US20180055020A1

US20180055020A1 - Mice With Transgene Of iBox Peptide Inhibitor Of Group B p21-Activated Kinases

Info

Publication number: US20180055020A1
Application number: US15/683,948
Authority: US
Inventors: Jonathan Chernoff; Hoi Yee Chow
Original assignee: Institute for Cancer Research
Current assignee: Institute for Cancer Research
Priority date: 2016-08-24
Filing date: 2017-08-23
Publication date: 2018-03-01
Anticipated expiration: 2037-08-23
Also published as: US11240996B2

Abstract

Mice comprising a transgene encoding a peptide (iBox) inhibitor of Group B p21-activated kinase are provided. Also provided are cells, tissue, and organs obtained from such transgenic mice. Also provided are methods for producing mice comprising an iBox-encoding transgene.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

This application claims priority to U.S. Application No. 62/378,769, filed Aug. 24, 2016, which is incorporated herein by reference in its entirety.

REFERENCE TO GOVERNMENT GRANTS

This invention was made with government support under Grant Nos. R01 CA142928 and R01 CA148805 awarded by the National Institutes of Health. The government has certain rights in the invention.

FIELD

The present disclosure relates generally to the field of transgenic animals. More particularly, the present disclosure relates to transgenic mice comprising a peptide inhibitor of Group B p21-activated kinase (Pak), the iBox peptide, that is constitutively expressed, including tissue-specific expression. The present disclosure further relates to cells, tissues, and organs obtainable from such mice, and methods for producing such mice.

BACKGROUND

Various Pak knock-out mice have been made. These mice only remove single group A or group B Pak genes and, therefore, cannot serve as a model of inhibition of the full group of Paks. In addition, knock-out mice eliminate Pak's scaffold function in addition to eliminating its kinase function.

