US20180245156A1 - Method of Testing for Endometriosis and Treatment Therefor - Google Patents

Method of Testing for Endometriosis and Treatment Therefor Download PDF

Info

Publication number
US20180245156A1
US20180245156A1 US15/838,133 US201715838133A US2018245156A1 US 20180245156 A1 US20180245156 A1 US 20180245156A1 US 201715838133 A US201715838133 A US 201715838133A US 2018245156 A1 US2018245156 A1 US 2018245156A1
Authority
US
United States
Prior art keywords
endometriosis
seq
biomarker
risk associated
defines
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US15/838,133
Inventor
Kenneth Ward
Rakesh N. Chettier
Hans Albertsen
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
JUNEAU BIOSCIENCES LLC
Original Assignee
JUNEAU BIOSCIENCES LLC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US12/056,754 external-priority patent/US20080305967A1/en
Priority claimed from US12/120,322 external-priority patent/US20080306034A1/en
Priority claimed from US12/765,643 external-priority patent/US11287425B2/en
Priority claimed from US13/159,132 external-priority patent/US20150361494A1/en
Priority claimed from US13/603,284 external-priority patent/US20150363558A1/en
Application filed by JUNEAU BIOSCIENCES LLC filed Critical JUNEAU BIOSCIENCES LLC
Priority to US15/838,133 priority Critical patent/US20180245156A1/en
Assigned to JUNEAU BIOSCIENCES, LLC reassignment JUNEAU BIOSCIENCES, LLC ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: ALBERTSEN, HANS M., CHETTIER, RAKESH N., WARD, KENNETH
Publication of US20180245156A1 publication Critical patent/US20180245156A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/172—Haplotypes

Definitions

  • the present invention relates to endometriosis prognosis, diagnosis and therapy.
  • the present invention relates to a novel algorithmic combination of endometriosis associated single nucleotide polymorphisms (SNPs) and Rare Variants (RVs), and endometriosis related clinical analysis to result in an endometriosis predictive and/or diagnostic test and related treatment therefor.
  • SNPs single nucleotide polymorphisms
  • RVs Rare Variants
  • Endometriosis may include autoimmune endometriosis, mild endometriosis, moderate endometriosis, severe endometriosis, superficial (peritoneal) endometriosis, deep (invasive) endometriosis, ovarian endometriosis, endometriosis-related cancers, and “endometriosis-associated conditions”.
  • endometriosis is used to describe any of these conditions.
  • Endometriosis is most generally defined as the presence of endometrium (glands and stroma) at sites outside of the uterus (ectopic endometrial tissues rather than eutopic or within the uterus).
  • the most common sites are the ovaries, pelvic peritoneum, uterosacral ligaments, pouch of Douglas, and rectovaginal septum although implants have been identified on the peritoneal surfaces of the abdomen (these may grow into the intestines, ureters or bladder), in the thorax, at the umbilicus, and at incision sites of prior surgeries (Child T J, Tan S L (2001) Endometriosis: aetiology, pathogenesis and treatment, Drugs 61:1735-1750; Giudice et al. (1998) Status of current research on endometriosis, The Journal of reproductive medicine 43:252-262).
  • Endometriosis is a common gynecologic disorder. The prevalence is difficult to know. It has been estimated that it affects approximately 14% of all women (range 1-43%), 40-60% of women with pelvic pain and 30%-50% of infertile women (Di Blasio et al. (2005) Genetics of endometriosis, Minerva ginecologica 57:225-236; Schindler AE (2004) Pathophysiology, diagnosis and treatment of endometriosis, Minerva ginecologica 56:419-435).
  • a non-surgical method of clinically assessing a predisposition to endometriosis is to determine the answer to three distinct endometriosis related questions, each question having an associated Odds Ratio (OR), as shown in FIG. 1 .
  • OR Odds Ratio
  • the results of answers to the FIG. 1 questions are then complied according to the endometriosis clinical factor assessment chart as shown in FIG. 2 resulting in a Raw Clinical Probability Value (RCPV).
  • the RCPV is preferably multiplied by a Relevance Factor (RF) based on a patient's age and race to result in a Final Clinical Probability Value (FCPV).
  • RF Relevance Factor
  • FCPV Final Clinical Probability Value
  • the RCPV may be used with data collected in population surveys.
  • MultiDimensional Analysis is an analysis process that groups data into two or more categories (e.g. cases and controls or patients having a high probability of endometriosis and patients having a low probability of endometriosis).
  • Logistic regression analysis is a process that is used for prediction of the probability of occurrence of an event by fitting data to a logit function logistic curve.
  • Bayesian analysis or Bayesian interference is a method of statistical inference in which evidence is used to estimate parameters and predictions in a probability model.
  • the administered therapeutic may be any of a hormonal treatment such as an estrogen containing composition, a progesterone containing composition, a progestin containing composition, a gonadotropin releasing-hormone (GnRH) agonist, or other ovulation suppression composition, an advanced reproductive therapy or ART (ART is used to treat endometriosis related infertility and may include any fertility treatments in which the egg or sperm are “handled” in vitro as part of the treatment), or a combination thereof.
  • the therapeutic may be administered in the form of an oral contraceptive (OC).
  • the GnRH therapeutic may take the form of a GnRH agonist in combination with a patient specific substantially low dose of estrogen, progestin, or tibolone.
  • a low dose of estrogen, progestin, or tibolone in combination with a GnRH agonist to compensate potential side effects of the GnRH agonist are commonly referred to as an “add-back” therapy. It is noted that in such add-back therapy, the dosage of estrogen, progestin, or tibolone is relatively small so as to not reduce the effectiveness of the GnRH agonist.
  • the present invention defines a method for endometriosis diagnosis/prognosis that preferably combines known endometriosis clinical factor assessment methods with endometriosis associated biomarkers such as single nucleotide polymorphisms (SNPs), indels, insertions, deletions, genomic rearrangements, Rare Variants (RVs), and more especially the biomarkers identified in table 1 (or diagnostically and predicatively functionally comparable biomarkers), preferably via a statistical assessment method such as MultiDimensional Scaling analysis (MDS), logistic regression, or Bayesian analysis.
  • MDS MultiDimensional Scaling analysis
  • the present invention further preferably includes the treatment of a subject determined to have or be predisposed to endometriosis by administering to such subject a therapeutic such as an OC that at least partially compensates for endometriosis or that prevents or reduces the severity of endometriosis that the subject would otherwise develop or that prevents endometriosis related complications, cancers, or associated disorders.
  • a therapeutic such as an OC that at least partially compensates for endometriosis or that prevents or reduces the severity of endometriosis that the subject would otherwise develop or that prevents endometriosis related complications, cancers, or associated disorders.
  • a SNP is understood to be a genetic polymorphism having a Minor Allele Frequency (MAF) of at least 1% in a population (such as for instance the Caucasian population or the CEU population) and an RV is understood to be a genetic polymorphism having a Minor Allele Frequency (MAF) of less than 1% in a population (such as for instance the Caucasian population or the CEU population).
  • MAF Minor Allele Frequency
  • Linkage disequilibrium means that a particular combination of alleles (alternative nucleotides) or genetic markers at two or more different SNP (or RV) sites are non-randomly co-inherited (i.e., the combination of alleles at the different SNP (or RV) sites occurs more or less frequently in a population than the separate frequencies of occurrence of each allele or the frequency of a random formation of haplotypes from alleles in a given population).
  • the term “LD” differs from “linkage,” which describes the association of two or more loci on a chromosome with limited recombination between them.
  • LD is also used to refer to any non-random genetic association between allele(s) at two or more different SNP (or RV) sites. Therefore, when a SNP (or RV) is in LD with other SNPs (or RVs), the particular allele of the first SNP (or RV) often predicts which alleles will be present in those SNPs (or RVs) in LD.
  • LD is generally, but not exclusively, due to the physical proximity of the two loci along a chromosome. Hence, genotyping one of the SNP (or RV) sites will give almost the same information as genotyping the other SNP (or RV) site that is in LD. Linkage disequilibrium is caused by fitness interactions between genes or by such non-adaptive processes as population structure, inbreeding, and stochastic effects.
  • LD is the non-random association of alleles adjacent loci.
  • a particular allele at one locus is found together on the same chromosome with a specific allele at a second locus-more often than expected if the loci were segregating independently in a population—the loci are in disequilibrium.
  • This concept of LD is formalized by one of the earliest measures of disequilibrium to be proposed (symbolized by D).
  • D in common with most other measures of LD, quantifies disequilibrium as the difference between the observed frequency of a two-locus haplotype and the frequency it would be expected to show if the alleles are segregating at random.
  • D has the intuitive concepts of LD, its numerical value is of little use for measuring the strength of and comparing levels of LD. This is due to the dependence of D on allele frequencies.
  • the two most common measures are the absolute value of D′ and r 2 .
  • the absolute value of D′ is determined by dividing D by its maximum possible value, given the allele frequencies at the two loci.
  • the measure r 2 is in some ways complementary to D′. An r 2 value of 1 indicates complete LD as well while an r 2 value of 0 indicates linkage equilibrium. Complete LD demonstrates complete dependency.
  • the number of counts of the minor allele in loci 1 corresponds to the counts of minor allele in loci 2.
  • the alleles themselves might be different the frequency of Minor allele in loci 1 will be equal to the frequency of Minor allele in loci 2.
  • the genotype on rs 2 is GC for that person.
  • the invention also provides a kit comprising SNP detection reagents, and methods for detecting the SNPs disclosed herein by employing detection reagents and a questionnaire of non-genetic clinical factors.
  • the questionnaire would be completed by a medical professional based on medical history physical exam or other clinical findings.
  • the questionnaire would include any other non-genetic clinical factors known to be associated with the risk of developing endometriosis.
  • the novel SNPs disclosed in '754 as well as other genetic markers are used in the selection of patients to whom a therapeutic will be administered based on the patient's assessed risk of developing endometriosis or based on the patient's assessed risk of endometriosis progression.
  • the administered therapeutic may preferably be a patient specific gene or protein based therapy enabled and informed by SNPs discovered to be associated with endometriosis.
  • the administered therapeutic may be any of a hormonal treatment such as an estrogen containing composition, a progesterone containing composition, a progestin containing composition, a gonadotropin releasing-hormone (GnRH) agonist, or other ovulation suppression composition, or a combination thereof.
  • GnRH gonadotropin releasing-hormone
  • the therapeutic may be administered in the form of an OC.
  • the GnRH therapeutic may take the form of a GnRH agonist in combination with a patient specific substantially low dose of estrogen, progestin, or tibolone.
  • Such administration of a low dose of estrogen, progestin, or tibolone in combination with a GnRH agonist to compensate potential side effects of the GnRH agonist are commonly referred to as an “add-back” therapy. It is noted that in such add-back therapy, the dosage of estrogen, progestin, or tibolone is relatively small so as to not reduce the effectiveness of the GnRH agonist.
  • a genetic marker e.g. SNP or RV
  • MA minor allele
  • the MA of the genetic marker in this instance the endometriosis associated genetic marker
  • C causative marker
  • P protective marker
  • the phrase “functional equivalent” as used herein with respect to biomarkers shall mean that a second biomarker is substantially equivalent in its diagnostic and/or prognostic value with respect to a given disease as is a first biomarker's diagnostic and/or prognostic value with respect to the given disease.
  • a second biomarker that is in complete LD with a first biomarker shall be expressly included within the scope of “functional equivalent” with respect to the relationship between the second biomarker to the first biomarker.
  • FIG. 1 depicts a “Threee Endometriosis Related Clinical Questions” chart, and;
  • FIG. 2 depicts an “Endometriosis Clinical Factor Assessment” chart.
  • the method of determining predisposition to endometriosis for a patient is performed according to the following steps.
  • a first step answers to the FIG. 1 questions are obtained for the patient.
  • an RCPV according to FIG. 2 is determined for the patient based on the answers obtained for the patient in step 1.
  • the RCPV is optionally multiplied by an RF or otherwise adjusted according to the patient's age and race or according to relevant population survey data to result in a FCPV.
  • at least one endometriosis associated biomarker preferably drawn from the biomarkers of table 1 is identified in genetic material of the patient.
  • at least one statistical analysis (preferably MDS) is performed to combine the RCPV (or the FCPV) and the predictive value of the identified genetic biomarker to result in a highly predictive endometriosis prognosis or diagnosis.
  • Oral contraceptives are contraceptives that are commonly taken orally for the principal purpose of the prevention of conception. Such contraceptives are also commonly referred to as “Oral Contraceptive Pills” or OCPs, or simply as the “Pill”. Such OCs typically define a substance in pill form being comprised at least partially of estrogen, progesterone, or a combination thereof.
  • the progesterone component may further be any of Desogestrel, Drospirenone, Ethynodiol, Levonorgestrel, Norethindrone, Norgestimate, and Norgestrel
  • the estrogen component may further be any of Mestranol, Estradiol, and Ethinyl.
  • Exemplary OCs that are commercially available are sold under the following names: ALESSE, APRI, ARANELLE, AVIANE, BREVICON, CAMILA, CESIA, CRYSELLE, CYCLESSA, DEMULEN, DESOGEN, ENPRESSE, ERRIN, ESTROSTEP, JOLIVETTE, JUNEL, KARIVA, LEENA, LESSINA, LEVLEN, LEVORA, LOESTRIN, LUTERA, MICROGESTIN, MICRONOR, MIRCETTE, MODICON, MONONESSA, NECON, NORA, NORDETTE, NORINYL, NOR-QD, NORTREL, OGESTREL, ORTHO-CEPT, ORTHO-CYCLEN, ORTHO-NOVUM, ORTHO-TRI-CYCLEN, OVCON, OVRAL, OVRETTE, PORTIA, PREVIFEM, RECLIPSEN, SOLIA, SPRINTEC, TRINESSA, TRI-NORINY
  • GnRH gonadotropin releasing-hormone
  • drugs are modified versions of a naturally occurring hormone known as gonadotropin releasing hormone, which helps to control the menstrual cycle.
  • Administration of such drugs is known to be performed in combination with an “add-back” therapy.
  • an add-back therapy could be for instance the administration of a low dose of estrogen, progestin, or tibolone in combination with a GnRH agonist to compensate potential side effects of the GnRH agonist. It is noted that in such add-back therapy, the dosage of estrogen, progestin, or tibolone is relatively small so as to not reduce the effectiveness of the GnRH agonist.
  • the present invention provides SNPs associated with endometriosis, nucleic acid molecules containing SNPs, methods and reagents for the detection of the SNPs disclosed herein, uses of these SNPs for the development of detection reagents, and assays or kits that utilize such reagents.
  • the SNPs disclosed herein are useful for diagnosing, screening for, and evaluating predisposition to endometriosis and progression of endometriosis. Additionally, such SNPs are useful in the determining individual subject treatment plans and design of clinical trials of devices for possible use in the treatment of endometriosis. Furthermore, such SNPs and their encoded products are useful targets for the development of therapeutic agents.
  • SNPs combined with other non-genetic clinical factors are useful for diagnosing, screening, evaluating predisposition to endometriosis, assessing risk of progression of endometriosis, determining individual subject treatment plans and design of clinical trials of devices for possible use in the treatment of endometriosis. Furthermore, such SNPs and are useful in the selection of recipients for an OC type therapeutic.
  • the invention disclosed herein further teaches a method of selectively administering a therapeutic.
  • Such method of administering a therapeutic preferably includes the following steps: a) Obtaining a genetic material sample of a human female subject, b) Identifying in the genetic material of the subject preferably at least one of the SNPs disclosed in '754 or alternatively identifying any other genetic marker having an association with endometriosis, c) Assessing the subject's risk of endometriosis or risk of endometriosis progression, d) Identifying the subject as having an altered risk of endometriosis or an altered risk of endometriosis progression, and e) administering to the subject a therapeutic.
  • the subject may be endometriosis presymptomatic or the subject may exhibit endometriosis symptoms. It is also noted that the assessment of risk may also include non-genetic clinical factors.
  • the therapeutic may be a gene or protein based therapy adapted to the specific needs of a select patient.
  • the therapeutic may alternatively take the form of a testosterone or a modified testosterone such as Danazol.
  • the therapeutic defines a hormonal treatment therapeutic which may be administered alone or in combination with a gene therapy.
  • the therapeutic may be an estrogen containing composition, a progesterone containing composition, a progestin containing composition, a gonadotropin releasing-hormone (GnRH) agonist, or other ovulation suppression composition, or a combination thereof.
  • GnRH gonadotropin releasing-hormone
  • the GnRH agonist may take the form of a GnRH agonist in combination with a patient specific substantially low dose of estrogen, progestin, or tibolone via an add-back administration.
  • the therapeutic is preferably an OC.
  • the OC preferably defines a substance in pill form that is comprised at least partially of estrogen, progesterone, or a combination thereof.
  • the progesterone component may further be any of Desogestrel, Drospirenone, Ethynodiol, Levonorgestrel, Norethindrone, Norgestimate, and Norgestrel
  • the estrogen component may further be any of Mestranol, Estradiol, and Ethinyl.
  • the OC may be any commercially available OC including ALESSE, APRI, ARANELLE, AVIANE, BREVICON, CAMILA, CESIA, CRYSELLE, CYCLESSA, DEMULEN, DESOGEN, ENPRESSE, ERRIN, ESTROSTEP, JOLIVETTE, JUNEL, KARIVA, LEENA, LESSINA, LEVLEN, LEVORA, LOESTRIN, LUTERA, MICROGESTIN, MICRONOR, MIRCETTE, MODICON, MONONESSA, NECON, NORA, NORDETTE, NORINYL, NOR-QD, NORTREL, OGESTREL, ORTHO-CEPT, ORTHO-CYCLEN, ORTHO-NOVUM, ORTHO-TRI-CYCLEN, OVCON, OVRAL, OVRETTE, PORTIA, PREVIFEM, RECLIPSEN, SOLIA, SPRINTEC, TRINESSA, TRI-NORINYL, T
  • the therapeutic may comprise any other ovulation suppression substance. It is further noted that the therapeutic is preferably adapted to the specific subject so as to be a proper and effective amount of therapeutic for the subject. It is further noted that the administration of the therapeutic may comprise multiple sequential instances of administration of the therapeutic and that such sequence instances may occur over an extended period of time or may occur on an indefinite on-going basis.
  • markers of table 1 are drawn from build 37 data (or “GRCh37” as defined by the Genome Reference Consortium) and that in the header of table 1: “Set” corresponds to a particular subset (i.e. subset 01, subset 02, or subset 03) of the biomarkers of table 1, “Name” corresponds to a name for a given biomarker and where possible is the reference SNP number (rs) of the particular biomarker, but if not possible then it is the exome variant number (exm) of the particular biomarker (as assigned by Illumina, Incorporated), but if not possible then it is a “JBL” number assigned by applicant, “Chr” corresponds to the chromosome where a given biomarker is located in the human genome, “Arm” corresponds to the arm of the chromosome where a given biomarker is located in the human genome, “Cyto” corresponds to the cytoband of the arm of the chromosome where a given biomarker is located in the human

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to novel genetic markers associated with endometriosis and risk of developing endometriosis, and methods and materials for determining whether a human subject has endometriosis or is at risk of developing endometriosis and the use of such risk information in selectively administering a treatment that at least partially prevents or compensates for an endometriosis related symptom.

Description

    CROSS REFERENCE TO RELATED APPLICATIONS
  • This nonprovisional utility patent application is a continuation of and claims the benefit under 35 USC § 120 to co-pending U.S. application Ser. No. 14/594,266 filed Jan. 12, 2015 and scheduled to issue as U.S. Pat. No. 9,840,738 on Dec. 12, 2017, which is a continuation of and claims the benefit under 35 USC § 120 to co-pending U.S. application Ser. No. 13/788,913 filed Mar. 7, 2013 and since issued as U.S. Pat. No. 8,932,993 on Jan. 13, 2015, which is a continuation-in-part of and claims the benefit under 35 USC § 120 to co-pending U.S. application Ser. No. 12/056,754 filed Mar. 27, 2008, which claims the benefit under 35 USC § 119(e) of U.S. provisional application No. 60/943,193, filed Jun. 11, 2007, and which is a continuation-in-part of and claims the benefit under 35 USC § 120 to co-pending U.S. application Ser. No. 12/120,322 filed May 14, 2008, and which is a continuation-in-part of and claims the benefit under 35 USC § 120 to co-pending U.S. application Ser. No. 12/765,643 filed Apr. 22, 2010, which claims the benefit under 35 USC § 119(e) of U.S. provisional application No. 61/171,717, filed Apr. 22, 2009 and of U.S. provisional application No. 61/245,808, filed Sep. 25, 2009, and which is a continuation-in-part of and claims the benefit under 35 USC § 120 to co-pending U.S. application Ser. No. 13/159,132 filed Jun. 13, 2011, which is a continuation-in-part of and claims the benefit under 35 USC § 120 to co-pending U.S. application Ser. No. 13/071,598 filed Mar. 25, 2011, which claims the benefit under 35 USC § 119(e) of U.S. provisional application No. 61/318,145, filed Mar. 26, 2010, and which is a continuation-in-part of and claims the benefit under 35 USC § 120 to co-pending U.S. application Ser. No. 13/681,575 filed Nov. 20, 2012, which is a continuation of and claims the benefit under 35 USC § 120 to co-pending U.S. application Ser. No. 13/602,409 filed Sep. 4, 2012, which claims the benefit under 35 USC § 119(e) of U.S. provisional application Nos. 61/530,944 and 61/530,948, both filed Sep. 3, 2011, and which is a continuation-in-part of and claims the benefit under 35 USC § 120 to co-pending U.S. application Ser. No. 13/603,284 filed Sep. 4, 2012, which claims the benefit under 35 USC § 119(e) of U.S. provisional application No. 61/530,945, filed Sep. 3, 2011, and which is a continuation-in-part of and claims the benefit under 35 USC § 120 to co-pending U.S. application Ser. No. 13/680,414 filed Nov. 19, 2012, which is a continuation of and claims the benefit under 35 USC § 120 to co-pending U.S. application Ser. No. 13/603,297 filed Sep. 4, 2012, which claims the benefit under 35 USC § 119(e) of U.S. provisional application No. 61/530,947, filed Sep. 3, 2011, and which is a continuation-in-part of and claims the benefit under 35 USC § 120 to co-pending U.S. application Ser. No. 13/735,828 filed Jan. 7, 2013, which is a continuation of and claims the benefit under 35 USC § 120 to co-pending U.S. application Ser. No. 13/652,018 filed Oct. 15, 2012, which claims the benefit under 35 USC § 119(e) of U.S. provisional application No. 61/547,624, filed Oct. 14, 2011, and which claims the benefit under 35 USC § 119(e) of U.S. provisional application Nos. 61/717,048 and 61/717,053, both filed Oct. 22, 2012, and which claims the benefit under 35 USC § 119(e) of U.S. provisional application No. 61/721,219, filed Nov. 1, 2012, all of which are incorporated, in their entirety, by this reference.
    • FIELD OF THE INVENTION
  • The present invention relates to endometriosis prognosis, diagnosis and therapy. In particular, the present invention relates to a novel algorithmic combination of endometriosis associated single nucleotide polymorphisms (SNPs) and Rare Variants (RVs), and endometriosis related clinical analysis to result in an endometriosis predictive and/or diagnostic test and related treatment therefor.
    • BACKGROUND OF THE INVENTION
  • Endometriosis may include autoimmune endometriosis, mild endometriosis, moderate endometriosis, severe endometriosis, superficial (peritoneal) endometriosis, deep (invasive) endometriosis, ovarian endometriosis, endometriosis-related cancers, and “endometriosis-associated conditions”. For the purpose of this invention the term endometriosis is used to describe any of these conditions.
  • Endometriosis is most generally defined as the presence of endometrium (glands and stroma) at sites outside of the uterus (ectopic endometrial tissues rather than eutopic or within the uterus). The most common sites are the ovaries, pelvic peritoneum, uterosacral ligaments, pouch of Douglas, and rectovaginal septum although implants have been identified on the peritoneal surfaces of the abdomen (these may grow into the intestines, ureters or bladder), in the thorax, at the umbilicus, and at incision sites of prior surgeries (Child T J, Tan S L (2001) Endometriosis: aetiology, pathogenesis and treatment, Drugs 61:1735-1750; Giudice et al. (1998) Status of current research on endometriosis, The Journal of reproductive medicine 43:252-262).
  • Endometriosis is a common gynecologic disorder. The prevalence is difficult to know. It has been estimated that it affects approximately 14% of all women (range 1-43%), 40-60% of women with pelvic pain and 30%-50% of infertile women (Di Blasio et al. (2005) Genetics of endometriosis, Minerva ginecologica 57:225-236; Schindler AE (2004) Pathophysiology, diagnosis and treatment of endometriosis, Minerva ginecologica 56:419-435).
  • A non-surgical method of clinically assessing a predisposition to endometriosis is to determine the answer to three distinct endometriosis related questions, each question having an associated Odds Ratio (OR), as shown in FIG. 1. The results of answers to the FIG. 1 questions are then complied according to the endometriosis clinical factor assessment chart as shown in FIG. 2 resulting in a Raw Clinical Probability Value (RCPV). The RCPV is preferably multiplied by a Relevance Factor (RF) based on a patient's age and race to result in a Final Clinical Probability Value (FCPV). Alternatively, the RCPV may be used with data collected in population surveys.
  • MultiDimensional Analysis (MDA) is an analysis process that groups data into two or more categories (e.g. cases and controls or patients having a high probability of endometriosis and patients having a low probability of endometriosis).
  • Logistic regression analysis is a process that is used for prediction of the probability of occurrence of an event by fitting data to a logit function logistic curve.
  • Bayesian analysis or Bayesian interference is a method of statistical inference in which evidence is used to estimate parameters and predictions in a probability model.
  • It is known to treat or prevent endometriosis, especially in women who have no outwardly manifest symptoms of endometriosis, by the prophylactic administration of a therapeutic. The administered therapeutic may be any of a hormonal treatment such as an estrogen containing composition, a progesterone containing composition, a progestin containing composition, a gonadotropin releasing-hormone (GnRH) agonist, or other ovulation suppression composition, an advanced reproductive therapy or ART (ART is used to treat endometriosis related infertility and may include any fertility treatments in which the egg or sperm are “handled” in vitro as part of the treatment), or a combination thereof. In particular, the therapeutic may be administered in the form of an oral contraceptive (OC). The GnRH therapeutic may take the form of a GnRH agonist in combination with a patient specific substantially low dose of estrogen, progestin, or tibolone. Such administration of a low dose of estrogen, progestin, or tibolone in combination with a GnRH agonist to compensate potential side effects of the GnRH agonist are commonly referred to as an “add-back” therapy. It is noted that in such add-back therapy, the dosage of estrogen, progestin, or tibolone is relatively small so as to not reduce the effectiveness of the GnRH agonist.
  • Various genetic markers are known to have a predictive association with endometriosis. Such genetic markers and methods are disclosed for instance in U.S. patent application Ser. Nos. 12/056,754, 12/120,322, 12/566,933, 12/765,643, 13/159,132, 13/602,409, 13/603,284, 13/603,297, 13/652,018, 61/721,219, 61/717,048, and 61/717,053, all of which are incorporated herein in their entirety by this reference.
    • SUMMARY OF THE INVENTION
  • The present invention defines a method for endometriosis diagnosis/prognosis that preferably combines known endometriosis clinical factor assessment methods with endometriosis associated biomarkers such as single nucleotide polymorphisms (SNPs), indels, insertions, deletions, genomic rearrangements, Rare Variants (RVs), and more especially the biomarkers identified in table 1 (or diagnostically and predicatively functionally comparable biomarkers), preferably via a statistical assessment method such as MultiDimensional Scaling analysis (MDS), logistic regression, or Bayesian analysis. The markers and related statistical data shown in table 1 were discovered by analyzing a number of endometriosis cases and controls much as has been described in the prior patent applications incorporated herein by reference. It is noted that all of the biomarkers of table 1, being variations or mutations in and of the same structure (i.e. the human genome), share a single structural similarity in that all of the biomarkers of table 1 are endometriosis associated nucleotide substitutions of the same DNA sequence—the human genome DNA sequence, and that the common use of endometriosis diagnosis and prognosis of all of the biomarkers of table 1 flow from such single structural similarity. The present invention further preferably includes the treatment of a subject determined to have or be predisposed to endometriosis by administering to such subject a therapeutic such as an OC that at least partially compensates for endometriosis or that prevents or reduces the severity of endometriosis that the subject would otherwise develop or that prevents endometriosis related complications, cancers, or associated disorders. It shall be noted that preventing or cancelling a procedure, especially an invasive procedure, such as a laparoscopy, that would otherwise have been performed on a subject but for the results of a (negative) diagnosis/prognosis disclosed herein being performed on said subject, shall be consider within the scope of treatment or the “administration of a therapeutic”.
  • It shall be noted that for the purposes of this application, a SNP is understood to be a genetic polymorphism having a Minor Allele Frequency (MAF) of at least 1% in a population (such as for instance the Caucasian population or the CEU population) and an RV is understood to be a genetic polymorphism having a Minor Allele Frequency (MAF) of less than 1% in a population (such as for instance the Caucasian population or the CEU population).
  • It shall be noted that “Linkage disequilibrium” or “LD” means that a particular combination of alleles (alternative nucleotides) or genetic markers at two or more different SNP (or RV) sites are non-randomly co-inherited (i.e., the combination of alleles at the different SNP (or RV) sites occurs more or less frequently in a population than the separate frequencies of occurrence of each allele or the frequency of a random formation of haplotypes from alleles in a given population). The term “LD” differs from “linkage,” which describes the association of two or more loci on a chromosome with limited recombination between them. LD is also used to refer to any non-random genetic association between allele(s) at two or more different SNP (or RV) sites. Therefore, when a SNP (or RV) is in LD with other SNPs (or RVs), the particular allele of the first SNP (or RV) often predicts which alleles will be present in those SNPs (or RVs) in LD. LD is generally, but not exclusively, due to the physical proximity of the two loci along a chromosome. Hence, genotyping one of the SNP (or RV) sites will give almost the same information as genotyping the other SNP (or RV) site that is in LD. Linkage disequilibrium is caused by fitness interactions between genes or by such non-adaptive processes as population structure, inbreeding, and stochastic effects.
  • It shall also be noted that LD is the non-random association of alleles adjacent loci. When a particular allele at one locus is found together on the same chromosome with a specific allele at a second locus-more often than expected if the loci were segregating independently in a population—the loci are in disequilibrium. This concept of LD is formalized by one of the earliest measures of disequilibrium to be proposed (symbolized by D). D, in common with most other measures of LD, quantifies disequilibrium as the difference between the observed frequency of a two-locus haplotype and the frequency it would be expected to show if the alleles are segregating at random. A wide variety of statistics have been proposed to measure the amount of LD, and these have different strengths, depending on the context. Although the measure D has the intuitive concepts of LD, its numerical value is of little use for measuring the strength of and comparing levels of LD. This is due to the dependence of D on allele frequencies. The two most common measures are the absolute value of D′ and r2. The absolute value of D′ is determined by dividing D by its maximum possible value, given the allele frequencies at the two loci. The case of D′=1 is known as complete LD (or CLD). The measure r2 is in some ways complementary to D′. An r2 value of 1 indicates complete LD as well while an r2 value of 0 indicates linkage equilibrium. Complete LD demonstrates complete dependency. In other words, in complete LD the number of counts of the minor allele in loci 1 corresponds to the counts of minor allele in loci 2. Although in complete LD the alleles themselves might be different the frequency of Minor allele in loci 1 will be equal to the frequency of Minor allele in loci 2. For example, in comparing two loci such as rs1 having (A/G) and rs2 having (G/C), if it is known that rs1 and rs2 are in complete LD, and if it is known that a person carries a genotype AG on rs1, then it is known that the genotype on rs2 is GC for that person. Similarly in complete LD, if A is the minor allele of rs1 and is associated with the disease (or conversely is not associated with the disease) then the corresponding minor allele of rs2 is also associated with the disease (or conversely or is not associated with the disease). Furthermore in complete LD, in any analysis of the disease, genotype for rs1 could easily be substituted for rs2 and vice versa.
  • In yet another embodiment, the invention also provides a kit comprising SNP detection reagents, and methods for detecting the SNPs disclosed herein by employing detection reagents and a questionnaire of non-genetic clinical factors. In one embodiment, the questionnaire would be completed by a medical professional based on medical history physical exam or other clinical findings. In yet another embodiment, the questionnaire would include any other non-genetic clinical factors known to be associated with the risk of developing endometriosis.
  • In yet another embodiment, the novel SNPs disclosed in '754 as well as other genetic markers are used in the selection of patients to whom a therapeutic will be administered based on the patient's assessed risk of developing endometriosis or based on the patient's assessed risk of endometriosis progression. The administered therapeutic may preferably be a patient specific gene or protein based therapy enabled and informed by SNPs discovered to be associated with endometriosis. Further, the administered therapeutic may be any of a hormonal treatment such as an estrogen containing composition, a progesterone containing composition, a progestin containing composition, a gonadotropin releasing-hormone (GnRH) agonist, or other ovulation suppression composition, or a combination thereof. In particular, the therapeutic may be administered in the form of an OC. Furthermore, the GnRH therapeutic may take the form of a GnRH agonist in combination with a patient specific substantially low dose of estrogen, progestin, or tibolone. Such administration of a low dose of estrogen, progestin, or tibolone in combination with a GnRH agonist to compensate potential side effects of the GnRH agonist are commonly referred to as an “add-back” therapy. It is noted that in such add-back therapy, the dosage of estrogen, progestin, or tibolone is relatively small so as to not reduce the effectiveness of the GnRH agonist.
  • It shall also be noted that unless indicated otherwise, when a genetic marker (e.g. SNP or RV) is identified as the genetic marker associated with a disease (in this instance endometriosis), it shall be understood that it is the minor allele (MA) of the particular genetic marker that is associated with the disease. Further it shall also be noted that unless indicated otherwise, if the Odds Ratio (OR) of the MA is greater than 1.0, the MA of the genetic marker (in this instance the endometriosis associated genetic marker) is correlated with an increased risk of endometriosis in a case subject as compared to a control subject and shall be considered a causative marker (C), and if the OR of the MA less than 1.0, the MA of the genetic marker is correlated with a decreased risk of endometriosis in a case subject as compared to a control subject and shall be considered a protective marker (P).
  • It shall also be noted that unless indicated otherwise, the phrase “functional equivalent” as used herein with respect to biomarkers shall mean that a second biomarker is substantially equivalent in its diagnostic and/or prognostic value with respect to a given disease as is a first biomarker's diagnostic and/or prognostic value with respect to the given disease. A second biomarker that is in complete LD with a first biomarker shall be expressly included within the scope of “functional equivalent” with respect to the relationship between the second biomarker to the first biomarker.
    • DESCRIPTION OF DRAWINGS
  • In order that the advantages of the invention will be readily understood, a more particular description of the invention briefly described above will be rendered by reference to specific embodiments that are illustrated in the appended drawings. Understanding that these drawings depict only typical embodiments of the invention and are not therefore to be considered to be limiting of its scope, the invention will be described and explained with additional specificity and detail through the use of the accompanying drawings, in which:
  • FIG. 1 depicts a “Three Endometriosis Related Clinical Questions” chart, and;
  • FIG. 2 depicts an “Endometriosis Clinical Factor Assessment” chart.
    •  DETAILED DESCRIPTION OF THE INVENTION
  • The method of determining predisposition to endometriosis for a patient is performed according to the following steps. In a first step, answers to the FIG. 1 questions are obtained for the patient. In a second step, an RCPV according to FIG. 2 is determined for the patient based on the answers obtained for the patient in step 1. In an optional third step, the RCPV is optionally multiplied by an RF or otherwise adjusted according to the patient's age and race or according to relevant population survey data to result in a FCPV. In a fourth step, at least one endometriosis associated biomarker preferably drawn from the biomarkers of table 1 is identified in genetic material of the patient. In a fifth step, at least one statistical analysis (preferably MDS) is performed to combine the RCPV (or the FCPV) and the predictive value of the identified genetic biomarker to result in a highly predictive endometriosis prognosis or diagnosis.
  • “Oral contraceptives” or OCs are contraceptives that are commonly taken orally for the principal purpose of the prevention of conception. Such contraceptives are also commonly referred to as “Oral Contraceptive Pills” or OCPs, or simply as the “Pill”. Such OCs typically define a substance in pill form being comprised at least partially of estrogen, progesterone, or a combination thereof. The progesterone component may further be any of Desogestrel, Drospirenone, Ethynodiol, Levonorgestrel, Norethindrone, Norgestimate, and Norgestrel, and the estrogen component may further be any of Mestranol, Estradiol, and Ethinyl. Exemplary OCs that are commercially available are sold under the following names: ALESSE, APRI, ARANELLE, AVIANE, BREVICON, CAMILA, CESIA, CRYSELLE, CYCLESSA, DEMULEN, DESOGEN, ENPRESSE, ERRIN, ESTROSTEP, JOLIVETTE, JUNEL, KARIVA, LEENA, LESSINA, LEVLEN, LEVORA, LOESTRIN, LUTERA, MICROGESTIN, MICRONOR, MIRCETTE, MODICON, MONONESSA, NECON, NORA, NORDETTE, NORINYL, NOR-QD, NORTREL, OGESTREL, ORTHO-CEPT, ORTHO-CYCLEN, ORTHO-NOVUM, ORTHO-TRI-CYCLEN, OVCON, OVRAL, OVRETTE, PORTIA, PREVIFEM, RECLIPSEN, SOLIA, SPRINTEC, TRINESSA, TRI-NORINYL, TRIPHASIL, TRIVORA, VELIVET, YASMIN, AND ZOVIA (the preceding names are the registered trademarks of the respective providers).
  • “Gonadotropin releasing-hormone (GnRH) agonists” are a group of drugs that are useful in treating patients having endometriosis. Such drugs are modified versions of a naturally occurring hormone known as gonadotropin releasing hormone, which helps to control the menstrual cycle. Administration of such drugs is known to be performed in combination with an “add-back” therapy. In this case, an add-back therapy could be for instance the administration of a low dose of estrogen, progestin, or tibolone in combination with a GnRH agonist to compensate potential side effects of the GnRH agonist. It is noted that in such add-back therapy, the dosage of estrogen, progestin, or tibolone is relatively small so as to not reduce the effectiveness of the GnRH agonist.
  • The present invention provides SNPs associated with endometriosis, nucleic acid molecules containing SNPs, methods and reagents for the detection of the SNPs disclosed herein, uses of these SNPs for the development of detection reagents, and assays or kits that utilize such reagents. The SNPs disclosed herein are useful for diagnosing, screening for, and evaluating predisposition to endometriosis and progression of endometriosis. Additionally, such SNPs are useful in the determining individual subject treatment plans and design of clinical trials of devices for possible use in the treatment of endometriosis. Furthermore, such SNPs and their encoded products are useful targets for the development of therapeutic agents. Furthermore, such SNPs combined with other non-genetic clinical factors are useful for diagnosing, screening, evaluating predisposition to endometriosis, assessing risk of progression of endometriosis, determining individual subject treatment plans and design of clinical trials of devices for possible use in the treatment of endometriosis. Furthermore, such SNPs and are useful in the selection of recipients for an OC type therapeutic.
  • Therefore, the invention disclosed herein further teaches a method of selectively administering a therapeutic. Such method of administering a therapeutic preferably includes the following steps: a) Obtaining a genetic material sample of a human female subject, b) Identifying in the genetic material of the subject preferably at least one of the SNPs disclosed in '754 or alternatively identifying any other genetic marker having an association with endometriosis, c) Assessing the subject's risk of endometriosis or risk of endometriosis progression, d) Identifying the subject as having an altered risk of endometriosis or an altered risk of endometriosis progression, and e) administering to the subject a therapeutic. It is noted that the subject may be endometriosis presymptomatic or the subject may exhibit endometriosis symptoms. It is also noted that the assessment of risk may also include non-genetic clinical factors. The therapeutic may be a gene or protein based therapy adapted to the specific needs of a select patient. The therapeutic may alternatively take the form of a testosterone or a modified testosterone such as Danazol. Alternatively, the therapeutic defines a hormonal treatment therapeutic which may be administered alone or in combination with a gene therapy. For instance, the therapeutic may be an estrogen containing composition, a progesterone containing composition, a progestin containing composition, a gonadotropin releasing-hormone (GnRH) agonist, or other ovulation suppression composition, or a combination thereof. Additionally, the GnRH agonist may take the form of a GnRH agonist in combination with a patient specific substantially low dose of estrogen, progestin, or tibolone via an add-back administration. It is further noted that the therapeutic is preferably an OC. The OC preferably defines a substance in pill form that is comprised at least partially of estrogen, progesterone, or a combination thereof. The progesterone component may further be any of Desogestrel, Drospirenone, Ethynodiol, Levonorgestrel, Norethindrone, Norgestimate, and Norgestrel, and the estrogen component may further be any of Mestranol, Estradiol, and Ethinyl. Specifically, the OC may be any commercially available OC including ALESSE, APRI, ARANELLE, AVIANE, BREVICON, CAMILA, CESIA, CRYSELLE, CYCLESSA, DEMULEN, DESOGEN, ENPRESSE, ERRIN, ESTROSTEP, JOLIVETTE, JUNEL, KARIVA, LEENA, LESSINA, LEVLEN, LEVORA, LOESTRIN, LUTERA, MICROGESTIN, MICRONOR, MIRCETTE, MODICON, MONONESSA, NECON, NORA, NORDETTE, NORINYL, NOR-QD, NORTREL, OGESTREL, ORTHO-CEPT, ORTHO-CYCLEN, ORTHO-NOVUM, ORTHO-TRI-CYCLEN, OVCON, OVRAL, OVRETTE, PORTIA, PREVIFEM, RECLIPSEN, SOLIA, SPRINTEC, TRINESSA, TRI-NORINYL, TRIPHASIL, TRIVORA, VELIVET, YASMIN, AND ZOVIA (the preceding names are the registered trademarks of the respective providers). It is further noted that the therapeutic may comprise any other ovulation suppression substance. It is further noted that the therapeutic is preferably adapted to the specific subject so as to be a proper and effective amount of therapeutic for the subject. It is further noted that the administration of the therapeutic may comprise multiple sequential instances of administration of the therapeutic and that such sequence instances may occur over an extended period of time or may occur on an indefinite on-going basis.
  • It shall be noted that the markers of table 1 are drawn from build 37 data (or “GRCh37” as defined by the Genome Reference Consortium) and that in the header of table 1: “Set” corresponds to a particular subset (i.e. subset 01, subset 02, or subset 03) of the biomarkers of table 1, “Name” corresponds to a name for a given biomarker and where possible is the reference SNP number (rs) of the particular biomarker, but if not possible then it is the exome variant number (exm) of the particular biomarker (as assigned by Illumina, Incorporated), but if not possible then it is a “JBL” number assigned by applicant, “Chr” corresponds to the chromosome where a given biomarker is located in the human genome, “Arm” corresponds to the arm of the chromosome where a given biomarker is located in the human genome, “Cyto” corresponds to the cytoband of the arm of the chromosome where a given biomarker is located in the human genome, “Gene” corresponds to the gene where a given biomarker is located in the human genome or alternatively if the biomarker is not located within a gene, “Gene” corresponds to the nearest two genes positioned on either side of the given biomarker in the human genome, “position” corresponds to the position of a given biomarker in the human genome, “p-value” corresponds to the p-value of a given biomarker, “OR” corresponds to the Odds Ratio of a given biomarker, “Case MAF” corresponds to the case Minor Allele Frequency of a given biomarker, “Cont MAF” corresponds to the control Minor Allele Frequency of a given biomarker, “MA” corresponds to the Minor Allele of a given biomarker, and “Context Sequence” corresponds to the context sequence in which a given biomarker is located and provides a SEQ ID NO and the identification of the biomarker variation of substitution (e.g. “A/C” or “A/G”, etc.). It shall be further noted that values for p-value, OR, Case MAF, and Cont MAF provided in Table 1 were derived by applicant using predetermined statistical methods and a predetermined group of cases and controls, and that while others who might analyze the same set of data may arrive at similar but not necessarily identical results if the identical analytical methods are not used. Moreover, it is believed that substantially similar results would occur based on a similar analysis performed on data drawn from different populations that used herein.
  • TABLE 1
    (Based on build 37 or ″GRCh37″ as defined by the Genome Reference Consortium)
    Case Cont
    Set Name Chr Arm Cyto Gene Position p-value OR MAF MAF MA Context Sequence
    03 rs7521023 1 p p13.1 CASQ2 116243380 7.63E-05 1.11 0.435 0.409 G (SEQ ID NO: 0001)
    aaggatcatcttggct[A/G]gaggagggatcccaac
    03 rs3811012 1 p p13.1 VANGL1 116234313 8.03E-05 1.11 0.425 0.399 A (SEQ ID NO: 0002)
    cctcgccttacaacta[A/G]ttcctgcctttcgtcc
    03 rs1373291 1 p p13.2 KCND3 112426851 4.79E-04 1.14 0.214 0.192 A (SEQ ID NO: 0003)
    gagaattgagttgaaa[A/C]tttaaagaaggagttg
    03 rs3008527 1 p p13.2 KCND3 112523095 2.53E-03 0.90 0.253 0.274 G (SEQ ID NO: 0004)
    gccaaaacccagaggc[A/G]atagtgttggtttttc
    03 rs3827735 1 p p13.2 TRIM33 115052708 2.52E-04 1.19 0.130 0.112 A (SEQ ID NO: 0005)
    ccatttaatccatagt[A/C]ctcctctctcctatct
    03 rs2640493 1 p p13.3 KCNA2| 111187885 2.04E-04 1.13 0.340 0.313 A (SEQ ID NO: 0006)
    KCNA3 gcacatgaaagtttaa[A/G]tagcactactaccaga
    03 rs17113362 1 p p21.3 LOC729977 95782971 7.57E-04 1.32 0.039 0.030 A (SEQ ID NO: 0007)
    tcatgaactatgtagg[A/G]aaggaagtgaaatttg
    02 rs4658172 1 p p22.2 BARHL2| 91225594 1.11E-05 1.16 0.327 0.296 G (SEQ ID NO: 0008)
    ZNF644 gaaacaactgctcagg[A/G]cattttgcaaatttac
    02 rs6656775 1 p p22.2 BARHL2| 91219359 5.36E-06 1.16 0.345 0.311 G (SEQ ID NO: 0009)
    ZNF644 atcctttctcagcagg[A/G]cccattatttctcatt
    02 rs1526480 1 p p22.2 BARHL2| 91209986 7.16E-06 1.15 0.408 0.374 G (SEQ ID NO: 0010)
    ZNF644 acagatagttcctatg[A/G]gctagacttggtcaga
    01 rs6699397 1 p p22.2 BARHL2| 91212216 3.32E-06 1.16 0.405 0.370 G (SEQ ID NO: 0011)
    ZNF644 gaactgcatagtccca[A/G]cttacaaagaatcagc
    03 rs13376108 1 p p22.2 GTF2B 89350741 1.15E-02 1.30 0.024 0.018 G (SEQ ID NO: 0012)
    agagcttagtagcttc[A/G]acagaaaccacatgtg
    03 rs3008445 1 p p22.2 LMO4|PKN2 88446605 2.37E-03 0.91 0.432 0.456 A (SEQ ID NO: 0013)
    agtaatagacatttac[A/G]tttcctccaggttttt
    03 rs3008453 1 p p22.2 LMO4|PKN2 88427851 8.00E-03 1.09 0.505 0.484 A (SEQ ID NO: 0014)
    tctagagttaaatcct[A/G]tctggggactctgggc
    03 rs4537535 1 p p22.2 ZNF326| 91080115 7.52E-03 1.09 0.503 0.482 G (SEQ ID NO: 0015)
    BARFIL2 cactcagaagagagta[A/G]ctagagtaagaagtca
    03 rs7527341 1 p p31.1 LOC729817| 82009424 8.91E-05 0.95 0.334 0.347 A (SEQ ID NO: 0016)
    LPHN2 gaaatgggaaactatc[A/G]tagggttctttgcaga
    02 exm68565 1 p p31.1 TNNI3K 74808620 8.37E-13 Inf 0.005 0.000 C (SEQ ID NO: 0017)
    tgctgcaaagtgattt[C/G]gaagttcaacctcatg
    03 rs17130484 1 p p31.3 GPR177 68581840 2.95E-04 0.77 0.048 0.062 C (SEQ ID NO: 0018)
    gctgctcctggtccct[A/C]ttgtaaggtcctgtga
    02 rs6693065 1 p p31.3 IL12RB2 67800018 3.19E-05 1.08 0.244 0.231 G (SEQ ID NO: 0019)
    gatcatacgatctgtc[A/G]caactgctaaatgtgc
    03 rs4255357 1 p p31.3 PDE4B 66399895 8.47E-04 1.11 0.487 0.461 G (SEQ ID NO: 0020)
    gagtaagacataggag[A/G]tcaaggtaggaggatt
    03 rs11208775 1 p p31.3 PDE4B 66410541 6.36E-04 1.11 0.487 0.460 G (SEQ ID NO: 0021)
    atttatcatgttctct[A/G]gtaggaatgctcccca
    03 rs7554648 1 p p32.1 FGGY|HOOK1 60238762 5.87E-03 1.17 0.087 0.075 A (SEQ ID NO: 0022)
    aaaatctcagctccac[A/C]tcagccccaattatct
    03 rs11805025 1 p p32.2 DAB1 57850717 4.08E-03 0.89 0.195 0.214 C (SEQ ID NO: 0023)
    tatacagaaacacaaa[A/C]cccatcttggatcact
    03 rs778406 1 p p32.2 USP24| 56703505 7.87E-05 1.17 0.067 0.058 A (SEQ ID NO: 0024)
    LOC100288320 tattaatctttttcac[A/C]tcagcacagcagaact
    03 rs12758665 1 p p32.3 USP24| 55839117 3.79E-04 0.87 0.196 0.218 A (SEQ ID NO: 0025)
    LOC100288320 ttcgtaactacgatga[A/C]tttctcggttaagagt
    03 rs7520205 1 p p32.3 USP24| 55834309 1.30E-04 0.86 0.190 0.215 A (SEQ ID NO: 0026)
    LOC100288320 agttttgtttcacagg[A/G]ctaaagcctgaacaga
    01 exm49794 1 p p34.2 CITED4 41327281 5.28E-60 21.62 0.056 0.035 A (SEQ ID NO: 0027)
    cgggcggcgcggaccc[A/C]aagtccgagaagcagt
    03 rs219007 1 p p34.3 CSF3R|GRIK3 37147203 5.68E-05 1.10 0.395 0.372 A (SEQ ID NO: 0028)
    aaaaagaatcagaaat[A/G]tctggtgcatggagcc
    02 rs2484556 1 p p34.3 LOC100287202| 37913283 4.34E-05 0.89 0.342 0.367 A (SEQ ID NO: 0029)
    LOC728431 gacctccagcaggggc[A/G]tggccagtgggtgcca
    03 rs4970614 1 p p34.3 POU3F1| 39135748 8.84E-04 0.84 0.103 0.120 A (SEQ ID NO: 0030)
    LOC400750 tagtttccctggaaac[A/G]tatatctttgtacact
    01 rs9438994 1 p p34.3 RHBDL2 39388838 3.11E-06 1.23 0.158 0.132 G (SEQ ID NO: 0031)
    gtgcaatgtatgaggt[A/G]taaattaatgcagcct
    02 rs6422258 1 p p34.3 RHBDL2 39406644 9.56E-05 1.21 0.118 0.099 A (SEQ ID NO: 0032)
    ttattttggagtcaca[A/G]agacacttggcttttt
    02 rs4475740 1 p p34.3 RHBDL2| 39425489 9.29E-05 1.23 0.101 0.084 A (SEQ ID NO: 0033)
    AKIRIN1 gtgctctagctgcaag[A/G]caggtggaaaaagtgt
    02 rs1138294 1 p p36.11 MAP3K6 27688633 2.76E-05 0.89 0.339 0.366 A (SEQ ID NO: 0034)
    agccagcaccacctgg[A/G]tggggtcattggcgag
    03 rs443523 1 p p36.11 RUNX31|SYF2 25403783 9.12E-04 1.12 0.288 0.265 A (SEQ ID NO: 0035)
    gtttgctctcactctt[A/C]atacaatcgccaaaat
    03 rs292005 1 p p36.12 C1QB|EPHB2 22993335 1.60E-02 0.93 0.460 0.479 C (SEQ ID NO: 0036)
    taggggatctcattgc[A/C]cagtaaaataggcgac
    03 rs7549747 1 p p36.12 C1QB|EPHB2 22996571 3.37E-03 0.91 0.395 0.418 G (SEQ ID NO: 0037)
    gttccattttgtagcc[A/G]aggatataaaagctca
    03 rs294218 1 p p36.12 C1QB|EPHB2 23033257 1.04E-02 1.09 0.393 0.373 C (SEQ ID NO: 0038)
    agagacttgggtacac[A/C]gagaggggatgtctat
    03 rs294214 1 p p36.12 C1QB|EPHB2 23026293 4.51E-03 1.10 0.315 0.294 A (SEQ ID NO: 0039)
    gggcggaggggaggcg[A/G]gagatttctgagctcc
    03 rs12734877 1 p p36.12 C1QC|C1QB 22977883 9.54E-02 0.95 0.408 0.421 C (SEQ ID NO: 0040)
    cactgcttctacccca[A/C]attgacatccatcttt
    01 rs1534949 1 p p36.12 CDC42| 22426187 2.18E-06 1.16 0.441 0.405 C (SEQ ID NO: 0041)
    LOC100289113 tgagagaatatgacac[A/C]ttcttcctttagagga
    01 rs2473277 1 p p36.12 HSPC157| 22361845 1.77E-06 1.16 0.508 0.471 G (SEQ ID NO: 0042)
    CDC42 gctatacctcccaatc[A/G]tcaacctgtagaacat
    01 rs4654783 1 p p36.12 LOC100289113| 22439520 2.16E-09 1.22 0.337 0.294 A (SEQ ID NO: 0043)
    WNT4 tgctggtcaggatgga[A/G]tatgttatcagagccc
    01 rs2235529 1 p p36.12 WNT4 22450487 4.66E-12 1.32 0.189 0.150 A (SEQ ID NO: 0044)
    agaaccaggtagagaa[A/G]gctggaggagccgcca
    02 rs7544210 1 p p36.12 WNT4 22455142 6.02E-06 1.15 0.463 0.428 G (SEQ ID NO: 0045)
    acagcgtctcctcatc[A/G]aggataagaccacaga
    02 rs1046310 1 p p36.12 WNT4/ 22443887 7.78E-06 1.15 0.492 0.457 C (SEQ ID NO: 0046)
    LOC100289113 tgctgccccaccccat[A/C]ctccaatttttatact
    02 rs3765351 1 p p36.12 WNT4/ 22445991 1.14E-05 1.15 0.487 0.452 G (SEQ ID NO: 0047)
    LOC100289113 aggtcaagggcaccag[A/G]ttcatttcagccctta
    01 rs12042083 1 p p36.12 WNT4|ZBTB40 22472732 4.84E-07 1.21 0.231 0.199 A (SEQ ID NO: 0048)
    aattcttaatgagaaa[A/G]tctcttggaggaaatg
    01 rs4623666 1 p p36.12 WNT4|ZBTB40 22480312 3.96E-06 1.16 0.440 0.405 G (SEQ ID NO: 0049)
    atgcacacagaagccc[A/G]gccggtatccccacag
    02 rs221047 1 p p36.13 ARHGEF19 16530364 4.01E-05 1.15 0.155 0.137 G (SEQ ID NO: 0050)
    ccctgatgatatggtt[A/G]tcagaatgtattttca
    03 rs12088541 1 p p36.22 MAD2L2 11751135 5.77E-04 0.83 0.093 0.110 A (SEQ ID NO: 0051)
    ggttctccgagaggtc[A/G]ctcctggatgtagggg
    03 rs641941 1 p p36.22 TNFRSF8| 12206652 4.79E-03 1.09 0.495 0.473 G (SEQ ID NO: 0052)
    TNFRSF1B actggctcattattcg[A/G]cgtctgtaactctggg
    03 rs17349921 1 p p36.31 CAMTA1 7170719 7.70E-05 1.09 0.101 0.094 G (SEQ ID NO: 0053)
    aatgagtgttcttaga[A/G]gctgggtcggattcct
    03 rs10915329 1 p p36.32 AJAP1| 5114102 2.26E-03 1.10 0.431 0.407 A (SEQ ID NO: 0054)
    LOC100287877 tcagacctgggagaat[A/G]tcaggtaagctgagat
    01 JBL0002 1 p p36.33 RNF223 1007306 6.27E-05 6.765 0.020 0.005 A (SEQ ID NO: 0055)
    gagcgcgcactgcacc[G/A]gccagagtgccacaca
    02 exm91506 1 q q21.1 ANKRD35 145560893 4.73E-08 18.9 0.004 0.000 C (SEQ ID NO: 0056)
    cttttcttataggtca[C/G]aggctagtccagcacc
    02 exm90634 1 q q21.1 PDE4DIP 144931581 6.11E-12 Inf 0.004 0.000 G (SEQ ID NO: 0057)
    ctcggctttgccatcg[C/G]gggggacatccttgcc
    02 exm90788 1 q q21.1 SEC22B 145115792 1.20E-13 3.71 0.011 0.000 A (SEQ ID NO: 0058)
    catgttcaagtacttc[A/G]catcctggcggtattt
    03 rs11204684 1 q q21.3 ENSA| 150608894 4.02E-04 1.12 0.481 0.454 A (SEQ ID NO: 0059)
    GOLPH3L gttggggagtgagcca[A/G]cagttatctggaggga
    03 rs10888510 1 q q21.3 LCE4A 152681835 1.53E-04 1.56 0.019 0.012 A (SEQ ID NO: 0060)
    tcagcaacagccccct[A/C]cagagcagcagccaga
    03 rs4970972 1 q q21.3 TARS2 150468547 1.65E-04 1.26 0.072 0.058 A (SEQ ID NO: 0061)
    catatcccattcctgg[A/C]cacatgaaatccaaaa
    03 rs16838078 1 q q23.1 ETV3L 157069261 2.43E-03 1.31 0.032 0.025 C (SEQ ID NO: 0062)
    ccaagaggctcacctg[A/C]gatccagttgccgggg
    03 rs4656849 1 q q23.2 CRP|DUSP23 159723521 2.04E-03 0.90 0.361 0.385 A (SEQ ID NO: 0063)
    aagggtcagaaaacaa[A/G]taaaaggccaagacag
    03 rs3897374 1 q q23.3 NOS1AP 162168958 7.13E-05 1.03 0.178 0.174 G (SEQ ID NO: 0064)
    caaacctccttgagtc[A/G]gctttaagagtttctt
    02 exm129317 1 q q25.3 RGS16 182571142 7.34E-08 13.65 0.004 0.000 C (SEQ ID NO: 0065)
    aactcctcaaagatct[C/G]gtgtgccctggaggcc
    03 rs10921412 1 q q31.2 CDC73|KCNT2 193661626 1.36E-03 1.11 0.361 0.337 A (SEQ ID NO: 0066)
    gaagttttttacaacc[A/G]aaatctatgaccgttg
    02 exm133014 1 q q31.2 GLRX2 193074511 1.85E-17 4.14 0.023 0.006 G (SEQ ID NO: 0067)
    cgcgcggcgccaaatc[A/G]tggtcagagcccggat
    02 rs6701700 1 q q31.2 RGS1|RGS13 192556309 7.80E-05 1.20 0.133 0.113 A (SEQ ID NO: 0068)
    aaggaattaccaagaa[A/G]agccatgcatctcaca
    03 rs10489873 1 q q31.2 RGS1|RGS13 192559646 2.31E-04 1.25 0.076 0.062 A (SEQ ID NO: 0069)
    ccgggaagtgcacgct[A/G]ccaccgaggagccatc
    03 rs17466945 1 q q32.1 CHI3L1|CHIT1 203183093 1.62E-03 1.16 0.131 0.116 C (SEQ ID NO: 0070)
    gatgagatcccaagtc[A/C]aaggaagatttgccca
    03 rs6662930 1 q q32.1 CNTN2 205041465 7.66E-03 0.92 0.451 0.472 G (SEQ ID NO: 0071)
    cgaaacaaagcccatg[A/G]aaatccaaaggttgga
    02 rs880790 1 q q32.1 IL10|1L19 206960216 1.83E-05 1.17 0.249 0.220 G (SEQ ID NO: 0072)
    gcttgggggctggaga[A/G]cagaatttaacatgtt
    03 rs17434403 1 q q32.1 RASSF5 206737276 4.07E-03 0.87 0.116 0.131 C (SEQ ID NO: 0073)
    ttcaaggccctttgag[A/C]tcttgatggcacatga
    03 rs4570460 1 q q32.1 SYT2|KDMSB 202689028 1.29E-03 1.33 0.034 0.025 A (SEQ ID NO: 0074)
    agtatattaggggatt[A/G]atattacaagcaagaa
    03 rs6670957 1 q q32.2 PLXNA2| 209195248 4.01E-03 1.21 0.063 0.053 A (SEQ ID NO: 0075)
    LOC642587 gctgtatgttataatt[A/C]tctgatagaacccaca
    02 rs11119874 1 q q32.3 DTL|PPP2R5A 212357017 4.15E-05 1.11 0.189 0.173 A (SEQ ID NO: 0076)
    gatgaaataatagact[A/C]cagggatttacttttt
    03 rs2359937 1 q q32.3 RPS6KC1| 214033051 1.14E-02 0.92 0.478 0.497 G (SEQ ID NO: 0077)
    PROX1 actctccaaagtcaca[A/G]tattttctggacaagc
    02 rs2789939 1 q q41 DISP1|TLR5 223191495 2.07E-03 0.86 0.281 0.311 C (SEQ ID NO: 0078)
    atcaggatcataggag[C/G]actgtctgaggatcag
    02 rs12747035 1 q q41 PTPN14 214719346 5.58E-06 1.12 0.385 0.359 G (SEQ ID NO: 0079)
    acctggctagggatac[A/G]aggccattaaccaagc
    02 rs903695 1 q q42.13 CDC42BPA| 227733069 2.19E-03 1.18 0.211 0.185 C (SEQ ID NO: 0080)
    ZNF678 tggttgttgcatggca[T/C]ttccagataagctgca
    03 rs2493142 1 q q42.2 COG2 230817384 5.27E-03 1.11 0.262 0.243 G (SEQ ID NO: 0081)
    aatgtttgtatttggg[A/G]ttgcccttcttacatg
    01 rs3789649 1 q q42.2 COG2 230816460 8.83E-07 1.21 0.227 0.195 A (SEQ ID NO: 0082)
    caagttctacacttcc[A/G]taactcaaacgtgttt
    03 rs1693210 1 q q42.2 KCNK1 233800613 1.98E-03 1.11 0.382 0.359 A (SEQ ID NO: 0083)
    tcaattataatcacct[A/G]tgtggatttttctcag
    02 rs7545302 1 q q43 FMN2 240476158 9.75E-06 0.92 0.243 0.258 A (SEQ ID NO: 0084)
    cgaactgatcagatcg[A/C]tgccctacacacttta
    03 rs6699695 1 q q43 RGS7|FH 241539802 6.47E-03 1.10 0.325 0.305 A (SEQ ID NO: 0085)
    caaatattactgcaat[A/G]agtaatatcatacaca
    03 rs987179 1 q q44 C1orf101| 244809936 7.12E-05 0.87 0.256 0.283 A (SEQ ID NO: 0086)
    PPPDE1 aacagatgccatggta[A/G]actagatgcctgggtg
    03 rs7548336 1 q q44 LOC4407421 244401066 6.04E-04 1.12 0.423 0.397 G (SEQ ID NO: 0087)
    C1orf100 tctttaaggtgggttc[A/G]gagaaaggagatggaa
    03 rs900895 1 q q44 LOC440742| 244510437 1.38E-03 1.15 0.156 0.138 A (SEQ ID NO: 0088)
    C1orf100 acagacagggtgtcat[A/G]gaagccgcgtcatatc
    03 rs3755095 2 p p12 CTNNA2 80097279 1.16E-03 1.19 0.098 0.084 G (SEQ ID NO: 0089)
    tccaccagtgaagcaa[A/G]taatctgtggcctgct
    03 rs953222 2 p p12 CTNNA2 79979967 3.88E-03 1.14 0.135 0.120 A (SEQ ID NO: 0090)
    caaaaaagaagtatc[A/G]ggtatatatgaagaga
    03 rs6547260 2 p p12 CTNNA2 79925969 4.27E-04 1.18 0.137 0.119 A (SEQ ID NO: 0091)
    aacagaaaattaagat[A/C]agattggctaacaaga
    03 rs1160581 2 p p12 CTNNA2 80026432 1.33E-04 1.14 0.284 0.257 G (SEQ ID NO: 0092)
    taaaggaatccctgtt[A/G]aaaaaaaagaataagg
    03 rs4284854 2 p p12 CTNNA2 80025940 1.47E-04 1.15 0.264 0.238 A (SEQ ID NO: 0093)
    tttcctttataaaact[A/G]tgttactctagtctga
    03 rs2861911 2 p p12 CTNNA2 80007717 5.79E-03 1.11 0.208 0.191 G (SEQ ID NO: 0094)
    ctaaatggtggttcac[A/G]gggaattcatgaaact
    03 rs1397687 2 p p12 CTNNA2 80015386 6.22E-03 1.10 0.253 0.235 A (SEQ ID NO: 0095)
    gggagctcagactcac[A/G]tggtggaaagcctaaa
    03 rs6732862 2 p p12 CTNNA2 79918572 7.64E-05 1.16 0.239 0.213 A (SEQ ID NO: 0096)
    atggcataacaatagt[A/G]actcaaagaggcaaaa
    03 rs4852536 2 p p12 CTNNA2 80104027 1.02E-02 1.16 0.086 0.076 G (SEQ ID NO: 0097)
    tttggaaatttaacac[A/G]tgaatataaccatcaa
    03 rs1265750 2 p p12 CTNNA2| 80951823 2.64E-02 1.10 0.169 0.157 A (SEQ ID NO: 0098)
    LOC100289658 aacaggactaagtggc[A/G]tataaattagggtaat
    02 rs1443896 2 p p12 LRRTM1| 80572750 8.14E-06 1.41 0.045 0.032 A (SEQ ID NO: 0099)
    CTNNA2 tatatcatcagtgccc[A/G]gaagagtacctgatgc
    03 rs1239102 2 p p12 SNAR-H| 78873621 1.21E-04 1.13 0.367 0.338 G (SEQ ID NO: 0100)
    REG3G accagtaccatccggt[A/G]tgatttgatggtatga
    03 rs11687801 2 p p12 SNAR-H| 78978011 2.30E-04 1.13 0.329 0.302 A (SEQ ID NO: 0101)
    REG3G tgatgaggccttctcg[A/G]ggaagttttacgatgt
    02 exm204635 2 p p13.1 CCDC142 74709541 8.09E-13 Inf 0.005 0.000 A (SEQ ID NO: 0102)
    tgcagctgcaggtcgc[A/G]gcaccactggggcaag
    03 rs879511 2 p p13.2 SFXN5 73179990 4.99E-04 1.48 0.020 0.014 G (SEQ ID NO: 0103)
    actcagccccagcccc[A/G]ctcactaagctcacag
    03 rs2312205 2 p p13.3 AAK1 69704941 1.17E-02 1.11 0.188 0.173 G (SEQ ID NO: 0104)
    ccattgcaaaccacag[A/G]ggtgattatttttagt
    03 rs3771452 2 p p13.3 ADD2 70936861 3.88E-04 0.89 0.334 0.360 A (SEQ ID NO: 0105)
    gggggaaagcgggaag[A/G]tctcttgctccaggaa
    03 rs12466648 2 p p13.3 GFPT1 69560024 1.74E-03 1.13 0.192 0.173 G (SEQ ID NO: 0106)
    ggatgagactccctct[A/G]taataaaatcacagtc
    03 rs12473304 2 p p13.3 GFPT1 69558112 1.02E-03 1.15 0.178 0.159 A (SEQ ID NO: 0107)
    ataaaatttatagtac[A/G]ttttgagcctgtgtgt
    03 rs7605572 2 p p13.3 NFU1 69646504 2.19E-03 1.14 0.177 0.159 A (SEQ ID NO: 0108)
    aaacatagcatatttc[A/G]cttgattcttgtgaca
    03 rs1430778 2 p p14 ETAA1|C1D 68012459 4.27E-03 0.91 0.312 0.333 G (SEQ ID NO: 0109)
    tgcttcaacaatttcc[A/G]tttgtgtatcgttggc
    03 rs6727061 2 p p15 B3GNT2| 62720684 3.86E-03 1.10 0.390 0.368 G (SEQ ID NO: 0110)
    TMEM17 tctgtgctgtttttca[A/G]ggaaaaacatctgggt
    03 rs2674061 2 p p16.1 LOC730134| 59753331 1.58E-03 1.11 0.319 0.296 A (SEQ ID NO: 0111)
    BCL11A cccaagacactgtagc[A/G]tttacatagtaggtag
    02 rs3814360 2 p p16.3 LOC100653325 47800603 8.19E-04 1.21 0.200 0.171 T (SEQ ID NO: 0112)
    atgatcatgtgattga[A/T]gtatctaaaccacagt
    02 rs989373 2 p p16.3 LOC646936| 49158325 1.12E-05 0.86 0.334 0.368 A (SEQ ID NO: 0113)
    FSHR gaacatatagacaatc[A/G]ggaatgctaaaataaa
    03 rs1067352 2 p p21 C2orf34 44669724 7.70E-04 0.89 0.290 0.314 A (SEQ ID NO: 0114)
    gactccttgcatttca[A/G]tataatgttagctctg
    03 rs1067339 2 p p21 C2orf34 44624448 3.83E-03 0.91 0.310 0.331 A (SEQ ID NO: 0115)
    atgcattgatgacctt[A/C]aatatttattttgtaa
    03 rs1223222 2 p p21 C2orf34 44756361 1.30E-02 0.92 0.319 0.338 C (SEQ ID NO: 0116)
    atatcattatgaactc[A/C]tagattttttaaccta
    03 rs1067350 2 p p21 C2orf34 44669946 2.56E-03 0.89 0.227 0.247 A (SEQ ID NO: 0117)
    ccagcagctcatcaga[A/G]agagggatgacagaca
    03 rs1067386 2 p p21 C2orf34 44644257 3.92E-03 0.91 0.311 0.332 C (SEQ ID NO: 0118)
    acaacgcaatactact[A/C]ggaataaaaaaggaaa
    03 rs1067343 2 p p21 C2orf34 44621042 4.58E-03 0.90 0.244 0.263 A (SEQ ID NO: 0119)
    agtagtggaacgaaat[A/G]actttggagaaaagga
    03 rs1067364 2 p p21 C2orf34 44655734 3.22E-03 0.90 0.230 0.250 A (SEQ ID NO: 0120)
    tccctgcctcctgtcc[A/G]tatcaatagatgttgg
    03 rs1067405 2 p p21 C2orf34 44674861 3.81E-03 0.90 0.240 0.260 A (SEQ ID NO: 0121)
    actgacaacaggcttc[A/G]ccatgtaaattgctct
    03 rs698793 2 p p21 C2orf34 44685685 3.74E-03 0.90 0.241 0.260 G (SEQ ID NO: 0122)
    taagatgaaaaggtct[A/G]ctttcaggggtttgtg
    03 rs1067370 2 p p21 C2orf34 44652343 4.01E-03 0.91 0.310 0.332 A (SEQ ID NO: 0123)
    aacccagccattaact[A/C]ttgttagatagcttta
    03 rs1067406 2 p p21 C2orf34 44674450 1.84E-03 0.90 0.302 0.325 G (SEQ ID NO: 0124)
    tccttttattctcctc[A/G]ttttatgtaattctgt
    03 rs1065785 2 p p21 C2orf34 44660699 1.98E-03 0.90 0.298 0.321 A (SEQ ID NO: 0125)
    actttttgcttagtct[A/G]aattaaaaaaagtctt
    03 rs698813 2 p p21 C2orf34 44705615 1.49E-03 0.89 0.217 0.238 A (SEQ ID NO: 0126)
    ttacaagattttcttt[A/G]gtttatagacctactt
    03 rs698815 2 p p21 C2orf34 44706974 7.55E-04 0.88 0.235 0.259 C (SEQ ID NO: 0127)
    cttgtttggggacaca[A/C]tttcaaatacaaaatg
    02 exm189795 2 p p21 PLEKHH2 43903164 1.13E-27 10.09 0.020 0.002 C (SEQ ID NO: 0128)
    tttttagtatcgtaga[C/G]ctctgctttgtcacag
    03 rs6712059 2 p p21 PPM1B| 44475174 3.36E-03 0.91 0.375 0.398 A (SEQ ID NO: 0129)
    SLC3A1 gactcaggtttgaggc[A/G]ttttgcatctggtggc
    03 rs9309116 2 p p21 PREPL 44557919 6.27E-04 0.89 0.331 0.357 G (SEQ ID NO: 0130)
    gggaacaaattaatat[A/G]taaactatagccttga
    03 rs4953089 2 p p21 PREPL 44565024 6.86E-04 0.89 0.293 0.318 G (SEQ ID NO: 0131)
    tccctgcatcccctgc[A/G]gataagaaaactggca
    03 rs1056865 2 p p21 PREPL/ 44546741 1.62E-03 0.90 0.294 0.318 A (SEQ ID NO: 0132)
    SLC3A1 atagtatgtgttcatt[A/G]aagatgatttgggttt
    03 rs698775 2 p p21 PREPL| 44588941 1.09E-03 0.89 0.300 0.324 G (SEQ ID NO: 0133)
    C2orf34 agatggctaccagcaa[A/G]aatggtgcaatggcgt
    02 rs7581914 2 p p21 PRKCE 46078964 4.68E-05 0.88 0.391 0.423 G (SEQ ID NO: 0134)
    tcatttattgcttgat[A/G]gacacctctaatgtat
    03 rs2340809 2 p p21 SLC3A1 44536249 2.28E-03 0.90 0.297 0.320 A (SEQ ID NO: 0135)
    aaaagtgtgtaattca[A/G]tgcattaaatacattc
    03 rs698761 2 p p21 SLC3A1 44547574 5.56E-04 0.89 0.293 0.319 G (SEQ ID NO: 0136)
    gccttcccgctaaaat[A/G]agaataaggttaagta
    03 rs2112040 2 p p21 SRBD1 45752214 7.29E-05 1.09 0.308 0.289 G (SEQ ID NO: 0137)
    tgtcggtaggactact[A/G]gatagccacaggcaaa
    03 rs10165323 2 p p22.2 LOC100129149| 38010296 1.28E-03 0.87 0.154 0.173 A (SEQ ID NO: 0138)
    LOC344382 ttgtggtctgtgttta[A/G]gataatgtggaagcta
    03 rs206811 2 p p23.1 XDH 31636915 2.30E-04 1.13 0.381 0.354 A (SEQ ID NO: 0139)
    ggagtggggggaatgc[A/G]ggagatgccattatg
    03 rs206816 2 p p23.1 XDH|SRD5A2 31644983 5.04E-04 1.12 0.408 0.381 A (SEQ ID NO: 0140)
    atgatgctgagaatct[A/G]tgaaatgacggaagaa
    03 rs7575607 2 p p23.1 XDH|SRD5A2 31640455 1.69E-03 1.11 0.413 0.389 G (SEQ ID NO: 0141)
    tttattccttctatct[A/G]actgaaattctgtatt
    03 rs2339554 2 p p23.2 ALK 29856155 7.90E-04 0.89 0.272 0.296 A (SEQ ID NO: 0142)
    acctcctgagctcaga[A/C]caagagtgcagccttt
    02 rs2339547 2 p p23.2 ALK 29860061 3.38E-05 0.88 0.239 0.263 A (SEQ ID NO: 0143)
    gtttaatcatacatcc[A/G]tggaggaacatgttgg
    03 rs6734278 2 p p23.3 KIF3C 26202233 1.70E-04 1.21 0.112 0.095 A (SEQ ID NO: 0144)
    ctctcagggttatggg[A/G]aattggatattaactg
    02 rs2384298 2 p p23.3 KIF3C 26156655 2.63E-06 1.15 0.291 0.263 G (SEQ ID NO: 0145)
    actaatagtgtatgag[A/G]gtttcattttctctac
    03 rs13029647 2 p p23.3 OTOF 26731244 7.95E-03 1.09 0.369 0.349 A (SEQ ID NO: 0146)
    ctaactgacattcaac[A/G]cactttcaaagacacc
    02 rs13031859 2 p p23.3 OTOF 26741961 3.98E-05 0.91 0.464 0.488 A (SEQ ID NO: 0147)
    ttctgcagcaccatgc[A/G]gaaggtcccgatgagc
    03 rs4665181 2 p p24.1 LOC100129278| 22759343 2.42E-03 1.11 0.350 0.327 A (SEQ ID NO: 0148)
    KLHL29 gcgaaagaacaaacaa[A/G]ccatgtaatacatatg
    02 rs851352 2 p p24.1 NT5C1B|OSR1 19475331 5.32E-06 1.14 0.253 0.229 A (SEQ ID NO: 0149)
    gccaggtctaggcatt[A/G]ttttggtaagtgactg
    02 rs851356 2 p p24.1 NT5C1B|OSR1 19474112 1.05E-05 1.13 0.252 0.230 G (SEQ ID NO: 0150)
    tttaactgctcggccc[A/G]tgtacttgatcatgga
    03 rs1871959 2 p p24.3 TRIB2| 13250740 2.61E-04 1.45 0.025 0.017 A (SEQ ID NO: 0151)
    FAM84A acatgttgcataggtt[A/C]tccctccattccctgt
    03 rs4669910 2 p p24.3 TRIB2| 13289018 2.44E-04 1.45 0.025 0.018 A (SEQ ID NO: 0152)
    FAM84A atagctatagcaccgc[A/G]aattgccacatctgta
    03 rs1813530 2 p p24.3 TRIB2| 13983167 1.46E-04 1.35 0.043 0.032 G (SEQ ID NO: 0153)
    FAM84A ttattgccattcttgt[A/G]gaagtaaggtggtatc
    03 rs16860924 2 p p24.3 TRIB2| 14031175 3.36E-04 1.33 0.042 0.031 G (SEQ ID NO: 0154)
    FAM84A cataagtggtggaatc[A/G]ttgttcagaaacatta
    03 rs4669907 2 p p24.3 TRIB2| 13279945 4.64E-04 1.43 0.025 0.018 A (SEQ ID NO: 0155)
    FAM84A tctagaaacttagtac[A/C]tcctgttgcattggta
    02 rs1900854 2 p p24.3 TRIB2| 14422091 7.04E-05 0.88 0.381 0.412 G (SEQ ID NO: 0156)
    FAM84A tttacatacttttcct[A/G]ttgacttctccatatt
    03 rs7608117 2 p p25.1 KCNF1| 11265972 1.99E-04 1.12 0.503 0.473 A (SEQ ID NO: 0157)
    C2orf50 attccttctgggatct[A/C]ttaagggataaaaccg
    02 rs1078589 2 p p25.2 SOX11| 5880342 1.01E-06 1.13 0.056 0.050 A (SEQ ID NO: 0158)
    LOC150622 caccacattctctctc[A/G]tcagcttctcagacat
    02 rs16864121 2 p p25.2 SOX11| 5892514 9.24E-07 1.15 0.051 0.045 G (SEQ ID NO: 0159)
    LOC150622 aaaaattcctccatga[A/G]tcttacccagatggag
    03 rs12714428 2 p p25.3 LOC100128185| 857713 2.00E-03 1.11 0.341 0.318 A (SEQ ID NO: 0160)
    LOC391343 gggaggttcagcagcc[A/G]ccactgcgaggagtgg
    01 rs17025744 2 q q11.2 TMEM131| 98636132 1.13E-06 1.34 0.075 0.057 G (SEQ ID NO: 0161)
    A3B ccagtgcttgaccctc[A/G]ccaacgaccgcactct
    03 rs2302621 2 q q12.1 IL1RL2 102842124 8.49E-04 1.11 0.411 0.385 C (SEQ ID NO: 0162)
    ctcctgggaacttata[A/C]gagtaaaagtctgcag
    02 rs2582974 2 q q12.1 LOC644265| 104578923 1.25E-05 0.87 0.376 0.410 A (SEQ ID NO: 0163)
    LOC100287010 gcaactaaaattaacc[A/G]tacttctgattgtgtc
    03 rs1159964 2 q q12.1 POU3F3| 105481442 3.06E-03 1.10 0.428 0.405 G (SEQ ID NO: 0164)
    LOC10012813| tcccatccagcttaag[A/G]catttaaaatacaatt
    03 rs732278 2 q q12.1 POU3F3| 105473698 3.91E-03 1.10 0.446 0.424 A (SEQ ID NO: 0165)
    LOC10012813| aaatgcctccttggtc[A/C]gtttctcccgcgtttt
    03 rs7602289 2 q q12.1 POU3F3| 103445960 2.81E-04 0.88 0.256 0.281 G (SEQ ID NO: 0166)
    LOC100128131 agcaatttatactggg[A/G]aaatatcagaaggtgt
    03 rs2420589 2 q q14.1 TMEM182| 115722009 4.55E-03 1.10 0.369 0.347 G (SEQ ID NO: 0167)
    LOC644265 ggacagtaaataagaa[A/G]aaaagaactggagcaa
    03 rs6745631 2 q q14.1 DPP10 115730919 4.01E-03 1.10 0.295 0.275 C (SEQ ID NO: 0168)
    ttcttatggctatttt[A/C]gtgtgtactcctactt
    03 rs13429901 2 q q14.1 DPP10 116279799 2.42E-02 1.11 0.128 0.117 A (SEQ ID NO: 0169)
    taagaatcacagagag[A/G]cggagtaatcagaccg
    03 rs10210316 2 q q14.1 DPP10 116298589 2.20E-02 1.11 0.128 0.117 C (SEQ ID NO: 0170)
    tattttgcatcccttc[A/C]ataaatacaaaaatgc
    02 rs10206874 2 q q14.2 DPP10 121160145 4.99E-05 0.90 0.463 0.489 C (SEQ ID NO: 0171)
    actctgccacagacac[A/C]ttccctggagccctcc
    03 rs7570552 2 q q14.2 INHBB| 119883331 7.92E-05 0.88 0.315 0.343 G (SEQ ID NO: 0172)
    LOC84931 tgggagaaagggcttc[A/G]actgtggtttcagaca
    03 rs9636365 2 q q14.2 MARCO| 119886918 7.31E-05 0.88 0.316 0.344 A (SEQ ID NO: 0173)
    C1QL2 ctcttcctataaggat[A/G]cactgttggatctagg
    03 rs12469732 2 q q14.3 MARCO| 127653376 2.71E-03 1.17 0.105 0.092 A (SEQ ID NO: 0174)
    C1QL2 gtcatgtaattttgat[A/G]accatcaaaaggattt
    03 rs6728117 2 q q14.3 LOC339760 123818496 7.09E-03 0.88 0.120 0.134 C (SEQ ID NO: 0175)
    ttgatatgaagtgagc[A/C]tgcataaatttcagtt
    03 rs13011089 2 q q14.3 TSN| 123828854 2.21E-02 0.90 0.120 0.132 A (SEQ ID NO: 0176)
    LOC100288443 ttatgaagatctactt[A/C]tattttgtcaatagta
    03 rs309161 2 q q21.3 TSN| 136688749 7.33E-05 1.13 0.164 0.148 A (SEQ ID NO: 0177)
    LOC100288443 atttccaaattcttta[A/G]cccttgactttgctga
    03 rs2322659 2 q q21.3 DARS 136555659 1.28E-03 1.12 0.271 0.248 A (SEQ ID NO: 0178)
    aagaatggagattaca[A/G]tgaggtgatgaagacg
    02 rs309152 2 q q21.3 LCT 136657252 1.81E-05 1.13 0.161 0.144 G (SEQ ID NO: 0179)
    gttggatctgtgaccc[A/G]tgctttctacagagaa
    02 rs10187054 2 q q21.3 MCM6|DARS 136388473 1.04E-05 1.31 0.176 0.140 C (SEQ ID NO: 0180)
    gaggtcctttggggag[T/C]gataccattaataata
    03 rs6739713 2 q q21.3 R3HDM1 136488978 3.10E-04 1.14 0.263 0.239 G (SEQ ID NO: 0181)
    tcactcaagaaaaaac[A/G]agaacagacaataata
    03 rs9287442 2 q q21.3 R3HDM1| 136522710 2.02E-03 1.12 0.248 0.227 A (SEQ ID NO: 0182)
    UBXN4 atgtttcactaaagta[A/G]cagatgtgaaatagga
    03 rs10188066 2 q q21.3 UBXN4 136539513 2.01E-03 1.12 0.246 0.226 G (SEQ ID NO: 0183)
    agctgtgtgtgatagc[A/G]tgtgcctatagtttca
    02 rs1900741 2 q q21.3 UBXN4 136002500 8.72E-05 1.17 0.216 0.191 A (SEQ ID NO: 0184)
    ttagaacatcacctat[A/G]ctgattactcccatgc
    02 rs10221893 2 q q22.1 ZRANB3 137013606 2.10E-05 1.15 0.446 0.412 G (SEQ ID NO: 0185)
    gagtgatttgcccatc[A/G]tgtaatggagactggt
    02 rs6430612 2 q q22.1 CXCR4 137006198 1.84E-05 1.15 0.444 0.411 G (SEQ ID NO: 0186)
    THSD7B ctcctccttaacatga[A/G]ttgagttcactttacc
    03 rs6755074 2 q q22.2 CXCR4| 143683066 5.38E-04 0.89 0.360 0.386 C (SEQ ID NO: 0187)
    THSD7B tgaaagagacggttac[A/C]tagtaccctgtttctg
    03 rs11689575 2 q q22.3 KYNU 145527778 1.09E-03 1.19 0.095 0.081 A (SEQ ID NO: 0188)
    caggatcccgtttagg[A/G]actttcaacacccttg
    03 rs7603516 2 q q22.3 LOC100131409 145504693 1.70E-03 1.18 0.095 0.082 C (SEQ ID NO: 0189)
    ctctgtgttgatgctt[A/C]cttccatttttagcac
    03 rs11691685 2 q q22.3 LOC100131409 145481827 7.74E-04 1.21 0.087 0.074 G (SEQ ID NO: 0190)
    atgagagaacatcact[A/G]tagataatttagactt
    03 rs7560871 2 q q22.3 LOC100131409 145616899 4.59E-03 1.18 0.079 0.067 A (SEQ ID NO: 0191)
    aaacattttaaaatgt[A/G]agtgggataaaacatg
    03 rs4422110 2 q q22.3 LOC100131409| 146114898 9.30E-05 0.89 0.448 0.478 G (SEQ ID NO: 0192)
    PABPCP2 tcctgcctttgtataa[A/G]catgctatttattcca
    03 rs11690035 2 q q22.3 LOC100131409| 145603306 5.95E-03 1.18 0.080 0.068 A (SEQ ID NO: 0193)
    PABPCP2 atgatgtcttgtgaca[A/G]ataataaagctatggg
    02 rs12621827 2 q q23.2 LOC100131409| 149981717 3.03E-05 0.93 0.230 0.244 A (SEQ ID NO: 0194)
    PABPCP2 cagtcagtgctgtaac[A/G]tcacaaatcactaatc
    01 rs1519761 2 q q23.3 LYPD6B 151633204 4.13E-10 1.22 0.446 0.398 G (SEQ ID NO: 0195)
    ttgtatatgagaaaaa[A/G]agaggcaattttttaa
    03 rs12328269 2 q q23.3 RND3|RBM43 151774643 2.59E-04 1.12 0.445 0.417 A (SEQ ID NO: 0196)
    atgtctattgaagccc[A/G]cctttgacatttatga
    01 rs7580162 2 q q23.3 RND3|RBM43 151655513 1.53E-06 1.18 0.279 0.246 G (SEQ ID NO: 0197)
    cttttttcttttccca[A/G]ttgcttcagtgatagc
    01 rs6734792 2 q q23.3 RND3|RBM43 151624882 6.83E-10 1.22 0.449 0.401 G (SEQ ID NO: 0198)
    aaagcaaaaggtgaag[A/G]agttatttattatcca
    01 rs9789673 2 q q23.3 RND3|RBM43 151627106 1.72E-07 1.19 0.325 0.288 A (SEQ ID NO: 0199)
    aataattttcagattt[A/C]tttgaacttactttct
    01 rs1519768 2 q q23.3 RND3|RBM43 151648276 9.30E-10 1.22 0.413 0.366 A (SEQ ID NO: 0200)
    tcattgactttgaaaa[A/G]aattccagtcattatc
    01 rs1519754 2 q q23.3 RND3|RBM43 151619693 1.29E-09 1.21 0.446 0.400 C (SEQ ID NO: 0201)
    tgaagagttagacaat[A/C]atttatttgagcatga
    01 rs6728560 2 q q23.3 RND3|RBM43 151653870 3.30E-06 1.18 0.278 0.246 A (SEQ ID NO: 0202)
    acagaaagaaaatgcc[A/G]tcttgtagtaatccac
    01 rs10515926 2 q q23.3 RND3|RBM43 151645865 6.00E-09 1.20 0.415 0.370 A (SEQ ID NO: 0203)
    cttgggaaggaacaca[A/G]tggattttccctggaa
    02 rs12465911 2 q q23.3 RND3|RBM43 151785742 1.40E-05 1.16 0.300 0.270 A (SEQ ID NO: 0204)
    gcctccttgcctacaa[A/G]tcaaatagtaggattt
    01 rs6757804 2 q q23.3 RND3|RBM43 151635832 3.85E-10 1.22 0.446 0.398 G (SEQ ID NO: 0205)
    cagtggggtgataggt[A/G]tgtcatggaaataata
    03 rs12987780 2 q q24.3 RND3|RBM43 166470623 5.14E-03 1.09 0.416 0.395 A (SEQ ID NO: 0206)
    acaaaccttagcgagg[A/C]atagtggtgtgatgaa
    03 rs1551825 2 q q24.3 CSRNP3 164340544 2.62E-03 1.10 0.365 0.343 G (SEQ ID NO: 0207)
    gaatatgaaatccacc[A/G]cactggctgtcaataa
    03 rs11896706 2 q q24.3 KCNH7|FIGN 166993034 5.32E-04 0.88 0.238 0.262 G (SEQ ID NO: 0208)
    agatagagatacatat[A/G]aagctactgctgtcct
    03 rs7587026 2 q q24.3 SCN1A|SCN9A 166978750 2.80E-03 0.90 0.256 0.277 A (SEQ ID NO: 0209)
    aaaagcatactagcaa[A/C]atatattacaaagaac
    03 rs7562413 2 q q24.3 SCN1A|SCN9A 168979569 3.66E-03 1.10 0.344 0.323 A (SEQ ID NO: 0210)
    cttaatatgatacaga[A/G]aagaacccaacatcac
    03 rs2287618 2 q q31.1 STK39 169842809 5.79E-03 1.10 0.326 0.306 A (SEQ ID NO: 0211)
    cgaaattgactcaagc[A/G]ttttgtcttcacaggt
    03 rs16864421 2 q q31.1 ABCB11 177628237 3.38E-04 1.27 0.060 0.048 A (SEQ ID NO: 0212)
    tgagagtcaaagaaga[A/G]gggaaaactccaggaa
    02 exm244817 2 q q31.2 LOC375295| 179315031 4.38E-62 Inf 0.056 0.010 G (SEQ ID NO: 0213)
    HNRNPA3 gaatgtgaaagatctg[A/G]tgtgcaaatacacgtg
    02 rs4563185 2 q q31.3 MIR548N 181684892 6.96E-04 1.23 0.168 0.141 A (SEQ ID NO: 0214)
    ccaatcctttgggtta[A/G]ctgatttagtaggtaa
    03 rs13034731 2 q q32.2 CWC22| 189414364 5.29E-04 0.89 0.356 0.382 A (SEQ ID NO: 0215)
    LOC729009  gttttgatttctctgg[A/G]ataaatgtccaagtat
    02 rs2709387 2 q q33.3 GULP1 208442095 9.76E-03 0.87 0.170 0.191 A (SEQ ID NO: 0216)
    tgctgattctttcaac[A/G]ctttagccagaatcat
    02 rs1263628 2 q q33.3 CREB1 207977132 8.58E-03 0.85 0.146 0.167 C (SEQ ID NO: 0217)
    gaaatgattccataaa[C/G]cctgaatttatcttat
    02 rs7582864 2 q q33.3 KLF7 207172627 3.60E-05 1.13 0.425 0.396 A (SEQ ID NO: 0218)
    ctgatgtttctgtcca[A/G]tctgtggctgatcaac
    02 rs3732084 2 q q33.3 ZDBF2 207174316 4.57E-05 1.13 0.417 0.388 A (SEQ ID NO: 0219)
    ttggatccttccgaag[A/G]ctggcttctttgtgag
    02 rs4673350 2 q q33.3 ZDBF2 207178872 4.33E-05 1.12 0.426 0.398 G (SEQ ID NO: 0220)
    tacaataaaaatctac[A/G]caaaatactgaacaag
    02 rs1448902 2 q q33.3 ZDBF2 207178422 3.15E-05 1.13 0.358 0.330 G (SEQ ID NO: 0221)
    agagagaacagttcct[A/G]taattcaagtaattaa
    03 rs2033645 2 q q34 ZDBF2 212325378 2.59E-03 1.23 0.058 0.048 G (SEQ ID NO: 0222)
    tacagacagtttttgt[A/G]tatttcaacttgccat
    03 rs1250258 2 q q35 ERBB4 216300185 3.96E-04 1.13 0.285 0.261 G (SEQ ID NO: 0223)
    ctgggatgataagacc[A/G]tgcattggaggacgag
    03 rs12053317 2 q q35 FN1 219733973 2.71E-04 0.85 0.148 0.170 G (SEQ ID NO: 0224
    aaacacgtgtgtgtgc[A/G]cgtgcattctcatgct
    01 rs10184043 2 q q36.1 WNT6 224204870 2.30E-07 1.20 0.283 0.248 A (SEQ ID NO: 0225)
    tactgggtctgaagga[A/G]catgtggaggaggcag
    01 rs10445738 2 q q36.1 KCNE4|SCG2 224186245 8.46E-07 1.19 0.266 0.233 A (SEQ ID NO: 0226)
    ccattcagcatttaca[A/G]tggtaccccaatagga
    03 rs17190891 2 q q36.1 KCNE4|SCG2 224046645 4.07E-04 1.18 0.138 0.120 A (SEQ ID NO: 0227)
    ttgtccccaagttttc[A/G]tgtttagcacaatata
    01 rs1400797 2 q q36.1 KCNE4|SCG2 224226772 4.31E-09 1.23 0.293 0.252 A (SEQ ID NO: 0228)
    attcaaactccaatat[A/G]gtcccaagtttaaaac
    03 rs7580493 2 q q36.3 KCNE4|SCG2 229427172 1.51E-03 1.48 0.017 0.012 A (SEQ ID NO: 0229)
    tctacattgcttttct[A/G]tctgctatcacccctc
    03 rs6431586 2 q q37.1 SPHKAP|PID1 234119635 4.44E-04 1.19 0.115 0.099 A (SEQ ID NO: 0230)
    tttgtgccccacggcg[A/G]ttctggacgcacctgt
    03 rs10084197 2 q q37.1 INPP5D| 232810183 2.86E-03 1.11 0.308 0.286 G (SEQ ID NO: 0231)
    ATG16L1 cattaccaatagtaat[A/G]tcagaaatgaaacacc
    03 rs838425 2 q q37.1 NPPC|D153L2 232597042 8.82E-04 0.81 0.062 0.076 G (SEQ ID NO: 0232)
    gtatttcactccagga[A/G]tggaactgatagatct
    02 exm284033 2 q q37.3 PTMA|PDE6D 242154318 6.11E-12 Inf 0.004 0.000 A (SEQ ID NO: 0233)
    aggaggtcctcatccc[A/G]tgagtcccccactcct
    03 rs7605254 2 q q37.3 ANO7 239362938 9.60E-03 0.91 0.274 0.293 A (SEQ ID NO: 0234)
    ctacccattttccttg[A/G]agttacgtcccttggt
    02 exm284661 2 q q37.3 ASB1| 242498984 8.95E-16 3.49 0.021 0.008 G (SEQ ID NO: 0235)
    LOC100287050 gacaaggagctggtgg[C/G]ccaggccaaggcgctg
    03 rs4073396 2 q q37.3 BOK 238111471 6.38E-04 0.88 0.209 0.232 C (SEQ ID NO: 0236)
    cccacatctaagatac[A/C]caaaggtcagtgacgc
    03 rs7585432 2 q q37.3 COPS8| 237626734 1.22E-03 1.16 0.132 0.115 C (SEQ ID NO: 0237)
    COL6A3 tgagcgtttaactcct[A/C]cctccccttactcaca
    03 rs2067620 2 q q37.3 CXCR7| 237642373 8.83E-04 1.17 0.124 0.108 G (SEQ ID NO: 0238)
    LOC93463 aggccttaaggacact[A/G]gtagactgaaggaggt
    03 rs11679123 2 q q37.3 CXCR7| 237647424 7.96E-04 1.17 0.124 0.108 A (SEQ ID NO: 0239)
    LOC93463 atccacatatccatcc[A/G]tccctctattctgaca
    01 exm281099 2 q q37.3 CXCR7| 240056067 7.45E-63 125.80 0.013 0.001 A (SEQ ID NO: 0240)
    LOC93463 gctctcccttttcccc[A/G]gcacccacctcactcc
    03 rs1796449 2 q q37.3 HDAC4 240420675 2.21E-04 0.89 0.423 0.452 A (SEQ ID NO: 0241)
    ctgaactacacggagg[A/G]ggatgacacgggggct
    03 rs1564974 2 q q37.3 HDAC4| 240436304 1.12E-03 0.90 0.441 0.467 C (SEQ ID NO: 0242)
    FLJ45964 ggcaagccatcccgga[A/C]ggacgtcagatcctgg
    03 rs1486323 2 q q37.3 HDAC4| 240417788 1.64E-04 0.88 0.325 0.353 G (SEQ ID NO: 0243)
    FLJ45964 ctgggcacgtgcttca[A/G]taagaacagctgctca
    03 rs4414678 2 q q37.3 HDAC4| 241680633 4.58E-04 1.12 0.372 0.346 A (SEQ ID NO: 0244)
    FLJ45964 tgtgtcggggggtgcg[A/C]ggagagggacgaggac
    03 rs1845754 3 p p11.1 KIF1A 88765697 4.79E-03 1.10 0.358 0.337 A (SEQ ID NO: 0245)
    ataaatcccacttggt[A/C]atgatgaatgctcttt
    03 rs1473624 3 p p12.2 C3orf38| 83169976 1.76E-04 1.16 0.193 0.171 G (SEQ ID NO: 0246)
    EPHA3 cttgaatttgtggatg[A/G]tttgtgaaatgtaata
    02 rs7618878 3 p p12.2 GBE1| 83089596 9.01E-07 1.13 0.474 0.444 A (SEQ ID NO: 0247)
    LOC100289598 ttattttatggacata[A/G]tgtgtgggagcttgaa
    03 rs1080728 3 p p12.2 GBE1| 83107505 7.42E-05 0.89 0.239 0.260 A (SEQ ID NO: 0248)
    LOC100289598 gaagcgcgcatgcaat[A/G]gatccagggtgtatgc
    03 rs1995065 3 p p12.2 GBE1| 82913445 6.05E-05 1.11 0.407 0.383 A (SEQ ID NO: 0249)
    LOC100289598 taacaaataggcagaa[A/G]ttttgagcaacattaa
    02 rs11127807 3 p p12.2 GBE1| 83130081 3.10E-07 1.14 0.474 0.443 G (SEQ ID NO: 0250)
    LOC100289598 atattgtactttgtat[A/G]cagaatttcaacttgg
    03 rs6806032 3 p p12.2 GBE1| 83132865 7.90E-05 0.89 0.236 0.258 G (SEQ ID NO: 0251)
    LOC100289598 tttctttatctagtgg[A/G]cacttttaggtcgatt
    03 rs2121783 3 p p13 GBE1| 71174475 6.22E-04 0.90 0.404 0.431 G (SEQ ID NO: 0252)
    LOC100289598 tttttgtgtgtatgtc[A/G]ttcttgaatacagtga
    03 rs9862251 3 p p14.2 FOXP1 61587570 2.48E-02 1.12 0.120 0.109 G (SEQ ID NO: 0253)
    aaggaggtaaagttaa[A/G]agttaggagcagaggg
    01 exm321427 3 p p21.1 PTPRG 52475886 1.55E-20 Inf 0.004 0.000 A (SEQ ID NO: 0254)
    tgagggcaccgccccc[A/G]gccactttccacactg
    03 rs375544 3 p p21.2 SEMA3G 50657826 1.28E-04 1.19 0.151 0.130 G (SEQ ID NO: 0255)
    ctgcctccctggtgat[A/G]tactccaggttaacca
    01 rs4688718 3 p p21.31 MAPKAPK3 50522063 4.92E-06 1.16 0.423 0.387 A (SEQ ID NO: 0256)
    tcacctgctccgtgaa[A/G]acctccttgcccctcc
    02 rs2236951 3 p p21.31 CACNA2D2 50421081 2.54E-05 1.17 0.223 0.197 G (SEQ ID NO: 0257)
    gccaggagctggggat[A/G]taaggaagggggatgt
    02 exm311992 3 p p21.31 CACNA2D2 48623625 4.98E-08 4.22 0.009 0.002 A (SEQ ID NO: 0258)
    ccagagcagctgcgtc[A/G]cttggcgccgggtatg
    02 rs2233474 3 p p21.31 COL7A1 50388607 1.37E-05 1.21 0.160 0.136 A (SEQ ID NO: 0259)
    ttacatggctttgcgc[A/C]tcctacctggaaggcg
    02 exm304730 3 p p22.1 TUSC4| 42916596 2.38E-09 Inf 0.003 0.000 G (SEQ ID NO: 0260)
    CYB561D2 cagcgtctctttcaca[A/G]gatgctctccgtgagc
    03 rs5029848 3 p p22.1 CYP8B1 42110843 1.99E-03 0.91 0.400 0.424 C (SEQ ID NO: 0261)
    tgcaccatccgaccca[A/C]ccataacttttctttt
    03 rs7644110 3 p p22.1 LOC100287063 42115488 1.85E-03 0.91 0.401 0.425 G (SEQ ID NO: 0262)
    gagttcctttgcccct[A/G]ttacgacaagagggtt
    03 rs1995137 3 p p22.1 LOC100287063 42131415 1.60E-03 0.90 0.405 0.429 A (SEQ ID NO: 0263)
    gtgtatcaattgtgtc[A/G]atttgtgcagtgagta
    03 rs10514703 3 p p22.1 LOC100287063| 40901256 7.31E-03 0.80 0.037 0.046 A (SEQ ID NO: 0264)
    TRAK1 aaacaatgaagccaag[A/G]acagaagtgactggac
    03 rs6798614 3 p p22.1 LOC729505| 40930857 7.30E-03 0.80 0.037 0.045 A (SEQ ID NO: 0265)
    CTNNB1 gtttttatgtcagctc[A/G]acctttgcttttaagt
    02 exm302831 3 p p22.1 LOC729505| 40085729 1.94E-08 34.64 0.004 0.000 G (SEQ ID NO: 0266)
    CTNNB1 taccagaagcacgaaa[A/G]ggcctgggtctgctgc
    03 rs4293737 3 p p22.3 MYRIP 32373530 1.28E-02 1.10 0.209 0.193 A (SEQ ID NO: 0267)
    tcttttgaccacacgc[A/G]cacacacacacacaca
    03 rs11713777 3 p p22.3 CMTM8 32245557 3.18E-04 1.21 0.101 0.085 G (SEQ ID NO: 0268)
    atggatatgcagttag[A/Gtaaaatgagtcatcact
    03 rs12493245 3 p p24.1 GPD1L| 27797810 2.08E-03 1.11 0.370 0.347 A (SEQ ID NO: 0269)
    LOC100129194 gtcgtaacttaaaatc[A/G]tattcaaagctgtgat
    03 rs4343572 3 p p24.2 EOMES|CMC1 24732019 1.36E-02 0.92 0.361 0.379 A (SEQ ID NO: 0270)
    ttcataattctacttt[A/G]ctggaatcagctgaga
    03 rs4600774 3 p p24.2 LOC644990| 24731037 2.65E-03 0.90 0.297 0.319 A (SEQ ID NO: 0271)
    LOC100130354 aagcaaagcaagcaaa[A/G]catcatctgtatttat
    03 rs7610222 3 p p24.2 OC644990| 24357286 6.07E-03 0.91 0.253 0.272 A (SEQ ID NO: 0272)
    LOC100130354 attagtggagtgaact[A/G]cttctccctgcaatta
    01 exm2265568 3 p p24.3 THRB 23242050 1.34E-08 2.49 0.004 0.000 G (SEQ ID NO: 0273)
    aactaactgtggctct[A/G]cttactcacgaagttg
    03 rs6442476 3 p p25.1 VENTXP7| 14812460 2.43E-03 1.10 0.486 0.462 G (SEQ ID NO: 0274)
    UBE2E2 tgtgaggtgtggcaca[A/G]aggtaaggaatagcca
    02 rs7651825 3 p p25.1 C3orf20 14812118 4.03E-05 0.90 0.418 0.444 A (SEQ ID NO: 0275)
    cccagagctacctcaa[A/G]ccccctccccaagcca
    03 rs2697149 3 p p25.3 C3orf20 11036480 6.59E-03 1.11 0.240 0.222 C (SEQ ID NO: 0276)
    gggtaaagatgaggca[A/C]aatcaagtccatcgaa
    03 rs6792001 3 p p26.1 SLC6A1 6106251 2.02E-04 1.16 0.183 0.161 A (SEQ ID NO: 0277)
    gatgcaattagagata[A/G]gctttaggaagatctt
    02 exm285495 3 p p26.3 EDEM1|GRM7 391100 7.65E-11 44.12 0.005 0.000 A (SEQ ID NO: 0278)
    accaaaggggagagaa[A/G]caaaagaaaattatgg
    03 rs2044602 3 p p26.3 CHL1 2315400 3.66E-03 0.91 0.416 0.438 A (SEQ ID NO: 0279)
    attttcctcttaatgc[A/G]gtactaatatatgttg
    03 rs16840752 3 q q12.1 CNTN4 98924050 6.69E-02 1.15 0.046 0.040 A (SEQ ID NO: 0280)
    gacttcacatagtgcc[A/G]cctagttcttccaatg
    03 rs1848252 3 q q12.2 DCBLD2| 100818827 5.34E-05 1.15 0.210 0.187 G (SEQ ID NO: 0281)
    COL8A1 cctctacccccaggct[A/G]aaaaggcctgacacaa
    02 rs16843225 3 q q12.2 ABI3BP| 100801257 1.13E-05 0.81 0.122 0.146 C (SEQ ID NO: 0282)
    IMPG2 ctgtgtagctatttga[A/C]gatatgctggcctgta
    02 rs2036650 3 q q12.2 ABI3BP| 100834729 2.07E-05 1.17 0.201 0.177 C (SEQ ID NO: 0283)
    IMPG2 aaaaaaaaaaataagt[A/C]ctcttaaagctagcac
    02 rs650567 3 q q12.3 ABI3BP| 101594402 4.53E-05 0.88 0.397 0.428 A (SEQ ID NO: 0284)
    IMPG2 ttctaaaaaagcaact[A/C]ctcatgagaagctgta
    02 rs641432 3 q q12.3 NFKBIZ| 101587566 2.88E-05 0.88 0.425 0.458 A (SEQ ID NO: 0285)
    LOC152225 gttgagtccttctcag[A/G]cttggaatctctaaga
    03 rs16844076 3 q q12.3 NFKBIZ| 101296067 1.06E-04 1.32 0.052 0.040 G (SEQ ID NO: 0286)
    LOC152225 tctcctccctttggtt[A/G]aatctttgtagctgtt
    02 rs2303476 3 q q12.3 PCNP 101280993 9.87E-05 1.32 0.052 0.040 G (SEQ ID NO: 0287)
    ttgtttcaggtactgt[A/G]ctagttatagtttatt
    03 rs6793744 3 q 813.11 RG9MTD1 105897816 5.72E-05 1.11 0.057 0.052 G (SEQ ID NO: 0288)
    ccagccaggatattca[A/G]aggaccgaaccctctt
    03 rs6774644 3 q 813.12 CBLB| 106379000 5.37E-04 0.86 0.144 0.164 G (SEQ ID NO: 0289)
    LOC344593 ttgagtgtgaaagaat[A/G]taacagtaaaaataaa
    03 rs12633892 3 q 813.12 CBLB| 106380005 9.96E-04 0.86 0.145 0.164 G (SEQ ID NO: 0290)
    LOC344593 ctacatgagaaacctg[A/G]gagctatcttcaaatc
    03 rs7613153 3 q 813.12 CBLB| 106380604 1.03E-03 0.86 0.144 0.163 A (SEQ ID NO: 0291)
    LOC344593 taatgctagccttcct[A/G]gagtctagtatttcag
    03 rs7617430 3 q q13.12 CBLB| 106392429 4.80E-04 0.85 0.122 0.141 A (SEQ ID NO: 0292)
    LOC344593 ctagcacgttttattg[A/G]ccatcattcttttcat
    02 exm337642 3 q q13.2 CBLB| 112357336 2.19E-15 5.62 0.015 0.003 A (SEQ ID NO: 0293)
    LOC344593 gggtctcggtggccat[A/G]ttcccgcctgtccatg
    03 rs16824243 3 q q13.31 CCDC80 115603783 5.66E-04 0.83 0.091 0.108 G (SEQ ID NO: 0294)
    ttcaaaggtcaggcaa[A/G]ttgattttgaaaagaa
    03 rs1731596 3 q q13.31 LSAMP 116131208 2.13E-04 1.15 0.218 0.195 C (SEQ ID NO: 0295)
    ctgcatagtgagactg[A/C]atgtttttcaggagtt
    03 rs9838534 3 q q13.31 LSAMP 116113609 2.48E-04 1.15 0.218 0.195 A (SEQ ID NO: 0296)
    tgtggaagaaaaacac[A/G]tattagttcaataaat
    03 rs6782605 3 q q13.31 LSAMP 116047619 1.55E-03 1.19 0.094 0.081 A (SEQ ID NO: 0297)
    tgatgaatgataatta[A/G]cttttcctctagagca
    02 rs1265646 3 q q21.2 LSAMP 124592700 6.86E-06 0.90 0.368 0.394 A (SEQ ID NO: 0298)
    tacacttagtctatcc[A/G]aaatgacaaaaatagt
    02 exm347865 3 q q21.3 ITGB5 127642561 1.95E-54 5.97 0.025 0.007 C (SEQ ID NO: 0299)
    ttgagcttttgaagca[A/C]gtcagattggaacttg
    03 rs4683547 3 q q23 KBTBD12 140801587 7.54E-03 0.87 0.102 0.116 A (SEQ ID NO: 0300)
    aaactgaggctgtgaa[A/C]ggctgaaaggtttcag
    03 rs12489920 3 q q26.1 SPSB4 162391801 1.21E-03 1.12 0.284 0.262 A (SEQ ID NO: 0301)
    gaaccagagcataagc[A/G]gcattgttcatatggt
    02 rs7643215 3 q q26.1 OTOL1| 167023279 2.99E-05 0.85 0.221 0.249 G (SEQ ID NO: 0302)
    LOC730129 attaatgttctctccc[A/G]tatgagtcactcttca
    02 rs9881097 3 q q26.31 ZBBX 172185376 5.44E-03 1.13 0.496 0.465 A (SEQ ID NO: 0303)
    aggatgaagcttaact[A/G]aggaaggtagaaccaa
    03 rs7632772 3 q q26.32 GHSR| 176103902 7.34E-03 1.15 0.101 0.089 G (SEQ ID NO: 0304)
    TNFSF10 caaaagcctgaggaag[A/G]gtgaaaagaacaaagc
    03 rs1106387 3 q q26.32 NAALADL2| 177490268 7.34E-05 1.12 0.293 0.271 A (SEQ ID NO: 0305)
    TBL1XR1 ttggaagagaaaggaa[A/G]aaaattttatgtggct
    03 rs1106388 3 q q26.32 TBL1XR1| 177490311 8.87E-05 1.12 0.293 0.271 G (SEQ ID NO: 0306)
    KCNMB2 cagcccagaaaatatt[A/G]aaaagataatgagcaa
    02 rs6443448 3 q q26.32 TBL1XR1| 177074926 2.16E-05 0.91 0.393 0.416 G (SEQ ID NO: 0307)
    KCNMB2 aaagtaacatcaggga[A/G]gtctggaaataaaatg
    02 exm372681 3 q q28 TBL1XR1| 191098660 1.05E-21 19.01 0.012 0.001 G (SEQ ID NO: 0308)
    KCNMB2 gaaaagaaagcttaca[A/G]aaaagccaaggagcgg
    03 rs890348 3 q q28 CCDC50 188241949 5.79E-05 1.08 0.168 0.158 G (SEQ ID NO: 0309)
    ggtcttgccatctctc[A/G]cacacatgcataccta
    02 exm376611 3 q q29 LPP 196236401 6.01E-31 Inf 0.012 0.000 A (SEQ ID NO: 0310)
    actcactggagtgccc[A/G]aactgctgtccacatc
    02 rs6444670 3 q q29 C3orf43 192599336 8.91E-06 0.86 0.360 0.394 C (SEQ ID NO: 0311)
    agaaaactgtactgac[A/C]gctacgaagtttgagc
    02 rs6799698 3 q q29 C3orf59 194105437 5.36E-03 1.21 0.126 0.106 A (SEQ ID NO: 0312)
    cccaagccaactcaac[A/G]cctgcagatggctctt
    03 rs10021613 4 p p13 LRRC15|GP5 41201819 8.45E-04 1.17 0.135 0.118 A (SEQ ID NO: 0313)
    gcttcactgttcttcc[A/G]gtgtctagtggcaaac
    03 rs7683746 4 p p13 APBB2 41203125 9.13E-04 1.17 0.136 0.119 A (SEQ ID NO: 0314)
    gacagttgccttatac[A/G]gagggctcattaaaca
    02 rs1373475 4 p p14 APBB2 36931424 7.58E-05 1.18 0.171 0.148 A (SEQ ID NO: 0315)
    ggaagagtgaagaaga[A/G]gagaagatgcccaagc
    02 rs1020808 4 p p14 FLJ16686| 36949073 1.88E-05 1.20 0.177 0.153 A (SEQ ID NO: 0316)
    KIAA1239 tagtgaccttataaga[A/G]gagatgtcagaaaatt
    03 rs4832890 4 p p14 FLJ16686| 37264627 1.41E-02 0.92 0.360 0.379 A (SEQ ID NO: 0317)
    KIAA1239 catcatgaagttcatg[A/G]agccgagaccaccagt
    03 rs10001618 4 p p14 KIAA1239 37340671 1.20E-02 1.28 0.027 0.021 G (SEQ ID NO: 0318)
    gaaatgatgtgtgact[A/G]aacaaagagacatgca
    02 rs3796533 4 p p14 KIAA1239 38692806 9.85E-06 1.20 0.181 0.155 A (SEQ ID NO: 0319)
    ggcaaagtgattacct[A/G]agacattagataactc
    01 rs17582575 4 p p14 KLF3 38703734 2.66E-06 1.21 0.193 0.165 A (SEQ ID NO: 0320)
    cttcccacatgactta[A/C]tttcacaggttggaga
    02 rs6838865 4 p p14 KLF3|TLR10 38745883 2.27E-05 1.22 0.115 0.096 A (SEQ ID NO: 0321)
    agactccttacctcta[A/C]tgaaatcatcccaaac
    02 rs12233656 4 p p14 KLF3|TLR10 38737018 4.07E-05 1.22 0.096 0.080 G (SEQ ID NO: 0322)
    attgctccaataatag[A/G]cgtgtatttctcatgt
    03 rs6849452 4 p p15.1 KLF3|TLR10 31216675 1.12E-04 1.14 0.311 0.283 A (SEQ ID NO: 0323)
    tgcaatatttcctctc[A/G]ctccttatgtctactc
    03 rs7659139 4 p p15.2 PCDH7|ARAP2 22297899 2.66E-04 0.84 0.122 0.142 G (SEQ ID NO: 0324)
    taggcctcagcccccc[A/G]tttaaacagagggtaa
    03 rs6448143 4 p p15.2 KCNIP4| 22303196 8.02E-04 0.86 0.130 0.148 G (SEQ ID NO: 0325)
    GPR125 cacactgttagagtgt[A/G]tttgagcatgtgggag
    02 rs7697101 4 p p15.2 KCNIP4| 22174771 5.99E-04 0.86 0.478 0.516 C (SEQ ID NO: 0326)
    GPR125 tcctgcataggtgtcc[T/C]tcttaaaaaataattg
    02 exm393187 4 p p15.2 KCNIP4| 25834624 9.17E-08 8.41 0.005 0.001 A (SEQ ID NO: 0327)
    LOC100505912 gatatctcttttaacg[A/G]aggccaggtatctgta
    02 rs11721812 4 p p15.2 SEL1L3 25730546 1.49E-05 1.23 0.121 0.101 A (SEQ ID NO: 0328)
    aaggtctccttggcca[A/G]taagagtctgttcagt
    03 rs210777 4 p p15.2 SLC34A2| 27432523 1.44E-03 1.14 0.188 0.170 A (SEQ ID NO: 0329)
    KIAA0746 agatttttatgtgcct[A/G]atgatagtctcaaaat
    03 rs7693245 4 p p15.31 STIM2|PCDH7 18321896 2.13E-03 1.10 0.471 0.447 G (SEQ ID NO: 0330)
    ccccactacactcata[A/G]gcagctgatttgcaca
    03 rs4140904 4 p p15.31 LCORL|SLIT2 18315992 2.96E-02 1.08 0.253 0.238 G (SEQ ID NO: 0331)
    tgaagatagaatggca[A/G]ataccctatcctatcc
    03 rs3846386 4 p p15.33 LCORL|SLIT2 14102069 3.29E-03 1.11 0.269 0.248 G (SEQ ID NO: 0332)
    tctatccgtctgc[A/G]accccccacccttgca
    03 rs4689003 4 p p16.1 LOC391636| 6428296 9.71E-05 1.14 0.182 0.163 G (SEQ ID NO: 0333)
    LOC441009 ggcaattgtggtcctt[A/G]tatttcagacacaagc
    02 exm379901 4 p p16.3 PPP2R2C 961122 4.35E-11 Inf 0.004 0.000 A (SEQ ID NO: 0334)
    gcgggcccaccacatc[A/C]ccgaggaccctggcca
    02 rs4865455 4 p p16.3 DGKQ 1653352 3.18E-03 1.15 0.355 0.324 C (SEQ ID NO: 0335)
    aaggcctgaggcagaa[C/T]aaccggggtcaagagg
    03 rs12331507 4 q q12 FAM53A 56011889 1.83E-04 0.88 0.304 0.332 A (SEQ ID NO: 0336)
    accatcagcctctcac[A/G]atttttgagtagttcc
    02 rs12505096 4 q q12 KDR|SRD5A3 56006102 4.20E-05 0.87 0.269 0.298 A (SEQ ID NO: 0337)
    tggggctgaagaatac[A/C]tttctggtgtgactca
    02 exm400714 4 q q12 KDR|SRD5A3 57180701 5.39E-15 7.33 0.012 0.002 G (SEQ ID NO: 0338)
    caggctggaggagcgg[A/G]ggcggcaggaggagga
    02 rs6554072 4 q q12 KIAA1211 54079547 2.04E-04 0.84 0.345 0.384 G (SEQ ID NO: 0339)
    aatgaatcaagtcaga[C/G]gcatttttttctactc
    02 rs11724057 4 q q13.1 SCFD2 62686490 7.24E-06 1.23 0.135 0.113 A (SEQ ID NO: 0340)
    ttgtaaataagtacat[A/G]agagttcttagcagga
    03 rs7683391 4 q q13.1 LPHN3 62676117 2.73E-04 1.17 0.154 0.134 G (SEQ ID NO: 0341)
    tctcatcctaaaatgt[A/G]gattctggaatataag
    03 rs1901223 4 q q13.1 LPHN3 62660731 3.78E-04 1.12 0.434 0.406 A (SEQ ID NO: 0342)
    taaaagcactttacat[A/G]aataattttatgtcag
    03 rs65344473 4 q q13.3 LPHN3 76005892 1.62E-04 0.78 0.062 0.078 A (SEQ ID NO: 0343)
    tgtcacttgttaatga[A/C]cttccaatcttctaag
    02 exm407053 4 q q21.1 DKFZP56400823| 76956246 6.81E-08 13.75 0.004 0.000 G (SEQ ID NO: 0344)
    RCHY1 aaagaaaataaaggac[A/G]acgatgcctaaatccc
    03 rs953534 4 q q21.22 ART3 83617849 1.47E-03 1.11 0.332 0.309 A (SEQ ID NO: 0345)
    cagctgggggagaaat[A/C]atccaaaatgcaatat
    03 rs2869362 4 q q21.23 SCD5 86591202 8.95E-03 1.16 0.083 0.072 A (SEQ ID NO: 0346)
    atttttattcagttgg[A/G]atggggtggctgcaaa
    03 rs1482090 4 q q21.23 ARHGAP24 86523580 3.91E-03 1.18 0.086 0.074 G (SEQ ID NO: 0347)
    ttgtgctcaggcaagt[A/G]tgttgattggataaat
    03 rs1161262 4 q q21.23 ARHGAP24 86508815 6.41E-05 1.19 0.083 0.070 G (SEQ ID NO: 0348)
    tcatttattaaaacac[A/G]gcatgattagaccact
    03 rs7697141 4 q q22.1 ARHGAP24 92457618 2.43E-04 1.26 0.067 0.054 G (SEQ ID NO: 0349)
    gtctctacctttttct[A/G]ccctgctttgctccct
    03 rs6847228 4 q q22.1 KIAA1680 90155694 2.76E-04 1.32 0.045 0.034 A (SEQ ID NO: 0350)
    agggagtggaaagaaa[A/G]agtgctgcaatttttt
    03 rs17020045 4 q q22.2 TIGD2|GPRIN3 93892487 2.03E-02 0.93 0.463 0.482 G (SEQ ID NO: 0351)
    tagtacagatttttat[A/G]ttgcaatcaaatccta
    03 rs1354296 4 q q22.2 GRID2 94075263 7.45E-03 1.09 0.457 0.436 A (SEQ ID NO: 0352)
    tgttaccaactgatta[A/G]ggtacaagttttagga
    03 rs11727464 4 q q22.2 GRID2 94324475 2.55E-04 0.89 0.399 0.427 A (SEQ ID NO: 0353)
    ccagaagtgaaactgt[A/G]ggaactgtgttcttaa
    02 rs11097364 4 q q22.2 GRID2 94367364 4.23E-05 0.89 0.453 0.482 A (SEQ ID NO: 0354)
    taggactcattcacat[A/G]gtgatccagggttcct
    03 rs2174558 4 q q25 GRID2 113927365 6.72E-03 1.15 0.106 0.094 A (SEQ ID NO: 0355)
    gttgtttgggctatcc[A/G]tcttctcaactgttta
    03 rs378405 4 q q25 ANK2 108000247 1.62E-03 1.13 0.192 0.173 A (SEQ ID NO: 0356)
    atttagtatataataa[A/C]agtaacactacagcac
    03 rs425273 4 q q25 DKK2| 108016162 2.58E-03 1.13 0.199 0.180 G (SEQ ID NO: 0357)
    LOC100288317 gggccccttccttgct[A/G]acctgcagtagcatgt
    03 rs852269 4 q q25 DKK2| 109236454 1.95E-02 0.90 0.126 0.139 G (SEQ ID NO: 0358)
    LOC100288317 caaagggaagtatacc[A/G]ctaaataaggaaggca
    03 rs220634 4 q q25 LEF1| 109235238 1.88E-02 0.89 0.124 0.137 A (SEQ ID NO: 0359)
    LOC285456 cgtggctccaggactg[A/G]tctcagcctttgcata
    03 rs1476569 4 q q26 LEF1| 114698696 3.28E-03 1.11 0.305 0.284 G (SEQ ID NO: 0360)
    LOC285456 tatctcagattcatga[A/G]atggtaacttctatgt
    03 rs4629529 4 q q26 CAMK2D| 117572163 1.10E-03 0.88 0.221 0.243 C (SEQ ID NO: 0361)
    ARSJ tctcaccaaggtcacc[A/C]gtgacttctagctgag
    02 rs1503535 4 q q27 NDST4| 120898509 9.10E-05 1.13 0.396 0.367 G (SEQ ID NO: 0362)
    TRAM1L1 ctaaagagtactgtaa[A/G]gttaaagggatcatgt
    03 rs7684836 4 q q27 LOC730456| 122526728 3.27E-03 1.17 0.096 0.083 A (SEQ ID NO: 0363)
    MAD2L1 acaatgacttaacaat[A/C]cctttcctttctgatt
    03 rs10857108 4 q q28.1 QRFPR| 126780071 2.20E-03 1.14 0.174 0.157 A (SEQ ID NO: 0364)
    ANXA5 taaccttgatcactgg[A/G]ctgaagtagtgtttgt
    03 rs1911014 4 q q28.1 FAT4| 126774098 7.02E-03 1.12 0.172 0.157 A (SEQ ID NO: 0365)
    LOC729424 cttaagaaggatacac[A/G]aaatatgtatgtatat
    03 rs958632 4 q q28.3 FAT4| 136572585 1.39E-03 1.18 0.109 0.094 A (SEQ ID NO: 0366)
    LOC729424 ccctggcaaccaaaga[A/G]ggagcttttacaccag
    02 rs2035469 4 q q28.3 PABPC4L| 136288768 1.19E-03 1.16 0.433 0.398 G (SEQ ID NO: 0367)
    LOC100289626 ctgccttctcagagtt[A/G]aacctgacataattta
    03 rs13435856 4 q q31.1 PABPC4L| 139535299 3.61E-04 1.36 0.035 0.026 A (SEQ ID NO: 0368)
    LOC100289626 gcaaatgagaataatc[A/G]ttttttgtcttttcca
    01 rs4835378 4 q q31.22 SLC7A11| 148040980 3.46E-06 1.20 0.216 0.188 C (SEQ ID NO: 0369)
    CCRN4L ggaatgaacttctaaa[A/C]tgctgtaatctcttga
    02 rs3749574 4 q q31.3 LOC100287219| 151207127 1.98E-05 0.86 0.277 0.307 A (SEQ ID NO: 0370)
    EDNRA tgaggtcacatgtgct[A/G]cggtgtgtgcggagct
    03 rs9995821 4 q q31.3 LRBA 154828366 4.02E-04 1.15 0.211 0.189 G (SEQ ID NO: 0371)
    tagtcaaattcattca[A/G]tgtggctcagatatga
    02 rs11941518 4 q q32.1 SFRP2|DCHS2 156950378 6.42E-06 1.22 0.146 0.123 G (SEQ ID NO: 0372)
    atgtgaacattttttt[A/G]gacaagtttattgcta
    03 rs6536518 4 q q32.1 CTSO|PDGFC 161308423 3.53E-04 1.12 0.463 0.435 A (SEQ ID NO: 0373)
    aacacagccaacatca[A/G]ttaagcctaatttaca
    02 rs1898871 4 q q32.1 RAPGEF2| 161402299 2.83E-06 1.11 0.381 0.358 A (SEQ ID NO: 0374)
    FSTL5 ggaaaagtggaatgcc[A/G]agaacagaaactaaga
    02 rs1371251 4 q q32.1 RAPGEF2| 161381482 1.70E-05 1.13 0.458 0.428 A (SEQ ID NO: 0375)
    FSTL5 ctctctagagtttact[A/G]tcatctggcattcatg
    02 rs6827968 4 q q32.1 RAPGEF2| 161399652 1.96E-06 1.12 0.393 0.366 A (SEQ ID NO: 0376)
    FSTL5 ctacatggaaaattga[A/C]gtagcaaggtaggtca
    02 rs13151634 4 q q32.1 RAPGEF2| 161411394 2.21E-07 1.14 0.480 0.448 A (SEQ ID NO: 0377)
    FSTL5 agcctgtctcctctgg[A/G]agtcttatctctcagt
    02 rs4690982 4 q q32.1 RAPGEF2| 161428827 2.06E-05 1.10 0.394 0.371 A (SEQ ID NO: 0378)
    FSTL5 ttccatatcctcgtcc[A/G]caattagtacgcacag
    02 rs4690983 4 q q32.1 RAPGEF2| 161429238 1.58E-05 1.10 0.393 0.370 A (SEQ ID NO: 0379)
    FSTL5 catgtttactatctct[A/G]taggtttgcctttttg
    03 rs1946867 4 q q32.1 RAPGEF2| 161307463 1.06E-04 0.88 0.446 0.476 A (SEQ ID NO: 0380)
    FSTL5 taccaaattgtatggt[A/G]tcagtgatggcagcag
    01 rs4525928 4 q q32.1 RAPGEF2| 161421752 8.63E-08 1.15 0.489 0.454 C (SEQ ID NO: 0381)
    FSTL5 cagaactgaaataatt[A/C]tccataggatccttag
    03 rs17039615 4 q q32.1 RAPGEF2| 161406478 8.21E-04 1.14 0.204 0.183 A (SEQ ID NO: 0382)
    FSTL5 ttttaatgaagcccct[A/G]taggctagttgtcaag
    03 rs9996901 4 q q32.2 RAPGEF2| 162482595 7.20E-04 1.19 0.112 0.096 A (SEQ ID NO: 0383)
    FSTL5 catctcaaaccatgca[A/G]ttcctggaaatcacta
    03 rs6536728 4 q q32.2 FSTL5 164333380 3.09E-03 1.14 0.155 0.139 G (SEQ ID NO: 0384)
    tgcaaggaaaccattt[A/G]ccagcctcctgcaatt
    03 rs10024430 4 q q32.2 NPY5R|TKTL2 164295108 1.44E-03 1.33 0.033 0.025 G (SEQ ID NO: 0385)
    ctgaaaataagttccc[A/G]catatatattgtagaa
    02 rs1534578 4 q q32.3 NPY5R|TKTL2 165514302 2.48E-05 1.16 0.252 0.226 G (SEQ ID NO: 0386)
    tgatgctataattcct[A/G]gattttgtttgatttc
    03 rs1459509 4 q q32.3 ANP32C| 166602111 1.15E-02 1.16 0.076 0.066 A (SEQ ID NO: 0387)
    LOC100131276 ctagagaagatgaagg[A/G]atgtgcattccaggca
    03 rs7695819 4 q q33 CPE|TLL1 171808256 5.63E-05 1.09 0.232 0.217 A (SEQ ID NO: 0388)
    tgctcaagagcagacc[A/G]gatgagccacacatgg
    02 rs1432083 4 q q33 AADAT| 171813412 1.91E-05 1.14 0.345 0.317 G (SEQ ID NO: 0389)
    LOC441052 agggatcaattcttac[A/G]ataaaattttaaaacc
    03 rs2584393 4 q q34.3 AADAT| 180591910 1.07E-03 1.15 0.176 0.157 A (SEQ ID NO: 0390)
    LOC441052 tgaaactgagtaaacc[A/G]ttaagaatgaattatt
    03 rs6852438 4 q q34.3 LOC100288304| 182061996 3.50E-04 1.14 0.242 0.219 G (SEQ ID NO: 0391)
    LOC100288373 ctgcataagccctggc[A/G]tgctaccacagcccaa
    03 rs6837023 4 q q34.3 LOC100288304| 180330521 2.38E-04 1.23 0.088 0.073 A (SEQ ID NO: 0392)
    OC100288373 gtgtgtcccatgtggc[A/G]agagctcaaacaaggc
    03 rs4861466 4 q q34.3 LOC100288304| 182064722 253E-03 1.10 0.470 0.446 G (SEQ ID NO: 0393)
    LOC100288373 atctaagttaaggtag[A/G]aatgatgaggtcaaaa
    03 rs4400034 4 q q35.1 LOC100288304| 184586738 6.03E-03 1.14 0.135 0.121 A (SEQ ID NO: 0394)
    LOC100288373 acttcatggtgatcca[A/C]tgtctacctccagcaa
    03 rs12108497 4 q q35.1 C4orf41 185571557 6.43E-05 1.12 0.316 0.291 A (SEQ ID NO: 0395)
    gtgactataaaagatg[A/G]ggccttcggcagctcc
    03 rs6850330 4 q q35.1 CCDC111 184415303 2.55E-04 1.26 0.068 0.055 C (SEQ ID NO: 0396)
    atattaatacgtggct[A/C]agattaatgacagcaa
    02 rs4861551 4 q q35.1 CDKN2AIP| 184362068 6.81E-05 1.15 0.280 0.253 G (SEQ ID NO: 0397)
    ING2 ggcaactcacagaaaa[A/G]gagagtttgaggatct
    03 rs766908 4 q q35.1 CLDN24| 185468885 4.92E-03 1.15 0.120 0.107 G (SEQ ID NO: 0398)
    LOC100131811 aaacaatgctgaggag[A/G]ctttatctttacagtt
    02 rs11939575 4 q q35.2 IRF2|CASP3 187627792 3.04E-05 0.85 0.187 0.214 A (SEQ ID NO: 0399)
    tcatgatgaggacgcc[A/G]gaagagatggggagat
    02 rs13123522 4 q q35.2 FAT1 187627160 2.65E-05 0.85 0.188 0.215 G (SEQ ID NO: 0400)
    tggcatgctgaactga[A/G]aagacctggcttggaa
    03 rs327080 4 q q35.2 FAT1 187593959 4.71E-04 0.89 0.305 0.331 G (SEQ ID NO: 0401)
    tccctccaattgaagg[A/G]caggcagggactccaa
    03 rs2279551 4 q q35.2 FAT1 189012809 4.98E-03 1.20 0.062 0.052 A (SEQ ID NO: 0402)
    tcttgctcacggggtc[A/G]gtgatggggaccgagt
    03 rs6849766 4 q q35.2 TRIML2 189010521 2.37E-02 1.10 0.174 0.161 A (SEQ ID NO: 0403)
    agtgtttcaaataatt[A/G]tctcacttccagctca
    01 rs4611976 4 q q35.2 ZFP42|TRIML2 188990955 1.78E-06 1.39 0.055 0.040 C (SEQ ID NO: 0404)
    acctggagagaggggc[A/C]cagctcagagctttcc
    03 rs1895435 5 p p13.2 ZFP42|TRIML2 37892952 8.57E-04 1.19 0.104 0.089 C (SEQ ID NO: 0405)
    catctgtggatatggc[A/C]gttttaccctcctggc
    03 rs13362367 5 p p13.3 GDNF| 29329716 2.03E-03 0.89 0.207 0.227 A (SEQ ID NO: 0406)
    EGFLAM gttttgaccccttgga[A/G]acactcatgaacaacc
    03 rs12109819 5 p p13.3 LOC7298621 32068026 4.13E-02 0.93 0.302 0.317 A (SEQ ID NO: 0407)
    LOC100130803 tgtaccccatggtttt[A/G]gcatcattgactatta
    03 rs2303748 5 p p14.3 PDZD2 21760602 8.97E-04 1.13 0.279 0.256 C (SEQ ID NO: 0408)
    aagaaaagtattgatt[A/C]ctccctttgtgccttt
    03 rs6555477 5 p p15.31 CDH12 7587939 2.36E-04 1.13 0.316 0.290 A (SEQ ID NO: 0409)
    aagaggatagggaaac[A/G]ttgagagaatcggttg
    02 exm443730 5 p p15.31 ADCY2 7831992 2.13E-08 8.93 0.006 0.001 A (SEQ ID NO: 0410)
    atgtgcccaaagccgg[A/G]ttccttgaggctgggg
    03 rs275447 5 p p15.31 C5orf49 6825016 3.29E-03 1.13 0.182 0.164 A (SEQ ID NO: 0411)
    ttttctgtgccttcac[A/G]tgtacttacacgcaca
    03 rs13177725 5 p p15.31 POLS| 6795764 1.21E-02 0.90 0.194 0.210 G (SEQ ID NO: 0412)
    LOC442132 gattagtgcacttaca[A/G]ggggatgaagagacca
    03 rs275442 5 p p15.31 POLS| 6827513 7.70E-04 1.11 0.438 0.412 A (SEQ ID NO: 0413)
    LOC442132 atgaataagctaactt[A/G]agccgaaatgttaaca
    03 rs37006 5 p p15.33 CLPTM1L| 1355058 2.05E-02 0.93 0.417 0.435 A (SEQ ID NO: 0414)
    SLC6A3 cactgcaacattttca[A/G]acttgaatctcacaga
    03 rs6861105 5 p p15.33 IRX4|IRX2 1897640 4.38E-04 0.80 0.064 0.079 G (SEQ ID NO: 0415)
    tgccagctgaggctcc[A/G]gcagacacaggtttgc
    03 rs12188301 5 p p15.33 NDUFS6|IRX4 1847639 9.14E-05 0.83 0.108 0.127 A (SEQ ID NO: 0416)
    agaaatgggatgtagc[A/G]tgagttgtgagttgtt
    02 exm442113 5 p p15.33 TERT 1293767 9.52E-14 7.19 0.011 0.002 A (SEQ ID NO: 0417)
    gctcgcagcgggcagt[A/G]cgtcttgaggagcacc
    03 rs7722066 5 q q11.2 LOC257396| 52417217 2.80E-04 0.89 0.386 0.415 A (SEQ ID NO: 0418)
    FST catatgtttgtgtgag[A/C]agatattgtaagttt
    03 rs10060367 5 q q12.3 FLJ46010| 65859130 3.38E-03 1.12 0.212 0.193 A (SEQ ID NO: 0419)
    MAST4 agagtcgagtagatga[A/G]gtgtgcttcaggtttt
    03 rs10056426 5 q q12.3 MAST4 66203615 8.76E-03 1.15 0.097 0.085 G (SEQ ID NO: 0420)
    aaaatctcacaaatgc[A/G]attcaagtaagttgaa
    03 rs26923 5 q q12.3 MAST4 66170504 5.15E-03 1.16 0.098 0.086 C (SEQ ID NO: 0421)
    tacagcagaccgaaac[A/C]atgtattttagaatta
    03 rs734828 5 q q12.3 MAST4 66221262 6.08E-03 1.16 0.101 0.088 G (SEQ ID NO: 0422)
    aatcactctaaacaac[A/G]catttaataggttcca
    02 rs12521058 5 q q13.3 LOC728723 76426987 3.31E-05 1.14 0.416 0.384 A (SEQ ID NO: 0423)
    aataaacgagagacat[A/C]tggagaaaggagacct
    03 rs7732628 5 q q13.3 LOC728723 76435346 4.66E-04 0.89 0.413 0.440 G (SEQ ID NO: 0424)
    atctgagaaaattctc[A/G]gtcactgtcacttcaa
    02 rs2972341 5 q q13.3 LOC728723| 76468843 1.15E-05 0.90 0.443 0.468 A (SEQ ID NO: 0425)
    PDE8B cactgattagctgatg[A/G]gactctaccctatata
    03 rs6862414 5 q q13.3 LOC728723| 76454559 9.74E-05 0.90 0.248 0.269 G (SEQ ID NO: 0426)
    PDE8B ggacaggccacaccca[A/G]aggaaaacctggagtc
    03 rs16875951 5 q q14.1 ARSB 78101191 2.19E-02 1.11 0.137 0.125 A (SEQ ID NO: 0427)
    gaacctaaactgttgt[A/G]attttataccaagtat
    02 rs1129770 5 q q14.1 CMYA5 79086883 2.40E-06 1.10 0.195 0.181 A (SEQ ID NO: 0428)
    tttggtgagaggagac[A/G]gctgacggagtaagta
    03 rs293045 5 q q15 MCTP1 94289131 7.79E-04 1.33 0.037 0.028 G (SEQ ID NO: 0429)
    actttttgttgtttca[A/G]aagagtggttctcttg
    03 rs1990745 5 q q21.2 NRDT12| 103381922 1.59E-03 1.15 0.150 0.133 A (SEQ ID NO: 0430)
    RAB9P1 cactttggtattaatc[A/G]ttgatcttgcagttag
    03 rs10464035 5 q q21.3 LOC100287833| 106562841 2.35E-03 1.14 0.167 0.150 A (SEQ ID NO: 0431)
    EFNA5 gacactccttgagact[A/G]caaaccacatacctgg
    03 rs10455070 5 q q21.3 LOC100287833| 106569691 8.74E-03 1.11 0.186 0.170 A (SEQ ID NO: 0432)
    EFNA5 aaacctaaaagatcaa[A/G]ttggctaaacacgtac
    03 rs4957696 5 q q21.3 LOC100287833| 106558682 2.53E-03 1.14 0.168 0.151 C (SEQ ID NO: 0433)
    EFNA5 tccgggcatttcttgg[A/C]tatttctttaataatg
    03 rs11749864 5 q q22.2 MCC 112612123 1.06E-02 1.19 0.058 0.049 G (SEQ ID NO: 0434)
    agaaactgagcagtgt[A/G]ttgtgcagaattggtg
    03 rs11740353 5 q q22.2 MCC 112577696 1.12E-02 1.19 0.057 0.049 A (SEQ ID NO: 0435)
    cagcagaatagagaac[A/G]accaaatcaaacaaca
    03 rs1965429 5 q q22.2 MCC 112679373 1.09E-02 0.92 0.349 0.368 C (SEQ ID NO: 0436)
    atggcctgtgacatag[A/C]tagcatttaataaaca
    03 rs10519343 5 q q22.2 MCC 112592606 5.94E-03 1.20 0.058 0.049 A (SEQ ID NO: 0437)
    acccataaaccattct[A/G]agggccagattaaaac
    03 rs17333442 5 q q22.2 YTHDC2| 112947050 1.27E-02 0.88 0.101 0.113 C (SEQ ID NO: 0438)
    KCNN2 aaatatgttatattta[A/C]tggcagttatctttct
    03 rs2112614 5 q q22.3 CCDC112| 114812584 1.10E-03 1.16 0.135 0.118 G (SEQ ID NO: 0439)
    FEM1C taaagtaaacgtactc[A/G]tcttagcttagacaca
    03 rs9637896 5 q q22.3 YTHDC2| 113561408 9.39E-05 1.17 0.132 0.115 G (SEQ ID NO: 0440)
    KCNN2 agaaaatcaaattttt[A/G]taagacttaccaaaaa
    03 rs2896965 5 q q23.1 HSD17B4| 118921139 2.37E-03 0.87 0.136 0.153 G (SEQ ID NO: 0441)
    FAM170A tagatggtaaccaggc[A/G]tgaagagacagctgac
    03 rs37391 5 q q23.2 CSNK1G3| 123525965 2.95E-04 0.88 0.308 0.334 G (SEQ ID NO: 0442)
    ZNF608 agacaagcagcgcctc[A/G]tttatgtgatgtattt
    02 rs7721313 5 q q31.1 H2AFY 134673961 3.90E-02 1.20 0.076 0.065 C (SEQ ID NO: 0443)
    ggttaagagctcagga[T/C]ttcccggagtcacaca
    03 rs40273 5 q q31.1 TCF7 133482348 3.98E-03 0.80 0.044 0.054 G (SEQ ID NO: 0444)
    atttcagaggctgcag[A/G]acttctgcctgaacct
    02 rs165179 5 q q31.2 UBE2D2/ 138985694 1.26E-05 1.29 0.074 0.058 G (SEQ ID NO: 0445)
    UBE2D2 atgagactgaatcccc[A/G]gagacctacacttgaa
    02 rs10476878 5 q q32 POU4F3| 145797485 4.95E-05 0.85 0.194 0.221 G (SEQ ID NO: 0446)
    TCERG1 caaacttatcacagta[A/G]tcacatttttaaggag
    03 rs979893 5 q q32 POU4F3| 145797020 8.30E-04 0.87 0.179 0.200 A (SEQ ID NO: 0447)
    TCERG1 agtgtgttaagctttc[A/C]tgctcagaaatgacag
    03 rs10056189 5 q q32 POU4F3| 145804118 4.51E-03 0.87 0.121 0.136 A (SEQ ID NO: 0448)
    TCERG1 ccagtaccaccattg[A/G]agctttacttgttttg
    02 rs7718446 5 q q32 POU4F3| 145749535 4.40E-06 0.87 0.264 0.292 G (SEQ ID NO: 0449)
    TCERG1 tccaacacttagggta[A/G]gtaagtagctagttac
    02 rs11747475 5 q q32 POU4F3| 145784922 5.98E-05 0.85 0.194 0.220 G (SEQ ID NO: 0450)
    TCERG1 cacgatgtcatgtgtt[A/G]attgagttgtatactt
    02 rs6886412 5 q q32 POU4F3| 145777478 5.42E-06 0.86 0.262 0.291 G (SEQ ID NO: 0451)
    TCERG1 atgcttcaccgtctac[A/G]tcccctaattctaacc
    02 exm494153 5 q q32 PPARGC1B 149213060 2.10E-16 20.56 0.008 0.000 A (SEQ ID NO: 0452)
    gagagctctgtgtgcc[A/C]cgtgcggcgttctcgg
    02 exm497501 5 q q33.1 FAT2 150946613 4.47E-11 Inf 0.004 0.000 G (SEQ ID NO: 0453)
    aaacgcccttttatca[A/G]tcttactgctggtcaa
    03 rs1438937 5 q q33.1 NMUR2| 152370448 2.03E-04 0.89 0.412 0.441 A (SEQ ID NO: 0454)
    GRIA1 cccaagcaaatgatag[A/C]tattgccaattaaact
    03 rs918509 5 q q33.2 GALNT10 153762653 4.81E-04 0.88 0.225 0.249 A (SEQ ID NO: 0455)
    ccagtgactgccaacc[A/G]tggccacacataagca
    02 rs954929 5 q q34 LOC285629| 160380401 2.37E-05 1.07 0.359 0.343 A (SEQ ID NO: 0456)
    GABRB2 ctctctatactacccc[A/G]tcagtgactcgcttta
    02 rs7725726 5 q q35.1 GABRP 170215670 1.65E-05 1.24 0.090 0.074 A (SEQ ID NO: 0457)
    tgagtctcttcactga[A/G]aggtgagctttgctac
    03 rs11134653 5 q q35.1 GABRP 170213757 6.23E-05 1.22 0.087 0.072 A (SEQ ID NO: 0458)
    cttacaactgtgccac[A/G]catatctagaatcctc
    02 rs258878 5 q q35.2 BOD1 173051169 1.51E-02 0.89 0.357 0.383 A (SEQ ID NO: 0459)
    accaccaggagaggtt[C/A]tctctcttcttggagc
    02 exm505619 5 q q35.2 EIF4E1B 176072243 1.70E-12 50.73 0.005 0.000 A (SEQ ID NO: 0460)
    cctcctccaactcacc[A/G]tctccagccacagccg
    03 rs11134853 5 q q35.2 HMP19| 173970989 1.81E-04 1.18 0.163 0.142 C (SEQ ID NO: 0461)
    LOC100127922 gtagtatgaacaaaag[A/C]gccctgggcttggagt
    01 rs2770967 5 q q35.3 LOC100289627| 180678717 4.44E-06 1.28 0.094 0.075 G (SEQ ID NO: 0462)
    TRIM52 tgtgataaatttaatc[A/G]tagtctgtccaaacca
    03 rs7727897 5 q q35.3 LOC202181 177047009 8.02E-03 1.15 0.097 0.085 G (SEQ ID NO: 0463)
    cagagtcttcccccca[A/G]tctgactcttctccat
    03 rs3940643 5 q q35.3 RASGEF1C 179585309 6.16E-04 1.13 0.302 0.277 A (SEQ ID NO: 0464)
    ttttacaggagac[A/G]tggagcccaacacataa
    03 rs4440459 6 p p12.1 ELOVL5| 53293410 8.62E-04 1.17 0.136 0.119 A (SEQ ID NO: 0465)
    GCLC tgagcctgacctccaa[A/C]acctcagcagcagcat
    02 rs9370209 6 p p12.1 ELOVL5| 53296156 4.28E-05 1.21 0.142 0.121 A (SEQ ID NO: 0466)
    GCLC atgagggttttagaat[A/G]tatttgaatgctgaca
    03 rs6458934 6 p p12.1 ELOVL5| 53291466 2.82E-04 1.18 0.136 0.117 G (SEQ ID NO: 0467)
    GCLC taactccaagttaaag[A/G]ctatactaccacatc
    03 rs12192659 6 p p12.1 FAM83B 54726327 2.63E-04 1.12 0.485 0.456 A (SEQ ID NO: 0468)
    tgacactgctgacaga[A/G]gaagaccccacctcca
    03 rs13200042 6 p p12.1 FAM83B| 55033223 2.49E-03 0.89 0.212 0.232 G (SEQ ID NO: 0469)
    HCRTR2 tctactgtggaaacag[A/G]atagagtaacagcaaa
    03 rs3134704 6 p p12.1 HCRTR2 55072273 1.42E-02 0.91 0.219 0.236 G (SEQ ID NO: 0470)
    atgtgatttattttaa[A/G]cctcaccatttgaagt
    02 exm555738 6 p p12.2 GSTA5 52696737 1.81E-08 Inf 0.003 0.000 A (SEQ ID NO: 0471)
    cagaaacttcttcacc[A/G]tgggcaggttgctgat
    03 rs4712023 6 p p12.2 LOC100287869| 52758653 6.91E-05 1.15 0.072 0.064 A (SEQ ID NO: 0472)
    GSTA3 taagttgttgaaccac[A/G]agcatgacagtcttta
    02 rs9296695 6 p p12.2 LOC100287869| 52758076 4.34E-05 1.13 0.069 0.061 A (SEQ ID NO: 0473)
    GSTA3 gaaaaccttgacaaac[A/G]gagctggaaaaccatg
    03 rs2505276 6 p p12.3 TFAP2B| 51087831 2.04E-04 0.89 0.430 0.459 A (SEQ ID NO: 0474)
    LOC646517 cagaggatgccagttt[A/G]cttgaatgccaaaatt
    03 rs9381940 6 p p12.3 TFAP2B 51073648 2.14E-03 0.91 0.383 0.406 A (SEQ ID NO: 0475)
    LOC646517 tcattttgatcactct[A/G]tggcatttgacacttt
    02 exm551051 6 p p21.1 CAPN11 44143862 1.57E-14 Inf 0.005 0.000 A (SEQ ID NO: 0476)
    gctggtgagagggcac[A/G]cttactctgtgactgg
    02 rs9381299 6 p p21.1 SLC29A1| 44211867 4.19E-05 1.14 0.141 0.126 G (SEQ ID NO: 0477)
    HSP90AB1 aaaggaacagagcccc[A/G]ttagaggaaccatagc
    03 rs3187 6 p p21.1 SLC35B2 44222047 6.79E-05 1.20 0.106 0.091 A (SEQ ID NO: 0478)
    cattggagcctacacc[A/G]cttgtgcttttctcac
    02 exm542389 6 p p21.31 ETV7 36339143 2.60E-19 8.74 0.014 0.002 A (SEQ ID NO: 0479)
    ggtctgttccttcccc[A/G]cgatgccgcaggcccc
    02 rs2499724 6 p p21.31 GRM4 34086671 1.08E-02 0.89 0.441 0.468 C (SEQ ID NO: 0480)
    aatgaatacaactgta[A/C]aaactggaaccaaacc
    02 rs2451330 6 p p21.31 GRM4|HMGA1 34118586 8.40E-05 0.88 0.380 0.411 G (SEQ ID NO: 0481)
    agttgagagaagccag[A/G]gtgaaattcctcctgc
    02 rs914813 6 p p21.31 GRM4|HMGA1 34103954 1.44E-05 0.87 0.358 0.392 G (SEQ ID NO: 0482)
    tagggataaaaatacc[A/G]tgaagctcatagggat
    03 rs2070600 6 p p21.32 AGER 32151443 1.63E-04 0.73 0.038 0.051 A (SEQ ID NO: 0483)
    tcgtgtccttcccaac[A/G]gctccctcttccttcc
    02 rs176248 6 p p21.32 BRD2|HLA- 32965942 2.07E-05 0.85 0.244 0.275 A (SEQ ID NO: 0484)
    DOA agaagagagagagtaa[A/G]tgtattccaccaagaa
    03 rs2076524 6 p p21.32 BTNL2 32370684 6.48E-03 0.91 0.268 0.287 G (SEQ ID NO: 0485)
    tcctgctgatctgagc[A/G]tgtgggtcctagaggc
    03 rs2076525 6 p p21.32 BTNL2 32370616 4.01E-03 0.90 0.267 0.287 G (SEQ ID NO: 0486)
    tttatcaagagacatt[A/G]tctatcatatagcaat
    03 rs2395175 6 p p21.32 BTNL2|HLA- 32405026 1.78E-03 0.87 0.150 0.168 A (SEQ ID NO: 0487)
    DRA ctgcaacatcagcaga[A/G]gcttcctgtgggttcc
    03 rs3763316 6 p p21.32 BTNL2|HLA- 32376746 5.49E-03 0.91 0.267 0.287 A (SEQ ID NO: 0488)
    DRA ctaaggggaggtgact[A/G]gtaagtttcaggtggc
    03 rs2073045 6 p p21.32 C6orf10 32339548 2.82E-03 0.91 0.350 0.373 A (SEQ ID NO: 0489)
    tcagagagagatcaag[A/G]taaaacgaaaaactca
    03 rs2050188 6 p p21.32 C6orf10| 32339897 1.47E-03 1.11 0.365 0.341 G (SEQ ID NO: 0490)
    BTNL2 tacaaagattaatgat[A/G]tacaatctctggcctt
    03 rs9268474 6 p p21.32 C6orf10| 32357165 4.56E-03 0.90 0.267 0.287 G (SEQ ID NO: 0491)
    BTNL2 tatttatgatgaaat[A/G]tgtaagcctcccttta
    03 rs9268461 6 p p21.32 C6orf10| 32351901 1.33E-02 0.92 0.268 0.286 A (SEQ ID NO: 0492)
    BTNL2 tttggtgccttcctac[A/C]gttatggaaggaagct
    03 rs9268456 6 p p21.32 C6orf10| 32349946 6.07E-03 0.91 0.268 0.287 A (SEQ ID NO: 0493)
    BTNL2 cctatagtcaagtaag[A/C]ctgtaataataaatat
    03 rs9268403 6 p p21.32 C6orf10| 32341473 6.93E-03 0.91 0.268 0.287 G (SEQ ID NO: 0494)
    BTNL2 gggagatctcttacac[A/G]tgatgtttctttcaga
    03 rs9268425 6 p p21.32 C6orf10| 32344376 8.36E-03 0.91 0.268 0.287 A (SEQ ID NO: 0495)
    BTNL2 agaaatccacttagat[A/G]tctaccctacttcccc
    03 rs9268428 6 p p21.32 C6orf10| 32344973 5.96E-03 0.91 0.268 0.287 A (SEQ ID NO: 0496)
    BTNL2 tttcttaacacagcag[A/C]aaaattgttttatgtc
    03 rs2894252 6 p p21.32 C6orf10| 32345443 6.38E-03 0.91 0.268 0.287 A (SEQ ID NO: 0497)
    BTNL2 gtagattctaatctta[A/G]gccctttgccatagac
    03 rs2395157 6 p p21.32 C6orf10| 32348145 6.94E-03 0.91 0.268 0.287 G (SEQ ID NO: 0498)
    BTNL2 agaaaataaaaactat[A/G]taatcttagatggcac
    03 rs9268454 6 p p21.32 C6orf10| 32349711 6.03E-03 0.91 0.268 0.287 G (SEQ ID NO: 0499)
    BTNL2 ataacactgatgatat[A/G]gatttgaggtgagaga
    02 rs1061807 6 p p21.32 EGFL8/ 32136838 1.27E-05 1.18 0.264 0.234 A (SEQ ID NO: 0500)
    AGPAT1 gggggtcaagagtgga[A/G]actgcaccgaggcaag
    02 exm536563 6 p p21.32 HLA-DQA2 32714067 3.35E-29 Inf 0.026 0.000 A (SEQ ID NO: 0501)
    agagactttggtctgc[A/G]ccctggggttgtctgt
    02 exm536439 6 p p21.32 HLA-DQB1 32634282 2.16E-08 5.59 0.007 0.001 G (SEQ ID NO: 0502) 
    ctgcacttaccgggag[A/G]gtctctgccctcagcc 
    03 rs1964995 6 p p21.32 HLA-DRA| 32449411 2.88E-03 0.91 0.417 0.440 G (SEQ ID NO: 0503)
    agaatcaaggaataag[A/G]aaaataatgtgagctg
    03 rs9267833 6 p p21.32 NOTCH4 32177900 8.69E-04 1.13 0.272 0.249 G (SEQ ID NO: 0504)
    catcttcttcaggaag[A/G]tgtccctaacttctcc
    02 rs206015 6 p p21.32 NOTCH4 32182759 6.17E-05 0.81 0.098 0.118 A (SEQ ID NO: 0505)
    ttcgccctgggattta[A/G]tgctcttctttctgct
    03 rs2071277 6 p p21.32 NOTCH4 32171683 3.77E-04 1.12 0.510 0.482 G (SEQ ID NO: 0506)
    tgatgcagtgtgtgac[A/G]tctaatctcccccata
    02 rs206016 6 p p21.32 NOTCH4 32181182 4.04E-05 0.81 0.096 0.116 A (SEQ ID NO: 0507)
    tatatgatattttatt[A/G]tttttagatagggtct
    03 rs394657 6 p p21.32 NOTCH4 32187023 7.27E-04 1.11 0.469 0.442 G (SEQ ID NO: 0508)
    ggagcattctgggttg[A/G]cctgagcaaaggctgc
    03 rs3134799 6 p p21.32 NOTCH4 32184221 6.64E-04 1.11 0.464 0.438 A (SEQ ID NO: 0509)
    tctgcttatctttcaa[A/G]actcatctcagccatc
    02 rs2071286 6 p p21.32 NOTCH4 32179896 6.41E-05 1.16 0.225 0.200 A (SEQ ID NO: 0510)
    tccagctacactcaac[A/G]catttcaccccacccc
    03 rs9357138 6 p p21.32 NOTCH4| 32219838 2.54E-03 1.14 0.154 0.138 A (SEQ ID NO: 0511)
    C6orf10 tattaattgccccaga[A/G]atctatcctcacatcc
    02 rs9267810 6 p p21.32 PPT2 32121594 3.97E-06 1.18 0.269 0.237 G (SEQ ID NO: 0512)
    tctggctccgcagcag[A/G]acacgaagtttgcatt
    02 rs2269424 6 p p21.32 PPT2|EGFL8 32132233 9.13E-06 1.18 0.265 0.234 A (SEQ ID NO: 0513)
    ggagccctttgctggg[A/G]tggggatgagggtagt
    03 rs35502919 6 p p21.33 BAT2 31604355 1.15E-04 0.72 0.034 0.047 A (SEQ ID NO: 0514)
    ctggtggccaaagtgg[A/C]tttctcccttcagggg
    03 rs3130977 6 p p21.33 C6orf15| 31081989 6.61E-04 0.89 0.310 0.335 G (SEQ ID NO: 0515)
    PSORS1C1 aagtctggaatcagca[A/G]aaatgtattacattga
    02 exm- 6 p p21.33 C6orf25 31692970 1.15E-13 Inf 0.017 0.003 A (SEQ ID NO: 0516)
    rs407283 atagaaataagtgcta[A/G]actgggagttgggaga
    03 rs3132550 6 p p21.33 CDSN 31086048 3.46E-04 0.87 0.212 0.236 A (SEQ ID NO: 0517)
    gtgagagcccaggctg[A/G]ggtcaggaatggaaac
    03 rs2844456 6 p p21.33 EHMT2 31864674 1.55E-04 0.73 0.035 0.048 G (SEQ ID NO: 0518)
    gctaaaacgggcccca[A/G]ttggaccgtcaccttc
    02 rs9263582 6 p p21.33 HCG22| 31070664 4.06E-05 0.77 0.063 0.080 A (SEQ ID NO: 0519)
    C6orf15 cacttaaagcccaaag[A/G]tggccggctgtggtgg
    01 rs35718543 6 p p21.33 HCG27|HLA-C 31177845 1.38E-06 1.28 0.106 0.085 A (SEQ ID NO: 0520)
    tgtggatcttcagcac[A/G]tctacaactccctcca
    03 rs2523457 6 p p21.33 HLA-B|MICA 31365707 3.63E-03 0.90 0.292 0.313 A (SEQ ID NO: 0521)
    acaaaccttcttggaa[A/G]gtggaaagttttgcaa
    02 rs2853925 6 p p21.33 HLA-C|HLA-B 31264922 1.63E-05 0.81 0.112 0.135 G (SEQ ID NO: 0522)
    acaaaagctaccagat1A/Gtaaaacactcactatgg
    02 rs9264869 6 p p21.33 HLA-C|HLA-B 31271630 1.33E-05 0.81 0.112 0.135 G (SEQ ID NO: 0523)
    cctgagagatctgagt[A/G]atcaagacccagtgtt
    02 rs7759127 6 p p21.33 HLA-C|HLA-B 31240988 5.21E-06 0.80 0.110 0.133 C (SEQ ID NO: 0524)
    attcggtatttaatac[A/C]ttttgtgtgactgcct
    02 rs2524043 6 p p21.33 HLA-C|HLA-B 31257012 1.42E-05 0.81 0.112 0.135 G (SEQ ID NO: 0525)
    ctttcatttattgaac[A/G]ccttagatatgagcta
    02 rs2524132 6 p p21.33 HLA-C|HLA-B 31264912 1.67E-05 0.81 0.112 0.135 A (SEQ ID NO: 0526)
    ttacagctcaacaaaa[A/G]ctaccagataaaaaca
    02 rs364415 6 p p21.33 HLA-C|HLA-B 31273224 1.33E-05 0.81 0.112 0.135 A (SEQ ID NO: 0527)
    ggaggaagtgtggggt[A/G]tgggtagactcctcct
    02 rs3873385 6 p p21.33 HLA-C|HLA-B 31269308 1.91E-05 0.84 0.137 0.159 A (SEQ ID NO: 0528)
    gtgtgtgatgcagtat[A/G]gggtagaaccaggaga
    02 rs9264870 6 p p21.33 HLA-C|HLA-B 31271662 1.51E-05 0.81 0.113 0.135 A (SEQ ID NO: 0529)
    ttcacacatggaaaat[A/G]aggtggaaaaggagaa
    02 rs2524160 6 p p21.33 HLA-C|HLA-B 31259854 1.77E-05 0.81 0.113 0.135 A (SEQ ID NO: 0530)
    gtttgtgataaggagc[A/G]ttggggaggagatttg
    02 rs2524048 6 p p21.33 HLA-C|HLA-B 31256561 1.56E-05 0.81 0.112 0.135 G (SEQ ID NO: 0531)
    tttaaggaggctaact[A/G]cttccacattagatca
    03 rs2524050 6 p p21.33 HLA-C|HLA-B 31255541 5.39E-05 0.82 0.109 0.130 G (SEQ ID NO: 0532)
    cttttttgtottcccc[A/G]tgcattcgcccccaca
    02 rs2524162 6 p p21.33 HLA-C|HLA-B 31259750 4.11E-05 0.82 0.123 0.146 A (SEQ ID NO: 0533)
    gacccaacagtaagac[A/G]tttctccttttggtaa
    02 rs2524115 6 p p21.33 HLA-C|HLA-B 31265554 1.44E-05 0.81 0.112 0.135 A (SEQ ID NO: 0534)
    cgttgaagaatcagta[A/C]aatttggagactttga
    01 rs2853930 6 p p21.33 HLA-C|HLA-B 31255424 3.02E-06 0.79 0.106 0.131 C (SEQ ID NO: 0535)
    atcctgcaccttttcc[A/C]gtcaaatccccattcc
    03 rs13220225 6 p p21.33 IER3|DDR1 30747802 1.36E-04 1.17 0.187 0.165 A (SEQ ID NO: 0536)
    taagagaagactcacc[A/G]ttctgaggctgtctga
    02 rs28780111 6 p p21.33 IER3|DDR1 30720311 4.13E-05 1.18 0.188 0.164 A (SEQ ID NO: 0537)
    tccttcccagaaaacc[A/G]cctcagggctcacccc
    02 rs2535323 6 p p21.33 IER3|DDR1 30718180 3.71E-05 1.18 0.196 0.171 G (SEQ ID NO: 0538)
    gaactggaatgagaaa[A/G]taacctctaactgcta
    03 rs10947091 6 p p21.33 IER3|DDR1 30747216 1.51E-03 1.11 0.322 0.299 A (SEQ ID NO: 0539)
    agctcctactcagata[A/G]cagaactcacaaactt
    03 rs986475 6 p p21.33 LST1/NCR3 31556709 8.74E-04 1.19 0.100 0.086 G (SEQ ID NO: 0540)
    ggtcaaatagtaattt[A/G]ttgggtgaatgacagt
    03 rs6916921 6 p p21.33 NFKBIL1 31520426 8.60E-04 1.19 0.104 0.088 A (SEQ ID NO: 0541)
    atttaccagatcaacc[A/G]ttctcaatgctcttta
    03 rs9263699 6 p p21.33 PSORS1C1 31093699 1.16E-03 1.14 0.211 0.191 A (SEQ ID NO: 0542)
    tggaagaatgtgtcca[A/G]gctgtgcttcccottt
    03 rs3815087 6 p p21.33 PSORS1C1 31093587 6.83E-04 1.14 0.213 0.192 A (SEQ ID NO: 0543)
    ccatcacccccggacc[A/G]tgggctccatgccagt
    03 rs9263715 6 p p21.33 PSORS1C1 31095801 6.12E-04 1.14 0.211 0.190 A (SEQ ID NO: 0544)
    tcctctcctgtagacc[A/G]ctggctcatgaaataa
    03 rs9468877 6 p p21.33 PSORS1C3 31142903 3.81E-04 1.16 0.160 0.141 A (SEQ ID NO: 0545)
    cagactgctggctctg[A/G]gcatctgagcagcgcc
    03 rs9393228 6 p p22.3 FLJ22536 22112043 1.16E-03 1.11 0.437 0.412 A (SEQ ID NO: 0546)
    agggttttcttgaatg[A/G]catttctcattgctaa
    03 rs952578 6 p p22.3 FLJ22536 21884519 1.16E-03 1.11 0.357 0.333 A (SEQ ID NO: 0547)
    agaatagacgtgttag[A/G]aaccaggttagcctgg
    03 rs199091 6 p p22.3 LOC389370| 23533562 1.76E-04 1.13 0.359 0.331 G (SEQ ID NO: 0548)
    LOC100129616 tcttgggggtcttttg[A/G]gggaacagagaacaat
    01 rs6907340 6 p p22.3 RNF144B|ID4 19803768 3.67E-10 1.20 0.416 0.373 A (SEQ ID NO: 0549)
    ttgatgatggtgatat[A/G]gaatgattaataacca
    02 rs7759616 6 p p22.3 RNF144B|ID4 19794585 1.70E-05 1.14 0.521 0.487 A (SEQ ID NO: 0550)
    tgatgggagagaaata[A/G]gaattcaacttgtagc
    02 rs760794 6 p p22.3 RNF144B|ID4 19790560 1.84E-07 1.17 0.469 0.431 A (SEQ ID NO: 0551)
    tttttccctgaaactc[A/G]gccaaaagtttttcct
    01 rs6904518 6 p p22.3 RNF144B|ID4 19798704 7.31E-10 1.19 0.426 0.385 G (SEQ ID NO: 0552)
    gctatattaaaagaaa[A/G]tagacttcaaagcaaa
    02 rs7766034 6 p p22.3 RNF144B|ID4 19753061 5.48E-06 1.15 0.464 0.429 A (SEQ ID NO: 0553)
    aggggcctaagcccag[A/G]tgtcagaggcacagta
    02 rs6916251 6 p p22.3 RNF144B|ID4 19761215 3.39E-07 1.16 0.465 0.428 G (SEQ ID NO: 0554)
    gtttccagccacctct[A/G]tttccattcccttaaa
    02 rs6920825 6 p p22.3 RNF144B|ID4 19732492 6.00E-05 1.16 0.223 0.198 G (SEQ ID NO: 0555)
    gacgcagtctgtaggc[A/G]cttggcaagtgtttgc
    02 rs6456259 6 p p22.3 RNF144B|ID4 19761718 5.65E-05 1.18 0.180 0.157 G (SEQ ID NO: 0556)
    tcccctgccactccct[A/G]tttaatgcctttgtaa
    01 rs2206034 6 p p22.3 RNF144B|ID4 19796863 2.22E-08 1.16 0.479 0.441 A (SEQ ID NO: 0557)
    gtgtgagggactcctc[A/G]taactcctgggcaagg
    02 rs2223361 6 p p22.3 RNF144B|ID4 19790809 1.76E-07 1.17 0.469 0.431 A (SEQ ID NO: 0558)
    gttgtcatgagttacc[A/G]tgattaaagtggtgga
    01 rs6903595 6 p p22.3 RNF144B|ID4 19798141 9.39E-09 1.18 0.423 0.383 A (SEQ ID NO: 0559)
    tataatctttgtctca[A/G]tagtcaaatacttaga
    02 rs7739264 6 p p22.3 RNF144B|ID4 19785588 3.29E-05 0.90 0.451 0.477 G (SEQ ID NO: 0560)
    tccccatagctatcca[A/G]ttgagccagaaccatt
    03 rs2842934 6 p p22.3 TPMT 18139214 2.14E-03 1.12 0.236 0.216 G (SEQ ID NO: 0561)
    tgcgatcacctggatt[A/G]atggcaactaatgctc
    03 rs2842947 6 p p22.3 TPMT 18132822 1.62E-03 1.12 0.237 0.216 G (SEQ ID NO: 0562)
    tctggaggtggagtct[A/G]aggatactgctatag
    03 rs2842950 6 p p22.3 TPMT 18135178 3.62E-03 1.11 0.233 0.215 A (SEQ ID NO: 0563)
    agtctagccaggctcc[A/G]tagaaactggagtgcc
    02 rs9462160 6 p p24.1 LOC389369| 11834883 1.60E-06 1.12 0.277 0.254 G (SEQ ID NO: 0564)
    HIVEP1 gaattttggaattcag[A/G]tatcagaaaaaagctg
    03 rs12193156 6 p p24.1 PHACTR1 13203570 4.07E-03 0.90 0.264 0.285 G (SEQ ID NO: 0565)
    agttatgtaaacagga[A/G]gtgcagcatagtgtct
    03 rs201051 6 p p25.1 LY86|RREB1 6721713 1.50E-04 1.15 0.261 0.236 A (SEQ ID NO: 0566)
    ttattcatccttatg[A/G]cctttcttgtataggt
    02 rs11242762 6 p p25.2 LOC100128372| 2379182 2.87E-05 0.88 0.446 0.477 G (SEQ ID NO: 0567)
    C6orf195 atatatcattttattt[A/G]atttcccagtcacctt
    03 rs9503159 6 p p25.2 LOC100128372| 2371304 7.88E-05 0.88 0.445 0.476 G (SEQ ID NO: 0568)
    C6orf195 cgtacccatgtgtcac[A/G]agtacacatgcttttc
    03 rs4959652 6 p p25.2 LOC100128372| 2386913 8.38E-05 1.10 0.420 0.397 A (SEQ ID NO: 0569)
    C6orf195 aatcattttttcaaaa[A/G]tgtagtcttttgtgag
    03 rs1715026 6 q q11.1 KHDRBS2 62515691 2.76E-02 1.08 0.287 0.271 G (SEQ ID NO: 0570)
    aggaggtgattagatc[A/G]tagaggttgttcccac
    03 rs6929584 6 q q13 BAI3|LMBRD1 70382870 8.84E-04 0.83 0.084 0.099 G (SEQ ID NO: 0571)
    ctttgaagtccttctg[A/G]aaaatacctaaattag
    03 rs1114785 6 q q13 BAI3|LMBRD1 70367148 4.75E-03 0.89 0.180 0.198 A (SEQ ID NO: 0572)
    aacccactccactaag[A/G]ccttcagtctgtgctc
    02 exm563585 6 q q14.2 SNAP91 84303230 3.86E-09 4.18 0.011 0.003 G (SEQ ID NO: 0573)
    ctccgctgccaccgcc[A/G]ccactgctcctcctgc
    02 rs9359587 6 q q14.3 KIAA1009| 85105960 4.29E-05 1.15 0.232 0.208 G (SEQ ID NO: 0574)
    TBX18 tttgccatactaattt[A/G]gtaactttagctaggt
    03 rs9294298 6 q q14.3 KIAA1009| 85147411 8.77E-03 0.92 0.385 0.405 A (SEQ ID NO: 0575)
    TBX18 gcctctagtcactaag[A/G]aaagtctaagtatctt
    03 rs4053608 6 q q15 BACH2 90787599 2.00E-03 1.11 0.290 0.268 A (SEQ ID NO: 0576)
    ttcaggattagatgct[A/G]agacttcaaatcagtc
    03 rs9342219 6 q q15 BACH2 90756453 6.39E-03 1.10 0.305 0.285 A (SEQ ID NO: 0577)
    acttgtttacaaaagc[A/G]tctctataggtctgtg
    03 rs453561 6 q q15 GABRR1 89904872 1.78E-03 1.11 0.404 0.380 A (SEQ ID NO: 0578)
    aagataaataagacaa[A/G]taacacattaaaaagc
    03 rs6908196 6 q q16.2 PRDM13| 100185261 6.25E-04 0.90 0.400 0.427 C (SEQ ID NO: 0579)
    MCHR2 atgggcaaacttctct[A/C]atgctaacagtgatga
    03 rs2198337 6 q q16.3 FLJ10088| 104756256 1.56E-03 1.16 0.139 0.123 A (SEQ ID NO: 0580)
    HACE1 ctgtottcattcctcc[A/G]gctactatccctaccc
    03 rs9386412 6 q q16.3 FLJ10088| 104760556 7.99E-04 1.17 0.139 0.122 A (SEQ ID NO: 0581)
    HACE1 tactgccaaacctcca[A/C]tcaaaatagctagggc
    03 rs6918769 6 q q16.3 FLJ10088| 104952471 2.49E-03 1.17 0.100 0.087 A (SEQ ID NO: 0582)
    HACE1 ctgtctgctaggagta[A/G]catcaggaagtgtctg
    03 rs404900 6 q q16.3 FLJ10088| 104765922 7.45E-04 1.16 0.145 0.127 C (SEQ ID NO: 0583)
    HACE1 accctagatctttctc[A/C]ttctcttcatacacat
    02 rs2852525 6 q q16.3 GRIK2 101875714 1.52E-05 0.88 0.433 0.466 C (SEQ ID NO: 0584)
    attgctagcatttatt[A/C]agtgaatgaataaatg
    03 rs7759938 6 q q16.3 HACE1| 105378954 8.66E-05 0.91 0.302 0.323 G (SEQ ID NO: 0585)
    LOC100129852 agcctcaaaggtagca[A/G]cctttagaaagaaaaa
    03 rs314286 6 q q16.3 LIN28B 105436053 3.63E-04 0.89 0.309 0.335 G (SEQ ID NO: 0586)
    aaaaactctgtagcta[A/G]tatcatgcttaatgat
    03 rs369065 6 q q16.3 LIN28B 105444058 6.34E-04 0.89 0.314 0.339 G (SEQ ID NO: 0587)
    tttctgatggcatcca[A/G]tccagagcaaatccct
    03 rs314272 6 q q16.3 LIN28B 105462004 7.45E-04 0.90 0.417 0.443 G (SEQ ID NO: 0588)
    tagtttgaaaccctat[A/G]atgttctttgaaacct
    03 rs453530 6 q q16.3 LOC100287035| 100829135 1.39E-03 1.34 0.031 0.024 A (SEQ ID NO: 0589)
    SIM1 agagcatcctaaatcc[A/G]actcttaggggaagac
    03 rs7769704 6 q q22.31 PKIB 122998592 8.72E-03 0.92 0.321 0.340 G (SEQ ID NO: 0590)
    ctgtgctgcttaccat[A/G]tatggatgaggggttg
    02 rs7774820 6 q q22.31 TRDN 123955723 2.22E-05 1.16 0.051 0.045 G (SEQ ID NO: 0591)
    aaaagactggaggaag[A/G]caattgtagctagggc
    03 rs3757169 6 q q23.3 MAP3K5|PEX7 137142946 1.24E-03 1.11 0.434 0.409 G (SEQ ID NO: 0592)
    ggtatatggttaagat[A/G]atcatacgacttggtt
    03 rs899894 6 q q23.3 PDE7B 136392020 1.13E-03 1.11 0.409 0.385 G (SEQ ID NO: 0593)
    tcaattgttcatttgg[A/G]caagagtttgggtttg
    03 rs1013020 6 q q23.3 PDE7B 136394895 1.00E-03 1.11 0.412 0.387 A (SEQ ID NO: 0594)
    tccagatttttactat[A/G]tgtggctgtaaaaatg
    03 rs844562 6 q q24.3 SAMD5| 147908995 9.13E-05 1.11 0.438 0.413 A (SEQ ID NO: 0595)
    SASH1 taaacttagacatgaa[A/G]tagagaaaggaggtta
    03 rs2294806 6 q q24.3 SAMD5| 148183190 1.94E-04 1.13 0.381 0.353 G (SEQ ID NO: 0596)
    SASH1 ataaaggaaggtaaaa[A/G]ctcagaaggccaaagg
    03 rs6924763 6 q q24.3 STXBP5 147685480 3.09E-03 1.13 0.173 0.156 A (SEQ ID NO: 0597)
    catgattaaaagtatc[A/G]tcttcagacatctgct
    03 rs12201953 6 q q25.1 UST| 149546620 4.05E-03 1.30 0.032 0.025 A (SEQ ID NO: 0598)
    MAP3K7IP2 gcctggtattccatgg[A/G]tcatgtcaaaaaacct
    03 rs1544041 6 q q25.3 ARID1B 157408118 1.80E-04 0.86 0.169 0.193 G (SEQ ID NO: 0599)
    acactttaaataacgt[A/G]tccaagaaagtggaaa
    02 rs240863 6 q q25.3 FNDC1|SOD2 159915825 1.87E-05 1.21 0.149 0.127 A (SEQ ID NO: 0600)
    tggtcattcgaccttc[A/G]ccccataaatagtggt
    03 rs2201886 6 q q25.3 NOX3|ARID1B 155999177 1.87E-04 0.89 0.378 0.407 A (SEQ ID NO: 0601)
    ggccaatctaacacaa[A/G]catgactagtgggttc
    03 rs7739122 6 q q25.3 NOX3|ARID1B 155998741 7.46E-05 1.10 0.319 0.298 G (SEQ ID NO: 0602)
    tatggtctgctgagtc[A/G]ataatctatgttttta
    03 rs6913088 6 q q25.3 NOX3|ARID1B 155970936 3.43E-03 1.10 0.512 0.488 G (SEQ ID NO: 0603)
    ctgtgtataattcaaa[A/G]catctccttttttgtt
    02 rs9397831 6 q q25.3 NOX3|ARID1B 155994436 3.48E-06 1.12 0.419 0.393 G (SEQ ID NO: 0604)
    aacaatcacaattttc[A/G]ttgatttatctcccca
    03 rs16892910 6 q q26 PARK2 162096342 1.20E-02 1.11 0.169 0.155 A (SEQ ID NO: 0605)
    gataccttatgtgacc[A/G]tagttagtcggtgatc
    02 rs4710698 6 q q27 C6orf208| 170439874 2.24E-05 1.12 0.414 0.386 A (SEQ ID NO: 0606)
    LOC154449 ttaaatatctaaatgt[A/G]taaaacagacctgatc
    02 rs4710879 6 q q27 C6orf208| 170426027 4.60E-05 1.12 0.415 0.389 G (SEQ ID NO: 0607)
    LOC154449 cgacaaggctgggatc[A/G]gtgctctccttccagc
    03 rs4710811 6 q q27 C6orf208| 170369459 1.02E-04 1.17 0.182 0.160 A (SEQ ID NO: 0608)
    LOC154449 caattcattctgtgcc[A/G]actcacccctggggtc
    03 rs698626 7 p p11.2 LOC389493| 56282855 1.27E-02 0.92 0.454 0.474 A (SEQ ID NO: 0609)
    LOC441228 gtctagcaatccttgt[A/G]tatgctttaatcacag
    03 rs9690458 7 p p12.1 DKFZp564N2472| 53360479 1.32E-03 1.20 0.082 0.070 G (SEQ ID NO: 0610)
    FLJ45974 caggtttagtttgaga[A/G]ccagcaaactgaaaag
    02 rs4326334 7 p p12.1 LOC100131871| 52996013 1.19E-05 0.87 0.411 0.445 G (SEQ ID NO: 0611)
    DKFZp564N2472 ggaagtcaattaaaaa[A/G]tctaaatataaatttg
    02 rs1358603 7 p p12.1 LOC100131871| 52757480 5.71E-05 1.14 0.501 0.469 A (SEQ ID NO: 0612)
    DKFZp564N2472 gaatttaaaaatatca[A/G]tacaagaaagtcatta
    03 rs6967460 7 p p12.1 LOC100131871| 52950472 3.33E-04 1.25 0.068 0.055 G (SEQ ID NO: 0613)
    DKFZp564N2472 ttagcatgagccacag[A/G]aaaggtttttgagcca
    01 exm2264261 7 p p12.3 TNS3|C7orf65 47641920 4.47E-11 Inf 0.011 0.001 C (SEQ ID NO: 0614)
    agtttctgtgttttaa[A/C]ggaatagcctgctgtg
    03 rs1434960 7 p p13 DDX56 44612992 3.58E-04 1.38 0.032 0.023 G (SEQ ID NO: 0615)
    gtccggccctgctacc[A/G]ccaacctttgcgtaat
    03 rs11535191 7 p p14.1 ELMO| 37747276 1.18E-03 0.87 0.171 0.191 G (SEQ ID NO: 0616)
    GPR141 aagtaaattgcccaag[A/G]tggcccagctagtaaa
    03 rs1364729 7 p p14.1 ELMO| 37618173 1.26E-03 0.87 0.163 0.182 G (SEQ ID NO: 0617)
    GPR141 tgtctgtctctaaatc[A/G]tgtgctgttaaaaaat
    03 rs3801216 7 p p14.1 GLI3 42233283 1.54E-04 1.13 0.403 0.374 A (SEQ ID NO: 0618)
    gctcctttttaactca[A/G]tattacctgtggtttt
    03 rs2392465 7 p p14.2 AOAH|ELMO1 36800555 4.78E-03 0.92 0.446 0.468 A (SEQ ID NO: 0619)
    tggggggtccatgtgg[A/G]aaagactgtgagtggc
    03 rs10488088 7 p p14.3 C7orf41 30182813 5.48E-04 0.85 0.117 0.135 G (SEQ ID NO: 0620)
    tgttttatctgtggac[A/G]ctacctcgtgagattg
    02 rs2270221 7 p p14.3 PDE1C 31904027 5.19E-07 1.20 0.302 0.266 A (SEQ ID NO: 0621)
    ttccttgcttcttttg[A/G]cccaacattttagcgc
    03 rs38523 7 p p15.1 JAZF1| 28039797 1.38E-02 0.92 0.350 0.368 G (SEQ ID NO: 0622)
    LOC100128081 ttctgaagtatctcta[A/G]aaagtgtctctataaa
    03 rs6949451 7 p p15.2 HOXA10 27215041 1.84E-04 1.12 0.493 0.464 A (SEQ ID NO: 0623)
    gactgccctagctgag[A/G]gtatgggagggagggg
    02 rs11773804 7 p p15.2 LOC100289444 27206688 1.84E-05 1.15 0.444 0.411 C (SEQ ID NO: 0624)
    tgattacccctgttct[A/C]ggagtcgctgctttct
    03 rs7795246 7 p p15.3 CDCA7L| 22047162 7.08E-03 1.09 0.489 0.468 A (SEQ ID NO: 0625)
    RAPGEFS gaattgactactgcaa[A/C]tgtgcatgattttatc
    03 rs2285942 7 p p15.3 DNAH11 21582917 6.99E-02 0.92 0.134 0.144 A (SEQ ID NO: 0626)
    ccgaggttaggcgaag[A/G]gtcggggcttctctga
    03 rs12534005 7 p p15.3 IGF2BP3 23502518 6.44E-04 0.85 0.122 0.141 G (SEQ ID NO: 0627)
    gatggcaagcatacat[A/G]gttttgagtgttccat
    02 rs11772760 7 p p15.3 RAPGEF5 22246644 1.88E-05 1.15 0.357 0.326 G (SEQ ID NO: 0628)
    gtagttgaatatttgc[A/G]acttatatcaacctat
    02 rs6461639 7 p p15.3 RAPGEFS 22186955 2.47E-05 1.12 0.382 0.356 A (SEQ ID NO: 0629)
    tgatttcggggctttc[A/G]ctttcattatgctgtc
    03 rs2723512 7 p p21.1 AHR|SNX13 17815402 7.51E-05 1.19 0.133 0.114 A (SEQ ID NO: 0630)
    tgagtcaacatgaagt[A/G]agggaaatgaaaaggg
    03 rs697521 7 p p21.1 BZW2| 16764156 7.81E-04 1.18 0.116 0.100 A (SEQ ID NO: 0631)
    TSPAN13 ctactgcttacttctg[A/C]ctccatgtagaataaa
    03 rs17437739 7 p p21.1 FERD3L| 19437424 1.41E-03 1.11 0.457 0.432 A (SEQ ID NO: 0632)
    WISTNB aaaggagcattcacac[A/C]gottctcttgtcatga
    03 rs4286843 7 p p21.1 FERD3L| 19463247 9.35E-03 1.09 0.484 0.464 A (SEQ ID NO: 0633)
    TWISTNB ggcagaacttttattg[A/G]ctaggagtttcttttt
    03 rs9648255 7 p p21.1 FERD3L| 19450683 1.38E-02 0.93 0.465 0.484 G (SEQ ID NO: 0634)
    TWISTNB gtgagcacatgcctct[A/G]taagtgattttaaaat
    03 rs6461452 7 p p21.1 FERD3L| 19691229 7.69E-05 1.11 0.316 0.294 A (SEQ ID NO: 0635)
    TWISTNB aagagccagggttgac[A/G]gctctcagagagaaga
    03 rs17140423 7 p p21.1 HDAC9 19007884 2.44E-04 1.13 0.314 0.288 G (SEQ ID NO: 0636)
    gaatgtttgaacatct[A/G]tagtaatattgaacca
    03 rs6955426 7 p p21.2 DGKB 14310702 1.05E-02 1.12 0.138 0.124 A (SEQ ID NO: 0637)
    ttctacagaaatacaa[A/G]ctgtcttatgagtaaa
    03 rs17614094 7 p p21.3 PHF14| 11328154 2.72E-04 1.19 0.133 0.115 A (SEQ ID NO: 0638)
    THSD7A agaagtaaaacagttc[A/G]tataaaagtgaatttt
    03 rs10261632 7 p p21.3 PHF14| 11383722 1.79E-04 1.13 0.402 0.373 A (SEQ ID NO: 0639)
    THSD7A gaaaggaggaatttct[A/G]tttcaagcgacaccgt
    02 rs2895215 7 p p22.3 ELFN1| 1837636 2.11E-05 1.16 0.251 0.224 A (SEQ ID NO: 0640)
    MAD1L1 ttagtatattgtatcc[A/G]gtgaatttcgctaaat
    03 rs160646 7 q q11.21 ASL 65556280 1.98E-04 1.19 0.126 0.107 A (SEQ ID NO: 0641)
    ctgggattacaagcat[A/G]agccaccaggcctagc
    03 rs419603 7 q q11.21 CRCP 65597341 2.04E-04 1.19 0.126 0.108 A (SEQ ID NO: 0642)
    actttggaagtgtcaa[A/G]gtcatggaagacaaag
    03 rs2243480 7 q q11.21 CRCP 65599196 2.24E-04 1.19 0.126 0.108 A (SEQ ID NO: 0643)
    tttaattacagtcatt[A/G]cctttgttttttctca
    02 rs1039664 7 q q11.21 GUSB|ASL 65449716 7.60E-05 1.21 0.124 0.104 C (SEQ ID NO: 0644)
    atgaaaataaaaaaac[A/C]atgtaaacatttggga
    03 rs1267818 7 q q11.21 KCTD7 66107024 3.02E-04 1.19 0.125 0.108 A (SEQ ID NO: 0645)
    tgataactactggccc[A/G]tctcaaggcaagatga
    03 rs1267817 7 q q11.21 KCTD7| 66110040 3.00E-04 1.19 0.125 0.108 A (SEQ ID NO: 0646)
    LOC100289135 tgagtcccaagccagg[A/C]acatggcatcccctga
    02 rs6460260 7 q q11.21 LOC100131973 65215455 4.87E-05 1.22 0.124 0.104 A (SEQ ID NO: 0647)
    atgctgctgaggccct[A/G]ggcttctatggtagat
    03 rs2178742 7 q q11.21 LOC100289135| 66197799 1.84E-04 1.20 0.126 0.107 A (SEQ ID NO: 0648)
    RABGEF1 tctcgcttttgctctc[A/G]ctctcactctgtagcc
    03 rs35315599 7 q q11.21 RABGEF1 66254767 1.56E-04 1.20 0.126 0.108 A (SEQ ID NO: 0649)
    atttaagtttcccctc[A/G]cctatcactatgtgct
    02 rs35391607 7 q q11.21 VKORC1L1 65360829 7.76E-05 1.21 0.124 0.105 A (SEQ ID NO: 0650)
    tagtaaatggtattgg[A/G]tgaactgagtagccat
    02 rs6949812 7 q q11.21 VKORC1L1 65387101 8.77E-05 1.21 0.124 0.105 A (SEQ ID NO: 0651)
    ttcatttaccaatcac[A/G]taccttttttgtcatt
    03 rs11983901 7 q q11.22 STAG3L4| 68571255 6.12E-03 0.82 0.050 0.060 C (SEQ ID NO: 0652)
    AUTS2 tattggttcagccctg[A/C]aacacaggccatcttg
    03 rs5745774 7 q q21.11 LOC100128317| 81330627 2.04E-02 1.17 0.057 0.049 A (SEQ ID NO: 0653)
    HGF ggaaagaaactagttt[A/G]tctcaactctgtattc
    03 rs17166931 7 q q21.13 C7orf621 88760129 1.81E-04 1.41 0.032 0.023 A (SEQ ID NO: 0654)
    ZNF804B gatcttctctaccttg[A/G]tataaaaatcacctca
    03 rs10255948 7 q q21.13 ZNF804B| 89536358 2.57E-03 1.10 0.449 0.425 A (SEQ ID NO: 0655)
    DPY19L2P4 ttggttaatttgaact[A/C]ttccctctgatatatt
    03 rs4466326 7 q q21.13 ZNF804B| 89645073 3.30E-04 0.89 0.373 0.401 A (SEQ ID NO: 0656)
    DPY19L2P4 ataccaggccatactt[A/G]gccatcaaaagtttga
    03 rs2214213 7 q q21.3 CALCR 93078060 3.44E-03 1.10 0.445 0.423 A (SEQ ID NO: 0657)
    tgctaatctgttcctt[A/G]taaattttcacacaaa
    03 rs2240293 7 q q21.3 LOC402679 96622720 1.19E-03 0.90 0.460 0.485 G (SEQ ID NO: 0658)
    gcggccggccgccaat[A/G]gaatcttgctcctact
    03 rs10282336 7 q q21.3 OCM2|LMTK2 97731700 2.78E-04 1.26 0.065 0.052 A (SEQ ID NO: 0659)
    tattttcaacaaacag[A/G]ataggactattttcac
    03 rs12532957 7 q q21.3 SLC25A13 95805504 1.14E-03 1.26 0.051 0.041 A (SEQ ID NO: 0660)
    agagagtctaggtgag[A/G]cacttcatcacaacca
    03 rs4727590 7 q q22.2 ORC5L| 103879276 1.50E-03 1.15 0.144 0.128 G (SEQ ID NO: 0661)
    LHFPL3 tctctctcaaaatcat[A/G]cacttctttccactac
    03 rs212438 7 q q22.3 ATXN7L1| 105528339 2.50E-03 1.13 0.204 0.185 G (SEQ ID NO: 0662)
    FLJ23834 atctgatgtgcaggta[A/G]gaaatgtcacaggagg
    02 rs2111201 7 q q31.1 NRCAM 107965942 2.99E-05 1.13 0.316 0.291 A (SEQ ID NO: 0663)
    tgagggggaaagcaac[A/G]tagatactgggaacaa
    03 rs4142284 7 q q31.1 NRCAM 107940173 5.92E-05 1.12 0.315 0.290 A (SEQ ID NO: 0664)
    ttctggtcaatgtgct[A/G]tatgtacatgacaaat
    03 rs2267887 7 q q31.1 NRCAM 107968803 3.06E-04 1.12 0.423 0.395 G (SEQ ID NO: 0665)
    tctctggactgtggaggaacaaaaacca[A/G]ccag
    02 rs10215206 7 q q31.1 PNPLA8 108117088 2.07E-05 1.18 0.205 0.179 A (SEQ ID NO: 0666)
    caatttcatttccttc[A/G]gacatatacccggagt
    03 rs10249427 7 q q31.1 PNPLA8 108116481 3.62E-04 1.15 0.200 0.178 G (SEQ ID NO: 0667)
    taagaaaaggaatgag[A/G]aaacttgattggtgta
    03 rs40851 7 q q31.1 PNPLA8 108145121 1.08E-03 0.90 0.385 0.410 A (SEQ ID NO: 0668)
    ccatgccaacaacatt[A/G]agaagaacaaggttgg
    03 rs3823855 7 q q31.32 CADPS2 122057923 7.65E-04 1.12 0.318 0.294 A (SEQ ID NO: 0669)
    ttagagaagaaatact[A/G]tatgacacagatgagg
    03 rs1582258 7 q q31.33 GRM8 126122354 1.22E-02 0.92 0.352 0.371 G (SEQ ID NO: 0670)
    gcaattccacttctgg[A/G]tatatgccacaaagta
    02 exm657854 7 q q32.2 CPA1 130023245 1.18E-11 47.29 0.005 0.000 A (SEQ ID NO: 0671)
    cagttcagcacggggg[A/G]cagtaagcgtccagcc
    02 rs13234407 7 q q32.3 KLF14 130438214 4.72E-05 0.89 0.461 0.491 A (SEQ ID NO: 0672)
    FLJ43663 gaatctgttactctgg[A/G]acacagatgcagggtt
    03 rs7795357 7 q q32.3 KLF14 130458874 2.68E-03 1.22 0.058 0.048 G (SEQ ID NO: 0673)
    FLJ43663 cccagcagcttacacc[A/G]cacctccctgttacat
    02 rs157950 7 q q32.3 LOC100506860 130601205 9.29E-03 1.26 0.075 0.060 G (SEQ ID NO: 0674)
    aatgaagattcaggac[A/G]acgaagcagtggtaac
    03 rs13228664 7 q q32.3 MKLN1 131132340 4.56E-03 0.91 0.442 0.464 G (SEQ ID NO: 0675)
    gtaatactccttctac[A/G]atcctaagatgggtct
    03 rs4725613 7 q q34 CLCN1 143025985 1.63E-03 1.10 0.474 0.450 G (SEQ ID NO: 0676)
    gaatgtctattctctg[A/G]atgagcaggggaggag
    03 rs6973542 7 q q35 CNTNAP2 147029028 3.45E-03 0.91 0.399 0.422 G (SEQ ID NO: 0677)
    atggtcagctggcttt[A/G]ctgttcacaacatgtt
    02 exm2262270 7 q q36.1 FABP5P3 152211627 4.47E-11 Inf 0.010 0.002 A (SEQ ID NO: 0678)
    XRCC2 tttccagtcttatttc[A/C]ggggctggcggtggta
    02 exm674318 7 q q36.1 MLL3 151882672 4.52E-15 3.24 0.026 0.008 A (SEQ ID NO: 0679)
    ctttcttgtgagcttg[A/C]ttttctccacaatttg
    03 rs4609156 8 p p12 LOC642513 31133658 2.74E-03 1.10 0.478 0.454 G (SEQ ID NO: 0680)
    NRG1 tcctgaaaaggtctca[A/G]ttctcatcagccagcg
    03 rs16879927 8 p p12 NRG1 32612705 4.22E-04 0.82 0.088 0.105 G (SEQ ID NO: 0681)
    accaaacttcaagacc[A/G]aacatagggaacccaa
    03 rs17671468 8 p p12 NRG1 32633362 7.92E-04 0.83 0.089 0.105 A (SEQ ID NO: 0682)
    FUT10 ctatttgcaagggaga[A/G]gaagggcacctaatat
    03 rs4732639 8 p p21.2 DPYSL2 26605110 8.05E-04 1.12 0.305 0.282 G (SEQ ID NO: 0683)
    ADRA1A gaagagcaccacttag[A/G]cacttcagagacccat
    03 rs7826422 8 p p21.2 DPYSL2 26602648 2.88E-04 1.25 0.073 0.059 A (SEQ ID NO: 0684)
    ADRA1A tgaaccaggaaactga[A/G]ggctcttgtggtccag
    03 rs10503799 8 p p21.2 DPYSL2 26605624 2.69E-04 1.25 0.073 0.059 A (SEQ ID NO: 0685)
    ADRA1A ctaccccttcaacagc[A/G]atttactacttgatcc
    03 rs7013854 8 p p21.2 EBF2 25733066 1.20E-04 1.17 0.185 0.163 G (SEQ ID NO: 0686)
    cttgaattattagaa[A/G]tcatagaaattatcct
    03 rs9203006 8 p p21.2 NKX3-1 23554565 2.33E-03 1.11 0.266 0.246 G (SEQ ID NO: 0687)
    NKX2-6 ggctccctgtcctttc[A/G]cccctcggttccttcc
    03 rs12543268 8 p p21.2 NKX3-1 23556615 6.68E-05 0.90 0.358 0.383 A (SEQ ID NO: 0688)
    NKX2-6 gagagattacggagac[A/G]gaagacaggcagctgg
    03 rs977262 8 p p21.3 LOC100128993 19081781 7.08E-04 1.12 0.301 0.277 G (SEQ ID NO: 0689)
    SH2D4A atgaaagatgagggga[A/G]agagagatgtgcaaaa
    03 rs7012411 8 p p22 TUSC3 15788332 1.41E-03 0.90 0.470 0.496 A (SEQ ID NO: 0690)
    MSR1 tgcaattcatccacac[A/C]ctgaaagatcctgtta
    03 rs2980418 8 p p23.1 FLJ1066| 8114228 3.75E-02 1.09 0.194 0.181 G (SEQ ID NO: 0691)
    PRAGMIN tgcacctttgttaaaa[A/G]acaaatgactgtatgt
    03 rs7014329 8 p p23.1 LOC340357 12626394 5.44E-02 0.94 0.478 0.493 A (SEQ ID NO: 0692)
    catgctgcccttttct[A/G]ctgtctcaaacttgat
    03 rs7011215 8 p p23.1 MSRA 10312694 5.53E-05 1.13 0.359 0.332 G (SEQ ID NO: 0693)
    LOC346702 cctgaacattataaac[A/G]agacaagtataaacag
    03 rs7816211 8 p p23.2 CSMD1 3980317 7.75E-03 1.10 0.235 0.218 G (SEQ ID NO: 0694)
    tcactgtcttccatca[A/G]aaaaacaaatgattta
    03 rs2617009 8 p p23.2 CSMD1 4496463 2.32E-02 0.92 0.202 0.217 A (SEQ ID NO: 0695)
    agggttctattctttc[A/G]aactactccagcagtc
    03 rs4523281 8 p p23.2 CSMD1 3496633 1.28E-04 1.33 0.049 0.038 A (SEQ ID NO: 0696)
    aatcttttgctagaat[A/G]aagtcctttgcatttt
    02 exm678864 8 p p23.2 CSMD1 3216809 1.26E-07 Inf 0.003 0.000 G (SEQ ID NO: 0697)
    tgccttcagccgaaga[A/G]ttggttttcactttgg
    03 rs2724974 8 p p23.2 CSMD1 4494520 4.03E-03 0.90 0.224 0.244 G (SEQ ID NO: 0698)
    gaatgcccttttttca[A/G]tcctccgtgtgattgg
    03 rs17071029 8 p p23.2 CSMD1 4536253 2.02E-03 1.14 0.166 0.148 A (SEQ ID NO: 0699)
    LOC100287015 ctgttgttaaacacat[A/G]tgctaatttcaaaata
    03 rs17073854 8 p p23.2 CSMD1 5377735 7.16E-03 1.16 0.095 0.083 A (SEQ ID NO: 0700)
    LOC100287015 aggaggtttgtctttg[A/G]ttcgcctgcaccttcc
    03 rs6990815 8 p p23.2 CSMD1 5713881 5.53E-03 1.27 0.036 0.029 A (SEQ ID NO: 0701)
    LOC100287015 gtggactagtgcctct[A/G]ttttctctaatgcttt
    03 rs17073881 8 p p23.2 CSMD1 5380363 6.09E-03 1.16 0.094 0.082 G (SEQ ID NO: 0702)
    LOC100287015 tttctcagaaacctct[A/G]aaagccatcttctgct
    02 exm2173787 8 q q11.22 PXDNL 52233381 2.20E-09 Inf 0.003 0.000 G (SEQ ID NO: 0703)
    gtatctttcatccag[C/G]gctcctcggccttcct
    03 rs1812576 8 q q12.2 LOC100130298 62173034 3.45E-03 1.14 0.149 0.134 G (SEQ ID NO: 0704)
    RLBP1L1 tccctcttcttcatac[A/G]cagccactgaatagga
    03 rs1866694 8 q q12.2 LOC100130298 62172668 1.61E-03 1.13 0.209 0.189 A (SEQ ID NO: 0705)
    RLBP1L1 tccctccgtcatgtaa[A/C]gtaggatggcagttac
    03 rs17802118 8 q q12.3 LOC100287835 62694154 9.69E-03 1.10 0.265 0.247 A (SEQ ID NO: 0706)
    NKAIN3 catgagtccactggag[A/G]tgttttgtagacttac
    02 rs896486 8 q q12.3 NKAIN3 63415467 3.74E-05 1.14 0.283 0.258 A (SEQ ID NO: 0707)
    tacaggaccttggaaa[A/C]catgcttgaacttctt
    03 rs10217013 8 q q12.3 YTHDF3 64878574 2.00E-03 1.11 0.377 0.354 A (SEQ ID NO: 0708)
    LOC100130155 aaatgagtgaggacca[A/C]agctgttatgtttttt
    03 rs4268113 8 q q13.2 C8orf34 69509456 3.04E-04 0.89 0.399 0.427 G (SEQ ID NO: 0709)
    gcaggatacccccttg[A/G]aacaagcagcgaagat
    03 rs638853 8 q q13.2 C8orf34 70014344 5.33E-03 1.13 0.150 0.135 A (SEQ ID NO: 0710)
    LOC100129096 cacctgtgtgtatcca[A/G]cagcaagaagactgaa
    03 rs10957982 8 q q21.13 ZBTB10 81455763 1.45E-04 1.16 0.202 0.179 G (SEQ ID NO: 0711)
    ZNF704 ggtttagagtaattca[A/G]tttagctgtcatttaa
    02 exm710751 8 q q22.1 INTS8 95878387 2.72E-17 9.20 0.012 0.0001 C (SEQ ID NO: 0712)
    atttttgttttgtagg[A/C]gtgaactgtcatttaa
    03 rs16896060 8 q q22.1 MTDH 98667777 4.96E-04 1.46 0.022 0.015 A (SEQ ID NO: 0713)
    gtcctggtggtcaaaa[A/G]ggcctggacaggcatc
    03 rs2618137 8 q q22.1 RUNX1T1| 93567028 2.40E-03 0.78 0.039 0.050 C (SEQ ID NO:0714)
    C8orf83 aaaagacttcttcaaa[A/C]gaaactgtgaagtctc
    03 rs2704253 8 q q22.1 SDC2|PGCP 97651358 1.77E-04 1.18 0.148 0.128 G (SEQ ID NO: 0715)
    gaagaaagtttagtag[A/G]gctgaagtgtgcattt
    03 rs4735529 8 q q22.2 POP1 99139610 1.844E-03 0.91 0.459 0.483 G (SEQ ID NO: 0716)
    gtaggtagcacacaag[A/G]taatcatgtcaggatg
    03 rs17476650 8 q q23 .2 KCNV1| 11110361 1.92E-04 1.19 0.129 0.111 A (SEQ ID NO: 0717)
    CSMD3 taatagacaaatgttg[A/C]acaatagtcaaattct
    03 rs7010965 8 q q23.3 CSMD3|TRPS1 116299406 2.20E-02 1.14 0.084 0.075 A (SEQ ID NO: 0718)
    tgcacatcaatctctc[A/G]tattttgcatttaaac
    03 rs16887231 8 q q23.3 CSMD3|TRPS1 116253370 1.32E-02 1.15 0.084 0.074 G (SEQ ID NO: 0719)
    acctcaggaaaggatc[A/G]tggaacagggaggcct
    03 rs4871240 8 q q24.13 HAS2AS| 123297701 1.02E-02 0.92 0.445 0.465 G (SEQ ID NO: 0720)
    LOC100131552 caagtttgttgatta[A/G]tactaccttgagtctg
    02 rs13274301 8 q q24.21 PVT1 128988045 7.96E-05 0.82 0.103 0.123 C (SEQ ID NO: 0721)
    gtttcctagcttgaaa[A/C]acgaagagaagaaaag
    03 rs7826937 8 q q24.21 PVT11 129264171 1.01E-02 0.92 0.345 0.365 G (SEQ ID NO: 0722)
    LOC100287906 tgactcaccatcagga[A/G]ggatctgctgcactgg
    03 rs491614 8 q q24.22 ADCY8|EFR3A 132719817 1.19E-03 1.11 0.463 0.438 G (SEQ ID NO: 0723)
    tactgaaaaagagaat[A/G]aacaacataacagtca
    03 rs581534 8 q q24.22 ADCY8|EFR3A 132711614 1.67E-02 1.15 0.085 0.075 G (SEQ ID NO: 0724)
    cttacttacctagagg[A/G]catatgtctgctactg
    02 rs6999964 8 q q24.22 ADCY8|EFR3A 132862920 1.68E-05 1.14 0.216 0.195 A (SEQ ID NO: 0725)
    tataattaaggttaat[A/G]gtgagattgttggct
    02 rs4433159 8 q q24.22 ASAP1|ADCY8 131571963 1.28E-03 1.17 0.320 0.287 G (SEQ ID NO: 0726)
    ttgacttatctatgga[G/A]tttttgactatttctg
    03 rs16904553 8 q q24.22 EFR3A 132947786 2.70E-03 1.12 0.212 0.194 A (SEQ ID NO: 0727)
    taacataatagaaatt[A/G]actgacatatgtatgg
    03 rs6985794 8 q q24.22 LOC100129104| 134689013 9.73E-02 1.08 0.129 0.121 G (SEQ ID NO: 0728)
    ZFAT atccatagaaacagac[A/G]ttaattaaataacaca
    03 rs12548244 8 q q24.23 KHDRBS3| 137112133 7.19E-04 0.90 0.368 0.395 G (SEQ ID NO: 0729)
    FLJ45872 tttcatatcagaggca[A/G]cctctcaaccagatgt
    03 rs2317547 8 q q24.23 KHDRBS3| 136933622 3.97E-03 1.10 0.337 0.316 C (SEQ ID NO: 0730)
    FLJ45872 tggccagaaagagaga[A/C]agagagacagagacag
    03 rs10505647 8 q q24.23 KHDRBS3| 137056293 1.23E-03 0.90 0.311 0.334 A (SEQ ID NO: 0731)
    FLJ45872 aaataggacccttgac[A/G]cacaaaggaattttgg
    02  exm728471 8 q q24.3 EPPK1 144940658 3.25E-16 Inf 0.006 0.000 A (SEQ ID NO: 0732)
    tggaagggcgtgctgc[A/G]gcccggcacggccctg
    03 rs903965 8 q q24.3 F11438601| 142698496 1.18E-03 1.44 0.020 0.014 A (SEQ ID NO: 0733)
    NCRNA00051 acattggtacccttg[A/G]tacatttaatagtaaa
    03 rs3819495 8 q q24.3 GML 143923250 1.12E-02 1.16 0.085 0.075 A (SEQ ID NO: 0734)
    ccacctgtgcgccagg[A/G]catacactggctgcac
    02 rs10971957 9 p p13.3 DCAF12| 34151463 7.13E-03 1.13 0.415 0.386 C (SEQ ID NO: 0735)
    UBAP1 ctatcattatcgattc[C/T]acccagcaatttctct
    02 rs10972684 9 p p13.3 ORS2S|RECK| 36003635 5.21E-03 0.85 0.167 0.190 A (SEQ ID NO: 0736)
    atctgctatacaacat[C/A]ctcagtccccctcatc
    03 rs12726 9 p p13.3 UNC13B 35404840 4.45E-04 1.13 0.263 0.240 A (SEQ ID NO: 0737)
    gttgaaggatccagga[A/G]tattttcttcttgggt
    03 rs2383733 9 p p21.2 C9orf72| 27869510 7.13E-03 1.17 0.079 0.068 A (SEQ ID NO: 0738)
    LINGO2 tgtcactttcagtata[A/G]ataaaactctttagaa
    03 rs10811800 9 p p21.3 DMRTA1| 22906729 2.19E-03 1.10 0.420 0.396 A (SEQ ID NO: 0739)
    LOC402360 ctacattataaattat[A/G]cttgataccagacatc
    03 rs1381923 9 p p21.3 DMRTA1| 22909348 7.90E-03 0.92 0.448 0.469 C (SEQ ID NO: 0740)
    LOC402360 actgatatcattccct[A/C]cctgaaatatcccatg
    03 rs10116397 9 p p21.3 DMRTA1| 23570688 3.01E-04 1.25 0.071 0.057 G (SEQ ID NO: 0741)
    LOC402360 ggcaaggagagcacca[A/G]tttaggaaatgttaga
    03 rs2149913 9 p p21.3 ELAVL2| 24573717 6.46E-04 0.89 0.318 0.343 A (SEQ ID NO: 0742)
    TUSC1 gaataagaatactaac[A/G]tttatcccctgcattt
    03 rs2026590 9 p p21.3 ELAVL2| 24833789 4.21E-04 1.14 0.240 0.217 A (SEQ ID NO: 0743)
    TUSC1 caatgggatttggtaa[A/C]tattttcttatctttg
    03 rs11788362 9 p p21.3 ELAVL2| 24493958 1.79E-03 0.89 0.216 0.237 A (SEQ ID NO: 0744)
    TUSC1 aaaaaagtactaattc[A/G]gaaaagatataaaagt
    03 rs1051162 9 p p22.2 BNC2| 16764989 3.61E-02 0.90 0.110 0.120 A (SEQ ID NO: 0745)
    atcagagtatatgcca[A/C]agcgggtttcgtatcc
    02 rs1442514 9 p p22.2 CNTLN 17419319 3.13E-05 1.25 0.094 0.076 A (SEQ ID NO: 0746)
    tactaagcattattct[A/G]tagatggaatatataa
    03 rs2772695 9 p p22.2 SH3GL2| 17985166 4.54E-03 1.13 0.166 0.150 A (SEQ ID NO: 0747)
    ADAMTSL1 gagacttcactctgac[A/G]tctttctctttttgga
    03 rs10810211 9 p p22.3 ZDHHC2| 14676870 1.30E-02 1.23 0.037 0.030 G (SEQ ID NO: 0748)
    caagtgctctctcaac[A/G]tgttcaatattactaa
    02 rs12236892 9 p p24.1 C9orf123| 7834442 5.91E-05 1.30 0.063 0.050 G (SEQ ID NO: 0749)
    PTPRD gttctaaatatgtca[A/G]agtagatattaaagaa
    02 exm737779 9 p p24.1 ERMP1 5832719 4.28E-04 4.87 0.028 0.006 G (SEQ ID NO: 0750)
    gcggggccgctggaca[C/G]cgcggggagttcgacg
    02 rs10975519 9 p p24.1 IL33 6253571 6.06E-07 1.18 0.338 0.302 A (SEQ ID NO: 0751)
    ggtgttgagactcata[A/G]taactcagtaacacct
    01 rs1332290 9 p p24.1 IL33 6255881 6.96E-07 1.17 0.391 0.354 A (SEQ ID NO: 0752)
    tggaaactaaagggga[A/C]tacttatttatgactt
    02 rs10975516 9 p p24.1 IL33 6247693 2.31E-05 1.15 0.335 0.304 A (SEQ ID NO: 0753)
    ctttgaccccagtgga[A/G]tgctctctcctgcaaa
    01 rs1048274 9 p p24.1 IL33 6256292 3.99E-06 1.17 0.333 0.300 A (SEQ ID NO: 0754)
    ttagcatgtgtggaat[A/G]ttttccatattatgta
    01 rs1330383 9 p p24.1 IL33 6251507 4.64E-06 1.17 0.333 0.300 A (SEQ ID NO: 0755)
    accatgggattccaat[A/C]cattgcaagtatttca
    02 rs10815398 9 p p24.1 IL33| 6272766 6.98E-06 1.16 0.393 0.359 C (SEQ ID NO: 0756)
