described in U.S. Pat. Nos. 3,959,642; 3,969,287; 3,691,016; 4,195,128; 4,247,642; 4,229,537; 4,055,635; and 4,330,440 are employed for protein immobilization and cross-linking.
  • immunoadhesins are chimeric antibody-like molecules combining the functional domain(s) of a binding protein (usually a receptor, a cell-adhesion molecule or a ligand) with the an immunoglobulin sequence.
  • a binding protein usually a receptor, a cell-adhesion molecule or a ligand
  • immunoglobulin sequence usually a receptor, a cell-adhesion molecule or a ligand
  • This type of molecule is called an "immunoadhesin", because it combines “immune” and “adhesion” functions; other frequently used names are "Ig-chimera”, “Ig-” or “Fc-fusion protein”, or "receptor-globulin.”
  • Immunoadhesins reported in the literature include, for example, fusions of the T cell receptor (Gascoigne et al., Proc. Natl. Acad. Sci. USA 84, 2936-2940 1987!); CD4 (Capon et al., Nature 337, 525-531 1989!; Traunecker et al., Nature 339, 68-70 1989!; Zettmeissl et al., DNA Cell Biol. USA 9, 347-353 1990!; Byrn et al., Nature 344, 667-670 1990!); L-selectin (homing receptor) (Watson et al., J.
  • ICAM-2 (Damle et al., J. Immunol. 148, 665-71 1992!); ICAM-3 (Holness et al., J. Biol. Chem. 270, 877-84 1995!); LFA-3 (Kanner et al., J. Immunol. 148, 2-23-29 1992!); L1 glycoprotein (Doherty et al., Neuron 14, 57-66 1995!); TNF-R1 (Ashkenazi et al., Proc. Natl. Acad. Sci.
  • the simplest and most straightforward immunoadhesin design combines the binding region(s) of the ⁇ adhesin ⁇ protein with the hinge and Fc regions of an immunoglobulin heavy chain.
  • nucleic acid encoding the desired PTP ⁇ polypeptide will be fused C-terminally to nucleic acid encoding the N-terminus of an immunoglobulin constant domain sequence, however N-terminal fusions are also possible.
  • the encoded chimeric polypeptide will retain at least functionally active hinge, CH2 and CH3 domains of the constant region of an immunoglobulin heavy chain.
  • Fusions are also made to the C-terminus of the Fc portion of a constant domain, or immediately N-terminal to the CH1 of the heavy chain or the corresponding region of the light chain.
  • the precise site at which the fusion is made is not critical; particular sites are well known and may be selected in order to optimize the biological activity, secretion or binding characteristics of the PTP ⁇ -immunoglobulin chimeras.
  • sequence of a native, mature PTP ⁇ polypeptide, or a soluble (transmembrane domain-inactivated) form thereof is fused to the N-terminus of the C-terminal portion of an antibody (in particular the Fc domain), containing the effector functions of an immunoglobulin, e.g. IgG-1. It is possible to fuse the entire heavy chain constant region to the PTP ⁇ sequence.
  • a sequence beginning in the hinge region just upstream of the papain cleavage site (which defines IgG Fc chemically; residue 216, taking the first residue of heavy chain constant region to be 114 Kobet et al., supra!, or analogous sites of other immunoglobulins) is used in the fusion.
  • the PTP ⁇ sequence (full length or soluble) is fused to the hinge region and CH2 and CH3 or CH1, hinge, CH2 and CH3 domains of an IgG-1, IgG-2, or IgG-3 heavy chain.
  • the precise site at which the fusion is made is not critical, and the optimal site can be determined by routine experimentation.
  • the PTP ⁇ -immunoglobulin chimeras are assembled as multimers, and particularly as homo-dimers or -tetramers (WO 91/08298).
  • these assembled immunoglobulins will have known unit structures.
  • a basic four chain structural unit is the form in which IgG, IgD, and IgE exist.
  • a four unit is repeated in the higher molecular weight immunoglobulins; IgM generally exists as a pentamer of basic four units held together by disulfide bonds.
  • IgA globulin, and occasionally IgG globulin may also exist in multimeric form in serum. In the case of multimer, each four unit may be the same or different.
  • V L is an immunoglobulin light chain variable domain
  • V H is an immunoglobulin heavy chain variable domain
  • C L is an immunoglobulin light chain constant domain
  • C H is an immunoglobulin heavy chain constant domain
  • n is an integer greater than 1;
  • Y designates the residue of a covalent cross-linking agent.
  • the PTP ⁇ amino acid sequences can be inserted between immunoglobulin heavy chain and light chain sequences such that an immunoglobulin comprising a chimeric heavy chain is obtained.
  • the PTP ⁇ polypeptide sequences are fused to the 3' end of an immunoglobulin heavy chain in each arm of an immunoglobulin, either between the hinge and the CH2 domain, or between the CH2 and CH3 domains. Similar constructs have been reported by Hoogenboom, H. R. et al., Mol. Immunol. 28, 1027-1037 (1991).
  • an immunoglobulin light chain might be present either covalently associated to a PTP ⁇ -immunoglobulin heavy chain fusion polypeptide, or directly fused to the PTP ⁇ polypeptide.
  • DNA encoding an immunoglobulin light chain is typically coexpressed with the DNA encoding the PTP ⁇ -immunoglobulin heavy chain fusion protein.
  • the hybrid heavy chain and the light chain will be covalently associated to provide an immunoglobulin-like structure comprising two disulfide-linked immunoglobulin heavy chain-light chain pairs.
  • the immunoglobulin sequences used in the construction of the immunoadhesins of the present invention are from an IgG immunoglobulin heavy chain constant domain.
  • IgG immunoglobulin heavy chain constant domain For human immunoadhesins, the use of human IgG-1 and IgG-3 immunoglobulin sequences is preferred.
  • a major advantage of using IgG-1 is that IgG-1 immunoadhesins can be purified efficiently on immobilized protein A. In contrast, purification of IgG-3 requires protein G, a significantly less versatile medium.
  • other structural and functional properties of immunoglobulins should be considered when choosing the Ig fusion partner for a particular immunoadhesin construction.
  • the IgG-3 hinge is longer and more flexible, so it can accommodate larger ⁇ adhesin ⁇ domains that may not fold or function properly when fused to IgG-1.
  • IgG immunoadhesins are typically mono- or bivalent, other Ig subtypes like IgA and IgM may give rise to dimeric or pentameric structures, respectively, of the basic Ig homodimer unit.
  • Multimeric immunoadhesins are advantageous in that they can bind their respective targets with greater avidity than their IgG-based counterparts. Reported examples of such structures are CD4-IgM (Traunecker et al., supra); ICAM-IgM (Martin et al., J. Virol. 67, 3561-68 1993!); and CD2-IgM (Arulanandam et al., J. Exp. Med. 177, 1439-50 1993!).
  • IgG-1, IgG-2 and IgG-4 all have in vivo half-lives of 21 days, their relative potencies at activating the complement system are different. IgG-4 does not activate complement, and IgG-2 is significantly weaker at complement activation than IgG-1. Moreover, unlike IgG-1, IgG-2 does not bind to Fc receptors on mononuclear cells or neutrophils. While IgG-3 is optimal for complement activation, its in vivo half-life is approximately one third of the other IgG isotypes.
  • immunoadhesins designed to be used as human therapeutics is the number of allotypic variants of the particular isotype.
  • IgG isotypes with fewer serologically-defined allotypes are preferred.
  • IgG-1 has only four serologically-defined allotypic sites, two of which (G1m and 2) are located in the Fc region; and one of these sites G1m1, is non-immunogenic.
  • there are 12 serologically-defined allotypes in IgG-3 all of which are in the Fc region; only three of these sites (G3m5, 11 and 21) have one allotype which is nonimmunogenic.
  • the potential immunogenicity of a ⁇ 3 immunoadhesin is greater than that of a ⁇ 1 immunoadhesin.
  • PTP ⁇ -Ig immunoadhesins are most conveniently constructed by fusing the cDNA sequence encoding the PTP ⁇ portion in-frame to an Ig cDNA sequence.
  • fusion to genomic Ig fragments can also be used (see, e.g. Gascoigne et al., Proc. Natl. Acad. Sci. USA 84, 2936-2940 1987!; Aruffo et al., Cell 61, 1303-1313 1990!; Stamenkovic et al., Cell 66, 1133-1144 1991!).
  • the latter type of fusion requires the presence of Ig regulatory sequences for expression.
  • cDNAs encoding IgG heavy-chain constant regions can be isolated based on published sequence from cDNA libraries derived from spleen or peripheral blood lymphocytes, by hybridization or by polymerase chain reaction (PCR) techniques.
  • the PTP ⁇ polypeptides may be linked to various nonproteinaceous polymers, such as polyethylene glycol, polypropylene glycol or polyoxyalkylenes, in the manner set forth in U.S. Pat. Nos. 4,640,835; 4,496,689; 4,301,144; 4,670,417; 4,791,192 or 4,179,337.
  • the PTP ⁇ polypeptides may be entrapped in microcapsules prepared, for example, by coacervation techniques or by interfacial polymerization, in colloidal drug delivery systems (e.g. liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules), or in macroemulsions.
  • colloidal drug delivery systems e.g. liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules
  • macroemulsions e.g. liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules
  • Polyclonal antibodies to a PTP ⁇ molecule generally are raised in animals by multiple subcutaneous (sc) or intraperitoneal (ip) injections of the PTP ⁇ and an adjuvant. It may be useful to conjugate the PTP ⁇ or a fragment containing the target amino acid sequence to a protein that is immunogenic in the species to be immunized, e.g.
  • Animals are immunized against the immunogenic conjugates or derivatives by combining 1 mg or 1 ⁇ g of conjugate (for rabbits or mice, respectively) with 3 volumes of Freud's complete adjuvant and injecting the solution intradermally at multiple sites.
  • the animals are boosted with 1/5 to 1/10 the original amount of conjugate in Freud's complete adjuvant by subcutaneous injection at multiple sites.
  • 7 to 14 days later the animals are bled and the serum is assayed for anti-PTP ⁇ antibody titer. Animals are boosted until the titer plateaus.
  • the animal boosted with the conjugate of the same PTP ⁇ , but conjugated to a different protein and/or through a different cross-linking reagent.
  • Conjugates also can be made in recombinant cell culture as protein fusions. Also, aggregating agents such as alum are used to enhance the immune response.
  • Monoclonal antibodies are obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical except for possible naturally-occurring mutations that may be present in minor amounts.
  • the modifier "monoclonal" indicates the character of the antibody as not being a mixture of discrete antibodies.
  • the anti-PTP ⁇ monoclonal antibodies of the present invention may be made using the hybridoma method first described by Kohler & Milstein, Nature 256:495 (1975), or may be made by recombinant DNA methods Cabilly, et al., U.S. Pat. No. 4,816,567!.
  • DNA encoding the monoclonal antibodies of the invention is readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of murine antibodies).
  • the hybridoma cells of the invention serve as a preferred source of such DNA.
  • the DNA may be placed into expression vectors, which are then transfected into host cells such as simian COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells that do not otherwise produce immunoglobulin protein, to obtain the synthesis of monoclonal antibodies in the recombinant host cells.
  • the DNA also may be modified, for example, by substituting the coding sequence for human heavy and light chain constant domains in place of the homologous murine sequences, Morrison, et al., Proc. Nat. Acad. Sci. 81, 6851 (1984), or by covalently joining to the immunoglobulin coding sequence all or part of the coding sequence for a non-immunoglobulin polypeptide.
  • “chimeric” or “hybrid” antibodies are prepared that have the binding specificity of an anti-PTP ⁇ monoclonal antibody herein.
  • non-immunoglobulin polypeptides are substituted for the constant domains of an antibody of the invention, or they are substituted for the variable domains of one antigen-combining site of an antibody of the invention to create a chimeric bivalent antibody comprising one antigen-combining site having specificity for a PTP ⁇ polypeptide and another antigen-combining site having specificity for a different antigen.
  • Chimeric or hybrid antibodies also may be prepared in vitro using known methods in synthetic protein chemistry, including those involving crosslinking agents.
  • immunotoxins may be constructed using a disulfide exchange reaction or by forming a thioether bond.
  • suitable reagents for this purpose include iminothiolate and methyl-4-mercaptobutyrimidate.
  • the antibodies of the invention typically will be labeled with a detectable moiety.
  • the detectable moiety can be any one which is capable of producing, either directly or indirectly, a detectable signal.
  • the detectable moiety may be a radioisotope, such as 3 H, 14 C, 32 P, 35 S, or 125 I, a fluorescent or chemiluminescent compound, such as fluorescein isothiocyanate, rhodamine, or luciferin; biotin; radioactive isotopic labels, such as, e.g., 125 I, 32 P, 14 C, or 3 H, or an enzyme, such as alkaline phosphatase, beta-galactosidase or horseradish peroxidase.
  • any method known in the art for separately conjugating the antibody to the detectable moiety may be employed, including those methods described by Hunter, et al., Nature 144:945 (1962); David, et al., Biochemistry 13:1014(1974); Pain, et al., J. Immunol. Meth. 40:219 (1981); and Nygren, J. Histochem. and Cytochem. 30:407 (1982).
  • the antibodies of the present invention may be employed in any known assay method, such as competitive binding assays, direct and indirect sandwich assays, and immunoprecipitation assays. Zola, Monoclonal Antibodies: A Manual of Techniques, pp.147-158 (CRC Press, Inc., 1987).
  • a humanized antibody has one or more amino acid residues introduced into it from a source which is non-human. These non-human amino acid residues are often referred to as "import" residues, which are typically taken from an "import” variable domain. Humanization can be essentially performed following the method of Winter and co-workers Jones et al., Nature 321, 522-525 (1986); Riechmann et al., Nature 332, 323-327 (1988); Verhoeyen et al., Science 239, 1534-1536 (1988)!, by substituting rodent CDRs or CDR sequence for the corresponding sequences of a human antibody.
  • humanized antibodies are chimeric antibodies (Cabilly, supra), wherein substantially less than an intact human variable domain has been substituted by the corresponding sequence from a non-human species.
  • humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies.
  • humanized antibodies are prepared by a process of analysis of the parental sequences and various conceptual humanized products using three dimensional models of the parental and humanized sequences.
  • Three dimensional immunoglobulin models are commonly available and are familiar to those skilled in the art.
  • Computer programs are available which illustrate and display probable three-dimensional conformational structures of selected candidate immunoglobulin sequences. Inspection of these displays permits analysis of the likely role of the residues in the functioning of the candidate immunoglobulin sequence, i.e. the analysis of residues that influence the ability of the candidate immunoglobulin to bind its antigen.
  • FR residues can be selected and combined from the consensus and import sequence so that the desired antibody characteristic, such as increased affinity for the target antigen(s), is achieved.
  • the CDR residues are directly and most substantially involved in influencing antigen binding.
  • transgenic animals e.g. mice
  • transgenic animals e.g. mice
  • J H antibody heavy chain joining region
  • transfer of the human germ-line immunoglobulin gene array in such germ-line mutant mice will result in the production of human antibodies upon antigen challenge.
  • Jakobovits et al. Proc. Natl. Acad. Sci. USA 90, 2551-255 (1993); Jakobovits et al., Nature 362, 255-258 (1993).
  • Bispecific antibodies are monoclonal, preferably human or humanized, antibodies that have binding specificities for at least two different antigens. In the present case, one of the binding specificities is for a PTP ⁇ polypeptide, the other one is for any other antigen. Methods for making bispecific antibodies are known in the art.
  • bispecific antibodies are based on the coexpression of two immunoglobulin heavy chain-light chain pairs, where the two heavy chains have different specificities (Millstein and Cuello, Nature 305, 537-539 (1983)). Because of the random assortment of immunoglobulin heavy and light chains, these hybridomas (quadromas) produce a potential mixture of 10 different antibody molecules, of which only one has the correct bispecific structure. The purification of the correct molecule, which is usually done by affinity chromatography steps, is rather cumbersome, and the product yields are low. Similar procedures are disclosed in PCT application publication No. WO 93/08829 (published 13 May 1993), and in Traunecker et al., EMBO 10, 3655-3659 (1991).
  • antibody variable domains with the desired binding specificities are fused to immunoglobulin constant domain sequences.
  • the fusion preferably is with an immunoglobulin heavy chain constant domain, comprising at least part of the hinge, and second and third constant regions of an immunoglobulin heavy chain (CH2 and CH3). It is preferred to have the first heavy chain constant region (CH1) containing the site necessary for light chain binding, present in at least one of the fusions.
  • DNAs encoding the immunoglobulin heavy chain fusions and, if desired, the immunoglobulin light chain are inserted into separate expression vectors, and are cotransfected into a suitable host organism.
  • the bispecific antibodies are composed of a hybrid immunoglobulin heavy chain with a first binding specificity in one arm, and a hybrid immunoglobulin heavy chain-light chain pair (providing a second binding specificity) in the other arm.
  • Heteroconjugate antibodies are also within the scope of the present invention.
  • Heteroconjugate antibodies are composed of two covalently joined antibodies. Such antibodies have, for example, been proposed to target immune system cells to unwanted cells (U.S. Pat. No. 4,676,980), and for treatment of HIV infection (PCT application publication Nos. WO 91/00360 and WO 92/200373; EP 03089).
  • Heteroconjugate antibodies may be made using any convenient cross-linking methods. Suitable cross-linking agents are well known in the art, and are disclosed in U.S. Pat. No. 4,676,980, along with a number of cross-linking techniques.
  • Peptide analogs of the PTP ⁇ polypeptides of the present invention are modeled based upon the three-dimensional structure of the native polypeptides.
  • Peptides may be synthesized by well known techniques such as the solid-phase synthetic techniques initially described in Merrifield, J. Am. Chem. Soc. 15, 2149-2154 (1963). Other peptide synthesis techniques are, for examples, described in Bodanszky et al., Peptide Synthesis, John Wiley & Sons, 2nd Ed., 1976, as well as in other reference books readily available for those skilled in the art. A summary of peptide synthesis techniques may be found in Stuart and Young, Solid Phase Peptide Synthelia, Pierce Chemical Company, Rockford, Ill. (1984). Peptides may also be prepared by recombinant DNA technology, using a DNA sequence encoding the desired peptide.
  • the present invention also contemplates non-peptide (e.g. organic) compounds which display substantially the same surface as the peptide analogs of the present invention, and therefore interact with other molecules in a similar fashion.
  • non-peptide e.g. organic
  • the PTP ⁇ polypeptides of the present invention are useful for a variety of purposes.
  • the PTP ⁇ polypeptides of the present invention are useful in the identification and purification of the PTP ⁇ ligand, for which a possible location is the brain.
  • the purification may be performed by using the native receptor(s) or immunoadhesins, comprising a fusion of the extracellular domain of the receptor(s) to an immunoglobulin heavy chain constant region.
  • the ligands are expected to be useful in the treatment of paralytic-type diseases.
  • An increased level of expression of the PTP ⁇ receptors of the present invention may be useful in reducing metastasis of various tumors of the lung and other organs.
  • the expression of the receptor may be upregulated by anti-PTP ⁇ antibodies, which are capable of cross-linking and thereby activating the receptors.
  • Non-antibody cross-liking agents may also be employed for this purpose.
  • the PTP ⁇ polypeptides of the present invention are also useful as molecular markers of the tissues in which they are specifically expressed. As such, the PTP ⁇ polypeptide is useful for tissue typing of specific mammalian tissues.
  • Native PTP ⁇ polypeptides and their functional equivalents are also useful in screening assays designed to identify agonists or antagonists of native PTP ⁇ polypeptides.
  • Such assays may take the form of any conventional cell-type or biochemical binding assay, and can be performed in a variety of assay formats well known to those skilled in the art.
  • An example is the so called “two-hybrid” assay format using the Matchmaker Two-Hybrid System (Clontech) according to the manufacturers instructions.
  • the native PTP ⁇ polypeptides of the present invention are also useful as protein molecular weight markers for protein gels.
  • Nucleic acids encoding the PTP ⁇ polypeptides of the present invention are also useful in providing hybridization probes for searching cDNA and genomic libraries for the coding sequence of other PTP ⁇ polypeptides analogs in other species.
  • Antagonists of the PTP ⁇ polypeptide of the present invention are useful for inhibiting the biological activity of the enzyme, thereby inhibiting the biological effects of tyrosine dephosphorylation.
  • Agonists of the PTP ⁇ polypeptide are useful for increasing or simulating the biological effects of the native PTP ⁇ polypeptide.
  • Sense and anti-sense primers corresponding to the amino acid sequences (H/D)FWRM(I/V)W (SEQ ID NO:5) (5'-A(C/T)TT(C/T)TGG(A/C)GIATG(A/G)TITGG-3') (SEQ ID NO:6) and WPD(F/H)GVP (SEQ ID NO:7) (5'-GGIAC(G/A)(T/A)(G/A)(G/A)TCIG GCCA-3') (SEQ ID NO:8) respectively were used.
  • PCR was carried out in 1 ⁇ Taq DNA polymerase buffer (GIBCO BRL) plus 0.2 mM of each dNTP, 10% DMSO and 5 units Taq polymerase (GIBCO BRL) for 25 cycles of 94° C. for 1 minute, 55° C. for 1 minute and 72° C. for 1 minute.
  • the PCR products were treated with Klenow enzyme (New England Biolabs) at 30° C. for 30 minutes, cloned into the Smal site of the pRK-5 plasmid (Genentech, Inc.) and subsequently sequenced (Sequenase, USB).
  • Adapter-linked double stranded cDNA was prepared from A+RNA of day-10 mice embryos (Marathon-ready cDNA synthesize kit, Clontech) using either random hexamer or oligo dT primers. Full-length cDNA was isolated by 5' or 3' rapid amplification of cDNA ends (RACE) of the marathon-ready cDNAs. A lambda cDNA library of adult mouse lung was screened following the standard protocol using cDNA fragments isolated by RACE as probes.
  • cDNA sequences encoding amino acids 791 to 1436 or amino acids 43 to 741 containing either the cytoplasmic region or the extracellular region of PTP ⁇ was obtained by PCR. PCR fragments were then treated with Sall and Notl restriction enzymes and cloned into the pGEX-4T-1 plasmid (Pharmacia). Fusion proteins were affinity purified using Glutathione sepharose columns (Pharmacia). Polyclonal anti-serum against either the cytoplasmic (Cy) or extracellular (Ex) region was generated by immunizing rabbits with each purified GST-fusion protein.
  • NGF-treated or untreated PC-12 cells grown on cover slips were fixed with 4% formaldehyde and 0.1% Triton X-100 in phosphate-buffered saline (PBS) and permeabilized with 0.05% saponin. Fixed cells were then blocked with 10% normal goat serum plus 0.05% NP40 in PBS, incubated with polyclonal rabbit anti-Cy primary antiserum (1:3000 dilution), washed, and incubated with phycoerytherin (PE)-tagged goat antibody to rabbit immunoglobulin G. Cells were viewed and digital images were taken by fluorescence confocal microscopy.
  • PBS phosphate-buffered saline
  • PC-12 cells expressing endogenous PTP ⁇ were washed in cold PBS, then lysed in buffer containing 50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, 1 mM benzamidine, 1 mg/ml leupeptin, 1 mg/ml aprotinin, 10 mM NaF, 0.5 mM okadaic acid, 10% (v/v) glycerol, 1% (v/v) Triton X-100, 0.5% (w/v) sodium deoxycholate and 0.01% (w/v) SDS (EMBO J., 13(16):3763-3771 (1994)).
  • Cell lysates were precleared by incubating with 50 ml of washed protein A-Sepharose beads (Pharmacia). Precleared lysate was then incubated with protein A-Sepharose beads pre-coupled with rabbit polyclonal antiserum (20 ml serum/50 ml beads) at 40° C. for 1 5 hours. The protein A-Sepharose/PTP ⁇ immunoprecipitate complex was then processed as described (Jiang et al., Mol. Cell Biol. 13(5):2942-2951 (1993)).
  • HNTG buffer (20 mM HEPES, pH 7.5, 150 mM NaCl, 10% glycerol, 0.1% Triton X-100) and once with M7.6 buffer (60 mM Tris-HCl, pH 7.6, 5 mM EDTA, 10 mM DTT, 50 mM NaCl, 50 mg/ml bovine serum albumin).
  • Washed immunoprecipitate complex was resuspended in M7.6 buffer and subject to non-radioactive protein tyrosine phosphatase assay with synthetic oligopeptide substrates (PPS1 corresponds to the hirudin 53-63 C-terminal fragment: Biotin-DGDFEEIPEEY-PO 4 (SEQ ID NO:9), PPS2 corresponds to amino acids 1-17 of human gastrin: Biotin-EGPWLEEEEEAY-PO 4 (SEQ ID NO:10)).
  • PTPase assay was carried out following the manufacturer's procedures (Tyrosine Phosphatase Assay Kit, Boehringer Mannheim).
  • a 2.5 kb cDNA fragment encoding the cytoplasmic region of PTP ⁇ was used to probe the murine multi-tissue northern blots (Clontech) or the A+RNA of PC-12 cells.
  • Rat E15.5 embryos and P1 brains were immersion fixed overnight at 4° C. in 4% paraformaldehyde, then cryoprotected overnight in 15% sucrose.
  • Adult rat brains were fresh frozen with powdered dry ice. All tissues were sectioned at 16 ⁇ m, and processed for in-situ hybridization for PTP ⁇ using 33 P-UTP labeled RNA probes.
  • Sense and antisense probes were synthesized from a 2.5 kb DNA fragment of PTP ⁇ using SP6 or T7 polymerase, respectively.
  • PTPs receptor protein tyrosine phosphatases
  • the second novel PCR fragment was homologous to PTPs ⁇ and ⁇ , both related receptor-type PTPs that mediate homophilic adhesion (Brady-Kalnay et al., Curr. Opin. Cell. Biol. 7(5):650-657 (1995)).
  • FIGS. 1A-1D The composite cDNA (SEQ ID NO:1) and derived protein (SEQ ID NO:2) sequences determined from these various clones is shown in FIGS. 1A-1D.
  • the ATG start codon utilized for translation of this large open reading frame was embedded within a consensus Kozak sequence, and there are several translational stop codons upstream of this initiator codon.
  • the protein (SEQ ID NO:2) derived from this cDNA (SEQ ID NO:1) is a large receptor-like molecule of 1,436 amino acids and a molecular weight of approximately 161,176 daltons.
  • FIGS. 2A-2B illustrate that the novel, hematopoietically-derived PTP-related protein reported here shows a high degree of homology to both PTP ⁇ ( ⁇ 60%) and PTP ⁇ ( ⁇ 53%) throughout their entire lengths (Jiang et al., (1993) supra and Gebbink et al., (1991) supra). Because this novel PTP is homologous throughout its entire length to PTPs ⁇ and ⁇ , it appears that the new PTP polypeptide contains MAM, IgG, 4 fibronectin type III, and two cytoplasmically localized phosphatase domains (see FIGS. 2A-2B) (Brady-Kalnay et al., Curr. Opin. Cell.
  • the overall sequence homologies between the three proteins is also relatively high in the FnIII domains, although the homology in the first of these domains is significantly higher than in the others.
  • Previous work has also demonstrated that a juxtamembrane site between the transmembrane domain and the first phosphatase domain is distantly homologous to a similar region in the cadherins (Brady-Kalnay et al., J. Cell. Biol. 130(4):977-986 (1995)), and this site shows a high degree of homology between these three receptors.
  • FIG. 4 demonstrates that this enzymatic activity was completely inhibited by the inclusion of vanadate, a potent tyrosine phosphatase inhibitor.
  • the PTP ⁇ polypeptide encoded by the cDNA (SEQ ID NO:1) described herein and shown in FIGS. 1A-1D is clearly a receptor tyrosine phosphatase protein.
  • PTP ⁇ expression included the anal canal (not shown), skin, olfactory and oral epithelium, esophagus (FIG. 6, Panels A and B), pituitary (FIG. 6, Panels A, B and C), aura mater (FIG. 6, Panels A, B and D), kidney (FIG. 6, Panels A and B), and lung (FIG. 6, Panels A and B). Higher magnification reveals expression restricted to developing glomeruli in the cortical region of the kidney (FIG. 6, Panels F and G), and bronchiolar epithelium of the lung (FIG. 6, Panels H and I). Within the E15.5 embryonic nervous system, high levels of expression were observed in the developing cerebral cortex (FIG.
  • FIG. 6, Panels A and B floor of the midbrain, choroid plexus primordium, gigantocellular reticular nucleus of the brain stem (FIG. 6, Panels A, B and C), aura mater and spinal cord (FIG. 6, Panels A, B and D). High magnification of the spinal cord reveals highest expression of PTP ⁇ in the ventrolateral motor column (FIG. 6, Panel D).
  • PTP ⁇ expression in the adult brain appears to be downregulated relative to the P1 brain (FIG. 7).
  • other areas of prominent expression in both P1 and adult brain include piriform cortex and endopiriform nucleus (FIG. 7, Panels A and D, respectively), amygdaloid nuclei, subiculum, and CAT, CA2 and, to a lesser extent, CA3 of the hippocampal formation (FIG. 7, Panels B and E, respectively).
  • the P1 brain also exhibits strong expression throughout the septal area, basal ganglia, thalamus, and midbrain (FIG. 7, Panels A, B and C). Weak expression is observed in the adult superior colliculus as well as scattered expression throughout the thalamus (FIG. 7, Panel E).
  • the relative levels of tyrosine phosphorylation of a diversity of proteins is critical for the regulation of a number of activities during embryonic differentiation and throughout the life of the mammalian organism.
  • the absolute levels of this modification are mediated through the balance of the enzymatic activities of tyrosine kinases with those of the tyrosine phosphatases.
  • these large families of proteins perform their roles through conserved enzymatic domains that are coupled to a plethora of specificity-determining motifs. These various motifs are found in the context of both membrane traversing, receptor-like molecules as well as intracellular forms of the enzymes.
  • tyrosine kinases and tyrosine phosphatases suggest that they mediate their relative specific activities through the use of these various domains.
  • the extracellular motifs are somewhat unusual in that they contain highly glycosylated regions with currently unknown ligand specificity.
  • a subset of these receptor-phosphatases also contain a diversity of domains, including immunoglobulin-like and fibronectin-like, which are associated with cell adhesion and ligand binding activities in other protein families.
  • adhesion-associated PTPs are the ⁇ and ⁇ receptors which are involved with homotypic types of interactions.
  • novel PTP ⁇ polypeptide described herein is homologous to the ⁇ and ⁇ receptors lies in the high degree of sequence conservation between these three proteins.
  • Analysis of these three receptors clearly revealed that the novel PTP ⁇ polypeptide of the present invention had a high degree of sequence homology with PTP ⁇ and PTP ⁇ throughout the entire length of the proteins.
  • This homology included the four major types of domains contained in this family including the MAM, the immunoglobulin (IgG), the fibronectin type III (FN III) and the dual phosphatase (PTPase) domains (Jiang et al., (1993) supra and Gebbink et al., (1991) supra).
  • epithelial layers in the lung bronchioles and kidney glomeruli requires that a sheet of epithelial cells that is one cell thick be constructed.
  • the cells grow and migrate during embryogenesis, they would require a mechanism where they sensed the location of other epithelial cells that were in contact with them, so that this cellular contiguity initiated an adhesive response that inhibited further epithelial movement via the enhancement of cell adhesion.
  • Tonks and colleagues Brady-Kalnay et al., Curr. Opin. Cell. Biol. 7(5):650-657 (1995) and Brady-Kalnay et al., J. Cell.
  • this receptor PTP in bone forming chondrocytes would also be expected to perform a similar type of sensing and adhesion function to assemble these structures, although this type of anatomy, which is more complex than the thin-walled epithelial-like morphology described above, would be expected to involve more elaborate types of sensing and adhesive mechanisms.
  • this type of anatomy which is more complex than the thin-walled epithelial-like morphology described above, would be expected to involve more elaborate types of sensing and adhesive mechanisms.
  • disruptions in the proposed function of this type of adhesion sensing mechanism might be involved with the disorganized morphology and high rate of metastasis of these tumors (Kemler, supra and Beherens et al., supra). Together, these hypotheses suggest a critical role for PTP ⁇ in the formation of various epithelial-like structures in the embryo.
  • PTP ⁇ is expressed in a number of developing neural sites, it is possible that it plays a similar role in the pathfinding of nerves in mammals.
  • the expression of this PTP in the developing midbrain, forebrain, and other neural sites would dispose it to function as a mediator of pathfinding in these maturing systems.
  • the expression of this receptor in these embryonic strom was confirmed by expression in the adult sites which arise from these embryonic structures.
  • the expression in the adult appeared to be somewhat reduced as compared to that observed in the embryo, and it was far more organized.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Wood Science & Technology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Cell Biology (AREA)
  • Immunology (AREA)
  • Toxicology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Peptides Or Proteins (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

This invention concerns novel receptor protein tyrosine phosphatase polypeptides. Specifically, this invention concerns the novel receptor protein tyrosine phosphatase lambda which is related to the homotypically adhering receptor protein tyrosine phosphatases kappa and mu . The invention further relates to analogs of these polypeptides in other mammals, functional derivatives thereof, antibodies which are capable of specifically binding to these polypeptides, nucleic acids encoding these polypeptides, vectors containing and capable of expressing such nucleic acid and recombinant host cells transformed with such nucleic acid. Methods for the recombinant production of these receptor protein tyrosine phosphatase polypeptides and assays for identifying agonists and antagonists of these polypeptides are also within the scope of the invention.

