US5710025A - Cell-type specific transcription factor - Google Patents

Cell-type specific transcription factor Download PDF

Info

Publication number
US5710025A
US5710025A US08/725,012 US72501296A US5710025A US 5710025 A US5710025 A US 5710025A US 72501296 A US72501296 A US 72501296A US 5710025 A US5710025 A US 5710025A
Authority
US
United States
Prior art keywords
htaf
nucleic acid
taf
seq
protein
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
US08/725,012
Inventor
Rivka Dikstein
Robert Tjian
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of California San Diego UCSD
Original Assignee
University of California San Diego UCSD
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of California San Diego UCSD filed Critical University of California San Diego UCSD
Priority to US08/725,012 priority Critical patent/US5710025A/en
Assigned to REGENTS OF THE UNIVERSITY OF CALIFORNIA reassignment REGENTS OF THE UNIVERSITY OF CALIFORNIA ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: TJIAN, ROBERT, DIKSTEIN, RIVKA
Application granted granted Critical
Publication of US5710025A publication Critical patent/US5710025A/en
Assigned to NIH reassignment NIH CONFIRMATORY LICENSE (SEE DOCUMENT FOR DETAILS). Assignors: R ICHARD HARRIS, UNIVERSITY OF CALIFORNIA
Assigned to NIH reassignment NIH CONFIRMATORY LICENSE (SEE DOCUMENT FOR DETAILS). Assignors: UNIVERSITY OF CALIFORNIA
Anticipated expiration legal-status Critical
Expired - Fee Related legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4738—Cell cycle regulated proteins, e.g. cyclin, CDC, INK-CCR

Definitions

  • the field of this invention is the regulation of cell specific genes.
  • TFIID isolated from Drosophila and human cells consists of TBP and eight or more tightly associated subunits (TAFs) provided the first clue that perhaps TAFs can mediate transcriptional activation.
  • TAFs tightly associated subunits
  • Recent experiments have provided evidence that the activation domains of different upstream regulators can recognize and bind selectively to specific TAF subunits of the TFIID complex.
  • transcription reactions reconstituted with recombinant TAFs are able to provide coactivator function and thus potentiate enhancer dependent activation by sequence specific regulators.
  • the assembly of partial TBP-TAF complexes suggested that specific activator-TAF interactions are required to direct both simple activation as well as synergistic transcription by multiple enhancer factors.
  • the invention provides methods and compositions relating to a human tata-binding protein associated factor 105 (hTAF II 105), related nucleic acids, and protein domains thereof having hTAF II 105-specific activity.
  • the proteins may be produced recombinantly from transformed host cells from the subject hTAF II 105 encoding nucleic acids or purified from human cells.
  • the invention provides isolated hTAF II 105 hybridization probes and primers capable of specifically hybridizing with the disclosed hTAF II 105 gene, hTAF II 105-specific binding agents such as specific antibodies, and methods of making and using the subject compositions in diagnosis (e.g. genetic hybridization screens for hTAF II 105 transcripts), therapy (e.g.
  • gene therapy to modulate hTAF II 105 gene expression and in the biopharmaceutical industry (e.g. as immunogens, reagents for isolating B-cell specific activators or other transcriptional regulators, reagents for screening chemical libraries for lead pharmacological agents, etc.).
  • biopharmaceutical industry e.g. as immunogens, reagents for isolating B-cell specific activators or other transcriptional regulators, reagents for screening chemical libraries for lead pharmacological agents, etc.
  • the nucleotide sequence of a natural cDNA encoding an hTAF II 105 protein is shown as SEQ ID NO:1 and the full conceptual translate shown as SEQ ID NO:2.
  • the hTAF II 105 proteins of the invention include incomplete translates of SEQ ID NO:1 and deletion mutants of SEQ ID NO:2, which translates and deletion routants have hTAF II 105-specific amino acid sequence and binding specificity or function.
  • Such active hTAF II 105 deletion mutants, hTAF II 105 peptides or protein domains comprise at least 20, preferably at least about 40, more preferably at least about 80 consecutive residues of SEQ ID NO:2.
  • the hTAF II 105 protein domain consisting of residues 547-801 is shown to provide TAF-binding function and the domain consisting of residues 1-546 is shown to provide activator binding function, inter alia, in solid-phase binding assays as described below.
  • hTAF II 105-specific activity or function may be determined by convenient in vitro, cell-based, or in vivo assays: e.g. in vitro binding assays, cell culture assays, in animals (e.g. immune response, gene therapy, transgenics, etc.), etc. Binding assays encompass any assay where the molecular interaction of an hTAF II 105 protein with a binding target is evaluated.
  • the binding target may be a natural intracellular binding target such as another TAF or other component of TFIID, a specific transcriptional activator, an hTAF II 105 substrate or nucleic acid binding site or other regulator that directly modulates hTAF II 105 activity or its localization; or non-natural binding target such a specific immune protein such as an antibody, or an hTAF II 105 specific agent such as those identified in screening assays such as described below.
  • a natural intracellular binding target such as another TAF or other component of TFIID, a specific transcriptional activator, an hTAF II 105 substrate or nucleic acid binding site or other regulator that directly modulates hTAF II 105 activity or its localization
  • non-natural binding target such a specific immune protein such as an antibody, or an hTAF II 105 specific agent such as those identified in screening assays such as described below.
  • hTAF II 105-binding specificity may assayed by binding equilibrium constants (usually at least about 10 7 M -1 , preferably at least about 10 8 M -1 , more preferably at least about 10 9 M -1 ), by the ability of the subject protein to function as negative mutants in hTAF II 105-expressing cells, to elicit hTAF II 105 specific antibody in a heterologous host (e.g a rodent or rabbit), etc.
  • a heterologous host e.g a rodent or rabbit
  • the hTAF II 105 binding specificity of the subject hTAF II 105 proteins necessarily distinguishes other natural human proteins including hTAF II 130.
  • the claimed hTAF II 105 proteins are isolated or pure: an "isolated" protein is unaccompanied by at least some of the material with which it is associated in its natural state, preferably constituting at least about 0.5%, and more preferably at least about 5% by weight of the total protein in a given sample and a pure protein constitutes at least about 90%, and preferably at least about 99% by weight of the total protein in a given sample.
  • the hTAF II 105 proteins and protein domains may be synthesized, produced by recombinant technology, or purified from human cells. A wide variety of molecular and biochemical methods are available for biochemical synthesis, molecular expression and purification of the subject compositions, see e.g.
  • hTAF II 105-specific binding agents are useful in a variety of diagnostic and therapeutic applications.
  • Novel hTAF II 105-specific binding agents include hTAF II 105-specific receptors, such as somatically recombined protein receptors like specific antibodies or T-cell antigen receptors (see, e.g Harlow and Lane (1988) Antibodies, A Laboratory Manual, Cold Spring Harbor Laboratory) and other natural intracellular binding agents identified with assays such as one-, two- and three-hybrid screens, non-natural intraceliular binding agents identified in screens of chemical libraries such as described below, etc.
  • the binding agents are frequently labeled, such as with fluorescent, radioactive, chemiluminescent, or other easily detectable molecules, either conjugated directly to the binding agent or conjugated to a probe specific for the binding agent.
  • Agents of particular interest modulate hTAF II 105 function, e.g. hTAF II 105-dependent transcriptional activation; for example, isolated cells, whole tissues, or individuals may be treated with an hTAF II 105 binding agent to activate, inhibit, or alter hTAF II 105-dependent transcriptional processes.
  • hTAF II 105 proteins are used to back-translate hTAF II 105 protein-encoding nucleic acids optimized for selected expression systems (Holler et al. (1993) Gene 136, 323-328; Martin et al. (1995) Gene 154, 150-166) or used to generate degenerate oligonucleotide primers and probes for use in the isolation of natural hTAF II 105-encoding nucleic acid sequences ("GCG” software, Genetics Computer Group, Inc, Madison Wis.).
  • GCG Genetics Computer Group, Inc, Madison Wis.
  • the invention also provides nucleic acid hybridization probes and replication/amplification primers having a hTAF II 105 cDNA specific sequence contained in SEQ ID NO:1 and sufficient to effect specific hybridization thereto (i.e. specifically hybridize with SEQ ID NO:1 in the presence of human B-cell cDNA).
  • Such primers or probes are at least 12, preferably at least 24, more preferably at least 36 and most preferably at least 96 bases in length.
  • Demonstrating specific hybridization generally requires stringent conditions, for example, hybridizing in a buffer comprising 30% formanaide in 5 ⁇ SSPE (0.18M NaCl, 0.01M NaPO 4 , pH 7.7, 0.001M EDTA) buffer at a temperature of 42° C.
  • hTAF II 105 cDNA homologs can also be distinguished from other protein using alignment algorithms, such as BLASTX (Altschul et al. (1990) Basic Local Alignment Search Tool, J Mol Biol 215, 403-410).
  • the subject nucleic acids are of synthetic/non-natural sequences and/or are isolated, i.e. unaccompanied by at least some of the material with which it is associated in its natural state, preferably constituting at least about 0.5%, preferably at least about 5% by weight of total nucleic acid present in a given fraction, and usually recombinant, meaning they comprise a non-natural sequence or a natural sequence joined to nucleotide(s) other than that which it is joined to on a natural chromosome.
  • Nucleic acids comprising the nucleotide sequence of SEQ ID NO:1 or fragments thereof contain such sequence or fragment at a terminus, immediately flanked by a sequence other than that which it is joined to on a natural chromosome, or flanked by a native flanking region fewer than 10 kb, preferably fewer than 2 kb, which is at a terminus or is immediately flanked by a sequence other than that which it is joined to on a natural chromosome. While the nucleic acids are usually RNA or DNA, it is often advantageous to use nucleic acids comprising other bases or nucleotide analogs to provide modified stability, etc.
  • the subject nucleie acids find a wide variety of applications including use as translatable transcripts, hybridization probes, PCR primers, diagnostic nucleic acids, etc.; use in detecting the presence of hTAF II 105 genes and gene transcripts and in detecting or amplifying nucleic acids encoding additional hTAF II 105 homologs and structural analogs.
  • hTAF II 105 hybridization probes find use in identifying wild-type and mutant hTAF II 105 alleles in clinical and laboratory samples. Mutant alleles are used to generate allele-specific oligonucleotide (ASO) probes for high-throughput clinical diagnoses.
  • therapeutic hTAF II 105 nucleic acids are used to modulate cellular expression or intracellular concentration or availability of active hTAF II 105.
  • the invention provides efficient methods of identifying agents, compounds or lead compounds for agents active at the level of a hTAF II 105 modulatable cellular function.
  • these screening methods involve assaying for compounds which modulate hTAF II 105 interaction with a natural hTAF II 105 binding target.
  • assays for binding agents are provided including labeled in vitro protein-protein binding assays, immunoassays, cell based assays, etc.
  • the methods are amenable to automated, cost-effective high throughput screening of chemical libraries for lead compounds.
  • Identified reagents find use in the pharmaceutical industries for animal and human trials; for example, the reagents may be derivatized and rescreened in in vitro and in vivo assays to optimize activity and minimize toxicity for pharmaceutical development.
  • Target indications include B-cell proliferative disease, inflammation, hypersensitivity, etc.
  • agents which enhance hTAF II 105 transcriptional activation may be selected for indications where the enhancement of B-cell differentiation is desirable, e.g. immune deficiencies, infection, etc.
  • In vitro binding assays employ a mixture of components including an hTAF II 105 protein, which may be part of a fusion product with another peptide or polypeptide, e.g. a tag for detection or anchoring, etc.
  • the assay mixtures comprise a natural intracellular hTAF II 105 binding target. While native binding targets may be used, it is frequently preferred to use portions (e.g. peptides) thereof so long as the portion provides binding affinity and avidity to the subject hTAF II 105 protein conveniently measurable in the assay.
  • the assay mixture also comprises a candidate pharmacological agent.
  • Candidate agents encompass numerous chemical classes, though typically they are organic compounds; preferably small organic compounds and are obtained from a wide variety of sources including libraries of synthetic or natural compounds.
  • reagents like salts, buffers, neutral proteins, e.g. albumin, detergents, protease inhibitors, nuclease inhibitors, antimicrobial agents, etc. may be used.
  • the resultant mixture is incubated under conditions whereby, but for the presence of the candidate pharmacological agent, the hTAF II 105 protein specifically binds the cellular binding target, portion or analog with a reference binding affinity.
  • the mixture components can be added in any order that provides for the requisite bindings and incubations may be performed at any temperature which facilitates optimal binding. Incubation periods are likewise selected for optimal binding but also minimized to facilitate rapid, high-throughput screening.
  • the agent-biased binding between the hTAF II 105 protein and one or more binding targets is detected by any convenient way.
  • a separation step is often used to separate bound from unbound components. Separation may be effected by precipitation (e.g. TCA precipitation, immunoprecipitation, etc.), immobilization (e.g on a solid substrate), etc., followed by washing by, for examples, membrane filtration (e.g. Whatman's P-81 ion exchange paper, Polyfiltronic's hydrophobic GFC membrane, etc.), gel chromatography (e.g. gel filtration, affinity, etc.).
  • hTAF II 105-dependent transcription assays binding is detected by a change in the expression of an hTAF II 105-dependent reporter.
  • Detection may be effected in any convenient way.
  • one of the components usually comprises or is coupled to a label.
  • the label may provide for direct detection as radioactivity, luminescence, optical or electron density, etc. or indirect detection such as an epitope tag, an enzyme, etc.
  • a variety of methods may be used to detect the label depending on the nature of the label and other assay components, e.g. through optical or electron density, radiative emissions, nonradiative energy transfers, etc. or indirectly detected with antibody conjugates, etc.
  • a difference in the binding affinity of the hTAF II 105 protein to the target in the absence of the agent as compared with the binding affinity in the presence of the agent indicates that the agent modulates the binding of the hTAF II 105 protein to the hTAF II 105 binding target.
  • a difference in the hTAF II 105 transcriptional induction in the presence and absence of an agent indicates the agent modulates hTAF II 105-induced transcription.
  • a difference is statistically significant and preferably represents at least a 50%, more preferably at least a 90% difference.
  • TFIID subunits might be cell type specific
  • nuclear extracts were first fractionated by phosphocellulose (PC) chromatography to separate TFIID from other TBP-TAF complexes (i.e. SL1 and TFIIIB).
  • PC phosphocellulose
  • the resulting 1.0M NaCl PC fractions were subjected to anti-TBP affinity purification followed by SDS-PAGE analysis and staining with silver.
  • the subunit composition and levels of the core TAFs relative to TBP were very similar among the different cell types examined.
  • the TFIID complex isolated from Daudi B cells contained an additional polypeptide of approximately 105 kDa that consistently coimmunoprecipitated with anti-TBP antibodies.
  • This novel polypeptide is barely detectable in TFIID isolated from non B cells such as the neuroblastoma SK-N, glioblastoma U87, Jurkat and Hut78 T cells and HeLa cervical carcinoma.
  • association of this 105 kDa polypeptide with the TBP/TAFs complex appears to be specific as it can be coimmunoprecipitated with TFIID using a different TBP antibody but not by mock immunoprecipitation in the absence of TBP antibodies.
  • Daudi cells are characterized as Epstein Barr virus positive (EBV + ), differentiated, IgG producing B cells.
  • EBV + Epstein Barr virus positive
  • TFIID Epstein Barr virus positive
  • Jy To determine whether the association of p105 with TBP is either EBV or differentiation related, we isolated TFIID from a less differentiated, EBV + B cell, Jy, and found insignificant amounts of p105 relative to the other TFIID subunits indicating that EBV gone expression is not responsible for the high levels of p105 found in TFIID isolated from Daudi cells. Therefore, we conclude that this 105 kDa protein is a TAF that becomes specifically associated with TFIID in highly differentiated B cells.
  • hTAF II 105 is a substoichiometric subunit of TFIID
  • TAF II 105 protein is selectively associated with TFIID rather than SL1 and TFIIIB
  • a monoclonal antibody directed against human TAF II 130 to isolate TFIID complexes from either Daudi B or Jurkat T cells.
  • unfractionated nuclear extracts rather than the 1.0M NaCl PC fraction enriched for TFIID to exclude the possibility that TAF II 105-containing complexes isolated from different cell types might merely reflect differential chromatographic properties.
  • Both TBP and TAF II 130 antibodies coimmunoprecipitated TAF II 105 together with the other "core" TFIID subunits from Daudi nuclear extract.
  • TAF II 130 antibody was isolated by TAF II 130 antibody from Jurkat nuclear extracts.
  • anti-TBP selectively precipitated the TAF II 105 subunit from Daudi cells but not from Jurkat cells.
  • TFIID complex containing a putative cell type specific subunit would most likely participate in transcription of only a limited subset of genes, perhaps cell type specific genes. Consequently, one might expect that only a subset of TFIID complexes within the cell will contain this subunit. Became silver staining of proteins is notoriously non-quantitative, we have attempted to determine the relative stoichiometry of TAF II 105 in the B cell TFIID complex by more reliable staining methods. Antibody affinity purified TFIID complexes isolated from Daudi cells were subjected to SDS-PAGE and stained both by silver and Coomassie blue.
  • TAF II 105 Unlike the intense band of TAF II 105 observed by silver staining, the Coomassie stained TAF II 105 revealed that it is present in approximately 10 fold lower levels relative to the core TAFs and TBP. The apparent substoichiometric amounts of TAF II 105 was further confirmed by two additional protein staining techniques, ponceau S and Zinc staining. These results indicate that only a small fraction ( ⁇ 5-10%) of the TFIID complexes within B cells contain TAF II 105.
  • hTAF II 105 is a homolog of Drosophila TAF II 110 and human TAF II 130
  • TFIID TFIID-derived neuropeptide
  • nuclear extracts prepared from 2000 liters of Daudi cells.
  • TFIID was first fractionated over a phosphocellulose column followed by anti-TBP affinity chromatography.
  • the TFIID polypeptides were resolved on a preparative SDS-PAGE gel, transferred onto nitrocellulose membrane and the band corresponding to hTAF II 105 was excised and digested with either trypsin or S. aureus V8 protease.
  • the resulting peptides were separated by reversed phase HPLC and subjected to microsequence analysis.
  • Amino acid sequence deduced from the cDNA revealed several regions with a high degree of similarity to hTAF II 130 and dTAF II 110.
  • the C-terminal 1/3 of these proteins that includes domains involved in binding to other TAFs is highly conserved (68% identity and 87% homology).
  • the majority of the sequences in the N-terminal region were quite diverged indicating that hTAF II 105 has evolved the ability to interact with a different subset of activators than those targeted by hTAF II 130 and dTAF II 110.
  • functional studies as described below demonstrate that the less conserved N-terminal domain of TAF II 105 contains interaction surfaces that bind to activators in differentiating B cells.
  • TAF II 105 and dTAF II 110 share conserved interfaces for interacting with other TFIID subunits
  • TFIID subunits Extensive analysis of the cloned TFIID subunits indicated that formation of a stable TFIID complex involves multiple TAF-TBP and TAF-TAF interactions.
  • TAF II 105 To identify the subunits in TFIID that contact TAF II 105, we performed a series of protein:protein interaction assays using immobilized flag-tagged TAF II 105 and 35S-labeled in vitro translated TFIID subunits. These experiments indicate that TAF II 105 specifically interacts with hTAF II 250, dTAF II 150, the large subunit of TFIIA, and weakly with TBP.
  • TAF II 105 did not appear to interact specifically with dTAF II 80, hTAF II 70, TAF II 60, dTAF II 40, hTAF II 32, dTAF II 30 ⁇ and dTAF II 30 ⁇ .
  • dTAF II 110 did not appear to interact specifically with dTAF II 80, hTAF II 70, TAF II 60, dTAF II 40, hTAF II 32, dTAF II 30 ⁇ and dTAF II 30 ⁇ .
  • dTAF II 110 did not appear to interact specifically with dTAF II 80, hTAF II 70, TAF II 60, dTAF II 40, hTAF II 32, dTAF II 30 ⁇ and dTAF II 30 ⁇ .
  • dTAF II 110 and TAF II 105 can interact with each other to form dimers and heterodimers.
  • TAF II 105 Cell type specific association of TAF II 105 with TFIID is post transcriptionally regulated.
  • TAF II 105 the levels of its mRNA in different cell types were determined by northern blot analysis with a TAF II 105 specific probe. As a control, identical samples were hybridized with the ubiquitous hTAF II 130 probe. Our analysis of TAF II 105 RNA revealed a single transcript of about 4.6 Kb that is expressed at relatively invariant levels in all the cell types examined. To further confirm this finding, we performed RNase protection assays. Similar amounts of RNA extracted from different cell types were hybridize with hTAF II 105 or hTAF II 250 specific probes followed by digestion with RNase A and RNase T1. Here again, the levels of protected TAF II 105 transcripts from different cell types appeared comparable. Taken together these data indicate that TAF II 105 may be post-transcriptionally regulated in a cell type specific manner.
  • TAF II 105 protein To quantitate the amounts of TAF II 105 protein in different cells, we expressed the less conserved N-terminal portion of the protein in E. coli and raised polyclonal antibodies against this region of TAF II 105. These anti-TAF II 105 antibodies specifically recognize a 105 Kd polypeptide present in Daudi nuclear extract as well as recombinant TAF II 105 produced in Sf9 cells. As expected, anti-TAF II 105 antibodies can also immunoprecipitate TAF II 105 together with all the core TFIID subunits including its homolog TAF II 130 from Daudi extracts indicating that both, TAF II 105 and TAF II 130, might be present in the same complex.
  • TAF II 105 protein expressed in different cell types similar amounts of nuclear extracts from different cell types were subjected to Western blot analysis using TAF II 105 and TBP antibodies.
  • the levels of TAF II 105 protein are significantly higher in Daudi B cells than in non B cells suggesting that the cell type specific regulation of TAF II 105 may be, in part, at the level of protein expression.
  • the anti-TAF II 105 antibodies were used to compare the levels of TAF II 105 associated with affinity purified TFIID isolated from either Daudi or HeLa cells. These antibodies specifically detected TAF II 105 in Daudi TFIID but not in HeLa TFIID.
  • Nuclear extracts from different cell types were prepared and fractionated by phosphocellulose P11 column (PC) as described (Tanese et al., 1991 Genes & Dev. 5, 2212-2224).
  • Polyclonal anti-TBP antibodies raised against recombinant hTBP were described (Tanese et al., supra).
  • the antibodies were affinity purified using TBP-coupled affinity resins
  • Monoclonal anti-TAF II 130 antibody IA5 was described (Ruppert et al., 1993, Nature 362, 175-179).
  • TAF II 105 polyclonal antibodies were raised against recombinant protein corresponding to amino acid 1-552 produced in bacteria with 6 histidine-tag.
  • TAF II 105 The inclusion bodies containing overexpressed TAF II 105 were dissolved in 6M urea, purified by Ni + agarose resin, resolved on SDS-PAGE and TAF II 105 protein was excised and injected into rabbits. Immunoprecipitations of TFIID complex by affinity purified TBP antibodies, anti-TAF II 130 (IA5) and anti-TAF II 105 were carried with TFIID enriched PC fractions or directly from nuclear extracts essentially as described (Tanese et al., supra).
  • 1.0M NaCl PC fraction or 5 mg of nuclear extracts in HEMG buffer (20 mM Hepes 7.9, 100 mM KCl, 12.5 mM MgCl 2 , 0.2 mM EDTA, 0.1% NP-40, 1 mM DTT, 0.2 mm PMSF) were incubated with antibodies and protein A sepharose beads at 4° C. for 2-3 hours.
  • the immune complexes were washed with HEMG buffer 5 times and eluted either by 1M guanidine-HCl followed by TCA precipitation or by 5 minutes boiling in SDS-PAGE protein sample buffer.
  • Daudi cells nuclear extracts were prepared from 2000 liters of culture and TFIID enriched fraction was obtained by PC column (Tanese et al., 1991, supra).
  • TFIID was immunopurified directly from PC 1.0M NaCl fraction using crosslinked anti-TBP resin and the TAFs were eluted by 50 mM glycine pH 2.5, 150 mM NaCl and precipitated with trichloroacetic acid (TCA) containing deoxycholate (4 mg/ml).
  • TCA trichloroacetic acid
  • the TAFs were resolved by SDS-PAGE, transferred to nitrocellulose membrane and stained with ponceau S (Sigma).
  • TAF II 105 The band corresponding to TAF II 105 was excised, digested with either trypsin or V8 proteases and peptides eluted from the membrane were resolved by reversed-phase HPLC and subjected to microsequencing. Daudi cDNA library (1.5 ⁇ 10 6 phages) was screened with 237 bp probe derived from hTAF II 130 generated by PCR. 2 TAF II 105 positive phages were isolated, their 1.9 and 2 kb inserts were cloned into Bluescript KS + (Stratagene), sequenced and found to contain a 1 kb of 3' untranslated region and 1 kb coding region containing the sequence of 7 peptides obtained by the proteolytic digestion.
  • KS + Bluescript KS +
  • TAF II 105 To clone the N-terminus of TAF II 105, the following human cDNA libraries were screened: human tertocarcinoma, Jurkat, HeLa and another Daudi cDNA library. 2 positive clones were obtained from the HeLa cell library, one of 1.6 Kb overlapping with the clones isolated from the Daudi library and a second clone of 3.6 Kb insert. This insert was cloned in Bluescript KS+ and both strands of this cDNA were completely sequenced with Bluescript or TAF II 105 specific primers.
  • RNA samples were prepared from cultured cells according to the procedure that has been described (Gough, 1988, Analytical Biochemistry 1 73, 93-95).
  • Northern blot analysis 30 ⁇ g of RNA prepared from different cell types were electrophoresed on a 1% formaldehyde/agarose gel in duplicates. RNA was transferred to nitrocellulose membrane and hybridized with riboprobes complementary to either hTAF II 105 or hTAF II 130.
  • RNase protection assay 30 ⁇ g of total RNA extracted from different cell types were hybridized with anti-sense RNA probes corresponding to hTAF II 105 or hTAF II 250 for 16 hours at 55° C.
  • 35 S-labeled TAFs were synthesized in vitro by T7 RNA polymerase and rabbit reticulocytes lysate and incubated with flag beads or with TAF II 105 coupled to flag beads in 0.1M KCl HEMG buffer for 2 hours at 4° C. The beads were washed 5 times with the same buffer and the bound proteins were eluted by 5 minutes boiling in protein sample buffer followed by SDS-PAGE and autoradiography.
  • Protocol for hTAF II 105-hTAF II 250 binding assay.
  • a solid phase bead-based TAF interaction assay uses immobilized flag-tagged hTAF II 105 and 35 S-labeled in vitro translated hTAF II 250 subunit.
  • the hTAF II 250 subunit was translated in vitro by rabbit reticulocyte lysate in the presence of 355-methionine.
  • Labeled hTAF II 250 was used in interaction assays with immobilized flag-tagged hTAF II 105.
  • As a control the labeled TAF was incubated with flag beads in the absence of hTAF II 105 protein. The beads were eluted, resolved on SDS-PAGE and autoradiographed. The input represented 10% of the labeled protein used for the interaction assay.
  • Protocol for high throughput hTAF II 105-TFIIA large subunit complex formation assay.
  • Neutralitc Avidin 20 ⁇ g/ml in PBS.
  • Blocking buffer 5% BSA, 0.5% Tween 20 in PBS; 1 hour at room temperature.
  • Assay Buffer 100 mM KCl, 20 mM HEPES pH 7.6, 1 mM MgCl 2 , 1% glycerol, 0.5% NP-40, 50 mM ⁇ -mercaptoethanol, 1 mg/ml BSA, cocktail of protease inhibitors.
  • Protease inhibitor cocktail 10 mg Trypsin Inhibitor (BMB #109894), 10 mg Aprotinin (BMB #236624), 25 mg Benzamidine (Sigma #B-6506), 25 mg Leupeptin (BMB #1017128), 10 mg APMSF (BMB #917575), and 2 mM NaVo 3 (Sigma #S-6508) in 10 ml of PBS.
  • hTFIIA large subunit 10 -7 -10 -5 M biotinylated hTFIIA large subunit in PBS.
  • Block with 150 ⁇ l of blocking buffer Block with 150 ⁇ l of blocking buffer.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Cell Biology (AREA)
  • Physics & Mathematics (AREA)
  • Toxicology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Plant Pathology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The invention provides methods and compositions relating to human tata-binding protein associated factor 105 (hTAFII 105) and related nucleic acids. The proteins may be produced recombinantly from transformed host cells from the disclosed hTAFII 105 encoding nucleic acids or purified from human cells. The invention provides isolated hTAFII 105 hybridization probes and primers capable of specifically hybridizing with the disclosed hTAFII 105 gene, hTAFII 105-specific binding agents such as specific antibodies, and methods of making and using the subject compositions in diagnosis, therapy and in the biopharmaceutical industry.

Description

FIELD OF THE INVENTION
The field of this invention is the regulation of cell specific genes.
BACKGROUND
The regulation of gene expression during development, differentiation and cell growth of metazoans is thought to be directed by a large number of different sequence specific DNA binding transcription factors. Extensive biochemical and genetic analysis carried out over the past decade reveals an elaborate cascade of protein-DNA and protein-protein transactions that collectively govern the levels of mRNA production. One key aspect of transcriptional regulation is the communication between enhancer bound gene specific activators and components of the basal apparatus. Recent studies have established that the transcription factor TFIID plays a critical role in receiving transcriptional activation signals from upstream enhancer and promoter binding factors and transducing them to the basal initiation complex.
The discovery that TFIID isolated from Drosophila and human cells consists of TBP and eight or more tightly associated subunits (TAFs) provided the first clue that perhaps TAFs can mediate transcriptional activation. Recent experiments have provided evidence that the activation domains of different upstream regulators can recognize and bind selectively to specific TAF subunits of the TFIID complex. More importantly, transcription reactions reconstituted with recombinant TAFs are able to provide coactivator function and thus potentiate enhancer dependent activation by sequence specific regulators. In addition, the assembly of partial TBP-TAF complexes suggested that specific activator-TAF interactions are required to direct both simple activation as well as synergistic transcription by multiple enhancer factors.
Several recent reports identified mammalian cell type specific cofactors that are required to implement activation of certain enhancer proteins (Sturbin et al., (1995) Cell 80, 497-506; Luo and Roeder (1995) Mol & Cell. Biol 15, 4115-4124). However, these cell type specific "coactivators" have been associated with activator complexes and were not part of the TFIID complex or the basal machinery.
Relevant Literature
Transcriptional activation has recently been reviewed by Tjian and Maniatis (1994) Cell 77, 5-8; Goodrich et al. (1996) Cell 84, 825-830; and Burley et al. (1996) Annu Rev Biochem 65, 769-799; see also references cited therein. Earlier references describing the isolation of TAFs include Dynlacht et al. (1991) Cell 66, 563-576 and Tanese et al. (1991) Genes & Dev 5, 2212-2224. Both hTAFII 130 and dTAFII 110 share sequence similarity with the disclosed hTAFII 105; see Tjian et al. (1996), U.S. Pat. No. 5,534,410 and Naoko Tanese (1996), unpublished hTAFII 130 sequence data.
SUMMARY OF THE INVENTION
The invention provides methods and compositions relating to a human tata-binding protein associated factor 105 (hTAFII 105), related nucleic acids, and protein domains thereof having hTAFII 105-specific activity. The proteins may be produced recombinantly from transformed host cells from the subject hTAFII 105 encoding nucleic acids or purified from human cells. The invention provides isolated hTAFII 105 hybridization probes and primers capable of specifically hybridizing with the disclosed hTAFII 105 gene, hTAFII 105-specific binding agents such as specific antibodies, and methods of making and using the subject compositions in diagnosis (e.g. genetic hybridization screens for hTAFII 105 transcripts), therapy (e.g. gene therapy to modulate hTAFII 105 gene expression) and in the biopharmaceutical industry (e.g. as immunogens, reagents for isolating B-cell specific activators or other transcriptional regulators, reagents for screening chemical libraries for lead pharmacological agents, etc.).
DETAILED DESCRIPTION OF THE INVENTION
The nucleotide sequence of a natural cDNA encoding an hTAFII 105 protein is shown as SEQ ID NO:1 and the full conceptual translate shown as SEQ ID NO:2. The hTAFII 105 proteins of the invention include incomplete translates of SEQ ID NO:1 and deletion mutants of SEQ ID NO:2, which translates and deletion routants have hTAFII 105-specific amino acid sequence and binding specificity or function. Such active hTAFII 105 deletion mutants, hTAFII 105 peptides or protein domains comprise at least 20, preferably at least about 40, more preferably at least about 80 consecutive residues of SEQ ID NO:2. For examples, the hTAFII 105 protein domain consisting of residues 547-801 is shown to provide TAF-binding function and the domain consisting of residues 1-546 is shown to provide activator binding function, inter alia, in solid-phase binding assays as described below.
hTAFII 105-specific activity or function may be determined by convenient in vitro, cell-based, or in vivo assays: e.g. in vitro binding assays, cell culture assays, in animals (e.g. immune response, gene therapy, transgenics, etc.), etc. Binding assays encompass any assay where the molecular interaction of an hTAFII 105 protein with a binding target is evaluated. The binding target may be a natural intracellular binding target such as another TAF or other component of TFIID, a specific transcriptional activator, an hTAFII 105 substrate or nucleic acid binding site or other regulator that directly modulates hTAFII 105 activity or its localization; or non-natural binding target such a specific immune protein such as an antibody, or an hTAFII 105 specific agent such as those identified in screening assays such as described below. hTAFII 105-binding specificity may assayed by binding equilibrium constants (usually at least about 107 M-1, preferably at least about 108 M-1, more preferably at least about 109 M -1), by the ability of the subject protein to function as negative mutants in hTAFII 105-expressing cells, to elicit hTAFII 105 specific antibody in a heterologous host (e.g a rodent or rabbit), etc. In any event, the hTAFII 105 binding specificity of the subject hTAFII 105 proteins necessarily distinguishes other natural human proteins including hTAFII 130.
The claimed hTAFII 105 proteins are isolated or pure: an "isolated" protein is unaccompanied by at least some of the material with which it is associated in its natural state, preferably constituting at least about 0.5%, and more preferably at least about 5% by weight of the total protein in a given sample and a pure protein constitutes at least about 90%, and preferably at least about 99% by weight of the total protein in a given sample. The hTAFII 105 proteins and protein domains may be synthesized, produced by recombinant technology, or purified from human cells. A wide variety of molecular and biochemical methods are available for biochemical synthesis, molecular expression and purification of the subject compositions, see e.g. Molecular Cloning, A Laboratory Manual (Sambrook, et al. Cold Spring Harbor Laboratory), Current Protocols in Molecular Biology (Eds. Ausubel, et al., Greene Publ. Assoc., Wiley-Interscience, NY) or that are otherwise known in the art.
The invention provides natural and non-natural hTAFII 105-specific binding agents, methods of identifying and making such agents, and their use in diagnosis, therapy and pharmaceutical development. For example, hTAFII 105-specific agents are useful in a variety of diagnostic and therapeutic applications. Novel hTAFII 105-specific binding agents include hTAFII 105-specific receptors, such as somatically recombined protein receptors like specific antibodies or T-cell antigen receptors (see, e.g Harlow and Lane (1988) Antibodies, A Laboratory Manual, Cold Spring Harbor Laboratory) and other natural intracellular binding agents identified with assays such as one-, two- and three-hybrid screens, non-natural intraceliular binding agents identified in screens of chemical libraries such as described below, etc. For diagnostic uses, the binding agents are frequently labeled, such as with fluorescent, radioactive, chemiluminescent, or other easily detectable molecules, either conjugated directly to the binding agent or conjugated to a probe specific for the binding agent. Agents of particular interest modulate hTAFII 105 function, e.g. hTAFII 105-dependent transcriptional activation; for example, isolated cells, whole tissues, or individuals may be treated with an hTAFII 105 binding agent to activate, inhibit, or alter hTAFII 105-dependent transcriptional processes.
The amino acid sequences of the disclosed hTAFII 105 proteins are used to back-translate hTAFII 105 protein-encoding nucleic acids optimized for selected expression systems (Holler et al. (1993) Gene 136, 323-328; Martin et al. (1995) Gene 154, 150-166) or used to generate degenerate oligonucleotide primers and probes for use in the isolation of natural hTAFII 105-encoding nucleic acid sequences ("GCG" software, Genetics Computer Group, Inc, Madison Wis.). hTAFII 105-encoding nucleic acids used in hTAFII 105-expression vectors and incorporated into recombinant host cells, e.g. for expression and screening, transgenic animals, e.g. for functional studies such as the efficacy of candidate drugs for disease associated with hTAFII 105-mediated signal transduction, etc.
The invention also provides nucleic acid hybridization probes and replication/amplification primers having a hTAFII 105 cDNA specific sequence contained in SEQ ID NO:1 and sufficient to effect specific hybridization thereto (i.e. specifically hybridize with SEQ ID NO:1 in the presence of human B-cell cDNA). Such primers or probes are at least 12, preferably at least 24, more preferably at least 36 and most preferably at least 96 bases in length. Demonstrating specific hybridization generally requires stringent conditions, for example, hybridizing in a buffer comprising 30% formanaide in 5×SSPE (0.18M NaCl, 0.01M NaPO4, pH 7.7, 0.001M EDTA) buffer at a temperature of 42° C. and remaining bound when subject to washing at 42° C. with 0.2×SSPE; preferably hybridizing in a buffer comprising 50% formamide in 5×SSPE buffer at a temperature of 42° C. and remaining bound when subject to washing at 42° C. with 0.2×SSPE buffer at 42° C. hTAFII 105 cDNA homologs can also be distinguished from other protein using alignment algorithms, such as BLASTX (Altschul et al. (1990) Basic Local Alignment Search Tool, J Mol Biol 215, 403-410).
The subject nucleic acids are of synthetic/non-natural sequences and/or are isolated, i.e. unaccompanied by at least some of the material with which it is associated in its natural state, preferably constituting at least about 0.5%, preferably at least about 5% by weight of total nucleic acid present in a given fraction, and usually recombinant, meaning they comprise a non-natural sequence or a natural sequence joined to nucleotide(s) other than that which it is joined to on a natural chromosome. Nucleic acids comprising the nucleotide sequence of SEQ ID NO:1 or fragments thereof, contain such sequence or fragment at a terminus, immediately flanked by a sequence other than that which it is joined to on a natural chromosome, or flanked by a native flanking region fewer than 10 kb, preferably fewer than 2 kb, which is at a terminus or is immediately flanked by a sequence other than that which it is joined to on a natural chromosome. While the nucleic acids are usually RNA or DNA, it is often advantageous to use nucleic acids comprising other bases or nucleotide analogs to provide modified stability, etc.
The subject nucleie acids find a wide variety of applications including use as translatable transcripts, hybridization probes, PCR primers, diagnostic nucleic acids, etc.; use in detecting the presence of hTAFII 105 genes and gene transcripts and in detecting or amplifying nucleic acids encoding additional hTAFII 105 homologs and structural analogs. In diagnosis, hTAFII 105 hybridization probes find use in identifying wild-type and mutant hTAFII 105 alleles in clinical and laboratory samples. Mutant alleles are used to generate allele-specific oligonucleotide (ASO) probes for high-throughput clinical diagnoses. In therapy, therapeutic hTAFII 105 nucleic acids are used to modulate cellular expression or intracellular concentration or availability of active hTAFII 105.
The invention provides efficient methods of identifying agents, compounds or lead compounds for agents active at the level of a hTAFII 105 modulatable cellular function. Generally, these screening methods involve assaying for compounds which modulate hTAFII 105 interaction with a natural hTAFII 105 binding target. A wide variety of assays for binding agents are provided including labeled in vitro protein-protein binding assays, immunoassays, cell based assays, etc. The methods are amenable to automated, cost-effective high throughput screening of chemical libraries for lead compounds. Identified reagents find use in the pharmaceutical industries for animal and human trials; for example, the reagents may be derivatized and rescreened in in vitro and in vivo assays to optimize activity and minimize toxicity for pharmaceutical development. Target indications include B-cell proliferative disease, inflammation, hypersensitivity, etc. Alternatively, agents which enhance hTAFII 105 transcriptional activation may be selected for indications where the enhancement of B-cell differentiation is desirable, e.g. immune deficiencies, infection, etc.
In vitro binding assays employ a mixture of components including an hTAFII 105 protein, which may be part of a fusion product with another peptide or polypeptide, e.g. a tag for detection or anchoring, etc. The assay mixtures comprise a natural intracellular hTAFII 105 binding target. While native binding targets may be used, it is frequently preferred to use portions (e.g. peptides) thereof so long as the portion provides binding affinity and avidity to the subject hTAFII 105 protein conveniently measurable in the assay. The assay mixture also comprises a candidate pharmacological agent. Candidate agents encompass numerous chemical classes, though typically they are organic compounds; preferably small organic compounds and are obtained from a wide variety of sources including libraries of synthetic or natural compounds. A variety of other reagents may also be included in the mixture. These include reagents like salts, buffers, neutral proteins, e.g. albumin, detergents, protease inhibitors, nuclease inhibitors, antimicrobial agents, etc. may be used.
The resultant mixture is incubated under conditions whereby, but for the presence of the candidate pharmacological agent, the hTAFII 105 protein specifically binds the cellular binding target, portion or analog with a reference binding affinity. The mixture components can be added in any order that provides for the requisite bindings and incubations may be performed at any temperature which facilitates optimal binding. Incubation periods are likewise selected for optimal binding but also minimized to facilitate rapid, high-throughput screening.
After incubation, the agent-biased binding between the hTAFII 105 protein and one or more binding targets is detected by any convenient way. For cell-free binding type assays, a separation step is often used to separate bound from unbound components. Separation may be effected by precipitation (e.g. TCA precipitation, immunoprecipitation, etc.), immobilization (e.g on a solid substrate), etc., followed by washing by, for examples, membrane filtration (e.g. Whatman's P-81 ion exchange paper, Polyfiltronic's hydrophobic GFC membrane, etc.), gel chromatography (e.g. gel filtration, affinity, etc.). For hTAFII 105-dependent transcription assays, binding is detected by a change in the expression of an hTAFII 105-dependent reporter.
Detection may be effected in any convenient way. For cell-free binding assays, one of the components usually comprises or is coupled to a label. The label may provide for direct detection as radioactivity, luminescence, optical or electron density, etc. or indirect detection such as an epitope tag, an enzyme, etc. A variety of methods may be used to detect the label depending on the nature of the label and other assay components, e.g. through optical or electron density, radiative emissions, nonradiative energy transfers, etc. or indirectly detected with antibody conjugates, etc.
A difference in the binding affinity of the hTAFII 105 protein to the target in the absence of the agent as compared with the binding affinity in the presence of the agent indicates that the agent modulates the binding of the hTAFII 105 protein to the hTAFII 105 binding target. Analogously, in the cell-based transcription assay also described below, a difference in the hTAFII 105 transcriptional induction in the presence and absence of an agent indicates the agent modulates hTAFII 105-induced transcription. A difference, as used herein, is statistically significant and preferably represents at least a 50%, more preferably at least a 90% difference.
The following examples are offered by way of illustration and not by way of limitation.
EXPERIMENTAL
1. TFIID subunits in different human cell types
To test the possibility that some TFIID subunits might be cell type specific, we compared the composition of TBP-TAF complexes isolated from several human cell lines representing different tissues. For this purpose, nuclear extracts were first fractionated by phosphocellulose (PC) chromatography to separate TFIID from other TBP-TAF complexes (i.e. SL1 and TFIIIB). The resulting 1.0M NaCl PC fractions were subjected to anti-TBP affinity purification followed by SDS-PAGE analysis and staining with silver. As expected, the subunit composition and levels of the core TAFs relative to TBP were very similar among the different cell types examined. By contrast, the TFIID complex isolated from Daudi B cells contained an additional polypeptide of approximately 105 kDa that consistently coimmunoprecipitated with anti-TBP antibodies. This novel polypeptide is barely detectable in TFIID isolated from non B cells such as the neuroblastoma SK-N, glioblastoma U87, Jurkat and Hut78 T cells and HeLa cervical carcinoma.
Association of this 105 kDa polypeptide with the TBP/TAFs complex appears to be specific as it can be coimmunoprecipitated with TFIID using a different TBP antibody but not by mock immunoprecipitation in the absence of TBP antibodies. We confirmed that the 105 Kd polypeptide is not a breakdown product of either TAF.sub. 250 or TAFII 130 by western blot analysis using either anti-TAFII 250 or anti-TAFII 130 antibodies.
Daudi cells are characterized as Epstein Barr virus positive (EBV+), differentiated, IgG producing B cells. To determine whether the association of p105 with TBP is either EBV or differentiation related, we isolated TFIID from a less differentiated, EBV+ B cell, Jy, and found insignificant amounts of p105 relative to the other TFIID subunits indicating that EBV gone expression is not responsible for the high levels of p105 found in TFIID isolated from Daudi cells. Therefore, we conclude that this 105 kDa protein is a TAF that becomes specifically associated with TFIID in highly differentiated B cells.
2. hTAFII 105 is a substoichiometric subunit of TFIID
In order to obtain independent evidence that the TAFII 105 protein is selectively associated with TFIID rather than SL1 and TFIIIB, we have used a monoclonal antibody directed against human TAFII 130 to isolate TFIID complexes from either Daudi B or Jurkat T cells. For these experiments, we used unfractionated nuclear extracts rather than the 1.0M NaCl PC fraction enriched for TFIID to exclude the possibility that TAFII 105-containing complexes isolated from different cell types might merely reflect differential chromatographic properties. Both TBP and TAFII 130 antibodies coimmunoprecipitated TAFII 105 together with the other "core" TFIID subunits from Daudi nuclear extract. By contrast, only TBP and the core TAFs were isolated by TAFII 130 antibody from Jurkat nuclear extracts. To confirm these results, we also performed immunoprecipitation using the PC 1.0M NaCl fraction from Daudi and Jurkat cell extracts. As expected, anti-TBP selectively precipitated the TAFII 105 subunit from Daudi cells but not from Jurkat cells. These results indicate that TAFII 105 is a novel TAF subunit that is only found associated with TFIID in selected cell types such as highly differenffated B cells.
We hypothesized that a TFIID complex containing a putative cell type specific subunit would most likely participate in transcription of only a limited subset of genes, perhaps cell type specific genes. Consequently, one might expect that only a subset of TFIID complexes within the cell will contain this subunit. Became silver staining of proteins is notoriously non-quantitative, we have attempted to determine the relative stoichiometry of TAFII 105 in the B cell TFIID complex by more reliable staining methods. Antibody affinity purified TFIID complexes isolated from Daudi cells were subjected to SDS-PAGE and stained both by silver and Coomassie blue. Unlike the intense band of TAFII 105 observed by silver staining, the Coomassie stained TAFII 105 revealed that it is present in approximately 10 fold lower levels relative to the core TAFs and TBP. The apparent substoichiometric amounts of TAFII 105 was further confirmed by two additional protein staining techniques, ponceau S and Zinc staining. These results indicate that only a small fraction (˜5-10%) of the TFIID complexes within B cells contain TAFII 105.
3. hTAFII 105 is a homolog of Drosophila TAFII 110 and human TAFII 130
In order to further characterize this candidate cell type specific TAF, we set out to isolate the corresponding cDNA. For this purpose, we purified TFIID from nuclear extracts prepared from 2000 liters of Daudi cells. TFIID was first fractionated over a phosphocellulose column followed by anti-TBP affinity chromatography. The TFIID polypeptides were resolved on a preparative SDS-PAGE gel, transferred onto nitrocellulose membrane and the band corresponding to hTAFII 105 was excised and digested with either trypsin or S. aureus V8 protease. The resulting peptides were separated by reversed phase HPLC and subjected to microsequence analysis. The amino acid sequence of several peptides revealed striking similarities to the conserved C-terminal region of dTAFII 110 and its human homolog TAFII 130. We, therefore, screened a Daudi cDNA library with a DNA fragment encompassing a highly conserved region of hTAFII 130 under low stringency hybridization conditions. Two cDNA clones of approximately 2 kb corresponding to TAFII 105 were obtained. These cDNAs contained a 3' poly(A) tail and a portion of the coding region of TAFII 105. To isolate the remaining portions of TAFII 105 we screened several additional human cDNA libraries with TAFII 105 specific probes. Two additional clones were isolated, one of 1.6 Kb and the other of 3.6 Kb that overlapped the 3' region. DNA sequence analysis of the 3.6 Kb insert revealed an open reading frame of 2406 bp that included all the peptide sequences obtained from the proteolytic digestions. When this long cDNA was expressed in Sf9 cells with a flag-tag, the size of the recombinant protein was very similar to the endogenous TAFII 105. However, since this clone does not contain a methionine residue that is preceded by a stop codon at its most 5' region, it appears to encode a deletion mutant of the native TAFII 105 (we estimate a 5-10 residue N-terminal truncation).
Amino acid sequence deduced from the cDNA revealed several regions with a high degree of similarity to hTAFII 130 and dTAFII 110. In particular, the C-terminal 1/3 of these proteins that includes domains involved in binding to other TAFs, is highly conserved (68% identity and 87% homology). However, the majority of the sequences in the N-terminal region were quite diverged indicating that hTAFII 105 has evolved the ability to interact with a different subset of activators than those targeted by hTAFII 130 and dTAFII 110. In particular, functional studies as described below demonstrate that the less conserved N-terminal domain of TAFII 105 contains interaction surfaces that bind to activators in differentiating B cells.
4. TAFII 105 and dTAFII 110 share conserved interfaces for interacting with other TFIID subunits
Extensive analysis of the cloned TFIID subunits indicated that formation of a stable TFIID complex involves multiple TAF-TBP and TAF-TAF interactions. To identify the subunits in TFIID that contact TAFII 105, we performed a series of protein:protein interaction assays using immobilized flag-tagged TAFII 105 and 35S-labeled in vitro translated TFIID subunits. These experiments indicate that TAFII 105 specifically interacts with hTAFII 250, dTAFII 150, the large subunit of TFIIA, and weakly with TBP. In contrast, TAFII 105 did not appear to interact specifically with dTAFII 80, hTAFII 70, TAFII 60, dTAFII 40, hTAFII 32, dTAFII 30α and dTAFII 30β. Interestingly, a similar pattern of selective protein interactions have been observed for dTAFII 110 indicating that these closely related TAFs have conserved interaction surfaces (i.e. C-terminus) for incorporating into the TFIID complex. An exception to this pattern of TAF:TAF interaction is the ability of dTAFII 110 to bind TAFII 30α. In addition, dTAFII 110 and TAFII 105 can interact with each other to form dimers and heterodimers.
5. Cell type specific association of TAFII 105 with TFIID is post transcriptionally regulated.
To address potential mechanisms of TAFII 105 regulation, the levels of its mRNA in different cell types were determined by northern blot analysis with a TAFII 105 specific probe. As a control, identical samples were hybridized with the ubiquitous hTAFII 130 probe. Our analysis of TAFII 105 RNA revealed a single transcript of about 4.6 Kb that is expressed at relatively invariant levels in all the cell types examined. To further confirm this finding, we performed RNase protection assays. Similar amounts of RNA extracted from different cell types were hybridize with hTAFII 105 or hTAFII 250 specific probes followed by digestion with RNase A and RNase T1. Here again, the levels of protected TAFII 105 transcripts from different cell types appeared comparable. Taken together these data indicate that TAFII 105 may be post-transcriptionally regulated in a cell type specific manner.
To quantitate the amounts of TAFII 105 protein in different cells, we expressed the less conserved N-terminal portion of the protein in E. coli and raised polyclonal antibodies against this region of TAFII 105. These anti-TAFII 105 antibodies specifically recognize a 105 Kd polypeptide present in Daudi nuclear extract as well as recombinant TAFII 105 produced in Sf9 cells. As expected, anti-TAFII 105 antibodies can also immunoprecipitate TAFII 105 together with all the core TFIID subunits including its homolog TAFII 130 from Daudi extracts indicating that both, TAFII 105 and TAFII 130, might be present in the same complex. To measure the relative levels of TAFII 105 protein expressed in different cell types, similar amounts of nuclear extracts from different cell types were subjected to Western blot analysis using TAFII 105 and TBP antibodies. The levels of TAFII 105 protein are significantly higher in Daudi B cells than in non B cells suggesting that the cell type specific regulation of TAFII 105 may be, in part, at the level of protein expression. Next, the anti-TAFII 105 antibodies were used to compare the levels of TAFII 105 associated with affinity purified TFIID isolated from either Daudi or HeLa cells. These antibodies specifically detected TAFII 105 in Daudi TFIID but not in HeLa TFIID. We verified that the levels of TBP and the core TAFs in the TFIID complex were similar by silver staining and by Western blotting with TBP antibodies. These results taken together indicate that both, the production of TAFII 105 protein and its association with TFIID are cell type specifically regulated.
6. Experimental Procedures
a) Antibodies and immunoprecipitations
Nuclear extracts from different cell types were prepared and fractionated by phosphocellulose P11 column (PC) as described (Tanese et al., 1991 Genes & Dev. 5, 2212-2224). Polyclonal anti-TBP antibodies raised against recombinant hTBP were described (Tanese et al., supra). The antibodies were affinity purified using TBP-coupled affinity resins Monoclonal anti-TAFII 130 antibody IA5 was described (Ruppert et al., 1993, Nature 362, 175-179). TAFII 105 polyclonal antibodies were raised against recombinant protein corresponding to amino acid 1-552 produced in bacteria with 6 histidine-tag. The inclusion bodies containing overexpressed TAFII 105 were dissolved in 6M urea, purified by Ni+ agarose resin, resolved on SDS-PAGE and TAFII 105 protein was excised and injected into rabbits. Immunoprecipitations of TFIID complex by affinity purified TBP antibodies, anti-TAFII 130 (IA5) and anti-TAFII 105 were carried with TFIID enriched PC fractions or directly from nuclear extracts essentially as described (Tanese et al., supra). Briefly, 400 μg of 1.0M NaCl PC fraction or 5 mg of nuclear extracts in HEMG buffer (20 mM Hepes 7.9, 100 mM KCl, 12.5 mM MgCl2, 0.2 mM EDTA, 0.1% NP-40, 1 mM DTT, 0.2 mm PMSF) were incubated with antibodies and protein A sepharose beads at 4° C. for 2-3 hours. The immune complexes were washed with HEMG buffer 5 times and eluted either by 1M guanidine-HCl followed by TCA precipitation or by 5 minutes boiling in SDS-PAGE protein sample buffer.
b) Cloning of TAFII 105 cDNA
Daudi cells nuclear extracts were prepared from 2000 liters of culture and TFIID enriched fraction was obtained by PC column (Tanese et al., 1991, supra). TFIID was immunopurified directly from PC 1.0M NaCl fraction using crosslinked anti-TBP resin and the TAFs were eluted by 50 mM glycine pH 2.5, 150 mM NaCl and precipitated with trichloroacetic acid (TCA) containing deoxycholate (4 mg/ml). The TAFs were resolved by SDS-PAGE, transferred to nitrocellulose membrane and stained with ponceau S (Sigma). The band corresponding to TAFII 105 was excised, digested with either trypsin or V8 proteases and peptides eluted from the membrane were resolved by reversed-phase HPLC and subjected to microsequencing. Daudi cDNA library (1.5×106 phages) was screened with 237 bp probe derived from hTAFII 130 generated by PCR. 2 TAFII 105 positive phages were isolated, their 1.9 and 2 kb inserts were cloned into Bluescript KS+ (Stratagene), sequenced and found to contain a 1 kb of 3' untranslated region and 1 kb coding region containing the sequence of 7 peptides obtained by the proteolytic digestion. To clone the N-terminus of TAFII 105, the following human cDNA libraries were screened: human tertocarcinoma, Jurkat, HeLa and another Daudi cDNA library. 2 positive clones were obtained from the HeLa cell library, one of 1.6 Kb overlapping with the clones isolated from the Daudi library and a second clone of 3.6 Kb insert. This insert was cloned in Bluescript KS+ and both strands of this cDNA were completely sequenced with Bluescript or TAFII 105 specific primers.
c) RNA analysis
Total cytoplasmic RNA samples were prepared from cultured cells according to the procedure that has been described (Gough, 1988, Analytical Biochemistry 1 73, 93-95). For Northern blot analysis, 30 μg of RNA prepared from different cell types were electrophoresed on a 1% formaldehyde/agarose gel in duplicates. RNA was transferred to nitrocellulose membrane and hybridized with riboprobes complementary to either hTAFII 105 or hTAFII 130. For RNase protection assay, 30 μg of total RNA extracted from different cell types were hybridized with anti-sense RNA probes corresponding to hTAFII 105 or hTAFII 250 for 16 hours at 55° C. in 40 mm PIPES pH 6.7, 350 mM NaCl, 1 mM EDTA and 80% formamide. RNase A (40 μg/ml) and RNase T1 (2 μg/ml) were added and digestion was carried out at 30° C. for 30 minutes. The reactions were terminated bit the addition of 50 μg of proteinase K, 10 μl of SDS and incubation at 37° C. for 30 minutes. After phenolchloroform extraction and ethanol precipitation the samples were resolved on 6% denaturing polyacrylamide gel and autoradiographed.
d) Expression of TAFII 105 protein
A 3.6 kb NotI fragment containing the entire sequences of the long cDNA was subcloned into the NotI site of the vector pVL1392. Next, a 3.1 kb NdeI fragment containing the coding region was subcloned into the baculovirus expression vector pVLSG2Flag in NdeI site. Crude extracts from cells expressing flag-TAFII 105 were bound to flag antibody beads (Kodak) in 0.5M KCl HEMG buffer for 2-3 hours. After 5 washes with the same buffer a small portion was analysed by SDS-PAGE. Before the interaction assays the beads were washed twice with 0.1M KCl HEMG.
e) In vitro binding experiments
35 S-labeled TAFs were synthesized in vitro by T7 RNA polymerase and rabbit reticulocytes lysate and incubated with flag beads or with TAFII 105 coupled to flag beads in 0.1M KCl HEMG buffer for 2 hours at 4° C. The beads were washed 5 times with the same buffer and the bound proteins were eluted by 5 minutes boiling in protein sample buffer followed by SDS-PAGE and autoradiography.
EXAMPLES
1. Protocol for hTAFII 105-hTAFII 250 binding assay.
A solid phase bead-based TAF interaction assay uses immobilized flag-tagged hTAFII 105 and 35 S-labeled in vitro translated hTAFII 250 subunit. The hTAFII 250 subunit was translated in vitro by rabbit reticulocyte lysate in the presence of 355-methionine. Labeled hTAFII 250 was used in interaction assays with immobilized flag-tagged hTAFII 105. As a control the labeled TAF was incubated with flag beads in the absence of hTAFII 105 protein. The beads were eluted, resolved on SDS-PAGE and autoradiographed. The input represented 10% of the labeled protein used for the interaction assay.
2. Protocol for high throughput hTAFII 105-TFIIA large subunit complex formation assay.
A. Reagents:
Neutralitc Avidin: 20 μg/ml in PBS.
Blocking buffer: 5% BSA, 0.5% Tween 20 in PBS; 1 hour at room temperature.
Assay Buffer: 100 mM KCl, 20 mM HEPES pH 7.6, 1 mM MgCl2, 1% glycerol, 0.5% NP-40, 50 mM β-mercaptoethanol, 1 mg/ml BSA, cocktail of protease inhibitors.
33 P hTAFII 105 protein 10x stock: 10-8 -10-6 M "cold" hTAFII 105 subunit supplemented with 200,000-250,000 cpm of labeled hTAFII 105 (Beckman counter). Place in the 4° C. microfridge during screening.
Protease inhibitor cocktail (1000X): 10 mg Trypsin Inhibitor (BMB #109894), 10 mg Aprotinin (BMB #236624), 25 mg Benzamidine (Sigma #B-6506), 25 mg Leupeptin (BMB #1017128), 10 mg APMSF (BMB #917575), and 2 mM NaVo3 (Sigma #S-6508) in 10 ml of PBS.
hTFIIA large subunit: 10-7 -10-5 M biotinylated hTFIIA large subunit in PBS.
B. Preparation of assay plates:
Coat with 120 μl of stock N-Avidin per well overnight at 4° C.
Wash 2 times with 200 μl PBS.
Block with 150 μl of blocking buffer.
Wash 2 times with 200 μl PBS.
C. Assay:
Add 40 μl assay buffer/well.
Add 10 μl compound or extract.
Add 10 μl 33 P-hTAFII 105 protein (20,000-25,000 cpm/0.1-10 pmoles/well=10-9 -10-7 M final concentration).
Shake at 25° C. for 15 minutes.
Incubate additional 45 minutes at 25° C.
Add 40 μl biotinylated hTFII subunit (0.1-10 pmoles/40 ul in assay buffer)
Incubate 1 hour at room temperature.
Stop the reaction by washing 4 times with 200 μl PBS.
Add 150 μl scintillation cocktail.
Count in Topcount.
D. Controls for all assays (located on each plate):
a. Non-specific binding
b. Soluble (non-biotinylated hTAFII 105) at 80% inhibition.
All publications and patent applications cited in this specification are herein incorporated by reference as if each individual publication or patent application were specifically and individually indicated to be incorporated by reference. Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be readily apparent to those of ordinary skill in the art in light of the teachings of this invention that certain changes and modifications may be made thereto without departing from the spirit or scope of the appended claims.
__________________________________________________________________________
SEQUENCE LISTING                                                          
(1) GENERAL INFORMATION:                                                  
(iii) NUMBER OF SEQUENCES: 2                                              
(2) INFORMATION FOR SEQ ID NO:1:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 2556 base pairs                                               
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: double                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: cDNA                                                  
(ix) FEATURE:                                                             
(A) NAME/KEY: CDS                                                         
(B) LOCATION: 1..2403                                                     
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:                                   
GGGACCCTGGTGACCAAAGTGGCTCCGGTCAGCGCCCCTCCTAAAGTC48                        
GlyThrLeuValThrLysValAlaProValSerAlaProProLysVal                          
151015                                                                    
AGCAGCGGCCCTAGGCTGCCTGCTCCTCAGATAGTCGCCGTGAAAGCC96                        
SerSerGlyProArgLeuProAlaProGlnIleValAlaValLysAla                          
202530                                                                    
CCCAACACCACGACAATCCAGTTTCCTGCTAATTTGCAGCTTCCTCCA144                       
ProAsnThrThrThrIleGlnPheProAlaAsnLeuGlnLeuProPro                          
354045                                                                    
GGAACCGTTTTGATTAAAAGTAACAGTGGTCCGTTGATGTTGGTATCT192                       
GlyThrValLeuIleLysSerAsnSerGlyProLeuMetLeuValSer                          
505560                                                                    
CCTCAGCAAACTGTAACAAGAGCCGAGACCACAAGTAACATAACCTCA240                       
ProGlnGlnThrValThrArgAlaGluThrThrSerAsnIleThrSer                          
65707580                                                                  
AGGCCAGCAGTACCAGCGAATCCTCAAACAGTCAAAATCTGTACAGTG288                       
ArgProAlaValProAlaAsnProGlnThrValLysIleCysThrVal                          
859095                                                                    
CCGAACTCTAGCTCACAATTAATCAAGAAAGTGGCAGTGACACCTGTT336                       
ProAsnSerSerSerGlnLeuIleLysLysValAlaValThrProVal                          
100105110                                                                 
AAAAAATTGGCACAAATAGGAACTACTGTGGTAACCACTGTTCCGAAG384                       
LysLysLeuAlaGlnIleGlyThrThrValValThrThrValProLys                          
115120125                                                                 
CCTTCCTCAGTACAATCTGTGGCTGTGCCAACCAGTGTCGTCACAGTT432                       
ProSerSerValGlnSerValAlaValProThrSerValValThrVal                          
130135140                                                                 
ACTCCTGGAAAGCCATTGAATACTGTAACTACCCTGAAGCCTTCAAGT480                       
ThrProGlyLysProLeuAsnThrValThrThrLeuLysProSerSer                          
145150155160                                                              
TTGGGAGCATCATCCACTCCTTCAAATGAGCCCAATCTTAAAGCAGAG528                       
LeuGlyAlaSerSerThrProSerAsnGluProAsnLeuLysAlaGlu                          
165170175                                                                 
AACTCAGCAGCTGTTCAGATTAATCTTTCTCCGACAATGCTAGAAAAT576                       
AsnSerAlaAlaValGlnIleAsnLeuSerProThrMetLeuGluAsn                          
180185190                                                                 
GTGAAGAAATGCAAGAACTTCCTTGCAATGTTAATAAAACTAGCATGT624                       
ValLysLysCysLysAsnPheLeuAlaMetLeuIleLysLeuAlaCys                          
195200205                                                                 
AGTGGATCACAGTCCCCTGAAATGGGGCAAAATGTGAAGAAGCTGGTG672                       
SerGlySerGlnSerProGluMetGlyGlnAsnValLysLysLeuVal                          
210215220                                                                 
GAACAACTTTTGGATGCAAAAATCGAAGCAGAAGAATTTACTAGGAAA720                       
GluGlnLeuLeuAspAlaLysIleGluAlaGluGluPheThrArgLys                          
225230235240                                                              
CTGTATGTTGAACTCAAGTCTTCACCTCAGCCTCACCTGGTTCCTTTT768                       
LeuTyrValGluLeuLysSerSerProGlnProHisLeuValProPhe                          
245250255                                                                 
CTTAAGAAAAGCGTGGTTGCCTTACGACAACTTCTGCCTAACTCCCAG816                       
LeuLysLysSerValValAlaLeuArgGlnLeuLeuProAsnSerGln                          
260265270                                                                 
AGCTTCATCCAGCAATGTGTTCAGCAGACTTCTAGTGACATGGTCATT864                       
SerPheIleGlnGlnCysValGlnGlnThrSerSerAspMetValIle                          
275280285                                                                 
GCTACCTGTACTACAACAGTAACAACTTCTCCTGTGGTGACAACTACA912                       
AlaThrCysThrThrThrValThrThrSerProValValThrThrThr                          
290295300                                                                 
GTGTCCTCAAGCCAGTCTGAAAAGTCAATTATTGTTTCTGGAGCAACA960                       
ValSerSerSerGlnSerGluLysSerIleIleValSerGlyAlaThr                          
305310315320                                                              
GCACCCAGAACTGTGTCAGTGCAAACTTTGAACCCACTTGCTGGTCCA1008                      
AlaProArgThrValSerValGlnThrLeuAsnProLeuAlaGlyPro                          
325330335                                                                 
GTGGGAGCAAAAGCTGGAGTTGTGACACTTCATTCTGTGGGCCCAACT1056                      
ValGlyAlaLysAlaGlyValValThrLeuHisSerValGlyProThr                          
340345350                                                                 
GCTGCAACAGGAGGAACAACAGCTGGAACTGGTTTGCTTCAGACTTCA1104                      
AlaAlaThrGlyGlyThrThrAlaGlyThrGlyLeuLeuGlnThrSer                          
355360365                                                                 
AAACCACTTGTGACATCTGTGGCAAACACAGTGACCACGGTCTCACTG1152                      
LysProLeuValThrSerValAlaAsnThrValThrThrValSerLeu                          
370375380                                                                 
CAACCTGAAAAGCCAGTTGTCTCTGGAACAGCAGTAACACTGTCCCTT1200                      
GlnProGluLysProValValSerGlyThrAlaValThrLeuSerLeu                          
385390395400                                                              
CCAGCAGTAACTTTTGGAGAAACTTCAGGTGCAGCTATTTGTCTTCCA1248                      
ProAlaValThrPheGlyGluThrSerGlyAlaAlaIleCysLeuPro                          
405410415                                                                 
TCTGTGAAACCTGTTGTTTCCTTCTGCTGGGACCACATCTGCAAGCCT1296                      
SerValLysProValValSerPheCysTrpAspHisIleCysLysPro                          
420425430                                                                 
GTTATTGGGACTCCAGTTCAAATCAAACTTGCCCAGCCGGGCCCTGTC1344                      
ValIleGlyThrProValGlnIleLysLeuAlaGlnProGlyProVal                          
435440445                                                                 
CTTTCACAACCAGCTGGGATTCCAACAGGCAGTTCAAGCAAGCAACTA1392                      
LeuSerGlnProAlaGlyIleProThrGlySerSerSerLysGlnLeu                          
450455460                                                                 
TTCTCATTGTTTCACGTAGTTCAGCAGCCTTCAGGAGGCAATGAAAAA1440                      
PheSerLeuPheHisValValGlnGlnProSerGlyGlyAsnGluLys                          
465470475480                                                              
CAAGTGACCACAATTTCACATTCCTCAACATTGACCATTCAGAAATGT1488                      
GlnValThrThrIleSerHisSerSerThrLeuThrIleGlnLysCys                          
485490495                                                                 
GGACAGAAGACGATGCCAGTGAACACCATAATACCTACTAGTCAGTTT1536                      
GlyGlnLysThrMetProValAsnThrIleIleProThrSerGlnPhe                          
500505510                                                                 
CCTCCAGCTTCCATTCTAAAGCAAATTACTCTGCCTGGAAATAAAATT1584                      
ProProAlaSerIleLeuLysGlnIleThrLeuProGlyAsnLysIle                          
515520525                                                                 
CTGTCACTTCAAGCATCTCCTACTCAGAAAAATAGAATAAAAGAGAAT1632                      
LeuSerLeuGlnAlaSerProThrGlnLysAsnArgIleLysGluAsn                          
530535540                                                                 
GTAACATCATGCTTCCGAGATGAGGATGACATCAATGATGTGACTTCT1680                      
ValThrSerCysPheArgAspGluAspAspIleAsnAspValThrSer                          
545550555560                                                              
ATGGCAGGGGTCAACCTTAATGAAGAAAATGCCTGCATCTTAGCAACA1728                      
MetAlaGlyValAsnLeuAsnGluGluAsnAlaCysIleLeuAlaThr                          
565570575                                                                 
AACTCTGAATTGGTTGGCACACTCATTCAGTCATGTAAAGATGAACCA1776                      
AsnSerGluLeuValGlyThrLeuIleGlnSerCysLysAspGluPro                          
580585590                                                                 
TTTCTTTTTATTGGAGCTCTACAAAAGAGAATCTTAGACATTGGTAAA1824                      
PheLeuPheIleGlyAlaLeuGlnLysArgIleLeuAspIleGlyLys                          
595600605                                                                 
AAGCATGACATTACAGAACTTAACTCTGATGCTGTGAACTTGATCTCC1872                      
LysHisAspIleThrGluLeuAsnSerAspAlaValAsnLeuIleSer                          
610615620                                                                 
CAAGCAACACAGGAACGACTACGAGGCCTTCTAGAAAAACTGACTGCA1920                      
GlnAlaThrGlnGluArgLeuArgGlyLeuLeuGluLysLeuThrAla                          
625630635640                                                              
ATTGCTCAGCATCGAATGACTACTTACAAGGCAAGTGAAAATTACATC1968                      
IleAlaGlnHisArgMetThrThrTyrLysAlaSerGluAsnTyrIle                          
645650655                                                                 
CTGTGTAGTGATACCAGGTCACAGCTCAAATTTCTTGAAAAGCTGGAT2016                      
LeuCysSerAspThrArgSerGlnLeuLysPheLeuGluLysLeuAsp                          
660665670                                                                 
CAATTGGAGAAGCAGAGAAAGGATTTGGAAGAAAGAGAAATGTTACTT2064                      
GlnLeuGluLysGlnArgLysAspLeuGluGluArgGluMetLeuLeu                          
675680685                                                                 
AAGGCAGCCAAGAGTCGTTCTAATAAAGAAGATCCAGAACAGCTGAGA2112                      
LysAlaAlaLysSerArgSerAsnLysGluAspProGluGlnLeuArg                          
690695700                                                                 
TTAAAGCAGAAAGCCAAAGAGTTACAGCAATTGGAACTTGCACAGATA2160                      
LeuLysGlnLysAlaLysGluLeuGlnGlnLeuGluLeuAlaGlnIle                          
705710715720                                                              
CAGCATAGAGACGCTAATCTCACAGCTCTTGCAGCTATTGGACCAAGG2208                      
GlnHisArgAspAlaAsnLeuThrAlaLeuAlaAlaIleGlyProArg                          
725730735                                                                 
AAGAAGAGACCACTAGAATCTGGAATTGAGGGCTTAAAAGACAACCTT2256                      
LysLysArgProLeuGluSerGlyIleGluGlyLeuLysAspAsnLeu                          
740745750                                                                 
CTTGCTTCTGGGACATCCAGCCTGACAGCCACCAAACAGTTGCATCGT2304                      
LeuAlaSerGlyThrSerSerLeuThrAlaThrLysGlnLeuHisArg                          
755760765                                                                 
CCAAGAATCACGAGAATCTGCCTCAGGGACTTGATATTTTGTATGGAA2352                      
ProArgIleThrArgIleCysLeuArgAspLeuIlePheCysMetGlu                          
770775780                                                                 
CAGGAACGGGAGATGAAGTATTCTCGAGCTCTATACCTGGCCCTTCTG2400                      
GlnGluArgGluMetLysTyrSerArgAlaLeuTyrLeuAlaLeuLeu                          
785790795800                                                              
AAGTGACCACTCCACTCTTCCATCCACATCCTTGCTATTTACTGCCAAAGAAG2453                 
Lys                                                                       
ACACAAAGCATTGTTGCACTGTCCTGAAATTTCAATTTCTGGAAAATAACACCAACATGA2513          
AAGAGCATTGTTTACGATTAGAACTTTATTAACTCTTACCTAT2556                           
(2) INFORMATION FOR SEQ ID NO:2:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 801 amino acids                                               
(B) TYPE: amino acid                                                      
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: protein                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:                                   
GlyThrLeuValThrLysValAlaProValSerAlaProProLysVal                          
151015                                                                    
SerSerGlyProArgLeuProAlaProGlnIleValAlaValLysAla                          
202530                                                                    
ProAsnThrThrThrIleGlnPheProAlaAsnLeuGlnLeuProPro                          
354045                                                                    
GlyThrValLeuIleLysSerAsnSerGlyProLeuMetLeuValSer                          
505560                                                                    
ProGlnGlnThrValThrArgAlaGluThrThrSerAsnIleThrSer                          
65707580                                                                  
ArgProAlaValProAlaAsnProGlnThrValLysIleCysThrVal                          
859095                                                                    
ProAsnSerSerSerGlnLeuIleLysLysValAlaValThrProVal                          
100105110                                                                 
LysLysLeuAlaGlnIleGlyThrThrValValThrThrValProLys                          
115120125                                                                 
ProSerSerValGlnSerValAlaValProThrSerValValThrVal                          
130135140                                                                 
ThrProGlyLysProLeuAsnThrValThrThrLeuLysProSerSer                          
145150155160                                                              
LeuGlyAlaSerSerThrProSerAsnGluProAsnLeuLysAlaGlu                          
165170175                                                                 
AsnSerAlaAlaValGlnIleAsnLeuSerProThrMetLeuGluAsn                          
180185190                                                                 
ValLysLysCysLysAsnPheLeuAlaMetLeuIleLysLeuAlaCys                          
195200205                                                                 
SerGlySerGlnSerProGluMetGlyGlnAsnValLysLysLeuVal                          
210215220                                                                 
GluGlnLeuLeuAspAlaLysIleGluAlaGluGluPheThrArgLys                          
225230235240                                                              
LeuTyrValGluLeuLysSerSerProGlnProHisLeuValProPhe                          
245250255                                                                 
LeuLysLysSerValValAlaLeuArgGlnLeuLeuProAsnSerGln                          
260265270                                                                 
SerPheIleGlnGlnCysValGlnGlnThrSerSerAspMetValIle                          
275280285                                                                 
AlaThrCysThrThrThrValThrThrSerProValValThrThrThr                          
290295300                                                                 
ValSerSerSerGlnSerGluLysSerIleIleValSerGlyAlaThr                          
305310315320                                                              
AlaProArgThrValSerValGlnThrLeuAsnProLeuAlaGlyPro                          
325330335                                                                 
ValGlyAlaLysAlaGlyValValThrLeuHisSerValGlyProThr                          
340345350                                                                 
AlaAlaThrGlyGlyThrThrAlaGlyThrGlyLeuLeuGlnThrSer                          
355360365                                                                 
LysProLeuValThrSerValAlaAsnThrValThrThrValSerLeu                          
370375380                                                                 
GlnProGluLysProValValSerGlyThrAlaValThrLeuSerLeu                          
385390395400                                                              
ProAlaValThrPheGlyGluThrSerGlyAlaAlaIleCysLeuPro                          
405410415                                                                 
SerValLysProValValSerPheCysTrpAspHisIleCysLysPro                          
420425430                                                                 
ValIleGlyThrProValGlnIleLysLeuAlaGlnProGlyProVal                          
435440445                                                                 
LeuSerGlnProAlaGlyIleProThrGlySerSerSerLysGlnLeu                          
450455460                                                                 
PheSerLeuPheHisValValGlnGlnProSerGlyGlyAsnGluLys                          
465470475480                                                              
GlnValThrThrIleSerHisSerSerThrLeuThrIleGlnLysCys                          
485490495                                                                 
GlyGlnLysThrMetProValAsnThrIleIleProThrSerGlnPhe                          
500505510                                                                 
ProProAlaSerIleLeuLysGlnIleThrLeuProGlyAsnLysIle                          
515520525                                                                 
LeuSerLeuGlnAlaSerProThrGlnLysAsnArgIleLysGluAsn                          
530535540                                                                 
ValThrSerCysPheArgAspGluAspAspIleAsnAspValThrSer                          
545550555560                                                              
MetAlaGlyValAsnLeuAsnGluGluAsnAlaCysIleLeuAlaThr                          
565570575                                                                 
AsnSerGluLeuValGlyThrLeuIleGlnSerCysLysAspGluPro                          
580585590                                                                 
PheLeuPheIleGlyAlaLeuGlnLysArgIleLeuAspIleGlyLys                          
595600605                                                                 
LysHisAspIleThrGluLeuAsnSerAspAlaValAsnLeuIleSer                          
610615620                                                                 
GlnAlaThrGlnGluArgLeuArgGlyLeuLeuGluLysLeuThrAla                          
625630635640                                                              
IleAlaGlnHisArgMetThrThrTyrLysAlaSerGluAsnTyrIle                          
645650655                                                                 
LeuCysSerAspThrArgSerGlnLeuLysPheLeuGluLysLeuAsp                          
660665670                                                                 
GlnLeuGluLysGlnArgLysAspLeuGluGluArgGluMetLeuLeu                          
675680685                                                                 
LysAlaAlaLysSerArgSerAsnLysGluAspProGluGlnLeuArg                          
690695700                                                                 
LeuLysGlnLysAlaLysGluLeuGlnGlnLeuGluLeuAlaGlnIle                          
705710715720                                                              
GlnHisArgAspAlaAsnLeuThrAlaLeuAlaAlaIleGlyProArg                          
725730735                                                                 
LysLysArgProLeuGluSerGlyIleGluGlyLeuLysAspAsnLeu                          
740745750                                                                 
LeuAlaSerGlyThrSerSerLeuThrAlaThrLysGlnLeuHisArg                          
755760765                                                                 
ProArgIleThrArgIleCysLeuArgAspLeuIlePheCysMetGlu                          
770775780                                                                 
GlnGluArgGluMetLysTyrSerArgAlaLeuTyrLeuAlaLeuLeu                          
785790795800                                                              
Lys                                                                       
__________________________________________________________________________

Claims (13)

What is claimed is:
1. A recombinant nucleic acid encoding a human tata-binding protein associated factor (hTAFII 105 protein (SEQ ID NO:2), or an hTAFII 105 protein deletion mutant thereof having at least 20 consecutive amino acids of SEQ ID NO:2 and said deletion mutant specifically binds at least one of hTAFII 250, hTAFII 150, TFIIA or a hTAFII 105-specific antibody.
2. A recombinant nucleic acid according to claim 1, wherein said deletion mutant comprises at least 40 consecutive amino acids of SEQ ID NO:2.
3. A recombinant nucleic acid according to claim 1, wherein said deletion mutant comprises at least SEQ ID NO:2, residues 547-801.
4. A recombinant nucleic acid according to claim 1, wherein said deletion mutant comprises at least SEQ ID NO:2, residues 1-546.
5. An isolated hTAFII 105 nucleic acid comprising SEQ ID NO:1, or a fragment thereof having at least 24 consecutive bases of SEQ ID NO:1 and sufficient to specifically hybridize with a nucleic acid having the sequence defined by SEQ ID NO:1 in the presence of human genomic DNA.
6. An isolated hTAFII 105 nucleic acid comprising SEQ ID NO:1, or a fragment thereof having at least 24 consecutive bases of SEQ ID NO:1 and sufficient to specifically hybridize with a nucleic acid having the sequence defined by SEQ ID NO:1 in the presence of human B cell cDNA.
7. An isolated hTAFII 105 nucleic acid according to claim 6, comprising SEQ ID NO:1.
8. A cell comprising a nucleic acid according to claim 1.
9. A cell comprising a nucleic acid according to claim 3.
10. A cell comprising a nucleic acid according to claim 4.
11. A method of making an isolated hTAFII 105 protein, comprising steps: introducing a nucleic acid according to claim 1 into a host cell or cellular extract, incubating said host cell or extract under conditions whereby said nucleic acid is expressed as a transcript and said transcript is expressed as a translation product comprising said protein, and isolating said translation product.
12. A method according to claim 11, wherein said introducing step comprises introducing nucleic acid according to claim 3.
13. A method according to claim 11, wherein said introducing step comprises introducing a nucleic acid according to claim 4.
US08/725,012 1996-10-02 1996-10-02 Cell-type specific transcription factor Expired - Fee Related US5710025A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US08/725,012 US5710025A (en) 1996-10-02 1996-10-02 Cell-type specific transcription factor

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
US08/725,012 US5710025A (en) 1996-10-02 1996-10-02 Cell-type specific transcription factor

Publications (1)

Publication Number Publication Date
US5710025A true US5710025A (en) 1998-01-20

Family

ID=24912779

Family Applications (1)

Application Number Title Priority Date Filing Date
US08/725,012 Expired - Fee Related US5710025A (en) 1996-10-02 1996-10-02 Cell-type specific transcription factor

Country Status (1)

Country Link
US (1) US5710025A (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000012699A1 (en) * 1998-08-27 2000-03-09 Yeda Research And Development Co. Ltd. A transcription factor tfiid subunit, tafii105, polypeptides, dna encoding therefor and pharmaceutical compositions
EP2765227A2 (en) 2010-04-06 2014-08-13 The George Washington University Compositions and methods for identifying autism spectrum disorders

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000012699A1 (en) * 1998-08-27 2000-03-09 Yeda Research And Development Co. Ltd. A transcription factor tfiid subunit, tafii105, polypeptides, dna encoding therefor and pharmaceutical compositions
EP2765227A2 (en) 2010-04-06 2014-08-13 The George Washington University Compositions and methods for identifying autism spectrum disorders

Similar Documents

Publication Publication Date Title
Haskins et al. ZO-3, a novel member of the MAGUK protein family found at the tight junction, interacts with ZO-1 and occludin
Warbrick et al. Homologous regions of Fen1 and p21Cip1 compete for binding to the same site on PCNA: a potential mechanism to co-ordinate DNA replication and repair
US5708158A (en) Nuclear factors and binding assays
US5837514A (en) IκB kinases
US5637686A (en) Tata-binding protein associated factor, nucleic acids
US5821082A (en) Anti-proliferation domain of a human Bcl-2 and DNA encoding the same
JP4387735B2 (en) Netrin receptor
US5710266A (en) Nucleic acid encoding an interleukin 4 signal transducer
US5610276A (en) Polypeptides and antibodies derived from GAP associated protein, p62
US5618693A (en) Interleukin-2 signal transducers and binding assays
US5874230A (en) Assays using TRAF2-associated protein kinase polypeptides
WO1998056806A1 (en) A TRANSCRIPTION FACTOR COACTIVATOR PROTEIN, p/CIP
US5710013A (en) Tumor necrosis factor receptor associated factor 6 (TRAF6)
US5756700A (en) Nucleic acid encoding human signal transducer and activator of transcription 4
US5654397A (en) Interleukin-1 receptor-associated protein kinase and assays
WO2000009678A1 (en) Irak3 polypeptides, polynucleotides and methods
US6242587B1 (en) DNA molecules encoding a calcium-integrin binding protein
US5891719A (en) IKAP nucleic acids
US6110690A (en) SODD-specific antibodies and methods
EP1403282A1 (en) Protein complexes of the Tumor necrosis factor-alpha (TNF-alpha) signalling pathway
WO2004035783A2 (en) Protein complexes of the tumor-necrosis-factor-alpha (tnf-alpha) signalling pathway
US7211402B2 (en) Transcription factor coactivator protein, p/CIP
US6300473B1 (en) SLM-1: a novel Sam68-like mammalian protein
JP2002525030A (en) Novel apoptotic protein
WO2003020903A2 (en) Dna binding protein

Legal Events

Date Code Title Description
AS Assignment

Owner name: REGENTS OF THE UNIVERSITY OF CALIFORNIA, CALIFORNI

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:DIKSTEIN, RIVKA;TJIAN, ROBERT;REEL/FRAME:008319/0049;SIGNING DATES FROM 19961223 TO 19961230

FPAY Fee payment

Year of fee payment: 4

REMI Maintenance fee reminder mailed
FPAY Fee payment

Year of fee payment: 8

SULP Surcharge for late payment

Year of fee payment: 7

REMI Maintenance fee reminder mailed
LAPS Lapse for failure to pay maintenance fees
STCH Information on status: patent discontinuation

Free format text: PATENT EXPIRED DUE TO NONPAYMENT OF MAINTENANCE FEES UNDER 37 CFR 1.362

FP Lapsed due to failure to pay maintenance fee

Effective date: 20100120

AS Assignment

Owner name: NIH, MARYLAND

Free format text: CONFIRMATORY LICENSE;ASSIGNORS:R ICHARD HARRIS;UNIVERSITY OF CALIFORNIA;REEL/FRAME:036488/0645

Effective date: 20150903

AS Assignment

Owner name: NIH, MARYLAND

Free format text: CONFIRMATORY LICENSE;ASSIGNOR:UNIVERSITY OF CALIFORNIA;REEL/FRAME:036508/0456

Effective date: 20150908