    LOC645969 gcagtctctcccttga[A/C]acatccttccccttcc
    02 rs10815402 9 p p24.1 LOC645969| 6293715 5.40E-06 1.17 0.305 0.273 A (SEQ ID NO: 0757)
    TPD52L3 tccagacacaagtcac[A/G]agttcaggggttcaca
    03 rs10975539 9 p p24.1 LOC645969| 6308729 9.21E-04 0.88 0.213 0.235 A (SEQ ID NO: 0758)
    TPD52L3 cccccaataacaggaa[A/G]gagattcctttgttcc
    03 rs12551256 9 p p24.1 RANBP6|IL33 6231239 1.64E-04 1.13 0.491 0.462 G (SEQ ID NO: 0759)
    cttcttggcttctca[A/G]tgcactctgaatgaaa
    02 rs1052335 9 p p24.1 TPD52L3 6330380 2.74E-05 1.19 0.220 0.192 C (SEQ ID NO: 0760)
    cactgcctgagataga[A/C]gtttgcatcttattgg
    03 rs4741806 9 p p24.2 KIAA0020| 3099009 1.23E-03 0.82 0.074 0.088 C (SEQ ID NO: 0761)
    RFX3 tttttcttattgattc[A/C]taggagttctttacat
    02 rs7021672 9 p p24.2 KIAA0020| 3097453 9.19E-05 0.86 0.205 0.231 A (SEQ ID NO: 0762)
    RFX3 tttattgatagtttac[A/G]ctgctggaaatataat
    03 rs2986687 9 p p24.2 RFX3 3301887 5.31E-05 1.19 0.124 0.106 A (SEQ ID NO: 0763)
    agacctgaagagcagg[A/G]accctggtggattttt
    03 rs3012708 9 p p24.2 RFX3 3322283 1.71E-03 1.14 0.184 0.165 G (SEQ ID NO: 0764)
    tcaagtttccttttgt[A/G]tccctggcgaacttta
    03 rs7868484 9 p p24.3 SMARCA2 2141357 7.19E-05 1.14 0.300 0.273 A (SEQ ID NO: 0765)
    tatggtttttggattt[A/C]gcatttagttaatgac
    02 rs10746874 9 q q21.12 TRPM3 73170382 3.23E-05 0.89 0.416 0.446 G (SEQ ID NO: 0766)
    tcctgtacaggtgcat[A/G]tggatgtgctatgtgt
    03 rs10746850 9 q q21.12 TRPM3 73183281 7.86E-05 0.90 0.443 0.469 G (SEQ ID NO: 0767)
    aaattctatgccaagc[A/G]ctttcatatacaatat
    02 rs3739776 9 q q21.12 TRPM3 73151970 1.35E-05 0.88 0.414 0.445 G (SEQ ID NO: 0768)
    gccattctttctattc[A/G]gtcaatatgaaagaca
    02 rs6560143 9 q q21.12 TRPM3 73168680 4.19E-05 0.89 0.415 0.444 G (SEQ ID NO: 0769)
    cctgttgttaattccc[A/G]atcaatagtcccgaga
    03 rs10119759 9 q q21.31 PSAT1|TLE4 82018583 6.22E-02 0.94 0.305 0.319 C (SEQ ID NO: 0770)
    gctccagggctgggac[A/C]ctttctgagcctcctc
    03 rs9314677 9 q q21.31 PSAT1|TLE4 82018917 3.29E-03 1.10 0.347 0.325 G (SEQ ID NO: 0771)
    gatgtaggtaaccatc[A/G]ttatgggaccccagag
    03 rs2378380 9 q q21.31 PSAT1|TLE4 82032456 3.22E-02 0.93 0.300 0.316 A (SEQ ID NO: 0772)
    gcaacaggggtactag[A/G]gcatcatgaaattcac
    03 rs3897745 9 q q21.32 TLE1 84215944 1.22E-03 0.88 0.182 0.202 A (SEQ ID NO: 0773)
    ctacacagtcgtgtga[A/G]ccaatccctccaaata
    03 rs9410282 9 q q22.1 LOC286238| 91318984 3.33E-04 0.89 0.418 0.446 A (SEQ ID NO: 0774)
    C9orf47 aggctctgtgatgggc[A/G]caggaacacactgagg
    03 rs944485 9 q q22.1 SHC3 91679818 4.83E-04 1.17 0.411 0.374 T (SEQ ID NO: 0775)
    ttgtgccgttattaat[T/G]ccatttgttatttcat
    02 exm764237 9 q q22.32 C9orf102 98684662 4.73E-08 18.90 0.004 0.000 A (SEQ ID NO: 0776)
    gcttgcagtagcgcga[A/C]atggttagctaccttc
    02 exm768001 9 q q31.1 GRIN3A 104335619 4.40E-10 3.17 0.017 0.005 G (SEQ ID NO: 0777)
    gccttgcggaccacca[A/G]tgggaaagcagactcc
    03 rs698459 9 q q31.1 LOC347281| 107234158 1.22E-03 0.89 0.282 0.306 C (SEQ ID NO: 0778)
    OR13F1 cttgatgtgtcaggac[A/C]attttgttgctgtagg
    03 rs2808374 9 q q31.2 LOC100128086| 109987079 4.12E-03 1.11 0.280 0.260 G (SEQ ID NO: 0779)
    RAD23B ctcgctactgatggac[A/G]ttcacatttaaatttt
    03 rs7864733 9 q q31.2 LOC644620 109427261 9.34E-03 0.92 0.474 0.494 C (SEQ ID NO: 0780)
    actgaaatatagccag[A/C]aataaataatcatgct
    03 rs16934033 9 q q33.1 ASTN2 119657927 2.09E-04 1.55 0.019 0.012 A (SEQ ID NO: 0781)
    ctcctatattcaacag[A/G]acagcaaatgaagact
    03 rs1990422 9 q q33.1 DBC1| 122244046 5.73E-05 1.15 0.240 0.216 G (SEQ ID NO: 0782)
    CDK5RAP2 atgaaaatataaaatc[A/G]attgtggtgatggttt
    02 rs10513376 9 q q33.2 DAB2IP 124354826 3.47E-04 0.84 0.294 0.331 C (SEQ ID NO: 0783)
    agctcagaaaatctca[T/C]tggaacccttgaagta
    02 rs10985200 9 q q33.2 GSN 124043867 5.48E-05 1.14 0.497 0.465 A (SEQ ID NO: 0784)
    cggggtttaagaggac[A/G]acaggtgtctgtattg
    03 rs3810942 9 q q33.2 GSN/ 124044995 1.76E-04 1.13 0.490 0.461 A (SEQ ID NO: 0785)
    LOC100128064 atcagagccaagaccc[A/G]gccctcaagtcctcct
    03 rs10156486 9 q q33.2 LOC729012| 125538981 5.27E-03 0.65 0.010 0.016 C (SEQ ID NO: 0786)
    OR5C1 tgtggaaggggaggtc[A/C]gtcagccagcattaag
    02 rs4556152 9 q q33.2 RAB14|GSN 124016909 6.03E-05 1.14 0.503 0.471 A (SEQ ID NO: 0787)
    gatttttctctcctct[A/G]aaagagcaattttctc
    03 rs10760160 9 q q33.2 RAB14|GSN 124003326 3.42E-04 1.12 0.490 0.462 C (SEQ ID NO: 0788)
    acaggaaacttcaacc[A/C]agtatcaagttactaa
    03 rs10760159 9 q q33.2 RAB14|GSN 123998342 2.45E-04 1.12 0.489 0.460 A (SEQ ID NO: 0789)
    cctcttcagagggaat[A/G]tggtcctgtggacacc
    02 rs2239696 9 q q33.2 RAB14|GSN 124029155 2.82E-05 1.14 0.502 0.469 G (SEQ ID NO: 0790)
    ggacccagggaatctc[A/G]ccctggctcttcctcc
    01 rs34250136 9 q q33.3 DENND1A| 126772954 3.07E-06 1.71 0.020 0.012 A (SEQ ID NO: 0791)
    LHX2 cactgatatcgaatgt[A/G]tcttggagtgagaaag
    03 rs10217721 9 q q33.3 PBX3| 128810846 2.46E-02 1.07 0.455 0.437 G (SEQ ID NO: 0792)
    FAM125B ggaattaacagccaca[A/G]tgcaagatcttgctg
    03 rs7861741 9 q q33.3 PBX3| 128810469 1.28E-02 1.08 0.459 0.440 G (SEQ ID NO: 0793)
    FAM125B ggatccatggcctggc[A/G]attccaggtctgggtt
    03 rs7023572 9 q q34.13 C9orf171 135414981 5.87E-05 1.05 0.356 0.344 G (SEQ ID NO: 0794)
    tgttctagggccaacc[A/G]ggggatcggaggagtc
    02 rs10508855 10 p p11.21 FZD8| 37070799 4.47E-06 1.30 0.050 0.039 A (SEQ ID NO: 0795)
    ANKRD30A gggcagagtacttatc[A/G]tatgtgcatactatat
    03 rs17615892 10 p p11.21 FZD8| 36635409 3.86E-03 0.89 0.172 0.190 G (SEQ ID NO: 0796)
    ANKRD30A ctcataacattttccc[A/G]ctagaaataatgtgtg
    03 rs17627587 10 p p11.21 FZD8| 36688414 1.64E-03 0.87 0.143 0.161 A (SEQ ID NO: 0797)
    ANKRD30A cttctattttgctgtt[A/G]ctgttttgcatttgag
    03 rs3124188 10 p p11.23 LOC645954 30955825 2.05E-03 0.89 0.232 0.253 G (SEQ ID NO: 0798)
    atccagtgggaaagtc[A/G]gttgcatcctatgttt
    03 rs17747622 10 p p12.1 ABIl 27044752 2.15E-04 0.77 0.050 0.065 A (SEQ ID NO: 0799)
    tatgtttgtggtcctt[A/G]taactgacttctgctt
    03 rs10826406 10 p p12.1 MPP7 28433708 4.41E-03 1.15 0.115 0.102 A (SEQ ID NO: 0800)
    tatggaaatgatatgg[A/G]atacataggaatggcg
    03 rs11006995 10 p p12.1 MPP7| 28585496 2.13E-02 1.16 0.069 0.060 A (SEQ ID NO: 0801)
    LOC100288110 aatacatagcagttgc[A/G]atatccattttgggta
    03 rs16927305 10 p p12.1 PDSS1 27023402 4.94E-03 1.16 0.096 0.083 A (SEQ ID NO: 0802)
    tgcttagcagggcact[A/G]ggaaatgcacttcagt
    03 rs4748738 10 p p12.31 NEBL 21219406 2.28E-03 1.11 0.350 0.328 A (SEQ ID NO: 0803)
    ttaatttgcattttca[A/G]aaagactaccttggct
    02 rs11012384 10 p p12.31 NEBL 21198380 4.04E-02 1.10 0.397 0.375 G (SEQ ID NO: 0804)
    tgcctctaagatattg[G/T]acacacaaatgaagca
    03 rs17464580 10 p p12.33 STAM 17750968 9.33E-04 0.79 0.051 0.064 C (SEQ ID NO: 0805)
    actaactccaaacaag[A/C]atcaacagtaaaatta
    01 rs11256106 10 p p14 GATA3| 9222228 1.98E-07 1.24 0.171 0.143 C (SEQ ID NO: 0806)
    SFTA1P tcacatatgatagatt[A/C]ggcaattgagttatat
    02 rs1001019 10 p p14 GATA3| 9243785 9.54E-06 1.19 0.198 0.171 A (SEQ ID NO: 0807)
    SFTA1P gctgtttaaatgttta[A/C]ttgatgatggaatgtg
    02 rs7911451 10 p p14 GATA3| 9248331 1.56E-05 1.18 0.206 0.180 A (SEQ ID NO: 0808)
    SFTA1P gtgtgtgtgaacaagc[A/G]caaagtccatatccag
    03 rs2387739 10 p p14 LOC439949| 6813564 1.55E-04 1.16 0.214 0.191 G (SEQ ID NO: 0809)
    SFMBT2 agtaatgccaactaca[A/G]attatgaaatatttca
    02 rs11257215 10 p p14 LOC439951| 11697403 3.79E-05 1.13 0.287 0.262 G (SEQ ID NO: 0810)
    ECHDC3 ggagtttccctatccc[A/G]ggctgcagtgcaatgg
    03 rs4881466 10 p p15.1 CALML5| 5542109 2.16E-04 1.14 0.289 0.263 A (SEQ ID NO: 0811)
    LOC100132159 atggggctcactgcct[A/G]taacttcaaggaagca
    03 rs10904508 10 p p15.1 NET1| 5503610 4.32E-04 0.89 0.298 0.324 A (SEQ ID NO: 0812)
    CALML5 ataagaaaatatccag[A/C]actgagtgtatgttta
    02 rs11253141 10 p p15.1 UCN3| 5422196 5.46E-05 0.88 0.361 0.392 C (SEQ ID NO: 0813)
    TUBAL3 tcaagtcatcagattg[A/C]atctccccacctgcca
    03 rs2279208 10 p p15.2 PFKP 3171043 1.52E-03 0.86 0.133 0.151 A (SEQ ID NO: 0814)
    cgcccaccactgtgcc[A/G]gaatgtgatgcacaca
    03 rs2388558 10 p p15.2 PITRM1 3180689 1.72E-03 0.89 0.240 0.262 A (SEQ ID NO: 0815)
    agagatcacaccccga[A/C]ctccagctcccacgtg
    03 rs4881111 10 p p15.2 PITRM1 3190265 4.38E-03 1.09 0.490 0.467 A (SEQ ID NO: 0816)
    gcacaccctgaaccaa[A/G]gaaaacacagaagaaa
    03 rs9423709 10 p p15.2 PITRM1 3202682 3.65E-03 0.89 0.211 0.230 A (SEQ ID NO: 0817)
    ggtccaaaaatatcac[A/G]gtacttcgagagacca
    03 rs7898695 10 p p15.2 PITRM1 3184507 3.61E-03 1.10 0.429 0.406 A (SEQ ID NO: 0818)
    cacctccccatctgtg[A/G]ccctctgtgacacacg
    03 rs4881109 10 p p15.2 PITRM1 3185237 1.42E-03 0.89 0.233 0.255 G (SEQ ID NO: 0819)
    acctaccatgtttatc[A/G]gaaatctcagcctaaa
    03 rs4881110 10 p p15.2 PITRM1 3185393 3.57E-03 0.90 0.244 0.264 G (SEQ ID NO: 0820)
    aatgactggctctaaa[A/G]ctgggtctctgttcac
    03 rs12763675 10 p p15.3 DIP2C|LARP5 744591 6.79E-04 0.89 0.335 0.360 A (SEQ ID NO: 0821)
    gcaatgtttaaaaaca[A/G]cattttgggctgggcg
    03 rs12572078 10 p p15.3 NCRNA00168| 1669110 5.49E-05 1.16 0.268 0.240 A (SEQ ID NO: 0822)
    ADARB2 ggtgggtgctgatgag[A/G]gaaggcaggagatgca
    03 rs1875005 10 p p15.3 NCRNA00168| 1661398 8.56E-04 0.90 0.450 0.476 A (SEQ ID NO: 0823)
    ADARB2 tttatctaatctgatg[A/G]tctctgctattttatt
    03 rs2802477 10 q q11.21 HNRNPA3P1| 44696034 1.83E-03 0.90 0.390 0.414 G (SEQ ID NO: 0824)
    LOC100130539 cctgccgcctagggag[A/G]ttgtgctctgcccctc
    02 rs11238956 10 q q11.21 HNRNPA3P1| 44749854 1.09E-05 0.87 0.316 0.348 G (SEQ ID NO: 0825)
    LOC100130539 ccactattctaca[A/G]tcagaatgcttggcaa
    03 rs268309 10 q q11.21 HNRNPA3P1| 44611148 3.62E-03 1.28 0.035 0.028 A (SEQ ID NO: 0826)
    LOC100130539 ctagaagccgaggaca[A/G]tgagatctcttcttct
    02 rs2503853 10 q q11.21 RASGEF1A| 43750260 2.57E-05 1.18 0.207 0.181 A (SEQ ID NO: 0827)
    FXYD4 ccctccctttagtcag[A/G]gattattctggggacc
    03 rs3844600 10 q q11.22 ARHGAP22 49683897 3.00E-02 1.09 0.224 0.211 A (SEQ ID NO: 0828)
    tgctaacagctctacc[A/G]tgatgacaaggccatt
    03 rs1345107 10 q q11.22 ARHGAP22 49794481 3.07E-04 1.15 0.204 0.182 A (SEQ ID NO: 0829)
    gggttactatggtgat[A/G]aggattaggataatgg
    03 rs1806437 10 q q11.22 ARHGAP22 49798463 4.29E-04 0.89 0.359 0.386 A (SEQ ID NO: 0830)
    tgcccccaccacaacc[A/G]aggacagtgtcttgcc
    03 rs1881740 10 q q11.22 FRMPD2| 49551560 1.12E-03 0.88 0.212 0.233 A (SEQ ID NO: 0831)
    MAPK8 ggacccagtatcttca[A/G]ggtagcatttttgaac
    03 rs7898026 10 q q11.22 FRMPD2| 49497934 5.13E-05 0.90 0.432 0.459 G (SEQ ID NO: 0832)
    MAPK8 ctgacagaaggactgc[A/G]gctgaatttcacattt
    02 exm8220865 10 q q11.22 GPRIN2 46999130 5.78E-20 79.75 0.008 0.000 A (SEQ ID NO: 0833)
    tggcctccagcactgg[A/G]tcgcgccttggggcca
    03 rs10509234 10 q q21.3 ANXA2P3| 67473973 7.69E-03 1.15 0.098 0.086 A (SEQ ID NO: 0834)
    CTNNA3 ttttttcaatgctgac[A/G]cagagtgatttaaaaa
    03 rs4370822 10 q q21.3 CTNNA3 68072084 6.73E-04 0.86 0.138 0.157 A (SEQ ID NO: 0835)
    ccttgggtagctatca[A/G]gtacatgcctaacttg
    02 exm8331707 10 q q22.1 SPOCK2 73822855 1.96E-13 17.37 0.007 0.000 A (SEQ ID NO: 0836)
    gtgtgaccagagcagc[A/G]gtgactgctggtgtgt
    02 exm829854 10 q q22.1 SUPV3L1 70940052 1.26E-07 Inf 0.003 0.000 A (SEQ ID NO: 0837)
    tagggcacgggagaag[A/G]acatcgaggccgcagg
    02 rs7081974 10 q q22.3 LOC100132987 80215612 8.53E-05 0.74 0.044 0.059 A (SEQ ID NO: 0838)
    ggcagctagggactga[A/G]gcagcgtagcataaca
    03 rs16935969 10 q q22.3 LOC100132987 80220796 1.55E-04 0.75 0.043 0.056 G (SEQ ID NO: 0839)
    gttcgactgcaggaaa[A/G]ccctacaggttgctgg
    02 rs12784427 10 q q22.3 LOC100132987 80207497 4.87E-05 0.74 0.045 0.060 C (SEQ ID NO: 0840)
    ctttcctggggatgct[A/C]attgaggttggaaaga
    03 rs4979997 10 q q22.3 LOC100132987| 80435887 1.49E-02 1.19 0.050 0.042 G (SEQ ID NO: 0841)
    LOC283050 ctggttttcctaatca[A/G]agaaagcttcaaagaa
    03 rs288444 10 q q22.3 LOC100132987| 80348121 1.30E-03 0.85 0.103 0.119 G (SEQ ID NO: 0842)
    LOC283050 tattagcagactcacc[A/G]caaaaggatatgccag
    03 rs288450 10 q q22.3 LOC100132987| 80356268 9.03E-03 0.87 0.102 0.115 A (SEQ ID NO: 0843)
    LOC283050 acagcacaagaggatg[A/G]tgagtgggtatatagt
    03 rs288447 10 q q22.3 LOC100132987| 80359650 1.12E-02 0.88 0.103 0.116 A (SEQ ID NO: 0844)
    LOC283050 gaagcccaggatgaaa[A/C]agggttgttcaatgtc
    03 rs288442 10 q q22.3 LOC100132987| 80348890 5.59E-03 0.87 0.100 0.114 G (SEQ ID NO: 0845)
    LOC283050 cacagacatgcaaatt[A/G]ggatgtggaaccactt
    02 rs1249122 10 q q22.3 RPS24| 79949403 1.28E-02 0.89 0.367 0.393 T (SEQ ID NO: 0846)
    LOC283050 gggaatagatgcagaa[C/T]tggcaaagaagcaaga
    03 rs703990 10 q q22.3 ZMIZ1 80930439 5.80E-04 1.14 0.224 0.202 A (SEQ ID NO: 0847)
    gcaggattcatgtgt[A/G]ttaactattaaggctc
    03 rs7906565 10 q q23.31 LOC119358| 91922383 8.31E-03 0.78 0.027 0.035 G (SEQ ID NO: 0848)
    HTR7 aacaaattccatatgt[A/G]attaggatgtacatgc
    02 rs6583759 10 q q23.32 NUDT9P1| 92976570 7.20E-05 1.27 0.074 0.059 C (SEQ ID NO: 0849)
    PCGF5 tccccctaccattcat[A/C]catcattgattttagg
    03 rs7894133 10 q q23.32 NUDT9P1| 92979176 8.65E-04 1.24 0.066 0.054 A (SEQ ID NO: 0850)
    PCGF5 ttgtggtatatataca[A/G]taatatcctccaatgc
    03 rs1057971 10 q q23.32 PCGF5 92987510 6.66E-04 1.24 0.067 0.054 A (SEQ ID NO: 0851)
    tggtaggggaggaagt[A/G]gtaggcagaaaccagt
    03 rs7074612 10 q q23.32 PCGF5 93041869 2.55E-03 1.22 0.064 0.053 G (SEQ ID NO: 0852)
    atataaatcccataga[A/G]tgaagtcttttctata
    03 rs7082510 10 q q23.32 PCGF5 93004825 9.19E-04 1.23 0.067 0.055 A (SEQ ID NO: 0853)
    ccttggtcctttactc[A/G]tgcctctctgtactca
    03 rs10882232 10 q q23.33 MYOF 95189263 1.29E-02 1.08 0.416 0.397 G (SEQ ID NO: 0854)
    aagatggtataagtca[A/G]tgatttttctgccttc
    02 rs2296580 10 q q24.32 ACTR1A 104241683 2.32E-05 0.88 0.265 0.292 A (SEQ ID NO: 0855)
    gcaccctgagaattga[A/C]ttgaagttctcctctt
    03 rs7075281 10 q q24.32 C10orf95| 104220301 1.16E-03 0.89 0.282 0.305 A (SEQ ID NO: 0856)
    TMEM180 acagcctacattgagc[A/C]aaacaaaacttgattt
    03 rs7475335 10 q q24.32 SUFU 104343428 1.27E-03 0.90 0.309 0.333 A (SEQ ID NO: 0857)
    tccagcctaaataaat[A/C]cccacccggtttgggg
    03 rs2236211 10 q q24.33 NEURL 105349816 3.89E-03 1.10 0.421 0.399 A (SEQ ID NO: 0858)
    ggggacacaagaggcc[A/G]gggagctctcttcccg
    03 rs7071247 10 q q24.33 NEURL 105257786 1.30E-04 1.19 0.151 0.130 A (SEQ ID NO: 0859)
    agatatacgctcaagc[A/C]cctccaagcctttact
    03 rs7918186 10 q q24.33 NEURL 105350447 2.46E-03 1.10 0.420 0.397 A (SEQ ID NO: 0860)
    ctagaaacctgcctca[A/G]atggggaaagattagg
    03 rs729952 10 q q24.33 NEURL| 105352990 6.35E-03 1.09 0.417 0.396 A (SEQ ID NO: 0861)
    SH3PXD2A caacactgtgcctaga[A/C]cttggggccagtctgg
    03 rs11191750 10 q q24.33 SH3PXD2A 105388286 2.73E-04 1.17 0.174 0.153 A (SEQ ID NO: 0862)
    ggtgcttgagccagta[A/G]ctcagaggtaacccct
    03 rs7918134 10 q q24.33 SH3PXD2A 105391300 1.29E-03 1.14 0.183 0.164 A (SEQ ID NO: 0863)
    gtgattgttaggggtg[A/G]catcagcaaggactgt
    02 rs11193561 10 q q25.1 SORCS1| 109374384 2.91E-05 1.16 0.269 0.240 A (SEQ ID NO: 0864)
    LOC100128304 gctgtaggcaaacagt[A/G]aatccaatttcctcca
    03 rs11195815 10 q 825.2 ADRA2A| 113859224 5.16E-03 1.30 0.029 0.022 A (SEQ ID NO: 0865)
    GPAM ctgtgctctaacactg[A/C]acattcatgtagcttt
    03 rs17129504 10 q 825.2 ADRA2A| 113855817 2.88E-03 1.37 0.023 0.017 C (SEQ ID NO: 0866)
    GPAM tccaggaattcagcac[A/C]ttccagccctggagac
    03 rs6584993 10 q q25.2 DUSP5|SMC3 112314670 3.83E-03 1.20 0.070 0.059 A (SEQ ID NO: 0867)
    agagaggaggggagag[A/G]taactgatacatgcta
    03 rs1541466 10 q q25.3 ATRNL1 117594744 3.71E-03 0.89 0.188 0.206 G (SEQ ID NO: 0868)
    cactgtccctgaatgc[A/G]aaataagggtgacctt
    03 rs2024179 10 q q25.3 ATRNL1 117591081 3.35E-03 0.89 0.188 0.207 G (SEQ ID NO: 0869)
    aagcaaaccaattgga[A/G]aggtgttccctgtatt
    03 rs7099933 10 q q25.3 LOC100286977| 115728772 6.95E-03 1.14 0.121 0.107 A (SEQ ID NO: 0870)
    LOC100132839 ccgatagttggtgact[A/G]ttttatttctttgttg
    02 rs2275111 10 q q26.11 SFXN4 120917445 1.11E-06 1.14 0.527 0.494 G (SEQ ID NO: 0871)
    cagaggaaaacctgcc[A/G]agaggggcaaatggat
    02 rs10749291 10 q q26.11 SFXN4 120920588 3.61E-05 0.91 0.463 0.487 G (SEQ ID NO: 0872)
    tctcctttaagataca[A/G]gaagcttggaagcgga
    03 rs12355817 10 q q26.12 SEC23IP| 121838912 2.46E-03 1.18 0.092 0.079 A (SEQ ID NO: 0873)
    PPAPDC1A cccatctgtaaaatgg[A/G]cacctaccattgattc
    02 rs2901297 10 q q26.13 ATE1 123521484 3.23E-05 1.08 0.125 0.117 A (SEQ ID NO: 0874)
    gagggaatggccatta[A/G]gtaaatgctctttaga
    02 rs1470996 10 q q26.13 FAM53B 126331555 2.39E-05 1.11 0.184 0.169 A (SEQ ID NO: 0875)
    caggtcccacgatacc[A/G]tcaggaatgtccgttt
    02 rs7919338 10 q q26.2 ADAM12 127731365 6.00E-02 1.10 0.276 0.258 A (SEQ ID NO: 0876)
    agttaagaaaagtgtc[A/G]caggctaaggaactgg
    03 rs7076942 10 q q26.3 GLRX3| 132374743 2.51E-04 1.13 0.292 0.266 C (SEQ ID NO: 0877)
    TCERG1L attgtagacttgcacg[A/C]ggggctgtatgggctc
    03 rs4880419 10 q q26.3 INPP5A 134456109 7.78E-03 0.92 0.411 0.432 A (SEQ ID NO: 0878)
    ggggacccctgctccc[A/G]gagtgacaggggagga
    03 rs2814183 10 q q26.3 JAKMIP3 133948347 4.01E-04 0.89 0.462 0.489 G (SEQ ID NO: 0879)
    cgcaaccgcgtgaggc[A/G]acagaaccgacgggca
    03 rs12774814 10 #N/A #N/A PITRM1 3182572 1.26E-03 0.89 0.241 0.264 A (SEQ ID NO: 0880)
    tttattacccacagtc[A/C]ccctcggtctgaaaat
    03 rs11038044 11 p p11.2 ALX4|CD82 44541295 5.37E-05 0.86 0.179 0.203 G (SEQ ID NO: 0881)
    tcaattttcgtccagc[A/G]ttctctgctacactgc
    01 exm2264447 11 p p11.2 C11orf49 46963196 1.45E-20 20.92 0.004 0.000 A (SEQ ID NO: 0882)
    cacgcctggccaacct[A/C]ttcaccctcaatctaa
    03 rs6416127 11 p p11.2 PRDM11 45239959 1.31E-03 1.15 0.169 0.151 C (SEQ ID NO: 0883)
    tcagcatcactaataa[A/C]agaaacacagcgtagt
    03 rs4756204 11 p p13 SLC1A2 35292312 4.58E-03 1.10 0.418 0.396 A (SEQ ID NO: 0884)
    gaaaatgagatagaga[A/G]aggaaagaaataatat
    03 rs11030997 11 p p14.1 KCNA4|FSHB 30206532 2.43E-03 0.90 0.337 0.360 G (SEQ ID NO: 0885)
    ccctattgggctatta[A/G]tagattggcatttaaa
    03 rs4074516 11 p p14.1 LGR4 27465591 5.78E-05 1.10 0.441 0.418 G (SEQ ID NO: 0886)
    attgaaaaaagcctgt[A/G]ggggtgctttgtgcag
    02 rs16916435 11 p p14.2 FIBIN|BBOXI 27030676 1.54E-05 1.09 0.095 0.088 G (SEQ ID NO: 0887)
    ctgttgattctaccct[A/G]tgaacagctgggctta
    03 rs1602916 11 p p14.3 LUZP2|ANO3 25696461 4.84E-03 1.09 0.447 0.425 A (SEQ ID NO: 0888)
    tcaagaccctgaattc[A/C]atttttttgaatatat
    02 rs324204 11 p p14.3 NELL1|ANO5 22001998 9.32E-06 1.17 0.265 0.235 A (SEQ ID NO: 0889)
    tccagtttttatggaa[A/G]ctaccatttactctgt
    02 rs324172 11 p p14.3 NELL1|ANO5 21952288 3.51E-05 1.15 0.326 0.296 A (SEQ ID NO: 0890)
    agactcatatcaaaac[A/G]caataagtgtgtggca
    02 rs2009912 11 p p14.3 NELL1|ANO5 21945004 5.97E-05 1.14 0.330 0.301 G (SEQ ID NO: 0891)
    tgatctagttagctt[A/G]tctatagcttccctgt
    02 rs10833683 11 p p14.3 NELL1|ANO5 21984498 2.53E-05 0.87 0.429 0.462 A (SEQ ID NO: 0892)
    accctacatacacata[A/G]ctaaatttttttttct
    03 rs793283 11 p p15.1 E2F8|NAV2 19264497 1.07E-03 0.88 0.205 0.226 A (SEQ ID NO: 0893)
    tgtggctcgcagattt[A/G]aaataaagcagaggtc
    03 rs7924734 11 p p15.2 ARNTL 13350747 8.93E-03 1.10 0.270 0.252 G (SEQ ID NO: 0894)
    gagagtcacaggaagg[A/G]cccattacgtcggat
    03 rs12290622 11 p p15.2 ARNTL 13314307 4.97E-03 1.10 0.310 0.290 G (SEQ ID NO: 0895)
    agtagatagtggtcca[A/G]gcctagtatttttaac
    03 rs7949336 11 p p15.2 ARNTL 13319894 1.22E-02 1.09 0.273 0.255 G (SEQ ID NO: 0896)
    tcccccagaggtgtgt[A/G]tggctagttagctcac
    03 rs10766066 11 p p15.2 RASSF10| 13278027 2.73E-02 1.08 0.296 0.280 G (SEQ ID NO: 0897)
    ARNTL attagtgtgcagttac[A/G]tagcttgggcccagac
    03 rs11042937 11 p p15.3 MRVI1|CTR9 10745394 3.79E-04 1.12 0.520 0.492 A (SEQ ID NO: 0898)
    cagcacatgaatatgg[A/C]ggcctgctgtgtgcca
    03 rs10834648 11 p p15.4 LOC650368| 3645345 2.92E-03 1.11 0.325 0.303 G (SEQ ID NO: 0899)
    TRPC2 ctagcctatacttaac[A/G]cataagtttcatccat
    03 rs17403795 11 p p15.4 LYVE1 10581217 2.51E-03 0.86 0.106 0.122 A (SEQ ID NO: 0900)
    aaaagattgggctgaa[A/G]ggaaagagatgagatg
    03 rs4910630 11 p p15.4 OR52M1| 4590639 2.59E-04 0.89 0.393 0.421 A (SEQ ID NO: 0901)
    C11orf40 ccctcctgctgccctc[A/G]gtttagggtttacaag
    03 rs12271195 11 p p15.4 SYT9 7463443 2.27E-03 0.86 0.116 0.132 A (SEQ ID NO: 0902)
    ctcagtgaaaatggct[A/G]aggggaggagcttttc
    02 rs1908177 11 p p15.4 TRIM68| 4659419 6.34E-06 0.87 0.389 0.424 A (SEQ ID NO: 0903)
    OR51D1 tctcctctttcacccc[A/C]acatgcaattcaactt
    03 rs1865558 11 p p15.4 WEE1| 9650585 1.83E-03 1.11 0.289 0.267 A (SEQ ID NO: 0904)
    SWAP70 tatatctccatgatat[A/G]taatccaagatatata
    02 rs885414 11 p p15.4 ZNF195|ART5 3644307 1.01E-02 1.16 0.189 0.168 C (SEQ ID NO: 0905)
    cttatttgtgagagaa[C/G]agaaacctccagggtg
    02 exm926722 11 q q13.1 SCYL1 65305309 3.44E-14 9.50 0.010 0.001 A (SEQ ID NO: 0906)
    cggtgctccagtcgtc[A/C]tgctgggccagcacag
    03 rs10752564 11 q q13.3 FGF19|FGF4 69540990 1.84E-04 1.13 0.322 0.295 A (SEQ ID NO: 0907)
    ggaggaagcggctgtc[A/G]cagtggctgggcttag
    02 exm936578 11 q q13.3 PPFIA1 70170536 1.14E-16 5.27 0.007 0.000 G (SEQ ID NO: 0908)
    cttactaaagaactca[A/G]tgtatgcagggaacag
    03 rs11228498 11 q q13.3 TPCN2| 68870298 9.14E-05 1.11 0.508 0.482 A (SEQ ID NO: 0909)
    MYEOV ttgcatttgttttggg[A/G]actgtctgaggttaga
    02 rs10751211 11 q q13.4 ARAP1 72405223 3.03E-05 1.18 0.202 0.177 A (SEQ ID NO: 0910)
    tggcagcagtggagat[A/G]gacagagcagagagat
    02 exm937263 11 q q13.4 DHCR7 71155161 1.41E-08 35.86 0.004 0.000 A (SEQ ID NO: 0911)
    tgaccagtacagctgc[A/G]ccctgactggccctgt
    02 rs6592850 11 q q14.1 ODZ4 79226201 9.43E-05 1.19 0.407 0.366 G (SEQ ID NO: 0912)
    aataagcaataataaa[A/G]atgtgacttttacagc
    03 rs10831309 11 q q21 ENDOD1| 94881894 5.60E-03 0.91 0.449 0.471 A (SEQ ID NO: 0913)
    SESN3 tcatataacttagcta[A/G]gtcattgtgaaatttt
    03 rs16922232 11 q q21 LOC100129203| 95304581 8.66E-03 1.26 0.033 0.026 A (SEQ ID NO: 0914)
    FAM76B catggagaacaggtgt[A/G]acctaagtgcagagcc
    03 rs2123325 11 q q22.1 CNTN5 99959543 4.27E-04 0.88 0.279 0.305 G (SEQ ID NO: 0915)
    tctaccaaacatacaa[A/G]aaagagctgatatcaa
    03 rs7128754 11 q q22.1 JRKL|CNTN5 97618161 1.23E-02 1.09 0.366 0.348 A (SEQ ID NO: 0916)
    aaatcctggtgaacac[A/C]tgtgccttttcacaga
    03 rs11212569 11 q q22.1 JRKL|CNTN5 97623375 7.12E-04 1.12 0.351 0.326 C (SEQ ID NO: 0917)
    atggtgcttttttcaa[A/C]catacccatgaccaat
    03 rs12792912 11 q q22.2 LOC100288111| 102801303 1.97E-02 0.93 0.414 0.432 C (SEQ ID NO: 0918)
    MMP13 ctcacatttaaactga[A/C]ggaatcataaagtaac
    03 rs12788925 11 q q22.2 LOC100288111| 102801847 1.80E-02 0.93 0.413 0.431 G (SEQ ID NO: 0919)
    MMP13 aaaagaaattctgggt[A/G]tctccagagagggaat
    02 rs1784408 11 q q22.2 MMP20 102469509 2.13E-02 1.11 0.367 0.343 G (SEQ ID NO: 0920)
    aaaagaagacctttaa[C/G]gctcaacaacatgcat
    02 exm952255 11 q q22.3 CASP12 104768141 5.64E-12 6.54 0.020 0.005 A (SEQ ID NO: 0921)
    aatgccatctagaaag[A/G]tcttgatcagcaactt
    03 rs10891431 11 q q23.2 LOC100132686| 112641531 1.95E-02 0.92 0.240 0.256 A (SEQ ID NO: 0922)
    NCAM1 ccagccaatgggagag[A/G]tgaatgctagagggtt
    03 rs2073848 11 q q23.2 ZBTB16 114051904 7.66E-04 1.15 0.178 0.159 G (SEQ ID NO: 0923)
    agagctcccttcatgc[A/G]attaaagtatgactga
    03 rs3782007 11 q q23.2 ZBTB16 114066438 4.47E-04 1.15 0.207 0.186 A (SEQ ID NO: 0924)
    gataatctcaatatag[A/G]cctcgcatggagtaag
    03 rs11215574 11 q q23.3 CADM1 115363443 3.37E-02 0.93 0.245 0.260 G (SEQ ID NO: 0925)
    gttttcaccatgggag[A/G]aagaaaacacaaataa
    02 exm960718 11 q q23.3 PHLDB1 118516274 5.43E-15 33.17 0.007 0.000 A (SEQ ID NO: 0926)
    ggaggagggtgagcac[A/G1cctatgatacgctgag
    01 rs11217801 11 q q23.3 POU2F3 120165942 2.66E-06 1.25 0.132 0.109 G (SEQ ID NO: 0927)
    ctaacagatagcgccc[A/G]ggttggaggcaaagca
    03 rs17671708 11 q q24.1 LOC100128242 123306172 1.59E-02 1.11 0.147 0.134 G (SEQ ID NO: 0928)
    cctcttcatattttca[A/G]ctttgtgcagtgaaaa
    03 rs10892895 11 q q24.1 UBASH3B 122630672 2.34E-02 1.14 0.086 0.076 G (SEQ ID NO: 0929)
    gtgttcactcctttgt[A/G]taattccctcccctca
    03 rs1946091 11 q q24.2 KIRREL3 126612903 3.20E-03 1.10 0.388 0.366 G (SEQ ID NO: 0930)
    tatctgagatgaggcc[A/G]tcagtgaggacctcct
    02 exm968612 11 q q24.2 RPUSD4 126081523 1.59E-08 Inf 0.003 0.000 A (SEQ ID NO: 0931)
    cgacgcgctccacctg[A/G]gcgccgccatcttaca
    03 rs11221660 11 q q24.3 RICS|BARX2 129182778 1.35E-02 0.92 0.388 0.407 A (SEQ ID NO: 0932)
    ctgaggtttccgggat[A/G]aggagagggtgtggcg
    03 rs7122696 11 q q25 NTM 132001390 1.81E-04 1.16 0.215 0.192 A (SEQ ID NO: 0933)
    acaaggctgcactttc[A/G]tagggttccatcataa
    03 rs7310913 12 p p11.23 ITPR2 26854487 1.45E-02 1.09 0.315 0.297 C (SEQ ID NO: 0934)
    ccagaccctatacata[A/C]gaataaaatgttacat
    03 rs11048661 12 p p11.23 ITPR2 26854124 1.31E-03 1.11 0.355 0.331 C (SEQ ID NO: 0935)
    ggcagtgaaagtcatg[A/C]ttgtaccgcaatcaat
    02 rs11054439 12 p p13.2 ETV6 11895308 7.91E-05 0.88 0.336 0.366 A (SEQ ID NO: 0936)
    atagggactcagaaaa[A/G]gcatcattcccttcat
    02 rs2051525 12 p p13.2 ETV6 11888423 7.12E-05 0.88 0.345 0.375 A (SEQ ID NO: 0937)
    ccctaataaacaaact[A/G]cttaattgaacagccc
    03 rs17181375 12 p p13.31 ANO2 5678868 6.25E-03 1.15 0.109 0.097 A (SEQ ID NO: 0938)
    gtctcaatcccagcca[A/G]gagtgaataatagatg
    03 rs7296720 12 p p13.32 TSPAN9 3374920 2.50E-04 1.19 0.128 0.110 G (SEQ ID NO: 0939)
    tagaaatttgtcgaac[A/G]tgtttgataaaatgga
    03 rs2429166 12 p p13.33 CACNA2D4 2025907 1.12E-03 0.88 0.181 0.201 G (SEQ ID NO: 0940)
    gtctcctggattgggc[A/G]tgaggagggctttggg
    03 rs10774066 12 p p13.33 FKBP4|ITFG2 2920736 3.61E-04 1.18 0.144 0.125 G (SEQ ID NO: 0941)
    aaaaaaaaatgattct[A/G]ccttatctgggatttt
    03 rs10848706 12 p p13.33 FKBP4|ITFG2 2919701 3.45E-04 1.18 0.144 0.125 G (SEQ ID NO: 0942)
    tgcagatatattctga[A/G]gctgaactgtgttaca
    03 rs2286601 12 p p13.33 ITFG2 2932177 2.25E-04 1.18 0.148 0.128 A (SEQ ID NO: 0943)
    cacttccctttctgac[A/G]tatcccctgatgtaag
    03 rs3759411 12 p p13.33 LOC100288472| 2901570 1.10E-04 1.19 0.145 0.124 G (SEQ ID NO: 0944)
    LOC728147 catccaccttatctgt[A/G]ggtgactcctgctggg
    03 rs3814249 12 p p13.33 NRIP2 2936276 1.57E-03 1.14 0.174 0.156 G (SEQ ID NO: 0945)
    tggaagggcagacacc[A/G]tagtccccagctacct
    03 rs3814250 12 p p13.33 NRIP2 2936049 1.89E-04 1.18 0.147 0.127 A (SEQ ID NO: 0946)
    ctgcttgggctgggtc[A/G]aaggctctgctgactg
    03 rs11062376 12 p p13.33 NRIP2|FOXM1 2950208 3.76E-04 1.17 0.146 0.127 A (SEQ ID NO: 0947)
    ttatgtccccaaaccc[A/G]cctggggcaagggggt
    02 exm997545 12 q q13.11 HDAC7 48187329 6.43E-21 12.71 0.013 0.001 A (SEQ ID NO: 0948)
    tccccggtgctgcccc[A/G]ggggagccgcccagcc
    03 rs7488270 12 q q13.12 SPATS2 49784365 1.05E-04 1.24 0.087 0.071 A (SEQ ID NO: 0949)
    ttcatccttatttggc[A/G]ttaaagttaacacaaa
    03 rs7309610 12 q q13.12 SPATS2 49783814 1.61E-04 1.24 0.087 0.071 A (SEQ ID NO: 0950)
    atttcaacttgaacaa[A/G]aaaacaaaggcgttag
    03 rs186231 12 q q13.13 FIGNL2 52212489 9.30E-04 1.16 0.145 0.127 A (SEQ ID NO: 0951)
    tgcacaggaggctgag[A/G]tgggagagagaaaaag
    03 rs172559 12 q q13.13 FLJ33996 52204246 7.90E-04 1.16 0.143 0.125 A (SEQ ID NO: 0952)
    taatatttggcaaagc[A/G]ttgccacttacccact
    03 rs3900362 12 q q13.13 SCN8A 52108030 2.18E-04 1.19 0.135 0.116 G (SEQ ID NO: 0953)
    ctgttatagtttccac[A/G]tcacaactaactgttt
    03 rs303808 12 q q13.13 SCN8A 52163789 2.88E-04 1.16 0.169 0.149 G (SEQ ID NO: 0954)
    aaaggggatgaggagc[A/G]gatgggctggggacac
    03 rs303771 12 q q13.13 SCN8A 52152192 8.38E-04 1.17 0.131 0.114 G (SEQ ID NO: 0955)
    gttcgacattttgcaa[A/G]tctctttaatgtctgg
    03 rs2580807 12 q q13.13 SCN8A 52174231 6.32E-04 1.17 0.143 0.125 A (SEQ ID NO: 0956)
    cctttccttccaggtc[A/G]tttgagtcaagttgaa
    03 rs715930 12 q q13.3 B4GALNT1 58023981 1.85E-03 0.88 0.190 0.210 A (SEQ ID NO: 0957)
    ggctgctgtaagtgac[A/C]agttgtagttgcctgt
    03 rs11173855 12 q q14.1 LOC100289417| 61637441 1.33E-03 0.90 0.438 0.463 A (SEQ ID NO: 0958)
    FAM19A2 tagactaaaattaata[A/C]agataagagttgaaac
    03 rs10784186 12 q q14.1 LOC100289417| 61604963 2.08E-03 0.91 0.425 0.449 A (SEQ ID NO: 0959)
    FAM19A2 attatcatttcttctt[A/C]atttattcctagtctg
    02 rs2270482 12 q q14.1 PPM1H 63087901 2.89E-05 0.82 0.131 0.155 A (SEQ ID NO: 0960)
    tccctataaaggaaga[A/G]gtagtcagtgtggtga
    03 rs2711666 12 q q14.1 SLC16A7 60132210 1.06E-02 0.92 0.437 0.457 A (SEQ ID NO: 0961)
    tgggctgctatttctc[A/G]tggaccaataacaaga
    03 rs10431559 12 q q14.1 SLC16A7| 60244639 7.38E-02 0.94 0.438 0.452 A (SEQ ID NO: 0962)
    LOC100289417 attagtcttgggtcca[A/G]attaatttcatgatca
    03 rs10437957 12 q q14.1 SLC16A7| 60202218 3.19E-02 0.93 0.440 0.457 A (SEQ ID NO: 0963)
    LOC100289417 ctaataatctccctag[A/G]ttttgtcctttgtcta
    03 rs7307997 12 q q14.2 AVPR1A| 63557914 8.89E-03 0.92 0.414 0.434 G (SEQ ID NO: 0964)
    DPY19L2 gaattcttgactgcct[A/G]tgtgttactcttcttc
    03 rs6581482 12 q q14.2 AVPR1A| 63682898 1.85E-02 0.92 0.324 0.342 A (SEQ ID NO: 0965)
    DPY19L2 gtaaagattgggaaaa[A/G]cttgcactaacttcca
    03 rs11612942 12 q q14.2 AVPR1A| 63704363 1.38E-03 1.16 0.142 0.125 A (SEQ ID NO: 0966)
    DPY19L2 ctggatgttggggaga[A/G]ttaacttgagttcaga
    02 exm1020169 12 q q15 CAND1 67706476 4.89E-10 40.96 0.004 0.000 A (SEQ ID NO: 0967)
    ctcttctctgcttctg[A/G]aatggttagcagtgct
    02 rs1861933 12 q q15 LOC100286998| 68842405 2.18E-05 1.16 0.214 0.190 G (SEQ ID NO: 0968)
    LOC100288856 aagtaaaggaattata[A/G]actagctgctgcttca
    02 rs7298169 12 q q15 LOC100286998| 68854225 1.61E-05 1.21 0.129 0.109 G (SEQ ID NO: 0969)
    LOC100288856 gccaaagctgtcagaa[A/G]acatcctacaatgcac
    02 rs2216437 12 q q15 LOC100286998| 68850924 4.99E-05 1.19 0.097 0.082 G (SEQ ID NO: 0970)
    LOC100288856 accccttgttgagcac[A/G]tggatacctttgaggt
    02 rs3863373 12 q q15 PTPRR 71288396 3.63E-05 1.09 0.349 0.330 A (SEQ ID NO: 0971)
    tatttttagtaaaata[A/C]taaatacacaccttgt
    03 rs2035151 12 q q21.2 E2F7 77445086 8.84E-05 1.11 0.098 0.089 G (SEQ ID NO: 0972)
    tgtctcctcaacccac[A/G]tttgaaaggggctcca
    03 rs12422952 12 q q21.2 GLIPR1 75881018 3.38E-04 0.89 0.372 0.400 A (SEQ ID NO: 0973)
    ctggagttgcttttgg[A/G]gtctgcattttaacaa
    03 rs7969930 12 q q21.2 GLIPR1L2| 75867565 6.61E-04 0.90 0.375 0.401 G (SEQ ID NO: 0974)
    GLIPR1 ttttgacagatagttg[A/G]caacagacatgtacag
    03 rs11180540 12 q q21.2 GLIPR1L2| 75873161 5.42E-04 0.89 0.375 0.402 A (SEQ ID NO: 0975)
    GLIPR1 gctacaggtgtgcctg[A/G]aatgtttctttacttt
    03 rs10785190 12 q q21.2 GLIPR1L2| 75819844 7.57E-04 0.90 0.375 0.401 G (SEQ ID NO: 0976)
    GLIPR1 aatacaactagagaga[A/G]atatatagatacttaa
    03 rs733880 12 q q21.2 KRR1| 75976164 7.43E-05 1.11 0.495 0.470 G (SEQ ID NO: 0977)
    LOC100289143 taaaattgaccatttt[A/G]cagacataatggcaag
    03 rs6582294 12 q q21.2 KRR1| 76034992 7.29E-04 0.90 0.383 0.409 A (SEQ ID NO: 0978)
    LOC100289143 gaatgaatcatcccca[A/G]tttgtttcttgctaca
    03 rs12423804 12 q q21.31 PPP1R12A| 80580111 7.63E-04 0.90 0.436 0.462 A (SEQ ID NO: 0979)
    C12orf64 acctgatgggagagac[A/G]cggctaagtaggaaag
    03 rs4882448 12 q q21.31 TMTC2| 83746599 1.24E-02 0.92 0.467 0.486 G (SEQ ID NO: 0980)
    SLC6A15 tcctctgacatggatg[A/G]ttgtggcattagtaac
    03 rs17790382 12 q q22 EEA1 93230276 4.98E-03 0.85 0.087 0.100 C (SEQ ID NO: 0981)
    atgcttcatagcttac[A/C]aagttatttcagagat
    03 rs11829776 12 q q22 FGD6 95531442 2.93E-03 0.89 0.195 0.214 G (SEQ ID NO: 0982)
    ataggactgaacaaca[A/G]agaattgctgatatct
    03 rs12579299 12 q q22 NR2C1 95442242 1.10E-03 0.88 0.193 0.214 G (SEQ ID NO: 0983)
    cgcaataactgctatt[A/G]taactgacttaacagg
    02 rs14121 12 q q22 VEZT 95694394 9.10E-06 0.85 0.262 0.294 G (SEQ ID NO: 0984)
    gaacagacttttggtg[A/G]tgaggaggaagaacaa
    01 rs3596 12 q q22 VEZT 95696420 8.71E-08 1.16 0.508 0.471 G (SEQ ID NO: 0985)
    gaagtcagtggttctc[A/G]gttgtattagtggggt
    02 rs10859856 12 q q22 VEZT 95631276 5.23E-07 1.15 0.505 0.470 G (SEQ ID NO: 0986)
    cctctggtttggtgat[A/G]tcagtggaggctgata
    02 rs7959730 12 q q23.1 NEDDlIRMST 97495927 3.16E-05 1.09 0.347 0.328 G (SEQ ID NO: 0987)
    aatgcaaatgaaaaca[A/G]tatgagaagccactac
    03 rs10861688 12 q q23.3 CRY1 107394048 9.61E-05 0.85 0.169 0.193 A (SEQ ID NO: 0988)
    tgtgctgcacaaggac[A/G]actgaaacaaaagaat
    03 rs973724 12 q q23.3 CRY1|BTBD11 107578877 4.68E-04 0.89 0.316 0.342 G (SEQ ID NO: 0989)
    taacaagaatgaccca[A/G]tctatatgatcaactt
    03 rs1896058 12 q q23.3 LOC100287556| 108405763 7.17E-04 1.11 0.436 0.410 A (SEQ ID NO: 0990)
    WSCD2 catgaaagtgtcacta[A/G]aaaactctacctactg
    03 rs11068393 12 q q24.22 FBXO21 117623136 3.08E-04 0.87 0.193 0.217 G (SEQ ID NO: 0991)
    ggagagagaaatatct[A/G]tcagtggaacaactgt
    03 rs1466852 12 q q24.22 FBXO21 117591843 1.57E-04 0.86 0.192 0.216 A (SEQ ID NO: 0992)
    atagacactggcccac[A/G]gtgttgttgaaaagaa
    01 rs10431397 12 q q24.23 KSR2 118106194 1.38E-15 2.43 0.021 0.009 A (SEQ ID NO: 0993)
    cctatgatctggtgga[A/G]caccctccctcctgaa
    03 rs10846578 12 q q24.31 DNAH10 124400278 7.08E-04 1.12 0.306 0.282 A (SEQ ID NO: 0994)
    tgtctgttcatacacc[A/G]gaatatcattcagccc
    03 rs7975815 12 q q24.31 DNAH10 124388129 3.30E-03 0.72 0.019 0.026 G (SEQ ID NO: 0995)
    gtgagagtaggtcact[A/G]ttgaggcccccataca
    02 exm1044289 12 q q24.31 P2RX7 121622550 1.22E-10 6.57 0.009 0.001 A (SEQ ID NO: 0996)
    tgccgctggaggatcc[A/G]gaaagagtttccgaag
    03 rs4765052 12 q q24.32 TMEM132B 126043965 1.91E-03 0.87 0.140 0.158 A (SEQ ID NO: 0997)
    atcacaaagccatact[A/G]caggtacagggtctga
    03 rs4765044 12 q q24.32 TMEM132B 125981136 9.73E-04 0.90 0.375 0.400 A (SEQ ID NO: 0998)
    ctcctgggttgccccc[A/G]tccttgagccaatgta
    02 exm1054045 12 q q24.33 POLE 133263886 1.21E-08 7.12 0.007 0.001 C (SEQ ID NO: 0999)
    catgtctctgaggagc[C/G]gcgggcggcggcgcgc
    02 rs2012359 13 q q12.12 PARP4 25078073 2.11E-02 1.16 0.135 0.119 G (SEQ ID NO: 1000)
    cacatattgcaagcta[C/G]gatattattcaatttt
    03 rs3117849 13 q q12.13 ATP8A2 26299179 4.22E-03 1.34 0.025 0.018 A (SEQ ID NO: 1001)
    tgtcctcccagagtct[A/G]tcatctatcaggaagt
    03 rs7328428 13 q q12.3 HMGB1| 31083678 8.44E-04 1.24 0.062 0.051 A (SEQ ID NO: 1002)
    USPL1 aattaagaatattggg[A/G]cacggccaggcgtggt
    03 rs1543660 13 q q12.3 KIAA0774 29855650 6.01E-03 1.29 0.031 0.024 G (SEQ ID NO: 1003)
    ttaagtcactgcataa[A/G]tatctgtcacacaaat
    03 rs9506012 13 q q12.3 LOC100287487| 29135021 2.97E-04 1.16 0.183 0.161 G (SEQ ID NO: 1004)
    POMP ccaaagctccctccac[A/G]gcagccaacacaccct
    03 rs663528 13 q q12.3 UBL3| 30607076 4.92E-04 0.90 0.464 0.492 A (SEQ ID NO: 1005)
    KATNAL1 tctgaacaaagatgac[A/C]ggaggagctgccttgg
    03 rs8002871 13 q q12.3 UBL3| 30574667 4.74E-04 1.12 0.464 0.437 G (SEQ ID NO: 1006)
    KATNAL1 tgtgctttggagtttg[A/G]gcggcagaaccgcgta
    02 rs9595159 13 q q13.1 FRY 32798953 4.76E-05 1.16 0.230 0.204 A (SEQ ID NO: 1007)
    tatttcccccgaataa[A/G]agccttatataatgtt
    02 rs394307 13 q q13.1 LOC122038|KL 33569834 3.37E-05 1.08 0.442 0.422 G (SEQ ID NO: 1008)
    actgagtagtcatcag[A/G]atatttggttgtgttg
    03 rs1199994 13 q q13.3 CSNK1A1L| 37694027 1.50E-03 1.23 0.063 0.052 G (SEQ ID NO: 1009)
    POSTN caagtactcaataaat[A/G]taaacaaacctgtcat
    03 rs9315468 13 q q13.3 FAM48A| 37667508 8.35E-04 0.90 0.416 0.442 A (SEQ ID NO: 1010)
    CSNK1A1L atgaaatagtaaatac[A/C]agccttacactttgaa
    03 rs9603439 13 q q13.3 FREM2 39402920 9.64E-03 1.20 0.055 0.046 A (SEQ ID NO: 1011)
    gagctgggtttatatg[A/C]attgacatgaaaagtt
    03 rs9603442 13 q q13.3 FREM2 39406629 5.34E-03 1.21 0.055 0.046 A (SEQ ID NO: 1012)
    aactggttatttccta[A/G]agctgagattgtgagg
    03 rs2766484 13 q q14.13 SIAH3|ZC3H13 46443060 1.56E-04 1.13 0.409 0.380 C (SEQ ID NO: 1013)
    attacaagtcagcagt[A/C]caagaaaggaacaggg
    03 rs9567586 13 q q14.13 SIAH3|ZC3H13 46431655 3.94E-04 1.12 0.409 0.382 G (SEQ ID NO: 1014)
    acaaagaatataaaca[A/G]agtacacagaagaagt
    02 exm1068520 13 q q14.2 CYSLTR2 49281785 5.84E-17 5.52 0.017 0.003 T (SEQ ID NO: 1015)
    agtctgtctttgcata[A/T]acccactttccatgtc
    03 rs2765760 13 q q14.2 FAM10A4| 50851577 1.59E-04 0.83 0.123 0.145 A (SEQ ID NO: 1016)
    DLEU7 ggcacagtcacacgcc[A/C]acgaggccagccctgc
    03 rs9591076 13 q q14.2 HTR2A| 48127371 1.44E-04 1.60 0.017 0.011 A (SEQ ID NO: 1017)
    SUCLA2 ccttcagtttctccct[A/G]gggcttcattatggct
    03 rs9596839 13 q q14.3 OLFM4| 54264395 3.64E-02 0.93 0.283 0.298 A (SEQ ID NO: 1018)
    LOC100287887 taa1111aattgatcc[A/G1tcacctctactgtttg
    03 rs9563182 13 q q14.3 OLFM4| 54395310 1.71E-02 0.90 0.155 0.169 G (SEQ ID NO: 1019)
    LOC100287887 gtaattattaaattac[A/G]tggaagttccttgccc
    03 rs9316660 13 q q14.3 OLFM4| 54353562 2.90E-03 0.88 0.146 0.163 G (SEQ ID NO: 1020)
    LOC100287887 tttacttacctcttac[A/G]tagtcctaagcacaat
    03 rs9563183 13 q q14.3 OLFM4| 54396931 1.71E-02 0.90 0.155 0.169 C (SEQ ID NO: 1021)
    LOC100287887 gaggagagctagtgaa[A/C]taaaagcctaagtata
    03 rs12860689 13 q q14.3 OLFM4| 54315805 2.89E-03 0.88 0.146 0.163 G (SEQ ID NO: 1022)
    LOC100287887 tttggggatatagcct[A/G]gaaatgtgtactttta
    03 rs9568924 13 q q14.3 OLFM4| 54360952 3.94E-03 0.88 0.148 0.165 C (SEQ ID NO: 1023)
    LOC100287887 ctgtattacacattat[A/C]cataatctagaaatga
    03 rs9568902 13 q q14.3 OLFM4| 54324954 3.15E-03 0.88 0.145 0.162 A (SEQ ID NO: 1024)
    LOC100287887 aaagctgtttgttttt[A/G]agaagttctatgctca
    03 rs2806731 13 q q14.3 OLFM41 54290333 3.33E-03 0.89 0.191 0.210 G (SEQ ID NO: 1025)
    LOC100287887 aacttctgtttttact[A/G]ttttctaggcaatgtc
    03 rs9568919 13 q q14.3 OLFM4| 54352229 2.71E-03 0.88 0.146 0.163 C (SEQ ID NO: 1026)
    LOC100287887 tggtgtctagaactgc[A/C]tctagcaagtgggagg
    02 rs2786266 13 q q21.32 LOC730236| 68327766 2.37E-03 1.30 0.078 0.061 G (SEQ ID NO: 1027)
    KLHL1 tgctggacaagtgtaa[A/G]gaatctggggtttaga
    03 rs287548 13 q q22.1 KLF5| 73905783 1.15E-03 0.76 0.033 0.043 A (SEQ ID NO: 1028)
    LOC647281 gagggtttggctttag[A/G]ctttgttagggcaagt
    03 rs9543642 13 q q22.1 LOC100288208| 75008312 2.48E-04 1.13 0.405 0.377 A (SEQ ID NO: 1029)
    LOC647288 tagaagcacacctagc[A/G]tatttaaaacttggag
    03 rs9543662 13 q q22.1 LOC100288208| 75066010 1.30E-04 0.89 0.434 0.464 G (SEQ ID NO: 1030)
    LOC647288 acggatgaatcaaaac[A/G]ttaagctctctaaaag
    03 rs1337278 13 q q31.1 SLITRK1| 86316853 1.97E-02 1.08 0.406 0.388 G (SEQ ID NO: 1031)
    SLITRK6 aaataatccttgatac[A/G]gtactgaatattttgt
    03 rs4344612 13 q q31.1 SPRY2| 81574866 3.11E-04 1.14 0.273 0.248 C (SEQ ID NO: 1032)
    SLITRK1 ttatctcaaaaaaaat[A/C]tgtaggtataaatttg
    03 rs7336590 13 q q31.1 SPRY2| 1529694 3.80E-04 0.89 0.448 0.476 A (SEQ ID NO: 1033)
    SLITRK1 aatccatttgaaattg[A/G]cagtgtttttatattt
    03 rs12865263 13 q q31.1 SPRY2| 81362430 8.35E-04 1.15 0.174 0.154 A (SEQ ID NO: 1034)
    SLITRK1 cttcagtottcgtaca[A/G]aaacacttactttata
    03 rs4536348 13 q q31.1 SPRY2| 81562924 5.42E-03 1.13 0.165 0.149 G (SEQ ID NO: 1035)
    SLITRK1 cctggtaatttgatca[A/G]tcattaagctatcctt
    03 rs2348445 13 q q31.2 LOC100287432| 89846656 1.08E-03 1.15 0.156 0.138 G (SEQ ID NO: 1036)
    LOC144776 tgaagaatttactcac[A/G]tggggaaataaaggcc
    03 rs11616543 13 q q31.2 LOC100287432| 89298757 3.61E-03 1.13 0.180 0.163 A (SEQ ID NO: 1037)
    LOC144776 tgtattctctagtcag[A/G]ttctctttccagcttg
    03 rs11620369 13 q q31.3 GPC5|GPC6 93873495 1.12E-03 0.82 0.068 0.082 A (SEQ ID NO: 1038)
    tagtattttaggtaac[A/G]atgagtaaatcttaag
    03 rs9556267 13 q q31.3 GPC5|GPC6 93839833 6.97E-04 0.81 0.067 0.082 G (SEQ ID NO: 1039)
    acagagtctggaaata[A/G]gaccgatgaaaccagg
    03 rs7322277 13 q q31.3 GPC6 94826895 7.99E-04 0.87 0.174 0.195 G (SEQ ID NO: 1040)
    agcacaaacttttgct[A/G]aatagcatgtcatcta
    03 rs7329232 13 q q31.3 GPC6 94828678 1.97E-03 0.86 0.113 0.130 G (SEQ ID NO: 1041)
    atatcggttctgctat[A/]tctatgagttcctttc
    03 rs9301082 13 q q33.2 DAOA| 106586930 1.40E-03 1.12 0.302 0.279 A (SEQ ID NO: 1042)
    LOC728192 aatagatgaggaagtt[A/G]aagtccaaaaatagtc
    03 rs9519858 13 q q33.2 DAOA| 106583444 1.03E-03 1.12 0.304 0.280 A (SEQ ID NO: 1043)
    LOC728192 aaagtgaatgagaaca[A/G]tactgataataatagc
    02 rs9583036 13 q q33.2 DAOA| 106389385 8.28E-04 1.29 0.104 0.083 G (SEQ ID NO: 1044)
    LOC728192 tgcctgtgacacaata[T/G]tgaaatcttacttaaa
    02 rs277836 13 q q33.3 MYO16 109710600 2.10E-05 1.15 0.394 0.362 G (SEQ ID NO: 1045)
    atgttgaaagggtgcc[A/G]gtgccttggtgatcaa
    03 rs12018760 13 4N/A 4N/A OLFM4| 54308253 3.67E-03 0.88 0.145 0.162 A (SEQ ID NO: 1046)
    LOC100287887 ttgattcttaatctgg[A/G]ggtgtttatttcccta
    02 exm1085390 14 q q11.2 EDDM3A 21216136 2.92E-12 9.13 0.008 0.001 A (SEQ ID NO: 1047)
    tggcgtagatggatat[A/G]ttgataacatagaaga
    02 rs227865 14 q q11.2 OR4E2|DAD1 22953607 4.78E-05 1.27 0.076 0.061 G (SEQ ID NO: 1048)
    tcgtcaatgttttaaa[A/G]ggtaggagttgttaca
    03 rs2233859 14 q q11.2 RNASE3 21359808 9.05E-04 0.90 0.398 0.423 A (SEQ ID NO: 1049)
    ataaccgagaccggat[A/C]ggggagtagttacttc
    03 rs2300850 14 q q12 AKAP6 33271488 9.28E-05 1.18 0.131 0.113 G (SEQ ID NO: 1050)
    agttcataatcttcca[A/G]gcctccatagtctggt
    02 exm- 14 q q12 NOVA1| 27406892 6.53E-10 4.47 0.011 0.002 A (SEQ ID NO: 1051)
    rs17111920 LINC00645 tagactaatgcaagca[A/C]aaaatttccatttgct
    03 rs8009605 14 q q12 PRKD1 30254780 1.23E-04 0.86 0.208 0.233 G (SEQ ID NO: 1052)
    ggaagtcttattcgga[A/G]caatcagtcaagaaaa
    02 rs17489969 14 q q12 STXBP6| 26642640 7.02E-04 1.36 0.073 0.055 C (SEQ ID NO: 1053)
    NOVA1 catgcaccgaaatctc[T/C]tcatgatggagaattt
    02 rs17110902 14 q q12 STXBP6| 26673425 9.11E-07 1.12 0.169 0.153 A (SEQ ID NO: 1054)
    NOVA1 ggactgcaaggtaatc[A/G]tcaagggactcttaga
    02 rs1012146 14 q q12 STXBP6| 26678953 6.04E-07 1.12 0.169 0.153 A (SEQ ID NO: 1055)
    NOVA1 ttcatttaattttaca[A/C]ggaagagtttaaaaaa
    03 rs2899875 14 q q21.1 CLEC14A| 39001144 8.58E-05 0.91 0.475 0.499 G (SEQ ID NO: 1056)
    LOC283547 tatcattgctatttcc[A/G]tgtttggtcaaggcat
    03 rs8005701 14 q q21.2 LOC644589| 46883709 7.79E-03 0.92 0.419 0.439 A (SEQ ID NO: 1057)
    LOC100289583 aaattataacaaaaga[A/G]aattttactcttataa
    03 rs10138214 14 q q21.2 LOC644589| 46866809 1.36E-02 0.92 0.418 0.437 A (SEQ ID NO: 1058)
    LOC100289583 agtgccagcattctga[A/G]ccataatttttgtgac
    03 rs1669786 14 q q21.2 LOC644589| 46894155 8.60E-03 0.92 0.420 0.440 G (SEQ ID NO: 1059)
    LOC100289583 gggttcaacagtctat[A/G]tttttagcagactgtc
    03 rs2415982 14 q q21.2 LOC644589| 46865899 9.90E-03 0.92 0.417 0.437 A (SEQ ID NO: 1060)
    LOC100289583 aggcctgcctgtgtat[A/G]actgtaaatattcatt
    03 rs12883384 14 q q21.3 MDGA2 47403684 6.84E-04 1.11 0.434 0.407 A (SEQ ID NO: 1061)
    tatggcttgaactgc[A/C]aatcttaaaagttaat
    03 rs11846126 14 q q21.3 RPL10L| 47249450 2.32E-04 0.89 0.455 0.484 G (SEQ ID NO: 1062)
    MDGA2 tgaaatattgtaaatc[A/G]gtggttttgagtgtct
    03 rs1253706 14 q q22.1 GNG2 52400377 2.84E-04 1.12 0.456 0.427 A (SEQ ID NO: 1063)
    aaagaaaatgagagcc[A/G]ctgctcgagtgaaggg
    03 rs4271525 14 q q22.1 GNG2 52408987 5.65E-05 1.12 0.428 0.401 A (SEQ ID NO: 1064)
    ttttcatgatggcttt[A/G]tggctatttttttagg
    03 rs10498440 14 q q22.1 GNG2 52413573 8.43E-04 1.11 0.429 0.403 G (SEQ ID NO: 1065)
    aaagtactaggccagc[A/G]ttccaaagaagtgttt
    03 rs1618825 14 q q22.1 GNG2 52407340 1.32E-03 1.11 0.439 0.414 A (SEQ ID NO: 1066)
    tgattgggaaagagtg[A/G]ctgagtgtgcaaggtg
    03 rs7157151 14 q q22.1 NID2|PTGDR 52571583 7.51E-04 1.12 0.311 0.287 A (SEQ ID NO: 1067)
    acgttactcatcaaat[A/G]tatacaatgtagctaa
    03 rs941630 14 q q22.1 NID2|PTGDR 52557650 7.32E-03 1.10 0.236 0.218 A (SEQ ID NO: 1068)
    ttgtctatcagttgcc[A/G]tcttccattggccaag
    03 rs34096981 14 q q22.3 C14orf34| 56302744 6.76E-05 1.12 0.315 0.291 A (SEQ ID NO: 1069)
    LOC100286940 ggcagagttacacctc[A/G]taaacaaactattcaa
    03 rs2342595 14 q q22.3 C14orf34| 56271486 8.48E-05 1.12 0.312 0.288 A (SEQ ID NO: 1070)
    LOC100286940 agggccaagctgccaa[A/G]aacttcttgaggtctg
    02 rs1953358 14 q q22.3 C14orf34| 56295580 5.14E-05 0.88 0.458 0.489 A (SEQ ID NO: 1071)
    LOC100286940 ggcagcatcaaagtca[A/G]atgactgacccaaggc
    02 rs12896938 14 q q22.3 TBPL2| 55955102 3.40E-05 1.12 0.236 0.216 G (SEQ ID NO: 1072)
    C14orf33 ctatgctctggtttct[A/G]tatttctagaacttgt
    03 rs12880763 14 q q22.3 TBPL2| 55970308 9.86E-05 1.12 0.225 0.206 G (SEQ ID NO: 1073)
    C14orf33 taatctttaaattgtt[A/G]catatttagcaagtgt
    03 rs12884010 14 q q22.3 TBPL2| 55944612 1.96E-04 1.13 0.372 0.344 G (SEQ ID NO: 1074)
    Cl4orf33 gctgtgctcccagcca[A/G]cagccagaatcaactg
    02 rs7156144 14 q q24.1 TMEM229B 67979713 5.74E-02 0.92 0.415 0.435 A (SEQ ID NO: 1075)
    taaatctgatacaacc[A/G]aaataaacacagtata
    03 rs17104036 14 q q24.3 C14orf179| 76573554 1.38E-02 1.18 0.060 0.051 A (SEQ ID NO: 1076)
    C14orf118 cactctagaagaccct[A/G]caaatcagaaccagag