Description

FIELD OF THE INVENTION
This present invention concerns novel receptor protein tyrosine phosphatase polypeptides. More particularly, the present invention concerns a novel receptor protein tyrosine phosphatase designated herein as PTP λ.
BACKGROUND OF THE INVENTION
An extraordinary number of cellular processes are regulated by the tyrosine phosphorylation of a diversity of proteins. Tyrosine phosphorylation is induced by a plethora of receptor-like molecules as well as by a wide range of intracellular enzymes. The effects of tyrosine phosphorylation are numerous, and they modulate a range of developmental as well as other cellular operations. Of course, the importance of tyrosine phosphorylation is underlined by the need for mechanisms which carefully regulate the levels of these events. Thus, protein tyrosine kinases represent positive mediators of tyrosine phosphorylation, while protein tyrosine phosphatases (PTPs) induce the removal of phosphate from tyrosine. The balance of the levels of tyrosine phosphate is thus mediated by the relative activities of these two types of enzymes. It is therefore clear that the mechanisms which regulate cellular function via tyrosine phosphorylation require specific proteins which mediate both the upregulation as well as the downregulation of the levels of this modified amino acid.
PTPs represent a growing family of enzymes that are found in both receptor as well as non-receptor forms (Tonks, Semin. Cell. Biol. 4:373-453 (1993), Walton et al., Ann. Rev. Biochem. 62:101-120 (1993) and Sun et al., Trends Biochem. Sci. 19(11):480-485 (1994)). Non-receptor PTPs are a highly diverse kindred, and they contain a number of motifs, in addition to the enzymatically active PTP domain, that serve to regulate the region of the cell occupied by these proteins as well as the substrate specificity of these enzymes. The receptor PTPs are also a highly diverse group that are unified by the inclusion of a transmembrane domain which disposes them to the plasma membrane of the cell. Recently, the receptor PTPs have been subdivided into 8 types based upon their domain content (Brady-Kalnay et al., Curr. Opin. Cell. Biol. 7(5):650-657 (1995)). These subtypes all contain one or two PTPase domains on their cytoplasmic sides, with a variety of extracellular motifs including heavily O-glycosylated mucin-like domains (for example, CD45), chondroitin sulfate domains (for example, PTP γ) and short, highly glycosylated segments (for example, PTP α). The largest family of PTPs is the family which contains various motifs related to those found in adhesion molecules. These motifs include immunoglobulin-like (IgG) domains and fibronectin type III (FnIII) regions similar to those found in cell adhesion molecules such as ICAM, N-CAM and Ng-CAM (Rao et al., J. Cell. Biol. 118:937-949 (1992)). In addition, a subset of these adhesion-like PTPs, including the PTPs κand μ, contain a third domain termed the MAM, for meprin/A5/PTP μ, motif (Beckman et al., Trends Biochem. Sci. 18:40-41 (1993)). The MAM motif has been previously shown to be involved with cell-cell recognition in neurons (Jiang et al., J. Biol. Chem. 267:9185-9193 (1992), Takagi et al., Neuron 7:295-307 (1991) and Hirata et al., Neurosci. Res. 17:159-169 (1993)). Interestingly, recent data suggest that three of these adhesion-like PTPs appear to be involved with neuronal pathfinding during Drosophila development (Desai et al., Cell 84:599-609 (1996) and Kreuger et al., Cell 84:611-622 (1996)). Together, these structural data are consistent with the conjecture that receptor PTPs encompass a diverse family of enzymatically active proteins which contain a number of interesting cell surface motifs potentially involved with the sensing of the extracellular environment.
PTPs κ and μ are the receptors that are most well characterized as adhesion molecules (Brady-Kalnay et al., supra, Jiang et al., Mol. Cell. Biol., 13:2942-2951 (1993) and Gebbink et al., Febs. Lett. 290(1-2):123-130 (1991)). Both of these PTPs have been demonstrated to mediate homotypic adhesion. Thus, a diversity of assays, including cell- as well as molecule-based, have demonstrated that the extracellular domain of these enzymes can bind with high specificity in a homophilic manner (Brady-Kalnay et al., J. Cell. Biol. 268:961-972 (1993), Gebbink et al., J. Biol. Chem. 268:16101-16104 (1993) and Sap et al., Mol. Cell. Biol. 14:1-9 (1994)). Interestingly, mixing experiments have revealed that these closely related PTPs will not bind to each other in a heterophilic mode, suggesting that the extracellular domain is meant to recognize other cells specifically expressing identical receptors, a situation highly reminiscent of the cadherin homotypic adhesion system (Kemler et al., Trends Genet. 9:317-321 (1993)). While the extracellular domains required for this homotypic binding remain controversial, it appears likely that both the MAM motif as well as the IgG region are involved with homophilic interactions (Brady-Kalnay et al., J. Biol. Chem. 269:28472-28477 (1994) and Zondag et al., J. Biol. Chem. 270(24):14247-14250 (1995)). While these data suggest that these homophilic adhesion enzymes are involved with the recognition of other cells expressing similar types of receptors, other data have suggested that this recognition event may play a role in the attachment of such cells to each other. Thus, Tonks and colleagues have recently demonstrated that the receptor PTP μ specifically associates with the catenin/cadherin complex of homotypic cell adhesion molecules (Brady-Kalnay et al., J. Cell. Biol. 130(4):977-986 (1995)). They also demonstrated that treatment of cells with the PTP inhibitor pervanadate resulted in the upregulation of tyrosine phosphorylation of cadherins and catenins, a result which suggested a role for a PTP, potentially PTP μ, in the maintenance of the cadherin/catenin complex in an underphosphorylated state. Interestingly, previous work suggested that the level of tyrosine phosphorylation of this complex was correlated with the adhesive capacity of the cadherins (Beherns et al., J. Cell. Biol. 120:757-766 (1993)), a result which is consistent with the hypothesis that the adhesion between cells mediated by the cadherins might be regulated by their tyrosine phosphorylation levels as determined by homotypic interactions between receptor PTPs such as κ and μ.
The finding that PTPs κ and μ mediated homotypic adhesion, together with the somewhat restricted tissue distribution of these PTPs (Jiang et al., (1993) supra and Gebbink et al., (1991) supra), has suggested that additional members of this family of adhesive enzymes might exist. Here we report the cloning and characterization of the third member of this receptor PTP family, termed PTP λ. The PTP λ polypeptide reported here contains structural motifs that are very similar to those found in PTP κ and μ. In addition, this novel PTP λ receptor reveals a tissue distribution that is divergent from that previously described for the other members of this family.
SUMMARY OF THE INVENTION
We have analyzed a large number of PTPs from a primitive murine hematopoietic cell population using consensus PCR. From this population we have cloned a novel receptor protein tyrosine phosphorylase polypeptide which is related to the receptor PTPs κ and μ. We have designated this novel protein tyrosine phosphorylase as the "PTP λ". Unlike other known receptor PTP polypeptides, PTP λ is predominantly expressed in mammalian adult brain, lung and kidney tissues but predominantly lacks expression in mammalian adult liver tissue.
Accordingly, the present invention concerns an isolated receptor protein tyrosine phosphatase polypeptide (PTP) λ, which
(1) is predominantly expressed in adult mammalian brain, lung and kidney tissue; and
(2) predominantly lacks expression in adult mammalian liver tissue,
wherein said polypeptide is capable of dephosphorylating phosphorylated tyrosine residues.
The present invention also concerns derivatives of these novel PTP polypeptides which substantially retain the ability to dephosphorylate phosphorylated tyrosine residues.
A preferred group of the PTP polypeptides of the present invention includes a polypeptide comprising the amino acid sequence shown in FIG. 1 (SEQ ID NO:2); a further mammalian homologue of amino acid sequence shown in FIG. 1 and a derivative of any of the above polypeptides which substantially retain the ability to dephosphorylate tyrosine residues.
In another aspect, the present invention is directed to agonists and antagonists of the above novel PTP polypeptides.
In yet another aspect, the present invention concerns isolated nucleic acid molecules encoding the novel PTP polypeptides disclosed herein.
In a further aspect, the invention concerns vectors comprising nucleic acid encoding the novel PTP polypeptides herein, operably linked to control sequences recognized by a host cell transformed with the vector, and to cells transformed with such vectors.
In a still further aspect of the present invention, there are provided antibodies capable of specific binding to the novel PTP polypeptides of this invention, and hybridoma cell lines producing such antibodies. The antibodies may be agonist antibodies, which stimulate the ability of the novel PTP polypeptides of the present invention to dephosphorylate tyrosines, or antagonist antibodies, which block this activity.
In yet a further aspect of the present invention, there is provided methods for producing the PTP polypeptides of the present invention comprising transforming a host cell with nucleic acid encoding said polypeptide, culturing the transformed cell and recovering said polypeptide from the cell culture.
The present invention further concerns an assay for identifying an antagonist or an agonist of a novel PTP polypeptide of the present invention, which comprises contacting a phosphatase domain of the PTP polypeptide with a candidate antagonist or agonist, and monitoring the ability of the phosphatase domain to dephosphorylate tyrosine residues.
BRIEF DESCRIPTION OF THE DRAWINGS
FIGS. 1A-1I. The file of this patent contains at least one drawing executed in color. Copies of this patent with color drawings will be provided by the Patent and Trademark Office upon request and payment of the necessary fee. The cDNA and derived protein sequence of PTP λ. Illustrated is the cDNA (SEQ ID NO:1) and derived protein sequence (SEQ ID NO:2) of the full length PTP λ clone homologous to a small PCR fragment derived from hematopoietic progenitor cells using consensus PTP primers. Amino acids are presented by their standard one-letter designations.
FIGS. 2A-2E. Homology between PTP λ, PTP κ and PTP μ. Illustrated as boxed residues are the amino acid homologies between the PTP λ (ptplambda) (SEQ ID NO:2), PTP κ (ptpkappa) (SEQ ID NO:3) and PTP μ (ptpmu) (SEQ ID NO:4) polypeptides. Amino acids are presented by their standard one-letter designations. Also shown above the amino acid sequences are the domains predicted previously from PTP κ and PTP μ. These domains include the signal sequence (SS), the MAM (mePrin, A5, PTP μ), immunoglobulin-like (IgG), fibronectin type III-like (FnIII), transmembrane domain (TMD), cadherin-like (Cadherin) and dual phosphatase domains (PTPase I and PTPase II).
FIG. 3. Comparative domain structures of PTP λ, PTP κ and PTP μ. Illustrated are the percent amino acid homologies between the various domains of the PTP λ, PTP κ and PTP μ polypeptides. These domains include the signal sequence (SS), the MAM (meprin, A5, PTP μ), immunoglobulin-like (IgG), fibronectin type III-like (FnIII), transmembrane domain (TMD), cadherin-like (Cadherin) and dual phosphatase domains (PTPase I and PTPase II).
FIG. 4. Tyrosine phosphatase activity of PTP λ immunoprecipitates from PC 12 cells. Lysates of PC 12 cells were immunoprecipitated with either preimmune antibody (Pre-immune) or antibody directed against the cytoplasmic domain of the PTP λ polypeptide (AntiPTP λ). The immunoprecipitates were incubated with two different immobilized tyrosine phosphorylated peptides (PPS1 and PPS2) using a commercially available tyrosine phosphatase assay kit. Immunoprecipitates were done either in the absence or presence of the tyrosine phosphatase inhibitor vanadate. Tyrosine phosphatase activity was determined by examining the residual binding of an anti-phosphotyrosine antibody to the immobilized peptide, so that a decreased OD405 correlates with tyrosine phosphatase activity.
FIG. 5. Northern blot analysis of PTP λ expression. Commercially available northern blots were probed with a 32 P-labeled fragment of PTP λ using standard hybridization conditions. The blot on the left illustrates the PTP λ transcript in RNA obtained from murine embryos at the developmental day shown in the figure. The blot on the right illustrates an analysis of the PTP λ transcript in RNA from a. heart, b. brain, c. spleen, d. lung, e. liver, f. skeletal muscle, g. kidney and h. testis.
FIGS. 6A-6I. PTP λ mRNA Expression In the E15.5 Rat Embryo. Emulsion autoradiographs of a sagittal embryo section (A), and higher magnifications of embryonic midbrain (C), spinal cord (D), kidney (F), and lung hybridized with a 33 P-UTP labeled PTP λ antisense probe are shown. Opposed to the darkfield autoradiographs are the corresponding lightfield images of the sagittal embryo section (B), kidney (G), and lung (I). Hybridization using a PTP λ sense strand control probe is shown in an E15.5 embryonic spinal cord section (E). (A,B,C,D,E) Bar, 1.0 mm; (F,G,H,I) Bar, 0.2 mm.
FIG. 7A-7F. PTP λ mRNA Expression in P1 and Adult Rat Brain. Emulsion autoradiographs of coronal sections of P1 rat brain (A,B,C) and adult rat brain (D,E) hybridized with a 33 P-UTP labeled PTP λ antisense probe are shown. Coronal sections of the P1 brain are at the level of the septum (A), hippocampus (B), and substantia nigra (C). For the adult animal, coronal brain sections are at the level of the septum (D) and the hippocampus and substantia nigra (E). Hybridization using a PTP λ sense strand control probe is shown in an adult coronal section at the level of the substantia nigra (F). (A,B,C) Bar, 1.0 mm; (D,E,F) Bar, 1.0 mm.
FIG. 8. Expression of PTP λ in PC 12 cells. Illustrated is the PTP λ transcript observed in RNA of PC 12 cells either untreated (-) or treated (+) with 10 ng/ml of nerve growth factor (NGF) for the days shown at the top of the figure. The lower blot shows the β-actin signal obtained for each of the RNAs.
FIG. 9A-9D. Immunofluorescence analysis of PTP λ expression in PC 12 cells. PC 12 cells were either left untreated or treated with 10 ng/ml nerve growth factor (NGF) for 7 days to induce neurite formation. At the end of this time, the cells were permeabilized and stained with either pre-immune serum or antibodies directed against the intracellular domain of PTP λ. Cells were washed and observed by confocal fluorescence microscopy. Panel A shows the results without NGF and with pre-immune serum. Panel B shows the results without NGF and with anti-PTP λ serum. Panel C shows the results with NGF and anti-PTP λ serum. Panel D shows the results obtained with NGF and anti-PTP λ serum at a higher magnification than in Panel C. The arrows show positively stained extended neurites.
DETAILED DESCRIPTION OF THE INVENTION
A. Definitions
The phrases "receptor protein tyrosine phosphatase λ", "protein tyrosine phosphatase λ" and "PTP λ" are used interchangeably and refer to a native membrane-bound protein tyrosine phosphatase polypeptide which (1) is predominantly expressed in adult mammalian brain, lung and kidney tissue and (2) predominantly lacks expression in adult mammalian liver tissue, wherein the polypeptide is capable of dephosphorylating phosphorylated tyrosine residues. The above terms are also intended to encompass functional derivatives of such native tyrosine phosphatases.
The term "native tyrosine phosphatase" in this context refers to a naturally occurring tyrosine phosphatase polypeptide, having the described properties, of any human or non-human animal species, with or without the initiating methionine, whether purified from the native source, synthesized, produced by recombinant DNA technology or by any combination of these and/or other methods. Native PTP λ specifically includes the native murine PTP λ protein shown in FIG. 1 (SEQ ID NO:2).
A "functional derivative" of a polypeptide is a compound having a qualitative biological activity in common with the native polypeptide. Thus, a functional derivative of a native PTP λ polypeptide is a compound that has a qualitative biological activity in common with a native PTP λ polypeptide, for example, as being capable of dephosphorylating phosphorylated tyrosine residues. "Functional derivatives" include, but are not limited to, fragments of native polypeptides from any animal species (including humans), derivatives of native (human and non-human) polypeptides and their fragments, glycosylation variants of a native polypeptide, and peptide and non-peptide analogs of native polypeptides, provided that they have a biological activity in common with a respective native polypeptide. "Fragments" comprise regions within the sequence of a mature native polypeptide. The term "derivative" is used to define amino acid sequence variants, and covalent modifications of a native polypeptide. "Non-peptide analogs" are organic compounds which display substantially the same surface as peptide analogs of the native polypeptides. Thus, the non-peptide analogs of the native PTP λ of the present invention are organic compounds which display substantially the same surface as peptide analogs of the native PTP λ. Such compounds interact with other molecules in a similar fashion as the peptide analogs, and mimic a biological activity of a native PTP λ of the present invention. The polypeptide functional derivatives of the native PTP λ of the present invention preferably have at least about 65%, more preferably at least about 75%, even more preferably at least about 85%, most preferably at least about 95% overall sequence homology with the amino acid sequence shown in FIG. 1 (SEQ ID NO:2) and substantially retain the ability to dephosphorylate phosphorylated tyrosine residues.
The term "biological activity" in the context of the definition of functional derivatives is defined as the possession of at least one adhesive, regulatory or effector function qualitatively in common with a native polypeptide (e.g. PTP λ). The functional derivatives of the native PTP λ of the present invention are unified by their qualitative ability to dephosphorylate phosphorylated tyrosine residues. Preferably, the functional derivatives of the native PTP λ polypeptides of the present invention qualitatively retain at least one of the following biological properties of the native molecules: mediation of cell adhesion, and involvement in neural pathfinding.
The terms "covalent modification" and "covalent derivatives" are used interchangeably and include, but are not limited to, modifications of a native polypeptide or a fragment thereof with an organic proteinaceous or non-proteinaceous derivatizing agent, fusions to heterologous polypeptide sequences, and post-translational modifications. Covalent modifications are traditionally introduced by reacting targeted amino acid residues with an organic derivatizing agent that is capable of reacting with selected sides or terminal residues, or by harnessing mechanisms of post-translational modifications that function in selected recombinant host cells. Certain post-translational modifications are the result of the action of recombinant host cells on the expressed polypeptide. Glutaminyl and asparaginyl residues are frequently post-translationally deamidated to the corresponding glutamyl and aspartyl residues. Alternatively, these residues are deamidated under mildly acidic conditions. Other post-translational modifications include hydroxylation of proline and lysine, phosphorylation of hydroxyl groups of seryl, tyrosine or threonyl residues, methylation of the α-amino groups of lysine, arginine, and histidine side chains T. E. Creighton, Proteins: Structure and Molecular Properties, W. H. Freeman & Co., San Francisco, pp. 79-86 (1983)!. Covalent derivatives/modifications specifically include fusion proteins comprising native PTP λ sequences of the present invention and their amino acid sequence variants, such as immunoadhesins, and N-terminal fusions to heterologous signal sequences.
"Predominantly expressed", "predominant expression" and grammatical equivalents thereof is defined as a level of expression of a nucleic acid encoding an amino acid sequence which is easily detectable using northern blot analysis under stringent conditions.
"Identity" or "homology" with respect to a native polypeptide and its functional derivative is defined herein as the percentage of amino acid residues in the candidate sequence that are identical with the residues of a corresponding native polypeptide, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent homology, and not considering any conservative substitutions as part of the sequence identity. Neither N- or C-terminal extensions nor insertions shall be construed as reducing identity or homology. Methods and computer programs for the alignment are well known in the art.
The term "agonist" is used to refer to peptide and non-peptide analogs of the native PTP λ of the present invention and to antibodies specifically binding native PTP λ provided that they retain at least one biological activity of a native PTP λ. Preferably, the agonists of the present invention retain the qualitative ability to dephosphorylate phosphorylated tyrosine residues.
The term "antagonist" is used to refer to a molecule inhibiting a biological activity of a native PTP λ of the present invention. Preferably, the antagonists herein inhibit the ability of the PTP λ of the present invention to dephosphorylate tyrosines. Preferred antagonists essentially completely block tyrosine dephosphorylation caused by PTP λ.
Ordinarily, the terms "amino acid" and "amino acids" refer to all naturally occurring L-α-amino acids. In some embodiments, however, D-amino acids may be present in the polypeptides or peptides of the present invention in order to facilitate conformational restriction. For example, in order to facilitate disulfide bond formation and stability, a D amino acid cysteine may be provided at one or both termini of a peptide functional derivative or peptide antagonist of the native PTP λ of the present invention. The amino acids are identified by either the single-letter or three-letter designations:
______________________________________                                    
Asp   D      aspartic acid                                                
                          Ile   I    isoleucine                           
Thr   T      threonine    Leu   L    leucine                              
Ser   S      serine       Tyr   Y    tyrosine                             
Glu   E      glutamic acid                                                
                          Phe   F    phenylalanine                        
Pro   P      proline      His   H    histidine                            
Gly   G      glycine      Lys   K    lysine                               
Ala   A      alanine      Arg   R    arginine                             
Cys   C      cysteine     Trp   W    tryptophan                           
Val   V      valine       Gln   Q    glutamine                            
Met   M      methionine   Asn   N    asparagine                           
______________________________________                                    
These amino acids may be classified according to the chemical composition and properties of their side chains. They are broadly classified into two groups, charged and uncharged. Each of these groups is divided into subgroups to classify the amino acids more accurately:
I. Charged Amino Acids
Acidic Residues: aspartic acid, glutamic acid
Basic Residues: lysine, arginine, histidine
II. Uncharged Amino Acids
Hydrophilic Residues: serine, threonine, asparagine, glutamine
Aliphatic Residues: glycine, alanine, valine, leucine, isoleucine
Non-polar Residues: cysteine, methionine, proline
Aromatic Residues: phenylalanine, tyrosine, tryptophan
The term "amino acid sequence variant" refers to molecules with some differences in their amino acid sequences as compared to a native amino acid sequence.
Substitutional variants are those that have at least one amino acid residue in a native sequence removed and a different amino acid inserted in its place at the same position. The substitutions may be single, where only one amino acid in the molecule has been substituted, or they may be multiple, where two or more amino acids have been substituted in the same molecule.
Insertional variants are those with one or more amino acids inserted immediately adjacent to an amino acid at a particular position in a native sequence. Immediately adjacent to an amino acid means connected to either the α-carboxy or α-amino functional group of the amino acid.
Deletional variants are those with one or more amino acids in the native amino acid sequence removed. Ordinarily, deletional variants will have one or two amino acids deleted in a particular region of the molecule.
"Antibodies (Abs)" and "immunoglobulins (Igs)" are glycoproteins having the same structural characteristics. While antibodies exhibit binding specificity to a specific antigen, immunoglobulins include both antibodies and other antibody-like molecules which lack antigen specificity. Polypeptides of the latter kind are, for example, produced at low levels by the lymph system and at increased levels by myelomas.
Native antibodies and immunoglobulins are usually heterotetrameric glycoproteins of about 150,000 daltons, composed of two identical light (L) chains and two identical heavy (H) chains. Each light chain is linked to a heavy chain by one covalent disulfide bond, while the number of disulfide linkages varies between the heavy chains of different immunoglobulin isotypes. Each heavy and light chain also has regularly spaced intrachain disulfide bridges. Each heavy chain has at one end a variable domain (VH) followed by a number of constant domains. Each light chain has a variable domain at one and (VL) and a constant domain at its other end; the constant domain of the light chain is aligned with the first constant domain of the heavy chain, and the light chain variable domain is aligned with the variable domain of the heavy chain. Particular amino acid residues are believed to form an interface between the light and heavy chain variable domains (Clothia et al., J. Mol. Biol. 186, 651-663 1985!; Novotny and Haber, Proc. Natl. Acad. Sci. USA 82, 4592-4596 1985!).
The term "variable" refers to the fact that certain portions of the variable domains differ extensively in sequence among antibodies and are used in the binding and specificity of each particular antibody for its particular antigen. However, the variability is not evenly distributed through the variable domains of antibodies. It is concentrated in three segments called complementarity determining regions (CDRs) or hypervariable regions both in the light chain and the heavy chain variable domains. The more highly conserved portions of variable domains are called the framework (FR). The variable domains of native heavy and light chains each comprise four FR regions, largely adopting a β-sheet configuration, connected by three CDRs, which form loops connecting, and in some cases forming part of, the β-sheet structure. The CDRs in each chain are held together in close proximity by the FR regions and, with the CDRs from the other chain, contribute to the formation of the antigen binding site of antibodies (see Kabat, E. A. et al., Sequences of Proteins of Immunological Interest, National Institute of Health, Bethesda, MD 1991!). The constant domains are not involved directly in binding an antibody to an antigen, but exhibit various effector functions, such as participation of the antibody in antibody-dependent cellular toxicity.
Papain digestion of antibodies produces two identical antigen binding fragments, called Fab fragments, each with a single antigen binding site, and a residual "Fc" fragment, whose name reflects its ability to crystallize readily. Pepsin treatment yields an F(ab')2 fragment that has two antigen combining sites and is still capable of cross-linking antigen.
"Fv" is the minimum antibody fragment which contains a complete antigen recognition and binding site. This region consists of a dimer of one heavy and one light chain variable domain in tight, non-covalent association. It is in this configuration that the three CDRs of each variable domain interact to define an antigen binding site on the surface of the VH -VL dimer. Collectively, the six CDRs confer antigen binding specificity to the antibody. However, even a single variable domain (or half of an Fv comprising only three CDRs specific for an antigen) has the ability to recognize and bind antigen, although at a lower affinity than the entire binding site.
The Fab fragment also contains the constant domain of the light chain and the first constant domain (CH1) of the heavy chain. Fab' fragments differ from Fab fragments by the addition of a few residues at the carboxy terminus of the heavy chain CH1 domain including one or more cysteines from the antibody hinge region. Fab'-SH is the designation herein for Fab' in which the cysteine residue(s) of the constant domains bear a free thiol group. F(ab')2 antibody fragments originally were produced as pairs of Fab' fragments which have hinge cysteines between them. Other, chemical couplings of antibody fragments are also known.
The light chains of antibodies (immunoglobulins) from any vertebrate species can be assigned to one of two clearly distinct types, called kappa (κ) and lambda (λ), based on the amino acid sequences of their constant domains.
Depending on the amino acid sequence of the constant domain of their heavy chains, immunoglobulins can be assigned to different classes. There are five major classes of immunoglobulins: IgA, IgD, IgE, IgG and IgM, and several of these may be further divided into subclasses (isotypes), e.g. IgG-1, IgG-2, IgG-3, and IgG-4; IgA-1 and IgA-2. The heavy chain constant domains that correspond to the different classes of immunoglobulins are called α, delta, epsilon, γ, and μ, respectively. The subunit structures and three-dimensional configurations of different classes of immunoglobulins are well known.
The term "antibody" is used in the broadest sense and specifically covers single monoclonal antibodies (including agonist and antagonist antibodies), antibody compositions with polyepitopic specificity, as well as antibody fragments (e.g., Fab, F(ab')2, and Fv), so long as they exhibit the desired biological activity.
The term "monoclonal antibody" as used herein refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical except for possible naturally occurring mutations that may be present in minor amounts. Monoclonal antibodies are highly specific, being directed against a single antigenic site. Furthermore, in contrast to conventional (polyclonal) antibody preparations which typically include different antibodies directed against different determinants (epitopes), each monoclonal antibody is directed against a single determinant on the antigen. In addition to their specificity, the monoclonal antibodies are advantageous in that they are synthesized by the hybridoma culture, uncontaminated by other immunoglobulins. The modifier "monoclonal" indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to be construed as requiring production of the antibody by any particular method. For example, the monoclonal antibodies to be used in accordance with the present invention may be made by the hybridoma method first described by Kohler & Milstein, Nature 256:495 (1975), or may be made by recombinant DNA methods see, e.g. U.S. Pat. No. 4,816,567 (Cabilly et al.)!.
The monoclonal antibodies herein specifically include "chimeric" antibodies (immunoglobulins) in which a portion of the heavy and/or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain(s) is identical with or homologous to corresponding sequences in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies, so long as they exhibit the desired biological activity (U.S. Pat. No. 4,816,567 (Cabilly et al.; Morrison et al., Proc. Natl. Acad. Sci. USA 81, 6851-6855 1984!).
"Humanized" forms of non-human (e.g. murine) antibodies are chimeric immunoglobulins, immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab', F(ab')2 or other antigen-binding subsequences of antibodies) which contain minimal sequence derived from non-human immunoglobulin. For the most part, humanized antibodies are human immunoglobulins (recipient antibody) in which residues from a complementary determining region (CDR) of the recipient are replaced by residues from a CDR of a non-human species (donor antibody) such as mouse, rat or rabbit having the desired specificity, affinity and capacity. In some instances, Fv framework residues of the human immunoglobulin are replaced by corresponding non-human residues. Furthermore, humanized antibody may comprise residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences. These modifications are made to further refine and optimize antibody performance. In general, the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or substantially all of the FR regions are those of a human immunoglobulin consensus sequence. The humanized antibody optimally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin. For further details see: Jones et al., Nature 321, 522-525 1986!; Reichmann et al., Nature 332, 323-329 1988!; EP-B-239 400 published 30 Sep. 1987; Presta, Curr. Op. Struct. Biol. 2 593-596 1992!; and EP-B-451 216 published 24 Jan. 1996).
In the context of the present invention the expressions "cell", "cell line", and "cell culture" are used interchangeably, and all such designations include progeny. It is also understood that all progeny may not be precisely identical in DNA content, due to deliberate or inadvertent mutations. Mutant progeny that have the same function or biological property, as screened for in the originally transformed cell, are included.
The terms "replicable expression vector" and "expression vector" refer to a piece of DNA, usually double-stranded, which may have inserted into it a piece of foreign DNA. Foreign DNA is defined as heterologous DNA, which is DNA not naturally found in the host cell. The vector is used to transport the foreign or heterologous DNA into a suitable host cell. Once in the host cell, the vector can replicate independently of the host chromosomal DNA, and several copies of the vector and its inserted (foreign) DNA may be generated. In addition, the vector contains the necessary elements that permit translating the foreign DNA into a polypeptide. Many molecules of the polypeptide encoded by the foreign DNA can thus be rapidly synthesized.
The term "control sequences" refers to DNA sequences necessary for the expression of an operably linked coding sequence in a particular host organism. The control sequences that are suitable for prokaryotes, for example, include a promoter, optionally an operator sequence, a ribosome binding site, and possibly, other as yet poorly understood sequences. Eukaryotic cells are known to utilize promoters, polyadenylation signals, and enhancers.
Nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence. For example, DNA for a presequence or a secretory leader is operably linked to DNA for a polypeptide if it is expressed as a preprotein that participates in the secretion of the polypeptide; a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence; or a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation. Generally, "operably linked" means that the DNA sequences being linked are contiguous and, in the case of a secretory leader, contiguous and in reading phase. However, enhancers do not have to be contiguous. Linking is accomplished by ligation at convenient restriction sites. If such sites do not exist, then synthetic oligonucleotide adaptors or linkers are used in accord with conventional practice.
"Immunoadhesins" or "PTP λ--immunoglobulin chimeras" are chimeric antibody-like molecules that combine the functional domain(s) of a binding protein (usually a receptor, a cell-adhesion molecule or a ligand) with the an immunoglobulin sequence. The most common example of this type of fusion protein combines the hinge and Fc regions of an immunoglobulin (Ig) with domains of a cell-surface receptor that recognizes a specific ligand. This type of molecule is called an "immunoadhesin", because it combines "immune" and "adhesion" functions; other frequently used names are "Ig-chimera", "Ig-" or "Fc-fusion protein", or "receptor-globulin."
"Oligonucleotides" are short-length, single- or double-stranded polydeoxynucleotides that are chemically synthesized by known methods such as phosphotriester, phosphite, or phosphoramidite chemistry, using solid phase techniques such as those described in EP 266,032, published 4 May 1988, or via deoxynucleoside H-phosphonate intermediates as described by Froehler et al., Nucl. Acids Res. 14, 5399 (1986). They are then purified on polyacrylamide gels.
Hybridization is preferably performed under "stringent conditions" which means (1) employing low ionic strength and high temperature for washing, for example, 0.01 5 sodium chloride/0.0015M sodium citrate/0.1% sodium dodecyl sulfate at 50° C., or (2) employing during hybridization a denaturing agent, such as formamide, for example, 50% (vol/vol) formamide with 0.1% bovine serum albumin/0.1% Ficoll/0.1% polyvinylpyrrolidone/50 nM sodium phosphate buffer at pH 6.5 with 750 mM sodium chloride, 75 mM sodium citrate at 42° C. Another example is use of 50% formamide, 5×SSC (0.75M NaCl, 0.075M sodium citrate), 50 mM sodium phosphate (pH 6/8), 0.1% sodium pyrophosphate, 5×Denhardt's solution, sonicated salmon sperm DNA (50 μg/ml), 0.1% SDS, and 10% dextran sulfate at 42° C., with washes at 42° C. in 0.2×SSC and 0.1% SDS. Yet another example is hybridization using a buffer of 10% dextran sulfate, 2×SSC (sodium chloride/sodium citrate) and 50% formamide at 55° C., followed by a high-stringency wash consisting of 0.1×SSC containing EDTA at 55° C.
"Transformation" means introducing DNA into an organism so that the DNA is replicable, either as an extrachromosomal element or by chromosomal integration. Depending on the host cell used, transformation is done using standard techniques appropriate to such cells. The calcium treatment employing calcium chloride, as described by Cohen, S. N., Proc. Natl. Acad. Sci. (USA), 69, 2110 (1972) and Mandel et al. J. Mol. Biol. 53, 154 (1970), is generally used for prokaryotes or other cells that contain substantial cell-wall barriers. For mammalian cells without such cell walls, the calcium phosphate precipitation method of Graham, F. and van der Eb, A., Virology, 52, 456-457 (1978) is preferred. General aspects of mammalian cell host system transformations have been described by Axel in U.S. Pat. No. 4,399,216 issued Aug. 16, 1983. Transformations into yeast are typically carried out according to the method of Van Solingen, P., et al. J. Bact., 130, 946 (1977) and Hsiao, C. L., et al. Proc. Natl. Acad. Sci. (USA) 76, 3829 (1979). However, other methods for introducing DNA into cells such as by nuclear injection, electroporation or by protoplast fusion may also be used.
"Recovery" or "isolation" of a given fragment of DNA from a restriction digest means separation of the digest on polyacrylamide or agarose gel by electrophoresis, identification of the fragment of interest by comparison of its mobility versus that of marker DNA fragments of known molecular weight, removal of the gel section containing the desired fragment, and separation of the gel from DNA. This procedure is known generally. For example, see R. Lawn et al., Nucleic Acids Res. 9, 6103-6114 (1981) and D. Goeddel et al., Nucleic Acids Res. 8, 4057 (1980).
"Ligation" refers to the process of forming phosphodiester bonds between two double stranded nucleic acid fragments (T. Maniatis et al. 1982, supra, p. 146). Unless otherwise provided, ligation may be accomplished using known buffers and conditions with 10 units of T4 DNA ligase ("ligase") per 0.5 mg of approximately equimolar amounts of the DNA fragments to be ligated.
"Preparation" of DNA from transformants means isolating plasmid DNA from microbial culture. Unless otherwise provided, the alkaline/SDS method of Maniatis et al. 1982, supra, p. 90, may be used.
B. Production of PTP λ by recombinant DNA technology
1. Identification and isolation of nucleic acid encoding PTP λ
The native PTP λ proteins of the present invention may be isolated from cDNA or genomic libraries. For example, a suitable cDNA library can be constructed by obtaining polyadenylated mRNA from cells known to express the desired PTP λ protein, and using the mRNA as a template to synthesize double stranded cDNA. Suitable sources of the mRNA are murine primitive hematopoietic cells and PC12 cells. mRNA encoding the native PTP λ of the present invention is expressed, for example, in tissues derived from adult brain, lung, kidney, heart, skeletal muscle and testis. The gene encoding the novel PTP λ polypeptide of the present invention can also be obtained from a genomic library, such as a human genomic cosmid library, or a mouse-derived embryonic cell (ES) genomic library.
Libraries, either cDNA or genomic, are then screened with probes designed to identify the gene of interest or the protein encoded by it. For cDNA expression libraries, suitable probes include monoclonal and polyclonal antibodies that recognize and specifically bind to a PTP λ polypeptide. For cDNA libraries, suitable probes include carefully selected oligonucleotide probes (usually of about 20-80 bases in length) that encode known or suspected portions of a PTP λ polypeptide from the same or different species, and/or complementary or homologous cDNAs or fragments thereof that encode the same or a similar gene. Appropriate probes for screening genomic DNA libraries include, without limitation, oligonucleotides, cDNAs, or fragments thereof that encode the same or a similar gene, and/or homologous genomic DNAs or fragments thereof. Screening the cDNA or genomic library with the selected probe may be conducted using standard procedures as described in Chapters 10-12 of Sambrook et al., Molecular Cloning: A Laboratory Manual, New York, Cold Spring Harbor Laboratory Press, 1989.
If DNA encoding an enzyme of the present invention is isolated by using carefully selected oligonucleotide sequences to screen cDNA libraries from various tissues, the oligonucleotide sequences selected as probes should be sufficient in length and sufficiently unambiguous that false positives are minimized. The actual nucleotide sequence(s) is/are usually designed based on regions which have the least codon redundance. The oligonucleotides may be degenerate at one or more positions. The use of degenerate oligonucleotides is of particular importance where a library is screened from a species in which preferential codon usage is not known.
The oligonucleotide must be labeled such that it can be detected upon hybridization to DNA in the library being screened. The preferred method of labeling is to use ATP (e.g., γ32 P) and polynucleotide kinase to radiolabel the 5' end of the oligonucleotide. However, other methods may be used to label the oligonucleotide, including, but not limited to, biotinylation or enzyme labeling.
cDNAs encoding PTP λ can also be identified and isolated by other known techniques of recombinant DNA technology, such as by direct expression cloning, or by using the polymerase chain reaction (PCR) as described in U.S. Pat. No. 4,683,195, issued 28 Jul. 1987, in section 14 of Sambrook et al., supra, or in Chapter 15 of Current Protocols in Molecular Biology, Ausubel et al. eds., Greene Publishing Associates and Wiley-lnterscience 1991. The use of the PCR technique for obtaining cDNA encoding murine PTP λ is also illustrated in the examples.
Once cDNA encoding a PTP λ enzyme from one species has been isolated, cDNAs from other species can also be obtained by cross-species hybridization. According to this approach, human or other mammalian cDNA or genomic libraries are probed by labeled oligonucleotide sequences selected from known PTP λ sequences (such as murine PTP λ) in accord with known criteria, among which is that the sequence should be sufficient in length and sufficiently unambiguous that false positives are minimized. Typically, a 32 P-labeled oligonucleotide having about 30 to 50 bases is sufficient, particularly if the oligonucleotide contains one or more codons for methionine or tryptophan. Isolated nucleic acid will be DNA that is identified and separated from contaminant nucleic acid encoding other polypeptides from the source of nucleic acid. Hybridization is preferably performed under "stringent conditions", as herein above defined.
Once the sequence is known, the gene encoding a particular PTP λ polypeptide can also be obtained by chemical synthesis, following one of the methods described in Engels and Uhlmann, Agnew. Chem. Int. Ed. Engl. 28, 716 (1989). These methods include triester, phosphite, phosphoramidite and H-phosphonate methods, PCR and other autoprimer methods, and oligonucleotide syntheses on solid supports.
2. Cloning and expression of nucleic acid encoding PTP λ
Once the nucleic acid encoding PTP λ is available, it is generally ligated into a replicable expression vector for further cloning (amplification of the DNA), or for expression.
Expression and cloning vectors are well known in the art and contain a nucleic acid sequence that enables the vector to replicate in one or more selected host cells. The selection of the appropriate vector will depend on 1) whether it is to be used for DNA amplification or for DNA expression, 2) the size of the DNA to be inserted into the vector, and 3) the host cell to be transformed with the vector. Each vector contains various components depending on its function (amplification of DNA of expression of DNA) and the host cell for which it is compatible. The vector components generally include, but are not limited to, one or more of the following: a signal sequence, an origin of replication, one or more marker genes, an enhancer element, a promoter, and a transcription termination sequence. Construction of suitable vectors containing one or more of the above listed components, the desired coding and control sequences, employs standard ligation techniques. Isolated plasmids or DNA fragments are cleaved, tailored, and religated in the form desired to generate the plasmids required. For analysis to confirm correct sequences in plasmids constructed, the ligation mixtures are commonly used to transform E. coli cells, e.g. E. coli K12 strain 294 (ATCC 31,446) and successful transformants selected by ampicillin or tetracycline resistance where appropriate. Plasmids from the transformants are prepared, analyzed by restriction endonuclease digestion, and/or sequenced by the method of Messing et al., Nucleic Acids Res. 9, 309 (1981) or by the method of Maxam et al., Methods in Enzymology 65, 499 (1980).
The polypeptides of the present invention may be expressed in a variety of prokaryotic and eukaryotic host cells. Suitable prokaryotes include gram negative or gram positive organisms, for example E. coli or bacilli. A preferred cloning host is E. coli 294 (ATCC 31,446) although other gram negative or gram positive prokaryotes such as E. coli B, E. coli X1776 (ATCC 31,537), E. coli W3110 (ATCC 27,325), Pseudomonas species, or Serratia Marcesans are suitable.
In addition to prokaryotes, eukaryotic microbes such as filamentous fungi or yeast are suitable hosts for vectors herein. Saccharomyces cerevisiae, or common baker's yeast, is the most commonly used among lower eukaryotic host microorganisms. However, a number of other genera, species and strains are commonly available and useful herein, such as S. pombe Beach and Nurse, Nature 290, 140 (1981)!, Kluyveromyces lactis Louvencourt et al., J. Bacteriol, 737 (1983)!; yarrowia (EP 402,226); Pichia pastoris (EP 183,070), Trichoderma reesia (EP 244,234), Neurospora crassa Case et al., Proc. Natl. Acad. Sci. USA 76, 5259-5263 (1979)!; and Aspergillus hosts such as A. nidulans Ballance et al., Biochem. Biophys. Res. Commun. 112, 284-289 (1983); Tilburn et al., Gene 26, 205-221 (1983); Yelton et al., Proc. Natl. Acad. Sci. USA 81, 1470-1474 (1984)! and A. niger Kelly and Hynes, EMBO J. 4, 475-479 (1985)!.
Suitable host cells may also derive from multicellular organisms. Such host cells are capable of complex processing and glycosylation activities. In principle, any higher eukaryotic cell culture is workable, whether from vertebrate or invertebrate culture, although cells from mammals such as humans are preferred. Examples of invertebrate cells include plants and insect cells. Numerous baculoviral strains and variants and corresponding permissive insect host cells from hosts such as Spodoptera frugiperda (caterpillar), Aedes aegypti (mosquito), Aedes albopictus (mosquito), Drosophila melanogaster (fruitfly), and Bombyx mori host cells have been identified. See, e.g. Luckow et al., Bio/Technology 6, 47-55 (1988); Miller et al., in Genetic Engineering, Setlow, J. K. et al., eds., Vol. 8 (Plenum Publishing, 1986), pp. 277-279; and Maeda et al., Nature 315, 592-594 (1985). A variety of such viral strains are publicly available, e.g. the L-1 variant of Autographa californica NPV, and such viruses may be used as the virus herein according to the present invention, particularly for transfection of Spodoptera frugiperda cells.
Plant cell cultures of cotton, corn, potato, soybean, petunia, tomato, and tobacco can be utilized as hosts. Typically, plant cells are transfected by incubation with certain strains of the bacterium Agrobacterium tumefaciens, which has been previously manipulated to contain the PTP λ DNA. During incubation of the plant cell culture with A. tumefaciens, the DNA encoding a PTP λ polypeptide is transferred to the plant cell host such that it is transfected, and will, under appropriate conditions, express the PTP λ DNA. In addition, regulatory and signal sequences compatible with plant cells are available, such as the nopaline synthase promoter and polyadenylation signal sequences. Depicker et al., J. Mol. Appl. Gen. 1, 561 (1982). In addition, DNA segments isolated from the upstream region of the T-DNA 780 gene are capable of activating or increasing transcription levels of plant-expressible genes in recombinant DNA-containing plant tissue. See EP 321,196 published 21 Jun. 1989.
However, interest has been greatest in vertebrate cells, and propagation of vertebrate cells in culture (tissue culture) is per se well known. See Tissue Culture, Academic Press, Kruse and Patterson, editors (1973). Examples of useful mammalian host cell lines are monkey kidney CV1 line transformed by SV40 (COS-7, ATCC CRL 1651); human embryonic kidney cell line 293 or 293 cells subcloned for growth in suspension culture, Graham et al., J. Gen. Virol. 36, 59 (1977)!; baby hamster kidney cells 9BHK, ATCC CCL 10); Chinese hamster ovary cells/-DHFR CHO, Urlaub and Chasin, Proc. Natl. Acad. Sci. USA 77, 4216 (1980)!; mouse sertolli cells TM4, Mather, Biol. Reprod. 23, 243-251 (1980)!; monkey kidney cells (CV1 ATCC CCL 70); African green monkey kidney cells (VERO-76, ATCC CRL-1587); human cervical carcinoma cells (HELA, ATCC CCL 2); canine kidney cells (MDCK, ATCC CCL 34); buffalo rat liver cells (BRL 3A, ATCC CRL 1442); human lung cells (W138, ATCC CCL75); human liver cells (Hep G2, HB 8065); mouse mammary tumor (MMT 060562, ATCC CCL51); TRI cells Mather et al., Annals N.Y. Acad. Sci. 383, 44068 (1982)!; MRC 5 cells; FS4 cells; and a human hepatoma cell line (Hep G2). Preferred host cells are human embryonic kidney 293 and Chinese hamster ovary cells.
Particularly useful in the practice of this invention are expression vectors that provide for the transient expression in mammalian cells of DNA encoding a PTP λ polypeptide. In general, transient expression involves the use of an expression vector that is able to replicate efficiently in a host cell, such that the host cell accumulates many copies of the expression vector and, in turn, synthesizes high levels of a desired polypeptide encoded by the expression vector. Transient systems, comprising a suitable expression vector and a host cell, allow for the convenient positive identification of polypeptides encoded by clones DNAs, as well as for the rapid screening of such polypeptides for desired biological or physiological properties. Thus, transient expression systems are particularly useful in the invention for purposes of identifying analogs and variants of a PTP λ polypeptide.
Other methods, vectors, and host cells suitable for adaptation to the synthesis of the PTP λ polypeptides in recombinant vertebrate cell culture are described in Getting et al., Nature 293, 620-625 (1981); Mantel et al., Nature 281, 40-46 (1979); Levinson et al.; EP 117,060 and EP 117,058. Particularly useful plasmids for mammalian cell culture expression of the PTP λ polypeptides are pRK5 (EP 307,247) or pSVI6B (PCT Publication No. WO 91/08291).
Other cloning and expression vectors suitable for the expression of the PTP λ polypeptides of the present invention in a variety of host cells are, for example, described in EP 457,758 published 27 Nov. 1991. A large variety of expression vectors are now commercially available. An exemplary commercial yeast expression vector is pPIC.9 (Invitrogen), while an commercially available expression vector suitable for transformation of E. coli cells is PET15b (Novagen).
C. Culturing the host cells
Prokaryote cells used to produced the PTP λ polypeptides of this invention are cultured in suitable media as describe generally in Sambrook et al., supra.
Mammalian cells can be cultured in a variety of media. Commercially available media such as Ham's F10 (Sigma), Minimal Essential Medium (MEM, Sigma), RPMI-1640 (Sigma), and Dulbecco's Modified Eagle's Medium (DMEM, Sigma) are suitable for culturing the host cells. In addition, any of the media described in Ham and Wallace, Meth. Enzymol. 58, 44 (1979); Barnes and Sato, Anal. Biochem. 102, 255 (1980), U.S. Pat. Nos. 4,767,704; 4,657,866; 4,927,762; or 4,560,655; WO 90/03430; WO 87/00195 or U.S. Pat. No. Re. 30,985 may be used as culture media for the host cells. Any of these media may be supplemented as necessary with hormones and/or other growth factors (such as insulin, transferrin, or epidermal growth factor), salts (such as sodium chloride, calcium, magnesium, and phosphate), buffers (such as HEPES), nucleosides (such as adenosine and thymidine), antibiotics (such as Gentamycin™ drug) trace elements (defined as inorganic compounds usually present at final concentrations in the micromolar range), and glucose or an equivalent energy source. Any other necessary supplements may also be included at appropriate concentrations that would be known to those skilled in the art. The culture conditions, such as temperature, pH and the like, suitably are those previously used with the host cell selected for cloning or expression, as the case may be, and will be apparent to the ordinary artisan.
The host cells referred to in this disclosure encompass cells in in vitro cell culture as well as cells that are within a host animal or plant.
It is further envisioned that the PTP λ polypeptides of this invention may be produced by homologous recombination, or with recombinant production methods utilizing control elements introduced into cells already containing DNA encoding the particular PTP λ polypeptide.
D. Detecting Gene Amplification/Expression
Gene amplification and/or expression may be measured in a sample directly, for example, by conventional Southern blotting, Northern blotting to quantitate the transcription of mRNA Thomas, Proc. Natl. Acad. Sci. USA 77, 5201-5205 (1980)!, dot blotting (DNA analysis), or in situ hybridization, using an appropriately labeled probe, based on the sequences provided herein. Various labels may be employed, most commonly radioisotopes, particularly 32 P. However, other techniques may also be employed, such as using biotin-modified nucleotides for introduction into a polynucleotide. The biotin then serves as a site for binding to avidin or antibodies, which may be labeled with a wide variety of labels, such as radionuclides, fluorescers, enzymes, or the like. Alternatively, antibodies may be employed that can recognize specific duplexes, including DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes or DNA-protein duplexes. The antibodies in turn may be labeled and the assay may be carried out where the duplex is bound to the surface, so that upon the formation of duplex on the surface, the presence of antibody bound to the duplex can be detected.
Gene expression, alternatively, may be measured by immunological methods, such as immunohistochemical staining of tissue sections and assay of cell culture or body fluids, to quantitate directly the expression of gene product. With immunohistochemical staining techniques, a cell sample is prepared, typically by dehydration and fixation, followed by reaction with labeled antibodies specific for the gene product coupled, where the labels are usually visually detectable, such as enzymatic labels, fluorescent labels, luminescent labels, and the like. A particularly sensitive staining technique suitable for use in the present invention is described by Hse et al., Am. J. Clin. Pharm. 75, 734-738 (1980).
Antibodies useful for immunohistochemical staining and/or assay of sample fluids may be either monoclonal or polyclonal, and may be prepared in any animal. Conveniently, the antibodies may be prepared against a native PTP λ polypeptide, or against a synthetic peptide based on the DNA sequence provided herein as described further hereinbelow.
E. Amino Acid Sequence Variants of Native PTP λ Polypeptides
Amino acid sequence variants of native PTP λ polypeptides are prepared by methods known in the art by introducing appropriate nucleotide changes into a PTP λ DNA, or by in vitro synthesis of the desired polypeptide. There are two principal variables in the construction of amino acid sequence variants: the location of the mutation site and the nature of the mutation. With the exception of naturally-occurring alleles, which do not require the manipulation of the DNA sequence encoding the PTP λ polypeptide, the amino acid sequence variants of PTP λ polypeptides are preferably constructed by mutating the DNA, either to arrive at an allele or an amino acid sequence variant that does not occur in nature.
One group of the mutations will be created within at least one of the phosphatase domains (PTPasel and/or PTPasell) of a native PTP λ protein. In view of the involvement of these domains in the enzymatic activity of PTP λ, amino acid alterations within these domains are expected to result in marked changes in the enzymatic properties of the native proteins. Non-conservative substitutions might ultimately result in PTP λ variants which lose the ability to dephosphatase tyrosines and will, therefore, be useful as antagonists of native PTP λ. PTP λ variants mutated to enhance the enzymatic activity of the native proteins may also be obtained, and will find use, for example, as potent mediators of cell adhesion.
Similarly, amino acid alterations in the MAM or IgG domains of the native PTP λ proteins are expected to affect the ability of these receptors to mediate homotypic cell adhesion, and the specificity of the homophilic interaction mediated.
Alternatively or in addition, amino acid alterations can be made at sites that differ in PTP λ proteins from various species, or in highly conserved regions, depending on the goal to be achieved. Sites at such locations will typically be modified in series, e.g. by (1) substituting first with conservative choices and then with more radical selections depending upon the results achieved, (2) deleting the target residue or residues, or (3) inserting residues of the same or different class adjacent to the located site, or combinations of options 1-3. One helpful technique is called "alanine scanning" (Cunningham and Wells, Science 244, 1081-1085 1989!). The replacement of sequence motifs within the MAM, IgG, FNIII or PTPase domains of the native PTP λ proteins of the present invention by sequences from native PTP κ and/or PTP μ receptors is expected to result in variants having altered specificities.
In yet another group of the variant PTP λ polypeptides of the present invention, one or more of the functionally less significant domains may be deleted or inactivated. For example, the deletion or inactivation of the transmembrane domain yields soluble variants of the native protein. Alternatively, or in addition, the cytoplasmic domain may be deleted, truncated or otherwise altered.
Naturally-occurring amino acids are divided into groups based on common side chain properties:
(1) hydrophobic: norleucine, met, ala, val, leu, ile;
(2) neutral hydrophobic: cys, ser, thr;
(3) acidic: asp, glu;
(4) basic: asn, gin, his, lys, arg;
(5) residues that influence chain orientation: gly, pro; and
(6) aromatic: trp, tyr, phe.
Conservative substitutions involve exchanging a member within one group for another member within the same group, whereas non-conservative substitutions will entail exchanging a member of one of these classes for another. Substantial changes in function or immunological identity are made by selecting substitutions that are less conservative, i.e. differ more significantly in their effect on maintaining (a) the structure of the polypeptide backbone in the area of substitution, for example as a sheet or helical conformation, (b) the charge or hydrophobicity of the molecule at the target site or (c) the bulk of the side chain. The substitutions which in general are expected to produce the greatest changes in the properties of the novel native PTP λ polypeptides of the present invention will be those in which (a) a hydrophilic residue, e.g. seryl or threonyl, is substituted for (or by) a hydrophobic residue, e.g. leucyl, isoleucyl, phenylalanyl, valyl or alanyl; (b) a cysteine or proline is substituted for (or by) any other residue; (c) a residue having an electropositive side chain, e.g. lysyl, arginyl, or histidyl, is substituted for (or by) an electronegative residue, e.g., glutamyl or aspartyl; or (d) a residue having a bulky side chain, e.g., phenylalanine, is substituted for (or by) one not having a side chain, e.g. glycine.
Amino acid sequence deletions generally range from about 1 to 30 residues, more preferably about 1 to 10 residues, and typically are contiguous. Typically, the transmembrane and cytoplasmic domains, or only the cytoplasmic domains are deleted. However, deletion from the C-terminal to any other suitable N-terminal to the transmembrane region which preserves the biological activity or immunological cross-reactivity of a native PTP λ is suitable.
A preferred class of substitutional and/or deletional variants of the present invention are those involving a transmembrane region of a novel PTP λ molecule. Transmembrane regions are highly hydrophobic or lipophilic domains that are the proper size to span the lipid bilayer of the cellular membrane. They are believed to anchor the PTP λ protein in the cell membrane and allow for homotypic complex formation. Inactivation of the transmembrane domain, typically by deletion or substitution of transmembrane domain hydroxylation residues, will facilitate recovery and formulation by reducing its cellular or membrane lipid affinity and improving its aqueous solubility. If the transmembrane and cytoplasmic domains are deleted one avoids the introduction of potentially immunogenic epitopes, whether by exposure of otherwise intracellular polypeptides that might be recognized by the body as foreign or by insertion of heterologous polypeptides that are potentially immunogenic. Inactivation of the membrane binding function is accomplished by deletion of sufficient residues to produce a substantially hydrophilic hydropathy profile at this site or by substituting with heterologous residues which accomplish the same result.
A principle advantage of the transmembrane inactivated variants of the PTP λ polypeptides of the present invention is that they may be secreted into the culture medium of recombinant hosts. These variants are soluble in body fluids such as blood and do not have an appreciable affinity for cell membrane lipids, thus considerably simplifying their recovery from recombinant cell culture. As a general proposition, such soluble variants will not have a functional transmembrane domain and preferably will not have a functional cytoplasmic domain. For example, the transmembrane domain may be substituted by any amino acid sequence, e.g. a random or predetermined sequences of about 5 to 50 serine, threonine, lysine, arginine, glutamine, aspartic acid and like hydrophilic residues, which altogether exhibit a hydrophilic hydropathy profile. Like the deletional (truncated) soluble variants, these variants are secreted into the culture medium of recombinant hosts.
Amino acid insertions include amino- and/or carboxyl-terminal fusions ranging in length from one residue to polypeptides containing a hundred or more residues, as well as intrasequence insertions of single or multiple amino acid residues. Intrasequence insertions (i.e. insertions within the PTP λ protein amino acid sequence) may range generally from about 1 to 10 residues, more preferably 1 to 5 residues, more preferably 1 to 3 residues. Examples of terminal insertions include PTP λ polypeptides with an N-terminal methionyl residue, an artifact of its direct expression in bacterial recombinant cell culture, and fusion of a heterologous N-terminal signal sequence to the N-terminus of the PTP λ molecule to facilitate the secretion of the mature PTP λ from recombinant host cells. Such signal sequences will generally be obtained from, and thus homologous to, the intended host cell species. Suitable sequences include STII or Ipp for E. coli, alpha factor for yeast, and viral signals such as herpes gD for mammalian cells.
Other insertional variants of the native PTP λ molecules include the fusion of the N- or C-terminus of the PTP λ molecule to immunogenic polypeptides, e.g. bacterial polypeptides such as beta-lactamase or an enzyme encoded by the E. coli trp locus, or yeast protein, and C-terminal fusions with proteins having a long half-life such as immunoglobulin regions (preferably immunoglobulin constant regions), albumin, or ferritin, as described in WO 89/02922 published on 6 Apr. 1989.
Further insertional variants are immunologically active derivatives of the novel PTP λ polypeptides, which comprise the PTP polypeptide and a polypeptide containing an epitope of an immunologically competent extraneous polypeptide, i.e. a polypeptide which is capable of eliciting an immune response in the animal to which the fusion is to be administered or which is capable of being bound by an antibody raised against an extraneous polypeptide. Typical examples of such immunologically competent polypeptides are allergens, autoimmune epitopes, or other potent immunogens or antigens recognized by pre-existing antibodies in the fusion recipient, including bacterial polypeptides such as trpLE, β-galactosidase, viral polypeptides such as herpes gD protein, and the like.
Immunogenic fusions are produced by cross-linking in vitro or by recombinant cell culture transformed with DNA encoding an immunogenic polypeptide. It is preferable that the immunogenic fusion be one in which the immunogenic sequence is joined to or inserted into a novel PTP λ molecule or fragment thereof by (a) peptide bond(s). These products therefore consist of a linear polypeptide chain containing the PTP λ epitope and at least one epitope foreign to the PTP λ polypeptide. It will be understood that it is within the scope of this invention to introduce the epitopes anywhere within a PTP λ molecule of the present invention or a fragment thereof. These immunogenic insertions are particularly useful when formulated into a pharmacologically acceptable carrier and administered to a subject in order to raise antibodies against the PTP λ molecule, which antibodies in turn are useful as diagnostics, in tissue-typing, or in purification of the novel PTP λ polypeptides by immunoaffinity techniques known per se. Alternatively, in the purification of the PTP λ polypeptides of the present invention, binding partners for the fused extraneous polypeptide, e.g. antibodies, receptors or ligands, are used to adsorb the fusion from impure admixtures, after which the fusion is eluted and, if desired, the novel PTP λ is recovered from the fusion, e.g. by enzymatic cleavage.
Since it is often difficult to predict in advance the characteristics of a variant PTP λ polypeptide, it will be appreciated that some screening will be needed to select the optimum variant.
After identifying the desired mutation(s), the gene encoding a PTP λ variant can, for example, be obtained by chemical synthesis as hereinabove described. More preferably, DNA encoding a PTP λ amino acid sequence variant is prepared by site-directed mutagenesis of DNA that encodes an earlier prepared variant or a nonvariant version of the PTP λ. Site-directed (site-specific) mutagenesis allows the production of PTP λ variants through the use of specific oligonucleotide sequences that encode the DNA sequence of the desired mutation, as well as a sufficient number of adjacent nucleotides, to provide a primer sequence of sufficient size and sequence complexity to form a stable duplex on both sides of the deletion junction being traversed. Typically, a primer of about 20 to 25 nucleotides in length is preferred, with about 5 to 10 residues on both sides of the junction of the sequence being altered. In general, the techniques of site-specific mutagenesis are well known in the art, as exemplified by publications such as, Edelman et al., DNA 2, 183 (1983). As will be appreciated, the site-specific mutagenesis technique typically employs a phage vector that exists in both a single-stranded and double-stranded form. Typical vectors useful in site-directed mutagenesis include vectors such as the M13 phage, for example, as disclosed by Messing et al., Third Cleveland Symposium on Macromolecules and Recombinant DNA, A. Walton, ed., Elsevier, Amsterdam (1981). This and other phage vectors are commercially available and their use is well known to those skilled in the art. A versatile and efficient procedure for the construction of oligodeoxyribonucleotide directed site-specific mutations in DNA fragments using M13-derived vectors was published by Zoller, M. J. and Smith, M., Nucleic Acids Res. 10, 6487-6500 1982!). Also, plasmid vectors that contain a single-stranded phage origin of replication (Veira et al., Meth. Enzymol. 153, 3 1987!) may be employed to obtain single-stranded DNA. Alternatively, nucleotide substitutions are introduced by synthesizing the appropriate DNA fragment in vitro, and amplifying it by PCR procedures known in the art.
The PCR technique may also be used in creating amino acid sequence variants of a PTP λ polypeptide. In a specific example of PCR mutagenesis, template plasmid DNA (1 μg) is linearized by digestion with a restriction endonuclease that has a unique recognition site in the plasmid DNA outside of the region to be amplified. Of this material, 100 ng is added to a PCR mixture containing PCR buffer, which contains the four deoxynucleotide triphosphates and is included in the GeneAmpR kits (obtained from Perkin-Elmer Cetus, Norwalk, Conn. and Emeryville, Calif.), and 25 pmole of each oligonucleotide primer, to a final volume of 50 μl. The reaction mixture is overlayered with 35 μl mineral oil. The reaction is denatured for 5 minutes at 100° C., placed briefly on ice, and then 1 μl Thermus aquaticus (Taq) DNA polymerase (5 units/ul), purchased from Perkin-Elmer Cetus, Norwalk, Conn. and Emeryville, Calif.) is added below the mineral oil layer. The reaction mixture is then inserted into a DNA Thermal Cycler (purchased from Perkin-Elmer Cetus) programmed as follows:
2 min. 55° C.,
30 sec. 72° C., then 19 cycles of the following:
30 sec. 94° C.,
30 sec. 55° C., and
30 sec. 72° C.
At the end of the program, the reaction vial is removed from the thermal cycler and the aqueous phase transferred to a new vial, extracted with phenol/chloroform (50:50 vol), and ethanol precipitated, and the DNA is recovered by standard procedures. This material is subsequently subjected to appropriate treatments for insertion into a vector.
Another method for preparing variants, cassette mutagenesis, is based on the technique described by Wells et al. Gene 34, 315 (1985)!.
Additionally, the so-called phagemid display method may be useful in making amino acid sequence variants of native or variant PTP λ polypeptides or their fragments. This method involves (a) constructing a replicable expression vector comprising a first gene encoding a receptor to be mutated, a second gene encoding at least a portion of a natural or wild-type phage coat protein wherein the first and second genes are heterologous, and a transcription regulatory element operably linked to the first and second genes, thereby forming a gene fusion encoding a fusion protein; (b) mutating the vector at one or more selected positions within the first gene thereby forming a family of related plasmids; (c) transforming suitable host cells with the plasmids; (d) infecting the transformed host cells with a helper phage having a gene encoding the phage coat protein; (e) culturing the transformed infected host cells under conditions suitable for forming recombinant phagemid particles containing at least a portion of the plasmid and capable of transforming the host, the conditions adjusted so that no more than a minor amount of phagemid particles display more than one copy of the fusion protein on the surface of the particle; (f) contacting the phagemid particles with a suitable antigen so that at least a portion of the phagemid particles bind to the antigen; and (g) separating the phagemid particles that bind from those that do not. Steps (d) through (g) can be repeated one or more times. Preferably in this method the plasmid is under tight control of the transcription regulatory element, and the culturing conditions are adjusted so that the amount or number of phagemid particles displaying more than one copy of the fusion protein on the surface of the particle is less than about 1%. Also, preferably, the amount of phagemid particles displaying more than one copy of the fusion protein is less than 10% of the amount of phagemid particles displaying a single copy of the fusion protein. Most preferably, the amount is less than 20%. Typically in this method, the expression vector will further contain a secretory signal sequence fused to the DNA encoding each subunit of the polypeptide and the transcription regulatory element will be a promoter system. Preferred promoter systems are selected from lac Z, λPL, tac, T7 polymerase, tryptophan, and alkaline phosphatase promoters and combinations thereof. Also, normally the method will employ a helper phage selected from M13K07, M13R408, M13-VCS, and Phi X 174. The preferred helper phage is M13K07, and the preferred coat protein is the M13 Phage gene III coat protein. The preferred host is E. coli, and protease-deficient strains of E. coli.
Further details of the foregoing and similar mutagenesis techniques are found in general textbooks, such as, for example, Sambrook et al., supra, and Current Protocols in Molecular Biology, Ausubel et al. eds., supra.
F. Glycosylation Variants
Glycosylation variants are included within the scope of the present invention. They include variants completely lacking in glycosylation (unglycosylated), variants having at least one less glycosylated site than the native form (deglycosylated) as well as variants in which the glycosylation has been changed. Included are deglycosylated and unglycosylated amino acid sequences variants, deglycosylated and unglycosylated native PTP λ, and other glycosylation variants. For example, substitutional or deletional mutagenesis may be employed to eliminate the N- or O-linked glycosylation sites in the a native or variant PTP λ molecule of the present invention, e.g. the asparagine residue may be deleted or substituted for another basic residue such as lysine or histidine. Alternatively, flanking residues making up the glycosylation site may be substituted or deleted, even though the asparagine residues remain unchanged, in order to prevent glycosylation by eliminating the glycosylation recognition site.
Additionally, unglycosylated PTP λ polypeptides which have the glycosylation sites of a native molecule may be produced in recombinant prokaryotic cell culture because prokaryotes are incapable of introducing glycosylation into polypeptides.
Glycosylation variants may be produced by selecting appropriate host cells or by in vitro methods. Yeast and insect cells, for example, introduce glycosylation which varies significantly from that of mammalian systems. Similarly, mammalian cells having a different species (e.g. hamster, murine, porcine, bovine or ovine), or tissue origin (e.g. lung, liver, lymphoid, mesenchymal or epidermal) than the source of the PTP λ polypeptide are routinely screened for the ability to introduce variant glycosylation as characterized for example by elevated levels of mannose or variant ratios of mannose, fucose, sialic acid, and other sugars typically found in mammalian glycoproteins. In vitro processing of the PTP λ typically is accomplished by enzymatic hydrolysis, e.g. neuraminidase digestion.
G. Covalent Modification of PTP λ Polypeptides
Covalent modifications of PTP λ polypeptides are included within the scope herein. Such modifications are traditionally introduced by reacting targeted amino acid residues of the PTP λ polypeptides with an organic derivatizing agent that is capable of reacting with selected sides or terminal residues, or by harnessing mechanisms of post-translational modifications that function in selected recombinant host cells. The resultant covalent derivatives are useful in programs directed at identifying residues important for biological activity, for immunoassays of the PTP λ polypeptide, or for the preparation of anti-PTP λ antibodies for immunoaffinity purification of the recombinant. For example, complete inactivation of the biological activity of the protein after reaction with ninhydrin would suggest that at least one arginyl or lysyl residue is critical for its activity, whereafter the individual residues which were modified under the conditions selected are identified by isolation of a peptide fragment containing the modified amino acid residue. Such modifications are within the ordinary skill in the art and are performed without undue experimentation.
Cysteinyl residues most commonly are reacted with α-haloacetates (and corresponding amines), such as chloroacetic acid or chloroacetamide, to give carboxymethyl or carboxyamidomethyl derivatives. Cysteinyl residues also are derivatized by reaction with bromotrifluoroacetone, α-bromo-β-(5-imidozoyl)propionic acid, chloroacetyl phosphate, N-alkylmaleimides, 3-nitro-2-pyridyl disulfide, methyl 2-pyridyl disulfide, p-chloromercuribenzoate, 2-chloromercuri-4-nitrophenol, or chloro-7-nitrobenzo-2-oxa-1,3-diazole.
Histidyl residues are derivatized by reaction with diethylpyro-carbonate at pH 5.5-7.0 because this agent is relatively specific for the histidyl side chain. Para-bromophenacyl bromide also is useful; the reaction is preferably performed in 0.1M sodium cacodylate at pH 6.0.
Lysinyl and amino terminal residues are reacted with succinic or other carboxylic acid anhydrides. Derivatization with these agents has the effect of reversing the charge of the lysinyl residues. Other suitable reagents for derivatizing α-amino-containing residues include imidoesters such as methyl picolinimidate; pyridoxal phosphate; pyridoxal; chloroborohydride; trinitrobenzenesulfonic acid; O-methylisourea; 2,4-pentanedione; and transaminase-catalyzed reaction with glyoxylate.
Arginyl residues are modified by reaction with one or several conventional reagents, among them phenylglyoxal, 2,3-butanedione, 1,2-cyclohexanedione, and ninhydrin. Derivatization of arginine residues requires that the reaction be performed in alkaline conditions because of the high PKa of the guanidine functional group. Furthermore, these reagents may react with the groups of lysine as well as the arginine epsilon-amino group.
The specific modification of tyrosyl residues may be made, with particular interest in introducing spectral labels into tyrosyl residues by reaction with aromatic diazonium compounds or tetranitromethane. Most commonly, N-acetylimidizole and tetranitromethane are used to form O-acetyl tyrosyl species and 3-nitro derivatives, respectively. Tyrosyl residues are iodinated using 125 I or 131 I to prepare labeled proteins for use in radioimmunoassay.
Carboxyl side groups (aspartyl or glutamyl) are selectively modified by reaction with carbodiimides (R'-N═C═N-R') such as 1-cyclohexyl-3-(2-morpholinyl-4-ethyl) carbodiimide or 1-ethyl-3-(4-azonia-4,4-dimethylpentyl) carbodiimide. Furthermore, aspartyl and glutamyl residues are converted to asparaginyl and glutaminyl residues by reaction with ammonium ions.
Glutaminyl and asparaginyl residues are frequently deamidated to the corresponding glutamyl and aspartyl residues. Alternatively, these residues are deamidated under mildly acidic conditions. Either form of these residues falls within the scope of this invention.
Other modifications include hydroxylation of proline and lysine, phosphorylation of hydroxyl groups of seryl, threonyl or tyrosyl residues, methylation of the α-amino groups of lysine, arginine, and histidine side chains (T. E. Creighton, Proteins: Structure and Molecular Properties, W. H. Freeman & Co., San Francisco, pp. 79-86 1983!), acetylation of the N-terminal amine, and amidation of any C-terminal carboxyl group. The molecules may further be covalently linked to nonproteinaceous polymers, e.g. polyethylene glycol, polypropylene glycol or polyoxyalkylenes, in the manner set forth in U.S. Ser. No. 07/275,296 or U.S. Pat. Nos. 4,640,835; 4,496,689; 4,301,144; 4,670,417; 4,791,192 or 4,179,337.
Derivatization with bifunctional agents is useful for preparing intramolecular aggregates of PTP λ polypeptides with polypeptides as well as for cross-linking the PTP λ polypeptide to a water insoluble support matrix or surface for use in assays or affinity purification. In addition, a study of interchain cross-links will provide direct information on conformational structure. Commonly used cross-linking agents include 1,1-bis(diazoacetyl)-2-phenylethane, glutaraldehyde, N-hydroxysuccinimide esters, homobifunctional imidoesters, and bifunctional maleimides. Derivatizing agents such as methyl-3- (p-azidophenyl)dithio!propioimidate yield photoactivatable intermediates which are capable of forming cross-links in the presence of light. Alternatively, reactive water insoluble matrices such as cyanogen bromide activated carbohydrates and the systems reactive substrates described in U.S. Pat. Nos. 3,959,642; 3,969,287; 3,691,016; 4,195,128; 4,247,642; 4,229,537; 4,055,635; and 4,330,440 are employed for protein immobilization and cross-linking.
Certain post-translational modifications are the result of the action of recombinant host cells on the expressed polypeptide. Glutaminyl and aspariginyl residues are frequently post-translationally deamidated to the corresponding glutamyl and aspartyl residues. Alternatively, these residues are deamidated under mildly acidic conditions. Either form of these residues falls within the scope of this invention.
Other post-translational modifications include hydroxylation of proline and lysine, phosphorylation of hydroxyl groups of seryl, threonyl or tyrosyl residues, methylation of the α-amino groups of lysine, arginine, and histidine side chains T. E. Creighton, Proteins: Structure and Molecular Properties, W. H. Freeman & Co., San Francisco, pp. 79-86 (1983)!.
Further derivatives of the PTP λ polypeptides herein are the so-called "immunoadhesins", which are chimeric antibody-like molecules combining the functional domain(s) of a binding protein (usually a receptor, a cell-adhesion molecule or a ligand) with the an immunoglobulin sequence. The most common example of this type of fusion protein combines the hinge and Fc regions of an immunoglobulin (Ig) with domains of a cell-surface receptor that recognizes a specific ligand. This type of molecule is called an "immunoadhesin", because it combines "immune" and "adhesion" functions; other frequently used names are "Ig-chimera", "Ig-" or "Fc-fusion protein", or "receptor-globulin."
