US5215912A - Monocot seed storage proteins in dicots - Google Patents

Monocot seed storage proteins in dicots Download PDF

Info

Publication number
US5215912A
US5215912A US07/393,834 US39383489A US5215912A US 5215912 A US5215912 A US 5215912A US 39383489 A US39383489 A US 39383489A US 5215912 A US5215912 A US 5215912A
Authority
US
United States
Prior art keywords
dna
promoter
gene
plant
structural gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Lifetime
Application number
US07/393,834
Inventor
Leslie M. Hoffman
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Mycogen Plant Science Inc
Original Assignee
Lubrizol Genetics Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Lubrizol Genetics Inc filed Critical Lubrizol Genetics Inc
Priority to US07/393,834 priority Critical patent/US5215912A/en
Application granted granted Critical
Publication of US5215912A publication Critical patent/US5215912A/en
Assigned to MYCOGEN PLANT SCIENCE, INC. reassignment MYCOGEN PLANT SCIENCE, INC. CHANGE OF NAME (SEE DOCUMENT FOR DETAILS). Assignors: LUBRIZOL GENETICS, INC.
Priority to US08/279,616 priority patent/US5589616A/en
Anticipated expiration legal-status Critical
Expired - Lifetime legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C12N15/8251Amino acid content, e.g. synthetic storage proteins, altering amino acid biosynthesis
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C07K14/425Zeins