    02 exm1114136 14 q q24.3 COQ6 74427993 6.12E-12 Inf 0.004 0.000 G (SEQ ID NO: 1077)
    gcccccaagcgtagcc[A/G]gggtggatgccaaaag
    02 exm1113959 14 q q24.3 ZNF410 74388791 4.89E-10 40.96 0.004 0.000 G (SEQ ID NO: 1078)
    aagcctcttcaagcaa[A/G]ctactgcccattagtg
    03 rs7148059 14 q q32.11 KCNK13| 90657405 8.80E-05 1.12 0.174 0.159 A (SEQ ID NO: 1079)
    PSMC1 gttgtcaatgctaaac[A/G]agaaagggtccctgga
    03 rs1241719 14 q q32.12 CPSF2| 92673710 3.01E-02 1.09 0.226 0.212 A (SEQ ID NO: 1080)
    SLC24A4 tcaaaccagccctgcc[A/G]gtgcccttgtgtccct
    02 rs1257415 14 q q32.2 BCL11B 99698931 3.94E-05 1.14 0.525 0.493 C (SEQ ID NO: 1081)
    cactccagggcccccatA/C]gtggattcccccatcg
    02 rs2614459 14 q q32.2 BCL11B 99691180 2.49E-06 1.15 0.314 0.285 C (SEQ ID NO: 1082)
    cattgtgggaagctct[A/C]gagatggggccatcct
    03 rs2793321 14 q q32.2 BCL11B 99676623 1.04E-04 1.14 0.326 0.298 A (SEQ ID NO: 1083)
    ctgcagtgcttattct[A/G]tctcttttgtttgttt
    03 rs756055 14 q q32.2 DEGS2|YY1 100691178 6.05E-05 0.88 0.376 0.408 G (SEQ ID NO: 1084)
    atcaggggaaaagcat[A/G]aactcaaaatagatga
    03 rs7153665 14 q q32.2 YY1 100730920 8.62E-05 0.88 0.376 0.408 A (SEQ ID NO: 1085)
    aagggcgatgaatcct[A/G]ggccaggctgtgcaga
    02 exm1134843 14 q q32.33 PACS2 105858969 1.20E-07 Inf 0.003 0.000 A (SEQ ID NO: 1086)
    cagccagggtgtcggc[A/G]ccgagctgatggggct
    02 rs8179187 15 q q11.2 UBE3A 25652326 2.69E-05 1.28 0.081 0.065 C (SEQ ID NO: 1087)
    gagggtcgcactttca[A/C]aaatgagtcagctggt
    03 rs12437614 15 q q12 GABRG3 27706661 2.08E-04 1.28 0.060 0.047 A (SEQ ID NO: 1088)
    cagcaagagttattgc[A/G]aagagaaacaacaaag
    03 rs939981 15 q q13.1 LOC727808| 30290306 3.19E-03 1.15 0.124 0.110 A (SEQ ID NO: 1089)
    LOC100128435 ggtcctttctaaaaat[A/G]gtcaccccaatccatc
    03 rs12905328 15 q q13.1 LOC727808| 30239328 1.72E-03 0.88 0.202 0.222 A (SEQ ID NO: 1090)
    LOC100128435 attaatattttatgtt[A/G]catgatttagatttat
    02 rs12438794 15 q q14 MEIS2| 38146571 8.47E-07 1.08 0.076 0.071 A (SEQ ID NO: 1091)
    TMCO5A tcatggaactaaaagt[A/G]agcatctcaagagact
    02 rs8041665 15 q q14 MEIS2| 38150179 2.56E-07 1.08 0.077 0.072 A (SEQ ID NO: 1092)
    TMCO5A agcgtatattatcttc[A/G]aagagcattttttattt
    02 rs8037309 15 q q14 MEIS2| 38150438 2.77E-07 1.08 0.077 0.072 A (SEQ ID NO: 1093)
    TMCO5A gagcatccacatccat[A/G]aggctgctgaattcat
    03 rs12907066 15 q q14 RYR3 33990976 7.93E-04 1.12 0.319 0.295 A (SEQ ID NO: 1094)
    tctccagaagatccct[A/G]agcacatgtctggatg
    03 rs7165303 15 q q14 RYR3 33693677 2.31E-04 0.89 0.391 0.420 G (SEQ ID NO: 1095)
    ttcagcactattcagc[A/G]cctatcactgccagct
    03 rs2279663 15 q q14 RYR3 33952326 5.80E-03 1.13 0.157 0.142 A (SEQ ID NO: 1096)
    cccagacattttaacc[A/G]atatggccagtataaa
    01 exm1159600 15 q q21.1 DUT 48623812 4.41E-08 1.65 0.010 0.000 A (SEQ ID NO: 1097)
    cgcacggcagagggcc[A/G]aagccgcggtactctc
    03 rs17645290 15 q q21.2 USP8 50787955 1.92E-02 1.10 0.191 0.177 G (SEQ ID NO: 1098)
    tacaaacacttgccag[A/G]tttagaaacacctgta
    02 rs16940167 15 q q21.3 AQP9|LIPC 58683697 7.99E-05 1.18 0.176 0.154 G (SEQ ID NO: 1099)
    ttatgggcccagaatg[A/G]ttccagatcagaattt
    03 rs1280415 15 q q21.3 CGNL1 57749193 4.60E-02 1.12 0.082 0.074 G (SEQ ID NO: 1100)
    tattgaacattctaca[A/G]atttttataaaaaagg
    03 rs1280416 15 q q21.3 CGNL1 57749300 2.10E-03 1.24 0.055 0.045 A (SEQ ID NO: 1101)
    ttctttgtcagctacc[A/G]ttgctataaaaccttt
    03 rs2017176 15 q q21.3 KIAA1370| 53006147 6.68E-05 0.89 0.440 0.469 A (SEQ ID NO: 1102)
    ONECUT1 tgactaattacactgg[A/G]gagtccatcaacatct
    02 rs17543144 15 q q21.3 KIAA1370| 53008923 2.07E-05 0.88 0.438 0.468 A (SEQ ID NO: 1103)
    ONECUT1 tggttggaacatagcc[A/G]tgacagctagccaaca
    03 rs2414407 15 q q21.3 RAB27A 55556228 4.27E-03 1.14 0.131 0.117 A (SEQ ID NO: 1104)
    caaacaaacagaaaaa[A/G]taaccctggctatagt
    03 rs1991574 15 q q21.3 UNC13C 54484950 6.41E-04 0.87 0.200 0.223 A (SEQ ID NO: 1105)
    gaaggcccagtgggaa[A/G]ccgagtagtgctacag
    03 rs12440360 15 q q21.3 UNC13C 54491059 1.01E-03 0.90 0.450 0.476 C (SEQ ID NO: 1106)
    atccaaatcaagaaaa[A/C]aatctctgaattgcca
    03 rs16950635 15 q q22.33 SMAD3 67418205 7.50E-04 1.27 0.052 0.041 A (SEQ ID NO: 1107)
    ggggtaatttattgcc[A/G]ccgctcgcttcaccag
    03 rs16951541 15 q q23 LOC100286942| 68276895 2.17E-04 1.23 0.090 0.074 A (SEQ ID NO: 1108)
    PIAS1 attctgcagacacaca[A/G]tcctttttgcctacaa
    02 exm1173822 15 q q23 THSD4 72023502 9.46E-11 17.87 0.006 0.000 A (SEQ ID NO: 1109)
    cgtgcactacgagtac[A/G]tgatcatggggaccaa
    03 rs1130741 15 q q24.1 MPI 75189930 1.47E-04 1.13 0.477 0.448 A (SEQ ID NO: 1110)
    tggtacaggggacagt[A/G]atagccagcacaccca
    03 rs2415251 15 q q24.2 COX5A|RPP25 75242155 2.06E-04 1.12 0.502 0.473 A (SEQ ID NO: 1111)
    atctgagccottgggt[A/G]cccctgcctttggaga
    03 rs11855944 15 q q24.3 LINGO| 78088127 8.41E-03 1.11 0.195 0.179 C (SEQ ID NO: 1112)
    LOC645752 tgccacttgctgccag[A/C]cctggctgaagcaggg
    03 rs4075024 15 q q24.3 LINGO| 78093898 1.18E-02 1.10 0.198 0.183 G (SEQ ID NO: 1113)
    LOC645752 ttgtttttctgattac[A/G]acagaagacccaacaa
    03 rs15939 15 q q24.3 RCN2 77241542 2.36E-02 0.89 0.105 0.117 G (SEQ ID NO: 1114)
    gctcatcatgatagaa[A/G]tagtcatcatggagct
    02 exm1181151 15 q q25.1 ADAMTS7 79089098 2.26E-09 Inf 0.003 0.000 A (SEQ ID NO: 1115)
    gagtctcgacgggagc[A/G]ttgggagcagcggcag
    02 exm1182536 15 q q25.1 IL16 81572094 1.94E-08 34.64 0.004 0.000 A (SEQ ID NO: 1116)
    caattacagaatcatg[A/G]tggaggtttctctgca
    03 rs12905510 15 q q25.3 AGBL1| 87944954 1.60E-04 1.13 0.353 0.325 G (SEQ ID NO: 1117)
    NCRNA00052 tgataagctggacttc[A/G]taaaaactatacacat
    03 rs2016517 15 q q25.3 AKAP13 86229618 1.28E-03 1.12 0.275 0.253 A (SEQ ID NO: 1118)
    catggtaaaatacttt[A/G]gctatatttccatcag
    03 rs11630274 15 q q25.3 AKAP13 86288387 9.24E-04 1.12 0.288 0.265 A (SEQ ID NO: 1119)
    tgaccagacgcctggt[A/G]cagactgggccttctt
    03 rs1978391 15 q q25.3 KLHL25 86311695 9.49E-04 1.12 0.288 0.264 A (SEQ ID NO: 1120)
    ggatgctggttcctcc[A/G]aaaacaaagagottca
    03 rs3743332 15 q q25.3 LOC100288896 86303751 1.33E-02 1.09 0.288 0.270 G (SEQ ID NO: 1121)
    accagaaaggtgacca[A/G]gacagattttttaagg
    03 rs11634975 15 q q25.3 PDE8A 85606478 3.07E-03 1.11 0.309 0.288 G (SEQ ID NO: 1122)
    aacagtgacctattct[A/G]gtaaacacattacgaa
    03 rs11629962 15 q q25.3 PDE8A 85530028 1.18E-03 1.12 0.268 0.246 A (SEQ ID NO: 1123)
    agcaagatctcgtctc[A/G]acaaaaaaaaagttta
    03 rs6496766 15 q q25.3 PDE8A| 85702375 1.06E-03 1.11 0.400 0.375 C (SEQ ID NO: 1124)
    LOC728121 atgaaccaactatatg[A/C]tgtctacaagaaacac
    03 rs12905479 15 q q26.1 LOC390638| 91711209 1.44E-02 0.93 0.431 0.450 A (SEQ ID NO: 1125)
    SV2B cggcctttgtggtgct[A/G]tttggtttcatcccca
    02 exm1190729 15 q q26.1 UNC45A 91486258 1.72E-08 Inf 0.003 0.000 A (SEQ ID NO: 1126)
    tccttgagagacttcc[A/G]gggcaccgctttaatc
    03 rs896070 15 q q26.2 LOC145820| 96428860 1.06E-04 1.17 0.198 0.175 A (SEQ ID NO: 1127)
    NR2F2 aaggctctgaggtttt[A/G]gtaccccagaaagatt
    03 rs1025833 15 q 826.2 SPATA8| 98224547 2.07E-04 1.25 0.073 0.059 A (SEQ ID NO: 1128)
    LOC91948 tattaccatgaacttt[A/G]gtaaaagttacaaata
    02 rs8024630 15 q 826.2 SPATA8| 98034118 4.66E-05 1.14 0.526 0.494 A (SEQ ID NO: 1129)
    LOC91948 ttagaaaatctataac[A/G]gtaaaaagtacattag
    03 rs12910816 15 q 826.2 SPATA8| 98249133 2.76E-04 1.26 0.065 0.052 C (SEQ ID NO: 1130)
    LOC91948 aaaacctctcacatga[A/C]taagcttacaaaatag
    03 rs8041786 15 q q26.2 SPATA8| 97896453 8.59E-04 1.18 0.112 0.096 G (SEQ ID NO: 1131)
    LOC91948 ttctatagcagacatt[A/G]gtctctgaacttgggt
    02 exm1193980 15 q q26.3 LRRK1 101567912 8.37E-13 Inf 0.005 0.000 A (SEQ ID NO: 1132)
    ccgcagccgggacgac[A/G]acgtgcagtacctgac
    02 rs7173796 15 q q26.3 PCSK6|TM2D3 102148666 1.66E-05 1.22 0.134 0.113 A (SEQ ID NO: 1133)
    ggcaggcagggaacag[A/G]tgattagtaaccaaag
    01 exm1194576 15 q q26.3 TM2D3 102192537 1.63E-21 46.41 0.013 0.000 C (SEQ ID NO: 1134)
    ggtgctcccgctgagg[C/G]gcctccgcgccttgtg
    03 rs1132812 16 p p11.2 CORO1A 30198151 2.94E-04 0.89 0.438 0.466 A (SEQ ID NO: 1135)
    aggtgtgggagatccc[A/G]gatgggggcctgatgc
    03 rs11859842 16 p p11.2 SLC7A5P1| 29661217 1.65E-04 1.13 0.497 0.467 A (SEQ ID NO: 1136)
    SPN cagcaaagtctgacca[A/G]tctaaagtaaccactc
    02 rs12447415 16 p p11.2 SPN|QPRT 29682945 5.03E-06 1.11 0.412 0.386 A (SEQ ID NO: 1137)
    agggacccttctaaaa[A/G]gtcactgtgggctggg
    02 rs2343605 16 p p12.1 TNRC6A| 24848663 1.33E-05 0.91 0.369 0.392 G (SEQ ID NO: 1138)
    SLC5A11 gagaccagcctacgca[A/G]catagaacctgtctct
    03 rs7200734 16 p p12.3 XYLT1 17443547 1.00E-02 1.08 0.495 0.475 A (SEQ ID NO: 1139)
    agtaatacttcccata[A/C]gagatagttgtgaaat
    02 exm1219737 16 p p13.11 KIAA0430 15729650 1.26E-07 Inf 0.003 0.000 A (SEQ ID NO: 1140)
    ttctgatttcacaagc[A/G]gggctccagggcattt
    03 rs1541702 16 p p13.13 C16orf75 11445552 2.32E-02 1.11 0.140 0.128 G (SEQ ID NO: 1141)
    tctacaaccatgtcag[A/G]acacaatctaactcct
    03 rs434762 16 p p13.13 GSPT1 12009781 4.81E-04 1.24 0.069 0.056 G (SEQ ID NO: 1142)
    cagaggcggcggcggc[A/G]gcagctcaaccctcct
    03 rs7204004 16 p p13.2 C16orf72| 9332745 2.64E-04 0.86 0.168 0.190 A (SEQ ID NO: 1143)
    GRIN2A ctcccctgacccaggt[A/G]aggcagtgagtacccc
    02 rs12443943 16 p p13.2 GRIN2A| 10428747 2.59E-05 1.15 0.236 0.212 G (SEQ ID NO: 1144)
    LOC100287628 atgtcctctggagcac[A/G]ccccacagcaagttgg
    02 exm1215795 16 p p13.3 ALG1 5122041 2.22E-15 16.45 0.008 0.001 A (SEQ ID NO: 1145)
    cacggcttctcggtga[A/C]cctcctggggttctgc
    02 exm1207746 16 p p13.3 C16orf59 2512728 1.48E-14 Inf 0.005 0.000 A (SEQ ID NO: 1146)
    aggctgcaggagctgc[A/G]tgcaggtgagaccccg
    02 rs2171226 16 p p13.3 LOC650177| 5588451 1.22E-06 0.88 0.427 0.458 A (SEQ ID NO: 1147)
    A2BP1 atcctcctcatttttc[A/G]tctaaaagccttagtc
    03 rs2294619 16 p p13.3 MAPK8IP3 1814440 1.89E-03 1.13 0.200 0.181 G (SEQ ID NO: 1148)
    gcccaagagcgcccac[A/G]cgtctcccgagaagaa
    03 rs3211995 16 p p13.3 SLC9A3R2 2089006 4.89E-04 1.15 0.187 0.166 A (SEQ ID NO: 1149)
    gcatgcgcgctctcag[A/G]ataaacaggccctgcc
    02 exm1211849 16 p p13.3 SLX4 3640815 8.05E-11 43.93 0.005 0.000 C (SEQ ID NO: 1150)
    aggggcacggggagca[C/G]aggcccctgagcagga
    03 rs13334798 16 q q12.1 ABCC11 48244717 5.74E-05 1.18 0.080 0.069 G (SEQ ID NO: 1151)
    aaaattcaaatttttc[A/G]tggagggcaaacacag
    03 rs7194667 16 q q12.1 ABCC11 48242898 5.35E-05 1.18 0.080 0.068 C (SEQ ID NO: 1152)
    cccatcccctcagctt[A/C]tattctgagctcaatg
    03 rs3910446 16 q q12.1 LOC388276| 52196841 1.68E-03 1.11 0.369 0.345 A (SEQ ID NO: 1153)
    TOX3 gagtcacagtgatggc[A/G]acccggtattctcagc
    03 rs8052698 16 q q12.2 TOX3|CHD9 52967995 3.62E-04 1.12 0.474 0.446 A (SEQ ID NO: 1154)
    tgcgccatcatgccct[A/G]cgcatttcatttaaat
    03 rs4784181 16 q q21 CDH8|CDH11 62346479 8.70E-03 0.92 0.410 0.431 A (SEQ ID NO: 1155)
    atgagcatgtgatcca[A/G]tgatagtcaatgaaat
    03 rs11861466 16 q q21 GOT2| 59495475 7.02E-03 1.09 0.434 0.413 A (SEQ ID NO: 1156)
    LOC644649 gtcaaaaaaagcatca[A/G]taaataagtagagagt
    03 rs1582600 16 q q21 GOT2| 59314789 1.09E-02 1.09 0.397 0.378 C (SEQ ID NO: 1157)
    LOC644649 taaatgtagtcatggc[A/C]gaaagctgagtgggtg
    03 rs1364204 16 q q21 GOT2| 59411217 1.77E-02 1.08 0.385 0.367 A (SEQ ID NO: 1158)
    LOC644649 tgatcaggttttgggc[A/G]agggtctgcttttttg
    02 rs7193968 16 q q22.1 IL34 70672952 4.90E-03 0.88 0.443 0.474 C (SEQ ID NO: 1159)
    tgccagctttacaagc[C/G]acagaatcaccaaaac
    02 rs4149499 16 q q22.2 CHST4 71570413 5.95E-06 1.36 0.057 0.042 A (SEQ ID NO: 1160)
    caacaatggcaccagt[A/C]cttctccaaatcattt
    03 rs150617 16 q q22.2 DHX38 72139396 1.82E-04 1.20 0.124 0.106 A (SEQ ID NO: 1161)
    gagcaggacatacagg[A/G]agggaaaaatgagtcc
    03 rs4788591 16 q q22.2 PKD1L3 72020323 1.51E-02 1.09 0.233 0.218 A (SEQ ID NO: 1162)
    tgtgatgtgatacttg[A/G]tagtactgaaggaaac
    03 rs152828 16 q q22.2 TXNL4B 72123886 1.93E-04 1.20 0.123 0.105 A (SEQ ID NO: 1163)
    tctaccctcagtcata[A/G]gcaggaggaaatacca
    02 exm1257256 16 q q22.2 ZFHX3 72821344 2.06E-15 5.63 0.015 0.003 A (SEQ ID NO: 1164)
    gacttcctggaggcgt[A/G]gggggaagcggaggag
    03 rs12102460 16 q q23.1 WWOX 79093317 6.10E-03 1.30 0.028 0.022 G (SEQ ID NO: 1165)
    tgagatgtagagcttg[A/G]cacctgcatataaagt
    02 rs9923563 16 q q23.1 WWOX 78615460 3.64E-05 1.16 0.262 0.234 G (SEQ ID NO: 1166)
    ttcctagaggttcaca[A/G]taaatctaaaaagatc
    02 rs12598440 16 q q23.1 WWOX 78576107 1.74E-05 1.14 0.508 0.474 G (SEQ ID NO: 1167)
    tccggcagtgtttacg[A/G]agggctggagatacac
    02 rs11150085 16 q q23.1 WWOX 78567094 1.50E-05 1.22 0.117 0.098 A (SEQ ID NO: 1168)
    caggtcagccagttgg[A/G]aacagagttgacggag
    03 rs2943768 16 q q23.1 WWOX 78612914 1.77E-03 1.13 0.206 0.187 C (SEQ ID NO: 1169)
    ttacattatacatctt[A/C]ggcatttttttccttt
    01 rs4319778 16 q q23.1 WWOX 78552954 1.99E-06 1.16 0.423 0.387 A (SEQ ID NO: 1170)
    tttctaatttaatctt[A/G]tacatgagacagctat
    02 rs2978632 16 q q23.1 WWOX 78559880 7.70E-05 1.14 0.341 0.312 A (SEQ ID NO: 1171)
    gcagataggatgatac[A/G]tgtgctctgcaaccat
    03 rs16947885 16 q q23.1 WWOX 78551317 3.56E-04 1.24 0.077 0.064 G (SEQ ID NO: 1172)
    caccagaactgaaatt[A/G]tttccagctatgttta
    03 rs30405 16 q q23.2 LOC729251| 79621818 9.13E-04 0.87 0.181 0.202 G (SEQ ID NO: 1173)
    MAF gaacacagaaactgca[A/G]tggcttttggacgcta
    01 rs30428 16 q q23.2 LOC729251| 79598399 2.68E-06 0.86 0.349 0.384 G (SEQ ID NO: 1174)
    MAF cttcttccatcaggga[A/G]gttatcaggctcaaag
    03 rs3784925 16 q q23.2 LOC729251| 79605583 2.50E-04 1.16 0.189 0.167 A (SEQ ID NO: 1175)
    MAF atcctctgctctccta[A/G]gttcaggcaggataga
    03 rs173645 16 q q23.2 LOC729251| 79594409 5.42E-04 0.88 0.243 0.267 G (SEQ ID NO: 1176)
    MAF caaaccattgcatcat[A/G]ttttggactgatagtt
    03 rs7206458 16 q q23.3 CDH13 83446995 3.30E-04 1.13 0.284 0.259 A (SEQ ID NO: 1177)
    ttccccaattattatc[A/C]gtcactcctcctccat
    02 rs1013465 16 q q23.3 CDH13 83412113 2.31E-05 1.14 0.406 0.375 A (SEQ ID NO: 1178)
    tggccaatccaactga[A/C]ggggacccctttattg
    02 exml263172 16 q q23.3 OSGIN1 83999431 1.18E-07 Inf 0.003 0.000 G (SEQ ID NO: 1179)
    gcagtggatcctgacc[A/G]gccgctgagcgccaag
    03 rs13521 16 q q24.1 COTL1 84599970 5.86E-04 0.88 0.263 0.287 A (SEQ ID NO: 1180)
    gccaggagctgtgccc[A/G]gtgcctgcagccttca
    03 rs11641616 16 q q24.1 FOXL1| 86638543 6.76E-04 1.24 0.070 0.057 A (SEQ ID NO: 1181)
    LOC100288525 ttaatcaaatatcggg[A/G]ttaaagaatgtatcaa
    03 rs7202350 16 q q24.1 FOXL1| 86642680 1.37E-03 1.22 0.070 0.058 G (SEQ ID NO: 1182)
    LOC100288525 gcagccccagcaggaa[A/G]gacacgataatcgatt
    03 rs11642168 16 q q24.1 L00732275| 86520474 4.54E-03 1.13 0.152 0.136 A (SEQ ID NO: 1183)
    FOXF1 aaggggaaacggagcc[A/G]gccaaggacaggtgaa
    03 rs7186320 16 q q24.1 TMEM148| 85577092 9.13E-05 0.79 0.052 0.065 A (SEQ ID NO: 1184)
    KIAA0182 acatggggaatggggt[A/G]tggactctatggggtg
    03 rs2274892 17 p p11.2 TNFRSF13B 16852027 1.23E-04 1.13 0.400 0.370 C (SEQ ID NO: 1185)
    cccaaggcaaacctgc[A/C]tggtgtcacgcagggt
    03 rs17793572 17 p p11.2 TNFRSF13B 16843992 5.67E-01 1.02 0.292 0.288 A (SEQ ID NO: 1186)
    tgctctctggatcctg[A/G]aggaagttgatccact
    03 rs4792801 17 p p11.2 TNFRSF13B 16845467 6.12E-05 1.11 0.438 0.412 G (SEQ ID NO: 1187)
    caggtcctcaaaaaac[A/G]aaacagagctattatg
    03 rs8072293 17 p p11.2 TNFRSF13B 16855878 1.02E-03 1.12 0.278 0.255 G (SEQ ID NO: 1188)
    cacagggcctgtggac[A/G]ggggtggctatgagat
    02 rs7223652 17 p p11.2 TNFRSF13B 16864559 3.60E-05 1.22 0.325 0.283 G (SEQ ID NO: 1189)
    gttcttttggatgttt[G/A]cttaggagtggaatta
    03 rs7504096 17 p p11.2 TNFRSF13B| 16877083 2.25E-04 1.15 0.216 0.192 A (SEQ ID NO: 1190)
    MPRIP caggccagagccagga[A/G]tctattgcacagttaa
    02 rs4441330 17 p p11.2 ZNF286B 18562720 1.22E-05 1.12 0.513 0.485 G (SEQ ID NO: 1191)
    cattcatcaagaagtc[A/G]gataaagggtttaaac
    02 rs11078211 17 p p12 HS3ST3A1| 13836036 7.83E-05 1.15 0.297 0.270 A (SEQ ID NO: 1192)
    CDRT15P ttaactcctttcaaac[A/G]atttcctttgtatctt
    03 rs10852926 17 p p12 PIRT|FLJ45455 10778976 2.25E-01 1.04 0.494 0.484 A (SEQ ID NO: 1193)
    aaatagagacacagcc[A/G]gagtgctggctatgac
    02 rs179521 17 p p12 PMP22|TEKT3 15173221 9.82E-05 1.13 0.387 0.357 A (SEQ ID NO: 1194)
    catctctgagttcctg[A/C]accacttatcaagtgt
    02 rs8068414 17 p p12 TEKT3| 15248449 9.77E-05 1.15 0.289 0.262 A (SEQ ID NO: 1195)
    LOC100287829 gggagtgtggacacgg[A/G]gctgcactgccaggct
    02 rs11078672 17 p p13.1 EIF5A 7215142 5.26E-05 0.87 0.306 0.336 A (SEQ ID NO: 1196)
    ctctctcctacctagg[A/G]tggcggtggtggcagc
    03 rs8072788 17 p p13.2 NLRP1| 5594285 8.70E-03 1.11 0.200 0.184 A (SEQ ID NO: 1197)
    WSCD1 aaataaaggcctgtgg[A/G]cctcagtttcctgtgt
    02 rs17804008 17 p p13.2 PITPNM3 6433659 6.08E-06 1.12 0.369 0.344 G (SEQ ID NO: 1198)
    ctgaccctgactttga[A/G]atttcgtctgtaaaat
    03 rs907941 17 p p13.2 PITPNM3 6362387 3.70E-04 0.89 0.433 0.461 G (SEQ ID NO: 1199)
    ggagcagcccctcttc[A/G]tctggcccttccacct
    03 rs11078612 17 p p13.2 WSCD1|AIPL1 6067298 8.12E-03 0.87 0.101 0.114 G (SEQ ID NO: 1200)
    tattgctcattttttt[A/G]tagatgaggaaactgc
    03 rs9894371 17 p p13.2 WSCD1|AIPL1 6212579 1.92E-03 0.91 0.475 0.499 G (SEQ ID NO: 1201)
    ccttgtcttagttcca[A/G]acgtctccctctgtga
    03 rs8078781 17 p p13.3 OR1D2|OR1G1 3008882 8.67E-05 1.16 0.082 0.072 A (SEQ ID NO: 1202)
    aacaccatacagcaat[A/G]agcatgaacaacctac
    03 rs9902340 17 q q11.2 CCDC55 28476458 3.06E-02 1.07 0.503 0.486 C (SEQ ID NO: 1203)
    gcaatcttactcctct[A/C]tgataacaaatagatc
    03 rs11080118 17 q q11.2 CCDC55 28475379 3.31E-02 1.07 0.502 0.486 A (SEQ ID NO: 1204)
    ctatgtctataagtgg[A/G]aaaggctttgtttatt
    03 rs9896012 17 q q11.2 CCDC55 28470091 3.12E-02 1.07 0.503 0.486 G (SEQ ID NO: 1205)
    gaagcagatgtgtatg[A/G]ttttggagaaacagaa
    03 rs9897794 17 q q11.2 EFCAB5 28296327 2.57E-02 1.07 0.507 0.489 C (SEQ ID NO: 1206)
    gtgacttctttcatca[A/C]cctctggtaaccagac
    03 rs3102555 17 q q11.2 SSH2 28044101 5.26E-03 0.92 0.464 0.486 G (SEQ ID NO: 1207)
    tctctgttttaagggc[A/G]gtggatagggtagggt
    03 rs10445384 17 q q11.2 SSH2|EFCAB5 28182685 1.59E-02 1.08 0.503 0.484 G (SEQ ID NO: 1208)
    tccttagttggatcag[A/G]cacagactatgaaatt
    03 rs10445400 17 q q11.2 SSH2|EFCAB5 28183059 1.33E-02 1.08 0.504 0.485 G (SEQ ID NO: 1209)
    gatgaggtctgtgcat[A/G]ctcctttccccatcaa
    03 rs7219163 17 q q11.2 SSH2|EFCAB5 28210703 1.11E-02 0.92 0.466 0.486 A (SEQ ID NO: 1210)
    ttaattctcttcctgg[A/C]cagcctaacttctcct
    03 rs9914342 17 q q12 FLJ43826 37190141 5.71E-04 0.88 0.238 0.262 G (SEQ ID NO: 1211)
    gtaaggactttatcca[A/G]aatcacttatgtgtct
    03 rs8070269 17 q q12 MRM1|LHX1 35134033 3.98E-03 1.14 0.146 0.130 A (SEQ ID NO: 1212)
    tgatagccatcaccca[A/G]ggagaatggtgaaaga
    02 rs3744474 17 q q21.31 CIQL1|DCAKD 43100070 2.70E-05 1.12 0.219 0.199 G (SEQ ID NO: 1213)
    ggatgtgtaagaccct[A/G]tagttaacataacact
    03 rs4793598 17 q q21.32 HOXB9|FRAC 46743914 7.15E-05 1.11 0.387 0.362 G (SEQ ID NO: 1214)
    tgctgaactttgtcct[A/G]gcatataattagttac
    02 rs12453356 17 q q22 TMEM100 53808950 4.16E-05 1.50 0.027 0.018 C (SEQ ID NO: 1215)
    tagctaacactactac[A/C]caagctaccagaacag
    03 rs10512502 17 q q23.3 DDX5 62495009 2.05E-03 1.21 0.071 0.059 A (SEQ ID NO: 1216)
    taatgactaatcagga[A/G]gcaacgtaaccaaaag
    02 exm1345526 17 q q23.3 SCN4A 62028920 7.02E-18 9.29 0.033 0.002 C (SEQ ID NO: 1217)
    gacggccccccatcca[C/G]cctcgagctggaccac
    02 exm1345636 17 q q23.3 SCN4A 62049749 1.33E-12 5.07 0.013 0.003 A (SEQ ID NO: 1218)
    gctgagccccttcagc[A/G]tagtcaggcgcggggc
    03 rs7218921 17 q q24.1 GNA13|RGS9 63068976 3.64E-04 0.89 0.461 0.489 A (SEQ ID NO: 1219)
    tcatgtcctaaccaac[A/G]gaatcaccctggttcc
    03 rs2907373 17 q q24.2 FAM20A 66533655 1.19E-04 1.13 0.372 0.343 A (SEQ ID NO: 1220)
    gccagagtctggggcc[A/G]actgttccactgggcc
    02 rs8076465 17 q q24.2 PRKAR1A 66513025 3.83E-05 1.13 0.372 0.343 A (SEQ ID NO: 1221)
    ttttgaagtcaagtgc[A/G]ttcctggagatccggt
    02 rs8080306 17 q q24.2 PRKAR1A 66508243 1.62E-05 1.16 0.314 0.284 C (SEQ ID NO: 1222)
    gagagcgaagagcagg[A/C]ggaggaacaaaggcag
    03 rs2952275 17 q q24.2 PRKAR1A 66518663 1.33E-04 1.13 0.372 0.344 A (SEQ ID NO: 1223)
    atggcttgtactaatg[A/G]cttttgcccattaata
    02 rs2302782 17 q q24.2 WIPI1 66446803 8.10E-05 1.14 0.334 0.306 G (SEQ ID NO: 1224)
    aaacaaaaagatggac[A/G]tctttcaagatcaatg
    03 rs2952291 17 q q24.2 WIPI1| 66460984 1.20E-04 1.14 0.327 0.299 G (SEQ ID NO: 1225)
    PRKAR1A ctattatgaaattctg[A/G]gtctaaagacattgca
    03 rs16969749 17 q q25.2 SEC14L1 75192907 2.88E-03 0.87 0.127 0.143 A (SEQ ID NO: 1226)
    ctaattctgtcagcct[A/G]cttactagaaaccaaa
    03 rs4969170 17 q q25.3 SOCS3|PGS1 76360538 7.40E-03 1.09 0.358 0.338 A (SEQ ID NO: 1227)
    gtttttagagaccaca[A/G]cctgctttcttctaga
    02 rs9957245 18 p p11.21 LOC100131500| 15102421 1.26E-03 1.21 0.188 0.161 A (SEQ ID NO: 1228)
    LOC644669 tcctaaaaggtttcac[G/A]tcaagcataagtttct
    03 rs1852893 18 p p11.21 LOC100131500| 15082789 1.12E-04 1.14 0.282 0.256 G (SEQ ID NO: 1229)
    LOC644669 attatctggagtcagg[A/G]ttcttctttagcagtg
    02 rs1893187 18 p p11.22 VAPA| 10295300 2.33E-06 1.20 0.170 0.146 A (SEQ ID NO: 1230)
    APCDD1 actcaccttgtcatca[A/G]aagagaaaggaccatg
    03 rs206475 18 p p11.22 VAPA| 10295284 4.30E-04 0.89 0.444 0.472 A (SEQ ID NO: 1231)
    APCDD1 gggcactaggtgccac[A/G]ctcaccttgtcatcag
    03 rs206470 18 p p11.22 VAPA| 10296623 5.55E-04 0.89 0.316 0.341 A (SEQ ID NO: 1232)
    APCDD1 cattactcagaattat[A/G]tctggagcaaataaca
    02 rs189982 18 p p11.22 VAPA| 10302384 1.52E-05 1.20 0.157 0.135 A (SEQ ID NO: 1233)
    APCDD1 cttacaccatgtttct[A/G]tcagtatcaaacaaag
    02 rs11080401 18 p p11.22 VAPA| 10304345 2.69E-06 1.20 0.177 0.153 A (SEQ ID NO: 1234)
    APCDD1 ggtttggagtctgatc[A/G]cttggattctggcagg
    03 rs475001 18 p p11.32 C18orf2| 2192946 8.65E-03 1.15 0.102 0.090 A (SEQ ID NO: 1235)
    METTL4 ttcatttgaatgaaac[A/G]ggtcactttaaaaatt
    03 rs1507732 18 p p11.32 C18orf2| 1464859 1.29E-03 1.14 0.181 0.162 A (SEQ ID NO: 1236)
    METTL4 ctgcaaagttccatta[A/G]aaagatggtggacaaa
    03 rs561312 18 p p11.32 C18orf2| 2194248 7.75E-03 1.15 0.103 0.091 A (SEQ ID NO: 1237)
    METTL4 cctgtgcctgagatga[A/G]gcaggaatctccaggg
    03 rs2419027 18 q q12.1 CDH2|DSC3 27785716 4.67E-03 1.09 0.493 0.470 A (SEQ ID NO: 1238)
    tttacttttggcctcc[A/G]ttgacccagatgggga
    03 rs954640 18 q q12.1 CDH2|DSC3 27688654 1.89E-03 1.10 0.475 0.451 A (SEQ ID NO: 1239)
    tttacagatactgact[A/G]cataaaacaacaatcc
    03 rs9967020 18 q q12.1 CDH2|DSC3 27681568 5.95E-03 1.09 0.492 0.471 A (SEQ ID NO: 1240)
    caaaaggacgtactgc[A/G]tgatgctaatttataa
    03 rs8090231 18 q q12.1 CDH2|DSC3 27755950 3.86E-03 1.10 0.468 0.446 A (SEQ ID NO: 1241)
    acagacttaagtgaag[A/G]cccgcattcctacttt
    03 rs12456839 18 q q12.1 CDH2|DSC3 25895735 2.66E-03 0.89 0.218 0.238 A (SEQ ID NO: 1242)
    aagctaggagcalttt[A/G]aatatgtatttctgga
    03 rs11564361 18 q q12.1 CDH2|DSC3 25904868 2.12E-03 0.89 0.217 0.238 G (SEQ ID NO: 1243)
    aacactagttgagtaa[A/G]tggatacaattgaggt
    03 rs9952363 18 q q12.1 CDH2|DSC3 27690198 6.81E-04 1.11 0.479 0.452 A (SEQ ID NO: 1244)
    ctagacctactgccat[A/G]agttttgtaagacaca
    03 rs12967345 18 q q12.1 CDH2|DSC3 27758155 2.29E-03 1.12 0.221 0.202 G (SEQ ID NO: 1245)
    caggacaggcaacaca[A/G]taacttgatacaaaag
    03 rs8094149 18 q q12.2 BRUNOL4 34979873 2.11E-04 0.89 0.365 0.394 C (SEQ ID NO: 1246)
    agtgaggctcatctgc[A/C]tgggtgagaagcgaaa
    03 rs1511938 18 q q12.2 BRUNOL4| 35967920 8.63E-04 0.90 0.461 0.488 G (SEQ ID NO: 1247)
    LOC647946 atgctgtagccacttg[A/G]taacatctttcttgaa
    03 rs12604671 18 q q12.2 BRUNOL4| 36039666 4.68E-04 1.12 0.343 0.318 A (SEQ ID NO: 1248)
    LOC647946 aacgacttggaaatag[A/G]ctataaatgtagaagg
    03 rs2625068 18 q q12.2 LOC647946 37172774 1.34E-04 0.88 0.337 0.366 A (SEQ ID NO: 1249)
    tttaatttaaaataat[A/C]acattctggggtgcca
    02 rs10502725 18 q q12.2 LOC647946 37111762 4.65E-05 0.88 0.365 0.396 A (SEQ ID NO: 1250)
    ccaatgacataatatc[A/C]gaccttaaaaaaatga
    03 rs2852346 18 q q12.2 LOC647946 37194499 7.92E-04 0.90 0.475 0.501 A (SEQ ID NO: 1251)
    caggtcttatttcttc[A/G]tttacgttatgtgaaa
    03 rs2255757 18 q q12.3 LOC100131669| 42958392 1.63E-03 1.11 0.416 0.392 C (SEQ ID NO: 1252)
    SLC14A2 gccatcccctatctct[A/C]ttgaaaactgacttca
    03 rs2726262 18 q q12.3 LOC647946 37200183 1.99E-04 0.89 0.351 0.379 A (SEQ ID NO: 1253)
    cctctcccatgatcca[A/G]tcatctctccccaggc
    03 rs2726267 18 q q12.3 LOC647946 37208969 2.06E-04 0.88 0.338 0.366 C (SEQ ID NO: 1254)
    gtattcaaatcttggc[A/C]aatatccaactagcaa
    03 rs2726232 18 q q12.3 LOC647946 37212167 3.33E-04 0.89 0.465 0.493 G (SEQ ID NO: 1255)
    gaagaatgaatgtctt[A/G]ggatacaattaagtga
    02 rs10163756 18 q q12.3 LOC6479461 38325874 7.90E-05 1.18 0.171 0.148 C (SEQ ID NO: 1256)
    KC6 aaaccattacataggt[A/C]tcaaaatccaaatatt
    03 rs981500 18 q q12.3 LOC6479461 38024748 5.32E-04 1.17 0.151 0.133 C (SEQ ID NO: 1257)
    KC6 aaacattttccagagt[A/C]aagaaagagtagaaaa
    03 rs16973432 18 q q12.3 LOC6479461 38041069 5.69E-04 1.16 0.151 0.133 C (SEQ ID NO: 1258)
    KC6 gtcattttatgagtga[A/C]aaaaagaaacaaatgg
    03 rs4799515 18 q q12.3 LOC6479461 37387509 9.04E-04 0.90 0.429 0.455 A (SEQ ID NO: 1259)
    KC6 aagcaatcctagctgg[A/G]gtagagctggcatttt
    03 rs12455503 18 q q12.3 LOC6479461 37373687 4.31E-04 0.89 0.340 0.367 G (SEQ ID NO: 1260)
    KC6 aacacaatggggttga[A/G]catcacctcatattca
    03 rs10502850 18 q q12.3 SETBP1 42589714 1.87E-04 1.28 0.060 0.048 A (SEQ ID NO: 1261)
    acctgttctgtttgat[A/G]tgcagactgaggctca
    02 exm1386239 18 q q21.1 C18ORF32 47008746 1.26E-07 Inf 0.003 0.000 A (SEQ ID NO: 1262)
    atcacagatttctgtt[A/G]gtccttttgttggtaa
    03 rs16949181 18 q q21.1 LOC647055 45945536 1.16E-03 0.90 0.444 0.470 G (SEQ ID NO: 1263)
    ttccaggtcccctttc[A/G]cttcctgtgctgttgc
    03 rs1377016 18 q q21.1 LOXHD| 44063598 1.14E-02 0.92 0.314 0.333 A (SEQ ID NO: 1264)
    ggtcttgacatgccag[A/G]caagttctctcttgggg
    03 rs10502876 18 q q21.1 LOXHD1| 44257422 4.14E-04 0.73 0.032 0.043 A (SEQ ID NO: 1265)
    ST8SIA5 agggaaagtgcttaac[A/G]tagcttgataaatgct
    03 rs17681615 18 q q21.2 DCC 50124619 2.09E-03 0.90 0.316 0.339 A (SEQ ID NO: 1266)
    cattatactaaatacc[A/G]aggttaagagaataaa
    03 rs9964201 18 q q21.2 DCC 50600552 1.82E-02 1.14 0.092 0.082 A (SEQ ID NO: 1267)
    agttactatgatttaa[A/C]tgtttcattgtgttta
    03 rs12327270 18 q q21.2 TCF4 53168073 5.79E-05 1.11 0.065 0.058 G (SEQ ID NO: 1268)
    gcttcattatatcaca[A/G]agaatgagctcaaata
    03 rs1506647 18 q q21.31 TCF4|TXNL1 54136314 1.01E-03 1.28 0.047 0.037 A (SEQ ID NO: 1269)
    ctacctttaagaaaca[A/G]gataaaaaataatgat
    02 rs1469488 18 q q21.32 CCBE1 57228450 6.44E-05 1.26 0.085 0.069 A (SEQ ID NO: 1270)
    gcttttgggtacacag[A/G]cccattacatacatga
    02 rs2332079 18 q q21.32 LOC728111| 58594189 4.68E-05 0.90 0.416 0.443 G (SEQ ID NO: 1271)
    CDH20 ccaatttcctttaaaa[A/G]agaggcttctgaaatt
    02 rs17609410 18 q q21.32 LOC728111| 58563363 111E-05 0.90 0.386 0.412 A (SEQ ID NO: 1272)
    CDH20 atagcacctctttctg[A/C]agctctcgggactctt
    02 rs1979787 18 q q21.32 LOC728111| 58684971 2.68E-05 0.88 0.407 0.438 G (SEQ ID NO: 1273)
    CDH20 tcctaactgtctaact[A/G]tatgaattccaaaagt
    02 rs2332197 18 q q21.32 LOC728111| 58717342 1.65E-05 0.88 0.406 0.436 A (SEQ ID NO: 1274)
    CDH20 ttaaggcagaacaatc[A/G]tcatatctgttcagga
    03 rs2850768 18 q q21.33 KDSR 61001410 6.16E-03 0.90 0.190 0.208 G (SEQ ID NO: 1275)
    tacattacagaatgaa[A/G]agaaaagagggcttgg
    03 rs12969516 18 q q22.2 SOCS6|CBLN2 68518485 6.27E-03 0.92 0.445 0.466 G (SEQ ID NO: 1276)
    gcttgagctctclttt[A/G]aggattcatctttgac
    03 rs7235677 18 q q22.2 SOCS6|CBLN2 68552596 1.23E-03 1.14 0.200 0.181 G (SEQ ID NO: 1277)
    agaggttgcaagcaca[A/G]gtatttgacacactgt
    03 rs4555235 18 q q22.3 LOC100289370| 71071370 6.68E-03 1.09 0.504 0.483 A (SEQ ID NO: 1278)
    FBX015 tctctggctttaaaca[A/G]aaagatgactaaaact
    02 exm1392554 18 q q22.3 TIMM21 71816278 3.44E-17 3.66 0.026 0.007 A (SEQ ID NO: 1279)
    aaaagcaaaggaggat[A/G]gcagcaaacaagtgtc
    03 rs8084536 18 q q23 FLJ44313| 74227791 1.30E-03 1.11 0.417 0.392 G (SEQ ID NO: 1280)
    LOC284276 cccaccagcagtatac[A/G]aggcttctcatttcac
    03 rs4891030 18 q q23 LOC284276| 74295607 3.91E-03 0.89 0.196 0.214 G (SEQ ID NO: 1281)
    FLJ44881 agagaaataagtggat[A/G]taacagagtggatctg
    03 rs11874114 18 q q23 MBP 74699134 1.41E-03 1.23 0.062 0.051 A (SEQ ID NO: 1282)
    agtggactttggggcc[A/G]tcgtgccggatcctcc
    03 rs8086634 18 q q23 MBP 74701192 2.52E-04 1.23 0.087 0.072 A (SEQ ID NO: 1283)
    cgctactcctagcccc[A/G]gaaagggctcacggtg
    03 rs11669407 19 p p13.11 CHERP| 16654444 2.29E-02 0.90 0.142 0.155 A (SEQ ID NO: 1284)
    SLC35E1 aggaggcaagatcaag[A/G]atttttttttttctaa
    02 exm1442461 19 p p13.11 SLC27A1 17597661 2.51E-20 7.24 0.017 0.002 A (SEQ ID NO: 1285)
    agcagcgcggcctcca[A/T]gcccgccttggccagg
    03 rs794084 19 p p13.2 XAB2 7692058 4.63E-04 1.12 0.422 0.395 G (SEQ ID NO: 1286)
    ctgggtgacatcctac[A/G]cggagctagtgtcaca
    02 exm1400852 19 p p13.3 APC2 1468696 1.17E-07 Inf 0.003 0.000 A (SEQ ID NO: 1287)
    ctgggcacggggtgcc[A/G]ggctggggacgtagat
    02 rs313784 19 p p13.3 BRUNOL5 3293593 1.27E-05 0.90 0.232 0.252 A (SEQ ID NO: 1288)
    ggtggggtgatgcttc[A/G]agaggctacaagaaac
    03 rs1610045 19 p p13.3 BTBD2 1997363 1.61E-04 0.88 0.300 0.328 G (SEQ ID NO: 1289)
    gcagtgcgaggaaggc[A/G]gcgggttccacgtcgg
    03 rs12976454 19 p p13.3 C19orf28 3544971 5.02E-04 1.13 0.312 0.288 A (SEQ ID NO: 1290)
    cgggggggtggtaccc[A/G]cggtgcctactcatcc
    03 rs3916080 19 p p13.3 FUT6 5832899 2.02E-03 0.90 0.345 0.369 A (SEQ ID NO: 1291)
    ccttttctggtgtgtc[A/C]ccagactcttcctcaa
    03 rs11878982 19 p p13.3 KDM4B 5041049 1.37E-04 1.15 0.252 0.227 A (SEQ ID NO: 1292)
    cacccatgaaagaggc[A/G]ggaggggctctgctcc
    02 rs33938520 19 p p13.3 KDM4B 4984588 4.40E-05 1.15 0.292 0.264 A (SEQ ID NO: 1293)
    acctgacgaggcgtac[A/G]gaacaggccggaacag
    03 rs4805077 19 q q13.11 LSM14A| 34742705 2.08E-02 1.08 0.381 0.363 G (SEQ ID NO: 1294)
    KIAA0355 ttccagtgtgaacatg[A/G]catcaaagaagaggca
    03 rs6510478 19 q q13.12 CD22 35834621 2.20E-04 0.87 0.234 0.260 G (SEQ ID NO: 1295)
    cccacacctcatagca[A/G]gatctcatctctacaa
    03 rs7251526 19 q q13.12 CD22 35829513 4.64E-03 0.90 0.263 0.283 A (SEQ ID NO: 1296)
    aaaacaagcatctacc[A/G]agcaccctccatgagc
    02 rs4806152 19 q q13.12 FFAR3| 35886660 5.27E-06 0.84 0.204 0.235 C (SEQ ID NO: 1297)
    LOC100128682 caagtgagagcagata[A/C]ggcagcacagggattc
    03 rs11669734 19 q q13.12 MAG 35794775 1.41E-03 0.89 0.233 0.254 A (SEQ ID NO: 1298)
    cgatattccagaggga[A/G]ttgcttaaggaagggg
    02 exm1458802 19 q q13.12 WDR62 36546015 8.28E-18 5.91 0.017 0.003 A (SEQ ID NO: 1299)
    tcggaggccgtcgaga[A/G]tcgcgtccgccgccgt
    03 rs234341 19 q q13.2 PSMC4 40486136 1.29E-02 1.25 0.034 0.027 A (SEQ ID NO: 1300)
    ctaaggggtggttatc[A/G]tgacaggaaggaggta
    03 rs17289513 19 q q13.32 AP2S1|GRLF1 47412622 3.06E-03 0.85 0.087 0.101 A (SEQ ID NO: 1301)
    cagtagactttcaagg[A/G]ctagtaactcgcatgc
    02 exm1493646 19 q q13.33 MYH14 50747534 4.61E-24 95.05 0.010 0.000 A (SEQ ID NO: 1302)
    ttcaaggcaatgttgc[A/C]aaactggagaactgct
    03 rs10403102 19 q q13.33 TPRX1|CRX 48317892 4.87E-03 0.91 0.452 0.474 A (SEQ ID NO: 1303)
    aggtgtctgatcaacg[A/C]cctcagagatgacctg
    03 rs11881877 19 q q13.41 ZNF320| 53401760 1.11E-04 0.89 0.446 0.476 A (SEQ ID NO: 1304)
    LOC388559 gatttttaaaaaaagc[A/G]ttgacattgtaacagt
    03 rs6080719 20 p p12.1 BFSP1 17477592 5.89E-03 1.11 0.254 0.236 A (SEQ ID NO: 1305)
    tctcagcactggatcc[A/G]gtgggaaaggtaacgc
    03 rs1333400 20 p p12.1 BTBD3| 12693139 6.20E-04 1.11 0.522 0.495 G (SEQ ID NO: 1306)
    LOC100289040 catgcccagagtatgg[A/G]tatattgggggaatca
    02 rs1333383 20 p p12.1 BTBD3| 12710164 5.83E-05 0.88 0.384 0.415 A (SEQ ID NO: 1307)
    LOC100289040 attgaactgtaactta[A/C]acagagcaaacattgt
    03 rs4814155 20 p p12.1 BTBD3| 12708838 1.08E-04 0.88 0.374 0.403 G (SEQ ID NO: 1308)
    LOC100289040 gcctactaacagcaag[A/G]gcctttattaatattt
    02 rs6111020 20 p p12.1 KIF16B 16273832 7.40E-05 1.14 0.364 0.334 A (SEQ ID NO: 1309)
    acccatgggttctatc[A/G]atttctgccatatcct
    03 rs7263619 20 p p12.1 KIF16B 16447367 1.08E-02 0.91 0.204 0.220 A (SEQ ID NO: 1310)
    gtgtccacctgtatta[A/G]agtgttttcatgtgct
    03 rs7273594 20 p p12.1 KIF16B 16302535 3.12E-03 1.14 0.143 0.128 A (SEQ ID NO: 1311)
    cacagttttcccataa[A/G]agctcaaatatctttg
    03 rs6111005 20 p p12.1 KIF16B 16256912 1.64E-03 0.86 0.113 0.129 G (SEQ ID NO: 1312)
    gcctaaagggtataat[A/G]agaagagaagtaaaag
    03 rs6043962 20 p p12.1 KIF16B 16438733 6.11E-04 1.13 0.286 0.262 C (SEQ ID NO: 1313)
    ggctcacagcaaaact[A/C]taccgttttgatctgg
    03 rs8120353 20 p p12.1 KIF16B 16412764 1.15E-02 0.90 0.158 0.173 A (SEQ ID NO: 1314)
    gtcagatgggcctgat[A/G]tcaagataaggcctac
    03 rs1028539 20 p p12.1 KIF16B 16445463 3.42E-04 1.14 0.244 0.221 A (SEQ ID NO: 1315)
    tacttgcatcccaacc[A/G]cctaaaagtgttggtt
    03 rs8116503 20 p p12.1 KIF16B 16359650 8.91E-03 0.90 0.184 0.201 A (SEQ ID NO: 1316)
    tggagtccagagagaa[A/G]cagcagagagaggcgc
    03 rs6085463 20 p p12.3 FERMT1| 6252538 1.46E-02 0.92 0.388 0.407 A (SEQ ID NO: 1317)
    BMP2 cttcaacctcatgtta[A/G]atcagtacttataagc
    02 exml519568 20 p p13 TGM3 2297721 4.47E-11 Inf 0.004 0.000 A (SEQ ID NO: 1318)
    tctgcccagatcaata[A/G]caatgatgacaatggt
    03 rs4911107 20 q q11.21 DNMT3B 31374991 3.21E-03 0.91 0.378 0.401 A (SEQ ID NO: 1319)
    ttggtctctggtcacc[A/G]acatcctttgctctgg
    02 exm1534977 20 q q11.22 EIF252 32685262 1.32E-35 Inf 0.023 0.000 A (SEQ ID NO: 1320)
    tgagcctgcccaagca[A/G]ggcctgtctgattact
    03 rs8050 20 q q11.22 RBM12 34237224 3.52E-03 0.73 0.021 0.028 A (SEQ ID NO: 1321)
    ccatacctgtacacaa[A/C]cacagactccagtaaa
    02 rs16988087 20 q q12 LOC339568| 38087936 3.89E-05 1.21 0.136 0.115 A (SEQ ID NO: 1322)
    MAFB ctaaatcaaatgacaa[A/G]gagaaaagttagcttt
    03 rs7263998 20 q q12 LOC339568| 38022796 1.65E-04 1.19 0.135 0.116 A (SEQ ID NO: 1323)
    MAFB tctcttccccccacaa[A/G]gtcattttcttaattc
    03 rs6028507 20 q q12 LOC339568| 38181661 9.17E-04 1.14 0.187 0.168 G (SEQ ID NO: 1324)
    MAFB ccaagaaaaagtgccc[A/G]caagaaaaccaaaaca
    03 rs11697337 20 q q12 LOC339568| 38236027 1.06E-02 1.25 0.035 0.028 A (SEQ ID NO: 1325)
    MAFB cacagttactcaagtc[A/G]agaggcaaaaaaaaaa
    03 rs6101558 20 q q12 LOC339568| 38090963 8.72E-05 1.16 0.174 0.154 G (SEQ ID NO: 1326)
    MAFB tgtgactaaaccactc[A/G]tctgtttcccccactc
    02 rs13044948 20 q q12 LOC339568| 38062804 1.20E-05 1.23 0.132 0.110 A (SEQ ID NO: 1327)
    MAFB attaaatatatttttc[A/G]taataacccagctaga
    03 rs2207799 20 q q12 LOC339568| 38195894 1.99E-04 1.26 0.069 0.055 A (SEQ ID NO: 1328)
    MAFB tattaacattcataaa[A/C]cattcagacaattgct
    02 rs13036738 20 q q12 LOC339568| 38078988 1.64E-05 1.22 0.132 0.110 C (SEQ ID NO: 1329)
    MAFB tgcctatttctaaact[A/C]tgctggggaaagcagg
    02 rs13044925 20 q q12 LOC339568| 38085378 1.81E-05 1.22 0.133 0.111 G (SEQ ID NO: 1330)
    MAFB aggagattagggtgtt[A/G]attttcccgttctttc
    03 rs2143216 20 q q12 LOC339568| 38066525 1.62E-04 1.17 0.183 0.161 A (SEQ ID NO: 1331)
    MAFB ataaacttgccttact[A/G]tatacacacacatgca
    03 rs8119002 20 q q12 PTPRT 41072290 1.06E-02 0.89 0.145 0.160 A (SEQ ID NO: 1332)
    ccagggctatgaaacc[A/G]tctcattctgcagcag
    03 rs6090639 20 q q13.12 EYA2| 45835008 2.30E-04 1.16 0.180 0.159 G (SEQ ID NO: 1333)
    ZMYND8 ttttagggggtgtgat[A/G]tctgctatgtggacac
    02 exm2264714 20 q q13.13 B4GALT5| 48383467 3.26E-10 Inf 0.005 0.000 C (SEQ ID NO: 1334)
    SLC9A8 ggattacaggcatgag[A/C]caccacatgctgccat
    03 rs13041253 20 q q13.13 LOC100130589| 46773023 3.39E-04 1.14 0.227 0.205 G (SEQ ID NO: 1335)
    LOC284749 atgagttggaagaggt[A/G]ttagagtccccatcgt
    03 rs162076 20 q q13.13 LOC100130589| 46785499 1.17E-04 1.13 0.461 0.431 G (SEQ ID NO: 1336)
    LOC284749 ggttttcaggaatgca[A/G]aagtctgagaagacac
    03 rs927478 20 q q13.13 LOC100130589| 46761590 2.66E-04 1.15 0.227 0.203 A (SEQ ID NO: 1337)
    LOC284749 taagacaaagataagg[A/G]tctaatttcattatt
    03 rs852353 20 q q13.13 LOC100130589| 46833654 2.34E-04 1.12 0.453 0.425 A (SEQ ID NO: 1338)
    LOC284749 aatttttccttagaag[A/C]ctcaacctcagcatac
    03 rs852373 20 q q13.13 LOC100130589| 46841297 4.67E-03 0.90 0.212 0.231 G (SEQ ID NO: 1339)
    LOC284749 ggggtcccttccctgc[A/G]ctctcataagctcccc
    02 rs162079 20 q q13.13 LOC100130589| 46784745 8.36E-05 1.16 0.239 0.214 A (SEQ ID NO: 1340)
    LOC284749 tcgagggctagagagt[A/G]atgagagtgggtgggg
    03 rs6023407 20 q q13.2 DOK5 53221238 9.11E-05 0.93 0.329 0.346 G (SEQ ID NO: 1341)
    atgtatatttaaggta[A/G]gcltttctttttccct
    03 rs6064102 20 q q13.2 DOK5|CBLN4 53283735 7.76E-03 0.88 0.123 0.137 A (SEQ ID NO: 1342)
    tgacatccctcctatc[A/G]ggtctttgagggagaa
    02 exm1550638 20 q q13.2 SALL4 50408481 1.26E-07 Inf 0.003 0.000 A (SEQ ID NO: 1343)
    agtggccaacactaat[A/G]tgaccttgcaggcact
    02 rs6013748 20 q q13.2 ZNF217| 52275163 1.44E-05 1.17 0.177 0.156 A (SEQ ID NO: 1344)
    SUMO1P1 agcatatttggcctcc[A/G]taatgccgcttaaggt
    03 rs6025739 20 q q13.31 PMEPA1| 56294313 1.40E-03 1.18 0.100 0.086 G (SEQ ID NO: 1345)
    LOC100129869 taaatggcaattgttc[A/G]tgcaataaagaacaat
    03 rs170602 20 q q13.31 RBM38| 56019162 2.24E-03 0.89 0.222 0.242 G (SEQ ID NO: 1346)
    HMGB1L1 ctcatctcttctagcc[A/G]gctttccccttacagg
    03 rs6129089 20 q q13.33 CDH4 59850852 2.39E-03 1.11 0.270 0.249 A (SEQ ID NO: 1347)
    ttccacccccagtgat[A/G]ctcagaatccaggatc
    03 rs2427021 20 q q13.33 CDH4 59845250 1.52E-03 1.15 0.157 0.140 A (SEQ ID NO: 1348)
    ataaataacgatagcc[A/G]gtaacttacgttcact
    03 rs6010784 20 q q13.33 DIDO1 61540319 1.25E-03 0.90 0.474 0.500 A (SEQ ID NO: 1349)
    ctcatgctgcgctgct[A/G]tcagaggccacatctg
    01 JBL0001 20 q q13.33 LAMA5 60892450 5.28E-12 3.959 0.020 0.010 T (SEQ ID NO: 1350)
    tgtgcgtgggcctcgg[C/T]ggcctccactagacgc
    03 rs6015653 20 q q13.33 LOC729296| 58692731 4.54E-04 1.21 0.095 0.080 A (SEQ ID NO: 1351)
    CDH4 actgggttttgtggac[A/C]ctttgcagaggtcggg
    03 rs2426990 20 q q13.33 LOC729296| 59788003 9.56E-03 1.09 0.356 0.337 G (SEQ ID NO: 1352)
    CDH4 gtgccttttaatatat[A/G]gaccacaagctcagag
    03 rs2426983 20 q q13.33 L00729296| 59777873 1.43E-02 1.08 0.424 0.405 C (SEQ ID NO: 1353)
    CDH4 cattgacacactggca[A/C]actcaatactgtgcac
    03 rs6028076 20 q q13.33 LOC729296| 59801421 2.54E-02 1.08 0.359 0.343 G (SEQ ID NO: 1354)
    CDH4 cccaaaaggaaaccct[A/G]aacccaataagcagtc
    03 rs2426986 20 q q13.33 L00729296| 59786367 1.33E-02 1.11 0.167 0.153 G (SEQ ID NO: 1355)
    CDH4 tgttactgaggtatgc[A/G]atgccatgatttccac
    03 rs6028080 20 q q13.33 L00729296| 59804478 8.27E-04 1.15 0.168 0.149 G (SEQ ID NO: 1356)
    CDH4 tgtaaatcaccacctc[A/G]ttttgttcctagagct
    03 rs2427000 20 q q13.33 L00729296| 59802749 2.07E-02 1.09 0.269 0.254 A (SEQ ID NO: 1357)
    CDH4 cccttgccataaattg[A/G]aatccagagctgtaag
    03 rs2426993 20 q q13.33 L00729296| 59798418 1.03E-02 1.12 0.167 0.153 G (SEQ ID NO: 1358)
    CDH4 acttctactcagcata[A/G]aatgggccgttgccaa
    03 rs6027379 20 q q13.33 L00729296| 58747589 9.67E-05 0.89 0.445 0.474 G (SEQ ID NO: 1359)
    CDH4 ccataaaaggccggct[A/G]tagactcacatgtttt
    02 rs1023361 21 q q21.1 NCAM2| 23344282 3.08E-05 1.13 0.049 0.044 A (SEQ ID NO: 1360)
    NCRNA00158 gtttaaatgaaataaa[A/G]catcctctgtttgcgg
    03 rs390955 21 q q21.3 ADAMTS1| 28218457 8.60E-04 0.89 0.283 0.307 C (SEQ ID NO: 1361)
    ADAMTS5 cgcacgccacctcttc[A/C]ccagagacgactttgt
    03 rs10482984 21 q q21.3 LOC100288252| 28820729 7.34E-04 1.22 0.075 0.062 G (SEQ ID NO: 1362)
    NCRNA00113 tggaagaagaggtaag[A/G]tatctccagagccgct
    03 rs12482697 21 q q22.11 ATP50| 35293199 2.60E-04 0.81 0.081 0.098 C (SEQ ID NO: 1363)
    FLJ46020 gtttctccctttgccc[A/C]caccactaaaatacag
    03 rs11701963 21 q q22.11 ATP50| 35323657 1.08E-03 0.80 0.055 0.068 A (SEQ ID NO: 1364)
    FLJ46020 agtccaagcagcacct[A/G]gtaattaaactgagtc
    03 rs2032314 21 q q22.11 FLJ46020| 35354523 2.40E-03 0.82 0.063 0.075 A (SEQ ID NO: 1365)
    MRPS6 gcaaatctatacagac[A/G]gacacagattcatggt
    03 rs2070371 21 q q22.11 HUNK 33368188 6.19E-04 1.13 0.246 0.223 A (SEQ ID NO: 1366)
    tctgaatctgtgtcat[A/G]agcgagcctgagggct
    03 rs198914 21 q q22.11 KRTAP6-21 31973405 7.04E-04 0.89 0.275 0.299 A (SEQ ID NO: 1367)
    KRTAP22-1 ctcagttgtatagcag[A/G]atcagattctagagtt
    03 rs2834889 21 q q22.12 RUNX1|SETD4 36675294 4.79E-04 0.90 0.437 0.464 C (SEQ ID NO: 1368)
    agaaaccagccatttg[A/C]atgcgctcaatggaat
    03 rs6517494 21 q q22.2 FLJ451391| 40330767 6.46E-03 1.10 0.314 0.295 A (SEQ ID NO: 1369)
    LOC100289305 aagctacgcccac[A/C]tcctaaccctcggact
    02 exm1571045 21 q q22.2 LCA5L 40778182 2.87E-10 1.47 0.127 0.090 A (SEQ ID NO: 1370)
    ggggccagccaatgcc[A/G]gcaacatgaggtacag
    02 rs9981939 21 q q22.3 C21orf121| 43473602 2.00E-05 1.13 0.259 0.236 C (SEQ ID NO: 1371)
    UMODL1 tataaccttccaaaaa[A/C]ttcaacatcatcttcc
    02 rs467997 21 q q22.3 C21orf121| 43488016 3.66E-05 1.16 0.279 0.251 A (SEQ ID NO: 1372)
    UMODL1 aaaggaaaagtcattc[A/G]ggctgtgataagaaag
    02 rs2839452 21 q q22.3 C21orf121| 43466047 1.88E-05 1.13 0.289 0.265 G (SEQ ID NO: 1373)
    UMODL1 taccactaattccaat[A/G]ctcaagaagagctgac
    03 rs220263 21 q q22.3 C21orf121| 43482161 5.74E-05 1.13 0.471 0.440 G (SEQ ID NO: 1374)
    UMODL1 ccccacgtgaactcgc[A/G]gcaggcagagaatcta
    03 rs762395 21 q q22.3 C21orf136| 44769676 5.57E-03 1.10 0.361 0.340 A (SEQ ID NO: 1375)
    FLJ41733 gggctcgtttcagaat[A/G]cggttgggcaagtttg
    03 rs9978582 21 q q22.3 COL6A1| 47488387 2.34E-03 0.91 0.417 0.441 C (SEQ ID NO: 1376)
    COL6A2 tccgtctacagccacc[A/C]agttaaataacagcgg
    03 rs2282527 21 q q22.3 RRP1B 45081426 3.72E-03 1.10 0.357 0.336 A (SEQ ID NO: 1377)
    gttcacctcctgatga[A/C]ataaattcttgaccgt
    03 rs3814903 21 q q22.3 TMPRSS3| 43817117 3.43E-04 1.12 0.363 0.336 A (SEQ ID NO: 1378)
    UBASH3A gggctatttgataggc[A/C]cacggcagcttgggtt
    03 rs5992034 22 q q11.1 CECR1|CECR2 17852805 1.63E-03 1.15 0.144 0.128 A (SEQ ID NO: 1379)
    aatccatgagttcagc[A/C]tggtgagatctttccc
    03 rs1296795 22 q q11.21 CECR2 18021760 1.19E-04 0.87 0.235 0.262 G (SEQ ID NO: 1380)
    cattgcgtcctttccc[A/G]aagagtctgttcccat
    03 rs714027 22 q q12.2 HORMAD2| 30577771 4.03E-03 1.09 0.475 0.453 A (SEQ ID NO: 1381)
    LIF aaagaattttccccca[A/G]tgctctagcaaattgc
    03 rs1049536 22 q q12.2 THOC5 29904354 5.88E-03 1.11 0.245 0.227 A (SEQ ID NO: 1382)
    ggctggtgtctttgga[A/G]aatatcaagagtcaca
    03 rs2016485 22 q q12.3 LARGE 34086416 7.28E-03 0.92 0.442 0.463 A (SEQ ID NO: 1383)
    gtcattcagccctccc[A/G]gcaaccccagaaatag
    03 rs739166 22 q q13.1 ELFN2|MFNG 37863459 9.09E-05 1.12 0.267 0.244 G (SEQ ID NO: 1384)
    gaagtgacccatctgg[A/G]ccccagaggcaggggc
    02 rs1005522 22 q q13.1 MAP3K7IP1| 39845898 7.35E-05 1.15 0.271 0.244 C (SEQ ID NO: 1385)
    MGAT3 cctgcagcacccctgg[A/C]cctcatggggcacttc
    02 exm1609618 22 q q13.1 PDGFB 39621819 2.38E-08 4.42 0.009 0.002 A (SEQ ID NO: 1386)
    ccggcggactcgcacc[A/G]tccgaatggtcacccg
    03 rs2187793 22 q q13.31 LOC100289420| 47688003 2.72E-04 0.89 0.330 0.357 G (SEQ ID NO: 1387)
    FAM19A5 tgcaaaatgcttctga[A/G]atgggtcaaccagaag
    03 rs16993202 22 q q13.31 PHF21B 45353413 1.02E-03 0.84 0.097 0.113 G (SEQ ID NO: 1388)
    aaagagagggctgact[A/G]ttgattctgtgcatac
    03 rs736490 22 q q13.31 PHF21B 45338213 4.34E-04 0.82 0.078 0.094 A (SEQ ID NO: 1389)
    agagggtgcccccagg[A/G]tcctactgtggatcag
    03 rs138850 22 q q13.33 BRD1 50193337 1.71E-03 1.12 0.241 0.220 G (SEQ ID NO: 1390)
    gaagggagcaggtgct[A/G]tcaatggaaatgggac
    03 rs138843 22 q q13.33 BRD1 50183162 3.97E-04 1.14 0.251 0.228 A (SEQ ID NO: 1391)
    gaatgtcgtaatcagg[A/G]cgagagctcggggcgg
    03 rs5769373 22 q q13.33 LOC100128946| 49411595 7.63E-02 1.06 0.413 0.399 A (SEQ ID NO: 1392)
    LOC100287247 caagtctctcagtgac[A/G]gggccgacacttggtc
    03 rs5769807 22 q q13.33 LOC100128946| 49415539 1.58E-02 1.09 0.303 0.285 G (SEQ ID NO: 1393)
    LOC100287247 aactttctgtaaagca[A/G]tgggagttagggcaac
    03 rs2064542 22 q q13.33 LOC100128946| 49430916 5.02E-02 1.07 0.399 0.384 C (SEQ ID NO: 1394)
    LOC100287247 ctgcctctaaacccga[A/C]gtcttcaagcctgact
    03 rs1548245 22 q q13.33 LOC100128946| 49412197 5.13E-02 1.07 0.249 0.236 A (SEQ ID NO: 1395)
    LOC100287247 gtgtcgtggcagatac[A/C]aggtctcacggaagtc
    03 rs4823969 22 q q13.33 LOC100128946| 49416063 6.92E-03 1.11 0.207 0.190 G (SEQ ID NO: 1396)
    LOC100287247 gtgagctgcacatcct[A/G]cctagaagggacatct
    03 rs5770992 22 q q13.33 SHANK3 51146139 1.21E-04 0.81 0.092 0.111 G (SEQ ID NO: 1397)
    tagctattccaaataa[A/G]ataaaacccaaagaaa
    02 rs1007461 X p p22.2 CLCN4|MID1 10297210 1.36E-04 1.19 0.466 0.423 A (SEQ ID NO: 1398)
    ccaatgtatgtgaagt[G/A]gctcaaatgaattttg