To date, more than fifty immunoadhesins have been reported in the art. Immunoadhesins reported in the literature include, for example, fusions of the T cell receptor (Gascoigne et al., Proc. Natl. Acad. Sci. USA 84, 2936-2940 1987!); CD4 (Capon et al., Nature 337, 525-531 1989!; Traunecker et al., Nature 339, 68-70 1989!; Zettmeissl et al., DNA Cell Biol. USA 9, 347-353 1990!; Byrn et al., Nature 344, 667-670 1990!); L-selectin (homing receptor) (Watson et al., J. Cell. Biol. 110, 2221-2229 1990!; Watson et al., Nature 349, 164-167 1991!); E-selectin Mulligan et al., J. Immunol. 151, 6410-17 1993!; Jacob et al., Biochemistry 34, 1210-1217 1995!); P-selectin (Mulligan et al., supra; Hollenbaugh et al., Biochemistry 34, 5678-84 1995!); ICAM-1 (Stauton et al., J. Exp. Med. 176, 1471-1476 1992!; Martin et al., J. Virol. 67, 3561-68 1993!; Roep et al., Lancet 343, 1590-93 1994!); ICAM-2 (Damle et al., J. Immunol. 148, 665-71 1992!); ICAM-3 (Holness et al., J. Biol. Chem. 270, 877-84 1995!); LFA-3 (Kanner et al., J. Immunol. 148, 2-23-29 1992!); L1 glycoprotein (Doherty et al., Neuron 14, 57-66 1995!); TNF-R1 (Ashkenazi et al., Proc. Natl. Acad. Sci. USA 88, 10535-539 1991!; Lesslauer et al., Eur. J. Immunol. 21, 2883-86 1991!; Peppel et al., J. Exp. Med. 174, 1483-1489 1991!); TNF-R2 (Zack et al., Proc. Natl. Acad. Sci. USA 90, 2335-39 1993!; Wooley et al., J. Immunol. 151, 6602-07 1993!); CD44 Aruffo et al., Cell 61, 1303-1313 (1990)!; CD28 and B7 Linsley et al., J. Exp. Med. 173, 721-730 (1991)!; CTLA-4 Lisley et al., J. Exp. Med. 174, 561-569 (1991)!; CD22 Stamenkovic et al., Cell 66. 1133-1144 (1991)!; NP receptors Bennett et al., J. Biol. Chem. 266, 23060-23067 (1991)!; IgE receptor α Ridgway and Gorman, J. Cell. Biol. 115, abstr. 1448 (1991)!; HGF receptor Mark, M. R. et al., 1992, J. Biol. Chem. submitted!; IFN-γR α-and β-chain Marsters et al., Proc. Natl. Acad. Sci. USA 92, 5401-05 1995!); trk-A, -B, and -C (Shelton et al., J. Neurosci. 15, 477-91 1995!); IL-2 (Landolfi, J. Immunol. 146, 915-19 1991!); IL-10 (Zheng et al., J. Immunol. 154, 5590-5600 1995!).
The simplest and most straightforward immunoadhesin design combines the binding region(s) of the `adhesin` protein with the hinge and Fc regions of an immunoglobulin heavy chain. Ordinarily, when preparing the PTP λ-immunoglobulin chimeras of the present invention, nucleic acid encoding the desired PTP λ polypeptide will be fused C-terminally to nucleic acid encoding the N-terminus of an immunoglobulin constant domain sequence, however N-terminal fusions are also possible. Typically, in such fusions the encoded chimeric polypeptide will retain at least functionally active hinge, CH2 and CH3 domains of the constant region of an immunoglobulin heavy chain. Fusions are also made to the C-terminus of the Fc portion of a constant domain, or immediately N-terminal to the CH1 of the heavy chain or the corresponding region of the light chain. The precise site at which the fusion is made is not critical; particular sites are well known and may be selected in order to optimize the biological activity, secretion or binding characteristics of the PTP λ-immunoglobulin chimeras.
In a preferred embodiment, the sequence of a native, mature PTP λ polypeptide, or a soluble (transmembrane domain-inactivated) form thereof, is fused to the N-terminus of the C-terminal portion of an antibody (in particular the Fc domain), containing the effector functions of an immunoglobulin, e.g. IgG-1. It is possible to fuse the entire heavy chain constant region to the PTP λ sequence. However, more preferably, a sequence beginning in the hinge region just upstream of the papain cleavage site (which defines IgG Fc chemically; residue 216, taking the first residue of heavy chain constant region to be 114 Kobet et al., supra!, or analogous sites of other immunoglobulins) is used in the fusion. In a particularly preferred embodiment, the PTP λ sequence (full length or soluble) is fused to the hinge region and CH2 and CH3 or CH1, hinge, CH2 and CH3 domains of an IgG-1, IgG-2, or IgG-3 heavy chain. The precise site at which the fusion is made is not critical, and the optimal site can be determined by routine experimentation.
In some embodiments, the PTP λ-immunoglobulin chimeras are assembled as multimers, and particularly as homo-dimers or -tetramers (WO 91/08298). Generally, these assembled immunoglobulins will have known unit structures. A basic four chain structural unit is the form in which IgG, IgD, and IgE exist. A four unit is repeated in the higher molecular weight immunoglobulins; IgM generally exists as a pentamer of basic four units held together by disulfide bonds. IgA globulin, and occasionally IgG globulin, may also exist in multimeric form in serum. In the case of multimer, each four unit may be the same or different.
Various exemplary assembled PTP λ-immunoglobulin chimeras within the scope herein are schematically diagramed below:
(a) ACL -ACL ;
(b) ACH - ACH, ACL -ACH, ACL -VH CH, or VL CL -ACH !;
(c) ACL -ACH - ACL -ACH, ACL -VH CH, VL CL -ACH, or VL CL -VH CH !;
(d) ACL -VH CH - ACH, or ACL -VH CH, or VL CL -ACH !;
(e) VL CL -ACH - ACL -VH CH, or VL CL -ACH !; and
(f) A-Y!n - VL CL -VH CH !2,
wherein
each A represents identical or different novel PTP λ polypeptide amino acid sequences;
VL is an immunoglobulin light chain variable domain;
VH is an immunoglobulin heavy chain variable domain;
CL is an immunoglobulin light chain constant domain;
CH is an immunoglobulin heavy chain constant domain;
n is an integer greater than 1;
Y designates the residue of a covalent cross-linking agent.
In the interests of brevity, the foregoing structures only show key features; they do not indicate joining (J) or other domains of the immunoglobulins, nor are disulfide bonds shown. However, where such domains are required for binding activity, they shall be constructed as being present in the ordinary locations which they occupy in the immunoglobulin molecules.
Alternatively, the PTP λ amino acid sequences can be inserted between immunoglobulin heavy chain and light chain sequences such that an immunoglobulin comprising a chimeric heavy chain is obtained. In this embodiment, the PTP λ polypeptide sequences are fused to the 3' end of an immunoglobulin heavy chain in each arm of an immunoglobulin, either between the hinge and the CH2 domain, or between the CH2 and CH3 domains. Similar constructs have been reported by Hoogenboom, H. R. et al., Mol. Immunol. 28, 1027-1037 (1991).
Although the presence of an immunoglobulin light chain is not required in the immunoadhesins of the present invention, an immunoglobulin light chain might be present either covalently associated to a PTP λ-immunoglobulin heavy chain fusion polypeptide, or directly fused to the PTP λ polypeptide. In the former case, DNA encoding an immunoglobulin light chain is typically coexpressed with the DNA encoding the PTP λ-immunoglobulin heavy chain fusion protein. Upon secretion, the hybrid heavy chain and the light chain will be covalently associated to provide an immunoglobulin-like structure comprising two disulfide-linked immunoglobulin heavy chain-light chain pairs. Method suitable for the preparation of such structures are, for example, disclosed in U.S. Pat. No. 4,816,567 issued 28 Mar. 1989.
In a preferred embodiment, the immunoglobulin sequences used in the construction of the immunoadhesins of the present invention are from an IgG immunoglobulin heavy chain constant domain. For human immunoadhesins, the use of human IgG-1 and IgG-3 immunoglobulin sequences is preferred. A major advantage of using IgG-1 is that IgG-1 immunoadhesins can be purified efficiently on immobilized protein A. In contrast, purification of IgG-3 requires protein G, a significantly less versatile medium. However, other structural and functional properties of immunoglobulins should be considered when choosing the Ig fusion partner for a particular immunoadhesin construction. For example, the IgG-3 hinge is longer and more flexible, so it can accommodate larger `adhesin` domains that may not fold or function properly when fused to IgG-1. While IgG immunoadhesins are typically mono- or bivalent, other Ig subtypes like IgA and IgM may give rise to dimeric or pentameric structures, respectively, of the basic Ig homodimer unit. Multimeric immunoadhesins are advantageous in that they can bind their respective targets with greater avidity than their IgG-based counterparts. Reported examples of such structures are CD4-IgM (Traunecker et al., supra); ICAM-IgM (Martin et al., J. Virol. 67, 3561-68 1993!); and CD2-IgM (Arulanandam et al., J. Exp. Med. 177, 1439-50 1993!).
For PTP λ-Ig immunoadhesins, which are designed for in vivo application, the pharmacokinetic properties and the effector functions specified by the Fc region are important as well. Although IgG-1, IgG-2 and IgG-4 all have in vivo half-lives of 21 days, their relative potencies at activating the complement system are different. IgG-4 does not activate complement, and IgG-2 is significantly weaker at complement activation than IgG-1. Moreover, unlike IgG-1, IgG-2 does not bind to Fc receptors on mononuclear cells or neutrophils. While IgG-3 is optimal for complement activation, its in vivo half-life is approximately one third of the other IgG isotypes. Another important consideration for immunoadhesins designed to be used as human therapeutics is the number of allotypic variants of the particular isotype. In general, IgG isotypes with fewer serologically-defined allotypes are preferred. For example, IgG-1 has only four serologically-defined allotypic sites, two of which (G1m and 2) are located in the Fc region; and one of these sites G1m1, is non-immunogenic. In contrast, there are 12 serologically-defined allotypes in IgG-3, all of which are in the Fc region; only three of these sites (G3m5, 11 and 21) have one allotype which is nonimmunogenic. Thus, the potential immunogenicity of a γ3 immunoadhesin is greater than that of a γ1 immunoadhesin.
PTP λ-Ig immunoadhesins are most conveniently constructed by fusing the cDNA sequence encoding the PTP λ portion in-frame to an Ig cDNA sequence. However, fusion to genomic Ig fragments can also be used (see, e.g. Gascoigne et al., Proc. Natl. Acad. Sci. USA 84, 2936-2940 1987!; Aruffo et al., Cell 61, 1303-1313 1990!; Stamenkovic et al., Cell 66, 1133-1144 1991!). The latter type of fusion requires the presence of Ig regulatory sequences for expression. cDNAs encoding IgG heavy-chain constant regions can be isolated based on published sequence from cDNA libraries derived from spleen or peripheral blood lymphocytes, by hybridization or by polymerase chain reaction (PCR) techniques.
Other derivatives comprise the novel peptides of this invention covalently bonded to a nonproteinaceous polymer. The nonproteinaceous polymer ordinarily is a hydrophilic synthetic polymer, i.e. a polymer not otherwise found in nature. However, polymers which exist in nature and are produced by recombinant or in vitro methods are useful, as are polymers which are isolated from nature. Hydrophilic polyvinyl polymers fall within the scope of this invention, e.g. polyvinylalcohol and polyvinylpyrrolidone. Particularly useful are polyvinylalkylene ethers such a polyethylene glycol, polypropylene glycol.
The PTP λ polypeptides may be linked to various nonproteinaceous polymers, such as polyethylene glycol, polypropylene glycol or polyoxyalkylenes, in the manner set forth in U.S. Pat. Nos. 4,640,835; 4,496,689; 4,301,144; 4,670,417; 4,791,192 or 4,179,337.
The PTP λ polypeptides may be entrapped in microcapsules prepared, for example, by coacervation techniques or by interfacial polymerization, in colloidal drug delivery systems (e.g. liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules), or in macroemulsions. Such techniques are disclosed in Remington's Pharmaceutical Sciences, 16th Edition, Oslo, A., Ed. (1980).
H. Anti-PTP λ Antibody Preparation
(i) Polyclonal antibodies
Polyclonal antibodies to a PTP λ molecule generally are raised in animals by multiple subcutaneous (sc) or intraperitoneal (ip) injections of the PTP λ and an adjuvant. It may be useful to conjugate the PTP λ or a fragment containing the target amino acid sequence to a protein that is immunogenic in the species to be immunized, e.g. keyhole limpet hemocyanin, serum albumin, bovine thyroglobulin, or soybean trypsin inhibitor using a bifunctional or derivatizing agent, for example maleimidobenzoyl sulfosuccinimide ester (conjugation through cysteine residues), N-hydroxysuccinimide (through lysine residues), glutaraldehyde, succinic anhydride, SOCl2, or R1 N═C═NR, where R and R1 are different alkyl groups.
Animals are immunized against the immunogenic conjugates or derivatives by combining 1 mg or 1 μg of conjugate (for rabbits or mice, respectively) with 3 volumes of Freud's complete adjuvant and injecting the solution intradermally at multiple sites. One month later the animals are boosted with 1/5 to 1/10 the original amount of conjugate in Freud's complete adjuvant by subcutaneous injection at multiple sites. 7 to 14 days later the animals are bled and the serum is assayed for anti-PTP λ antibody titer. Animals are boosted until the titer plateaus. Preferably, the animal boosted with the conjugate of the same PTP λ, but conjugated to a different protein and/or through a different cross-linking reagent. Conjugates also can be made in recombinant cell culture as protein fusions. Also, aggregating agents such as alum are used to enhance the immune response.
(ii) Monoclonal antibodies
Monoclonal antibodies are obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical except for possible naturally-occurring mutations that may be present in minor amounts. Thus, the modifier "monoclonal" indicates the character of the antibody as not being a mixture of discrete antibodies.
For example, the anti-PTP λ monoclonal antibodies of the present invention may be made using the hybridoma method first described by Kohler & Milstein, Nature 256:495 (1975), or may be made by recombinant DNA methods Cabilly, et al., U.S. Pat. No. 4,816,567!.
DNA encoding the monoclonal antibodies of the invention is readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of murine antibodies). The hybridoma cells of the invention serve as a preferred source of such DNA. Once isolated, the DNA may be placed into expression vectors, which are then transfected into host cells such as simian COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells that do not otherwise produce immunoglobulin protein, to obtain the synthesis of monoclonal antibodies in the recombinant host cells. The DNA also may be modified, for example, by substituting the coding sequence for human heavy and light chain constant domains in place of the homologous murine sequences, Morrison, et al., Proc. Nat. Acad. Sci. 81, 6851 (1984), or by covalently joining to the immunoglobulin coding sequence all or part of the coding sequence for a non-immunoglobulin polypeptide. In that manner, "chimeric" or "hybrid" antibodies are prepared that have the binding specificity of an anti-PTP λ monoclonal antibody herein.
Typically such non-immunoglobulin polypeptides are substituted for the constant domains of an antibody of the invention, or they are substituted for the variable domains of one antigen-combining site of an antibody of the invention to create a chimeric bivalent antibody comprising one antigen-combining site having specificity for a PTP λ polypeptide and another antigen-combining site having specificity for a different antigen.
Chimeric or hybrid antibodies also may be prepared in vitro using known methods in synthetic protein chemistry, including those involving crosslinking agents. For example, immunotoxins may be constructed using a disulfide exchange reaction or by forming a thioether bond. Examples of suitable reagents for this purpose include iminothiolate and methyl-4-mercaptobutyrimidate.
For diagnostic applications, the antibodies of the invention typically will be labeled with a detectable moiety. The detectable moiety can be any one which is capable of producing, either directly or indirectly, a detectable signal. For example, the detectable moiety may be a radioisotope, such as 3 H, 14 C, 32 P, 35 S, or 125 I, a fluorescent or chemiluminescent compound, such as fluorescein isothiocyanate, rhodamine, or luciferin; biotin; radioactive isotopic labels, such as, e.g., 125 I, 32 P, 14 C, or 3 H, or an enzyme, such as alkaline phosphatase, beta-galactosidase or horseradish peroxidase.
Any method known in the art for separately conjugating the antibody to the detectable moiety may be employed, including those methods described by Hunter, et al., Nature 144:945 (1962); David, et al., Biochemistry 13:1014(1974); Pain, et al., J. Immunol. Meth. 40:219 (1981); and Nygren, J. Histochem. and Cytochem. 30:407 (1982).
The antibodies of the present invention may be employed in any known assay method, such as competitive binding assays, direct and indirect sandwich assays, and immunoprecipitation assays. Zola, Monoclonal Antibodies: A Manual of Techniques, pp.147-158 (CRC Press, Inc., 1987).
(iii) Humanized antibodies
Methods for humanizing non-human antibodies are well known in the art. Generally, a humanized antibody has one or more amino acid residues introduced into it from a source which is non-human. These non-human amino acid residues are often referred to as "import" residues, which are typically taken from an "import" variable domain. Humanization can be essentially performed following the method of Winter and co-workers Jones et al., Nature 321, 522-525 (1986); Riechmann et al., Nature 332, 323-327 (1988); Verhoeyen et al., Science 239, 1534-1536 (1988)!, by substituting rodent CDRs or CDR sequence for the corresponding sequences of a human antibody. Accordingly, such "humanized" antibodies are chimeric antibodies (Cabilly, supra), wherein substantially less than an intact human variable domain has been substituted by the corresponding sequence from a non-human species. In practice, humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies.
It is important that antibodies be humanized with retention of high affinity for the antigen and other favorable biological properties. To achieve this goal, according to a preferred method, humanized antibodies are prepared by a process of analysis of the parental sequences and various conceptual humanized products using three dimensional models of the parental and humanized sequences. Three dimensional immunoglobulin models are commonly available and are familiar to those skilled in the art. Computer programs are available which illustrate and display probable three-dimensional conformational structures of selected candidate immunoglobulin sequences. Inspection of these displays permits analysis of the likely role of the residues in the functioning of the candidate immunoglobulin sequence, i.e. the analysis of residues that influence the ability of the candidate immunoglobulin to bind its antigen. In this way, FR residues can be selected and combined from the consensus and import sequence so that the desired antibody characteristic, such as increased affinity for the target antigen(s), is achieved. In general, the CDR residues are directly and most substantially involved in influencing antigen binding. For further details see U.S. application Ser. No. 07/934,373 filed 21 Aug. 1992, which is a continuation-in-part of application Ser. No. 07/715,272 filed 14 Jun. 1991.
Alternatively, it is now possible to produce transgenic animals (e.g. mice) that are capable, upon immunization, of producing a full repertoire of human antibodies in the absence of endogenous immunoglobulin production. For example, it has been described that the homozygous deletion of the antibody heavy chain joining region (JH) gene in chimeric and germ-line mutant mice results in complete inhibition of endogenous antibody production. Transfer of the human germ-line immunoglobulin gene array in such germ-line mutant mice will result in the production of human antibodies upon antigen challenge. See, e.g. Jakobovits et al., Proc. Natl. Acad. Sci. USA 90, 2551-255 (1993); Jakobovits et al., Nature 362, 255-258 (1993).
(iv) Bispecific antibodies
Bispecific antibodies are monoclonal, preferably human or humanized, antibodies that have binding specificities for at least two different antigens. In the present case, one of the binding specificities is for a PTP λ polypeptide, the other one is for any other antigen. Methods for making bispecific antibodies are known in the art.
Traditionally, the recombinant production of bispecific antibodies is based on the coexpression of two immunoglobulin heavy chain-light chain pairs, where the two heavy chains have different specificities (Millstein and Cuello, Nature 305, 537-539 (1983)). Because of the random assortment of immunoglobulin heavy and light chains, these hybridomas (quadromas) produce a potential mixture of 10 different antibody molecules, of which only one has the correct bispecific structure. The purification of the correct molecule, which is usually done by affinity chromatography steps, is rather cumbersome, and the product yields are low. Similar procedures are disclosed in PCT application publication No. WO 93/08829 (published 13 May 1993), and in Traunecker et al., EMBO 10, 3655-3659 (1991).
According to a different and more preferred approach, antibody variable domains with the desired binding specificities (antibody-antigen combining sites) are fused to immunoglobulin constant domain sequences. The fusion preferably is with an immunoglobulin heavy chain constant domain, comprising at least part of the hinge, and second and third constant regions of an immunoglobulin heavy chain (CH2 and CH3). It is preferred to have the first heavy chain constant region (CH1) containing the site necessary for light chain binding, present in at least one of the fusions. DNAs encoding the immunoglobulin heavy chain fusions and, if desired, the immunoglobulin light chain, are inserted into separate expression vectors, and are cotransfected into a suitable host organism. This provides for great flexibility in adjusting the mutual proportions of the three polypeptide fragments in embodiments when unequal ratios of the three polypeptide chains used in the construction provide the optimum yields. It is, however, possible to insert the coding sequences for two or all three polypeptide chains in one expression vector when the expression of at least two polypeptide chains in equal ratios results in high yields or when the ratios are of no particular significance. In a preferred embodiment of this approach, the bispecific antibodies are composed of a hybrid immunoglobulin heavy chain with a first binding specificity in one arm, and a hybrid immunoglobulin heavy chain-light chain pair (providing a second binding specificity) in the other arm. It was found that this asymmetric structure facilitates the separation of the desired bispecific compound from unwanted immunoglobulin chain combinations, as the presence of an immunoglobulin light chain in only one half of the bispecific molecule provides for a facile way of separation. This approach is disclosed in PCT application WO 94/04690 published 3 Mar. 1994.
For further details of generating bispecific antibodies see, for example, Suresh et al., Methods in Enzymology 121, 210 (1986).
(v) Heteroconjugate antibodies
Heteroconjugate antibodies are also within the scope of the present invention. Heteroconjugate antibodies are composed of two covalently joined antibodies. Such antibodies have, for example, been proposed to target immune system cells to unwanted cells (U.S. Pat. No. 4,676,980), and for treatment of HIV infection (PCT application publication Nos. WO 91/00360 and WO 92/200373; EP 03089). Heteroconjugate antibodies may be made using any convenient cross-linking methods. Suitable cross-linking agents are well known in the art, and are disclosed in U.S. Pat. No. 4,676,980, along with a number of cross-linking techniques.
I. Peptide and Non-Peptide Analogs of PTP λ Polypeptides
Peptide analogs of the PTP λ polypeptides of the present invention are modeled based upon the three-dimensional structure of the native polypeptides. Peptides may be synthesized by well known techniques such as the solid-phase synthetic techniques initially described in Merrifield, J. Am. Chem. Soc. 15, 2149-2154 (1963). Other peptide synthesis techniques are, for examples, described in Bodanszky et al., Peptide Synthesis, John Wiley & Sons, 2nd Ed., 1976, as well as in other reference books readily available for those skilled in the art. A summary of peptide synthesis techniques may be found in Stuart and Young, Solid Phase Peptide Synthelia, Pierce Chemical Company, Rockford, Ill. (1984). Peptides may also be prepared by recombinant DNA technology, using a DNA sequence encoding the desired peptide.
In addition to peptide analogs, the present invention also contemplates non-peptide (e.g. organic) compounds which display substantially the same surface as the peptide analogs of the present invention, and therefore interact with other molecules in a similar fashion.
J. Use of the PTP λ Polypeptides
The PTP λ polypeptides of the present invention are useful for a variety of purposes. For example, the PTP λ polypeptides of the present invention are useful in the identification and purification of the PTP λ ligand, for which a possible location is the brain. The purification may be performed by using the native receptor(s) or immunoadhesins, comprising a fusion of the extracellular domain of the receptor(s) to an immunoglobulin heavy chain constant region. The ligands are expected to be useful in the treatment of paralytic-type diseases.
An increased level of expression of the PTP λ receptors of the present invention may be useful in reducing metastasis of various tumors of the lung and other organs. The expression of the receptor may be upregulated by anti-PTP λ antibodies, which are capable of cross-linking and thereby activating the receptors. Non-antibody cross-liking agents may also be employed for this purpose.
The PTP λ polypeptides of the present invention are also useful as molecular markers of the tissues in which they are specifically expressed. As such, the PTP λ polypeptide is useful for tissue typing of specific mammalian tissues.
Native PTP λ polypeptides and their functional equivalents are also useful in screening assays designed to identify agonists or antagonists of native PTP λ polypeptides. Such assays may take the form of any conventional cell-type or biochemical binding assay, and can be performed in a variety of assay formats well known to those skilled in the art. An example is the so called "two-hybrid" assay format using the Matchmaker Two-Hybrid System (Clontech) according to the manufacturers instructions.
The native PTP λ polypeptides of the present invention are also useful as protein molecular weight markers for protein gels.
Nucleic acids encoding the PTP λ polypeptides of the present invention are also useful in providing hybridization probes for searching cDNA and genomic libraries for the coding sequence of other PTP λ polypeptides analogs in other species.
Antagonists of the PTP λ polypeptide of the present invention are useful for inhibiting the biological activity of the enzyme, thereby inhibiting the biological effects of tyrosine dephosphorylation. Agonists of the PTP λ polypeptide are useful for increasing or simulating the biological effects of the native PTP λ polypeptide.
K. Materials and Methods
1. RNA Isolation and Polymerase Chain Reaction
Messenger RNA was isolated from the non-adherent Linlo CD34hi fraction of fetal yolk sac cells (Micro-FastTrack, InVitrogene). Poly A+RNA was reverse transcribed with random hexamers (Promega) and Molony murine Leukemia virus reverse transcriptase (SuperScript II, GIBCO BRL). One quarter of this cDNA was amplified by PCR using degenerate mixed oligonucleotide primers. Sense and anti-sense primers corresponding to the amino acid sequences (H/D)FWRM(I/V)W (SEQ ID NO:5) (5'-A(C/T)TT(C/T)TGG(A/C)GIATG(A/G)TITGG-3') (SEQ ID NO:6) and WPD(F/H)GVP (SEQ ID NO:7) (5'-GGIAC(G/A)(T/A)(G/A)(G/A)TCIG GCCA-3') (SEQ ID NO:8) respectively were used. PCR was carried out in 1×Taq DNA polymerase buffer (GIBCO BRL) plus 0.2 mM of each dNTP, 10% DMSO and 5 units Taq polymerase (GIBCO BRL) for 25 cycles of 94° C. for 1 minute, 55° C. for 1 minute and 72° C. for 1 minute. The PCR products were treated with Klenow enzyme (New England Biolabs) at 30° C. for 30 minutes, cloned into the Smal site of the pRK-5 plasmid (Genentech, Inc.) and subsequently sequenced (Sequenase, USB).
2. Isolation of cDNA clones
Adapter-linked double stranded cDNA was prepared from A+RNA of day-10 mice embryos (Marathon-ready cDNA synthesize kit, Clontech) using either random hexamer or oligo dT primers. Full-length cDNA was isolated by 5' or 3' rapid amplification of cDNA ends (RACE) of the marathon-ready cDNAs. A lambda cDNA library of adult mouse lung was screened following the standard protocol using cDNA fragments isolated by RACE as probes.
3. Bacterial Expression of GST-PTP Fusion Protein
cDNA sequences encoding amino acids 791 to 1436 or amino acids 43 to 741 containing either the cytoplasmic region or the extracellular region of PTP λ was obtained by PCR. PCR fragments were then treated with Sall and Notl restriction enzymes and cloned into the pGEX-4T-1 plasmid (Pharmacia). Fusion proteins were affinity purified using Glutathione sepharose columns (Pharmacia). Polyclonal anti-serum against either the cytoplasmic (Cy) or extracellular (Ex) region was generated by immunizing rabbits with each purified GST-fusion protein.
4. Indirect immunofluorescence of PC-12 Cells
NGF-treated or untreated PC-12 cells grown on cover slips were fixed with 4% formaldehyde and 0.1% Triton X-100 in phosphate-buffered saline (PBS) and permeabilized with 0.05% saponin. Fixed cells were then blocked with 10% normal goat serum plus 0.05% NP40 in PBS, incubated with polyclonal rabbit anti-Cy primary antiserum (1:3000 dilution), washed, and incubated with phycoerytherin (PE)-tagged goat antibody to rabbit immunoglobulin G. Cells were viewed and digital images were taken by fluorescence confocal microscopy.
5. Immunoprecipitation and Tyrosine Phosphatase Assay of PTPλ
PC-12 cells expressing endogenous PTP λ were washed in cold PBS, then lysed in buffer containing 50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, 1 mM benzamidine, 1 mg/ml leupeptin, 1 mg/ml aprotinin, 10 mM NaF, 0.5 mM okadaic acid, 10% (v/v) glycerol, 1% (v/v) Triton X-100, 0.5% (w/v) sodium deoxycholate and 0.01% (w/v) SDS (EMBO J., 13(16):3763-3771 (1994)). Cell lysates were precleared by incubating with 50 ml of washed protein A-Sepharose beads (Pharmacia). Precleared lysate was then incubated with protein A-Sepharose beads pre-coupled with rabbit polyclonal antiserum (20 ml serum/50 ml beads) at 40° C. for 1 5 hours. The protein A-Sepharose/PTP λ immunoprecipitate complex was then processed as described (Jiang et al., Mol. Cell Biol. 13(5):2942-2951 (1993)). Briefly, the complex was washed four times with HNTG buffer (20 mM HEPES, pH 7.5, 150 mM NaCl, 10% glycerol, 0.1% Triton X-100) and once with M7.6 buffer (60 mM Tris-HCl, pH 7.6, 5 mM EDTA, 10 mM DTT, 50 mM NaCl, 50 mg/ml bovine serum albumin). Washed immunoprecipitate complex was resuspended in M7.6 buffer and subject to non-radioactive protein tyrosine phosphatase assay with synthetic oligopeptide substrates (PPS1 corresponds to the hirudin 53-63 C-terminal fragment: Biotin-DGDFEEIPEEY-PO4 (SEQ ID NO:9), PPS2 corresponds to amino acids 1-17 of human gastrin: Biotin-EGPWLEEEEEAY-PO4 (SEQ ID NO:10)). PTPase assay was carried out following the manufacturer's procedures (Tyrosine Phosphatase Assay Kit, Boehringer Mannheim).
6. Northern Analysis
A 2.5 kb cDNA fragment encoding the cytoplasmic region of PTP λ was used to probe the murine multi-tissue northern blots (Clontech) or the A+RNA of PC-12 cells.
7. In Situ Hybridization
Rat E15.5 embryos and P1 brains were immersion fixed overnight at 4° C. in 4% paraformaldehyde, then cryoprotected overnight in 15% sucrose. Adult rat brains were fresh frozen with powdered dry ice. All tissues were sectioned at 16 μm, and processed for in-situ hybridization for PTP λ using 33 P-UTP labeled RNA probes. Sense and antisense probes were synthesized from a 2.5 kb DNA fragment of PTP λ using SP6 or T7 polymerase, respectively.
Further experimental details will be apparent from the following non-limiting examples.
L. EXAMPLES Example 1 Isolation and Characterization of the cDNA encoding PTP λ
In order to isolate novel receptor protein tyrosine phosphatases (PTPs) expressed in murine primitive hematopoietic cells, we undertook the cloning of PCR fragments produced by priming with sequences directed against conserved protein motifs found in PTPs from a number of different genes and species (Dixon, Ann. Ny. Acad. Sci. 766:18-22 (1995)). Analysis of 70 different PCR-derived subclones revealed an array of previously described PTPs, as well as two novel PTPs. One of these novel PTPs, termed PTP HSC, is a member of the PTP PEST family of enzymes, and it has been previously described (Cheng et al., Blood, in press). The second novel PCR fragment was homologous to PTPs κ and μ, both related receptor-type PTPs that mediate homophilic adhesion (Brady-Kalnay et al., Curr. Opin. Cell. Biol. 7(5):650-657 (1995)).
In order to further characterize the cDNA encoding this novel PTP, a combined cloning approach that utilized RACE as well as cloning from phage cDNA libraries was performed. The composite cDNA (SEQ ID NO:1) and derived protein (SEQ ID NO:2) sequences determined from these various clones is shown in FIGS. 1A-1D. The ATG start codon utilized for translation of this large open reading frame was embedded within a consensus Kozak sequence, and there are several translational stop codons upstream of this initiator codon. As can be seen from FIGS. 1A-1D, the protein (SEQ ID NO:2) derived from this cDNA (SEQ ID NO:1) is a large receptor-like molecule of 1,436 amino acids and a molecular weight of approximately 161,176 daltons.
FIGS. 2A-2B illustrate that the novel, hematopoietically-derived PTP-related protein reported here shows a high degree of homology to both PTP κ (˜60%) and PTP μ (˜53%) throughout their entire lengths (Jiang et al., (1993) supra and Gebbink et al., (1991) supra). Because this novel PTP is homologous throughout its entire length to PTPs κ and μ, it appears that the new PTP polypeptide contains MAM, IgG, 4 fibronectin type III, and two cytoplasmically localized phosphatase domains (see FIGS. 2A-2B) (Brady-Kalnay et al., Curr. Opin. Cell. Biol. 7(5):650-657 (1995), Jiang et al., (1993) supra and Gebbink et al., (1991) supra). These homologies with the novel PTP polypeptide are somewhat less than the homology between PTP κ and μ (˜62%), suggesting that the novel PTP polypeptide reported here is rather more distantly related to these two PTPs than they are to each other. These data suggest that this novel PTP is the third member of the homotypically interacting PTP family containing PTPs κ and μ, and we have therefore named the novel receptor PTP λ.
As can be seen from FIG. 3, the relative sequence homologies in each of the domains of these three enzymes suggests that they are indeed closely related. Interestingly, previous data suggested that both the MAM and IgG domains mediated specific homotypic adhesion between PTPs κ and μ (Brady-Kalnay et al., (1994) supra and Zondag et al., (1995) supra), and it is clear from the sequence comparisons between these three related proteins that these two domains are substantially homologous. However, the fact that there are a large number of sequence changes between these two motifs is also consistent with the supposition that they can mediate specific homotypic interactions. Thus, it is likely that, while these motifs are undoubtedly structurally related, differences in their relative sequences are involved with homotypic recognition.
The overall sequence homologies between the three proteins is also relatively high in the FnIII domains, although the homology in the first of these domains is significantly higher than in the others. Previous work has also demonstrated that a juxtamembrane site between the transmembrane domain and the first phosphatase domain is distantly homologous to a similar region in the cadherins (Brady-Kalnay et al., J. Cell. Biol. 130(4):977-986 (1995)), and this site shows a high degree of homology between these three receptors. A high degree of sequence homology is also found between the first PTPase domains of these three receptors, with a somewhat lower level of homology between the second PTPase domains of these proteins. This latter result may be significant, since it has been reported that the first phosphatase domain is the most important enzymatic motif of the dual phosphatase regions in the receptor PTPs (Pot et al., J. Biol. Chem. 266(29):19688-19696 (1991)). The homology between these PTPase domains includes many of the residues previously found to be important for substrate recognition and tyrosine dephosphorylation in the PTP 1B (Jia et al., Science 268(5218):1754-1758 (1995)), although not all of these residues are completely conserved. In summary, the sequence homologies between these three proteins suggest a common ancestor as well as potentially similar functions.
Example 2 Analysis of the Enzymatic Activity of PTP λ
In order to analyze the enzymatic activity of the PTPase domains of the novel PTP λ polypeptide, we immunoprecipitated the enzyme from PC 12 cells which we show below express the protein. In these experiments, a polyclonal antibody directed against the entire cytoplasmic domain as predicted from the cDNA sequence was produced by injecting rabbits with a GST fusion containing this region of the receptor. The immunoprecipitate was incubated with a tyrosine phosphorylated peptide using a commercial kit, and the degree of dephosphorylation was determined using an anti-phosphotyrosine antibody. As is shown in FIG. 4, the immunoprecipitate obtained using the immune serum had clear phosphatase activity, while the preimmune serum immunoprecipitate showed no such activity. In addition, FIG. 4 demonstrates that this enzymatic activity was completely inhibited by the inclusion of vanadate, a potent tyrosine phosphatase inhibitor. Thus, the PTP λ polypeptide encoded by the cDNA (SEQ ID NO:1) described herein and shown in FIGS. 1A-1D is clearly a receptor tyrosine phosphatase protein.
Example 3 Tissue Expression of the PTP λ Transcript
As is shown in FIG. 5, northern blot analysis of fetal as well as adult tissues demonstrates that PTP λ mRNA is expressed in a diversity of tissues outside of the hematopoietic progenitor cells from which it was originally cloned. Thus, the expression of PTP λ mRNA is detected throughout embryonic development beginning in the very early embryo at day 7. Interestingly, analysis of adult organs reveals that the PTP λ transcript is expressed specifically in only a subset of tissues. Thus, there appears to be a very high level of expression of the PTP λ polypeptide in adult brain, lung and kidney, a much decreased level in heart, skeletal muscle and testis, and a lack of obvious expression at this exposure in spleen and liver.
The high level of PTP λ expression in lung and brain, together with the lack of expression in liver, is in contrast to PTP κ, a PTP which is expressed at high levels in liver but is almost undetectable in lung and brain (Jiang et al., (1993) supra). Thus, in spite of the fact that PTP κ was originally isolated from hematopoietic stem cells, there is no obvious expression in two sites which contain hematopoietic cells, the spleen and the liver. The lack of signal in the spleen, an organ which contains mostly mature hematopoietic cells, suggests, therefore, that this receptor may be expressed specifically in earlier hematopoietic progenitor cells. Interestingly, there appears to also be an alternatively spliced transcript in the lung which is not detected in the other two organs that express this receptor at high levels nor in the embryos although the nature of this alternatively spliced transcript remains to be determined. In summary, these data demonstrate that PTP λ is specifically expressed in a subset of adult tissues, some of which are divergent from PTP κ.
Example 4 In Situ Hybridization Analysis
We performed in-situ mRNA analysis of the rat E15.5 embryo, P1 and adult rat brain to determine potential sites of PTP λ production. The results in FIG. 6 shown that extensive PTP λ expression was observed in developing skeletal, epithelial, and neuronal structures throughout the E15.5 embryo. Systemic expression was observed in various developing skeletal elements such as vertebral perichondrium, intervertebral discs, teeth, mandible and maxilla (FIG. 6, Panels A and B). Expression of PTP λ within urogenital structures included the genital tubercle (FIG. 6, Panels A and B), urethra, and urogenital sinus (not shown). Other positive areas of PTP λ expression included the anal canal (not shown), skin, olfactory and oral epithelium, esophagus (FIG. 6, Panels A and B), pituitary (FIG. 6, Panels A, B and C), aura mater (FIG. 6, Panels A, B and D), kidney (FIG. 6, Panels A and B), and lung (FIG. 6, Panels A and B). Higher magnification reveals expression restricted to developing glomeruli in the cortical region of the kidney (FIG. 6, Panels F and G), and bronchiolar epithelium of the lung (FIG. 6, Panels H and I). Within the E15.5 embryonic nervous system, high levels of expression were observed in the developing cerebral cortex (FIG. 6, Panels A and B), floor of the midbrain, choroid plexus primordium, gigantocellular reticular nucleus of the brain stem (FIG. 6, Panels A, B and C), aura mater and spinal cord (FIG. 6, Panels A, B and D). High magnification of the spinal cord reveals highest expression of PTP λ in the ventrolateral motor column (FIG. 6, Panel D).
In P1 and adult brain, expression of PTP λ was localized to regions derived from embryonic anlage that also contained high levels of expression. For instance, expression in the embryonic midbrain preceded the high levels of PTP λ expression in the P1 and adult substantia nigra (FIG. 7, Panels C and E, respectively). Expression in the embryonic forebrain (FIG. 6, Panel A) preceded expression observed in the inner layers of the P1 and adult cortex (FIG. 7, Panels A, B and D, E, respectively). Expression in the choroid plexus primordia of the embryo begets high levels of expression in the P1 brain (FIG. 7, Panel A), and low levels of expression in the adult brain (FIG. 7, Panel D).
In general, PTP λ expression in the adult brain appears to be downregulated relative to the P1 brain (FIG. 7). However, other areas of prominent expression in both P1 and adult brain include piriform cortex and endopiriform nucleus (FIG. 7, Panels A and D, respectively), amygdaloid nuclei, subiculum, and CAT, CA2 and, to a lesser extent, CA3 of the hippocampal formation (FIG. 7, Panels B and E, respectively). The P1 brain also exhibits strong expression throughout the septal area, basal ganglia, thalamus, and midbrain (FIG. 7, Panels A, B and C). Weak expression is observed in the adult superior colliculus as well as scattered expression throughout the thalamus (FIG. 7, Panel E).
Example 5 Expression of PTP λ in PC 12 Cells
The expression of PTP λ in various regions throughout the embryonic, neonatal and adult brain suggested that this receptor might be expressed in PC12 cells, a cell line which is derived from a neural pheochromocytoma. Indeed, the immunoprecipitation experiments described in Example 2 above demonstrated enzymatic activity in anti-PTP λ precipitates derived from these cells. In addition, these cells will differentiate and extend neurites in response to nerve growth factor, so they provided a system to test a possible role for PTP λ in this developmental transition. As is shown in FIG. 8, the novel PTP λ receptor polypeptide is indeed expressed in these neuronal progenitor cells. FIG. 8 also illustrates that treatment of these cells with NGF results in a modest upregulation (˜5 fold) of the transcript encoding this receptor with relatively slow kinetics. These data are thus consistent with a role for this receptor in some aspect of neuronal differentiation in this cell line.
In order to investigate the distribution of PTP λ on PC 12 cells, immunofluorescence was performed using cells that were left untreated or were treated with NGF to induce neurite outgrowth stained with an antibody directed against the cytoplasmic domain of the PTP λ receptor. As is shown in FIG. 9, PTP λ is expressed at significant levels in both treated and untreated cells, confirming the enzymatic analysis shown in FIG. 4 and the northern blot analysis shown in FIG. 8. Perhaps more interesting, however, is the cellular distribution of the PTP λ polypeptide. As FIG. 9 shows, PTP λ is found to be partitioned on the neurites as well as on the growth cone-like structures at the neurite tips. These data are consistent with a role for this receptor in neurite function, perhaps analogous to that recently described for two different Drosophila receptor PTPs (Desai et al., supra and Kreuger et al., supra).
M. Discussion
The relative levels of tyrosine phosphorylation of a diversity of proteins is critical for the regulation of a number of activities during embryonic differentiation and throughout the life of the mammalian organism. The absolute levels of this modification are mediated through the balance of the enzymatic activities of tyrosine kinases with those of the tyrosine phosphatases. In both cases, these large families of proteins perform their roles through conserved enzymatic domains that are coupled to a plethora of specificity-determining motifs. These various motifs are found in the context of both membrane traversing, receptor-like molecules as well as intracellular forms of the enzymes.
The similarities in overall structure of the tyrosine kinases and tyrosine phosphatases suggest that they mediate their relative specific activities through the use of these various domains. In the cases of some of the receptor PTPs, the extracellular motifs are somewhat unusual in that they contain highly glycosylated regions with currently unknown ligand specificity. Alternatively, a subset of these receptor-phosphatases also contain a diversity of domains, including immunoglobulin-like and fibronectin-like, which are associated with cell adhesion and ligand binding activities in other protein families. Among the most interesting of these types of adhesion-associated PTPs are the κ and μ receptors which are involved with homotypic types of interactions. Earlier predictions, based upon the likely function of these receptors in mediating cell adhesion as well as their limited tissue distribution, suggested that there might be other κ and μ-like receptor PTPs with different tissue dispositions. We here report the isolation of the third member of this family of homotypically interacting receptor PTPs, PTP λ, which may be associated with the construction of epithelial and neural structures during development and in the adult.
The strongest data suggesting that the novel PTP λ polypeptide described herein is homologous to the κ and μ receptors lies in the high degree of sequence conservation between these three proteins. Analysis of these three receptors clearly revealed that the novel PTP λ polypeptide of the present invention had a high degree of sequence homology with PTP κ and PTP μ throughout the entire length of the proteins. This homology included the four major types of domains contained in this family including the MAM, the immunoglobulin (IgG), the fibronectin type III (FN III) and the dual phosphatase (PTPase) domains (Jiang et al., (1993) supra and Gebbink et al., (1991) supra). Because previous data have suggested that both the MAM as well as the IgG domain appear to be involved with homotypic adhesion (Brady-Kalnay et al., (1994) supra and Zondag et al., supra), it is likely that these motifs are used for a similar function in PTP λ, a hypothesis that is consistent with a role for this receptor in cell adhesion. However, the degree of sequence homology of these domains between the herein reported PTP λ receptor and the PTP κ and PTP μ receptors is quite divergent, suggesting that the novel receptor may also specifically mediate a homophilic interaction only to itself and not to these domains in the other family members (Zondag et al., supra). As will be discussed below, these results, together with the tissue localization of this receptor, suggest that it may be involved with the formation of very specific edifices during development. It will, of course, be interesting to determine the structural aspects of these domains which are involved with homophilic binding, especially in light of the recent crystallographic analysis of one of the homophilically interacting cadherins (Shapiro et al., Nature 374(6520):327-337 (1995)). While it is difficult to currently interpret the significance of the conservation of the FNIII domains, which may act as spacer domains to extend the functionally critical MAM and IgG domains from the cell surface, the conservation of the dual PTP domains lends itself to some comment. For example, the higher degree of conservation of the first domain as compared to the second substantiates previous work suggesting that the N-terminal PTPase motif is the enzymatically active one, while the C-terminal domain may be involved with the regulation of enzyme activity (Pot et al., supra). We have attempted, without success, to bacterially express enzymatically active forms of the PTPase domains of PTP λ under conditions which gave a high level of activity with another PTP, the PTP HSC (Cheng et al., supra) (J. Cheng and L. Lasky-unpublished observations). These negative data, which of course might be technical, suggest that the PTP λ polypeptide may require an activation event, although it is clear from the immunoprecipitation studies with PC 12 cells that this receptor is endowed with enzymatic activity. Finally, previous data have suggested a role for this category of receptor PTPs in cadherin/catenin regulation, and other investigators have pointed to an intracellular, juxtamembrane site with significant homology to a similarly localized region in the cadherins (Brady-Kalnay et al., Curr. Opin. Cell. Biol. 7(5):650-657 (1995) and Brady-Kalnay et al., J. Cell. Biol. 130(4):977-986 (1995)). We have also found a very high degree of sequence conservation in this region, again consistent with a potential role for this domain in cadherin interactions. In summary, the data reported here are consistent with PTP λ being the third member of the homotypically interacting receptor PTP family.
The in situ hybridization analysis of the expression of PTP λ in the developing embryo and adult suggest some potentially important hypotheses. The expression of this receptor in a diversity of developing skeletal areas as well as in epithelial sites which line various organ systems with a layer of these cells, coupled with the proposed role for PTP μ (Brady-Kalnay et al., Curr. Opin. Cell. Biol. 7(5):650-657 (1995) and Brady-Kalnay et al., J. Cell. Biol. 130(4):977-986 (1995)), and potentially PTP κ, in the control of cadherin adhesion suggests that the novel PTP λ might be involved in a similar type of adhesion control in the developing embryo. For example, the development of epithelial layers in the lung bronchioles and kidney glomeruli requires that a sheet of epithelial cells that is one cell thick be constructed. Thus, as the cells grow and migrate during embryogenesis, they would require a mechanism where they sensed the location of other epithelial cells that were in contact with them, so that this cellular contiguity initiated an adhesive response that inhibited further epithelial movement via the enhancement of cell adhesion. One mechanism that would provide for such a sensing phenomenon would be that proposed by Tonks and colleagues (Brady-Kalnay et al., Curr. Opin. Cell. Biol. 7(5):650-657 (1995) and Brady-Kalnay et al., J. Cell. Biol. 130(4):977-986 (1995)). In this hypothesis, the μ receptor PTP comes into homophilic contact with another μ receptor PTP on an adjacent cell, and this contact upregulates cadherin-mediated adhesion through the dephosphorylation of the cadherin/catenin complex. The formation of single cell-thick epithelial structures in these embryonic organs could be mediated by a similar type of sensing mechanism using PTP κ. The expression of this receptor PTP in bone forming chondrocytes would also be expected to perform a similar type of sensing and adhesion function to assemble these structures, although this type of anatomy, which is more complex than the thin-walled epithelial-like morphology described above, would be expected to involve more elaborate types of sensing and adhesive mechanisms. Finally, because many common types of tumors of the lung and other organs involve epithelial cells, it is possible that disruptions in the proposed function of this type of adhesion sensing mechanism might be involved with the disorganized morphology and high rate of metastasis of these tumors (Kemler, supra and Beherens et al., supra). Together, these hypotheses suggest a critical role for PTP λ in the formation of various epithelial-like structures in the embryo.
Recent data from the Drosophila system also suggest interesting possibilities for the function of PTP λ in the developing nervous system (Desai et al., supra and Kreuger et al., supra). In these reports, three different Drosophila receptor PTPs, termed DPTP69D, DPTP99A and DLAR, which all contain IgG and fibronectin type III adhesion domains similar to those found in PTP λ, were shown to be critically involved with neuronal pathfinding in the developing nervous systems. Thus, mutations in either of these receptors resulted in a loss of the ability of certain neural subsets to become reoriented during their formation in the embryo. Because PTP λ is expressed in a number of developing neural sites, it is possible that it plays a similar role in the pathfinding of nerves in mammals. Thus, the expression of this PTP in the developing midbrain, forebrain, and other neural sites would dispose it to function as a mediator of pathfinding in these maturing systems. Interestingly, the expression of this receptor in these embryonic anlage was confirmed by expression in the adult sites which arise from these embryonic structures. However, the expression in the adult appeared to be somewhat reduced as compared to that observed in the embryo, and it was far more organized. These data suggest that this enzyme might be utilized during adult neuronal formation, although the apparent decrease in adult expression suggests a potentially more critical role during embryogenesis. The observed expression of this receptor in neuronal progenitor PC 12 cells, coupled with the upregulation of the transcript during neurite formation in response to NGF in these cells, also agrees with a role for this receptor PTP during neural pathfinding. Indeed, the observation that this PTP is expressed on neurites as well as on the growth-cone like structures at the tips of these processes is consistent with a potential role for this receptor in neuronal pathfinding in the mammalian nervous system. However, the relatively slow kinetics of upregulation suggest that this may be a late function. Finally, while the clear observation of the loss of pathfinding in Drosophila will be difficult to recapitulate in the mouse, due to the relatively high complexity of the mammalian nervous system, it will nevertheless be potentially of interest to examine the formation of the nervous system in animals which have been made null for the expression of this receptor.
In summary, the data reported herein demonstrate the existence of a third member of the family of receptor PTPs, PTP λ, that appear to be involved with homotypic adhesion and, potentially, cadherin mediated organ formation. The role that this novel receptor might play in the formation of epithelial sheets and neuronal structures remains to be determined. However, the existence of three of these types of receptors further suggests that this growing family may be involved with the specific formation of various types of complex structures during development as well as in the adult.
N. Concluding Remarks
The foregoing description details specific methods which can be employed to practice the present invention. Having detailed such specific methods, those skilled in the art will well enough known how to devise alternative reliable methods at arriving at the same information in using the fruits of the present invention. Thus, however, detailed the foregoing may appear in text, it should not be construed as limiting the overall scope thereof; rather, the ambit of the present invention is to be determined only by the lawful construction of the appended claims. All documents cited herein are expressly incorporated by reference.
__________________________________________________________________________
SEQUENCE LISTING                                                          
(1) GENERAL INFORMATION:                                                  
(iii) NUMBER OF SEQUENCES: 10                                             
(2) INFORMATION FOR SEQ ID NO:1:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 5769 base pairs                                               
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(ix) FEATURE:                                                             
(A) NAME/KEY: CDS                                                         
(B) LOCATION: 379..4686                                                   
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:                                   
GTTGACTACTCAGCTGCCAGAACATCCAATCTGGCTCCTGCAACTTTAGACCAACATATT60            
GTGTTTGATCTTCTCCTGAACAACTTGGGAGATACGTCTGATCTTCAGCTTGGTACATAC120           
AGTTGCGCAGTGAATGGCACTTACGTGTTCATTGTGCACATGCTAAAGCTGGCATGATTA180           
ATGTTCGACTGCTATGTCAACCTGATTAACAATGAGGATGTCTTGGTGTCAGCTATGCCA240           
ACGATGGTGCTCCAGACCGGCGCCAGTCCCGCTCCGCGCGGCACTGTCCACTACGGCTCC300           
CGCTCGCCTTGGGCTCCCGGTCGGGCTCCGGAGGCGTCGCCTCCCCAGCTGCGGGTCTCC360           
AGGACCTAGGCGGCGGCCATGGCCCGGGCTCAGGCTCTGGTCCTGGCGCTC411                    
MetAlaArgAlaGlnAlaLeuValLeuAlaLeu                                         
1510                                                                      
ACCTTCCAGTTCTGCGCGCCTGAGACCGAGACTCCCGCAGCTGGCTGC459                       
ThrPheGlnPheCysAlaProGluThrGluThrProAlaAlaGlyCys                          
152025                                                                    
ACCTTCGAGGAGGCGAGTGACCCGGTCGTGCCCTGCGAGTTCAGCCAG507                       
ThrPheGluGluAlaSerAspProValValProCysGluPheSerGln                          
303540                                                                    
GCTCAGTATGACGACTTCCAATGGGAGCAAGTGCGGATCCACCCCGGC555                       
AlaGlnTyrAspAspPheGlnTrpGluGlnValArgIleHisProGly                          
455055                                                                    
ACCCGGACCCCTGAAGACCTGCCCCATGGTGCCTACTTGATGGTCAAT603                       
ThrArgThrProGluAspLeuProHisGlyAlaTyrLeuMetValAsn                          
60657075                                                                  
GCTTCTCAGCATACCCCAGGTCAGAGGGCCCACATCATCTTCCAGACC651                       
AlaSerGlnHisThrProGlyGlnArgAlaHisIleIlePheGlnThr                          
808590                                                                    
CTGAGCGAGAACGACACCCATTGTGTGCAGTTCAGCTACTTCCTGTAC699                       
LeuSerGluAsnAspThrHisCysValGlnPheSerTyrPheLeuTyr                          
95100105                                                                  
AGCAGGGATGGGCACAGCCCAGGCACCCTGGGGGTCTACGTGCGCGTG747                       
SerArgAspGlyHisSerProGlyThrLeuGlyValTyrValArgVal                          
110115120                                                                 
AATGGGGGCCCTCTGGGCAGTGCCGTGTGGAATATGACCGGATCCCAC795                       
AsnGlyGlyProLeuGlySerAlaValTrpAsnMetThrGlySerHis                          
125130135                                                                 
GGCCGTCAGTGGCACCAGGCTGAGCTGGCTGTCAGCACCTTCTGGCCC843                       
GlyArgGlnTrpHisGlnAlaGluLeuAlaValSerThrPheTrpPro                          
140145150155                                                              
AATGAGTWTCAGGTGCTGTTTGAGGCCCTCATCTCCCCAGACCACAAG891                       
AsnGluXaaGlnValLeuPheGluAlaLeuIleSerProAspHisLys                          
160165170                                                                 
GGCTACATAGGCTTAGACGACATCTTGCTCTTCAGCTATCCCTGCGCA939                       
GlyTyrIleGlyLeuAspAspIleLeuLeuPheSerTyrProCysAla                          
175180185                                                                 
AAGGCCCCTCACTTCTCCCGCCTTGGGGACGTGGAGGTCAATGCAGGC987                       
LysAlaProHisPheSerArgLeuGlyAspValGluValAsnAlaGly                          
190195200                                                                 
CAGAACGCATCCTTCCAATGCATGGCAGCAGGCAGAGCCGCAGAGGCA1035                      
GlnAsnAlaSerPheGlnCysMetAlaAlaGlyArgAlaAlaGluAla                          
205210215                                                                 
GAACACTTCTTCCTGCAGCGTCAGAGTGGAGTGCTGGTGCCTGCGGCC1083                      
GluHisPhePheLeuGlnArgGlnSerGlyValLeuValProAlaAla                          
220225230235                                                              
GGGGTGCGGCACATCAGTCACCGTCGCTTCCTGGCCACTTTTCCGCTG1131                      
GlyValArgHisIleSerHisArgArgPheLeuAlaThrPheProLeu                          
240245250                                                                 
GCCTCGGTAGGCCGCTCAGAGCAGGATCTGTACCGTTGCGTGTCCCAG1179                      
AlaSerValGlyArgSerGluGlnAspLeuTyrArgCysValSerGln                          
255260265                                                                 
GCCCCGCGTGGTGCTGGCGTCTCCAACTTTGCAGAGCTCATCGTCAAA1227                      
AlaProArgGlyAlaGlyValSerAsnPheAlaGluLeuIleValLys                          
270275280                                                                 
GAGCCTCCCACCCCCATCGCGCCCCCACAGCTGCTGCGTGCAGGCCCC1275                      
GluProProThrProIleAlaProProGlnLeuLeuArgAlaGlyPro                          
285290295                                                                 
ACCTACCTCATTATCCAGCTCAACACCAACTCCATCATTGGCGACGGG1323                      
ThrTyrLeuIleIleGlnLeuAsnThrAsnSerIleIleGlyAspGly                          
300305310315                                                              
CCGATCGTGCGCAAGGAGATCGAGTACCGCATGGCACGGGGCCCGTGG1371                      
ProIleValArgLysGluIleGluTyrArgMetAlaArgGlyProTrp                          
320325330                                                                 
GCCGAGGTGCACGCTGTCAACCTGCARACCTACAAGCTGTGGCATCTG1419                      
AlaGluValHisAlaValAsnLeuXaaThrTyrLysLeuTrpHisLeu                          
335340345                                                                 
GACCCAGACACTGAGTATGAAATCAGCGTGCTGCTCACACGCCCGGGA1467                      
AspProAspThrGluTyrGluIleSerValLeuLeuThrArgProGly                          
350355360                                                                 
GATGGAGGCACAGGCCGCCCTGGGCCACCACTGATCAGCCGGACCAAG1515                      
AspGlyGlyThrGlyArgProGlyProProLeuIleSerArgThrLys                          
365370375                                                                 
TGCGCAGAGCCCACGAGGGCCCCCAAAGGTCTGGCTTTTGCTGAGATC1563                      
CysAlaGluProThrArgAlaProLysGlyLeuAlaPheAlaGluIle                          
380385390395                                                              
CAGGCTCGCCAGCTGACCCTGCAGTGGGAGCCCCTGGGCTATAATGTC1611                      
GlnAlaArgGlnLeuThrLeuGlnTrpGluProLeuGlyTyrAsnVal                          
400405410                                                                 
ACACGTTGTCATACCTACGCTGTGTCCCTTTGCTATCGCTACACCCTG1659                      
ThrArgCysHisThrTyrAlaValSerLeuCysTyrArgTyrThrLeu                          
415420425                                                                 
GGCGGCAGCCACAACCAGACCATCCGGGAGTGTGTGAAGATGGAGCGG1707                      
GlyGlySerHisAsnGlnThrIleArgGluCysValLysMetGluArg                          
430435440                                                                 
GGTGCCAGCCGCTACACCATCAAGAATCTGCTGCCATTCAGAAACATC1755                      
GlyAlaSerArgTyrThrIleLysAsnLeuLeuProPheArgAsnIle                          
445450455                                                                 
CACGTGCGTCTGATTCTCACAAACCCTGAGGGGCGCAAGGAGGGCAAG1803                      
HisValArgLeuIleLeuThrAsnProGluGlyArgLysGluGlyLys                          
460465470475                                                              
GAGGTCACCTTCCAGACAGATGAAGATGTGCCTGGTGGGATTGCAGCT1851                      
GluValThrPheGlnThrAspGluAspValProGlyGlyIleAlaAla                          
480485490                                                                 
GAGTCCCTAACCTTCACTCCACTGGAGGACATGATCTTTCTCAAGTGG1899                      
GluSerLeuThrPheThrProLeuGluAspMetIlePheLeuLysTrp                          
495500505                                                                 
GAGGAGCCCCAGGAGCCCAATGGCCTCATCACTCAGTATGAGATCAGC1947                      
GluGluProGlnGluProAsnGlyLeuIleThrGlnTyrGluIleSer                          
510515520                                                                 
TACCAAAGCATTGAGTCCTCAGACCCAGCAGTGAACGTGCCCGGCCCG1995                      
TyrGlnSerIleGluSerSerAspProAlaValAsnValProGlyPro                          
525530535                                                                 
AGACGCACCATCTCCAAACTCCGGAATGAGACTTACCACGTCTTCTCC2043                      
ArgArgThrIleSerLysLeuArgAsnGluThrTyrHisValPheSer                          
540545550555                                                              
AACCTGCATCCCGGCACCACGTATCTGTTCTCCGTGCGTGCTCGGACG2091                      
AsnLeuHisProGlyThrThrTyrLeuPheSerValArgAlaArgThr                          
560565570                                                                 
AGCAAGGGCTTCGGCCAGGCGGCTCTCACTGAGATAACCACCAACATC2139                      
SerLysGlyPheGlyGlnAlaAlaLeuThrGluIleThrThrAsnIle                          
575580585                                                                 
TCAGCTCCCAGCTTTGATTATGCCGACATGCCGTCACCCCTGGGCGAG2187                      
SerAlaProSerPheAspTyrAlaAspMetProSerProLeuGlyGlu                          
590595600                                                                 
TCCGAGAACACCATCACTGTGCTGTTGAGGCCGGCCCAGGGCCGAGGA2235                      
SerGluAsnThrIleThrValLeuLeuArgProAlaGlnGlyArgGly                          
605610615                                                                 
GCCCCCATCAGCGTCTACCAGGTGGTTGTGGAGGAAGAGCGGCCACGG2283                      
AlaProIleSerValTyrGlnValValValGluGluGluArgProArg                          
620625630635                                                              
CGCTTGCGGCGGGAGCCCGGAGCTCAGGACTGCTTCTCGGTACCTCTG2331                      
ArgLeuArgArgGluProGlyAlaGlnAspCysPheSerValProLeu                          
640645650                                                                 
ACCTTTGAGACGGCCCTGGCTCGCGGCCTGGTGCACTACTTTGGGGCT2379                      
ThrPheGluThrAlaLeuAlaArgGlyLeuValHisTyrPheGlyAla                          
655660665                                                                 
GAACTGGCTGCCAGCAGCCTGCTTGAGGCCATGCCCTTCACCGTGGGT2427                      
GluLeuAlaAlaSerSerLeuLeuGluAlaMetProPheThrValGly                          
670675680                                                                 
GACAACCAGACCTATCGTGGCTTCTGGAACCCACCGCTTGAGCCCAGA2475                      
AspAsnGlnThrTyrArgGlyPheTrpAsnProProLeuGluProArg                          
685690695                                                                 
AAGGCCTATCTCATCTATTTCCAGGCAGCAAGCCACCTGAAAGGGGAA2523                      
LysAlaTyrLeuIleTyrPheGlnAlaAlaSerHisLeuLysGlyGlu                          
700705710715                                                              
ACCCGACTGAACTGCATCCGAATTGCCAGGAAAGCTGCGTGCAAGGAG2571                      
ThrArgLeuAsnCysIleArgIleAlaArgLysAlaAlaCysLysGlu                          
720725730                                                                 
AGCAAGCGACCCCTCGAAGTGTCCCAGAGATCGGAGGAGATGGGGCTC2619                      
SerLysArgProLeuGluValSerGlnArgSerGluGluMetGlyLeu                          
735740745                                                                 
ATCCTGGGCATCTGTGCAGGTGGTCTTGCCGTCCTCATTCTCCTCCTG2667                      
IleLeuGlyIleCysAlaGlyGlyLeuAlaValLeuIleLeuLeuLeu                          
750755760                                                                 
GGGGCCATCATTGTCATCATCCGCAAAGGGAAGCCAGTGAACATGACG2715                      
GlyAlaIleIleValIleIleArgLysGlyLysProValAsnMetThr                          
765770775                                                                 
AAAGCCACGGTCAACTACCGCCAGGAGAAGACTCACATGATGAGTGCC2763                      
LysAlaThrValAsnTyrArgGlnGluLysThrHisMetMetSerAla                          
780785790795                                                              
GTGGACCGCAGCTTCACAGATCAGAGTACTCTGCAGGAGGATGAGCGG2811                      
ValAspArgSerPheThrAspGlnSerThrLeuGlnGluAspGluArg                          
800805810                                                                 
TTGGGTCTGTCCTTTATGGATGCTCCTGGCTATAGTCCTCGTGGAGAC2859                      
LeuGlyLeuSerPheMetAspAlaProGlyTyrSerProArgGlyAsp                          
815820825                                                                 
CAGCGAAGCGGTGGTGTCACCGAGGCCAGCAGCCTCCTGGGGGGTTCT2907                      
GlnArgSerGlyGlyValThrGluAlaSerSerLeuLeuGlyGlySer                          
830835840                                                                 
CCAAGGCGCCCATGCGGCCGGAAGGGTTCTCCGTATCATACCGGGCAG2955                      
ProArgArgProCysGlyArgLysGlySerProTyrHisThrGlyGln                          
845850855                                                                 
CTCCACCCTGCAGTCCGAGTGGCTGACCTTCTACAGCACATCAACCAG3003                      
LeuHisProAlaValArgValAlaAspLeuLeuGlnHisIleAsnGln                          
860865870875                                                              
ATGAAGACAGCCGAGGGCTACGGCTTCAAGCAGGAGTACGAGAGTTTC3051                      
MetLysThrAlaGluGlyTyrGlyPheLysGlnGluTyrGluSerPhe                          
880885890                                                                 
TTTGAGGGCTGGGACGCCACCAAGAAGAAAGACAAGCTCAAGGGCGGC3099                      
PheGluGlyTrpAspAlaThrLysLysLysAspLysLeuLysGlyGly                          
895900905                                                                 
CGACAGGAGCCAGTGTCTGCCTATGATCGACACCATGTGAAACTACAC3147                      
ArgGlnGluProValSerAlaTyrAspArgHisHisValLysLeuHis                          
910915920                                                                 
CCGATGCTGGCAGACCCTGATGCCGACTACATCTCTGCCAACTACATA3195                      
ProMetLeuAlaAspProAspAlaAspTyrIleSerAlaAsnTyrIle                          
925930935                                                                 
GACGGCTACCACAGGTCAAACCACTTCATAGCCACTCAAGGGCCAAAG3243                      
AspGlyTyrHisArgSerAsnHisPheIleAlaThrGlnGlyProLys                          
940945950955                                                              
CCTGAGATGATCTACGATTTCTGGCGCATGGTGTGGCAGGAACAGTGT3291                      
ProGluMetIleTyrAspPheTrpArgMetValTrpGlnGluGlnCys                          
960965970                                                                 
GCGAGCATCGTCATGATCACCAAGCTGGTAGAGGTGGGCAGGGTGAAG3339                      
AlaSerIleValMetIleThrLysLeuValGluValGlyArgValLys                          
975980985                                                                 
TGTTCTCGCTACTGGCCTGAGGACTCAGACATGTATGGGGACATCAAG3387                      
CysSerArgTyrTrpProGluAspSerAspMetTyrGlyAspIleLys                          
9909951000                                                                
ATCACGCTGGTAAAGACAGAGACACTGGCTGAGTATGTGGTGCGCACC3435                      
IleThrLeuValLysThrGluThrLeuAlaGluTyrValValArgThr                          
100510101015                                                              
TTTGCCCTGGAGCGGAGAGGTTACTCAGCCCGGCATGAGGTCCGCCAG3483                      
PheAlaLeuGluArgArgGlyTyrSerAlaArgHisGluValArgGln                          
1020102510301035                                                          
TTCCATTTCACAGCGTGGCCAGAGCATGGTGTCCCCTACCACGCCACG3531                      
PheHisPheThrAlaTrpProGluHisGlyValProTyrHisAlaThr                          
104010451050                                                              
GGGCTGCTGGCCTTCATCCGGCGTGTGAAGGCTTCCACTCCACCTGAT3579                      
GlyLeuLeuAlaPheIleArgArgValLysAlaSerThrProProAsp                          
105510601065                                                              
GCCGGGCCCATTGTCATTCACTGCAGTGCAGGAACTGGCCGCACAGGC3627                      
AlaGlyProIleValIleHisCysSerAlaGlyThrGlyArgThrGly                          
107010751080                                                              
TGCTACATCGTCCTGGATGTGATGCTGGACATGGCTGAATGTGAGGGG3675                      
CysTyrIleValLeuAspValMetLeuAspMetAlaGluCysGluGly                          
108510901095                                                              
GTCGTGGACATTTACAACTGTGTGAAGACCCTCTGTTCCCGACGGGTC3723                      
ValValAspIleTyrAsnCysValLysThrLeuCysSerArgArgVal                          
1100110511101115                                                          
AACATGATCCAGACGGAGGAACAATATATCTTCATCCACGATGCAATC3771                      
AsnMetIleGlnThrGluGluGlnTyrIlePheIleHisAspAlaIle                          
112011251130                                                              
TTGGAGGCCTGCCTGTGTGGGGAGACCACCATCCCTGTCAACGAGTTC3819                      
LeuGluAlaCysLeuCysGlyGluThrThrIleProValAsnGluPhe                          
113511401145                                                              
AGGGCCACCTACAGGGAGATGATCCGCATTGACCCTCAGAGCAATTCC3867                      
ArgAlaThrTyrArgGluMetIleArgIleAspProGlnSerAsnSer                          
115011551160                                                              
TCCCAGCTTCGGGAAGAGTTCCAGACGCTGAACTCGGTCACGCCGCCG3915                      
SerGlnLeuArgGluGluPheGlnThrLeuAsnSerValThrProPro                          
116511701175                                                              
CTGGATGTGGAGGAGTGTAGCATTGCCCTGCTGCCCCGGAATCGAGAC3963                      
LeuAspValGluGluCysSerIleAlaLeuLeuProArgAsnArgAsp                          
1180118511901195                                                          
AAGAACCGTAGCATGGATGTGCTGCCACCAGACCGCYGCCTGCCCTTC4011                      
LysAsnArgSerMetAspValLeuProProAspArgXaaLeuProPhe                          
120012051210                                                              
CTCATCTCCAGTGATGGGGACCCCAATAACTACATCAATGCAGCACTG4059                      
LeuIleSerSerAspGlyAspProAsnAsnTyrIleAsnAlaAlaLeu                          
121512201225                                                              
ACTGACAGCTACACACGGAGCGCCGCCTTCATCGTGACCCTGCACCCG4107                      
ThrAspSerTyrThrArgSerAlaAlaPheIleValThrLeuHisPro                          
123012351240                                                              
CTGCAGAGTACCACGCCCGACTTCTGGCGGCTGGTCTACGACTACGGG4155                      
LeuGlnSerThrThrProAspPheTrpArgLeuValTyrAspTyrGly                          
124512501255                                                              
TGCACCTCCATCGTCATGCTGAACCAACTTAACCAGTCCAACTCCGCC4203                      
CysThrSerIleValMetLeuAsnGlnLeuAsnGlnSerAsnSerAla                          
1260126512701275                                                          
TGGCCCTGCTTGCAGTACTGGCCGGAGCCAGGCCGACAGCAGTATGGG4251                      
TrpProCysLeuGlnTyrTrpProGluProGlyArgGlnGlnTyrGly                          
128012851290                                                              
CTCATGGAGGTGGAGTTTGTGTCTGGCACAGCAAACGAGGATTTGGTG4299                      
LeuMetGluValGluPheValSerGlyThrAlaAsnGluAspLeuVal                          
129513001305                                                              
TCCCGAGTGTTCCGGGTGCAGAACTCTTCTCGGCTGCAGGAGGGTCAC4347                      
SerArgValPheArgValGlnAsnSerSerArgLeuGlnGluGlyHis                          
131013151320                                                              
CTGCTGGTACGGCACTTCCAGTTTCTGCGTTGGTCTGCTTATCGGGAC4395                      
LeuLeuValArgHisPheGlnPheLeuArgTrpSerAlaTyrArgAsp                          
132513301335                                                              
ACGCCTGACTCCAGGAAGGCCTTTCTGCACCTGTTGGCTGAGGTGGAC4443                      
ThrProAspSerArgLysAlaPheLeuHisLeuLeuAlaGluValAsp                          
1340134513501355                                                          
AAGTGGCAGGCAGAGAGTGGGGATGGGCGCACCGTGGTGCATTGTCTC4491                      
LysTrpGlnAlaGluSerGlyAspGlyArgThrValValHisCysLeu                          
136013651370                                                              
AACGGGGGTGGCCGCAGTGGCACCTTCTGCGCCTGTGCCACGGTCTTG4539                      
AsnGlyGlyGlyArgSerGlyThrPheCysAlaCysAlaThrValLeu                          
137513801385                                                              
GAGATGATCCGCTGTCACAGCCTGGTGGATGTTTTCTTTGCTGCCAAA4587                      
GluMetIleArgCysHisSerLeuValAspValPhePheAlaAlaLys                          
139013951400                                                              
ACACTTCGGAACTACAAGCCCAATATGGTGGAGACCATGGATCAGTAT4635                      
ThrLeuArgAsnTyrLysProAsnMetValGluThrMetAspGlnTyr                          
140514101415                                                              
CATTTCTGCTACGACGTGGCCCTGGAGTACCTGGAGGCTCTGGAGTTG4683                      
HisPheCysTyrAspValAlaLeuGluTyrLeuGluAlaLeuGluLeu                          
1420142514301435                                                          
AGATAGCAGGCGCCTGACCTGGGGCACCCAGTGAACACCCAGGGCATGGCCCA4736                 
Arg                                                                       
TCATCCCAGATGARGAGGGCCTGTGGCCCCAACTTTGCTCAGCCATAATTCCACAGGGAC4796          
AACACTGGAACGGACGGACACTGCACCATCTTGGTGACCCCCACGGGAAGGCTGCAGGCC4856          
AAGGAGAAGCTTTGCAAGACTGTATCAGCCCCACCTCTAGAGGGCCCTGCAGACCTGTGC4916          
AGAGAAGCTCGCCTGGACCAAAATAGCTAGTGCTGGAGAGCACAGGCCAGGCCCCTCTGC4976          
TCCATCACAGTCCTTGGCCAGAAATGAATGAGTGTCTGCAGAGAGCACCCATGGTTTGCA5036          
CCCAGTATGGTCCTTTCTGCACGTGGTGGAGGCTCACTGGGACTTGGCAGGGGCTGAGTC5096          
CCCGAGAGTCCTGAAGCTGGGACTCTTCCCCGTCTCGCCGGTGGGACCCGCTGAGCATCC5156          
TGCAGCTCCATTCTCCATCCCCACTGCCCCTACAGACCTGGGGTGCTTTGCTCGCTTTCC5216          
TCCTGCTTCTGAGCTTTTCCTGCAACAGGACCCGTGCCTCCTTCCTGGGCTCCATCCCTG5276          
CCTGGCCCAGTATATGCAGAATGATATACTTCAGCTCCTTCTTCCCCTGGCCTTTGGGTC5336          
TCCATGGTTCAGTCCTGCTCAGCTTGGGCCTGTGACAATCCACAAGGCTGAATCACAGCC5396          
CCTGGGGTTGAGGTCCCTGTGGCTCTTGGTGAGGCTGCCACTGGATCGGGGCAGGCTAGA5456          
ACAGGGCTGGTGTCAGCTCCTAGAGTACAGAGGAAGAAGGGATACTTTGGAATGGAGGAC5516          
CAGTGCTTTTTTTGTTGTTGTTATTTTGTTATTTTTTTGATGGGAGGGTGGGAAGTTCTC5576          
TTTATAATGGGGTAGGCCACACCCCCATTTCGTGCCTCAATTTCCCCATCTGTAAACTGT5636          
AGATATGACTACTGACCTACCTCACAGGGGGCTGTGGGGAGGTGTAAGGTAATGTTTGTA5696          
AAGCGCTTTGTAAATAAATGTGCTCTCTGAATGCCAAAAAAAAAAAAAAAAAAAAAAAAA5756          
AAAAAAAAAAAAA5769                                                         
(2) INFORMATION FOR SEQ ID NO:2:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 1436 amino acids                                              
(B) TYPE: amino acid                                                      
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: protein                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:                                   
MetAlaArgAlaGlnAlaLeuValLeuAlaLeuThrPheGlnPheCys                          
151015                                                                    
AlaProGluThrGluThrProAlaAlaGlyCysThrPheGluGluAla                          
202530                                                                    
SerAspProValValProCysGluPheSerGlnAlaGlnTyrAspAsp                          
354045                                                                    
PheGlnTrpGluGlnValArgIleHisProGlyThrArgThrProGlu                          
505560                                                                    
AspLeuProHisGlyAlaTyrLeuMetValAsnAlaSerGlnHisThr                          
65707580                                                                  
ProGlyGlnArgAlaHisIleIlePheGlnThrLeuSerGluAsnAsp                          
859095                                                                    
ThrHisCysValGlnPheSerTyrPheLeuTyrSerArgAspGlyHis                          
100105110                                                                 
SerProGlyThrLeuGlyValTyrValArgValAsnGlyGlyProLeu                          
115120125                                                                 
GlySerAlaValTrpAsnMetThrGlySerHisGlyArgGlnTrpHis                          
130135140                                                                 
GlnAlaGluLeuAlaValSerThrPheTrpProAsnGluXaaGlnVal                          
145150155160                                                              
LeuPheGluAlaLeuIleSerProAspHisLysGlyTyrIleGlyLeu                          
165170175                                                                 
AspAspIleLeuLeuPheSerTyrProCysAlaLysAlaProHisPhe                          
180185190                                                                 
SerArgLeuGlyAspValGluValAsnAlaGlyGlnAsnAlaSerPhe                          
195200205                                                                 
GlnCysMetAlaAlaGlyArgAlaAlaGluAlaGluHisPhePheLeu                          
210215220                                                                 
GlnArgGlnSerGlyValLeuValProAlaAlaGlyValArgHisIle                          
225230235240                                                              
SerHisArgArgPheLeuAlaThrPheProLeuAlaSerValGlyArg                          
245250255                                                                 
SerGluGlnAspLeuTyrArgCysValSerGlnAlaProArgGlyAla                          
260265270                                                                 
GlyValSerAsnPheAlaGluLeuIleValLysGluProProThrPro                          
275280285                                                                 
IleAlaProProGlnLeuLeuArgAlaGlyProThrTyrLeuIleIle                          
290295300                                                                 
GlnLeuAsnThrAsnSerIleIleGlyAspGlyProIleValArgLys                          
305310315320                                                              
GluIleGluTyrArgMetAlaArgGlyProTrpAlaGluValHisAla                          
325330335                                                                 
ValAsnLeuXaaThrTyrLysLeuTrpHisLeuAspProAspThrGlu                          
340345350                                                                 
TyrGluIleSerValLeuLeuThrArgProGlyAspGlyGlyThrGly                          
355360365                                                                 
ArgProGlyProProLeuIleSerArgThrLysCysAlaGluProThr                          
370375380                                                                 
ArgAlaProLysGlyLeuAlaPheAlaGluIleGlnAlaArgGlnLeu                          
385390395400                                                              
ThrLeuGlnTrpGluProLeuGlyTyrAsnValThrArgCysHisThr                          
405410415                                                                 
TyrAlaValSerLeuCysTyrArgTyrThrLeuGlyGlySerHisAsn                          
420425430                                                                 
GlnThrIleArgGluCysValLysMetGluArgGlyAlaSerArgTyr                          
435440445                                                                 
ThrIleLysAsnLeuLeuProPheArgAsnIleHisValArgLeuIle                          
450455460                                                                 
LeuThrAsnProGluGlyArgLysGluGlyLysGluValThrPheGln                          
465470475480                                                              
ThrAspGluAspValProGlyGlyIleAlaAlaGluSerLeuThrPhe                          
485490495                                                                 
ThrProLeuGluAspMetIlePheLeuLysTrpGluGluProGlnGlu                          
500505510                                                                 
ProAsnGlyLeuIleThrGlnTyrGluIleSerTyrGlnSerIleGlu                          
515520525                                                                 
SerSerAspProAlaValAsnValProGlyProArgArgThrIleSer                          
530535540                                                                 
LysLeuArgAsnGluThrTyrHisValPheSerAsnLeuHisProGly                          
545550555560                                                              
ThrThrTyrLeuPheSerValArgAlaArgThrSerLysGlyPheGly                          
565570575                                                                 
GlnAlaAlaLeuThrGluIleThrThrAsnIleSerAlaProSerPhe                          
580585590                                                                 
AspTyrAlaAspMetProSerProLeuGlyGluSerGluAsnThrIle                          
595600605                                                                 
ThrValLeuLeuArgProAlaGlnGlyArgGlyAlaProIleSerVal                          
610615620                                                                 
TyrGlnValValValGluGluGluArgProArgArgLeuArgArgGlu                          
625630635640                                                              
ProGlyAlaGlnAspCysPheSerValProLeuThrPheGluThrAla                          
645650655                                                                 
LeuAlaArgGlyLeuValHisTyrPheGlyAlaGluLeuAlaAlaSer                          
660665670                                                                 
SerLeuLeuGluAlaMetProPheThrValGlyAspAsnGlnThrTyr                          
675680685                                                                 
ArgGlyPheTrpAsnProProLeuGluProArgLysAlaTyrLeuIle                          
690695700                                                                 
TyrPheGlnAlaAlaSerHisLeuLysGlyGluThrArgLeuAsnCys                          
705710715720                                                              
IleArgIleAlaArgLysAlaAlaCysLysGluSerLysArgProLeu                          
725730735                                                                 
GluValSerGlnArgSerGluGluMetGlyLeuIleLeuGlyIleCys                          
740745750                                                                 
AlaGlyGlyLeuAlaValLeuIleLeuLeuLeuGlyAlaIleIleVal                          
755760765                                                                 
IleIleArgLysGlyLysProValAsnMetThrLysAlaThrValAsn                          
770775780                                                                 
TyrArgGlnGluLysThrHisMetMetSerAlaValAspArgSerPhe                          
785790795800                                                              
ThrAspGlnSerThrLeuGlnGluAspGluArgLeuGlyLeuSerPhe                          
805810815                                                                 
MetAspAlaProGlyTyrSerProArgGlyAspGlnArgSerGlyGly                          
820825830                                                                 
ValThrGluAlaSerSerLeuLeuGlyGlySerProArgArgProCys                          
835840845                                                                 
GlyArgLysGlySerProTyrHisThrGlyGlnLeuHisProAlaVal                          
850855860                                                                 
ArgValAlaAspLeuLeuGlnHisIleAsnGlnMetLysThrAlaGlu                          
865870875880                                                              
GlyTyrGlyPheLysGlnGluTyrGluSerPhePheGluGlyTrpAsp                          
885890895                                                                 
AlaThrLysLysLysAspLysLeuLysGlyGlyArgGlnGluProVal                          
900905910                                                                 
SerAlaTyrAspArgHisHisValLysLeuHisProMetLeuAlaAsp                          
915920925                                                                 
ProAspAlaAspTyrIleSerAlaAsnTyrIleAspGlyTyrHisArg                          
930935940                                                                 
SerAsnHisPheIleAlaThrGlnGlyProLysProGluMetIleTyr                          
945950955960                                                              
AspPheTrpArgMetValTrpGlnGluGlnCysAlaSerIleValMet                          
965970975                                                                 
IleThrLysLeuValGluValGlyArgValLysCysSerArgTyrTrp                          
980985990                                                                 
ProGluAspSerAspMetTyrGlyAspIleLysIleThrLeuValLys                          
99510001005                                                               
ThrGluThrLeuAlaGluTyrValValArgThrPheAlaLeuGluArg                          
101010151020                                                              
ArgGlyTyrSerAlaArgHisGluValArgGlnPheHisPheThrAla                          
1025103010351040                                                          
TrpProGluHisGlyValProTyrHisAlaThrGlyLeuLeuAlaPhe                          
104510501055                                                              
IleArgArgValLysAlaSerThrProProAspAlaGlyProIleVal                          
106010651070                                                              
IleHisCysSerAlaGlyThrGlyArgThrGlyCysTyrIleValLeu                          
107510801085                                                              
AspValMetLeuAspMetAlaGluCysGluGlyValValAspIleTyr                          
109010951100                                                              
AsnCysValLysThrLeuCysSerArgArgValAsnMetIleGlnThr                          
1105111011151120                                                          
GluGluGlnTyrIlePheIleHisAspAlaIleLeuGluAlaCysLeu                          
112511301135                                                              
CysGlyGluThrThrIleProValAsnGluPheArgAlaThrTyrArg                          
114011451150                                                              
GluMetIleArgIleAspProGlnSerAsnSerSerGlnLeuArgGlu                          
115511601165                                                              
GluPheGlnThrLeuAsnSerValThrProProLeuAspValGluGlu                          
117011751180                                                              
CysSerIleAlaLeuLeuProArgAsnArgAspLysAsnArgSerMet                          
1185119011951200                                                          
AspValLeuProProAspArgXaaLeuProPheLeuIleSerSerAsp                          
120512101215                                                              
GlyAspProAsnAsnTyrIleAsnAlaAlaLeuThrAspSerTyrThr                          
122012251230                                                              
ArgSerAlaAlaPheIleValThrLeuHisProLeuGlnSerThrThr                          
123512401245                                                              
ProAspPheTrpArgLeuValTyrAspTyrGlyCysThrSerIleVal                          
125012551260                                                              
MetLeuAsnGlnLeuAsnGlnSerAsnSerAlaTrpProCysLeuGln                          
1265127012751280                                                          
TyrTrpProGluProGlyArgGlnGlnTyrGlyLeuMetGluValGlu                          
128512901295                                                              
PheValSerGlyThrAlaAsnGluAspLeuValSerArgValPheArg                          
130013051310                                                              
ValGlnAsnSerSerArgLeuGlnGluGlyHisLeuLeuValArgHis                          
131513201325                                                              
PheGlnPheLeuArgTrpSerAlaTyrArgAspThrProAspSerArg                          
133013351340                                                              
LysAlaPheLeuHisLeuLeuAlaGluValAspLysTrpGlnAlaGlu                          
1345135013551360                                                          
SerGlyAspGlyArgThrValValHisCysLeuAsnGlyGlyGlyArg                          
136513701375                                                              
SerGlyThrPheCysAlaCysAlaThrValLeuGluMetIleArgCys                          
138013851390                                                              
HisSerLeuValAspValPhePheAlaAlaLysThrLeuArgAsnTyr                          
139514001405                                                              
LysProAsnMetValGluThrMetAspGlnTyrHisPheCysTyrAsp                          
141014151420                                                              
ValAlaLeuGluTyrLeuGluAlaLeuGluLeuArg                                      
142514301435                                                              
(2) INFORMATION FOR SEQ ID NO:3:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 1457 amino acids                                              
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS:                                                         
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: protein                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:                                   
MetAspValAlaAlaAlaAlaLeuProAlaPheValAlaLeuTrpLeu                          
151015                                                                    
LeuTyrProTrpProLeuLeuGlySerAlaLeuGlyGlnPheSerAla                          
202530                                                                    
GlyGlyCysThrPheAspAspGlyProGlyAlaCysAspTyrHisGln                          
354045                                                                    
AspLeuTyrAspAspPheGluTrpValHisValSerAlaGlnGluPro                          
505560                                                                    
HisTyrLeuProProGluMetProGlnGlySerTyrMetValValAsp                          
65707580                                                                  
SerSerAsnHisAspProGlyGluLysAlaArgLeuGlnLeuProThr                          
859095                                                                    
MetLysGluAsnAspThrHisCysIleAspPheSerTyrLeuLeuTyr                          
100105110                                                                 
SerGlnLysGlyLeuAsnProGlyThrLeuAsnIleLeuValArgVal                          
115120125                                                                 
AsnLysGlyProLeuAlaAsnProIleTrpAsnValThrGlyPheThr                          
130135140                                                                 
GlyArgAspTrpLeuArgAlaGluLeuAlaValSerThrPheTrpPro                          
145150155160                                                              
AsnGluTyrGlnValIlePheGluAlaGluValSerGlyGlyArgSer                          
165170175                                                                 
GlyTyrIleAlaIleAspAspIleGlnValLeuSerTyrProCysAsp                          
180185190                                                                 
LysSerProHisPheLeuArgLeuGlyAspValGluValAsnAlaGly                          
195200205                                                                 
GlnAsnAlaThrPheGlnCysIleAlaThrGlyArgAspAlaValHis                          
210215220                                                                 
AsnLysLeuTrpLeuGlnArgArgAsnGlyGluAspIleProValAla                          
225230235240                                                              
GlnThrLysAsnIleAsnHisArgArgPheAlaAlaSerPheArgLeu                          
245250255                                                                 
GlnGluValThrLysThrAspGlnAspLeuTyrArgCysValThrGln                          
260265270                                                                 
SerGluArgGlySerGlyValSerAsnPheAlaGlnLeuIleValArg                          
275280285                                                                 
GluProProArgProIleAlaProProGlnLeuLeuGlyValGlyPro                          
290295300                                                                 
ThrTyrLeuLeuIleGlnLeuAsnAlaAsnSerIleIleGlyAspGly                          
305310315320                                                              
ProIleIleLeuLysGluValGluTyrArgMetThrSerGlySerTrp                          
325330335                                                                 
ThrGluThrHisAlaValAsnAlaProThrTyrLysLeuTrpHisLeu                          
340345350                                                                 
AspProAspThrGluTyrGluIleArgValLeuLeuThrArgProGly                          
355360365                                                                 
GluGlyGlyThrGlyLeuProGlyProProLeuIleThrArgThrLys                          
370375380                                                                 
CysAlaGluProMetArgThrProLysThrLeuLysIleAlaGluIle                          
385390395400                                                              
GlnAlaArgArgIleAlaValAspTrpGluSerLeuGlyTyrAsnIle                          
405410415                                                                 
ThrArgCysHisThrPheAsnValThrIleCysTyrHisTyrPheArg                          
420425430                                                                 
GlyHisAsnGluSerArgAlaAspCysLeuAspMetAspProLysAla                          
435440445                                                                 
ProGlnHisValValAsnHisLeuProProTyrThrAsnValSerLeu                          
450455460                                                                 
LysMetIleLeuThrAsnProGluGlyArgLysGluSerGluGluThr                          
465470475480                                                              
IleIleGlnThrAspGluAspValProGlyProValProValLysSer                          
485490495                                                                 
LeuGlnGlyThrSerPheGluAsnLysIlePheLeuAsnTrpLysGlu                          
500505510                                                                 
ProLeuGluProAsnGlyIleIleThrGlnTyrGluValSerTyrSer                          
515520525                                                                 
SerIleArgSerPheAspProAlaValProValAlaGlyProProGln                          
530535540                                                                 
ThrValSerAsnLeuTrpAsnSerThrHisHisValPheMetHisLeu                          
545550555560                                                              
HisProGlyThrThrTyrGlnPhePheIleArgAlaSerThrValLys                          
565570575                                                                 
GlyPheGlyProAlaThrAlaIleAsnValThrThrAsnIleSerAla                          
580585590                                                                 
ProSerLeuProAspTyrGluGlyValAspAlaSerLeuAsnGluThr                          
595600605                                                                 
AlaThrThrIleThrValLeuLeuArgProAlaGlnAlaLysGlyAla                          
610615620                                                                 
ProIleSerAlaTyrGlnIleValValGluGlnLeuHisProHisArg                          
625630635640                                                              
ThrLysArgGluAlaGlyAlaMetGluCysTyrGlnValProValThr                          
645650655                                                                 
TyrGlnAsnAlaLeuSerGlyGlyAlaProTyrTyrPheAlaAlaGlu                          
660665670                                                                 
LeuProProGlyAsnLeuProGluProAlaProPheThrValGlyAsp                          
675680685                                                                 
AsnArgThrTyrLysGlyPheTrpAsnProProLeuAlaProArgLys                          
690695700                                                                 
GlyTyrAsnIleTyrPheGlnAlaMetSerSerValGluLysGluThr                          
705710715720                                                              
LysThrGlnCysValArgIleAlaThrLysAlaAlaAlaThrGluGlu                          
725730735                                                                 
ProGluValIleProAspProAlaLysGlnThrAspArgValValLys                          
740745750                                                                 
IleAlaGlyIleSerAlaGlyIleLeuValPheIleLeuLeuLeuLeu                          
755760765                                                                 
ValValIleValIleValLysLysSerLysLeuAlaLysLysArgLys                          
770775780                                                                 
AspAlaMetGlyAsnThrArgGlnGluMetThrHisMetValAsnAla                          
785790795800                                                              
MetAspArgSerTyrAlaAspGlnSerThrLeuHisAlaGluAspPro                          
805810815                                                                 
LeuSerLeuThrPheMetAspGlnHisAsnPheSerProArgLeuPro                          
820825830                                                                 
AsnAspProLeuValProThrAlaValLeuAspGluAsnHisSerAla                          
835840845                                                                 
ThrAlaGluSerSerArgLeuLeuAspValProArgTyrLeuCysGlu                          
850855860                                                                 
GlyThrGluSerProTyrGlnThrGlyGlnLeuHisProAlaIleArg                          
865870875880                                                              
ValAlaAspLeuLeuGlnHisIleAsnLeuMetLysThrSerAspSer                          
885890895                                                                 
TyrGlyPheLysGluGluTyrGluSerPhePheGluGlyGlnSerAla                          
900905910                                                                 
SerTrpAspValAlaLysLysAspGlnAsnArgAlaLysAsnArgTyr                          
915920925                                                                 
GlyAsnIleIleAlaTyrAspHisSerArgValIleLeuGlnProVal                          
930935940                                                                 
GluAspAspProSerSerAspTyrIleAsnAlaAsnTyrIleAspIle                          
945950955960                                                              
TrpLeuTyrArgAspGlyTyrGlnArgProSerHisTyrIleAlaThr                          
965970975                                                                 
GlnGlyProValHisGluThrValTyrAspPheTrpArgMetValTrp                          
980985990                                                                 
GlnGluGlnSerAlaCysIleValMetValThrAsnLeuValGluVal                          
99510001005                                                               
GlyArgValLysCysTyrLysTyrTrpProAspAspThrGluValTyr                          
101010151020                                                              
GlyAspPheLysValThrCysValGluMetGluProLeuAlaGluTyr                          
1025103010351040                                                          
ValValArgThrPheThrLeuGluArgArgGlyTyrAsnGluIleArg                          
104510501055                                                              
GluValLysGlnPheHisPheThrGlyTrpProAspHisGlyValPro                          
106010651070                                                              
TyrHisAlaThrGlyLeuLeuSerPheIleArgArgValLysLeuSer                          
107510801085                                                              
AsnProProSerAlaGlyProIleValValHisCysSerAlaGlyAla                          
109010951100                                                              
GlyArgThrGlyCysTyrIleValIleAspIleMetLeuAspMetAla                          
1105111011151120                                                          
GluArgGluGlyValValAspIleTyrAsnCysValLysAlaLeuArg                          
112511301135                                                              
SerArgArgIleAsnMetValGlnThrGluGluGlnTyrIlePheIle                          
114011451150                                                              
HisAspAlaIleLeuGluAlaCysLeuCysGlyGluThrAlaIlePro                          
115511601165                                                              
ValCysGluPheLysAlaAlaTyrPheAspMetIleArgIleAspSer                          
117011751180                                                              
GlnThrAsnSerSerHisLeuLysAspGluPheGlnThrLeuAsnSer                          
1185119011951200                                                          
ValThrProArgLeuGlnAlaGluAspCysSerIleAlaCysLeuPro                          
120512101215                                                              
ArgAsnHisAspLysAsnArgPheMetAspMetLeuProProAspArg                          
122012251230                                                              
CysLeuProPheLeuIleThrIleAspGlyGluSerSerAsnTyrIle                          
123512401245                                                              
AsnAlaAlaLeuMetAspSerTyrArgGlnProAlaAlaPheIleVal                          
125012551260                                                              
ThrGlnTyrProLeuProAsnThrValLysAspPheTrpArgLeuVal                          
1265127012751280                                                          
TyrAspTyrGlyCysThrSerIleValMetLeuAsnGluValAspLeu                          
128512901295                                                              
SerGlnGlyCysProGlnTyrTrpProGluGluGlyMetLeuArgTyr                          
130013051310                                                              
GlyProIleGlnValGluCysMetSerCysSerMetAspCysAspVal                          
131513201325                                                              
IleAsnArgIlePheArgIleCysAsnLeuThrArgProGlnGluGly                          
133013351340                                                              
TyrLeuMetValGlnGlnPheGlnTyrLeuGlyTrpAlaSerHisArg                          
1345135013551360                                                          
GluValProGlySerLysArgSerPheLeuLysLeuIleLeuGlnVal                          
136513701375                                                              
GluLysTrpGlnGluGluCysGluGluGlyGluGlyArgThrIleIle                          
138013851390                                                              
HisCysLeuAsnGlyGlyGlyArgSerGlyMetPheCysAlaIleGly                          
139514001405                                                              
IleValValGluMetValLysArgGlnAsnValValAspValPheHis                          
141014151420                                                              
AlaValLysThrLeuArgAsnSerLysProAsnMetValGluAlaPro                          
1425143014351440                                                          
GluGlnTyrArgPheCysTyrAspValAlaLeuGluTyrLeuGluSer                          
144514501455                                                              
Ser                                                                       
(2) INFORMATION FOR SEQ ID NO:4:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 1452 amino acids                                              
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS:                                                         
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: protein                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:                                   
MetArgThrLeuGlyThrCysLeuValThrLeuAlaGlyLeuLeuLeu                          
151015                                                                    
ThrAlaAlaGlyGluThrPheSerGlyGlyCysLeuPheAspGluPro                          
202530                                                                    
TyrSerThrCysGlyTyrSerGlnAlaAspGluAspAspPheAsnTrp                          
354045                                                                    
GluGlnValAsnThrLeuThrLysProThrSerAspProTrpMetPro                          
505560                                                                    
SerGlySerPheMetLeuValAsnThrSerGlyLysProGluGlyGln                          
65707580                                                                  
ArgAlaHisLeuLeuLeuProGlnLeuLysGluAsnAspThrHisCys                          
859095                                                                    
IleAspPheHisTyrPheValSerSerLysSerAsnAlaAlaProGly                          
100105110                                                                 
LeuLeuAsnValTyrValLysValAsnAsnGlyProLeuGlyAsnPro                          
115120125                                                                 
IleTrpAsnIleSerGlyAspProThrArgThrTrpHisArgAlaGlu                          
130135140                                                                 
LeuAlaIleSerThrPheTrpProAsnPheTyrGlnValIlePheGlu                          
145150155160                                                              
ValValThrSerGlyHisGlnGlyTyrLeuAlaIleAspGluValLys                          
165170175                                                                 
ValLeuGlyHisProCysThrArgThrProHisPheLeuArgIleGln                          
180185190                                                                 
AsnValGluValAsnAlaGlyGlnPheAlaThrPheGlnCysSerAla                          
195200205                                                                 
IleGlyArgThrValAlaGlyAspArgLeuTrpLeuGlnGlyIleAsp                          
210215220                                                                 
ValArgAspAlaProLeuLysGluIleLysValThrSerSerArgArg                          
225230235240                                                              
PheIleAlaSerPheAsnValValAsnThrThrLysArgAspAlaGly                          
245250255                                                                 
LysTyrArgCysMetIleCysThrGluGlyGlyValGlyIleSerAsn                          
260265270                                                                 
TyrAlaGluLeuValValLysGluProProValProIleAlaProPro                          
275280285                                                                 
GlnLeuAlaSerValGlyAlaThrTyrLeuTrpIleGlnLeuAsnAla                          
290295300                                                                 
AsnSerIleAsnGlyAspGlyProIleValAlaArgGluValGluTyr                          
305310315320                                                              
CysThrAlaSerGlySerTrpAsnAspArgGlnProValAspSerThr                          
325330335                                                                 
SerTyrLysIleGlyHisLeuAspProAspThrGluTyrGluIleSer                          
340345350                                                                 
ValLeuLeuThrArgProGlyGluGlyGlyThrGlySerProGlyPro                          
355360365                                                                 
AlaLeuArgThrArgThrLysCysAlaAspProMetArgGlyProArg                          
370375380                                                                 
LysLeuGluValValGluValLysSerArgGlnIleThrIleArgTrp                          
385390395400                                                              
GluProPheGlyTyrAsnValThrArgCysHisSerTyrAsnLeuThr                          
405410415                                                                 
ValHisTyrGlyTyrGlnValGlyGlyGlnGluGlnValArgGluGlu                          
420425430                                                                 
ValSerTrpAspThrAspAsnSerHisProGlnHisThrIleThrAsn                          
435440445                                                                 
LeuSerProTyrThrAsnValSerValLysLeuIleLeuMetAsnPro                          
450455460                                                                 
GluGlyArgLysGluSerGlnGluLeuThrValGlnThrAspGluAsp                          
465470475480                                                              
LeuProGlyAlaValProThrGluSerIleGlnGlySerAlaPheGlu                          
485490495                                                                 
GluLysIlePheLeuGlnTrpArgGluProThrGlnThrTyrGlyVal                          
500505510                                                                 
IleThrLeuTyrGluIleThrTyrLysAlaValSerSerPheAspPro                          
515520525                                                                 
GluIleAspLeuSerAsnGlnSerGlyArgValSerLysLeuGlyAsn                          
530535540                                                                 
GluThrHisPheLeuPhePheGlyLeuTyrProGlyThrThrTyrSer                          
545550555560                                                              
PheThrIleArgAlaSerThrAlaLysGlyPheGlyProProAlaThr                          
565570575                                                                 
AsnGlnPheThrThrLysIleSerAlaProSerMetProAlaTyrGlu                          
580585590                                                                 
PheGluThrProLeuAsnGlnThrAspAsnThrValThrValMetLeu                          
595600605                                                                 
LysProAlaGlnSerArgGlyAlaProValSerValTyrGlnIleVal                          
610615620                                                                 
ValGluGluGluArgProArgArgThrLysLysThrThrGluIleLeu                          
625630635640                                                              
LysCysTyrProValProIleHisPheGlnAsnAlaSerIleLeuAsn                          
645650655                                                                 
SerGlnTyrTyrPheAlaAlaGluPheProAlaAspSerLeuGlnAla                          
660665670                                                                 
AlaGlnProPheThrIleGlyAspAsnLysThrTyrAsnGlyTyrTrp                          
675680685                                                                 
AsnThrProLeuLeuProHisLysSerTyrArgIleTyrTyrGlnAla                          
690695700                                                                 
AlaSerArgAlaAsnGlyGluThrLysIleAspCysValArgValAla                          
705710715720                                                              
ThrLysGlyAlaValThrProLysProValProGluProGluLysGln                          
725730735                                                                 
ThrAspHisThrValLysIleAlaGlyValIleAlaGlyIleLeuLeu                          
740745750                                                                 
PheValIleIlePheLeuGlyValValLeuValMetLysLysArgLys                          
755760765                                                                 
LeuAlaLysLysArgLysGluThrMetSerSerThrArgGlnGluMet                          
770775780                                                                 
ThrValMetValAsnSerMetAspLysSerTyrAlaGluGlnGlyThr                          
785790795800                                                              
AsnCysAspGluAlaPheSerPheMetGlyThrHisAsnLeuAsnGly                          
805810815                                                                 
ArgSerValSerSerProSerSerPheThrMetLysThrAsnThrLeu                          
820825830                                                                 
SerThrSerValProAsnSerTyrTyrProAspGluThrHisThrMet                          
835840845                                                                 
AlaSerAspThrSerSerLeuAlaGlnProHisThrTyrLysLysArg                          
850855860                                                                 
GluAlaAlaAspValProTyrGlnThrGlyGlnLeuHisProAlaIle                          
865870875880                                                              
ArgValAlaAspLeuLeuGlnHisIleThrGlnMetLysCysAlaGlu                          
885890895                                                                 
GlyTyrGlyPheLysGluGluTyrGluSerPhePheGluGlyGlnSer                          
900905910                                                                 
AlaProTrpAspSerAlaLysLysAspGluAsnArgMetLysAsnArg                          
915920925                                                                 
TyrGlyAsnIleIleAlaTyrAspHisSerArgValArgLeuGlnMet                          
930935940                                                                 
LeuGluGlyAspAsnAsnSerAspTyrIleAsnGlyAsnTyrIleAsp                          
945950955960                                                              
GlyTyrHisArgProAsnHisTyrIleAlaThrGlnGlyProMetGln                          
965970975                                                                 
GluThrIleTyrAspPheTrpArgMetValTrpHisGluAsnThrAla                          
980985990                                                                 
SerIleIleMetValThrAsnLeuValGluValGlyArgValLysCys                          
99510001005                                                               
CysLysTyrTrpProAspAspThrGluIleTyrLysAspIleLysVal                          
101010151020                                                              
ThrLeuIleAspThrGluLeuLeuAlaGluTyrValIleArgThrPhe                          
1025103010351040                                                          
AlaValGluLysArgGlyIleHisGluIleArgGluIleArgGlnPhe                          
104510501055                                                              
HisPheThrGlyTrpProAspHisGlyValProTyrHisAlaThrGly                          
106010651070                                                              
LeuLeuGlyPheValArgGlnValLysSerLysSerProProAsnAla                          
107510801085                                                              
GlyProLeuValValHisCysSerAlaGlyAlaGlyArgThrGlyCys                          
109010951100                                                              
PheIleValIleAspIleMetLeuAspMetAlaGluArgGluGlyVal                          
1105111011151120                                                          
ValAspIleTyrAsnCysValArgGluLeuArgSerArgArgValAsn                          
112511301135                                                              
MetValGlnThrGluGluGlnTyrValPheIleHisAspAlaIleLeu                          
114011451150                                                              
GluAlaCysLeuCysGlyAspThrSerIleProAlaSerGlnValArg                          
115511601165                                                              
SerLeuTyrTyrAspMetAsnLysLeuAspProGlnThrAsnSerSer                          
117011751180                                                              
GlnIleLysGluGluPheArgThrLeuAsnMetValThrProThrLeu                          
1185119011951200                                                          
ArgValGluAspCysSerIleAlaLeuLeuProArgAsnHisGluLys                          
120512101215                                                              
AsnArgCysMetAspIleLeuProProAspArgCysLeuProPheLeu                          
122012251230                                                              
IleThrIleAspGlyGluSerSerAsnTyrIleAsnAlaAlaLeuMet                          
123512401245                                                              
AspSerTyrLysGlnProSerAlaPheIleValThrGlnHisProLeu                          
125012551260                                                              
ProAsnThrValLysAspPheTrpArgLeuValLeuAspTyrHisCys                          
1265127012751280                                                          
ThrSerValValMetLeuAsnAspValAspProAlaGlnLeuCysPro                          
128512901295                                                              
GlnTyrTrpProGluAsnGlyValHisArgHisGlyProIleGlnVal                          
130013051310                                                              
GluPheValSerAlaAspLeuGluGluAspIleIleSerArgIlePhe                          
131513201325                                                              
ArgIleTyrAsnAlaSerArgProGlnAspGlyHisArgMetValGln                          
133013351340                                                              
GlnPheGlnPheLeuGlyTrpProMetTyrArgAspThrProValSer                          
1345135013551360                                                          
LysArgSerPheLeuLysLeuIleArgGlnValAspLysTrpGlnGlu                          
136513701375                                                              
GluTyrAsnGlyGlyGluGlyProThrValValHisCysLeuAsnGly                          
138013851390                                                              
GlyGlyArgSerGlyThrPheCysAlaIleSerIleValCysGluMet                          
139514001405                                                              
LeuArgHisGlnArgThrValAspValPheHisAlaValLysThrLeu                          
141014151420                                                              
ArgAsnAsnLysProAsnMetValAspLeuLeuAspGlnTyrLysPhe                          
1425143014351440                                                          
CysTyrGluValAlaLeuGluTyrLeuAsnSerGly                                      
14451450                                                                  
(2) INFORMATION FOR SEQ ID NO:5:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 7 amino acids                                                 
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS:                                                         
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: protein                                               
(ix) FEATURE:                                                             
(A) NAME/KEY: Active-site                                                 
(B) LOCATION: 1..2                                                        
(D) OTHER INFORMATION: /note= "Let 'X'located at position                 
1 represent either Histidine or Aspartic Acid"                            
(ix) FEATURE:                                                             
(A) NAME/KEY: Modified-site                                               
(B) LOCATION: 6..7                                                        
(D) OTHER INFORMATION: /note= "Let 'X'located at position                 
6 represent either Isoleucine or Valine."                                 
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:                                   
XaaPheTrpArgMetXaaTrp                                                     
15                                                                        
(2) INFORMATION FOR SEQ ID NO:6:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 20 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(ix) FEATURE:                                                             
(A) NAME/KEY: misc.sub.-- feature                                         
(B) LOCATION: 11..12                                                      
(D) OTHER INFORMATION: /note= "Let the 'N'at position 11                  
represent Inosine."                                                       
(ix) FEATURE:                                                             
(A) NAME/KEY: misc.sub.-- feature                                         
(B) LOCATION: 17..18                                                      
(D) OTHER INFORMATION: /note= "Let the 'N'at position 17                  
represent Inosine."                                                       
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:                                   
AYTTYTGGMGNATGRTNTGG20                                                    
(2) INFORMATION FOR SEQ ID NO:7:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 7 amino acids                                                 
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS:                                                         
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: protein                                               
(ix) FEATURE:                                                             
(A) NAME/KEY: Modified-site                                               
(B) LOCATION: 4..5                                                        
(D) OTHER INFORMATION: /note= "Let 'X'located at position                 
4 represent either Phenyalanine or Histidine."                            
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:                                   
TrpProAspXaaGlyValPro                                                     
15                                                                        
(2) INFORMATION FOR SEQ ID NO:8:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 17 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(ix) FEATURE:                                                             
(A) NAME/KEY: misc.sub.-- feature                                         
(B) LOCATION: 3..4                                                        
(D) OTHER INFORMATION: /note= "Let 'N'located at position                 
3 represent Inosine."                                                     
(ix) FEATURE:                                                             
(A) NAME/KEY: misc.sub.-- feature                                         
(B) LOCATION: 12..13                                                      
(D) OTHER INFORMATION: /note= "Let 'N'located at position                 
12 represent Inosine."                                                    
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:                                   
GGNACRWRRTCNGGCCA17                                                       
(2) INFORMATION FOR SEQ ID NO:9:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 11 amino acids                                                
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS:                                                         
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: protein                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:                                   
AspGlyAspPheGluGluIleProGluGluTyr                                         
1510                                                                      
(2) INFORMATION FOR SEQ ID NO:10:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 12 amino acids                                                
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS:                                                         
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: protein                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:                                  
GluGlyProTrpLeuGluGluGluGluGluAlaTyr                                      
1510                                                                      
__________________________________________________________________________

Claims (14)

What is claimed is:
1. An isolated receptor protein tyrosine phosphatase λ polypeptide which dephosphorylates phosphorylated tyrosine residues, said polypeptide comprising an amino acid sequence selected from the group consisting of:
(a) the amino acid sequence shown in FIG. 1 (SEQ ID NO: 2);
(b) an amino acid sequence which is encoded by a nucleic acid molecule that hybridizes under stringent conditions to a nucleic acid molecule that encodes the amino acid sequence of (a).
2. The isolated receptor protein tyrosine phosphatase λ polypeptide of claim 1 which is of murine origin.
3. The isolated receptor protein tyrosine phosphatase λ polypeptide of claim 1 which is of human origin.
4. The isolated receptor protein tyrosine phosphatase λ polypeptide of claim 1 which is fused to a heterologous polypeptide sequence.
5. The isolated receptor protein tyrosine phosphatase λ polypeptide of claim 4 wherein said heterologous polypeptide sequence is an immunoglobulin molecule or fragment thereof.
6. The isolated receptor protein tyrosine phosphatase λ polypeptide of claim 4 wherein said heterologous polypeptide sequence is an immunologically competent polypeptide.
7. The isolated receptor protein tyrosine phosphatase λ polypeptide of claim 1 which further comprises an N-terminal methionyl residue.
8. The isolated receptor protein tyrosine phosphatase λ polypeptide of claim 1 which is unglycosylated.
9. An isolated extracellular domain of a receptor protein tyrosine phosphatase λ polypeptide which comprises an amino acid sequence selected from the group consisting of:
(a) amino acids 19-748 of the receptor protein tyrosine phosphatase λ polypeptide shown in FIG. 1 (SEQ ID NO: 2);
(b) an amino acid sequence which is encoded by a nucleic acid molecule that hybridizes under stringent conditions to a nucleic acid molecule that encodes the amino acid sequence of (a).
10. The isolated extracellular domain of claim 9 which is of murine origin.
11. The isolated extracellular domain of claim 9 which is of human origin.
12. The isolated extracellular domain of claim 9 which is fused to a heterologous polypeptide sequence.
13. The isolated extracellular domain of claim 12 wherein said heterologous polypeptide sequence is an immunoglobulin molecule or fragment thereof.
14. The isolated extracellular domain of claim 12 wherein said heterologous polypeptide sequence is an immunologically competent polypeptide.
US08/652,971 1996-05-24 1996-05-24 κ/μ-like protein tyrosine phosphatase, PTP λ Expired - Lifetime US5814507A (en)

Priority Applications (16)

Application Number Priority Date Filing Date Title
US08/652,971 US5814507A (en) 1996-05-24 1996-05-24 κ/μ-like protein tyrosine phosphatase, PTP λ
US08/769,399 US5976852A (en) 1996-05-24 1996-12-19 Kκ/μ-like protein tyrosine phosphatase, PTP λ
IL12710897A IL127108A0 (en) 1996-05-24 1997-05-22 Kappa/mu-like protein tyrosine phosphatase ptp lambda
PCT/US1997/009056 WO1997044458A1 (en) 1996-05-24 1997-05-22 Kappa/mu-like protein tyrosine phosphatase, ptp lambda
CA002253431A CA2253431A1 (en) 1996-05-24 1997-05-22 Kappa/mu-like protein tyrosine phosphatase, ptp lambda
ES97927799T ES2263177T3 (en) 1996-05-24 1997-05-22 PROTEIN THYROSINE PHOSPHATASE, PTP LAMBDA ANALOG TO PTP KAPPA / MU.
EP97927799A EP0912733B1 (en) 1996-05-24 1997-05-22 Kappa/mu-like protein tyrosine phosphatase, ptp lambda
JP54289997A JP3587857B2 (en) 1996-05-24 1997-05-22 κ / μ-like protein tyrosine phosphatase, PTPλ
AT97927799T ATE323764T1 (en) 1996-05-24 1997-05-22 KAPPA/MU SIMILAR PROTEIN TYROSINE PHOSPHATASE, PROTEIN TYROSINE PHOSPHATASE LAMBDA
PT97927799T PT912733E (en) 1996-05-24 1997-05-22 PROTEIN-TYROSINE-PHOSPHATASE SIMILAR TO KAPA / MU, PTP LAMBDA
DK97927799T DK0912733T3 (en) 1996-05-24 1997-05-22 Kappa / my-like protein tyrosine phosphatase PTP Lambda
DE69735716T DE69735716T2 (en) 1996-05-24 1997-05-22 KAPPA / MU SIMILAR PROTEINTYROSINE PHOSPHATASE, PROTEINTYROSINPHOSPHATASE LAMBDA
AU32171/97A AU722949B2 (en) 1996-05-24 1997-05-22 Kappa/MU-like protein tyrosine phosphatase, PTP lambda
ZA9704526A ZA974526B (en) 1996-05-24 1997-05-23 Kappa/mu-like protein tyrosine phosphatase, PTP Lambda.
US08/991,953 US6083748A (en) 1996-05-24 1997-12-16 Antibodies which specifically bind to a novel κ/μ-like protein tyrosineospatase, PTPλ, and hybridoma cell lines producing the same
US08/991,258 US5928887A (en) 1996-05-24 1997-12-16 κ/μ-Like protein tyrosine phosphatase, PTP λ

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
US08/652,971 US5814507A (en) 1996-05-24 1996-05-24 κ/μ-like protein tyrosine phosphatase, PTP λ

Related Child Applications (3)

Application Number Title Priority Date Filing Date
US08/769,399 Division US5976852A (en) 1996-05-24 1996-12-19 Kκ/μ-like protein tyrosine phosphatase, PTP λ
US08/991,258 Division US5928887A (en) 1996-05-24 1997-12-16 κ/μ-Like protein tyrosine phosphatase, PTP λ
US08/991,953 Division US6083748A (en) 1996-05-24 1997-12-16 Antibodies which specifically bind to a novel κ/μ-like protein tyrosineospatase, PTPλ, and hybridoma cell lines producing the same

Publications (1)

Publication Number Publication Date
US5814507A true US5814507A (en) 1998-09-29

Family

ID=24618971

Family Applications (4)

Application Number Title Priority Date Filing Date
US08/652,971 Expired - Lifetime US5814507A (en) 1996-05-24 1996-05-24 κ/μ-like protein tyrosine phosphatase, PTP λ
US08/769,399 Expired - Lifetime US5976852A (en) 1996-05-24 1996-12-19 Kκ/μ-like protein tyrosine phosphatase, PTP λ
US08/991,258 Expired - Lifetime US5928887A (en) 1996-05-24 1997-12-16 κ/μ-Like protein tyrosine phosphatase, PTP λ
US08/991,953 Expired - Lifetime US6083748A (en) 1996-05-24 1997-12-16 Antibodies which specifically bind to a novel κ/μ-like protein tyrosineospatase, PTPλ, and hybridoma cell lines producing the same

Family Applications After (3)

Application Number Title Priority Date Filing Date
US08/769,399 Expired - Lifetime US5976852A (en) 1996-05-24 1996-12-19 Kκ/μ-like protein tyrosine phosphatase, PTP λ
US08/991,258 Expired - Lifetime US5928887A (en) 1996-05-24 1997-12-16 κ/μ-Like protein tyrosine phosphatase, PTP λ
US08/991,953 Expired - Lifetime US6083748A (en) 1996-05-24 1997-12-16 Antibodies which specifically bind to a novel κ/μ-like protein tyrosineospatase, PTPλ, and hybridoma cell lines producing the same

Country Status (13)

Country Link
US (4) US5814507A (en)
EP (1) EP0912733B1 (en)
JP (1) JP3587857B2 (en)
AT (1) ATE323764T1 (en)
AU (1) AU722949B2 (en)
CA (1) CA2253431A1 (en)
DE (1) DE69735716T2 (en)
DK (1) DK0912733T3 (en)
ES (1) ES2263177T3 (en)
IL (1) IL127108A0 (en)
PT (1) PT912733E (en)
WO (1) WO1997044458A1 (en)
ZA (1) ZA974526B (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1199370A1 (en) * 2000-10-18 2002-04-24 Evotec OAI AG Process for detecting dephosphorylation of phosphorylated threonine or serine by phosphatase activity
US7311912B1 (en) * 1997-01-10 2007-12-25 Plantbodies Corporation Epithelial tissue targeting agent
WO2014183062A1 (en) * 2013-05-10 2014-11-13 La Jolla Institute For Allergy And Immunology Autoimmune disease treatments
US20210032684A1 (en) * 2014-06-10 2021-02-04 Biomatrica, Inc. Stabilization of non-denatured polypeptides, nucleic acids, and exosomes in a blood sample at ambient temperatures
WO2024098026A3 (en) * 2022-11-04 2024-07-18 Mink Therapeutics, Inc. B-cell maturation antigen (bcma) chimeric antigen receptor invariant natural killer t cells and uses thereof

Families Citing this family (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030224415A1 (en) * 2001-06-29 2003-12-04 Gala Design, Inc. Selection free growth of host cells containing multiple integrating vectors
KR100545945B1 (en) * 2000-07-03 2006-01-25 갈라 디자인, 인크. Expression vector
AU2001271614B2 (en) * 2000-07-03 2007-05-31 Catalent Pharma Solutions, Llc Host cells containing multiple integrating vectors
AU2002220229A1 (en) * 2000-12-06 2002-06-18 Deltagen, Inc. Transgenic mice containing phosphatase target gene disruptions
US20040038304A1 (en) * 2002-03-28 2004-02-26 Gala Design, Inc. Antibody libraries
US7384738B2 (en) * 2002-03-28 2008-06-10 Bremel Robert D Retrovirus-based genomic screening
US20050221429A1 (en) * 2004-01-16 2005-10-06 Cardinal Health Pts, Llc Host cells containing multiple integrating vectors comprising an amplifiable marker
JP5615181B2 (en) 2007-11-27 2014-10-29 ザ・ユニバーシティ・オブ・ブリティッシュ・コロンビア Compositions and methods for prevention and treatment of arthritis
WO2010102412A1 (en) 2009-03-11 2010-09-16 Augurex Life Sciences Corporation Compositions and methods for characterizing arthritic conditions
PT2768851T (en) 2011-10-21 2017-09-08 Augurex Life Sciences Corp Antigens derived from citrullinated 14-3-3 and uses thereof in the diagnosis of rheumatoid arthritis
US9616114B1 (en) 2014-09-18 2017-04-11 David Gordon Bermudes Modified bacteria having improved pharmacokinetics and tumor colonization enhancing antitumor activity
US10676723B2 (en) 2015-05-11 2020-06-09 David Gordon Bermudes Chimeric protein toxins for expression by therapeutic bacteria
US11129906B1 (en) 2016-12-07 2021-09-28 David Gordon Bermudes Chimeric protein toxins for expression by therapeutic bacteria
US11180535B1 (en) 2016-12-07 2021-11-23 David Gordon Bermudes Saccharide binding, tumor penetration, and cytotoxic antitumor chimeric peptides from therapeutic bacteria
CN111040019B (en) * 2019-12-25 2022-06-07 上海交通大学 A kind of ligand polypeptide for specific binding with TfR protein and application thereof

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5863755A (en) * 1993-04-21 1999-01-26 Max Planck Gessellschaft Nucleic acid encoding novel receptor-type phosphotyrosine phosphatase-κ

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
Fang, K.S et al. (1994) A Transmembrane Protein tyrosine Phosphatase Contains Spectrin like Repeats in Its Extracellular Domain, J. Biol. Chem. 269 (19): 14056 14063, May 13, 1994. *
Fang, K.S et al. (1994) A Transmembrane Protein-tyrosine Phosphatase Contains Spectrin-like Repeats in Its Extracellular Domain, J. Biol. Chem. 269 (19): 14056-14063, May 13, 1994.
Gebbink, M. F. B. G. et al. (1991) Cloning, expression and chromosomal localization of a new putative receptor like protein tyrosine phosphatase, FEBS Letters 290(1,2): 123 130, Sep. 1991. *
Gebbink, M. F. B. G. et al. (1991) Cloning, expression and chromosomal localization of a new putative receptor-like protein tyrosine phosphatase, FEBS Letters 290(1,2): 123-130, Sep. 1991.
Kaplan, et al. (1990) Cloning of three human tyrosine phosphatases reveals a multigene family of receptor linked protein tyrosine phosphatases expressed in brain Proc. Natl. Acad. Sci. USA 87: 7000 7004, Sep. 1990. *
Kaplan, et al. (1990) Cloning of three human tyrosine phosphatases reveals a multigene family of receptor-linked protein-tyrosine-phosphatases expressed in brain Proc. Natl. Acad. Sci. USA 87: 7000-7004, Sep. 1990.

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7311912B1 (en) * 1997-01-10 2007-12-25 Plantbodies Corporation Epithelial tissue targeting agent
EP1199370A1 (en) * 2000-10-18 2002-04-24 Evotec OAI AG Process for detecting dephosphorylation of phosphorylated threonine or serine by phosphatase activity
WO2014183062A1 (en) * 2013-05-10 2014-11-13 La Jolla Institute For Allergy And Immunology Autoimmune disease treatments
US10385340B2 (en) 2013-05-10 2019-08-20 La Jolla Institute For Allergy And Immunology Autoimmune disease treatments
US20210032684A1 (en) * 2014-06-10 2021-02-04 Biomatrica, Inc. Stabilization of non-denatured polypeptides, nucleic acids, and exosomes in a blood sample at ambient temperatures
WO2024098026A3 (en) * 2022-11-04 2024-07-18 Mink Therapeutics, Inc. B-cell maturation antigen (bcma) chimeric antigen receptor invariant natural killer t cells and uses thereof

Also Published As

Publication number Publication date
DE69735716D1 (en) 2006-05-24
ES2263177T3 (en) 2006-12-01
PT912733E (en) 2006-08-31
JPH11511033A (en) 1999-09-28
US5928887A (en) 1999-07-27
JP3587857B2 (en) 2004-11-10
US5976852A (en) 1999-11-02
IL127108A0 (en) 1999-09-22
CA2253431A1 (en) 1997-11-27
EP0912733B1 (en) 2006-04-19
AU722949B2 (en) 2000-08-17
ZA974526B (en) 1997-12-30
DE69735716T2 (en) 2007-02-08
US6083748A (en) 2000-07-04
AU3217197A (en) 1997-12-09
WO1997044458A1 (en) 1997-11-27
DK0912733T3 (en) 2006-08-21
EP0912733A1 (en) 1999-05-06
ATE323764T1 (en) 2006-05-15

Similar Documents

Publication Publication Date Title
US5814507A (en) κ/μ-like protein tyrosine phosphatase, PTP λ
WO1997044458A9 (en) Kappa/mu-like protein tyrosine phosphatase, ptp lambda
AU705107B2 (en) HTK ligand
CA2246430C (en) Protein tyrosine phosphatases of hematopoietic cells
US6238902B1 (en) Protein tyrosine phosphatases
WO1997035019A9 (en) Protein tyrosine phosphatases of hematopoietic cells
US6040437A (en) Tyrosine phosphorylated cleavage furrow-associated proteins (PSTPIPS)
JP3503951B2 (en) Tyrosine phosphorylation cleavage groove-related protein (PSTPIP)
US6111073A (en) Tyrosine phosphorylated cleavage furrow-associated proteins (PSTPIPs)
EP0980426B1 (en) TYROSINE PHOSPHORYLATED CLEAVAGE FURROW-ASSOCIATED PROTEINS (PSTPIPs)
US6887705B1 (en) Tyrosine phosphorylated cleavage furrow-associated proteins (PSTPIPs)
WO1998035037A9 (en) TYROSINE PHOSPHORYLATED CLEAVAGE FURROW-ASSOCIATED PROTEINS (PSTPIPs)
US20030219791A1 (en) Transducer of MAS signalling
Maiti Molecular analysis of the domains in CD45 that affect expression and function

Legal Events

Date Code Title Description
AS Assignment

Owner name: GENENTECH, INC., CALIFORNIA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:CHENG, JILL;LASKY, LAURENCE A.;REEL/FRAME:009346/0311

Effective date: 19960524

Owner name: GENENTECH, INC., CALIFORNIA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:CHENG, JILL;LASKY, LAURENCE A.;REEL/FRAME:009366/0211

Effective date: 19960524

STCF Information on status: patent grant

Free format text: PATENTED CASE

FPAY Fee payment

Year of fee payment: 4

FPAY Fee payment

Year of fee payment: 8

FPAY Fee payment

Year of fee payment: 12