New! View global litigation for patent families

US5804375A - Reaction mixtures for detection of target nucleic acids - Google Patents

Reaction mixtures for detection of target nucleic acids Download PDF

Info

Publication number
US5804375A
US5804375A US08428941 US42894195A US5804375A US 5804375 A US5804375 A US 5804375A US 08428941 US08428941 US 08428941 US 42894195 A US42894195 A US 42894195A US 5804375 A US5804375 A US 5804375A
Authority
US
Grant status
Grant
Patent type
Prior art keywords
probe
oligonucleotide
nucleic
acid
labeled
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Lifetime
Application number
US08428941
Inventor
David H. Gelfand
Pamela M. Holland
Randall K. Saiki
Robert M. Watson
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Roche Molecular Systems Inc
Original Assignee
Roche Molecular Systems Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Grant date
Family has litigation

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/686Polymerase Chain Reaction [PCR]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07HSUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6816Hybridisation assays characterised by the means of detection
    • C12Q1/6818Hybridisation assays characterised by the means of detection involving interaction of at least two labels, e.g. resonant energy transfer
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6816Hybridisation assays characterised by the means of detection
    • C12Q1/6823Release of bound marker
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6827Hybridisation assays for mutation or polymorphism detection
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701Specific hybridization probes
    • C12Q1/702Specific hybridization probes for retroviruses
    • C12Q1/703Viruses associated with AIDS
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10TECHNICAL SUBJECTS COVERED BY FORMER USPC
    • Y10STECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10S435/00Chemistry: molecular biology and microbiology
    • Y10S435/805Test papers
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10TECHNICAL SUBJECTS COVERED BY FORMER USPC
    • Y10STECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10S435/00Chemistry: molecular biology and microbiology
    • Y10S435/81Packaged device or kit
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10TECHNICAL SUBJECTS COVERED BY FORMER USPC
    • Y10STECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10S436/00Chemistry: analytical and immunological testing
    • Y10S436/815Test for named compound or class of compounds

Abstract

A process of detecting a target nucleic acid using labeled oligonucleotides uses the 5' to 3' nuclease activity of a nucleic acid polymerase to cleave annealed labeled oligonucleotide from hybridized duplexes and release labeled oligonucleotide fragments for detection. This process is easily incorporated into a PCR amplification assay.

Description

This application is a continuation of U.S. Ser. No. 07/961,884, filed Jan. 5, 1993, which issued as U.S. Pat. No. 5,487,972, which application claims priority to International Patent Application No. PCT/US91/05571, which application is a continuation-in-part of U.S. Ser. No. 07/563,758, filed Aug. 6, 1990, which issued as U.S. Pat. No. 5,210,015.

This invention relates generally to the field of nucleic acid chemistry. More specifically, it relates to the use of the 5' to 3' nuclease activity of a nucleic acid polymerase to degrade a labeled oligonucleotide in a hybridized duplex composed of the labeled oligonucleotide and a target oligonucleotide sequence and form detectable labeled fragments.

Investigational microbiological techniques are routinely applied to diagnostic assays. For example, U.S. Pat. No. 4,358,535 discloses a method for detecting pathogens by spotting a sample (e.g., blood, cells, saliva, etc.) on a filter (e.g., nitrocellulose), lysing the cells, and fixing the DNA through chemical denaturation and heating. Then, labeled DNA probes are added and allowed to hybridize with the fixed sample DNA, hybridization indicating the presence of the pathogen's DNA. The sample DNA in this case may be amplified by culturing the cells or organisms in place on the filter.

A significant improvement in DNA amplification, the polymerase chain reaction (PCR) technique, is disclosed in U.S. Pat. Nos. 4,683,202; 4,683,195; 4,800,159; and 4,965,188. In its simplest form, PCR is an in vitro method for the enzymatic synthesis of specific DNA sequences, using two oligonucleotide primers that hybridize to opposite strands and flank the region of interest in the target DNA. A repetitive series of reaction steps involving template denaturation, primer annealing, and the extension of the annealed primers by DNA polymerase results in the exponential accumulation of a specific fragment whose termini are defined by the 5' ends of the primers. PCR is capable of producing a selective enrichment of a specific DNA sequence by a factor of 109. The PCR method is also described in Saiki et al., 1985, Science 230:1350.

Detection methods generally employed in standard PCR techniques use a labeled probe with the amplified DNA in a hybridization assay. For example, EP Publication No. 237,362 and PCT Publication No. 89/11548 disclose assay methods wherein the PCR-amplified DNA is first fixed to a filter, and then a specific oligonucleotide probe is added and allowed to hybridize. Preferably, the probe is labeled, e.g., with 32 P, biotin, horseradish peroxidase (HRP), etc., to allow for detection of hybridization. The reverse is also suggested, that is, the probe is instead bound to the membrane, and the PCR-amplified sample DNA is added.

Other means of detection include the use of fragment length polymorphism (PCR-FLP), hybridization to allele-specific oligonucleotide (ASO) probes (Saiki et al., 1986, Nature 324:163), or direct sequencing via the dideoxy method using amplified DNA rather than cloned DNA. The standard PCR technique operates essentially by replicating a DNA sequence positioned between two primers, providing as the major product of the reaction a DNA sequence of discrete length terminating with the primer at the 5' end of each strand. Thus, insertions and deletions between the primers result in product sequences of different lengths, which can be detected by sizing the product in PCR-FLP. In an example of ASO hybridization, the amplified DNA is fixed to a nylon 5 filter (by, for example, UV irradiation) in a series of "dot blots", then allowed to hybridize with an oligonucleotide probe labeled with HRP under stringent conditions. After washing, tetramethylbenzidine (TMB) and hydrogen peroxide are added: HRP catalyzes the hydrogen peroxide oxidation of TMB to a soluble blue dye that can be precipitated, indicating hybridized probe.

While the PCR technique as presently practiced is an extremely powerful method for amplifying nucleic acid sequences, the detection of the amplified material requires additional manipulation and subsequent handling of the PCR products to determine whether the target DNA is present. It would be desirable to decrease the number of subsequent handling steps currently required for the detection of amplified material. A "homogeneous" assay system, that is, one which generates signal while the target sequence is amplified, requiring minimal post-amplification handling, would be ideal.

The present invention provides a process for the detection of a target nucleic acid sequence in a sample, said process comprising:

(a) contacting a sample comprising single-stranded nucleic acids with an oligonucleotide containing a sequence complementary to a region of the target nucleic acid and a labeled oligonucleotide containing a sequence complementary to a second region of the same target nucleic acid strand, but not including the nucleic acid sequence defined by the first oligonucleotide, to create a mixture of duplexes during hybridization conditions, wherein the duplexes comprise the target nucleic acid annealed to the first oligonucleotide and to the labeled oligonucleotide such that the 3' end of the first oligonucleotide is adjacent to the 5' end of the labeled oligonucleotide;

(b) maintaining the mixture of step (a) with a template-dependent nucleic acid polymerase having a 5' to 3' nuclease activity under conditions sufficient to permit the 5' to 3' nuclease activity of the polymerase to cleave the annealed, labeled oligonucleotide and release labeled fragments; and

(c) detecting and/or measuring the release of labeled fragments.

This process is especially suited for analysis of nucleic acid amplified by PCR. This process is an improvement over known PCR detection methods because it allows for both amplification of a target and the release of a label for detection to be accomplished in a reaction system without resort to multiple handling steps of the amplified product. Thus, in another embodiment of the invention, a polymerase chain reaction amplification method for concurrent amplification and detection of a target nucleic acid sequence in a sample is provided. This method comprises:

(a) providing to a PCR assay containing said sample, at least one labeled oligonucleotide containing a sequence complementary to a region of the target nucleic acid, wherein said labeled oligonucleotide anneals within the target nucleic acid sequence bounded by the oligonucleotide primers of step (b);

(b) providing a set of oligonucleotide primers, wherein a first primer contains a sequence complementary to a region in one strand of the target nucleic acid sequence and primes the synthesis of a complementary DNA strand, and a second primer contains a sequence complementary to a region in a second strand of the target nucleic acid sequence and primes the synthesis of a complementary DNA strand; and wherein each oligonucleotide primer is selected to anneal to its complementary template upstream of any labeled oligonucleotide annealed to the same nucleic acid strand;

(c) amplifying the target nucleic acid sequence employing a nucleic acid polymerase having 5' to 3' nuclease activity as a template-dependent polymerizing agent under conditions which are permissive for PCR cycling steps of (i) annealing of primers and labeled oligonucleotide to a template nucleic acid sequence contained within the target region, and (ii) extending the primer, wherein said nucleic acid polymerase synthesizes a primer extension product while the 5' to 3' nuclease activity of the nucleic acid polymerase simultaneously releases labeled fragments from the annealed duplexes comprising labeled oligonucleotide and its complementary template nucleic acid sequences, thereby creating detectable labeled fragments; and

(d) detecting and/or measuring the release of labeled fragments to determine the presence or absence of target sequence in the sample.

FIG. 1 is an autoradiograph of a DEAE cellulose thin layer chromatography (TLC) plate illustrating the release of labeled fragments from cleaved probe.

FIG. 2 is an autoradiograph of DEAE cellulose TLC plates illustrating the thermostability of the labeled probe.

FIGS. 3A and 3B are autoradiographs of DEAE cellulose TLC plates showing that the amount of labeled probe fragment released correlates with an increase in PCR cycle number and starting template DNA concentration.

FIG. 4 illustrates the polymerization independent 5'-3' nuclease activity of Taq DNA polymerase shown in the autoradiograph using a series of primers which anneal from zero to 20 nucleotides upstream of the probe.

FIG. 5 is an autoradiograph showing the release of labeled probe fragments under increasing incubation temperatures and time, wherein the composition at the 5' end of the probe is GC rich.

FIG. 6 is an autoradiograph showing the release of labeled probe fragments under increasing incubation temperatures and time, wherein the composition at the 5' end of the probe is AT rich.

FIGS. 7A and 7B provide 5% acrylamide electrophoresis gel analysis of a 142 base pair HIV product, amplified in the presence or absence of labeled probe.

FIGS. 8A and 8B are a composite of two autoradiographs of TLC analysis of aliquots of PCR amplification products which show that radiolabel release occurs and increases in amount with both increases in starting template and with longer thermocycling.

FIG. 9 is a schematic for a reaction in which an NHS-active ester derivative of biotin is added to the 3'-amine of an oligonucleotide probe.

FIG. 10 is a schematic for a reaction in which a biotin hydrazide is used to label an oligonucleotide probe that has a 3'-ribonucleotide.

FIGS. 11A-11C are a schematic for labeling an oligonucleotide probe with biotin using a biotin phosphoramidite.

FIG. 12 shows a reagents for labeling oligonucleotide probes with biotin.

FIG. 13 shows an oligonucleotide probe labeled with rhodamine-X-590 and crystal violet.

FIG. 14 shows a schematic for a reaction to generate an active acyl azide of crystal violet.

FIG. 15 shows a schematic for a reaction to add an amine to a thymidine for use in conjugating a label to an oligonucleotide probe.

FIG. 16 shows typical results and relation of signal to input target number for the present method using Bakerbond™ PEI solid phase extractant.

As used herein, a "sample" refers to any substance containing or presumed to contain nucleic acid and includes a sample of tissue or fluid isolated from an individual or individuals, including but not limited to, for example, skin, plasma, serum, spinal fluid, lymph fluid, synovial fluid, urine, tears, blood cells, organs, tumors, and also to samples of in vitro cell culture constituents (including but not limited to conditioned medium resulting from the growth of cells in cell culture medium, recombinant cells and cell components).

As used herein, the terms "nucleic acid", "polynucleotide" and "oligonucleotide" refer to primers, probes, oligomer fragments to be detected, oligomer controls and unlabeled blocking oligomers and shall be generic to polydeoxyribonucleotides (containing 2-deoxy-D-ribose), to polyribonucleotides (containing D-ribose), and to any other type of polynucleotide which is an N-glycoside of a purine or pyrimidine base, or modified purine or pyrimidine bases. There is no intended distinction in length between the term "nucleic acid", "polynucleotide" and "oligonucleotide", and these terms will be used interchangeably. These terms refer only to the primary structure of the molecule. Thus, these terms include double- and single-stranded DNA, as well as double- and single-stranded RNA. The oligonucleotide is comprised of a sequence of approximately at least 6 nucleotides, preferably at least about 10-12 nucleotides, and more preferably at least about 15-20 nucleotides corresponding to a region of the designated nucleotide sequence. "Corresponding" means identical to or complementary to the designated sequence.

The oligonucleotide is not necessarily physically derived from any existing or natural sequence but may be generated in any manner, including chemical synthesis, DNA replication, reverse transcription or a combination thereof. The terms "oligonucleotide" or "nucleic acid" intend a polynucleotide of genomic DNA or RNA, cDNA, semisynthetic, or synthetic origin which, by virtue of its origin or manipulation: (1) is not associated with all or a portion of the polynucleotide with which it is associated in nature; and/or (2) is linked to a polynucleotide other than that to which it is linked in nature; and (3) is not found in nature.

Because mononucleotides are reacted to make oligonucleotides in a manner such that the 5' phosphate of one mononucleotide pentose ring is attached to the 3' oxygen of its neighbor in one direction via a phosphodiester linkage, an end of an oligonucleotide is referred to as the "5' end" if its 5' phosphate is not linked to the 3' oxygen of a mononucleotide pentose ring and as the "3' end" if its 3' oxygen is not linked to a 5' phosphate of a subsequent mononucleotide pentose ring. As used herein, a nucleic acid sequence, even if internal to a larger oligonucleotide, also may be said to have 5' and 3' ends.

When two different, non-overlapping oligonucleotides anneal to different regions of the same linear complementary nucleic acid sequence, and the 3' end of one oligonucleotide points toward the 5' end of the other, the former may be called the "upstream" oligonucleotide and the latter the "downstream" oligonucleotide.

The term "primer" may refer to more than one primer and refers to an oligonucleotide, whether occurring naturally, as in a purified restriction digest, or produced synthetically, which is capable of acting as a point of initiation of synthesis along a complementary strand when placed under conditions in which synthesis of a primer extension product which is complementary to a nucleic acid strand is catalyzed. Such conditions include the presence of four different deoxyribonucleoside triphosphates and a polymerization-inducing agent such as DNA polymerase or reverse transcriptase, in a suitable buffer ("buffer" includes substituents which are cofactors, or which affect pH, ionic strength, etc.), and at a suitable temperature. The primer is preferably single-stranded for maximum efficiency in amplification.

The complement of a nucleic acid sequence as used herein refers to an oligonucleotide which, when aligned with the nucleic acid sequence such that the 5' end of one sequence is paired with the 3' end of the other, is in "antiparallel association." Certain bases not commonly found in natural nucleic acids may be included in the nucleic acids of the present invention and include, for example, inosine and 7-deazaguanine. Complementarity need not be perfect; stable duplexes may contain mismatched base pairs or unmatched bases. Those skilled in the art of nucleic acid technology can determine duplex stability empirically considering a number of variables including, for example, the length of the oligonucleotide, base composition and sequence of the oligonucleotide, ionic strength, and incidence of mismatched base pairs.

Stability of a nucleic acid duplex is measured by the melting temperature, or "Tm." The Tm of a particular nucleic acid duplex under specified conditions is the temperature at which half of the base pairs have disassociated.

As used herein, the term "target sequence" or "target nucleic acid sequence" refers to a region of the oligonucleotide which is to be either amplified, detected or both. The target sequence resides between the two primer sequences used for amplification.

As used herein, the term "probe" refers to a labeled oligonucleotide which forms a duplex structure with a sequence in the target nucleic acid, due to complementarity of at least one sequence in the probe with a sequence in the target region. The probe, preferably, does not contain a sequence complementary to sequence(s) used to prime the polymerase chain reaction. Generally the 3' terminus of the probe will be "blocked" to prohibit incorporation of the probe into a primer extension product. "Blocking" can be achieved by using non-complementary bases or by adding a chemical moiety such as biotin or a phosphate group to the 3' hydroxyl of the last nucleotide, which may, depending upon the selected moiety, serve a dual purpose by also acting as a label for subsequent detection or capture of the nucleic acid attached to the label. Blocking can also be achieved by removing the 3'-OH or by using a nucleotide that lacks a 3'-OH such as a dideoxynucleotide.

The term "label" as used herein refers to any atom or molecule which can be used to provide a detectable (preferably quantifiable) signal, and which can be attached to a nucleic acid or protein. Labels may provide signals detectable by fluorescence, radioactivity, colorimetry, gravimetry, X-ray diffraction or absorption, magnetism, enzymatic activity, and the like.

As defined herein, "5'→3' nuclease activity" or "5' to 3' nuclease activity" refers to that activity of a template-specific nucleic acid polymerase including either a 5'→3' exonuclease activity traditionally associated with some DNA polymerases whereby nucleotides are removed from the 5' end of an oligonucleotide in a sequential manner, (i.e., E. coli DNA polymerase I has this activity whereas the Klenow fragment does not), or a 5'→3' endonuclease activity wherein cleavage occurs more than one phosphodiester bond (nucleotide) from the 5' end, or both.

The term "adjacent" as used herein refers to the positioning of the primer with respect to the probe on its complementary strand of the template nucleic acid. The primer and probe may be separated by 1 to about 20 nucleotides, more preferably, about 1 to 10 nucleotides, or may directly abut one another, as may be desirable for detection with a polymerization-independent process. Alternatively, for use in the polymerization-dependent process, as when the present method is used in the PCR amplification and detection methods as taught herein, the "adjacency" may be anywhere within the sequence to be amplified, anywhere downstream of a primer such that primer extension will position the polymerase so that cleavage of the probe occurs.

As used herein, the term "thermostable nucleic acid polymerase" refers to an enzyme which is relatively stable to heat when compared, for example, to nucleotide polymerases from E. coli and which catalyzes the polymerization of nucleoside triphosphates. Generally, the enzyme will initiate synthesis at the 3'-end of the primer annealed to the target sequence, and will proceed in the 5'-direction along the template, and if possessing a 5' to 3' nuclease activity, hydrolyzing intervening, annealed probe to release both labeled and unlabeled probe fragments, until synthesis terminates. A representative thermostable enzyme isolated from Thermus aquaticus (Taq) is described in U.S. Pat. No. 4,889,818 and a method for using it in conventional PCR is described in Saiki et al., 1988, Science 239:487.

Taq DNA polymerase has a DNA synthesis-dependent, strand replacement 5'-3' exonuclease activity (see Gelfand, "Taq DNA Polymerase" in PCR Technology: Principles and Applications for DNA Amplification, Erlich, Ed., Stockton Press, N.Y. (1989), Chapter 2). In solution, there is little, if any, degradation of labeled oligonucleotides.

The practice of the present invention will employ, unless otherwise indicated, conventional techniques of molecular biology, microbiology and recombinant DNA techniques, which are within the skill of the art. Such techniques are explained fully in the literature. See, e.g., Sambrook, Fritsch & Maniatis, Molecular Cloning: A Laboratory Manual, Second Edition (1989); Oligonucleotide Synthesis (M. J. Gait, ed., 1984); Nucleic Acid Hvbridization (B. D. Hames & S. J. Higgins, eds., 1984); A Practical Guide to Molecular Cloning (B. Perbal, 1984); and a series, Methods in Enzymology (Academic Press, Inc.). All patents, patent applications, and publications mentioned herein, both supra and infra, are hereby incorporated by reference.

The various aspects of the invention are based on a special property of nucleic acid polymerases. Nucleic acid polymerases can possess several activities, among them, a 5' to 3' nuclease activity whereby the nucleic acid polymerase can cleave mononucleotides or small oligonucleotides from an oligonucleotide annealed to its larger, complementary polynucleotide. In order for cleavage to occur efficiently, an upstream oligonucleotide must also be annealed to the same larger polynucleotide.

The 3' end of this upstream oligonucleotide provides the initial binding site for the nucleic acid polymerase. As soon as the bound polymerase encounters the 5' end of the downstream oligonucleotide, the polymerase can cleave mononucleotides or small oligonucleotides therefrom.

The two oligonucleotides can be designed such that they anneal in close proximity on the complementary target nucleic acid such that binding of the nucleic acid polymerase to the 3' end of the upstream oligonucleotide automatically puts it in contact with the 5' end of the downstream oligonucleotide. This process, because polymerization is not required to bring the nucleic acid polymerase into position to accomplish the cleavage, is called "polymerization-independent cleavage."

Alternatively, if the two oligonucleotides anneal to more distantly spaced regions of the template nucleic acid target, polymerization must occur before the nucleic acid polymerase encounters the 5' end of the downstream oligonucleotide. As the polymerization continues, the polymerase progressively cleaves mononucleotides or small oligonucleotides from the 5' end of the downstream oligonucleotide. This cleaving continues until the remainder of the downstream oligonucleotide has been destabilized to the extent that it dissociates from the template molecule. This process is called "polymerization-dependent cleavage."

In the present invention, a label is attached to the downstream oligonucleotide. Thus, the cleaved mononucleotides or small oligonucleotides which are cleaved by the 5'-3' nuclease activity of the polymerase can be detected.

Subsequently, any of several strategies may be employed to distinguish the uncleaved labeled oligonucleotide from the cleaved fragments thereof. In this manner, the present invention permits identification of those nucleic acid samples which contain sequences complementary to the upstream and downstream oligonucleotides.

The present invention exploits this 5' to 3' nuclease activity of the polymerase when used in conjunction with PCR. This differs from previously described PCR amplification wherein the post-PCR amplified target oligonucleotides are detected, for example, by hybridization with a probe which forms a stable duplex with that of the target sequence under stringent to moderately stringent hybridization and wash conditions. In contrast to those known detection methods used in post-PCR amplifications, the present invention permits the detection of the target nucleic acid sequences during amplification of this target nucleic acid. In the present invention, a labeled oligonucleotide is added concomitantly with the primer at the start of PCR, and the signal generated from hydrolysis of the labeled nucleotide(s) of the probe provides a means for detection of the target sequence during its amplification.

The present invention is compatible, however, with other amplification systems, such as the transcription amplification system, in which one of the PCR primers encodes a promoter that is used to make RNA copies of the target sequence. In similar fashion, the present invention can be used in a self-sustained sequence replication (3SR) system, in which a variety of enzymes are used to make RNA transcripts that are then used to make DNA copies, all at a single temperature. By incorporating a polymerase with 5'→3' exonuclease activity into a ligase chain reaction (LCR) system, together with appropriate oligonucleotides, one can also employ the present invention to detect LCR products.

Of course, the present invention can be applied to systems that do not involve amplification. In fact, the present invention does not even require that polymerization occur. One advantage of the polymerization-independent process lies in the elimination of the need for amplification of the target sequence. In the absence of primer extension, the target nucleic acid is substantially single-stranded. Provided the primer and labeled oligonucleotide are adjacently bound to the target nucleic acid, sequential rounds of oligonucleotide annealing and cleavage of labeled fragments can occur. Thus, a sufficient amount of labeled fragments can be generated, making detection possible in the absence of polymerization. As would be appreciated by those skilled in the art, the signal generated during PCR amplification could be augmented by this polymerization-independent activity.

In either process described herein, a sample is provided which is suspected of containing the particular oligonucleotide sequence of interest, the "target nucleic acid". The target nucleic acid contained in the sample may be first reverse transcribed into cDNA, if necessary, and then denatured, using any suitable denaturing method, including physical, chemical, or enzymatic means, which are known to those of skill in the art. A preferred physical means for strand separation involves heating the nucleic acid until it is completely (>99%) denatured. Typical heat denaturation involves temperatures ranging from about 80° C. to about 105° C., for times ranging from a few seconds to minutes. As an alternative to denaturation, the target nucleic acid may exist in a single-stranded form in the sample, such as, for example, single-stranded RNA or DNA viruses.

The denatured nucleic acid strands are then incubated with preselected oligonucleotide primers and labeled oligonucleotide (also referred to herein as "probe") under hybridization conditions, conditions which enable the binding of the primers and probes to the single nucleic acid strands. As known in the art, the primers are selected so that their relative positions along a duplex sequence are such that an extension product synthesized from one primer, when the extension product is separated from its template (complement), serves as a template for the extension of the other primer to yield a replicate chain of defined length.

Because the complementary strands are longer than either the probe or primer, the strands have more points of contact and thus a greater chance of finding each other over any given period of time. A high molar excess of probe, plus the primer, helps tip the balance toward primer and probe annealing rather than template reannealing.

The primer must be sufficiently long to prime the synthesis of extension products in the presence of the agent for polymerization. The exact length and composition of the primer will depend on many factors, including temperature of the annealing reaction, source and composition of the primer, proximity of the probe annealing site to the primer annealing site, and ratio of primer:probe concentration. For example, depending on the complexity of the target sequence, the oligonucleotide primer typically contains about 15-30 nucleotides, although a primer may contain more or fewer nucleotides. The primers must be sufficiently complementary to anneal to their respective strands selectively and form stable duplexes.

The primers used herein are selected to be "substantially" complementary to the different strands of each specific sequence to be amplified. The primers need not reflect the exact sequence of the template, but must be sufficiently complementary to hybridize selectively to their respective strands. Non-complementary bases or longer sequences can be interspersed into the primer or located at the ends of the primer, provided the primer retains sufficient complementarity with a template strand to form a stable duplex therewith. The non-complementary nucleotide sequences of the primers may include restriction enzyme sites.

In the practice of the invention, the labeled oligonucleotide probe must be first annealed to a complementary nucleic acid before the nucleic acid polymerase encounters this duplex region, thereby permitting the 5' to 3' nuclease activity to cleave and release labeled oligonucleotide fragments.

To enhance the likelihood that the labeled oligonucleotide will have annealed to a complementary nucleic acid before primer extension polymerization reaches this duplex region, or before the polymerase attaches to the upstream oligonucleotide in the polymerization-independent process, a variety of techniques may be employed. For the polymerization-dependent process, one can position the probe so that the 5'-end of the probe is relatively far from the 3'-end of the primer, thereby giving the probe more time to anneal before primer extension blocks the probe binding site. Short primer molecules generally require lower temperatures to form sufficiently stable hybrid complexes with the target nucleic acid. Therefore, the labeled oligonucleotide can be designed to be longer than the primer so that the labeled oligonucleotide anneals preferentially to the target at higher temperatures relative to primer annealing.

One can also use primers and labeled oligonucleotides having differential thermal stability. For example, the nucleotide composition of the labeled oligonucleotide can be chosen to have greater G/C content and, consequently, greater thermal stability than the primer. In similar fashion, one can incorporate modified nucleotides into the probe, which modified nucleotides contain base analogs that form more stable base pairs than the bases that are typically present in naturally occurring nucleic acids.

Modifications of the probe that may facilitate probe binding prior to primer binding to maximize the efficiency of the present assay include the incorporation of positively charged or neutral phosphodiester linkages in the probe to decrease the repulsion of the polyanionic backbones of the probe and target (see Letsinger et al., 1988, J. Amer. Chem. Soc. 110:4470); the incorporation of alkylated or halogenated bases, such as 5-bromouridine, in the probe to increase base stacking; the incorporation of ribonucleotides into the probe to force the probe:target duplex into an "A" structure, which has increased base stacking; and the substitution of 2,6-diaminopurine (amino adenosine) for some or all of the adenosines in the probe. In preparing such modified probes of the invention, one should recognize that the rate limiting step of duplex formation is "nucleation," the formation of a single base pair, and therefore, altering the biophysical characteristic of a portion of the probe, for instance, only the 3' or 5' terminal portion, can suffice to achieve the desired result In addition, because the 3' terminal portion of the probe (the 3' terminal 8 to 12 nucleotides) dissociates following exonuclease degradation of the 5' terminus by the polymerase, modifications of the 3' terminus can be made without concern about interference with polymerase/nuclease activity.

The thermocycling parameters can also be varied to take advantage of the differential thermal stability of the labeled oligonucleotide and primer. For example, following the denaturation step in thermocycling, an intermediate temperature may be introduced which is permissible for labeled oligonucleotide binding but not primer binding, and then the temperature is further reduced to permit primer annealing and extension. One should note, however, that probe cleavage need only occur in later cycles of the PCR process for suitable results. Thus, one could set up the reaction mixture so that even though primers initially bind preferentially to probes, primer concentration is reduced through primer extension so that, in later cycles, probes bind preferentially to primers.

To favor binding of the labeled oligonucleotide before the primer, a high molar excess of labeled oligonucleotide to primer concentration can also be used. In this embodiment, labeled oligonucleotide concentrations are typically in the range of about 2 to 20 times higher than the respective primer concentration, which is generally 0.5-5×10-7 M. Those of skill recognize that oligonucleotide concentration, length, and base composition are each important factors that affect the Tm of any particular oligonucleotide in a reaction mixture. Each of these factors can be manipulated to create a thermodynamic bias to favor probe annealing over primer annealing.

The oligonucleotide primers and labeled oligonucleotides may be prepared by any suitable method. Methods for preparing oligonucleotides of specific sequence are known in the art, and include, for example, cloning and restriction of appropriate sequences and direct chemical synthesis. Chemical synthesis methods may include, for example, the phosphotriester method described by Narang et al., 1979, Methods in Enzymology 68:90, the phosphodiester method disclosed by Brown et al., 1979, Methods in Enzymology 68:109, the diethylphosphoramidate method disclosed in Beaucage et al., 1981, Tetrahedron Letters 22:1859, and the solid support method disclosed in U.S. Pat. No. 4,458,066.

The composition of the labeled oligonucleotide can be designed to favor nuclease activity over strand displacement (mono- and dinucleotide fragments over oligonucleotides) by means of choice of sequences that are GC-rich or that avoid sequential A's and T's and by choice of label position in the probe. In the presence of AT-rich sequences in the 5' complementary probe region, cleavage occurs after the approximately fourth, fifth or sixth nucleotide. However, in a GC-rich 5' complementary probe region, cleavage generally occurs after the first or second nucleotide. Alternatively, the incorporation of modified phosphodiester linkages (e.g., phosphorothioate or methylphosphonates) in the labeled probe during chemical synthesis (Noble et al., 1984, Nuc Acids Res 12:3387-3403; Iyer et al., 1990, J. Am. Chem. Soc. 112:1253-1254) may be used to prevent cleavage at a selected site. Depending on the length of the probe, the composition of the 5' complementary region of the probe, and the position of the label, one can design a probe to favor preferentially the generation of short or long labeled probe fragments for use in the practice of the invention.

The oligonucleotide is labeled, as described below, by incorporating moieties detectable by spectroscopic, photochemical, biochemical, immunochemical, or chemical means. The method of linking or conjugating the label to the oligonucleotide probe depends, of course, on the type of label(s) used and the position of the label on the probe.

A variety of labels that would be appropriate for use in the invention, as well as methods for their inclusion in the probe, are known in the art and include, but are not limited to, enzymes (e.g., alkaline phosphatase and horseradish peroxidase) and enzyme substrates, radioactive atoms, fluorescent dyes, chromophores, chemilumnescent labels, electrochemiluminescent labels, such as Origen™ (Igen), ligands having specific binding partners, or any other labels that may interact with each other to enhance, alter, or diminish a signal. Of course, should the PCR be practiced using a thermal cycler instrument, the label must be able to survive the temperature cycling required in this automated process.

Among radioactive atoms, 32 P is preferred. Methods for introducing 32 P into nucleic acids are known in the art, and include, for example, 5' labeling with a kinase, or random insertion by nick translation. Enzymes are typically detected by their activity. "Specific binding partner" refers to a protein capable of binding a ligand molecule with high specificity, as for example in the case of an antigen and a monoclonal antibody specific therefor. Other specific binding partners include biotin and avidin or streptavidin, IgG and protein A, and the numerous receptor-ligand couples known in the art. The above description is not meant to categorize the various labels into distinct classes, as the same label may serve in several different modes. For example, 125 I may serve as a radioactive label or as an electron-dense reagent. HRP may serve as enzyme or as antigen for a monoclonal antibody. Further, one may combine various labels for desired effect. For example, one might label a probe with biotin, and detect the presence of the probe with avidin labeled with 125 I, or with an anti-biotin monoclonal antibody labeled with HRP. Other permutations and possibilities will be readily apparent to those of ordinary skill in the art and are considered as equivalents within the scope of the instant invention.

Fluorophores for use as labels in constructing labeled probes of the invention include rhodamine and derivatives, such as Texas Red, fluorescein and derivatives, such as 5-bromomethyl fluorescein, Lucifer Yellow, IAEDANS, 7-Me2 N-coumarin-4-acetate, 7-OH-4-CH3 -coumarin-3-acetate, 7-NH2 -4-CH3 -coumarin-3-acetate (AMCA), monobromobimane, pyrene trisulfonates, such as Cascade Blue, and monobromotrimethyl-ammoniobimane. In general, fluorophores with wide Stokes shifts are preferred, to allow using fluorimeters with filters rather than a monochromometer and to increase the efficiency of detection.

In some situations, one can use two interactive labels on a single oligonucleotide with due consideration given for maintaining an appropriate spacing of the labels on the oligonucleotide to permit the separation of the labels during oligonucleotide hydrolysis. Rhodamine and crystal violet are preferred interactive labels.

In another embodiment of the invention, detection of the hydrolyzed labeled probe can be accomplished using, for example, fluorescence polarization, a technique to differentiate between large and small molecules based on molecular tumbling. Large molecules (e.g., intact labeled probe) tumble in solution much more slowly than small molecules. Upon linkage of a fluorescent moiety to the molecule of interest (e.g., the 5' end of a labeled probe), this fluorescent moiety can be measured (and differentiated) based on molecular tumbling, thus differentiating between intact and digested probe. Detection may be measured directly during PCR or may be performed post PCR.

In yet another embodiment, two labelled oligonucleotides are used, each complementary to separate regions of separate strands of a double-stranded target region, but not to each other, so that an oligonucleotide anneals downstream of each primer. For example, the presence of two probes can potentially double the intensity of the signal generated from a single label and may further serve to reduce product strand reannealing, as often occurs during PCR amplification. The probes are selected so that the probes bind at positions adjacent (downstream) to the positions at which primers bind.

One can also use multiple probes in the present invention to achieve other benefits. For instance, one could test for any number of pathogens in a sample simply by putting as many probes as desired into the reaction mixture; the probes could each comprise a different label to facilitate detection.

One can also achieve allele-specific or species-specific (i.e., specific for the different species of Borrelia, the causative agent of Lyme disease) discrimination using multiple probes in the present invention, for instance, by using probes that have different Tm s and conducting the annealing/cleavage reaction at a temperature specific for only one probe/allele duplex. For instance, one can choose a primer pair that amplifies both HTLVI and HTLVII and use two probes, each labeled uniquely and specific for either HTLVI or HTLVII. One can also achieve allele specific discrimination by using only a single probe and examining the types of cleavage products generated. In this embodiment of the invention, the probe is designed to be exactly complementary, at least in the 5' terminal region, to one allele but not to the other allele(s). With respect to the other allele(s), the probe will be mismatched in the 5' terminal region of the probe so that a different cleavage product will be generated as compared to the cleavage product generated when the probe is hybridized to the exactly complementary allele.

Although probe sequence can be selected to achieve important benefits, one can also realize important advantages by selection of probe label(s). The labels may be attached to the oligonucleotide directly or indirectly by a variety of techniques. Depending on the precise type of label used, the label can be located at the 5' or 3' end of the probe, located internally in the probe, or attached to spacer arms of various sizes and compositions to facilitate signal interactions. Using commercially available phosphoramidite reagents, one can produce oligomers containing functional groups (e.g., thiols or primary amines) at either the 5' or the 3' terminus via an appropriately protected phosphoramidite, and can label them using protocols described in, for example, PCR Protocols: A Guide to Methods and Applications (Innis et al., eds. Academic Press, Inc., 1990).

Methods for introducing oligonucleotide functionalizing reagents to introduce one or more sulfhydryl, amino or hydroxyl moieties into the oligonucleotide probe sequence, typically at the 5' terminus, are described in U.S. Pat. No. 4,914,210. A 5' phosphate group can be introduced as a radioisotope by using polynucleotide kinase and gamma-32 P-ATP to provide a reporter group. Biotin can be added to the 5' end by reacting an aminothymidine residue, or a 6-amino hexyl residue, introduced during synthesis, with an N-hydroxysuccinimide ester of biotin. Labels at the 3' terminus may employ polynucleotide terminal transferase to add the desired moiety, such as for example, cordycepin 35 S-dATP, and biotinylated dUTP.

Oligonucleotide derivatives are also available labels. For example, etheno-dA and etheno-A are known fluorescent adenine nucleotides that can be incorporated into an oligonucleotide probe. Similarly, etheno-dC or 2-amino purine deoxyriboside is another analog that could be used in probe synthesis. The probes containing such nucleotide derivatives may be hydrolyzed to release much more strongly fluorescent mononucleotides by the 5' to 3' nuclease activity as DNA polymerase extends a primer during PCR.

Template-dependent extension of the oligonucleotide primer(s) is catalyzed by a polymerizing agent in the presence of adequate amounts of the four deoxyribonucleoside triphosphates (dATP, dGTP, dCTP, and dTTP) or analogs as discussed above, in a reaction medium comprised of the appropriate salts, metal cations, and pH buffering system. Suitable polymerizing agents are enzymes known to catalyze primer- and template-dependent DNA synthesis and possess the 5' to 3' nuclease activity. Known DNA polymerases include, for example, E. coli DNA polymerase I, Thermus thermophilus (Tth) DNA polymerase, Bacillus stearothermophilus DNA polymerase, Thermococcus litoralis DNA polymerase, and Thermus aquaticus (Taq) DNA polymerase. The reaction conditions for catalyzing DNA synthesis with these DNA polymerases are well known in the art. To be useful in the present invention, the polymerizing agent must efficiently cleave the oligonucleotide and release labeled fragments so that the signal is directly or indirectly generated.