Claims (31)

1. A method comprising applying an endometriosis increased risk therapeutic to a patient having at least one endometriosis increased risk associated biomarker in the DNA of said patient.
2. The method of claim 1, wherein said at least one endometriosis increased risk associated biomarker defines the minor allele of a SNP.
3. The method of claim 1, wherein said at least one endometriosis increased risk associated biomarker defines the minor allele of a biomarker of table 1 having an OR of greater than 1.0.
4. The method of claim 1, wherein said at least one endometriosis increased risk associated biomarker defines a plurality of endometriosis increased risk associated biomarkers, each endometriosis increased risk associated biomarker defining the minor allele of a biomarker of table 1 having an OR of greater than 1.0.
5. The method of claim 1, wherein said endometriosis increased risk therapeutic defines administering a hormonal treatment.
6. The method of claim 5, wherein said hormonal treatment defines at least one of administering a composition in an amount effective to alter the hormone level of said patient, performing a surgical procedure, and a combination thereof.
7. The method of claim 1, wherein said endometriosis increased risk therapeutic defines administering an Oral Contraceptive Pill (OCP).
8. The method of claim 1, wherein said patient defines an endometriosis asymptomatic human female.
9. The method of claim 1, wherein said applying step is preceded by the step of obtaining clinical data (CD) of said patient.
10. The method of claim 1, wherein said applying step is preceded by the steps of:
identifying an endometriosis asymptomatic human female subject,
obtaining clinical data (CD) and a biological sample of said subject, said CD defining the answers to the questions of “menarche after age 14 (Y/N)”, “dysmenorrhea (Y/N)”, and “previous pregnancy (Y/N)”,
assigning a raw clinical probability value (RCPV) to said CD,
assaying said sample,
detecting in said sample a plurality of endometriosis increased risk associated biomarkers, each endometriosis increased risk associated biomarker defining the minor allele of a biomarker of table 1 having an OR of greater than 1.0 resulting in endometriosis increased risk associated biomarker data, and
performing a statistical analysis using said RCPV and said endometriosis increased risk associated biomarker data to result in an endometriosis condition prognosis of said subject of at least one of an increased risk of endometriosis existence and an increased risk of endometriosis predisposition.
11. A method comprising applying an endometriosis decreased risk therapeutic to a patient having at least one endometriosis decreased risk associated biomarker in the DNA of said patient.
12. The method of claim 11, wherein said at least one endometriosis decreased risk associated biomarker defines the minor allele of a SNP.
13. The method of claim 11, wherein said at least one endometriosis decreased risk associated biomarker defines the minor allele of a biomarker of table 1 having an OR of less than 1.0.
14. The method of claim 11, wherein said at least one endometriosis decreased risk associated biomarker defines a plurality of endometriosis decreased risk associated biomarkers, each endometriosis decreased risk associated biomarker defining the minor allele of a biomarker of table 1 having an OR of less than 1.0.
15. The method of claim 11, wherein said endometriosis decreased risk therapeutic defines canceling a contemplated hormonal treatment.
16. The method of claim 15, wherein said hormonal treatment defines at least one of administering a composition in an amount effective to alter the hormone level of said patient, performing a surgical procedure, and a combination thereof.
17. The method of claim 11, wherein said endometriosis decreased risk therapeutic defines canceling a contemplated administration of an Oral Contraceptive Pill (OCP).
18. The method of claim 11, wherein said patient defines an endometriosis asymptomatic human female.
19. The method of claim 11, wherein said applying step is preceded by the step of obtaining clinical data (CD) of said patient.
20. The method of claim 11, wherein said applying step is preceded by the steps of:
identifying an endometriosis asymptomatic human female subject,
obtaining clinical data (CD) and a biological sample of said subject, said CD defining the answers to the questions of “menarche after age 14 (Y/N)”, “dysmenorrhea (Y/N)”, and “previous pregnancy (Y/N)”,
assigning a raw clinical probability value (RCPV) to said CD,
assaying said sample,
detecting in said sample a plurality of endometriosis decreased risk associated biomarkers, each endometriosis decreased risk associated biomarker defining the minor allele of a biomarker of table 1 having an OR of less than 1.0 resulting in endometriosis decreased risk associated biomarker data, and
performing a statistical analysis using said RCPV and said endometriosis decreased risk associated biomarker data to result in an endometriosis condition prognosis of said subject of at least one of a decreased risk of endometriosis existence and a decreased risk of endometriosis predisposition.
21. A method comprising applying an endometriosis altered risk therapeutic to a patient having at least one endometriosis altered risk associated biomarker in the DNA of said patient.
22. The method of claim 21, wherein said at least one endometriosis altered risk associated biomarker defines the minor allele of a SNP.
23. The method of claim 21, wherein said endometriosis altered risk defines at least one of an endometriosis increased risk as compared to a control subject and an endometriosis decreased risk as compared to a control subject, and wherein said endometriosis altered risk therapeutic defines at least one of an endometriosis increased risk therapeutic and an endometriosis decreased risk therapeutic.
24. The method of claim 23, wherein said at least one endometriosis increased risk associated biomarker defines the minor allele of a biomarker of table 1 having an OR of greater than 1.0, and wherein said at least one endometriosis decreased risk associated biomarker defines the minor allele of a biomarker of table 1 having an OR of less than 1.0.
25. The method of claim 23, wherein said at least one endometriosis increased risk associated biomarker defines a plurality of endometriosis increased risk associated biomarkers, each endometriosis increased risk associated biomarker defining the minor allele of a biomarker of table 1 having an OR of greater than 1.0, and wherein said at least one endometriosis decreased risk associated biomarker defines a plurality of endometriosis decreased risk associated biomarkers, each endometriosis decreased risk associated biomarker defining the minor allele of a biomarker of table 1 having an OR of less than 1.0.
26. The method of claim 23, wherein said endometriosis increased risk therapeutic defines administering a hormonal treatment, and wherein said endometriosis decreased risk therapeutic defines canceling a contemplated hormonal treatment.
27. The method of claim 26, wherein said hormonal treatment defines at least one of administering a composition in an amount effective to alter the hormone level of said subject, performing a surgical procedure, and a combination thereof.
28. The method of claim 23, wherein said endometriosis increased risk therapeutic defines administering an Oral Contraceptive Pill (OCP), and wherein said endometriosis decreased risk therapeutic defines canceling a contemplated administration of an OCP.
29. The method of claim 21, wherein said patient defines an endometriosis asymptomatic human female.
30. The method of claim 21, wherein said applying step is preceded by the step of obtaining clinical data (CD) of said patient.
31. The method of claim 21, wherein said applying step is preceded by the steps of:
identifying an endometriosis asymptomatic human female subject,
obtaining clinical data (CD) and a biological sample of said subject, said CD defining the answers to the questions of “menarche after age 14 (Y/N)”, “dysmenorrhea (Y/N)”, and “previous pregnancy (Y/N)”,
assigning a raw clinical probability value (RCPV) to said CD,
assaying said sample,
detecting in said sample at least one of a plurality of endometriosis increased risk associated biomarkers, each endometriosis increased risk associated biomarker defining the minor allele of a biomarker of table 1 having an OR of greater than 1.0 resulting in endometriosis increased risk associated biomarker data and a plurality of endometriosis decreased risk associated biomarkers, each endometriosis decreased risk associated biomarker defining the minor allele of a biomarker of table 1 having an OR of less than 1.0 resulting in endometriosis decreased risk associated biomarker data, and
performing at least one of a statistical analysis using said RCPV and said endometriosis increased risk associated biomarker data to result in an endometriosis condition prognosis of said subject of at least one of an increased risk of endometriosis existence and an increased risk of endometriosis predisposition and a statistical analysis using said RCPV and said endometriosis decreased risk associated biomarker data to result in an endometriosis condition prognosis of said subject of at least one of a decreased risk of endometriosis existence and a decreased risk of endometriosis predisposition.
US15/838,133 2007-06-11 2017-12-11 Method of Testing for Endometriosis and Treatment Therefor Abandoned US20180245156A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US15/838,133 US20180245156A1 (en) 2007-06-11 2017-12-11 Method of Testing for Endometriosis and Treatment Therefor

Applications Claiming Priority (27)

Application Number Priority Date Filing Date Title
US94319307P 2007-06-11 2007-06-11
US12/056,754 US20080305967A1 (en) 2007-06-11 2008-03-27 Genetic Markers Associated with Endometriosis and Use Thereof
US12/120,322 US20080306034A1 (en) 2007-06-11 2008-05-14 Method of Administering a Therapeutic
US17171709P 2009-04-22 2009-04-22
US24580809P 2009-09-25 2009-09-25
US31814510P 2010-03-26 2010-03-26
US12/765,643 US11287425B2 (en) 2009-04-22 2010-04-22 Genetic markers associated with endometriosis and use thereof
US201113071598A 2011-03-25 2011-03-25
US13/159,132 US20150361494A1 (en) 2010-03-26 2011-06-13 Genetic Markers Associated with Endometriosis and Use Thereof
US201161530948P 2011-09-03 2011-09-03
US201161530944P 2011-09-03 2011-09-03
US201161530947P 2011-09-03 2011-09-03
US201161530945P 2011-09-03 2011-09-03
US201161547624P 2011-10-14 2011-10-14
US201213603297A 2012-09-04 2012-09-04
US201213602409A 2012-09-04 2012-09-04
US13/603,284 US20150363558A1 (en) 2011-09-03 2012-09-04 Method of Determining Predisposition to Endometriosis
US201213652018A 2012-10-15 2012-10-15
US201261717048P 2012-10-22 2012-10-22
US201261717053P 2012-10-22 2012-10-22
US201261721219P 2012-11-01 2012-11-01
US201213680414A 2012-11-19 2012-11-19
US201213681575A 2012-11-20 2012-11-20
US201313735828A 2013-01-07 2013-01-07
US13/788,913 US8932993B1 (en) 2007-06-11 2013-03-07 Method of testing for endometriosis and treatment therefor
US14/594,266 US9840738B2 (en) 2007-06-11 2015-01-12 Method of testing for endometriosis and treatment therefor
US15/838,133 US20180245156A1 (en) 2007-06-11 2017-12-11 Method of Testing for Endometriosis and Treatment Therefor

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US14/594,266 Continuation US9840738B2 (en) 2007-06-11 2015-01-12 Method of testing for endometriosis and treatment therefor

Publications (1)

Publication Number Publication Date
US20180245156A1 true US20180245156A1 (en) 2018-08-30

Family

ID=52247735

Family Applications (3)

Application Number Title Priority Date Filing Date
US13/788,913 Expired - Fee Related US8932993B1 (en) 2007-06-11 2013-03-07 Method of testing for endometriosis and treatment therefor
US14/594,266 Active US9840738B2 (en) 2007-06-11 2015-01-12 Method of testing for endometriosis and treatment therefor
US15/838,133 Abandoned US20180245156A1 (en) 2007-06-11 2017-12-11 Method of Testing for Endometriosis and Treatment Therefor

Family Applications Before (2)

Application Number Title Priority Date Filing Date
US13/788,913 Expired - Fee Related US8932993B1 (en) 2007-06-11 2013-03-07 Method of testing for endometriosis and treatment therefor
US14/594,266 Active US9840738B2 (en) 2007-06-11 2015-01-12 Method of testing for endometriosis and treatment therefor

Country Status (1)

Country Link
US (3) US8932993B1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11287425B2 (en) 2009-04-22 2022-03-29 Juneau Biosciences, Llc Genetic markers associated with endometriosis and use thereof
KR20230088975A (en) * 2021-12-13 2023-06-20 (주)비엠에스 Method of providing information for diagnosis of endometriosis using NRG1 and SMAD7 gene expression level and composition therefor

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8932993B1 (en) * 2007-06-11 2015-01-13 Juneau Biosciences, LLC. Method of testing for endometriosis and treatment therefor
AU2014268779A1 (en) 2013-05-21 2016-01-21 Predictive Therapeutics, LLC Therapeutic and method of use
DK3511422T3 (en) 2013-11-12 2023-02-06 Population Bio Inc METHODS AND COMPOSITIONS FOR DIAGNOSING, PROGNOSIS AND TREATMENT OF ENDOMETRIOSIS
US20170137804A1 (en) * 2016-02-13 2017-05-18 Rakesh N. Chettier Method of Stem Cell Preparation and Administration
CA3057613A1 (en) * 2017-03-15 2018-09-20 Juneau Biosciences, L.L.C. Methods of using genetic markers associated with endometriosis
KR102422364B1 (en) * 2020-10-21 2022-07-19 (주)비엠에스 Method of providing information for diagnosis of endometriosis using gene expression level and composition therefor

Family Cites Families (37)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7122322B2 (en) 1994-10-25 2006-10-17 The Curators Of The University Of Missouri Endometriosis-specific secretory protein
DE19824230A1 (en) 1998-05-29 1999-12-02 Starzinski Powitz Anna New endometriosis-associated gene
US20080187527A1 (en) 1998-05-29 2008-08-07 Anna Starzinski-Powitz Novel endometriosis-associated gene
US6525187B1 (en) 1998-07-31 2003-02-25 Diagnostic Products Corporation Polynucleotide encoding autoantigens associated with endometriosis
US6540980B1 (en) 1999-04-02 2003-04-01 Center For Molecular Medicine And Immunology Method of detecting endometriosis
AU1159601A (en) 1999-11-03 2001-05-14 Metris Therapeutics Limited Agents implicated in endometriosis
GB0004232D0 (en) 2000-02-24 2000-04-12 Zeneca Ltd Diagnostic method
CA2399259A1 (en) 2000-02-25 2001-08-30 Metriogene Biosciences Inc. Endometriosis-related markers and uses thereof
US6780594B2 (en) 2000-09-25 2004-08-24 Schering Aktiengesellschaft Method for in vitro diagnosis of endometriosis
GB0025132D0 (en) 2000-10-13 2000-11-29 Medical Res Council Method
US7601692B2 (en) 2000-11-28 2009-10-13 Compugen Ltd. MCP-1 splice variants and methods of using same
US20020147155A1 (en) 2001-04-06 2002-10-10 Foster Warren G. Prevention and treatment of endometriosis with aryl hydrocarbon receptor binding ligands
CA2475298A1 (en) 2002-02-13 2003-08-21 Kamran Shazand Cd16b as a marker for the diagnosis of endometriosis
EP1517667A2 (en) 2002-07-02 2005-03-30 Galileo Pharmaceuticals, Inc. Compositions and methods for reduction of inflammatory symptoms and/or biomarkers in female subjects
US20050214836A1 (en) 2002-08-30 2005-09-29 Oncotherapy Science, Inc. Method of diagnosing ovarian endometriosis
WO2004024952A1 (en) 2002-08-30 2004-03-25 Oncotherapy Science, Inc. Method of diagnosing ovarian endometriosis
US20040210400A1 (en) * 2003-01-27 2004-10-21 Perlegen Sciences, Inc. Analysis methods for individual genotyping
WO2005008251A2 (en) 2003-07-11 2005-01-27 Praecis Pharmaceuticals, Inc. Compositions, kits, and methods for identification, assessment, prevention, and therapy of endometriosis
WO2005005983A1 (en) 2003-07-14 2005-01-20 Japan Science And Technology Agency Method of diagnosing disease relating to endometriosis
SG109604A1 (en) 2003-09-03 2005-03-30 Singapore General Hospital Pte Method and probes for diagnosing a gynaecological condition
WO2005072049A2 (en) 2004-01-27 2005-08-11 Compugen Usa, Inc. Novel nucleotide and amino acid sequences, and assays and methods of use thereof for diagnosis of endometriosis
US7943324B2 (en) 2004-12-22 2011-05-17 The Trustees Of The University Of Pennsylvania Endometriosis markers
US20090208939A1 (en) 2005-02-18 2009-08-20 Idhaliz Flores Identification of Molecular Diagnostic Markers for Endometriosis in Blood Lymphocytes
WO2006116873A1 (en) 2005-05-05 2006-11-09 Mount Sinai Hospital Diagnosis and treatment of endometriosis
US7399598B2 (en) 2005-10-14 2008-07-15 Taipei Medical University Diagnosis method of endometriosis by detecting biochemical markers and usage of these biochemical markers
CA2634934A1 (en) 2005-12-23 2007-07-05 The Burnham Institute For Medical Research Endometriosis cell targeting peptide and uses thereof
EP2010922B1 (en) 2006-04-03 2012-06-27 Oratel Diagnostics, LLC Methods for endometriosis screening
US20070287676A1 (en) 2006-05-16 2007-12-13 Sun-Wei Guo Diagnosis and treatment of endometriosis
WO2008049175A1 (en) 2006-10-24 2008-05-02 Katholieke Universiteit Leuven High discriminating power biomarker diagnosing
WO2008123901A2 (en) 2007-02-06 2008-10-16 Genizon Biosciences Genemap of the human genes associated with endometriosis
WO2008103812A1 (en) 2007-02-21 2008-08-28 Yale University Compositions and methods for diagnosing and treating endometriosis
US7871778B2 (en) 2007-04-25 2011-01-18 The Regents Of The University Of California Methods of diagnosing endometriosis
US8932993B1 (en) * 2007-06-11 2015-01-13 Juneau Biosciences, LLC. Method of testing for endometriosis and treatment therefor
CN101334410B (en) 2007-06-26 2013-03-27 沙桂华 Method and reagent kit for detecting endometriosis
EP2065707A1 (en) 2007-11-28 2009-06-03 Laboratorios S.A.L.V.A.T., S.A. Detection of endometrial secretion markers for assesment of endometriosis
JP2009168646A (en) 2008-01-17 2009-07-30 Fuji Pharmaceutical Co Ltd Specific biomarker for endometriosis
WO2010010951A1 (en) 2008-07-24 2010-01-28 Kuroda Masahiko Method for detection of expression of indicator mrna acting as indicator for endometriosis-related diseases, and probe for use in the method

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11287425B2 (en) 2009-04-22 2022-03-29 Juneau Biosciences, Llc Genetic markers associated with endometriosis and use thereof
KR20230088975A (en) * 2021-12-13 2023-06-20 (주)비엠에스 Method of providing information for diagnosis of endometriosis using NRG1 and SMAD7 gene expression level and composition therefor
KR102677786B1 (en) 2021-12-13 2024-06-25 (주)비엠에스 Method of providing information for diagnosis of endometriosis using NRG1 and SMAD7 gene expression level and composition therefor

Also Published As

Publication number Publication date
US20150133382A1 (en) 2015-05-14
US9840738B2 (en) 2017-12-12
US8932993B1 (en) 2015-01-13

Similar Documents

Publication Publication Date Title
US9840738B2 (en) Method of testing for endometriosis and treatment therefor
US20160367568A1 (en) Method of Testing for Endometriosis and Treatment Therefor
AU2018338314B2 (en) Protein degraders and uses thereof
Grech et al. EPMA position paper in cancer: current overview and future perspectives
WO2013086464A1 (en) Markers associated with chronic lymphocytic leukemia prognosis and progression
AU2008212117B2 (en) Genetic variants contributing to risk of prostate cancer
Han et al. Genomic alterations identified by array comparative genomic hybridization as prognostic markers in tamoxifen-treated estrogen receptor-positive breast cancer
WO2019090263A1 (en) Diagnostic and therapeutic methods for cancer
KR20100112192A (en) PAR-How to Diagnose and Treat Mediated Diseases
AU2023205539A1 (en) Methods for cancer detection and monitoring
AU2006287191A1 (en) Methods and compositions for identifying biomarkers useful in diagnosis and/or treatment of biological states
US20220033880A1 (en) Epigenetic biomarker and uses therefor
JP2011530306A (en) Genetic variation useful for risk assessment of thyroid cancer
AU2009269542A1 (en) Genetic variants for breast cancer risk assessment
US20210188928A1 (en) Treatment of disease via transcription factor modulation
EP4417708A2 (en) Methods for assessing risk of developing a viral disease using a genetic test
Constantinou et al. Genetics of gynaecological cancers
US20200325234A1 (en) Immune-based treatment of kras-variant cancer patients
Mucha et al. Association of Thr241Met polymorphism of XRCC3 gene with risk of colorectal cancer in the Polish population
Lin et al. Relationship of genetic variant distributions of WW domain-containing oxidoreductase gene with uterine cervical cancer
Alexiev et al. Uncommon molecular alterations in follicular-derived thyroid carcinoma: A single institution study
EP3230478B1 (en) Methods for treating or preventing cancer in a kras-variant patient and for diagnosing risk of developing multiple primary breast tumors
Heo et al. Advances in cancer genomics and precision oncology
WO2022109395A2 (en) Panel of er regulated genes for use in monitoring endocrine therapy in breast cancer
Yamaguchi et al. In vivo CRISPR screening reveals cooperation of KMT2D and TP53 deficiencies in B-cell lymphomagenesis

Legal Events

Date Code Title Description
AS Assignment

Owner name: JUNEAU BIOSCIENCES, LLC, UTAH

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:WARD, KENNETH;CHETTIER, RAKESH N.;ALBERTSEN, HANS M.;REEL/FRAME:044358/0415

Effective date: 20150105

STPP Information on status: patent application and granting procedure in general

Free format text: DOCKETED NEW CASE - READY FOR EXAMINATION

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION MAILED

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION MAILED

STPP Information on status: patent application and granting procedure in general

Free format text: RESPONSE TO NON-FINAL OFFICE ACTION ENTERED AND FORWARDED TO EXAMINER

STPP Information on status: patent application and granting procedure in general

Free format text: FINAL REJECTION MAILED

STPP Information on status: patent application and granting procedure in general

Free format text: DOCKETED NEW CASE - READY FOR EXAMINATION

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION MAILED

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION