US5753787A - Nucleic acids encoding ancylostoma secreted protein - Google Patents

Nucleic acids encoding ancylostoma secreted protein Download PDF

Info

Publication number
US5753787A
US5753787A US08/419,414 US41941495A US5753787A US 5753787 A US5753787 A US 5753787A US 41941495 A US41941495 A US 41941495A US 5753787 A US5753787 A US 5753787A
Authority
US
United States
Prior art keywords
asp
protein
seq
hookworm
nucleic acid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
US08/419,414
Inventor
John M. Hawdon
Peter J. Hotez
Brian F. Jones
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Yale University
Original Assignee
Yale University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Yale University filed Critical Yale University
Priority to US08/419,414 priority Critical patent/US5753787A/en
Assigned to YALE UNIVERSITY reassignment YALE UNIVERSITY ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: HAWDON, JOHN M., HOTEZ, PETER J., JONES, BRIAN F.
Priority to PCT/US1996/004821 priority patent/WO1996032479A1/en
Priority to AU55379/96A priority patent/AU5537996A/en
Assigned to NATIONAL INSTITUTES OF HEALTH, THE reassignment NATIONAL INSTITUTES OF HEALTH, THE CONFIRMATORY LICENSE (SEE DOCUMENT FOR DETAILS). Assignors: YALE, UNIVERSITY
Application granted granted Critical
Publication of US5753787A publication Critical patent/US5753787A/en
Assigned to NATIONAL INSTITUTES OF HEALTH, THE reassignment NATIONAL INSTITUTES OF HEALTH, THE CONFIRMATORY LICENSE (SEE DOCUMENT FOR DETAILS). Assignors: YALE UNIVERSITY
Assigned to NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF HEALTH AND HUMAN SERVICES (DHHS), U.S. GOVERNMENT reassignment NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF HEALTH AND HUMAN SERVICES (DHHS), U.S. GOVERNMENT CONFIRMATORY LICENSE (SEE DOCUMENT FOR DETAILS). Assignors: YALE UNIVERSITY
Anticipated expiration legal-status Critical
Expired - Fee Related legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/43504Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
    • C07K14/43536Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from worms
    • C07K14/4354Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from worms from nematodes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies

Definitions

  • the present invention is generally in the area of treatments and diagnostics for hookworm infection.
  • Hookworm disease continues to rank among the most important infectious diseases on a world-wide basis. Over 20% of the world population is infected, and hookworms are the leading cause of anemia in the tropics (Gilles, Reviews of Infectious Diseases 7: 111-118 (1985)). In China alone, an estimated 194 million people are infected with hookworm, with up to 50 percent prevalence in the agriculturally rich areas along the Yangtze River.
  • hookworm remains a serious geohelminth infection. This is due to several factors. First, many of the latest generation of anthelminthics are prohibitively expensive, and therefore unaffordable by the developing countries that would benefit most from their use. Secondly, there is no sterile immunity developed following hookworm infection, such that people treated with anthelminthics are quickly re-infected when they are re-exposed to infective stages. Third, previously unreported toxicities have been now observed with wide scale use of anthelminthic drugs including seizures, encephalitis and deafness. Fourth, disappointing efficacy has been noted with the conventional anthleminthic drugs.
  • An effective and inexpensive recombinant vaccine would provide an affordable approach to controlling the ravages of hookworm disease.
  • the protein has been designated Ancylostoma Secreted Protein (ASP).
  • ASP has an apparent molecular weight of 37-40 kDa.
  • ASP from Ancylostoma caninum contains 406 amino acids.
  • the pro-form of ASP contains an 18 amino acid secretion signal sequence which does not appear in mature ASP.
  • ASP is released from larval A. caninum that begin feeding.
  • DNA encoding the protein has been isolated.
  • the protein can be made by recombinant means in a variety of hosts.
  • the recombinant protein, or immunogenic fragments thereof, can be formulated as a vaccine.
  • the recombinant protein, or antibodies to the protein, can also be used in an assay to detect hookworm infection.
  • DNA encoding all or parts of the protein can be used as probes to detect the presence of hookworm nucleic acid. Such probes are useful in assays of tissue samples, body fluid samples, and hookworm infection sources.
  • a protein that is released by hookworm larvae following infection designated Ancylostoma Secreted Protein.
  • the protein has an apparent molecular weight of 37-40 kDa.
  • ASP from Ancylostoma caninum contains 406 amino acids.
  • the pro-form of ASP contains an 18 amino acid secretion signal sequence which does not appear in mature ASP.
  • the sequence of A. caninum ASP is listed as SEQ ID NO:2. This sequence includes the 18 amino acid secretion signal sequence.
  • ASP is released from larval A. caninum that begin feeding. Larvae begin feeding at the transition from the free-living stage to the parasitic stage. ASP is thought to be involved in this transition.
  • Ancylostoma Secreted Protein and ASP refer to a protein having the amino acid sequence shown in SEQ ID NO:2 from amino acid 19 to amino acid 424; derivatives thereof with conservative amino acid substitutions, deletions, or additions; any homolog or allelic form of ASP produced in nematodes; any protein having at least 40% amino acid sequence identity with amino acids 19 to 424 of SEQ ID NO:2; or any protein that is immunoreactive with an antibody immunoreactive with the ASP of SEQ ID NO:2 but that is not immunoreactive with hymenoptera proteins.
  • ASP derivatives have an amino acid sequence identity with amino acids 19 to 424 of SEQ ID NO:2 of greater than 40%, such as at least 50% amino acid sequence identity, at least 60% amino acid sequence identity, or at least 70% amino acid sequence identity.
  • ASP derivatives have at least 80% amino acid sequence identity; more preferably, at least 90% amino acid sequence identity; and most preferably, at least 95% amino acid sequence identity with amino acids 19 to 424 of SEQ ID NO:2.
  • percent amino acid sequence identity is calculated as the percentage of aligned amino acids that match the reference sequence, where the sequence alignment has been determined using the alignment algorithm of Dayhoff et al., Methods in Enzymology 91: 524-545 (1983).
  • the reference sequence is amino acids 19 to 424 of SEQ ID NO:2.
  • all amino acid position references use the numbering shown in SEQ ID NO:2.
  • immunoreactivity is determined by any standard technique for detecting antibody-antigen interactions. Many assays useful for determining immunoreactivity are described in Johnstone and Thorpe, Immunochemistry in Practice, Second edition (Blackwell Scientific Publications, Oxford, 1987). Preferred assays are the immunoassays described on pages 241 to 260 of Johnstone and Thorpe.
  • preferred fragments are those that are not immunoreactive with antibodies that are immunoreactive to proteins other than ASP. Accordingly, preferred immunogenic fragments of ASP have an amino acid sequence with at least five consecutive amino acids that are present in an ASP as defined above, where no amino acid sequence of five or more, six or more, seven or more, or eight or more consecutive amino acids present in the immunogenic fragment of ASP is present in a protein other than ASP. More preferred immunogenic fragments of ASP have an amino acid sequence of at least five consecutive amino acids in SEQ ID NO:2, where no amino acid sequence of five or more, six or more, seven or more, or eight or more, consecutive amino acids present in the immunogenic fragment of ASP is present in a protein other than ASP.
  • Antibodies against the antigen 5 of the yellow jacket Vespula squarnosa recognize a 40 kDa protein in activated, but not in non-activated, A. caninum L 3 excretory/secretory (ES) products. Additionally, this antibody recognizes a 38 kDa protein in lysates of bacteria that are expressing a one kilobase 3'-end fragment of the ASP cDNA, but not in uninduced bacteria.
  • the anti-antigen 5 antibody recognizes bands of slightly higher molecular weight, approximately 42 kDa, in soluble extracts of A. caninum adults and L 3 and A. braziliense, Haemonchus contortus, and Strongyloides stercoralis L 3 . The size difference is due to the presence of the 18 amino acid eukaryotic secretory signal peptide of ASP in the unsecreted form.
  • a cDNA molecule encoding ASP has the nucleotide sequence listed as SEQ ID NO:1.
  • the coding region in this sequence is 1272 nucleotides long.
  • the coding region for mature ASP begins at nucleotide 55 and ends at nucleotide 1272. Unless otherwise stated, all nucleotide position references use the numbering shown in SEQ ID NO:1.
  • nucleic acid molecule encoding ASP refers to a nucleic acid molecule encoding a protein having the amino acid sequence shown in SEQ ID NO360:2 from amino acid 19 to amino acid 424; derivatives thereof with conservative amino acid substitutions, deletions, or additions; any homolog or allelic form of ASP produced in nematodes; any protein having at least 40% amino acid sequence identity with amino acids 19 to 424 of SEQ ID NO:2; or any protein that is immunoreactive with an antibody immunoreactive with the ASP of SEQ ID NO:2 but that is not immunoreactive with hymenoptera proteins.
  • the encoded ASP derivatives have an amino acid sequence identity with amino acids 19 to 424 of SEQ ID NO:2 of greater than 40%, such as at least 50% amino acid sequence identity, at least 60% amino acid sequence identity, or at least 70% amino acid sequence identity.
  • the encoded ASP derivatives have at least 80% amino acid sequence identity; more preferably, at least 90% amino acid sequence identity; and most preferably, at least 95% amino acid sequence identity with amino acids 19 to 424 of SEQ ID NO:2. Amino acid sequence identity and immunoreactivity of the encoded protein are determined as described earlier.
  • Nucleic acid molecules encoding all or a part of ASP can be manipulated using any of the numerous nucleic acid manipulation methods known to those of skill in the art. Such manipulation include amplification, purification, recombination, insertion into vectors, and use as probes, consisting of at least 14 to 17 nucleotides, and primers.
  • ASP can be made recombinantly using any of the established expression systems, such as bacteria, yeast, baculovirus, and mammalian cell culture.
  • recombinant refers to any protein or nucleic acid produced by any methods within the large body of well known nucleic acid manipulations, examples of which are provided below.
  • any protein or nucleic acid that results from, or is expressed from a nucleic acid resulting from, such manipulations is a recombinantly produced protein or nucleic acid.
  • Recombinant expression allows the production of fragments of ASP, combinations of ASP fragments in a single fusion protein, and fusion proteins combining ASP, or a fragment of ASP, with one or more other proteins or amino acid sequences. Such fusions are useful for combining multiple immunogenic fragments in a single protein.
  • the DNA used to produce ASP may be genomic DNA, in which case it may include introns, or it may be cDNA which is prepared in vitro from mRNA using a reverse transcriptase and which contains open reading frames. Methods for isolation, cloning or synthesizing DNA and cDNA are well known to those of skill in the art.
  • Expression refers to the process by which nucleic acid is transcribed and translated into peptides, polypeptides, or proteins. If the nucleic acid is derived from genomic DNA, expression may, if an appropriate eukaryotic host cell or organism is selected, include splicing of the mRNA.
  • An expression vector refers to a recombinant DNA or RNA construct, such as a plasmid, a phage, recombinant virus or other vector that, upon introduction into appropriate host cells, causes nucleic acid molecules that have been cloned into the vector to be transcribed, and then translation of the transcribed nucleic acid into a polypeptide.
  • the nucleic acid molecule is cloned into the vector in such a manner that it is operably linked to regulatory sequences that effect expression of the heterologous nucleic acid molecules.
  • the expression product may be exported to the cytoplasm and/or may be secreted out of the host cell.
  • Appropriate expression vectors are well-known to those of skill in the art and include those that are replicable in eukaryotic cells and/or prokaryotic cells. Such expression vectors may remain episomal or may integrate into the host cell genome.
  • the ASP cDNA or gene can be inserted into appropriate expression vectors containing expression regulatory elements, such as transcription initiation signals, translation initiation signals, starting codon, termination codon, transcription terminating signals, polyadenylation signals, and others. Suitable vectors are commercially available from a variety of companies. After the recombinant vectors containing ASP-encoding DNA are transfected into the host cells, they may remain as extrachromosomal DNA or they may be integrated into the host genome. In either case, they may direct the synthesis of recombinant ASP in the host cells. Some examples for the expression of heterologous genes are described in Methods in Enzymology, Vol.
  • E. coli or other bacteria as host Many mammalian cDNA's have been expressed in E. coli and many expression vectors with different promoters, operators, and other regulatory elements are available commercially. A typical vector construction and expression is described by Lin and Tang, J. Biol. Chem. 264: 4482-4489 (1989). The expression of some eukaryotic proteins in the cytosol of E. coli produces insoluble ⁇ inclusion bodies ⁇ and would require the refolding of recombinant protein. However, the use of a ⁇ leader ⁇ sequence, such as omp, described by Duffaud et al. in Methods in Enzymology 153: 492-506 (Wu and Grossman, eds., Academic Press, 1987), will direct the proper folding and also export of the recombinant ASP to the periplasmic space of the bacterial.
  • ⁇ leader ⁇ sequence such as omp
  • yeast host cells may express a foreign gene either in the cytosol or as secreted protein.
  • Fungi as host There are small numbers of fungal expression vectors which have been successfully used to express heterologous genes.
  • the existing fungal expression vectors integrate themselves into the host genome after transfection as indicated by Cullen et al., in A Survey of Molecular Cloning Vectors and their Uses, (Butterworth Publishers, Stoneham, MA 1986).
  • the secreted recombinant proteins can be glycosylated.
  • Some examples of successful expressions involve bovine chymosin, described by Cullen et al., Bio/Technology 5: 369-378 (1987), and an acid protease from a different fungus, described by Gray et al., Gene 48: 41-53 (1987).
  • Insect cells as host Baculovirus expression vectors for the synthesis of foreign genes in insect cells have been successfully used to express many eukaryotic and viral proteins. This system is capable of glycosylation, if the protein has glycosylation sites, and can also express recombinant proteins at a high level. The use of this system has been reviewed in some detail by Luckow and Summers, Bio/Technology, Sep. 11, 1987. The recombinant ASP fusion proteins can also be expressed in insect cells using other expression vectors such as Entomopox viruses and cytoplasmic polyhedrosis viruses (CPV).
  • CPV cytoplasmic polyhedrosis viruses
  • Mammalian cells as host Many heterologous genes have been expressed in mammalian cells on a commercial scale. The commercial production of recombinant human tissue plasminogen activator is an example. Most of these expression vectors contain 1) either a mammalian promoter, such as metallocyanin or growth hormone, or viral promoters, such as SV40 early promoter or long terminal repeats of viral genes; 2) polyadenylation signals; and 3) appropriate regulatory elements for E. coli cloning including antibiotic resistance genes. After the insertion of ASP downstream from the promoter, the vector can be first cloned in E. coli, isolated and transfected into mammalian cells.
  • a mammalian promoter such as metallocyanin or growth hormone
  • viral promoters such as SV40 early promoter or long terminal repeats of viral genes
  • polyadenylation signals such as SV40 early promoter or long terminal repeats of viral genes
  • polyadenylation signals such as SV40 early promoter or long terminal
  • Neomycin or similar resistant selection markers can be either cotransfected in another vector or in the same vector.
  • a gene amplification system is advantageous.
  • the expression vector can contain the gene of dihydrofolate reductase (dhfr).
  • dhfr dihydrofolate reductase
  • the cloned gene can be coamplified with that of dhfr by adapting the transformed cells to increasing methotrexate concentration.
  • the transformant clones secreting ASP can be identified by enzyme assays or by western blots.
  • Methods for purifying proteins are well known and can be generally divided into chromatographic methods, for example, ion exchange chromatography, molecular weight sieving, high pressure liquid chromatography, affinity chromatography, and electrophoretic methods, for example, electrophoresis on agarose or acrylamide gels and isoelectric focusing. Any of these methods can be adapted to purify ASP.
  • a preferred method of purification is affinity chromatography.
  • immunoaffinity chromatography an antibody to ASP is immobilized on a chromatographic substrate, a mixture containing ASP is applied to the substrate under conditions allowing the antibody to bind ASP, the unbound material is removed by washing, and the bound ASP is eluted using, for example, high or low pH, protein denaturants or chaotropes.
  • ASP may be purified by affinity chromatography using one or a combination of immobilized antibodies such as those described below covalently bound to agarose beads or bound non-covalently via a Goat-anti mouse IgM antibody to Staphylococcus aureus protein G beads.
  • ASP isolation can also be achieved, for example, by incubating cell extracts with an anti-ASP antibodies, described below, attached to a solid phase, such as chemical conjugation to agarose beads. After incubation, the beads are washed, denatured and resolved on a polyacrylamide gel.
  • ASP or immunogenic fragments of ASP can be formulated and packaged using methods and materials known to those skilled in the art of vaccines, examples of which are described below.
  • an immunogenic fragment of a protein is a protein fragment of at least five to eight amino acids that elicits an immune response in an animal or individual.
  • ASP or immunogenic fragments of ASP can be fused to one or more other proteins or amino acid sequences. Such fusions are useful for combining multiple antigens in a single vaccine.
  • Simple liquid carriers such as water or a buffered saline, can be used; either alone or in combination with other carriers.
  • Adjuvants For administration as a vaccine, ASP can be combined with an adjuvant, in an amount effective to enhance the immunogenic response.
  • a common adjuvant widely used in humans is alum, that is, aluminum phosphate or aluminum hydroxide. Saponin and its purified component Quil A, Freund's complete adjuvant and other adjuvants used in research and veterinary applications have toxicities which limit their potential use in human vaccines. Chemically defined preparations such as muramyl dipeptide, monophosphoryl lipid A, and phospholipid conjugates such as those described by Goodman-Snitkoff et al., J. Immunol. 147: 410-415 (1991), and incorporated by reference herein, can also be used.
  • a preferred adjuvant is Syntex Adjuvant Formulation (SAF), which is described by Allison and Byars, J. Immunol. Methods 95: 157 (1986), and Byars and Allison, Vaccine 5: 223 (1987).
  • CT cholera toxin
  • mucosally delivered CT functions as a powerful immunostimulant or adjuvant of both mucosal and humoral immunity. It is therefore preferred to enhance immunogenicity of the orally administered antigen by including CT in the vaccine.
  • adjuvants examples include muramyl dipeptides, muramyl tripeptide, cytokines, diphtheria toxin, and exotoxin A.
  • Commercially available adjuvants include QS-21 from Cambridge Biosciences, Worcester, MA, and monophosphoryl lipid A (MPLA) from Ribi Immunochem.
  • the carrier may also be a polymeric delayed release system. Synthetic polymers are particularly useful in the formulation of a vaccine to effect the controlled release of antigens. An example of this is described by Kreuter, Microcapsules and Nanoparticles in Medicine and Pharmacology, pages 125-148 (M. Donbrow, ed., CRC Press). The use of other particles have demonstrated that the adjuvant effect of these polymers depends on particle size and hydrophobicity.
  • Microencapsulation has been applied to the injection of microencapsulated pharmaceuticals to give a controlled release.
  • a number of factors contribute to the selection of a particular polymer for microencapsulation.
  • the reproducibility of polymer synthesis and the microencapsulation process, the cost of the microencapsulation materials and process, the toxicological profile, the requirements for variable release kinetics and the physicochemical compatibility of the polymer and the antigens are all factors that must be considered.
  • useful polymers are polycarbonates, polyesters, polyurethanes, polyorthoesters, and polyamides, particularly those that are biodegradable.
  • PLGA poly (d,l-lactide-co-glycolide)
  • PLGA poly (d,l-lactide-co-glycolide)
  • the PLGA microencapsulation process uses a phase separation of a water-in-oil emulsion.
  • ASP is prepared as an aqueous solution and the PLGA is dissolved in a suitable organic solvents such as methylene chloride and ethyl acetate. These two immiscible solutions are co-emulsified by high-speed stirring. A non-solvent for the polymer is then added, causing precipitation of the polymer around the aqueous droplets to form embryonic microcapsules.
  • microcapsules are collected, and stabilized with one of an assortment of agents (polyvinyl alcohol (PVA), gelatin, alginates, polyvinylpyrrolidone (PVP), methyl cellulose) and the solvent removed by either drying in vacuo or solvent extraction.
  • agents polyvinyl alcohol (PVA), gelatin, alginates, polyvinylpyrrolidone (PVP), methyl cellulose
  • Proteosome Carriers Proteosomes, combinations of protein and liposomes, can also be used as carriers for ASP; using ASP as the protein component.
  • the procedures and materials for the use of proteosomes are as described in Lowell et al., Science 240:800 (1988); Lowell, in New Generation Vaccines (Woodrow and Levine, eds., Marcel Dekker, NY, 1990), Ch. 12, pages 141-160; and Orr et al., Infect. Immun. 61: 2390 (1993), the teachings of which are incorporated herein.
  • the immunogenic vaccine composition can contain other physiologically acceptable ingredients such as water, saline or a mineral oil such as DrakeolTM, MarkolTM, and squalene, to form an emulsion, or in combination with aqueous buffers, or encapsulated within a capsule or enteric coating to protect the protein from degradation while passing through the stomach.
  • physiologically acceptable ingredients such as water, saline or a mineral oil such as DrakeolTM, MarkolTM, and squalene
  • Nucleic acid encoding all or an immunogenic part of ASP can also be used as or in a vaccine.
  • a benign microorganism expressing ASP can be administered as a vaccine.
  • a vaccine of this type is described by Eisinstein, Science 214: 337-338 (1981).
  • Nucleic acid encoding ASP can also be directly administered, in the manner described by Liu et al., AIDS Research and Human Retroviruses 10: S34 (1994), and Donnelly et al., J. Immunol. Methods 176(2): 145-152 (1994).
  • the vaccine is packaged in a single dosage for immunization by parenteral, that is, intramuscular, intradermal or subcutaneous, administration; or nasopharyngeal, that is, intranasal, administration.
  • the effective dosage is determined using standard techniques, such as antibody titer.
  • the antigen may be lyophilized for resuspension at the time of administration or in solution. If administered with adjuvant, the adjuvant may be administered in combination with or in the vicinity of the vaccine.
  • Immunity can be measured using assays to detect and quantitate antibodies that bind to ASP.
  • Cellular immunity can be measured using assays that measure specific T-cell responses such as delayed type hypersensitivity (DTH) and lymphocyte proliferation.
  • DTH delayed type hypersensitivity
  • the dosage is determined by the antigen loading and by standard techniques for determining dosage and schedules for administration for each antigen, based on titer of antibody elicited by the antigen administration.
  • a dose effective to elicit an immune response is considered to be one that causes antibody titer to increase compared to untreated animals or individuals, using any of the known methods of titering antibodies.
  • ASP vaccine use in animals and to test the use of ASP as a vaccine, the following procedure can be used.
  • Dogs in the experimental group can be immunized with 0.2 mg of recombinant ASP in the presence of an equal volume of aluminum hydroxide (alum).
  • the initial injection can be performed at an intramuscular (i.m.) site.
  • control dogs can be injected with alum alone.
  • Boosts can be administered over two week intervals.
  • the first boost can also use 0.2 mg recombinant ASP injected i.m. in the presence of an alum adjuvant, while the second boost can use 0.1 mg of recombinant ASP in buffer administered by the intravenous route.
  • Circulating antibodies to recombinant ASP can be detected by enzyme immunoassay using recombinant ASP as antigen. Such assays are described below. Briefly, plates can be coated with 1 microgram of recombinant ASP per well. Horse radish peroxidase (HRP)-conjugated goat anti-dog IgG antibodies is used at 1:1,000 dilution. Canine immune responses can also be measured by immunofluorescence (IFA), two-direction agarose diffusion and by Western/immunoblotting as described by Liu Shu-xian et al., SE Asian J. Trop. Med. Pub. Health 24: 61-65 (1993).
  • HRP horse radish peroxidase
  • IFA immunofluorescence
  • Detection and quantitation of ASP, hookworm nucleic acid, and anti-ASP antibodies in clinical samples and body fluids can be accomplished using any of the known methods for detection of antigens, nucleic acids, and antibodies. Such assay are useful for determining if an individual is infected with hookworm, whether an individual is producing hookworm antibodies, and for testing the concentration or potency of ASP vaccines or ASP antibodies.
  • an antibody specific for ASP protein is an antibody that is immunoreactive with an ASP protein, as defined herein, but that is not immunoreactive with hymenoptera proteins.
  • mice Animals such as mice may be immunized by administration of an amount of ASP, or a fragment of ASP, effective to produce an immune response.
  • a mouse is subcutaneously injected in the back with 100 micrograms of antigen, followed three weeks later with an intraperitoneal injection of 100 micrograms of ASP with adjuvant, most preferably Freund's complete adjuvant. Additional intraperitoneal injections every two weeks with adjuvant, preferably Freund's incomplete adjuvant, may be necessary until the proper titer in the mouse's blood is achieved.
  • a titer of at least 1:5000 is preferred, and a titer of 1:100,000 or more is most preferred.
  • Rabbits may be immunized by administration of ASP, or a fragment of ASP, effective to produce an immune response.
  • a rabbit is intradermally and intravascularly injected at multiple sites with an adjuvant, preferably Freund's complete adjuvant, and ASP coupled to a carrier.
  • In vitro immunization of human lymphocytes can be used to generate human monoclonal antibodies (MAb) to ASP.
  • Techniques for in vitro immunization of human lymphocytes are well known to those skilled in the art. Examples of this method are described by Inai et al., Histochemistry (Germany) 99(5): 335-362 (May 1993); Mulder et al., Hum. Immunol. 36(3): 186-192 (Mar. 1993); Harada et al., J. Oral Pathol. Med. (Denmark) 22(4): 145-152 (Apr. 1993); Stauber et al., J. Immunol.
  • MAbs to ASP can be produced after immunization of mice with purified ASP or a fragment of ASP.
  • Hybridomas are produced using spleen cells from mice immunized with the antigen. The spleen cells of each immunized mouse is fused with mouse myeloma Sp 2/0 cells, for example using the polyethylene glycol fusion method described by Galfre and Milstein (1981). Growth of hybridomas, selection in HAT medium, cloning and screening of clones against antigens are carried out using standard methodology described by Galfre and Milstein (1981).
  • HAT-selected clones are injected into mice to produce large quantities of MAb in ascites, as described by Galfreand Milstein (1981), and the MAbs in ascites may then, if desired, be purified using protein A column chromatography.
  • MAbs are selected on the basis of their (a) specificity for ASP, (b) high binding affinity, (c) isotype, and (d) stability.
  • ASP antibodies can be purified by affinity chromatography using antigen molecules immobilized on a solid support.
  • Anti-ASP antibodies can be directly or indirectly labelled with a detectable label to facilitate detection of the presence of the antibodies by detection of the label.
  • a detectable label such as, but not restricted to, 32 P, 3 H, 14 C, 35 S, 125 I, or 131 I.
  • the radiolabel is generally attached by chemical modification. Detection of a label can be by methods such as scintillation counting, gamma ray spectrometry or autoradiography.
  • Fluorogens can also be used directly or indirectly to label the anti-ASP antibodies.
  • fluorogens include fluorescein and derivatives, phycoerythrin, allo-phycocyanin, phycocyanin, rhodamine, or Texas Red.
  • the fluorogens are generally attached by chemical modification and can be detected by a fluorescence detector.
  • the anti-ASP antibody can alternatively be labelled directly or indirectly with a chromogen to provide an enzyme or affinity label.
  • the antibody can be biotinylated so that it can be utilized in a biotin-avidin reaction which may also be coupled to a label such as an enzyme or fluorogen.
  • the antibody can be labelled with peroxidase, alkaline phosphatase or other enzymes giving a chromogenic or fluorogenic reaction upon addition of substrate.
  • Additives such as 5-amino-2,3-dihydro-1,4-phthalazinedione, also known as LuminolTM(Sigma Chemical Company, St.
  • rate enhancers such as p-hydroxybiphenyl, also known as p-phenylphenol (Sigma Chemical Company, St. Louis, Mo.) can be used to amplify enzymes such as horseradish peroxidase through a luminescent reaction; and luminogeneic or fluorogenic dioxetane derivatives of enzyme substrates can also be used.
  • enzymes such as horseradish peroxidase through a luminescent reaction
  • luminogeneic or fluorogenic dioxetane derivatives of enzyme substrates can also be used.
  • Such labels can be detected using enzyme-linked immunosorbent assays (ELISA) or by detecting a color change with the aid of a spectrophotometer.
  • ELISA enzyme-linked immunosorbent assays
  • Anti-ASP antibodies can be screened or tested for specificity using any of a variety of standard techniques, including Western Blotting and ELISA, both described by Koren et al., Biochim. Biophys., Acta 876: 91-100 (1986). Many assays useful for determining immunoreactivity and specificity are described in Johnstone and Thorpe, Immunochemistry in Practice, Second edition (Blackwell Scientific Publication, Oxford, 1987). For example, in ELISA, separate wells in microtiter plates are coated with purified ASP which adsorb to the wall of the wells. The wells are then treated with a blocking agent, such as bovine serum albumin or nonfat milk proteins, to cover areas in the wells not bound by antigen.
  • a blocking agent such as bovine serum albumin or nonfat milk proteins
  • Ascites fluid or other antibody-containing preparation can then be applied to each well in varying concentrations and adequate time allowed for antibody to bind the antigen adsorbed on the wall of each well.
  • the presence of antibody bound to antigen in a well can then be detected using a standard enzyme-conjugated anti-mouse antibody which will bind antibody that has bound to ASP in the well.
  • Wells in which antibody is bound to antigen are then identified by adding a chromogenic substrate for the enzyme conjugated to the anti-antibody antibody and color production detected by an optical device such as ELISA plate reader.
  • Antibodies that bind to a particular ASP fragment with no reactivity with other ASP regions are considered specific for that fragment.
  • specificity of MAbs for a particular ASP fragment individual wells on ELISA plates are coated with various ASP fragments and subjected to the identical procedure.
  • a competitive ELISA is carried out as follows. For example, one of the antibodies is biotinylated whereas the other is not so modified. Mixtures containing a constant concentration of the biotinylated antibody and increasing concentrations of the non-biotinylated antibody are incubated with wells coated with the appropriate ASP fragment.
  • the quantity of biotinylated antibody bound to the coated antigen is determined using a streptavidin-peroxidase conjugate and a chromogenic substrate.
  • a decreased binding of the biotinylated antibody with increasing concentrations of the non-biotinylated antibody indicates that the two antibodies compete for the same epitope. If the biotinylated antibody binds equally to the antigen despite increasing concentrations of the non-biotinylated antibody, the two antibodies do not compete for the same epitope. This competition can be complete or partial.
  • Affinity of antibodies can be determined using radioactively labelled ( 125 I) ASP and purified antibodies as described previously by Koren et al., (1986).
  • Solid Phase Materials Antibodies and ASP can be bound to a solid phase material for use in assays described herein.
  • Various types of adsorptive materials such as nitrocellulose, ImmobilonTM, polyvinyldiene difluoride (all from BioRad, Hercules, calif.) can be used as a solid phase material in the compositions and methods described herein.
  • Pieces or strips of these materials can be coated with one or more antibodies, or functional fragments thereof, directed against specific epitopes of ASP; or with ASP, for detection of anti-ASP antibodies. Such strips are referred to herein as "dipsticks".
  • the strips may also be attached to one end of a longer strip of a solid support material, such as plastic, which can serve as a handle for dipping the dipstick into various solutions and samples.
  • a solid support material such as plastic
  • the plastic handle can also serve as a tether so that multiple dipsticks can be attached to a common support.
  • Such a multi-strip design may be particularly useful in screening for different forms of ASP simultaneously.
  • pieces of the solid phase material that are coated with antibody have the general dimensions of 0.5 cm ⁇ 0.5 cm and can be attached to the longer solid support strips having general dimensions of 0.5 cm ⁇ 5 cm. Such dimensions permit an accurate determination of ASP levels in as little as 100 ⁇ l of blood.
  • the solid phase material may be coated with antibodies or ASP by any of a variety of methods. If the material is made of a protein-receptive solid phase material that adsorbs proteins, such as nitrocellulose or polyvinyldiene difluoride (PVDF) membrane, the material can be coated directly with antibody or ASP by immersing the solid phase material directly into a solution of the protein.
  • a protein-receptive solid phase material that adsorbs proteins such as nitrocellulose or polyvinyldiene difluoride (PVDF) membrane
  • the material is treated ("blocked") with a blocking agent in order to minimize nonspecific adsorption of proteins to unoccupied domains on the material.
  • the solid phase material can be treated with any of a variety of blocking agents such as bovine serum albumin (BSA), gelatin, Tris, all of which are available commercially (Sigma, St Louis, Mo.) or nonfat milk proteins.
  • BSA bovine serum albumin
  • Tris Tris, all of which are available commercially (Sigma, St Louis, Mo.) or nonfat milk proteins.
  • PVDF strips can be blocked with two percent (w/v) milk blocking solution (Kirkegaard and Perry Laboratories, Gaithersburg, Md.) for 48 hours at 4° C.
  • a dipstick may be coated with more than one antibody or ASP so that the single dipstick can be used to detect more than one anti-ASP antibody or more than one form of ASP.
  • two or more separate pieces of a solid phase material, each coated with an antibody directed against a particular ASP or ASP fragment, can be attached (for example, by gluing) to a longer strip of solid support to produce a dipstick with two or more separate areas.
  • ASP can be detected and quantitated using any of the known methods of protein detection. Examples include radioimmunoassays (RIA), Western Blotting (Koren et al. (1986)) and enzyme-linked immunosorbent assay (ELISA)(Koren et al. (1986)). Many assays useful for detection of ASP are described in Johnstone and Thorpe, Immunochemistry in Practice, Second edition (Blackwell Scientific Publication, Oxford, 1987). Preferred assays use the ASP-specific antibodies and antibody compositions described above. All of the antibody assays involve bringing into contact a sample to be tested and an antibody that recognizes an Ancylostoma Secreted Protein under conditions promoting conjugation of an Ancylostoma Secreted Protein and the antibody.
  • RIA radioimmunoassays
  • ELISA enzyme-linked immunosorbent assay
  • Detection and quantitation is typically facilitated by using labelled antibody as described above.
  • Detection of a radiolabel can be by methods such as scintillation counting, gamma ray spectrometry or autoradiography.
  • Fluorogens can be detected by a fluorescence detector.
  • Antibodies directly or indirectly labelled with chromogens are detected visually or spectrophotometrically. Such by detection is preceded by an enzymatic development step when using some chromogens.
  • Antibodies that recognize ASP can be detected and quantitated using any of the known methods of antibody detection. Examples include dot blot assays and ELISA. Detection of antibodies that recognize ASP is useful for determining if an individual has ever been infected with hookworm and to evaluate antibody preps. Detection of these antibodies involves bringing into contact a sample to be tested and ASP or an immunogenic part of ASP under conditions promoting conjugation of antibody and ASP. The bound protein is then detected, and, depending on the assay, quantitated. Detection and quantitation is typically facilitated by using labelled protein.
  • ASP can be used in solution or immobilized to a solid substrate, such as a gel suitable for affinity chromatography, or a multi-well plate, using standard techniques known to those skilled in the art.
  • the peptides can be labelled using standard techniques, for use in routine assays, with radioactive, fluorescent, or enzyme labels. Detection of a radiolabel can be by methods such as scintillation counting, gamma ray spectrometry or autoradiography. Fluorogens can be detected by a fluorescence detector. Proteins directly or indirectly labelled with chromogens are detected visually or spectrophoto-metrically. Such by detection is preceded by an enzymatic development step when using some chromogens.
  • An advantage of the cloned antigens is the ease of preparation of the antigen for use in ELISA.
  • ELISA has advantages over other techniques for quantitation of antibody, which can be used to determine antibody titer.
  • the cloned antigen can also be used to simplify detection of the antigen in a dot blot assay, which cannot be done with whole extract.
  • a dot blot assay can be modified to a "dip-stick" type of test to make it even more simple and incorporate it into a test for multiple specificities at once.
  • Nucleic acid molecules encoding all or a part of ASP can be performed using any of the many well known nucleic acid detection methods.
  • Nucleic acid hybridization assays generally involve bringing into contact a sample to be tested and a labelled nucleic acid probe encoding ASP under conditions promoting hybridization of nucleic acid molecules. The bound nucleic acid is then detected, and, depending on the assay, quantitated.
  • the detectable portion of the bound probe has traditionally been a substance chemically affixed to the probe such as a chemical label.
  • chemical labels are radioisotopes, substrate-modifying enzymes such as alkaline phosphatase, enzymatic cascade processes utilizing NADP, and fluorescent compounds.
  • Assays utilizing nucleic acid probes, to which a chemical label has been attached, are described by Grunstein et al., Proc. Natl. Acad. Sci. USA 72: 3961 (1975) and Southern, J. Mol. Biol. 98: 503 (1975), and in U.S. Pat. No. 4,851,331 to Vary et al.; U.S. Pat. No.
  • Recent probe technology has utilized signal-amplification systems that amplify the signal for detection of smaller quantities of target molecule. For example, in nucleic acid assays, the polymerase chain reaction (PCR) and similar processes are used to increase the number of copies of the target molecule to which the detectable probe will bind.
  • PCR polymerase chain reaction
  • PCR has emerged as a powerful and sensitive procedure for the amplification of specific DNA sequences, and is a valuable tool in paternity identification, tissue typing, and forensics.
  • PCR technology requires pairs of dissimilar DNA oligonucleotides that act as primers to initiate a controlled polymerase reaction for amplification of the DNA sequence that lies between the two oligonucleotide binding sites.
  • the polymerase chain reaction employs the heat-stable Taq polymerase that permits repeated heating and cooling of the reaction mixture.
  • the amplification process is initiated by first heating the reaction mixture to denature, or dissociate, the two complementary strands of the double-stranded DNA to be amplified.
  • each single-stranded DNA oligonucleotide hybridizes to a specific region of one or the other of the complementary DNA strands and acts as a primer for the heat-stable polymerase.
  • the polymerase uses the oligonucleotide primers as starting points for the elongation of a DNA molecule complementary to the template DNA molecule to which each primer is hybridized.
  • Each of the elongating DNA chains grows towards and beyond the distal primer site of the other template strand.
  • the cycle is repeated many times, exponentially doubling the number of copies each time. In this way, even a single copy of a specific DNA sequence can be amplified to detectable levels in a relatively short period of time.
  • RNA polymerase promoter sequence is included as part of a single-stranded DNA probe so that, after hybridization of the probe to the target, the promoter can be used to promote polymerase-catalyzed synthesis of target or probe segments.
  • Assays employing DNA transcription-based amplification systems are described by Kwoh et al., Proc. Natl. Acad. Sci. USA 86: 1173-1177 (1989); Guarelli et al., Proc. Natl. Acad. Sci.
  • RNA based amplification system a nucleic acid probe containing an RNA molecule is autocatalytically replicated using Q ⁇ bacteriophage replicase as described by Chu et al., Nucl. Acids Res. 14: 5591-5603 (1986); U.S. Pat. No. 4,957,858 to Chu et al.; U.S. Pat. No. 4,786,600 to Kramer et al.; and International Pat. Application No. WO92/12261 to Promega Corp.
  • Probes have been indirectly labelled in an attempt to avoid the problems associated with direct radioactive labelling.
  • the most common method of indirect labelling is to attach biotin, a small vitamin, to the nucleic acid using a chemical or enzymatic technique. Following hybridization, the biotin is detected by reaction with avidin, an egg white protein which has been labelled with an enzyme or fluorochrome. Bound enzyme can be detected by reaction with color-producing substrates and the fluorochrome can be seen when reacted with incident light of appropriate wavelength.
  • Hybridization has been detected with the use of an intercalating agent such as acridine orange or ethidium bromide as described in U.S. Pat. No. 4,563,417 to Albarella et al.
  • the intercalating agent becomes inserted between hybridized base pairs of probe and sample nucleic acids and causes the tertiary structure of the helix to unwind.
  • An antibody specific for the newly formed antigenic determinant created by the intercalating agent and the unwound helix is detected by conventional means.
  • Hybridization can also be detected with the aid of an antibody specific for a labelled probe as described in U.S. Pat. No. 4,743,535 to Carrico.
  • the probe is labelled with a detectable substance such as flavin adenine dinucleotide (FAD) or a fluorescent agent.
  • FAD flavin adenine dinucleotide
  • An antibody specific for the labelled probe, after it has hybridized to the sample nucleic acid, is detected by a biochemical reaction.
  • Therapeutics that can bind to, and inhibit the effect of, ASP during hookworm infection can be designed.
  • Computer modeling technology allows visualization of the three-dimensional atomic structure of a selected molecule and the rational design of new compounds that will interact with the molecule.
  • the three-dimensional construct typically depends on data from x-ray crystallographic analyses or NMR imaging of the selected molecule.
  • the molecular dynamics require force field data. Methods for generating this data and determining three-dimensional structure of a protein are known to those of skill in the art.
  • the computer graphics systems enable prediction of how a new compound will link to the target molecule and allow experimental manipulation of the structures of the compound and target molecule to perfect binding specificity. Prediction of what the molecule-compound interaction will be when small changes are made in one or both requires molecular mechanics software and computationally intensive computers, usually coupled with user-friendly, menu-driven interfaces between the molecular design program and the user.
  • CHARMm performs the energy minimization and molecular dynamics functions.
  • QUANTA performs the construction, graphic modelling and analysis of molecular structure. QUANTA allows interactive construction, modification, visualization, and analysis of the behavior of molecules with each other.
  • L 3 were collected from one to four week old coprocultures by the Baermann technique, and decontaminated with 1% HCl in BU buffer (50 mM Na 2 HP0 4 /22 mM KH 2 PO 4 /70 mM NaCl, pH 6.8) (Hawdon and Schad, Journal of the Helminthological Society of Washington 58: 140-142 (1991)) for 30 minutes at 22° C.
  • Approximately 3500-7500 L 3 were "activated” by incubation in 0.5 mL RPMI1640 tissue culture medium (supplemented with 0.25 mM HEPES pH 7.2, 100 U/mL penicillin, 100 ⁇ g/mL streptomycin, 100 ⁇ g/mL gentamicin, and 2.5 ⁇ g/mL amphotericin B) containing 15% (v/v) of a less than 10 kDa filtrate of canine serum (FIL) (Hawdon et al. (1995)) and 25 mM GSM in individual wells of 12 well tissue culture plates.
  • Non-activated L 3 were incubated in RPMI alone. The larvae were incubated at 37° C., 5% CO 2 for 24 hours.
  • ES products from approximately 50,000 activated A. caninum L 3 were concentrated and electrophoresed in a 12.5% acrylamide gel (Laemmli, Nature (London) 227: 680-685 (1970)) under non-reducing conditions.
  • a band of molecular weight (MW) 37-40 kDa was excised, digested with trypsin in situ, and the peptides separated by HPLC.
  • One peptide was subjected to sequential Edman degradation, yielding the sequence Gly-Leu-Glu-Pro-Asp-Ala-Leu-Gly-Gly-Asn-Ala-Pro-Lys (SEQ ID NO:3). Sequencing was performed by the Keck Microsequencing facility at Yale University.
  • Degenerate primers in both orientations were synthesized based on the amino acid sequence, and used to amplify an ASP gene-specific product from DNA isolated from an A. caninum L 3 cDNA library constructed in lambda ZAP IITM (Stratagene).
  • the degenerate primers were paired with opposing flanking vector primers (T3 or T7 promoter) in preliminary experiments.
  • the sense strand degenerate primer ASP-5 SEQ ID NO: 11; Table 1
  • the T7 primer SEQ ID NO: 16; Table 1 amplified a product of approximately 550 bp, and therefore these primers were used to amplify DNA for cloning.
  • the reaction conditions for PCR were 10 mM Tris-HCl (pH 9.0), 50 mM KCl, 0.1% Triton X-100, 1.5 mM MgCl 2 , 0.2 mM of each dNTP, 1 U Taq DNA polymerase (Promega), and 75 ng of phage DNA containing the L 3 cDNA library in a 20 ⁇ l reaction.
  • Ten identical reactions containing only the DNA and primers in 10 ⁇ l were subjected to "hot start" PCR (Amheim and Erlich, Annual Review of Biochemistry 61: 131-156 (1992)) by heating at 94° C. for 5 minutes, then lowered to 85° C. for 5 minutes, during which time the remaining reaction components were added.
  • the reactions were subjected to 30 cycles of 1 minute denaturation at 94° C., 1 minute annealing at 45° C., and 2 minutes extension at 72° C. Following amplification, the products were pooled and digested with PstI and KpnI. The digested DNA was electrophoresed in a 3% low melting point NuSieveTM GTG agarose gel (FMC Bioproducts) containing 0.5 ⁇ g/mL ethidium bromide.
  • a band of approximately 550 bp was excised, transferred to a microfuge tube, and melted at 65° C.
  • the melted agarose was frozen in a dry ice-ethanol bath, and immediately centrifuged at 16,000 ⁇ g for 10 minutes.
  • the aqueous phase was transferred to a new tube, ethanol precipitated, resuspended in 7 ⁇ L of dH 2 0, and cloned into pBluescriptTM by standard methods.
  • Double-stranded plasmid DNA was sequenced by the dideoxy method (Hattori and Sakaid (1986); Sanger et al. (1977)), using the SequenaseTM 2.0 kit (USB) and sequential synthetic oligonucleotide primers.
  • the A. caninum L 3 cDNA library was propagated in XLI-BLUE cells (Stratagene, La Jolla, calif.), and plated according to standard methods (Sambrook et al., Molecular Cloning: A Laboratory Manual (Cold Spring Harbor, Cold Spring Harbor Laboratory Press, 1989)). Approximately 2 ⁇ 10 5 plaques were screened with an RNA probe made by transcription of the 550 bp PCR product, using T3 RNA polymerase (Boehringer Manheim), in the presence of ⁇ - 32 p!-UTP.
  • Plasmid DNAs were isolated by standard procedures, and digested with EcoRl and XhoI to release the inserts.
  • Two of the 8 clones were of different sizes, of approximately 1000 and 1200 bp.
  • the 5' and 3' ends were sequenced using T3 and T7 primers, respectively.
  • Both clones had poly(A) tails 3', and identical 3' sequences.
  • the 5' ends were different, but further sequencing indicated that the shorter clone was a truncated version of the longer clone, renamed pASP-1.
  • Restriction mapping indicated internal EcoRI and NcoI restriction sites at nucleotide positions 284 and 888 of SEQ ID NO: 1, respectively, which were utilized for subcloning to facilitate sequencing. Both strands were sequenced completely.
  • a modified 5'-RACE technique was used to isolate the 5' end and start codon of the ASP cDNA (Frohman et al., Proceedings of the National Academy of Sciences USA 85: 8998-9002 (1988); Jain and Gomer, Biotechniques 12: 58-59 (1992); Templeton et al., Biotechniques 15: 48-51 (1993)).
  • Approximately 400 mg of frozen A. caninum L 3 were ground to a powder in a mortar chilled in liquid nitrogen, and total RNA isolated using the TRIzol reagent (BRL).
  • First strand cDNA was synthesized using M-MLV reverse transcriptase (SuperscriptTM II, BRL) and one pmole of ASP gene-specific primer 1 (GSP 1; SEQ ID NO: 12; Table 1) according to the manufacturer's protocol.
  • the cDNA was ethanol precipitated in the presence of 10 ⁇ g of yeast tRNA, and resuspended in 200 ⁇ l dH 2 0.
  • the cDNA was 3'-tailed with in a 50 ⁇ l reaction containing 33.5 ⁇ l cDNA, 1 mM dGTP, and 15 U of terminal deoxytransferase (TdT, BRL) for 1 hour at 37° C.
  • reaction was extracted once with phenol:chloroform:isoamyl alcohol (25: 24: 1), ethanol precipitated, and resuspended in 150 ⁇ l of dH 2 0.
  • Two ⁇ l were used as template for the first PCR reaction, containing 25 pmoles of GSP 2 antisense primer (SEQ ID NO: 13), located internally to the primer used for RT (Table 1), together with 25 pmoles of a 5' poly(G) anchor primer (SEQ ID NO: 15; Table 1).
  • the 50 ⁇ l reaction was subjected to 40 cycles of one minute at 94° C., one minute at 48° C., and 1 minute at 72° C.
  • ES products were electrophoresed in 11% polyacrylamide gel and transferred to ImmobilonTM-P PVDF membranes (Millipore) by electroblotting at 20V for 16 to 18 hours at 4° C.
  • the membranes were blocked with 5% non-fat dry milk (Carnation) in PBS (NFDM) for 6 to 8 hours at 4° C.
  • NFDM non-fat dry milk
  • the membrane was incubated with a 1:1000 dilution of rabbit antiVespula squamosa antigen 5 (Vesq Ag5) antibody (a gift of Donald Hoffman, Dept. of Pathology, East Carolina University) in NFDM for 16-18 hours at 4° C.
  • the membrane was incubated with a 1:5000 dilution of HRP-conjugated goat anti-rabbit secondary antibody (Sigma) for one hour at 22° C. Bands were visualized using Enhanced Chemiluminescence (Amersham).
  • a 1 kb EcoRI/XhoI fragment containing the 3' end and poly(A) tail of ASP-1 was cloned in-frame into the pET28(c) expression vector (Novagen) and used to transform competent BL21 E. coli cells.
  • Log-phase cells were induced by the addition of one mM IPTG, and incubated for three hours. One milliliter aliquots were removed after 0, 1, 2, and 3 hours of induction, and examined by SDS-PAGE and Western blotting.
  • the pellet containing the expressed ASP was resuspended in 60 mL 1% SDS/0.5% 2-mercaptoethanol (2-ME), boiled for 5 minutes, and incubated at 22 C. for 14-18 hours (overnight).
  • the lysate was transferred to dialysis membrane (12,000-14,000 molecular weight cut-off) and dialyzed against two liters of 0.1% SDS in PBS for two days, with two changes of buffer.
  • the pET28 expression system is designed to attach a short leader containing 6 histidine residues on the amino terminus of the expressed protein. This allows purification of the recombinant protein using a Ni ++ chelating resin (HisBind, Novagen) to bind the His tag.
  • Recombinant ASP was purified from the cell extract according to the manufacturers's instructions, except that 0.1% SDS was added to the column buffers. The protein was eluted from the column with 1.0 M imidazole, dialyzed as above, and examined by SDS-PAGE. Protein concentration was determined by the bicinchoninic acid (BCA) method (BCA Protein Assay Kit, Pierce).
  • the L 3 were removed, pelleted, and the supernatant transferred to a new tube and concentrated by lyophilization.
  • the L 3 were returned to a new well, fresh medium containing the stimuli was added, and the incubation resumed, except at 24 hours, which was the terminal time point.
  • a negative control (no stimuli) and a positive control (entire 24 hour ES output) were harvested at 24 hours.
  • the second type of experiment was to determine the effect of feeding inhibitors on the release of ASP. Approximately 2000 L 3 were incubated with 0.5 mM 4,7-phenanthroline, a known feeding inhibitor, and activation stimuli for 24 hours. Following incubation, the ES products were harvested as above. The ES products from all experiments were examined by Western blotting as described above.
  • A. caninum L 3 When A. caninum L 3 are stimulated to resume feeding in vitro, they release a major product with a Mr of approximately 40 kDa, referred to as the Ancylostoma Secreted Protein.
  • microsequencing of a tryptic digest of this protein revealed a peptide with the sequence N-Gly-Leu-Glu-Pro-Asp-Ala-Leu-Gly-Gly-Asn-Ala-Pro-Lys (SEQ ID NO:3).
  • This product was used as a probe to isolate a 1.2 kb cDNA clone encoding ASP from the A. caninum L 3 cDNA library.
  • the cDNA contained a 3' poly(A) tail, but lacked a 5' initiation codon.
  • the 5' end containing the ATG (Met) start codon was isolated from L 3 cDNA by 5' RACE.
  • Four 5' end clones were sequenced, and found to encode untranslated leaders of variable sequence and length, but identical coding sequences that overlapped with the cDNA clone.
  • caninum L 3 cDNA are depicted in SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, and SEQ ID NO:7. None of the leaders contained the conserved nematode SL 1 or SL 2 (Bektesh and Hirsh, Nucleic Acids Research 16: 5692 (1988); Nilsen, Annual Review of Microbiology 47: 413-440 (1993); Spieth et al., Cell 73: 521-532 (1993)), nor could the 5' end be amplified from cDNA using an SL 1 primer and an internal gene specific primer.
  • the full length cDNA encodes an open reading frame (ORF) of 424 amino acids (nucleotides 1-1272 of SEQ ID NO:1), with a predicted molecular weight of 45,735 and an isolelectric point of 7.13.
  • the full length cDNA also has a 34 bp 3' untranslated region (nucleotides 1273-1306 of SEQ ID NO:1).
  • the entire sequence of the isolated peptide is present in the ORF (amino acids 255 to 267 of SEQ ID NO:2), confirming that this cDNA encodes the ASP molecule.
  • the amino terminal 18 amino acids are highly hydrophobic, and a potential eukaryotic signal sequence cleavage site is located between amino acids 18 and 19 (von Heijne, Nucleic Acids Research 14: 4683-4690 (1986)).

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biophysics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

A protein, Ancylostoma Secreted Protein (ASP), that is released by hookworm larvae following infection, and which is highly immunogenic in experimental animals, is disclosed. Nucleic acids encoding ASP, antibodies recognizing ASP, and methods of detecting ASP, nucleic acids encoding ASP, and antibodies recognizing ASP, in a sample are also disclosed. ASP is useful in a vaccine for hookworm as well as other soil-transmitted human and veterinary nematodiases. ASP is also useful as a target for specific treatment of hookworm, and can be used in a diagnostic assay for hookworm, using standard protein detection techniques, especially those based on antibodies. DNA encoding ASP is useful both for producing ASP recombinantly and in a diagnostic assay for hookworm. Antibodies recognizing ASP are useful in diagnostic assays to detect protein produced during hookworm infection.\!

Description

This invention was made with government support under Grant Numbers R29-AI32726 awarded by the Department of Health and Human Services. The government has certain rights in the invention.
BACKGROUND OF THE INVENTION
The present invention is generally in the area of treatments and diagnostics for hookworm infection.
Hookworm disease continues to rank among the most important infectious diseases on a world-wide basis. Over 20% of the world population is infected, and hookworms are the leading cause of anemia in the tropics (Gilles, Reviews of Infectious Diseases 7: 111-118 (1985)). In China alone, an estimated 194 million people are infected with hookworm, with up to 50 percent prevalence in the agriculturally rich areas along the Yangtze River.
Adult hookworms attach to the mucosa of the small intestine and feed on blood, resulting in the loss of up to 0.26 mL of blood per worm per day (Gilles, Hookworm Disease: Current Status and New Directions (Schad and Warren, Eds., Taylor and Francis, London, 1990), pages 221-230). The subsequent iron deficiency anemia is especially devastating to children, resulting in stunted physical and cognitive development, which may be permanent (Lozoff et al., New England Journal of Medicine 235: 687-694 (1991)). Furthermore, acute neonatal hookworm disease, resulting from the lactogenic transmission of infective stages to nursing children, is often fatal (Hotez, Pediatric Infectious Disease Journal 8: 516-520 (1989)).
Despite the availability of effective chemotherapeutic agents, hookworm remains a serious geohelminth infection. This is due to several factors. First, many of the latest generation of anthelminthics are prohibitively expensive, and therefore unaffordable by the developing countries that would benefit most from their use. Secondly, there is no sterile immunity developed following hookworm infection, such that people treated with anthelminthics are quickly re-infected when they are re-exposed to infective stages. Third, previously unreported toxicities have been now observed with wide scale use of anthelminthic drugs including seizures, encephalitis and deafness. Fourth, disappointing efficacy has been noted with the conventional anthleminthic drugs.
An effective and inexpensive recombinant vaccine would provide an affordable approach to controlling the ravages of hookworm disease.
There is also a need for a vaccine against canine hookworm. Prevalence estimates range from 27% of stray dogs in New Jersey (Lillis, Journal of Parasitology 53: 1082-1084 (1967)) to 14% of dogs presented to an urban veterinary teaching hospital (Kirkpatrick, Veterinary Parasitology 30: 113-124 (1988)). Neonatal ancylostomiasis caused by vertical transmission of arrested A. caninum third-stage larvae (L3) continues to be a serious problem, often resulting in fatal exsanguination of puppies (Kalkofen, Veterinary Clinics of North America: Small Animal Practice 17: 1341-1354 (1987)).
Experimental evidence suggests that vaccination holds promise as an effective hookworm control strategy. Using the canine hookworm as a model system, Miller was able to prevent anemia and hookworm disease in dogs vaccinated with an attenuated larval vaccine (Miller, Adv. Parasitol . 9: 153-183 (1971)). Although a commercial failure for technical and logistical reasons; primarily due to short shelf life and the requirement for special handling; the vaccine demonstrated that the serious effects of hookworm disease could be reduced or eliminated by vaccination. Instead of preventing infection, the vaccine decreased the pathogenicity and fecundity of worms in the challenge infection, thereby preventing anemia in the challenged animals. Although this vaccine was effective in preventing symptoms of hookworm disease in dogs, such a vaccine would be both risky to use in humans and prohibitively expensive to produce and distribute. Moreover, it would be impossible to harvest the quantities of feces required in order to accumulate sufficient numbers of infective larvae. Therefore, the X-irradiated larval vaccine is not an option for use in humans.
However, if similar results could be obtained with a recombinant vaccine, neither risk nor cost should hamper its widespread use. To date, there has been little interest in the production of a recombinant vaccine, mostly because of an absence of promising target molecules.
It is therefore an object of the present invention to provide a method and means for vaccinating people and other animals against hookworm infection.
It is a further object of the present invention to provide a hookworm vaccine that can be prepared using recombinant genetically engineered hookworm proteins and fragments thereof.
It is another object of the present invention to provide a target for selective hookworm treatment.
It is still another object of the present invention to provide a diagnostic for hookworm infection.
SUMMARY OF THE INVENTION
A protein that is released by hookworm larvae following infection, and which is highly immunogenic in experimental animals, has been identified. The protein has been designated Ancylostoma Secreted Protein (ASP). ASP has an apparent molecular weight of 37-40 kDa. ASP from Ancylostoma caninum contains 406 amino acids. The pro-form of ASP contains an 18 amino acid secretion signal sequence which does not appear in mature ASP. ASP is released from larval A. caninum that begin feeding.
DNA encoding the protein has been isolated. The protein can be made by recombinant means in a variety of hosts. The recombinant protein, or immunogenic fragments thereof, can be formulated as a vaccine. The recombinant protein, or antibodies to the protein, can also be used in an assay to detect hookworm infection. DNA encoding all or parts of the protein can be used as probes to detect the presence of hookworm nucleic acid. Such probes are useful in assays of tissue samples, body fluid samples, and hookworm infection sources.
DETAILED DESCRIPTION OF THE INVENTION Ancylostoma Secreted Protein
A protein that is released by hookworm larvae following infection, designated Ancylostoma Secreted Protein, is disclosed. The protein has an apparent molecular weight of 37-40 kDa. ASP from Ancylostoma caninum contains 406 amino acids. The pro-form of ASP contains an 18 amino acid secretion signal sequence which does not appear in mature ASP. The sequence of A. caninum ASP is listed as SEQ ID NO:2. This sequence includes the 18 amino acid secretion signal sequence. ASP is released from larval A. caninum that begin feeding. Larvae begin feeding at the transition from the free-living stage to the parasitic stage. ASP is thought to be involved in this transition.
This is demonstrated by data showing that ASP is released within 30 minutes of activation of larval feeding in vitro, and that ASP is released continuously once the L3 have been activated. Inhibition of activation with 4,7-phenanthroline prevents the release of ASP. The specific, rapid release of ASP by activated infective larvae indicates that ASP has a role in the transition to parasitism, and as such is a desirable target for a recombinant vaccine against hookworm disease.
As used herein, Ancylostoma Secreted Protein and ASP refer to a protein having the amino acid sequence shown in SEQ ID NO:2 from amino acid 19 to amino acid 424; derivatives thereof with conservative amino acid substitutions, deletions, or additions; any homolog or allelic form of ASP produced in nematodes; any protein having at least 40% amino acid sequence identity with amino acids 19 to 424 of SEQ ID NO:2; or any protein that is immunoreactive with an antibody immunoreactive with the ASP of SEQ ID NO:2 but that is not immunoreactive with hymenoptera proteins. Preferred ASP derivatives have an amino acid sequence identity with amino acids 19 to 424 of SEQ ID NO:2 of greater than 40%, such as at least 50% amino acid sequence identity, at least 60% amino acid sequence identity, or at least 70% amino acid sequence identity. Preferably, ASP derivatives have at least 80% amino acid sequence identity; more preferably, at least 90% amino acid sequence identity; and most preferably, at least 95% amino acid sequence identity with amino acids 19 to 424 of SEQ ID NO:2.
As used herein, percent amino acid sequence identity is calculated as the percentage of aligned amino acids that match the reference sequence, where the sequence alignment has been determined using the alignment algorithm of Dayhoff et al., Methods in Enzymology 91: 524-545 (1983). Here the reference sequence is amino acids 19 to 424 of SEQ ID NO:2. Unless otherwise stated, all amino acid position references use the numbering shown in SEQ ID NO:2. As used herein, immunoreactivity is determined by any standard technique for detecting antibody-antigen interactions. Many assays useful for determining immunoreactivity are described in Johnstone and Thorpe, Immunochemistry in Practice, Second edition (Blackwell Scientific Publications, Oxford, 1987). Preferred assays are the immunoassays described on pages 241 to 260 of Johnstone and Thorpe.
In the case of immunogenic fragments of ASP, preferred fragments are those that are not immunoreactive with antibodies that are immunoreactive to proteins other than ASP. Accordingly, preferred immunogenic fragments of ASP have an amino acid sequence with at least five consecutive amino acids that are present in an ASP as defined above, where no amino acid sequence of five or more, six or more, seven or more, or eight or more consecutive amino acids present in the immunogenic fragment of ASP is present in a protein other than ASP. More preferred immunogenic fragments of ASP have an amino acid sequence of at least five consecutive amino acids in SEQ ID NO:2, where no amino acid sequence of five or more, six or more, seven or more, or eight or more, consecutive amino acids present in the immunogenic fragment of ASP is present in a protein other than ASP.
Database searching reveals significant homology between the C-terminal portion of the ASP deduced amino acid sequence, approximately 230 amino acids, and the antigen 5 molecule of Hymenoptera venoms.
Antibodies against the antigen 5 of the yellow jacket Vespula squarnosa recognize a 40 kDa protein in activated, but not in non-activated, A. caninum L3 excretory/secretory (ES) products. Additionally, this antibody recognizes a 38 kDa protein in lysates of bacteria that are expressing a one kilobase 3'-end fragment of the ASP cDNA, but not in uninduced bacteria. The anti-antigen 5 antibody recognizes bands of slightly higher molecular weight, approximately 42 kDa, in soluble extracts of A. caninum adults and L3 and A. braziliense, Haemonchus contortus, and Strongyloides stercoralis L3. The size difference is due to the presence of the 18 amino acid eukaryotic secretory signal peptide of ASP in the unsecreted form.
DNA Encoding Aacylostoma Secreted Protein
A cDNA molecule encoding ASP has the nucleotide sequence listed as SEQ ID NO:1. The coding region in this sequence is 1272 nucleotides long. The coding region for mature ASP begins at nucleotide 55 and ends at nucleotide 1272. Unless otherwise stated, all nucleotide position references use the numbering shown in SEQ ID NO:1. As used herein, a nucleic acid molecule encoding ASP refers to a nucleic acid molecule encoding a protein having the amino acid sequence shown in SEQ ID NO360:2 from amino acid 19 to amino acid 424; derivatives thereof with conservative amino acid substitutions, deletions, or additions; any homolog or allelic form of ASP produced in nematodes; any protein having at least 40% amino acid sequence identity with amino acids 19 to 424 of SEQ ID NO:2; or any protein that is immunoreactive with an antibody immunoreactive with the ASP of SEQ ID NO:2 but that is not immunoreactive with hymenoptera proteins. Preferred the encoded ASP derivatives have an amino acid sequence identity with amino acids 19 to 424 of SEQ ID NO:2 of greater than 40%, such as at least 50% amino acid sequence identity, at least 60% amino acid sequence identity, or at least 70% amino acid sequence identity. Preferably, the encoded ASP derivatives have at least 80% amino acid sequence identity; more preferably, at least 90% amino acid sequence identity; and most preferably, at least 95% amino acid sequence identity with amino acids 19 to 424 of SEQ ID NO:2. Amino acid sequence identity and immunoreactivity of the encoded protein are determined as described earlier.
Nucleic acid molecules encoding all or a part of ASP can be manipulated using any of the numerous nucleic acid manipulation methods known to those of skill in the art. Such manipulation include amplification, purification, recombination, insertion into vectors, and use as probes, consisting of at least 14 to 17 nucleotides, and primers.
A. Recombinant ASP
ASP can be made recombinantly using any of the established expression systems, such as bacteria, yeast, baculovirus, and mammalian cell culture. As used herein, recombinant refers to any protein or nucleic acid produced by any methods within the large body of well known nucleic acid manipulations, examples of which are provided below. As used herein, any protein or nucleic acid that results from, or is expressed from a nucleic acid resulting from, such manipulations is a recombinantly produced protein or nucleic acid.
Recombinant expression allows the production of fragments of ASP, combinations of ASP fragments in a single fusion protein, and fusion proteins combining ASP, or a fragment of ASP, with one or more other proteins or amino acid sequences. Such fusions are useful for combining multiple immunogenic fragments in a single protein.
The DNA used to produce ASP may be genomic DNA, in which case it may include introns, or it may be cDNA which is prepared in vitro from mRNA using a reverse transcriptase and which contains open reading frames. Methods for isolation, cloning or synthesizing DNA and cDNA are well known to those of skill in the art. Expression refers to the process by which nucleic acid is transcribed and translated into peptides, polypeptides, or proteins. If the nucleic acid is derived from genomic DNA, expression may, if an appropriate eukaryotic host cell or organism is selected, include splicing of the mRNA. An expression vector refers to a recombinant DNA or RNA construct, such as a plasmid, a phage, recombinant virus or other vector that, upon introduction into appropriate host cells, causes nucleic acid molecules that have been cloned into the vector to be transcribed, and then translation of the transcribed nucleic acid into a polypeptide. The nucleic acid molecule is cloned into the vector in such a manner that it is operably linked to regulatory sequences that effect expression of the heterologous nucleic acid molecules. Upon expression in a selected host cell or organism, if the appropriate regulatory sequences are operably linked to the DNA or included in the heterologous DNA, the expression product may be exported to the cytoplasm and/or may be secreted out of the host cell.
Appropriate expression vectors are well-known to those of skill in the art and include those that are replicable in eukaryotic cells and/or prokaryotic cells. Such expression vectors may remain episomal or may integrate into the host cell genome.
In all cases, the ASP cDNA or gene can be inserted into appropriate expression vectors containing expression regulatory elements, such as transcription initiation signals, translation initiation signals, starting codon, termination codon, transcription terminating signals, polyadenylation signals, and others. Suitable vectors are commercially available from a variety of companies. After the recombinant vectors containing ASP-encoding DNA are transfected into the host cells, they may remain as extrachromosomal DNA or they may be integrated into the host genome. In either case, they may direct the synthesis of recombinant ASP in the host cells. Some examples for the expression of heterologous genes are described in Methods in Enzymology, Vol. 153, Chapters 23 to 34 (Wu and Grossman, eds., Academic Press, 1987). Large scale culture of the ASP synthesizing host cells and the purification of the enzyme may form a cost effective commercial means of production of ASP. Methods are well known to those skilled in the art for the large scale production of proteins. Many methods and reagents useful for recombinant expression of ASP are described in The 1995 Lab Manual Source Book (Cold Spring Harbor Laboratory Press, NY, 1995).
Some examples of potentially useful expression systems for ASP are given below:
1. E. coli or other bacteria as host: Many mammalian cDNA's have been expressed in E. coli and many expression vectors with different promoters, operators, and other regulatory elements are available commercially. A typical vector construction and expression is described by Lin and Tang, J. Biol. Chem. 264: 4482-4489 (1989). The expression of some eukaryotic proteins in the cytosol of E. coli produces insoluble `inclusion bodies` and would require the refolding of recombinant protein. However, the use of a `leader` sequence, such as omp, described by Duffaud et al. in Methods in Enzymology 153: 492-506 (Wu and Grossman, eds., Academic Press, 1987), will direct the proper folding and also export of the recombinant ASP to the periplasmic space of the bacterial.
2. Yeast as host: The principles for the expression of recombinant ASP in the yeast are similar to those for E. coli expression. Examples are provided by Bitter et al. in Methods in Enzymology 153: 516-544 (Wu and Grossman, eds., Academic Press, 1987). Like E. coli, yeast host cells may express a foreign gene either in the cytosol or as secreted protein.
3. Fungi as host: There are small numbers of fungal expression vectors which have been successfully used to express heterologous genes. The existing fungal expression vectors integrate themselves into the host genome after transfection as indicated by Cullen et al., in A Survey of Molecular Cloning Vectors and their Uses, (Butterworth Publishers, Stoneham, MA 1986). When a leader is present in front of the expressed protein codons, the secreted recombinant proteins can be glycosylated. Some examples of successful expressions involve bovine chymosin, described by Cullen et al., Bio/Technology 5: 369-378 (1987), and an acid protease from a different fungus, described by Gray et al., Gene 48: 41-53 (1987).
4. Insect cells as host: Baculovirus expression vectors for the synthesis of foreign genes in insect cells have been successfully used to express many eukaryotic and viral proteins. This system is capable of glycosylation, if the protein has glycosylation sites, and can also express recombinant proteins at a high level. The use of this system has been reviewed in some detail by Luckow and Summers, Bio/Technology, Sep. 11, 1987. The recombinant ASP fusion proteins can also be expressed in insect cells using other expression vectors such as Entomopox viruses and cytoplasmic polyhedrosis viruses (CPV).
5. Mammalian cells as host: Many heterologous genes have been expressed in mammalian cells on a commercial scale. The commercial production of recombinant human tissue plasminogen activator is an example. Most of these expression vectors contain 1) either a mammalian promoter, such as metallocyanin or growth hormone, or viral promoters, such as SV40 early promoter or long terminal repeats of viral genes; 2) polyadenylation signals; and 3) appropriate regulatory elements for E. coli cloning including antibiotic resistance genes. After the insertion of ASP downstream from the promoter, the vector can be first cloned in E. coli, isolated and transfected into mammalian cells. Neomycin or similar resistant selection markers can be either cotransfected in another vector or in the same vector. For high level expression, a gene amplification system is advantageous. For example, the expression vector can contain the gene of dihydrofolate reductase (dhfr). When the dhfr-strain of Chinese hamster ovary (CHO) cells are used, the cloned gene can be coamplified with that of dhfr by adapting the transformed cells to increasing methotrexate concentration. The transformant clones secreting ASP can be identified by enzyme assays or by western blots. Successful examples of this approach include the synthesis of recombinant prorenin, described by Poorman et al., Proteins 1: 139-145 (1986), and human immune interferon, described by Scahill et al., Proc. Natl. Acad. Sci., U.S.A. 80: 4654-4658 (1983).
B. Purification of Recombinant ASP.
Methods for purifying proteins are well known and can be generally divided into chromatographic methods, for example, ion exchange chromatography, molecular weight sieving, high pressure liquid chromatography, affinity chromatography, and electrophoretic methods, for example, electrophoresis on agarose or acrylamide gels and isoelectric focusing. Any of these methods can be adapted to purify ASP.
A preferred method of purification is affinity chromatography. In immunoaffinity chromatography, an antibody to ASP is immobilized on a chromatographic substrate, a mixture containing ASP is applied to the substrate under conditions allowing the antibody to bind ASP, the unbound material is removed by washing, and the bound ASP is eluted using, for example, high or low pH, protein denaturants or chaotropes.
For example, ASP may be purified by affinity chromatography using one or a combination of immobilized antibodies such as those described below covalently bound to agarose beads or bound non-covalently via a Goat-anti mouse IgM antibody to Staphylococcus aureus protein G beads. ASP isolation can also be achieved, for example, by incubating cell extracts with an anti-ASP antibodies, described below, attached to a solid phase, such as chemical conjugation to agarose beads. After incubation, the beads are washed, denatured and resolved on a polyacrylamide gel.
HOOKWORM VACCINES
ASP or immunogenic fragments of ASP can be formulated and packaged using methods and materials known to those skilled in the art of vaccines, examples of which are described below. As used herein, an immunogenic fragment of a protein is a protein fragment of at least five to eight amino acids that elicits an immune response in an animal or individual. For use in a vaccine, ASP or immunogenic fragments of ASP can be fused to one or more other proteins or amino acid sequences. Such fusions are useful for combining multiple antigens in a single vaccine.
A. Carriers
Numerous carriers for administration of vaccine compounds are known. These include simple liquid carriers, adjuvants, and polymeric and lipid compositions. Simple liquid carriers, such as water or a buffered saline, can be used; either alone or in combination with other carriers.
1. Adjuvants: For administration as a vaccine, ASP can be combined with an adjuvant, in an amount effective to enhance the immunogenic response. A common adjuvant widely used in humans is alum, that is, aluminum phosphate or aluminum hydroxide. Saponin and its purified component Quil A, Freund's complete adjuvant and other adjuvants used in research and veterinary applications have toxicities which limit their potential use in human vaccines. Chemically defined preparations such as muramyl dipeptide, monophosphoryl lipid A, and phospholipid conjugates such as those described by Goodman-Snitkoff et al., J. Immunol. 147: 410-415 (1991), and incorporated by reference herein, can also be used. A preferred adjuvant is Syntex Adjuvant Formulation (SAF), which is described by Allison and Byars, J. Immunol. Methods 95: 157 (1986), and Byars and Allison, Vaccine 5: 223 (1987).
Adjuvants for oral administration.
It is known that oral administration of an admixture of trace amounts of cholera toxin (CT), either cholera toxin subunit A, cholera toxin subunit B, or both, and a second antigen stimulate a mucosal immunity to the co-administered antigen. Furthermore, there is a dramatic humoral immune response to the second antigen instead of the immune tolerance that is elicited by oral delivery of the antigen alone. Thus, mucosally delivered CT functions as a powerful immunostimulant or adjuvant of both mucosal and humoral immunity. It is therefore preferred to enhance immunogenicity of the orally administered antigen by including CT in the vaccine.
Adiuvants for parenteral administration.
Examples of adjuvants include muramyl dipeptides, muramyl tripeptide, cytokines, diphtheria toxin, and exotoxin A. Commercially available adjuvants include QS-21 from Cambridge Biosciences, Worcester, MA, and monophosphoryl lipid A (MPLA) from Ribi Immunochem.
2. Polymeric Carriers: The carrier may also be a polymeric delayed release system. Synthetic polymers are particularly useful in the formulation of a vaccine to effect the controlled release of antigens. An example of this is described by Kreuter, Microcapsules and Nanoparticles in Medicine and Pharmacology, pages 125-148 (M. Donbrow, ed., CRC Press). The use of other particles have demonstrated that the adjuvant effect of these polymers depends on particle size and hydrophobicity.
Microencapsulation has been applied to the injection of microencapsulated pharmaceuticals to give a controlled release. A number of factors contribute to the selection of a particular polymer for microencapsulation. The reproducibility of polymer synthesis and the microencapsulation process, the cost of the microencapsulation materials and process, the toxicological profile, the requirements for variable release kinetics and the physicochemical compatibility of the polymer and the antigens are all factors that must be considered. Examples of useful polymers are polycarbonates, polyesters, polyurethanes, polyorthoesters, and polyamides, particularly those that are biodegradable.
A frequent choice of a carrier for pharmaceuticals and more recently for antigens is poly (d,l-lactide-co-glycolide) (PLGA). This is a biodegradable polyester that has a long history of medical use in erodible sutures, bone plates and other temporary prostheses, where it has exhibited no toxicity. A wide variety of pharmaceuticals including peptides and antigens have been formulated into PLGA microcapsules. A body of data has accumulated on the adaptation of PLGA for the controlled release of antigen, for example, as reviewed by Eldridge et al., Current Topics in Microbiology and Immunology 146: 59-66 (1989). The PLGA microencapsulation process uses a phase separation of a water-in-oil emulsion. In this process, ASP is prepared as an aqueous solution and the PLGA is dissolved in a suitable organic solvents such as methylene chloride and ethyl acetate. These two immiscible solutions are co-emulsified by high-speed stirring. A non-solvent for the polymer is then added, causing precipitation of the polymer around the aqueous droplets to form embryonic microcapsules. The microcapsules are collected, and stabilized with one of an assortment of agents (polyvinyl alcohol (PVA), gelatin, alginates, polyvinylpyrrolidone (PVP), methyl cellulose) and the solvent removed by either drying in vacuo or solvent extraction.
3. Proteosome Carriers: Proteosomes, combinations of protein and liposomes, can also be used as carriers for ASP; using ASP as the protein component. The procedures and materials for the use of proteosomes are as described in Lowell et al., Science 240:800 (1988); Lowell, in New Generation Vaccines (Woodrow and Levine, eds., Marcel Dekker, NY, 1990), Ch. 12, pages 141-160; and Orr et al., Infect. Immun. 61: 2390 (1993), the teachings of which are incorporated herein.
It will be understood by those skilled in the art that the immunogenic vaccine composition can contain other physiologically acceptable ingredients such as water, saline or a mineral oil such as Drakeol™, Markol™, and squalene, to form an emulsion, or in combination with aqueous buffers, or encapsulated within a capsule or enteric coating to protect the protein from degradation while passing through the stomach.
B. Nucleic Acid Vaccines
Nucleic acid encoding all or an immunogenic part of ASP can also be used as or in a vaccine. For example, a benign microorganism expressing ASP can be administered as a vaccine. A vaccine of this type is described by Eisinstein, Science 214: 337-338 (1981). Nucleic acid encoding ASP can also be directly administered, in the manner described by Liu et al., AIDS Research and Human Retroviruses 10: S34 (1994), and Donnelly et al., J. Immunol. Methods 176(2): 145-152 (1994).
Administration of Vaccine
In a preferred embodiment, the vaccine is packaged in a single dosage for immunization by parenteral, that is, intramuscular, intradermal or subcutaneous, administration; or nasopharyngeal, that is, intranasal, administration. The effective dosage is determined using standard techniques, such as antibody titer. The antigen may be lyophilized for resuspension at the time of administration or in solution. If administered with adjuvant, the adjuvant may be administered in combination with or in the vicinity of the vaccine.
Immunity can be measured using assays to detect and quantitate antibodies that bind to ASP. Cellular immunity can be measured using assays that measure specific T-cell responses such as delayed type hypersensitivity (DTH) and lymphocyte proliferation.
The dosage is determined by the antigen loading and by standard techniques for determining dosage and schedules for administration for each antigen, based on titer of antibody elicited by the antigen administration. As used herein, a dose effective to elicit an immune response is considered to be one that causes antibody titer to increase compared to untreated animals or individuals, using any of the known methods of titering antibodies.
As an example of ASP vaccine use in animals, and to test the use of ASP as a vaccine, the following procedure can be used. Dogs in the experimental group can be immunized with 0.2 mg of recombinant ASP in the presence of an equal volume of aluminum hydroxide (alum). The initial injection can be performed at an intramuscular (i.m.) site. For testing efficacy, control dogs can be injected with alum alone. Boosts can be administered over two week intervals. The first boost can also use 0.2 mg recombinant ASP injected i.m. in the presence of an alum adjuvant, while the second boost can use 0.1 mg of recombinant ASP in buffer administered by the intravenous route.
Circulating antibodies to recombinant ASP can be detected by enzyme immunoassay using recombinant ASP as antigen. Such assays are described below. Briefly, plates can be coated with 1 microgram of recombinant ASP per well. Horse radish peroxidase (HRP)-conjugated goat anti-dog IgG antibodies is used at 1:1,000 dilution. Canine immune responses can also be measured by immunofluorescence (IFA), two-direction agarose diffusion and by Western/immunoblotting as described by Liu Shu-xian et al., SE Asian J. Trop. Med. Pub. Health 24: 61-65 (1993).
Following immunization both experimental and control groups of dogs can be challenged with 500 A. caninum infective larvae. The natural history of these hookworm infections will be monitored by following a number of biological parameters including 1) numbers of gastrointestinal tract, 2) parasite wet weight (size), 3) quantitative egg counts in order to examine parasite fecundity, 4) circulating hemoglobin concentrations and hematocrits to measure the extent of hookworm anemia, 5) circulating total protein and albumin concentration, and 6) measurement of ASP and ASP nucleic acid levels.
Diagnostics
Detection and quantitation of ASP, hookworm nucleic acid, and anti-ASP antibodies in clinical samples and body fluids can be accomplished using any of the known methods for detection of antigens, nucleic acids, and antibodies. Such assay are useful for determining if an individual is infected with hookworm, whether an individual is producing hookworm antibodies, and for testing the concentration or potency of ASP vaccines or ASP antibodies.
A. Antibodies
Many useful assays involve the use of antibodies specific for ASP protein. Such antibodies can be made using any of the known procedures, examples of which are described below. As used herein, an antibody specific for ASP protein is an antibody that is immunoreactive with an ASP protein, as defined herein, but that is not immunoreactive with hymenoptera proteins.
1. In vivo Immunization of Mice: Animals such as mice may be immunized by administration of an amount of ASP, or a fragment of ASP, effective to produce an immune response. Preferably a mouse is subcutaneously injected in the back with 100 micrograms of antigen, followed three weeks later with an intraperitoneal injection of 100 micrograms of ASP with adjuvant, most preferably Freund's complete adjuvant. Additional intraperitoneal injections every two weeks with adjuvant, preferably Freund's incomplete adjuvant, may be necessary until the proper titer in the mouse's blood is achieved. In order to use the mice for fusion and hybridoma production, a titer of at least 1:5000 is preferred, and a titer of 1:100,000 or more is most preferred.
2. In vivo Immunization of Rabbits: Rabbits may be immunized by administration of ASP, or a fragment of ASP, effective to produce an immune response. Preferably a rabbit is intradermally and intravascularly injected at multiple sites with an adjuvant, preferably Freund's complete adjuvant, and ASP coupled to a carrier.
3.In vitro Inmmunization: In vitro immunization of human lymphocytes can be used to generate human monoclonal antibodies (MAb) to ASP. Techniques for in vitro immunization of human lymphocytes are well known to those skilled in the art. Examples of this method are described by Inai et al., Histochemistry (Germany) 99(5): 335-362 (May 1993); Mulder et al., Hum. Immunol. 36(3): 186-192 (Mar. 1993); Harada et al., J. Oral Pathol. Med. (Denmark) 22(4): 145-152 (Apr. 1993); Stauber et al., J. Immunol. Methods (Netherlands) 161(2): 157-168 (May 26, 1993); and Venkateswaran et al., Hybridoma 11(6): 729-739 (Dec. 1992), which are incorporated herein by reference. These techniques can be used to produce antigen-reactive human monoclonal antibodies, including antigen-specific IgG, and IgM human monoclonal antibodies.
4. Monoclonal Antibodies: Standard monoclonal antibody technology, described by Galfre and Milstein, Methods Enzymol. 73: 3-46 (1981), can be used to obtain anti-ASP MAbs. Briefly, MAbs to ASP can be produced after immunization of mice with purified ASP or a fragment of ASP. Hybridomas are produced using spleen cells from mice immunized with the antigen. The spleen cells of each immunized mouse is fused with mouse myeloma Sp 2/0 cells, for example using the polyethylene glycol fusion method described by Galfre and Milstein (1981). Growth of hybridomas, selection in HAT medium, cloning and screening of clones against antigens are carried out using standard methodology described by Galfre and Milstein (1981).
HAT-selected clones are injected into mice to produce large quantities of MAb in ascites, as described by Galfreand Milstein (1981), and the MAbs in ascites may then, if desired, be purified using protein A column chromatography. MAbs are selected on the basis of their (a) specificity for ASP, (b) high binding affinity, (c) isotype, and (d) stability.
C. Purification of Antibodies
Several standard methods of antibody purification are known in the art. Any of these is suitable to purify ASP antibodies. For example, ASP antibodies can be purified by affinity chromatography using antigen molecules immobilized on a solid support.
D. Labelled Antibodies
Anti-ASP antibodies can be directly or indirectly labelled with a detectable label to facilitate detection of the presence of the antibodies by detection of the label. Various types of labels and methods of labelling antibodies are well known to those skilled in the art. For example, the antibody can be labelled directly or indirectly with a radiolabel such as, but not restricted to, 32 P, 3 H, 14 C, 35 S, 125 I, or 131 I. The radiolabel is generally attached by chemical modification. Detection of a label can be by methods such as scintillation counting, gamma ray spectrometry or autoradiography.
Fluorogens can also be used directly or indirectly to label the anti-ASP antibodies. Examples of fluorogens include fluorescein and derivatives, phycoerythrin, allo-phycocyanin, phycocyanin, rhodamine, or Texas Red. The fluorogens are generally attached by chemical modification and can be detected by a fluorescence detector.
The anti-ASP antibody can alternatively be labelled directly or indirectly with a chromogen to provide an enzyme or affinity label. For example, the antibody can be biotinylated so that it can be utilized in a biotin-avidin reaction which may also be coupled to a label such as an enzyme or fluorogen. For example the antibody can be labelled with peroxidase, alkaline phosphatase or other enzymes giving a chromogenic or fluorogenic reaction upon addition of substrate. Additives such as 5-amino-2,3-dihydro-1,4-phthalazinedione, also known as Luminol™(Sigma Chemical Company, St. Louis, Mo.), and rate enhancers such as p-hydroxybiphenyl, also known as p-phenylphenol (Sigma Chemical Company, St. Louis, Mo.), can be used to amplify enzymes such as horseradish peroxidase through a luminescent reaction; and luminogeneic or fluorogenic dioxetane derivatives of enzyme substrates can also be used. Such labels can be detected using enzyme-linked immunosorbent assays (ELISA) or by detecting a color change with the aid of a spectrophotometer.
E. Testing for Specificity and Affinity
Anti-ASP antibodies can be screened or tested for specificity using any of a variety of standard techniques, including Western Blotting and ELISA, both described by Koren et al., Biochim. Biophys., Acta 876: 91-100 (1986). Many assays useful for determining immunoreactivity and specificity are described in Johnstone and Thorpe, Immunochemistry in Practice, Second edition (Blackwell Scientific Publication, Oxford, 1987). For example, in ELISA, separate wells in microtiter plates are coated with purified ASP which adsorb to the wall of the wells. The wells are then treated with a blocking agent, such as bovine serum albumin or nonfat milk proteins, to cover areas in the wells not bound by antigen. Ascites fluid or other antibody-containing preparation can then be applied to each well in varying concentrations and adequate time allowed for antibody to bind the antigen adsorbed on the wall of each well. The presence of antibody bound to antigen in a well can then be detected using a standard enzyme-conjugated anti-mouse antibody which will bind antibody that has bound to ASP in the well. Wells in which antibody is bound to antigen are then identified by adding a chromogenic substrate for the enzyme conjugated to the anti-antibody antibody and color production detected by an optical device such as ELISA plate reader.
Antibodies that bind to a particular ASP fragment with no reactivity with other ASP regions are considered specific for that fragment. To determine specificity of MAbs for a particular ASP fragment individual wells on ELISA plates are coated with various ASP fragments and subjected to the identical procedure. To determine whether or not two antibodies specific for the same ASP fragments bind to different epitopes, a competitive ELISA is carried out as follows. For example, one of the antibodies is biotinylated whereas the other is not so modified. Mixtures containing a constant concentration of the biotinylated antibody and increasing concentrations of the non-biotinylated antibody are incubated with wells coated with the appropriate ASP fragment. The quantity of biotinylated antibody bound to the coated antigen is determined using a streptavidin-peroxidase conjugate and a chromogenic substrate. A decreased binding of the biotinylated antibody with increasing concentrations of the non-biotinylated antibody indicates that the two antibodies compete for the same epitope. If the biotinylated antibody binds equally to the antigen despite increasing concentrations of the non-biotinylated antibody, the two antibodies do not compete for the same epitope. This competition can be complete or partial.
Affinity of antibodies can be determined using radioactively labelled (125 I) ASP and purified antibodies as described previously by Koren et al., (1986).
F. Antibodies and ASP Immobilized on Solid Phase Materials
1. Solid Phase Materials: Antibodies and ASP can be bound to a solid phase material for use in assays described herein. Various types of adsorptive materials, such as nitrocellulose, Immobilon™, polyvinyldiene difluoride (all from BioRad, Hercules, calif.) can be used as a solid phase material in the compositions and methods described herein. Pieces or strips of these materials can be coated with one or more antibodies, or functional fragments thereof, directed against specific epitopes of ASP; or with ASP, for detection of anti-ASP antibodies. Such strips are referred to herein as "dipsticks". The strips may also be attached to one end of a longer strip of a solid support material, such as plastic, which can serve as a handle for dipping the dipstick into various solutions and samples. The plastic handle can also serve as a tether so that multiple dipsticks can be attached to a common support. Such a multi-strip design may be particularly useful in screening for different forms of ASP simultaneously.
Although various sizes of dipsticks are possible, typically, pieces of the solid phase material that are coated with antibody have the general dimensions of 0.5 cm×0.5 cm and can be attached to the longer solid support strips having general dimensions of 0.5 cm×5 cm. Such dimensions permit an accurate determination of ASP levels in as little as 100 μl of blood.
2. Coating solid phase material with antibodies and ASP: The solid phase material may be coated with antibodies or ASP by any of a variety of methods. If the material is made of a protein-receptive solid phase material that adsorbs proteins, such as nitrocellulose or polyvinyldiene difluoride (PVDF) membrane, the material can be coated directly with antibody or ASP by immersing the solid phase material directly into a solution of the protein.
After protein has been adsorbed on the material, the material is treated ("blocked") with a blocking agent in order to minimize nonspecific adsorption of proteins to unoccupied domains on the material. The solid phase material can be treated with any of a variety of blocking agents such as bovine serum albumin (BSA), gelatin, Tris, all of which are available commercially (Sigma, St Louis, Mo.) or nonfat milk proteins. For example, PVDF strips can be blocked with two percent (w/v) milk blocking solution (Kirkegaard and Perry Laboratories, Gaithersburg, Md.) for 48 hours at 4° C.
A dipstick may be coated with more than one antibody or ASP so that the single dipstick can be used to detect more than one anti-ASP antibody or more than one form of ASP. For example, two or more separate pieces of a solid phase material, each coated with an antibody directed against a particular ASP or ASP fragment, can be attached (for example, by gluing) to a longer strip of solid support to produce a dipstick with two or more separate areas.
G. Detection of ASP
ASP can be detected and quantitated using any of the known methods of protein detection. Examples include radioimmunoassays (RIA), Western Blotting (Koren et al. (1986)) and enzyme-linked immunosorbent assay (ELISA)(Koren et al. (1986)). Many assays useful for detection of ASP are described in Johnstone and Thorpe, Immunochemistry in Practice, Second edition (Blackwell Scientific Publication, Oxford, 1987). Preferred assays use the ASP-specific antibodies and antibody compositions described above. All of the antibody assays involve bringing into contact a sample to be tested and an antibody that recognizes an Ancylostoma Secreted Protein under conditions promoting conjugation of an Ancylostoma Secreted Protein and the antibody. The bound antibody is then detected, and, depending on the assay, quantitated. Detection and quantitation is typically facilitated by using labelled antibody as described above. Detection of a radiolabel can be by methods such as scintillation counting, gamma ray spectrometry or autoradiography. Fluorogens can be detected by a fluorescence detector. Antibodies directly or indirectly labelled with chromogens are detected visually or spectrophotometrically. Such by detection is preceded by an enzymatic development step when using some chromogens.
H. Detection of Antibodies to ASP
Antibodies that recognize ASP can be detected and quantitated using any of the known methods of antibody detection. Examples include dot blot assays and ELISA. Detection of antibodies that recognize ASP is useful for determining if an individual has ever been infected with hookworm and to evaluate antibody preps. Detection of these antibodies involves bringing into contact a sample to be tested and ASP or an immunogenic part of ASP under conditions promoting conjugation of antibody and ASP. The bound protein is then detected, and, depending on the assay, quantitated. Detection and quantitation is typically facilitated by using labelled protein.
ASP can be used in solution or immobilized to a solid substrate, such as a gel suitable for affinity chromatography, or a multi-well plate, using standard techniques known to those skilled in the art.
To facilitate detection and quantitation, the peptides can be labelled using standard techniques, for use in routine assays, with radioactive, fluorescent, or enzyme labels. Detection of a radiolabel can be by methods such as scintillation counting, gamma ray spectrometry or autoradiography. Fluorogens can be detected by a fluorescence detector. Proteins directly or indirectly labelled with chromogens are detected visually or spectrophoto-metrically. Such by detection is preceded by an enzymatic development step when using some chromogens.
An advantage of the cloned antigens is the ease of preparation of the antigen for use in ELISA. ELISA has advantages over other techniques for quantitation of antibody, which can be used to determine antibody titer. The cloned antigen can also be used to simplify detection of the antigen in a dot blot assay, which cannot be done with whole extract. A dot blot assay can be modified to a "dip-stick" type of test to make it even more simple and incorporate it into a test for multiple specificities at once.
I. Detection of hookworm nucleic acid: Nucleic acid molecules encoding all or a part of ASP can be performed using any of the many well known nucleic acid detection methods. Nucleic acid hybridization assays generally involve bringing into contact a sample to be tested and a labelled nucleic acid probe encoding ASP under conditions promoting hybridization of nucleic acid molecules. The bound nucleic acid is then detected, and, depending on the assay, quantitated.
The detectable portion of the bound probe has traditionally been a substance chemically affixed to the probe such as a chemical label. Examples of chemical labels are radioisotopes, substrate-modifying enzymes such as alkaline phosphatase, enzymatic cascade processes utilizing NADP, and fluorescent compounds. Assays utilizing nucleic acid probes, to which a chemical label has been attached, are described by Grunstein et al., Proc. Natl. Acad. Sci. USA 72: 3961 (1975) and Southern, J. Mol. Biol. 98: 503 (1975), and in U.S. Pat. No. 4,851,331 to Vary et al.; U.S. Pat. No. 4,581,333 to Kourilsky et al.; U.S. Pat. No. 4,994,373 to Stavrianopoulos et al.; U.S. Pat. No. 4,882,269 to Schneider et al.; and International Patent Application Publication No. WO87/03622 to Princeton University.
Recent probe technology has utilized signal-amplification systems that amplify the signal for detection of smaller quantities of target molecule. For example, in nucleic acid assays, the polymerase chain reaction (PCR) and similar processes are used to increase the number of copies of the target molecule to which the detectable probe will bind.
PCR has emerged as a powerful and sensitive procedure for the amplification of specific DNA sequences, and is a valuable tool in paternity identification, tissue typing, and forensics. PCR technology requires pairs of dissimilar DNA oligonucleotides that act as primers to initiate a controlled polymerase reaction for amplification of the DNA sequence that lies between the two oligonucleotide binding sites. The polymerase chain reaction employs the heat-stable Taq polymerase that permits repeated heating and cooling of the reaction mixture. The amplification process is initiated by first heating the reaction mixture to denature, or dissociate, the two complementary strands of the double-stranded DNA to be amplified. Upon cooling, each single-stranded DNA oligonucleotide hybridizes to a specific region of one or the other of the complementary DNA strands and acts as a primer for the heat-stable polymerase. The polymerase uses the oligonucleotide primers as starting points for the elongation of a DNA molecule complementary to the template DNA molecule to which each primer is hybridized. Each of the elongating DNA chains grows towards and beyond the distal primer site of the other template strand. By the end of the first cycle, two double-stranded copies of the intervening genomic sequence lying between the primer binding sites are generated. The cycle is repeated many times, exponentially doubling the number of copies each time. In this way, even a single copy of a specific DNA sequence can be amplified to detectable levels in a relatively short period of time.
PCR technology is described in U.S. Pat. No. 4,683,202 to Mullis; U.S. Pat. Nos. 4,683,195 and 4,965,188 to Mullis et al.; and International Pat. Application Publication No. WO92/14843 to Gilead Sciences Inc.
Other assays employing the concept of signal amplification utilize DNA-dependent RNA polymerases for the amplification of portions of either the target molecules or probe molecules bound to target molecules. In this type of signal amplification assay, an RNA polymerase promoter sequence is included as part of a single-stranded DNA probe so that, after hybridization of the probe to the target, the promoter can be used to promote polymerase-catalyzed synthesis of target or probe segments. Assays employing DNA transcription-based amplification systems are described by Kwoh et al., Proc. Natl. Acad. Sci. USA 86: 1173-1177 (1989); Guarelli et al., Proc. Natl. Acad. Sci. USA 87: 1874-1878 (1990); Japanese Patent Application No. 2,131,599 to Toray Ind. Inc.; International Patent Application Publication No. WO91/17442 to Chiron Corp.; International Patent Application Publication No. WO91/10746 to Chiron Corp.; and International Patent Application Publication No. WO89/06700 to Genentech, Inc.
In a similar RNA based amplification system, a nucleic acid probe containing an RNA molecule is autocatalytically replicated using Qβ bacteriophage replicase as described by Chu et al., Nucl. Acids Res. 14: 5591-5603 (1986); U.S. Pat. No. 4,957,858 to Chu et al.; U.S. Pat. No. 4,786,600 to Kramer et al.; and International Pat. Application No. WO92/12261 to Promega Corp.
Probes have been indirectly labelled in an attempt to avoid the problems associated with direct radioactive labelling. The most common method of indirect labelling is to attach biotin, a small vitamin, to the nucleic acid using a chemical or enzymatic technique. Following hybridization, the biotin is detected by reaction with avidin, an egg white protein which has been labelled with an enzyme or fluorochrome. Bound enzyme can be detected by reaction with color-producing substrates and the fluorochrome can be seen when reacted with incident light of appropriate wavelength.
Hybridization has been detected with the use of an intercalating agent such as acridine orange or ethidium bromide as described in U.S. Pat. No. 4,563,417 to Albarella et al. The intercalating agent becomes inserted between hybridized base pairs of probe and sample nucleic acids and causes the tertiary structure of the helix to unwind. An antibody specific for the newly formed antigenic determinant created by the intercalating agent and the unwound helix is detected by conventional means.
Hybridization can also be detected with the aid of an antibody specific for a labelled probe as described in U.S. Pat. No. 4,743,535 to Carrico. The probe is labelled with a detectable substance such as flavin adenine dinucleotide (FAD) or a fluorescent agent. An antibody specific for the labelled probe, after it has hybridized to the sample nucleic acid, is detected by a biochemical reaction.
Monoclonal antibodies to DNA-RNA hybrids are now available. U.S. Pat. No. 4,732,847 to Stuart et al. and the publication of Stuart et al., Proc. Natl. Acad. Sci., USA 78: 3751 (1981) describe a method of hybridization detection involving a monoclonal antibody specific for a poly(A)-poly(dT) duplex. A monoclonal antibody specific for DNA-RNA hybrids, secreted by hybridoma HB 8730, is disclosed in U.S. Pat. No. 4,833,084 to Carrico et al. Boguslawski et al., J. Immunuol. Methods 89: 123-130 (1986) developed a hybridization assay using anti-hybrid coated polystyrene beads isolated on filter paper in an attempt to reduce non-specific binding and avoid complicated washing procedures.
Targeting of Therapeutics
Therapeutics that can bind to, and inhibit the effect of, ASP during hookworm infection can be designed. Computer modeling technology allows visualization of the three-dimensional atomic structure of a selected molecule and the rational design of new compounds that will interact with the molecule. The three-dimensional construct typically depends on data from x-ray crystallographic analyses or NMR imaging of the selected molecule. The molecular dynamics require force field data. Methods for generating this data and determining three-dimensional structure of a protein are known to those of skill in the art. The computer graphics systems enable prediction of how a new compound will link to the target molecule and allow experimental manipulation of the structures of the compound and target molecule to perfect binding specificity. Prediction of what the molecule-compound interaction will be when small changes are made in one or both requires molecular mechanics software and computationally intensive computers, usually coupled with user-friendly, menu-driven interfaces between the molecular design program and the user.
Examples of molecular modelling systems are the CHARMm and QUANTA programs, Polygen Corporation, Waltham, MA. CHARMm performs the energy minimization and molecular dynamics functions. QUANTA performs the construction, graphic modelling and analysis of molecular structure. QUANTA allows interactive construction, modification, visualization, and analysis of the behavior of molecules with each other.
A number of articles review computer modeling of drugs interactive with specific proteins, such as Rotivinen, et al., 1988 Acta Pharmaceutica Fennica 97, 159-166; Ripka, New Scientist 54-57 (Jun. 16, 1988); McKinaly and Rossmann, 1989 Annu. Rev. Pharmacol. Toxiciol. 29, 111-122; Perry and Davies, QSAR: Quantitative Structure-Activity Relationships in Drug Design pp. 189-193 (Alan R. Liss, Inc. 1989); and Lewis and Dean, 1989 Proc. R. Soc. Lond. 236, 125-140 and 141-162. Other computer programs that screen and graphically depict chemicals are available from companies such as BioDesign, Inc., Pasadena, CA., Allelix, Inc, Mississauga, Ontario, Canada, and Hypercube, Inc., Cambridge, Ontario. Although these are primarily designed for application to drugs specific to particular proteins, they can be adapted to design of drugs specific to regions of DNA or RNA, once that region is identified.
Although described above with reference to design and generation of compounds which could alter binding, one could also screen libraries of known compounds, including natural products or synthetic chemicals, and biologically active materials, including proteins, for compounds which bind to ASP.
The present invention will be further understood by reference to the following non-limiting examples.
EXAMPLE 1 CLONING OF ASP.
Materials and Methods
Larval Activation:
Ancylostoma caninum was maintained as described previously by Hawdon and Schad, Experimental Parasitology 77: 489-491 (1993), and Schad, in Aspects of Parasitology: A Festschrift Dedicated to the Fiftieth Anniversary of the Institute of Parasitology of McGill University (Meerovitch, ed., McGill University, Montreal, 1982), pages 361-391). L3 were collected from one to four week old coprocultures by the Baermann technique, and decontaminated with 1% HCl in BU buffer (50 mM Na2 HP04 /22 mM KH2 PO4 /70 mM NaCl, pH 6.8) (Hawdon and Schad, Journal of the Helminthological Society of Washington 58: 140-142 (1991)) for 30 minutes at 22° C. Approximately 3500-7500 L3 were "activated" by incubation in 0.5 mL RPMI1640 tissue culture medium (supplemented with 0.25 mM HEPES pH 7.2, 100 U/mL penicillin, 100 μg/mL streptomycin, 100 μg/mL gentamicin, and 2.5 μg/mL amphotericin B) containing 15% (v/v) of a less than 10 kDa filtrate of canine serum (FIL) (Hawdon et al. (1995)) and 25 mM GSM in individual wells of 12 well tissue culture plates. Non-activated L3 were incubated in RPMI alone. The larvae were incubated at 37° C., 5% CO2 for 24 hours.
Collection of ES products:
Media containing activated larvae was transferred to individual microfuge tubes and centrifuged for 5 minutes at 16,000 rpm. The tubes were placed on ice for 10 minutes to slow the swimming motions of the larvae. The supernatant containing the ES products was carefully transferred to a new microfuge tube, and inspected visually using a dissection microscope to assure that no L3 had been transferred. The supernatants were pooled and stored at -20° C. Prior to electrophoresis, supernatants are concentrated four to ten fold by lyophilization or ultrafiltration using Centricon™10 cartridges (Amicon).
Protein Sequencing:
ES products from approximately 50,000 activated A. caninum L3 were concentrated and electrophoresed in a 12.5% acrylamide gel (Laemmli, Nature (London) 227: 680-685 (1970)) under non-reducing conditions. A band of molecular weight (MW) 37-40 kDa was excised, digested with trypsin in situ, and the peptides separated by HPLC. One peptide was subjected to sequential Edman degradation, yielding the sequence Gly-Leu-Glu-Pro-Asp-Ala-Leu-Gly-Gly-Asn-Ala-Pro-Lys (SEQ ID NO:3). Sequencing was performed by the Keck Microsequencing facility at Yale University.
PCR:
Degenerate primers in both orientations were synthesized based on the amino acid sequence, and used to amplify an ASP gene-specific product from DNA isolated from an A. caninum L3 cDNA library constructed in lambda ZAP II™ (Stratagene). The degenerate primers were paired with opposing flanking vector primers (T3 or T7 promoter) in preliminary experiments. The sense strand degenerate primer ASP-5 (SEQ ID NO: 11; Table 1) and the T7 primer (SEQ ID NO: 16; Table 1) amplified a product of approximately 550 bp, and therefore these primers were used to amplify DNA for cloning. The reaction conditions for PCR were 10 mM Tris-HCl (pH 9.0), 50 mM KCl, 0.1% Triton X-100, 1.5 mM MgCl2, 0.2 mM of each dNTP, 1 U Taq DNA polymerase (Promega), and 75 ng of phage DNA containing the L3 cDNA library in a 20 μl reaction. Ten identical reactions containing only the DNA and primers in 10 μl were subjected to "hot start" PCR (Amheim and Erlich, Annual Review of Biochemistry 61: 131-156 (1992)) by heating at 94° C. for 5 minutes, then lowered to 85° C. for 5 minutes, during which time the remaining reaction components were added. The reactions were subjected to 30 cycles of 1 minute denaturation at 94° C., 1 minute annealing at 45° C., and 2 minutes extension at 72° C. Following amplification, the products were pooled and digested with PstI and KpnI. The digested DNA was electrophoresed in a 3% low melting point NuSieve™ GTG agarose gel (FMC Bioproducts) containing 0.5 μg/mL ethidium bromide.
A band of approximately 550 bp was excised, transferred to a microfuge tube, and melted at 65° C. The melted agarose was frozen in a dry ice-ethanol bath, and immediately centrifuged at 16,000×g for 10 minutes. The aqueous phase was transferred to a new tube, ethanol precipitated, resuspended in 7 μL of dH2 0, and cloned into pBluescript™ by standard methods. Double-stranded plasmid DNA was sequenced by the dideoxy method (Hattori and Sakaid (1986); Sanger et al. (1977)), using the Sequenase™ 2.0 kit (USB) and sequential synthetic oligonucleotide primers.
Library screening:
The A. caninum L3 cDNA library was propagated in XLI-BLUE cells (Stratagene, La Jolla, calif.), and plated according to standard methods (Sambrook et al., Molecular Cloning: A Laboratory Manual (Cold Spring Harbor, Cold Spring Harbor Laboratory Press, 1989)). Approximately 2×105 plaques were screened with an RNA probe made by transcription of the 550 bp PCR product, using T3 RNA polymerase (Boehringer Manheim), in the presence of α- 32 p!-UTP. Hybridization conditions were as follows: 6X SSPE (lX SSPE=150 mM NaCl/10 mM NaH2 PO4 /1 mM EDTA), 10X Denhardt's solution (lX=0.02% bovine serum albumin, 0.02% polyvinyl-pyrrolidone, 0.02% Ficoll 400), 1.0% SDS, 200 μg/mL yeast tRNA, 50% formamide, and the radiolabelled probe (approximately 1.2×106 cpm/mL) at 42° C. for 18 hours. Filters were washed with 2X SSC/0.1% SDS at 60° C. for 45 minutes, 0.2X SSC/0.1% SDS at 60° C. for 30 minutes, and 0.1X SSC/0.1% SDS at 60° C. for 60 minutes. Filters were exposed to XAR-5 film (Kodak) with an intensifying screen for 7 hours at -70° C. Eight positive clones from the tertiary screen were picked, and the phagemids containing the cDNAs were converted to plasmids (Bluescript™) by in vivo excision (Short and Sorge 1992). Plasmid DNAs were isolated by standard procedures, and digested with EcoRl and XhoI to release the inserts.
Two of the 8 clones were of different sizes, of approximately 1000 and 1200 bp. The 5' and 3' ends were sequenced using T3 and T7 primers, respectively. Both clones had poly(A) tails 3', and identical 3' sequences. The 5' ends were different, but further sequencing indicated that the shorter clone was a truncated version of the longer clone, renamed pASP-1. Restriction mapping indicated internal EcoRI and NcoI restriction sites at nucleotide positions 284 and 888 of SEQ ID NO: 1, respectively, which were utilized for subcloning to facilitate sequencing. Both strands were sequenced completely.
5' RACE:
A modified 5'-RACE technique was used to isolate the 5' end and start codon of the ASP cDNA (Frohman et al., Proceedings of the National Academy of Sciences USA 85: 8998-9002 (1988); Jain and Gomer, Biotechniques 12: 58-59 (1992); Templeton et al., Biotechniques 15: 48-51 (1993)). Approximately 400 mg of frozen A. caninum L3 were ground to a powder in a mortar chilled in liquid nitrogen, and total RNA isolated using the TRIzol reagent (BRL). First strand cDNA was synthesized using M-MLV reverse transcriptase (Superscript™ II, BRL) and one pmole of ASP gene-specific primer 1 (GSP 1; SEQ ID NO: 12; Table 1) according to the manufacturer's protocol. The cDNA was ethanol precipitated in the presence of 10 μg of yeast tRNA, and resuspended in 200 μl dH2 0. The cDNA was 3'-tailed with in a 50 μl reaction containing 33.5 μl cDNA, 1 mM dGTP, and 15 U of terminal deoxytransferase (TdT, BRL) for 1 hour at 37° C. Following tailing, the reaction was extracted once with phenol:chloroform:isoamyl alcohol (25: 24: 1), ethanol precipitated, and resuspended in 150 μl of dH2 0. Two μl were used as template for the first PCR reaction, containing 25 pmoles of GSP 2 antisense primer (SEQ ID NO: 13), located internally to the primer used for RT (Table 1), together with 25 pmoles of a 5' poly(G) anchor primer (SEQ ID NO: 15; Table 1). The 50 μl reaction was subjected to 40 cycles of one minute at 94° C., one minute at 48° C., and 1 minute at 72° C. Following amplification, 1 μl of the reaction was used in a second PCR reaction, which was identical to the first, except that a third nested antisense primer, GSP 3 (SEQ ID NO: 14; Table 1) with a 5' EcoRI restriction site, was substituted for GSP 2, and the annealing temperature increased to 55° C. Four reactions were pooled, extracted with phenol and chloroform, precipitated, and digested with BamHI and EcoRI. The inserts were gel purified, cloned into pBluescript™, and sequenced as above.
              TABLE 1                                                     
______________________________________                                    
Primers used for PCR and 5' RACE.                                         
______________________________________                                    
ASP 5      5'-GGTACTGCAGGARCCNGAYGCNYTNGG-3'                              
GSP 1      5'-CCGACTCCATTATAGATGG-3'                                      
GSP 2      5'-CCACCAGCCGGAGAGC-3'                                         
GSP 3      5'-CTTGAATTCCAGCGAACGCGC-3'                                    
Anchor     5'-GAATCGATGGATCCTGCAGC.sub.(17)                               
T7 promoter                                                               
           5'-AATACGACTCACTATAG-3'                                        
______________________________________                                    
 R = A or G; Y = C or T; N = A, C, T, or G. Restriction sites PstI (ASP 5)
 EcoRI (GSP 3), and BamHI (anchor) used for cloning are underlined.       
Western Blotting:
Concentrated ES products were electrophoresed in 11% polyacrylamide gel and transferred to Immobilon™-P PVDF membranes (Millipore) by electroblotting at 20V for 16 to 18 hours at 4° C. The membranes were blocked with 5% non-fat dry milk (Carnation) in PBS (NFDM) for 6 to 8 hours at 4° C. Following blocking, the membrane was incubated with a 1:1000 dilution of rabbit antiVespula squamosa antigen 5 (Vesq Ag5) antibody (a gift of Donald Hoffman, Dept. of Pathology, East Carolina University) in NFDM for 16-18 hours at 4° C. After 3 washes in NFDM, the membrane was incubated with a 1:5000 dilution of HRP-conjugated goat anti-rabbit secondary antibody (Sigma) for one hour at 22° C. Bands were visualized using Enhanced Chemiluminescence (Amersham).
EXAMPLE 2 EXPRESSION OF ASP.
Expression of ASP-1:
A 1 kb EcoRI/XhoI fragment containing the 3' end and poly(A) tail of ASP-1 was cloned in-frame into the pET28(c) expression vector (Novagen) and used to transform competent BL21 E. coli cells. Log-phase cells were induced by the addition of one mM IPTG, and incubated for three hours. One milliliter aliquots were removed after 0, 1, 2, and 3 hours of induction, and examined by SDS-PAGE and Western blotting.
Purification of ASP:
Two liters of induced BL21 cells containing the recombinant pET28: ASP plasmid were centrifuged, and the supernatant discarded. The pellet was resuspended in 60 mL of 50 mM Tris, pH 8.0/2 mM EDTA/0.1% Triton X-100 containing 100 μg/mL lysozyme, and incubated at 30 C. for 30 minutes. The solution was sonicated using a Branson 450 Sonifier equipped with a microtip for four minutes (output setting 3, 30% duty cycle) until no longer viscous. The solution was centrifuged at 12,000×g for 15 minutes, and the supernatant discarded. The pellet containing the expressed ASP was resuspended in 60 mL 1% SDS/0.5% 2-mercaptoethanol (2-ME), boiled for 5 minutes, and incubated at 22 C. for 14-18 hours (overnight). The lysate was transferred to dialysis membrane (12,000-14,000 molecular weight cut-off) and dialyzed against two liters of 0.1% SDS in PBS for two days, with two changes of buffer.
The pET28 expression system is designed to attach a short leader containing 6 histidine residues on the amino terminus of the expressed protein. This allows purification of the recombinant protein using a Ni++ chelating resin (HisBind, Novagen) to bind the His tag. Recombinant ASP was purified from the cell extract according to the manufacturers's instructions, except that 0.1% SDS was added to the column buffers. The protein was eluted from the column with 1.0 M imidazole, dialyzed as above, and examined by SDS-PAGE. Protein concentration was determined by the bicinchoninic acid (BCA) method (BCA Protein Assay Kit, Pierce).
EXAMPLE 3 DETERMINATION OF BIOLOGICAL FUNCTION OF ASP.
In Vitro Activation Experiments:
METHOD
In vitro activation experiments were conducted to investigate the biological function of ASP. The first group of experiments were to determine the kinetics of ASP release. Individual wells containing approximately 5000 activated L3 were harvested after 30 minutes, 1, 3, 6, and 24 hours of incubation, and the ES removed and concentrated by lyophilization. Non-activated L3 incubated for 24 hours in RPMI alone were used as a negative control. A second kinetic experiment, in which the ES products of a single population of L3 was sampled over time, was conducted as follows. A well containing approximately 5300 L3 was incubated under standard activation conditions (see above). After 1, 3, 6 and 24 hours of incubation, the L3 were removed, pelleted, and the supernatant transferred to a new tube and concentrated by lyophilization. The L3 were returned to a new well, fresh medium containing the stimuli was added, and the incubation resumed, except at 24 hours, which was the terminal time point. A negative control (no stimuli) and a positive control (entire 24 hour ES output) were harvested at 24 hours.
The second type of experiment was to determine the effect of feeding inhibitors on the release of ASP. Approximately 2000 L3 were incubated with 0.5 mM 4,7-phenanthroline, a known feeding inhibitor, and activation stimuli for 24 hours. Following incubation, the ES products were harvested as above. The ES products from all experiments were examined by Western blotting as described above.
RESULTS
When A. caninum L3 are stimulated to resume feeding in vitro, they release a major product with a Mr of approximately 40 kDa, referred to as the Ancylostoma Secreted Protein. As described above, microsequencing of a tryptic digest of this protein revealed a peptide with the sequence N-Gly-Leu-Glu-Pro-Asp-Ala-Leu-Gly-Gly-Asn-Ala-Pro-Lys (SEQ ID NO:3). A degenerate primer derived from this sequence, together with a primer complementary to flanking vector sequence, amplified a fragment of approximately 550 bp from phage λ DNA containing an A. caninum L3 cDNAs. This product was used as a probe to isolate a 1.2 kb cDNA clone encoding ASP from the A. caninum L3 cDNA library. The cDNA contained a 3' poly(A) tail, but lacked a 5' initiation codon. The 5' end containing the ATG (Met) start codon was isolated from L3 cDNA by 5' RACE. Four 5' end clones were sequenced, and found to encode untranslated leaders of variable sequence and length, but identical coding sequences that overlapped with the cDNA clone. The nucleotide sequences of untranslated 5' leader sequences isolated using 5' RACE of A. caninum L3 cDNA are depicted in SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, and SEQ ID NO:7. None of the leaders contained the conserved nematode SL 1 or SL 2 (Bektesh and Hirsh, Nucleic Acids Research 16: 5692 (1988); Nilsen, Annual Review of Microbiology 47: 413-440 (1993); Spieth et al., Cell 73: 521-532 (1993)), nor could the 5' end be amplified from cDNA using an SL 1 primer and an internal gene specific primer.
The full length cDNA encodes an open reading frame (ORF) of 424 amino acids (nucleotides 1-1272 of SEQ ID NO:1), with a predicted molecular weight of 45,735 and an isolelectric point of 7.13. The full length cDNA also has a 34 bp 3' untranslated region (nucleotides 1273-1306 of SEQ ID NO:1). The entire sequence of the isolated peptide is present in the ORF (amino acids 255 to 267 of SEQ ID NO:2), confirming that this cDNA encodes the ASP molecule. The amino terminal 18 amino acids are highly hydrophobic, and a potential eukaryotic signal sequence cleavage site is located between amino acids 18 and 19 (von Heijne, Nucleic Acids Research 14: 4683-4690 (1986)).
Sequence editing, alignments and comparisons were performed using the GCG computer program (Genetics Computer Group Wisconsin Package) on a VAX 7610 computer. The potential signal sequence cleavage sites was determined using the PSIGNAL program (PC/GENE Release 5.18, Intelligenetics, Mountain View, Calif.) on a personal computer.
Database comparison (SwissProt) revealed significant homology between 215 amino acids of the carboxyl terminal of the ASP deduced amino acid sequence and the antigen 5 molecule of Hymenoptera venoms, whereas the amino terminal 191 amino acids failed to show significant homology to any proteins in the database. This homology is apparent by comparing the ASP deduced amino acid sequence (amino acids 192 to 406 of SEQ ID NO:2) with the amino acid sequences of representative Hymenoptera species, Dola, Dolichovespula arenaria (SEQ ID NO:8); Vesv, Vespula vulgaris (SEQ ID NO:9); and Pola, Polistes annulatis (SEQ ID NO:10). Western blots using Vesq Ag5, a polyclonal antibody against the antigen 5 of the yellowjacket Vespula squamosa, recognized a 40 kDa protein in activated, but not non-activated, A. caninum L3 ES products. Additionally, this antibody recognized a protein of Mr=38 kDa in lysates of E. coli that express an approximately 1 kb 3' fragment of the ASP CDNA (amino acids 96 to 424 in SEQ ID NO:2), but not in uninduced bacteria. The anti-Ag 5 antibody recognized bands of slightly higher molecular weight (Mr approximately 42 kDa) in soluble extracts of A. caninum adults and L3, and A. braziliense, Strongyloides stercoralis, and Haemonchus contortus L3.
The in vitro kinetics experiments described above indicate that ASP is released within the first 30 minutes of incubation, and is released continuously thereafter, following larval activation. Inhibition of activation with the feeding inhibitor 4,7-phenanthroline, performed as described above, prevents the release of ASP. This indicates that release of ASP is associated with the activation of hookworm larvae.
Modifications and variations of the present invention will be obvious to those skilled in the art from the foregoing detailed description. Such modifications and variations are intended to come within the scope of the appended claims.
__________________________________________________________________________
SEQUENCE LISTING                                                          
(1) GENERAL INFORMATION:                                                  
(iii) NUMBER OF SEQUENCES: 16                                             
(2) INFORMATION FOR SEQ ID NO:1:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 1320 base pairs                                               
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: double                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: cDNA                                                  
(iii) HYPOTHETICAL: NO                                                    
(iv) ANTI-SENSE: NO                                                       
(vi) ORIGINAL SOURCE:                                                     
(A) ORGANISM: Anacylostoma caninum                                        
(D) DEVELOPMENTAL STAGE: Larva                                            
(ix) FEATURE:                                                             
(A) NAME/KEY: terminator                                                  
(B) LOCATION: 1273..1275                                                  
(ix) FEATURE:                                                             
(A) NAME/KEY: sig.sub.-- peptide                                          
(B) LOCATION: 1..54                                                       
(ix) FEATURE:                                                             
(A) NAME/KEY: mat.sub.-- peptide                                          
(B) LOCATION: 55..1272                                                    
(ix) FEATURE:                                                             
(A) NAME/KEY: CDS                                                         
(B) LOCATION: 1..1272                                                     
(ix) FEATURE:                                                             
(A) NAME/KEY: 3'UTR                                                       
(B) LOCATION: 1273..1306                                                  
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:                                   
ATGTTTTCACCTGTAATCGTCAGTGTGATTTTCACAATCGCCTTCTGCGATGCGTCTCCA60            
GCAAGAGACGGCTTCGGCTGTTCAAACAGTGGGATAACTGACAAGGACCGGCAAGCATTC120           
CTCGACTTCCACAACAATGCTCGTCGACGGGTTGCGAAAGGCGTTGAGGATAGCAACTCC180           
GGCAAACTGAATCCAGCGAAGAACATGTACAAGCTGTCATGGGACTGTGCAATGGAACAG240           
CAGCTTCAGGATGCCATTCAGTCATGCCCAAGCGCGTTCGCTGGAATTCAAGGTGTTGCG300           
CAGAATGTAATGAGCTGGTCAAGCTCTGGTGGATTCCCCGATCCATCGGTAAAGATAGAA360           
CAAACGCTCTCCGGCTGGTGGAGTGGTGCTAAAAAGAACGGCGTCGGCCCGGACAACAAA420           
TACAACGGTGGCGGTCTCTTCGCCTTCTCTAACATGGTATACTCCGAAACGACGAAACTT480           
GGCTGCGCCTACAAGGTTTGCGGCACTAAACTGGCGGTTTCGTGCATCTATAATGGAGTC540           
GGGTACATCACAAATCAACCTATGTGGGAGACAGGTCAGGCTTGCAAGACAGGAGCAGAC600           
TGCTCCACTTACAAGAACTCAGGCTGCGAGGATGGCCTTTGCACGAAAGGACCAGACGTA660           
CCAGAAACAAACCAGCAGTGCCCCTCAAACACTGGAATGACTGATTCAGTCAGAGATACT720           
TTCCTATCGGTGCACAATGAGTTCAGGTCGAGTGTTGCCCGAGGTCTGGAACCCGACGCT780           
CTGGGCGGAAATGCACCAAAAGCAGCTAAAATGCTCAAGATGGTGTATGACTGTGAAGTA840           
GAAGCATCGGCCATCAGACATGGAAATAAATGCGTCTATCAACATTCCCATGGCGAAGAC900           
AGACCTGGACTAGGAGAAAACATCTACAAGACTAGTGTACTCAAATTCGATAAGAACAAA960           
GCAGCCAAGCAGGCTTCACAACTCTGGTGGAATGAGTTAAAAGAGTTCGGCGTCGGCCCA1020          
TCCAACGTCCTTACCACTGCTTTATGGAATAGACCCGGCATGCAGATTGGTCACTACACC1080          
CAGATGGCATGGGACACCACCTACAAACTTGGATGTGCAGTTGTTTTCTGCAATGATTTC1140          
ACATTCGGTGTTTGTCAGTATGGGCCAGGAGGCAATTACATGGGTCATGTCATCTACACT1200          
ATGGGCCAGCCGTGTTCTCAGTGTTCGCCTGGTGCTACTTGCAGCGTGACCGAAGGCTTG1260          
TGCAGTGCTCCTTAATCAGTTCTTAACAATGAATATCTTACAGTTGAAAAAAAAAAAAAA1320          
(2) INFORMATION FOR SEQ ID NO:2:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 424 amino acids                                               
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS:                                                         
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: protein                                               
(iii) HYPOTHETICAL: NO                                                    
(iv) ANTI-SENSE: NO                                                       
(vi) ORIGINAL SOURCE:                                                     
(A) ORGANISM: Ancylostoma caninum                                         
(D) DEVELOPMENTAL STAGE: Larva                                            
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:                                   
MetPheSerProValIleValSerValIlePheThrIleAlaPheCys                          
151015                                                                    
AspAlaSerProAlaArgAspGlyPheGlyCysSerAsnSerGlyIle                          
202530                                                                    
ThrAspLysAspArgGlnAlaPheLeuAspPheHisAsnAsnAlaArg                          
354045                                                                    
ArgArgValAlaLysGlyValGluAspSerAsnSerGlyLysLeuAsn                          
505560                                                                    
ProAlaLysAsnMetTyrLysLeuSerTrpAspCysAlaMetGluGln                          
65707580                                                                  
GlnLeuGlnAspAlaIleGlnSerCysProSerAlaPheAlaGlyIle                          
859095                                                                    
GlnGlyValAlaGlnAsnValMetSerTrpSerSerSerGlyGlyPhe                          
100105110                                                                 
ProAspProSerValLysIleGluGlnThrLeuSerGlyTrpTrpSer                          
115120125                                                                 
GlyAlaLysLysAsnGlyValGlyProAspAsnLysTyrAsnGlyGly                          
130135140                                                                 
GlyLeuPheAlaPheSerAsnMetValTyrSerGluThrThrLysLeu                          
145150155160                                                              
GlyCysAlaTyrLysValCysGlyThrLysLeuAlaValSerCysIle                          
165170175                                                                 
TyrAsnGlyValGlyTyrIleThrAsnGlnProMetTrpGluThrGly                          
180185190                                                                 
GlnAlaCysLysThrGlyAlaAspCysSerThrTyrLysAsnSerGly                          
195200205                                                                 
CysGluAspGlyLeuCysThrLysGlyProAspValProGluThrAsn                          
210215220                                                                 
GlnGlnCysProSerAsnThrGlyMetThrAspSerValArgAspThr                          
225230235240                                                              
PheLeuSerValHisAsnGluPheArgSerSerValAlaArgGlyLeu                          
245250255                                                                 
GluProAspAlaLeuGlyGlyAsnAlaProLysAlaAlaLysMetLeu                          
260265270                                                                 
LysMetValTyrAspCysGluValGluAlaSerAlaIleArgHisGly                          
275280285                                                                 
AsnLysCysValTyrGlnHisSerHisGlyGluAspArgProGlyLeu                          
290295300                                                                 
GlyGluAsnIleTyrLysThrSerValLeuLysPheAspLysAsnLys                          
305310315320                                                              
AlaAlaLysGlnAlaSerGlnLeuTrpTrpAsnGluLeuLysGluPhe                          
325330335                                                                 
GlyValGlyProSerAsnValLeuThrThrAlaLeuTrpAsnArgPro                          
340345350                                                                 
GlyMetGlnIleGlyHisTyrThrGlnMetAlaTrpAspThrThrTyr                          
355360365                                                                 
LysLeuGlyCysAlaValValPheCysAsnAspPheThrPheGlyVal                          
370375380                                                                 
CysGlnTyrGlyProGlyGlyAsnTyrMetGlyHisValIleTyrThr                          
385390395400                                                              
MetGlyGlnProCysSerGlnCysSerProGlyAlaThrCysSerVal                          
405410415                                                                 
ThrGluGlyLeuCysSerAlaPro                                                  
420                                                                       
(2) INFORMATION FOR SEQ ID NO:3:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 13 amino acids                                                
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS:                                                         
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: peptide                                               
(iii) HYPOTHETICAL: NO                                                    
(iv) ANTI-SENSE: NO                                                       
(v) FRAGMENT TYPE: internal                                               
(vi) ORIGINAL SOURCE:                                                     
(A) ORGANISM: Ancylostoma caninum                                         
(D) DEVELOPMENTAL STAGE: Larva                                            
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:                                   
GlyLeuGluProAspAlaLeuGlyGlyAsnAlaProLys                                   
1510                                                                      
(2) INFORMATION FOR SEQ ID NO:4:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 62 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: double                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: cDNA                                                  
(iii) HYPOTHETICAL: NO                                                    
(iv) ANTI-SENSE: NO                                                       
(vi) ORIGINAL SOURCE:                                                     
(A) ORGANISM: Ancylostoma caninum                                         
(D) DEVELOPMENTAL STAGE: Larva                                            
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:                                   
ACCGCGGCCCGCTTTTCTTGTTGTGCCGCTCTGTTATTTTCACACGGTTACATCTTATCA60            
TG62                                                                      
(2) INFORMATION FOR SEQ ID NO:5:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 62 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: double                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: cDNA                                                  
(iii) HYPOTHETICAL: NO                                                    
(iv) ANTI-SENSE: NO                                                       
(vi) ORIGINAL SOURCE:                                                     
(A) ORGANISM: Ancylostoma caninum                                         
(D) DEVELOPMENTAL STAGE: Larva                                            
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:                                   
CTAACGCTCTCTCTATTGTATCACGCCTCCCGCATTTCAATTCCCGGTTACATCTTATCA60            
TG62                                                                      
(2) INFORMATION FOR SEQ ID NO:6:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 36 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: double                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: cDNA                                                  
(iii) HYPOTHETICAL: NO                                                    
(iv) ANTI-SENSE: NO                                                       
(vi) ORIGINAL SOURCE:                                                     
(A) ORGANISM: Ancylostoma caninum                                         
(D) DEVELOPMENTAL STAGE: Larva                                            
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:                                   
GGTCCGGCATAATCCTTCACTCGACATCTTATCATG36                                    
(2) INFORMATION FOR SEQ ID NO:7:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 44 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: double                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: cDNA                                                  
(iii) HYPOTHETICAL: NO                                                    
(iv) ANTI-SENSE: NO                                                       
(vi) ORIGINAL SOURCE:                                                     
(A) ORGANISM: Ancylostoma caninum                                         
(D) DEVELOPMENTAL STAGE: Larva                                            
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:                                   
GGGCTATAGGGAGCTCTTCGCGTTTCTTTCGTCATCTTATCATG44                            
(2) INFORMATION FOR SEQ ID NO:8:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 203 amino acids                                               
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS:                                                         
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: protein                                               
(iii) HYPOTHETICAL: NO                                                    
(iv) ANTI-SENSE: NO                                                       
(vi) ORIGINAL SOURCE:                                                     
(A) ORGANISM: Dolichovespula arenaria                                     
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:                                   
AsnAsnTyrCysLysIleCysProLysGlyThrHisThrLeuCysLys                          
151015                                                                    
TyrGlyThrSerMetLysProAsnCysGlyGlyLysIleValLysSer                          
202530                                                                    
TyrGlyValThrAsnAspGluLysAsnGluIleValLysArgHisAsn                          
354045                                                                    
GluPheArgGlnLysValAlaGlnGlyLeuGluThrArgGlyAsnPro                          
505560                                                                    
GlyProGlnProProAlaLysAsnMetAsnLeuLeuValTrpAsnAsp                          
65707580                                                                  
GluLeuAlaLysIleAlaGlnThrTrpAlaAsnGlnCysAsnPheGly                          
859095                                                                    
HisAspGlnCysArgAsnThrAlaLysTyrProValGlyGlnAsnVal                          
100105110                                                                 
AlaIleAlaSerThrThrGlyAsnSerTyrGlnThrMetSerTyrLeu                          
115120125                                                                 
IleLysMetTrpGluAspGluValLysAspTyrAsnProHisLysAsp                          
130135140                                                                 
LeuMetHisAsnAsnPheSerLysValGlyHisTyrThrGlnMetVal                          
145150155160                                                              
TrpGlyLysThrLysGluIleGlyCysGlySerValLysTyrIleGlu                          
165170175                                                                 
AsnLysTrpHisThrHisTyrLeuValCysAsnTyrGlyProAlaGly                          
180185190                                                                 
AsnTyrMetAsnGlnProValTyrGluArgLys                                         
195200                                                                    
(2) INFORMATION FOR SEQ ID NO:9:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 204 amino acids                                               
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: protein                                               
(iii) HYPOTHETICAL: NO                                                    
(iv) ANTI-SENSE: NO                                                       
(vi) ORIGINAL SOURCE:                                                     
(A) ORGANISM: Vespula vulgaris                                            
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:                                   
AsnAsnTyrCysLysIleLysCysLeuLysGlyGlyValHisThrAla                          
151015                                                                    
CysLysTyrGlySerLeuLysProAsnCysGlyAsnLysValValVal                          
202530                                                                    
SerTyrGlyLeuThrLysGlnGluLysGlnAspIleLeuLysGluHis                          
354045                                                                    
AsnAspPheArgGlnLysIleAlaArgGlyLeuGluThrArgGlyAsn                          
505560                                                                    
ProGlyProGlnProProAlaLysAsnMetLysAsnLeuValTrpAsn                          
65707580                                                                  
AspGluLeuAlaTyrValAlaGlnValTrpAlaAsnGlnCysGlnTyr                          
859095                                                                    
GlyHisAspThrCysArgAspValAlaLysTyrGlnValGlyGlnAsn                          
100105110                                                                 
ValAlaLeuThrGlySerThrAlaAlaLysTyrAspAspProValLys                          
115120125                                                                 
LeuValLysMetTrpGluAspGluValLysAspTyrAsnProLysLys                          
130135140                                                                 
LysPheSerGlyAsnAspPheLeuLysThrGlyHisTyrThrGlnMet                          
145150155160                                                              
ValTrpAlaAsnThrLysGluValGlyCysGlySerIleLysTyrIle                          
165170175                                                                 
GlnGluLysTrpHisLysHisTyrLeuValCysAsnTyrGlyProSer                          
180185190                                                                 
GlyAsnPheMetAsnGluGluLeuTyrGlnThrLys                                      
195200                                                                    
(2) INFORMATION FOR SEQ ID NO:10:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 205 amino acids                                               
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: protein                                               
(iii) HYPOTHETICAL: NO                                                    
(iv) ANTI-SENSE: NO                                                       
(vi) ORIGINAL SOURCE:                                                     
(A) ORGANISM: Polistes annulatis                                          
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:                                  
ValAspTyrCysLysIleLysCysProSerGlyIleHisThrValCys                          
151015                                                                    
GlnTyrGlyGluSerThrLysProSerLysAsnCysAlaGlyLysVal                          
202530                                                                    
IleLysSerValGlyProThrGluGluGluLysLysLeuIleValSer                          
354045                                                                    
GluHisAsnArgPheArgGlnLysValAlaGlnGlyLeuGluThrArg                          
505560                                                                    
GlyAsnProGlyProGlnProAlaAlaSerAspMetAsnAspLeuVal                          
65707580                                                                  
TrpAsnAspGluLeuAlaHisIleAlaGlnValTrpAlaSerGlnCys                          
859095                                                                    
GlnPheLeuValHisAspLysCysArgAsnThrAlaLysTyrProVal                          
100105110                                                                 
GlyGlnAsnIleAlaTyrAlaGlyGlySerAsnLeuProAspValVal                          
115120125                                                                 
SerLeuIleLysLeuTrpGluAsnGluValLysAspPheAsnTyrAsn                          
130135140                                                                 
ThrGlyIleThrLysGlnAsnPheAlaLysIleGlyHisTyrThrGln                          
145150155160                                                              
MetValTrpGlyLysThrLysGluIleGlyCysGlySerLeuLysTyr                          
165170175                                                                 
MetGluAsnAsnMetGlnAsnHisTyrLeuIleCysAsnTyrGlyPro                          
180185190                                                                 
AlaGlyAsnTyrLeuGlyGlnLeuProTyrThrLysLys                                   
195200205                                                                 
(2) INFORMATION FOR SEQ ID NO:11:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 27 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: other nucleic acid                                    
(A) DESCRIPTION: /desc = "DNA primer"                                     
(iii) HYPOTHETICAL: NO                                                    
(iv) ANTI-SENSE: NO                                                       
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:                                  
GGTACTGCAGGARCCNGAYGCNYTNGG27                                             
(2) INFORMATION FOR SEQ ID NO:12:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 19 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: other nucleic acid                                    
(A) DESCRIPTION: /desc = "DNA primer"                                     
(iii) HYPOTHETICAL: NO                                                    
(iv) ANTI-SENSE: NO                                                       
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:                                  
CCGACTCCATTATAGATGG19                                                     
(2) INFORMATION FOR SEQ ID NO:13:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 16 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: other nucleic acid                                    
(A) DESCRIPTION: /desc = "DNA primer"                                     
(iii) HYPOTHETICAL: NO                                                    
(iv) ANTI-SENSE: NO                                                       
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:                                  
CCACCAGCCGGAGAGC16                                                        
(2) INFORMATION FOR SEQ ID NO:14:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 21 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: other nucleic acid                                    
(A) DESCRIPTION: /desc = "DNA primer"                                     
(iii) HYPOTHETICAL: NO                                                    
(iv) ANTI-SENSE: NO                                                       
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:                                  
CTTGAATTCCAGCGAACGCGC21                                                   
(2) INFORMATION FOR SEQ ID NO:15:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 36 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: other nucleic acid                                    
(A) DESCRIPTION: /desc = "DNA primer"                                     
(iii) HYPOTHETICAL: NO                                                    
(iv) ANTI-SENSE: NO                                                       
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:                                  
GAATCGATGGATCCTGCAGCCCCCCCCCCCCCCCCC36                                    
(2) INFORMATION FOR SEQ ID NO:16:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 17 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: other nucleic acid                                    
(A) DESCRIPTION: /desc = "DNA primer"                                     
(iii) HYPOTHETICAL: NO                                                    
(iv) ANTI-SENSE: NO                                                       
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:                                  
AATACGACTCACTATAG17                                                       
__________________________________________________________________________

Claims (4)

We claim:
1. An isolated nucleic acid molecule comprising a nucleic acid segment encoding all or a fragment of the amino terminal 191 amino acids of SEQ ID NO:2, wherein the fragment includes at least five consecutive amino acids of the amino terminal 191 amino acids of SEQ ID NO:2.
2. The nucleic acid molecule of claim 1 wherein the nucleic acid molecule encodes the amino acid sequence of SEQ ID NO:2.
3. The nucleic acid molecule of claim 1 further comprising a vector.
4. The nucleic acid molecule of claim 3 wherein the vector is an expression vector for a host selected from the group consisting of bacteria, yeast, insect cells, and mammalian cells.
US08/419,414 1995-04-10 1995-04-10 Nucleic acids encoding ancylostoma secreted protein Expired - Fee Related US5753787A (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
US08/419,414 US5753787A (en) 1995-04-10 1995-04-10 Nucleic acids encoding ancylostoma secreted protein
PCT/US1996/004821 WO1996032479A1 (en) 1995-04-10 1996-04-10 Hookworm vaccine
AU55379/96A AU5537996A (en) 1995-04-10 1996-04-10 Hookworm vaccine

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
US08/419,414 US5753787A (en) 1995-04-10 1995-04-10 Nucleic acids encoding ancylostoma secreted protein

Publications (1)

Publication Number Publication Date
US5753787A true US5753787A (en) 1998-05-19

Family

ID=23662162

Family Applications (1)

Application Number Title Priority Date Filing Date
US08/419,414 Expired - Fee Related US5753787A (en) 1995-04-10 1995-04-10 Nucleic acids encoding ancylostoma secreted protein

Country Status (3)

Country Link
US (1) US5753787A (en)
AU (1) AU5537996A (en)
WO (1) WO1996032479A1 (en)

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004053056A3 (en) * 2002-09-24 2005-01-06 Univ Kentucky Res Found Nanoparticle-based vaccine delivery system containing adjuvant
US20080311557A1 (en) * 2007-06-15 2008-12-18 Idexx Laboratories, Inc. Device, kit and method for hookworm antigen capture and detection
US20090286231A1 (en) * 2007-06-15 2009-11-19 Idexx Laboratories, Inc. Methods, Devices, Kits and Compositions for Detecting Roundworm, Whipworm, and Hookworm
US20090286230A1 (en) * 2008-05-19 2009-11-19 Idexx Laboratories, Inc. Methods, Devices, Kits and Compositions for Detecting Roundworm
US20090286227A1 (en) * 2008-05-19 2009-11-19 Idexx Laboratories, Inc. Methods, Devices, Kits and Compositions for Detecting Whipworm
US20090286228A1 (en) * 2008-05-19 2009-11-19 Idexx Laboratories, Inc. Methods, Devices, Kits and Compositions for Detecting Roundworm
US20100151500A1 (en) * 2007-06-15 2010-06-17 Idexx Laboratories, Inc. Compositions, Devices, Kits and Methods for Detecting Hookworm
US20110086340A1 (en) * 2008-05-19 2011-04-14 Idexx Laboratories, Inc. Methods, devices, kits and compositions for detecting roundworm
US8580518B2 (en) 2008-05-19 2013-11-12 Idexx Laboratories, Inc. Methods, devices, kits and compositions for detecting roundworm
US20180299466A1 (en) * 2015-04-17 2018-10-18 Kenneth Davin Fine Diagnostic testing for immunologic food sensitivity

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040052817A1 (en) * 2002-09-13 2004-03-18 Peter Geldhof Ostertagia vaccine

Citations (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4563417A (en) * 1984-08-31 1986-01-07 Miles Laboratories, Inc. Nucleic acid hybridization assay employing antibodies to intercalation complexes
US4581333A (en) * 1978-04-13 1986-04-08 Institut Pasteur Method of detecting and characterizing a nucleic acid or reactant for the application of this method
WO1987003622A1 (en) * 1985-12-13 1987-06-18 Princeton University Amplified hybridization assay
US4683195A (en) * 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US4683202A (en) * 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4732847A (en) * 1981-06-09 1988-03-22 University Of Hawaii Monoclonal antibodies for DNA-RNA hybrid complexes and their uses
US4743535A (en) * 1984-11-07 1988-05-10 Miles Inc. Hybridization assay employing labeled probe and anti-hybrid
US4786600A (en) * 1984-05-25 1988-11-22 The Trustees Of Columbia University In The City Of New York Autocatalytic replication of recombinant RNA
US4833084A (en) * 1984-06-01 1989-05-23 Miles Inc. Monoclonal antibody specific for DNA.RNA hybrids
US4851331A (en) * 1986-05-16 1989-07-25 Allied Corporation Method and kit for polynucleotide assay including primer-dependant DNA polymerase
WO1989006700A1 (en) * 1988-01-21 1989-07-27 Genentech, Inc. Amplification and detection of nucleic acid sequences
JPH02131599A (en) * 1988-07-15 1990-05-21 Toray Ind Inc Signal-amplifying dna and detection with the same
US4957858A (en) * 1986-04-16 1990-09-18 The Salk Instute For Biological Studies Replicative RNA reporter systems
US4965188A (en) * 1986-08-22 1990-10-23 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences using a thermostable enzyme
US4994373A (en) * 1983-01-27 1991-02-19 Enzo Biochem, Inc. Method and structures employing chemically-labelled polynucleotide probes
WO1991010746A1 (en) * 1990-01-10 1991-07-25 Chiron Corporation Dna-dependent rna polymerase transcripts as reporter molecules for signal amplification in nucleic acid hybridization assays
WO1991017442A1 (en) * 1990-05-04 1991-11-14 Chiron Corporation Protein-nucleic acid probes and immunoassays using same
WO1992012261A1 (en) * 1990-12-31 1992-07-23 Promega Corporation Nucleic acid amplification with dna-dependent rna polymerase activity of rna replicases
WO1992013890A1 (en) * 1991-02-06 1992-08-20 Biotech Australia Pty Limited Nematode vaccine
WO1992014843A1 (en) * 1991-02-21 1992-09-03 Gilead Sciences, Inc. Aptamer specific for biomolecules and method of making

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
NZ225295A (en) * 1987-07-07 1991-07-26 Biotech Australia Pty Ltd Nematode antigen, its production and vaccines containing it
US5525508A (en) * 1991-02-06 1996-06-11 Biotech Australia Pty Limited Haemonchus contortus vaccine
GB9322576D0 (en) * 1993-11-02 1993-12-22 Univ Nottingham Antihaemostatic agents

Patent Citations (23)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4581333A (en) * 1978-04-13 1986-04-08 Institut Pasteur Method of detecting and characterizing a nucleic acid or reactant for the application of this method
US4732847A (en) * 1981-06-09 1988-03-22 University Of Hawaii Monoclonal antibodies for DNA-RNA hybrid complexes and their uses
US4994373A (en) * 1983-01-27 1991-02-19 Enzo Biochem, Inc. Method and structures employing chemically-labelled polynucleotide probes
US4786600A (en) * 1984-05-25 1988-11-22 The Trustees Of Columbia University In The City Of New York Autocatalytic replication of recombinant RNA
US4833084A (en) * 1984-06-01 1989-05-23 Miles Inc. Monoclonal antibody specific for DNA.RNA hybrids
US4563417A (en) * 1984-08-31 1986-01-07 Miles Laboratories, Inc. Nucleic acid hybridization assay employing antibodies to intercalation complexes
US4743535A (en) * 1984-11-07 1988-05-10 Miles Inc. Hybridization assay employing labeled probe and anti-hybrid
US4683202B1 (en) * 1985-03-28 1990-11-27 Cetus Corp
US4683202A (en) * 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
WO1987003622A1 (en) * 1985-12-13 1987-06-18 Princeton University Amplified hybridization assay
US4882269A (en) * 1985-12-13 1989-11-21 Princeton University Amplified hybridization assay
US4683195A (en) * 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US4683195B1 (en) * 1986-01-30 1990-11-27 Cetus Corp
US4957858A (en) * 1986-04-16 1990-09-18 The Salk Instute For Biological Studies Replicative RNA reporter systems
US4851331A (en) * 1986-05-16 1989-07-25 Allied Corporation Method and kit for polynucleotide assay including primer-dependant DNA polymerase
US4965188A (en) * 1986-08-22 1990-10-23 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences using a thermostable enzyme
WO1989006700A1 (en) * 1988-01-21 1989-07-27 Genentech, Inc. Amplification and detection of nucleic acid sequences
JPH02131599A (en) * 1988-07-15 1990-05-21 Toray Ind Inc Signal-amplifying dna and detection with the same
WO1991010746A1 (en) * 1990-01-10 1991-07-25 Chiron Corporation Dna-dependent rna polymerase transcripts as reporter molecules for signal amplification in nucleic acid hybridization assays
WO1991017442A1 (en) * 1990-05-04 1991-11-14 Chiron Corporation Protein-nucleic acid probes and immunoassays using same
WO1992012261A1 (en) * 1990-12-31 1992-07-23 Promega Corporation Nucleic acid amplification with dna-dependent rna polymerase activity of rna replicases
WO1992013890A1 (en) * 1991-02-06 1992-08-20 Biotech Australia Pty Limited Nematode vaccine
WO1992014843A1 (en) * 1991-02-21 1992-09-03 Gilead Sciences, Inc. Aptamer specific for biomolecules and method of making

Non-Patent Citations (198)

* Cited by examiner, † Cited by third party
Title
Allison and Byars, "An adjuvant formulation that selectively elicits the formation of antibodies of protective isotypes and of cell-mediated immunity," J. Immunol. Methods 95:157 (1986).
Allison and Byars, An adjuvant formulation that selectively elicits the formation of antibodies of protective isotypes and of cell mediated immunity, J. Immunol. Methods 95:157 (1986). *
Arheim, N. and Erlich, H., "Polymerase chain reaction strategy," Annual Review of Biochemistry 61:131-156 (1992).
Arheim, N. and Erlich, H., Polymerase chain reaction strategy, Annual Review of Biochemistry 61:131 156 (1992). *
Bektesh and Hirsh, "C elegans mRNA's acquire a spliced leader through a trans-splicing mechanism," Nucleic Acids Research 16:5692 (1988).
Bektesh and Hirsh, C elegans mRNA s acquire a spliced leader through a trans splicing mechanism, Nucleic Acids Research 16:5692 (1988). *
Bitter, et al., "Expression and Secretion Vectors for Yeast," Methods in Enzymology 153:516-544 (Wu and Grossman, eds., Academic Press, 1987).
Bitter, et al., Expression and Secretion Vectors for Yeast, Methods in Enzymology 153:516 544 (Wu and Grossman, eds., Academic Press, 1987). *
Boguslawski, et al., "Characterization of monoclonal antibody to DNA -RNA and its application to immunodetection of hybrids," J. Immunol. Methods 89:123-130 (1986).
Boguslawski, et al., Characterization of monoclonal antibody to DNA RNA and its application to immunodetection of hybrids, J. Immunol. Methods 89:123 130 (1986). *
Byars and Allison, "Adjuvant formulation for use in vaccines to elicit both cell-mediated and humoral immunity," Vaccine 5:223 (1987).
Byars and Allison, Adjuvant formulation for use in vaccines to elicit both cell mediated and humoral immunity, Vaccine 5:223 (1987). *
Cappello, et al., "Ancylostoma caninum anticoagulant peptide: A hookworm-derived inhibitor of human coagulation factor xa," Proc. Natl. Acad. Sci. USA 92:6152-6156 (1995).
Cappello, et al., "Ancylostoma Factor Xa Inhibitor: Partial Purification and Its Identification as a Major Hookworm-Derived Anticoagulant In Vitro," J. Infec. Dis. 167:1474-7 (1993).
Cappello, et al., Ancylostoma caninum anticoagulant peptide: A hookworm derived inhibitor of human coagulation factor xa, Proc. Natl. Acad. Sci. USA 92:6152 6156 (1995). *
Cappello, et al., Ancylostoma Factor Xa Inhibitor: Partial Purification and Its Identification as a Major Hookworm Derived Anticoagulant In Vitro, J. Infec. Dis . 167:1474 7 (1993). *
Chu, et al., "Syntheisis of an amplifiable reporter RNA for bioassays," Nucl. Acids Res. 14:5591-5603 (1986).
Chu, et al., Syntheisis of an amplifiable reporter RNA for bioassays, Nucl. Acids Res . 14:5591 5603 (1986). *
Cook, "Use of Benzimidazole Chemotherapy in Huamn Helminthiases: Indications and Efficacy," Parasitol. Today 6:133-136 (1990).
Cook, Use of Benzimidazole Chemotherapy in Huamn Helminthiases: Indications and Efficacy, Parasitol. Today 6:133 136 (1990). *
Cullen, et al., "Controlled Expression and Secretion of Bovine Chymosin in Aspergillus nidulans," Bio/Technology 5:369-378 (1987).
Cullen, et al., "Molecular Cloning Vectors for Aspergillus and Neurospora," A Survey of Molecular Cloning Vectors and their Uses Chapter 21:419-433 (Butterworth Publishers, Stoneham, MA 1986).
Cullen, et al., Controlled Expression and Secretion of Bovine Chymosin in Aspergillus nidulans , Bio/Technology 5:369 378 (1987). *
Cullen, et al., Molecular Cloning Vectors for Aspergillus and Neurospora, A Survey of Molecular Cloning Vectors and their Uses Chapter 21:419 433 (Butterworth Publishers, Stoneham, MA 1986). *
Dayhoff, et al., "Establishing Homologies in Protein Sequences," Methods in Enzymology 91:524-545 (1983).
Dayhoff, et al., Establishing Homologies in Protein Sequences, Methods in Enzymology 91:524 545 (1983). *
Donnelly, et al., "Immunization with DNA," J. Immunol. Methods 176(2):145-152 (1994).
Donnelly, et al., Immunization with DNA, J. Immunol. Methods 176(2):145 152 (1994). *
Duffaud, et al., "Expression and Secretion of Foreign Proteins in Escherichia coli," Methods in Enzymology 153:492-506 (Wu and Grossman, eds., Academic Press, 1987).
Duffaud, et al., Expression and Secretion of Foreign Proteins in Escherichia coli, Methods in Enzymology 153:492 506 (Wu and Grossman, eds., Academic Press, 1987). *
Eisinstein, "Phase Variation of Type 1 Fimbriae in Escherichia coli Is Under Transcriptional Control," Science 214:337-338 (1981).
Eisinstein, Phase Variation of Type 1 Fimbriae in Escherichia coli Is Under Transcriptional Control, Science 214:337 338 (1981). *
Eldridge, et al., "Biodegradable Microspheres: Vaccine Delivery System for Oral Immunization," Current Topics in Microbiology and Immunology 146:59-66 (1989).
Eldridge, et al., Biodegradable Microspheres: Vaccine Delivery System for Oral Immunization, Current Topics in Microbiology and Immunology 146:59 66 (1989). *
Frohman, M.A., et al., "Rapid production of full-length cDNA from rate transcripts: amplification using a single gene-specific oligonucleotide primer," Proc. Natl. Acad. Sci. USA 85: 8998-9002 (1988).
Frohman, M.A., et al., Rapid production of full length cDNA from rate transcripts: amplification using a single gene specific oligonucleotide primer, Proc. Natl. Acad. Sci. USA 85: 8998 9002 (1988). *
Galfr e and Milstein, Preparation of Monoclonal Antibodies: Strategies and Procedures, Methods Enzymol . 73:3 46 (1981). *
Galfre and Milstein, "Preparation of Monoclonal Antibodies: Strategies and Procedures," Methods Enzymol. 73:3-46 (1981).
Gilles, H. M., "Selective primary health care: strategies for control of disease in the developing world. XVII. Hookworm infection and anemia," Reviews of Infectious Diseases 7:111-118 (1985).
Gilles, H. M., Selective primary health care: strategies for control of disease in the developing world. XVII. Hookworm infection and anemia, Reviews of Infectious Diseases 7:111 118 (1985). *
Gilles, H., Naturally acquired infections: what s needed In Hookworm Disease: Current Status and New Directions (G. A. Schad and K. S. Warren, Eds.), pp. 221 230. Taylor and Francis, London (1990). *
Gilles, H., Naturally acquired infections: what's needed? In "Hookworm Disease: Current Status and New Directions" (G. A. Schad and K. S. Warren, Eds.), pp. 221-230. Taylor and Francis, London (1990).
Goodman Snitkoff, et al., Role of Intrastructural/Intermolecular Help in Immunization with Peptide Phospholipid Complexes,. J. Immunol . 147:410 415 (1991). *
Goodman-Snitkoff, et al., "Role of Intrastructural/Intermolecular Help in Immunization with Peptide-Phospholipid Complexes,." J. Immunol. 147:410-415 (1991).
Gray, et al., "Primary structure of Mucor miehei aspartyl protease: evidence for a zymogen intermediate," Gene 48:41-53 (1987).
Gray, et al., Primary structure of Mucor miehei aspartyl protease: evidence for a zymogen intermediate, Gene 48:41 53 (1987). *
Grunstein, et al., colony hybridization: A method for the isolation of cloned DNAs that contain a specific gene, Proc. Natl. Acad. Sci. USA 72:3961 (1975). *
Guarelli, et al., "Isothermal, in vitro, amplication of nucleic acids by a multienzyme reaction modeled after retroviral replication," Proc. Natl. Acad. Sci. USA 87:1874-1878 (1990).
Guarelli, et al., Isothermal, in vitro, amplication of nucleic acids by a multienzyme reaction modeled after retroviral replication, Proc. Natl. Acad. Sci. USA 87:1874 1878 (1990). *
Hainan, et al., "Effect of Albendazole on the Larvae and Eggs of Necator Americanus in Golden Hamster," Chinese Journal of Parasitology & Parasitic Diseases 12:200-204 (1994).
Hainan, et al., Effect of Albendazole on the Larvae and Eggs of Necator Americanus in Golden Hamster, Chinese Journal of Parasitology & Parasitic Diseases 12:200 204 (1994). *
Harada, et al., "Monoclonal antibody G6K12 specific for membrane-associated differentiation marker of human stratified squamous epithelia and squamous cell carcinoma," J. Oral Pathol. Med. (Denmark) 22(4):145-152 (Apr. 1993).
Harada, et al., Monoclonal antibody G6K12 specific for membrane associated differentiation marker of human stratified squamous epithelia and squamous cell carcinoma, J. Oral Pathol. Med . (Denmark) 22(4):145 152 (Apr. 1993). *
Hattori and Sakald, "Dideoxy sequencing method using denatured plasmid templates," Analytical Biochemistry 152:232-238 (1988).
Hattori and Sakald, Dideoxy sequencing method using denatured plasmid templates, Analytical Biochemistry 152:232 238 (1988). *
Hawdon and Schad, "Albumin and a Dialyzable Serum Factor Stimulate Feeding in Vitro by Third-Stage Larvae of the Canine Hookworm Ancylostoma caninum," J. Parasitol. 77:587-591 (1991).
Hawdon and Schad, "Ancylostoma caninum: Glutathione Stimulates Feeding in Third-Stage Larvae by a Sulfhydryl-Independent Mechanism," Experimental Parasitology 77:489-491 (1993).
Hawdon and Schad, "Long-term storage of hookworm infective larvae in buffered saline solution maintains larval responsiveness to host signals," Journal of the Helminthological Society of Washington 58:140-142 (1991).
Hawdon and Schad, "Serum-Stimulated Feeding in Vitro by Third-Stage Infective Larvae of the Canine Hookworm Ancylostoma caninum," J. Parasitol. 76:394-398 (1990).
Hawdon and Schad, Albumin and a Dialyzable Serum Factor Stimulate Feeding in Vitro by Third Stage Larvae of the Canine Hookworm Ancylostoma caninum, J. Parasitol . 77:587 591 (1991). *
Hawdon and Schad, Ancylostoma caninum : Glutathione Stimulates Feeding in Third Stage Larvae by a Sulfhydryl Independent Mechanism, Experimental Parasitology 77:489 491 (1993). *
Hawdon and Schad, Long term storage of hookworm infective larvae in buffered saline solution maintains larval responsiveness to host signals, Journal of the Helminthological Society of Washington 58:140 142 (1991). *
Hawdon and Schad, Serum Stimulated Feeding in Vitro by Third Stage Infective Larvae of the Canine Hookworm Ancylostoma caninum, J. Parasitol . 76:394 398 (1990). *
Hawdon, et al., "Ancylostoma caninum: Metalloprotease Release Coincides with Activation of Infective Larvae in Vitro," Experimental Parasitology 80:205-211 (1995).
Hawdon, et al., "Cloning and Characterization of Ancylostoma Secreted Protein: a Novel Protein Associated with the Transition to Parasitism by Infective Hookworm Larvae," J. Biol. Chem. (In Press, 1996).
Hawdon, et al., Ancylostoma caninum : Metalloprotease Release Coincides with Activation of Infective Larvae in Vitro, Experimental Parasitology 80:205 211 (1995). *
Hawdon, et al., Cloning and Characterization of Ancylostoma Secreted Protein: a Novel Protein Associated with the Transition to Parasitism by Infective Hookworm Larvae, J. Biol. Chem . (In Press, 1996). *
Hotez and Pritchard, "Hookworm Infection," Sci. Amer. 272:42-48 (1995).
Hotez and Pritchard, Hookworm Infection, Sci. Amer . 272:42 48 (1995). *
Hotez et al Infectious Agents & Disease vol. 4 pp. 71 75, 1995. *
Hotez et al Infectious Agents & Disease vol. 4 pp. 71-75, 1995.
Hotez et al J. Biol Chemistry 260: 734 3 8, 1985. *
Hotez et al J. Biol Chemistry 260: 734 3-8, 1985.
Hotez et al Scientific American 272: 68 74, 1995 Hookworm Infection. *
Hotez et al Scientific American 272: 68-74, 1995 Hookworm Infection.
Hotez et al Scientific American Jun. 1995, pp. 42 48, vol. 272. *
Hotez et al Scientific American Jun. 1995, pp. 42-48, vol. 272.
Hotez Peter Jay Dissertation Abstr. Int B 1987 47(10) p. 4145 Identification, Isolation, and Molecular Cloning of a Hookworm Protease, an Approach Towards a Defined Vaccine for Ancylosotomiasis. *
Hotez, et al., "Hookworm Antigens: the Potential for Vaccination," Parasitol. Today 3:247-249 (1987).
Hotez, et al., "Hookworm Larval Infectivity, Arrest and Amphiparatenesis: The Caenorhabditis elegans Daf-c Paradigm," Parasitol. Today 9:23-26 (1993).
Hotez, et al., "Metalloproteases of Infective Ancylostoma Hookworm Larvae and Their Possible Functions in Tissue Invasion and Ecdysis," Infect. Immun. 58:3883-3894 (1990).
Hotez, et al., "Molecular Pathobiology of Hookworm Infection," Infect. Agents and Disease 4:71-75 (1995).
Hotez, et al., Hookworm Antigens: the Potential for Vaccination, Parasitol. Today 3:247 249 (1987). *
Hotez, et al., Hookworm Larval Infectivity, Arrest and Amphiparatenesis: The Caenorhabditis elegans Daf c Paradigm, Parasitol. Today 9:23 26 (1993). *
Hotez, et al., Metalloproteases of Infective Ancylostoma Hookworm Larvae and Their Possible Functions in Tissue Invasion and Ecdysis, Infect. Immun . 58:3883 3894 (1990). *
Hotez, et al., Molecular Pathobiology of Hookworm Infection, Infect. Agents and Disease 4:71 75 (1995). *
Hotez, P. J., "Hookworm disease in children," Pediatric Infectious Disease Journal 8:516-520 (1989).
Hotez, P. J., Hookworm disease in children, Pediatric Infectious Disease Journal 8:516 520 (1989). *
Houghten Vaccine 86 pp. 21 25. *
Houghten Vaccine 86 pp. 21-25.
Inai, et al., "Immunohistochemical detection of an enamel protein-related epitope in rat bone at an early stage of osteogenesis," Histochemistry (Germany) 99(5):335-362 (May 1993).
Inai, et al., Immunohistochemical detection of an enamel protein related epitope in rat bone at an early stage of osteogenesis, Histochemistry (Germany) 99(5):335 362 (May 1993). *
Jain and Gomer, "Increasing specificity from the PCR-RACE technique," Biotechniques 12:58-59 (1992).
Jain and Gomer, Increasing specificity from the PCR RACE technique, Biotechniques 12:58 59 (1992). *
Johnstone and Thorpe, Immunochemistry in Practice , Second edition (Blackwell Scientific Publication, Oxford, 1987). *
Johnstone and Thorpe, Immunochemistry in Practice, Second edition (Blackwell Scientific Publication, Oxford, 1987).
Kalkofen, "Hookworms of Dogs and Cats," Veterinary Clinics of North America: Small Animal Practice 17:1341-1354 (1987).
Kalkofen, Hookworms of Dogs and Cats, Veterinary Clinics of North America: Small Animal Practice 17:1341 1354 (1987). *
Kirkpatrick, "Epizootiology of endoparasitic infections in pet dogs and cats presented to a veterinary teaching hospital," Veterinary Parasitology 30:113-124 (1988).
Kirkpatrick, Epizootiology of endoparasitic infections in pet dogs and cats presented to a veterinary teaching hospital, Veterinary Parasitology 30:113 124 (1988). *
Koren, et al., "Characterization of a monoclonal antibody that binds equally to all apolipoprotein and lipoprotein forms of human plasma apolipoprotein B. I. Specificity and binding studies," Biochim. Biophys. Acta 876:91-100 (1986).
Koren, et al., Characterization of a monoclonal antibody that binds equally to all apolipoprotein and lipoprotein forms of human plasma apolipoprotein B. I. Specificity and binding studies, Biochim. Biophys. Acta 876:91 100 (1986). *
Kreuter, Microcapsules and Nanoparticles in Medicine and Pharmacology , pp. 125 148 (M. Donbrow, ed., CRC Press, 1991). *
Kreuter, Microcapsules and Nanoparticles in Medicine and Pharmacology, pp. 125-148 (M. Donbrow, ed., CRC Press, 1991).
Kwoh, et al., "Transcription-based amplification system and detection of amplified human immunodeficiency virus type 1 with a bead-based sandwich hybridization format," Proc. Natl. Acad. Sci. USA 86:1173-1177 (1989).
Kwoh, et al., Transcription based amplification system and detection of amplified human immunodeficiency virus type 1 with a bead based sandwich hybridization format, Proc. Natl. Acad. Sci. USA 86:1173 1177 (1989). *
Laemmli, "Cleavage of structural proteins during the assembly of the head of bacteriophage T4," Nature (London) 227, 680-685 (1970).
Laemmli, Cleavage of structural proteins during the assembly of the head of bacteriophage T4, Nature ( London ) 227, 680 685 (1970). *
Lewis and Dean, "Automated site-directed drug design: the concept of spacer skeletons for primary structure generation," Proc. R. Soc. Lond. 236:125-140 (1989).
Lewis and Dean, "Automated site-directed drug design: the formation of molecular templates in primary structure generation," Proc. R. Soc. Lond. 236:141-162 (1989).
Lewis and Dean, Automated site directed drug design: the concept of spacer skeletons for primary structure generation, Proc. R. Soc. Lond . 236:125 140 (1989). *
Lewis and Dean, Automated site directed drug design: the formation of molecular templates in primary structure generation, Proc. R. Soc. Lond . 236:141 162 (1989). *
Lillis, "Helminth Survey of Dogs and Cats in New Jersey," Journal of Parasitology 53:1082-1084 (1967).
Lillis, Helminth Survey of Dogs and Cats in New Jersey, Journal of Parasitology 53:1082 1084 (1967). *
Lin and Tang, "Synthesis, Purification, and Active Site Mutagenesis of Recombinant Porcine Pepsinogen," J. Biol. Chem. 264:4482-4489 (1989).
Lin and Tang, Synthesis, Purification, and Active Site Mutagenesis of Recombinant Porcine Pepsinogen, J. Biol. Chem . 264:4482 4489 (1989). *
Liu, "Medical Progress in China: An Overview of Molecular Parasitology in China," Chin. Med. J. 105:91-96 (1992).
Liu, et al., "Comparative Study on Antigenicity and Immunogenicity of 26-28 kDa Antigen and Recombinant SJ26 (RSJ26) of Schistosoma japonicum," SE Asian J. Trop. Med. Pub. Health 24:65-69 (1993).
Liu, et al., "DNA Vaccination Induces Long-Lived TH 1-Like Immune Responses to HIV-1 GP120," AIDS Research and Human Retroviruses 10:S34 (1994).
Liu, et al., "The Posibility of GST Antigen from Chinese Strain of Schistosoma japonicum for Immunodiagnosis of Schistosomiasis," SE Asian J. Trop. Med. Pub. Health 24:70-73 (1993).
Liu, et al., Comparative Study on Antigenicity and Immunogenicity of 26 28 kDa Antigen and Recombinant SJ26 (RSJ26) of Schistosoma japonicum, SE Asian J. Trop. Med. Pub. Health 24:65 69 (1993). *
Liu, et al., DNA Vaccination Induces Long Lived T H 1 Like Immune Responses to HIV 1 GP120, AIDS Research and Human Retroviruses 10:S34 (1994). *
Liu, et al., SE Asian J. Trop. Med. Pub. Health 24:61 64 (1993)*. *
Liu, et al., SE Asian J. Trop. Med. Pub. Health 24:61-64 (1993)*.
Liu, et al., The Posibility of GST Antigen from Chinese Strain of Schistosoma japonicum for Immunodiagnosis of Schistosomiasis, SE Asian J. Trop. Med. Pub. Health 24:70 73 (1993). *
Liu, Medical Progress in China: An Overview of Molecular Parasitology in China, Chin. Med. J . 105:91 96 (1992). *
Liu, Shu xian, et al., The Antigenicity of GST Antigen Extracted from Chinese Strain of Schistosoma japonicum, SE Asian J. Trop. Med. Pub. Health 24:61 65 (1993). *
Liu, Shu-xian, et al., "The Antigenicity of GST Antigen Extracted from Chinese Strain of Schistosoma japonicum," SE Asian J. Trop. Med. Pub. Health 24:61-65 (1993).
Lowell, "Proteosomes, Hydrophobic Anchors, Iscoms, and Liposomes for Improved Presentation of Peptide and Protein Vaccines," New Generation Vaccines (Woodrow and Levine, eds., Marcel Dekker, NY, 1990), Ch. 12, pp. 141-160.
Lowell, et al., "Proteosome-Lipopeptide Vacines: Enhancement of Immunogenicity for Malaria CS Peptides," Science 240:800 (1988).
Lowell, et al., Proteosome Lipopeptide Vacines: Enhancement of Immunogenicity for Malaria CS Peptides, Science 240:800 (1988). *
Lowell, Proteosomes, Hydrophobic Anchors, Iscoms, and Liposomes for Improved Presentation of Peptide and Protein Vaccines, New Generation Vaccines (Woodrow and Levine, eds., Marcel Dekker, NY, 1990), Ch. 12, pp. 141 160. *
Lozoff, et al., "Long-term developmental outcome of infants with iron deficiency," New England Journal of Medicine 235:687-694 (1991).
Lozoff, et al., Long term developmental outcome of infants with iron deficiency, New England Journal of Medicine 235:687 694 (1991). *
Luckow and Summers, "Trends in the Development of Baculovirus Expression Vectors," Bio/Technology 6:47-55 (1988).
Luckow and Summers, Trends in the Development of Baculovirus Expression Vectors, Bio/Technology 6:47 55 (1988). *
McKinaly and Rossmann, "Rational Design of Antiviral Agents," Annu. Rev. Pharmacol. Toxiciol. 29:111-122 (1989).
McKinaly and Rossmann, Rational Design of Antiviral Agents, Annu. Rev. Pharmacol. Toxiciol . 29:111 122 (1989). *
Miller, "Vaccination against canine hookworm disease," Advances in Parasitology 9:153-183 (1971).
Miller, et al., "Industrial Development and Field Use of the Canine Hookworn Vaccine," Adv. Parasitol. 16:333-342 (1978).
Miller, et al., Industrial Development and Field Use of the Canine Hookworn Vaccine, Adv. Parasitol. 16:333 342 (1978). *
Miller, Vaccination against canine hookworm disease, Advances in Parasitology 9:153 183 (1971). *
Mulder, et al., "Characterization of Two Human Monoclonal Antibodies Reactive with HLA-B12 and HLA-B60, Respectively, Raised by in vitro Secondary Immunization of Peripheral Blood Lymphocytes," Hum. Immunol. 36(3):186-192 (Mar. 1993).
Mulder, et al., Characterization of Two Human Monoclonal Antibodies Reactive with HLA B12 and HLA B60, Respectively, Raised by in vitro Secondary Immunization of Peripheral Blood Lymphocytes, Hum. Immunol . 36(3):186 192 (Mar. 1993). *
Nilsen, "Trans-splicing of nematode messenger RNA," Annual Review of Microbiology 47:413-440 (1993).
Nilsen, Trans splicing of nematode messenger RNA, Annual Review of Microbiology 47:413 440 (1993). *
Orr, et al., "Immunogenicity and Efficacy of Oral or Intranasal Shigella flexneri 2a and Shigella sonnei Proteosome-Lipopolysaccharide Vaccines in Animal Models," Infect. Immun. 61: 2390 (1993).
Orr, et al., Immunogenicity and Efficacy of Oral or Intranasal Shigella flexneri 2a and Shigella sonnei Proteosome Lipopolysaccharide Vaccines in Animal Models, Infect. Immun . 61: 2390 (1993). *
Perry and Davies, "The Use of 3D Modelling Databases for Identifying Structure Activity Relationships," QSAR: Quantitative Structure-Activity Relationships in Drug Design pp. 189-193 (Alan R. Liss, Inc. 1989).
Perry and Davies, The Use of 3D Modelling Databases for Identifying Structure Activity Relationships, QSAR: Quantitative Structure Activity Relationships in Drug Design pp. 189 193 (Alan R. Liss, Inc. 1989). *
Poorman, et al., "Isolation and Characterization of Native Human Renin Derived From Chinese Hamster Ovary Cells," Proteins 1:139-145 (1986).
Poorman, et al., Isolation and Characterization of Native Human Renin Derived From Chinese Hamster Ovary Cells, Proteins 1:139 145 (1986). *
Ren, et al., Chin. J. Parasitol. Paras. Dis . 12:200 204 (1994). *
Ren, et al., Chin. J. Parasitol. Paras. Dis. 12:200-204 (1994).
Ripka, "Computers picture the perfect drug," New Scientist 54-57 (Jun. 16, 1988).
Ripka, Computers picture the perfect drug, New Scientist 54 57 (Jun. 16, 1988). *
Rotivinen, et al., 1988 Acta Pharmaceutica Fennica 97, 159 166*. *
Rotivinen, et al., 1988 Acta Pharmaceutica Fennica 97, 159-166*.
Rusia, et al., "Placental morphology & histochemistry in iron deficiency anaemia," Indian J. Med. Res. 87:468 (1988).
Rusia, et al., Placental morphology & histochemistry in iron deficiency anaemia, Indian J. Med. Res . 87:468 (1988). *
Sambrook, J., Fritsch, E. F. and Maniatis, T. 1989. Molecular Cloning: A Laboratory Manual Cold Spring Harbor, Cold Spring Harbor Laboratory Press. *
Sanger, et al., "DNA sequencing with chain-terminating inhibitors," Proceedings of the National Academy of Science USA 74:5463-5467 (1977).
Sanger, et al., DNA sequencing with chain terminating inhibitors, Proceedings of the National Academy of Science USA 74:5463 5467 (1977). *
Scahill, et al., "Expression and characterization of the product of a human immune interferon cDNA gene in Chinese hamster ovary cells," Proc. Natl. Acad. Sci., U.S.A. 80:4654-4658 (1983).
Scahill, et al., Expression and characterization of the product of a human immune interferon cDNA gene in Chinese hamster ovary cells, Proc. Natl. Acad. Sci., U.S.A . 80:4654 4658 (1983). *
Schad and Anderson, "Predisposition to Hookworm Infection in Humans," Science 228:1537-1540 (1985).
Schad and Anderson, Predisposition to Hookworm Infection in Humans, Science 228:1537 1540 (1985). *
Schad, "Arrested Development of Ancylostoma caninum In Dogs: Influence of Photoperiod and Temperature on Induction of a Potential to Arrest," Aspects of Parasitology: A Festschrift Dedicated to the Fiftieth Anniversary of the Institute of Parasitology of McGill University (Meerovitch, ed., McGill University, Montreal, pp. 361-391) (1982).
Schad, Arrested Development of Ancylostoma caninum In Dogs: Influence of Photoperiod and Temperature on Induction of a Potential to Arrest, Aspects of Parasitology: A Festschrift Dedicated to the Fiftieth Anniversary of the Institute of Parasitology of McGill University (Meerovitch, ed., McGill University, Montreal, pp. 361 391) (1982). *
Scrimshaw, "Iron Deficiency," Scien. Amer. 265:46-52 (1991).
Scrimshaw, Iron Deficiency, Scien. Amer . 265:46 52 (1991). *
Sen hai, Nationwide Survey of Human Parasites in China, SE Asian J. Trop. Med. Pub. Health 25:4 10 (1994). *
Sen-hai, "Nationwide Survey of Human Parasites in China," SE Asian J. Trop. Med. Pub. Health 25:4-10 (1994).
Short and Sorge, "In vivo excision properties of bacteriophage lambda ZAP expression vectors," Methods in Enzymology 216:495-508 (1992).
Short and Sorge, In vivo excision properties of bacteriophage lambda ZAP expression vectors, Methods in Enzymology 216:495 508 (1992). *
Southern, "Detection of Specific Sequences Among DNA Fragments Separated by Gel Electrophoresis," J. Mol. Biol. 98:503 (1975).
Southern, Detection of Specific Sequences Among DNA Fragments Separated by Gel Electrophoresis, J. Mol. Biol . 98:503 (1975). *
Spieth, et al., "Operons in C elegans: polycistronic MRNA precursors are processed by trans-splicing of SL2 to downstream coding regions," Cell 73:521-532 (1993).
Spieth, et al., Operons in C elegans : polycistronic MRNA precursors are processed by trans splicing of SL2 to downstream coding regions, Cell 73:521 532 (1993). *
Stauber, et al., "Rapid generation of monoclonal antibody-secreting hybridomas against African horse sickness virus by in vitro immunization and the fusion/cloning technique," J. Immunol. Methods (Netherlands) 161(2):157-168 (May 26, 1993).
Stauber, et al., Rapid generation of monoclonal antibody secreting hybridomas against African horse sickness virus by in vitro immunization and the fusion/cloning technique, J. Immunol. Methods (Netherlands) 161(2):157 168 (May 26, 1993). *
Stuart, et al., "Location of the 18/28S ribosomal RNA genes in two Hawaiian Drosphila species by monoclonal immunological identification of RNA-DNA hybrids in situ," Proc. Natl. Acad. Sci., USA 78:3751 (1981).
Stuart, et al., Location of the 18/28S ribosomal RNA genes in two Hawaiian Drosphila species by monoclonal immunological identification of RNA DNA hybrids in situ, Proc. Natl. Acad. Sci., USA 78:3751 (1981). *
Suggs et al PNAS 78: 6613 6617, 1981. *
Suggs et al PNAS 78: 6613-6617, 1981.
Sung, et al., "Short Homopeptide Leader Sequences Enhanced Production of Human Proinsulin in Excherichia coli," Methods in Enzymology, vol. 153, Chapters 23 to 34 (Wu and Grossman, eds., Academic Press, 1987).
Sung, et al., Short Homopeptide Leader Sequences Enhanced Production of Human Proinsulin in Excherichia coli, Methods in Enzymology , vol. 153, Chapters 23 to 34 (Wu and Grossman, eds., Academic Press, 1987). *
Templeton, N. S., et al., "Reducing artifact and increasing the yield of specific DNA target fragments during PCR-RACE or anchor PCR," Biotechniques 15:48-51 (1993).
Templeton, N. S., et al., Reducing artifact and increasing the yield of specific DNA target fragments during PCR RACE or anchor PCR, Biotechniques 15:48 51 (1993). *
The 1995 Lab Manual Source Book (Cold Spring Harbor Laboratory Press, NY, 1995).
Venkateswaran, et al., "Production of Anti-Fibroblast Growth Factor Receptor Monoclonal Antibodies by In Vitro Immunization," Hybridoma 11(6):729-739 (Dec. 1992).
Venkateswaran, et al., Production of Anti Fibroblast Growth Factor Receptor Monoclonal Antibodies by In Vitro Immunization, Hybridoma 11(6):729 739 (Dec. 1992). *
von Heijne, "A new method for predicting signal sequences cleavage sites," Nucleic Acids Research 14:4683-4690 (1986).
von Heijne, A new method for predicting signal sequences cleavage sites, Nucleic Acids Research 14:4683 4690 (1986). *
Willadsen, "Immunological Approaches to the control of Ticks," Int. J. Parasitol. 17:671 (1987).
Willadsen, Immunological Approaches to the control of Ticks, Int. J. Parasitol . 17:671 (1987). *
Xiao, et al., Chin. J. Parasitol. Paras. Dis. 12:214-17 (1994).
Yu, et al., Chin. J. Parasitol. Paras. Dis. 12:241-248 (1994)*.

Cited By (31)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004053056A3 (en) * 2002-09-24 2005-01-06 Univ Kentucky Res Found Nanoparticle-based vaccine delivery system containing adjuvant
US20060189554A1 (en) * 2002-09-24 2006-08-24 Russell Mumper Nanoparticle-Based vaccine delivery system containing adjuvant
US20080124350A1 (en) * 2002-09-24 2008-05-29 University Of Kentucky Research Foundation Nanoparticle-based vaccine delivery system containing adjuvant
US10640551B2 (en) 2007-06-15 2020-05-05 Idexx Laboratories, Inc. Compositions, devices, kits and methods for detecting hookworm
US10429388B2 (en) 2007-06-15 2019-10-01 Idexx Laboratories, Inc. Methods, devices, kits and compositions for detecting roundworm, whipworm and hookworm
US20090286231A1 (en) * 2007-06-15 2009-11-19 Idexx Laboratories, Inc. Methods, Devices, Kits and Compositions for Detecting Roundworm, Whipworm, and Hookworm
US11267879B2 (en) 2007-06-15 2022-03-08 Idexx Laboratories, Inc. Compositions, devices, kits and methods for detecting hookworm
US10942180B2 (en) 2007-06-15 2021-03-09 Idexx Laboratories, Inc. Methods, devices, kits and compositions for detecting roundworm, whipworm and hookworm
US8895294B2 (en) 2007-06-15 2014-11-25 Idexx Laboratories, Inc. Methods, devices, kits and compositions for detecting roundworm, whipworm, and hookworm
US20100151500A1 (en) * 2007-06-15 2010-06-17 Idexx Laboratories, Inc. Compositions, Devices, Kits and Methods for Detecting Hookworm
WO2008156650A3 (en) * 2007-06-15 2009-09-03 Idexx Laboratories, Inc. Device, kit and method for hookworm antigen capture and detection
US7951547B2 (en) 2007-06-15 2011-05-31 Idexx Laboratories, Inc. Methods, devices, kits and compositions for detecting roundworm, whipworm, and hookworm
US9746469B2 (en) 2007-06-15 2017-08-29 Idexx Laboratories, Inc. Methods, devices, kits and compositions for detecting roundworm, whipworm, and hookworm
US9239326B2 (en) 2007-06-15 2016-01-19 Idexx Laboratories, Inc. Compositions, devices, kits and methods for detecting hookworm
US20080311557A1 (en) * 2007-06-15 2008-12-18 Idexx Laboratories, Inc. Device, kit and method for hookworm antigen capture and detection
US9063129B2 (en) 2007-06-15 2015-06-23 Idexx Laboratories, Inc. Device, kit and method for hookworm antigen capture and detection
US9040245B2 (en) 2007-06-15 2015-05-26 Idexx Laboratories, Inc. Methods, devices, kits and compositions for detecting roundworm, whipworm, and hookworm
US8105795B2 (en) 2008-05-19 2012-01-31 Idexx Laboratories, Inc. Methods, devices, kits and compositions for detecting roundworm
US7993861B2 (en) 2008-05-19 2011-08-09 Idexx Laboratories, Inc. Methods, devices, kits and compositions for detecting whipworm
US8367808B2 (en) 2008-05-19 2013-02-05 Idexx Laboratories, Inc. Methods, devices, kits and compositions for detecting whipworm
US8268574B2 (en) 2008-05-19 2012-09-18 Idexx Laboratories, Inc. Methods, devices, kits and compositions for detecting roundworm
US9103823B2 (en) 2008-05-19 2015-08-11 Idexx Laboratories, Inc. Methods, devices, kits and compositions for detecting roundworm
US9212220B2 (en) 2008-05-19 2015-12-15 Idexx Laboratories, Inc. Methods, devices, kits and compositions for detecting roundworm
US7993862B2 (en) 2008-05-19 2011-08-09 Idexx Laboratories, Inc. Methods, devices, kits and compositions for detecting roundworm
US8580518B2 (en) 2008-05-19 2013-11-12 Idexx Laboratories, Inc. Methods, devices, kits and compositions for detecting roundworm
US20090286230A1 (en) * 2008-05-19 2009-11-19 Idexx Laboratories, Inc. Methods, Devices, Kits and Compositions for Detecting Roundworm
US20110086340A1 (en) * 2008-05-19 2011-04-14 Idexx Laboratories, Inc. Methods, devices, kits and compositions for detecting roundworm
US20090286227A1 (en) * 2008-05-19 2009-11-19 Idexx Laboratories, Inc. Methods, Devices, Kits and Compositions for Detecting Whipworm
US20090286228A1 (en) * 2008-05-19 2009-11-19 Idexx Laboratories, Inc. Methods, Devices, Kits and Compositions for Detecting Roundworm
US10539570B2 (en) * 2015-04-17 2020-01-21 Kenneth Davin Fine Diagnostic testing for immunologic food sensitivity
US20180299466A1 (en) * 2015-04-17 2018-10-18 Kenneth Davin Fine Diagnostic testing for immunologic food sensitivity

Also Published As

Publication number Publication date
WO1996032479A1 (en) 1996-10-17
AU5537996A (en) 1996-10-30

Similar Documents

Publication Publication Date Title
US6001361A (en) Mycobacterium vaccae antigens
US5753787A (en) Nucleic acids encoding ancylostoma secreted protein
Wilkowsky et al. Babesia bovis merozoite surface protein-2c (MSA-2c) contains highly immunogenic, conserved B-cell epitopes that elicit neutralization-sensitive antibodies in cattle
US6855322B2 (en) Isolation and purification of P. falciparum merozoite protein-142 vaccine
US5656451A (en) OspE, OspF, and S1 polypeptides in borrelia burgdorferi
US7052696B2 (en) Antigenic epitopes and mosaic polypeptides of hepatitis C virus proteins
EP1151118B1 (en) Recombinant expression of heterologous nucleic acids in protozoa
US8227584B2 (en) Ostertagia vaccine
US6710166B1 (en) 41 kDa Cryptosporidium parvum oocyst wall protein
US20030104003A1 (en) Novel surface protein of the malaria parasite plasmodium falciparum
AU774887B2 (en) Antigenic epitopes and mosaic polypeptides of hepatitis C virus proteins
US7306806B2 (en) Recombinant P. falciparum merozoite protein-142 vaccine
JPH06505865A (en) Cloning and expression of Toxoplasma gondii protein antigens
WO2008097812A1 (en) Toxoplasma gondii oocyst protein
US6204003B1 (en) Methods for the diagnosis of feline infectious anemia
WO1999025826A1 (en) Method and kit for determining severe inflammatory reactions to mosquito bites
WO1998004274A1 (en) Recombinant mosquito salivary allergens
WO1998004274A9 (en) Recombinant mosquito salivary allergens
EP0915977A1 (en) B. burgdorferi polypeptides expressed in vivo
US7595191B2 (en) Isolation and purification of P. falciparum merozoite protein-142 vaccine
US20090068218A1 (en) Antigens for Vaccination Against and Detection of Mycoplasma Suis
WO1990015621A1 (en) A malaria vaccine
Shah Identification of genes encoding secreted proteins of schistosomes.
AU8154801A (en) Compositions and methods for the prevention and diagnosis of human granulocytic enrlichiosis

Legal Events

Date Code Title Description
AS Assignment

Owner name: YALE UNIVERSITY, CONNECTICUT

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:HAWDON, JOHN M.;HOTEZ, PETER J.;JONES, BRIAN F.;REEL/FRAME:007601/0805

Effective date: 19950531

AS Assignment

Owner name: NATIONAL INSTITUTES OF HEALTH, THE, MARYLAND

Free format text: CONFIRMATORY LICENSE;ASSIGNOR:YALE, UNIVERSITY;REEL/FRAME:007984/0681

Effective date: 19950707

AS Assignment

Owner name: NATIONAL INSTITUTES OF HEALTH, THE, MARYLAND

Free format text: CONFIRMATORY LICENSE;ASSIGNOR:YALE UNIVERSITY;REEL/FRAME:010052/0555

Effective date: 19990503

REMI Maintenance fee reminder mailed
FPAY Fee payment

Year of fee payment: 4

SULP Surcharge for late payment
FPAY Fee payment

Year of fee payment: 8

REMI Maintenance fee reminder mailed
LAPS Lapse for failure to pay maintenance fees
STCH Information on status: patent discontinuation

Free format text: PATENT EXPIRED DUE TO NONPAYMENT OF MAINTENANCE FEES UNDER 37 CFR 1.362

FP Lapsed due to failure to pay maintenance fee

Effective date: 20100519

AS Assignment

Owner name: NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF

Free format text: CONFIRMATORY LICENSE;ASSIGNOR:YALE UNIVERSITY;REEL/FRAME:027232/0600

Effective date: 20111024