The products of the synthesis are duplex molecules consisting of the template strands and the primer extension strands, which include the target sequence. Byproducts of this synthesis are labeled oligonucleotide fragments that consist of a mixture of mono-, di- and larger nucleotide fragments. Repeated cycles of denaturation, labeled oligonucleotide and primer annealing, and primer extension and cleavage of the labeled oligonucleotide result in the exponential accumulation of the target region defined by the primers and the exponential generation of labeled fragments. Sufficient cycles are run to achieve a detectable species of label, which can be several orders of magnitude greater than background signal, although in common practice such high ratios of signal to noise may not be achieved or desired.

In a preferred method, the PCR process is carried out as an automated process that utilizes a thermostable enzyme. In this process the reaction mixture is cycled through a denaturing step, a probe and primer annealing step, and a synthesis step, whereby cleavage and displacement occurs simultaneously with primer-dependent template extension. A DNA thermal cycler, such as the commercially available machine from Perkin-Elmer Cetus Instruments, which is specifically designed for use with a thermostable enzyme, may be employed.

Temperature stable polymerases are preferred in this automated process, because the preferred way of denaturing the double stranded extension products is by exposing them to a high temperature (about 95° C.) during the PCR cycle. For example, U.S. Pat. No. 4,889,818 discloses a representative thermostable enzyme isolated from Thermnus aquaticus. Additional representative temperature stable polymerases include, e.g., polymerases extracted from the thermostable bacteria Thermus flavus, Thermus ruber, Thermus thermophilus, Bacillus stearothermophilus (which has a somewhat lower temperature optimum than the others listed), Thermus lacteus, Thermus rubens, Thermotoga maritima, Thermococcus litoralis, and Methanothermnus fervidus.

Detection or verification of the labeled oligonucleotide fragments may be accomplished by a variety of methods and may be dependent on the source of the label or labels employed. One convenient embodiment of the invention is to subject the reaction products, including the cleaved labeled fragments, to size analysis. Methods for determining the size of the labeled nucleic acid fragments are known in the art, and include, for example, gel electrophoresis, sedimentation in gradients, gel exclusion chromatography and homochromatography.

During or after amplification, separation of the labeled fragments from the PCR mixture can be accomplished by, for example, contacting the PCR mixture with a solid phase extractant (SPE). For example, materials having an ability to bind oligonucleotides on the basis of size, charge, or interaction with the oligonucleotide bases can be added to the PCR mixture, under conditions where labeled, uncleaved oligonucleotides are bound and short, labeled fragments are not. Such SPE materials include ion exchange resins or beads, such as the commercially available binding particles Nensorb (DuPont Chemical Co.), Nucleogen (The Nest Group), PEI, BakerBond™ PEI, Amicon PAE 1,000, Selectacel™ PEI, Boronate SPE with a 3'-ribose probe, SPE containing sequences complementary to the 3'-end of the probe, and hydroxylapatite. In a specific embodiment, if a dual labeled oligonucleotide comprising a 3' biotin label separated from a 5' label by a nuclease susceptible cleavage site is employed as the signal means, the PCR amplified mixture can be contacted with materials containing a specific binding partner such as avidin or streptavidin, or an antibody or monoclonal antibody to biotin. Such materials can include beads and particles coated with specific binding partners and can also include magnetic particles.

Following the step in which the PCR mixture has been contacted with an SPE, the SPE material can be removed by filtration, sedimentation, or magnetic attraction, leaving the labeled fragments free of uncleaved labeled oligonucleotides and available for detection.

Reagents employed in the methods of the invention can be packaged into diagnostic kits. Diagnostic kits include the labeled oligonucleotides and the primers in separate containers. If the oligonucleotide is unlabeled, the specific labeling reagents may also be included in the kit. The kit may also contain other suitably packaged reagents and materials needed for amplification, for example, buffers, dNTPs, and/or polymerizing means, and for detection analysis, for example, enzymes and solid phase extractants, as well as instructions for conducting the assay.

The examples presented below are intended to be illustrative of the various methods and compounds of the invention.

EXAMPLE 1 PCR Probe Label Release

A PCR amplification was performed which liberated the 5'32 P-labeled end of a complementary probe when specific intended product was synthesized.

A. Labeling of probe with gamma-32 P-ATP and polynucleotide kinase

Ten pmol of each probe (BW31, BW33, BW35, sequences provided below) were individually mixed with fifteen units of T4 polynucleotide kinase (New England Biolabs) and 15.3 pmol of gamma-32 P-ATP (New England Nuclear, 3000 Ci/mmol) in a 50 μl reaction volume containing 50 mM Tris-HCl, pH 7.5, 10 mM MgCl2, 5 mM dithiothreitol, 0.1 mM spermidine and 0.1 mM EDTA for 60 minutes at 37° C. The total volume was then phenol/chloroform extracted, and ethanol precipitated as described by Sambrook et al., Molecular Cloning, Second Edition (1989). Probes were resuspended in 100 μl of TE buffer and run over a Sephadex G-50 spin dialysis column to remove unincorporated gamma-32 P-ATP as taught in Sambrook et al., supra. TCA precipitation of the reaction products indicated the following specific activities:

BW31: 1.98×106 cpm/pmol

BW33: 2.54×106 cpm/pmol

BW35: 1.77×106 cpM/pmol

Final concentration of all three probes was 0.10 pmol/μl.

B. Amplification

The amplified region was a 350 base pair product from the bacteriophage M13mp10w directed by primers BW36 and BW42. The region of each numbered primer sequence designated herein, follows standard M13 nucleotide sequence usage.

______________________________________SEQ ID NO: 1    BW36 = 5' 5241-5268 3'    5'-CCGATAGTTTGAGTTCTTCTACTCAGGC-3'SEQ ID NO: 2    BW42 = 5' 5591-5562 3'    5'-GAAGAAAGCGAAAGGAGCGGGCGCTAGGGC-3'______________________________________

Three different probes were used; each contained the 30 base exactly complementary sequence to M13mp10w but differed in the lengths of non-complementary 5' tail regions. Probes were synthesized to have a 3'-PO4 instead of a 3'-OH to block any extension by Taq polymerase.

__________________________________________________________________________SEQ ID NO: 3     BW31 = 5' 5541-5512 3'     5'-*CGCTGCGCGTAACCACCACCCGCCGCGCX-3'SEQ ID NO: 4     BW33 = 5' 5541-5512 3'     5'-*gatCGCTGCGCGTAACCACCACACCCGCCGCCGCGCX-3'SEQ ID NO: 5     BW35 = 5' 5541-5512 3'     5'-*cgtcaccgatCGCTGCGCGTAACCACCACACCCGCCGCGCX-3'__________________________________________________________________________ X= 3'-phosphate a,t,g,c,= bases noncomplementary to template strand *= gamma .sup.32 PATP label

For amplification of the 350 bp fragment, 10-3 pmol of target M13mp10w sequence were added to a 50 μl reaction volume containing 50 mM KCl, 10 mM Tris-HCl, pH 8.3, 3 mM MgCl2, 10 pmol each of primers BW36 and BW42, 200 μM each of the four deoxyribonucleoside triphosphates, 1.25 units Taq DNA polymerase, and either 1, 10 or 20 pmol of isotopically diluted probe BW31, BW33 or BW35. The amount of radiolabeled probe was held constant at 0.4 pmol per reaction and diluted to 1, 10 or 20 pmol with nonradioactive probe. Taq polymerase was added at 4 μl per reaction at 0.3125 U/μl and diluted in 10 mM Tris-HCl, pH 8.0, 50 mM KCl, 0.1 mM EDTA, 0.5% NP40, 0.5% Tween 20, and 500 μg/ml gelatin.

A master reaction mix was made containing appropriate amounts of reaction buffer, nucleoside triphosphates, both primers and enzyme. From this master mix aliquots were taken and to them were added template and various concentrations of each probe. Control reactions consisted of adding all reaction components except template, and all reaction components except probe. Each reaction mixture was overlayed with 50 μl of mineral oil to prevent evaporation, microcentrifuged for 45 seconds, and then placed into a thermal cycler. Reaction mixtures were subjected to the following amplification scheme:

______________________________________Fifteen cycles:         96° C. denaturation, 1 min         60° C. anneal/extension, 1.5 minOne cycle:    96° C. denaturation, 1 min         60° C. anneal/extension, 5.5 min______________________________________

After cycling, the mineral oil was extracted with 50 μl of chloroform, the mixtures were stored at 4° C., and the following tests were performed.

C. Analysis

For acrylamide gel analysis, 4 μl of each amplification reaction were mixed with 3 μl of 5× gel loading mix (0.125% bromophenol blue, 12.5% Ficoll 400 in H2 O) and loaded onto a 4% acrylamide gel (10 ml of 10× TBE buffer, 1 ml of 10% ammonium persulfate, 10 ml of 40% Bis Acrylamide 19:1, 50 μl of TEMED, and 79 ml of H2 O) in 1× TBE buffer (0.089M Tris, 0.089M boric acid, and 2 mM EDTA) and electrophoresed for 90 minutes at 200 volts. After staining with ethidium bromide, DNA was visualized by UV fluorescence.

The results showed that the presence of each of these three probes at the various concentrations had no effect on the amount of amplified product generated. Sample lanes containing no probe showed discrete high intensity 350 base pair bands corresponding to the desired sequence. All lanes containing probe showed the same, as well as a few faint bands at slightly higher molecular weight. Control lanes without template added showed no bands whatsoever at 350 bases, only lower intensity bands representing primer at 30-40 bases.

After photographing, the gel was transferred onto Whatman paper, covered with Saran Wrap and autoradiographed. An overnight exposure revealed that 90-95% of the radiolabel was near the bottom of the gel, where probe or partially degraded probe would run.

For the denaturing gel analysis, 2 μl of each amplification reaction were mixed with 2 μl of forrnamide loading buffer (0.2 ml of 0.5M EDTA pH 8, 10 mg of bromophenol blue, 10 mg of xylene cyanol, and 10 ml of formamide), then heated to 96° C. for 3-5 min and placed on ice. Samples were loaded onto a 6.2% denaturing gradient polyacrylamide gel (7M urea with both a sucrose and a buffer gradient) according to the procedure of Sambrook eftai., supra. The gel was electrophoresed for 90 minutes at 2000 V, 45 W, then transferred onto Whatman paper and autoradiographed.

Results from the denaturing gel indicated that about 50% of each probe was degraded into smaller labeled fragments. Approximately 50-60% of the counts lie in the 30-40 base range, corresponding to undergraded probe. A very faint band is visible at 300 bases for all the amplification reactions, suggesting that a very small percentage of the probes have lost, or never had, a 3'-PO4 group and have been extended. The remainder of the counts are in the range of zero to fifteen bases. The resolution on such a gel does not reveal the exact size of products, which can be better determined by homochromatography analysis.

For a homochromatography analysis, 1 μl of each sample was spotted 1.2 cm apart onto a Polygram CEL 300 DEAE 20×20 cm cellulose thin layer plate, which was pre-spotted with 5 μl of sheared herring sperm DNA (150 μg/ml) and allowed to dry. After the sample was dried, the plate was placed in a trough with distilled H2 O, and the water allowed to migrate just above the sample loading area. The plate was then placed in a glass development tank containing filtered Homo-mix III (Jay et al., 1979, Nuc. Acid Res. 1(3):331-353), a solution of partially hydrolized RNA containing 7M urea, in a 70° C. oven. The Homo-Mix was allowed to migrate by capillary action to the top of the plate, at which time the plate was removed, allowed to dry, covered with Saran Wrap, and then autoradiographed.

An overnight exposure of the homochromatography plate also indicated that about 40% of the probes were degraded into smaller fragments. These fragments were very specific in size, depending upon the length of the 5' non-complementary tail of each probe. FIG. 1 shows an autoradiograph of the TLC plate. Probe BW31 (Lanes 1-3), which was fully complementary to the M13mp10w template, generated labeled fragments predominantly one to two bases long. Probe BW33, (Lanes 4-6), containing a 5' 3 base non-complementary region, released products predominantly four to six bases long. BW35 (Lanes 7-9) had a 5' 10 base non-complementary tail and released products predominantly 12 to 13 bases in length. Lanes 10-12 are control reactions containing either BW31, BW33 or BW35 and all PCR components except template after 15 cycles. During DNA synthesis, the enzyme displaced the first one or two paired bases encountered and then cut at that site, indicative of an endonuclease-like activity. The results show specific probe release coordinately with product accumulation in PCR.

EXAMPLE 2 Specificity of Probe Label Release

The specificity of labeled probe release was examined by performing a PCR amplification using bacteriophage lambda DNA and primers, and a series of non-complementary kinased probes.

The region to be amplified was a 500 nucleotide region on bacteriophage lambda DNA from the GeneAmp® DNA Amplification Reagent kit (Perkin-Elmer Cetus), flanked by primers PCRO1 and PCRO2, also from the GeneAmp® DNA kit.

______________________________________SEQ ID NO: 6       PCRO1 = 5' 7131-7155 3'       5'-GATGAGTTCGTGTCCGTACAACTGG-3'SEQ ID NO: 7       PCRO2 = 5' 7630-7606 3';       5'-GGTTATCGAAATCAGCCACAGCGCC-3'______________________________________

Aliquots of the same three labeled probes BW31, BW33 and BW35 identified in Example I, were used, all of which were entirely non-complementary to the target sequence.

For amplification of the 500 base pair region, 0.5 ng of target lambda DNA sequence (control Template, Lot #3269, 1 μg/ml, dilute 1:10 in 10 mM Tris-HCl pH 8.0, 1 mM EDTA, and 10 mM NaCl for stock) were added to a 50 μl reaction volume containing 50 mM KCl, 10 mM Tris-HCl, pH 8.3, 3 mM MgCl2, 1 μM each of primers PCRO1 (Lot #3355) and PCRO2 (Lot #3268), 200 μM each of four deoxynucleoside triphosphates, 1.25 units Taq DNA polymerase, and either 2, 10 or 20 pmol of isotopically diluted probe BW31, BW33 or BW35. The amount of radiolabeled probe was held constant to 0.4 pmol per reaction and diluted to 1, 10 or 20 pmol with nonradioactive probe. Taq DNA polymerase was added at 4 μl per reaction at 0.3125 units/μl and diluted in 10 mM Tris-HCl pH 8.0, 50 mM KCl, 0.1 mM EDTA, 0.5% NP40, 0.5% Tween 20, and 500 μg/ml gelatin.

The master reaction mix was made as previously taught, along with the control reactions minus probe or minus enzyme. The reaction mixtures were amplified following the cycling conditions set forth in Example 1B and then analyzed as follows. For acrylamide gel analysis, 4 μl of each amplification reaction mixed with 3 μl of 5× loading mix were loaded onto a 4% acrylamide gel in 1× TBE buffer and electrophoresed for 90 minutes at 200 volts. After staining with ethidium bromide, DNA was visualized by UV fluorescence.

The results show that the presence of any probe at any concentration has no effect on the amount of amplified product generated. Sample control lanes containing no probe, and all lanes containing probe, showed a discrete high intensity 500 base pair band corresponding to the desired sequence. Control lanes with no enzyme added did not show any product bands but only low intensity bands representing primer and probe of approximately 30-40 nucleotides.

The homochromatography analysis provided in FIG. 2 shows an overnight exposure of the plate in which no degradation of the probes was observed. All of the counts were located at the point of origin, showing no release of labeled fragments. Lanes 1-3 are reactions containing probe BW31; Lanes 4-6 include probe BW33; Lanes 7-9 include probe BW35; and Lanes 10-12 are control reactions without template. The results show that the probe is not degraded unless specifically bound to target and is able to withstand the PCR cycling conditions.

In the denaturing gel analysis, 2 μl of each amplification reaction were mixed with 2 μl of formamide loading buffer (described in Example I) and placed on a heat block at 96° C. for 3-5 min. Samples were immediately placed on ice and loaded onto a 6.2% denaturing gradient acrylamide gel, and electrophoresed for 90 minutes at 2000 volts. After electrophoresis, the gel was transferred onto Whatman paper, covered with Saran Wrap, and autoradiographed.

An overnight exposure revealed all of the counts in the 30-40 base pair range, corresponding to the sizes of the probes. Once again, there was no probe degradation apparent, further confirming that probe must be specifically bound to template before any degradation can occur.

EXAMPLE 3 Specificity of Probe Label Release in the Presence of Genomic DNA

In this example, the specificity of probe label release was examined by performing a PCR amplification in the presence of degraded or non-degraded human genomic DNA.

The BW33 kinased probe used in this experiment had a specific activity of 5.28×106 cprn/pmol determined by TCA precipitation following the kinasing reaction. The region amplified was the 350 base pair region of M13mp10w, flanked by primers BW36 and BW42. Primer sequences and locations are listed in Example 1. Human genomic DNA was from cell line HL60 and was used undegraded or degraded by shearing in a french press to an average size of 800 base pairs.

Each 50 μl amplification reaction consisted of 10-2 or 10-3 pmol of M13mp10w target sequence, 1 μg of either degraded or non-degraded HL60 genomic DNA added to a mixture containing 50 mM KCl, 10 mM Tris HCl, pH 8.3, 3 mM MgCl2, 10 pmol each of primers BW36 and BW42, 200 μM each of four deoxyribonucleoside triphosphates, 1.25 units Taq DNA polymerase and 10 pmol of isotopically diluted probe BW33.

A master reaction mix was made containing appropriate amounts of reaction buffer, nucleoside triphosphates, primers, probe, and enzyme. Aliquots were made and to them was added M13mp10w template and/or genomic DNA. Control reactions included all reaction components except M13mp10w target DNA or all reaction components except genomic DNA.

Each reaction mixture was overlayed with 50 μl of mineral oil, microcentrifuged, and placed into a thermal cycler. Reaction mixtures were subjected to the following amplification scheme:

______________________________________For 10, 15 or 20 cycles:          96° C. denaturation, 1 min          60° C. anneal/extension, 1.5 minFinal cycle:   96° C. denaturation, 1 min          60° C. anneal/extension, 5.5 min______________________________________

After cycling, the mineral oil was extracted using 50 μl of chloroform and samples were stored at 4° C. Samples were subsequently analyzed by a 4% acrylamide gel electrophoresis, and homochromatography analysis.

For the acrylamide gel analysis, 4 μl of each reaction mixture were mixed with 3 μl of 5× gel loading mix, loaded onto a 4% acrylamide gel in 1× TBE buffer, and electrophoresed for 90 minutes at 220 volts. DNA was visualized by UV fluorescence after staining with ethidium bromide.

In the lanes corresponding to control samples containing no M13mp10w target DNA, there were no visible product bands, indicating the absence of any crossover contamination of M13mp10w. All subsequent lanes showed a band at 350 bases corresponding to the expected sequence. The intensity of the band was greater when 10-2 pmol M13mp10w target DNA was present over 10-3 pmol in the absence or presence of genomic DNA (degraded or undegraded). The product band intensity increased with increasing number of amplification cycles. Twenty cycles produced a band with twice the intensity of that seen at ten cycles, and fifteen cycles generated a band of intermediate intensity. The amount of PCR product present varied with the amount of starting target template and the number of cycles, and the presence of 1 μg of human genomic DNA, whether degraded or undegraded, showed no effect at all on this product formation.

In the homochromatography analysis, 1 μl of each reaction mixture was spotted onto a DEAE thin layer plate, and placed in a developing chamber containing Homo-Mix III at 70° C. After 90 minutes, the plate was removed, allowed to dry, covered with Saran Wrap, and autoradiographed. An overnight exposure is shown in FIG. 3; in FIG. 3A, Lanes 1 to 6 show PCR reaction cycles in the absence of M13mp10w template DNA containing, alternately, degraded and undegraded HL60 DNA at 10, 15, and 20 cycles; and Lanes 7-12 are duplicate loading control reactions containing M13mp10w template DNA without any human genomic DNA at 10, 15 and 20 cycles. In FIG. 3B, reactions are amplified over increasing 5 cycle increments starting at 10 cycles. The M13mp10w template DNA concentration in the reactions shown in Lanes 1, 2, 5, 6, 9, and 10 is 10-2 pmol, while in lanes 3, 4, 7, 8, 11, and 12 is 10-3 pmol. The reactions shown in the odd numbered lanes from 1 through 11 contain degraded human genomic DNA, and the even numbered lanes contain non-degraded human genomic DNA. Labeled probe fragments were seen as two well-defined spots migrating at approximately 4 and 5 bases in length on the thin layer plate. As the starting template concentration increased and/or as the cycle number increased, the amount of released labeled probe fragments also increased. The presence or absence of degraded or non-degraded human genomic DNA did not interfere with or enhance probe hybridization and degradation.

The results show that increased amounts of released small probe fragments occur coordinately and simultaneously with specific product accumulation during the course of a PCR assay. The presence or absence of either a large amount of high complexity human genomic DNA or a large number of random DNA "ends" has no effect on specific product accumulation or degree of probe release. Finally, the presence of a large amount of high complexity human genomic DNA does not lead to any detectable probe release in the absence of specific product accumulation.

EXAMPLE 4 PCR with 3' Labeled Probe

A PCR amplification was performed which liberated a hybridized 3' radiolabeled probe into smaller fragments when the probe was annealed to template. The sequences of the probes were as follows:

__________________________________________________________________________SEQ ID NO: 8     DG46 = 5' 5541-5512-3'     5'-CGCTGCGCGTAACCACCACACCCGCCGCGC-3'SEQ ID NO: 9     BW32 = 5' 5541-5512-3'     5'-gatCGCTGCGCGTAACCACCACACCCGCCGCGC-3'SEQ ID NO: 10     BW34 = 5' 5541-5512-3'     5'-cgtcaccgatCGCTGCGCGTAACCACCACACCCGCCGCGC-3'__________________________________________________________________________

A. Labeling of Probes with 32 P-cordycepin and terminal transferase

Five pmol of each probe (DG46, BW32, and BW34) were individually mixed with 17.4 units of terminal transferase (Stratagene) and 10 pmol of α-32 P!-cordycepin (cordycepin: 3'-deoxyadenosine-5' triphosphate, New England Nuclear, 5000 Ci/mmol, diluted 3× with ddATP Pharmacia!) in a 17.5 μl reaction volume containing 100 mM potassium cacodylate, 25 mM Tris-HCl, pH 7.6, 1 mM CoCl2, and 0.2 mM dithiothreitol for 60 minutes at 37° C. The total volume was then phenol/chloroform extracted and ethanol precipitated. Probes were resuspended in 50 μl of TE buffer and run over a Sephadex G-50 spin dialysis column according to the procedure of Sambrook, et al., Molecular Cloning, supra. The final concentration of probes was 0.1 pmol/μl. TCA precipitation of the reaction products indicated the following specific activities:

DG46: 2.13×106 cpm/pmol

BW32: 1.78×106 cpm/pmol

BW34: 5.02×106 cpm/pmol

Denaturing gradient gel analysis comparison of the 3' radiolabeled probes to 5' kinased probes BW31, BW33 and BW35, show that the 3' radiolabeled probes ran in a similar fashion to the 5' radiolabeled probes.

Once again, the region amplified was the 350 base region on M13mp10w defined by primers BW36 and BW42. Primer sequences and locations are listed in Example 1. Each amplification mixture was prepared adding 10-3 pmol of the target M13mp10w DNA to a 50 μl reaction volume containing 50 mM KCl, 10 mM Tris HCl, pH 8.3, 3 mM MgCl2, 10 pmol each of primers BW36 and BW42, 200 μM each of four deoxynucleoside triphosphates, 1.25 units of Taq DNA polymerase, and either 2, 10, or 20 pmol of isotopically diluted probe DG46, BW32, or BW34.

A master reaction mix was made containing appropriate amounts of reaction buffer, nucleoside triphosphates, template, and enzyme. Aliquots were made and to them was added the appropriate amount of primers and probes. Control reactions included all reaction components except primers, and all reaction components except probe.

Reaction mixtures were overlaid with 50 μl of mineral oil, microcentrifuged, and placed into a thermal cycler. The amplification scheme was as follows:

______________________________________Fifteen cycles:         96° C. denaturation, 1 min         60° C. anneal/extension, 1.5 minFinal cycle:  96° C. denaturation, 1 min         60° C. anneal/extension, 5.5 min______________________________________

After cycling, the mineral oil was extracted using 50 μl of chloroform, and samples were stored at 4° C.

Samples were analyzed by a 4% acrylamide gel, an 8% denaturing gradient acrylamide gel, and by homochromatography. For all three analyses, handling of reaction mixtures was as previously described.

In the 4% acrylamide gel analysis, a sharp band corresponding to the desired product at 350 bases was visible in all of the reaction mixtures except control reactions minus primers. In all of the reaction mixtures containing both primers and probe, a second band was visible at approximately 300 bases. This second band became more intense with increasing probe concentration, and probably corresponded to probe which was either not efficiently 3' radiolabeled or lost the 3' label, allowing probe extension and generating a product.

An overnight exposure of the 8% denaturing gradient acrylamide gel showed a distribution of products ranging from full size probe down to less than 15 bases with all three probes being run. As would be expected, the 5'-3' nuclease activity of Taq DNA polymerase degraded the probe to a point where the degraded probe dissociated from the template.

The wide size distribution of products was illustrative of the continuously changing concentrations of reactants and temperature changes during PCR cycling. Such variations would lead to changes in annealing kinetics of probe and enzyme, allowing for probe to dissociate in a variety of sizes at different times in the cycling routine.

The homochromatography plate revealed the smallest product to be about 10 to 12 bases in length for all the probes examined. Since all three probes had identical sequence except at the 5' tail region, this result shows that for this particular probe sequence at an anneal/extend temperature of 60° C., the probe was degraded to about 10 bases and then dissociated from the template.

EXAMPLE 5 Polymerization Independent 5'-3' Nuclease Activity of Taq DNA Polymerase

Taq DNA polymerase was able to liberate the 5' 32 P-labeled end of a hybridized probe when positioned in proximity to that probe by an upstream primer. A series of primers was designed to lie from zero to twenty bases upstream of hybridized kinased probe BW33. These primers are shown below.

______________________________________BW37  SEQ ID NO: 11     Delta-0 5' 5571-5542 3'5'-GCGCTAGGGCGCTGGCAAGTGTAGCGGTCA-3'BW38  SEQ ID NO: 12     Delta-1 5' 5572-5543 3'5'-GGCGCTAGGGCGCTGGCAAGTGTAGCGGTC-3'BW39  SEQ ID NO: 13     Delta-2 5' 5573-5544 3'5'-GGGCGCTAGGGCGCTGGCAAGTGTAGCGGT-3'BW40  SEQ ID NO: 14     Delta-5 5' 5576-5547 3'5'-AGCGGGCGCTAGGGCGCTGGCAAGTGTAGC-3'BW41  SEQ ID NO: 15     Delta-10 5' 5581-5552 3'5'-AAAGGAGCGGGCGCTAGGGCGCTGGCAAGT-3'BW42  SEQ ID NO: 16     Delta-20 5' 5591-5562 3'5'-GAAGAAAGCGAAAGGAGCGGGCGCTAGGGC-3'______________________________________

About 0.5 pmol of probe BW33 and 0.5 pmol of one of each of the primers were annealed to 0.5 pmol M13mp10w in a 10.5 μl reaction volume containing 50 mM KCl, 10 mM Tris-HCl, pH 8.3, and 3 mM MgCl2. Control reaction mixtures contained either 20 μM or 200 μM each of four deoxynucleoside triphosphates. An additional primer, DG47, positioned 530 bases upstream from the probe was used.

______________________________________DG47  SEQ ID NO: 17     Delta-530 5' 6041-6012 3'5'-CGGCCAACGCGCGGGGAGAGGCGGTTTGCG-3'______________________________________

Reaction mixtures were heated to 98° C. for 1 min and annealed at 60° C. for 30 min. Tubes were then microcentrifuged and placed in a water bath at 70° C. After ample time for reaction mixtures to equilibrate to temperature, 10, 5, 2.5, 1.25, or 0.3125 units of Taq DNA polymerase were added, and 4 μl aliquots were removed at 2, 5, and 10 minutes. Enzyme was inactivated by adding 4 μl of 10 mM EDTA to each aliquot and placing at 4° C. Reaction mixtures were examined by homochromatography analysis.

In the homochromatography analysis, 1 μl of each sample was spotted onto DEAE cellulose thin layer plates and placed into a development chamber containing Homo-Mix III at 70° C. Homo-Mix was allowed to migrate to the top of each plate, at which time the plates were removed, dried, covered with Saran Wrap, and autoradiographed. FIG. 4 shows the results of this experiment.

In FIG. 4, Lanes 1 through 3 contain radiolabeled oligonucleotide molecular size markers of 6, 8, 9, 10, 11, 12, and 13 nucleotides. Lanes 4-10 show reactions for primers BW37, BW38, BW39, BW40, BW41, BW42, and DG47, respectively, in the absence of dNTP's. Lanes 11-24 show control reactions for all primers in the presence of 20 mM or 200 mM dNTP.

In the absence of dNTPs, Taq DNA polymerase generated labeled probe fragments using all of the primers with considerably less label being released as the primer-probe spacing increased. This effect was seen at all the enzyme concentrations examined (0.3125 U to 10 U/reaction) and all timepoints. The sizes of fragments released were the same, about two and three bases in length; however, the primary species varied depending upon which primer was added. The majority species released by the delta zero and delta two primers was one base smaller than that released by the delta one, five, ten, and twenty primers. This nuclease activity was polymerization-independent and proximity-dependent.

In the presence of nucleoside triphosphates, the sizes of labeled probe fragments released, and the relative proportions of each, were identical for all the primers examined. Also, the sizes of products were larger by one to two bases when dNTPs were present. It may be that while the enzyme was polymerizing, it had a "running start" and as it encountered hybridized probe, was simultaneously displacing one to two bases and then cutting, thus generating a larger fragment.

There was no detectable difference in amount of product released when dNTPs were at 20 μM or 200 μM each and no significant differences were seen due to extension times or enzyme concentrations in the presence of dNTPs.

EXAMPLE 6 Example to Illustrate the Nature of Released Product Based on Probe Sequence at the 5' End

The effect of strong or weak base pairing at the 5' complementary region of a probe on the size of released product was assessed. Two probes, BW50 and BW51, were designed to contain either a GC- or an AT-rich 5' complementary region. BW50 and BW51 were compared to probe BW33 used in Example V.

__________________________________________________________________________SEQ ID NO: 18     BW50 = 5' 5521-5496 3'     5'-tatCCCGCCGCGCTTAATGCGCCGCTACA-3'SEQ ID NO: 19     BW51 = 5' 5511-5481 3'     5'-gcaTTAATGCGCCGCTACAGGGCGCGTACTATGG-3'__________________________________________________________________________ a,t,g,c = bases which are noncomplementary to template strand

W50, BW51, and BW33 were labeled with 32 P-ATP using polynucleotide kinase and had the following specific activities:

BW50: 1.70×106 cpm/pmol

BW51: 2.22×106 cpm/pmol

BW33: 1.44×106 cpm/pmol

The final concentration of all three probes was 0.10 pmol/ul.

Individually, 0.5 pmol of either probe BW50, BW51, or BW33 and 0.5 pmol of primer BW42 were annealed to 0.5 pmol of M13mp10w in a 10.5 μl reaction volume containing 50 mM KCl, 10 mM Tris HCl, pH 8.3, 3 mM MgCl2, and 200 μM each of four deoxynucleoside triphosphates. Control samples contained all reaction components except template. For the annealing step, reaction mixtures were heated to 98° C. for 1 minute and annealed at 60° C. for 30 minutes. Tubes were then microcentrifuged and placed in a water bath at 50° C., 60° C., or 70° C. After ample time for reaction mixtures to equilibrate to temperature, 0.3125 units of Taq DNA polymerase was added. Four μl aliquots were removed at 1, 2, and 5 minutes. Reactions were inactivated by adding 4 μl of 10 mM EDTA to each aliquot and placing at 4° C. Samples were examined by homochromatography analysis and the results are shown in FIGS. 5 and 6.

FIG. 5 shows the reactions containing the GC-rich probe BW50. Lanes 1-3 contain oligonucleotide molecular size markers of 6, 8, 9, 10, 11, 12, and 13 nucleotides. Lanes 4-6 show extension reactions performed at 50° C. for 1, 2, and 5 minutes. Lanes 7-9 show extension reactions at 60° C. for 1, 2, and 5 minutes. Lanes 10-12 show reactions at 70° C. for 1, 2, and 5 minutes. Lanes 13-15 are control reactions containing all components except template, incubated at 70° C. for 1, 2, and 5 minutes.

FIG. 6 shows the reactions containing the AT rich probe BW51. As in FIG. 5, Lanes 1-3 are oligonucleotide molecular size markers of 6, 8, 9, 10, 11, 12, and 13 nucleotides. Lanes 4-6 are extension reactions performed at 50° C. for 1, 2 and 5 minutes. Lanes 7-9 are reactions at 60° C. at 1, 2, and 5 minutes. Lanes 10-12 are reactions at 70° C. at 1, 2, and 5 minutes. Lanes 13-15 are control reactions containing all components except template, incubated at 70° C. for 1, 2, and 5 minutes.

The results demonstrate that the nature of probe label release was dependent on temperature and base composition at the 5' end. The more stable GC-rich probe BW50 showed little label release at 50° C. (FIG. 5, Lanes 4-6) and increasingly more at 60° C. (FIG. 5, Lanes 7-9) and 70° C. (FIG. 5, Lanes 10-12). The major products released were about 3-5 bases in length. BW51, which was AT-rich at the 5' end, showed as much label release at 50° C. (FIG. 6, Lanes 4-6) as was observed at the higher temperatures. In addition, the AT-rich probe generated larger-sized products than the GC-rich probe. The base composition of the AT-rich probe may give the opportunity for a greater "breathing" capacity, and thus allow for more probe displacement before cutting, and at lower temperatures than the GC-rich probe.

EXAMPLE 7 HIV Capture Assay

The following is an example of the use of a dual labeled probe containing biotin in a PCR to detect the presence of a target sequence. Two oligonucleotides, BW73 and BW74, each complementary to a portion of the HIV genome, were synthesized with a biotin molecule attached at the 3' end of the oligonucleotide. The 5' end of each oligonucleotide was additionally labeled with 32 P using polynucleotide kinase and gamma-32 P-ATP. The two oligonucleotides PH7 and PH8 are also complimentary to the HIV genome, flank the region containing homology to the two probe oligonucleotides, and can serve as PCR primers defining a 142 base product. The sequences of these oligonucleotides are shown below.

__________________________________________________________________________SEQ ID NO: 20     BW73 = .sup.32 P-GAGACCATCAATGAGGAAGCTGCAGAATGGGAT-YSEQ ID NO: 21     BW74 .sup.32 P-gtgGAGACCATCAATGAGGAAGCTGCAGAATGGGAT-YSEQ ID NO: 22     PH7 = AGTGGGGGGACATCAAGCAGCCATGCAAATSEQ ID NO: 23     PH8 = TGCTATGTCAGTTCCCCTTGGTTCTCT__________________________________________________________________________

In the sequences,"Y" is a biotin, and lower case letters indicate bases that are non-complementary to the template strand.

A set of 50 μl polymerase chain reactions was constructed containing either BW73 or BW74, each doubly labeled, as probe oligonucleotides at 2 nM. Additionally, HIV template in the form of a plasmid clone was added at either 102 or 103 copies per reaction, and primer oligonucleotides PH7 and PH8 were added at 0.4 μM each. Taq polymerase was added at 1.25 U per reaction and dNTPs at 200 μM each. Each reaction was overlayed with 50 μl of oil, spun briefly in a microcentrifuge to collect all liquids to the bottom of the tube, and thermocycled between 95° C. and 60° C., pausing for 60 seconds at each temperature, for 30, 35, or 40 cycles. At the conclusion of the thermocycling, each reaction was extracted with 50 μl of CHCl3 and the aqueous phase collected.

Each reaction was analyzed for amplification by loading 3 μl onto a 5% acrylamide electrophoresis gel and examined for the expected 142 base pair product. Additionally, 1 μl of each reaction was examined by TLC homochromotography on DEAE cellulose plates. Finally, each reaction was further analyzed by contacting the remaining volume with 25 μl of a 10 mg/ml suspension of DYNABEADS M-280 streptavidin labeled, superparamagnetic, polystyrene beads. After reacting with the beads, the mixture was separated by filtration through a Costar Spin X centrifuge filter, 35 the filtrate collected and the presence of released radiolabel determined.

FIG. 7 contains images of the two gels used and shows that 142 base pair product occurs in all reactions, with and without probe, and increases in amount both as starting template was increased from 102 to 103 copies and as thermocycling was continued from 30 to 35 and 40 cycles.

FIG. 8 is a composite of two autoradiographs of the TLC analysis of aliquots of the PCRs and show that radiolabel release occurs and increases in amount with both increase in starting template and with longer thermocycling. In the first TLC of PCRs using BW73, lanes 1 and 3 contain radiolabeled oligonucleotides 2 and 3 bases in length as size standards. Lanes 4, 5, and 6 contain samples from PCRs with 102 starting copies of template and lanes 7, 8, and 9 with 103 starting copies. Samples in lanes 4 and 7 were thermoycled for 30 cycles; in lanes 5 and 8 for 35 cycles; and in lanes 6 and 9 for 40 cycles. In the second TLC of PCRs using BW74, lanes 1 and 2 are the radiolabeled 2 mer and 3 mer lanes 4,5, and 6 contain samples from PCRs with 102 starting copies of template thermocycled for 30, 35, and 40 cycles, respectively, and lanes 7, 8 and 9 with 103 copies of starting template thermocycled for 30, 35 and 40 cycles, respectively. The size of the released label is smaller with BW73, which has no 5' non-complementary bases, and larger with BW74, which has a 5' three base non-complementary extension.

Each chromatogram was additionally analyzed by two-dimensional radioisotope imaging using an Ambis counter. The results of Ambis counting and bead capture counting are shown in Table 1. The good agreement in the two methods of measuring label release demonstrates the practicality of the use of labeled biotinylated probes and avidinylated beads in PCRs to determine product formation.

              TABLE 1______________________________________   Number     % of Label Released   of Cycles  Ambis    Capture______________________________________BW73      30           6.9      10.810.sup.2 copies     35           29.0     32.7     40           47.2     47.210.sup.3 copies     30           11.8     16.8     35           35.6     39.3     40           53.4     52.5BW74      30           8.3      7.910.sup.2 copies     35           20.7     25.2     40           43.2     48.310.sup.3 copies     30           15.7     14.7     35           32       37.7     40           46       47.9______________________________________
EXAMPLE 8 Probe Labeling and Solid Phase Extractant Methodology

In one embodiment of the present invention, a separation step is employed after probe cleavage but prior to determination of the amount of cleaved probe to separate cleaved probe products from uncleaved probe. Two alternate separation methods are preferred: (1) the use of avidinylated or streptavidinylated magnetic particles to bind probes labeled at the 3'-end with biotin and at the 5'-end with a fluorophore; the magnetic particles bind both uncleaved probe and the 3'-fragment that is the product of probe cleavage; and (2) the use of magnetic ion exchange particles that bind oligonucleotides but not mono- or dinucleotides that are typically labeled at the 5'-end with a fluorophore or 32 P. Various aspects of these alternate strategies are discussed below.

A. Avidinylated Magnetic Particles

The separation system involving 3'-biotinylated probes and magnetic avidinylated (or streptavidinylated) beads is carried out preferably with beads such as Dynabeads™ from Dynal; these beads have a biotin binding capacity of approximately 100 pmoles per 50 μl of beads. Nonspecific adsorption is minimized by first treating the beads with both Denhardt's solution and carrier DNA.

The probe for streptavidin-biotin separation methods requires a biotin moiety at the 3'-terminus and a fluorophore at the 5'-terminus. The 3'-biotin functions both as a ligand for separation by streptavidinylated (or avidinylated) beads and as a block to prevent the extension of probe during the amplification. Post-synthesis modifications can be simplified by extending each end of the probe with a different nucleophile; for instance, one can add an amine to the 3'-end for the addition of biotin and a blocked thiol at the 5'-end for later addition of the fluorophore. The 3'-biotinylated probes can be prepared in a variety of ways; some of which are illustrated below.

An NHS-active ester derivative of biotin can be added to the 3'-amine of the probe by the reaction mechanism shown in FIG. 9. The resulting linkage creates a secondary hydroxyl gamma to the amide carbonyl, which may result in instability during the repeated thermal cycling of a typical PCR. For instance, thermal cycling for 40 cycles can render as much as 6% of the initial probe added unable to bind to magnetic avidinylated particles. When the bond between the probe and the attached biotin breaks down as a result of thermal cycling, the probe can no longer be separated from the cleaved products and contributes to the background. Although one can help overcome this problem by attaching more than one biotin to the probe, several alternate methods for attaching biotin to an oligonucleotide may yield more stable products.

One can react biotin hydrazide with aldehydes generated from a 3'-ribose on the probe to yield a biotinylated oligonucleotide. For this strategy, the 3'-nucleotide of the probe contains a ribose sugar in place of the deoxyribose sugar. During synthesis, the 3'-ribose is attached to the solid support by either its 2'- or 3'-OH. Following synthesis, the completed oligonucleotide is released from the solid support, and the vicinal diols of the ribose are oxidized by sodium periodate (NaIO4) to aldehydes that are then reacted with the biotin hydrazide, as shown in FIG. 10, and the product is reduced by sodium borohydride (NaBH4). However, the resulting biotinylated probe does not bind efficiently to avidinylated magnetic particles. The use of biotin long chain hydrazide, a compound also shown in FIG. 10, can solve this problem.

One can attach the biotin to the probe during probe synthesis using a soluble biotin phosphoramidite, as shown in FIG. 11. The synthesis begins with a base attached to controlled porous glass (CPG), which is ultimately discarded. A phosphoramidite, which allows the generation of a 3'-phosphate on ammonium hydroxide deprotection of the synthetic oligonucleotide, is added. The biotin phosphoramidite is then added, and the oligonucleotide synthesized is as shown in FIG. 11, which also shows the final product. This method of attachment allows the use of 5'-amine terminated oligonucleotides for the attachment of a fluorophore. The use of a 3'-amine for the attachment of biotin limits the chemistry of attachment of fluorophore to 5'-thiols. Utilization of a biotin phosphoramidite in which one of the biotin nitrogens is blocked may improve the synthesis of the biotin labeled probe.

One can also use a commercial reagent that consists of biotin directly attached to porous glass; the reagent is the starting substrate for probe synthesis and is shown in FIG. 12. This method of attachment allows the use of 5'-amine terminated oligonucleotides for the attachment of a fluorophore. The use of a 3'-amine for the attachment of biotin limits the chemistry of attachment of fluorophore to 5'-thiols. Enzymatic methods of attachment of modified nucleotides to the 5'-ends of oligonucleotides are also available, although limited in their generality and practicality.

B. Magnetic Ion Exchange Matrices

One can use commercially available polyethyleneimine (PEI) matrices (cellulose-, silica-, and polyol polymer-based) particles to separate cleaved from uncleaved probe. For instance, Hydrophase PEI, Selectacel™ PEI, Bakerbond™ PEI, and Amicon PAE 300, 1000, and 1000L are all commercially available PEI matrices that give separation of uncleaved probe from cleaved probe products.

Commercially available activated cellulose magnetic particles, such as Cortex MagaCell™ particles can be derivatized with PEIs of various lengths, such as PEI600, PEI 1800, and PEI 10,000, and at different molar ratios of PEI per gram of matrix. However, all sizes of oligonucleotides and coumarin-labeled oligonucleotides bind to magnetic cellulose and agarose beads whether or not they have been derivatized with PEI (the specificity seen with oligonucleotides on commercially available PEI matrices is lost when one labels the oligonucleotides with coumarin). The addition of high concentrations of salt (2.0M NaCl) or N-methyl pyrrolidone (10 to 20%) partially increases the specificity, and other cosolvents such as SDS, Brij 35, guanidine, and urea can also be used to increase the specificity of binding. However, 8M urea provides efficient blocking of the nonspecific binding of coumarin labeled di- and tri-nucleotides to both Bakerbond™ PEI and magnetic Cortex™ PEI derivatized particles, although the use of N-substituted ureas may be more preferred.

As noted above, Cortex Biochem sells a variety of activated cellulose coated magnetic particles that can be linked to PEI. The most convenient of these is the periodate activated matrix. The protocol recommended by the manufacturer to attach amines to the periodate activated matrix, however, has several problems: the reaction of an amine with an aldehyde results in imines that are labile and can be hydrolyzed or reacted further with amines; during the step to block remaining aldehydes by the addition of excess ethanolamine, the PEI can be displaced by ethanolamine, thus removing the PEI from the matrix; during the conjugation reaction under basic conditions, aldol condensation can lead to reaction among the aldehyde groups, thereby resulting in aggregation of the particles; and reaction of aldehydes under basic conditions may result in free radicals that can attack the cellulose, and participate in a variety of reactions.

To stabilize the imine, a reduction step (with NaBH4 and NaBH3 CN) can be included; however, this step can result in the production of gas, a decrease in the mass of the particles, and particle agglutination. These unwanted effects may result from the production of free radicals. The complications resulting from conjugation to active aldehydes may be avoided through the use of epoxide chemistry. The resulting beta-hydroxyamines are stable and do not require reduction. In addition, because oxygen may participate in the generation of free radicals, the removal of oxygen from the system should minimize free radical formation, especially during the reduction step. In one synthesis of PEI derivatized cellulose coated magnetic particles, the ethanolamine blocking step was eliminated and the preparation purged overnight with helium prior to and during reduction with sodium cyanoborohydride. There was little aggregation in the final preparation.

Polyacrolein magnetic particles can be derivatized with both PEI600 and ethylene diamine, and the non-specific binding of coumarin labeled di- and trinucleotides can be inhibited by high concentrations of NMP. The use of longer chained PEI polymers may mask nonspecific backbone interaction with small, coumarin labeled oligonucleotides.

One important factor in selecting a magnetic matrix for use in the present method is the amount of background fluorescence contributed by the matrix. One strategy to minimize this background fluorescence is to select fluorophores with excitation and emission maxima that minimally overlap the background fluorescence spectra of the buffer, matrix, and clinical samples. In addition, the fluorescent background may result from the presence of contaminants in the matrix that might be removed by extensive pretreatment prior to binding.

C. Chemistry of Attachment of the Fluorophore to the Probe

As noted above, the preferred label for the probe, regardless of separation strategy, is a fluorophore. There appears to be interaction between the oligonucleotide probe and the attached fluorophore. This interaction may be responsible for the reported quenching observed when fluorophores have been attached to oligonucleotides. One should select fluorophores that minimally interact with DNA when attached to the 5'-terminus of a nucleic acid.

Three preferred fluorophores are 7-diethylamino-3-(4'-maleimidylphenyl)-4-methyl coumarin (CPM), 6-(bromomethyl)fluorescein (BMF), Lucifer Yellow iodoacetamide (LYIA), and 5-(and 6-)carboxy-X-rhodamine succinimidyl ester, with CPM preferred due to several properties: large extinction coefficient, large quantum yield, low bleaching, and large Stokes shift. The fluorophore can be attached through a thiol attached to the 5'-phosphate group of the probe, but in the case of CPM, this process yields an aryl maleimide, which can be unstable under thermocycling conditions.

A number of commercial instruments are available for analysis of fluorescently labeled materials. For instance, the ABI Gene Analyzer can be used to analyze attomole quantities of DNA tagged with fluorophores such as ROX (6-carboxy-X-rhodamine), rhodamine-NHS, TAMRA (5/6-carboxytetramethyl rhodamine NHS), and FAM (5'-carboxyfluorescein NHS). These compounds are attached to the probe by an amide bond through a 5'-alkylamine on the probe. Other useful fluorophores include CNHS (7-amino-4-methyl-coumarin-3-acetic acid, succinimidyl ester), which can also be attached through an amide bond.

Modifications may be necessary in the labeling process to achieve efficient attachment of a given fluorophore to a particular oligonucleotide probe. For instance, the initial reaction between a 5'-amine terminated probe and 7-diethylaminocoumarin-3-carboxylate NHS ester was very inefficient. The probe, which had been phosphorylated at the 3'-end to prevent extension of the probe during amplification, had significant secondary structure, one conformation of which placed the 5'-amine and the 3'-phosphate in close enough proximity to form a salt bridge. This structure may have prevented the 5'-amine from being available for reacting with the NHS ester, thus causing the low yield of product. Addition of 25% N-methylpyrrolidinone (NMP) markedly improved the efficiency of the reaction.

One can also use both a fluorophore and quenching agent to label the probe.

When the probe is intact, the fluorescence of the fluorophore is quenched by the quencher. During the present method, the probe is cleaved between the fluorophore and the quencher, allowing full expression of the fluorophore fluorescence. Quenching involves transfer of energy between the fluorophore and the quencher, the emission spectrum of the fluorophore and the absorption spectrum of the quencher must overlap. A preferred combination for this aspect of the invention is the fluorophore rhodamine 590 and the quencher crystal violet.

One such probe is shown in FIG. 13. The synthesis of this construct requires 10 attachment of a rhodamine derivative through a 5'-thiol and the attachment of the crystal violet through an amine extending from a thymidine two bases away. The separation of the two moieties by two phosphodiester bonds increases the chances for cleavage by the DNA polymerase between them.

Initial attempts to attach the crystal violet by reaction between a lactone and amine were unsuccessful. The crystal violet was modified to generate an active acyl azide, shown in FIG. 14. This form of crystal violet was reacted with amine-modified DNA, and the desired product was purified on reverse phase HPLC.

Attempts to react the rhodamine-X-maleimide group with the 5'-thiol were unsuccessful. This was also the case when the rhodamine-X-maleimide was reacted prior to addition of the crystal violet. This may be because the deblocked 5'-thiol reacts with the acrylamide double bond in the thymidine spacer arm (see FIG. 13). An alternate method for the addition of an amine to the thymidine is shown in FIG. 15.

This example provides general guidance for attaching a biotin to the 3'-end of an oligonucleotide probe and a fluorophore to the 5'-end of an oligonucleotide probe. Those of skill in the art will recognize that a number of methods for such attachments are known in the art and that the present invention is not limited by the particular method chosen to label the probe.

EXAMPLE 9 Protocol for AmpliWax™ Mediated PCR with UNG and dUTP

The PCR process can be improved with respect to specificity of amplification by processes and reagents described more fully in PCT patent application Ser. No. 91/01039, filed Feb. 15, 1991; U.S. patent application Ser. No. 481,501, filed Feb. 16, 1991; PCT patent application Ser. No. PCT/US 91/05210, filed Jul. 23, 1991; U.S. patent application Ser. No. 609,157, filed Nov. 2, 1990; and U.S. patent application Ser. No. 557,517, filed Jul. 24, 1990. The disclosures of these patent applications are incorporated herein by reference, and the following protocol demonstrates how these improved PCR methods can be used in conjunction with the present method for superior results. All reagents can be purchased from Perkin-Elmer Cetus Instruments (PECI, Norwalk, Conn.).

This protocol essentially involves three components: MicroAmp™ tubes containing dNTPs, primers, magnesium, and Tris that have been covered with wax; Premix B to which is added AmpliTaq® DNA Polymerase and UNG (and is therefore called the Enzyme Mixture); and Premix C to which are added the test sample and probe. The Enzyme Mixture and test sample with probe are made and added above the wax layer. The tubes are then placed in a TC9600 thermocycler and thermocycled. The protocol below assumes a 50 μl reaction, with test samples of no more than 27 μl, and the target is HIV.

The reagents are preferably supplied as follows. MicroAmp™ tubes containing 12.5 μl of Premix A and one 12 mg AmpliWax™ PCR pellet per tube are prepared. Premix A contains 1 μM SK145 primer and 1 μM SK43 1 primer (neither primer is biotinylated), 800 μM dATP, 800 μM dGTP, 800 μM dCTP, 800 μM dUTP, 15 mM MgCl2, and 10 mM Tris-HCl, pH 8.3. The AmpliWax™ pellet consists of a 55° C.-melting paraffin (Aldrich Chemical Co.) containing 0.15% Tween 65, and the wax pellet and Premix A bottom layer are added together in a DNA-free room. The wax pellet is then melted to form a vapor barrier on top. This barrier will retain its integrity when the tubes are stored at 4° to 25° C., and the PCR reagents below the barrier are storage stable for months at 4° C. There is no mixing of material added above the barrier until the wax is melted during the initial stages of thermal cycling. Control tubes are identical but contain no primer.

Premix B buffer contains 10 mM Tris-HCl, pH 8.3, and 50 mM KCl and is used for dilution of the enzymes AmpliTaq® DNA polymerase and UNG. About 2.6 μl of Premix B buffer are used per reaction.

Premix C buffer is prepared as a 10× concentrate, which contains 105 mM Tris-HCl, pH 8.3, and 715 mM KCl and is added to the test DNA sample so that the final Tris and KCl concentrations in the final reaction are 10 mM and 50 mM, respectively. The probe is also added in this layer, as well as carrier DNA, if any. If plasmid controls are run, about 1 μg of human placental DNA (1 μg/μl in 10 mM Tris, pH 8, 1 mM EDTA, and 10 mM NaCI, which has been sheared, phenol/chloroform extracted, chloroform extracted, and ethanol precipitated) per reaction is usually added as carrier DNA. About 3.3 μl of the 10× stock of Premix C are added per reaction.

The probe is prepared as a 5 μM stock and designated as LG101C. Probe LG101C has a 3'-phosphate to prevent extension of the probe and a 7-diethylaminocoumarin-3-carboxylate attached to a 5'-amino aliphatic group on the oligonucleotide by an amide bond. The nucleotide sequence of the probe is shown below:

__________________________________________________________________________SEQ ID NO: 24    LG101C:          5'-GAGACCATCAATGAGGAAGCTGCAGAATGGGAT__________________________________________________________________________

This probe should be stored at -20° C. in the dark.

AmpliTaq® DNA polymerase is provided at a stock concentration of 5 U/μl from PECI, and UNG is provided at a stock concentration of 1 U/μl from the same vendor. One can also run plasmid calibration samples, and for this purpose, the 5 preparation of stock dilutions (copies/mil) of 300, 1,000; 3,000; 10,000; 30,000; 100,000; and 1,000,000 with GeneAmplimer™ Positive Control DNA is helpful. This DNA consists of the HIVZ6 genome rearranged to interrupt the pol region, and so block infectivity, inserted into plasmid pBR322.

Each final reaction will consist of 12.5 μl of Premix A; 2.6 μl of Premix B; 3.3 μl of Premix C; 2 μl of LG101 C probe; 27 μl of test sample; 0.4 μl of AmpliTaq® DNA polymerase; and 2 μl of UNG yielding a final volume of 49.8 μl. This mixture comprises 250 nM of each primer; 200 μM of each dNTP; 3.75 MM MgCl2 ; 50 mm KCl, 10 mM Tris-HCl, pH 8.3; 200 nM of probe; 2 units of UNG; and 2 units of polymerase.

To run the reaction, one first prepares the Enzyme Mixture in a DNA-free hood or room by mixing, per reaction, 2.6 μl of Premix B buffer, 0.4 μl of AmpliTaq® DNA polymerase, and 2 μl of UNG. For every 16 reactions that will be run, one should prepare enough Enzyme Mixture for 18 reactions to ensure enough material. The Enzyme Mixture is then added to each MicroAmp™ tube containing wax-covered Premix A over the wax in a DNA-free hood or room. A single sampler tip can suffice for all. transfers, and 5 μl of Enzyme Mixture are added to each tube.

In the sample preparation area, the Sample Mixture is prepared by mixing, per reaction, 3.3 μl of 10× Premix C Buffer, 27 μl of sample (for quantification controls, add 10 μl of stock dilution and 17 μl of water), and 2 μl of probe (carrier DNA, if any, is mixed with sample). Then, using a separate sampler tip for each transfer, add 32.3 μl of Sample Mixture to each tube; the volume imbalance between the Enzyme Mixture and Sample Mixture assures complete mixing. One should also set up two control tubes lacking primers to serve as a measure of probe cleavage resulting from thermal cycling. This control typically contains 1,000 copies of control template. In addition, one should set up a dilution series of plasmid to calibrate the assay. This calibration is typically in the range of 3 to 10,000 copies of HIV target per sample. After the above steps are completed, the tubes are capped and assembled into the TC9600 tray.

The thermal cycler profile is as follows: 1 cycle of 50° C. for 2 minutes; 5 cycles of 95° C. for 10 seconds, 55° C. for 10 seconds, and 72° C. for 10 seconds; and 35 cycles of 90° C. for 10 seconds, 60° C. for 10 seconds, and 72° C. for 10 seconds. When thermal cycling is complete, the tubes are removed from the TC9600 and stored at -20° C., if necessary. Prolonged soaking of the tubes at above 70° C. is not recommended, and alkaline denaturation should not be employed.

A number of controls are useful, including a no-template control to determine contamination of reaction mixtures as well as amplification of nonspecific products that may result in probe cleavage and give nonspecific signals; a no-primer control to prove a measure of nonamplification related cleaveage of the probe that might contribute to background (one might also include some clinical samples in the tests to detect the presence of components that may result in probe cleavage); and quantitation controls.

To remove PCR product from beneath the wax layer that will form after amplification using the above protocol, one can withdraw sample after poking a sampler tip through the center of the wax layer, advancing the tip slowly with gentle pressure to minimize the chance that reaction mixture will spurt past the tip and contaminate the lab. Steadying the sampler with one finger of the hand holding the reaction tube greatly increases control. Slim (gel-loading) sampler tips penetrate the wax especially well. A slicing motion rather than a poking motion also facilitates penetration and helps to assure that the tip will not be clogged with wax. If the tip picks up a piece of wax, the wax can normally be dislodged by gentle rubbing against the remaining wax.

One can also freeze the reaction tubes (e.g., in dry ice ethanol or overnight in a freezer), thaw them, and spin briefly in a microfuge (angle rotor). The wax layer will be heavily fractured, allowing sampler insertion without any chance of clogging. Wax fragments can be wiped from the sampler tip against the inner wall of the tube. This method is especially convenient for positive displacement samplers, which often have tips so thick that direct penetration of the intact wax layer is hard. Either of the above methods should exclude wax from the withdrawn sample so completely that chloroform extraction is unnecessary.

Although the foregoing invention has been described in some detail for the purpose of illustration, it will be obvious that changes and modifications may be practiced within the scope of the appended claims by those of ordinary skill in the art.

EXAMPLE 10 Solid Phase Extraction with Bakerbond™ PEI

This example provides a protocol for sampling a PCR mixture in which the amplification was carried out in the presence of a fluorescently labeled (a coumarin derivative) probe according to the method of the present invention.

The preparation of certain stock reagents facilitates practice of this protocol. One such reagent is Eppendorf tubes containing 50 mg of pre-washed Bakerbond PEI matrix. The Bakerbond™ PEI can be obtained from J. T. Baker (product No. 7264-00) and is a silica based, 40 μm particle size, 275 angstrom pore size. The matrix is prepared by washing first with water; then ethanol; then water; and then a mixture of 10 mM Tris, pH 8.3, 50 mM KCl, 1 mM EDTA, 2M NaCl, and 8M urea; and then equilibrated in 10 mM Tris, pH 8.3, 50 mM KCl, 1 mM EDTA, 500 mM NaCl, and 8M urea. Following distribution, 15 μl of water is added to each tube to keep the matrix hydrated. The tubes should be stored at 4° C.

Binding buffer can also be prepared as a stock solution, and the composition is 10 mM Tris, pH 8,500 mM NaCI, 50 mM KCl, 1 mM EDTA, and 8M urea. The binding buffer should be stored at 4° C., although urea may precipitate at this temperature. The binding buffer can be warmed briefly before use to resuspend the urea.

Certain equipment is useful in carrying out this protocol. During the binding 10 step, the tubes should be mixed to keep the matrix in suspension, and a Vortex Genie 2 mixer (available from Fischer Scientific, Cat. No. 12-812, with the 60 microtube holder, Cat. No. 12-812-B) is useful for this purpose. In addition, an Eppendorf microfuge, an Hitachi Model 2000 spectrofluorometer, and microfluorimeter quartz cuvettes with 2 mm internal width and a 2.5 mm base path length (available from Starna Cells, Inc., No. 18F Q 10 mm 5) are also useful in carrying out this protocol.

Appropriate controls should also be performed, and the binding step requires three controls. The control for background fluorescence involves the preparation of a sample that contains all components of the PCR amplification except probe. The control sample should be processed identically as the actual test samples in that 20 μl will be added to matrix and the fluorescence present in the supernatant measured. This control provides a way to measure background fluorescence present in the matrix, binding buffer, and any of the components in the PCR amplification mixture and also provides a measurement of the amount of fluorescence present in clinical samples.

The second control provides a measurement for inadvertent probe breakdown and for the binding reaction and consists of a mock PCR amplification mixture that contains all of the components including probe but is not subjected to thermal cycling. The control sample should be processed identically as the actual test samples in that 20 μl will be added to matrix and the fluorescence present in the supernatant measured. This control provides a way to measure the presence of probe breakdown on storage as well as the efficiency of the binding reaction. If no breakdown occurred and if the binding reaction is complete, the fluorescence of the supernatant following binding to the Bakerbond™ PEI should be similar to the background measured in the first control.

The third control provides a way to measure the input amount of probe. The sample prepared for the second control can be used for this measurement. However, in this case, 20 μl are added to a tube containing 290 μl of binding buffer without matrix. This control can be used to determine the input amount of probe.

To begin the protocol, one first determines the number of binding tubes required; this number is the sum of test samples and controls. The controls are a no-template control, a no-primer control, calibration controls, and the first and second controls discussed above. Controls can be done in triplicate. To each tube, one adds 235 μl of binding buffer.

One also prepares a tube to measure the input by adding to an empty Eppendorf tube: 290 μl of binding buffer, which is equivalent to the volume in the tubes with matrix (235 μl of binding buffer, 15 μl of water, and 40 μl contributed by matrix volume). The input amount determination can be done in triplicate.

To the tubes containing matrix (the test samples and first and second controls), one adds 20 μl a of sample. To the tubes containing buffer (the third control), one adds 20 μl of mock PCR amplification mixture. The tubes are then shaken on a Vortex Genie 2 mixer at a setting of 4 at room temperature for 30 minutes. The tubes are then centrifuged in an Eppendorf microfuge (16,000×g) for 5 minutes at room temperature. The upper 200 μl of supernatant from each tube is removed without disturbing the pellet or matrix present on the wall of the tube and placed in a clean Eppendorf tube.

The fluorescence of the supernatant is measured on a Hitachi Model 2000 in the cuvettes indicated above. For probes labeled with 7-diethylamino-3 (4'-maleimidophenyl)-4-methyl-coumarin, the spectrofluorometer is set as follows: PM voltage is 700 V; the excitation wavelength is 432 nm; the emission wavelength is 480 nm; the excitation slit width is 10 nm; and the emission slit width is 20 nm. One should minimize exposure of sample to excitation light; if the sample is to remain in the spectrofluorometer for a prolonged period, the shutter should be closed.

The number of pmoles of probe cleaved is the most convenient way of assessing the amount of signal. To assess the amount of signal, then, one first determines the input signal from the third control by the following calculation: ##EQU1## In this formula, the subtraction corrects for any background fluorescence in the test sample; 310/20 is the dilution factor; and 10 pmoles is the amount of probe added to the PCR amplifications. ##EQU2## The above protocol can be modified according to the particular fluorophore used to label the probe and is merely illustrative of the invention.

FIG. 16 shows typical results and relation of signal to input target number for the present method using Bakerbond™ PEI solid phase extractant.

__________________________________________________________________________SEQUENCE LISTING(1) GENERAL INFORMATION:(iii) NUMBER OF SEQUENCES: 24(2) INFORMATION FOR SEQ ID NO: 1:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 28 bases(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: Other Nucleic Acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1:CCGATAGTTTGAGTTCTTCTACTCAGGC28(2) INFORMATION FOR SEQ ID NO: 2:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 30 bases(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: Other Nucleic Acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2:GAAGAAAGCGAAAGGAGCGGGCGCTAGGGC30(2) INFORMATION FOR SEQ ID NO: 3:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 30 bases(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: Other Nucleic Acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3:CGCTGCGCGTAACCACCACACCCGCCGCGC30(2) INFORMATION FOR SEQ ID NO: 4:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 36 bases(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: Other Nucleic Acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4:GATCGCTGCGCGTAACCACCACACCCGCCGCCGCGC36(2) INFORMATION FOR SEQ ID NO: 5:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 40 bases(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: Other Nucleic Acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5:CGTCACCGATCGCTGCGCGTAACCACCACACCCGCCGCGC40(2) INFORMATION FOR SEQ ID NO: 6:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 25 bases(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: Other Nucleic Acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6:GATGAGTTCGTGTCCGTACAACTGG25(2) INFORMATION FOR SEQ ID NO: 7:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 25 bases(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: Other Nucleic Acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 7:GGTTATCGAAATCAGCCACAGCGCC25(2) INFORMATION FOR SEQ ID NO: 8:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 30 bases(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: Other Nucleic Acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8:CGCTGCGCGTAACCACCACACCCGCCGCGC30(2) INFORMATION FOR SEQ ID NO: 9:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 33 bases(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: Other Nucleic Acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 9:GATCGCTGCGCGTAACCACCACACCCGCCGCGC33(2) INFORMATION FOR SEQ ID NO: 10:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 40 bases(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: Other Nucleic Acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 10:CGTCACCGATCGCTGCGCGTAACCACCACACCCGCCGCGC40(2) INFORMATION FOR SEQ ID NO: 11:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 30 bases(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: Other Nucleic Acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 11:GCGCTAGGGCGCTGGCAAGTGTAGCGGTCA30(2) INFORMATION FOR SEQ ID NO: 12:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 30 bases(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: Other Nucleic Acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 12:GGCGCTAGGGCGCTGGCAAGTGTAGCGGTC30(2) INFORMATION FOR SEQ ID NO: 13:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 30 bases(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: Other Nucleic Acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 13:GGGCGCTAGGGCGCTGGCAAGTGTAGCGGT30(2) INFORMATION FOR SEQ ID NO: 14:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 30 bases(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: Other Nucleic Acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 14:AGCGGGCGCTAGGGCGCTGGCAAGTGTAGC30(2) INFORMATION FOR SEQ ID NO: 15:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 30 bases(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: Other Nucleic Acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 15:AAAGGAGCGGGCGCTAGGGCGCTGGCAAGT30(2) INFORMATION FOR SEQ ID NO: 16:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 30 bases(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: Other Nucleic Acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 16:GAAGAAAGCGAAAGGAGCGGGCGCTAGGGC30(2) INFORMATION FOR SEQ ID NO: 17:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 30 bases(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: Other Nucleic Acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 17:CGGCCAACGCGCGGGGAGAGGCGGTTTGCG30(2) INFORMATION FOR SEQ ID NO: 18:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 29 bases(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: Other Nucleic Acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 18:TATCCCGCCGCGCTTAATGCGCCGCTACA29(2) INFORMATION FOR SEQ ID NO: 19:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 34 bases(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: Other Nucleic Acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 19:GCATTAATGCGCCGCTACAGGGCGCGTACTATGG34(2) INFORMATION FOR SEQ ID NO: 20:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 33 bases(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: Other Nucleic Acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 20:GAGACCATCAATGAGGAAGCTGCAGAATGGGAT33(2) INFORMATION FOR SEQ ID NO: 21:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 36 bases(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: Other Nucleic Acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 21:GTGGAGACCATCAATGAGGAAGCTGCAGAATGGGAT36(2) INFORMATION FOR SEQ ID NO: 22:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 30 bases(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: Other Nucleic Acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 22:AGTGGGGGGACATCAAGCAGCCATGCAAAT30(2) INFORMATION FOR SEQ ID NO: 23:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 27 bases(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: Other Nucleic Acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 23:TGCTATGTCAGTTCCCCTTGGTTCTCT27(2) INFORMATION FOR SEQ ID NO: 24:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 33 bases(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: Other Nucleic Acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 24:GAGACCATCAATGAGGAAGCTGCAGAATGGGAT33__________________________________________________________________________

Claims (24)

We claim:
1. A reaction mixture for use in a process for the amplification and detection of a target nucleic acid sequence in a sample which reaction mixture, prior to amplification, comprises a pair of oligonucleotide primers and a labeled oligonucleotide, which pair of primers and labeled oligonucleotide are characterized in that:
said pair of oligonucleotide primers comprises a first a primer complementary to said target nucleic acid and which primes the synthesis of a first extension product that is complementary to said target nucleic acid, and a second primer complementary to said first extension product and which primes the synthesis of a second extension product; and
said labeled oligonucleotide hybridizes to a region of said target nucleic acid or the complement of said target nucleic acid, wherein said region is between one member of said primer pair and the complement of the other member of said primer pair.
2. The reaction mixture of claim 1 that further comprises a template-dependent nucleic acid polymerase having a 5' to 3' nuclease activity.
3. The reaction mixture of claim 1 wherein said labeled oligonucleotide is labeled at the 5' terminus.
4. The reaction mixture of claim 1 wherein said labeled oligonucleotide further comprises a tail of non-nucleic acids or a sequence of nucleotides which is non-complementary to the target nucleic acid sequence.
5. The reaction mixture of claim 1 wherein said labeled oligonucleotide comprises a first and second label.
6. The reaction mixture of claim 5 wherein said first and second labels are interactive signal generating labels effectively positioned on said labeled oligonucleotide to quench the generation of detectable signal.
7. The reaction mixture of claim 1 wherein the 3' terminus of said labeled oligonucleotide is blocked.
8. The reaction mixture of claim 1 wherein said labeled oligonucleotide is detectable by fluorescence.
9. The labeled oligonucleotide of claim 5 wherein said first label is a fluorophore and said second label is a quenching agent.
10. The labeled oligonucleotide of claim 5 wherein said first label is at the 5' terminus and said second label is at the 3' terminus.
11. The labeled oligonucleotide of claim 1 wherein said labeled oligonucleotide comprises a ligand having a specific binding partner.
12. The labeled oligonucleotide of claim 11 wherein said ligand is biotin.
13. A kit for detecting a target nucleic acid sequence in a sample comprising:
(a) at least one labeled oligonucleotide containing a sequence complementary to a region of the target nucleic acid, wherein said labeled oligonucleotide anneals within the target nucleic acid sequence bounded by the oligonucleotide primers of part (b) and wherein said labeled oligonucleotide is blocked at the 3' terminus to prohibit incorporation of said labeled oligonucleotide into a primer extension product, wherein said blocking is achieved by adding a chemical moiety to the 3' hydroxyl of the last nucleotide, which moiety does not also serve as a label for subsequent detection or by removing said 3'-hydroxyl; and
(b) a set of oligonucleotide primers, wherein a first primer contains a sequence complementary to a region in one strand of the target nucleic acid sequence and primes the synthesis of a first extension product, and a second primer contains a sequence complementary to a region in said first extension product and primes the synthesis of a nucleic acid strand complementary to said first extension product,
and wherein each oligonucleotide primer is selected to anneal to its complementary template upstream of any labeled oligonucleotide annealed to the same nucleic acid strand.
14. The kit of claim 13 wherein said blocking is achieved by adding a chemical moiety to the 3' hydroxyl of the last nucleotide of said labeled oligonucleotide, which chemical moiety is a phosphate group.
15. The kit of claim 13 wherein said blocking is achieved by removing the 3'-hydroxyl from said labeled oligonucleotide.
16. The kit of claim 13 further comprising a nucleic acid polymerase having a 5' to 3' nuclease activity.
17. The kit of claim 16 wherein said nucleic acid polymerase is a thermostable enzyme.
18. The kit of claim 17 wherein said thermostable nucleic acid polymerase is a DNA polymerase from a Thermus species.
19. The kit of claim 13, wherein in said labeled oligonucleotide is detectable by fluorescence.
20. The kit of claim 13 wherein said labeled oligonucleotide is labeled at the 5' terminus.
21. The kit of claim 13, wherein said labeled oligonucleotide comprises first and second labels wherein said first label is separated from said second label by a nuclease susceptible cleavage site.
22. The kit of claim 21 wherein said first label is at the 5' terminus and said second label is at the 3' terminus.
23. The kit of claim 22 wherein the labels in said labeled oligonucleotide comprise a pair of interactive signal-generating labels positioned on said labeled oligonucleotide to quench the generation of detectable signal.
24. The kit of claim 23, wherein in said labeled oligonucleotide said first label is a flourophore and said second label is a quencher which interacts therewith.
US08428941 1990-08-06 1995-04-25 Reaction mixtures for detection of target nucleic acids Expired - Lifetime US5804375A (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
US07563758 US5210015A (en) 1990-08-06 1990-08-06 Homogeneous assay system using the nuclease activity of a nucleic acid polymerase
US07961884 US5487972A (en) 1990-08-06 1993-01-05 Nucleic acid detection by the 5'-3'exonuclease activity of polymerases acting on adjacently hybridized oligonucleotides
US08428941 US5804375A (en) 1990-08-06 1995-04-25 Reaction mixtures for detection of target nucleic acids

Applications Claiming Priority (7)

Application Number Priority Date Filing Date Title
US08428941 US5804375A (en) 1990-08-06 1995-04-25 Reaction mixtures for detection of target nucleic acids
US08934378 US6214979B1 (en) 1990-08-06 1997-09-19 Homogeneous assay system
US11043099 US7141377B2 (en) 1990-08-06 2005-01-27 Process for discrimination of nucleic acid sequence variants
US11203461 US7445900B2 (en) 1990-08-06 2005-08-11 Homogeneous assay system
US11203048 US20060084092A1 (en) 1993-01-05 2005-08-11 Homogeneous assay system
US11203622 US20060257885A1 (en) 1993-01-05 2005-08-11 Homogeneous assay system
US11203040 US20060078914A1 (en) 1993-01-05 2005-08-11 Homogeneous assay system

Related Parent Applications (3)

Application Number Title Priority Date Filing Date
US07961884 Continuation
PCT/US1991/005571 Continuation WO1992002638A1 (en) 1990-08-06 1991-08-06 Homogeneous assay system
US07961884 Continuation US5487972A (en) 1990-08-06 1993-01-05 Nucleic acid detection by the 5'-3'exonuclease activity of polymerases acting on adjacently hybridized oligonucleotides

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US08934378 Continuation US6214979B1 (en) 1990-08-06 1997-09-19 Homogeneous assay system

Publications (1)

Publication Number Publication Date
US5804375A true US5804375A (en) 1998-09-08

Family

ID=24251781

Family Applications (6)

Application Number Title Priority Date Filing Date
US07563758 Expired - Lifetime US5210015A (en) 1990-08-06 1990-08-06 Homogeneous assay system using the nuclease activity of a nucleic acid polymerase
US07961884 Expired - Lifetime US5487972A (en) 1990-08-06 1993-01-05 Nucleic acid detection by the 5'-3'exonuclease activity of polymerases acting on adjacently hybridized oligonucleotides
US08428941 Expired - Lifetime US5804375A (en) 1990-08-06 1995-04-25 Reaction mixtures for detection of target nucleic acids
US08934378 Expired - Fee Related US6214979B1 (en) 1990-08-06 1997-09-19 Homogeneous assay system
US11043099 Expired - Fee Related US7141377B2 (en) 1990-08-06 2005-01-27 Process for discrimination of nucleic acid sequence variants
US11203461 Expired - Fee Related US7445900B2 (en) 1990-08-06 2005-08-11 Homogeneous assay system

Family Applications Before (2)

Application Number Title Priority Date Filing Date
US07563758 Expired - Lifetime US5210015A (en) 1990-08-06 1990-08-06 Homogeneous assay system using the nuclease activity of a nucleic acid polymerase
US07961884 Expired - Lifetime US5487972A (en) 1990-08-06 1993-01-05 Nucleic acid detection by the 5'-3'exonuclease activity of polymerases acting on adjacently hybridized oligonucleotides

Family Applications After (3)

Application Number Title Priority Date Filing Date
US08934378 Expired - Fee Related US6214979B1 (en) 1990-08-06 1997-09-19 Homogeneous assay system
US11043099 Expired - Fee Related US7141377B2 (en) 1990-08-06 2005-01-27 Process for discrimination of nucleic acid sequence variants
US11203461 Expired - Fee Related US7445900B2 (en) 1990-08-06 2005-08-11 Homogeneous assay system

Country Status (8)

Country Link
US (6) US5210015A (en)
EP (3) EP1302549B1 (en)
JP (1) JP2825976B2 (en)
CA (1) CA2088683C (en)
DE (6) DE69133329T3 (en)
DK (3) DK1302549T3 (en)
ES (3) ES2209033T5 (en)
WO (1) WO1992002638A1 (en)

Cited By (222)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0930370A1 (en) * 1997-12-15 1999-07-21 Centeon Pharma GmbH Labeled primer for use in detection of target nucleic acids
US6077669A (en) * 1997-11-04 2000-06-20 Becton Dickinson And Company Kit and method for fluorescence based detection assay
EP1013775A1 (en) * 1998-12-21 2000-06-28 LUTZ, Hans Quantitative polymerase chain reaction using a fluorogenic real-time detection system
WO2000071559A1 (en) * 1999-05-24 2000-11-30 Invitrogen Corporation Method for deblocking of labeled oligonucleotides
US6251600B1 (en) 1996-07-26 2001-06-26 Edward E. Winger Homogeneous nucleotide amplification and assay
US6258569B1 (en) 1994-11-16 2001-07-10 The Perkin-Elmer Corporation Hybridization assay using self-quenching fluorescence probe
WO2001071037A1 (en) * 2000-03-23 2001-09-27 Lumigen, Inc. Methods of detecting polynucleotide kinase and its use as a label
US6326145B1 (en) 1998-06-13 2001-12-04 Zeneca Limited Methods for detecting target nucleic acid sequences
US6355433B1 (en) 2000-06-02 2002-03-12 Dna Sciences, Inc. Determination of nucleotide sequence variations through limited primer extension
EP1185695A1 (en) * 1999-05-14 2002-03-13 University Of Southern California Process for high throughput dna methylation analysis
US6358679B1 (en) 2000-08-24 2002-03-19 Pe Corporation (Ny) Methods for external controls for nucleic acid amplification
US6361945B1 (en) 1998-07-02 2002-03-26 Gen-Probe Incorporated Molecular torches
US20020137920A1 (en) * 1995-06-08 2002-09-26 Boehringer Mannheim Gmbh. Magnetic pigment
US20020137036A1 (en) * 1999-10-29 2002-09-26 Sorge Joseph A. Methods for detection of a target nucleic acid by capture
US6458544B1 (en) 1999-12-02 2002-10-01 Dna Sciences, Inc. Methods for determining single nucleotide variations and genotyping
US6479267B1 (en) 1998-06-17 2002-11-12 Amersham Pharmacia Biotech, Inc. FY7 polymerase
US6485901B1 (en) 1997-10-27 2002-11-26 Boston Probes, Inc. Methods, kits and compositions pertaining to linear beacons
US6518025B1 (en) 1998-02-05 2003-02-11 Bavarian Nordic Research Institute A/S Quantification by inhibition of amplication
US20030099999A1 (en) * 1993-07-23 2003-05-29 Ai-Ping Wei Assay procedure using fluorogenic tracers
US6573047B1 (en) 1999-04-13 2003-06-03 Dna Sciences, Inc. Detection of nucleotide sequence variation through fluorescence resonance energy transfer label generation
US20030119005A1 (en) * 2001-12-14 2003-06-26 Motorola, Inc. Post-synthesis labeling of nucleic acids, assays using nucleic acids that are labeled post-synthetically, single nucleotide polymorphism detection, and associated compounds and microarrays
WO2003057910A2 (en) 2002-01-08 2003-07-17 Roche Diagnostics Gmbh Use of silica material in an amplification reaction
US20030186299A1 (en) * 2002-02-27 2003-10-02 Cogburn Larry A. Molecular markers for identification of fat and lean phenotypes in chickens
US20030199078A1 (en) * 1997-10-01 2003-10-23 Jorg Kleiber Method, kit and apparatus for the isolation of nucleic acids
US20030198982A1 (en) * 2000-08-03 2003-10-23 Frank Seela Nucleic acid binding compounds containing pyrazolo[3,4-d]pyrimidine analogues of purin-2,6-diamine and their uses
US20030224366A1 (en) * 1999-11-17 2003-12-04 Kurt Weindel Magnetic glass particles, method for their preparation and uses thereof
US20040009479A1 (en) * 2001-06-08 2004-01-15 Jay Wohlgemuth Methods and compositions for diagnosing or monitoring auto immune and chronic inflammatory diseases
US20040157247A1 (en) * 2002-12-20 2004-08-12 Roche Molecular Systems, Inc Mannitol and glucitol derivatives
US20040203050A1 (en) * 1999-11-24 2004-10-14 Norbert Reich Polymer arrays and methods of using labeled probe molecules to identify and quantify target molecule expression
WO2004092412A2 (en) 2003-03-31 2004-10-28 Roche Diagnostics Gmbh Compositions and methods for detecting certain flaviviruses, including members of the japanese encephalitis virus serogroup
US6821727B1 (en) 1993-11-15 2004-11-23 Applera Corporation Hybridization assay using self-quenching fluorescence probe
US20040241704A1 (en) * 2002-08-29 2004-12-02 Roche Molecular Systems, Inc Method for bisulfite treatment
US20050004078A1 (en) * 2003-04-05 2005-01-06 Frank Bergmann Nucleotide analogs with six-membered rings
US20050037410A1 (en) * 2003-08-01 2005-02-17 Dieter Heindl Detection format for hot start real time polymerase chain reaction
US20050048517A1 (en) * 2002-12-20 2005-03-03 Stratagene Compositions and methods for polynucleotide detection
US20050079535A1 (en) * 2003-10-13 2005-04-14 Michael Kirchgesser Methods for isolating nucleic acids
US20050142598A1 (en) * 2003-12-02 2005-06-30 Dieter Heindl Oligonucleotides containing molecular rods
US20050227247A1 (en) * 1995-05-05 2005-10-13 Applera Corporation Methods and reagents for combined PCR amplification and hybridization probing
US20050255499A1 (en) * 1990-08-06 2005-11-17 Roche Molecular Systems, Inc. Process for discrimination of nucleic acid sequence variants
WO2006006722A1 (en) 2004-07-13 2006-01-19 Takeda Pharmaceutical Company Limited Method of controlling cell functions
US20060040303A1 (en) * 2004-08-18 2006-02-23 Christian Weilke Reaction mixture for positioning a reaction vessel relative to a detection unit
US20060051796A1 (en) * 2004-09-09 2006-03-09 Inga Boell Real time PCR with the addition of pyrophosphatase
EP1634965A1 (en) 2004-09-09 2006-03-15 Boehringer Mannheim Gmbh Real time PCR with the addition of pyrophosphatase
US20060058518A1 (en) * 2003-01-29 2006-03-16 Frank Bergmann Method for bisulfite treatment
US7026121B1 (en) 2001-06-08 2006-04-11 Expression Diagnostics, Inc. Methods and compositions for diagnosing and monitoring transplant rejection
US20060078914A1 (en) * 1993-01-05 2006-04-13 Gelfand David H Homogeneous assay system
US20060178507A1 (en) * 2004-12-30 2006-08-10 Berry & Associates, Inc. Fluorous oligonucleotide reagents and affinity purification of oligonucleotides
US20060246469A1 (en) * 1999-10-29 2006-11-02 Stratagene California Compositions and methods for the detection of a nucleic acid using a cleavage reaction
US20060275798A1 (en) * 2005-04-04 2006-12-07 Steichen John C Detection of organisms using a media sachet and primer directed nucleic acid amplification
EP1739190A1 (en) 2005-06-30 2007-01-03 Boehringer Mannheim Gmbh Light emission modifiers and their uses in nucleic acid detection, amplification and analysis
WO2007002031A2 (en) 2005-06-28 2007-01-04 Invitrogen Corporation Dna polymerase blends and mutant dna polymerases
US20070099205A1 (en) * 1999-10-29 2007-05-03 Stratagene California Compositions for detection of a target nucleic acid sequence
US20070099190A1 (en) * 2003-11-04 2007-05-03 Martin Dugas Method for distinguishing leukemia subtypes
US20070105118A1 (en) * 2003-11-04 2007-05-10 Martin Dugas Method for distinguishing aml subtypes with recurring genetic aberrations
US20070122814A1 (en) * 2003-11-04 2007-05-31 Martin Dugas Methods for distinguishing prognostically definable aml
US20070128607A1 (en) * 2003-11-04 2007-06-07 Martin Dugas Method for distinguishing aml subtypes with different gene dosages
US20070141563A1 (en) * 2005-12-21 2007-06-21 Roche Molecular Systems, Inc. Control for nucleic acid testing
US7235358B2 (en) 2001-06-08 2007-06-26 Expression Diagnostics, Inc. Methods and compositions for diagnosing and monitoring transplant rejection
EP1801114A1 (en) 2005-11-23 2007-06-27 Boehringer Mannheim Gmbh Polynucleotides with a phosphate mimetic
US20070154889A1 (en) * 2004-06-25 2007-07-05 Veridex, Llc Methods and reagents for the detection of melanoma
US20070190540A1 (en) * 2005-09-01 2007-08-16 Corbett Life Science Pty Ltd Methods for the amplification, quantitation and identification of nucleic acids
US20070207459A1 (en) * 2003-11-04 2007-09-06 Martin Dugas Method For Distinguishing Immunologically Defined All Subtype
US20070212688A1 (en) * 2003-11-04 2007-09-13 Martin Dugas Method For Distinguishing Cbf-Positive Aml Subtypes From Cbf-Negative Aml Subtypes
US20070212734A1 (en) * 2003-11-04 2007-09-13 Martin Dugas Method for Distinguishing T(11Q23)/Mll-Positive Leukemias From t(11Q23)/Mll Negative Leukemia
US20070212687A1 (en) * 2003-11-04 2007-09-13 Martin Dugas Method For Distinguishing Mll-Ptd-Positive Aml From Other Aml Subtypes
EP1847616A2 (en) 2006-04-07 2007-10-24 Siemens Medical Solutions Diagnostics Neisseria gonorrhoeae specific oligonucleotide sequences
US20070269803A1 (en) * 2003-06-26 2007-11-22 Khalil Arar Fluorogenic Nucleic Acid Probes Including Lna for Methods to Detect and/or Quantify Nucleic Acid Analytes
US20070275380A1 (en) * 2003-11-04 2007-11-29 Martin Dugas Method for Distinguishing Aml Subtypes With Aberrant and Prognostically Intermediate Karyotypes
US20070281294A1 (en) * 2004-02-10 2007-12-06 Roche Moleculr Systems, Inc. Primers And Probes For The Detection Of Parvovirus B19
US20070292970A1 (en) * 2003-11-04 2007-12-20 Martin Dugas Method for Distinguishing Aml-Specific Flt3 Length Mutations From Tkd Mutations
EP1909108A2 (en) 2005-03-10 2008-04-09 Gen-Probe Incorporated Systems and methods to perform assays for detecting or quantifiying analytes
US7371830B2 (en) 1995-06-08 2008-05-13 Roche Diagnostics Gmbh Method for separating biological material from a fluid using magnetic particles
EP1932913A1 (en) 2006-12-11 2008-06-18 Boehringer Mannheim Gmbh Nucleic acid isolation using polidocanol and derivatives
US20080182759A1 (en) * 2006-12-18 2008-07-31 Arcxis Biotechnologies Selection of aptamers based on geometry
US20080187905A1 (en) * 2006-12-11 2008-08-07 Roche Molecular Systems, Inc. Nucleic acid isolation using polidocanol and derivatives
EP1978109A1 (en) 2007-04-05 2008-10-08 Boehringer Mannheim Gmbh Rapid one-step RT-PCR
US20080254474A1 (en) * 2007-04-12 2008-10-16 University Of Southern California Dna methylation analysis by digital bisulfite genomic sequencing and digital methylight
US7445898B2 (en) 2004-04-01 2008-11-04 Bio-Rad Laboratories, Inc. Quantitative amplification with a labeled probe and 3′ to 5′ exonuclease activity
US20080305481A1 (en) * 2006-12-13 2008-12-11 Luminex Corporation Systems and methods for multiplex analysis of pcr in real time
US20090011408A1 (en) * 1999-10-29 2009-01-08 Stratagene California Methods for detection of a target nucleic acid by forming a cleavage structure using a reverse transcriptase
US7476735B2 (en) 2005-05-20 2009-01-13 Integrated Dna Technologies, Inc. Compounds and methods for labeling oligonucleotides
US20090017453A1 (en) * 2007-07-14 2009-01-15 Maples Brian K Nicking and extension amplification reaction for the exponential amplification of nucleic acids
EP2017356A2 (en) 2006-06-06 2009-01-21 Gen-Probe Incorporated Tagged oliggonucleotides and their use in nucleic acid amplification methods
EP2016188A1 (en) * 2006-04-24 2009-01-21 Xiyu Jia Methods for detection of methylated dna
US20090023138A1 (en) * 2007-07-17 2009-01-22 Zila Biotechnology, Inc. Oral cancer markers and their detection
US20090035777A1 (en) * 2007-06-19 2009-02-05 Mark Stamatios Kokoris High throughput nucleic acid sequencing by expansion
US20090053821A1 (en) * 2003-11-14 2009-02-26 Integrated Dna Technologies, Inc. Fluorescence quenching azo dyes, their methods of preparation and use
US7501240B2 (en) 2003-12-02 2009-03-10 Roche Molecular Systems, Inc. Method for bisulfite treatment
EP2036990A1 (en) 2007-09-11 2009-03-18 Boehringer Mannheim Gmbh Diagnostic test for susceptibility to B-Raf kinase inhibitors
US20090118132A1 (en) * 2004-11-04 2009-05-07 Roche Molecular Systems, Inc. Classification of Acute Myeloid Leukemia
US20090117540A1 (en) * 1999-10-29 2009-05-07 Stratagene California Methods for detection of a target nucleic acid by forming a cleavage structure using an RNA polymerase
US7534568B2 (en) 1999-10-29 2009-05-19 Hologic Inc. Methods for detection of a target nucleic acid by forming a cleavage structure with a cleavage resistant probe
WO2009064766A1 (en) 2007-11-16 2009-05-22 E. I. Du Pont De Nemours And Company Method for detection and/or analysis of yeast and mold in filterable liquids
WO2009085221A2 (en) 2007-12-21 2009-07-09 Biomerieux Sa Detection of methicillin-resistant staphylococcus aureus
US20090208930A1 (en) * 2004-09-03 2009-08-20 Frank Bergmann Dna decontamination method
EP2103693A1 (en) 2008-03-19 2009-09-23 Boehringer Mannheim Gmbh Nucleic acid amplification in the presence of modified randomers
US20090239283A1 (en) * 2000-02-23 2009-09-24 City Of Hope Pyrophosphorolysis activated polymerization (pap)
US20090253142A1 (en) * 2008-03-15 2009-10-08 Hologic, Inc. Compositions and methods for analysis of nucleic acid molecules during amplification reactions
EP2108700A1 (en) 2008-04-08 2009-10-14 Boehringer Mannheim Gmbh Analytical processing and detection device
EP2110439A1 (en) 2004-05-06 2009-10-21 F. Hoffmann-Roche AG SENP1 as a marker for cancer
EP2112233A1 (en) * 2000-02-23 2009-10-28 City of Hope Pyrophosphorolysis activated polymerization (PAP): application to allele-specific amplification and nucleic acid sequence determination
EP2123360A1 (en) 2008-05-20 2009-11-25 F.Hoffmann-La Roche Ag Thermocycling device having a thermocycler module with a thermal switch, method of cooling a heating block in a thermocycler module of a thermocycling device and analytical apparatus
US20090317888A1 (en) * 2006-10-09 2009-12-24 Lars-Erik Peters Thermus egertssonii dna polymerases
US7645575B2 (en) 2004-09-08 2010-01-12 Xdx, Inc. Genes useful for diagnosing and monitoring inflammation related disorders
EP2163556A1 (en) 2008-09-09 2010-03-17 Roche Diagnostics GmbH Polyanion for improved nucleic acid amplification
US20100081124A1 (en) * 2008-09-30 2010-04-01 Abbott Laboratories Primers and probes for detecting human papillomavirus and human beta globin sequences in test samples
EP2182357A1 (en) 2008-10-17 2010-05-05 Boehringer Mannheim Gmbh Cell monitoring and molecular analysis
WO2010071833A1 (en) 2008-12-19 2010-06-24 Life Technologies Corporation Proteinase k inhibitors, methods and compositions therefor
US20100159529A1 (en) * 2008-12-19 2010-06-24 Thomas Metzler Dry composition of reaction compounds with stabilized polmerase
US7767447B2 (en) 2007-06-21 2010-08-03 Gen-Probe Incorporated Instruments and methods for exposing a receptacle to multiple thermal zones
WO2010093820A2 (en) 2009-02-11 2010-08-19 Orion Genomics Llc Combinations of polymorphisms for determining allele-specific expression of igf2
US7781165B2 (en) 2005-10-19 2010-08-24 Roche Diagnostics Operations, Inc. Benzimidazolium compounds and salts of benzimidazolium compounds for nucleic acid amplification
US20100248991A1 (en) * 2009-02-25 2010-09-30 Angelika Roesler Solid support for high-throughput nucleic acid analysis
US20100248237A1 (en) * 2009-02-25 2010-09-30 Thomas Froehlich Miniaturized, high-throughput nucleic acid analysis
US20100255482A1 (en) * 2007-11-06 2010-10-07 Siemens Healthcare Diagnostics Inc. Hepatitis B Virus (HBV) Specific Oligonucleotide Sequences
US20100261617A1 (en) * 2006-09-14 2010-10-14 Deutsches Krebsforschungszentrum Stiftung des öffentkuchen Rechts Gene expression signature for the prognosis, diagnosis, and therapy of prostate cancer and uses thereof
WO2010123058A1 (en) 2009-04-22 2010-10-28 田辺三菱製薬株式会社 Probe set for identification of nucleotide mutation, and method for identification of nucleotide mutation
US20100285535A1 (en) * 2006-02-27 2010-11-11 Waltraud Ankenbauer Pcr hot start by magnesium sequestration
US20110003290A1 (en) * 2007-10-22 2011-01-06 Nittaya Gale Oligonucleotides and Uses Thereof
EP2272989A1 (en) 2009-07-08 2011-01-12 Veridex, LLC Methods and reagents for the early detection of melanoma
WO2011011391A1 (en) 2009-07-22 2011-01-27 E.I. Dupont De Nemours And Company Sequences and their use for detection and characterization of e. coli o157:h7
US7879556B2 (en) 2003-04-24 2011-02-01 Xdx, Inc. Methods and compositions for diagnosing and monitoring transplant rejection
US20110060150A1 (en) * 2002-09-20 2011-03-10 Integrated Dna Technologies, Inc. Method of detecting fluorescence
US20110065209A1 (en) * 2009-08-31 2011-03-17 Mbio Diagnostics, Inc. Integrated Sample Preparation and Analyte Detection
EP2308887A2 (en) 2003-11-12 2011-04-13 Bayer HealthCare LLC Oligonucleotides and methods for detection of west nile virus
WO2011053845A2 (en) 2009-10-30 2011-05-05 Illumina, Inc. Microvessels, microparticles, and methods of manufacturing and using the same
WO2011053852A1 (en) 2009-10-30 2011-05-05 The Regents Of The University Of California Gna11 mutations in melanoma
US20110111463A1 (en) * 2008-08-01 2011-05-12 Michael Kubista Lysis and reverse transcription for mrna quantification
EP2322940A1 (en) 2005-03-10 2011-05-18 Gen-Probe Incorporated Systems amd methods to perform assays for detecting or quantifing analytes within samples
WO2011060174A1 (en) 2009-11-13 2011-05-19 Beckman Coulter, Inc. Systems and methods for detecting the presence of a biological status using plot
WO2011060222A2 (en) 2009-11-13 2011-05-19 Beckman Coulter, Inc. Systems and methods for detecting the presence of a biological status using clustering
WO2011066589A1 (en) 2009-11-30 2011-06-03 Caris Life Sciences Luxembourg Holdings Methods and systems for isolating, storing, and analyzing vesicles
WO2011088226A2 (en) 2010-01-13 2011-07-21 Caris Life Sciences Luxembourg Holdings Detection of gastrointestinal disorders
US7993832B2 (en) 2006-08-14 2011-08-09 Xdx, Inc. Methods and compositions for diagnosing and monitoring the status of transplant rejection and immune disorders
US20110236898A1 (en) * 2010-03-26 2011-09-29 Scott Rose Methods for enhancing nucleic acid hybridization
EP2374874A2 (en) 2010-04-12 2011-10-12 Roche Diagnostics GmbH Detergent free polymerases
WO2011128096A1 (en) 2010-04-16 2011-10-20 Roche Diagnostics Gmbh Polymorphism markers for predicting response to interleukin-6 receptor-inhibiting monoclonal antibody drug treatment
WO2011150277A2 (en) 2010-05-28 2011-12-01 Life Technologies Corporation Synthesis of 2', 3'-dideoxynucleosides for automated dna synthesis and pyrophosphorolysis activated polymerization
WO2012003409A1 (en) 2010-06-30 2012-01-05 Life Technologies Corporation Detection of listeria species in food and environmental samples, methods and compositions thereof
WO2012003412A2 (en) 2010-06-30 2012-01-05 Life Technologies Corporation Inducible nucleic acid targets for detection of pathogens, methods and compositions thereof
EP2405020A1 (en) 2010-07-07 2012-01-11 Roche Diagnostics GmbH Clonal pre-amplification in emulsion
US8105477B2 (en) 2003-04-16 2012-01-31 Handylab, Inc. System and method for electrochemical detection of biological compounds
WO2012018964A1 (en) 2010-08-03 2012-02-09 Life Technologies Corporation Detection of salmonella enterica subspecies enterica serovar enteritidis in food and environmental samples, methods and compositions thereof
WO2012040619A2 (en) 2010-09-24 2012-03-29 Massachusetts Eye And Ear Infirmary Methods and compositions for prognosing and/or detecting age-related macular degeneration
US8148067B2 (en) 2006-11-09 2012-04-03 Xdx, Inc. Methods for diagnosing and monitoring the status of systemic lupus erythematosus
WO2012045670A1 (en) 2010-10-04 2012-04-12 F. Hoffmann-La Roche Ag Method for cell lysis in a pcr reaction buffer
WO2012045668A1 (en) 2010-10-04 2012-04-12 Roche Diagnostics Gmbh Method for cell lysis in a rt-pcr reaction buffer
WO2012045669A1 (en) 2010-10-04 2012-04-12 F. Hoffmann-La Roche Ag Method for cell lysis and pcr within the same reaction vessel
WO2012073053A1 (en) 2010-11-30 2012-06-07 Diagon Kft. Procedure for nucleic acid-based molecular diagnostic determination of bacterial germ counts and kit for this purpose
WO2012092461A2 (en) 2010-12-30 2012-07-05 Pioneer Hi-Bred International, Inc. Methods of identifying aphid resistant soybeans
EP2479287A1 (en) 2008-05-13 2012-07-25 Gen-Probe Incorporated Inactivatable target capture oligomers for use in the selective hybridization and capture of target nucleic acid sequences
WO2012099896A2 (en) 2011-01-17 2012-07-26 Life Technologies Corporation Workflow for detection of ligands using nucleic acids
WO2012149438A1 (en) 2011-04-28 2012-11-01 Life Technologies Corporation Methods and compositions for multiplex pcr
WO2012170907A2 (en) 2011-06-08 2012-12-13 Life Technologies Corporation Polymerization of nucleic acids using proteins having low isoelectric points
WO2012170908A1 (en) 2011-06-08 2012-12-13 Life Technologies Corporation Design and development of novel detergents for use in pcr systems
WO2012171997A1 (en) 2011-06-14 2012-12-20 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods for determining the expression level of a gene of interest including correction of rt-qpcr data for genomic dna-derived signals
WO2013030167A1 (en) 2011-08-31 2013-03-07 F. Hoffmann-La Roche Ag Responsiveness to angiogenesis inhibitors
WO2013030168A1 (en) 2011-08-31 2013-03-07 F. Hoffmann-La Roche Ag Method for predicting risk of hypertension associated with anti-angiogenesis therapy
EP2570487A1 (en) 2011-09-16 2013-03-20 Lexogen GmbH Nucleic acid transcription method
WO2013038010A2 (en) 2011-09-16 2013-03-21 Lexogen Gmbh Nucleic acid transcription method
WO2013043715A1 (en) 2011-09-19 2013-03-28 Genentech, Inc. Combination treatments comprising c-met antagonists and b-raf antagonists
WO2013044097A1 (en) 2011-09-21 2013-03-28 Gen-Probe Incorporated Methods for amplifying nucleic acid using tag-mediated displacement
US8409807B2 (en) 2010-10-22 2013-04-02 T2 Biosystems, Inc. NMR systems and methods for the rapid detection of analytes
WO2013049489A1 (en) 2011-09-28 2013-04-04 E.I. Dupont De Nemours And Company Sequences and their use for detection and characterization of stec bacteria
WO2013070662A1 (en) 2011-11-09 2013-05-16 E.I. Du Pont De Nemours And Company Sequences and their use for detection of salmonella
WO2013076029A1 (en) 2011-11-23 2013-05-30 F. Hoffmann-La Roche Ag Responsiveness to angiogenesis inhibitors
WO2013081864A1 (en) 2011-11-29 2013-06-06 Life Technologies Corporation Methods and compositions for multiplex pcr
WO2013091835A1 (en) 2011-12-22 2013-06-27 Roche Diagnostics Gmbh Methods and reagents for reducing non-specific amplification
WO2013093106A1 (en) 2011-12-23 2013-06-27 Biomerieux Detection of meca variant strains of methicillin-resistant staphylococcus aureus
WO2013101750A1 (en) 2011-12-29 2013-07-04 Pioneer Hi-Bred International, Inc. Methods of improving aphid resistance in soybeans
EP2636755A1 (en) 2006-05-26 2013-09-11 AltheaDx Incorporated Biochemical analysis of partitioned cells
WO2013139860A1 (en) 2012-03-21 2013-09-26 Roche Diagnostics Gmbh Methods for assessing rna quality
US8563298B2 (en) 2010-10-22 2013-10-22 T2 Biosystems, Inc. NMR systems and methods for the rapid detection of analytes
WO2013188612A1 (en) 2012-06-15 2013-12-19 Pioneer Hi-Bred International, Inc. Genetic loci associated with soybean cyst nematode resistance and methods of use
WO2013188839A1 (en) 2012-06-14 2013-12-19 Life Technologies Corporation Novel compositions, methods and kits for real time polymerase chain reaction (pcr)
EP2700723A2 (en) 2007-08-06 2014-02-26 Orion Genomics, LLC Novel single nucleotide polymorphisms and combinations of novel and known polymorphisms for determining the allele-specific expression of the IGF2 gene
WO2014071315A1 (en) 2012-11-02 2014-05-08 Life Technologies Corporation Novel compositions, methods and kits for enhancing pcr specificity
US8721968B2 (en) 2004-06-07 2014-05-13 Fluidigm Corporation Optical lens system and method for microfluidic devices
EP2730662A1 (en) 2008-11-12 2014-05-14 Caris Life Sciences Luxembourg Holdings Methods and systems of using exosomes for determining phenotypes
US8778843B1 (en) 2011-08-03 2014-07-15 Fry Laboratories, L.L.C. Semi-pan-protozoal by quantitative PCR
WO2014135669A1 (en) 2013-03-08 2014-09-12 Roche Diagnostics Gmbh Egfr mutation blood testing
US8838394B2 (en) 2012-02-03 2014-09-16 California Institute Of Technology Signal encoding and decoding in multiplexed biochemical assays
WO2014140147A1 (en) 2013-03-15 2014-09-18 Roche Diagnostics Gmbh Nucleic acid target identification by structure based probe cleavage
WO2014150300A2 (en) 2013-03-15 2014-09-25 Abbott Molecular Inc. Method for amplification and assay of rna fusion gene variants, method of distinguishing same and related primers, probes, and kits
WO2014165210A2 (en) 2013-03-12 2014-10-09 Life Technologies Corporation Universal reporter-based genotyping methods and materials
WO2015026757A2 (en) 2013-08-20 2015-02-26 E. I. Du Pont De Nemours And Company Sequences and their use for detection of salmonella enteritidis and/or salmonella typhimurium
EP2851432A1 (en) 2007-11-01 2015-03-25 University of Iowa Research Foundation RCA locus analysis to assess susceptibility to AMD and MPGNII
WO2015061548A1 (en) 2013-10-25 2015-04-30 Pioneer Hi-Bred International, Inc. Stem canker tolerant soybeans and methods of use
WO2015061714A1 (en) 2013-10-25 2015-04-30 Life Technologies Corporation Novel compounds for use in pcr systems and applications thereof
WO2015091765A1 (en) 2013-12-20 2015-06-25 Roche Diagnostics Gmbh Multiplexed nucleic acid target identification by structure based probe cleavage
WO2015091756A1 (en) 2013-12-20 2015-06-25 Roche Diagnostics Gmbh A method for coding of multiple pcr reactions for assay recognition
WO2015097137A1 (en) 2013-12-23 2015-07-02 Roche Diagnostics Gmbh Method for screening reagents used in pcr assays
US9127308B2 (en) 2002-03-07 2015-09-08 Atlas Genetics Limited Nucleic acid probes, their synthesis and use
US9128101B2 (en) 2010-03-01 2015-09-08 Caris Life Sciences Switzerland Holdings Gmbh Biomarkers for theranostics
US9139870B2 (en) 2012-08-30 2015-09-22 Gen-Probe Incorporated Multiphase nucleic acid amplification
WO2015162102A1 (en) 2014-04-22 2015-10-29 Roche Diagnostics Gmbh A method for visual identification of pcr solutions for accurate reaction set-up
EP2966180A1 (en) 2011-11-29 2016-01-13 Life Technologies Corporation Methods and compositions for multiplex pcr
US9309565B2 (en) 2010-05-14 2016-04-12 Life Technologies Corporation Karyotyping assay
WO2016061111A1 (en) 2014-10-13 2016-04-21 Life Technologies Corporation Methods, kits & compositions for determining gene copy numbers
WO2016077366A1 (en) 2014-11-10 2016-05-19 Genentec, Inc. Therapeutic and diagnostic methods for il-33-mediated disorders
WO2016079078A1 (en) 2014-11-19 2016-05-26 Roche Diagnostics Gmbh Photoblocked probes and methods for sequential detection of nucleic acids
US9352312B2 (en) 2011-09-23 2016-05-31 Alere Switzerland Gmbh System and apparatus for reactions
EP3061834A1 (en) 2005-10-21 2016-08-31 The Regents of the University of California Shp-2 gene mutations in melanoma
US9469876B2 (en) 2010-04-06 2016-10-18 Caris Life Sciences Switzerland Holdings Gmbh Circulating biomarkers for metastatic prostate cancer
US9488648B2 (en) 2010-10-22 2016-11-08 T2 Biosystems, Inc. NMR systems and methods for the rapid detection of analytes
US9487833B2 (en) 2014-03-06 2016-11-08 Samsung Electronics Co., Ltd Primer set specific for vancomycin-resistant Enterococcus, composition comprising the same and method of detecting vancomycin-resistant microorganism Enterococcus in sample
US9506057B2 (en) 2010-03-26 2016-11-29 Integrated Dna Technologies, Inc. Modifications for antisense compounds
US9506059B2 (en) 2010-03-26 2016-11-29 Integrated Dna Technologies, Inc. Modifications for antisense compounds
EP3124619A1 (en) 2015-07-31 2017-02-01 Menicon Co., Ltd Reagents, method and kit for across and within dog breed glaucoma diagnosis
US9562271B2 (en) 2012-04-20 2017-02-07 T2 Biosystems, Inc. Compositions and methods for detection of Candida species
WO2017031101A1 (en) 2015-08-17 2017-02-23 Kura Oncology, Inc. Methods of treating cancer patients with farnesyl transferase inhibitors
EP3168309A1 (en) 2015-11-10 2017-05-17 Lifecodexx AG Detection of foetal chromosomal aneuploidies using dna regions that are differentially methylated between the foetus and the pregnant female
WO2017106447A1 (en) 2015-12-18 2017-06-22 Pioneer Hi-Bred International, Inc. Genetic loci associated with reproductive growth phenotypes in soybean and methods of use
WO2017136204A1 (en) 2016-02-05 2017-08-10 Pioneer Hi-Bred International, Inc. Genetic loci associated with brown stem rot resistance in soybean and methods of use
US9758837B2 (en) 2011-08-02 2017-09-12 The United States Of America, As Represented By The Secretary Of Agriculture Sensitive and rapid method for Candidatus Liberibacter species detection
US9782772B2 (en) 2014-10-31 2017-10-10 Samsung Electronics Co., Ltd. Method of bonding two surfaces and construct therefrom and microfluidic device containing the construct
WO2017184968A1 (en) 2016-04-22 2017-10-26 Kura Oncology, Inc. Methods of selecting cancer patients for treatment with farnesyltransferase inhibitors
US9822412B2 (en) 2014-05-09 2017-11-21 Lifecodexx Ag Detection of DNA that originates from a specific cell-type
US9822413B2 (en) 2014-05-09 2017-11-21 Lifecodexx Ag Multiplex detection of DNA that originates from a specific cell-type
US9914979B2 (en) 2013-03-04 2018-03-13 Fry Laboratories, LLC Method and kit for characterizing microorganisms
US9914975B2 (en) 2013-03-08 2018-03-13 Roche Molecular Systems, Inc. EGFR blood monitoring
US9932633B2 (en) 2012-03-21 2018-04-03 Roche Molecular Systems, Inc. Methods for assessing RNA quality

Families Citing this family (755)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5635347A (en) * 1986-04-30 1997-06-03 Igen, Inc. Rapid assays for amplification products
US5795762A (en) * 1986-08-22 1998-08-18 Roche Molecular Systems, Inc. 5' to 3' exonuclease mutations of thermostable DNA polymerases
US5466591A (en) * 1986-08-22 1995-11-14 Hoffmann-La Roche Inc. 5' to 3' exonuclease mutations of thermostable DNA polymerases
US6589734B1 (en) * 1989-07-11 2003-07-08 Gen-Probe Incorporated Detection of HIV
US5856088A (en) * 1989-07-11 1999-01-05 Gen-Probe Incorporated Detection of human immunodeficiency virus type 1
US7273749B1 (en) * 1990-06-04 2007-09-25 University Of Utah Research Foundation Container for carrying out and monitoring biological processes
US5994056A (en) 1991-05-02 1999-11-30 Roche Molecular Systems, Inc. Homogeneous methods for nucleic acid amplification and detection
DK0620822T3 (en) * 1991-11-07 2001-08-27 Nanotronics Inc Hybridization of polynucleotides conjugated with chromophores and fluorophores to form a donor-to-donor energy transfer system;
US5567583A (en) * 1991-12-16 1996-10-22 Biotronics Corporation Methods for reducing non-specific priming in DNA detection
US6033854A (en) * 1991-12-16 2000-03-07 Biotronics Corporation Quantitative PCR using blocking oligonucleotides
FI115214B (en) * 1992-01-22 2005-03-31 Hoechst Ag Process for preparing oligonucleotide analogues and their use
US6033909A (en) * 1992-01-22 2000-03-07 Hoechst Aktiengesellschaft Oligonucleotide analogs, their preparation and use
US5646261A (en) * 1992-01-22 1997-07-08 Hoechst Aktiengesellschaft 3'-derivatized oligonucleotide analogs with non-nucleotidic groupings, their preparation and use
JP3516953B2 (en) * 1992-08-03 2004-04-05 アボツト・ラボラトリーズ Detection and amplification of target nucleic acid using the equi Sonu Cleo Li tic activity
DE4239531A1 (en) * 1992-11-25 1994-05-26 Gabor Dr Igloi Reagent for the coupling of different substances to nucleic acids, and methods for its preparation
US6673616B1 (en) 1992-12-07 2004-01-06 Third Wave Technologies, Inc. Methods and compositions for characterizing nucleic acids
US5719028A (en) * 1992-12-07 1998-02-17 Third Wave Technologies Inc. Cleavase fragment length polymorphism
US5843654A (en) * 1992-12-07 1998-12-01 Third Wave Technologies, Inc. Rapid detection of mutations in the p53 gene
US5888780A (en) * 1992-12-07 1999-03-30 Third Wave Technologies, Inc. Rapid detection and identification of nucleic acid variants
US5541311A (en) * 1992-12-07 1996-07-30 Third Wave Technologies, Inc. Nucleic acid encoding synthesis-deficient thermostable DNA polymerase
US7601496B2 (en) * 1992-12-07 2009-10-13 Third Wave Technologies, Inc. Cleavage of nucleic acids
US5614402A (en) * 1992-12-07 1997-03-25 Third Wave Technologies, Inc. 5' nucleases derived from thermostable DNA polymerase
EP0788557A4 (en) * 1994-11-09 2003-08-06 Third Wave Tech Inc Rapid detection and identification of nucleic acid variants and pathogens
US5422253A (en) * 1992-12-07 1995-06-06 Wisconsin Alumni Research Foundation Method of site specific nucleic acid cleavage
JP3099853B2 (en) * 1993-02-19 2000-10-16 株式会社日立製作所 Measuring reagent and measurement methods of nucleic acid
CA2159103C (en) 1993-03-26 2002-03-12 Sherrol H. Mcdonough Detection of human immunodeficiency virus type 1
US5491086A (en) * 1993-05-14 1996-02-13 Hoffmann-La Roche Inc. Purified thermostable nucleic acid polymerase and DNA coding sequences from pyrodictium species
DE4344742A1 (en) * 1993-06-09 1994-12-15 Boehringer Mannheim Gmbh A process for the immobilization of nucleic acids
JPH0723800A (en) * 1993-07-08 1995-01-27 Eiken Chem Co Ltd Method for detecting nucleic acid
DE69429038D1 (en) * 1993-07-28 2001-12-20 Pe Corp Ny Norwalk Apparatus and method for nucleic acid amplification
ES2123162T3 (en) * 1993-10-21 1999-01-01 Abbott Lab Apparatus and method for transferring a fluid sample.
US5645801A (en) * 1993-10-21 1997-07-08 Abbott Laboratories Device and method for amplifying and detecting target nucleic acids
US5925517A (en) * 1993-11-12 1999-07-20 The Public Health Research Institute Of The City Of New York, Inc. Detectably labeled dual conformation oligonucleotide probes, assays and kits
WO1995014106A3 (en) * 1993-11-17 1995-08-24 Id Biomedical Corp Cycling probe cleavage detection of nucleic acid sequences
DE69432919D1 (en) * 1993-12-28 2003-08-14 Tanabe Seiyaku Co A method for detecting specific polynucleotides
US5869255A (en) 1994-02-01 1999-02-09 The Regents Of The University Of California Probes labeled with energy transfer couples dyes exemplified with DNA fragment analysis
US6028190A (en) 1994-02-01 2000-02-22 The Regents Of The University Of California Probes labeled with energy transfer coupled dyes
US5547861A (en) * 1994-04-18 1996-08-20 Becton, Dickinson And Company Detection of nucleic acid amplification
WO1995030139A1 (en) * 1994-04-29 1995-11-09 Perkin-Elmer Corporation System for real time detection of nucleic acid amplification products
ES2158895T3 (en) * 1994-05-23 2001-09-16 Biotronics Corp Method for detecting a target nucleic acid.
CN1152946A (en) * 1994-05-28 1997-06-25 特普尼尔医学有限公司 Producing copies of nucleic acids
US5773213A (en) * 1994-06-06 1998-06-30 Brigham & Women's Hospital Method for conducting sequential nucleic acid hybridization steps
US20070269799A9 (en) * 1994-06-22 2007-11-22 Zhang David Y Nucleic acid amplification methods
US5580730A (en) * 1994-08-19 1996-12-03 Olympus America, Inc. Enzyme digestion method for the detection of amplified DNA
US5491063A (en) * 1994-09-01 1996-02-13 Hoffmann-La Roche Inc. Methods for in-solution quenching of fluorescently labeled oligonucleotide probes
US5512441A (en) * 1994-11-15 1996-04-30 American Health Foundation Quantative method for early detection of mutant alleles and diagnostic kits for carrying out the method
US5571673A (en) * 1994-11-23 1996-11-05 Hoffmann-La Roche Inc. Methods for in-solution quenching of fluorescently labeled oligonucleotide probes
US5786139A (en) * 1994-12-09 1998-07-28 Panvera Corporation Method and kit for detecting nucleic acid cleavage utilizing a covalently attached fluorescent tag
EP1260593A3 (en) * 1994-12-23 2003-12-03 Dade International Inc. Detection of nucleic acids by nuclease-catalyzed product formation
US20030165908A1 (en) * 1994-12-30 2003-09-04 Georgetown University Fluorometric assay for detecting nucleic acid cleavage
US6787304B1 (en) 1994-12-28 2004-09-07 Georgetown University Fluorometric assay for detecting nucleic acid cleavage
WO1996021144A1 (en) * 1994-12-30 1996-07-11 Georgetown University Fluorometric assay for detecting nucleic acid cleavage
EP0807816A4 (en) 1995-02-02 1999-09-22 Chugai Pharmaceutical Co Ltd Method of assaying specimen substance by controlling dose of chemiluminescence
US6312894B1 (en) 1995-04-03 2001-11-06 Epoch Pharmaceuticals, Inc. Hybridization and mismatch discrimination using oligonucleotides conjugated to minor groove binders
US5801155A (en) * 1995-04-03 1998-09-01 Epoch Pharmaceuticals, Inc. Covalently linked oligonucleotide minor grove binder conjugates
US7556923B1 (en) 1995-04-03 2009-07-07 Epoch Biosciences, Inc. Hybridization and mismatch discrimination using oligonucleotides conjugated to minor groove binders
US6949367B1 (en) 1998-04-03 2005-09-27 Epoch Pharmaceuticals, Inc. Modified oligonucleotides for mismatch discrimination
US7045610B2 (en) * 1998-04-03 2006-05-16 Epoch Biosciences, Inc. Modified oligonucleotides for mismatch discrimination
US6683173B2 (en) * 1998-04-03 2004-01-27 Epoch Biosciences, Inc. Tm leveling methods
US7715989B2 (en) * 1998-04-03 2010-05-11 Elitech Holding B.V. Systems and methods for predicting oligonucleotide melting temperature (TmS)
US5994063A (en) * 1995-06-23 1999-11-30 Metzker; Michael L. Substituted 4,4-difluoro-4-bora-3A,4A-diaza-s-indacene compounds for homogenous amplification/detection assays
US6027879A (en) * 1995-08-09 2000-02-22 The Regents Of The University Of California Detection and isolation of nucleic acid sequences using a bifunctional hybridization probe
US6372424B1 (en) * 1995-08-30 2002-04-16 Third Wave Technologies, Inc Rapid detection and identification of pathogens
WO1997010056A3 (en) * 1995-09-12 1997-05-22 Becton Dickinson Co Device and method for dna amplification and assay
US5837442A (en) 1995-11-29 1998-11-17 Roche Molecular Systems, Inc. Oligonucleotide primers for amplifying HCV nucleic acid
DE19548680A1 (en) * 1995-12-23 1997-06-26 Boehringer Mannheim Gmbh A method for quantitative detection of specific nucleic acid sequences
US6027890A (en) * 1996-01-23 2000-02-22 Rapigene, Inc. Methods and compositions for enhancing sensitivity in the analysis of biological-based assays
CN1159452C (en) * 1996-01-23 2004-07-28 佳根基因组学公司 Method and compositions for detecting binding of ligand pair using non-fluorescent label
US6613508B1 (en) 1996-01-23 2003-09-02 Qiagen Genomics, Inc. Methods and compositions for analyzing nucleic acid molecules utilizing sizing techniques
US6312893B1 (en) 1996-01-23 2001-11-06 Qiagen Genomics, Inc. Methods and compositions for determining the sequence of nucleic acid molecules
US6872816B1 (en) * 1996-01-24 2005-03-29 Third Wave Technologies, Inc. Nucleic acid detection kits
US5994069A (en) * 1996-01-24 1999-11-30 Third Wave Technologies, Inc. Detection of nucleic acids by multiple sequential invasive cleavages
US7256020B2 (en) * 1996-11-29 2007-08-14 Third Wave Technologies, Inc. Methods and compositions for detecting target sequences
DE69739108D1 (en) 1996-11-29 2008-12-24 Third Wave Tech Inc Fen-1 endonucleases, mixtures and divisive methods
US6875572B2 (en) 1996-01-24 2005-04-05 Third Wave Technologies, Inc. Nucleic acid detection assays
US5846717A (en) * 1996-01-24 1998-12-08 Third Wave Technologies, Inc. Detection of nucleic acid sequences by invader-directed cleavage
US7122364B1 (en) * 1998-03-24 2006-10-17 Third Wave Technologies, Inc. FEN endonucleases
US20080160524A1 (en) * 1996-01-24 2008-07-03 Third Wave Technologies, Inc. Methods and Compositions for Detecting Target Sequences
WO2002070755A3 (en) * 2000-11-15 2003-06-19 Third Wave Tech Inc Fen endonucleases
US7432048B2 (en) * 1996-11-29 2008-10-07 Third Wave Technologies, Inc. Reactions on a solid surface
US6780982B2 (en) * 1996-07-12 2004-08-24 Third Wave Technologies, Inc. Charge tags and the separation of nucleic acid molecules
US6913881B1 (en) 1996-01-24 2005-07-05 Third Wave Technologies, Inc. Methods and compositions for detecting target sequences
US7195871B2 (en) * 1996-01-24 2007-03-27 Third Wave Technologies, Inc Methods and compositions for detecting target sequences
US6706471B1 (en) 1996-01-24 2004-03-16 Third Wave Technologies, Inc. Detection of nucleic acid sequences by invader-directed cleavage
US5985557A (en) * 1996-01-24 1999-11-16 Third Wave Technologies, Inc. Invasive cleavage of nucleic acids
US6090606A (en) * 1996-01-24 2000-07-18 Third Wave Technologies, Inc. Cleavage agents
CA2243353C (en) * 1996-01-24 2010-03-30 Third Wave Technologies, Inc. Invasive cleavage of nucleic acids
US7527928B2 (en) * 1996-11-29 2009-05-05 Third Wave Technologies, Inc. Reactions on a solid surface
US5763184A (en) 1996-01-30 1998-06-09 Roche Molecular Systems, Inc. Nucleotide sequence variation in the ABO glycosyltransferase gene
US5716784A (en) * 1996-02-05 1998-02-10 The Perkin-Elmer Corporation Fluorescence detection assay for homogeneous PCR hybridization systems
US5874216A (en) 1996-02-23 1999-02-23 Ensys Environmental Products, Inc. Indirect label assay device for detecting small molecules and method of use thereof
EP0892856B1 (en) * 1996-03-01 2005-11-09 E.I. Du Pont De Nemours And Company A method for the amplification and detection of a nucleic acid fragment of interest
CA2199213C (en) 1996-03-11 2007-04-17 John Wesley Backus Amplifying and detecting target nucleic acids using a post amplification incubation step
US7244622B2 (en) 1996-04-03 2007-07-17 Applera Corporation Device and method for multiple analyte detection
WO1997039008A1 (en) * 1996-04-12 1997-10-23 The Public Health Research Institute Of The City Of New York, Inc. Detection probes, kits and assays
WO1998010096A1 (en) * 1996-04-12 1998-03-12 The Public Health Research Institute Of The City Of New York, Inc. Detection probes, kits and assays
US5955268A (en) * 1996-04-26 1999-09-21 Abbott Laboratories Method and reagent for detecting multiple nucleic acid sequences in a test sample
US5887385A (en) * 1996-05-28 1999-03-30 Rite-Hite Holding Corporation Release mechanism for industrial doors
US5736333A (en) * 1996-06-04 1998-04-07 The Perkin-Elmer Corporation Passive internal references for the detection of nucleic acid amplification products
ES2326050T5 (en) * 1996-06-04 2012-04-26 University Of Utah Research Foundation Monitoring hybridization during PCR
DE69740030D1 (en) * 1996-06-04 2010-12-02 Univ Utah Res Found An apparatus for performing PCR under timely monitoring of the fluorescence
US7081226B1 (en) 1996-06-04 2006-07-25 University Of Utah Research Foundation System and method for fluorescence monitoring
US7070925B1 (en) 1996-07-16 2006-07-04 Gen-Probe Incorporated Method for determining the presence of an RNA analyte in a sample using a modified oligonucleotide probe
US5866336A (en) * 1996-07-16 1999-02-02 Oncor, Inc. Nucleic acid amplification oligonucleotides with molecular energy transfer labels and methods based thereon
EP0912767B1 (en) * 1996-07-16 2006-09-13 Gen-Probe Incorporated Methods for detecting and amplifying nucleic acid sequences using modified oligonucleotides having increased target specific tm
US6117635A (en) * 1996-07-16 2000-09-12 Intergen Company Nucleic acid amplification oligonucleotides with molecular energy transfer labels and methods based thereon
US6361940B1 (en) 1996-09-24 2002-03-26 Qiagen Genomics, Inc. Compositions and methods for enhancing hybridization and priming specificity
US20050202499A1 (en) 1996-10-31 2005-09-15 Billing-Medel Patricia A. Reagents and methods useful for detecting diseases of the breast
US20030165971A1 (en) * 1996-10-31 2003-09-04 Billing-Medel Patricia A. Reagents and methods useful for detecting diseases of the breast
US20050153373A1 (en) * 1996-10-31 2005-07-14 Billing-Medel Patricia A. Reagents and methods useful for detecting diseases of the breast
US8182991B1 (en) 1997-11-26 2012-05-22 Third Wave Technologies, Inc. FEN-1 endonucleases, mixtures and cleavage methods
US5840879A (en) * 1996-12-06 1998-11-24 Wang; Edge R. Reagents and solid supports for improved synthesis and labeling of polynucleotides
US20050208567A1 (en) * 1997-04-25 2005-09-22 Billing-Medel Patricia A Reagents and methods useful for detecting diseases of the prostate
JP3948503B2 (en) * 1997-08-01 2007-07-25 西川ゴム工業株式会社 Detection method of the measurement method and Vero toxin producing bacteria of nucleic acids by fluorescence polarization
US6355421B1 (en) 1997-10-27 2002-03-12 Boston Probes, Inc. Methods, kits and compositions pertaining to PNA molecular beacons
EP1029077A2 (en) 1997-11-04 2000-08-23 Boehringer Mannheim Gmbh A specific and sensitive nulceic acid detection method
US6294326B1 (en) 1997-11-07 2001-09-25 Abbott Laboratories Analyte detection process using dual labeled probes
US6583168B1 (en) 1997-11-25 2003-06-24 Applera Corporation Sulfonated diarylrhodamine dyes
DE19752898A1 (en) 1997-11-28 1999-08-05 Centeon Pharma Gmbh A method for detecting high Four concentrations in blood plasma and / or blood serum using the polymerase chain reaction
DE19755642B4 (en) * 1997-12-15 2005-03-10 Zlb Behring Gmbh Labeled primers for the polymerase chain reaction
EP1053348B1 (en) * 1998-02-04 2010-06-02 Life Technologies Corporation Determination of a genotype of an amplification product at multiple allelic sites
US6361942B1 (en) * 1998-03-24 2002-03-26 Boston Probes, Inc. Method, kits and compositions pertaining to detection complexes
US5952202A (en) * 1998-03-26 1999-09-14 The Perkin Elmer Corporation Methods using exogenous, internal controls and analogue blocks during nucleic acid amplification
US20020137904A1 (en) * 1998-03-27 2002-09-26 Patricia A. Billing-Medel Reagents and methods useful for detecting diseases of the gastrointestinal tract
EP1944310A3 (en) 2000-03-01 2008-08-06 Epoch Biosciences, Inc. Modified oligonucleotides for mismatch discrimination
US6127121A (en) * 1998-04-03 2000-10-03 Epoch Pharmaceuticals, Inc. Oligonucleotides containing pyrazolo[3,4-D]pyrimidines for hybridization and mismatch discrimination
JP2003525292A (en) 2000-03-01 2003-08-26 エポック・バイオサイエンシーズ・インコーポレイテッド Modified oligonucleotides for the mismatch discrimination
GB9808145D0 (en) * 1998-04-17 1998-06-17 Zeneca Ltd Assay
US20030203394A1 (en) * 1998-05-04 2003-10-30 Yoav Eichen Detection of a target in a sample
DE19822108A1 (en) * 1998-05-12 2000-02-03 Schering Ag A method for detecting microorganisms in products, particularly in pharmaceuticals and cosmetics
US6468743B1 (en) 1998-05-18 2002-10-22 Conagra Grocery Products Company PCR techniques for detecting microbial contaminants in foodstuffs
DE19824535A1 (en) 1998-06-03 1999-12-09 Roche Diagnostics Gmbh New rhodamine derivatives and their use
JP3437094B2 (en) 1998-07-03 2003-08-18 松下電器産業株式会社 Multi-wavelength fluorescence polarization
US20040203078A1 (en) * 1998-07-22 2004-10-14 National Institute Of Advanced Industrial Science And Technology Labeled complex, process for producing same and process for utilizing same
US6037130A (en) * 1998-07-28 2000-03-14 The Public Health Institute Of The City Of New York, Inc. Wavelength-shifting probes and primers and their use in assays and kits
WO2000025136A1 (en) * 1998-10-27 2000-05-04 Technion Research And Development Foundation Ltd. Method for gold deposition
US6492111B1 (en) * 1998-11-25 2002-12-10 Isis Pharmaceuticals, Inc. In situ binary synthesis of biologically effective molecules
WO2000034521A1 (en) * 1998-12-08 2000-06-15 Boston Probes, Inc. Methods, kits and compositions for the identification of nucleic acids electrostatically bound to matrices
US6432642B1 (en) * 1999-01-15 2002-08-13 Pe Corporation (Ny) Binary probe and clamp composition and methods for a target hybridization detection
DE19906169A1 (en) * 1999-02-08 2000-08-10 Bioinside Ges Fuer Biodiagnost A test kit and method for the quantitative detection of genetically modified DNA in foods using fluorescence-coupled PCR
US7141417B1 (en) 1999-02-25 2006-11-28 Thomas Jefferson University Compositions, kits, and methods relating to the human FEZ1 gene, a novel tumor suppressor gene
US20040248150A1 (en) * 1999-04-02 2004-12-09 Sharat Singh Methods employing oligonucleotide-binding e-tag probes
GB9908437D0 (en) * 1999-04-13 1999-06-09 Minton Treharne & Davies Limit Methods of marking materials
DE29906582U1 (en) * 1999-04-14 2000-09-21 Langenbach Guido Crash protection device
US20030235832A1 (en) * 2000-06-21 2003-12-25 Ahmed Chenna Multiplexed analysis by chromatographic separation of molecular tags
US6322980B1 (en) 1999-04-30 2001-11-27 Aclara Biosciences, Inc. Single nucleotide detection using degradation of a fluorescent sequence
US7771929B2 (en) * 2000-04-28 2010-08-10 Monogram Biosciences, Inc. Tag library compounds, compositions, kits and methods of use
US6514700B1 (en) * 1999-04-30 2003-02-04 Aclara Biosciences, Inc. Nucleic acid detection using degradation of a tagged sequence
US20040067498A1 (en) * 2000-04-28 2004-04-08 Ahmed Chenna Detection of nucleic acid sequences by cleavage and separation of tag-containing structures
US6180349B1 (en) 1999-05-18 2001-01-30 The Regents Of The University Of California Quantitative PCR method to enumerate DNA copy number
DE19923168A1 (en) 1999-05-20 2000-11-23 Roche Diagnostics Gmbh New fluorescent dyes and their use as fluorescent markers
US6277607B1 (en) 1999-05-24 2001-08-21 Sanjay Tyagi High specificity primers, amplification methods and kits
US7097973B1 (en) 1999-06-14 2006-08-29 Alpha Mos Method for monitoring molecular species within a medium
US7537886B1 (en) 1999-06-22 2009-05-26 Life Technologies Corporation Primers and methods for the detection and discrimination of nucleic acids
EP1194535A4 (en) * 1999-06-23 2004-03-10 Genesource Inc Non-destructive cell-based assay
US6750357B1 (en) 1999-06-25 2004-06-15 Syngen, Inc. Rhodamine-based fluorophores useful as labeling reagents
US6692834B1 (en) * 1999-06-28 2004-02-17 Medtronic, Inc. Method for coating implantable devices
US6830902B1 (en) * 1999-07-02 2004-12-14 Invitrogen Corporation Compositions and methods for enhanced sensitivity and specificity of nucleic acid synthesis
US6339147B1 (en) 1999-07-29 2002-01-15 Epoch Biosciences, Inc. Attachment of oligonucleotides to solid supports through Schiff base type linkages for capture and detection of nucleic acids
EP1214331B1 (en) * 1999-08-30 2006-10-11 Boehringer Mannheim Gmbh 2-azapurine compounds and their use
EP1088590B1 (en) 1999-09-29 2003-04-16 Tecan Trading AG Thermocycling device and hoisting element for microtitre plate
GB9923144D0 (en) * 1999-09-30 1999-12-01 Socrates Biotech International Methods
US20030082616A1 (en) * 1999-10-15 2003-05-01 Hitachi, Ltd. Apparatus and method for analyzing nucleic acids and related genetic abnormality
US6272939B1 (en) 1999-10-15 2001-08-14 Applera Corporation System and method for filling a substrate with a liquid sample
EP1230387B1 (en) * 1999-10-22 2006-08-16 The Public Health Research Institute of the City of New York, Inc. Assays for short sequence variants
US6528254B1 (en) 1999-10-29 2003-03-04 Stratagene Methods for detection of a target nucleic acid sequence
WO2001036442A9 (en) * 1999-11-17 2002-07-25 Jiuping Ji Simultaneous detection of hbv, hcv and hiv in plasma samples using a multiplex capture assay
US6660845B1 (en) * 1999-11-23 2003-12-09 Epoch Biosciences, Inc. Non-aggregating, non-quenching oligomers comprising nucleotide analogues; methods of synthesis and use thereof
US7205105B2 (en) * 1999-12-08 2007-04-17 Epoch Biosciences, Inc. Real-time linear detection probes: sensitive 5′-minor groove binder-containing probes for PCR analysis
US6727356B1 (en) 1999-12-08 2004-04-27 Epoch Pharmaceuticals, Inc. Fluorescent quenching detection reagents and methods
US20040081959A9 (en) * 1999-12-08 2004-04-29 Epoch Biosciences, Inc. Fluorescent quenching detection reagents and methods
US7250252B2 (en) * 1999-12-30 2007-07-31 David Aaron Katz Amplification based polymorphism detection
WO2001055438A1 (en) 2000-01-26 2001-08-02 University Of Cincinnati Detection of nucleic acid target sequences by electron paramagnetic resonance spectroscopy
DE10004147A1 (en) * 2000-01-31 2001-08-09 Gsf Forschungszentrum Umwelt Oligonucleotides for the amplification and qualitative and quantitative detection of bacterial 16S rRNA useful to determine bacterial contamination of foodstuffs, waters, and in clinical microbiology
US7169355B1 (en) * 2000-02-02 2007-01-30 Applera Corporation Apparatus and method for ejecting sample well trays
FI20000333A0 (en) * 2000-02-16 2000-02-16 Jussi Nurmi A homogeneous method for detecting a polynucleotide
US20030117705A1 (en) * 2000-02-25 2003-06-26 Cambridge Research & Instrumentation Inc. Fluorescence polarization assay system and method
EP1950313A3 (en) 2000-03-27 2010-12-08 GlaxoSmithKline LLC Detection of viable agents
US7998673B2 (en) * 2000-03-29 2011-08-16 Lgc Limited Hybridisation beacon and method of rapid sequence detection and discrimination
US7211381B1 (en) 2000-04-04 2007-05-01 Abbott Laboratories β2 andrenergic polymorphism detection
US6593092B2 (en) 2000-04-04 2003-07-15 Abbott Laboratories Beta 2 adrenergic polymorphism detection
WO2001090417A3 (en) * 2000-05-19 2003-08-07 Eragen Biosciences Inc Materials and methods for detection of nucleic acids
DE60137649D1 (en) * 2000-10-14 2009-03-26 Eragen Biosciences Inc Detection systems on solid carriers and methods for use of non-standard bases
US6887664B2 (en) 2000-06-06 2005-05-03 Applera Corporation Asynchronous primed PCR
US6719949B1 (en) * 2000-06-29 2004-04-13 Applera Corporation Apparatus and method for transporting sample well trays
GB0016836D0 (en) * 2000-07-07 2000-08-30 Lee Helen Improved dipstick assays (1)
WO2002004122B1 (en) * 2000-07-07 2003-08-07 Magda Anastassova Dineva Improved stability of hybridisation interactions in dipstick assays
WO2002029085A3 (en) * 2000-10-03 2004-06-24 Id & Plus Ltd Nucleotide detection method
US6350580B1 (en) 2000-10-11 2002-02-26 Stratagene Methods for detection of a target nucleic acid using a probe comprising secondary structure
JP2002369700A (en) * 2000-10-11 2002-12-24 Internatl Reagents Corp Method for analyzing nucleic acid
EP1334113A4 (en) * 2000-10-20 2007-08-08 Expression Diagnostics Inc Leukocyte expression profiling
JP2002125687A (en) * 2000-10-30 2002-05-08 Tosoh Corp Oligonucleotide for detecting hiv-1 and method for detecting the same
US7309573B2 (en) * 2000-11-21 2007-12-18 Stratagene California Methods for detection of a nucleic acid by sequential amplification
US7157232B2 (en) * 2000-12-13 2007-01-02 The Regents Of The University Of California Method to detect the end-point for PCR DNA amplification using an ionically labeled probe and measuring impedance change
US20020142336A1 (en) * 2001-02-02 2002-10-03 Genome Therapeutics Corporation Methods for determining a nucleotide at a specific location within a nucleic acid molecule
US7135291B2 (en) * 2001-02-15 2006-11-14 Takara Bio Inc. Method of detecting nucleotide polymorphism
EP1236804A1 (en) 2001-03-02 2002-09-04 Boehringer Mannheim Gmbh A method for determination of a nucleic acid using a control
US6713620B2 (en) * 2001-03-28 2004-03-30 Council Of Scientific And Industrial Research Oligonucleotide primers for phosphotidyl inositol in bacillus cereus
US7532920B1 (en) 2001-05-31 2009-05-12 Advanced Cardiovascular Systems, Inc. Guidewire with optical fiber
US7329223B1 (en) * 2001-05-31 2008-02-12 Abbott Cardiovascular Systems Inc. Catheter with optical fiber sensor
CA2348042A1 (en) 2001-06-04 2002-12-04 Ann Huletsky Sequences for detection and identification of methicillin-resistant staphylococcus aureus
US6825927B2 (en) * 2001-06-15 2004-11-30 Mj Research, Inc. Controller for a fluorometer
US6514750B2 (en) 2001-07-03 2003-02-04 Pe Corporation (Ny) PCR sample handling device
EP1275735A1 (en) * 2001-07-11 2003-01-15 F.Hoffmann-La Roche Ag Composition and method for hot start nucleic acid amplification
US7183052B2 (en) * 2001-07-17 2007-02-27 Stratagene California Methods for detection of a target nucleic acid using multi-subunit probes
US6852491B2 (en) 2001-09-04 2005-02-08 Abbott Laboratories Amplification and detection reagents for HIV-1
US6593091B2 (en) 2001-09-24 2003-07-15 Beckman Coulter, Inc. Oligonucleotide probes for detecting nucleic acids through changes in flourescence resonance energy transfer
WO2003033741A1 (en) * 2001-10-16 2003-04-24 Aclara Biosciences, Inc. Universal e-tag primer and probe compositions and methods
US6942836B2 (en) * 2001-10-16 2005-09-13 Applera Corporation System for filling substrate chambers with liquid
EP1442142A4 (en) 2001-10-19 2006-11-15 Proligo Llc Nucleic acid probes and methods to detect and/or quantify nucleic acid analytes
US20030165859A1 (en) * 2001-10-23 2003-09-04 Invitrogen Corporation Primers and methods for the detection and discrimination of nucleic acids
DE10153829A1 (en) * 2001-11-05 2003-05-28 Bayer Ag Assay based on doped nanoparticles
CN1166422C (en) * 2001-11-05 2004-09-15 北京源德生物医学工程股份有限公司 Holder for external high-energy focusing ultrasonic treating apparatus
US20050053939A1 (en) * 2001-11-09 2005-03-10 Ahmed Chenna Methods and compositions for enhancing detection in determinations employing cleavable electrophoretic tag reagents
EP1456409B1 (en) * 2001-11-28 2010-02-24 Bio-Rad Laboratories, Inc. Parallel polymorphism scoring by amplification and error correction
US7118910B2 (en) 2001-11-30 2006-10-10 Fluidigm Corporation Microfluidic device and methods of using same
US7198897B2 (en) * 2001-12-19 2007-04-03 Brandeis University Late-PCR
WO2003064679A3 (en) * 2002-01-30 2004-03-04 Id Biomedical Corp Methods for detecting vancomycin-resistant microorganisms and compositions therefor
EP1340818A1 (en) * 2002-02-27 2003-09-03 Epigenomics AG Method and nucleic acids for the analysis of a colon cell proliferative disorder
US7166478B2 (en) * 2002-03-12 2007-01-23 Enzo Life Sciences, Inc., C/O Enzo Biochem, Inc. Labeling reagents and labeled targets, target labeling processes and other processes for using same in nucleic acid determinations and analyses
US9261460B2 (en) 2002-03-12 2016-02-16 Enzo Life Sciences, Inc. Real-time nucleic acid detection processes and compositions
US9353405B2 (en) 2002-03-12 2016-05-31 Enzo Life Sciences, Inc. Optimized real time nucleic acid detection processes
JP4358637B2 (en) * 2002-03-14 2009-11-04 ジェノイド・ケーエフティー Amplification for the type detects the human papillomavirus - Hybridization methods
EP1498486A4 (en) * 2002-03-29 2005-08-03 Prec System Science Co Ltd Nucleic acid library and protein library
US7081339B2 (en) * 2002-04-12 2006-07-25 Primera Biosystems, Inc. Methods for variation detection
US7445893B2 (en) * 2002-04-12 2008-11-04 Primera Biosystems, Inc. Sampling method for amplification reaction analysis
US7745180B2 (en) 2002-04-24 2010-06-29 Hitachi Chemical Co., Ltd. Device and method for high-throughput quantification of mRNA from whole blood
US7220544B2 (en) 2002-05-08 2007-05-22 Arkray, Inc. Method for detecting target nucleic acid
US20030219754A1 (en) * 2002-05-23 2003-11-27 Oleksy Jerome E. Fluorescence polarization detection of nucleic acids
US20040096870A1 (en) * 2002-06-28 2004-05-20 Sention, Inc. Methods of detecting sequence differences
US6896727B2 (en) * 2002-06-28 2005-05-24 Seh America, Inc. Method of determining nitrogen concentration within a wafer
US20040023220A1 (en) * 2002-07-23 2004-02-05 Lawrence Greenfield Integrated method for PCR cleanup and oligonucleotide removal
FR2842827B1 (en) * 2002-07-26 2004-10-22 Biocortech NEW METHOD FOR ANALYZING NUCLEIC ACID AND ITS USE TO ASSESS THE DEGREE OF EDITING mRNA RECEIVER 5-HT2C
US7662553B2 (en) 2002-07-31 2010-02-16 University Of Southern California Polymorphisms in the ERCC1 gene for predicting treatment outcome
US7245789B2 (en) * 2002-10-07 2007-07-17 Vascular Imaging Corporation Systems and methods for minimally-invasive optical-acoustic imaging
US7807802B2 (en) 2002-11-12 2010-10-05 Abbott Lab Polynucleotides for the amplification and detection of Chlamydia trachomatis and Neisseria gonorrhoeae
CA2506129C (en) 2002-11-15 2015-02-17 Idenix (Cayman) Limited 2'-branched nucleosides and flaviviridae mutation
FI113549B (en) * 2002-11-19 2004-05-14 Mobidiag Oy A diagnostic method for detecting and identifying bacteria causing respiratory tract infections and a method useful in the primer mixture
US20050089875A1 (en) * 2002-11-21 2005-04-28 Sention Inc. Quantitative analysis of expression profiling information produced at various stages of an amplification process
WO2004048397A3 (en) * 2002-11-22 2004-07-01 Hoffmann La Roche Detectable labeled nucleoside analogs and methods of use thereof
US20040248085A1 (en) * 2002-11-29 2004-12-09 Sang-Wha Lee General primers and process for detecting diverse genotypes of human papillomavirus by PCR
EP2031070B1 (en) 2002-12-04 2013-07-17 Life Technologies Corporation Multiplex amplification of polynucleotides
EP1426447A1 (en) * 2002-12-06 2004-06-09 Boehringer Mannheim Gmbh Method for the detection of pathogenic gram positive bacteria selected from the genera Staphylococcus, Enterococcus and Streptococcus
CA2504911C (en) * 2002-12-06 2015-08-11 Innogenetics N.V. Detection, identification and differentiation of eubacterial taxa using a hybridization assay
US7718361B2 (en) 2002-12-06 2010-05-18 Roche Molecular Systems, Inc. Quantitative test for bacterial pathogens
CA2507240C (en) 2002-12-06 2011-05-24 F. Hoffmann-La Roche Ag Multiplex assay detection of pathogenic organisms
US8206904B2 (en) 2002-12-18 2012-06-26 Third Wave Technologies, Inc. Detection of nucleic acids
US7851150B2 (en) 2002-12-18 2010-12-14 Third Wave Technologies, Inc. Detection of small nucleic acids
EP2500440B1 (en) 2002-12-20 2015-12-16 Celera Corporation Genetic polymorphisms associated with myocardial infarction, methods of detection and uses thereof
WO2004065550A3 (en) * 2003-01-17 2004-12-23 Eragen Biosciences Inc Nucleic acid amplification using non-standard bases
EP1601955B1 (en) * 2003-03-07 2013-01-09 Luxcel Biosciences Limited An oxygen sensitive probe and method for measuring oxygen uptake
WO2004085670A3 (en) * 2003-03-24 2005-06-02 Jerome E Oleksy Polarization detection
US7820808B2 (en) 2003-04-01 2010-10-26 Eragen Biosciences, Inc. Polymerase inhibitor and method of using same
WO2004089810A3 (en) 2003-04-03 2005-07-07 Fluidigm Corp Microfluidic devices and methods of using same
EP1861512A4 (en) 2005-03-18 2009-12-09 Fluidigm Corp Thermal reaction device and method for using the same
US20040214176A1 (en) * 2003-04-22 2004-10-28 Osborne James C. Multiplexed DNA assays using structure-specific endonucleases
US7148043B2 (en) * 2003-05-08 2006-12-12 Bio-Rad Laboratories, Inc. Systems and methods for fluorescence detection with a movable detection module
ES2305808T3 (en) 2003-05-20 2008-11-01 Bayer Healthcare Llc Diarylureas with kinase inhibitory activity.
DE10327756B4 (en) * 2003-06-18 2005-12-29 november Aktiengesellschaft Gesellschaft für Molekulare Medizin A method for real-time quantification of a nucleic acid
US20060216715A1 (en) * 2004-06-28 2006-09-28 Jun Nakayama Method of detecting cancer
US20050233314A1 (en) * 2003-06-30 2005-10-20 National Health Research Institutes Sensitive and quantitative detection of pathogens by real-time nested PCR
US7745125B2 (en) 2004-06-28 2010-06-29 Roche Molecular Systems, Inc. 2′-terminator related pyrophosphorolysis activated polymerization
GB0317592D0 (en) * 2003-07-26 2003-08-27 Astrazeneca Ab Method
US7790372B2 (en) 2003-07-29 2010-09-07 Otsuka Pharmaceutical Co., Ltd. Method of judging risk for onset of drug-induced granulocytopenia
EP1502961B1 (en) * 2003-08-01 2010-09-08 Roche Diagnostics GmbH New detection format for hot start real time polymerase chain reaction
WO2005029041A3 (en) * 2003-09-19 2006-07-27 Applera Corp High density sequence detection methods and apparatus
US20070122811A1 (en) * 2003-09-30 2007-05-31 Philip Buzby Compositions and processes for genotyping single nucleotide polymorphisms
US7348146B2 (en) * 2003-10-02 2008-03-25 Epoch Biosciences, Inc. Single nucleotide polymorphism analysis of highly polymorphic target sequences
JP4887154B2 (en) 2003-10-21 2012-02-29 オリオン ゲノミクス エルエルシー The method of quantitative measurement of methylation density in Dna seat
EP1680666A4 (en) * 2003-10-27 2008-03-26 Monogram Biosciences Inc Detecting human anti-therapeutic antibodies
US7381818B2 (en) * 2003-10-28 2008-06-03 Epoch Biosciences, Inc. Fluorescent probes containing 5′-minor groove binder, fluorophore and quenching moieties and methods of use thereof
US20050261841A1 (en) * 2003-11-07 2005-11-24 Shepard Donald F Physical geolocation system
WO2005051967A3 (en) * 2003-11-19 2007-08-16 Allelogic Biosciences Corp Oligonucleotides labeled with a plurality of fluorophores
WO2005054435A3 (en) * 2003-11-26 2005-08-18 Elaine Best Methods and compositions for in vitro amplification of extrachromosomal nucleic acid
JP5649263B2 (en) 2003-11-26 2015-01-07 セレラ コーポレーション Cardiovascular disorders and drug related to response gene polymorphisms, their detection methods and uses
US7842794B2 (en) 2004-12-17 2010-11-30 Roche Molecular Systems, Inc. Reagents and methods for detecting Neisseria gonorrhoeae
US20050266554A1 (en) 2004-04-27 2005-12-01 D Amour Kevin A PDX1 expressing endoderm
US7704738B2 (en) 2003-12-23 2010-04-27 Cythera, Inc. Definitive endoderm
US7625753B2 (en) 2003-12-23 2009-12-01 Cythera, Inc. Expansion of definitive endoderm cells
US8647873B2 (en) 2004-04-27 2014-02-11 Viacyte, Inc. PDX1 expressing endoderm
US7985585B2 (en) 2004-07-09 2011-07-26 Viacyte, Inc. Preprimitive streak and mesendoderm cells
US7541185B2 (en) 2003-12-23 2009-06-02 Cythera, Inc. Methods for identifying factors for differentiating definitive endoderm
US20050208539A1 (en) * 2003-12-31 2005-09-22 Vann Charles S Quantitative amplification and detection of small numbers of target polynucleotides
WO2005067646A3 (en) 2004-01-07 2006-08-10 Hitachi Chemical Co Ltd Primers and probes for the detection of hiv
CA2553270C (en) * 2004-02-06 2016-08-23 Innogenetics N.V. Detection, identification and differentiation of proteus species using the spacer region
US7393665B2 (en) 2005-02-10 2008-07-01 Population Genetics Technologies Ltd Methods and compositions for tagging and identifying polynucleotides
JP2007525218A (en) * 2004-02-19 2007-09-06 ユニバーシティ・カレッジ・コークーナショナル・ユニバーシティ・オブ・アイルランド,コーク Detection of the biologically active compound
EP2208797A3 (en) 2004-03-01 2010-11-24 Applied Biosystems, LLC Methods, compositions and kits for use in polynucleotide amplification
US8679788B2 (en) 2004-03-22 2014-03-25 The Johns Hopkins University Methods for the detection of nucleic acid differences
KR100906749B1 (en) * 2004-03-25 2009-07-09 (주)바이오니아 Methods for Detecting Nucleic Acid Amplification Using Probe Labeled with Intercalating Dye
DE602005011943D1 (en) * 2004-04-08 2009-02-05 Sangamo Biosciences Inc Compositions for the treatment of neuropathic and neurodegenerative diseases
US7534775B2 (en) * 2004-04-08 2009-05-19 Sangamo Biosciences, Inc. Methods and compositions for modulating cardiac contractility
WO2005103249A1 (en) 2004-04-26 2005-11-03 Wako Pure Chemical Industries, Ltd. Probe and primer for tubercle bacillus detection, and method of detecting human tubercle bacillus therewith
CA2852855C (en) 2004-05-07 2016-07-05 Celera Corporation Genetic polymorphisms associated with liver fibrosis methods of detection and uses thereof
US20050255485A1 (en) * 2004-05-14 2005-11-17 Livak Kenneth J Detection of gene duplications
US7491662B2 (en) * 2004-05-17 2009-02-17 Hitachi Kokusai Electric Inc. Substrate processing apparatus
WO2005115115A3 (en) * 2004-05-25 2009-04-09 Hitachi Chemical Co Ltd Method of measuring cancer susceptibility
US20060030036A1 (en) * 2004-05-28 2006-02-09 Victor Joseph Chips for multiplex analyses
US7575863B2 (en) 2004-05-28 2009-08-18 Applied Biosystems, Llc Methods, compositions, and kits comprising linker probes for quantifying polynucleotides
US8415298B2 (en) 2004-06-21 2013-04-09 The Board Of Trustees Of The Leland Stanford Junior University Of Stanford Administration of FGF2 for treamtent of anxiety
EP1609871A1 (en) * 2004-06-21 2005-12-28 Biolytix AG Methods and kits for the detection, identification and quantification of bacteria and yeast in food and beverages
US7776530B2 (en) * 2004-06-29 2010-08-17 Wallac Oy Integrated nucleic acid analysis
US20090269737A1 (en) * 2004-06-29 2009-10-29 Wallac Oy Integrated non-homogeneous nucleic acid amplification and detection
US7399614B2 (en) * 2004-06-30 2008-07-15 Applera Corporation 5-methylcytosine detection, compositions and methods therefor
EP1776482A2 (en) * 2004-06-30 2007-04-25 Applera Corporation Log-linear amplification
US20060115827A1 (en) 2004-07-01 2006-06-01 University Of Southern California Genetic markers for predicting disease and treatment outcome
US20070009910A1 (en) * 2004-07-05 2007-01-11 Bureau Of Food And Drug Analysis, Department Of Health, Executive Yuan Primers, probes and reference plasmid for detection of meat adulteration
WO2006030826A1 (en) 2004-09-17 2006-03-23 Eisai R & D Management Co., Ltd. Medicinal composition
EP1791982B1 (en) * 2004-09-21 2011-01-05 Life Technologies Corporation TWO-COLOR REAL-TIME/END-POINT QUANTITATION OF MICRORNAS (MIRNAs)
ES2393302T3 (en) * 2004-09-30 2012-12-20 Innogenetics N.V. Detection, identification and differentiation of the species Serratia using the intergenic region
US7166680B2 (en) * 2004-10-06 2007-01-23 Advanced Cardiovascular Systems, Inc. Blends of poly(ester amide) polymers
CA2584576C (en) * 2004-10-18 2015-12-08 Brandeis University Reagents and methods for improving reproducibility and reducing mispriming in pcr amplification
KR101424812B1 (en) 2004-10-18 2014-08-07 브랜데이스 유니버시티 Primers, probes and methods for nucleic acid amplification
US20060147954A1 (en) * 2004-10-19 2006-07-06 Wallac Oy Novel probe and its use in bioaffinity assays
WO2006045053A3 (en) * 2004-10-20 2007-05-18 Hitachi Chemical Co Ltd Method for tailoring administration of drugs by quantitation of mrna
EP2316927B1 (en) 2004-10-21 2014-11-05 Helmholtz Zentrum München Deutsches Forschungszentrum für Gesundheit und Umwelt (GmbH) Kaspp (lrrk2) gene, its production and use for the detection and treatment of neurodegenerative disorders
CN100441696C (en) * 2004-10-22 2008-12-10 中国疾病预防控制中心传染病预防控制所 Method for detecting enterohemorrhagic Escherichia coli O157:H7 strain
EP1805318B1 (en) 2004-10-27 2014-09-03 Cepheid Closed-system multi-stage nucleic acid amplification reactions
EP2354228A8 (en) 2004-10-28 2012-03-14 Otsuka Pharmaceutical Co., Ltd. Identification marker responsive to interferon therapy for renal cell cancer
EP1815016B1 (en) 2004-11-01 2012-06-27 George Mason University Compositions and methods for diagnosing colon disorders
US20060275792A1 (en) * 2004-11-15 2006-12-07 Lee Jun E Enhancement of nucleic acid amplification using double-stranded DNA binding proteins
US20060105348A1 (en) * 2004-11-15 2006-05-18 Lee Jun E Compositions and methods for the detection and discrimination of nucleic acids
EP1666150B1 (en) 2004-11-20 2015-01-07 Roche Diagnostics GmbH Nucleic acid preparation
EP1829964A4 (en) * 2004-12-08 2009-03-04 Takeshi Yamamoto Method of examining gene sequence
WO2006063093A3 (en) * 2004-12-08 2006-11-30 Cedars Sinai Medical Center Methods for diagnosis and treatment of crohn's disease
US20060252032A1 (en) * 2005-01-28 2006-11-09 Third Wave Technologies, Inc. Detection of human herpesviruses
EP2314614B1 (en) * 2005-02-28 2015-11-25 Sangamo BioSciences, Inc. Anti-angiogenic methods and compositions
US7521188B2 (en) * 2005-03-02 2009-04-21 The Regents Of The University Of Michigan Optical monitoring of cleaving enzyme activity
WO2006099365A9 (en) 2005-03-11 2009-05-14 Applera Corp Genetic polymorphisms associated with coronary heart disease, methods of detection and uses thereof
US20070026423A1 (en) * 2005-03-16 2007-02-01 Thomas Koehler Method and test kit for the detection of target nucleic acids
US7776567B2 (en) * 2005-03-17 2010-08-17 Biotium, Inc. Dimeric and trimeric nucleic acid dyes, and associated systems and methods
US7601498B2 (en) * 2005-03-17 2009-10-13 Biotium, Inc. Methods of using dyes in association with nucleic acid staining or detection and associated technology
US7498136B2 (en) * 2005-03-18 2009-03-03 Eragen Biosciences, Inc. Methods for detecting multiple species and subspecies of Neisseria
EP1710016A3 (en) 2005-03-30 2011-03-30 Roche Diagnostics GmbH Device having a self sealing fluid port
GB0506807D0 (en) 2005-04-04 2005-05-11 Dxs Ltd Polynucleotide primers
EP1888089B9 (en) * 2005-04-28 2012-08-08 Hitachi Chemical Research Center, Inc. Ex vivo gene expression in whole blood as a model of assessment of individual variation to dietary supplements
CA2607369A1 (en) * 2005-05-02 2006-11-09 Stratagene California Oligonucleotide probe/primer compositions and methods for polynucleotide detection
WO2006122295A3 (en) * 2005-05-11 2009-04-16 Expression Diagnostics Inc Methods of monitoring functional status of transplants using gene panels
EP2623596B1 (en) 2005-05-13 2014-10-08 Wako Pure Chemical Industries, Ltd. Primer and probe for use in detection of Mycobacterium kansasii and method for detection of Mycobacterium kansasii using the same
US7569695B2 (en) * 2005-05-24 2009-08-04 Enzo Life Sciences, Inc. Dyes for the detection or quantification of desirable target molecules
US8357801B2 (en) 2005-05-24 2013-01-22 Enzo Life Sciences, Inc. Labeling of target molecules, identification of organelles and other applications, novel compositions, methods and kits
US8362250B2 (en) 2005-05-24 2013-01-29 Enzo Biochem, Inc. Fluorescent dyes and compounds, methods and kits useful for identifying specific organelles and regions in cells of interest
US7737281B2 (en) * 2005-05-24 2010-06-15 Enzo Life Sciences, Inc. C/O Enzo Biochem, Inc. Purine based fluorescent dyes
EP1893777B1 (en) * 2005-06-07 2014-10-01 Luminex Corporation Methods for detection and typing of nucleic acids
CN101194027B (en) * 2005-06-08 2012-10-24 日立化成工业株式会社 Method for predicting immune response to neoplastic disease based on mRNA expression profile in neoplastic cells and stimulated leukocytes
WO2006135765A1 (en) * 2005-06-09 2006-12-21 Epoch Biosciences, Inc. Improved primer-based amplification methods
US7884260B2 (en) * 2005-06-14 2011-02-08 University Of Chicago Cell-based screen for agents useful for reducing neuronal demyelination or promoting neuronal remyelination
US7423194B2 (en) * 2005-06-14 2008-09-09 University Of Chicago Animal models for demyelination disorders
US8053627B2 (en) * 2005-06-14 2011-11-08 University Of Chicago Methods for treating demyelination disorders
EP1951900B1 (en) 2005-10-07 2016-06-15 Callida Genomics, Inc. Self-assembled single molecule arrays and uses thereof
EP2620510B1 (en) 2005-06-15 2016-10-12 Complete Genomics Inc. Single molecule arrays for genetic and chemical analysis
US20060292577A1 (en) * 2005-06-27 2006-12-28 Purdue Research Foundation Neoplasia-specific splice variants and methods
WO2007008693B1 (en) * 2005-07-09 2007-08-09 Steven A Belinsky Gene methylation as a biomarker in sputum
US20070020671A1 (en) * 2005-07-12 2007-01-25 Radtkey Ray R Method for detecting large mutations and duplications using control amplification comparisons to paralogous genes
US7977108B2 (en) * 2005-07-25 2011-07-12 Roche Molecular Systems, Inc. Method for detecting a mutation in a repetitive nucleic acid sequence
CN101448953B (en) * 2005-07-26 2014-05-07 新泽西医学与牙科大学 Assays for resistance to echinocandin-class drugs
JP4989476B2 (en) 2005-08-02 2012-08-01 エーザイ・アール・アンド・ディー・マネジメント株式会社 How to test the effect of angiogenesis inhibitors
WO2007019410A3 (en) * 2005-08-05 2007-11-15 Univ Leland Stanford Junior Mammalian obestatin receptors
EP1760465B1 (en) 2005-09-06 2010-06-23 Roche Diagnostics GmbH Device with a compressible matrix having a homogeneous flow profile
US7799530B2 (en) 2005-09-23 2010-09-21 Celera Corporation Genetic polymorphisms associated with cardiovascular disorders and drug response, methods of detection and uses thereof
ES2371088T3 (en) * 2005-10-05 2011-12-27 F. Hoffmann-La Roche Ag Non-fluorescent energy transfer.
US7838221B2 (en) 2005-10-11 2010-11-23 Geneohm Sciences, Inc. Sequences for detection and identification of methicillin-resistant Staphylococcus aureus (MRSA)
US8831887B2 (en) * 2005-10-12 2014-09-09 The Research Foundation For The State University Of New York Absolute PCR quantification
US20070084706A1 (en) * 2005-10-18 2007-04-19 Shuichi Takayama Microfluidic cell culture device and method for using same
US20070092904A1 (en) * 2005-10-19 2007-04-26 Biogen Idec Ma Inc. Method for preparing limiting quantities of nucleic acids
CA2528222A1 (en) * 2005-10-31 2007-04-30 Centre For Addiction And Mental Health Slc1a1 marker for anxiety disorder
RU2008123008A (en) * 2005-11-07 2009-12-20 Сименс Хелткэа Дайагностикс Инк. (Us) Specific oligonucleotide sequences chlamydia trachomatis
EP2564864B8 (en) 2005-11-12 2015-05-13 The Board of Trustees of The Leland Stanford Junior University FGF2-related methods for diagnosing and treating depression
WO2007059007A3 (en) 2005-11-14 2007-08-30 Cythera Inc Markers of definitive endoderm
WO2007120208A3 (en) * 2005-11-14 2008-08-28 George M Church Nanogrid rolling circle dna sequencing
CN103710429B (en) 2005-11-29 2016-03-30 剑桥企业有限公司 Breast cancer markers
EP1798542A1 (en) 2005-12-19 2007-06-20 Roche Diagnostics GmbH Analytical method and instrument
EP1798650A1 (en) 2005-12-19 2007-06-20 Roche Diagnostics GmbH Analytical method and instrument
KR100652903B1 (en) * 2005-12-21 2006-11-24 한국과학기술연구원 Manufacturing method of dehumidifying agent having superabsorbing polymer and manufacturing apparatus thereof
EP1994171B1 (en) 2006-01-17 2015-03-11 Somalogic, Inc. Multiplexed analyses of test samples
JP2009525732A (en) * 2006-02-06 2009-07-16 オーフス ユニバーシティAarhus Universitet Health characteristics of the breast
WO2007092538A3 (en) * 2006-02-07 2008-12-11 Harvard College Methods for making nucleotide probes for sequencing and synthesis
US20090181386A1 (en) * 2006-02-08 2009-07-16 Kvaegavlsforeningen Dansire Calving Characteristics
CA2644475A1 (en) * 2006-03-01 2007-09-07 Perlegen Sciences, Inc. Markers for addiction
WO2007105673A1 (en) 2006-03-13 2007-09-20 Wako Pure Chemical Industries, Ltd. Method for detection of mutant gene
RU2394915C2 (en) * 2006-03-24 2010-07-20 Александр Борисович Четверин Non-contact methods of detecting molecular colonies, sets of reagents and device for realising said methods
US20090311684A1 (en) * 2006-04-07 2009-12-17 Hitachi Chemical Co., Ltd Enhanced fc receptor-mediated tumor necrosis factor superfamily and chemokine mrna expression in peripheral blood leukocytes in patients with rheumatoid arthritis
CA2648580A1 (en) * 2006-04-07 2008-05-02 Xdx, Inc. Steroid responsive nucleic acid expression and prediction of disease activity
EP2005175B1 (en) * 2006-04-07 2011-07-27 Hitachi Chemical Company, Ltd. Enhanced t cell receptor-mediated tumor necrosis factor superfamily and chemokine mrna expression in peripheral blood leukocytes in patients with crohn's disease
US20070264694A1 (en) * 2006-04-07 2007-11-15 Eragen Biosciences, Inc. Use of non-standard bases and proximity effects for gene assembly and conversion of non-standard bases to standard bases during dna synthesis
EP2021510A2 (en) * 2006-04-28 2009-02-11 Biogen Idec MA Inc. Composition and methods for the detection of cripto-3
WO2007127454A3 (en) 2006-04-28 2008-04-10 Cythera Inc Hepatocyte lineage cells
EP2021488A4 (en) 2006-04-28 2010-04-07 Igor Kutyavin Use of base-modified deoxynucleoside triphosphates to improve nucleic acid detection
WO2007127999A3 (en) * 2006-04-28 2008-12-11 Igor Kutyavin Use of products of pcr amplification carrying elements of secondary structure to improve pcr-based nucleic acid detection
US8900828B2 (en) 2006-05-01 2014-12-02 Cepheid Methods and apparatus for sequential amplification reactions
EP2011871A4 (en) 2006-05-02 2010-01-27 Wako Pure Chem Ind Ltd Primer and probe for detection of mycobacterium intracellulare, and method for detection of mycobacterium intracellulare by using the primer and probe
US20090298071A1 (en) * 2006-05-08 2009-12-03 Masato Mitsuhashi Method for testing drug sensitivity in solid tumors by quantifying mrna expression in thinly-sliced tumor tissue
US20070264639A1 (en) * 2006-05-10 2007-11-15 Sigma Aldrich, Co. Identification of Echinacea and its imposters using genetic variations
US20070264638A1 (en) * 2006-05-10 2007-11-15 Sigma-Aldrich Co. Identification of ginseng and its imposters using genetic variations
WO2008070198A3 (en) 2006-05-17 2009-04-16 California Inst Of Techn Thermal cycling system
US8232091B2 (en) * 2006-05-17 2012-07-31 California Institute Of Technology Thermal cycling system
WO2007136103A1 (en) 2006-05-18 2007-11-29 Eisai R & D Management Co., Ltd. Antitumor agent for thyroid cancer
US7674924B2 (en) * 2006-05-22 2010-03-09 Third Wave Technologies, Inc. Compositions, probes, and conjugates and uses thereof
US7759062B2 (en) * 2006-06-09 2010-07-20 Third Wave Technologies, Inc. T-structure invasive cleavage assays, consistent nucleic acid dispensing, and low level target nucleic acid detection
US8119352B2 (en) * 2006-06-20 2012-02-21 Cepheld Multi-stage amplification reactions by control of sequence replication times
EP1886727A1 (en) 2006-07-14 2008-02-13 Roche Diagnostics GmbH Analytical device
CN101506384B (en) 2006-07-17 2014-01-29 布兰迪斯大学 Specialized oligonucleotides and their use in nucleic acid amplification and detection
US7772390B1 (en) 2006-07-18 2010-08-10 The Regents Of The University Of California Lipid mediated nucleic acid synthesis
WO2008019319A3 (en) * 2006-08-04 2008-10-16 Ikonisys Inc Improved slide holder for staining procedures
US8076067B2 (en) * 2006-08-15 2011-12-13 Genetag Technology, Inc. Probe-antiprobe compositions and methods for DNA or RNA detection
KR101472600B1 (en) 2006-08-28 2014-12-15 에자이 알앤드디 매니지먼트 가부시키가이샤 Antitumor agent for undifferentiated gastric cancer
EP2069788B1 (en) 2006-10-05 2017-03-01 Massachusetts Institute of Technology Multifunctional encoded particles for high-throughput analysis
EP2084297A4 (en) 2006-10-20 2010-10-20 Celera Corp Genetic polymorphisms associated with venous thrombosis, methods of detection and uses thereof
GB0621864D0 (en) 2006-11-02 2006-12-13 Univ Manchester Assay for fungal infection
US20080131880A1 (en) * 2006-11-22 2008-06-05 Bortolin Laura T PNA-DNA oligomers and methods of use thereof
US8133701B2 (en) * 2006-12-05 2012-03-13 Sequenom, Inc. Detection and quantification of biomolecules using mass spectrometry
US7902345B2 (en) 2006-12-05 2011-03-08 Sequenom, Inc. Detection and quantification of biomolecules using mass spectrometry
WO2008076375A8 (en) * 2006-12-13 2009-07-30 Autogenomics Inc Concurrent analysis of multiple patient samples using solid phase addressable multiplex test with high signal-to-noise ratio
EP2107114B1 (en) 2006-12-18 2011-08-31 Wako Pure Chemical Industries, Ltd. Primer and probe for detection of mycobacterium avium and method for detection of mycobacterium avium by using the primer or probe
WO2008140612A3 (en) 2006-12-19 2009-05-07 Geneohm Sciences Inc Detection of staphylococcus aureus and identification of methicillin-resistant staphylococcus aureus
ES2371723T3 (en) 2006-12-20 2012-01-09 Bayer Healthcare, Llc 4- {4 - [({3-tert-butyl-1- [3- (hydroxymethyl) phenyl] -1H-pyrazol-5-yl} carbamoyl) amino] -3-chlorophenoxy} -N-methylpyridine-2-carboxamide as a VEGFR kinase inhibitor for cancer treatment.
EP2118310B1 (en) * 2006-12-29 2013-03-06 Applied Biosystems, LLC Systems and methods for detecting nucleic acids
CN101978070A (en) * 2006-12-29 2011-02-16 应用生物系统公司 Systems and methods for detecting nucleic acids
US8435752B2 (en) * 2007-01-18 2013-05-07 University Of Southern California Gene polymorphisms predictive for dual TKI therapy
JP2010516281A (en) * 2007-01-22 2010-05-20 ウェハージェン,インコーポレイテッド High-throughput chemical reaction device
JP5319306B2 (en) 2007-01-29 2013-10-16 エーザイ・アール・アンド・ディー・マネジメント株式会社 Undifferentiated gastric cancer therapeutic composition
WO2008094678A3 (en) 2007-01-31 2008-11-20 Applera Corp A molecular prognostic signature for predicting breast cancer distant metastasis, and uses thereof
WO2008092213A1 (en) 2007-02-02 2008-08-07 Genera Biosystems Pty Ltd Generation of nucleic acid molecules
WO2008098142A3 (en) 2007-02-08 2008-11-27 Sequenom Inc Nucleic acid-based tests for rhd typing, gender determination and nucleic acid quantification
US20100021917A1 (en) * 2007-02-14 2010-01-28 Cedars-Sinai Medical Center Methods of using genes and genetic variants to predict or diagnose inflammatory bowel disease
WO2008106451A3 (en) * 2007-02-26 2008-11-06 Cedars Sinai Medical Center Methods of using single nucleotide polymorphisms in the tl1a gene to predict or diagnose inflammatory bowel disease
GB0703996D0 (en) * 2007-03-01 2007-04-11 Oxitec Ltd Nucleic acid detection
GB0703997D0 (en) * 2007-03-01 2007-04-11 Oxitec Ltd Methods for detecting nucleic sequences
DE102007013099A1 (en) 2007-03-14 2008-09-18 Aj Innuscreen Gmbh The method and test kit for rapid detection of specific nucleic acid sequences, in particular for the detection of mutations or SNPs
WO2008116150A3 (en) 2007-03-21 2008-11-13 Cedars Sinai Medical Center Ileal pouch-anal anastomosis (ipaa) factors in the treatment of inflammatory bowel disease
EP2140031A4 (en) 2007-03-26 2011-04-20 Sequenom Inc Restriction endonuclease enhanced polymorphic sequence detection
EP2385119B1 (en) 2007-04-06 2015-11-11 Janssen Diagnostics BVBA Respiratory syncytial virus (RSV) viral load detection assay
JP5619602B2 (en) * 2007-04-13 2014-11-05 アボツト・モレキユラー・インコーポレイテツド Primer and probe sequences for detection of Chlamydia trachomatis
EP2150625B1 (en) 2007-04-19 2013-03-20 Molecular Detection Inc. Methods, compositions and kits for detection and analysis of antibiotic-resistant bacteria
WO2008134569A3 (en) * 2007-04-26 2009-02-26 Cedars Sinai Medical Center Diagnosis and treatment of inflammatory bowel disease in the puerto rican population
CA2686337A1 (en) * 2007-05-04 2008-11-13 Myconostica Ltd. Detecting triazole resistance in aspergillus
US20100144903A1 (en) * 2007-05-04 2010-06-10 Cedars-Sinai Medical Center Methods of diagnosis and treatment of crohn's disease
CA2688225C (en) 2007-05-31 2017-09-26 Yale University A genetic lesion associated with cancer
US9271455B2 (en) * 2007-05-31 2016-03-01 Monsanto Technology Llc Soybean polymorphisms and methods of genotyping
CN103710458A (en) 2007-06-08 2014-04-09 比奥根艾迪克Ma公司 Biomarkers for predicting anti-TNF responsiveness or non-responsiveness
DE102007029772B4 (en) 2007-06-22 2011-12-08 Aj Innuscreen Gmbh Method and rapid test for the detection of specific nucleic acid sequences
WO2009031054A3 (en) 2007-06-29 2009-12-17 Population Genetics Technologies Ltd. Methods and compositions for isolating nucleic acid sequence variants
EP2336314A1 (en) 2007-07-17 2011-06-22 Somalogic, Inc. Improved selex and photoselex
US20090181366A1 (en) * 2007-07-30 2009-07-16 Quest Diagnostics Investments Incorporated Internal positive control for nucleic acid assays
EP2913398B1 (en) 2007-08-27 2017-07-12 Life Technologies Corporation Methods for PCR
EP2183392A2 (en) 2007-08-29 2010-05-12 Monsanto Technology LLC Methods and compositions for breeding for preferred traits
EP2195452B1 (en) 2007-08-29 2012-03-14 Sequenom, Inc. Methods and compositions for universal size-specific polymerase chain reaction
DE102007041864B4 (en) 2007-09-04 2012-05-03 Sirs-Lab Gmbh A method for the detection of bacteria and fungi
ES2380844T3 (en) 2007-09-07 2012-05-18 Fluidigm Corporation Determining the copy-number variation, methods and systems
US7695963B2 (en) 2007-09-24 2010-04-13 Cythera, Inc. Methods for increasing definitive endoderm production
GB0719034D0 (en) 2007-09-28 2007-11-07 Dxs Ltd Polynucleotide primers
JP2011501965A (en) * 2007-10-30 2011-01-20 コンプリート・ゲノミックス・インコーポレーテッド Apparatus for high throughput sequencing of a nucleic acid
US8039212B2 (en) 2007-11-05 2011-10-18 Celera Corporation Genetic polymorphisms associated with liver fibrosis, methods of detection and uses thereof
CA2705213C (en) * 2007-11-07 2016-10-04 The University Of British Columbia Microfluidic device and method of using same
WO2009060945A1 (en) 2007-11-09 2009-05-14 Eisai R & D Management Co., Ltd. Combination of anti-angiogenic substance and anti-tumor platinum complex
CA2706444C (en) 2007-11-27 2017-06-06 Bio-Rad Laboratories, Inc. Reduced inhibition of one-step rt-pcr
CN102016579B (en) 2007-11-30 2015-04-08 健泰科生物技术公司 VEGF polymorphisms and anti-angiogenesis therapy
US9551026B2 (en) 2007-12-03 2017-01-24 Complete Genomincs, Inc. Method for nucleic acid detection using voltage enhancement
US20090197254A1 (en) * 2007-12-14 2009-08-06 Ming-Chou Lee Variant scorpion primers for nucleic acid amplification and detection
US20090186344A1 (en) * 2008-01-23 2009-07-23 Caliper Life Sciences, Inc. Devices and methods for detecting and quantitating nucleic acids using size separation of amplicons
US20100323365A1 (en) 2008-02-08 2010-12-23 Tomokazu Ishikawa Primer and probe for detecting chlamydophila caviae, as well as a chlamydophila caviae detection method using the same
WO2009103003A3 (en) * 2008-02-15 2009-12-30 Bio-Rad Laboratories, Inc. Scanning fluorescent reader with diffuser system
KR20110011600A (en) * 2008-02-20 2011-02-08 이와키, 코수케, 켄 Detection of polyomavirus
US20090221620A1 (en) 2008-02-20 2009-09-03 Celera Corporation Gentic polymorphisms associated with stroke, methods of detection and uses thereof
US20090215064A1 (en) * 2008-02-27 2009-08-27 Hitachi Chemical Co., Ltd. Quantitative assessment of individual cancer susceptibility by measuring dna damage-induced mrna in whole blood
WO2009114543A3 (en) * 2008-03-11 2010-04-15 Sequenom, Inc. Nucleic acid-based tests for prenatal gender determination
WO2009120808A3 (en) 2008-03-26 2010-03-04 Sequenom, Inc. Restriction endonuclease enhanced polymorphic sequence detection
US8206925B2 (en) * 2008-04-14 2012-06-26 Medical Diagnostic Laboratories, Llc Splice variants of human IL-23 receptor (IL-23R) mRNA and use of a delta 9 isoform in predicting inflammatory bowel diseases
US9249455B2 (en) * 2008-04-18 2016-02-02 Luminex Corporation Methods for detection and quantification of small RNA
EP2271201B1 (en) 2008-04-24 2014-07-09 Monsanto Technology LLC A method to identify asian soybean rust resistance quantitative trait loci in soybean and compositions thereof
CA2722541C (en) 2008-04-30 2017-01-10 Integrated Dna Technologies, Inc. Rnase h-based assays utilizing modified rna monomers
US8911948B2 (en) * 2008-04-30 2014-12-16 Integrated Dna Technologies, Inc. RNase H-based assays utilizing modified RNA monomers
EP2853594B1 (en) 2008-05-28 2017-10-25 Wako Pure Chemical Industries, Ltd. Primer and probe for detection of Mycobacterium intracellulare, and method for detection of Mycobacterium intracellulare using the primer or the probe
US8208909B2 (en) 2008-06-02 2012-06-26 West Corporation System, apparatus and method for availing a mobile call of address information
EP2133434A1 (en) 2008-06-12 2009-12-16 Institut National de la Santé et de la Recherche Médicale (INSERM) Method for the detection of target nucleic acid
EP2294221B1 (en) * 2008-06-13 2015-12-16 National University of Ireland, Galway Ace2 as a target gene for the molecular identification of yeast and fungal species
JP2011522552A (en) * 2008-06-13 2011-08-04 リボックス・ゲーエムベーハー Method for the enzymatic synthesis of chemically modified rna
EP2141246A1 (en) 2008-07-01 2010-01-06 Philips Electronics N.V. Separation-free methods of PCR detection using SERRS
EP2733222A1 (en) 2008-07-09 2014-05-21 Celera Corporation Genetic polymorphisms associated with cardiovascular diseases, methods of detection and uses thereof
EP2147981A1 (en) 2008-07-25 2010-01-27 Biotype AG Kit and method for evaluating detection properties in amplification reactions
CA2638458A1 (en) * 2008-07-31 2010-01-31 Spartan Bioscience Inc. Thermal recycling by positioning relative to fixed-temperature source
US9250249B2 (en) 2008-09-08 2016-02-02 Enzo Biochem, Inc. Autophagy and phospholipidosis pathway assays
US9334281B2 (en) * 2008-09-08 2016-05-10 Enzo Life Sciences, Inc. Fluorochromes for organelle tracing and multi-color imaging
WO2010030716A1 (en) * 2008-09-10 2010-03-18 Igor Kutyavin Detection of nucleic acids by oligonucleotide probes cleaved in presence of endonuclease v
US8962247B2 (en) * 2008-09-16 2015-02-24 Sequenom, Inc. Processes and compositions for methylation-based enrichment of fetal nucleic acid from a maternal sample useful for non invasive prenatal diagnoses
US8476013B2 (en) * 2008-09-16 2013-07-02 Sequenom, Inc. Processes and compositions for methylation-based acid enrichment of fetal nucleic acid from a maternal sample useful for non-invasive prenatal diagnoses
WO2010039931A3 (en) * 2008-10-01 2010-06-03 Cedars-Sinai Medical Center Methods of using il17rd and il23-il17 pathway genes to diagnose crohn's disease
CA2740913C (en) 2008-10-20 2015-02-10 F. Hoffmann-La Roche Ag Improved allele-specific amplification
US20110189685A1 (en) * 2008-10-22 2011-08-04 Cedars-Sinai Medical Center Methods of using jak3 genetic variants to diagnose and predict crohn's disease
US8278041B2 (en) * 2008-10-27 2012-10-02 Infraegis, Inc. Compositions and methods for detecting food-borne pathogens
CA2740242A1 (en) 2008-11-05 2010-05-14 Genentech, Inc. Genetic polymorphisms in age-related macular degeneration
US9528160B2 (en) 2008-11-07 2016-12-27 Adaptive Biotechnolgies Corp. Rare clonotypes and uses thereof
GB2483810B (en) 2008-11-07 2012-09-05 Sequenta Inc Methods for correlating clonotypes with diseases in a population
US8628927B2 (en) 2008-11-07 2014-01-14 Sequenta, Inc. Monitoring health and disease status using clonotype profiles
US9506119B2 (en) 2008-11-07 2016-11-29 Adaptive Biotechnologies Corp. Method of sequence determination using sequence tags
US9394567B2 (en) 2008-11-07 2016-07-19 Adaptive Biotechnologies Corporation Detection and quantification of sample contamination in immune repertoire analysis
US9365901B2 (en) 2008-11-07 2016-06-14 Adaptive Biotechnologies Corp. Monitoring immunoglobulin heavy chain evolution in B-cell acute lymphoblastic leukemia
US8748103B2 (en) 2008-11-07 2014-06-10 Sequenta, Inc. Monitoring health and disease status using clonotype profiles
EP2463385B1 (en) 2008-11-13 2014-08-27 RiboxX GmbH Kit for RNA detection
US20110229471A1 (en) * 2008-11-26 2011-09-22 Cedars-Sinai Medical Center Methods of determining responsiveness to anti-tnf alpha therapy in inflammatory bowel disease
WO2010067055A1 (en) 2008-12-09 2010-06-17 Oxitec Ltd. Enhanced taqman probe based amplification
WO2010075579A3 (en) 2008-12-24 2010-10-14 Cedars-Sinai Medical Center Methods of predicting medically refractive ulcerative colitis (mr-uc) requiring colectomy
US7989214B2 (en) * 2008-12-29 2011-08-02 Stmicroelectronics S.R.L. Self-sealing microreactor and method for carrying out a reaction
US8206929B2 (en) 2009-01-07 2012-06-26 Roche Molecular Systems, Inc. Nucleic acid amplification with allele-specific suppression of sequence variants
EP2379753B1 (en) 2009-01-13 2016-12-28 Fluidigm Corporation Single-cell nucleic acid analysis
US20100285473A1 (en) 2009-01-27 2010-11-11 John Wolff Thermophilic helicase dependent amplification technology with endpoint homogenous fluorescent detection
US20120028254A1 (en) 2009-02-06 2012-02-02 Weidhaas Joanne B SNP Marker of Breast and Ovarian Cancer Risk
US8039215B2 (en) 2009-03-10 2011-10-18 Roche Molecular Systems, Inc. Multiplex quantitative nucleic acid amplification and melting assay
EP2703501A1 (en) 2009-03-12 2014-03-05 Brandeis University Reagents and Methods for PCR
WO2010107946A3 (en) * 2009-03-18 2011-02-24 Sequenom, Inc. Use of thermostable endonucleases for generating reporter molecules
WO2010112033A3 (en) 2009-03-31 2011-01-06 Østjysk Innovation A/S Method for estimating the risk of having or developing multiple sclerosis using sequence polymorphisms in a specific region of chromosome x
EP2789694A1 (en) 2009-04-02 2014-10-15 Fluidigm Corporation Microfluidic device with reaction product recovery system
EP2414504A4 (en) 2009-04-03 2013-08-28 Illumina Inc Devices and methods for heating biological samples
WO2010123625A1 (en) 2009-04-24 2010-10-28 University Of Southern California Cd133 polymorphisms predict clinical outcome in patients with cancer
EP2256215A1 (en) 2009-04-30 2010-12-01 Steffen Mergemeier Assay system using a nuclease activity of a nucleic acid polymerase
EP2248915B1 (en) * 2009-05-05 2013-09-18 Qiagen GmbH Detection of multiple nucleic acid sequences in a reaction cartridge
US20100299773A1 (en) * 2009-05-20 2010-11-25 Monsanto Technology Llc Methods and compositions for selecting an improved plant
WO2010133972A1 (en) 2009-05-22 2010-11-25 Population Genetics Technologies Ltd Sorting asymmetrically tagged nucleic acids by selective primer extension
EP2267153A1 (en) 2009-05-26 2010-12-29 Universite Claude Bernard Lyon 1 Identification of netrin-1 receptor unc5c gene mutation in solid cancers
WO2010138796A3 (en) * 2009-05-29 2011-04-21 Genomind, Llc Methods for assessment and treatment of depression via utilization of single nucleotide polymorphisms analysis
US20110237537A1 (en) * 2009-05-29 2011-09-29 Lombard Jay L Methods for assessment and treatment of mood disorders via single nucleotide polymorphisms analysis
US8776573B2 (en) 2009-05-29 2014-07-15 Life Technologies Corporation Methods and apparatus for measuring analytes
US20120261274A1 (en) 2009-05-29 2012-10-18 Life Technologies Corporation Methods and apparatus for measuring analytes
GB0909333D0 (en) 2009-06-01 2009-07-15 Fu Guoliang Multiplex amplification and detection
JP2012531210A (en) 2009-06-25 2012-12-10 イェール ユニバ−シティ−Yale University Single nucleotide polymorphisms and cancer risk in Brca1
WO2010151416A1 (en) 2009-06-25 2010-12-29 Fred Hutchinson Cancer Research Center Method of measuring adaptive immunity
US9752191B2 (en) 2009-07-09 2017-09-05 The Scripps Research Institute Gene expression profiles associated with chronic allograft nephropathy
CA2805033A1 (en) 2009-07-14 2011-01-20 Beth Israel Deaconess Medical Center, Inc. Methods of increasing liver proliferation
EP2789693B1 (en) 2009-08-13 2017-10-04 Life Technologies Corporation Amelogenin SNP on chromosome X
ES2562159T3 (en) 2009-08-20 2016-03-02 Population Genetics Technologies Ltd. Compositions and methods for the reordering of molecular nucleic acid
EP2301666A1 (en) 2009-09-09 2011-03-30 Helixis Inc. Optical system for multiple reactions
WO2011030091A1 (en) 2009-09-11 2011-03-17 Myconostica Limited Assay for candida species
JP2013505718A (en) 2009-09-24 2013-02-21 シージーン アイエヌシー Detection of a target nucleic acid sequence by repetitive exo nucleic acid cleavage reaction
WO2011037802A3 (en) 2009-09-28 2011-07-28 Igor Kutyavin Methods and compositions for detection of nucleic acids based on stabilized oligonucleotide probe complexes
WO2011050034A1 (en) 2009-10-21 2011-04-28 Genentech, Inc. Genetic polymorphisms in age-related macular degeneration
WO2011050278A1 (en) * 2009-10-23 2011-04-28 Eragen Biosciences, Inc. Amplification primers with non-standard bases for increased reaction specificity
US9315860B2 (en) 2009-10-26 2016-04-19 Genovoxx Gmbh Conjugates of nucleotides and method for the application thereof
CA2778532A1 (en) * 2009-10-27 2011-05-12 Swift Biosciences, Inc. Polynucleotide primers and probes
WO2011055232A3 (en) 2009-11-04 2011-11-10 Population Genetics Technologies Ltd. Base-by-base mutation screening
KR20110050327A (en) 2009-11-07 2011-05-13 주식회사 씨젠 T h d primer target detection
US20110117546A1 (en) * 2009-11-18 2011-05-19 Microfluidic Systems, Inc. Increase of signal sensitivity using dual probes in pcr reactions
US9133343B2 (en) * 2009-11-30 2015-09-15 Enzo Biochem, Inc. Dyes and compositions, and processes for using same in analysis of protein aggregation and other applications
US8614071B2 (en) 2009-12-11 2013-12-24 Roche Molecular Systems, Inc. Preferential amplification of mRNA over DNA using chemically modified primers
US9238832B2 (en) 2009-12-11 2016-01-19 Roche Molecular Systems, Inc. Allele-specific amplification of nucleic acids
CA2784344C (en) 2009-12-21 2018-01-02 Seegene, Inc. Tsg primer target detection
US20120288861A1 (en) 2009-12-21 2012-11-15 Heinz-Josef Lenz Germline polymorphisms in the sparc gene associated with clinical outcome in gastric cancer
CA2785020A1 (en) 2009-12-22 2011-07-21 Sequenom, Inc. Processes and kits for identifying aneuploidy
US8877437B1 (en) 2009-12-23 2014-11-04 Biotium, Inc. Methods of using dyes in association with nucleic acid staining or detection
WO2011085334A1 (en) 2010-01-11 2011-07-14 University Of Southern California Cd44 polymorphisms predict clinical outcome in patients with gastric cancer
WO2011100057A3 (en) * 2010-02-09 2011-12-22 Eugene Spier Methods and compositions for universal detection of nucleic acids
WO2011101744A3 (en) 2010-02-22 2011-12-08 Population Genetics Technologies Ltd. Region of interest extraction and normalization methods
WO2011107887A3 (en) 2010-03-02 2012-01-19 Population Genetic Technologies Ltd. Methods for replicating polynucleotides with secondary structure
CN102918155B (en) 2010-03-23 2015-12-16 和光纯药工业株式会社 Detecting Chlamydia trachomatis primers and probes, and the detection method using the primers and probes of the Chlamydia trachomatis
DE102010003781B4 (en) 2010-04-08 2012-08-16 Aj Innuscreen Gmbh A method for detecting specific nucleic acid sequences
WO2011130728A1 (en) 2010-04-17 2011-10-20 Bayer Healthcare Llc Synthetic metabolites of fluoro substituted omega-carboxyaryl diphenyl urea for the treatment and prevention diseases and conditions
US20110269735A1 (en) 2010-04-19 2011-11-03 Celera Corporation Genetic polymorphisms associated with statin response and cardiovascular diseases, methods of detection and uses thereof
EP2730663A3 (en) 2010-04-21 2014-09-10 Erik Berntorp Genetic factors associated with inhibitor development in hemophilia A
US8774494B2 (en) 2010-04-30 2014-07-08 Complete Genomics, Inc. Method and system for accurate alignment and registration of array for DNA sequencing
JP6085249B2 (en) 2010-05-06 2017-02-22 アダプティヴ バイオテクノロジーズ コーポレーション Sequence analysis of complex amplicon
US8618253B2 (en) 2010-05-25 2013-12-31 Samsung Techwin Co., Ltd. Modified RNAse H and detection of nucleic acid amplification
WO2011150227A1 (en) 2010-05-26 2011-12-01 Qiagen Gaithersburg, Inc. Quantitative helicase assay
US8828688B2 (en) 2010-05-27 2014-09-09 Affymetrix, Inc. Multiplex amplification methods
WO2011156434A3 (en) 2010-06-07 2012-04-12 Firefly Bioworks, Inc. Nucleic acid detection and quantification by post-hybridization labeling and universal encoding
EP2576824A2 (en) 2010-06-07 2013-04-10 Roche Diagnostics GmbH Gene expression markers for predicting response to interleukin-6 receptor-inhibiting monoclonal antibody drug treatment
EP2580353B1 (en) 2010-06-11 2015-07-29 Life Technologies Corporation Alternative nucleotide flows in sequencing-by-synthesis methods
JP5926247B2 (en) 2010-06-18 2016-05-25 エフ.ホフマン−ラ ロシュ アーゲーF. Hoffmann−La Roche Aktiengesellschaft dna polymerase having increased 3 'terminal mismatch discrimination
EP2582806B1 (en) 2010-06-18 2015-12-16 Roche Diagnostics GmbH Dna polymerases with increased 3'-mismatch discrimination
EP2582802B1 (en) 2010-06-18 2016-01-13 Roche Diagnostics GmbH Dna polymerases with increased 3'-mismatch discrimination
JP5876478B2 (en) 2010-06-18 2016-03-02 エフ.ホフマン−ラ ロシュ アーゲーF. Hoffmann−La Roche Aktiengesellschaft dna polymerase having increased 3 'terminal mismatch discrimination
CN103025870B (en) 2010-06-18 2015-07-01 霍夫曼-拉罗奇有限公司 DNA polymerases with increased 3'-mismatch discrimination
WO2011157436A1 (en) 2010-06-18 2011-12-22 Roche Diagnostics Gmbh Dna polymerases with increased 3'-mismatch discrimination
JP5926246B2 (en) 2010-06-18 2016-05-25 エフ.ホフマン−ラ ロシュ アーゲーF. Hoffmann−La Roche Aktiengesellschaft dna polymerase having increased 3 'terminal mismatch discrimination
CN103025869B (en) 2010-06-18 2015-07-01 霍夫曼-拉罗奇有限公司 DNA polymerases with increased 3'-mismatch discrimination
EP2585593B1 (en) 2010-06-24 2017-03-01 Population Genetics Technologies Ltd. Methods for polynucleotide library production, immortalization and region of interest extraction
CA2802644C (en) 2010-06-25 2017-02-21 Eisai R & D Management Co., Ltd. Antitumor agent using compounds having kinase inhibitory effect in combination
WO2012016936A1 (en) 2010-07-31 2012-02-09 Aj Innuscreen Gmbh Detection of specific nucleic acid sequences by means of fluorescence quenching
DE102010033107A1 (en) 2010-08-02 2012-02-02 Aj Innuscreen Gmbh Detection of specific nucleic acid sequences by fluorescence quenching
EP2606343A4 (en) 2010-08-18 2017-08-16 Life Technologies Corp Chemical coating of microwell for electrochemical detection device
EP2611932A2 (en) 2010-08-30 2013-07-10 Gen-Probe Incorporated Compositions, methods and reaction mixtures for the detection of xenotropic murine leukemia virus-related virus
US8557532B2 (en) 2010-08-30 2013-10-15 The University Of Utah Research Foundation Diagnosis and treatment of drug-resistant Ewing'S sarcoma
WO2012034130A3 (en) 2010-09-10 2012-06-07 Qiagen Methods and compositions for nucleic acid detection
EP2614159B1 (en) 2010-09-10 2017-11-08 Bio-Rad Laboratories, Inc. Size selection of dna for chromatin analysis
WO2012039529A1 (en) * 2010-09-20 2012-03-29 Seegene, Inc. Detection of target nucleic acid sequences by exonucleolytic activity using single-labeled immobilized probes on solid phase
CA2811185A1 (en) 2010-09-21 2012-03-29 Population Genetics Technologies Ltd. Increasing confidence of allele calls with molecular counting
WO2012040403A1 (en) 2010-09-21 2012-03-29 Life Technologies Corporation Se33 mutations impacting genotype concordance
WO2012038049A3 (en) 2010-09-22 2012-05-31 F. Hoffmann-La Roche Ag Amplification of distant nucleic acid targets using engineered primers
US8725422B2 (en) 2010-10-13 2014-05-13 Complete Genomics, Inc. Methods for estimating genome-wide copy number variations
JP5924595B2 (en) * 2010-10-21 2016-05-25 国立研究開発法人理化学研究所 Bovine leukemia virus (blv) detection kit and use thereof
KR20120042100A (en) 2010-10-22 2012-05-03 주식회사 씨젠 Detection of target nucleic acid sequences using dual-labeled immobilized probes on solid phase
WO2012052758A1 (en) 2010-10-22 2012-04-26 Astrazeneca Ab Response biomarkers for iap antagonists in human cancers
GB201017978D0 (en) 2010-10-25 2010-12-08 Oxitec Ltd Multiplex amplification and detection
US20120108651A1 (en) 2010-11-02 2012-05-03 Leiden University Medical Center (LUMC) Acting on Behalf of Academic Hospital Leiden (AZL) Genetic polymorphisms associated with venous thrombosis and statin response, methods of detection and uses thereof
US8355927B2 (en) 2010-11-05 2013-01-15 Genomind, Llc Neuropsychiatric test reports
DE102010052524A1 (en) 2010-11-22 2012-05-24 Aj Innuscreen Gmbh A method for qualitative and quantitative detection of specific nucleic acid sequences in real time
CN103459612A (en) 2010-12-03 2013-12-18 布兰代斯大学 Methods and kits for detecting nucleic acid mutants in wild-type populations
WO2012087135A1 (en) 2010-12-22 2012-06-28 Academisch Ziekenhuis Leiden H.O.D.N. Lumc Genetic markers specific for clostridium difficile ribotypes 027 (nap01/b1; rt 027) and 078 (nap7/8; rt 078) and their use
WO2012092259A1 (en) 2010-12-27 2012-07-05 Ibis Biosciences, Inc. Quantitating high titer samples by digital pcr
EP2658994B1 (en) 2010-12-28 2017-07-19 Qiagen Hamburg GmbH Oligonucleotide probe for the detection of adenovirus
EP2659408A1 (en) 2010-12-29 2013-11-06 Life Technologies Corporation Time-warped background signal for sequencing-by-synthesis operations
WO2012092515A9 (en) 2010-12-30 2013-01-03 Life Technologies Corporation Methods, systems, and computer readable media for nucleic acid sequencing
WO2012096430A1 (en) 2011-01-11 2012-07-19 Seegene, Inc. Detection of target nucleic acid sequences by pto cleavage and extension assay
EP2670865A4 (en) * 2011-01-31 2014-09-10 Primeradx Inc Methods of nucleic acid quantification and detection using anomalous migration
WO2012108864A1 (en) 2011-02-08 2012-08-16 Illumina, Inc. Selective enrichment of nucleic acids
WO2012107537A1 (en) 2011-02-09 2012-08-16 Riboxx Gmbh Method for the detection of polynucleotide sequences
WO2012112606A1 (en) 2011-02-15 2012-08-23 Bio-Rad Laboratories, Inc. Detecting methylati0n in a subpopulation of genomic dna
JP5847201B2 (en) 2011-02-15 2016-01-20 エフ.ホフマン−ラ ロシュ アーゲーF. Hoffmann−La Roche Aktiengesellschaft dna polymerase having increased 3 'terminal mismatch discrimination
US20140024590A1 (en) 2011-02-18 2014-01-23 Yale University KRAS-Variant And Endometriosis
EP2683833A1 (en) 2011-03-10 2014-01-15 Gen-Probe Incorporated Methods and compositions for the selection and optimization of oligonucleotide tag sequences
US20140065615A1 (en) 2011-03-21 2014-03-06 Yale University The KRAS Variant and Tumor Biology
WO2012135053A3 (en) 2011-03-25 2012-12-20 Integrated Dna Technologies, Inc. Rnase h-based assays utilizing modified rna monomers
US20140057264A1 (en) 2011-03-29 2014-02-27 Seegene, Inc. Detection of target nucleic acid sequence by pto cleavage and extension-dependent cleavage
EP2508625A1 (en) 2011-04-05 2012-10-10 Université de Franche-Comté Real-time duplex PCR for HPV16 and HPV18 simultaneous viral load quantification
EP2694675B1 (en) 2011-04-08 2018-01-24 Life Technologies Corporation Phase-protecting reagent flow orderings for use in sequencing-by-synthesis
CA2831180C (en) 2011-04-11 2017-02-14 Keith Bauer Dna polymerases with improved activity
CN103402519B (en) 2011-04-18 2015-11-25 卫材R&D管理有限公司 Cancer therapeutic agent
US20140295438A1 (en) 2011-04-27 2014-10-02 Genovoxx Gmbh Method and components for detecting nucleic acid chains
US8450061B2 (en) 2011-04-29 2013-05-28 Sequenom, Inc. Quantification of a minority nucleic acid species
US20140115732A1 (en) 2011-04-29 2014-04-24 Monsanto Technology Llc Diagnostic Molecular Markers for Seed Lot Purity Traits in Soybeans
WO2012150749A1 (en) * 2011-05-04 2012-11-08 Seegene, Inc. Detection of target nucleic acid sequences by po cleavage and hybridization
US9850524B2 (en) 2011-05-04 2017-12-26 Seegene, Inc. Detection of target nucleic acid sequences by PO cleavage and hybridization
EP2707496A1 (en) 2011-05-11 2014-03-19 Diagon Kft. Procedure for rapid determination of viruses using nucleic acid-based molecular diagnostics, and a kit for this purpose
US9034581B2 (en) 2011-05-26 2015-05-19 Roche Molecular Systems, Inc. Compositions and methods for detection of Staphylococcus aureus
CA2840542A1 (en) 2011-06-28 2013-01-03 Igor Kutyavin Methods and compositions for enrichment of nucleic acids in mixtures of highly homologous sequences
DE102011078342A1 (en) 2011-06-29 2013-01-03 Aj Innuscreen Gmbh Rehybridisierendes probe system for the qualitative and quantitative measurement of specific nucleic acids in real time
ES2553400T3 (en) 2011-07-28 2015-12-09 F. Hoffmann-La Roche Ag DNA polymerases with enhanced activity
US8592156B2 (en) 2011-08-08 2013-11-26 Roche Molecular Systems, Inc. Predicting response to anti-CD20 therapy in DLBCL patients
WO2013040491A3 (en) 2011-09-15 2013-05-10 Shafer David A Probe: antiprobe compositions for high specificity dna or rna detection
US8889159B2 (en) 2011-11-29 2014-11-18 Gilead Pharmasset Llc Compositions and methods for treating hepatitis C virus
DE202012013382U1 (en) 2011-09-16 2016-08-23 Gilead Pharmasset Llc Compositions for the treatment of HCV
WO2013041577A1 (en) 2011-09-20 2013-03-28 Vib Vzw Methods for the diagnosis of amyotrophic lateral sclerosis and frontotemporal lobar degeneration
EP2758546B1 (en) 2011-09-23 2017-11-22 Roche Diagnostics GmbH Use of g-clamp for improved allele-specific pcr
CN104039978A (en) * 2011-09-29 2014-09-10 露美内克丝公司 Hydrolysis probes
US9416153B2 (en) 2011-10-11 2016-08-16 Enzo Life Sciences, Inc. Fluorescent dyes
WO2013055995A3 (en) 2011-10-14 2013-08-15 President And Fellows Of Harvard College Sequencing by structure assembly
WO2013059725A1 (en) 2011-10-21 2013-04-25 Adaptive Biotechnologies Corporation Quantification of adaptive immune cell genomes in a complex mixture of cells
US20140349295A1 (en) 2011-10-31 2014-11-27 Eiken Kagaku Kabushiki Kaisha Method for detecting target nucleic acid
US9260714B2 (en) 2011-12-02 2016-02-16 Roche Molecular Systems, Inc. Suppression of non-specific amplification with high-homology oligonucleotides
CN103987843B (en) 2011-12-08 2015-12-23 霍夫曼-拉罗奇有限公司 Dna polymerase having improved activity
EP2788479B1 (en) 2011-12-08 2016-02-10 Roche Diagnostics GmbH Dna polymerases with improved activity
JP6224613B2 (en) 2011-12-08 2017-11-01 エフ.ホフマン−ラ ロシュ アーゲーF. Hoffmann−La Roche Aktiengesellschaft dna polymerase having improved activity
WO2013086450A1 (en) 2011-12-09 2013-06-13 Adaptive Biotechnologies Corporation Diagnosis of lymphoid malignancies and minimal residual disease detection
US9499865B2 (en) 2011-12-13 2016-11-22 Adaptive Biotechnologies Corp. Detection and measurement of tissue-infiltrating lymphocytes
US9222115B2 (en) 2011-12-30 2015-12-29 Abbott Molecular, Inc. Channels with cross-sectional thermal gradients
US9194840B2 (en) 2012-01-19 2015-11-24 Life Technologies Corporation Sensor arrays and methods for making same
US9515676B2 (en) 2012-01-31 2016-12-06 Life Technologies Corporation Methods and computer program products for compression of sequencing data
US9864846B2 (en) 2012-01-31 2018-01-09 Life Technologies Corporation Methods and computer program products for compression of sequencing data
KR20130101952A (en) 2012-02-02 2013-09-16 주식회사 씨젠 Detection of target nucleic acid sequence by pto cleavage and extension-dependent hybridization
US20150111256A1 (en) 2012-02-17 2015-04-23 President And Fellows Of Harvard College Assembly of Nucleic Acid Sequences in Emulsions
WO2013124743A1 (en) 2012-02-22 2013-08-29 Population Genetics Technologies Ltd. Compositions and methods for intramolecular nucleic acid rearrangement ii
EP2820155B1 (en) 2012-02-28 2017-07-26 Population Genetics Technologies Ltd. Method for attaching a counter sequence to a nucleic acid sample
US9045803B2 (en) 2012-02-29 2015-06-02 Abbott Molecular Inc. Hepatitis B virus typing and resistance assay
US9127317B2 (en) 2012-03-02 2015-09-08 Winthrop-University Hospital Method for using probe based PCR detection to measure the levels of circulating demethylated β cell derived DNA as a measure of β cell loss in diabetes
WO2013131021A1 (en) 2012-03-02 2013-09-06 Sequenom Inc. Methods and processes for non-invasive assessment of genetic variations
US20150031043A1 (en) 2012-03-05 2015-01-29 Sequenta, Inc. Determining paired immune receptor chains from frequency matched subunits
KR101794981B1 (en) 2012-03-05 2017-11-09 주식회사 씨젠 Detection of Nucleotide Variation on Target Nucleic Acid Sequence by PTO Cleavage and Extension Assay
EP2770065B1 (en) 2013-02-25 2017-12-13 Seegene, Inc. Detection of nucleotide variation on target nucleic acid sequence
US9803239B2 (en) 2012-03-29 2017-10-31 Complete Genomics, Inc. Flow cells for high density array chips
EP2834371A1 (en) 2012-04-05 2015-02-11 The Regents of The University of California Gene expression panel for breast cancer prognosis
US20150111769A1 (en) 2012-04-17 2015-04-23 Yamaguchi University Method for assessing endometrial cancer susceptibility
EP2653558B1 (en) 2012-04-18 2015-10-07 Roche Diagniostics GmbH A method of detecting nucleic acid targets using a statistical classifier
CA2872468A1 (en) 2012-05-08 2013-11-14 Adaptive Biotechnologies Corporation Compositions and methods for measuring and calibrating amplification bias in multiplexed pcr reactions
US9920361B2 (en) 2012-05-21 2018-03-20 Sequenom, Inc. Methods and compositions for analyzing nucleic acid
US9914967B2 (en) 2012-06-05 2018-03-13 President And Fellows Of Harvard College Spatial sequencing of nucleic acids using DNA origami probes
US9628676B2 (en) 2012-06-07 2017-04-18 Complete Genomics, Inc. Imaging systems with movable scan mirrors
US9488823B2 (en) 2012-06-07 2016-11-08 Complete Genomics, Inc. Techniques for scanned illumination
WO2013192100A1 (en) 2012-06-18 2013-12-27 The United States Of America, As Represented By The Secretary, Department Of Health & Human Services Methods and compositions for detecting jc virus
CA2878042C (en) 2012-07-19 2017-11-28 President And Fellows Of Harvard College Methods of storing information using nucleic acids
US20140051590A1 (en) 2012-08-17 2014-02-20 Roche Molecular Systems, Inc. Compositions and Methods for Detection of Herpes Simplex Virus 1 and 2
US9914968B2 (en) 2012-09-26 2018-03-13 Cepheid Honeycomb tube
EP2902499A4 (en) 2012-09-28 2016-08-17 Bna Inc Bna clamp method
EP2722399A1 (en) 2012-10-18 2014-04-23 Roche Diagniostics GmbH Method for preventing high molecular weight products during amplification
ES2659747T3 (en) 2012-10-18 2018-03-19 F. Hoffmann-La Roche Ag Double probe assay for the detection of heterogeneous populations of amplicon
EP2722398B1 (en) 2012-10-18 2017-07-12 F. Hoffmann-La Roche AG Dual probe assay for the detection of HCV
US9476089B2 (en) 2012-10-18 2016-10-25 President And Fellows Of Harvard College Methods of making oligonucleotide probes
WO2014068072A1 (en) 2012-10-31 2014-05-08 Institut Gustave-Roussy Identification, assessment and therapy of essential thrombocythemia with resistance to jak2 inhibitors
US20140157450A1 (en) 2012-12-04 2014-06-05 Seminis Vegetable Seeds, Inc. Methods and compositions for watermelon sex expression
EP2931892A1 (en) 2012-12-12 2015-10-21 The Broad Institute, Inc. Methods, models, systems, and apparatus for identifying target sequences for cas enzymes or crispr-cas systems for target sequences and conveying results thereof
WO2014204728A8 (en) 2013-06-17 2015-07-09 The Broad Institute Inc. Delivery, engineering and optimization of systems, methods and compositions for targeting and modeling diseases and disorders of post mitotic cells
EP2784162B1 (en) 2012-12-12 2015-04-08 The Broad Institute, Inc. Engineering of systems, methods and optimized guide compositions for sequence manipulation
WO2014093635A9 (en) 2012-12-12 2014-07-24 The Broad Institute, Inc. Engineering and optimization of improved systems, methods and enzyme compositions for sequence manipulation
WO2014093655A9 (en) 2012-12-12 2014-12-04 The Broad Institute, Inc. Engineering and optimization of systems, methods and compositions for sequence manipulation with functional domains
KR20160056869A (en) 2013-06-17 2016-05-20 더 브로드 인스티튜트, 인코퍼레이티드 Delivery, use and therapeutic applications of the crispr-cas systems and compositions for targeting disorders and diseases using viral components
EP2931899A1 (en) 2012-12-12 2015-10-21 The Broad Institute, Inc. Functional genomics using crispr-cas systems, compositions, methods, knock out libraries and applications thereof
US20140179770A1 (en) 2012-12-12 2014-06-26 Massachusetts Institute Of Technology Delivery, engineering and optimization of systems, methods and compositions for sequence manipulation and therapeutic applications
WO2014093714A1 (en) 2012-12-14 2014-06-19 Bio-Rad Laboratories, Inc. Methods and compositions for using oils for analysis and detection of molecules
RU2015115397A (en) 2012-12-21 2017-01-25 Эйсай Ар Энд Ди Менеджмент Ко., Лтд. The amorphous form of the quinoline derivative and method for its preparation
JP6178430B2 (en) 2012-12-27 2017-08-09 シージーン アイエヌシー Pto cleavage and extension-dependent non-hybridization assay according to the detection of a target nucleic acid sequence
EP2954102A4 (en) 2013-02-08 2017-01-04 Bio-Rad Laboratories Inc Affinity-based partition assay for detection of target molecules
EP2971115A4 (en) 2013-03-13 2016-03-02 Seegene Inc Quantification of target nucleic acid using melting peak analysis
GB201515589D0 (en) 2013-03-15 2015-10-21 Abvitro Inc Single cell bar-coding for antibody discovery
US9567632B2 (en) 2013-03-19 2017-02-14 New England Biolabs, Inc. Enrichment of target sequences
CN105324492A (en) 2013-03-26 2016-02-10 健能泰格技术公司 Dual probe:antiprobe compositions for DNA and RNA detection
CN105247071A (en) * 2013-04-01 2016-01-13 基因特力株式会社 Nucleic acid amplification method using allele-specific reactive primer
WO2014176259A1 (en) 2013-04-22 2014-10-30 Icahn School Of Medicine At Mount Sinai Mutations in pdgfrb and notch3 as causes of autosomal dominant infantile myofibromatosis
WO2014182835A1 (en) 2013-05-09 2014-11-13 Bio-Rad Laboratories, Inc. Magnetic immuno digital pcr assay
CN105264380B (en) 2013-05-14 2017-09-05 卫材R&D管理有限公司 For predicting and evaluating the subject for endometrial cancer galvanic music compound biomarkers for responsiveness
US20140378327A1 (en) * 2013-06-19 2014-12-25 Luminex Corporation Real-time multiplexed hydrolysis probe assay using spectrally identifiable microspheres
US9708657B2 (en) 2013-07-01 2017-07-18 Adaptive Biotechnologies Corp. Method for generating clonotype profiles using sequence tags
DE102013213279A1 (en) 2013-07-06 2015-01-08 Aj Innuscreen Gmbh Universal method for detection of various analytes
US9926597B2 (en) 2013-07-26 2018-03-27 Life Technologies Corporation Control nucleic acid sequences for use in sequencing-by-synthesis and methods for designing the same
WO2015023596A1 (en) 2013-08-12 2015-02-19 Genentech, Inc. Compositions and method for treating complement-associated conditions
US20150113679A1 (en) 2013-09-25 2015-04-23 Board Of Regents Of The University Of Nebraska Methods and Compositions for Obtaining Useful Plant Traits
US20160289747A1 (en) 2013-11-22 2016-10-06 Orion Diagnostica Oy Detection of nucleic acids by strand invasion based amplification
US20150150155A1 (en) 2013-11-27 2015-05-28 Seminis Vegetable Seeds, Inc. Disease resistance loci in onion
WO2015083004A1 (en) 2013-12-02 2015-06-11 Population Genetics Technologies Ltd. Method for evaluating minority variants in a sample
EP2986719A4 (en) 2013-12-06 2016-10-26 Bio Rad Laboratories Fusion polymerases
US9476853B2 (en) 2013-12-10 2016-10-25 Life Technologies Corporation System and method for forming microwells
CA2932475A1 (en) 2013-12-12 2015-06-18 The Broad Institute Inc. Delivery, use and therapeutic applications of the crispr-cas systems and compositions for targeting disorders and diseases using particle delivery components
WO2015120280A1 (en) 2014-02-08 2015-08-13 Genentech, Inc. Methods of treating alzheimer's disease
US9822396B2 (en) 2014-02-13 2017-11-21 Bio-Rad Laboratories, Inc. Chromosome conformation capture in partitions
US20150240256A1 (en) 2014-02-27 2015-08-27 Seminis Vegetable Seeds, Inc. Compositions and methods for peronospora resistance in spinach
WO2015175530A1 (en) 2014-05-12 2015-11-19 Gore Athurva Methods for detecting aneuploidy
EP3149195A1 (en) * 2014-06-02 2017-04-05 Base4 Innovation Ltd Nucleotide polymorphism detection method
US9777340B2 (en) 2014-06-27 2017-10-03 Abbott Laboratories Compositions and methods for detecting human Pegivirus 2 (HPgV-2)
US20160130670A1 (en) 2014-06-27 2016-05-12 Seminis Vegetable Seeds, Inc. Methods and assays for male sterile watermelon
CN107002076A (en) 2014-09-15 2017-08-01 阿布维特罗有限责任公司 High-throughput nucleotide library sequencing
CN107205353A (en) 2014-09-26 2017-09-26 谱赛科美国股份有限公司 Single nucleotide polymorphism (SNP) markers for stevia
GB201417497D0 (en) 2014-10-03 2014-11-19 Convergence Pharmaceuticals Novel use
GB201417500D0 (en) 2014-10-03 2014-11-19 Convergence Pharmaceuticals Novel use
GB201417499D0 (en) 2014-10-03 2014-11-19 Convergence Pharmaceuticals Novel use
EP3005862A1 (en) 2014-10-10 2016-04-13 Seminis Vegetable Seeds, Inc. Melon plants with improved disease tolerance
WO2016060974A1 (en) 2014-10-13 2016-04-21 Life Technologies Corporation Methods, systems, and computer-readable media for accelerated base calling
CA2962956A1 (en) 2014-10-20 2016-04-28 Gen-Probe Incorporated Red blood cell lysis solution
US9920381B2 (en) 2014-12-02 2018-03-20 Roche Molecular Systems, Inc. Compositions and methods for detecting MECC-containing methicillin-resistant Staphylococcus aureus
JP2017537657A (en) 2014-12-11 2017-12-21 ニユー・イングランド・バイオレイブス・インコーポレイテツド Enrichment of the target sequence
WO2016094874A1 (en) 2014-12-12 2016-06-16 The Broad Institute Inc. Escorted and functionalized guides for crispr-cas systems
WO2016094867A1 (en) 2014-12-12 2016-06-16 The Broad Institute Inc. Protected guide rnas (pgrnas)
US9909169B2 (en) 2014-12-17 2018-03-06 Roche Molecular Systems, Inc. Allele-specific amplification of nucleic acids using blocking oligonucleotides for wild type suppression
CA2970370A1 (en) 2014-12-24 2016-06-30 Massachusetts Institute Of Technology Crispr having or associated with destabilization domains
EP3250588A1 (en) 2015-01-29 2017-12-06 Board of Trustees of Michigan State University Cryptic polypeptides and uses thereof
CN105936930A (en) 2015-03-04 2016-09-14 松下知识产权经营株式会社 DNA detection method and DNA detection device
CN105969655A (en) 2015-03-10 2016-09-28 松下知识产权经营株式会社 Method for analyzing multiple nucleic acid targets
US20160289779A1 (en) 2015-03-30 2016-10-06 Enzo Biochem, Inc. Monoazo dyes with cyclic amine as fluorescence quenchers
CA2985015A1 (en) 2015-05-29 2016-12-08 F. Hoffmann-La Roche Ag A method of inactivating microbes by citraconic anhydride
WO2016205233A3 (en) 2015-06-15 2017-02-02 Cepheid Integrated purification and measurement of dna methylation and co-measurement of mutations and/or mrna expression levels in an automated reaction cartridge
US9790490B2 (en) 2015-06-18 2017-10-17 The Broad Institute Inc. CRISPR enzymes and systems
WO2016205764A9 (en) 2015-06-18 2017-04-13 The Broad Institute Inc. Novel crispr enzymes and systems
WO2016205749A8 (en) 2015-06-18 2017-06-08 The Broad Institute Inc. Novel crispr enzymes and systems
RU2600873C1 (en) * 2015-06-24 2016-10-27 Закрытое акционерное общество "ЕВРОГЕН" Method of identifying native pairs of dna or rna fragments present in the same living cells
US20170064918A1 (en) 2015-09-03 2017-03-09 Seminis Vegetable Seeds, Inc. Downy mildew resistant lettuce plants
US9499861B1 (en) 2015-09-10 2016-11-22 Insilixa, Inc. Methods and systems for multiplex quantitative nucleic acid amplification
WO2017053905A1 (en) 2015-09-24 2017-03-30 Abvitro Llc Affinity-oligonucleotide conjugates and uses thereof
WO2017053902A1 (en) 2015-09-25 2017-03-30 Abvitro Llc High throughput process for t cell receptor target identification of natively-paired t cell receptor sequences
US20170211142A1 (en) 2015-10-22 2017-07-27 The Broad Institute, Inc. Novel crispr enzymes and systems
WO2017075294A1 (en) 2015-10-28 2017-05-04 The Board Institute Inc. Assays for massively combinatorial perturbation profiling and cellular circuit reconstruction
WO2017106657A1 (en) 2015-12-18 2017-06-22 The Broad Institute Inc. Novel crispr enzymes and systems
WO2017123696A1 (en) 2016-01-12 2017-07-20 Interleukin Genetics, Inc. Methods for predicting response to treatment
WO2017130059A1 (en) 2016-01-25 2017-08-03 Bio-Rad Innovations Digital microbiology
WO2017153566A1 (en) 2016-03-11 2017-09-14 Roche Diagnostics Gmbh Compositions and methods for detection of zika virus
WO2017177025A9 (en) 2016-04-06 2018-02-22 Life Technologies Corporation Compositions, methods, and kits for synthesis and detection of nucleic acids
WO2017189308A1 (en) 2016-04-19 2017-11-02 The Broad Institute Inc. Novel crispr enzymes and systems
WO2017184768A1 (en) 2016-04-19 2017-10-26 The Broad Institute Inc. Novel crispr enzymes and systems
WO2017184786A8 (en) 2016-04-19 2017-12-21 The Broad Institute Inc. Cpf1 complexes with reduced indel activity
WO2017189746A1 (en) 2016-04-27 2017-11-02 Gen-Probe Incorporated Blood cell lysis reagent
WO2017189906A1 (en) 2016-04-27 2017-11-02 Mira Dx, Inc. Immune-based treatment of kras-variant cancer patients

Citations (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4358535A (en) * 1980-12-08 1982-11-09 Board Of Regents Of The University Of Washington Specific DNA probes in diagnostic microbiology
EP0185494A2 (en) * 1984-12-13 1986-06-25 Applied Biosystems, Inc. Detection of specific sequences in nucleic acids
US4683202A (en) * 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4683195A (en) * 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US4683194A (en) * 1984-05-29 1987-07-28 Cetus Corporation Method for detection of polymorphic restriction sites and nucleic acid sequences
US4820630A (en) * 1984-11-23 1989-04-11 Digene Diagnostics, Incorporated Assay for nucleic acid sequences, particularly genetic lesions, using interactive labels
WO1989009284A1 (en) * 1988-03-24 1989-10-05 University Of Iowa Research Foundation Catalytic hybridization systems for the detection of nucleic acid sequences based on their activity as cofactors in catalytic reactions in which a complementary labeled nucleic acid probe is cleaved
WO1989010979A1 (en) * 1988-05-10 1989-11-16 E.I. Du Pont De Nemours And Company Process for rapid nucleic acid detection
US4889818A (en) * 1986-08-22 1989-12-26 Cetus Corporation Purified thermostable enzyme
EP0357011A2 (en) * 1988-08-30 1990-03-07 Abbott Laboratories Detection and amplification of target nucleic acid sequences
US4914210A (en) * 1987-10-02 1990-04-03 Cetus Corporation Oligonucleotide functionalizing reagents
US5011769A (en) * 1985-12-05 1991-04-30 Meiogenics U.S. Limited Partnership Methods for detecting nucleic acid sequences
US5108892A (en) * 1989-08-03 1992-04-28 Promega Corporation Method of using a taq dna polymerase without 5'-3'-exonuclease activity
US5210015A (en) * 1990-08-06 1993-05-11 Hoffman-La Roche Inc. Homogeneous assay system using the nuclease activity of a nucleic acid polymerase
EP0320308B1 (en) * 1987-12-11 1993-11-03 Abbott Laboratories Method for detecting a target nucleic acid sequence
EP0246864B1 (en) * 1986-05-19 1994-07-13 Bio-Rad Laboratories, Inc. Hybridisation probes
EP0439182B1 (en) * 1990-01-26 1996-04-24 Abbott Laboratories Improved method of amplifying target nucleic acids applicable to both polymerase and ligase chain reactions

Family Cites Families (29)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4318981A (en) 1980-04-24 1982-03-09 Miles Laboratories, Inc. Homogeneous specific binding assay employing an intramolecularly modulated photogenic enzyme substrate label
US4711955A (en) * 1981-04-17 1987-12-08 Yale University Modified nucleotides and methods of preparing and using same
CA1219824A (en) 1981-04-17 1987-03-31 David C. Ward Modified nucleotides and methods of preparing and using same
CA1190838A (en) * 1981-07-17 1985-07-23 Cavit Akin Homogeneous nucleic acid hybridization diagnostics by non-radiative energy transfer
CA1180647A (en) * 1981-07-17 1985-01-08 Cavit Akin Light-emitting polynucleotide hybridization diagnostic method
CA1185177A (en) * 1981-07-17 1985-04-09 Larry E. Morrison Non-radiative energy transfer immunochemical technique
FR2540122B1 (en) 1983-01-27 1985-11-29 Centre Nat Rech Scient Novel compounds having an oligonucleotide sequence bound to an intercalating agent, their process of synthesis and their application
GB8311018D0 (en) 1983-04-22 1983-05-25 Amersham Int Plc Detecting mutations in dna
US4743535A (en) 1984-11-07 1988-05-10 Miles Inc. Hybridization assay employing labeled probe and anti-hybrid
DK150841C (en) 1984-12-19 1988-07-11 Medicotest Systemer As Connector for establishing electrical connection with a engangshudelektrode
ES8706823A1 (en) 1985-03-28 1987-06-16 Cetus Corp A method for detecting the presence or absence of at least one specific nucleic acid sequence in a sample
US4780405A (en) 1985-06-25 1988-10-25 Siska Diagnostics, Inc. Carbonic anhydrase inhibitor-tagged nucleic acid probes
DE3674662D1 (en) 1985-07-23 1990-11-08 Volcano Int Medical Ab Orthopedic kniestuetze.
FR2586704B1 (en) 1985-09-04 1987-12-18 Centre Nat Rech Scient New compounds containing a sequence of oligonucleotide linked to an intercalating agent and an activatable chemical group, their synthesis and applications by way of specific artificial nucleases sequences. National Center for Scientific Research (CNRS)
CA1273552A (en) * 1985-12-23 1990-09-04 Michael J. Heller Fluorescent stokes shift probes for polynucleotide hybridization assays
US4996143A (en) * 1985-12-23 1991-02-26 Syngene, Inc. Fluorescent stokes shift probes for polynucleotide hybridization
EP0232967B1 (en) 1986-01-10 1993-04-28 Amoco Corporation Competitive homogeneous assay
US4868103A (en) * 1986-02-19 1989-09-19 Enzo Biochem, Inc. Analyte detection by means of energy transfer
CA1284931C (en) 1986-03-13 1991-06-18 Henry A. Erlich Process for detecting specific nucleotide variations and genetic polymorphisms present in nucleic acids
US4851331A (en) * 1986-05-16 1989-07-25 Allied Corporation Method and kit for polynucleotide assay including primer-dependant DNA polymerase
JPS638396A (en) 1986-06-30 1988-01-14 Wakunaga Pharmaceut Co Ltd Poly-labeled oligonucleotide derivative
CA1340806C (en) * 1986-07-02 1999-11-02 James Merrill Prober Method, system and reagents for dna sequencing
CA1338457C (en) * 1986-08-22 1996-07-16 Henry A. Erlich Purified thermostable enzyme
FR2627590A1 (en) 1988-02-24 1989-08-25 Ire Celltarg Sa Probe nucleic acid having a terminal nucleotide chemically modifies 5 (prime) (oh) to its non-radioactive labeling and processes of preparation
US5082830A (en) 1988-02-26 1992-01-21 Enzo Biochem, Inc. End labeled nucleotide probe
DE68928853T2 (en) 1988-05-20 1999-08-05 Cetus Corp Mounting of sequence-specific samples
US4997928A (en) * 1988-09-15 1991-03-05 E. I. Du Pont De Nemours And Company Fluorescent reagents for the preparation of 5'-tagged oligonucleotides
US5118801A (en) * 1988-09-30 1992-06-02 The Public Health Research Institute Nucleic acid process containing improved molecular switch
WO1990011372A1 (en) * 1989-03-21 1990-10-04 Collaborative Research, Inc. Multiplex dna diagnostic test

Patent Citations (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4358535B1 (en) * 1980-12-08 1986-05-13
US4358535A (en) * 1980-12-08 1982-11-09 Board Of Regents Of The University Of Washington Specific DNA probes in diagnostic microbiology
US4683194A (en) * 1984-05-29 1987-07-28 Cetus Corporation Method for detection of polymorphic restriction sites and nucleic acid sequences
US4820630A (en) * 1984-11-23 1989-04-11 Digene Diagnostics, Incorporated Assay for nucleic acid sequences, particularly genetic lesions, using interactive labels
EP0185494A2 (en) * 1984-12-13 1986-06-25 Applied Biosystems, Inc. Detection of specific sequences in nucleic acids
US4683202A (en) * 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4683202B1 (en) * 1985-03-28 1990-11-27 Cetus Corp
US5011769A (en) * 1985-12-05 1991-04-30 Meiogenics U.S. Limited Partnership Methods for detecting nucleic acid sequences
US4683195A (en) * 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US4683195B1 (en) * 1986-01-30 1990-11-27 Cetus Corp
EP0246864B1 (en) * 1986-05-19 1994-07-13 Bio-Rad Laboratories, Inc. Hybridisation probes
US4889818A (en) * 1986-08-22 1989-12-26 Cetus Corporation Purified thermostable enzyme
US4914210A (en) * 1987-10-02 1990-04-03 Cetus Corporation Oligonucleotide functionalizing reagents
EP0320308B1 (en) * 1987-12-11 1993-11-03 Abbott Laboratories Method for detecting a target nucleic acid sequence
WO1989009284A1 (en) * 1988-03-24 1989-10-05 University Of Iowa Research Foundation Catalytic hybridization systems for the detection of nucleic acid sequences based on their activity as cofactors in catalytic reactions in which a complementary labeled nucleic acid probe is cleaved
WO1989010979A1 (en) * 1988-05-10 1989-11-16 E.I. Du Pont De Nemours And Company Process for rapid nucleic acid detection
EP0357011A2 (en) * 1988-08-30 1990-03-07 Abbott Laboratories Detection and amplification of target nucleic acid sequences
US5108892A (en) * 1989-08-03 1992-04-28 Promega Corporation Method of using a taq dna polymerase without 5'-3'-exonuclease activity
EP0439182B1 (en) * 1990-01-26 1996-04-24 Abbott Laboratories Improved method of amplifying target nucleic acids applicable to both polymerase and ligase chain reactions
US5210015A (en) * 1990-08-06 1993-05-11 Hoffman-La Roche Inc. Homogeneous assay system using the nuclease activity of a nucleic acid polymerase
US5487972A (en) * 1990-08-06 1996-01-30 Hoffmann-La Roche Inc. Nucleic acid detection by the 5'-3'exonuclease activity of polymerases acting on adjacently hybridized oligonucleotides

Non-Patent Citations (10)

* Cited by examiner, † Cited by third party
Title
Gelfand, "Taq DNA Polymerase" in PCR Technology, Erlich, ed., Stockton Press, 1989.
Gelfand, Taq DNA Polymerase in PCR Technology, Erlich, ed., Stockton Press, 1989. *
Lawyer et al., 1989, "Isolation, Characterization, and Expression in Escherichia coli of the DNA Polymerase Gene from Thermus Aquaticus" J.Biol. Chem. 264(11):6427-6437.
Lawyer et al., 1989, Isolation, Characterization, and Expression in Escherichia coli of the DNA Polymerase Gene from Thermus Aquaticus J.Biol. Chem. 264(11):6427 6437. *
Lehman et al., 1973, "Persistence of Deoxyribonucleic Acid Polymerase I and Its 5'--3'Exonuclease Activity in Po1A Mutants of Escherichia coli K12" J. Biological Chemistry 248(22):7717-7723.
Lehman et al., 1973, Persistence of Deoxyribonucleic Acid Polymerase I and Its 5 3 Exonuclease Activity in Po1A Mutants of Escherichia coli K12 J. Biological Chemistry 248(22):7717 7723. *
Matthews et al. (1988) Analytical Chemistry, vol. 169, pp. 1 25. *
Matthews et al. (1988) Analytical Chemistry, vol. 169, pp. 1-25.
Setlow et al., 1972, "Deoxyribonucleic Acid Polymerase: Two Distinct Enzymes in One Polypeptide" J. Biological Chemistry 247(1):224-231.
Setlow et al., 1972, Deoxyribonucleic Acid Polymerase: Two Distinct Enzymes in One Polypeptide J. Biological Chemistry 247(1):224 231. *

Cited By (426)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7445900B2 (en) 1990-08-06 2008-11-04 Roche Molecular Systems, Inc. Homogeneous assay system
US20050255499A1 (en) * 1990-08-06 2005-11-17 Roche Molecular Systems, Inc. Process for discrimination of nucleic acid sequence variants
US20080171315A1 (en) * 1990-08-06 2008-07-17 Gelfand David H Homogeneous assay system
US7141377B2 (en) * 1990-08-06 2006-11-28 Roche Molecular Systems, Inc. Process for discrimination of nucleic acid sequence variants
US20060078914A1 (en) * 1993-01-05 2006-04-13 Gelfand David H Homogeneous assay system
US20060257885A1 (en) * 1993-01-05 2006-11-16 Gelfand David H Homogeneous assay system
US20060084092A1 (en) * 1993-01-05 2006-04-20 Gelfand David H Homogeneous assay system
US20030099999A1 (en) * 1993-07-23 2003-05-29 Ai-Ping Wei Assay procedure using fluorogenic tracers
US7153654B2 (en) 1993-07-23 2006-12-26 University Of Utah Research Foundation Assay procedure using fluorogenic tracers
US6821727B1 (en) 1993-11-15 2004-11-23 Applera Corporation Hybridization assay using self-quenching fluorescence probe
US6258569B1 (en) 1994-11-16 2001-07-10 The Perkin-Elmer Corporation Hybridization assay using self-quenching fluorescence probe
US7847076B2 (en) 1995-05-05 2010-12-07 Life Technologies Corporation Methods and reagents for combined PCR amplification
US7413708B2 (en) 1995-05-05 2008-08-19 Applied Biosystems Inc. Methods and reagents for combined PCR amplification
US20050227247A1 (en) * 1995-05-05 2005-10-13 Applera Corporation Methods and reagents for combined PCR amplification and hybridization probing
US7241596B2 (en) 1995-05-05 2007-07-10 Applera Corporation Methods and reagents for combined PCR amplification and hybridization probing
US20080050742A1 (en) * 1995-05-05 2008-02-28 Applera Corporation Methods and Reagents for Combined PCR Amplification
US20090258351A1 (en) * 1995-05-05 2009-10-15 Applied Biosystems Inc. Methods and Reagents for Combined PCR Amplification
US20050266462A1 (en) * 1995-06-08 2005-12-01 Roche Diagnostics Gmbh Magnetic glass particles, method for their preparation and uses thereof
US20020137920A1 (en) * 1995-06-08 2002-09-26 Boehringer Mannheim Gmbh. Magnetic pigment
US8129118B2 (en) 1995-06-08 2012-03-06 Roche Diagnostics Gmbh Magnetic glass particles, method for their preparation and uses thereof
US7371830B2 (en) 1995-06-08 2008-05-13 Roche Diagnostics Gmbh Method for separating biological material from a fluid using magnetic particles
US6870047B2 (en) 1995-06-08 2005-03-22 Roche Diagnostics Gmbh Magnetic pigment
US20030135038A1 (en) * 1995-06-08 2003-07-17 Roche Diagnostics Gmbh. Magnetic pigment
US6251600B1 (en) 1996-07-26 2001-06-26 Edward E. Winger Homogeneous nucleotide amplification and assay
US20030199078A1 (en) * 1997-10-01 2003-10-23 Jorg Kleiber Method, kit and apparatus for the isolation of nucleic acids
US6485901B1 (en) 1997-10-27 2002-11-26 Boston Probes, Inc. Methods, kits and compositions pertaining to linear beacons
US7892741B2 (en) 1997-10-27 2011-02-22 Boston Probes, Inc. Methods, kits and compositions pertaining to linear beacons
US20090136941A1 (en) * 1997-10-27 2009-05-28 Boston Probes, Inc. Methods, kits and compositions pertaining to linear beacons
US6649349B2 (en) 1997-10-27 2003-11-18 Boston Probes, Inc. In-situ methods for analyzing target sequences using linear beacons
US7422852B2 (en) 1997-10-27 2008-09-09 Boston Probes, Inc. Detection of nucleic acid using linear beacons
US6077669A (en) * 1997-11-04 2000-06-20 Becton Dickinson And Company Kit and method for fluorescence based detection assay
EP0930370A1 (en) * 1997-12-15 1999-07-21 Centeon Pharma GmbH Labeled primer for use in detection of target nucleic acids
US6248526B1 (en) 1997-12-15 2001-06-19 Aventis Behring, Gmbh Labeled primer for use in and detection of target nucleic acids
US6518025B1 (en) 1998-02-05 2003-02-11 Bavarian Nordic Research Institute A/S Quantification by inhibition of amplication
US9273350B2 (en) 1998-06-13 2016-03-01 Qiagen Manchester Limited Methods and primers for detecting target nucleic acid sequences
US6326145B1 (en) 1998-06-13 2001-12-04 Zeneca Limited Methods for detecting target nucleic acid sequences
US20050164219A1 (en) * 1998-06-13 2005-07-28 Dxs Limited Methods and primers for detecting target nucleic acid sequences
US6479267B1 (en) 1998-06-17 2002-11-12 Amersham Pharmacia Biotech, Inc. FY7 polymerase
US6835542B2 (en) 1998-07-02 2004-12-28 Gen-Probe Incorporated Molecular torches
US20050130216A1 (en) * 1998-07-02 2005-06-16 Becker Michael M. Molecular torches and their use under strand displacement conditions
US7252947B2 (en) 1998-07-02 2007-08-07 Gen-Probe Incorporated Molecular torches and their use under denaturing conditions
US7250259B2 (en) 1998-07-02 2007-07-31 Gen-Probe Incorporated Molecular torches and their use under strand displacement conditions
US6534274B2 (en) 1998-07-02 2003-03-18 Gen-Probe Incorporated Molecular torches
US6849412B2 (en) 1998-07-02 2005-02-01 Gen-Probe Incorporated Molecular torches
US6361945B1 (en) 1998-07-02 2002-03-26 Gen-Probe Incorporated Molecular torches
US20030165957A1 (en) * 1998-07-02 2003-09-04 Becker Michael M. Molecular torches
EP1013775A1 (en) * 1998-12-21 2000-06-28 LUTZ, Hans Quantitative polymerase chain reaction using a fluorogenic real-time detection system
WO2000037672A1 (en) * 1998-12-21 2000-06-29 Hans Lutz Quantitative polymerase chain reaction using a fluorogenic real-time detection system
US6573047B1 (en) 1999-04-13 2003-06-03 Dna Sciences, Inc. Detection of nucleotide sequence variation through fluorescence resonance energy transfer label generation
US20070212699A1 (en) * 1999-05-14 2007-09-13 University Of Southern California Process for high throughput DNA methylation analysis
EP1185695A4 (en) * 1999-05-14 2004-05-19 Univ Southern California Process for high throughput dna methylation analysis
EP1185695A1 (en) * 1999-05-14 2002-03-13 University Of Southern California Process for high throughput dna methylation analysis
EP1710321A3 (en) * 1999-05-14 2007-04-04 University Of Southern California Process for high throughput DNA methylation analysis
US20100009365A1 (en) * 1999-05-14 2010-01-14 University Of Southern California Process for high-throughput dna methylation analysis
US8323890B2 (en) 1999-05-14 2012-12-04 The University Of Southern California Process for high-throughput DNA methylation analysis
US7553627B2 (en) 1999-05-14 2009-06-30 University of Southern California, USC Stevens Center for Innovation Process for high throughput DNA methylation analysis
US7112404B2 (en) 1999-05-14 2006-09-26 Epigenomics Ag Process for high throughput DNA methylation analysis
US20020086324A1 (en) * 1999-05-14 2002-07-04 Laird Peter W. Process for high throughput DNA methylation analysis
EP1710321A2 (en) * 1999-05-14 2006-10-11 University Of Southern California Process for high throughput DNA methylation analysis
US9085797B2 (en) 1999-05-24 2015-07-21 Life Technologies Corporation Method for deblocking of labeled oligonucleotides
WO2000071559A1 (en) * 1999-05-24 2000-11-30 Invitrogen Corporation Method for deblocking of labeled oligonucleotides
US8093372B2 (en) 1999-05-24 2012-01-10 Life Technologies Corporation Method for deblocking of labeled oligonucleotides
US6593464B1 (en) 1999-05-24 2003-07-15 Invitrogen Corporation Method for deblocking of labeled oligonucleotides
US20030120063A1 (en) * 1999-05-24 2003-06-26 Invitrogen Corporation Method for deblocking of labeled oligonucleotides
US8524882B2 (en) 1999-05-24 2013-09-03 Life Technologies Corporation Method for deblocking of labeled oligonucleotides
US20090117540A1 (en) * 1999-10-29 2009-05-07 Stratagene California Methods for detection of a target nucleic acid by forming a cleavage structure using an RNA polymerase
US7655405B2 (en) 1999-10-29 2010-02-02 Hologic, Inc Compositions and kits for detection of a target nucleic acid
US20060094036A1 (en) * 1999-10-29 2006-05-04 Stratagene California Methods for detection of a target nucleic acid by capture
US7534568B2 (en) 1999-10-29 2009-05-19 Hologic Inc. Methods for detection of a target nucleic acid by forming a cleavage structure with a cleavage resistant probe
US20060035215A9 (en) * 1999-10-29 2006-02-16 Sorge Joseph A Methods for detection of a target nucleic acid by capture
US20020137036A1 (en) * 1999-10-29 2002-09-26 Sorge Joseph A. Methods for detection of a target nucleic acid by capture
US7361467B2 (en) 1999-10-29 2008-04-22 Stratagene California Methods for detection of a target nucleic acid by capture
US7838225B2 (en) 1999-10-29 2010-11-23 Hologic, Inc. Methods for detection of a target nucleic acid by forming a cleavage structure using a reverse transcriptase
US7482121B2 (en) 1999-10-29 2009-01-27 Hologic Inc. Methods for detection of a target nucleic acid by capture
US20050255512A1 (en) * 1999-10-29 2005-11-17 Stratagene California Methods for detection of a target nucleic acid by capture
US7381532B2 (en) * 1999-10-29 2008-06-03 Stratagene California Compositions and methods for the detection of a nucleic acid using a cleavage reaction
US20060246469A1 (en) * 1999-10-29 2006-11-02 Stratagene California Compositions and methods for the detection of a nucleic acid using a cleavage reaction
US7824859B2 (en) * 1999-10-29 2010-11-02 Cytyc Corporation Methods for detection of a target nucleic acid by forming a cleavage structure using an RNA polymerase
US7736854B2 (en) 1999-10-29 2010-06-15 Hologic, Inc. Methods of detection of a target nucleic acid sequence
US20090011408A1 (en) * 1999-10-29 2009-01-08 Stratagene California Methods for detection of a target nucleic acid by forming a cleavage structure using a reverse transcriptase
US7846661B2 (en) 1999-10-29 2010-12-07 Hologic, Inc. Methods of detecting an amplified nucleic acid
US20070099205A1 (en) * 1999-10-29 2007-05-03 Stratagene California Compositions for detection of a target nucleic acid sequence
US7118860B2 (en) 1999-10-29 2006-10-10 Stratagene California Methods for detection of a target nucleic acid by capture
US20030224366A1 (en) * 1999-11-17 2003-12-04 Kurt Weindel Magnetic glass particles, method for their preparation and uses thereof
US20040203050A1 (en) * 1999-11-24 2004-10-14 Norbert Reich Polymer arrays and methods of using labeled probe molecules to identify and quantify target molecule expression
US6811973B1 (en) * 1999-11-24 2004-11-02 The Regents Of The University Of California Methods of using labeled probe molecules to quantify target molecules
US6458544B1 (en) 1999-12-02 2002-10-01 Dna Sciences, Inc. Methods for determining single nucleotide variations and genotyping
EP2112233A1 (en) * 2000-02-23 2009-10-28 City of Hope Pyrophosphorolysis activated polymerization (PAP): application to allele-specific amplification and nucleic acid sequence determination
US20110124051A1 (en) * 2000-02-23 2011-05-26 City Of Hope Pyrophosphorolysis activated polymerization (pap)
US7914995B2 (en) 2000-02-23 2011-03-29 City Of Hope Reaction mixture for pyrophosphorolysis activated polymerization (PAP)
US7919253B2 (en) 2000-02-23 2011-04-05 City Of Hope Serial coupling of nucleic acid metabolism and extension for nucleic acid amplification
US8173371B2 (en) 2000-02-23 2012-05-08 City Of Hope Serial coupling of nucleic acid metabolism and extension for nucleic acid amplification
US20100129871A1 (en) * 2000-02-23 2010-05-27 City Of Hope Pyrophosphorolysis activated polymerization (pap)
US20090239283A1 (en) * 2000-02-23 2009-09-24 City Of Hope Pyrophosphorolysis activated polymerization (pap)
US7129045B2 (en) 2000-03-23 2006-10-31 Lumigen, Inc. Methods of detecting polynucleotide kinase and its use as a label
US20040253585A1 (en) * 2000-03-23 2004-12-16 Hashem Akhavan-Tafti Methods of detecting polynucleotide kinase and its use as a label
WO2001071037A1 (en) * 2000-03-23 2001-09-27 Lumigen, Inc. Methods of detecting polynucleotide kinase and its use as a label
US20070003968A1 (en) * 2000-03-23 2007-01-04 Lumigen Inc. Methods of detecting polynucleotide kinase and its use as a label
US6355433B1 (en) 2000-06-02 2002-03-12 Dna Sciences, Inc. Determination of nucleotide sequence variations through limited primer extension
US20030198982A1 (en) * 2000-08-03 2003-10-23 Frank Seela Nucleic acid binding compounds containing pyrazolo[3,4-d]pyrimidine analogues of purin-2,6-diamine and their uses
US7238795B2 (en) 2000-08-03 2007-07-03 Roche Molecular Systems, Inc. Nucleic acid binding compounds containing pyrazolo[3,4-d]pyrimidine analogues of purin-2,6-diamine and their uses
US6358679B1 (en) 2000-08-24 2002-03-19 Pe Corporation (Ny) Methods for external controls for nucleic acid amplification
US20030027179A1 (en) * 2000-08-24 2003-02-06 Pe Corporation (Ny) External control reagents for nucleic acid amplification
US6890718B2 (en) 2000-08-24 2005-05-10 Applera Corporation External control reagents for nucleic acid amplification
US6905827B2 (en) 2001-06-08 2005-06-14 Expression Diagnostics, Inc. Methods and compositions for diagnosing or monitoring auto immune and chronic inflammatory diseases
US7026121B1 (en) 2001-06-08 2006-04-11 Expression Diagnostics, Inc. Methods and compositions for diagnosing and monitoring transplant rejection
US7829286B2 (en) 2001-06-08 2010-11-09 Xdx, Inc. Methods and compositions for diagnosing and monitoring transplant rejection
US8110364B2 (en) 2001-06-08 2012-02-07 Xdx, Inc. Methods and compositions for diagnosing or monitoring autoimmune and chronic inflammatory diseases
US7579148B2 (en) 2001-06-08 2009-08-25 Expression Diagnostics, Inc. Methods and compositions for diagnosing or monitoring autoimmune and chronic inflammatory diseases
US7960121B2 (en) 2001-06-08 2011-06-14 Xdx, Inc. Methods and compositions for diagnosing and monitoring transplant rejection
US7235358B2 (en) 2001-06-08 2007-06-26 Expression Diagnostics, Inc. Methods and compositions for diagnosing and monitoring transplant rejection
US20040009479A1 (en) * 2001-06-08 2004-01-15 Jay Wohlgemuth Methods and compositions for diagnosing or monitoring auto immune and chronic inflammatory diseases
US20030119005A1 (en) * 2001-12-14 2003-06-26 Motorola, Inc. Post-synthesis labeling of nucleic acids, assays using nucleic acids that are labeled post-synthetically, single nucleotide polymorphism detection, and associated compounds and microarrays
US7223538B2 (en) 2001-12-14 2007-05-29 Ge Healthcare Bio-Sciences Ab Post-synthesis labeling of nucleic acids, assays using nucleic acids that are labeled post-synthetically, single nucleotide polymorphism detection, and associated compounds and microarrays
WO2003057910A2 (en) 2002-01-08 2003-07-17 Roche Diagnostics Gmbh Use of silica material in an amplification reaction
US20110124852A1 (en) * 2002-02-27 2011-05-26 University Of Delaware Molecular markers for identification of fat and lean phenotypes in chickens
US20030186299A1 (en) * 2002-02-27 2003-10-02 Cogburn Larry A. Molecular markers for identification of fat and lean phenotypes in chickens
US9127308B2 (en) 2002-03-07 2015-09-08 Atlas Genetics Limited Nucleic acid probes, their synthesis and use
US7691569B2 (en) 2002-04-24 2010-04-06 Xdx, Inc. Methods and compositions for diagnosing and monitoring transplant rejection
US7785797B2 (en) 2002-04-24 2010-08-31 Xdx, Inc. Methods and compositions for diagnosing and monitoring transplant rejection
US7771950B2 (en) 2002-04-24 2010-08-10 Xdx, Inc. Methods and compositions for diagnosing and monitoring auto immune and chronic inflammatory diseases
US7604936B2 (en) 2002-04-24 2009-10-20 Xdx, Inc. Methods and compositions for diagnosis and monitoring auto immune and chronic inflammatory diseases
US9394332B2 (en) 2002-08-29 2016-07-19 Epigenomics Ag Method for bisulfite treatment
US20040241704A1 (en) * 2002-08-29 2004-12-02 Roche Molecular Systems, Inc Method for bisulfite treatment
US9868756B2 (en) 2002-08-29 2018-01-16 Epigenomics Ag Method for bisulfite treatment
US8114979B2 (en) 2002-09-20 2012-02-14 Integrated Dna Technologies, Inc. Di-alpha amino anthraquinone compositions
US20110060150A1 (en) * 2002-09-20 2011-03-10 Integrated Dna Technologies, Inc. Method of detecting fluorescence
US20040157247A1 (en) * 2002-12-20 2004-08-12 Roche Molecular Systems, Inc Mannitol and glucitol derivatives
US20050048517A1 (en) * 2002-12-20 2005-03-03 Stratagene Compositions and methods for polynucleotide detection
US7560231B2 (en) 2002-12-20 2009-07-14 Roche Molecular Systems, Inc. Mannitol and glucitol derivatives
US20060058518A1 (en) * 2003-01-29 2006-03-16 Frank Bergmann Method for bisulfite treatment
US7413855B2 (en) 2003-01-29 2008-08-19 Roche Molecular Systems, Inc. Method for bisulfite treatment
WO2004092412A2 (en) 2003-03-31 2004-10-28 Roche Diagnostics Gmbh Compositions and methods for detecting certain flaviviruses, including members of the japanese encephalitis virus serogroup
US20080038745A1 (en) * 2003-04-05 2008-02-14 Frank Bergmann Nucleotide analogs with six-membered rings
US7276592B2 (en) 2003-04-05 2007-10-02 Roche Diagnostics Operations, Inc. Nucleotide analogs with six-membered rings
US20050004078A1 (en) * 2003-04-05 2005-01-06 Frank Bergmann Nucleotide analogs with six-membered rings
US8105477B2 (en) 2003-04-16 2012-01-31 Handylab, Inc. System and method for electrochemical detection of biological compounds
US7879556B2 (en) 2003-04-24 2011-02-01 Xdx, Inc. Methods and compositions for diagnosing and monitoring transplant rejection
US7892745B2 (en) 2003-04-24 2011-02-22 Xdx, Inc. Methods and compositions for diagnosing and monitoring transplant rejection
US20070269803A1 (en) * 2003-06-26 2007-11-22 Khalil Arar Fluorogenic Nucleic Acid Probes Including Lna for Methods to Detect and/or Quantify Nucleic Acid Analytes
US20050037410A1 (en) * 2003-08-01 2005-02-17 Dieter Heindl Detection format for hot start real time polymerase chain reaction
US20090181401A1 (en) * 2003-08-01 2009-07-16 Dieter Heindl Detection format for hot start real time polymerase chain reaction
US20050079535A1 (en) * 2003-10-13 2005-04-14 Michael Kirchgesser Methods for isolating nucleic acids
US7329491B2 (en) 2003-10-13 2008-02-12 Roche Diagnostics Operations, Inc. Methods for isolating nucleic acids
US20070292970A1 (en) * 2003-11-04 2007-12-20 Martin Dugas Method for Distinguishing Aml-Specific Flt3 Length Mutations From Tkd Mutations
US20070275380A1 (en) * 2003-11-04 2007-11-29 Martin Dugas Method for Distinguishing Aml Subtypes With Aberrant and Prognostically Intermediate Karyotypes
US20070207459A1 (en) * 2003-11-04 2007-09-06 Martin Dugas Method For Distinguishing Immunologically Defined All Subtype
US20070212687A1 (en) * 2003-11-04 2007-09-13 Martin Dugas Method For Distinguishing Mll-Ptd-Positive Aml From Other Aml Subtypes
US20070099190A1 (en) * 2003-11-04 2007-05-03 Martin Dugas Method for distinguishing leukemia subtypes
US20070105118A1 (en) * 2003-11-04 2007-05-10 Martin Dugas Method for distinguishing aml subtypes with recurring genetic aberrations
US20070128607A1 (en) * 2003-11-04 2007-06-07 Martin Dugas Method for distinguishing aml subtypes with different gene dosages
US20070212734A1 (en) * 2003-11-04 2007-09-13 Martin Dugas Method for Distinguishing T(11Q23)/Mll-Positive Leukemias From t(11Q23)/Mll Negative Leukemia
US20070122814A1 (en) * 2003-11-04 2007-05-31 Martin Dugas Methods for distinguishing prognostically definable aml
US20070212688A1 (en) * 2003-11-04 2007-09-13 Martin Dugas Method For Distinguishing Cbf-Positive Aml Subtypes From Cbf-Negative Aml Subtypes
EP2308887A2 (en) 2003-11-12 2011-04-13 Bayer HealthCare LLC Oligonucleotides and methods for detection of west nile virus
US20090053821A1 (en) * 2003-11-14 2009-02-26 Integrated Dna Technologies, Inc. Fluorescence quenching azo dyes, their methods of preparation and use
US9540515B2 (en) 2003-11-14 2017-01-10 Integrated Dna Technologies, Inc. Fluorescence quenching azo dyes, their methods of preparation and use
US8084588B2 (en) 2003-11-14 2011-12-27 Integrated Dna Technologies, Inc. Fluorescence quenching azo dyes, their methods of preparation and use
US8377641B2 (en) 2003-11-14 2013-02-19 Integrated Dna Technologies, Inc. Fluorescence quenching azo dyes, their methods of preparation and use
US7541448B2 (en) 2003-12-02 2009-06-02 Roche Diagnostis Operations, Inc. Oligonucleotides containing molecular rods
US20050142598A1 (en) * 2003-12-02 2005-06-30 Dieter Heindl Oligonucleotides containing molecular rods
US7501240B2 (en) 2003-12-02 2009-03-10 Roche Molecular Systems, Inc. Method for bisulfite treatment
US20070281294A1 (en) * 2004-02-10 2007-12-06 Roche Moleculr Systems, Inc. Primers And Probes For The Detection Of Parvovirus B19
US7445898B2 (en) 2004-04-01 2008-11-04 Bio-Rad Laboratories, Inc. Quantitative amplification with a labeled probe and 3′ to 5′ exonuclease activity
US8426132B2 (en) 2004-04-01 2013-04-23 Bio-Rad Laboratories, Inc. Quantitative amplification with a labeled probe and 3′ to 5′ exonuclease activity
US20100159447A1 (en) * 2004-04-01 2010-06-24 Bio-Rad Laboratories, Inc. Quantitative amplification with a labeled probe and 3' to 5' exonuclease activity
EP2110439A1 (en) 2004-05-06 2009-10-21 F. Hoffmann-Roche AG SENP1 as a marker for cancer
US8926905B2 (en) 2004-06-07 2015-01-06 Fluidigm Corporation Optical lens system and method for microfluidic devices
US9663821B2 (en) 2004-06-07 2017-05-30 Fluidigm Corporation Optical lens system and method for microfluidic devices
US9234237B2 (en) 2004-06-07 2016-01-12 Fluidigm Corporation Optical lens system and method for microfluidic devices
US8721968B2 (en) 2004-06-07 2014-05-13 Fluidigm Corporation Optical lens system and method for microfluidic devices
US20070154889A1 (en) * 2004-06-25 2007-07-05 Veridex, Llc Methods and reagents for the detection of melanoma
WO2006006722A1 (en) 2004-07-13 2006-01-19 Takeda Pharmaceutical Company Limited Method of controlling cell functions
US20060040303A1 (en) * 2004-08-18 2006-02-23 Christian Weilke Reaction mixture for positioning a reaction vessel relative to a detection unit
EP2330214A1 (en) 2004-09-03 2011-06-08 F. Hoffmann-La Roche AG Method for DNA decontamination
US20090208930A1 (en) * 2004-09-03 2009-08-20 Frank Bergmann Dna decontamination method
US7989169B2 (en) 2004-09-03 2011-08-02 Roche Molecular Systems, Inc. Selective amplification of methylated nucleic acids
US7645575B2 (en) 2004-09-08 2010-01-12 Xdx, Inc. Genes useful for diagnosing and monitoring inflammation related disorders
US20060051796A1 (en) * 2004-09-09 2006-03-09 Inga Boell Real time PCR with the addition of pyrophosphatase
EP1634965A1 (en) 2004-09-09 2006-03-15 Boehringer Mannheim Gmbh Real time PCR with the addition of pyrophosphatase
US20090118132A1 (en) * 2004-11-04 2009-05-07 Roche Molecular Systems, Inc. Classification of Acute Myeloid Leukemia
WO2006081035A3 (en) * 2004-12-30 2007-12-13 Berry & Associates Inc Fluorous oligonucleotide reagents and affinity purification of oligonucleotides
US20060178507A1 (en) * 2004-12-30 2006-08-10 Berry & Associates, Inc. Fluorous oligonucleotide reagents and affinity purification of oligonucleotides
EP2348320A2 (en) 2005-03-10 2011-07-27 Gen-Probe Incorporated Systems and methods for detecting multiple optical signals
EP1921454A2 (en) 2005-03-10 2008-05-14 Gen-Probe Incorporated Systems and methods to perform assays for detecting or quantifying analytes
EP1909108A2 (en) 2005-03-10 2008-04-09 Gen-Probe Incorporated Systems and methods to perform assays for detecting or quantifiying analytes
EP1930730A2 (en) 2005-03-10 2008-06-11 Gen-Probe Incorporated Systems and methods to perform assays for detecting or quantifying analytes
EP2322940A1 (en) 2005-03-10 2011-05-18 Gen-Probe Incorporated Systems amd methods to perform assays for detecting or quantifing analytes within samples
EP2333561A2 (en) 2005-03-10 2011-06-15 Gen-Probe Incorporated System for performing multi-formatted assays
EP2348321A2 (en) 2005-03-10 2011-07-27 Gen-Probe Incorporated System and methods to perform assays for detecting or quantifying analytes within samples
US20060275798A1 (en) * 2005-04-04 2006-12-07 Steichen John C Detection of organisms using a media sachet and primer directed nucleic acid amplification
US20100076181A1 (en) * 2005-05-20 2010-03-25 Integrated Dna Technologies, Inc. Compounds and methods for labeling oligonucleotides
US7476735B2 (en) 2005-05-20 2009-01-13 Integrated Dna Technologies, Inc. Compounds and methods for labeling oligonucleotides
US7605243B2 (en) 2005-05-20 2009-10-20 Integrated Dna Technologies, Inc. Compounds and methods for labeling oligonucleotides
US20090299041A1 (en) * 2005-05-20 2009-12-03 Integrated Dna Technologies, Inc. Compounds and methods for labeling oligonucleotides
US8258276B2 (en) 2005-05-20 2012-09-04 Integrated Dna Technologies, Inc. Compounds and methods for labeling oligonucleotides
US7645872B2 (en) 2005-05-20 2010-01-12 Integrated Dna Technologies, Inc. Compounds and methods for labeling oligonucleotides
US20100298554A1 (en) * 2005-05-20 2010-11-25 Integrated Dna Technologies, Inc. Compounds and methods for labeling oligonucleotides
US7803936B2 (en) 2005-05-20 2010-09-28 Integrated Dna Technologies, Inc. Compounds and methods for labeling oligonucleotides
US8030460B2 (en) 2005-05-20 2011-10-04 Integrated Dna Technologies, Inc. Compounds and methods for labeling oligonucleotides
US20080254525A1 (en) * 2005-06-28 2008-10-16 Invitrogen Corporation DNA Polymerase Blends and Mutant DNA Polymerases
WO2007002031A2 (en) 2005-06-28 2007-01-04 Invitrogen Corporation Dna polymerase blends and mutant dna polymerases
EP2314596A2 (en) 2005-06-28 2011-04-27 Life Technologies Corporation DNA-Polymerase blends and mutant DNA polymerases
US9376698B2 (en) 2005-06-28 2016-06-28 Life Technologies Corporation Mutant DNA polymerases
EP1739190A1 (en) 2005-06-30 2007-01-03 Boehringer Mannheim Gmbh Light emission modifiers and their uses in nucleic acid detection, amplification and analysis
EP2128269A1 (en) 2005-06-30 2009-12-02 Boehringer Mannheim Gmbh Light emission modifiers and their uses in nucleic acid detection, amplification and analysis
US20070190540A1 (en) * 2005-09-01 2007-08-16 Corbett Life Science Pty Ltd Methods for the amplification, quantitation and identification of nucleic acids
US8962250B2 (en) 2005-09-01 2015-02-24 Qiagen Gmbh Methods for the amplification, quantitation and identification of nucleic
US7781165B2 (en) 2005-10-19 2010-08-24 Roche Diagnostics Operations, Inc. Benzimidazolium compounds and salts of benzimidazolium compounds for nucleic acid amplification
EP3061834A1 (en) 2005-10-21 2016-08-31 The Regents of the University of California Shp-2 gene mutations in melanoma
EP1801114A1 (en) 2005-11-23 2007-06-27 Boehringer Mannheim Gmbh Polynucleotides with a phosphate mimetic
US7741472B2 (en) 2005-11-23 2010-06-22 Roche Diagnostics Operations, Inc. Polynucleotide containing a phosphate mimetic
US7981606B2 (en) 2005-12-21 2011-07-19 Roche Molecular Systems, Inc. Control for nucleic acid testing
US20070141563A1 (en) * 2005-12-21 2007-06-21 Roche Molecular Systems, Inc. Control for nucleic acid testing
US20100285535A1 (en) * 2006-02-27 2010-11-11 Waltraud Ankenbauer Pcr hot start by magnesium sequestration
US8026058B2 (en) 2006-02-27 2011-09-27 Roche Diagnostics Operations, Inc. PCR hot start by magnesium sequestration
US20080090240A1 (en) * 2006-04-07 2008-04-17 Lailing Ku Neisseria gonorrhoeae specific oligonucleotide sequences
US7790386B2 (en) 2006-04-07 2010-09-07 Siemens Healthcare Diagnostics Inc. Neisseria gonorrhoeae specific oligonucleotide sequences
EP1847616A2 (en) 2006-04-07 2007-10-24 Siemens Medical Solutions Diagnostics Neisseria gonorrhoeae specific oligonucleotide sequences
EP2016188A1 (en) * 2006-04-24 2009-01-21 Xiyu Jia Methods for detection of methylated dna
EP2016188B1 (en) * 2006-04-24 2015-10-21 Xiyu Jia Methods for detection of methylated dna
EP2636755A1 (en) 2006-05-26 2013-09-11 AltheaDx Incorporated Biochemical analysis of partitioned cells
EP2017356A2 (en) 2006-06-06 2009-01-21 Gen-Probe Incorporated Tagged oliggonucleotides and their use in nucleic acid amplification methods
EP2345740A1 (en) 2006-06-06 2011-07-20 Gen-Probe Incorporated Tagged oligonucleotides and their use in nucleic acid amplification methods
US7993832B2 (en) 2006-08-14 2011-08-09 Xdx, Inc. Methods and compositions for diagnosing and monitoring the status of transplant rejection and immune disorders
US20100261617A1 (en) * 2006-09-14 2010-10-14 Deutsches Krebsforschungszentrum Stiftung des öffentkuchen Rechts Gene expression signature for the prognosis, diagnosis, and therapy of prostate cancer and uses thereof
US20090317888A1 (en) * 2006-10-09 2009-12-24 Lars-Erik Peters Thermus egertssonii dna polymerases
US8183023B2 (en) 2006-10-09 2012-05-22 Qiagen Gmbh Thermus egertssonii DNA polymerases
US8148067B2 (en) 2006-11-09 2012-04-03 Xdx, Inc. Methods for diagnosing and monitoring the status of systemic lupus erythematosus
EP1932913A1 (en) 2006-12-11 2008-06-18 Boehringer Mannheim Gmbh Nucleic acid isolation using polidocanol and derivatives
US8192958B2 (en) 2006-12-11 2012-06-05 Roche Molecular Systems, Inc. Nucleic acid isolation using polidocanol and derivatives