SUMMARY

The present disclosure provides a transgenic mouse comprising a transgene comprising a nucleic acid sequence encoding a peptide inhibitor of Group B p21-activated kinase (Pak), the iBox peptide, which may optionally be operably linked to glutathione S-transferase (GST) to facilitate detection of this inhibitor. The transgene may further encode a fluorescent marker such as eGFP. In some embodiments, the transgene is stably integrated into the mouse genome, for example, into a chromosome. In some embodiments, the iBox peptide is constitutively expressed in the transgenic mouse. The expression may be limited to a particular cell, tissue, or organ of interest. The cell, tissue, or organ of interest may include the skin, tongue, esophagus, stomach, intestine, colon, mesothelium, Schwann cells, brain, lung, heart, liver, pancreas, kidney, bladder, testes, thyroid, ovaries, skeletal muscle, bone, or other organ, cell, or tissue. In some embodiments, the organ of interest is the pancreas. Cells, tissues, or organs comprising the transgene may be isolated from the transgenic mouse. Thus, the present disclosure provides a transgenic mouse comprising a transgene encoding the iBox peptide inhibitor.
In some embodiments, the transgene comprises the nucleic acid sequence of SEQ ID NO:1 (gaagcagaggactggacggcagccctgctgaacaggggccgcagtcggcagcccctggtgctaggggataactgattg ctgatttagttcacaattggatggagttgcctgaatga). In some embodiments, the transgene comprises the nucleic acid sequence of SEQ ID NO:2 (atgtcccctatactaggttattggaaaattaagggccttgtgcaacccactcgac acttaggaatatcagaagaaaaatatgaagagcatagtatgagcgcgatgaaggtgataaatggcgaaacaaaaagatgaattgggatg gagtacccaatcaccttattatattgatggtgatgaaaattaacacagtctatggccatcatacgttatatagctgacaagcacaacatgagg gtggagtccaaaagagcgtgcagagatacaatgcttgaaggagcggattggatattagatacggtgatcgagaattgcatatagtaaaga catgaaactctcaaagagattacttagcaagctacctgaaatgctgaaaatgacgaagatcgatatgtcataaaacatatttaaatggtgatc atgtaacccatcctgacttcatgagtatgacgctcagatgagattatacatggacccaatgtgcctggatgcgacccaaaattagatgatta aaaaacgtattgaagctatcccacaaattgataagtacttgaaatccagcaagtatatagcatggccatgcagggctggcaagccacgtag gtggtggcgaccatcctccaaaatcggatctggaccgcgtggatccgaagcagaggactggacggcagccctgctgaacaggggccgc agtcggcagcccctggtgctaggggataactgttttgctgatttagttcacaattggatggagttgcctgaatga). In some embodiments, the transgene further comprises the nucleic acid sequence of SEQ ID NO:3 (atggt gagcaagggcgaggagctgacaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagacagcgtgtcc ggcgagggcgagggcgatgccacctacggcaagctgaccctgaagacatctgcaccaccggcaagctgcccgtgccctggcccaccc tcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccga aggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctg gtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccaca acgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctc gccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctga gcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtac aagta). The transgene may be inserted at the ROSA26 locus.
In some embodiments, the iBox transgene is expressed in one or more organs in the mouse. In some embodiments, the one or more organs includes the pancreas. In some embodiments, the iBox transgene is expressed only in the pancreas.
The mouse may further comprise a transgene encoding a KRas oncogene, which KRas oncogene may be expressed only in the pancreas. Thus, the transgenic mouse may comprise the iBox transgene and a KRas oncogene transgene, both of which may be expressed in the pancreas of the mouse. The KRas oncogene may comprise one or more alterations and the KRas oncogene induces pancreatic cancer in the mouse.
The present disclosure provides methods for producing a mouse comprising a transgene encoding the iBox peptide inhibitor. In general, the methods comprise introducing a nucleic acid sequence encoding the iBox peptide inhibitor into a mouse egg, embryo, or embryonic stem cell, and transferring the mouse egg, embryo, or embryonic stem cell having the introduced nucleic acid sequence into a female mouse. In some embodiments, the transgene comprises the nucleic acid sequence of SEQ ID NO:1. In some embodiments, the transgene comprises the nucleic acid sequence of SEQ ID NO:2. In some embodiments, the transgene further comprises the nucleic acid sequence of SEQ ID NO:3. The methods may further comprise breeding the female mouse and selecting offspring comprising the nucleic acid sequence. The female mouse may be bred, for example, with a male Cre mouse. Upon breeding the female mouse with a male Cre mouse, the offspring may be selected according to their expression of the iBox peptide. The methods may further comprise breeding the selected offspring, for example, with a second (male or female) Cre mouse comprising a transgene encoding a KRas oncogene. In some embodiments, the second Cre mouse expresses the KRas oncogene in the pancreas. Mice produced according to the inventive methods are also included.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1, panels A through E, show construction of an LSL-iBox knock-in vector and expected genomic organization in the mouse genome. Panel A shows an LR reaction performed between the pROSA26-DV1 vector and pEntry clone containing GST-iBox fragment to generate ROSA26 targeting vector. Panel B shows that homologous recombination occurred between

exon

1 and 2 of wild-type ROSA26 locus in G4 ES cells after electroporation. Black boxes represent the exons located at ROSA26 locus. Panel C shows the genomic structure of the targeted allele. Panel D shows that the Cre-mediated deletion of intervening loxP flanked PGK-neo-3xpA (STOP) cassette results in the ROSA26-locus-based expression of an exonl-GST-iBox-IRES-eGFP bi-cistronic fusion transcript. Panel E shows genotyping PCR analysis of genomic DNA isolated from the tail detecting presence of fusion transcript by both external primers (F1 and R1) and internal primers (F2 and R2), verifying genomic organization of the LSL-iBox transgene.

FIG. 2 shows the nucleic acid sequence of the pROSA26-Gst-iBox plasmid (circular plasmid, at 15,318 bp). Relevant sub-sections of the plasmid are designated.

FIG. 3 shows a map of the pROSA26-Gst-iBox plasmid.

FIG. 4 shows the expression of Gst-iBox in cells from transgenic mice. Mouse embryonic fibroblasts (MEFs) were established from an e13 embryo from a transgenic mouse (#7). These MEFs were transduced with an adenovirus encoding no insert (−) or the Cre gene (+) to remove the LSL cassette and permit Gst-iBox expression. 2 days post adenoviral infection, cell lysates were analyzed by immunoblot with anti-Gst antibodies.

FIGS. 5A-5D show the expression of iBox and its effects on signaling. FIG. 5A: mouse embryo fibroblasts (MEFs) derived from Tg-LSL-iBox mice were infected with an empty Adenovirus or Adenovirus-Cre. An anti-Gst blot is shown; FIG. 5B: proliferation rates of MEFs expressing iBox (Cre+); FIG. 5C: Pak4 was immunoprecipitated from lysates from these MEFs were assayed for Pak4 kinase activity; and FIG. 5D: lysates were probed for the indicated signaling molecules.

DESCRIPTION OF EMBODIMENTS

Various terms relating to embodiments of the present disclosure are used throughout the specification and claims. Such terms are to be given their ordinary meaning in the art, unless otherwise indicated. Other specifically defined terms are to be construed in a manner consistent with the definition provided herein.
As used herein, the singular forms “a,” “an,” and “the” include plural referents unless expressly stated otherwise.
As used herein, “Cre mouse” is a mouse that comprises a transgene encoding Cre recombinase (plural, “Cre mice”). The transgene may be expressed in one or more tissues or organs in the Cre mouse.
In order to determine the effects of inhibiting the Group B p21-activated kinases (Paks) in vivo, a vector was designed to overexpress a peptide inhibitor of Group B Paks (Pak 4, Pak 5, and Pak 6) in mice. This peptide inhibitor, termed iBox, is derived from amino acids 166 to 203 of the human INKA-1 protein. The iBox peptide transgene was linked to GST to facilitate detection upon expression. Transgene expression was restricted to a limited number of tissues in order to avoid the potential for wide-ranging, deleterious effects on development.
This transgenic mouse model is designed such that mice constitutively express the iBox peptide. In some embodiments, the transgene is compatible with the Cre-recombinase system. Thus, for example, when a mouse comprising the iBox transgene is bred with a particular Cre recombinase-expressing mouse, the iBox peptide is expressed in the offspring. As there are many Cre-recombinase mice available, including mice with Cre-recombinase expression limited to particular tissues, it is possible to have tissue-specific expression of the iBox peptide. Accordingly, Group B Pak inhibition can be tissue specific. Tissue specificity may be useful, for example, in evaluating the role of Group B Paks in mouse development, tissue development, organ development, organ function, and system cross-talk. Tissue specificity may also be useful in evaluating disease, including cancer, diseases in which Group B Pak activity or impaired or inhibited activity is implicated, and other conditions that relate, directly or indirectly, to Group B Pak activity or impaired or inhibited activity.
The transgenic mice allow the evaluation of the role of group B Paks in preclinical cancer models. Group B Paks may be conditionally inhibited in mice in any tissue at any time. This allows an assessment concerning the loss of Group B Pak activity, e.g., whether the loss may be beneficial in any condition, such as cancer. Unlike Pak-knock-out mice, the iBox transgenic mouse continues to express endogenous group B Pak proteins, such that the expression of the iBox transgene will mimic the effects of a small molecule group B Pak inhibitor, thereby predicting drug effects on Pak 3, 4, and/or 5 inhibition. Thus, by expressing a regulated peptide inhibitor of Group B Paks, the iBox transgenic mouse model provides a better indicator of small molecule inhibitors than knock-outs or shRNA-expressing mice, as endogenous Pak proteins are still expressed.
For example, it is believed that Group B Pak inhibition may be relevant to pancreatic cancer treatment. Accordingly, a model of Group B Pak inhibition in the pancreas may establish any one or combination of the Group B Paks as a druggable target. The survival of transgenic mice with the iBox peptide expressed in the pancreas is compared to control mice in which the iBox peptide is not expressed in the pancreas, or in which the iBox peptide is expressed in other tissue (aside from the pancreas).
It is believed that the iBox inhibitor is specific to Group B Paks (e.g., Pak 4, 5, and 6), and does not titrate out other binding partners, such as small GTPases, PIX, or Nck. As well, expression of the iBox peptide is regulated by Cre recombinase in the mouse, thereby allowing flexibility in Pak inhibition in particular tissues and at particular times. An additional advantage is that the iBox inhibitor transgene is inserted as a single copy into a safe, well-characterized location in the genome (the ROSA26 locus), thus not disturbing expression of other mouse genes that may be key to continued viability of the mouse from conception through adulthood. FIG. 1, panels A through E, describes an exemplary embodiment of the generation of the ROSA26-promoter-based expression of the iBox transgene. The ROSA26-promoter was selected for gene expression because it is known as a safe harbor site in the mouse genome, whereby insertion of the iBox transgene was not expected to not disrupt the expression of other genes of the mouse.
Generally, a gateway enzyme mix (LR-clonase) is used to catalyze recombination between an entry clone (containing a gene of interest flanked by attL sites) and a destination vector (containing attR sites) to generate an expression clone. More specifically, the LR-clonase reaction can be used to insert the pROSA26-DV1 vector and pEntry clone containing GST-iBox (GST as reporter) fragment to generate ROSA26 targeting vector as shown in Panel B. Using this technique, homologous recombination occurred between exon 1 and 2 of wild-type ROSA26 locus in G4 ES cells after electroporation as shown in Panel B. The targeted allele comprises a fused GST-iBox gene sequence, as well as the reporter gene sequence, IRES-eGFP, as shown in Panel C.
During recombination, a Cre recombinase-mediated deletion of intervening loxP flanked PGK-neo-3xpA (STOP) cassette occurs in the ROSA26-locus-based expression of an exonl-GST-iBox-IRES-eGFP bi-cistronic fusion transcript. This deletion results from Cre-Lox recombinase technology at a site-specific location so that the GST-iBox gene sequence can be expressed. The system consists of a single enzyme, Cre recombinase, that recombines a pair of short target sequences, e.g., the Lox sequences, without the need to insert extra supporting proteins or sequences. Placing the Lox sequence appropriately flanking the PGK-neo-3xpA (STOP) cassette allows the genes to be deleted. As a result, the activity of the Cre recombinase enzyme can be controlled so that it is expressed in a particular cell type or triggered by an external stimulus like a chemical signal or a heat shock. These targeted DNA changes are useful in cell lineage tracing and when mutants are lethal if expressed globally.
Genotyping using PCR analysis of genomic DNA isolated from tail detecting presence of fusion transcript by both external primers (F1 and R1) and internal primers (F2 and R2). These primers are as follows:

	(SEQ ID NO: 4)
	F1: 5′-TAGGTAGGGGATCGGGACTCT-3′;

	(SEQ ID NO: 5)
	R1: 5′-GCGAAGAGTTTGTCCTCAACC-3′;

	(SEQ ID NO: 6)
	F2: 5′-CCCATCAAGCTGATCCGGAAC-3′;
	and

	(SEQ ID NO: 7)
	R2: 5′-GTGAACAGCTCCTCGCCCTTG-3′.

These primers were used to confirm expression of the GST-iBox gene sequence in vitro and in vivo. The IRES-eGFP plasmid was used to confirm expression of GST-iBox plasmid. Viable GST-iBox transgenic mice can be produced, and these mice allow constitutive expression of a potent peptide inhibitor of Group B Paks (Pak 3, Pak 4, and Pak 5), iBox. In preliminary experiments, the expression of the iBox transgene inhibited cell proliferation in each of the tissues studied. The iBox gene sequence is provided as SEQ ID NO:1, the GST-iBox gene sequence is shown in SEQ ID NO:2. The GST-iBox plasmid sequence is shown in FIG. 2.
The present disclosure provides iBox transgenic mice. This provides control of expression of the transgene in mice, and they may be useful as a tool to aid studies of development, tissue renewal, aging, cancer, and a variety of conditions or diseases that involve cell proliferation.
In one aspect, a transgenic mouse comprises a transgene comprising a nucleic acid sequence encoding a peptide inhibitor of Group B Paks (Pak 4, Pak 5, and Pak 6), iBox. In some embodiments, the mouse comprises a transgene comprising a nucleic acid sequence encoding the iBox peptide linked to GST. The mice comprise at least one copy of the transgene which, in some embodiments, is stably integrated into a chromosome. The transgene may be present in the gametes and/or somatic cells of the animal. The transgene may comprise the nucleic acid sequence of SEQ ID NO:1 or SEQ ID NO:2 or the complement thereof. The transgene may further comprise the nucleic acid sequence of SEQ ID NO:3 (eGFP). The iBox plasmid for transformation may comprise the plasmid shown in FIG. 2 and FIG. 3.
In some embodiments, the transgene is present in and capable of expression in one or more tissues or organs in the mouse. Exemplary tissues and organs include, but are not limited to, the skin, tongue, bone marrow, brain, heart, liver, kidney, lung, pancreas, bladder, mammary tissue, skeletal muscle, esophagus, stomach, small intestine, and large intestine, or any subpart thereof. Cells, tissues, or organs comprising the transgene may be isolated from the mouse, and may be grown in culture and/or subjected to further study. Cells, tissue, or organs comprising the iBox transgene (e.g., SEQ ID NO:1 or SEQ ID NO:2) isolated or obtained from a mouse further are provided.
It is possible to achieve tissue-specific (and organ-specific) expression of the iBox transgene, for example, by breeding the foxed iBox mouse with a Cre mouse having the Cre recombinase gene expressed in particular tissues or organs. An example of expression of the iBox transgene following Cre-mediated excision of the LSL motif is shown in FIG. 4. For example, a Cre mouse can include, but not be limited to, CDX2-Cre, Tie2-Cre, Postn-Cre, B6.FVB-Tg(Pdxl-cre)6Tuv/J (Pdx-Cre), in addition to others. Many Cre mice are commercially available, including many mice with particular tissues having Cre. Any such Cre mice are suitable for breeding with the foxed iBox mouse in order to establish tissue-specific expression of the iBox transgene. Cre mice are available, for example, from The Jackson Laboratory (world wide web at jax.org). Constitutive expression of the transgene in particular tissues can thus be achieved through breeding with appropriate Cre mice.
The Group B Paks ( Pak 4, 5, and 6) may be expressed in any combination in a given tissue. Some tissues within the body express all three Group B Paks, though other tissues in the body express only one or two of these Group B Paks. As well, some tissues in the body may express more of a particular Group B Pak or combination thereof than another Group B Pak. Thus, for example, in embodiments where a given organ or tissue expresses only a single Group B Pak, the effects of the iBox inhibitor and, more generally, on inhibition of that Group B Pak can be assessed.
The present disclosure is not limited to mice, and can include any member of a category of other non-human mammals such as rodents (e.g., rats, rabbits), companion animals, farm animals, non-human primates, and other non-human mammals. Any non-human animal expressing Cre, which can be bred with any non-human animal expressing a foxed iBox transgene, can produce iBox transgene expression. Mice, being exemplified, are suitable.
The present disclosure also provides methods for producing a transgenic mouse, as well as mice produced by any of the methods. In some embodiments, the method comprises breeding a mouse comprising an iBox transgene (e.g., foxed iBox) with a Cre mouse, and selecting offspring having the iBox transgene and the CRE-expressing transgene. Such offspring should express the iBox peptide.
In some embodiments, the method comprises introducing a nucleic acid sequence encoding the iBox peptide inhibitor into a mouse egg (fertilized or unfertilized), zygote, embryo, or embryonic stem cell, and transferring the mouse egg, zygote, embryo, or embryonic stem cell having the introduced nucleic acid sequence into a female mouse. The method may further comprise fertilizing the egg. The method may further comprise breeding the female mouse and selecting offspring having the nucleic acid sequence. Offspring may be referred to as “progeny.”
In some embodiments, the method comprises introducing a nucleic acid sequence encoding iBox peptide inhibitor into a mouse egg (fertilized or unfertilized), zygote, embryo, or embryonic stem cell, transferring the mouse egg, zygote, embryo, or embryonic stem cell having the introduced nucleic acid sequence into a female mouse, breeding the female mouse with a male Cre mouse, and selecting offspring having the nucleic acid sequence and the CRE-expressing transgene, expressed in specific target tissues. Such offspring should express the iBox peptide in the target tissues.
Any technique suitable for introducing the nucleic acid sequence may be used. Non-limiting examples include electroporation, microinjection, viruses, lipofection, calcium phosphate, and other known transformation techniques.
Animals, including offspring, may be screened to confirm the presence of the transgene according to any technique suitable in the art. For example, cells may be isolated and tested for the presence of the gene, a detectable marker, selection marker, translation product, detectable mRNA, and/or detectable phenotype. Green fluorescent protein (GFP) or enhanced GFP (eGFP), or similar fluorescent marker, may be linked to or co-expressed with the iBox transgene to confirm presence, as well as expression of the transgene. The eGFP protein may comprise the protein encoded by the nucleic acid sequence of SEQ ID NO:3.
Offspring carrying the transgene can further be bred with other animals to perpetuate the transgenic line, or can be bred with animals carrying other transgenes. Breeding includes back crossing, including back crossing into distinct genetic backgrounds. Offspring include any filial or backcross generation.
In some embodiments, offspring from the iBox+Cre mice (e.g., mice expressing the iBox transgene) can be further bred with a Cre-induced cancer model mouse. For example, mice with a mutant KRAS transgene under loxP control can be bred with a Cre mouse comprising Cre in the pancreas, creating pancreas-specific expression of the mutant KRAS gene to induce mutant KRAS expression in the pancreas of progeny mice. The progeny mice will therefore develop pancreatic cancer. Such mutant-KRAS-expressing progeny mice can then be further bred with an iBox-expressing mouse, to determine the effect of Group B Pak inhibition (via the expressed iBox peptide) on KRAS-induced pancreatic cancer.
The following representative embodiments are presented:

Embodiment 1

A transgenic mouse, comprising a transgene encoding the iBox peptide inhibitor.

Embodiment 2

The transgenic mouse according to embodiment 1, wherein the transgene comprises the nucleic acid sequence of SEQ ID NO:1.

Embodiment 3

The transgenic mouse according to embodiment 1 or 2, wherein the transgene comprises the nucleic acid sequence of SEQ ID NO:2.

Embodiment 4

The transgenic mouse according to any one of embodiments 1 to 3, wherein the transgene further comprises the nucleic acid sequence of SEQ ID NO:3.

Embodiment 5

The transgenic mouse according to any one of embodiments 1 to 4, wherein the transgene is inserted at the ROSA26 locus.

Embodiment 6

The transgenic mouse according to any one of embodiments 1 to 5, wherein the transgene is expressed in a single organ in the mouse.

Embodiment 7

The transgenic mouse according to embodiment 6, wherein the organ is the pancreas.

Embodiment 8

The transgenic mouse according to embodiment 7, wherein the mouse further comprises a transgene encoding a KRas oncogene in the pancreas.

Embodiment 9

The transgenic mouse according to embodiment 8, wherein the KRas oncogene comprises one or more alterations.

Embodiment 10

A cell isolated from the transgenic mouse according to any one of embodiments 1 to 9, wherein the cell comprises the transgene.

Embodiment 11

A tissue isolated from the transgenic mouse according to any one of embodiments 1 to 9, wherein at least one cell in the tissue comprises the transgene.

Embodiment 12

An organ isolated from the transgenic mouse according to any one of embodiments 1 to 9, wherein at least one cell in the organ comprises the transgene.

Embodiment 13

The organ according to embodiment 12, wherein the organ is the pancreas.

Embodiment 14

A method for producing a mouse comprising a transgene encoding the iBox peptide inhibitor, comprising introducing a nucleic acid sequence encoding the iBox peptide inhibitor into a mouse egg, embryo, or embryonic stem cell, and transferring the mouse egg, embryo, or embryonic stem cell having the introduced nucleic acid sequence into a female mouse.

Embodiment 15

The method according to embodiment 14, wherein the nucleic acid sequence comprises the nucleic acid sequence of SEQ ID NO:1.

Embodiment 16

The method according to embodiment 14 or 15, wherein the nucleic acid sequence comprises the nucleic acid sequence of SEQ ID NO:2.

Embodiment 17

The method according to any one of embodiments 14 to 16, wherein the nucleic acid sequence further comprises the nucleic acid sequence of SEQ ID NO:3.

Embodiment 18

The method according to any one of embodiments 14 to 17, further comprising breeding the female mouse and selecting offspring having the nucleic acid sequence.

Embodiment 19

A mouse produced according to the methods of any one of embodiments 14 to 18.

Embodiment 20

A method for producing a mouse comprising a transgene encoding the iBox peptide inhibitor, comprising introducing a nucleic acid sequence encoding the iBox peptide inhibitor into a mouse egg, embryo, or embryonic stem cell, and transferring the mouse egg, embryo, or embryonic stem cell having the introduced nucleic acid sequence into a female mouse, breeding the female mouse with a male Cre mouse, and selecting offspring expressing the iBox transgene.

Embodiment 21

The method according to embodiment 20, wherein the nucleic acid sequence comprises the nucleic acid sequence of SEQ ID NO:1.

Embodiment 22

The method according to embodiment 20 or 21, wherein the nucleic acid sequence comprises the nucleic acid sequence of SEQ ID NO:2.

Embodiment 23

The method according to any one of embodiments 20 to 22, wherein the nucleic acid sequence further comprises the nucleic acid sequence of SEQ ID NO:3.

Embodiment 24

The method according to any one of embodiments 20 to 23, wherein the male Cre mouse expresses Cre recombinase in a single organ.

Embodiment 25

The method according to embodiment 24, wherein the single organ is the pancreas.

Embodiment 26

The method according to any one of embodiments 20 to 25, further comprising breeding the offspring with a second Cre mouse comprising a transgene encoding a KRas oncogene.

Embodiment 27

The method according to embodiment 26, wherein the second Cre mouse expresses the KRas oncogene in the pancreas.

Embodiment 28

The method according to embodiment 26 or 27, wherein the KRas oncogene comprises one or more alterations.

Embodiment 29

A mouse produced according to the methods of any one of embodiments 20 to 28.
The following examples are provided to describe the present disclosure in greater detail. They are intended to illustrate, not to limit, the present disclosure.

EXAMPLES

Example 1: General Experimental Methods

Gateway-Compatible Vector Construction

The Gateway-compatible pROSA26-DV1 was obtained from Dr. Jody Haigh. A GST-iBox fragment was cloned into a pEntry vector after PCR and gel purification. The LR reaction was performed using Clonase™ Enzyme Mix (Life Technology) according to the manufacture's instruction. A positive clone (pROSA26-GST-iBox-IRES-eGFP) was analyzed by restriction digests and sequencing. In particular, pROSA26-GST-iBox-IRES-eGFP was linearized by PvuI and electroporated into G4 ES cells.

Generation of Transgenic Mice

B6C3F1 female mice were superovulated with 5 iu of PMSG and 5 iu of hCG each, and mated to B6C3F1 males to generate 1-cell fertilized embryos for microinjection. ROSA26 L/R zinc finger nuclease mRNA (50 ng/μl) and iBox DNA construct (2 ng/μl) were injected into the embryos' pronuclei. The surviving embryos were implanted into d0.5 pseudo-pregnant recipient mothers (Swiss Webster).
The pROSA26-GST-iBox-IRES-eGFP plasmid was co-injected with Zinc-finger constructs targeting the Rosa26 locus into mouse zygotes. Zygotes were obtained by superovulation of C57BL/6N females (Charles River). The next day zygotes were collected from oviducts and microinjected in M2 embryo medium following standard procedures with a mixture of targeting vector and ZFNRosa mRNAs (2.5 ng/μL each) loaded into a single microinjection needle. For microinjection a two-step procedure was applied: A first aliquot of the DNA/RNA mixture was injected into the male pronucleus (to deliver the DNA vector, as used for the production of transgenic mice). Upon the withdrawal of the injection needle from the pronucleus, a second aliquot of the DNA/RNA mixture was injected into the cytoplasm to deliver the ZFN mRNA directly to the translation machinery. Injections were performed using a Leica micromanipulator and microscope and an Eppendorf FemtoJet injection device. Injected zygotes were transferred into pseudopregnant CD1 female mice and fetuses recovered at day E18 for further analysis. Recovered fetuses were analyzed by PCR using the F1 and R1, and F2 and R2 primers to identify successfully targeted mice. Genomic DNA of pups was prepared from tails for detecting existence of transgene by both external primer (F1 and R1) and internal primer (F2 and R2).

Cell Culture, Transfections and Infections

Primary mouse embryo fibroblasts were established from E14 embryos from pregnant ROSA26-iBox mice. Cell lines were maintained in DMEM medium supplemented with 10% of FBS, 2 mM L-glutamine and 100 Um′ penicillin/streptomycin ay 37° C. in a humidified 5% CO₂incubator. To document iBox and EGFP expression, the MEFs were transduced with Adeno-Cre which removes the LSL cassette. MEFs were imaged to documents EGFP expression and lysates were probed by immunoblot to document iBox expression using anti-GST antibodies that recognize the GST protein that is fused to the N-terminus of iBox. These lysates were also probed with antibodies against Erk and P-Erk, Src and P-Src, Fak and P-Fak, as well as GAPDH.

Cell Proliferation Assay

Cells were plated at 2×10³in 96-well plates and 10 μl of 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl tetrazolium bromide (MTT) solution was added to each well to a final concentration of 0.5 mg/ml. The reaction was stopped after 4 hours at 37° C. by adding 100 μl of solubilization solution (10% SDS in 0.01M HCl) and the samples were analyzed at 595 nm on Perkin Elmer Envision plate reader. Triplicates were performed for each sample, and experiments were performed on three occasions. FIG. 5A shows mouse embryo fibroblasts (MEFs) derived from Tg-LSL-iBox mice were infected with an empty Adenovirus or Adenovirus-Cre. An anti-Gst blot is shown. FIG. 5B shows proliferation rates of MEFs expressing iBox (Cre+).

Kinase Assay

To analyze endogenous Pak4 activity, Pak4 was immunoprecipitated from ROSA26-iBox MEFs and Protein-A-Pak4 beads were incubated with recombinant Pacsin or CRTC1 for 10 minutes at 30° C. in a buffer containing 50 mM Tris-HCl, pH 7.5, 10 mM MgCl₂, 1 mM DTT, and 50 μM ATP. Reactions were terminated with hot 6×SDS/PAGE buffer and the samples were analyzed by immunoblot using anti-P-pacsin or anti-P-CRTC1 antibodies. FIG. 5C shows Pak4 was immunoprecipitated from lysates from these MEFs were assayed for Pak4 kinase activity. FIG. 5D shows lysates were probed for the indicated signaling molecules. Inhibition of Erk, Src, and Fak was observed.
The present disclosure is not limited to the embodiments described and exemplified above, but is capable of variation and modification within the scope of the appended claims.

Claims

What is claimed is:

1. A transgenic mouse comprising a transgene encoding the iBox peptide inhibitor.

2. The transgenic mouse according to claim 1, wherein the transgene comprises the nucleic acid sequence of SEQ ID NO:1.

3. The transgenic mouse according to claim 1, wherein the transgene comprises the nucleic acid sequence of SEQ ID NO:2.

4. The transgenic mouse according to claim 1, wherein the transgene further comprises the nucleic acid sequence of SEQ ID NO:3.

5. The transgenic mouse according to claim 1, wherein the transgene is inserted at the ROSA26 locus.

6. The transgenic mouse according to claim 1, wherein the transgene is expressed in the pancreas in the mouse.

7. The transgenic mouse according to claim 6, wherein the mouse further comprises a transgene encoding a KRas oncogene in the pancreas.

8. The transgenic mouse according to claim 7, wherein the KRas oncogene comprises one or more alterations.

9. A cell, tissue, or organ isolated from the transgenic mouse according to claim 1, wherein at least one cell comprises the transgene.

10. A method for producing a mouse comprising a transgene encoding the iBox peptide inhibitor, comprising introducing a nucleic acid sequence encoding the iBox peptide inhibitor into a mouse egg, embryo, or embryonic stem cell, and transferring the mouse egg, embryo, or embryonic stem cell having the introduced nucleic acid sequence into a female mouse.

11. The method according to claim 10, wherein the nucleic acid sequence comprises the nucleic acid sequence of SEQ ID NO:1.

12. The method according to claim 10, wherein the nucleic acid sequence comprises the nucleic acid sequence of SEQ ID NO:2.

13. The method according to claim 10, wherein the nucleic acid sequence further comprises the nucleic acid sequence of SEQ ID NO:3.

14. The method according to claim 10, further comprising breeding the female mouse and selecting offspring having the nucleic acid sequence.

15. A method for producing a mouse comprising a transgene encoding the iBox peptide inhibitor, comprising introducing a nucleic acid sequence encoding the iBox peptide inhibitor into a mouse egg, embryo, or embryonic stem cell, and transferring the mouse egg, embryo, or embryonic stem cell having the introduced nucleic acid sequence into a female mouse, breeding the female mouse with a male Cre mouse, and selecting offspring expressing the iBox transgene.

16. The method according to claim 15, wherein the nucleic acid sequence comprises the nucleic acid sequence of SEQ ID NO:1.

17. The method according to claim 15, wherein the nucleic acid sequence comprises the nucleic acid sequence of SEQ ID NO:2.

18. The method according to claim 15, wherein the nucleic acid sequence further comprises the nucleic acid sequence of SEQ ID NO:3.

19. The method according to claim 15, wherein the male Cre mouse expresses Cre recombinase in the pancreas.

20. The method according to claim 15, further comprising breeding the offspring with a second Cre mouse comprising a transgene encoding a KRas oncogene.

21. The method according to claim 20, wherein the second Cre mouse expresses the KRas oncogene in the pancreas, wherein the KRas oncogene comprises one or more alterations.