US5516512A - N- and C-terminal truncation and deletion mutants of human interleukin-3 - Google Patents

N- and C-terminal truncation and deletion mutants of human interleukin-3 Download PDF

Info

Publication number
US5516512A
US5516512A US08/150,331 US15033193A US5516512A US 5516512 A US5516512 A US 5516512A US 15033193 A US15033193 A US 15033193A US 5516512 A US5516512 A US 5516512A
Authority
US
United States
Prior art keywords
seq
sup
amino acids
mutants
human
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Lifetime
Application number
US08/150,331
Inventor
Lambertus C. J. Dorssers
Robert W. van Leen
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
DSM IP Assets BV
Original Assignee
Gist Brocades NV
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=27513697&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=US5516512(A) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Priority claimed from EP90202117A external-priority patent/EP0413383B1/en
Application filed by Gist Brocades NV filed Critical Gist Brocades NV
Priority to US08/150,331 priority Critical patent/US5516512A/en
Priority to US08/569,284 priority patent/US6500417B1/en
Application granted granted Critical
Publication of US5516512A publication Critical patent/US5516512A/en
Assigned to DSM IP ASSETS B.V. reassignment DSM IP ASSETS B.V. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: DSM N.V.
Assigned to DSM N.V. reassignment DSM N.V. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: GIST-BROCADES N.V.
Anticipated expiration legal-status Critical
Expired - Lifetime legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52Cytokines; Lymphokines; Interferons
    • C07K14/54Interleukins [IL]
    • C07K14/5403IL-3
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/24Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against cytokines, lymphokines or interferons
    • C07K16/244Interleukins [IL]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/30Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/34Identification of a linear epitope shorter than 20 amino acid residues or of a conformational epitope defined by amino acid residues
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10TECHNICAL SUBJECTS COVERED BY FORMER USPC
    • Y10STECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10S930/00Peptide or protein sequence
    • Y10S930/01Peptide or protein sequence
    • Y10S930/14Lymphokine; related peptides
    • Y10S930/141Interleukin
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10TECHNICAL SUBJECTS COVERED BY FORMER USPC
    • Y10STECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10S930/00Peptide or protein sequence
    • Y10S930/01Peptide or protein sequence
    • Y10S930/14Lymphokine; related peptides
    • Y10S930/145Colony stimulating factor

Definitions

  • the present invention relates to mutants of colony stimulating factors, obtained by recombinant DNA techniques. More specifically, the invention relates to mutants of interleukin-3, containing one or more deletions and/or one or more substitutions, with interesting pharmacological properties.
  • CSFs colony-stimulating factors
  • these proteins include G-CSF and M-CSF. These proteins stimulate the in vitro formation of predominantly neutrophilic granulocyte and macrophage colonies, respectively.
  • Interleukin-2 (“IL-2”) stimulates the proliferation of both activated T-cells and activated B-cells, but is not considered a colony stimulating factor.
  • GM-CSF and interleukin-3 stimulate the formation of macrophage and both neutrophilic and eosinophilic granulocyte colonies.
  • IL-3 stimulates the formation of mast, megakaryocyte and pure and mixed erythroid colonies (D. Metcalf "The hematopoietic colony-stimulating factors", 1984, Elsevier, Amsterdam, and D. Metcalf, Science 299 (1985) 16-22).
  • Growth factor-induced cell proliferation is a complicated process. Following highly specific binding of the growth factor to its receptor at the cell surface, the complex is internalized by endocytosis and induces an intracellular response often preceded by phosphorylation of the receptor (Sibley et al., Cell 48 (1987) 913-922). These intracellular signals result in specific gene transcription and finally in DNA synthesis and cell replication.
  • hIL-3 Human IL-3
  • Mature hIL-3 consists of 133 amino acids; the protein contains one disulfide bridge and has two potential glycosylation sites (Yang et al., Cell 47 (1986) 3-10). It has inter alia the following activities:
  • Useful agonists and antagonists of a protein can be created once the structure-function relationship of the molecule is understood. Generally, this relationship is studied by modifying, replacing or deleting amino acids. In this way, information can be obtained about the importance of each of the amino acids for the activity of the protein.
  • Important domains of proteins may be the active site, metal and cofactor binding sites, receptor binding sites, the amino acids involved in subunit interactions, and the antigenic determinants.
  • the aim of the present invention is to provide IL-3 mutants with similar or improved pharmaceutical properties with respect to the native IL-3, preferably using the procedures mentioned above.
  • cDNA clones coding for murine IL-3 were isolated (Fung et al., Nature 307 (1984) 233-237 and Yokota et al., Proc. Natl. Acad. Sci. USA 81 (1984) 1070-1074). This cDNA would not hybridize with human DNA or cDNA clones. Thus, it was speculated that a human counterpart for murine IL-3 (mIL-3) did not exist. This belief was reinforced by the wide spectrum of activities of the human GM-CSF. Finally, in 1986, a gibbon cDNA expression library provided the gibbon IL-3 sequence. This sequence was subsequently used as a probe against a human genomic library. This provided evidence for the presence of IL-3 in human beings (Yang et al., Cell 47 (1986) 3-10).
  • IL-1 human interleukin-1
  • the carboxyl terminal third (63 amino acids) of the polypeptide contains the active site (Makino et al., Proc. Natl. Acad. Sci. USA 84 (1987) 7841-7845).
  • a recent study on IL-lalpha and IL-lbeta shows that 140 and 147 amino acids, respectively (out of a total of 153 amino acids), are required for full biological activity (Mosley et al., Proc. Natl. Acad. Sci. USA 84 (1987) 4572-4576).
  • Single amino acid changes at both termini result in significant decrease of biological activity.
  • no detailed information with respect to the receptor-binding domain of IL-1 has been obtained from these studies.
  • Clark-Lewis et al. Science 231 (1986) 134-139, performed a functional analysis of synthetic murine IL-3 analogs. They concluded that the stable tertiary structure of the complete molecule was required for full activity.
  • a study on the role of the disulfide bridges showed that replacement of two of the four Cys residues by Ala (Cys 79 , Cys 140 ⁇ Ala 79 , Ala 140 ) resulted in increased activity (Clark-Lewis et al., Proc. Natl. Acad. Sci. USA 85 (1988) 7897-7901).
  • EP-A-0275598 (WO 88/04691) illustrates that Ala 1 can be deleted while retaining biological activity.
  • Some mutant hIL-3 sequences are provided, viz. two double mutants, Ala 1 ⁇ Asp 1 , Trp 13 ⁇ Arg 13 (pGB/IL-302) and Ala 1 ⁇ Asp 1 Met 3 ⁇ Thr 3 ((pGB/IL-304) and one triple mutant Ala 1 ⁇ Asp 1 , Leu 9 ⁇ Pro 9 , Trp 13 ⁇ Arg 13 (pGB/IL-303).
  • WO88/05469 describes deglycosylation mutants and mutants of Arg 54 Arg 55 and Arg 108 Arg 109 Lys 110 (converted to the same numbering as in EP-A-0275598). The latter are suggested in order to avoid proteolysis upon expression in Saccharomyces cerevisiae by KEX2 protease. No mutated proteins are disclosed. Glycosylation and the KEX2 protease activity are only important, in this context, upon expression in yeast.
  • EP-A-0282185 describes various mutants that may be conformationally and antigenically neutral. To achieve this, a series of synonymous amino acid substitutions are suggested. The proposed changes are aimed at keeping the structure and charge distribution of the IL-3 molecule unaltered. However, the only actually performed mutations are Met 2 ⁇ Ile 2 and Ile 131 ⁇ Leu 131 . It is not disclosed whether the contemplated neutralities are obtained.
  • the present invention provides new classes of pharmacologically interesting compounds, viz. deletion and substitution mutants of hIL-3, showing biological activities similar and in some cases possibly antagonistic to those of hIL-3.
  • biologically active polypeptide analogs of human interleukin-3 are provided having a deletion of at least two amino acids.
  • Preferred mutants are those having one or more deletions at the N-terminus (amino acids 1-14) and/or the C-terminus (amino acids 120-130 and/or 130-133).
  • substitution mutants of hIL-3 having at least one of the following substitutions:
  • antagonists of hIL-3 are disclosed. These antagonists are substitution mutants of hIL-3 that are more potent in receptor binding than in stimulation of DNA synthesis. More specifically, the antagonists are single or double Cys mutants Preferably Cys is replaced by Ala (Cys 16 ⁇ Ala 16 , Cys 16 Cys 84 ⁇ Ala 16 Ala 84 ). Other mutants having an antagonistic effect are Glu 50 ⁇ Lys 50 and Lys 79 ⁇ Glu 79 .
  • polypeptides are obtained through expression of suitably modified DNA sequences.
  • the present invention also provides suitable expression vectors and host cells compatible therewith.
  • the invention comprises pharmaceutical compositions that include biologically active peptide analogs of hIL-3 as described above, in combination with a pharmaceutically acceptable carrier.
  • the present invention discloses monoclonal antibodies aimed at an epitope localized between amino acids 29 and 54.
  • FIG. 1 SEQ ID NO: 45 and SEQ ID NO: 46 shows the nucleotide and translated amino acid sequence of the fusion protein insert of pGB/IL-336. Amino acids indicated with lower case letters are non-hIL-3 amino acids. The IL-3 protein sequence begins at Ala1.
  • FIG. 2 SEQ ID NO: 47 and SEQ ID NO: 48 shows the 5' and 3' sequence changes introduced to obtain pGB/IL-339. Lower case letters indicate non-hIL-3 amino acids.
  • the mature IL-3 sequence begins at Ala1.
  • FIG. 3 is a photograph of the polyacrylamide gel of the following 19 IL-3 mutants (lanes 1 to 19 respectively): pGB/IL-336, pGB/IL-339, 932, 810, 934, 812, 935, 813, 936, 820, 937, 821, 938, 822, 939, 9329, 904, 905, 9045; and the Pharmacia LMW marker (lane 20). Mutations corresponding with these numbers are given in Table 4.
  • FIG. 4 shows an AML proliferation assay for IL-3 (*) and IL-3 mutant 821 (.).
  • FIG. 5 shows an IL-3-receptor binding experiment. Radiolabeled IL-3 binding to patient AML blasts is competed with unlabeled IL-3 protein (reference preparation). The levels of non-specific (lower bar) and maximal total binding (upper bar) in this experiment are indicated (see Example 5).
  • FIG. 6 shows a comparison of selected mutant IL-3 proteins with respect to relative biological activity (open bars) and relative binding activity (closed bars). The percentage of activity compared to the reference IL-3 preparation is indicated (Table 4).
  • human IL-3 corresponds to the amino acid sequence (1-133) as depicted in FIG. 1. Naturally occurring variants are also included.
  • hIL-3 molecules which are modified post-translationally are also encompassed by the term IL-3.
  • derivative of IL-3 is meant any IL-3 molecule that has been chemically or enzymatically modified, but which retains at least a part of its biological activity.
  • an "analog" of human IL-3 as used herein refers to a molecule having a sequence which differs from mature IL-3 by one or more deletions or substitutions.
  • Human IL-3 is further characterized by its biological activity to stimulate colony formation by human hematopoietic progenitor cells.
  • the colonies formed include erythroids, granulocytes, megakaryocytes, granulocyte macrophages and mixtures thereof.
  • the biological activity of hIL-3 can (for the present purpose) be further divided into two parts: signal transduction and receptor binding.
  • an hIL-3 analog exhibiting improved properties, is defined herein as an analog having a better signal transduction/receptor binding ratio, where better is dependent on the desired properties--i.e., a higher binding coefficient for an antagonist or an equal or higher biological activity for a deletion mutant. Better can also mean that the polypeptide analog is less susceptible to forming aggregates.
  • the biological activity of the human IL-3 analogs is determined by DNA synthesis by human acute myelogenous blasts. Furthermore, receptor binding assays are performed with donor leucocytes, patient AML cells or MV4-11 cells.
  • IL-3 is active in both receptor binding and signal transduction. If these activities can be attributed to specific amino acid sequences, which may be either continuous or discontinuous, it may become possible to uncouple the binding and signal transducing activities.
  • One aspect of the present invention is the development of a specific antagonist which blocks the receptor by binding specifically to it, preferably with a high binding coefficient, thereby hindering the signal transduction.
  • An antagonist can be any chemical molecule that binds to the receptor and thereby avoids binding of the agonist.
  • the present invention specifically aims at proteins having such a blocking effect.
  • the present invention provides an hIL-3 mutein which may have at least a partial antagonist effect. More specifically, these are single or double Cys mutants. Preferably, Cys is replaced by Ala (Cys 16 ⁇ Ala 16 , Cys 16 Cys 84 ⁇ Ala 16 Ala 84 ) Other mutants having an antagonistic effect are Glu 50 ⁇ Lys 50 and Lys 79 Glu 79 . It may be envisaged that administration of significant doses of the described mutants will prevent the physiological availability of IL-3.
  • proteins having hIL-3 or hIL-3-like activity which are smaller, preferably from about 3 to about 25%, than the native hIL-3 molecule.
  • it can be determined by introducing specific deletions which part of the molecule is indispensable for receptor binding and signal transduction.
  • the properties of the naturally occurring or naturally mutated IL-3 may be altered by introducing a variety of mutations in the protein. Such alterations are suitably introduced using the mutagenesis techniques described herein and the mutated molecules (hIL-3 muteins) are suitably synthesized using the expression vectors described below.
  • mutants Two kinds of mutants have specifically been made; a) deletion mutants and b) substitution mutants. It is to be understood that combinations of these mutants can easily be obtained by the described methods.
  • Deletion mutants have been made, together covering virtually the complete coding region.
  • Deletions can be any amino acid deletion of minimally two consecutive (or separated) amino acids. Preferably, four or more amino acids can be deleted. The deletions can start with any amino acid in the molecule (except near the C-terminus). It is also possible to have two separated deletions in the molecule (e.g., two times one amino acid deletion, two times two, etc.). In a preferred embodiment, 32 amino acids are deleted, 14 at the N-terminus and 18 at the C-terminus of the protein. Surprisingly, all of the expressed deletion mutant proteins showed biological activity.
  • mutants include an N-terminal deletion mutant missing amino acids 1 to 14, a C-terminal deletion mutant missing amino acids 120 to 130, a double mutant missing amino acids 1 to 14 and 120 to 130 and a C-terminal mutant missing amino acids 130 to 133. These mutants retained 100 percent of both the biological and the binding activity. It is surprising that hIL-3, missing 25 amino acids (20% of the full length hIL-3), still retains 100% of its activity. In view of Cys 16 which is involved in the formation of a disulfide bridge, it is expected that a -15 N-terminal deletion mutant also retains its activity.
  • the double deletion mutant lacking the 14 amino terminal and up to 18 C-terminal amino acids still retains full activity. Such mutants, lacking 32 amino acids, miss at most about 25% of the native molecule. Since this double mutant is fully active, it is expected that the -18 C-terminal mutant will also be fully active.
  • a pharmaceutical composition containing hIL-3 can be administered parenterally, intravenously or subcutaneously.
  • the use of a hydrogel composed of biodegradable polymer enclosing the polypeptide and continuously releasing said polypeptide is limited by the amount of peptide that can be enclosed.
  • Using a deletion mutant of the polypeptide with higher specific activity implies that, on a molar basis, more of the active substance can be enclosed in the same volume, thereby increasing the time between successive administrations or possibly avoiding repeated administrations.
  • Breaking of the disulfide bridge results in a substantial change in the 3D structure of the subject protein; other amino acid substitutions will also influence this structure and hence the activity.
  • alpha-helices are located between the following amino acids: Met 19 -His 26 , Gly 42 -Arg 55 , Leu 58 -Glu 69 , Ala 71 -Leu 81 , Leu 87 -His 95 , His 98 -Leu 111 and Leu 115 -Ala 121 .
  • Both deletion and substitution mutants can be used to alter the glycosylation sites, thus enabling the production of glycosylated or unglycosylated polypeptides in eukaryotic host cells at will.
  • mutants described above have been used in epitope mapping experiments to determine where exposed segments of the molecule, which may be relevant in receptor binding, are located.
  • monoclonal antibodies were prepared against mature hIL-3. These antibodies were used in Western blotting experiments against mutant proteins. At least one antigenic fragment was detected.
  • the new hIL-3 mutants according to the present invention can be conveniently prepared by site-directed mutagenesis, as well as by a variety of other techniques which are known in the art.
  • Suitable vectors which are capable of transforming microorganisms, which can express the mutated DNA sequences encoding the desired hIL-3 mutants include expression vectors comprising the mutated sequences derived from the mature hIL-3 coding sequence, joined to expression regulating regions and terminator regions. These regions are chosen depending on the prokaryotic or eukaryotic host cells used. Preferable hosts include E. coli or Bacillus. However, fungi, yeast cells and tissue culture cells can also be employed (see EP-A-0275598).
  • Expression vectors for E. coli include pGB/IL-336 and pGB/IL-339, each containing the lacZ promoter.
  • a preferable expression vector for Bacillus is pGB/IL-322, containing the ⁇ -amylase promoter and signal peptide, and derivatives thereof.
  • Other suitable vectors for expression in Bacillus are, for example, HpaII promoter containing vectors and derivatives thereof.
  • expression constructs which are capable of secreting the protein from the host cell. This can be accomplished using Bacillus constructs. Isolation from inclusion bodies, as exemplified here in E. coli, is also possible.
  • Purification of the polypeptide obtained after expression is dependent on the host cell and the expression construct used.
  • the purification of hIL-3 muteins can be performed in the same way as the purification of native hIL-3.
  • the following steps can be used; hydrophobic interaction chromatography, followed by anion exchange chromatography and optionally followed by gel filtration. It may also be sufficient to use only one or two of these purification steps.
  • a detailed description of the purification of hIL-3 is disclosed in commonly owned, copending U.S. patent application Ser. No. 494,182, filed 13 Mar. 1990, and EPA 0390252, filed 15 Mar. 1990, the disclosures of which are incorporated herein by reference in their entirety.
  • inclusion bodies containing the protein are isolated.
  • the protein is further purified using anion exchange chromatography. After removal of the urea, filter sterilization yields a protein that can be used for subsequent biological and biochemical characterization.
  • the elution conditions and column materials to be used with a particular mutein can be determined by one skilled in the art.
  • compositions can be formulated into pharmaceutical compositions by admixture with a pharmaceutically acceptable nontoxic carrier.
  • a pharmaceutically acceptable nontoxic carrier such compositions may be prepared for use for parenteral (subcutaneous, intramuscular or intravenous) administration particularly in the form of liquid solutions or suspensions.
  • the compositions may conveniently be administered in unit dosage form and may be prepared by any of the methods well known in the pharmaceutical art, for example, as described in Remington's Pharmaceutical Sciences, Mack Publishing Company, Easton, Pa. 1970.
  • Formulations for parenteral administration may contain as common excipients sterile water or saline, polyalkylene glycols such as polyethylene glycol, oils of vegetable origin, hydrogenated naphthalenes and the like.
  • the materials of this invention can be employed as the sole active agent in a pharmaceutical or can be used in combination with other active ingredients.
  • Other active ingredients can be selected, for example, from appropriate hematopoietins, CSFs and interleukins. These include GM-CSF, CSF-1, G-CSF, M-CSF, erythropoietin, IL-1 ⁇ , IL-1 ⁇ , IL-2, IL-4-IL-8, and tumor necrosis factor.
  • a number of tests are available for assaying the biological activity and potency of hIL-3 analogs of the invention.
  • the analog can be tested, using techniques well known in the art, to see if the protein stimulates colony formation by human hematopoietic progenitor cells. The colonies formed include erythroids, granulocytes, granulocyte macrophages, and mixed.
  • the ability of the subject analogs to stimulate DNA synthesis by human acute myelogenous leukemia (AML) blasts as evidenced, for example, by labeled thymidine uptake, can be used to indicate activity.
  • AML proliferation assays are discussed further below.
  • biological activity can be determined using an IL-3 receptor assay as described further in the Examples.
  • the biologically active polypeptide analogs of human IL-3 as provided by the present invention can be used for both therapeutic and diagnostic purposes.
  • Therapeutic uses include the treatment and prevention of malignant and non-malignant disorders.
  • the subject muteins can be used in the treatment of cytopenias and/or immnosuppression due to infections, cytopenias due to chemotherapy and/or irradiation, bone disorders such as bone fractures and osteoporosis, immunodeficiencies due to general anaesthetic procedures, recovery following bone marrow transplantation, adjunct to vaccination and adjunctive therapy of infections.
  • IL-3 cDNA insert of pLH1 was excised with HincII and HindIII, ligated to a synthetic oligonucleotide (SalI-overhang/blunt, 419/420, Table 1) comprising the sequence encoding the N-terminal 14 amino acids of the mature IL-3 and inserted into SalI-HindIII digested pTZ18R (Pharmacia).
  • the complete insert was transferred to pUC8 for protein production (as described previously in WO 88/04691), resulting in plasmid pGB/IL-335.
  • the PvuI fragment of plasmid pTZ18R carrying the fl-origin of replication was used to replace the corresponding PvuI fragment of pUC8.
  • the resulting bacterial expression plasmid pGB/IL-336 gives rise to a fusion protein of 145 amino acids with a calculated mw of 16,384 dalton (FIG. 1).
  • pGB/IL-336 was digested with HpaI and HindIII to remove most of the 3'-terminal part of the IL-3 cDNA. The protruding ends were made blunt and subsequently a blunt fragment carrying the corresponding IL-3 sequences (nt 137-497) and the B. licheniformis alpha-amylase terminator from plasmid pGB/IL-337 was ligated into it, resulting in plasmid pGB/IL-338.
  • pGB/IL-337 had been constructed from pGB/IL-324 (as disclosed in EPA 0390252 which is incorporated herein by reference) by looping-out of 3' non-coding IL-3 cDNA and alpha-amylase structural sequences between the IL-3 stop codon in the cDNA and the alpha-amylase terminator, using a synthetic oligonucleotide (Table 1, 944). This oligonucleotide also introduced a XhoI site just downstream of the IL-3 stop codon.
  • Plasmid pGB/IL-338 was digested with BamHI and HincII and part of the polylinker and 5'-terminal IL-3 sequences were substituted by the phosphorylated synthetic oligonucleotides 1055/1056 (Table 1) giving rise to plasmid pGB/IL-339.
  • the IL-3 gene was reconstructed with a slightly modified heterologous signal peptide encoding sequence.
  • a fusion protein of 148 aa with a calculated mw of 16,541 dalton was synthesized (FIG. 2).
  • the DNA sequence of pGB/IL-339 was verified and found to be correct. The biological activity of the expressed fusion protein was found to be unaltered.
  • E. coli expression vector pGB/IL-340
  • the lacZ promoter is followed immediately by sequences encoding the Bacillus ⁇ -amylase signal peptide precisely fused to mature IL-3, with the amylase terminator downstream thereof.
  • This plasmid which also serves as an intermediate for the construction of Bacillus expression vectors, was constructed by introduction of the NdeI-KpnI fragment from pGB/IL-337, carrying all the sequences just mentioned, into the NdeI-KpnI-cleaved E. coli vector pTZ18RN.
  • pTZ18RN is pTZ18R (Pharmacia) modified just upstream of the lacZ ATG start codon to introduce an NdeI site, using oligonucleotide 731 (see Table 1).
  • pGB/IL-340 gives rise to high production of IL-3 in E. coli.
  • Purified pGB/IL-336 or pGB/IL-339 ssDNA ( ⁇ 100 ng) was annealed with 20 ng of phosphorylated primer at 65° C. and slowly cooled to room temperature. Synthesis of the complementary strand was performed using 1-2 ⁇ g of gene 32 protein, 4 units of T4-DNA polymerase and 2.5 units of T4-DNA ligase. Reaction was carried out at 0° C. for 5 min, at 20° C. for 10 min and at 37° C. for 90 min. After completion, one third of the reaction mixture was mixed with thawed competent (Hanahan, D. (1985) in: "DNA Cloning" (D. M. Glover ed.) Vol.
  • the double cysteine mutant (9045) was constructed by ligation of the corresponding BstBI/BamHI fragments of the plasmids carrying the mutant IL-3 genes 904 and 905.
  • the combination mutants X and Z were constructed by ligation of fragments containing a 5' deletion and fragments containing a 3' deletion. Resulting clones were controlled by restriction enzyme analysis and sequence analysis.
  • Mutant 9329 was derived from 939 following HpaI and BamHI digestion and ligation with oligonucleotides 1424/1425. Clones were verified first for loss of the HpaI site and subsequently for correct DNA sequence.
  • plasmid DNA was isolated for a second round of transformation into JM109 cells to exclude potential contamination with the parental IL-3 construct. Following sequence verification, these clones were used for protein production.
  • mutants described here 811, 933 and 9329 were introduced into pGB/IL-340. This was done by ligating the PstI-XhoI fragment of a pGB/IL-339 derived mutant into PstI-XhoI cleaved pGB/IL-340, this resulted in plasmids pGB/IL-340/811, pGB/IL-340/933 and pGB/IL-340/9329.
  • Bacillus expression vectors for IL-3 muteins were constructed by exchanging the PstI-HindIII fragment of pGB/IL-322 (carrying part of the alpha-amylase signal peptide, the complete mature IL-3 cDNA sequence and the amylase terminator) with the PstI-HindIII fragment of a pGB/IL-340 mutant derivative (carrying part of the ⁇ -amylase signal peptide, the mutant IL-3 cDNA sequence and the ⁇ -amylase terminator).
  • the Bacillus expression vectors for the muteins 811, 933 and 9329 were named pGB/IL-322/811, pGB/IL-322/933 and pGB/IL-322/9329, respectively.
  • mutants 1455 lacking amino acids 130-133 were constructed directly in pGB/IL-340 by loop-out mutagenesis, using oligonucleotide 1455 (Table 1), resulting in plasmid pGB/IL-340/1455. Subsequently, the mutant sequence was transferred to pGB/IL-322 in a similar way as described for mutants 811, 933 and 9329, resulting in plasmid pGB/IL-341.
  • E. coli JM109 cultures (100 ml) were inoculated with 0.5 ml of a fresh overnight culture of the (mutant) IL-3 clone and grown at 37° C. until an OD of 0.4-0.6 at 550 nm was reached. Plasmid-directed protein synthesis was induced by addition of 1 mM of IPTG (Pharmacia). After an additional culture for 3-16 hours, the cells were collected by centrifugation (10 min, 4000 rpm at 4° C.) and stored frozen.
  • TE Tris-HCl pH 8; 1 mM EDTA
  • the pellet was resuspended in 4 ml of 55% sucrose in buffer TPD (50 mM Tris-HCl, pH 8; 0.1 mM PMSF and 2 mM DTT) by sonification and layered onto a discontinuous sucrose gradient (2 ml portions of 75% and 60% of sucrose in TPD buffer), essentially as described in WO 88/00598.
  • TPD buffer TPD
  • the inclusion bodies containing the IL-3 proteins were recovered from the 75% sucrose interphase.
  • the inclusion bodies were pelleted at 25,000 ⁇ g (30 min at 13,000 rpm in the Beckman JS13.1 rotor) and sonificated in 5 ml of 8M urea containing 50 mM Tris-HCl pH 8.9 and 2 mM DTT and left overnight at 4° C.
  • the clarified solution was subsequently applied to a 3 ml DEAE-Sepharose Fast Flow column (Pharmacia), equilibrated with 8M urea, 50 mM Tris-HCl pH 8.9 and 1 mM DTT buffer.
  • the IL-3 protein was bound to the column and step eluted with 75 mM NaCl in the same buffer.
  • the eluted protein was dialyzed against several portions of 10 mM Tris-HCl pH 8.0 and 1 mM DTT buffer and made isotonic by adding 10-fold concentrated RPMI cell culture medium (Sigma) containing 1% bovine serum albumin.
  • the filter sterilized (0.22 ⁇ m Millex-GV, Millipore) solution was used for biochemical and biological characterization.
  • Mutant proteins 811, 933, 1455 and 9329, X and Z, produced by Bacillus were secreted into the culture medium and did not require such drastic purification procedures for testing of biological activity. Therefore, the clarified supernatant (1 liter) (adjusted to 5 mM EDTA, 1 mM PMSF and 1M ammonium sulfate) was passed over a 15-20 ml Fractogel TSK Butyl 650 (C) column (Merck) equilibrated with 1M ammonium sulfate in 10 mM Tris-HCl pH 7.0 buffer.
  • the bound IL-3 protein was eluted with 10 mM Tris-HCl buffer and subsequently passed over a 1.5 ml DEAE-Sepharose Fast Flow column equilibrated with 10 mM Tris-HCl pH 8.0 buffer. The flow-through was collected and adjusted to 70% ammonium sulfate to concentrate the IL-3 protein. The precipitate was collected by centrifugation at 10,000 rpm (JS-13 rotor), dissolved and dialyzed against 10 mM Tris-HCl pH 8.0, 1 mM DTT buffer.
  • FIG. 3 shows an example of purified muteins expressed in E. coli.
  • the expression in E. coli of mutant pGB/IL-339 derived IL-3 proteins was generally higher than the same mutant protein from the pGB/IL-336 expression vector.
  • the applied purification procedure was not devised to render completely pure IL-3 protein preparations. In general, minor higher molecular weight contaminants were observed on SDS gels. Using densitometric scanning of stained SDS gels, the amount of IL-3 protein was determined. Although occasionally severe loss of protein occurred following dialysis, total recovery was generally 0.1-1 mg of "purified" IL-3 protein. The only exception were the mutants 811 and 933, which gave no fusion protein production in either of the E. coli expression vectors.
  • the only convenient method for synthesis of the muteins 811 and 933 is expression in Bacillus licheniformis. Although the amount of protein produced is very low compared to the amount of protein produced by Bacillus strains synthesizing other muteins such as 9329 and 1455, enough is made to purify the muteins 811 and 933 in sufficient quantities to carry out the biological assays described herein.
  • the gel fractionated proteins were transferred onto nitrocellulose (0.2 ⁇ m, Schleicher and Schuell BA83) using the semi-dry blotting system (Novablot, Pharmacia/LKB) with a continuous buffer system (39 mM glycine, 48 mM Tris, 0.0375% SDS and 20% methanol) at 1.2 mA/cm 2 for 90 min.
  • the nitrocellulose filter was subsequently air dried, preincubated with a 3% bovine serum albumin (BSA, Sigma) solution (10 mM Tris-HCl pH 7.6; 350 mM NaCl; 0.1% PMSF and 0.1% sodium azide) and incubated for 4-16 hr with the polyclonal (10 -3 dilution) or a mixture of monoclonal antibodies directed against human IL-3 (MCA A1, A4, A5, A8, A18 at 10 -4 dilution) in RIA buffer (10 mM Tris/HCl pH 7.6; 150 mM NaCl; 1% Triton X-100; 0.1% SDS; 0.5% Na-deoxycholate; 0.1 mM PMSF and 0.3% BSA).
  • BSA bovine serum albumin
  • Immunological complexes were visualized using biotinylated anti-rabbit or mouse Ig, streptavidinbiotinylated horseradish peroxidase (Amersham International, Amersham, UK) and 4-chloro-1-naphtol (Gibco-BRL) according to the protocols provided by the manufacturer.
  • antiserum incubations were performed in Tris-buffered saline plus 0.05% Tween 20. Alkaline phosphatase-linked anti-mouse Ig complexes were visualized according to standard protocols (Promega).
  • epitopes can be localized as follows:
  • A1 and A18 are aimed against an epitope localized between amino acids 29 and 37. Furthermore, from the 36 D ⁇ R mutant it can be concluded that the A18 epitope is localized somewhat more toward the C-terminus than the A1 epitope.
  • A5 is aimed against an epitope localized between amino acids 45 and 54.
  • A8 is aimed against an epitope localized between amino acids 36 and 47.
  • AML DNA synthesis was tested on human AML193 cells as follows.
  • Human AML193 cells (ATCC: CRL-9589) were maintained in Serum Free Medium (SFM), (Iscove's Modified Dulbecco's Medium (Gibco BRL) containing 0.1% BSA (Behringwerke AG, Marburg), 10 ⁇ g/ml of Insulin (Organon) and Transferrin, 0.1 mM beta-mercaptoethanol) and 10 to 20 units of human IL-3.
  • SFM Serum Free Medium
  • Gabco BRL Iscove's Modified Dulbecco's Medium
  • BSA Insulin
  • Transferrin 0.1 mM beta-mercaptoethanol
  • Dilutions of (mutant) IL-3 preparations were prepared (50 ⁇ l) in round bottom 96 well plates in SFM. Washed cells (1-2 ⁇ 10 4 in 50 ⁇ l SFM) were added and cultured for 6 days. 3 H-Thymidine (0.1 uCi, 2 uCI/mmol) was added in 20 ⁇ l and cells were harvested 16 hours later. A unit of IL-3 activity was defined as the amount required to give 50% of maximal DNA synthesis in this assay. For the reference IL-3 preparation, the specific activity varied between 2 ⁇ 10 6 to 2 ⁇ 10 7 Units per mg protein. In general, the biological activity of the muteins was compared to this reference preparation.
  • FIG. 4 shows an example of the AML proliferation assay in which mutein 812 is compared with the reference IL-3 expressed in Bacillus.
  • the graph shows that the mutein 812 has an activity which is reduced by about 4 orders of magnitude with respect to unmodified IL-3. However, the mutein is still able to stimulate the AML cells to maximal activity, only more protein is needed.
  • IL-3 receptor binding assay was performed with purified recombinant hIL-3 (see EPA 0390252) was radiolabeled with the Bolton-Hunter reagent (as described by Budel et al., Blood 74 (1989) 565-571). The specific activity was estimated at 80,000 cpm/ng of IL-3.
  • target either donor leukocytes, patient AML cells, or MV4-11 (ATCC: CRL-9591) cells were used. Cells were washed in Hanks Balanced Salt solution and suspended in Alpha-MEM plus 1% BSA.
  • FIG. 5 shows an example of an IL-3 receptor binding experiment. Radiolabeled IL-3 binding to patient AML blasts is competed with unlabeled IL-3 protein (reference preparation). Due to the low number of receptors (less than 200) on the target cells, data for competition mostly varied by one order of magnitude.
  • IL-3 fusion proteins derived from both pGB/IL-336 and pGB/IL-339 expression plasmids were identical in biological activity and were not significantly different from the B. licheniformis reference preparation derived from expression of the full-length IL-3 cDNA in pGB/IL-322 (see EPA 0390252). Apparently, no negative effect on the biological activity is exerted by the heterologous leader peptide in the E. coli fusion proteins. Most IL-3 deletion mutants were significantly reduced in biological activity. Deletions between amino acids 50 and 105 resulted in more than 10,000-fold reduction in specific activity.
  • the muteins expressed in E. coli described above are all fusion proteins. To provide evidence that the extra N-terminal amino acids are not necessary as compensation for the loss of the deleted IL-3 specific amino acids, construct pGB/IL-322/9329 was made and expressed in B. licheniformis. This construct gives rise to a 1-14/ 120-130 IL-3 mutein without any extra amino acids at the N-terminus. The activity of this mutein is comparable to the wild-type molecule proving that only the residual 108 amino acids are responsible for the IL-3 activity.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

Biologically active deletion and substitution mutants of hIL-3 are provided. Preferred mutants are those having one or more deletions at the N-terminus (amino acids 1-14) and/or the C-terminus (amino acids 116-133, 120-130 and/or 130-133). Preferred substitution mutants include Cys16 →Ala16 and/or Cys84 →Ala84, Glu50 →Lys50 and Lys79 →Glu79. These mutants can be used to formulate pharmaceutical compositions. Also disclosed are antibodies directed against specific epitopes localized between amino acids 29 and 54.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS
This application is a continuation, of application Ser. No. 07/651,437, filed 5 Feb. 1991, now abandoned, which is in turn a continuation-in-part application of U.S. Ser. No. 517,653, filed 3 May 1990, now abandoned from which priority is claimed pursuant to 35 USC ∫120 and which is incorporated herein by reference in its entirety.
TECHNICAL FIELD
The present invention relates to mutants of colony stimulating factors, obtained by recombinant DNA techniques. More specifically, the invention relates to mutants of interleukin-3, containing one or more deletions and/or one or more substitutions, with interesting pharmacological properties.
BACKGROUND OF THE INVENTION
Historically, factors affecting hematopoietic cells have been detected in an assay measuring the proliferation and/or differentiation of bone marrow cells in soft agar cultures. The factors showing this activity have been collectively called colony-stimulating factors (CSFs). More recently, it has been found that a variety of CSFs exist which, in part, can be classified by the hematopoietic lineages that are stimulated.
In human and murine systems, these proteins include G-CSF and M-CSF. These proteins stimulate the in vitro formation of predominantly neutrophilic granulocyte and macrophage colonies, respectively. Interleukin-2 ("IL-2") stimulates the proliferation of both activated T-cells and activated B-cells, but is not considered a colony stimulating factor.
GM-CSF and interleukin-3 ("IL-3", also known as "Multi-CSF") stimulate the formation of macrophage and both neutrophilic and eosinophilic granulocyte colonies. In addition, IL-3 stimulates the formation of mast, megakaryocyte and pure and mixed erythroid colonies (D. Metcalf "The hematopoietic colony-stimulating factors", 1984, Elsevier, Amsterdam, and D. Metcalf, Science 299 (1985) 16-22).
Growth factor-induced cell proliferation is a complicated process. Following highly specific binding of the growth factor to its receptor at the cell surface, the complex is internalized by endocytosis and induces an intracellular response often preceded by phosphorylation of the receptor (Sibley et al., Cell 48 (1987) 913-922). These intracellular signals result in specific gene transcription and finally in DNA synthesis and cell replication.
There is considerable interest in the CSFs, since they may be therapeutically useful for restoring depressed levels of hematopoietic and lymphoid stem cell-derived cells.
Human IL-3 ("hIL-3") is such a CSF. Mature hIL-3 consists of 133 amino acids; the protein contains one disulfide bridge and has two potential glycosylation sites (Yang et al., Cell 47 (1986) 3-10). It has inter alia the following activities:
1) stimulation of colony formation by human hematopoietic progenitor cells wherein the colonies formed include erythroids, granulocytes, megakaryocytes, granulocyte macrophages, and mixtures thereof; and
2) stimulation of DNA synthesis by human acute myelogenous leukemia (AML) blasts.
Useful agonists and antagonists of a protein can be created once the structure-function relationship of the molecule is understood. Generally, this relationship is studied by modifying, replacing or deleting amino acids. In this way, information can be obtained about the importance of each of the amino acids for the activity of the protein. Important domains of proteins may be the active site, metal and cofactor binding sites, receptor binding sites, the amino acids involved in subunit interactions, and the antigenic determinants.
Once the primary sequence of a protein has been determined, various procedures can be employed to study the above-mentioned characteristics. For example, if primary structures of homologous proteins from other species are available, the sequences can be compared. Conserved sequences are often indicative of the importance of certain amino acids.
Secondary structures can be predicted with the use of known algorithms. See, e.g., Hopp and Woods, Proc. Natl. Acad. Sci. USA 78 (1981) 3824-3828, Garnier et al., J. Mol. Biol. 120 (1978) 97-120, Biou et al., Prot. Eng. 2 (1988) 185-191, Carmenes et al., Biochem. Biophys. Res. Commun. 159 (1989) 687-693.
If interspecies homology between homologous proteins is high and the 3-D structure of one of them is known, important amino acids can also be deduced from this structure.
Primary and/or spatial-structure data can be used to make an educated guess for mutagenesis experiments. Expression of mutagenized proteins and the testing of these muteins in biological assays provides information about the relative importance of certain amino acids.
The aim of the present invention is to provide IL-3 mutants with similar or improved pharmaceutical properties with respect to the native IL-3, preferably using the procedures mentioned above.
BACKGROUND LITERATURE
Human Interleukin-3
In 1984, cDNA clones coding for murine IL-3 were isolated (Fung et al., Nature 307 (1984) 233-237 and Yokota et al., Proc. Natl. Acad. Sci. USA 81 (1984) 1070-1074). This cDNA would not hybridize with human DNA or cDNA clones. Thus, it was speculated that a human counterpart for murine IL-3 (mIL-3) did not exist. This belief was reinforced by the wide spectrum of activities of the human GM-CSF. Finally, in 1986, a gibbon cDNA expression library provided the gibbon IL-3 sequence. This sequence was subsequently used as a probe against a human genomic library. This provided evidence for the presence of IL-3 in human beings (Yang et al., Cell 47 (1986) 3-10).
Meanwhile, Dorssers et al., Gene 55 (1987) 115-124, found a clone from a human cDNA library that surprisingly hybridized with mIL-3. This hybridization was the result of the high degree of homology between the 3' noncoding regions of mIL-3 and hIL-3.
Modified CSFs (other than IL-3)
Moonen et al., Proc. Natl. Acad. Sci. USA 84 (1987) 4428-4431 describe the production of human GM-CSF by several recombinant sources including E. coli, yeast and animal cells. Partially purified expression products from yeast and animal cells were assayed for the effect of deglycosylation. The immunoreactivity was increased 4- to 8-fold upon removal of the N-linked oligosaccharides. The specific biological activity was increased by a factor of 20, both in the chronic myelogenous leukemia (CML) and in the human bone marrow assay.
Kaushansky et al., Proc. Natl. Acad. Sci. USA 86 (1989) 1213-1217, tried to define the region(s) of the GM-CSF polypeptide required for biological activity. Since human and murine GM-CSF do not cross-react in their respective colony-forming assays, the approach was based on the use of hybrid DNA molecules containing various lengths of the coding regions for h- and mGM-CSF. After expression in COS cells, the hybrid proteins were tested in both human and murine colony-forming assays. Two regions of GM-CSF were found to be critical for hematopoietic function. These regions are structurally characterized by an amphiphilic helix and by a disulfide-bonded loop.
Gough et al., Eur. J. Biochem. 169 (1987) 353-358, describe internal deletion mutants of murine GM-CSF. None of the mutants is reported to show biological activity.
Kuga et al., Biochem. Biophys. Res. Com. 159 (1989) 103-111, describe mutagenesis of human G-CSF. The results indicate that most of the expression products with mutations localized in the internal or C-terminal regions abolish hG-CSF activity. On the other hand, N-terminal deletion mutants missing 4, 5, 7 or 11 amino acids, out of a total of 174 amino acids, retained activity. Some of the N-terminal amino acid mutants showed increased activity.
Deletion mutants of human interleukin-1 (IL-1) have been created using available endonuclease restriction sites and expression in eukaryotic cells. The carboxyl terminal third (63 amino acids) of the polypeptide contains the active site (Makino et al., Proc. Natl. Acad. Sci. USA 84 (1987) 7841-7845). A recent study on IL-lalpha and IL-lbeta shows that 140 and 147 amino acids, respectively (out of a total of 153 amino acids), are required for full biological activity (Mosley et al., Proc. Natl. Acad. Sci. USA 84 (1987) 4572-4576). Single amino acid changes at both termini result in significant decrease of biological activity. However, no detailed information with respect to the receptor-binding domain of IL-1 has been obtained from these studies.
Activity of human interleukin-2 was shown to be severely inhibited by removal of both Cys58 and Cys105, whereas deletion of the third Cys residue (125) had no effect (Wang et al., Science 224 (1984) 1431-1433; Cohen et al., Science 234 (1986) 349-352). All substitutions resulting in a disturbance of helical folding of this protein were found to give significant reductions of biological activity. The potential receptor binding site of IL-2 has been mapped on an eleven amino acid long peptide. Individual amino acid substitutions in this region had dramatic effects (Cohen et al., (supra); Zurawski and Zurawski, EMBO J. 7 (1988) 1061-1069). Mutational analysis further revealed that different domains of IL-2 are involved in high and low affinity binding of the IL-2 receptor complex (Robb et al., Proc. Natl. Acad. Sci. USA 85 (1988) 5654-5658; Collins et al., Proc. Natl. Acad. Sci. USA 85 (1988) 7709-7713).
Modified IL-3
Clark-Lewis et al., Science 231 (1986) 134-139, performed a functional analysis of synthetic murine IL-3 analogs. They concluded that the stable tertiary structure of the complete molecule was required for full activity. A study on the role of the disulfide bridges showed that replacement of two of the four Cys residues by Ala (Cys79, Cys140 →Ala79, Ala140) resulted in increased activity (Clark-Lewis et al., Proc. Natl. Acad. Sci. USA 85 (1988) 7897-7901).
Literature on proposed and actually performed modifications of hIL-3 is scarce. International Patent Application (PCT) WO 88/00598 discloses a Ser27 →Pro27 replacement. (It should be noted that the numbering of amino acids in WO 88/00598 includes the signal peptide of 19 amino acids.) Furthermore, suggestions are made to replace Cys with Ser, breaking the disulfide bridge, and to replace one or more amino acids at the glycosylation sites (Asn34 Cys35 Ser36 and Asn89 Ala90 Ser91).
EP-A-0275598 (WO 88/04691) illustrates that Ala1 can be deleted while retaining biological activity. Some mutant hIL-3 sequences are provided, viz. two double mutants, Ala1 →Asp1, Trp13 →Arg13 (pGB/IL-302) and Ala1 →Asp1 Met3 →Thr3 ((pGB/IL-304) and one triple mutant Ala1 →Asp1, Leu9 →Pro9, Trp13 →Arg13 (pGB/IL-303).
WO88/05469 describes deglycosylation mutants and mutants of Arg54 Arg55 and Arg108 Arg109 Lys110 (converted to the same numbering as in EP-A-0275598). The latter are suggested in order to avoid proteolysis upon expression in Saccharomyces cerevisiae by KEX2 protease. No mutated proteins are disclosed. Glycosylation and the KEX2 protease activity are only important, in this context, upon expression in yeast.
Finally, EP-A-0282185 describes various mutants that may be conformationally and antigenically neutral. To achieve this, a series of synonymous amino acid substitutions are suggested. The proposed changes are aimed at keeping the structure and charge distribution of the IL-3 molecule unaltered. However, the only actually performed mutations are Met2 →Ile2 and Ile131 →Leu131. It is not disclosed whether the contemplated neutralities are obtained.
No known extensive mutagenesis experiments on hIL-3 have been disclosed to date.
The present invention provides new classes of pharmacologically interesting compounds, viz. deletion and substitution mutants of hIL-3, showing biological activities similar and in some cases possibly antagonistic to those of hIL-3.
SUMMARY OF THE INVENTION
In one aspect of the invention, biologically active polypeptide analogs of human interleukin-3 (also referred to hereinafter as "hIL-3 mutants" or "muteins") are provided having a deletion of at least two amino acids.
Preferred mutants are those having one or more deletions at the N-terminus (amino acids 1-14) and/or the C-terminus (amino acids 120-130 and/or 130-133).
In another aspect of this invention, substitution mutants of hIL-3 are disclosed having at least one of the following substitutions:
Asp21 Glu22 →Lys21 Ar22
Asp36 →Arg36
Glu43 Asp44 →Lys43 Arg44
Arg54 Arg55 →Glu54 Asp55
Asp46 →Lys46 or Arg46
Glu50 →Lys50 or Arg50,
Glu59 →Lys59 or Arg59
Glu59 →Gly59 or Pro59,
Ar63 Ala64 →Pro63 Gly64
Glu75 →Arg75 or Gly75
Lys79 →Glu79
Arg94 →Pro94
His98 Lys100 Asp101 →Glu98 Asp100 Gln101
Glu106 →Lys106
Arg108 Arg109 Lys110 →Glu108 Asp109 Glu110,
Phe113 Tyr114 →Ala113 Thr114
Cys16 →Ala16
Cys84 →Ala84
Cys16 Cys84 →Ala16 Ala84
In yet another aspect of this invention, antagonists of hIL-3 are disclosed. These antagonists are substitution mutants of hIL-3 that are more potent in receptor binding than in stimulation of DNA synthesis. More specifically, the antagonists are single or double Cys mutants Preferably Cys is replaced by Ala (Cys16 →Ala16, Cys16 Cys84 →Ala16 Ala84). Other mutants having an antagonistic effect are Glu50 →Lys50 and Lys79 →Glu79.
The polypeptides are obtained through expression of suitably modified DNA sequences. Thus, the present invention also provides suitable expression vectors and host cells compatible therewith.
In yet other aspects, the invention comprises pharmaceutical compositions that include biologically active peptide analogs of hIL-3 as described above, in combination with a pharmaceutically acceptable carrier.
Finally, the present invention discloses monoclonal antibodies aimed at an epitope localized between amino acids 29 and 54.
Other embodiments of the subject invention are readily determined by one skilled in the art.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 SEQ ID NO: 45 and SEQ ID NO: 46 shows the nucleotide and translated amino acid sequence of the fusion protein insert of pGB/IL-336. Amino acids indicated with lower case letters are non-hIL-3 amino acids. The IL-3 protein sequence begins at Ala1.
FIG. 2 SEQ ID NO: 47 and SEQ ID NO: 48 shows the 5' and 3' sequence changes introduced to obtain pGB/IL-339. Lower case letters indicate non-hIL-3 amino acids. The mature IL-3 sequence begins at Ala1.
FIG. 3 is a photograph of the polyacrylamide gel of the following 19 IL-3 mutants (lanes 1 to 19 respectively): pGB/IL-336, pGB/IL-339, 932, 810, 934, 812, 935, 813, 936, 820, 937, 821, 938, 822, 939, 9329, 904, 905, 9045; and the Pharmacia LMW marker (lane 20). Mutations corresponding with these numbers are given in Table 4.
FIG. 4 shows an AML proliferation assay for IL-3 (*) and IL-3 mutant 821 (.).
FIG. 5 shows an IL-3-receptor binding experiment. Radiolabeled IL-3 binding to patient AML blasts is competed with unlabeled IL-3 protein (reference preparation). The levels of non-specific (lower bar) and maximal total binding (upper bar) in this experiment are indicated (see Example 5).
FIG. 6 shows a comparison of selected mutant IL-3 proteins with respect to relative biological activity (open bars) and relative binding activity (closed bars). The percentage of activity compared to the reference IL-3 preparation is indicated (Table 4).
DETAILED DESCRIPTION OF THE INVENTION
As used herein, "human IL-3" corresponds to the amino acid sequence (1-133) as depicted in FIG. 1. Naturally occurring variants are also included. Furthermore, hIL-3 molecules which are modified post-translationally (e.g., by glycosylation) are also encompassed by the term IL-3. By "derivative" of IL-3 is meant any IL-3 molecule that has been chemically or enzymatically modified, but which retains at least a part of its biological activity.
An "analog" of human IL-3 as used herein refers to a molecule having a sequence which differs from mature IL-3 by one or more deletions or substitutions.
Human IL-3 is further characterized by its biological activity to stimulate colony formation by human hematopoietic progenitor cells. The colonies formed include erythroids, granulocytes, megakaryocytes, granulocyte macrophages and mixtures thereof. The biological activity of hIL-3 can (for the present purpose) be further divided into two parts: signal transduction and receptor binding.
An hIL-3 analog, exhibiting improved properties, is defined herein as an analog having a better signal transduction/receptor binding ratio, where better is dependent on the desired properties--i.e., a higher binding coefficient for an antagonist or an equal or higher biological activity for a deletion mutant. Better can also mean that the polypeptide analog is less susceptible to forming aggregates.
For the present purpose the biological activity of the human IL-3 analogs is determined by DNA synthesis by human acute myelogenous blasts. Furthermore, receptor binding assays are performed with donor leucocytes, patient AML cells or MV4-11 cells.
As explained above, IL-3 is active in both receptor binding and signal transduction. If these activities can be attributed to specific amino acid sequences, which may be either continuous or discontinuous, it may become possible to uncouple the binding and signal transducing activities.
In order to determine the structure-function relationship of hIL-3, the following mutagenesis techniques are inter alia to be considered:
a) replacement of one amino acid by an isosteric residue of different function--e.g., Asp by Asn. This maintains the hydrogen bonding characteristics, while removing the charge;
b) replacement of one amino acid by another of identical function but different structure--e.g., Glu by Asp, where a carboxyl group would be moved by about 1 Angstrom;
c) replacement of one amino acid by another of different function;
d) introduction or removal of disulfide bridges;
e) construction of deletion mutants;
f) introduction of helix breakers (e.g. Pro);
g) construction of insertion mutants;
h) generation of glycosylation mutants.
One aspect of the present invention is the development of a specific antagonist which blocks the receptor by binding specifically to it, preferably with a high binding coefficient, thereby hindering the signal transduction.
An antagonist can be any chemical molecule that binds to the receptor and thereby avoids binding of the agonist. The present invention specifically aims at proteins having such a blocking effect. In one of its aspects, the present invention provides an hIL-3 mutein which may have at least a partial antagonist effect. More specifically, these are single or double Cys mutants. Preferably, Cys is replaced by Ala (Cys16 →Ala16, Cys16 Cys84 →Ala16 Ala84) Other mutants having an antagonistic effect are Glu50 →Lys50 and Lys79 Glu79. It may be envisaged that administration of significant doses of the described mutants will prevent the physiological availability of IL-3.
In another aspect of the present invention, there are provided proteins having hIL-3 or hIL-3-like activity, which are smaller, preferably from about 3 to about 25%, than the native hIL-3 molecule. As is further illustrated by the Examples, it can be determined by introducing specific deletions which part of the molecule is indispensable for receptor binding and signal transduction.
The properties of the naturally occurring or naturally mutated IL-3 may be altered by introducing a variety of mutations in the protein. Such alterations are suitably introduced using the mutagenesis techniques described herein and the mutated molecules (hIL-3 muteins) are suitably synthesized using the expression vectors described below.
Two kinds of mutants have specifically been made; a) deletion mutants and b) substitution mutants. It is to be understood that combinations of these mutants can easily be obtained by the described methods.
Deletion mutants have been made, together covering virtually the complete coding region. Deletions, as used herein, can be any amino acid deletion of minimally two consecutive (or separated) amino acids. Preferably, four or more amino acids can be deleted. The deletions can start with any amino acid in the molecule (except near the C-terminus). It is also possible to have two separated deletions in the molecule (e.g., two times one amino acid deletion, two times two, etc.). In a preferred embodiment, 32 amino acids are deleted, 14 at the N-terminus and 18 at the C-terminus of the protein. Surprisingly, all of the expressed deletion mutant proteins showed biological activity.
Four such mutants include an N-terminal deletion mutant missing amino acids 1 to 14, a C-terminal deletion mutant missing amino acids 120 to 130, a double mutant missing amino acids 1 to 14 and 120 to 130 and a C-terminal mutant missing amino acids 130 to 133. These mutants retained 100 percent of both the biological and the binding activity. It is surprising that hIL-3, missing 25 amino acids (20% of the full length hIL-3), still retains 100% of its activity. In view of Cys16 which is involved in the formation of a disulfide bridge, it is expected that a -15 N-terminal deletion mutant also retains its activity.
The double deletion mutant lacking the 14 amino terminal and up to 18 C-terminal amino acids (Table 4, X and Z), still retains full activity. Such mutants, lacking 32 amino acids, miss at most about 25% of the native molecule. Since this double mutant is fully active, it is expected that the -18 C-terminal mutant will also be fully active.
Internal deletion mutants have also been made. One such mutant which retains complete activity lacks amino acids 120 to 130 (Table 4, 939). It is likely that more such mutants can be made. For processing reasons it may be advantageous to retain the first few amino acids of the mature IL-3 protein. Since the -14 N-terminal deletion mutant retains full activity, it is expected that an internal deletion mutant in the N-terminal region will also retain its activity. Another successful internal deletion might be introduced in the Gln29 -Leu35 region. Additionally, deletion of 1 to 7 amino acids, possibly in combination with a Lys28 →Pro28 substitution, may provide other biologically active mutants.
The discovery that the activity of hIL-3 is retained in the disclosed double mutants or for any other mutant lacking a large part of the protein (e.g., approximately 25 percent) has another potential advantage. A pharmaceutical composition containing hIL-3 can be administered parenterally, intravenously or subcutaneously. The use of a hydrogel composed of biodegradable polymer enclosing the polypeptide and continuously releasing said polypeptide is limited by the amount of peptide that can be enclosed. Using a deletion mutant of the polypeptide with higher specific activity implies that, on a molar basis, more of the active substance can be enclosed in the same volume, thereby increasing the time between successive administrations or possibly avoiding repeated administrations.
It is also possible to introduce specific mutations at the DNA level thereby introducing amino acid substitutions into the encoded protein. These substitutions may be introduced in important conformational or activity regions. An example of such a mutation is a mutation disturbing the disulfide bridge present between Cys16 and Cys84. By replacing either (or both) of the cysteine residues by an alanine, the bridge cannot be formed, resulting in heavily decreased activity. All three of these mutants have been made and show a relatively high binding activity (with respect to biological activity) in a receptor binding assay.
Since different ratios of relative binding activity to relative biological activity (Table 4) are found, it may be advantageous to use combinations of the disclosed IL-3 analogs. Furthermore, it may be advantageous to use polypeptide analogs having both one or more deletions and one or more substitutions.
Breaking of the disulfide bridge results in a substantial change in the 3D structure of the subject protein; other amino acid substitutions will also influence this structure and hence the activity.
Secondary structure measurements (circular dichroism) show that the hIL-3 molecule has a high percentage (70% at 20° C.) of alpha-helices. Secondary structure prediction programs (i.e., Hopp and Woods, Proc. Natl. Acad. Sci. USA 78 (1981) 3824-3828; Garnier et al., J. Mol. Biol. 120 (1978) 97-120; Biou et al., Prot. Eng. 2 (1988) 185-191; Carmenes et al., Biochem. Biophys. Res. Commun. 159 (1989) 687-693) suggest that these alpha-helices are located between the following amino acids: Met19 -His26, Gly42 -Arg55, Leu58 -Glu69, Ala71 -Leu81, Leu87 -His95, His98 -Leu111 and Leu115 -Ala121.
In view of the charge distribution in the alpha-helices and since it is possible that these charges may play an important role in the interaction with the receptor, the following "charge reversal" substitutions are also encompassed by the present invention:
______________________________________                                    
Asp.sup.21 Glu.sup.22                                                     
                →                                                  
                        Lys.sup.21 Arg.sup.22                             
Asp.sup.36      →                                                  
                        Arg.sup.36                                        
Glu.sup.43 Asp.sup.44                                                     
                →                                                  
                        Lys.sup.43 Arg.sup.44                             
Arg.sup.54 Arg.sup.55                                                     
                →                                                  
                        Glu.sup.54 Asp.sup.55                             
Asp.sup.46      →                                                  
                        Lys.sup.46 or Arg.sup.46                          
Glu.sup.50      →                                                  
                        Lys.sup.50 or Arg.sup.50                          
Glu.sup.59      →                                                  
                        Lys.sup.59 or Arg.sup.59                          
Glu.sup.59      →                                                  
                        Gly.sup.59 or Pro.sup.59                          
              (alpha-helix breaker)                                       
Arg.sup.63 Ala.sup.64                                                     
                →                                                  
                        Pro.sup.63 Gly.sup.64                             
Glu.sup.75      →                                                  
                        Arg.sup.75 or Gly.sup.75                          
Lys.sup.79      →                                                  
                        Glu.sup.79                                        
Arg.sup.94      →                                                  
                        Pro.sup.94                                        
His.sup.98 Lys.sup.100 Asp.sup.101                                        
                →                                                  
                        Glu.sup.98 Asp.sup.100 Gln.sup.101                
Glu.sup.106     →                                                  
                        Lys.sup.106                                       
Arg.sup.108 Arg.sup.109 Lys.sup.110                                       
                →                                                  
                        Glu.sup.108 Asp.sup.109 Glu.sup.110               
Phe.sup.113 Tyr.sup.114                                                   
                →                                                  
                        Ala.sup.113 Thr.sup.114.                          
______________________________________                                    
Both deletion and substitution mutants can be used to alter the glycosylation sites, thus enabling the production of glycosylated or unglycosylated polypeptides in eukaryotic host cells at will.
The mutants described above have been used in epitope mapping experiments to determine where exposed segments of the molecule, which may be relevant in receptor binding, are located. To achieve this, monoclonal antibodies were prepared against mature hIL-3. These antibodies were used in Western blotting experiments against mutant proteins. At least one antigenic fragment was detected.
The new hIL-3 mutants according to the present invention can be conveniently prepared by site-directed mutagenesis, as well as by a variety of other techniques which are known in the art.
Suitable vectors which are capable of transforming microorganisms, which can express the mutated DNA sequences encoding the desired hIL-3 mutants, include expression vectors comprising the mutated sequences derived from the mature hIL-3 coding sequence, joined to expression regulating regions and terminator regions. These regions are chosen depending on the prokaryotic or eukaryotic host cells used. Preferable hosts include E. coli or Bacillus. However, fungi, yeast cells and tissue culture cells can also be employed (see EP-A-0275598).
Expression vectors for E. coli include pGB/IL-336 and pGB/IL-339, each containing the lacZ promoter. A preferable expression vector for Bacillus is pGB/IL-322, containing the α-amylase promoter and signal peptide, and derivatives thereof. Other suitable vectors for expression in Bacillus are, for example, HpaII promoter containing vectors and derivatives thereof. These and other vectors are described in EPA 0390252, the disclosures of which are incorporated herein by reference in their entirety.
For convenience it may be useful to use expression constructs which are capable of secreting the protein from the host cell. This can be accomplished using Bacillus constructs. Isolation from inclusion bodies, as exemplified here in E. coli, is also possible.
Purification of the polypeptide obtained after expression is dependent on the host cell and the expression construct used. Generally, the purification of hIL-3 muteins can be performed in the same way as the purification of native hIL-3. To obtain highly purified hIL-3 muteins, the following steps can be used; hydrophobic interaction chromatography, followed by anion exchange chromatography and optionally followed by gel filtration. It may also be sufficient to use only one or two of these purification steps. A detailed description of the purification of hIL-3 is disclosed in commonly owned, copending U.S. patent application Ser. No. 494,182, filed 13 Mar. 1990, and EPA 0390252, filed 15 Mar. 1990, the disclosures of which are incorporated herein by reference in their entirety.
Briefly, after expression in E. coli, inclusion bodies containing the protein are isolated. After sonification in 8M urea, the protein is further purified using anion exchange chromatography. After removal of the urea, filter sterilization yields a protein that can be used for subsequent biological and biochemical characterization. Hydrophobic interaction and anion exchange chromatography, as well as the use of Bacillus as a host strain, in combination with secretion of the polypeptides, yields highly pure proteins. The elution conditions and column materials to be used with a particular mutein can be determined by one skilled in the art.
The subject muteins can be formulated into pharmaceutical compositions by admixture with a pharmaceutically acceptable nontoxic carrier. As explained above, such compositions may be prepared for use for parenteral (subcutaneous, intramuscular or intravenous) administration particularly in the form of liquid solutions or suspensions. The compositions may conveniently be administered in unit dosage form and may be prepared by any of the methods well known in the pharmaceutical art, for example, as described in Remington's Pharmaceutical Sciences, Mack Publishing Company, Easton, Pa. 1970. Formulations for parenteral administration may contain as common excipients sterile water or saline, polyalkylene glycols such as polyethylene glycol, oils of vegetable origin, hydrogenated naphthalenes and the like.
The materials of this invention can be employed as the sole active agent in a pharmaceutical or can be used in combination with other active ingredients. Other active ingredients can be selected, for example, from appropriate hematopoietins, CSFs and interleukins. These include GM-CSF, CSF-1, G-CSF, M-CSF, erythropoietin, IL-1α, IL-1β, IL-2, IL-4-IL-8, and tumor necrosis factor.
A number of tests are available for assaying the biological activity and potency of hIL-3 analogs of the invention. For example, the analog can be tested, using techniques well known in the art, to see if the protein stimulates colony formation by human hematopoietic progenitor cells. The colonies formed include erythroids, granulocytes, granulocyte macrophages, and mixed. Alternatively, the ability of the subject analogs to stimulate DNA synthesis by human acute myelogenous leukemia (AML) blasts, as evidenced, for example, by labeled thymidine uptake, can be used to indicate activity. AML proliferation assays are discussed further below. Finally, biological activity can be determined using an IL-3 receptor assay as described further in the Examples.
The biologically active polypeptide analogs of human IL-3 as provided by the present invention can be used for both therapeutic and diagnostic purposes. Therapeutic uses include the treatment and prevention of malignant and non-malignant disorders. For example, the subject muteins can be used in the treatment of cytopenias and/or immnosuppression due to infections, cytopenias due to chemotherapy and/or irradiation, bone disorders such as bone fractures and osteoporosis, immunodeficiencies due to general anaesthetic procedures, recovery following bone marrow transplantation, adjunct to vaccination and adjunctive therapy of infections.
Below are examples of specific embodiments for carrying out the present invention. The examples are offered for illustrative purposes only, and are not intended to limit the scope of the present invention in any way.
Experimental EXAMPLE 1 Construction of Expression Vectors
Construction of pGB/IL-336
In order to produce a polypeptide closely resembling the mature human IL-3, a construct was made lacking the 5' nontranslated and signal peptide encoding sequences. The IL-3 cDNA insert of pLH1 (see EP-A-0275598) was excised with HincII and HindIII, ligated to a synthetic oligonucleotide (SalI-overhang/blunt, 419/420, Table 1) comprising the sequence encoding the N-terminal 14 amino acids of the mature IL-3 and inserted into SalI-HindIII digested pTZ18R (Pharmacia). Following verification of the sequence, the complete insert was transferred to pUC8 for protein production (as described previously in WO 88/04691), resulting in plasmid pGB/IL-335. To allow for direct sequencing and mutagenesis, the PvuI fragment of plasmid pTZ18R carrying the fl-origin of replication was used to replace the corresponding PvuI fragment of pUC8. The resulting bacterial expression plasmid pGB/IL-336 gives rise to a fusion protein of 145 amino acids with a calculated mw of 16,384 dalton (FIG. 1).
Construction of pGB/IL-339
An alternative expression plasmid was constructed to facilitate efficient transfer of potentially interesting mutants into Bacillus expression vectors (see below). For this purpose, pGB/IL-336 was digested with HpaI and HindIII to remove most of the 3'-terminal part of the IL-3 cDNA. The protruding ends were made blunt and subsequently a blunt fragment carrying the corresponding IL-3 sequences (nt 137-497) and the B. licheniformis alpha-amylase terminator from plasmid pGB/IL-337 was ligated into it, resulting in plasmid pGB/IL-338. pGB/IL-337 had been constructed from pGB/IL-324 (as disclosed in EPA 0390252 which is incorporated herein by reference) by looping-out of 3' non-coding IL-3 cDNA and alpha-amylase structural sequences between the IL-3 stop codon in the cDNA and the alpha-amylase terminator, using a synthetic oligonucleotide (Table 1, 944). This oligonucleotide also introduced a XhoI site just downstream of the IL-3 stop codon. Plasmid pGB/IL-338 was digested with BamHI and HincII and part of the polylinker and 5'-terminal IL-3 sequences were substituted by the phosphorylated synthetic oligonucleotides 1055/1056 (Table 1) giving rise to plasmid pGB/IL-339. Thus, the IL-3 gene was reconstructed with a slightly modified heterologous signal peptide encoding sequence. A fusion protein of 148 aa with a calculated mw of 16,541 dalton was synthesized (FIG. 2). The DNA sequence of pGB/IL-339 was verified and found to be correct. The biological activity of the expressed fusion protein was found to be unaltered.
Another E. coli expression vector, pGB/IL-340, was constructed, in which the lacZ promoter is followed immediately by sequences encoding the Bacillus α-amylase signal peptide precisely fused to mature IL-3, with the amylase terminator downstream thereof. This plasmid, which also serves as an intermediate for the construction of Bacillus expression vectors, was constructed by introduction of the NdeI-KpnI fragment from pGB/IL-337, carrying all the sequences just mentioned, into the NdeI-KpnI-cleaved E. coli vector pTZ18RN. pTZ18RN is pTZ18R (Pharmacia) modified just upstream of the lacZ ATG start codon to introduce an NdeI site, using oligonucleotide 731 (see Table 1). pGB/IL-340 gives rise to high production of IL-3 in E. coli.
EXAMPLE 2 Construction of Deletion and Substitution Mutants
In vitro mutagenesis was performed using synthetic oligonucleotides (Table 1 and Table 2) according to the procedure developed by Kunkel et al. (1987) Meth. Enzymol. 154:367-382. Single-stranded template DNA was prepared by transformation of pGB/IL-336 or pGB/IL-339 DNA into E. coli strain CJ236 (BioRad) and superinfecton with M13K07 (Pharmacia) helper phage. Phage DNA was prepared according to standard procedures and fractionated on 0.6% low-melting agarose to remove the helper phage ssDNA. The excised band was melted and extracted with phenol. pGB/IL-336 or pGB/IL-339 ssDNA was recovered by butanol concentration and ethanol precipitation and tested for primer-dependent DNA synthesis in a sequencing reaction.
Purified pGB/IL-336 or pGB/IL-339 ssDNA (±100 ng) was annealed with 20 ng of phosphorylated primer at 65° C. and slowly cooled to room temperature. Synthesis of the complementary strand was performed using 1-2 μg of gene 32 protein, 4 units of T4-DNA polymerase and 2.5 units of T4-DNA ligase. Reaction was carried out at 0° C. for 5 min, at 20° C. for 10 min and at 37° C. for 90 min. After completion, one third of the reaction mixture was mixed with thawed competent (Hanahan, D. (1985) in: "DNA Cloning" (D. M. Glover ed.) Vol. 1, IRL Press, Washington) JM109 cells and plated. Individually picked colonies were used to inoculate liquid media and the cells were superinfected with the M13K07 helper phage to produce ssDNA. The sequence of the clones was verified using the M13 reverse sequencing primer and two IL-3 sequence specific primers (Table 1; 823: nt 118-137 and 824: nt 261-280).
The double cysteine mutant (9045) was constructed by ligation of the corresponding BstBI/BamHI fragments of the plasmids carrying the mutant IL-3 genes 904 and 905. Similarly, the combination mutants X and Z were constructed by ligation of fragments containing a 5' deletion and fragments containing a 3' deletion. Resulting clones were controlled by restriction enzyme analysis and sequence analysis.
Mutant 9329 was derived from 939 following HpaI and BamHI digestion and ligation with oligonucleotides 1424/1425. Clones were verified first for loss of the HpaI site and subsequently for correct DNA sequence.
From all transformants, plasmid DNA was isolated for a second round of transformation into JM109 cells to exclude potential contamination with the parental IL-3 construct. Following sequence verification, these clones were used for protein production.
Some of the mutants described here (811, 933 and 9329) were introduced into pGB/IL-340. This was done by ligating the PstI-XhoI fragment of a pGB/IL-339 derived mutant into PstI-XhoI cleaved pGB/IL-340, this resulted in plasmids pGB/IL-340/811, pGB/IL-340/933 and pGB/IL-340/9329.
Bacillus expression vectors for IL-3 muteins were constructed by exchanging the PstI-HindIII fragment of pGB/IL-322 (carrying part of the alpha-amylase signal peptide, the complete mature IL-3 cDNA sequence and the amylase terminator) with the PstI-HindIII fragment of a pGB/IL-340 mutant derivative (carrying part of the α-amylase signal peptide, the mutant IL-3 cDNA sequence and the α-amylase terminator). The Bacillus expression vectors for the muteins 811, 933 and 9329 were named pGB/IL-322/811, pGB/IL-322/933 and pGB/IL-322/9329, respectively.
Another mutant (1455 lacking amino acids 130-133) was constructed directly in pGB/IL-340 by loop-out mutagenesis, using oligonucleotide 1455 (Table 1), resulting in plasmid pGB/IL-340/1455. Subsequently, the mutant sequence was transferred to pGB/IL-322 in a similar way as described for mutants 811, 933 and 9329, resulting in plasmid pGB/IL-341.
                                  TABLE 1                                 
__________________________________________________________________________
Mutagenesis Oligonucleotides                                              
                                                      Amino Acids         
Code  Sequence (5' → 3')                       Involved            
__________________________________________________________________________
810   AACTGCTCTAACATGCCTTTGCCTTTGCTG SEQ ID NO:1      20-30               
811   CACTTAAAGCAGCCAGAAAATAACCTTCGA SEQ ID NO:2      31-49               
812   ATGGAAAATAACCTTAACAGGGCTGTCAAG SEQ ID NO:3      54-61               
813   TTCAACAGGGCTGTCCTCCTGCCATGTCTG SEQ ID NO:4      66-80               
820   AATCTCCTGCCATGTGCACCCACGCGACAT SEQ ID NO:5      85-90               
821   ACGGCCGCACCCACGGACTGGAATGAATTC SEQ ID NO:6       94-102             
822   GGTGACTGGAATGAAAATGCGCAGGCTCAA SEQ ID NO:7      107-119             
904                                                                       
       ##STR1##                                       Ala 16              
905                                                                       
       ##STR2##                                       Ala 84              
932   CGGGGATCCGTCGACAACTGCTCTAACATG SEQ ID NO:10      1-14               
933   ATAACACACTTAAAGAACAACCTCAATGGG SEQ ID NO:11     29-37               
934   GGGGAAGACCAAGACAGGCCAAACCTGGAG SEQ ID NO:12     47-54               
935   AGGCCAAACCTGGAGGCATCAGCAATTGAG SEQ ID NO:13     60-70               
936   GCATCAGCAATTGAGTGTCTGCCCCTGGCC SEQ ID NO:14     76-83               
937   TGTCTGCCCCTGGCCCCAATCCATATCAAG SEQ ID NO:15     89-95               
938   CATATCAAGGACGGTACGTTCTATCTGAAA SEQ ID NO:16     103-111             
939   CTGAAAACCCTTGAGGCGATCTTTTGAGTC SEQ ID NO:17     120-130             
823   CCTTGAAGACAAGCTGGGTT SEQ ID NO:18                                   
824   CCAAACCTGGAGGCATTCAA SEQ ID NO:19                                   
419   TCGACGCTCCCATGACCCAGACAACGCCCTTGAAGACAAGCTGGGTT SEQ ID NO:20        
420   AACCCAGCTTGTCTTCAAGGGCGTTGTCTGGGTCATGGGAGCG SEQ ID NO:21            
731   CAGGAAACACATATGACCATGATT SEQ ID NO:22                               
944   TGAGCCTCGCGATCTTTTGACTCGAGTAGAAGAGCAGAGAGGACGG SEQ ID NO:23         
1055  GATCCTCTGCAGCAGCGGCGGCTCCCATGACCCAGACAACGCCCTTGAAG-                 
      ACAAGCTGGGTT SEQ ID NO:24                                           
1056  AACCCAGCTTGTCTTCAAGGGCGTTGTCTGGGTCATGGGAGCCGCCGCTG-                 
      CTGCAGAG SEQ ID NO:25                                               
1424  GATCCTCTGCAGCAGCGGCG SEQ ID NO:26                                   
1425  CGCCGCTGCTGCAGAG SEQ ID NO:27                                       
1455  CTCAACAGACGACTTTGAGCTGACTCGAGTAGAAGAGCAGAG SEQ ID                   
__________________________________________________________________________
      NO:28                                                               
  indicates nucleotide next to the deletion in the IL3 gene.              
 *indicates nucleotide substitutions in the IL3 sequence.                 
                                  TABLE 2                                 
__________________________________________________________________________
Oligonucleotides for Substitution Mutagenesis                             
                                             Amino Acids                  
Code Sequence (5' → 3')               Involved                     
__________________________________________________________________________
 904 GACAAGCTGGGTTAACGCTAGCAACATGATCGATGAA SEQ ID NO:29                   
                                             16                           
 905 CTTAAAAATCTCCTGCCGGCGCTGCCCCTGGCCACGG SEQ ID NO:30                   
                                             84                           
1480 TTGCCTTTGCTGCGCTTCAACAACCTC SEQ ID NO:31                             
                                             36                           
1481 AACCTCAATGGGAAACGCCAAGACATTCTG SEQ ID NO:22                          
                                             43-44                        
1482 GGGGAAGACCAACGCATTCTGATGGAA SEQ ID NO:33                             
                                             46                           
1483 GACATTCTGATGAAAAATAACCTTCGA SEQ ID NO:34                             
                                             50                           
1484 GAAAATAACCTTGAAGATCCAAACCTGGAG SEQ ID NO:35                          
                                             54-55                        
1485 AGGCCAAACCTGAAAGCATTCAACAGG SEQ ID NO:36                             
                                             59                           
1486 GAGGCATTCAACCCGGGCGTCAAGAGTTTA SEQ ID NO:37                          
                                             63-64                        
1487 GCATCAGCAATT[C/G]GTAGCATTCTTAAA SEQ ID NO:38                         
                                             75                           
1488 GAGAGCATTCTTGAAAATCTCCTGCCA SEQ ID NO:39                             
                                             79                           
1489 GCCGCACCCACGCCGCATCCAATCCAT SEQ ID NO:40                             
                                             94                           
1490 CGACATCCAATCGAAATCGATCAGGGTGACTGGAAT SEQ ID NO:41                    
                                              98-101                      
1491 GGTGACTGGAATAAATTCCCGGAGGAAA SEQ ID NO:42                            
                                             106                          
1492 TGGAATGAATTCGAAGATGAACTGACGTTCTAT SEQ ID NO:43                       
                                             108-110                      
1493 AGGAAACTGACGGCGACCCTGAAAACCCTT SEQ ID NO:44                          
                                             113-114                      
__________________________________________________________________________
EXAMPLE 3 Purification of IL-3 Muteins from E. coli and B. licheniformis
E. coli JM109 cultures (100 ml) were inoculated with 0.5 ml of a fresh overnight culture of the (mutant) IL-3 clone and grown at 37° C. until an OD of 0.4-0.6 at 550 nm was reached. Plasmid-directed protein synthesis was induced by addition of 1 mM of IPTG (Pharmacia). After an additional culture for 3-16 hours, the cells were collected by centrifugation (10 min, 4000 rpm at 4° C.) and stored frozen.
The bacteria were suspended in 10 ml of TE (10 mM Tris-HCl pH 8; 1 mM EDTA) and lysozyme was added (0.025%=500 μg/ml). Following incubation for 30 min at room temperature, MgCl2 and DNase were added to final concentrations of 10 mM and 20 μg/ml, respectively. After incubation at 37° C. for 15 min, Tween 20 (0.2%), DTT (2 mM) and PMSF (0.1 mM) were added. The suspension was cooled on ice and vigorously sonified (two times, 35 sec.). The homogenate was clarified by centrifugation (30 min. 15,000× g, 10,000 rpm in a Beckman JS13.1 rotor) at 4° C. and the supernatant was discarded.
The pellet was resuspended in 4 ml of 55% sucrose in buffer TPD (50 mM Tris-HCl, pH 8; 0.1 mM PMSF and 2 mM DTT) by sonification and layered onto a discontinuous sucrose gradient (2 ml portions of 75% and 60% of sucrose in TPD buffer), essentially as described in WO 88/00598. Following centrifugation at 200,000× g (35,000 rpm in a Sorvall TH641 rotor) at 25° C. for 2 hours, the inclusion bodies containing the IL-3 proteins were recovered from the 75% sucrose interphase.
After at least 4-fold dilution, the inclusion bodies were pelleted at 25,000× g (30 min at 13,000 rpm in the Beckman JS13.1 rotor) and sonificated in 5 ml of 8M urea containing 50 mM Tris-HCl pH 8.9 and 2 mM DTT and left overnight at 4° C. The clarified solution was subsequently applied to a 3 ml DEAE-Sepharose Fast Flow column (Pharmacia), equilibrated with 8M urea, 50 mM Tris-HCl pH 8.9 and 1 mM DTT buffer. The IL-3 protein was bound to the column and step eluted with 75 mM NaCl in the same buffer. The eluted protein was dialyzed against several portions of 10 mM Tris-HCl pH 8.0 and 1 mM DTT buffer and made isotonic by adding 10-fold concentrated RPMI cell culture medium (Sigma) containing 1% bovine serum albumin. The filter sterilized (0.22 μm Millex-GV, Millipore) solution was used for biochemical and biological characterization.
Mutant proteins 811, 933, 1455 and 9329, X and Z, produced by Bacillus were secreted into the culture medium and did not require such drastic purification procedures for testing of biological activity. Therefore, the clarified supernatant (1 liter) (adjusted to 5 mM EDTA, 1 mM PMSF and 1M ammonium sulfate) was passed over a 15-20 ml Fractogel TSK Butyl 650 (C) column (Merck) equilibrated with 1M ammonium sulfate in 10 mM Tris-HCl pH 7.0 buffer. The bound IL-3 protein was eluted with 10 mM Tris-HCl buffer and subsequently passed over a 1.5 ml DEAE-Sepharose Fast Flow column equilibrated with 10 mM Tris-HCl pH 8.0 buffer. The flow-through was collected and adjusted to 70% ammonium sulfate to concentrate the IL-3 protein. The precipitate was collected by centrifugation at 10,000 rpm (JS-13 rotor), dissolved and dialyzed against 10 mM Tris-HCl pH 8.0, 1 mM DTT buffer.
Samples corresponding to 25-100 μl of the original bacterial culture were analyzed on 0.75×75×100 mm (BioRad miniprotean II) 13.5% SDS-polyacrylamide gels (acryl/bisacryl=29/1). Proteins were visualized by either Coomassie Brilliant Blue G250 staining or immunological methods. FIG. 3 shows an example of purified muteins expressed in E. coli.
The expression in E. coli of mutant pGB/IL-339 derived IL-3 proteins was generally higher than the same mutant protein from the pGB/IL-336 expression vector. The applied purification procedure was not devised to render completely pure IL-3 protein preparations. In general, minor higher molecular weight contaminants were observed on SDS gels. Using densitometric scanning of stained SDS gels, the amount of IL-3 protein was determined. Although occasionally severe loss of protein occurred following dialysis, total recovery was generally 0.1-1 mg of "purified" IL-3 protein. The only exception were the mutants 811 and 933, which gave no fusion protein production in either of the E. coli expression vectors. Northern analysis indicated a strong reduction of IL-3 specific RNA in the bacteria, whereas no significant difference in the plasmid DNA content was observed. This result suggests that probably mRNA stability is decreased through the deletions introduced in the eukaryotic IL-3 cDNA sequence.
The only convenient method for synthesis of the muteins 811 and 933 is expression in Bacillus licheniformis. Although the amount of protein produced is very low compared to the amount of protein produced by Bacillus strains synthesizing other muteins such as 9329 and 1455, enough is made to purify the muteins 811 and 933 in sufficient quantities to carry out the biological assays described herein.
EXAMPLE 4 Immunological Characterization of the IL-3 Muteins
Preparation of polyclonal and monoclonal antisera has been described in WO 88/04691.
For immunological detection of IL-3 muteins, the gel fractionated proteins (see Example 3) were transferred onto nitrocellulose (0.2 μm, Schleicher and Schuell BA83) using the semi-dry blotting system (Novablot, Pharmacia/LKB) with a continuous buffer system (39 mM glycine, 48 mM Tris, 0.0375% SDS and 20% methanol) at 1.2 mA/cm2 for 90 min. The nitrocellulose filter was subsequently air dried, preincubated with a 3% bovine serum albumin (BSA, Sigma) solution (10 mM Tris-HCl pH 7.6; 350 mM NaCl; 0.1% PMSF and 0.1% sodium azide) and incubated for 4-16 hr with the polyclonal (10-3 dilution) or a mixture of monoclonal antibodies directed against human IL-3 (MCA A1, A4, A5, A8, A18 at 10-4 dilution) in RIA buffer (10 mM Tris/HCl pH 7.6; 150 mM NaCl; 1% Triton X-100; 0.1% SDS; 0.5% Na-deoxycholate; 0.1 mM PMSF and 0.3% BSA). Immunological complexes were visualized using biotinylated anti-rabbit or mouse Ig, streptavidinbiotinylated horseradish peroxidase (Amersham International, Amersham, UK) and 4-chloro-1-naphtol (Gibco-BRL) according to the protocols provided by the manufacturer.
Alternatively, antiserum incubations were performed in Tris-buffered saline plus 0.05% Tween 20. Alkaline phosphatase-linked anti-mouse Ig complexes were visualized according to standard protocols (Promega).
The data, pertaining to the interaction of specific monoclonal antibodies with hIL-3 muteins in western blotting experiments, are presented in Table 3.
                                  TABLE 3                                 
__________________________________________________________________________
Evaluation of IL-3/MCA Data                                               
__________________________________________________________________________
MUTANT                                                                    
(AA)  4810                                                                
          933 811 934 812 935 4813                                        
                                  ALL                                     
MCA   20-30                                                               
          29-37                                                           
              31-49                                                       
                  47-54                                                   
                      54-61                                               
                          60-70                                           
                              66-80                                       
                                  OTHER                                   
__________________________________________________________________________
A1    ++  - - - - ++  ++  ++  ++  ++                                      
A4    ++  ++  ++  ++  +   +   +   ++                                      
A5    ++  ++  - - - - +   ++  ++  ++                                      
A8    ++  ++  - - ++  ++  ++  ++  ++                                      
A18   ++  - - - - ++  ++  ++  ++  ++                                      
 2    ++  - - - - ++  ++  ++  ++  ++                                      
 3    ++  ++  - - - - +   ++  ++  ++                                      
 6    ++  ++  - - +   ++  ++  ++  ++                                      
10    ++  ++  - - +   ++  ++  ++  ++                                      
12    ++  - - - - ++  ++  ++  ++  ++                                      
13    +   - - - - ++  ++  +   +   ++                                      
14    ++  ++  - - - - +   ++  ++  ++                                      
15    ++  - - - - ++  ++  ++  ++  ++                                      
26    ++  ++  -  -                                                        
                  +   ++  ++  ++  ++                                      
27    ++  ++  ++  ++  +   +   +   ++                                      
32    ++  - - - - ++  ++  ++  ++  ++                                      
33    ++  - - - - ++  ++  ++  ++  ++                                      
__________________________________________________________________________
      36D→R 43ED→KR                                         
                         46D→R                                     
      1480         1481  1482                                             
__________________________________________________________________________
A1    ++           ++    ++                                               
A4    ++           ++    ++                                               
A5    ++           ++    - -                                              
A8    ++           - -   +                                                
A18   +            ++    ++                                               
__________________________________________________________________________
 A: ascites monoclonals                                                   
 ++: full response on western blot                                        
 +: at least 5fold reduced response                                       
 - -: no reaction observed                                                
From a review of Table 3, it is apparent that the majority of the monoclonal antibodies raised against the gel-purified denatured fusion protein are directed against epitopes located between residues 30 and 50 of the mature IL-3 polypeptide. These epitopes mostly reflect linear polypeptide chains, only one example (13) of a discontinuous epitope has been identified. The largest group is capable of identifying the 933 mutant, but fails to react with the 811 mutant. Thus, the epitope must reside between residues 37 and 50. This region is highly hydrophilic with a postulated β-turn and α-helix (DNASIS software) and was proposed to be an antigenic determinant using Hopp and Wood algorithm. The second group of antibodies is characterized by the absence of reaction with mutant 933 (which lacks 9 amino acids). This hydrophobic, proline-rich coil region is not predicted to be a major antigenic site.
More refined localization of these epitopes comes from reaction of the ascites monoclonals with the following substitution mutants: Asp36 →Arg, Glu43 Asp→Lys43 Arg and Asp46 →Arg.
Further characterization of the ascites monoclonals by double sandwich ELISA revealed lack of interference between A1 and A5 or A8, and between A5 and A18. Competition ELISA showed cross-competition between A1 and A18, between A5 and A8, and between A8 and A18. No cross-competition was observed with A4. These data are in agreement with the immunoblotting experiments. Furthermore, ascites antibodies were found to react with hIL-3 preparations from mammalian, bacterial and yeast cultures, irrespective of glycosylation state.
From the combined information of these immunological tests epitopes can be localized as follows:
A1 and A18 are aimed against an epitope localized between amino acids 29 and 37. Furthermore, from the 36 D→R mutant it can be concluded that the A18 epitope is localized somewhat more toward the C-terminus than the A1 epitope.
A5 is aimed against an epitope localized between amino acids 45 and 54.
A8 is aimed against an epitope localized between amino acids 36 and 47.
EXAMPLE 5 Biological characterization of the IL-3 Muteins
A. AML DNA synthesis
AML DNA synthesis was tested on human AML193 cells as follows. Human AML193 cells (ATCC: CRL-9589) were maintained in Serum Free Medium (SFM), (Iscove's Modified Dulbecco's Medium (Gibco BRL) containing 0.1% BSA (Behringwerke AG, Marburg), 10 μg/ml of Insulin (Organon) and Transferrin, 0.1 mM beta-mercaptoethanol) and 10 to 20 units of human IL-3.
Dilutions of (mutant) IL-3 preparations were prepared (50 μl) in round bottom 96 well plates in SFM. Washed cells (1-2×104 in 50 μl SFM) were added and cultured for 6 days. 3 H-Thymidine (0.1 uCi, 2 uCI/mmol) was added in 20 μl and cells were harvested 16 hours later. A unit of IL-3 activity was defined as the amount required to give 50% of maximal DNA synthesis in this assay. For the reference IL-3 preparation, the specific activity varied between 2×106 to 2×107 Units per mg protein. In general, the biological activity of the muteins was compared to this reference preparation.
FIG. 4 shows an example of the AML proliferation assay in which mutein 812 is compared with the reference IL-3 expressed in Bacillus. The graph shows that the mutein 812 has an activity which is reduced by about 4 orders of magnitude with respect to unmodified IL-3. However, the mutein is still able to stimulate the AML cells to maximal activity, only more protein is needed.
B. IL-3 receptor assay
An IL-3 receptor binding assay was performed with purified recombinant hIL-3 (see EPA 0390252) was radiolabeled with the Bolton-Hunter reagent (as described by Budel et al., Blood 74 (1989) 565-571). The specific activity was estimated at 80,000 cpm/ng of IL-3. As target, either donor leukocytes, patient AML cells, or MV4-11 (ATCC: CRL-9591) cells were used. Cells were washed in Hanks Balanced Salt solution and suspended in Alpha-MEM plus 1% BSA. Usually, 3-10×106 cells were incubated with 200-300 pM of radiolabeled IL-3 and various concentrations of unlabeled mutant protein in a total volume of 200 μl for 1 hr at 37° C. Cell-bound labeled IL-3 was centrifuged for 10 min at 1000 ×g at 4° C. through a 0.5 ml cushion of bovine calf serum in an Eppendorf tube (Budel et al., 1989). The tubes were frozen in liquid nitrogen and the tips cut off for counting in a Packard gamma counter. Competition binding was determined relative to the reference preparation. FIG. 5 shows an example of an IL-3 receptor binding experiment. Radiolabeled IL-3 binding to patient AML blasts is competed with unlabeled IL-3 protein (reference preparation). Due to the low number of receptors (less than 200) on the target cells, data for competition mostly varied by one order of magnitude.
The results from the above assays are presented in Table 4. The biological activity of the deletion mutants and the Cys→Ala substitution mutants is graphically presented in FIG. 6.
As can be seen, IL-3 fusion proteins derived from both pGB/IL-336 and pGB/IL-339 expression plasmids were identical in biological activity and were not significantly different from the B. licheniformis reference preparation derived from expression of the full-length IL-3 cDNA in pGB/IL-322 (see EPA 0390252). Apparently, no negative effect on the biological activity is exerted by the heterologous leader peptide in the E. coli fusion proteins. Most IL-3 deletion mutants were significantly reduced in biological activity. Deletions between amino acids 50 and 105 resulted in more than 10,000-fold reduction in specific activity. However, in all cases, residual biological activity was detected, indicating the sensitivity of the bio-assay and the absence of toxic components in the protein preparations. Complete recovery of biological activity was observed for deletion mutants 932 (1-14) and 939 (120-130) and the corresponding double mutant 9329 as well as for the C-terminal mutant 1455. The deleted N- and C-terminal sequences are apparently not involved in binding to the receptor or proper folding of the molecule. In contrast, single substitutions of the cysteine residues (mutants 904 and 905) resulted in a 5,000-fold reduction of biological activity. Similar effects were seen with a double cysteine mutant (9045), indicating that the S--S bridge plays an important stabilizing role in the native IL- 3 molecule.
The muteins expressed in E. coli described above are all fusion proteins. To provide evidence that the extra N-terminal amino acids are not necessary as compensation for the loss of the deleted IL-3 specific amino acids, construct pGB/IL-322/9329 was made and expressed in B. licheniformis. This construct gives rise to a 1-14/ 120-130 IL-3 mutein without any extra amino acids at the N-terminus. The activity of this mutein is comparable to the wild-type molecule proving that only the residual 108 amino acids are responsible for the IL-3 activity.
Receptor binding of most of the mutant IL-3 proteins was determined. The binding experiments do not allow for detailed comparison of receptor binding activity due to the low receptor numbers on the target cells. However, in general there is a good correlation between biological activity and receptor binding (Table 4). For most mutant IL-3 proteins, the ratio between relative binding and biological activity is approximately 1. The muteins 1483, 488, 904 and 9045 show considerably higher ratios (Table 4 and FIG. 6), indicating potential antagonistic activity. This means that these molecules can be regarded as partial antagonists of IL-3. Upon further experimentation, muteins may be found that have the same binding capacity as native IL-3 but that has a 104 -fold lower activity. Those molecules would be true antagonists of IL-3. The approach described in this invention provides the means and methods to obtain such molecules.
              TABLE 4                                                     
______________________________________                                    
Biological Activities of IL-3 Mutants                                     
                                RELATIVE                                  
MU-   AMINO ACID    REL. SPEC.  ANTAG-                                    
TANT  DELETION OR   BIOLOGICAL  ONISTIC                                   
CODE  SUBSTITUTION.sup.1                                                  
                    ACTIVITY.sup.2                                        
                                POTENTIAL.sup.3                           
______________________________________                                    
Ref.                1.0                                                   
pGB/                3.7 × 10.sup.-1                                 
IL-339                                                                    
pGB/                7.9 × 10.sup.-1                                 
                                1.1 (0.2-3.3)                             
IL-336                                                                    
932   1-14          7.1 × 10.sup.-1                                 
                                2.8 (0.6-4.9)                             
810   20-30         2.1 × 10.sup.-3                                 
                                2.4                                       
934   47-54         7.3 × 10.sup.-5                                 
                                N.C.                                      
812   54-61         5.3 × 10.sup.-5                                 
                                1.2 (0.9-1.4)                             
935   60-70         1.2 × 10.sup.-5                                 
                                N.C.                                      
813   66-80         2.4 × 10.sup.-5                                 
                                N.C.                                      
936   76-83         6.4 × 10.sup.-6                                 
                                N.C.                                      
820   85-90         1.1 × 10.sup.-5                                 
                                N.C.                                      
937   89-95         1.0 × 10.sup.-5                                 
                                N.C.                                      
821   94-102        1.8 × 10.sup.-5                                 
                                N.C.                                      
938   103-111       6.6 × 10.sup.-5                                 
                                N.C.                                      
822   107-119       2.1 × 10.sup.-4                                 
                                1.9 (0.6-3.9)                             
939   120-130       2.0         1.8 (0.3-2.8)                             
9329  1-14/120-130  4.0 × 10.sup.-1                                 
                                2.0 (1.8-2.1)                             
904   16C → A                                                      
                    2.4 × 10.sup.-4                                 
                                100 (33-210)                              
905   84C → A                                                      
                    1.9 × 10.sup.-4                                 
                                11 (4.8-38)                               
9045  16/84C → A                                                   
                    3.1 × 10.sup.-4                                 
                                88 (13-170)                               
1480* 36D → R                                                      
                    3.1 × 10.sup.-3                                 
                                12                                        
1481  43ED → KR                                                    
                    <1.5 × 10.sup.-4                                
                                N.C.                                      
1482* 46D → R                                                      
                    7.5 × 10.sup.-3                                 
                                0.6                                       
1483  50E → K                                                      
                    2.7 × 10.sup.-3                                 
                                37 (4-67)                                 
1484  54RR → ED                                                    
                    8.0 × 10.sup.-5                                 
                                3.5 (2.3-4.7)                             
1485* 59E → K                                                      
                    1.1 × 10.sup.-2                                 
                                3                                         
1486  63RA → PG                                                    
                    9.8 × 10.sup.-5                                 
                                14 (3.5-27)                               
1487A*                                                                    
      75E → G                                                      
                    1.5 × 10.sup.-2                                 
                                3                                         
1487B*                                                                    
      75E → R                                                      
                    8.6 × 10.sup.-3                                 
                                3                                         
1488  79K → E                                                      
                    1.9 × 10.sup.-3                                 
                                65 (54-77)                                
1489  94R → P                                                      
                    1.7 × 10.sup.-3                                 
                                N.C.                                      
1490* 98HIKD →  EIKQ                                               
                    2.2 × 10.sup.-3                                 
                                5                                         
1491* 106E → K                                                     
                    3.2 × 10.sup.-4                                 
                                6                                         
1492  108RRK → EDE                                                 
                    3.1 × 10.sup.-5                                 
                                2 (1.2-3)                                 
1493  113FY → AT                                                   
                    <1.2 × 10.sup.-5                                
                                N.C.                                      
X     1-14/120-133  2.3 × 10.sup.-1                                 
                                8.9 (3.6-14)                              
Z     1/14/116-133  1.1 × 10.sup.-1                                 
                                1.6 (1-1.9)                               
933   29-37         5.7 × 10.sup.-3                                 
                                1.1 (0.2-2.9)                             
811   31-49         4.8 × 10.sup.-3                                 
                                1.6 (0.5-3.2)                             
______________________________________                                    
 .sup.1 Deletion between amino acid numbers of mature human IL3 is        
 indicated. Substitutions of amino acids are indicated in single letter   
 code.                                                                    
 .sup.2 Median specific biological activity is expressed relative to the  
 reference IL3 preparations.                                              
 .sup.3 Antagonistic potential is represented as relative receptor binding
 activity divided by relative biological activity. The range is presented 
 between brackets.                                                        
 N.C. No competition was observed for the particular mutein preparation.  
 *Inclusion bodies were pelleted from sucrose solutions and solubilized in
 urea. Muteins were diluted in medium and tested for biological activity. 
 Receptor binding experiments were performed once.                        
   Mutein protein concentration was too low for densitometric scanning and
 was estimated from gels and western blots.                               
   Mutant proteins were expressed in Bacillus and lack a leader polypeptid
 sequence.                                                                
All publications (including patents and patent applications) mentioned in this specification are indicative to the level of skill of those skilled in the art to which this invention pertains. All publications are herein incorporated by reference to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference.
Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be apparent to one of ordinary skill in the art that many changes and modifications can be made thereto without departing from the spirit or scope of the appended claims.
__________________________________________________________________________
SEQUENCE LISTING                                                          
(1) GENERAL INFORMATION:                                                  
(iii) NUMBER OF SEQUENCES: 48                                             
(2) INFORMATION FOR SEQ ID NO:1:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 30 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:                                   
AACTGCTCTAA CATGCCTTTGCCTTTGCTG30                                         
(2) INFORMATION FOR SEQ ID NO:2:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 30 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:                                   
CACTTAAAGCAGCCAG AAAATAACCTTCGA30                                         
(2) INFORMATION FOR SEQ ID NO:3:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 30 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:                                   
ATGGAAAATAACCTTAACAG GGCTGTCAAG30                                         
(2) INFORMATION FOR SEQ ID NO:4:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 30 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:                                   
TTCAACAGGGCTGTCCTCCTGCCAT GTCTG30                                         
(2) INFORMATION FOR SEQ ID NO:5:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 30 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:                                   
AATCTCCTGCCATGTGCACCCACGCGACAT 30                                         
(2) INFORMATION FOR SEQ ID NO:6:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 30 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:                                   
ACGGCCGCACCCACGGACTGGAATGAATTC 30                                         
(2) INFORMATION FOR SEQ ID NO:7:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 30 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:                                   
GGTGACTGGAATGAAAATGCGCAGGCTCAA 30                                         
(2) INFORMATION FOR SEQ ID NO:8:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 37 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:                                   
GACAAGCTGGGTTAACGCTAGCAACATGATCGATGAA 37                                  
(2) INFORMATION FOR SEQ ID NO:9:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 37 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:                                   
CTTAAAAATCTCCTGCCGGCGCTGCCCCTGGCCACGG 37                                  
(2) INFORMATION FOR SEQ ID NO:10:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 30 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:                                  
CGGGGATCCGTCGACAACTGCTCTAACATG 30                                         
(2) INFORMATION FOR SEQ ID NO:11:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 30 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:                                  
ATAACACACTTAAAGAACAACCTCAATGGG 30                                         
(2) INFORMATION FOR SEQ ID NO:12:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 30 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:                                  
GGGGAAGACCAAGACAGGCCAAACCTGGAG 30                                         
(2) INFORMATION FOR SEQ ID NO:13:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 30 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:                                  
AGGCCAAACCTGGAGGCATCAGCAATTGAG30                                          
(2) INFORMATION FOR SEQ ID NO:14:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 30 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:                                  
GCATCAGCAATTGAGTGTCTGCCCCTGGCC30                                          
 (2) INFORMATION FOR SEQ ID NO:15:                                        
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 30 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:                                  
TGTCTGCCCCTGGCCCCAATCCATATCAAG30                                          
(2) INFORMATION FOR SEQ ID NO:16:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 30 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:                                  
CATATCAAGGACGGTACGTTCTATCTGAAA30                                          
(2) INFORMATION FOR SEQ ID NO:17:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 30 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:                                  
CTGAAAACCCTTGAGGCGATCTTTTGAGTC30                                          
(2) INFORMATION FOR SEQ ID NO:18:                                         
 (i) SEQUENCE CHARACTERISTICS:                                            
(A) LENGTH: 20 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:                                  
CCTTGAAGACAAGCTGGGTT20                                                    
(2) INFORMATION FOR SEQ ID NO:19:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 20 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:19:                                  
CCAAACCTGGAGGCATTCAA20                                                    
(2) INFORMATION FOR SEQ ID NO:20:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
 (A) LENGTH: 47 base pairs                                                
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:                                  
TCGACGCTCCCATGACCCAGACAACGCCCTTGAAGACAAGCTGGGTT47                         
(2) INFORMATION FOR SEQ ID NO:21:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
 (A) LENGTH: 43 base pairs                                                
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:                                  
AACCCAGCTTGTCTTCAAGGGCGTTGTCTGGGTCATGGGAGCG43                             
(2) INFORMATION FOR SEQ ID NO:22:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
 (A) LENGTH: 24 base pairs                                                
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:22:                                  
CAGGAAACACATATGACCATGATT24                                                
(2) INFORMATION FOR SEQ ID NO:23:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 46 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:                                  
TGAGCCTCGCGATCTTTTGACTCGAGTAGAAGAGCAGAGAGGACGG46                          
(2) INFORMATION FOR SEQ ID NO:24:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 62 base pairs                                                 
 (B) TYPE: nucleic acid                                                   
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:24:                                  
GATCCTCTGCAGCAGCGGCGGCTCCCATGACCCAGACAACGCCCTTGAAGACAAGCTGGG60            
TT 62                                                                     
(2) INFORMATION FOR SEQ ID NO:25:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 58 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:25:                                  
AACCCAGCTTGTCTTCAAGGGCGTTGTCTGGGTCATGGGAGCCGCCGCTGC TGCAGAG58             
(2) INFORMATION FOR SEQ ID NO:26:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 20 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:26:                                  
GATCCTCTGCAGCAGCGGCG 20                                                   
(2) INFORMATION FOR SEQ ID NO:27:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 16 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:27:                                  
CGCCGCTGCTGCAGAG 16                                                       
(2) INFORMATION FOR SEQ ID NO:28:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 42 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:28:                                  
CTCAACAGACGACTTTGAGCTGACTCGAGTAGAAGAGCAGAG4 2                             
(2) INFORMATION FOR SEQ ID NO:29:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 37 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:29:                                  
GACAAGCTGGGTTAACGCTAGCAACATGATCGATGAA37                                   
 (2) INFORMATION FOR SEQ ID NO:30:                                        
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 37 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:30:                                  
CTTAAAAATCTCCTGCCGGCGCTGCCCCTGGCCACGG37                                   
(2) INFORMATION FOR SEQ ID NO:31:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 27 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:31:                                  
TTGCCTTTGCTGCGCTTCAACAACCTC27                                             
(2) INFORMATION FOR SEQ ID NO:32:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 30 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:32:                                  
AACCTCAATGGGAAACGCCAAGACATTCTG30                                          
(2) INFORMATION FOR SEQ ID NO:33:                                         
 (i) SEQUENCE CHARACTERISTICS:                                            
(A) LENGTH: 27 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:33:                                  
GGGGAAGACCAACGCATTCTGATGGAA27                                             
(2) INFORMATION FOR SEQ ID NO:34:                                         
(i ) SEQUENCE CHARACTERISTICS:                                            
(A) LENGTH: 27 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:34:                                  
GACATTCTGATGAAAAATAACCTTCGA27                                             
(2) INFORMATION FOR SEQ ID NO:35:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
 (A) LENGTH: 30 base pairs                                                
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:35:                                  
GAAAATAACCTTGAAGATCCAAACCTGGAG30                                          
(2) INFORMATION FOR SEQ ID NO:36:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
 (A) LENGTH: 27 base pairs                                                
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:36:                                  
AGGCCAAACCTGAAAGCATTCAACAGG27                                             
(2) INFORMATION FOR SEQ ID NO:37:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
 (A) LENGTH: 30 base pairs                                                
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:37:                                  
GAGGCATTCAACCCGGGCGTCAAGAGTTTA30                                          
(2) INFORMATION FOR SEQ ID NO:38:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 27 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:38:                                  
GCATCAGCAATTSGTAGCATTCTTAAA27                                             
(2) INFORMATION FOR SEQ ID NO:39:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 27 base pairs                                                 
 (B) TYPE: nucleic acid                                                   
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:39:                                  
GAGAGCATTCTTGAAAATCTCCTGCCA27                                             
(2) INFORMATION FOR SEQ ID NO:40:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 27 base pairs                                                 
 (B) TYPE: nucleic acid                                                   
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:40:                                  
GCCGCACCCACGCCGCATCCAATCCAT27                                             
(2) INFORMATION FOR SEQ ID NO:41:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 36 base pairs                                                 
 (B) TYPE: nucleic acid                                                   
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:41:                                  
CGACATCCAATCGAAATCGATCAGGGTGACTGGAAT36                                    
(2) INFORMATION FOR SEQ ID NO:42:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 28 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:42:                                  
GGTGACTGGAATAAATTCCCGGAGGAAA28                                            
(2) INFORMATION FOR SEQ ID NO:43:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 33 base pairs                                                 
(B) TYPE: nucleic acid                                                    
 (C) STRANDEDNESS: single                                                 
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:43:                                  
TGGAATGAATTCGAAGATGAACTGACGTTCTAT33                                       
(2) INFORMATION FOR SEQ ID NO:44:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 30 base pairs                                                 
(B) TYPE: nucleic acid                                                    
 (C) STRANDEDNESS: single                                                 
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:44:                                  
AGGAAACTGACGGCGACCCTGAAAACCCTT30                                          
(2) INFORMATION FOR SEQ ID NO:45:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 596 base pairs                                                
(B) TYPE: nucleic acid                                                    
 (C) STRANDEDNESS: single                                                 
(D) TOPOLOGY: linear                                                      
(ix) FEATURE:                                                             
(A) NAME/KEY: CDS                                                         
(B) LOCATION: 1..435                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:45:                                  
ATGACCATGATTACGAATTCCCGGGGATCCGTCGACGCTCCCATGACC48                        
MetThrMetIleThrAsnSerArg GlySerValAspAlaProMetThr                         
151015                                                                    
CAGACAACGCCCTTGAAGACAAGCTGGGTTAACTGCTCTAACATGATC96                        
GlnThrThrProLeuLysThr SerTrpValAsnCysSerAsnMetIle                         
202530                                                                    
GATGAAATTATAACACACTTAAAGCAGCCACCTTTGCCTTTGCTGGAC144                       
AspGluIleIleThrHisLeu LysGlnProProLeuProLeuLeuAsp                         
354045                                                                    
TTCAACAACCTCAATGGGGAAGACCAAGACATTCTGATGGAAAATAAC192                       
PheAsnAsnLeuAsnGlyGluAsp GlnAspIleLeuMetGluAsnAsn                         
505560                                                                    
CTTCGAAGGCCAAACCTGGAGGCATTCAACAGGGCTGTCAAGAGTTTA240                       
LeuArgArgProAsnLeuGluAlaPheAsn ArgAlaValLysSerLeu                         
65707580                                                                  
CAGAACGCATCAGCAATTGAGAGCATTCTTAAAAATCTCCTGCCATGT288                       
GlnAsnAlaSerAlaIleGluSer IleLeuLysAsnLeuLeuProCys                         
859095                                                                    
CTGCCCCTGGCCACGGCCGCACCCACGCGACATCCAATCCATATCAAG336                       
LeuProLeuAlaThrAlaAla ProThrArgHisProIleHisIleLys                         
100105110                                                                 
GACGGTGACTGGAATGAATTCCGGAGGAAACTGACGTTCTATCTGAAA384                       
AspGlyAspTrpAsnGluPhe ArgArgLysLeuThrPheTyrLeuLys                         
115120125                                                                 
ACCCTTGAGAATGCGCAGGCTCAACAGACGACTTTGAGCCTCGCGATC432                       
ThrLeuGluAsnAlaGlnAlaGln GlnThrThrLeuSerLeuAlaIle                         
130135140                                                                 
TTTTGAGTCCAACGTCCAGCTCGTTCTCTGGGCCTTCTCACCACAGAGCCTCG485                  
Phe                                                                       
145                                                                       
GTCGAGTTTTAAACTGGTTCCTAGG GATGTGTGAGAATAAACTAGACTCTGAACAAAAAA545          
AAAAAAAAAAAAAAAAAAAAAAAAAAACCGAATTCCCGGGGATCTAAACTT596                    
(2) INFORMATION FOR SEQ ID NO:46:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 145 amino acids                                               
(B) TYPE: amino acid                                                      
 (D) TOPOLOGY: linear                                                     
(ii) MOLECULE TYPE: protein                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:46:                                  
MetThrMetIleThrAsnSerArgGlySerValAspAlaProMetThr                          
151015                                                                    
GlnThrThrProLeuLysThrSe rTrpValAsnCysSerAsnMetIle                         
202530                                                                    
AspGluIleIleThrHisLeuLysGlnProProLeuProLeuLeuAsp                          
3540 45                                                                   
PheAsnAsnLeuAsnGlyGluAspGlnAspIleLeuMetGluAsnAsn                          
505560                                                                    
LeuArgArgProAsnLeuGluAlaPheAsnArgAlaValLysSerLeu                          
 65707580                                                                 
GlnAsnAlaSerAlaIleGluSerIleLeuLysAsnLeuLeuProCys                          
859095                                                                    
LeuP roLeuAlaThrAlaAlaProThrArgHisProIleHisIleLys                         
100105110                                                                 
AspGlyAspTrpAsnGluPheArgArgLysLeuThrPheTyrLeuLys                          
115 120125                                                                
ThrLeuGluAsnAlaGlnAlaGlnGlnThrThrLeuSerLeuAlaIle                          
130135140                                                                 
Phe                                                                       
145                                                                       
(2) INFORMATION FOR SEQ ID NO:47:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
 (A) LENGTH: 86 base pairs                                                
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ix) FEATURE:                                                             
(A) NAME/KEY: CDS                                                         
(B) LOCATION: 1..60                                                       
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:47:                                  
ATGACCATGATTACGAATTCCCGGGGATCCTCTGCAGCAGCGGCGG CT48                       
MetThrMetIleThrAsnSerArgGlySerSerAlaAlaAlaAlaAla                          
151015                                                                    
CTCGCGATCTTTTGACTCGAGTAGAAGAGAAGAGAATC 86                                 
LeuAlaIlePhe                                                              
20                                                                        
(2) INFORMATION FOR SEQ ID NO:48:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 20 amino acids                                                
(B) TYPE: amino acid                                                      
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: protein                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:48:                                  
MetThrMetIleThrAsnSerA rgGlySerSerAlaAlaAlaAlaAla                         
151015                                                                    
LeuAlaIlePhe                                                              
20                                                                        

Claims (4)

We claim:
1. A biologically active modified form of human interleukin-3 (IL-3), wherein the modification is selected from the group consisting of:
deletion of amino acids 120-130 of human IL-3;
deletion of amino acids 120-133 of human IL-3;
deletion of amino acids 116-133 of human IL-3; and
deletion of amino acids 130-133 of human IL-3.
2. A biologically active modified form of human interleukin-3 (IL-3), wherein the modification consists of deletion of at least two amino acids within the range of amino acids 1-14, in combination with
deletion of amino acids 120-130 of human IL-3;
deletion of amino acids 120-133 of human IL-3;
deletion of amino acids 116-133 of human IL-3; or
deletion of amino acids 130-133 of human IL-3.
3. A pharmaceutical composition comprising as active ingredient the human IL-3 of claim 1 in admixture with a pharmaceutically acceptable excipient.
4. A pharmaceutical composition comprising as active ingredient the human IL-3 of claim 2 in admixture with a pharmaceutically acceptable excipient.
US08/150,331 1989-08-14 1993-11-08 N- and C-terminal truncation and deletion mutants of human interleukin-3 Expired - Lifetime US5516512A (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US08/150,331 US5516512A (en) 1989-08-14 1993-11-08 N- and C-terminal truncation and deletion mutants of human interleukin-3
US08/569,284 US6500417B1 (en) 1989-08-14 1995-12-08 Mutants of human interleukin-3

Applications Claiming Priority (9)

Application Number Priority Date Filing Date Title
EP89202082 1989-08-14
EP89202082 1989-08-14
EP89202331 1989-09-14
EP89202331 1989-09-14
US51765390A 1990-05-03 1990-05-03
EP90202117 1990-08-02
EP90202117A EP0413383B1 (en) 1989-08-14 1990-08-02 Mutants of human interleukin-3
US65143791A 1991-02-05 1991-02-05
US08/150,331 US5516512A (en) 1989-08-14 1993-11-08 N- and C-terminal truncation and deletion mutants of human interleukin-3

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US65143791A Continuation 1989-08-14 1991-02-05

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US08/569,284 Continuation US6500417B1 (en) 1989-08-14 1995-12-08 Mutants of human interleukin-3

Publications (1)

Publication Number Publication Date
US5516512A true US5516512A (en) 1996-05-14

Family

ID=27513697

Family Applications (2)

Application Number Title Priority Date Filing Date
US08/150,331 Expired - Lifetime US5516512A (en) 1989-08-14 1993-11-08 N- and C-terminal truncation and deletion mutants of human interleukin-3
US08/569,284 Expired - Fee Related US6500417B1 (en) 1989-08-14 1995-12-08 Mutants of human interleukin-3

Family Applications After (1)

Application Number Title Priority Date Filing Date
US08/569,284 Expired - Fee Related US6500417B1 (en) 1989-08-14 1995-12-08 Mutants of human interleukin-3

Country Status (1)

Country Link
US (2) US5516512A (en)

Cited By (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5747453A (en) * 1995-06-06 1998-05-05 Alza Corporation Method for increasing the electrotransport flux of polypeptides
US5858347A (en) * 1992-11-24 1999-01-12 G. D. Searle & Co. Therapeutic methods using fusion proteins between interleukin-3 (IL-3) variants and other hematopoietic factors
US5877298A (en) * 1995-05-04 1999-03-02 Connaught Lab Acellular pertussis vaccines and methods of preparing thereof
US5997860A (en) * 1992-11-24 1999-12-07 G. D. Searle & Co. Ex-vivo expansion of stem cells using combinations of interleukin-3 (IL-3) variants and other cytokines
US6022535A (en) * 1993-11-22 2000-02-08 G. D. Searle & Company Treatment of hematopoietic disorders with fusion proteins comprising multiply mutated interleukin-3 (IL-3) polypeptides and second growth factors
US6051217A (en) * 1992-11-24 2000-04-18 G. D. Searle & Co. Therapeutic uses of interleukin-3 (IL-3) multiple mutation polypeptides
US6060047A (en) * 1992-11-24 2000-05-09 G. D. Searle & Co. Co-administration of interleukin-3 mutant polypeptides with CSF's for multi-lineage hematopoietic cell production
WO2000066632A1 (en) * 1999-04-29 2000-11-09 Medvet Science Pty Ltd Agonists or antagonists for haemopoietic growth factors
US6361976B1 (en) * 1992-11-24 2002-03-26 S. Christopher Bauer Co-administration of interleukin-3 mutant polypeptides with CSF'S for multi-lineage hematopoietic cell production
US6361977B1 (en) * 1992-11-24 2002-03-26 S. Christopher Bauer Methods of using multivariant IL-3 hematopoiesis fusion protein
US6403076B1 (en) * 1992-11-24 2002-06-11 S. Christopher Bauer Compositions for increasing hematopoiesis with interleukin-3 mutants
US6413509B1 (en) * 1992-11-24 2002-07-02 S. Christopher Bauer Methods of ex-vivo expansion of hematopoietic cells using interleukin-3 mutant polypeptides with other hematopoietic growth factors
US6436387B1 (en) * 1992-11-24 2002-08-20 G.D. Searle & Co. Methods of ex-vivo expansion of hematopoietic cells using multivariant IL-3 hematopoiesis chimera proteins
US6500417B1 (en) * 1989-08-14 2002-12-31 Dsm N.V. Mutants of human interleukin-3
US20050059149A1 (en) * 1993-11-22 2005-03-17 Bauer S. Christopher Methods of ex-vivo expansion of hematopoeitic cells using multivariant IL-3 hematopoiesis chimera proteins
US7091319B1 (en) * 1992-11-24 2006-08-15 Bauer S Christopher IL-3 variant hematopoiesis fusion protein
US20100279344A1 (en) * 2006-12-13 2010-11-04 Stiching Pharma Park IP Integrated cytokine production system
US20180170966A1 (en) * 2013-07-23 2018-06-21 Caregen Co., Ltd. Peptide for suppressing osteoclast differentiation and use thereof

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1988000598A1 (en) * 1986-07-14 1988-01-28 Genetics Institute, Inc. A novel family of primate hematopoietic growth factors
WO1988004691A1 (en) * 1986-12-16 1988-06-30 Gist-Brocades N.V. Molecular cloning and expression of human il-3
WO1988005469A1 (en) * 1987-01-20 1988-07-28 Immunex Corporation Human interleukin-3 proteins
EP0282185A1 (en) * 1987-02-18 1988-09-14 Schering Biotech Corporation Human interleukin-3 and muteins thereof
US4959455A (en) * 1986-07-14 1990-09-25 Genetics Institute, Inc. Primate hematopoietic growth factors IL-3 and pharmaceutical compositions

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5516512A (en) * 1989-08-14 1996-05-14 Gist-Brocades, N.V. N- and C-terminal truncation and deletion mutants of human interleukin-3

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1988000598A1 (en) * 1986-07-14 1988-01-28 Genetics Institute, Inc. A novel family of primate hematopoietic growth factors
US4959455A (en) * 1986-07-14 1990-09-25 Genetics Institute, Inc. Primate hematopoietic growth factors IL-3 and pharmaceutical compositions
WO1988004691A1 (en) * 1986-12-16 1988-06-30 Gist-Brocades N.V. Molecular cloning and expression of human il-3
WO1988005469A1 (en) * 1987-01-20 1988-07-28 Immunex Corporation Human interleukin-3 proteins
EP0282185A1 (en) * 1987-02-18 1988-09-14 Schering Biotech Corporation Human interleukin-3 and muteins thereof

Non-Patent Citations (34)

* Cited by examiner, † Cited by third party
Title
Clark Lewis et al., Proc. Natl. Acad. Sci. (1988) 85:7897 7901. *
Clark Lewis et al., Science (1986) 231:134 139. *
Clark-Lewis et al., Proc. Natl. Acad. Sci. (1988) 85:7897-7901.
Clark-Lewis et al., Science (1986) 231:134-139.
Cohen et al., Science (1986) 234:349 352. *
Cohen et al., Science (1986) 234:349-352.
Collins et al., Proc. Natl. Acad. Sci. (1988) 85:7709 7713. *
Collins et al., Proc. Natl. Acad. Sci. (1988) 85:7709-7713.
Dorssers et al., Gene (1987) 55:115 124. *
Dorssers et al., Gene (1987) 55:115-124.
Dunbar et al, Science 245, 1989, pp. 1493 96. *
Dunbar et al, Science 245, 1989, pp. 1493-96.
Gough et al., Eur. J. Biochem. (1987) 169:353 358. *
Gough et al., Eur. J. Biochem. (1987) 169:353-358.
Kaushansky et al, J. Clin Invest 90/992, pp. 1879 88. *
Kaushansky et al, J. Clin Invest 90/992, pp. 1879-88.
Kaushansky et al., Proc. Natl. Acad. Sci. (89) 86:1213 1217. *
Kaushansky et al., Proc. Natl. Acad. Sci. (89) 86:1213-1217.
Kuga et al., Biochem, Bopphys. Res. Commun. (1989) 159:103 111. *
Kuga et al., Biochem, Bopphys. Res. Commun. (1989) 159:103-111.
Makino et al., Proc. Natl. Acad. Sci. (1987) 84:7841 7845. *
Makino et al., Proc. Natl. Acad. Sci. (1987) 84:7841-7845.
Moonen et al., Proc. Natl. Acad. Sci. (1987) 84:4428 4431. *
Moonen et al., Proc. Natl. Acad. Sci. (1987) 84:4428-4431.
Mosely et al., Proc. Natl. Acad. Sci. (1984) 84:4572 4576. *
Mosely et al., Proc. Natl. Acad. Sci. (1984) 84:4572-4576.
Robb et al., Proc. Natl. Acad. Sci. (1988) 85:5654 5658. *
Robb et al., Proc. Natl. Acad. Sci. (1988) 85:5654-5658.
Wang et al., Science (1984) 224:1431 1433. *
Wang et al., Science (1984) 224:1431-1433.
Yang et al., Cell (1986) 47:3 10. *
Yang et al., Cell (1986) 47:3-10.
Zurawski et al., EMBO J. (1988) 7:1061 1069. *
Zurawski et al., EMBO J. (1988) 7:1061-1069.

Cited By (29)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6500417B1 (en) * 1989-08-14 2002-12-31 Dsm N.V. Mutants of human interleukin-3
US6051217A (en) * 1992-11-24 2000-04-18 G. D. Searle & Co. Therapeutic uses of interleukin-3 (IL-3) multiple mutation polypeptides
US7091319B1 (en) * 1992-11-24 2006-08-15 Bauer S Christopher IL-3 variant hematopoiesis fusion protein
US5997860A (en) * 1992-11-24 1999-12-07 G. D. Searle & Co. Ex-vivo expansion of stem cells using combinations of interleukin-3 (IL-3) variants and other cytokines
US5997857A (en) * 1992-11-24 1999-12-07 G. D. Searle & Co. Co-administration of interleukin-3 mutants with colony stimulating factors
US6379662B1 (en) * 1992-11-24 2002-04-30 Mckearn John P. Co-administration of interleukin-3 mutant polypeptides with CSF's for multi-lineage hematopoietic cell production
US6030812A (en) * 1992-11-24 2000-02-29 G. D. Searle & Company Fusion proteins comprising multiply mutated interleukin-3 (IL-3) polypeptides and second growth factors
US6361977B1 (en) * 1992-11-24 2002-03-26 S. Christopher Bauer Methods of using multivariant IL-3 hematopoiesis fusion protein
US6060047A (en) * 1992-11-24 2000-05-09 G. D. Searle & Co. Co-administration of interleukin-3 mutant polypeptides with CSF's for multi-lineage hematopoietic cell production
US6074639A (en) * 1992-11-24 2000-06-13 G. D. Searle & Co. Ex vivo expansion of hematopoietic cells using interleukin-3 (IL-3) variant fusion proteins
US6093395A (en) * 1992-11-24 2000-07-25 G. D. Searle & Co. Co-administration of interleukin-3 mutant polypeptides with CSF's for multi-lineage hematopoietic cell production
US6132991A (en) * 1992-11-24 2000-10-17 G. D. Searle & Co. Human interleukin-3 (IL-3) variant fusion proteins
US20040018618A1 (en) * 1992-11-24 2004-01-29 Bauer S. Christopher Interleukin-3 (IL-3) mutant polypeptides
US5858347A (en) * 1992-11-24 1999-01-12 G. D. Searle & Co. Therapeutic methods using fusion proteins between interleukin-3 (IL-3) variants and other hematopoietic factors
US6361976B1 (en) * 1992-11-24 2002-03-26 S. Christopher Bauer Co-administration of interleukin-3 mutant polypeptides with CSF'S for multi-lineage hematopoietic cell production
US6479261B1 (en) * 1992-11-24 2002-11-12 Pharmacia Corporation Methods of using interleukin-3 (IL-3) mutant polypeptides for ex-vivo expansion of hematopoietic stem cells
US6403076B1 (en) * 1992-11-24 2002-06-11 S. Christopher Bauer Compositions for increasing hematopoiesis with interleukin-3 mutants
US6413509B1 (en) * 1992-11-24 2002-07-02 S. Christopher Bauer Methods of ex-vivo expansion of hematopoietic cells using interleukin-3 mutant polypeptides with other hematopoietic growth factors
US6436387B1 (en) * 1992-11-24 2002-08-20 G.D. Searle & Co. Methods of ex-vivo expansion of hematopoietic cells using multivariant IL-3 hematopoiesis chimera proteins
US6440407B1 (en) * 1992-11-24 2002-08-27 G. D. Searle Methods of ex-vivo expansion of hematopoietic cells using interleukin-3 (IL-3) multiple mutation polypeptides
US6022535A (en) * 1993-11-22 2000-02-08 G. D. Searle & Company Treatment of hematopoietic disorders with fusion proteins comprising multiply mutated interleukin-3 (IL-3) polypeptides and second growth factors
US20050059149A1 (en) * 1993-11-22 2005-03-17 Bauer S. Christopher Methods of ex-vivo expansion of hematopoeitic cells using multivariant IL-3 hematopoiesis chimera proteins
US5877298A (en) * 1995-05-04 1999-03-02 Connaught Lab Acellular pertussis vaccines and methods of preparing thereof
US5747453A (en) * 1995-06-06 1998-05-05 Alza Corporation Method for increasing the electrotransport flux of polypeptides
WO2000066632A1 (en) * 1999-04-29 2000-11-09 Medvet Science Pty Ltd Agonists or antagonists for haemopoietic growth factors
US20100279344A1 (en) * 2006-12-13 2010-11-04 Stiching Pharma Park IP Integrated cytokine production system
US20180170966A1 (en) * 2013-07-23 2018-06-21 Caregen Co., Ltd. Peptide for suppressing osteoclast differentiation and use thereof
US10669312B2 (en) * 2013-07-23 2020-06-02 Caregen Co., Ltd. Peptide for suppressing osteoclast differentiation and use thereof
US11512112B2 (en) * 2013-07-23 2022-11-29 Caregen Co., Ltd. Peptide for suppressing osteoclast differentiation and use thereof

Also Published As

Publication number Publication date
US6500417B1 (en) 2002-12-31

Similar Documents

Publication Publication Date Title
US5516512A (en) N- and C-terminal truncation and deletion mutants of human interleukin-3
AU636641B2 (en) Mutants of human interleukin-3
JP3507507B2 (en) Hybrid of interferon-α and immunoglobulin linked via non-immunogenic peptide
US5399345A (en) Muteins of the granulocyte colony stimulating factor
ES2198416T3 (en) MULTIPLE MUTATION POLYPEPTIDES OF INTERLEUQUINA-3 (IL-3).
JP3115318B2 (en) Fusion protein containing GM-CSF and IL-3
EP0742826B1 (en) Multivariant il-3 hematopoiesis fusion protein
US6433142B1 (en) Megakaryocyte stimulating factors
JP2642942B2 (en) A new race of primate hematopoietic growth factors
US5606024A (en) Canine G-CSF polypeptides and pharmaceutical compositions comprising same
NZ303843A (en) An antagonist of interleukin-15 (il-15)
HU215241B (en) A method for preparing new forms of colony stimulating factor-1 and for producing expression cassette, vector and recombinant host cells useful in the method.
US6361977B1 (en) Methods of using multivariant IL-3 hematopoiesis fusion protein
US20060008872A1 (en) Method of improving efficacy of biological response-modifying proteins and the exemplary muteins
WO1997010338A1 (en) Improved interleukin-6 receptor antagonist
WO1997010338A9 (en) Improved interleukin-6 receptor antagonist
WO1990001039A1 (en) Nonglycosylated human interleukin-3 compositions
US5696250A (en) DNA encoding megakaryocyte growth and development factor analogs
WO1992013548A1 (en) Method of inhibiting replication of hiv in macrophages
AU697433C (en) Multivariant IL-3 hematopoiesis fusion protein
IE871727L (en) Novel family of primate il3-like hematopoietic growth¹factors.
HK1066827A (en) Megakaryocyte stimulating factors
HK1075258A (en) Megakaryocyte stimulating factors

Legal Events

Date Code Title Description
STCF Information on status: patent grant

Free format text: PATENTED CASE

FEPP Fee payment procedure

Free format text: PAYOR NUMBER ASSIGNED (ORIGINAL EVENT CODE: ASPN); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

FPAY Fee payment

Year of fee payment: 4

AS Assignment

Owner name: DSM IP ASSETS B.V., NETHERLANDS

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:DSM N.V.;REEL/FRAME:014634/0415

Effective date: 20031013

FPAY Fee payment

Year of fee payment: 8

FPAY Fee payment

Year of fee payment: 12

REMI Maintenance fee reminder mailed
AS Assignment

Owner name: DSM N.V., NETHERLANDS

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:GIST-BROCADES N.V.;REEL/FRAME:026560/0385

Effective date: 19980824