Definitions

  • the present invention is in the fields of genetic engineering and plant husbandry, and especially provides a means for producing monocot seed storage proteins in a dicot by transforming a dicot to contain a monocot seed storage protein structural gene under control of a nonmonocot promoter. Also provided are plant-transforming prokaryotic plasmid vectors carrying such dicot-expressible monocot seed storage genes and plant cells transformed by such a vector.
  • Plant cells can be transformed by Agrobacterium by several methods well known in the art. For a review of recent work, see Syono K (1984) Oxford Surveys Plant Mol. Cell Biol. 1:217-219. Inoculation of leaf disks is particularly advantageous (Horsch R B et al. (1985) Science 227:1229-1231).
  • the host range of crown gall pathogenesis may be influenced by T-DNA-encoded functions such as onc genes (Hoekema A et al. (1984) J. Bacteriol. 158:383-385; Hoekema A et al. (1984) EMBO J. 3:3043-3047; Buchholz W C and Thomasshow M F (1984) 160:327-332; Yanofsky M (1985) Mol. Gen. Genet. 201:237-246) Vir genes also affect host range (Yanofsky, supra).
  • T-DNA of an octopine-type plasmid found in ATCC 15955, pTi15955 has been reported (Barker R F et al. (1983) Plant Mol Biol. 2:335-350) as has the T L region of pTiAch5 (Gielen J et al. (1984) EMBO J. 3:835-846). Published T-DNA genes do not contain introns. Sequences resembling canonical eukaryotic promoter elements and polyadenylation sites can be recognized.
  • the ocs gene encodes octopine synthase (lysopine dehydrogenase).
  • Koncz C et al. (1983) EMBO J. 2:1597-1603 provide a functional analysis of ocs.
  • Dhaese P et al. (1983) EMBO J. 2:419-426 reported the utilization of various polyadenylation sites by "transcript 7" (ORF3 of Barker R et al., supra) and ocs.
  • nos gene encodes nopaline synthase (sequenced by Depicker A et al. (1982) J. Mol. Appl. Genet. 1:561-573). Shaw C H et al. (1984) Nucl. Acids Res. 12:7831-7846; and An G et al. (1986) Mol. Gen. Genet. 203:245-250, provide functional analyses of nos.
  • Ti and Ri plasmid genes outside of the T-DNA region include the vir genes, which when mutated result in an avirulent Ti plasmid.
  • the vir genes function in trans, being capable of causing the transformation of plant cells with T-DNA of a different plasmid type and physically located on another plasmid.
  • Such arrangements are known as binary systems and the T-DNA bearing plasmids are generally known as micro-Ti plasmids.
  • Many binary systems are known to the art.
  • T-DNA need not be on a plasmid to transform a plant cell; chromosomally located T-DNA is functional (Hoekema A et al. (1984) EMBO J. 3:2485-2490).
  • Ti plasmid-determined characteristics have been reviewed by Merlo, supra (see especially Table 11), and Ream and Gordon, supra.
  • a gene encoding bean phaseolin has been transferred into and expressed in sunflower tumors. Transcription started and stopped at the correct positions, and introns were posttranscriptionally processed properly (Murai N et al. (1983) Science 222:476-482). The phaseolin gene was expressed at a high level in developing tobacco seeds (SenguptaGopalan C et al. (1985) Proc. Natl. Acad. Sci. USA 82:3320-3324). Similar results have been observed with a homologous gene, soybean betaconglycinin (Beachy R N et al. (1985) EMBO J. 4:3047-3053).
  • RuBP-Case small subunit genes are light-regulated and developmentally regulated in transformed cells; the small subunit protein produced is correctly processed and sequestered within chloroplasts (Broglie R et al. (1984) Science 224:838-843; Fluhr R and Chua N H (1986) Proc. Natl. Acad. Sci. USA 83:2358-2362). Sequences involved in this light-inducibility and those needed for maximal expression have been identified (Morelli G et al. (1985) Nature 315:200-204; Nagy F et al. (1985) EMBO J. 4:3063-3068; Timko M P et al. (1985) Nature 318:579-582; Fluhr R et al. (1986) Science 232:1106-1112). Expression of transformed chlorophyll a/b binding protein genes is light-regulated and organspecific in transformed tobacco plants (Lamppa G et al (1985) Nature 316:750-752).
  • a soybean heat shock gene is thermoinducible in sunflower tissue (Schoffl F and Baumann G (1985) EMBO J. 4:1119-1124). (A Drosophila melanogaster heat shock promoter is similarly functional in tobacco tissue (Spena A et al. (1985) EMBO J. 4:2739-2743).)
  • the nos promoter can drive expression of drug resistance structural genes useful for selection of transformed plant cells.
  • Many resistance genes have been created for drugs including kanamycin, methotrexate, chloramphenicol, and hygromycin B.
  • Helmer G et al., (1984) Biotechnol. 2:520-527 have created a fusion gene useful as a screenable marker having the promoter and 5'-end of the nos structural gene fused to E. coli betagalactosidase (lacZ) sequences.
  • lacZ E. coli betagalactosidase
  • An ocs/hygromycin B resistance fusion protein gene has been created and is functional (Waldron C et al. (1985) Plant Mol. Biol. 5:103-108).
  • An ocs-driven glyphosate gene has been constructed (Comai L et al. (1985) Nature 317:741-744).
  • Promoters for octopine T L genes ORF24 and ORF25 can also drive structural gene expression (Velten J et al. (1984) EMBO J. 3:2723-2730; Velten J and Schell J (1985) Nucl. Acids Res. 13:6981-6998; Gelvin SB et al. (1985) Mol. Gen. Genet. 199:240-248; Comai L et al. (1985) Nature 317:741-744).
  • RuBP-Case small subunit promoter confers light-inducible expression in callus to chloramphenicol and kanamycin resistance genes (Herrera-Estrella L et al. (1984) Nature 310:115-120; Facciotti D et al. (1985) Biotechnol. 3:241-246; Simpson J et al. (1986) Science 233:34-38; Fluhr R et al. (1986) Science 232:1106-1112).
  • a chalcone synthase promoter also drove light-inducible expression of a kanamycin resistance gene (Kaulen H et al. (1986) EMBO J. 5:1-8).
  • Chlorophyll a/b binding protein promoters have been used to drive expression of ocs and kanamycin resistance structural genes (Jones JDG et al. (1985) EMBO J. 4:2411-2418; Simpson J et al. (1985) EMBO J. 4:2723-2729; Simpson et al. (1986) supra).
  • Nodule-specific expression of a chloramphenicol resistance structural gene under control of a leghemoglobin promoter has been observed in a transgenic legume (Jensen J S et al. (1986) Nature 321:669-674).
  • Teeri T H et al. (1986) EMBO J. 5:1755-1760 disclose a scheme for the identification of plant promoters by T-DNA-mediated transcriptional fusions with a kanamycin resistance gene.
  • Kanamycin resistance genes under control of a cauliflower mosaic virus (CaMV) promoters were expressed in plant cells transformed by T-DNA (Koziel M G et al. (1984) J. Mol. Appl. Genet. 2:549-562; Balazs E et al. (1985) Gene 40:343-348; Pietrzak M (1986) Nucl. Acids Res. 14:5857-5868).
  • a methotrexate resistance gene behind the CaMV 35S promoter conferred methotrexate resistance (Brisson N et al. (1984) Nature 310:51114 514).
  • the 35S promoter has been used to express an enzyme which conferred herbicide tolerance to transgenic cells and plants (Shah D M et al.
  • Tobacco mosaic virus coat protein has been expressed in transformed tobacco tissue under control of a CaMV promoter (Bevan M W et al. (1985) EMBO J. 4:1921-1926; Abel PP et al. (1986) Science 232:738-743). Odell J T et al., (1985) Nature 313:810-812, have mapped sequences of the CaMV 35S promoter needed for transcription.
  • amino acids which must be supplied in the herbivore's diet, are referred to as "essential amino acids.”
  • the basic amino acids e.g. lysine
  • the sulfur-containing amino acids e.g. methionine
  • cereal seed storage proteins are low in basic amino acids
  • legume storage proteins are low in sulfur-containing amino acids
  • mammalian diets often contain a mixture of legumes and grains so that the total amino acid complement consumed is balanced.
  • a monocot seed storage protein having relatively high levels of methionine, such as zein, in a dicot can allow one to create a more nutritious legume having a better mix of amino acids.
  • the 15 kD variant of zein is useful, having over 15 mole % sulfur-containing amino acids. Therefore, it is an object of the present invention to express a monocot seed storage protein in a dicot. Methods are provided for expression of monocot genes in dicot cells. Dicot transcription controlling sequences/monocot seed storage protein gene combinations are also provided. Furthermore, DNA molecules useful for this are provided. As exemplified herein, an endosperm protein of Zea mays, the prolamine (ethanol soluble protein) zein, has been expressed in seeds of Nicotiana tabacum.
  • the dicot cell is of the family Solanaceae and of the genus Nicotiana
  • the monocot protein is from the family Gramineae and from the genus Zea
  • the protein is a prolamine, zein, having a molecular weight of 15 kD (kilodaltons).
  • This protein can be present in dicot cells at a level greater than about 0.05% total protein including a level about or greater than 1.0% total protein.
  • a plant, plant tissue, plant organ, or seed descended from or containing the monocot seed storage protein can also be produced.
  • the promoter is a dicot promoter, more specifically is a seed storage protein promoter, and in particular a phaseolin promoter.
  • the monocot protein is from the family Gramineae and in particular is from the genus Zea.
  • the protein is a 15 kD prolamine, zein.
  • This DNA also includes a transcript terminator, the promoter, the structural gene, and the transcript terminator being in such position and orientation with respect to one another that the structural gene is expressible in a dicot cell under control of the promoter and the transcript terminator.
  • the transcript terminator is a dicot polyadenylation site, in particular a phaseolin polyadenylation site.
  • the dicot-expressible monocot seed storage protein gene can be combined with a T-DNA border sequence in the form of a micro-Ti plasmid.
  • This micro-Ti plasmid can include a selectable or screenable marker that is expressible in a plant cell, e.g. neomycin phosphotransferase.
  • this DNA After transformation into a dicot cell and integration into that cell's genome, this DNA will be flanked by dicot DNA that is not naturally contiguous with any dicot-derived components of the promoter/structural gene/transcript terminator combination.
  • This combination flanked with genomic dicot sequences, these genomic sequences being not naturally contiguous with any dicot sequences that are part of the combination, is contained by a dicot cell, as exemplified herein by a cell of the family Solanaceae, more specifically a cell of the genus Nicotiana.
  • a plant, plant tissue, plant organ, or seed may be descended from or contain this cell.
  • transformed cells can be produced by transforming a dicot cell to contain a DNA comprising a nonmonocot promoter and a monocot seed storage protein structural gene, the promoter and the structural gene being in such position and orientation with respect to each other that the structural gene is expressible under control of the promoter in the transformed dicot cell or in a cell descended from the transformed dicot cell.
  • this transformation can be accomplished by placing an Agrobacterium cell containing the DNA in contact with a dicot cell.
  • FIG. 1 diagrams, schematically and not necessarily to scale, insertion of a zein structural gene between phaseolin transcription controlling sequences.
  • Restriction sites are abbreviated as follows: A, AhaI; Ba, BamHI; Bg, BglII; E, EcoRI; H, Hind III; Nd, NdeI; Sa, SalI; Sc, SacI; Sm, SmaI; and Xh, XhoI.
  • Other abbreviations include Amp® for a ampicillin resistance gene and PL for a polylinker (a short stretch of DNA having numerous restriction sites).
  • the phaseolin promoter is indicated by an arrow within a curved box. Curved boxes represent locations of either the Amp® gene, the PL (polylinker), and P. vulgaris and Z. mays sequences.
  • FIG. 2 diagrams, schematically and not necessarily to scale, various micro-Ti plasmids. Restriction sites are designated as in FIG. 1.
  • Other abbreviations include A and B for the octopine-type T L -DNA border repeats A and B, Tet® for a bacteria-expressible tetracycline resistance gene, NPT1 for a bacterial expressible neomycin phosphotransferase I gene, NPT2 for a plant-expressible neomycin phosphotransferase II gene, and OCS for a plant-expressible octopine synthase gene (ocs).
  • a and B for the octopine-type T L -DNA border repeats A and B
  • Tet® for a bacteria-expressible tetracycline resistance gene
  • NPT1 for a bacterial expressible neomycin phosphotransferase I gene
  • NPT2 for a plant-expressible neo
  • the curved boxes indicate the location of the Tet®, NPT1, NPT2, and ocs genes, and the A and B border repeats. Arrows below the curved boxes indicate the direction of a gene's transcription while the arrow within the straight box indicates the location and direction of transcription of a phaseolin promoter.
  • a plant-expressible promoter is any promoter capable of driving transcription in at least one type of plant cell in at least one developmental stage.
  • Eukaryotic promoter sequences are commonly recognized by the presence of DNA sequences homologous to the canonical form 5' . . . TATAA . . . 3' about 10-30 base pairs (bp) 5'-to the location of the 5'-end of the mRNA (cap site). About 30 bp 5'-to the TATAA, another promoter sequence is often found which is recognized by the presence of DNA sequences homologous to the canonical form 5' . . . CCAAT . . . 3'.
  • Transcript Terminator refers herein to any nucleic acid sequence capable of determining the position of the 3'-end of a transcript.
  • the transcript terminator DNA segment may itself be a composite of segments derived from a plurality of sources, naturally occurring or synthetic, prokaryotic, or eukaryotic, and may be from a genomic DNA or an mRNA-derived cDNA (mRNA: messenger RNA).
  • Transcript termination sites include polyadenylation sites and sites determining the 3'-end of ribosomal RNAs (rRNAs), transfer RNAs (tRNAs), and nonpolyadenylated mRNAs (e.g. histone mRNA: Krieg PA and Melton DA (1984) Nature 308:203-206).
  • a polyadenylation site is a nucleic acid sequence correlated with polyadenylation of mRNA in eukaryotes, i.e. after transcriptional termination polyadenylic acid "tails" are added to the 3'-end of mRNA precursors.
  • Polyadenylation sites are commonly recognized by the presence of homology to the canonical form 5' . . . AATAAA . . . 3', although variations of distance 5' to the 3'-end of the transcript, partial "read-through", and multiple tandem canonical sequences are not uncommon. DNA sequences between 20 and 35 bp downstream from the transcripts 3'-end seem to be necessary (McDevitt MA et al. (1984) Cell 37:993-999).
  • a canonical "polyadenylation site” may actually determine the location of the 3'-end of the mRNA and not polyadenylation per se (Proudfoot N (1984) Nature 307:412-413; Birnstiel ML et al. (1985) Cell 41 349-359).
  • Transcription Controlling Sequences refers to a promoter/transcript terminator site combination flanking a structural gene.
  • the promoter and terminator DNA sequences flanking a particular foreign structural gene need not be derived from the same source genes (e.g. pairing two different T-DNA transcripts) or the same taxonomic source (e.g. pairing sequences from T-DNA with sequences from non-T-DNA sources such as plants, animals, fungi, yeasts, eukaryotic viruses, bacteria, and synthetic sequences).
  • Translational Initiation Site refers herein to the 5'AUg 3' translational start codon at the 5'-end of a structural gene, the nucleotide following the AUG, and the 3 nucleotides preceding the AUG (see Kozak M (1983) Microbiol. Rev. 47:1-45, and Kozak M (1984) Nucl. Acids Res. 12:857-872).
  • 5'-Untranslated Sequence refers herein to the part of an mRNA between its 5'-end, or "cap site,” and the translational start codon.
  • 3'-Untranslated Sequence refers herein to the part of an mRNA between its translational stop codon and either its polyadenlylic acid segment or the 3'-end of a nonpolyadenylated mRNA.
  • Plant-Expressible Selectable or Screenable Marker refers herein to a genetic marker functional in a plant cell.
  • a selectable marker e.g. a kanamycin resistance gene
  • a screenable marker e.g. a beta-galactosidase gene
  • Dicot-Expressible refers to the ability of a gene to be expressed in a dicot cell.
  • Seed Storage Protein Is a term well known in the art that refers to protein present in a seed having as its primary function the storage of amino acids for use by a seedling after germination to make other proteins.
  • T-DNA refers in the art to a DNA sequence, between and including two T-DNA border repeats, capable of being transferred from a vir genecontaining Agrobacterium cell to a plant cell and of being incorporated into the genome thereof.
  • Transforming refers to the act of causing a cell to contain a nucleic acid molecule or sequence not originally part of that cell.
  • Plant Tissue Includes differentiated and undifferentiated tissues of plants including but not limited to roots, shoots, pollen, seeds, tumor tissue, such as crown galls, and various forms of aggregations of plant cells in culture, such as embryos and calluses.
  • the plant tissue may be in planta or in organ, tissue, or cell culture.
  • Plant Cell As used herein includes plant cells in planta and plant cells and protoplasts in culture.
  • prolamine zein
  • phaseolin zein-like protein
  • T-DNA border repeat transcription under control of a promoter
  • the fundamental aspects of the invention are the nature of the nonmonocot promoter/monocot seed storage protein structural gene combination and its use to synthesize the encoded storage protein in cells of plants transformed therewith. Other aspects include the nature and structure of the promoter/structural gene sequence and its means of insertion and expression in a plant genome.
  • the remaining steps of the preferred embodiment for obtaining a genetically modified plant include inserting the combination into T-DNA, transferring the modified T-DNA to a plant cell wherein the modified T-DNA becomes stably integrated as part of the plant cell genome, techniques for in vitro culture and eventual regeneration into whole plants, which may include steps for selecting and detecting transformed plant cells and steps of transferring the introduced gene combination from the originally transformed strain into commercially acceptable cultivars, and monitoring expression in transformed plants.
  • a principal feature of the present invention in its preferred embodiment is the construction of a T-DNA derivative having an inserted gene under control of dicot-expressible transcription controlling sequences, i.e., between a promoter and a transcript terminator, as these terms have been defined, supra.
  • the structural gene must be inserted in correct position and orientation with respect to the promoter. Position relates to which side of the promoter the structural gene is inserted. It is known that the majority of promoters control initiation of transcription and translation in one direction only along the DNA. The region of DNA lying under promoter control is said to lie "downstream” or alternatively "behind” or "3' to" the promoter.
  • the correct position of a structural gene insertion must be "downstream" from the promoter.
  • Orientation refers to the directionality of the structural gene. That portion of a structural gene which encodes the amino terminus of a protein is termed the 5'-end of the structural gene, while that end which encodes amino acids near the carboxyl end of the protein is termed the 3'-end of the structural gene.
  • Correct orientation of the structural gene is with the 5'-end thereof proximal to the promoter.
  • the transcript terminator must be located in correct position and orientation relative to the structural gene being proximal to the 3'-end of the structural gene.
  • Differences in rates of gene expression or developmental control may be observed depending on the particular components, e.g. promoters, transcript terminators, flanking DNA sequences, or site of insertion into the transformed plant's genome.
  • Storage protein accumulation may also be affected by storage protein mRNA stability, which can be greatly infuenced by mRNA secondary structure, especially stem-loop structures.
  • Different properties including, but not limited to, such properties as stability, intracellular localization, posttranscriptional processing, and other functional properties of the expressed structural gene itself may be observed when promoter/structural gene/transcript terminator components are varied. All of these variations present numerous opportunities to manipulate and control the functional properties of the monocot seed storage protein, depending upon the desired physiological properties within the plant cell, plant tissue, and whole plant.
  • the fundamental principle of the present invention is that monocot seed storage proteins are capable of being made in dicot cells that contain a nonmonocot promoter/monocot seed storage protein structural gene combination.
  • the requirements for which DNA sequence segments are to be included in a promoter/structural gene combination are best couched in functional terms.
  • Transcript terminators, in particular polyadenylation sites, and promoters are understood in the art to be functional terms. Canonical sequences thereof are discussed above.
  • a promoter to be that DNA segment capable of initiating transcription. Numerous promoters have been defined by methods such as deletion analysis.
  • a promoter is the smallest continuous DNA segment that is necessary and sufficient to cause RNA polymerase to transcribe a flanking DNA segment.
  • a promoter-bearing DNA segment may contain additional DNA sequences that are not necessary for transcription.
  • a polyadenylation site (or other transcript terminator) is functionally defined as the smallest continuous DNA segment that is necessary and sufficient to cause a transcript to become polyadenylated (or otherwise terminated).
  • the functional requirements for a structural gene are also well understood.
  • a structural gene must start with a translational initiation (start) site (AUG), end with a translational termination (stop) codon (UAA, UAG, or UGA) and have a integral number of triplet codons in-between, without an intervening stop codon.
  • the transcript of the dicot promoter/monocot structural gene may include nonmonocot sequences in addition to monocot sequences. Usually these nonmonocot sequences will be at the 5'- and 3'-ends of the mRNA. Often these nonmonocot components will be derived from promoter or transcript terminator DNA segments. As exemplified herein, the zeinencoding transcript probably has both its 5'- and 3'-ends donated from phaseolin mRNA 5'- and 3'ends. Inclusion of various nonmonocot sequences may affect mRNA stability, cellular localization of the mRNA, posttranscriptional processing, and the like.
  • RNA stability is affected by terminal structures such as 5'-capping and 3'-polyadenylation and by the extent of internal structure, i.e. intramolecular basepairing.
  • Translational efficiency can similarly be affected by structures in the 5'-untranslated region, and by the exact sequence of the translational initiation site.
  • An intron may be included in a monocot mRNA, provided that, if the splice sites are derived from two different genes, the intron splice sites be compatible.
  • telomere/structural gene/terminator combination Combining of DNA segments, including coding, promoter, and transcript terminator sequences, to form a promoter/structural gene/terminator combination is accomplished by means known and understood by those of ordinary skill in the art of recombinant DNA technology.
  • Choice of promoter depends on the developmental regulation desired. Use of developmentally regulated promoters for gene expression in plants is described in the Background. T-DNA or CaMV promoters are advantageous as they are constitutive.
  • the RuBP-Case small subunit promoter may be useful for expression in the green tissues of a plant transformed to contain a nonmonocot promoter/monocot seed storage gene combination.
  • the promoter of a dicot seed storage protein gene e.g. phaseolin
  • can be used to express a monocot seed storage protein structural gene e.g.
  • the transcript terminator is a polyadenylation site.
  • the plant gene source of the polyadenylation site is not crucial provided that the polyadenylation site, the promoter and the structural gene are compatible for transcription and posttranscriptional processing.
  • the promoter/structural gene combination may be placed between any restriction sites convenient for removing the combination from the plasmid it is carried on and convenient for insertion into the plant transformation vector of choice.
  • location of the gene combination insertion site within T-DNA is not critical as long as the transfer function of sequences immediately surrounding the T-DNA borders are not disrupted, since in prior art studies these regions appear to be essential for insertion of the modified T-DNA into the plant genome.
  • the combination is inserted into the plant transformation vector by standard techniques well known to those skilled in the art.
  • the orientation of the assembled promoter/structural gene combination, with respect to the direction of transcription and translation of endogenous vector genes is not usually critical; generally, either of the two possible orientations is functional.
  • T-DNA of micro-Ti plasmids can be transferred from an Agrobacterium strain to a plant cell provided the Agrobacterium strain contains certain trans-acting genes whose function is to promote the transfer of T-DNA to a plant cell.
  • Micro-Ti plasmids are advantageous in that they are small and relatively easy to manipulate directly, eliminating the need to transfer the gene to T-DNA from a shuttle vector by homologous recombination. After the desired promoter/structural gene combination has been inserted, they can easily be introduced directly into an Agrobacterium cell containing trans-acting vir genes, the vir genes usually being on a "helper plasmid", that promotes T-DNA transfer.
  • Introduction into an Agrobacterium strain is conveniently accomplished either by transformation of the Agrobacterium strain or by conjugal transfer from a donor bacterial cell, the techniques for which are well known to those of ordinary skill.
  • Ti plasmids, Ri plasmids, micro-Ti plasmids, and T-DNA integrated into chromosomes should be considered functionally equivalent.
  • T-DNA having a promoter/structural gene combination can be transferred to plant cells by any technique known in the art. For example, this transfer is most conveniently accomplished by cocultivation of the Agrobacterium strain with plant cells or with plant tissues. Using these methods, a certain proportion of the plant cells are transformed, that is to say have T-DNA transferred therein and inserted in the plant cell genome. In either case, the transformed cells must be selected or screened to distinguish them from untransformed cells. Selection is most readily accomplished by providing a selectable marker or screenable marker incorporated into the T-DNA in addition to the gene combination. Examples of artificial markers include those reviewed in the Background (see the sections on Chimeric Genes).
  • the T-DNA provides endogenous markers such as gene(s) controlling abnormal morphology of Ri-induced tumor roots and gene(s) that control resistance to toxic compounds such as amino acid analogs, such resistance being provided by an opine synthesizing enzyme (e.g. ocs).
  • Screening methods well known to those skilled in the art include, but are not limited to, assays for opine production, specific hybridization to characteristic nucleic acid sequences (e.g. storage protein mRNA or T-DNA) or immunological assays for specific proteins (e.g. zein or neomycin phosphotransferase II).
  • T-DNA-based vector systems known to the art may readily be substituted.
  • the preferred embodiment of this invention incorporates a T-DNA-based Agrobacterium-mediated system for incorporation of the nonmonocot promoter/monocot seed storage protein structural gene into the genome of the plant which is to be transformed, other means for transferring and incorporating the promoter/structural gene combination are also included within the scope of this invention.
  • Other means for the stable incorporation of the gene combination into a plant genome additionally include, but are not limited to, use of vectors based upon viral genomes, minichromosomes, transposons, and homologous or nonhomologous recombination into plant chromosomes.
  • Alternate forms of delivery of these vectors into a plant cell additionally include, but are not limited to, fusion with vector-containing liposomes or bacterial spheroplasts, microinjection, encapsidation in viral coat protein followed by an infection-like process, and direct uptake of DNA, possibly after induction of plasmalemma permeability by an electric pulse, a laser, or a chemical agent. Means for transient incorporation and/or expression are also included within the scope of this invention.
  • Systems based on Agrobacterium cells and T-DNAs can be used to transform angiosperms, including dicots and monocots, by transfer of DNA from a bacterium to a plant cell; systems based on alternate vectors or means for vector delivery may be used to transform gymnosperms and angiosperms.
  • Regeneration of transformed cells and tissues is accomplished by known techniques.
  • An object of the regeneration step is to obtain a whole plant that grows and reproduces normally but which retains integrated T-DNA.
  • the techniques of regeneration vary somewhat according to principles known in the art, and may depend upon the plant transformation vector and the species of the transformed plant. Regeneration of transformed tobacco plants, petunia plants, and plants of related species is well known to the art. As means for regeneration of other plant species are developed, the art will understand, without undue experimentation, how to adapt these newly discovered means for regeneration of plants from transformed plant cells and transformed plant tissues.
  • the genotype of the plant tissue transformed is often chosen for the ease with which its cells can be grown and regenerated in in vitro culture and for susceptibility to the selective agent to be used. Should a cultivar of agronomic interest be unsuitable for these manipulations, a more amenable variety is first transformed. After regeneration, the newly introduced promoter/structural gene combination may be readily transferred to the desired agronomic cultivar by techniques well known to those skilled in the arts of plant breeding and plant genetics. Sexual crosses of transformed plants with the agronomic cultivars yield initial hybrids. These hybrids can then be back-crossed with plants of the desired genetic background.
  • Progeny are screened and/or selected for the continued presence of integrated promoter/structural gene combination, T-DNA, or for a new phenotype resulting from expression of the gene combination or other genes carried by the inserted DNA. In this manner, after a number of rounds of back-crossing and selection, plants can be produced having a genotype essentially identical to the agronomically desired parents with the addition of inserted DNA sequences.
  • Plasmids, and only plasmids, are prefaced with a "p,” e.g., pTi15955 or pH400, and strain designations parenthetically indicate a plasmid harbored within, e.g., A. tumefaciens (pTi15955) or E. coli H802 (pH400).
  • p e.g., A. tumefaciens
  • pH400 E. coli H802
  • Example 1 Construction of a micro-Ti plasmid, pH575
  • E. coli K802 (pCT29K-2), which has been deposited as NRRL B-18010, was disclosed by Sutton D W et al., U.S. patent application Ser. No. 788,984, filed Oct. 21, 1985,now abandoned, which is hereby incorporated by reference.
  • the T-DNA of pCT29K-2 can be represented as follows: ##STR1## Except for NPT1 (NPT1 is neomycin phosphotransferase I, NPT2 is neomycin phosphotransferase 11), all of these genes are transcribed in the same direction. This T-DNA can be removed from pCT29K-2 on a 9.52 kbp HindIII fragment.
  • p8.8 (designated pPVPh8.8 in FIG. 3 of Hall T C et al. (1983) in Structure and Function of Plant Genes, eds. Ciferri 0 and Dure L, pp. 123-142) is a subclone of lambda-177.4 (Sun S M et al. (1981) Nature 289:37-41). p8.8 was made by partial EcoRI digestion of lambda-177.4 and insertion of a 8.8 kbp fragment into EcoRI-linearized pBR322. E. coli HB101 (p8.8) is on deposit as NRRL B-15393.
  • p3.8 (designated AG-pPVPh3.8 by Slightom J L et al. (1983) Proc. Natl. Acad. Sci. USA 80:1897-1901) could be substituted.
  • E. coli HB101 (p3.8) is on deposit as NRRL B-15392.
  • Phaseolus DNA was removed from p8.8 and inserted into an M13-based vector suitable for oligonucleotide-directed, site-specific mutagenesis.
  • p8.8pro differs from p8.8 as follows: ##STR2##
  • the phaseolin promoter can be removed from p8.8pro on a 0.85 kbp (kilobase pair) BamHI/BglII fragment, the BamHI site being 5'-to the new BglII site.
  • Example 3 Preparation of a zein structural gene
  • a plasmid designated herein as pZG15RX (FIG. 1) is an EcoRI/XhoI subclone in pBR322 of the genomic clone gZ15A.
  • pZG15RX carries the left most EcoRI/XhoI fragment disclosed by FIG. 1 of Pedersen K et al. (1986) J. Biol. Chem. 261:6279-6284.
  • gZ15A carries a 15 kD zein gene and was isolated and sequenced by Pedersen et al.
  • pZG15RX DNA was digested with HindIII and AhaIII, which respectively cut at about positions -179 and 673, as numbered in FIG.
  • Example 4 Combination of a phaseolin promoter and a zein structural gene
  • pSPZ3 DNA was digested with NdeI and S 1 nuclease, thereby converting the NdeI sticky-end to blunt-ends.
  • p8.8pro (FIG. 1) DNA was digested with BglII, BglII sticky-ends were converted to blunt-ends with S 1 nuclease, and a 0.85 kbp fragment was isolated by acrylamide gel electrophoresis. This 0.85 kbp fragment, which carried a phaseolin promoter, was mixed with and ligated to the blunt-ended, linearized pSPZ3 DNA. After transformation into E. coli MC1061, DNA was isolated from ampicillin-resistant transformants.
  • pPPZ60 plasmid having the phaseolin promoter and the zein structural gene in such position and orientation with respect to each other that in a plant cell a zein-encoding transcript can be transcribed under control of phaseolin promoter.
  • pPPZ6O has a zein-derived polyadenylic acid addition concensus sequence, it does not have extensive zein sequences 3'-to this concensus sequence.
  • a more extensive phaseolin sequence which included a polyadenylation site was inserted behind the phaseolin promoter/zein structural gene combination.
  • pPPZ60 DNA was digested with EcoRI. After having the EcoRI sticky-ends converted to blunt ends by incubation with T4 DNA polymerase, the linearized pPPZ6O DNA was digested with SacI, which, like EcoRI, cuts in the pSP64-derived polylinker 3'-to the promoter/structural gene combination. p3.8 (FIG.
  • DNA (Slightom et al., surpa) was cut with BamHI, had its BamHI sticky-ends converted to blunt-ends by incubation with the Klenow fragment of E. coli DNA polymerase I, and then, cut with SacI. A 1.1 kbp fragment carrying the phaseolin polyadenylation site was then electrophoretically isolated. This 1.1 kbp fragment was mixed with and ligated to the opened pPPZ60 DNA. After transformation into E. coli and selection for resistance to ampicillin, a colony was found harboring a plasmid, designated pPPZ60A (FIG.
  • phaseolin polyadenylation site 3'-to the promoter/structural gene combination in such position and orientation relative to the structural gene that in a plant cell a zein-encoding transcript can be transcribed under control of the phaseolin promoter and polyadenylation site.
  • SacI site between the zein and phaseolin polyadenylation sites was restored and BamHI 3'-to the phaseolin polyadenylation site was reconstructed.
  • the promoter/structural gene/polyadenylation site combination can be removed from pPPZ60A on a 2.8 kbp HindIII/BamHI fragment, the HindIII and BamHI sites being respectively 5'-to and 3'-to the combination.
  • the HindIII site was converted to a BamHI site.
  • pPPZ60A DNA was digested with HindIII. This linearized, phosphorylated DNA was blunt-ended by digestion with mung bean nuclease.
  • the blunt-ended pPPZ60A DNA was then mixed with and ligated to unphosphorylated BamHI linkers having a single-stranded sequence of 5'CGGGATCCCG3'.
  • plasmid DNAs isolated from ampicillin-resistant transformants were characterized by restriction mapping.
  • a colony was identified which harbored a plasmid, designated pPPZ60AB (FIG. 1), having a BamHI site replacing the pPPZ60A HindIII site.
  • BamHI-digested pPPZ60AB DNA was mixed with and ligated to BglII-digested, dephosphorylated pH575 (FIG. 2) DNA.
  • the ligation mix was transformed into E. coli MC1061 and plasmid DNAs isolated from kanamycin-resistant transformants were characterized by hybridization with a [32]P-labeled zein gene fragment. Colonies were identified which harbored plasmids, designated PH5PZIC and pH5PZ3D (FIG. 2), which had the promoter/structural gene combination antiparallel and parallel, respectively, to the ocs and kan genes of pH575.
  • PH5PZIC and pH5PZ3D were individually transferred into A. tumefaciens LBA4404 (Ooms G et al. (1981) Gene 14:33-50), a vir gene-harboring, microTi-mobilizing strain, by the triparental mating technique (Ruvkun GB and Ausubel FM (1981) Nature 289:85-88), which is well known in the art.
  • Tobacco leaf tissue was obtained from 4- or 5-week old Nicotiana tabacum var. Xanthi NC plants grown in a greenhouse. Inoculation was by a modification of the method Horsch RB et al. (1985) Science 227:1229-1231.
  • Inocula were prepared by placing two loopfuls of agrobacteria in 10 ml of L-broth. After suspension by forceful pipetting with a Pasteur pipet, inocula could be used immediately. Leaves were excised and midribs were removed; cutting surfaces were wetted with L-broth to help keep the leaves wet. Leaf pieces were about 2-4 mm wide and about 7-10 mm long. Leaf pieces were dipped in the inoculum for 5-10 min, though in some experiments, leaf pieces were just dipped into the inoculum or were infiltrated with the inoculum in a vacuum flask. Pieces were then blotted dry on sterile filter paper and placed upside-down on feeder plates prepared from a Xanthi suspension culture.
  • the feeder plates had a SMPi medium (SMPi: MX - supplemented with 0.1 mg/l p-chlorophenoxyacetic acid (pCPA) and 7.5 mg/l 6-(8,8-dimethylallylamino)purine (2iP); MX - :1.65 g/l NH 4 NO 3 , 1.9 g/l KNO 3 , 440 mg/l CaCl 2 .2H 2 O, 370 mg/l MgSO 4 .7H 2 O, 170 mg/l KH 2 PO 4 , 0.83 mg/l KI, 6.2 mg/l H 3 BO 3 , 22.3 mg/l MnSO4.4H 2 O, 8.6 mg/l ZnSO 4 .7H2O, 0.25 mg/l Na 2 MoO 4 .2H 2 O, 0.025 mg/l CuSO 4 .5H 2 O, 0.025 mg/l CoCl 2 .6H 2 O, 1 g/l inositol, 50
  • Leaf pieces were removed from feeder plates after 4-6 days and placed on SMPi medium supplemented with 500 mg/l carbenicillin, 50 mg/l cloxacillin, and 100-300 mg/l kanamycin (200 mg/l optimum). The resulting shoots were excised and placed on MX- medium supplemented with 100-300 mg/l kanamycin (200 mg/l optimum).
  • Regenerated tobacco plants descended from cells transformed by A. tumefaciens LBA4404 (pH5PZ1C) or A. tumefaciens LBA44O4 (pH5PZ3D) were self-fertilized.
  • the resulting seeds were germinated on MX - supplemented with 100-300 mg/l kanamycin (200 mg/l optimum) to select plants containing the nonmonocot promoter/monocot seed storage protein structural genebearing T-DNA. Presence of the transformed T-DNA was confirmed by Southern blot analysis.
  • Presence of zein protein in developing tobacco seeds was detected by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) followed by staining of the resultant gels, western blots (SDS-PAGE followed by transfer to membrane filters and immunological detection), and immuno-dot blots (immobilization of protein in dots on filter paper followed by immunological detection).
  • Zein protein was detectable at levels over about 0.25 ng/seed or at about 0.05% protein, and many transformants had zein levels of 5 ng/seed or about 1% protein.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • Biophysics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Wood Science & Technology (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • Physics & Mathematics (AREA)
  • Nutrition Science (AREA)
  • Botany (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention discloses dicot cells containing monocot seed storage protein. Construction of genes encoding monocot seed storage proteins which are expressible in dicot cells and transformation of such genes into plant cells is also taught. Furthermore, methods and DNA molecules useful for producing plant cells containing monocot seed storage proteins are also disclosed. The invention is exemplified by combination of a 15 kD zein structural gene from Zea mays gene with a promoter and a polyadenylation site derived from a Phaseolus vulgaris phaseolin gene.

Description

This application is a continuation, of application Ser. No. 902,224, filed Aug. 29, 1986, now abandoned.
FIELD
The present invention is in the fields of genetic engineering and plant husbandry, and especially provides a means for producing monocot seed storage proteins in a dicot by transforming a dicot to contain a monocot seed storage protein structural gene under control of a nonmonocot promoter. Also provided are plant-transforming prokaryotic plasmid vectors carrying such dicot-expressible monocot seed storage genes and plant cells transformed by such a vector.
BACKGROUND Overview of Agrobacterium
Reviews of Agrobacterium-caused disease, plant transformation, genetic engineering, and gene expression include those by, or found in, Merlo D J (1982) Adv. Plant Pathol. 1:139-178; Ream L W and Gordon M P (1982) Science 218:854-859; Bevan M W and Chilton M-D (1982) Ann. Rev. Genet. 16:357-384; Kahl G and Schell J (1982) Molecular Biology of Plant Tumors; Barton K A and Chilton M-D (1983) Meth. Enzymol. 101:527-539; Weissbach A and Weissbach H, eds. (1986) Meth. Enzymol. 118 (see especially Rogers S G et al., pp. 627-640); Depicker A et al. (1983) in Genetic Engineering of Plants: an Agricultural Perspective, eds: Kosuge T et al., pp. 143-176; Caplan A et al. (1983) Science 222:815-821; Hall T C et al., European Patent application 126,546; and Binns A N (1984) Oxford Surveys Plant Mol. Cell Biol. 1:130-160; Hall T C (1985) Oxford Surveys Plant Mol. Biol. 2:329-338; Hooykaas P J J and Schilperoort R A (1985) Trends Biochem. Sci. 10:307-309; Thomas T L and Hall T C (1985) Bioassays 3:149-153; Puhler A, ed. (1983) Molecular Genetics of the Bacteria-Plant Interaction; and Schilperoort R A (1984) in Efficiency in Plant Breeding (Proc. 10 th Congr. Eur. Assoc. Res. Plant Breeding), eds: Lange W et al., pp. 251-285.
Transformation of Plants by Agrobacterium
Plant cells can be transformed by Agrobacterium by several methods well known in the art. For a review of recent work, see Syono K (1984) Oxford Surveys Plant Mol. Cell Biol. 1:217-219. Inoculation of leaf disks is particularly advantageous (Horsch R B et al. (1985) Science 227:1229-1231).
The host range of crown gall pathogenesis may be influenced by T-DNA-encoded functions such as onc genes (Hoekema A et al. (1984) J. Bacteriol. 158:383-385; Hoekema A et al. (1984) EMBO J. 3:3043-3047; Buchholz W C and Thomasshow M F (1984) 160:327-332; Yanofsky M (1985) Mol. Gen. Genet. 201:237-246) Vir genes also affect host range (Yanofsky, supra).
Genes on the Transformation-Inducing Plasmids
The complete sequence of the T-DNA of an octopine-type plasmid found in ATCC 15955, pTi15955, has been reported (Barker R F et al. (1983) Plant Mol Biol. 2:335-350) as has the TL region of pTiAch5 (Gielen J et al. (1984) EMBO J. 3:835-846). Published T-DNA genes do not contain introns. Sequences resembling canonical eukaryotic promoter elements and polyadenylation sites can be recognized.
The ocs gene encodes octopine synthase (lysopine dehydrogenase). Koncz C et al. (1983) EMBO J. 2:1597-1603 provide a functional analysis of ocs. Dhaese P et al. (1983) EMBO J. 2:419-426, reported the utilization of various polyadenylation sites by "transcript 7" (ORF3 of Barker R et al., supra) and ocs.
The nos gene encodes nopaline synthase (sequenced by Depicker A et al. (1982) J. Mol. Appl. Genet. 1:561-573). Shaw C H et al. (1984) Nucl. Acids Res. 12:7831-7846; and An G et al. (1986) Mol. Gen. Genet. 203:245-250, provide functional analyses of nos.
Ti and Ri plasmid genes outside of the T-DNA region include the vir genes, which when mutated result in an avirulent Ti plasmid. The vir genes function in trans, being capable of causing the transformation of plant cells with T-DNA of a different plasmid type and physically located on another plasmid. Such arrangements are known as binary systems and the T-DNA bearing plasmids are generally known as micro-Ti plasmids. Many binary systems are known to the art. T-DNA need not be on a plasmid to transform a plant cell; chromosomally located T-DNA is functional (Hoekema A et al. (1984) EMBO J. 3:2485-2490). Ti plasmid-determined characteristics have been reviewed by Merlo, supra (see especially Table 11), and Ream and Gordon, supra.
Foreign Gene Expression
A gene encoding bean phaseolin has been transferred into and expressed in sunflower tumors. Transcription started and stopped at the correct positions, and introns were posttranscriptionally processed properly (Murai N et al. (1983) Science 222:476-482). The phaseolin gene was expressed at a high level in developing tobacco seeds (SenguptaGopalan C et al. (1985) Proc. Natl. Acad. Sci. USA 82:3320-3324). Similar results have been observed with a homologous gene, soybean betaconglycinin (Beachy R N et al. (1985) EMBO J. 4:3047-3053). Some genes for the endosperm protein zein, from the monocot Zea mays, are transcribed in dicot cells, though translational products of these transcripts has not been detected (Matzke M A et al. (1984) EMBO J. 3:1525-1531; Goldsbrough et (1986) Mol. Gen. Genet. 202:374-381).
Expression of RuBP-Case small subunit genes is light-regulated and developmentally regulated in transformed cells; the small subunit protein produced is correctly processed and sequestered within chloroplasts (Broglie R et al. (1984) Science 224:838-843; Fluhr R and Chua N H (1986) Proc. Natl. Acad. Sci. USA 83:2358-2362). Sequences involved in this light-inducibility and those needed for maximal expression have been identified (Morelli G et al. (1985) Nature 315:200-204; Nagy F et al. (1985) EMBO J. 4:3063-3068; Timko M P et al. (1985) Nature 318:579-582; Fluhr R et al. (1986) Science 232:1106-1112). Expression of transformed chlorophyll a/b binding protein genes is light-regulated and organspecific in transformed tobacco plants (Lamppa G et al (1985) Nature 316:750-752).
A soybean heat shock gene is thermoinducible in sunflower tissue (Schoffl F and Baumann G (1985) EMBO J. 4:1119-1124). (A Drosophila melanogaster heat shock promoter is similarly functional in tobacco tissue (Spena A et al. (1985) EMBO J. 4:2739-2743).)
Chimeric Genes Having T-DNA Promoters
The nos promoter can drive expression of drug resistance structural genes useful for selection of transformed plant cells. Many resistance genes have been created for drugs including kanamycin, methotrexate, chloramphenicol, and hygromycin B. Helmer G et al., (1984) Biotechnol. 2:520-527, have created a fusion gene useful as a screenable marker having the promoter and 5'-end of the nos structural gene fused to E. coli betagalactosidase (lacZ) sequences. A chimeric nos/kanamycin gene was functional (An G et al (1985) EMBO J. 4:277-284).
Murai N et al., (1983) Science 222:476-482, reported fusion of the ocs promoter and its structural gene's 5'-end to a phaseolin structural gene, and expression thereof. An ocs/hygromycin B resistance fusion protein gene has been created and is functional (Waldron C et al. (1985) Plant Mol. Biol. 5:103-108). An ocs-driven glyphosate gene has been constructed (Comai L et al. (1985) Nature 317:741-744).
Promoters for octopine TL genes ORF24 and ORF25 can also drive structural gene expression (Velten J et al. (1984) EMBO J. 3:2723-2730; Velten J and Schell J (1985) Nucl. Acids Res. 13:6981-6998; Gelvin SB et al. (1985) Mol. Gen. Genet. 199:240-248; Comai L et al. (1985) Nature 317:741-744).
Chimeric Genes Having Plant Promoters
An RuBP-Case small subunit promoter confers light-inducible expression in callus to chloramphenicol and kanamycin resistance genes (Herrera-Estrella L et al. (1984) Nature 310:115-120; Facciotti D et al. (1985) Biotechnol. 3:241-246; Simpson J et al. (1986) Science 233:34-38; Fluhr R et al. (1986) Science 232:1106-1112). A chalcone synthase promoter also drove light-inducible expression of a kanamycin resistance gene (Kaulen H et al. (1986) EMBO J. 5:1-8). Chlorophyll a/b binding protein promoters have been used to drive expression of ocs and kanamycin resistance structural genes (Jones JDG et al. (1985) EMBO J. 4:2411-2418; Simpson J et al. (1985) EMBO J. 4:2723-2729; Simpson et al. (1986) supra). Nodule-specific expression of a chloramphenicol resistance structural gene under control of a leghemoglobin promoter has been observed in a transgenic legume (Jensen J S et al. (1986) Nature 321:669-674). Teeri T H et al. (1986) EMBO J. 5:1755-1760, disclose a scheme for the identification of plant promoters by T-DNA-mediated transcriptional fusions with a kanamycin resistance gene.
Chimeric Genes Having Viral Promoters
Kanamycin resistance genes under control of a cauliflower mosaic virus (CaMV) promoters were expressed in plant cells transformed by T-DNA (Koziel M G et al. (1984) J. Mol. Appl. Genet. 2:549-562; Balazs E et al. (1985) Gene 40:343-348; Pietrzak M (1986) Nucl. Acids Res. 14:5857-5868). A methotrexate resistance gene behind the CaMV 35S promoter conferred methotrexate resistance (Brisson N et al. (1984) Nature 310:51114 514). The 35S promoter has been used to express an enzyme which conferred herbicide tolerance to transgenic cells and plants (Shah D M et al. (1986) Science 233:478-481). Tobacco mosaic virus coat protein has been expressed in transformed tobacco tissue under control of a CaMV promoter (Bevan M W et al. (1985) EMBO J. 4:1921-1926; Abel PP et al. (1986) Science 232:738-743). Odell J T et al., (1985) Nature 313:810-812, have mapped sequences of the CaMV 35S promoter needed for transcription.
SUMMARY OF THE INVENTION
It is well known that most herbivores cannot synthesize all twenty of the amino acids used to make proteins. These amino acids, which must be supplied in the herbivore's diet, are referred to as "essential amino acids." For many species of mammals, the basic amino acids, e.g. lysine, and the sulfur-containing amino acids, e.g. methionine, are essential. As cereal seed storage proteins are low in basic amino acids and legume storage proteins are low in sulfur-containing amino acids, mammalian diets often contain a mixture of legumes and grains so that the total amino acid complement consumed is balanced. The ability to express a monocot seed storage protein having relatively high levels of methionine, such as zein, in a dicot can allow one to create a more nutritious legume having a better mix of amino acids. In particular, the 15 kD variant of zein is useful, having over 15 mole % sulfur-containing amino acids. Therefore, it is an object of the present invention to express a monocot seed storage protein in a dicot. Methods are provided for expression of monocot genes in dicot cells. Dicot transcription controlling sequences/monocot seed storage protein gene combinations are also provided. Furthermore, DNA molecules useful for this are provided. As exemplified herein, an endosperm protein of Zea mays, the prolamine (ethanol soluble protein) zein, has been expressed in seeds of Nicotiana tabacum.
I have found it possible to produce a dicot cell containing a monocot seed storage protein. As exemplified herein, the dicot cell is of the family Solanaceae and of the genus Nicotiana, the monocot protein is from the family Gramineae and from the genus Zea; the protein is a prolamine, zein, having a molecular weight of 15 kD (kilodaltons). This protein can be present in dicot cells at a level greater than about 0.05% total protein including a level about or greater than 1.0% total protein. A plant, plant tissue, plant organ, or seed descended from or containing the monocot seed storage protein can also be produced. To obtain cells containing this monocot protein I have made DNA molecules having a nonmonocot promoter and a monocot seed storage protein structural gene, the promoter and the structural gene being in such position and orientation with respect to one another that the structural gene is expressible in a dicot cell under control of the promoter. As exemplified herein, the promoter is a dicot promoter, more specifically is a seed storage protein promoter, and in particular a phaseolin promoter. As exemplified herein the monocot protein is from the family Gramineae and in particular is from the genus Zea. As exemplified herein the protein is a 15 kD prolamine, zein. This DNA also includes a transcript terminator, the promoter, the structural gene, and the transcript terminator being in such position and orientation with respect to one another that the structural gene is expressible in a dicot cell under control of the promoter and the transcript terminator. As exemplified herein the transcript terminator is a dicot polyadenylation site, in particular a phaseolin polyadenylation site. The dicot-expressible monocot seed storage protein gene can be combined with a T-DNA border sequence in the form of a micro-Ti plasmid. This micro-Ti plasmid can include a selectable or screenable marker that is expressible in a plant cell, e.g. neomycin phosphotransferase. After transformation into a dicot cell and integration into that cell's genome, this DNA will be flanked by dicot DNA that is not naturally contiguous with any dicot-derived components of the promoter/structural gene/transcript terminator combination. This combination flanked with genomic dicot sequences, these genomic sequences being not naturally contiguous with any dicot sequences that are part of the combination, is contained by a dicot cell, as exemplified herein by a cell of the family Solanaceae, more specifically a cell of the genus Nicotiana. A plant, plant tissue, plant organ, or seed may be descended from or contain this cell. These transformed cells can be produced by transforming a dicot cell to contain a DNA comprising a nonmonocot promoter and a monocot seed storage protein structural gene, the promoter and the structural gene being in such position and orientation with respect to each other that the structural gene is expressible under control of the promoter in the transformed dicot cell or in a cell descended from the transformed dicot cell. For example, this transformation can be accomplished by placing an Agrobacterium cell containing the DNA in contact with a dicot cell.
It is believed that before this invention there were no published reports of expression of a monocot seed storage protein structural gene in a dicot. Published reports indicated that zein structural genes under control of zein promoters could be transcribed in dicot cell; however, no translational products were detected. Interpretations of the published data include the possibility that zein protein was not stable in dicot cells or the possibility that zein-encoding mRNA could not be translated in dicot cells. Therefore, the discovery that insertion into dicot cells of this monocot seed storage protein structural gen under control of dicot transcription controlling sequences resulted in accumulation of the monocot seed storage protein was not expected.
DESCRIPTION OF THE DRAWINGS
FIG. 1 diagrams, schematically and not necessarily to scale, insertion of a zein structural gene between phaseolin transcription controlling sequences. Restriction sites are abbreviated as follows: A, AhaI; Ba, BamHI; Bg, BglII; E, EcoRI; H, Hind III; Nd, NdeI; Sa, SalI; Sc, SacI; Sm, SmaI; and Xh, XhoI. Other abbreviations include Amp® for a ampicillin resistance gene and PL for a polylinker (a short stretch of DNA having numerous restriction sites). The phaseolin promoter is indicated by an arrow within a curved box. Curved boxes represent locations of either the Amp® gene, the PL (polylinker), and P. vulgaris and Z. mays sequences.
FIG. 2 diagrams, schematically and not necessarily to scale, various micro-Ti plasmids. Restriction sites are designated as in FIG. 1. Other abbreviations include A and B for the octopine-type TL -DNA border repeats A and B, Tet® for a bacteria-expressible tetracycline resistance gene, NPT1 for a bacterial expressible neomycin phosphotransferase I gene, NPT2 for a plant-expressible neomycin phosphotransferase II gene, and OCS for a plant-expressible octopine synthase gene (ocs). The curved boxes indicate the location of the Tet®, NPT1, NPT2, and ocs genes, and the A and B border repeats. Arrows below the curved boxes indicate the direction of a gene's transcription while the arrow within the straight box indicates the location and direction of transcription of a phaseolin promoter.
DETAILED DESCRIPTION OF THE INVENTION
The following definitions are provided, in order to remove ambiguities to the intent or scope of their usage in the Specification and claims.
Promoter: Refers to sequences at the 5'-end of a structural gene involved in initiation of transcription. A plant-expressible promoter is any promoter capable of driving transcription in at least one type of plant cell in at least one developmental stage. Eukaryotic promoter sequences are commonly recognized by the presence of DNA sequences homologous to the canonical form 5' . . . TATAA . . . 3' about 10-30 base pairs (bp) 5'-to the location of the 5'-end of the mRNA (cap site). About 30 bp 5'-to the TATAA, another promoter sequence is often found which is recognized by the presence of DNA sequences homologous to the canonical form 5' . . . CCAAT . . . 3'.
Transcript Terminator: Refers herein to any nucleic acid sequence capable of determining the position of the 3'-end of a transcript. The transcript terminator DNA segment may itself be a composite of segments derived from a plurality of sources, naturally occurring or synthetic, prokaryotic, or eukaryotic, and may be from a genomic DNA or an mRNA-derived cDNA (mRNA: messenger RNA). Transcript termination sites include polyadenylation sites and sites determining the 3'-end of ribosomal RNAs (rRNAs), transfer RNAs (tRNAs), and nonpolyadenylated mRNAs (e.g. histone mRNA: Krieg PA and Melton DA (1984) Nature 308:203-206).
A polyadenylation site is a nucleic acid sequence correlated with polyadenylation of mRNA in eukaryotes, i.e. after transcriptional termination polyadenylic acid "tails" are added to the 3'-end of mRNA precursors. Polyadenylation sites are commonly recognized by the presence of homology to the canonical form 5' . . . AATAAA . . . 3', although variations of distance 5' to the 3'-end of the transcript, partial "read-through", and multiple tandem canonical sequences are not uncommon. DNA sequences between 20 and 35 bp downstream from the transcripts 3'-end seem to be necessary (McDevitt MA et al. (1984) Cell 37:993-999). It should be recognized that a canonical "polyadenylation site" may actually determine the location of the 3'-end of the mRNA and not polyadenylation per se (Proudfoot N (1984) Nature 307:412-413; Birnstiel ML et al. (1985) Cell 41 349-359).
Transcription Controlling Sequences: Refers to a promoter/transcript terminator site combination flanking a structural gene. The promoter and terminator DNA sequences flanking a particular foreign structural gene need not be derived from the same source genes (e.g. pairing two different T-DNA transcripts) or the same taxonomic source (e.g. pairing sequences from T-DNA with sequences from non-T-DNA sources such as plants, animals, fungi, yeasts, eukaryotic viruses, bacteria, and synthetic sequences).
Translational Initiation Site: Refers herein to the 5'AUg 3' translational start codon at the 5'-end of a structural gene, the nucleotide following the AUG, and the 3 nucleotides preceding the AUG (see Kozak M (1983) Microbiol. Rev. 47:1-45, and Kozak M (1984) Nucl. Acids Res. 12:857-872).
5'-Untranslated Sequence: Refers herein to the part of an mRNA between its 5'-end, or "cap site," and the translational start codon.
3'-Untranslated Sequence: Refers herein to the part of an mRNA between its translational stop codon and either its polyadenlylic acid segment or the 3'-end of a nonpolyadenylated mRNA.
Plant-Expressible Selectable or Screenable Marker: Refers herein to a genetic marker functional in a plant cell. A selectable marker (e.g. a kanamycin resistance gene) allows cells containing and expressing that marker to grow under conditions unfavorable to growth of cells not expressing that marker. A screenable marker (e.g. a beta-galactosidase gene) facilitates identification of cells which express that marker.
Dicot-Expressible: Refers to the ability of a gene to be expressed in a dicot cell.
Seed Storage Protein: Is a term well known in the art that refers to protein present in a seed having as its primary function the storage of amino acids for use by a seedling after germination to make other proteins.
T-DNA: Refers in the art to a DNA sequence, between and including two T-DNA border repeats, capable of being transferred from a vir genecontaining Agrobacterium cell to a plant cell and of being incorporated into the genome thereof.
Transforming: Refers to the act of causing a cell to contain a nucleic acid molecule or sequence not originally part of that cell.
Plant Tissue: Includes differentiated and undifferentiated tissues of plants including but not limited to roots, shoots, pollen, seeds, tumor tissue, such as crown galls, and various forms of aggregations of plant cells in culture, such as embryos and calluses. The plant tissue may be in planta or in organ, tissue, or cell culture.
Plant Cell: As used herein includes plant cells in planta and plant cells and protoplasts in culture.
The following terms are well known in the art and are not specifically or specially defined herein: prolamine, zein, phaseolin, T-DNA border repeat, transcription under control of a promoter, and structural gene.
Production of a genetically modified dicot cell expressing a monocot seed storage protein structural gene combines the specific teachings of the present disclosure with a variety of techniques and expedients known in the art. In most instances, alternative expedients exist for each stage of the overall process. The choice of expedients depends on variables such as the choice of the particular promoter, the particular structural gene, in many cases the particular transcript terminator, the exact locations of the sutures between the promoter, the structural gene, and the transcript terminator, the dicot species to be modified, the basic vector system for the introduction and stable maintenance of the promoter/structural gene combination, and the like, all of which present alternative process steps which those of ordinary skill are able to select and use to achieve a desired result. As novel means are developed for the stable insertion and transcription of foreign DNA in plant cells, those of ordinary skill in the art will be able to select among those alternate process steps to achieve a desired result. The fundamental aspects of the invention are the nature of the nonmonocot promoter/monocot seed storage protein structural gene combination and its use to synthesize the encoded storage protein in cells of plants transformed therewith. Other aspects include the nature and structure of the promoter/structural gene sequence and its means of insertion and expression in a plant genome. The remaining steps of the preferred embodiment for obtaining a genetically modified plant include inserting the combination into T-DNA, transferring the modified T-DNA to a plant cell wherein the modified T-DNA becomes stably integrated as part of the plant cell genome, techniques for in vitro culture and eventual regeneration into whole plants, which may include steps for selecting and detecting transformed plant cells and steps of transferring the introduced gene combination from the originally transformed strain into commercially acceptable cultivars, and monitoring expression in transformed plants.
A principal feature of the present invention in its preferred embodiment is the construction of a T-DNA derivative having an inserted gene under control of dicot-expressible transcription controlling sequences, i.e., between a promoter and a transcript terminator, as these terms have been defined, supra. The structural gene must be inserted in correct position and orientation with respect to the promoter. Position relates to which side of the promoter the structural gene is inserted. It is known that the majority of promoters control initiation of transcription and translation in one direction only along the DNA. The region of DNA lying under promoter control is said to lie "downstream" or alternatively "behind" or "3' to" the promoter. Therefore, to be controlled by the promoter, the correct position of a structural gene insertion must be "downstream" from the promoter. Orientation refers to the directionality of the structural gene. That portion of a structural gene which encodes the amino terminus of a protein is termed the 5'-end of the structural gene, while that end which encodes amino acids near the carboxyl end of the protein is termed the 3'-end of the structural gene. Correct orientation of the structural gene is with the 5'-end thereof proximal to the promoter. Similarly to the promoter region, the transcript terminator must be located in correct position and orientation relative to the structural gene being proximal to the 3'-end of the structural gene. Differences in rates of gene expression or developmental control may be observed depending on the particular components, e.g. promoters, transcript terminators, flanking DNA sequences, or site of insertion into the transformed plant's genome. Storage protein accumulation may also be affected by storage protein mRNA stability, which can be greatly infuenced by mRNA secondary structure, especially stem-loop structures. Different properties, including, but not limited to, such properties as stability, intracellular localization, posttranscriptional processing, and other functional properties of the expressed structural gene itself may be observed when promoter/structural gene/transcript terminator components are varied. All of these variations present numerous opportunities to manipulate and control the functional properties of the monocot seed storage protein, depending upon the desired physiological properties within the plant cell, plant tissue, and whole plant.
The fundamental principle of the present invention is that monocot seed storage proteins are capable of being made in dicot cells that contain a nonmonocot promoter/monocot seed storage protein structural gene combination. The requirements for which DNA sequence segments are to be included in a promoter/structural gene combination are best couched in functional terms. Transcript terminators, in particular polyadenylation sites, and promoters are understood in the art to be functional terms. Canonical sequences thereof are discussed above. However, the art understands a promoter to be that DNA segment capable of initiating transcription. Numerous promoters have been defined by methods such as deletion analysis. A promoter is the smallest continuous DNA segment that is necessary and sufficient to cause RNA polymerase to transcribe a flanking DNA segment. A promoter-bearing DNA segment may contain additional DNA sequences that are not necessary for transcription. Similarly, a polyadenylation site (or other transcript terminator) is functionally defined as the smallest continuous DNA segment that is necessary and sufficient to cause a transcript to become polyadenylated (or otherwise terminated). The functional requirements for a structural gene are also well understood. A structural gene must start with a translational initiation (start) site (AUG), end with a translational termination (stop) codon (UAA, UAG, or UGA) and have a integral number of triplet codons in-between, without an intervening stop codon.
The transcript of the dicot promoter/monocot structural gene may include nonmonocot sequences in addition to monocot sequences. Usually these nonmonocot sequences will be at the 5'- and 3'-ends of the mRNA. Often these nonmonocot components will be derived from promoter or transcript terminator DNA segments. As exemplified herein, the zeinencoding transcript probably has both its 5'- and 3'-ends donated from phaseolin mRNA 5'- and 3'ends. Inclusion of various nonmonocot sequences may affect mRNA stability, cellular localization of the mRNA, posttranscriptional processing, and the like. It is known to the art that RNA stability is affected by terminal structures such as 5'-capping and 3'-polyadenylation and by the extent of internal structure, i.e. intramolecular basepairing. Translational efficiency can similarly be affected by structures in the 5'-untranslated region, and by the exact sequence of the translational initiation site. An intron may be included in a monocot mRNA, provided that, if the splice sites are derived from two different genes, the intron splice sites be compatible.
Combining of DNA segments, including coding, promoter, and transcript terminator sequences, to form a promoter/structural gene/terminator combination is accomplished by means known and understood by those of ordinary skill in the art of recombinant DNA technology. Choice of promoter depends on the developmental regulation desired. Use of developmentally regulated promoters for gene expression in plants is described in the Background. T-DNA or CaMV promoters are advantageous as they are constitutive. The RuBP-Case small subunit promoter may be useful for expression in the green tissues of a plant transformed to contain a nonmonocot promoter/monocot seed storage gene combination. The promoter of a dicot seed storage protein gene (e.g. phaseolin) can be used to express a monocot seed storage protein structural gene (e.g. zein) in dicot (e.g. Nicotiana tobaccum) seeds. In the preferred embodiments, the transcript terminator is a polyadenylation site. The plant gene source of the polyadenylation site is not crucial provided that the polyadenylation site, the promoter and the structural gene are compatible for transcription and posttranscriptional processing.
As will be apparent to those of ordinary skill in the art, the promoter/structural gene combination may be placed between any restriction sites convenient for removing the combination from the plasmid it is carried on and convenient for insertion into the plant transformation vector of choice. For example, location of the gene combination insertion site within T-DNA is not critical as long as the transfer function of sequences immediately surrounding the T-DNA borders are not disrupted, since in prior art studies these regions appear to be essential for insertion of the modified T-DNA into the plant genome. The combination is inserted into the plant transformation vector by standard techniques well known to those skilled in the art. The orientation of the assembled promoter/structural gene combination, with respect to the direction of transcription and translation of endogenous vector genes is not usually critical; generally, either of the two possible orientations is functional.
As is well known in the art, T-DNA of micro-Ti plasmids can be transferred from an Agrobacterium strain to a plant cell provided the Agrobacterium strain contains certain trans-acting genes whose function is to promote the transfer of T-DNA to a plant cell. Micro-Ti plasmids are advantageous in that they are small and relatively easy to manipulate directly, eliminating the need to transfer the gene to T-DNA from a shuttle vector by homologous recombination. After the desired promoter/structural gene combination has been inserted, they can easily be introduced directly into an Agrobacterium cell containing trans-acting vir genes, the vir genes usually being on a "helper plasmid", that promotes T-DNA transfer. Introduction into an Agrobacterium strain is conveniently accomplished either by transformation of the Agrobacterium strain or by conjugal transfer from a donor bacterial cell, the techniques for which are well known to those of ordinary skill. For purpose of introduction of novel DNA sequences into a plant genome, Ti plasmids, Ri plasmids, micro-Ti plasmids, and T-DNA integrated into chromosomes should be considered functionally equivalent.
T-DNA having a promoter/structural gene combination can be transferred to plant cells by any technique known in the art. For example, this transfer is most conveniently accomplished by cocultivation of the Agrobacterium strain with plant cells or with plant tissues. Using these methods, a certain proportion of the plant cells are transformed, that is to say have T-DNA transferred therein and inserted in the plant cell genome. In either case, the transformed cells must be selected or screened to distinguish them from untransformed cells. Selection is most readily accomplished by providing a selectable marker or screenable marker incorporated into the T-DNA in addition to the gene combination. Examples of artificial markers include those reviewed in the Background (see the sections on Chimeric Genes). In addition, the T-DNA provides endogenous markers such as gene(s) controlling abnormal morphology of Ri-induced tumor roots and gene(s) that control resistance to toxic compounds such as amino acid analogs, such resistance being provided by an opine synthesizing enzyme (e.g. ocs). Screening methods well known to those skilled in the art include, but are not limited to, assays for opine production, specific hybridization to characteristic nucleic acid sequences (e.g. storage protein mRNA or T-DNA) or immunological assays for specific proteins (e.g. zein or neomycin phosphotransferase II).
Although the preferred embodiments involve use of micro-Ti plasmids, other T-DNA-based vector systems known to the art may readily be substituted. Furthermore, though the preferred embodiment of this invention incorporates a T-DNA-based Agrobacterium-mediated system for incorporation of the nonmonocot promoter/monocot seed storage protein structural gene into the genome of the plant which is to be transformed, other means for transferring and incorporating the promoter/structural gene combination are also included within the scope of this invention. Other means for the stable incorporation of the gene combination into a plant genome additionally include, but are not limited to, use of vectors based upon viral genomes, minichromosomes, transposons, and homologous or nonhomologous recombination into plant chromosomes. Alternate forms of delivery of these vectors into a plant cell additionally include, but are not limited to, fusion with vector-containing liposomes or bacterial spheroplasts, microinjection, encapsidation in viral coat protein followed by an infection-like process, and direct uptake of DNA, possibly after induction of plasmalemma permeability by an electric pulse, a laser, or a chemical agent. Means for transient incorporation and/or expression are also included within the scope of this invention. Systems based on Agrobacterium cells and T-DNAs can be used to transform angiosperms, including dicots and monocots, by transfer of DNA from a bacterium to a plant cell; systems based on alternate vectors or means for vector delivery may be used to transform gymnosperms and angiosperms.
Regeneration of transformed cells and tissues is accomplished by known techniques. An object of the regeneration step is to obtain a whole plant that grows and reproduces normally but which retains integrated T-DNA. The techniques of regeneration vary somewhat according to principles known in the art, and may depend upon the plant transformation vector and the species of the transformed plant. Regeneration of transformed tobacco plants, petunia plants, and plants of related species is well known to the art. As means for regeneration of other plant species are developed, the art will understand, without undue experimentation, how to adapt these newly discovered means for regeneration of plants from transformed plant cells and transformed plant tissues.
The genotype of the plant tissue transformed is often chosen for the ease with which its cells can be grown and regenerated in in vitro culture and for susceptibility to the selective agent to be used. Should a cultivar of agronomic interest be unsuitable for these manipulations, a more amenable variety is first transformed. After regeneration, the newly introduced promoter/structural gene combination may be readily transferred to the desired agronomic cultivar by techniques well known to those skilled in the arts of plant breeding and plant genetics. Sexual crosses of transformed plants with the agronomic cultivars yield initial hybrids. These hybrids can then be back-crossed with plants of the desired genetic background. Progeny are screened and/or selected for the continued presence of integrated promoter/structural gene combination, T-DNA, or for a new phenotype resulting from expression of the gene combination or other genes carried by the inserted DNA. In this manner, after a number of rounds of back-crossing and selection, plants can be produced having a genotype essentially identical to the agronomically desired parents with the addition of inserted DNA sequences.
EXAMPLES
The following Examples are presented for the purpose of illustrating specific embodiments within the scope of the present invention without limiting the scope, the scope being defined by the claims. Numerous variations will be readily apparent to those of ordinary skill in the art.
The Examples utilize many techniques well known and accessible to those skilled in the arts of molecular biology and manipulation of T-DNA and Agrobacterium; such methods are fully described in one or more of the cited references if not described in detail herein. All references cited in this Specification are hereby incorporated by reference. Enzymes are obtained from commerical sources and are used according to the vendors' recommendations and other variations known to the art. Reagents, buffers, and culture conditions are also known to those in the art. Reference works containing such standard techniques include the following: Wu R, ed. (1979) Meth. Enzymol. 68: Wu R et al., eds. (1983) Meth. Enzymol. 100 and 101: Grossman L and Moldave K, eds. (1980) Meth. Enzymol. 65; Weissbach A and Weissbach H, eds. (1986) Meth. Enzymol. 118 (see especially Rogers S G et al., pp. 627-640); Miller J H (1972) Experiments in Molecular Genetics; Davis R et al. (1980) Advanced Bacterial Genetics; Schleif R F and Wensink P C (1982 ) Practical Methods in Molecular Biology: Walker J M and Gaastra W, eds. (1983) Techniques in Molecular Biology; and Maniatis T et al. (1982) Molecular Cloning. Additionally, Lathe R F et al., (1983) Genet. Engin. 4:1-56, make useful comments on DNA manipulations.
Textual use of the name of a restriction endonuclease in isolation, e.g. "BclI," refers to use of that enzyme in an enzymatic digestion, except in a diagram where it can refer to the site of a sequence susceptible to action of that enzyme, e.g. a restriction site. In the text, restriction sites are indicated by the additional use of the word "site," e.g. "BclI sites." The additional use of the word "fragment," e.g. "BclI fragment," indicates a linear double-stranded DNA molecule having ends generated by action of the named enzyme (e.g., a restriction fragment). A phrase such as "BclI/SmaI fragment" indicates that the restriction fragment was generated by the action of two different enzymes, here BclI and SmaI, the two ends resulting from the action of different enzymes.
Plasmids, and only plasmids, are prefaced with a "p," e.g., pTi15955 or pH400, and strain designations parenthetically indicate a plasmid harbored within, e.g., A. tumefaciens (pTi15955) or E. coli H802 (pH400). The following strains have been deposited:
______________________________________                                    
E. coli K802 (pCT29K-2)                                                   
                      NRRL B-18010                                        
A. tumefaciens (pTi15955)                                                 
                      ATCC 15955                                          
E. coli HB101 (p8.8)  NRRL B-15393                                        
E. coli HB101 (p3.8)  NRRL B-15392                                        
______________________________________                                    
(ATCC American Type Culture Collection, 12301 Parklawn Dr., Rockville, M.D. 20852 USA; NRRL: ARS Patent Collection, Northern Regional Research Center, 1815 N. University St., Peoria, Ill. 61614 USA.) Other plasmids and strains are widely available and accessible to those in the art.
Example 1: Construction of a micro-Ti plasmid, pH575
E. coli K802 (pCT29K-2), which has been deposited as NRRL B-18010, was disclosed by Sutton D W et al., U.S. patent application Ser. No. 788,984, filed Oct. 21, 1985,now abandoned, which is hereby incorporated by reference. The T-DNA of pCT29K-2 can be represented as follows: ##STR1## Except for NPT1 (NPT1 is neomycin phosphotransferase I, NPT2 is neomycin phosphotransferase 11), all of these genes are transcribed in the same direction. This T-DNA can be removed from pCT29K-2 on a 9.52 kbp HindIII fragment.
The micro-T-DNA-carrying 9.52 kbp HindIII fragment of pCT29K-2 was mixed with and ligated to HindIII-linearized, dephosphorylated pTJS75 DNA (see Klee H J et al. (1985) Biotechnol. 3:637-642). Restriction mapping of E. coli transformants resistant both to kanamycin and to tetracycline resulted in identification of a colony harboring a plasmid designated pH575 (FIG. 2).
Example 2: Preparation of a phaseolin promoter
p8.8 (designated pPVPh8.8 in FIG. 3 of Hall T C et al. (1983) in Structure and Function of Plant Genes, eds. Ciferri 0 and Dure L, pp. 123-142) is a subclone of lambda-177.4 (Sun S M et al. (1981) Nature 289:37-41). p8.8 was made by partial EcoRI digestion of lambda-177.4 and insertion of a 8.8 kbp fragment into EcoRI-linearized pBR322. E. coli HB101 (p8.8) is on deposit as NRRL B-15393. Though the work done herein was done with p8.8 and derivatives thereof, p3.8 (designated AG-pPVPh3.8 by Slightom J L et al. (1983) Proc. Natl. Acad. Sci. USA 80:1897-1901) could be substituted. E. coli HB101 (p3.8) is on deposit as NRRL B-15392.
Phaseolus DNA was removed from p8.8 and inserted into an M13-based vector suitable for oligonucleotide-directed, site-specific mutagenesis. Hybridization to an oligonucleotide having sequence 5'CATCATAGTAGATCTAGTATTGAATATGAG', the two underlined bases representing a mutation relative to the sequence of the Phaseolus DNA. This substitutes GA for the C present at position +71 as reckoned by Slightom et al., supra., thereby creating a BglII site. Then the site specific mutagenesis procedure was completed, a mutated M13-derivative was identified, and the mutated Phaseolus DNA was reinserted into pBR322, thereby producing a plasmid designated p8.8pro, having a BglII site present about 8 bp 5'-to the phaseolin ATG translational start site. To summarize, p8.8pro differs from p8.8 as follows: ##STR2## The phaseolin promoter can be removed from p8.8pro on a 0.85 kbp (kilobase pair) BamHI/BglII fragment, the BamHI site being 5'-to the new BglII site.
Example 3: Preparation of a zein structural gene
A plasmid designated herein as pZG15RX (FIG. 1) is an EcoRI/XhoI subclone in pBR322 of the genomic clone gZ15A. pZG15RX carries the left most EcoRI/XhoI fragment disclosed by FIG. 1 of Pedersen K et al. (1986) J. Biol. Chem. 261:6279-6284. gZ15A carries a 15 kD zein gene and was isolated and sequenced by Pedersen et al. pZG15RX DNA was digested with HindIII and AhaIII, which respectively cut at about positions -179 and 673, as numbered in FIG. 2 of Pedersen et al. A 0.75 kbp fragment carrying the zein structural gene was then electrophoretically isolated. This fragment was then mixed with and ligated to HindIII- and SmaI-digested, dephosphorylated, pSP64 (FIG. 1) DNA (Melton D A et al. (1984) Nucl. Acids Res. 12:7035-7056). The ligation mixture was transformed into E. coli MC1061, ampicillin-resistant transformants were screened by restriction analysis, and a colony was identified which harbored a plasmid, designated pSPZ3 (FIG. 1), having the 15 kD zein gene inserted into pSP64.
Example 4: Combination of a phaseolin promoter and a zein structural gene
pSPZ3 DNA was digested with NdeI and S1 nuclease, thereby converting the NdeI sticky-end to blunt-ends. p8.8pro (FIG. 1) DNA was digested with BglII, BglII sticky-ends were converted to blunt-ends with S1 nuclease, and a 0.85 kbp fragment was isolated by acrylamide gel electrophoresis. This 0.85 kbp fragment, which carried a phaseolin promoter, was mixed with and ligated to the blunt-ended, linearized pSPZ3 DNA. After transformation into E. coli MC1061, DNA was isolated from ampicillin-resistant transformants. A colony was identified which harbored a plasmid, designated pPPZ60 (FIG. 1), having the phaseolin promoter and the zein structural gene in such position and orientation with respect to each other that in a plant cell a zein-encoding transcript can be transcribed under control of phaseolin promoter.
Example 5: Addition of a polyadenylation site
Though pPPZ6O has a zein-derived polyadenylic acid addition concensus sequence, it does not have extensive zein sequences 3'-to this concensus sequence. To assure proper polyadenylation, a more extensive phaseolin sequence which included a polyadenylation site was inserted behind the phaseolin promoter/zein structural gene combination. pPPZ60 DNA was digested with EcoRI. After having the EcoRI sticky-ends converted to blunt ends by incubation with T4 DNA polymerase, the linearized pPPZ6O DNA was digested with SacI, which, like EcoRI, cuts in the pSP64-derived polylinker 3'-to the promoter/structural gene combination. p3.8 (FIG. 1) DNA (Slightom et al., surpa) was cut with BamHI, had its BamHI sticky-ends converted to blunt-ends by incubation with the Klenow fragment of E. coli DNA polymerase I, and then, cut with SacI. A 1.1 kbp fragment carrying the phaseolin polyadenylation site was then electrophoretically isolated. This 1.1 kbp fragment was mixed with and ligated to the opened pPPZ60 DNA. After transformation into E. coli and selection for resistance to ampicillin, a colony was found harboring a plasmid, designated pPPZ60A (FIG. 1), having a phaseolin polyadenylation site 3'-to the promoter/structural gene combination in such position and orientation relative to the structural gene that in a plant cell a zein-encoding transcript can be transcribed under control of the phaseolin promoter and polyadenylation site. In pPPZ60A the SacI site between the zein and phaseolin polyadenylation sites was restored and BamHI 3'-to the phaseolin polyadenylation site was reconstructed.
The promoter/structural gene/polyadenylation site combination can be removed from pPPZ60A on a 2.8 kbp HindIII/BamHI fragment, the HindIII and BamHI sites being respectively 5'-to and 3'-to the combination. However, to insert the combination into the pH575 micro-Ti plasmid, it is useful to have the combination on a BamHI fragment. Therefore, the HindIII site was converted to a BamHI site. pPPZ60A DNA was digested with HindIII. This linearized, phosphorylated DNA was blunt-ended by digestion with mung bean nuclease. The blunt-ended pPPZ60A DNA was then mixed with and ligated to unphosphorylated BamHI linkers having a single-stranded sequence of 5'CGGGATCCCG3'. After transformation into E. coli MC1061, plasmid DNAs isolated from ampicillin-resistant transformants were characterized by restriction mapping. A colony was identified which harbored a plasmid, designated pPPZ60AB (FIG. 1), having a BamHI site replacing the pPPZ60A HindIII site.
Example 6: Insertion of the promoter/structural gene combination into pH575
BamHI-digested pPPZ60AB DNA was mixed with and ligated to BglII-digested, dephosphorylated pH575 (FIG. 2) DNA. The ligation mix was transformed into E. coli MC1061 and plasmid DNAs isolated from kanamycin-resistant transformants were characterized by hybridization with a [32]P-labeled zein gene fragment. Colonies were identified which harbored plasmids, designated PH5PZIC and pH5PZ3D (FIG. 2), which had the promoter/structural gene combination antiparallel and parallel, respectively, to the ocs and kan genes of pH575.
Example 7: Plant transformation
PH5PZIC and pH5PZ3D were individually transferred into A. tumefaciens LBA4404 (Ooms G et al. (1981) Gene 14:33-50), a vir gene-harboring, microTi-mobilizing strain, by the triparental mating technique (Ruvkun GB and Ausubel FM (1981) Nature 289:85-88), which is well known in the art. Tobacco leaf tissue was obtained from 4- or 5-week old Nicotiana tabacum var. XanthiNC plants grown in a greenhouse. Inoculation was by a modification of the method Horsch RB et al. (1985) Science 227:1229-1231. Inocula were prepared by placing two loopfuls of agrobacteria in 10 ml of L-broth. After suspension by forceful pipetting with a Pasteur pipet, inocula could be used immediately. Leaves were excised and midribs were removed; cutting surfaces were wetted with L-broth to help keep the leaves wet. Leaf pieces were about 2-4 mm wide and about 7-10 mm long. Leaf pieces were dipped in the inoculum for 5-10 min, though in some experiments, leaf pieces were just dipped into the inoculum or were infiltrated with the inoculum in a vacuum flask. Pieces were then blotted dry on sterile filter paper and placed upside-down on feeder plates prepared from a Xanthi suspension culture. The feeder plates had a SMPi medium (SMPi: MX- supplemented with 0.1 mg/l p-chlorophenoxyacetic acid (pCPA) and 7.5 mg/l 6-(8,8-dimethylallylamino)purine (2iP); MX- :1.65 g/l NH4 NO3, 1.9 g/l KNO3, 440 mg/l CaCl2.2H2 O, 370 mg/l MgSO4.7H2 O, 170 mg/l KH2 PO4, 0.83 mg/l KI, 6.2 mg/l H3 BO3, 22.3 mg/l MnSO4.4H2 O, 8.6 mg/l ZnSO4.7H2O, 0.25 mg/l Na2 MoO4.2H2 O, 0.025 mg/l CuSO4.5H2 O, 0.025 mg/l CoCl2.6H2 O, 1 g/l inositol, 50 mg/l nicotinic acid, 50 mg/l pyroxidine.HCl, 50 mg/l thiamine.HCl, 30 g/l sucrose, pH 5.8, solidified with 8 g/l agar). Leaf pieces were removed from feeder plates after 4-6 days and placed on SMPi medium supplemented with 500 mg/l carbenicillin, 50 mg/l cloxacillin, and 100-300 mg/l kanamycin (200 mg/l optimum). The resulting shoots were excised and placed on MX- medium supplemented with 100-300 mg/l kanamycin (200 mg/l optimum).
Example 8: Expression in plants
Regenerated tobacco plants descended from cells transformed by A. tumefaciens LBA4404 (pH5PZ1C) or A. tumefaciens LBA44O4 (pH5PZ3D) were self-fertilized. The resulting seeds were germinated on MX- supplemented with 100-300 mg/l kanamycin (200 mg/l optimum) to select plants containing the nonmonocot promoter/monocot seed storage protein structural genebearing T-DNA. Presence of the transformed T-DNA was confirmed by Southern blot analysis. Presence of zein protein in developing tobacco seeds was detected by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) followed by staining of the resultant gels, western blots (SDS-PAGE followed by transfer to membrane filters and immunological detection), and immuno-dot blots (immobilization of protein in dots on filter paper followed by immunological detection). Zein protein was detectable at levels over about 0.25 ng/seed or at about 0.05% protein, and many transformants had zein levels of 5 ng/seed or about 1% protein.

Claims (4)

I claim:
1. A dicot cell containing a monocot seed storage protein, wherein said protein is a prolamine, wherein said prolamine is a zein.
2. A cell according to claim 1, wherein the protein is a 15 kD zein.
3. A cell according to claim 2, wherein the cell is a cell in a seed and wherein the protein is present at a level greater than or equal to about 0.05% total protein.
4. A cell according to claim 2, wherein the cell is a cell in a seed and wherein the protein is present at a level greater than or equal to about 1.0% total protein.
US07/393,834 1986-08-29 1989-08-14 Monocot seed storage proteins in dicots Expired - Lifetime US5215912A (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US07/393,834 US5215912A (en) 1986-08-29 1989-08-14 Monocot seed storage proteins in dicots
US08/279,616 US5589616A (en) 1986-08-29 1994-07-25 Monocot seed storage proteins in dicots

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US90222486A 1986-08-29 1986-08-29
US07/393,834 US5215912A (en) 1986-08-29 1989-08-14 Monocot seed storage proteins in dicots

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US90222486A Continuation 1986-08-29 1986-08-29

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US98286992A Division 1986-08-29 1992-11-30

Publications (1)

Publication Number Publication Date
US5215912A true US5215912A (en) 1993-06-01

Family

ID=27014469

Family Applications (2)

Application Number Title Priority Date Filing Date
US07/393,834 Expired - Lifetime US5215912A (en) 1986-08-29 1989-08-14 Monocot seed storage proteins in dicots
US08/279,616 Expired - Lifetime US5589616A (en) 1986-08-29 1994-07-25 Monocot seed storage proteins in dicots

Family Applications After (1)

Application Number Title Priority Date Filing Date
US08/279,616 Expired - Lifetime US5589616A (en) 1986-08-29 1994-07-25 Monocot seed storage proteins in dicots

Country Status (1)

Country Link
US (2) US5215912A (en)

Cited By (34)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5589616A (en) * 1986-08-29 1996-12-31 Mycogen Plant Science, Inc. Monocot seed storage proteins in dicots
US5633436A (en) * 1993-03-02 1997-05-27 E. I. Du Pont De Nemours And Company Feedcrops enriched in sulfur amino acids and methods for improvements
US5874265A (en) * 1990-04-17 1999-02-23 Dekalb Genetics Corporation Methods and compositions for the production of stably transformed fertile monocot plants and cells thereof
US5894079A (en) * 1996-11-15 1999-04-13 Proctor; Larry M. Field bean cultivar named enola
US5990390A (en) * 1990-01-22 1999-11-23 Dekalb Genetics Corporation Methods and compositions for the production of stably transformed, fertile monocot plants and cells thereof
US6013863A (en) * 1990-01-22 2000-01-11 Dekalb Genetics Corporation Fertile transgenic corn plants
US6025545A (en) * 1990-01-22 2000-02-15 Dekalb Genetics Corporation Methods and compositions for the production of stably transformed, fertile monocot plants and cells thereof
US6087558A (en) * 1998-07-22 2000-07-11 Prodigene, Inc. Commercial production of proteases in plants
US6118047A (en) * 1993-08-25 2000-09-12 Dekalb Genetic Corporation Anthranilate synthase gene and method of use thereof for conferring tryptophan overproduction
WO2001002590A3 (en) * 1999-07-02 2001-08-09 Max Planck Gesellschaft Plants with modified gene expression
US6281411B1 (en) 1993-08-25 2001-08-28 Dekalb Genetics Corporation Transgenic monocots plants with increased glycine-betaine content
US6326527B1 (en) 1993-08-25 2001-12-04 Dekalb Genetics Corporation Method for altering the nutritional content of plant seed
US6329574B1 (en) 1990-01-22 2001-12-11 Dekalb Genetics Corporation High lysine fertile transgenic corn plants
US6395966B1 (en) 1990-08-09 2002-05-28 Dekalb Genetics Corp. Fertile transgenic maize plants containing a gene encoding the pat protein
US6399861B1 (en) 1990-04-17 2002-06-04 Dekalb Genetics Corp. Methods and compositions for the production of stably transformed, fertile monocot plants and cells thereof
US6407313B1 (en) 1995-08-15 2002-06-18 The Regents Of The University Of California Regulation of plant development and physiology through plasmodesmatal macromolecular transport of proteins and oligonucleotides
US20020124278A1 (en) * 1996-02-09 2002-09-05 Niu Man C. Methods for effectuating mRNA transfer of genetic information between species and product of the same
USH2074H1 (en) 1990-01-22 2003-07-01 Dekalb Genetics Corporation Fertile transgenic corn plants
EP1370130A4 (en) * 2001-02-27 2004-08-04 Multigenesis Corp Methods for effectuating mrna-mediated transfer of genetic information into plants and products of the same
EP1445321A1 (en) 2002-12-18 2004-08-11 Monsanto Technology LLC Maize embryo-specific promoter compositions and methods for use thereof
US6803499B1 (en) 1989-08-09 2004-10-12 Dekalb Genetics Corporation Methods and compositions for the production of stably transformed, fertile monocot plants and cells thereof
US6825398B2 (en) * 2001-09-05 2004-11-30 Monsanto Company Seed specific 7Sα promoter for expressing genes in plants
US20050166290A1 (en) * 1995-09-15 2005-07-28 All Benjamin P. Expression cassettes and methods for delivery of animal vaccines
WO2006089950A2 (en) 2005-02-26 2006-08-31 Basf Plant Science Gmbh Expression cassettes for seed-preferential expression in plants
WO2006120197A2 (en) 2005-05-10 2006-11-16 Basf Plant Science Gmbh Expression cassettes for seed-preferential expression in plants
WO2008099013A1 (en) 2007-02-16 2008-08-21 Basf Plant Science Gmbh Nucleic acid sequences for regulation of embryo-specific expression in monocotyledonous plants
EP2116606A1 (en) 2003-03-28 2009-11-11 Monsanto Technology, LLC Novel plant promoters for use in early seed development
EP2216405A1 (en) 2002-05-03 2010-08-11 Monsanto Technology LLC Speed specific USP promoters for expressing genes in plants
WO2010118477A1 (en) 2009-04-17 2010-10-21 Molecular Plant Breeding Nominees Ltd Plant promoter operable in endosperm and uses thereof
WO2011003901A1 (en) 2009-07-10 2011-01-13 Basf Plant Science Company Gmbh Expression cassettes for endosperm-specific expression in plants
US7902423B2 (en) 2005-04-20 2011-03-08 Basf Plant Science Gmbh Expression cassettes for seed-preferential expression that utilize the promoter from a flax tonoplast intrinsic protein gene
WO2011067712A1 (en) 2009-12-03 2011-06-09 Basf Plant Science Company Gmbh Expression cassettes for embryo-specific expression in plants
US9555097B2 (en) 2006-02-23 2017-01-31 Era Biotech, S.A. Recombinant protein bodies as immunogen-specific adjuvants
US9637751B2 (en) 2010-05-28 2017-05-02 Era Biotech, S.A. Recombinant protein body-inducing polypeptides

Families Citing this family (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5780709A (en) * 1993-08-25 1998-07-14 Dekalb Genetics Corporation Transgenic maize with increased mannitol content
US6821781B1 (en) * 1999-03-18 2004-11-23 Rutgers, The State University Method for selecting transformed plant cells using ethionine and cystathionine gamma synthase as the selection agent and marker gene
AU3763100A (en) * 1999-03-18 2000-10-04 Rutgers, The State University Transgenic plants having imroved flavor properties
AU2001255797A1 (en) * 2000-05-02 2001-11-12 Applied Phytologics, Inc. Enhanced gene expression in plants using transcription factors
US6878861B2 (en) * 2000-07-21 2005-04-12 Washington State University Research Foundation Acyl coenzyme A thioesterases
US7060442B2 (en) * 2000-10-30 2006-06-13 Regents Of The University Of Michigan Modulators on Nod2 signaling
US6863731B2 (en) * 2002-10-18 2005-03-08 Controls Corporation Of America System for deposition of inert barrier coating to increase corrosion resistance
US8008545B2 (en) * 2003-04-15 2011-08-30 Basf Plant Science Gmbh Process for the production of fine chemicals
EP2434019A1 (en) 2003-08-01 2012-03-28 BASF Plant Science GmbH Process for the production of fine chemicals
EP1735452A2 (en) 2004-04-06 2006-12-27 Metanomics GmbH Process for the production of fine chemicals
EP1765857A2 (en) 2004-07-02 2007-03-28 Metanomics GmbH Process for the production of fine chemicals
EP2096177A3 (en) 2004-12-17 2010-01-13 Metanomics GmbH Process for the production of lutein
EP2573188A2 (en) 2005-03-02 2013-03-27 Metanomics GmbH Process for the production of fine chemicals
AU2006219823A1 (en) 2005-03-02 2006-09-08 Metanomics Gmbh Process for the production of fine chemicals
CN101198701B (en) 2005-04-19 2013-04-24 巴斯福植物科学有限公司 Endosperm-specific and/or germinating embryo-specific expression of starch in monocots
CA2644273A1 (en) 2006-04-05 2008-03-27 Metanomics Gmbh Process for the production of a fine chemical
US7472940B2 (en) * 2006-10-11 2009-01-06 John Timothy Sullivan Universal instrument mount

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0142924A2 (en) * 1983-09-26 1985-05-29 Mycogen Plant Science, Inc. Insect resistant plants

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5215912A (en) * 1986-08-29 1993-06-01 Lubrizol Genetics, Inc. Monocot seed storage proteins in dicots

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0142924A2 (en) * 1983-09-26 1985-05-29 Mycogen Plant Science, Inc. Insect resistant plants

Non-Patent Citations (57)

* Cited by examiner, † Cited by third party
Title
Adang et al., 1985. Chem. Abstr. 103(9): #66080c.
Adang et al., 1985. Chem. Abstr. 103(9): 66080c. *
Ellis et al. (1987) EMBO J. 6:11 16. *
Ellis et al. (1987) EMBO J. 6:11-16.
Forde et al. (1981) Nucl. Acids. Res. 9:6689 6707. *
Forde et al. (1981) Nucl. Acids. Res. 9:6689-6707.
Forde et al. (1983) FEBS Lett. 162:360 366. *
Forde et al. (1983) FEBS Lett. 162:360-366.
Forde et al. (1985) EMBO J. 4:9 15. *
Forde et al. (1985) EMBO J. 4:9-15.
Gelvin (1987) Plant Mol. Biol. 8:355 359. *
Gelvin (1987) Plant Mol. Biol. 8:355-359.
Gelvin et al. 1985. Mol. Gen. Genet. 199:240 248. *
Gelvin et al. 1985. Mol. Gen. Genet. 199:240-248.
Geraghty et al. (1981) Nucl. Acids. Res. 9:5163 5174. *
Geraghty et al. (1981) Nucl. Acids. Res. 9:5163-5174.
Goldsbrough et al (1986) Mol. Gen. Genet. 202:374 381. *
Goldsbrough et al (1986) Mol. Gen. Genet. 202:374-381.
Hepburn and White (1985) Plant Mol. Biol 5:3 11. *
Hepburn and White (1985) Plant Mol. Biol 5:3-11.
Keith et al. 1986. EMBO J 5(10):2419 25. *
Keith et al. 1986. EMBO J 5(10):2419-25.
Lamppa et al. 1985. Nature 316:750 752. *
Lamppa et al. 1985. Nature 316:750-752.
Lewin, B. 1987. Genes, Third edition, John Wiley & Sons: New York. *
Loenen and Brammar (1980) Gene 20:249 259. *
Loenen and Brammar (1980) Gene 20:249-259.
Marks et al. 1982. J. Biol. Chem. 257:9976 9983. *
Marks et al. 1982. J. Biol. Chem. 257:9976-9983.
Marks et al. 1985. J. Biol. Chem. 260(30):16451 16459. *
Marks et al. 1985. J. Biol. Chem. 260(30):16451-16459.
Matzke et al (1984) EMBO J. 3:1525 1531. *
Matzke et al (1984) EMBO J. 3:1525-1531.
Pedersen et al. (1982) Cell 29:1015 1026. *
Pedersen et al. (1982) Cell 29:1015-1026.
Pedersen et al. (1986) J. Biol. Chem. 261:6279 6284. *
Pedersen et al. (1986) J. Biol. Chem. 261:6279-6284.
Rafalski et al. (1984) EMBO J. 3:1409 1415. *
Rafalski et al. (1984) EMBO J. 3:1409-1415.
Rochester et al. (1986) EMBO J. 5:451 458. *
Rochester et al. (1986) EMBO J. 5:451-458.
Rubin (1986) Mol. Gen. Genet. 202:312 320. *
Rubin (1986) Mol. Gen. Genet. 202:312-320.
Scheets et al. (1985) Plant Sci. Lett. 37:221 225. *
Scheets et al. (1985) Plant Sci. Lett. 37:221-225.
Sengupta Gopalan et al. 1985. Proc. Natl. Acad. Sci. USA 82:3320 3324. *
Sengupta-Gopalan et al. 1985. Proc. Natl. Acad. Sci. USA 82:3320-3324.
Shaw et al. (1984) Nucl. Acids Res. 12:6031 6041. *
Shaw et al. (1984) Nucl. Acids Res. 12:6031-6041.
Spena et al. (1982) EMBO J. 1:1589 1594. *
Spena et al. (1982) EMBO J. 1:1589-1594.
Spena et al. (1983) J. Mol. Biol. 169:799 811. *
Spena et al. (1983) J. Mol. Biol. 169:799-811.
Sumner Smith et al. (1985) Nucl. Acids Res. 13:3905 3916. *
Sumner-Smith et al. (1985) Nucl. Acids Res. 13:3905-3916.
Wilson et al. 1984. J. Mol. Evol. 20:330 340. *
Wilson et al. 1984. J. Mol. Evol. 20:330-340.

Cited By (56)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5589616A (en) * 1986-08-29 1996-12-31 Mycogen Plant Science, Inc. Monocot seed storage proteins in dicots
US6803499B1 (en) 1989-08-09 2004-10-12 Dekalb Genetics Corporation Methods and compositions for the production of stably transformed, fertile monocot plants and cells thereof
US20070300315A1 (en) * 1990-01-22 2007-12-27 Lundquist Ronald C Fertile transgenic corn plants
US20070044181A1 (en) * 1990-01-22 2007-02-22 Lundquist Ronald C Methods and compositions for the production of stably transformed, fertile monocot plants and cells thereof
US6946587B1 (en) 1990-01-22 2005-09-20 Dekalb Genetics Corporation Method for preparing fertile transgenic corn plants
USH2074H1 (en) 1990-01-22 2003-07-01 Dekalb Genetics Corporation Fertile transgenic corn plants
US5990390A (en) * 1990-01-22 1999-11-23 Dekalb Genetics Corporation Methods and compositions for the production of stably transformed, fertile monocot plants and cells thereof
US6013863A (en) * 1990-01-22 2000-01-11 Dekalb Genetics Corporation Fertile transgenic corn plants
US6025545A (en) * 1990-01-22 2000-02-15 Dekalb Genetics Corporation Methods and compositions for the production of stably transformed, fertile monocot plants and cells thereof
US20060010520A1 (en) * 1990-01-22 2006-01-12 Lundquist Ronald C Fertile transgenic corn plants
US7615685B2 (en) 1990-01-22 2009-11-10 Dekalb Genetics Corporation Methods of producing human or animal food from stably transformed, fertile maize plants
US20070022493A1 (en) * 1990-01-22 2007-01-25 Lundquist Ronald C Fertile transgenic corn plants
US8440886B2 (en) 1990-01-22 2013-05-14 Monsanto Technology Llc Fertile transgenic corn plants
US6777589B1 (en) 1990-01-22 2004-08-17 Dekalb Genetics Corporation Methods and compositions for the production of stably transformed, fertile monocot plants and cells thereof
US7064248B2 (en) 1990-01-22 2006-06-20 Dekalb Genetics Corp. Method of preparing fertile transgenic corn plants by microprojectile bombardment
US6329574B1 (en) 1990-01-22 2001-12-11 Dekalb Genetics Corporation High lysine fertile transgenic corn plants
US6399861B1 (en) 1990-04-17 2002-06-04 Dekalb Genetics Corp. Methods and compositions for the production of stably transformed, fertile monocot plants and cells thereof
US5874265A (en) * 1990-04-17 1999-02-23 Dekalb Genetics Corporation Methods and compositions for the production of stably transformed fertile monocot plants and cells thereof
US7705215B1 (en) 1990-04-17 2010-04-27 Dekalb Genetics Corporation Methods and compositions for the production of stably transformed, fertile monocot plants and cells thereof
US5969213A (en) * 1990-04-17 1999-10-19 Dekalb Genetics Corporation Methods and compositions for the production of stably transformed fertile monocot plants and cells thereof
US5919675A (en) * 1990-04-17 1999-07-06 Dekalb Genetics Corporation Methods and compositions for the production of stably transformed, fertile monocot plants and cells thereof
US6395966B1 (en) 1990-08-09 2002-05-28 Dekalb Genetics Corp. Fertile transgenic maize plants containing a gene encoding the pat protein
US20030126634A1 (en) * 1990-08-09 2003-07-03 Dekalb Genetics Corporation Methods and compositions for the increase of yield in plants
US5633436A (en) * 1993-03-02 1997-05-27 E. I. Du Pont De Nemours And Company Feedcrops enriched in sulfur amino acids and methods for improvements
US7547820B2 (en) 1993-08-25 2009-06-16 Dekalb Genetics Corporation Method for altering the nutritional content of plant seed
US6118047A (en) * 1993-08-25 2000-09-12 Dekalb Genetic Corporation Anthranilate synthase gene and method of use thereof for conferring tryptophan overproduction
US6271016B1 (en) 1993-08-25 2001-08-07 Dekalb Genetics Corporation Anthranilate synthase gene and method of use thereof for conferring tryptophan overproduction
US6960709B1 (en) 1993-08-25 2005-11-01 Dekalb Genetics Corporation Method for altering the nutritional content of plant seed
US6281411B1 (en) 1993-08-25 2001-08-28 Dekalb Genetics Corporation Transgenic monocots plants with increased glycine-betaine content
US6326527B1 (en) 1993-08-25 2001-12-04 Dekalb Genetics Corporation Method for altering the nutritional content of plant seed
US20060112443A1 (en) * 1993-08-25 2006-05-25 Kirihara Julie A Method for altering the nutritional content of plant seed
US6407313B1 (en) 1995-08-15 2002-06-18 The Regents Of The University Of California Regulation of plant development and physiology through plasmodesmatal macromolecular transport of proteins and oligonucleotides
US20050166290A1 (en) * 1995-09-15 2005-07-28 All Benjamin P. Expression cassettes and methods for delivery of animal vaccines
US20020124278A1 (en) * 1996-02-09 2002-09-05 Niu Man C. Methods for effectuating mRNA transfer of genetic information between species and product of the same
US5894079A (en) * 1996-11-15 1999-04-13 Proctor; Larry M. Field bean cultivar named enola
US20060015971A1 (en) * 1998-07-22 2006-01-19 Prodigene, Inc. Commerical production of proteases in plants
US7049484B2 (en) 1998-07-22 2006-05-23 Prodi Gene, Inc. Commercial production of proteases in plants
US6087558A (en) * 1998-07-22 2000-07-11 Prodigene, Inc. Commercial production of proteases in plants
US20040049812A1 (en) * 1998-07-22 2004-03-11 Howard John A. Commercial production of proteases in plants
WO2001002590A3 (en) * 1999-07-02 2001-08-09 Max Planck Gesellschaft Plants with modified gene expression
EP1370130A4 (en) * 2001-02-27 2004-08-04 Multigenesis Corp Methods for effectuating mrna-mediated transfer of genetic information into plants and products of the same
US6825398B2 (en) * 2001-09-05 2004-11-30 Monsanto Company Seed specific 7Sα promoter for expressing genes in plants
EP2216405A1 (en) 2002-05-03 2010-08-11 Monsanto Technology LLC Speed specific USP promoters for expressing genes in plants
EP1445321A1 (en) 2002-12-18 2004-08-11 Monsanto Technology LLC Maize embryo-specific promoter compositions and methods for use thereof
EP2116606A1 (en) 2003-03-28 2009-11-11 Monsanto Technology, LLC Novel plant promoters for use in early seed development
EP2116607A1 (en) 2003-03-28 2009-11-11 Monsanto Technology, LLC Novel plant promoters for use in early seed development
WO2006089950A2 (en) 2005-02-26 2006-08-31 Basf Plant Science Gmbh Expression cassettes for seed-preferential expression in plants
US7902423B2 (en) 2005-04-20 2011-03-08 Basf Plant Science Gmbh Expression cassettes for seed-preferential expression that utilize the promoter from a flax tonoplast intrinsic protein gene
WO2006120197A2 (en) 2005-05-10 2006-11-16 Basf Plant Science Gmbh Expression cassettes for seed-preferential expression in plants
US9555097B2 (en) 2006-02-23 2017-01-31 Era Biotech, S.A. Recombinant protein bodies as immunogen-specific adjuvants
WO2008099013A1 (en) 2007-02-16 2008-08-21 Basf Plant Science Gmbh Nucleic acid sequences for regulation of embryo-specific expression in monocotyledonous plants
WO2010118477A1 (en) 2009-04-17 2010-10-21 Molecular Plant Breeding Nominees Ltd Plant promoter operable in endosperm and uses thereof
WO2011003901A1 (en) 2009-07-10 2011-01-13 Basf Plant Science Company Gmbh Expression cassettes for endosperm-specific expression in plants
WO2011067712A1 (en) 2009-12-03 2011-06-09 Basf Plant Science Company Gmbh Expression cassettes for embryo-specific expression in plants
EP3002332A2 (en) 2009-12-03 2016-04-06 BASF Plant Science Company GmbH Expression cassettes for embryo-specific expression in plants
US9637751B2 (en) 2010-05-28 2017-05-02 Era Biotech, S.A. Recombinant protein body-inducing polypeptides

Also Published As

Publication number Publication date
US5589616A (en) 1996-12-31

Similar Documents

Publication Publication Date Title
US5215912A (en) Monocot seed storage proteins in dicots
US5003045A (en) Modified 7S legume seed storage proteins
US5466792A (en) RI T-DNA Promoters
US6015891A (en) Synthetic insecticidal crystal protein gene having a modified frequency of codon usage
Bordas et al. Transfer of the yeast salt tolerance gene HAL1 to Cucumis melo L. cultivars and in vitro evaluation of salt tolerance
US6130366A (en) Chimaeric gene coding for a transit peptide and a heterologous polypeptide
EP0571500B1 (en) A high sulfur seed protein gene and method for increasing the sulfur amino acid content of plants
US6013523A (en) Transgenic plants comprising a synthetic insecticidal crystal protein gene having a modified frequency of codon usage
AU704510B2 (en) Chimeric genes and methods for increasing the lysine content of the seeds of corn, soybean and rapeseed plants
CN103269577B (en) Strains of Agrobacterium modified to increase plant transformation frequency
EP0240332B1 (en) Virus resistant plants having antisense RNA
EP0459643A2 (en) A recombinant promoter for gene expression in monocotyledonous plants
US20030188345A1 (en) Binary vectors for the improved transformation of plants systems
WO1997013843A9 (en) Production of water stress or salt stress tolerant transgenic cereal plants
EP0429458A1 (en) METHOD FOR INDUCING OVERPRODUCTION OF LYSINE IN PLANTS.
EP0954584B1 (en) Methods for improving transformation efficiency
CA2073412A1 (en) Selection-gene-free transgenic plants
WO2011125748A1 (en) Polynucleotides encoding nf-yb originating in jatropha and utilization thereof
AU620317B2 (en) Intracellular directed delivery of expression products
US5850018A (en) Expression control sequence for general and effective expression of genes in plants
EP0240331B1 (en) Virus resistant plants having a viral coat protein
US5955330A (en) Means for enhancing gene expression
EP0174166A1 (en) Disarmed T-DNA
EP0222493A1 (en) TR-based sub-TI plasmids
US6770800B2 (en) Methods of using viral replicase polynucleotides and polypeptides

Legal Events

Date Code Title Description
STCF Information on status: patent grant

Free format text: PATENTED CASE

AS Assignment

Owner name: MYCOGEN PLANT SCIENCE, INC., CALIFORNIA

Free format text: CHANGE OF NAME;ASSIGNOR:LUBRIZOL GENETICS, INC.;REEL/FRAME:006920/0047

Effective date: 19921130

FPAY Fee payment

Year of fee payment: 4

FPAY Fee payment

Year of fee payment: 8

FPAY Fee payment

Year of fee payment: 12

FEPP Fee payment procedure

Free format text: PAYOR NUMBER ASSIGNED (ORIGINAL EVENT CODE: ASPN); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY