US20160298151A1 - Novel Method for the cheap, efficient, and effective production of pharmaceutical and therapeutic api's intermediates, and final products - Google Patents

Novel Method for the cheap, efficient, and effective production of pharmaceutical and therapeutic api's intermediates, and final products Download PDF

Info

Publication number
US20160298151A1
US20160298151A1 US15096164 US201615096164A US2016298151A1 US 20160298151 A1 US20160298151 A1 US 20160298151A1 US 15096164 US15096164 US 15096164 US 201615096164 A US201615096164 A US 201615096164A US 2016298151 A1 US2016298151 A1 US 2016298151A1
Authority
US
Grant status
Application
Patent type
Prior art keywords
compounds
interest
process
final products
cheap
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
US15096164
Inventor
Sher Ali Butt
Jacob Michael Vogan
Original Assignee
Sher Ali Butt
Jacob Michael Vogan
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00Preparation of nitrogen-containing organic compounds
    • C12P13/02Amides, e.g. chloramphenicol or polyamides; Imides or polyimides; Urethanes, i.e. compounds comprising N-C=O structural element or polyurethanes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52Genes encoding for enzymes or proenzymes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00Preparation of nitrogen-containing organic compounds
    • C12P13/001Amines; Imines
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P17/00Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
    • C12P17/02Oxygen as only ring hetero atoms
    • C12P17/06Oxygen as only ring hetero atoms containing a six-membered hetero ring, e.g. fluorescein
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00Preparation of oxygen-containing organic compounds
    • C12P7/02Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C12P7/22Preparation of oxygen-containing organic compounds containing a hydroxy group aromatic
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00Preparation of oxygen-containing organic compounds
    • C12P7/40Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
    • C12P7/42Hydroxy-carboxylic acids

Abstract

The present invention is a method for the biosynthesis of hundreds of compounds, mainly found in the cannabis plant. The starting material for these compounds can be any biological compound that is used/produced in a biological organism from the sugar family starting materials or other low cost raw materials processed via enzymes or within organisms to give final products. These final products include, but are not limited to: cannabinoids, terpenoids, stilbenoids, flavonoids, phenolic amides, lignanamides, spermidine alkaloids, and phenylpropanoids. Specifically, the present invention relates to the regular/modified/synthetic gene(s) of select enzymes are processed and inserted into an expression system (vector, cosmid, BAC, YAC, phage, etc.) to produce modified hosts. The modified host is then optimized for efficient production and yield via manipulation, silencing, and amplifying inserted or other genes in the host, leading to an efficient system for product.

Description

    RELATED APPLICATIONS
  • The present application claims the benefit of priority to U.S. Provisional Patent Application Ser. No. 62/145,430, entitled “A Novel Method for the Cheap, Efficient, and Effective Production of Pharmaceutical and Therapeutic API's, Intermediate, and Final Products”, filed Apr. 9, 2015, and currently co-pending.
  • FIELD OF THE INVENTION
  • The present invention is in the technical field of large scale production of pharmaceutical and supplemental products for various common illnesses, medical conditions, and general industrial use. More particularly, the present invention is in the technical field of bio-synthesis of cannabinoids, terpenoids, stilbenoids, flavonoids, phenolic amides, lignanamides, spermidine alkaloids, and phenylpropanoids; compounds found in cannabis sativa, along with various combinations and specialized formulations which are beneficial in ailments ranging from cancer to glaucoma. The final product(s) can be an intermediate or a compound of interest. The core concept of the invention is based on the idea of cheaper and more efficient production, along with novel products and applications.
  • BACKGROUND OF THE INVENTION
  • Cannabinoids from cannabis have been used for thousands of years for treatment of various ailments and conditions in many different cultures around the world. However, most of various types of cannabinoids in cannabis are at a very low concentration in the plant. Therefore, most patients/users never get a threshold dosage for any kind of relief from anything other than tetrahydrocannabinolic acid (THC/A), cannabinolic-acid (CBD/A), and cannabinol (CBN). There are a few strains or concentrates available that have a rare cannabinoid, but are usually very highly concentrated in tetrahydrocannabinol (THC) or cannabidiol (CBD) to have any pronounced effect by the rare cannabinoid.
  • In other words, the pharmaceutical industry has not tapped into the real potential of the cannabis plant. With time, more research is being conducted into the different kinds of cannabinoids and their medicinal applications. Researchers are finding that many of the other cannabinoids also have unique medicinal properties.
  • SUMMARY OF THE INVENTION
  • Biosynthesis of important molecules can be used for therapeutic applications, bulk substance production, intermediate API biosynthesis, and various other novel formulations and applications for such substances, as known to those skilled in the art. Many biological molecules can be changed/converted into molecules of importance by using enzymes and other processes. This process can be utilized by employing methods for transforming a range of starting materials into final products to be used in pharmaceuticals and supplements as active ingredients, or donating a significant portion of their structure to the final active ingredients. The final products can also be used in other industries and applications, such as food, beverage, and other goods production. For example, table sugar, starch, and cellulose can be converted to glucose, creating a molecule that can readily be utilized by any organism as an energy source. Therefore, depending on the specific compound(s) being manufactured, and the kind(s) of starting materials available, along with the host and production technique(s) any kind of host engineering, various expression systems and methods, and varying materials, a spectrum of different methods and products is possible.
  • The advantages of the present invention include, without limitation, creation of hundreds of compounds from readily available biological molecules that can be produced and harvested from virtually all known sources of plants and other energy producing organisms. Since sugar producing plants and organisms, biomass, and carbon based industrial waste products are very abundant, our “raw material” will be very cheap and easy to obtain anywhere in the world. After scaling up the given methods, hundreds of compounds with medicinal properties can be produced at a very low cost, allowing the widespread distribution and aiding of millions of people.
  • Another advantage is that there is no need or use of growing any illegal plants. For example, no marijuana, poppy, or other plant production is necessary. This is advantageous as it will lead to drastically cutting down the production, consumption, and trafficking of many unregulated substances.
  • The most important advantage of the present invention is that we can make and use many compounds that are virtually so low in concentration in the cannabis plant, that there is no effect in using cannabis if we are only after the therapeutic effects of these compounds. For example, patients using marijuana can only benefit from tetrahydrocannabinolic acic (THCA), THC, cannabidiolic acid (CBDA), CBD, CBN, and a few other compound class families, as the concentrations of the other compounds is so low that it has no effect. This invention will allow the production of hundreds of compounds in pure form, leading to many new medical discoveries and applications.
  • BRIEF DESCRIPTION OF THE FIGURES
  • The nature, objects, and advantages of the present invention will become more apparent to those skilled in the art after considering the following detailed description in connection with the accompanying figures, in which like reference numerals designate like parts throughout, and wherein:
  • FIG. 1 is a diagram of the pathway for the biosynthesis of all molecules of interest via the conversion of starting materials to glucose and then to final products;
  • FIG. 2 is a diagram of the pathway for the biosynthesis of cannabinoids;
  • FIG. 3 is a diagram of the pathway for the biosynthesis of stilbenoids;
  • FIG. 4 is a diagram of the pathway for the biosynthesis of phenylpropanoids and flavonoids;
  • FIG. 5 is a diagram of the pathway for the biosynthesis of phenolic amides and ligananamides;
  • FIG. 6 is a diagram of the pathway for the biosynthesis of spermidine alkaloids;
  • FIG. 7 is a diagram of the combined biosynthetic pathways of FIGS. 1-6; and
  • FIG. 8 is diagram of the genetic modification of certain genes for higher product yield in Saccharomyces cerevisiae yeast.
  • DETAILED DESCRIPTION OF THE INVENTION
  • The present invention is a method for the biosynthesis of hundreds of compounds, mainly found in the cannabis plant. The starting material for these compounds can be any biological compound that is used/produced in a biological organism from the sugar family starting materials or other low cost raw materials processed via enzymes or within organisms to give final products. These final products include, but are not limited to: cannabinoids, terpenoids, stilbenoids, flavonoids, phenolic amides, lignanamides, spermidine alkaloids, and phenylpropanoids (collectively, “final products”).
  • DEFINITIONS, TERMS, ELEMENTS
  • The following are a list of terms and their definitions:
      • Genetic engineering: targeted manipulation of a cell's genetic information
      • Rational Metabolic Engineering: engineering of enzymes, transporters, or regulatory proteins based on available information about enzymes, pathways, and their regulation.
      • Evolutionary engineering: encompasses all methods for empirical strain improvement (mutagenesis [natural or induced] and recombination and/or shuffling of genes, pathways, and even whole cells; usually performed in cycles or sequentially
      • Cannabinoids: compounds that are terpenophenolic with 22 carbons (21 carbons for neutral forms), found in cannabis
      • Terpenoids: also known as isoprenoids, class of organic compounds
      • Stilbenoids: hydroxylated derivatives of stilbene
      • Flavonoids/phenylpropanoids: compounds derived from or using phenylalanine as a precursor
      • Lignanamides/phenolic amides: compounds produced through tyramine pathways
      • Spermidine alkaloids: compounds produced through glutamic acid pathways
      • Starting material/reactant/excipient: compounds used for the initial step of biosynthesis, which are cheap and readily available
      • Intermediate: products that are formed within the biosynthesis pathways, which can further be processed to make final products, or can, themselves, be utilized as a final product
      • Final product/product/end product/compounds of interest: cannabinoids, terpenoids, stilbenoids, flavonoids, phenolic amides, lignanamides, spermidine alkaloids, and phenylpropanoids
      • In-vivo: inside the cell
      • In-vitro: outside the cell
      • BAC: bacterial artificial chromosome, carrier of DNA of interest into host
      • YAC: yeast artificial chromosome, carrier of DNA of interest into host
      • Vector/cosmid/phage: carrier of DNA of interest into host
    Starting Materials
  • All biological organisms produce organic molecules that are processed in many different processes in the organism. The present invention utilizes starting materials that are either:
      • 1) Readily available and relatively pure
      • 2) Cheap to produce or buy
      • 3) Easily modified (via enzymes, catalysts, or other methods)
  • Based on the above criteria, there are multiple groups and families of compounds that would fit one or all three of the above criteria. These groups and families of compounds include, but are not limited to: ligno-cellulosic biomass, forest biomass, energy/food production waste, commonly available sugar-based substrates, food and feed grains.
  • Sugars and metabolic intermediates from cellular processes can be used as starting materials. Sugars can be found in abundance in many substances, including, but not limited to the following: rice, soya/rape, cereals (maize), wheat, beans, sugar beet (sugar cane), plant biomass (wood), grasses, and various other sources. Starch, cellulose, fructose, ethanol, and saccharose in the aforementioned substances can be enzymatically converted to glucose, which, after filtration and purification steps, can be used as a raw material for the final products.
  • Subsequent steps can also be performed on the lignocellulose, which further makes hemicellulose and cellulose, both which make glucose. An advantage of this method is that there are by-products generated which can be sold as raw material to make hydrocarbons, biogas, and other fuel sources. Whole crops or parts of crops, or waste matter from crop products can be used and incorporated into this system, yielding an “eco-friendly” facility. Products made from these raw materials can use any of the starting materials listed in Table 2.
  • Within the realm of readily available non-biomass/crop bulk material, HFCS (high fructose corn syrup) is a cost effective syrup made with fruit sources that contains anywhere from 30-90% fructose, along with some other sugars. Plants that make molasses, HFCS, and other sugars can be genetically modified to enhance the production of sugar, leading to better yields of starting material from the crop. Other products from these plants can also be incorporated into compounds of interest production via slight system modification. Biodiesel, ethanol, glycerol, lactic acid, whey and glucose are a few others. These work due to the fact that any of these products can be converted into starting material for our own purposes using enzymatic or physiochemical tools.
  • Plants also have their own innate levels of metabolites that can be harvested into the process from a plant biomass source. Processes can be crafted that utilize most of the metabolites and biomass for API production giving the maximum efficiency and usability per amount of starting material used. (Enzyme combinations or chambers that utilize most intermediates, sugars, oils, etc. in each biomass load).
  • Biorefineries can be custom designed that cater to specific raw material (plant biomass for harvesting lignocellulose which is further processed and refined into a simple carbohydrate used in the API manufacturing processes). During certain steps throughout the process, thermochemical and other processing can be used for higher efficiencies which are not possible with biochemical processing alone.
  • Another group of cheap starting materials is agricultural residue, grass, aquatic biomass, and water hyacinth. Products such as oils and alcohols can be made with these bulk materials. These materials can be converted enzymatically and chemically into starting materials that can readily by injected into our API production system.
  • Specifically, biorefineries can be designed to be extremely efficient, using all parts of the raw material. For example, concerning plant biomass, the biomass can be step-wise processed so we are able to harvest all individual components. The first step can be using solvent to extract terpenes, alkaloids, etc. Other methods can be used to extract steroids, triglycerides, and other valuable metabolites. Finally the biomass can be treated with cellulases to give glucose, which is one of the primary raw materials of choice.
  • Production Roadmap Summary
  • The present invention is a method that covers the bio-synthesis of hundreds of compounds, mainly found in the cannabis plant. The starting material for these compounds can be any biological compound that is used/produced in a biological organism from the sugar family starting materials or other low cost raw materials processed via enzymes or within organisms to give final products. Information related to the starting materials were detailed in the previous section.
  • Most sugars and related compounds can be inter-changed using various enzyme systems. For example, we can convert glucose to fructose using Fructose 6-Phosphate (F-6-P) as an intermediate.
  • Apart from starting materials, we can either:
      • 1) Make enzymes via vectors in bacteria (e.g. E. coli) or yeast (e.g. S. cerevisiae), extract enzymes, and create in vitro models for making cannabinoids.
      • 2) Make enzymes via protein synthesizing systems (Protein Synth. Robot, Cell Free Expression Systems, etc.)
      • 3) Make final products (compounds of interest) in bacteria or yeast via vectors, plasmids, cosmids, mRNA, various RNA, etc; feed them substrate and purify product.
      • 4) Genetically engineer strains of bacteria and yeast that specialize in cannabinoid production, or intermediate production, or substrate production, etc.
      • 5) Use organic chemistry for certain parts of the above processes.
      • 6) Use various plant starting material for large quantities of substrates or intermediates.
      • 7) Genetically engineer various plants to produce cannabinoids. (e.g. Tomatoes or celery that naturally produce cannabinoids, or algae that produces cannabinoids)
      • 8) Using bioengineered or unengineered C. sativa or any other plant/algae cell lines for enzyme/substrate/intermediates/product(s) production.
      • 9) Protein engineering on the various proteins involved in the processes; engineering will enhance the functionality, ruggedness, and efficiency of the enzymes, and altering them into a novel protein, one not found to be covered in any of the above prior art patents.
      • 10) Genetically engineer various plant species to produce higher yielding raw material (sugars) to be used in production of the products. A possibility is to have an indoor/grow for different plants to be used as raw material producers.
  • After the final product is made, a purification system will filter and concentrate the target molecules. Examples include large scale filtration systems such as chromatography. Once a pure product, we can utilize liquid solutions, caps, sprays, and other delivery systems.
  • As many of these final products are made, their applications can be seen from glaucoma to cancer, or general well-being. Certain cofactors can be combined with certain final products for more efficacy against specific medical conditions (e.g. combine certain vitamins or other therapeutic compounds with certain compounds of interest). We can also make final products that have certain combinations of compounds of interest with other cofactors as well (e.g. combine THCA/CBDANitamin C, or CBDVA/CBD). This patent covers all the products above and also ones discovered in the future based on the same principles and methods.
  • DETAILED DESCRIPTION OF THE FIGURES
  • Referring now to the invention in more detail, in FIG. 1 there is shown a family of sugars and other common derivatives. Along each arrow for each reaction, the number denotes a specific enzyme that catalyzes the reaction. Starting with any sugar in Figurel (list of starting materials in Table 1), we can convert it to glucose to incorporate it into the reaction using the appropriate enzyme, as known to those skilled in the art. An unlimited number of ways are possible when dealing with any starting material, as described above. Enzymes needed for each kind of substrate can be made in vivo or in vitro just as we will be doing for the enzymes in the final product or intermediate production. The final sugar that enters our mechanism will be either glucose or fructose. Through the glycolysis pathway, the sugar will be converted into Acetyl-CoA with the addition of ATP and CoA (shown in FIG. 1). From this point on, the intermediate can follow a variety of paths that can lead to hundreds of products. There are many alternative ways of doing this. We can use the DOX, MEP or MVA pathways to get IPP and DMAPP, which give us GPP and NPP. For a reaction with Olivetolic Acid or Divarinolic Acid, we get many cannabinoids as final products.
  • The generalized pathway for the production of cannabinoids once the starting material is converted to glucose is the following, using appropriate enzymes as known by those skilled in the art:
      • Glucose→Fructose→F-6-P→FI:6BP→3-P-Glyceraldehyde→1,3-BPG→3PGA→2-PGA→PEP→Pyruvate→Acetyl-CoA→Acetoacetyl CoA→HMG-CoA→MVA→Mevalonic Acid→Mevalonate-5-P→Mevalonate-5-PP→Isopentyl-5-PP→Dimethylallyl-PP→NPP/GPP→GPP
  • This general pathway is outlined in FIG. 1. From this point on, the pathway can utilize Olivetolic Acid or Divarinolic Acid with GPP, yielding CBGA or CBGVA, which can further yield other cannabinoids, as shown in FIG. 2.
  • The pathways for stilbenoids, phenylpropanoids, and flavonoids work in a similar fashion. Phenylalanine is generated from sugars, which is then further processed into other compounds using enzymes to final compounds, as shown in FIG. 3 and FIG. 4.
  • Phenolic amides and lignanamide pathways are derived from tyramine molecules reacting with other compounds, as shown in FIG. 5. Tyramine can also be synthesized in our cells of interest as most living organisms contain the pathway to synthesize tyramine on their own. Same is the case for spermidine alkaloid production, as most cells already produce glutamic acid, which can be further processed by enzymes into the final components, as shown in FIG. 6.
  • FIG. 7 is the total pathway overview, showing how all the different classes of compounds can be made, and the general paths they take for being biosynthesized in the cell.
  • Overview of Procedure
  • A general scheme of the work flow is as follows:
      • 1) Regular/modified/synthetic gene(s) of select enzymes are processed and inserted into an expression system (vector, cosmid, BAC, YAC, phage, etc.) to produce modified hosts.
      • 2) Mod host is then optimized for efficient production and yield via manipulation, silencing, and amplifying inserted or other genes in the host, leading to an efficient system for product. It is important to remember that every organism is different, and to get a specific compound each optimization will also be different.
      • 3) Mod host can produce enzymes and final products/intermediates, or be further modified using host engineering techniques. (Host engineering Can also be performed before insertion of exp. System)
      • 4) Mod and engineering hosts produce products and intermediates.
      • 5) Product is purified and can be further modified/processed.
  • In Table 1, different final products are listed along with possible uses. This list is by no means exhaustive, and as such this patent covers any molecules that are made this way. Table 2 lists all possible starting materials that can be utilized for a cheap and efficient biosynthesis.
  • In more detail, referring to the inter-conversion of sugars, we employ enzymes readily available in the market. Pure enzyme stock can be diluted and added to a solution with the substrates. Once the reaction is complete, we can filter out the enzyme via dialysis tubing, by precipitation out of the solution, chromatography, or other industrial methods for filtration and purification. Each step in FIGS. 1 to 7 will give work with this strategy, leading us up to the final products or key intermediate molecules. Certain steps in the process can be worked on by using chemical and physical methods as well. For example, prenylation of certain compounds can be done outside the cell, as it may be advantageous to do so since unprenylated compounds are also high value compounds. Small batches can be prenylated accordingly to demand via a chemical process.
  • There are also commercially available cell free expression systems, which are able to produce proteins without the need of any host. With appropriate optimization steps, it is possible to get a cheap and efficient process for production of these compounds using identified starting molecules.
  • Application Techniques
  • Referring to bacterial, yeast, plant, and algae incorporation of genes, there are a number of strategies that can be applied to achieve this. We can:
      • 1) Add genes for 1-10 enzymes in various commercially available vectors, cosmids, plasmids, etc. Only need 1-10 enzymes added, as others are already built in most living organisms. For example, glycolysis pathway and related enzymes are already present in most hosts.
      • 2) Bioengineer genes for better yield and suitability in the host.
      • 3) Bioengineer strains of bacteria and yeast that are specialized in producing important molecules. Many metabolic strategies exist, with identification by appropriate screening methods:
        • 1) Rational metabolic engineering: engineering pathways using available information
        • 2) Evolutionary engineering: using random genetic perturbations and/or mutations (via random mutagenesis in whole genome and/or parts)
        • 3) Transposon mutagenesis & gene overexpression libraries: overexpression and/or deletion of single or multiple genes;
        • 4) Global transcription machinery engineering: basal transcription factors mutagenesis causing a global reprogramming of gene transcription and/or translation
      • One strategy is to suppress any pathway that is not essential to our goals or the survival of the host.
  • Another is to enhance our key pathways, or mixing and matching the two methods. The second strategy is through rapid directed evolution, possible by producing many generations so eventually we get a generation of host that has evolved with our genes/functions of interest.
      • 4) Bioengineer custom basic life forms that are specifically making our products, using another organism or using synthetic/modifications. Components from other hosts and system to make a custom organism.
      • 5) Bioengineer bacteria and yeast to have enzyme genes in their chromosomes, and make intermediates or final products inside the host. The product of this process can further be modified.
      • 6) Propagate various colonies of organisms which co-exist symbiotically, with the first making our starting material after utilizing a precursor, and the other colonies making our final product. This process can also be incorporated into an ecosystem type setup of different chambers, each holding different organisms that use specific parts of the raw material to produce intermediates or final products that can be modified post-manufacturing.
  • Referring to the extraction of enzymes once they have been produced in the host, there are many ways to isolate and purify our enzymes. Many organisms have the ability to excrete proteins, which can be collected much easier than cell lysis, as known by those skilled in the art. This technique is the preferred method.
  • Another method is to lyse the host culture and purify with traditional biochemistry methods (gels, centrifugation, ammonium sulfate precipitation, etc.), use a specialized nickel column with a prep HPLC (need to add a HIS tag to our proteins; remove HIS tag after purification), etc.
  • Example Bacterial
  • Bacteria (E. Coli, etc.) are inserted with exp. system giving us a modified host. The mod host can either be further processed or it can generate products. Products/intermediates are made in the host, and may be either enzymes that are further extracted and used in vitro, or we add substrates into the bacterial culture so they use the enzymes produced in them to make the substrate. Either way (protein or prod production), purification is carried out to get final products, or intermediates that can be further processed in vitro to give final products. Throughout this procedure, host engineering can be carried out at any step of any process to get better yields.
  • Example 2 Plants
  • Plant tissue can be used as a starting material to get a tissue culture going. Appropriate expression vectors/systems carry our interest genes into the cells. Alternatively, cell engineering can lead to many combinations that may have similar or different outcomes. The culture can be grown into full plants, and products are ingested by consuming the plants (e.g. tomatoes with certain cannabinoids produced within, etc.). The second way uses the cell culture in a synthetic environment to produce final products/intermediates. Finally, product is purified and used.
  • Example 3 Algae
  • Algae are modified with the usual techniques used for host engineering. Once completed, the mod host can be embedded into a system similar to biofuel production from algae. Using sunlight and some nutrients, the algae produces final products/intermediates, which is appropriately filtered from the bulk. Other products generated can be further processed to get biofuels or other important compounds that can readily be sold in the market.
  • Example 4 Fungi
  • Fungi modified with the techniques can:
    • 1) Use plastic to produce final products/intermediates. Plastic needs to be processed and broken down into components before being used in this process via chemical and biological processes, known by those skilled in the art.
    • 2) Clean up waste, whilst producing final products/intermediates at the same time.
    • 3) Produce beer and wine with fungi that also makes final prod/intermediates. Beer and wine will contain our compounds of interest.
    • 4) Use fungi cultures to produce compounds of interest.
    • 5) Genes for s. cerevisiae strains to be modified for better yields of final products:
      • tHMGR
      • upc2-1 (allows higher uptake of exogenous sterol five-fold from medium)
      • ERG genes (ERG6, ERG2, ERG3, ERG1, ERG11, ERG24, ERG25, ERG9, ERG10, ERG13, ERG12, ERGS, ERG19, ERG20)
      • HMGR1 and HMGR2
      • IDI genes
      • Gal80p
      • DPP1, ADH2, and ALD6 genes
      • FPP/GPP synthase (chose avian FPP synthase as it exhibits higher catalytic turnover rates and lower Kms for substrates than other prenyltransferases)
  • Manipulation, deletion, overexpression, and other modifications to the genes listed above will produce strains that are highly efficient for the production of our compounds of interest. These strains have an exogenous sterol uptake, as the internal sterol pathway has been disabled by manipulations so that all the carbon flux can be directed toward the production of our compounds of interest. Example of genetic pathway regulation in yeast is shown in FIG. 8.
  • Our initial strategy in S. Cerevisiae was to increase the carbon flux of our pathways of interest, while decreasing or eliminating pathways that led carbon flux away from our pathways as well. We also focused on exogenous sterol uptake for higher production and secretion levels, cell permeability for more efficient and cheaper production, along with focusing the pathways on utilizing the cheapest sugars. Dynamic control over ergosterol regulation can increase yields as well. Overall result is a strain that is has increased yield many fold, while making the overall production more stable and cheaper.
      • 1) Perform EMS mutagenesis on yeast strains (BY4741, BY4742, CEN.PK, CEN.PK2, EPY300) to get colonies with a SUE (sterol uptake exogenous) mutation. This enables us to provide exogenous sterol to the yeast while cancelling out the gene that diverts carbon flux towards ergosterol, thereby increasing total carbon flux. Without the SUE mutation, the cell diverts lots of carbon flux toward manufacturing sterols, thereby diverting the pools of intermediates away from our compounds and interest leading to very low yields.
      • 2) Perform ERG1 and ERG9 gene knockouts. ERG1 knockout stops the activity of conversion of squalene to squalene epoxide, thereby complementing the SUE mutation and allowing higher uptake of exogenous ergosterol, while ERG9 knockout takes out the cells ability to divert carbon flux towards other metabolites.
      • 3) On some lines, we can perform a DPP1 knockout. DPP1 knockout ensures that FPP/GPP are not converted to FOH, thereby blocking the pathway towards FOH products in the cell.
      • 4) Perform ERG2, ERG3, or ERG6 mutations in different cell lines, while performing upregulation mutation on upc2-1 gene (general transcription factor) on all three lines. This helps increase cell membrane permeability for better excretion of our compounds without the need for cell lysis and having the ability to use two-phase or continuous fermentation. This also allows the cells to uptake more fatty acids, thereby increasing the yield many fold.
      • 5) Overexpression of ERG10, ERG13, HMGR1/2 or tHMGR, ERG12, ERG8, IDI11, HFA1 genes in yeast inserted via vectors. By overexpression of these genes, we are amplifying the enzymes of the MVA pathway from the sugars to our compounds, thereby amplifying the intermediates and final products.
      • 6) Modification of avian and/or salmonella ERG20 gene encoded FPP synthase (ERG20p). Some cells lines can also be modified using the Erg20p(F96C) mutations. This allows for higher Kms and increased catalytic turnover compared to endogenous GPP synthase, while the engineering itself allows for production of GPP.
      • 7) Gal80p gene deletion so we do not need to use galactose sugar when inducing promoter expression. This is important since others have used galactose promoters, which need expensive galactose sugars for production. By deleting this gene, the cells bypass the need for galactose to express enzymes, leading to cheaper and more efficient biosynthesis.
      • 8) Adding ADH2p promoter to induce strong transcription under conditions with low glucose. This promoter is more efficient than the GAL promoter, and has best results while using non-glucose sugars (ethanol, fructose, etc.) which are cheaper.
      • 9) On some lines, we also overexpress ADH2 and ALD6 genes, along with overexpression of an acetyl-CoA C-acetyltransferase to increase efficiency of the system, while also gaining the ability to convert ethanol to acetate efficiently.
      • 10) Adding and overexpressing enzymes for the production of CBDA (OS-OAC fusion enzyme, CsPti, CBDA Synthase), constructed in a single vector. These enzymes are codon optimized.
      • 11) Grow colonies while adding free fatty acids, and hexanoic acid (for THCA, CBDA, CBGA, CBCA) or butyric acid (for THCVA, CBDVA, CBGVA, CBCVA).
      • 12) For production of THCA/THCVA, use THCA synthase in step 10 instead of CBDA synthase. For production of CBGA/CBGVA, follow step 10 but don't use CBDA synthase in vector construct. For production of CBCA/CBCVA, use CBC synthase in step 10 instead.
  • Our strategy for Pichia pastoris (Pichia Pink 1, 2, 3 from Invitrogen) yeast was similar to S. Cerevisiae, except for the following differences:
    • 1) Each enzyme, vector, and primer were optimized for insertion into pichia cells instead of s. cerevisiae.
    • 2) Methanol is used to supplement cells in addition to free fatty acid, hexanoic acid, and butyric acid, thereby reducing the total cost of production many fold, while eliminating any contamination issues from other species.
    • 3) No EMS mutagenesis is performed.
    • 4) Knockouts of pep4 (encoding Proteinase A), prb1 (encoding Proteinase B), and YPS1 genes are also introduced. These knockouts allow for the integration of high copy plasmids leading to higher yields.
    • 5) Steps 7, 8, and 9 from the S. cerevisiae strategy above are not to be performed in pichia cells.
    Example 5 Cell Free Expression Systems
  • Vectors are introduced into cell free expression systems, and make either enzymes or intermediate/final products. Further processing or steps are needed to get purified final products.
  • Procedures EMS Mutagensis (S. Cere.; BY4741, BY4742, CEN.PK, CEN.Pk2, BY300)
    • 1) Cells incubated overnight @30 C in 5 mL TPD medium while shaking @200 rpm to establish 200 mL YPD shake flask culture.
    • 2) When OD600 of yeast culture reaches 1.0, cells are spun down by centrifugation (12 mins at 4,000 g), washed twice with 20 mL 0.1M sodium phosphate buffer, pH7.0.
    • 3) Cells concentrated by centrifugation again, re-suspended in 1 mL 0.1M sodium phosphate buffer, transferred to 30 mL FALCON tubes, treated with 300 uL EMS (1.2 g/mL).
    • 4) Cells are incubated at 30 C for 1 hr while shaking.
    • 5) Stop mutagenesis by adding 8 mL of sterile 5% sodium thiosulfate to yeast cells.
    • 6) Cells are pelleted, washed with 8 mL sterile water, concentrated by centrifugation, re-suspended in 1 mL sterile water and 100 uL aliquots plated into YPD-NCS agar plate (YPD+50 mg/L each of cholesterol, nystatin, sqalestatin, and 2% Bacto-agar).
    • 7) In some instances, washed cells were resuspended in 1 mL YPDE liquid media for overnight recovery before plating to YPD-NCS agar medium.
    • 8) Incubate cultures for up to two weeks at 30 C until distinct colonies are visible.
    Bacteria & Yeast Culturing
      • 1) Grown using standard culture practices.
      • 2) YPD media without selection consisted of 1% Bacto-yeast extract, 2% Bacto-peptone, and 2% glucose.
      • 3) Add 40 mg/L ergosterol to YPD media to get YPDE media.
      • 4) Add 40 mg/L each of nystatin, cholesterol, and squalestatin to YPD media to get TPDNCS media.
      • 5) Add 40 mg/L each of ergosterol and squalestatin to YPD media to get YPDSE media.
      • 6) Prepare minimal media, SCE (pH5.3), by adding 0.67% Bacto-yeast nitrogen base (without amino acids), 2% dextrose, 0.6% succinic acid, 0.14% Sigma yeast dropout soln (-his, -leu, -ura, -trp), uracil (300 mg/L), L-tryptophan (150 mg/L), L-histidine (250 mg/L), L-methionine (200 mg/L), L-leucine (I g/L), and 40 mg/L of ergosterol.
      • 7) Cholesterol and ergosterol stocks are 10 mg/mL in 50% Triton X-100, 50% ethanol and kept at −20 C.
      • 8) Selection media prepared similarly except without supplementation of media with indicated reagent based on the yeast auxotrophic markers.
      • 9) All solid media plates are prepared with 2% Bacto-agar.
    Yeast Transformation & Culture Performance
      • 1) Used FROZEN-EZ Yeast Transformation II Kit from Zymo Research, Orange, CA, according to manufacturer's recommendations.
      • 2) lug of plasmid was used per transformation, followed by selection on agar plates of SCE medium lacking specified amino acids for auxotrophic markers, or YPDE containing 300 mg/L hygromycin B for screening erg9 knockout at 30 C.
      • 3) Colonies are picked and used to start 3 mL cultures in minimal media to characterize their terpene production capabilities. (6 days incubation at 30 C while shaking)
      • 4) Best cultures are chosen to move further, using 30 mL shake flask cultures.
      • 5) Cultures are grown to saturation in minimal media, inoculated into 30 mL SCE media and 1 mL aliquots are taken out daily for 15 days.
      • 6) Cell growth is monitored via change in optical density at 600 nm every two days using dilutions at later stages of growth.
      • 7) Production of terpenes is determined via testing.
    ERG9 Knockout Mutations
      • 1) Primers ERG9PS1 and ERG9-250downS2 used to amplify hygromycin resistance gene, hphNT1, from the pFA6-hph-NT1 vector.
      • 2) Simulataneously add 42 bp nucleotide sequences homologous to regions surrounding ERG9 gene in yeast genome.
      • 3) Purified PCR fragment is transformed into various cell lines identified in phase 2 with the ability to accumulate farnesol and selected on YPDE plates containing 300 mg/L hygromycin.
      • 4) Independent single colonies are picked for ergosterol dependent test, PCR confirmation of recombination with hphF and ERG9 450DWR primer.
      • 5) Farnesol production analysis done by GC-MS/LC-MS.
    ERG1 Knockout Mutations
      • 1) Primers ERG1F and ERG1R used to amplify the sqalene epoxidase synthase ERG1 gene by using Takara high fidelity Primerstar taq polymerase.
      • 2) Obtained PCR fragment is gel purified, A tailed and ligated into the pGEM-Teasy vector.
      • 3) Obtained vector is used as template to run second PCR with primers Erg1-splitF and EGR1-splitR to obtain PCR fragment with deletion of 8916 bp CDS in the middle, yet containing 310 bp at 5′ end region and 291 bp at 3′ end region of ERG1 gene which are the target homologous recombination sequence for ERG1 knockout.
      • 4) After digestion with BamHI, self-ligation, and transformation to DH5alpha competent cells, resulting vector is pGEM-ERG1-split.
      • 5) Padh-Kanmx4-Tcyc-LoxP antibiotic selection marker cassette is constructed by assembly PCR of three fragments.
      • 6) Padh promoter is PCR amplified with Padh-loxP-ManHIF and Padh-Kanmx4R primers using Yep352 vector as a template.
      • 7) Kanmx4 selection gene is PCR amplified using Padh-kanmx4F and Tcyc-kanmx4R primers using PYM-N14 plasmid as a template.
      • 8) Tcyc terminator was PCR amplified with Padh-loxP-BamHIF and Padh-Kanmx4R primers using Pesc vector as a template.
      • 9) 3 PCR fragments containing homologous regions with each other were gel purified and 250 ng of each fragment were mixed together to serve as template for the secondary assembly PCR reaction to yield pAdh-Kanmx4-Tcyc-LoxP cassette.
      • 10) Cassette is digested and inserted into pGEM-ERG1-split vector, and used as template to run PCR with ERG1F and ERG1R to get PCR fragment used to generate cell lines.
      • 11) Pgpd-tHMGR-Tadh fragment was amplified from Pesc-Gpd-leu-tHMGR vector with primers GPD-BamHIP and Tadh-XholIR.
      • 12) Insert fragment into pGEM-ERG1-split vector containing kanmx4 cassette.
      • 13) Use construct as template to amplify with ERG1F and EGR1R primers to gain the fragment for building slightly different cell lines, which include integration of one copy of tHMGR into the ERG1 gene.
  • Primer name Primer Sequence
    ERG9pS1 GTACATTTCATAGCCCATCTTCAACAACAATACCGACTTACCCGTACG
    (SEQ ID NO 1) CTGCAGGTCGAC
    ERG9 250dwS2 CAGATTGACGGAGAGAGGGCCACATTGTTTGTCGGAATAAATCGAT
    (SEQ ID NO 2) GAATTCGAGCTCG
    Hph F ATGGGTAAAAAGCCTGAACTCA
    (SEQ ID NO 3)
    Hph R TTATTCCTTTGCCCTCGGACGAG
    (SEQ ID NO 4)
    ERG9 450dwR AGATGCTAGTCAATGGCAGAAG
    (SEQ ID NO 5)
    WEG9p300upF TGCTTACACAGAGTGAACCTGC
    (SEQ ID NO 6)
    ERG9 300R CTCGTGGAAGTGACGCAAC
    (SEQ ID NO 7)
    pGPD-BAMHI F cgGGATCCagtttatcattatcaatactcgcc
    (SEQ ID NO 8)
    pGPD-NotIR gggGCGGCCGCgagctcagtttatcattatc
    (SEQ ID NO 9)
    tHMGR-NotIF GGGGCGGCCGCAAAACAATGTTGTCACGACTTTTCCGTATGC
    (SEQ ID NO 10)
    tHMGR-SpeIR GACTAGTTCAAGCTGACTTCTTGGTGCACGTTCCTTG
    (SEQ ID NO 11)
    ERG1F ATGTCTGCTGTTAACGTTGCACCTG
    (SEQ ID NO 12)
    ERG1R TTAACCAATCAACTCACCAAAC
    (SEQ ID NO 13)
    ERG1-split F CGGGATCCCTCGAG TTGTTCGCTGCTGACAGCGATAAC
    (SEQ ID NO 14)
    ERG1-splitR CGGGATCCGCTAGCGGTACCACATGGGTCCTTTATATTGACACG
    (SEQ ID NO 15)
    ERG1 90up F ATCAGAACAATTGTCCAGTATTG
    (SEQ ID NO 16)
    ERG1100dwR AATGTACTATACAAGCCTTCC
    (SEQ ID NO 17)
    bSQS-NotIF GGGGCGGCCGCAAAACAATGGGGATGCTTCGCTGGGGAGT
    (SEQ ID NO 18)
    bSQS-SpeIR GACTAGTTTAGCTCCTCAATTCGTCAAAGGT
    (SEQ ID NO 19)
    Cre-NotIF GGGGCGGCCGCAAAACAATGGACATGTTCAGGGATCGCCAGG
    (SEQ ID NO 20)
    Cre-SpeIR GACTAGTCTAATCGCCATCTTCCAGCAGGCG
    (SEQ ID NO 21)
    Padb-Loxp- CGGGATCCATAACTTCGTATAGCATACATTATACGAAGTTATGTGGAA
    BamHIF TATTTCGGATAT
    (SEQ ID NO 22)
    Padh-Kanmx4F GCATACAATCAACTAAGCTAAGCTAAAACAATGGGTAAGGAAAAGACT
    (SEQ ID NO 23) CACGTTTC
    Padh-Hanmx4R GAAACGTGAGTCTTTTCCTTACCCATTGTTTTAGCTTAGCTTAGTTGA
    (SEQ ID NO 24) TTGTATGC
    Kanmx4-TcycF CATTTGATGCTCGATGAGTTTTTCTAAATCCGCTCTAACCGAAAAGGA
    (SEQ ID NO 25) AGGAG
    Kanmx4-TcycR CTCCTTCCTTTTCGGTTAGAGCGGATTTAGAAAAACTCATCGAGCATC
    (SEQ ID NO 26) AAATG
    Tcyc-LoxP-NheIR GGGGCTAGCATAACTTCGTATAATGTATGCTATACGAAGTTATCTTCG
    (SEQ ID NO 27) AGCGTCCCAAAA
    Gpd-GamHIF CGGGATCCAGTTTATCATTATCAATACTCG
    (SEQ ID NO 28)
    Tadh-XohI GGGCTCGAG GAGCGACCTCATGCTATACCTG
    (SEQ ID NO 29)
    Kanmx4R TTAGAAAAACTCATCGAGCATC
    (SEQ ID NO 30)
  • Expression of Enzymes for Cannabinoid Production OLS 5′ FWD SEQ ID NO 31 Length: 55 Type: DNA Organism: Artificial Sequence Notes: Primer
  • Gcatagcaatctaatctaagtttaaa atgaatcatttgagagcagaa
    gggcctgc
  • CB 5′ FWD SEQ ID NO 32 Length: 56 Type: DNA Organism: Artificial Sequence Notes: Primer
  • caccagaacttagtttcgacggataaa atggaaaccggtttgtcctcgg
    tttgcac
  • All REV SEQ ID NO 33 Length: 58 Type: DNA Organism: Artificial Sequence Notes: Primer
  • cataactaattacatgatttaaccTAAACATCAGATTCAATAGAGCCGCC
    TCCACTG

    Backbone|CBGA synthase|Flexible spacer|CBD synthase|target peptide
  • SEQ ID NO 34 Length: Type: DNA
  • Organism: artificial sequence
    Notes: Codon optimized
  •    1 ggttaaatca tgtaattagt tatgtcacgc ttacattcac gccctccccc cacatccgct
      61 ctaaccgaaa aggaaggagt tagacaacct gaagtctagg tccctattta tttttttata
     121 gttatgttag tattaagaac gttatttata tttcaaattt ttcttttttt tctgtacaga
     181 cgcgtgtacg catgtaacat tatactgaaa accttgcttg agaaggtttt gggacgctcg
     241 aaggctttaa tttgcggccc ctcacctgca cgcaaaatag gataattata ctctatttct
     301 caacaagtaa ttggttgttt ggccgagcgg tctaaggcgc ctgattcaag aaatatcttg
     361 accgcagtta actgtgggaa tactcaggta tcgtaagatg caagagttcg aatctcttag
     421 caaccattat ttttttcctc aacataacga gaacacacag gggcgctatc gcacagaatc
     481 aaattcgatg actggaaatt ttttgttaat ttcagaggtc gcctgacgca tatacctttt
     541 tcaactgaaa aattgggaga aaaaggaaag gtgagagcgc cggaaccggc ttttcatata
     601 gaatagagaa gcgttcatga ctaaatgctt gcatcacaat acttgaagtt gacaatatta
     661 tttaaggacc tattgttttt tccaataggt ggttagcaat cgtcttactt tctaactttt
     721 cttacctttt acatttcagc aatatatata tatatatttc aaggatatac cattctaatg
     781 tctgccccta agaagatcgt cgttttgcca ggtgaccacg ttggtcaaga aatcacagcc
     841 gaagccatta aggttcttaa agctatttct gatgttcgtt ccaatgtcaa gttcgatttc
     901 gaaaatcatt taattggtgg tgctgctatc gatgctacag gtgttccact tccagatgag
     961 gcgctggaag cctccaagaa ggctgatgcc gttttgttag gtgctgtggg tggtcctaaa
    1021 tggggtaccg gtagtgttag acctgaacaa ggtttactaa aaatccgtaa agaacttcaa
    1081 ttgtacgcca acttaagacc atgtaacttt gcatccgact ctcttttaga cttatctcca
    1141 atcaagccac aatttgctaa aggtactgac ttcgttgttg tcagagaatt agtgggaggt
    1201 atttactttg gtaagagaaa ggaagatgat ggtgatggtg tcgcttggga tagtgaacaa
    1261 tacaccgttc cagaagtgca aagaatcaca agaatggccg ctttcatggc cctacaacat
    1321 gagccaccat tgcctatttg gtccttggat aaagctaatg ttttggcctc ttcaagatta
    1381 tggagaaaaa ctgtggagga aaccatcaag aacgaattcc ctacattgaa ggttcaacat
    1441 caattgattg attctgccgc catgatccta gttaagaacc caacccacct aaatggtatt
    1501 ataatcacca gcaacatgtt tggtgatatc atctccgatg aagcctccgt tatcccaggt
    1561 tccttgggtt tgttgccatc tgcgtccttg gcctctttgc cagacaagaa caccgcattt
    1621 ggtttgtacg aaccatgcca cggttctgct ccagatttgc caaagaataa ggtcaaccct
    1681 atcgccacta tcttgtctgc tgcaatgatg ttgaaattgt cattgaactt gcctgaagaa
    1741 ggtaaggcca ttgaagatgc agttaaaaag gttttggatg caggcatcag aactggtgat
    1801 ttaggtggtt ccaacagtac caccgaagtc ggtgatgctg tcgccgaaga agttaagaaa
    1861 atccttgctt aaaaagattc tcttttttta tgatatttgt acataaactt tataaatgaa
    1921 attcataata gaaacgacac gaaattacaa aatggaatat gttcataggg taacgctatg
    1981 atccaatatc aaaggaaatg atagcattga aggatgagac taatccaatt gaggagtggc
    2041 agcatataga acagctaaag ggtagtgctg aaggaagcat acgatacccc gcatggaatg
    2101 ggataatatc acaggaggta ctagactacc tttcatccta cataaataga cgcatataag
    2161 tacgcattta agcataaaca cgcactatgc cgttcttctc atgtatatat atatacaggc
    2221 aacacgcaga tataggtgcg acgtgaacag tgagctgtat gtgcgcagct cgcgttgcat
    2281 tttcggaagc gctcgtttCc ggaaacgctt tgaagttcct attccgaagt tcctattctc
    2341 tagaaagtat aggaacttca gagcgctttt gaaaaccaaa agcgctctga agtcgcactt
    2401 tcaaaaaacc aaaaacgcac cggactgtaa cgagctacta aaatattgcg aataccgctt
    2461 ccacaaacat tgctcaaaag tatctctttg ctatatatct ctgtgctata tccctatata
    2521 acctacccat ccacctttcg ctccttgaac ttgcatctaa actcgacctc tacatttttt
    2581 atgtttatct ctagtattac tctttagaca aaaaaattgt agtaagaact attcatagag
    2641 tgaatcgaaa acaatacgaa aatgtaaaca tttcctatac gtagtatata gagacaaaat
    2701 agaagaaacc gttcataatt ttctgaccaa tgaagaatca tcaacgctat cactttctgt
    2761 tcacaaagta tgcgcaatcc acatcggtat agaatataat cggggatgcc tttatcttga
    2821 aaaaatgcac ccgcagcttc gctagtaatc agtaaacgcg ggaagtggag tcaggctttt
    2881 tttatggaag agaaaataga caccaaagta gccttcttct aaccttaacg gacctacagt
    2941 gcaaaaagtt atcaagagac tgcattatag agcgcacaaa ggagaaaaaa agtaatctaa
    3001 gatgctttgt tagaaaaata gcgctctcgg gatgcatttt tgtagaacaa aaaagaagta
    3061 tagattcttt gttggtaaaa tagcgctctc gcgttgcatt tctgttctgt aaaaatgcag
    3121 ctcagattct ttgtttgaaa aattagcgct ctcgcgttgc atttttgttt tacaaaaatg
    3181 aagcacagat tcttcgttgg taaaatagcg ctttcgcgtt gcatttctgt tctgtaaaaa
    3241 tgcagctcag attctttgtt tgaaaaatta gcgctctcgc gttgcatttt tgttctacaa
    3301 aatgaagcac agatgcttcg ttcaggtggc acttttcggg gaaatgtgcg cggaacccct
    3361 atttgtttat ttttctaaat acattcaaat atgtatccgc tcatgagaca ataaccctga
    3421 tattggtcag aattggttaa ttggttgtaa cactgacccc tatttgttta tttttctaaa
    3481 tacattcaaa tatgtatccg ctcatgagac aataaccctg ataaatgctt caataatatt
    3541 gaaaaaggaa gaatatgagc catattcaac gggaaacgtc gaggccgcga ttaaattcca
    3601 acatggatgc tgatttatat gggtataaat gggctcgcga taatgtcggg caatcaggtg
    3661 cgacaatcta tcgcttgtat gggaagcccg atgcgccaga gttgtttctg aaacatggca
    3721 aaggtagcgt tgccaatgat gttacagatg agatggtcag actaaactgg ctgacggaat
    3781 ttatgccact tccgaccatc aagcatttta tccgtactcc tgatgatgca tggttactca
    3841 ccactgcgat ccccggaaaa acagcgttcc aggtattaga agaatatcct gattcaggtg
    3901 aaaatattgt tgatgcgctg gcagtgttcc tgcgccggtt gcactcgatt cctgtttgta
    3961 attgtccttt taacagcgat cgcgtatttc gcctcgctca ggcgcaatca cgaatgaata
    4021 acggtttggt tgatgcgagt gattttgatg acgagcgtaa tggctggcct gttgaacaag
    4081 tctggaaaga aatgcataaa cttttgccat tctcaccgga ttcagtcgtc actcatggtg
    4141 atttctcact tgataacctt atttttgacg aggggaaatt aataggttgt attgatgttg
    4201 gacgagtcgg aatcgcagac cgataccagg atcttgccat cctatggaac tgcctcggtg
    4261 agttttctcc ttcattacag aaacggcttt ttcaaaaata tggtattgat aatcctgata
    4321 tgaataaatt gcaatttcat ttgatgctcg atgagttttt ctaactcatg accaaaatcc
    4381 cttaacgtga gttacgcgcg cgtcgttcca ctgagcgtca gaccccgtag aaaagatcaa
    4441 aggatcttct tgagatcctt tttttctgcg cgtaatctgc tgcttgcaaa caaaaaaacc
    4501 accgctacca gcggtggttt gtttgccgga tcaagagcta ccaactcttt ttccgaaggt
    4561 aactggcttc agcagagcgc agataccaaa tactgttctt ctagtgtagc cgtagttagc
    4621 ccaccacttc aagaactctg tagcaccgcc tacatacctc gctctgctaa tcctgttacc
    4681 agtggctgct gccagtggcg ataagtcgtg tcttaccggg ttggactcaa gacgatagtt
    4741 accggataag gcgcagcggt cgggctgaac ggggggttcg tgcacacagc ccagcttgga
    4801 gcgaacgacc tacaccgaac tgagatacct acagcgtgag ctatgagaaa gcgccacgct
    4861 tcccgaaggg agaaaggcgg acaggtatcc ggtaagcggc agggtcggaa caggagagcg
    4921 cacgagggag cttccagggg gaaacgcctg gtatctttat agtcctgtcg ggtttcgcca
    4981 cctctgactt gagcgtcgat ttttgtgatg ctcgtcaggg gggcggagcc tatggaaaaa
    5041 cgccagcaac gcggcctttt tacggttcct ggccttttgc tggccttttg ctcacatgtt
    5101 ctttcctgcg ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga
    5161 taccgctcgg ggtcgtgcag gtagtttatc attatcaata ctcgccattt caaagaatac
    5221 gtaaataatt aatagtagtg attttcctaa ctttatttag tcaaaaaatt agccttttaa
    5281 ttctgctgta acccgtacat gcccaaaata gggggcgggt tacacagaat atataacatc
    5341 gtaggtgtct gggtgaacag tttattcctg gcatccacta aatataatgg agcccgctCt
    5401 ttaagctggc atccagaaaa aaaaagaatc ccagcaccaa aatattgttt tcttcaccaa
    5461 ccatcagttc ataggtccat tctcttagcg caactacaga gaacaggggc acaaacaggc
    5521 aaaaaacggg cacaacctca atggagtgat gcaaccagcc tggagtaaat gatgacacaa
    5581 ggcaattgac ccacgcatgt atctatctca ttttcttaca ccttctatta ccttctgctc
    5641 tctctgattt ggaaaaagct gaaaaaaaag gttgaaacca gttccctgaa attattcccc
    5701 tacttgacta ataagtatat aaagacggta ggtattgatt gtaattctgt aaatctattt
    5761 cttaaacttc ttaaattcta cttttatagt tagtcttttt tttagtttta aaacaccaga
    5821 acttagtttc gacggataaa atggaaaccg gtttgtcctc ggtttgcact ttctccttcc
    5881 aaacaaacta tcatacactc ctgaacccgc acaataacaa tcccaaaact tccctgctgt
    5941 gttataggca cccaaagaca ccaatcaaat actcctacaa taactttcca tctaagcatt
    6001 gtagcacaaa aagtttccat ttgcaaaata agtgttccga atctctgtcc atcgccaaaa
    6061 attccattag ggctgccact actaatcaaa ctgaaccacc agagtctgat aatcattctg
    6121 tcgccacaaa gattctgaat tttgggaagg cttgttggaa gttacaaaga ccatatacaa
    6181 ttattgcctt tacctcttgt gcctgtggtt tatttggtaa ggaactgttg cataatacaa
    6241 atttaatatc ttggtcattg atggaaacgt tcaaagcatt ttttttctta gtcgctatcc
    6301 tttgtattgc ttctttcacc accactatca accagattta cgacttacat attgacagaa
    6361 ttaacaagcc agatttgcca ctggcttcgg gcgagatttc cgtcaatact gcctggatca
    6421 tggaaacttc tattattgtt gccttgtttg gattgataat caccataaaa atggaaacta
    6481 agggtggtcc attgtatatt ttcggttact gttttggtat cttcgggggc atcgtctact
    6541 ctgttcctcc attcagatgg aaacaaaatc cttccacagc attccttttg aacttcctgg
    6601 cgcacattat aaccaacttt actttttatt atgcctccag agccgccctg gggctgccct
    6661 ttgaattacg cccctccttt acatttttac tggccttcat ggagaccaag tccatggaga
    6721 ctggttctgc tctcgcgttg atcaaagatg cttccgatgt ggaaggtgac accaaatttg
    6781 gtatatccac tttggccagc aagtatggtt ccaggaattt gaccctattt tgttctggta
    6841 tcgtgctgct gtcttatgtt gcagccatct tggctggcat catttggcca caggctttca
    6901 attcaaatgt tatggagacg ctgctctcgc atgctatttt ggcattttgg ttgattctac
    6961 agacaagaga ttttgcttta accaattatg acccagaagc tggtagaaga ttttacgaat
    7021 ttatggaaac atggaaatta tactatgctg aatatttagt gtacgttttc attgggggcg
    7081 gctccagcgc cggcggcggc tcttctgcgg gcggttggtc tcatccacaa tttgagaaag
    7141 gtgggtcgtc tggcggcggc agcgggggcg ggtccggcgg ggggagcggc ggtatgaaat
    7201 gttcgacctt ctctttttgg tttgtctgta aaataatttt ttttttcttc agctttaaca
    7261 ttcaaaccag cattgcaaat ccaagagaaa atttcttgaa atgcttttca caatatatcc
    7321 ccaataatgc tactaacttg aagctagttt atactcaaaa caaccctttg tacatgtccg
    7381 tgctcaactc caccattcac aacctaagat tcacttcaga cactacccca aaaccattag
    7441 ttattgtgac accttctcac gtttcacata tccaaggtac tattttatgc tccaagaagg
    7501 tcggcctgca aattagaact agatctggag gtcatgattc agaaggaatg tcttacatct
    7561 ctcaagttcc atttgtgatt gtcgatttaa gaaatatgag gagcattaag atcgatgttc
    7621 actcccaaac ggcatgggtt gaagccggtg ccaccttggg cgaagtttac tactgggtca
    7631 acgagaagaa tgaaaactta tcactagccg caggttattg tccaactgtt tgtgctggtg
    7741 gccatttcgg aggcggcggc tacggtcctc taatgagaaa ctacggctta gctgctgaca
    7801 atatcatcga cgctcacttg gttaacgttc atggtaaagt tttagataga aaatctatgg
    7861 gtgaggatct tttctgggct ttgagaggtg gcggcgcaga atcatttggc attatcgttg
    7921 cttggaagat cagattggtg gctgtcccca agtctacaat gttttctgtg aagaaaatta
    7981 tggaaatcca tgaattggtc aaactggtga ataaatggca aaacatagct tacaagtacg
    8041 ataaagactt gctgttaatg acacatttta ttaccaggaa catcactgat aaccaaggca
    8101 agaacaagac tgcaattcat acttattttt cctccgtttt tttgggtggt gtcgactccc
    8161 tcgtggatct gatgaataaa tcattccctg aactaggtat taaaaaaacc gattgtagac
    8221 aattgagttg gattgatacc atcatattct acagtggtgt tgttaattat gatactgaca
    8281 acttcaacaa agaaatactg ctggaccgtt ccgccggcca gaatggtgct tttaaaatca
    8341 agttggatta tgtgaaaaag cctattccag aatccgtatt tgttcaaata ttggaaaagc
    8401 tgtatgaaga agacattggt gcaggcatgt acgctcttta tccttatggc ggcataatgg
    8461 atgaaatttc tgaaagtgcc attcctttcc cacatagggc cgggatcctg tacgagttat
    8521 ggtacatttg ttcatgggaa aagcaagaag ataatgaaaa acatttaaat tggataagaa
    8581 atatttataa ttttatgact ccatacgtct ccaaaaaccc acgcctggca tatttgaatt
    8641 acagagacct ggatattggc atcaatgatc ctaaaaaccc aaataattac actcaggcaa
    8701 gaatatgggg tgaaaaatat ttcggcaaaa attttgatag gctggtcaag gttaaaacac
    8761 tggttgatcc aaacaatttc tttagaaacg aacaatctat cccacctctg cctagacata
    8821 gacacggcgg tggaagcagt ggaggcggct ctattgaatc tgatgtttaa tga
  • Backbone|OLS|Flexible spacer|OAC|target peptide
  • SEQ ID NO 35 Length: Type: DNA
  • Organism: artificial sequence
    Notes: Codon optimized
  •    1 ggttaaatca tgtaattagt tatgtcacgc ttacattcac gccctccccc cacatccgct
      61 ctaaccgaaa aggaaggagt tagacaacct gaagtctagg tccctattta tttttttata
     121 gttatgttag tattaagaac gttatttata tttcaaattt ttcttttttt tctgtacaga
     181 cgcgtgtacg catgtaacat tatactgaaa accttgcttg agaaggtttt gggacgctcg
     241 aaggctttaa tttgcggccc ctcacctgca cgcaaaaagc ttttcaattc aattcatcat
     301 ttttttttta ttcttttttt tgatttcggt ttctttgaaa tttttttgat tcggtaatct
     361 ccgaacagaa ggaagaacga aggaaggagc acagacttag attggtatat atacgcatat
     421 gtagtgttga agaaacatga aattgcccag tattcttaac ccaactgcac agaacaaaaa
     481 ccagcaggaa acgaagataa atcatgtcga aagctacata taaggaacgt gctgctactc
     541 atcctagtcc tgttgctgcc aagctattta atatcatgca cgaaaagcaa acaaacttgt
     601 gtgcttcatt ggatgttcgt accaccaagg aattactgga gttagttgaa gcattaggtc
     661 ccaaaatttg tttactaaaa acacatgtgg atatcttgac tgatttttcc atggagggca
     721 cagttaagcc gctaaaggca ttatccgcca agtacaattt tttactcttc gaagatagaa
     781 aatttgctga cattggtaat acagtcaaat tgcagtactc tgcgggtgta tacagaatag
     841 cagaatgggc agacattacg aatgcacacg gtgtggtggg cccaggtatt gttagcggtt
     901 tgaagcaggc ggcagaagaa gtaacaaagg aacctagagg ccttttgatg ttagcagaat
     961 tgtcatgcaa gggctcccta tctactggag aatatactaa gggtactgtt gacattgcga
    1021 aaagcgacaa agattttgtt atcggcttta ttgctcaaag agacatgggt ggaagagatg
    1081 aaggttacga ttggttgatt atgacacccg gtgtgggttt agatgacaag ggagatgcat
    1141 tgggtcaaca gtatagaacc gtggatgatg ttgtctctac aggatctgac attattattg
    1201 ttggaagagg actatttgca aagggaaggg atgctaaggt agagggtgaa cgttacagaa
    1261 aagcaggctg ggaagcatat ttgagaagat gcggccagca aaactaaaaa actgtattat
    1321 aagtaaatgc atgtatacta aactcacaaa ttagagcttc aatttaatta tatcagttat
    1381 tacccacgct atgatccaat atcaaaggaa atgatagcat tgaaggatga gactaatcca
    1441 attgaggagt ggcagcatat agaacagcta aagggtagtg ctgaaggaag catacgatac
    1501 cccgcatgga atgggataat atcacaggag gtactagact acctttcatc ctacataaat
    1561 agacgcatat aagtacgcat ttaagcataa acacgcacta tgccgttctt ctcatgtata
    1621 tatatataca ggcaacacgc agatataggt gcgacgtgaa cagtgagctg tatgtgcgca
    1681 gctcgcgttg cattttcgga agcgctcgtt ttcggaaacg ctttgaagtt cctattccga
    1741 agttcctatt ctctagaaag tataggaact tcagagcgct tttgaaaacc aaaagcgctc
    1801 tgaagtcgca ctttcaaaaa accaaaaacg caccggactg taacgagcta ctaaaatatt
    1861 gcgaataccg cttccacaaa cattgctcaa aagtatctct ttgctatata tctctgtgct
    1921 atatccctat ataacctacc catccacctt tcgctccttg aacttgcatc taaactcgac
    1981 ctctacattt tttatgttta tctctagtat tactctttag acaaaaaaat tgtagtaaga
    2041 actattcata gagtgaatcg aaaacaatac gaaaatgtaa acatttccta tacgtagtat
    2101 atagagacaa aatagaagaa accgttcata attttctgac caatgaagaa tcatcaacgc
    2161 tatcactttc tgttcacaaa gtatgcgcaa tccacatcgg tatagaatat aatcggggat
    2221 gcctttatct tgaaaaaatg cacccgcagc ttcgctagta atcagtaaac gcgggaagtg
    2281 gagtcaggct ttttttatgg aagagaaaat agacaccaaa gtagccttct tctaacctta
    2341 acggacctac agtgcaaaaa gttatcaaga gactgcatta tagagcgcac aaaggagaaa
    2401 aaaagtaatc taagatgctt tgttagaaaa atagogctct cgggatgcat ttttgtagaa
    2461 caaaaaagaa gtatagattc tttgttggta aaatagcgct ctcgcgttgc atttctgttc
    2521 tgtaaaaatg cagctcagat tctttgtttg aaaaattagc gctctcgcgt tgcatttttg
    2581 ttttacaaaa atgaagcaca gattcttcgt tggtaaaata gcgctttcgc gttgcatttc
    2641 tgttctgtaa aaatgcagct cagattcttt gtttgaaaaa ttagcgctct cgcgttgcat
    2701 ttttgttcta caaaatgaag cacagatgct tcgttcaggt ggcacttttc ggggaaatgt
    2761 gcgcggaacc cctatttgtt tatttttcta aatacattca aatatgtatc cgctcatgag
    2621 acaataaccc tgatattggt cagaattggt taattggttg taacactgac ccctatttgt
    2881 ttatttttct aaatacattc aaatatgtat ccgctcatga gacaataacc ctgataaatg
    2941 cttcaataat attgaaaaag gaagaatatg agtattcaac atttccgtgt cgcccttatt
    3001 cccttttttg cggcattttg ccttcctgtt tttgctcacc cagaaacgct ggtgaaagta
    3061 aaagatgctg aagatcagtt gggtgcacga gtgggttaca tcgaactgga tctcaacagc
    3121 ggtaagatcc ttgagagttt tcgccccgaa gaacgttttc caatgatgag cacttttaaa
    3131 gttctgctat gtggcgcggt attatcccgt attgacgccg ggcaagagca actcggtcgc
    3241 cgcatacact attctcagaa tgacttggtt gagtactcac cagtcacaga aaagcatctt
    3301 acggatggca tgacagtaag agaattatgc agtgctgcca taaccatgag tgataacact
    3361 gcggccaact tacttctgac aacgatcgga ggaccgaagg agctaaccgc ttttttgcac
    3421 aacatggggg atcatgtaac tcgccttgat cgttgggaac cggagctgaa tgaagccata
    3481 ccaaacgacg agcgtgacac cacgatgcct gtagcgatgg caacaacgtt gcgcaaacta
    3541 ttaactggcg aactacttac tctagcttcc cggcaacaat taatagactg gatggaggcg
    3601 gataaagttg caggaccact tctgcgctcg gcccttccgg ctggctggtt tattgctgat
    3661 aaatccggag ccggtgagcg tggttctcgc ggtatcatcg cagcgctggg gccagatggt
    3721 aagccctccc gtatcgtagt tatctacacg acggggagtc aggcaactat ggatgaacga
    3781 aatagacaga tcgctgagat aggtgcctca ctgattaagc attggtaact catgaccaaa
    3841 atcccttaac gtgagttacg cgcgcgtcgt tccactgagc gtcagacccc gtagaaaaga
    3901 tcaaaggatc ttcttgagat cctttttttc tgcgcgtaat ctgctgcttg caaacaaaaa
    3961 aaccaccgct accagcggtg gtttgtttgc cggatcaaga gctaccaact ctttttccga
    4021 aggtaactgg cttcagcaga gcgcagatac caaatactgt tcttctagtg tagccgtagt
    4081 tagcccacca cttcaagaac tctgtagcac cgcctacata cctcgctctg ctaatcctgt
    4141 taccagtggc tgctgccagt ggcgataagt cgtgtcttac cgggttggac tcaagacgat
    4201 agttaccgga taaggcgcag cggtcgggct gaacgggggg ttcgtgcaca cagcccagct
    4261 tggagcgaac gacctacacc gaactgagat acctacagcg tgagctatga gaaagcgcca
    4321 cgcttcccga agggagaaag gcggacaggt atccggtaag cggcagggtc ggaacaggag
    4381 agcgcacgag ggagcttcca gggggaaacg cctggtatct ttatagtcct gtcgggtttc
    4441 gccacctctg acttgagcgt cgatttttgt gatgctcgtc aggggggcgg agcctatgga
    4501 aaaacgccag caacgcggcc tttttacggt tcctggcctt ttgctggcct tttgctcaca
    4561 tgttctttcc tgcgttatcc cctgattctg tggataaccg tattaccgcc tttgagtgag
    4621 ctgataccgc tcggggtcgt gcaggtatag cttcaaaatg tttctactcc ttttttactc
    4681 ttccagattt tctcggactc cgcgcatcgc cgtaccactt caaaacaccc aagcacagca
    4741 tactaaattt cccctctttc ttcctctagg gtgtcgttaa ttacccgtac taaaggtttg
    4801 gaaaagaaaa aagtgaccgc ctcgtttctt tttcttcgtc gaaaaaggca ataaaaattt
    4861 ttatcacgtt tctttttctt gaaaattttt ttttttgatt tttttctctt tcgatgacct
    4921 cccattgata tttaagttaa taaacggact tcaatctctc aagtttcagt ttcatttttc
    4981 ttgttctatt acaacttttt ttacttcttg ctcattagaa agaaagcata gcaatctaat
    5041 ctaagtttaa aatgaatcat ttgagagcag aagggcctgc ttccgtgctg gctattggta
    5101 ccgccaatcc agaaaatatc ctgctgcagg acgaattccc agattactat tttagggtca
    5161 ccaaatctga acatatgaca caattgaaag agaaattcag aaagatttgt gacaagtcca
    5221 tgattaggaa aagaaattgt tttttgaatg aagaacactt gaagcaaaat cctcgcctgg
    5281 tggagcatga aatgcaaact ttggatgcta gacaagacat gttggtggtg gaagttccaa
    5341 agctggggaa ggatgcctgt gccaaggcca ttaaagaatg gggccaacca aaatccaaaa
    5401 ttacccacct gattttcacc tccgcctcca ccactgatat gccaggtgca gactatcatt
    5461 gtgctaaatt gttgggtttg tccccctccg tgaagagagt tatgatgtat caattaggtt
    5521 gttatggcgg cggcaccgtt ctgagaattg ccaaagacat tgctgaaaac aataaaggtg
    5581 cgcgcgtttt ggctgtttgt tgtgatatta tggcatgttt atttagaggt ccaagtgaaa
    5641 gtgacttgga attgctagtg ggccaggcca tatttggtga tggtgccgct gctgtgatcg
    5701 ttggtgctga gcctgatgaa tctgtcggtg aaagaccaat ttttgaactg gtttccactg
    5761 gtcaaaccat tttgccaaat tcagaaggta ctattggcgg ccatatcaga gaagctggtt
    5821 taatctttga tttgcacaag gatgtcccaa tgttaatttc caataatatt gaaaaatgtt
    5881 tgatcgaagc atttaccccc atcggtattt ctgattggaa ttccatcttc tggattacac
    5941 atcctggcgg taaagctatc ttagataaag ttgaggagaa gttgcattta aagtctgaca
    6001 aatttgttga ttcaagacat gtcctgtctg agcacggtaa tatgtcttcc tcgaccgtct
    6061 tgtttgtcat ggatgagttg aggaagaggt ccctggaaga aggcaagagc accaccggtg
    6121 acggttttga gtggggggtc ctctttggat ttgggccagg cctgaccgta gaaagggttg
    6181 ttgtccgctc ggtgccaatc aaatatggtg gggggtccag cgccggtggc gggagctccg
    6241 cgggcggttg gtctcaccca caatttgaaa agggtggcag cagcggcggc ggctctggcg
    6301 gaggctccgg cgggggctcg gggggtatgg ctgtcaagca tctgatcgtg ctgaagttca
    6361 aagatgaaat tactgaagcc caaaaggagg aatttttcaa gacatatgtt aatttggtta
    6421 acatcattcc agcaatgaaa gatgtttatt ggggtaagga cgttactcaa aaaaataagg
    6481 aagagggtta cactcatatt gttgaagtca ctttcgaatc cgtcgaaaca attcaagatt
    6541 atattattca tccagctcat gttgggtttg gcgatgtgta cagatcattt tgggaaaaat
    6601 tattgatttt tgactacaca ccaagaaaag gcggtggaag cagtggaggc ggctctattg
    6661 aatctgatgt ttaatag

    Overexpression of ERG8, HFA1, ERG 10, ERG13, tHMGR, HMGR, ERG12, ERG8, IDI Genes (for Higher Levels of Intermediates)
    Same process as expression of Synthase expression, but with 3 copies expressed in yeast cells.
    Backbone|GGPS1|2a protease|HMG-CoA reductase|flexible spacer|IDI1
  • SEQ ID NO 36 Length: Type: DNA
  • Organsm: artificial sequence
    Notes: Codon optimized
  •    1 atggagaaga ctcaagaaac agtccaaaga attcttctag aaccctataa atacttactt
      61 cagttaccag gtaaacaagt gagaaccaaa ctttcacagg catttaatca ttggctgaaa
     121 gttccagagg acaagctaca gattattatt gaagtgacag aaatgttgca taatgccagt
     181 ttactcatcg atgatattga agacaactca aaactccgac gtggctttcc agtggcccac
     241 agcatctatg gaatcccatc tgtcatcaat tctgccaatt acgtgtattt ccttggcttg
     301 gagaaagtct taacccttga tcacccagat gcagtgaagc tttttacccg ccagcttttg
     361 gaactccatc agggacaagg cctagatatt tactggaggg ataattacac ttgtcccact
     421 gaagaagaat ataaagctat ggtgctgcag aaaacaggtg gactgtttgg attagcagta
     481 ggtctcatgc agttgttctc tgattacaaa gaagatttaa aaccgctact taatacactt
     541 gggctctttt tccaaattag ggatgattat gctaatctac actccaaaga atatagtgaa
     601 aacaaaagtt tttgtgaaga tctgacagag ggaaagttct catttcctac tattcatgct
     661 atttggtcaa ggcctgaaag cacccaggtg cagaatatct tgcgccagag aacagaaaac
     721 atagatataa aaaaatactg tgtacattat cttgaggatg taggttcttt tgaatacact
     761 cgtaataccc ttaaagagct tgaagctaaa gcctataaac agattgatgc acgtggtggg
     841 aaccctgagc tagtagcctt agtaaaacac ttaagtaaga tgttcaaaga agaaaatgaa
     901 ggcggttctg gcagcggaga gggcagagga agtcttctaa catgcggtga cgtggaggag
     961 aatcccggcc ctaggtctgg cagcggagag ggcagaggaa gtcttctaac atgcggtgac
    1021 gtggaggaga atcccggccc taggacacaa aagaaagtcc cagacaattg ttgtagacgt
    1081 gaacctatgc tggtcagaaa taaccagaaa tgtgattcag tagaggaaga gacagggata
    1141 aaccgagaaa gaaaagttga ggttataaaa cccttagtgg ctgaaacaga taccccaaac
    1201 agagctacat ttgtggttgg taactcctcc ttactcgata cttcatcagt actggtgaca
    1261 caggaacctg aaattgaact tcccagggaa cctcggccta atgaagaatg tctacagata
    1321 cttgggaatg cagagaaagg tgcaaaattc cttagtgatg ctgagatcat ccagttagtc
    1351 aatgctaagc atatcccagc ctacaagttg gaaactctga tggaaactca tgagcgtggt
    1441 gtatctattc gccgacagtt actttccaag aagctttcag aaccttcttc tctccagtac
    1501 ctaccttaca gggattataa ttactccttg gtgatgggag cttgttgtga gaatgttatt
    1561 ggatatatgc ccatccctgt tggagtggca ggaccccttt gcttagatga aaaagaattt
    1621 caggttccaa tggcaacaac agaaggttgt cttgtggcca gcaccaatag aggctgcaga
    1681 gcaataggtc ttggtggagg tgccagcagc cgagtccttg cagaCgggat gactcgtggc
    1741 ccagttgtgc gtcttccacg tgcttgtgac tctgcagaag tgaaagcctg gctcgaaaca
    1801 tctgaagggt tcgcagtgat aaaggaggca tttgacagca ctagcagatt tgcacgtcta
    1861 cagaaacttc atacaagtat agctggacgc aacctttata tccgtttcca gtccaggtca
    1921 ggggatgcca tggggatgaa catgatttca aagggtacag agaaagcact ttcaaaactt
    1981 cacgagtatt tccctgaaat gcagattcta gccgttagtg gtaactattg tactgacaag
    2041 aaacctgctg ctataaattg gatagaggga agaggaaaat ctgttgtttg tgaagctgtc
    2101 attccagcca aggttgtcag agaagtatta aagactacca cagaggctat gattgaggtc
    2161 aacattaaca agaatttagt gggctctgcc atggctggga gcataggagg ctacaacgcc
    2221 catgcagcaa acattgtcac cgccatctac attgcctgtg gacaggatgc agcacagaat
    2281 gttggtagtt caaactgtat tactttaatg gaagcaagtg gtcccacaaa tgaagattta
    2341 tatatcagct gcaccatgcc atctatagag ataggaacgg tgggtggtgg gaccaaccta
    2401 ctacctcagc aagcctgttt gcagatgcta ggtgttcaag gagcatgcaa agataatcct
    2461 ggggaaaatg cccggcagct tgcccgaatt gtgtgtggga ccgtaatggc tggggaattg
    2521 tcacttatgg cagcattggc agcaggacat cttgtcaaaa gtcacatgat tcacaacagg
    2581 tcgaagatca atttacaaga cctccaagga gcttgcacca agaagacagc cggctcagga
    2641 ggttcttcag gactggaagt gctgtttcag ggcccgggtg gatctggcat gatgcctgaa
    2701 ataaacacta accacctcga caagcaacag gttcaactcc tggcagagat gtgtatcctt
    2761 attgatgaaa atgacaataa aattggagct gagaccaaga agaattgtca cctgaacgag
    2821 aacattgaga aaggattatt gcatcgagct tttagtgtct tcttattcaa caccgaaaat
    2881 aagcttctgc tacagcaaag atcagatgct aagattacct ttccaggttg ttttacgaat
    2941 acgtgttgta gtcatccatt aagcaatcca gccgagcttg aggaaagtga cgcccttgga
    3001 gtgaggcgag cagcacagag acggctgaaa gctgagctag gaattccctt ggaagaggtt
    3061 cctccagaag aaattaatta tttaacacga attcactaca aagctcagtc tgatggtatc
    3121 tggggtgaac atgaaattga ttacattttg ttggtgagga agaatgtaac tttgaatcca
    3181 gatcccaatg agattaaaag ctattgttat gtgtcaaagg aagaactaaa agaacttctg
    3241 aaaaaagcag ccagtggtga aattaagata acgccatggt ttaaaattat tgcagcgact
    3301 tttctcttta aatggtggga taacttaaat catttgaatc agtttgttga ccatgagaaa
    3361 atatacagaa tg

    ERG2, ERG3, and ERG6 mutations/deletions for increased membrane permeability
  • Same process as ERG9 knockout, but targeting ERG2, ERG3, and ERG6 genes.
  • ERG20p Modification
  • We experimented with a few types of ERG20 genes, (avian, salmon entrica, and human). Currently we are still trying to see which is the best by engineering the ERG20p gene into a FPP synthase, thereby creating a new enzyme that can create GPP instead at high rates.
  • Gal80p Deletion/Mutation for not Needing Expensive Galactose to Induce Promoter
  • Induce mutation in Gal80 gene by site directed mutagenesis.
  • Using ADH2p (Glucose Repressible Promoter) Induces Strong Transcription with No Glucose, Better than GAL Promoter
  • Same process as Gal80p deletion.
  • Overexpression of ADH2 and ALD6 (Ethanol to Acetate), as Well as Overexpression of an Acetyl-CoA C-Acetyltransferase
  • Same process as IDI and HMGR overexpression, but with genes for ADH2 and ALD6.
  • Tables
  • Below is a table of various cannabinoids, along with their structure and variants and main pharmacological characteristics as well as a table listing potential starting materials.
  • TABLE 1
    Compounds Pharmacological Characteristics
    Cannabinoids (FIG. 1 and 2)
    Cannabigerolic acid (CBGA) Antibiotic (1)
    Cannabigerolic acid
    monomethylether (CBGAM)
    Cannabigerol (CBG) Antibiotic, antifungal,
    anti-inflammatory, analgesic (1)
    Partial agonist at
    CB1/CB2 receptors (2)
    Cannabigerovarinic acid (CBGVA)
    Cannabigerovarin (CBGV)
    Cannabichromenic acid (CBCA)
    Cannabichromene (CBC) Anti-inflammatory, antibiotic,
    antifungal, analgesic (1)
    Cannabichromevarinic
    acid (CBCVA)
    Cannabichromevarin (CBCV)
    Cannabidiolic acid (CBDA) Antibiotic
    Cannabidiol (CBD) Anxiolytic, antipsychotic,
    analgesic, anti-inflammatory,
    antioxidant, antispasmodic (1)
    Ant schizophrenic, antiepileptic,
    sleep-promoting, anti-oxidizing,
    anti-inflammatory,
    immunomodulation properties (2)
    Cannabidiol
    monomethylether (CBDM)
    Cannabidiol-C4 (CBD-C4)
    Cannabidivarinic acid (CBDVA)
    Cannabidivarin (CBDV)
    Cannabidiorcol (CBD-C1)
    Tetrahydrocannabinolic
    acid A (THCA-A)
    Tetrahydrocannabinolic
    acid B (THCA-B)
    Delta-9-tetrahydrocannabinol Euphoriant, analgesic, anti-
    (THC) inflammatory, antioxidant,
    antiemetic (1)
    Delta-9-tetrahydrocannabinolic
    acid-C4 (THCA-C4)
    Delta-9-tetrahydrocannabinol-C4
    (THC-C4)
    Delta-8-tetrahydrocannabivarin Exhibit in vitro pharma
    (D8-THCV) properties similar to
    THCV, and both can
    antagonize THC;
    behave as agonists or
    antagonists in dose
    dependent manner (2)
    Delta-9-tetrahydrocannabivarinic
    acid (THCVA)
    Delta-9-tetrahydrocannabivarin Analgesic, euphoriant (1)
    (THCV) Strong antagonist of
    anandamide (due to
    interactions with non-
    CB1/2 receptors),
    neuromodulator (in
    animal and human
    organs), some affects
    due to interaction with
    non CB1/CB2
    receptors (2)
    Delta-9-tetrahydrocannabiorcolic
    acid (THCA-C1)
    Delta-9-tetrahydrocannabiorcol
    (THC-C1)
    Delta-7-cis-iso-
    tetrahydrocannabivarin (D7-THCV)
    Delta-8-
    tetrahydrocannabinolic
    acid (D8-THCA)
    Delta-8-tetrahydrocannabinol Similar to THC (1)
    (D8-THC) Several 1-O-methyl-
    and 1-deoxy-delta-8-
    THC analogs have high
    CB2 receptor
    affinity[JWH133,
    JWH359, trans-
    (6aR,10aR)-3-(1,1-
    dimethylhexyl)-1-O-
    methyl-delta-8-THC];
    antiemetic effects
    similar to THC (2)
    Cannabicyclolic acid (CBLA)
    Cannabicyclol (CBL)
    Cannabicyclovarin (CBLV)
    Cannabielsoic acid A (CBEA-A)
    Cannabielsoic acid B (CBEA-B)
    Cannabielsoin (CBE)
    Cannabinolic acid (CBNA)
    Cannabinol (CBN) Sedative, antibiotic,
    anticonvulsant, anti-
    inflammatory (1)
    Cannabinol methylether (CBNM)
    Cannabinol-C4 (CBN-C4)
    Cannabivarin (CBV)
    Cannabinol-C2 (CBN-C2)
    Cannabinol-C1 (CBN-C1)
    Cannabinodiol (CBND)
    Cannabinodivarin (CBVD)
    Cannabitriol (CBT)
    10-Ethoxy-9-hydroxy-
    delta-6a-tetrahydrocannabinol
    8,9-Dihydroxy-delta-6a-
    tetrahydrocannabinol
    Cannabitriolvarin (CBTV)
    Ethoxy-cannabitriolvarin (CBTVE)
    Dehydrocannabifuran (DCBF)
    Cannabifuran (CBF)
    Cannabichromanon (CBCN)
    Cannabicitran (CBT)
    10-oxo-delta-6a-
    tetrahydrocannabinol (OTHC)
    Delta-9-cis-
    tetrahydrocannabinol (Cis-THC)
    3,4,5,6-Tetrahydro-7-hydroxy-
    alpha-alpha-2-trimethyl-9-n-
    propyl-2,6-methano-2H-1-
    benzoxocin-5-methanol
    (OH-iso-HHCV)
    Cannabiripsol (CBR)
    Trihydroxy-delta-9-
    tetrahydrocannabinol (triOH-THC)
    Terpeses/Terpenoids
    Beta-Myrcene Analgesic, anti-inflammatory,
    antibiotic, antimutagenic
    d-Limonene Immune potentiator,
    antidepressant, antimutagenic
    Linalool Sedative, antidepressant,
    anxiolytic, immune potentiator
    Trans-Ocimene
    Beta-Pinene
    Alpha-Pinene Anti-inflammatory, bronchodilator,
    stimulant, antibiotic,
    antineoplastic, AChE inhibitor
    Beta-Caryophyllene Anti-inflammatory, cytoprotective,
    antimalarial, CB2 agonist
    Delta-3-Carene
    Pulegone AChE inhibitor, sedative,
    Trans-gamma-Bisabolene antipyretic
    Trans-alpha-Farnesene
    Beta-Fenchol
    Beta-Phellandrene
    Alpha-Humulene
    Guajol
    Alpha-Gualene
    Alpha-Eudesmol
    Terpinolene
    Alpha-Selinene
    Alpha-Terpineol Sedative, antibiotic, AChE
    inhibitor, antioxidant, antimalarial
    Fenchone
    Camphene
    Cis-Sabinene hydrate
    Cis-Ocimene
    Beta-Eudesmol
    Beta-Selinene
    Alpha-trans-Bergamolene
    Gamma-Eudesmol
    Borneol
    Cis-beta-Farnescene
    Gamma-Curcumene
    Cis-gamma-Bisabolene
    Alpha-Thujene
    Epi-alpha-Bisabolol
    Ipsdienol
    Alpha-Yiangene
    Beta-Elemene
    Alpha-cis-Bergamontene
    Gamma-Muurolene
    Alpha-Cadinene
    Alpha-Longipinene
    Caryophyllene oxide
    Spermidine Alkaloids (FIG. 6)
    (+)-Cannabisativine
    Palustridine
    Palustrine
    Spermidine
    Anhydrocannabisativine
    Phenolic Amides and Lignanamides (FIG. 5)
    N-trans-Feruloyltyramine
    N-p-Coumaroyltyramine
    N-trans-Caffeoyltyramine
    Grossamide
    Cannabisin-A
    Cannabisin-B
    Cannabisin-C
    Cannabisin-D
    Cannabisin-E
    Cannabisin-F
    Cannabisin-G
    Phenylpropanoids and Flavonoids (FIG. 4)
    Apigenin
    Luteolin
    Kaempferol
    Quercetin
    Orientin
    Vitexin
    Cannflavin A Inhibit prostaglandin E2 in
    human rheumatoid synovial cells
    Cannflavin B Inhibit prostaglandin E2 in
    human rheumatoid synovial cells
    Stilbenoids (FIG. 3)
    Cannabispiran
    Isocannabispiran
    Cannabistilbene-IIa
    Cannabistilbene-IIb
    Cannithrene-1
    Cannithrene-2
    Acetyl cannabispirol
    Alpha-cannabisporanol
    Canniprene
    Cannabispirone
  • TABLE 2
    (Starting Materials)
    Sugar based concentrates (High Hemicellulose Glycerol
    Fructose Corn Syrup, Molasses)
    Glucose Xylose Whey
    Sucrose Methanol Biodiesel
    Cellulose Lactic Acid Citrate
    Ethanol Lignin Fructose
    Succinic Acid Arabinose Biofuels
    Biomass Saccharose Starch based products
    Agricultural residue Water hyacinth Aquatic biomass

Claims (13)

  1. 1) Process of biosynthesis of compounds of interest (Table 1); using a cheap and readily available starting materials in any organism or cell-free expression system (Table 2).
  2. 2) Process of genetically engineering micro-organisms that produce compounds of interest in large/industrial-scale quantities.
  3. 3) Process of altering genes in organisms to allow better yields for compounds of interest.
  4. 4) Process of genetically engineering food plants that are optimized for production of compounds of interest.
  5. 5) Using s. cerevisaie, e coli, p. pastorisis, n. crassa, s. pombe, r. palmatum, c. longa, o. sativa, a. arborescens, a. terrus, c. sativa, s. griseus, s. erythera, s. coelicolor, s. toxytruini, s. cellulosum, p. floresceus, a. orientalis, s. livedans, a. vinelandii, b. subtilis, m. tuberculosis, m. xanthus, a. oryzae, a. niger, r. palmatum, h. serrata, r. rubra, l. erythrhizon, l. acetobutylicum, c. utilis, a. niger, c. glutamicum, b. spp., and other large-scale biotechnology organisms to biosynthesize a total pathway using cheap and readily available starting materials to make our compounds of interest.
  6. 6) Process of claims 1 to 5, wherein the products are those listed in table 1.
  7. 7) Process of claims 1 to 6, wherein the starting materials are those listed in table 2.
  8. 8) Process of claims 1 to 7, wherein certain steps are performed outside or inside an organism or cell free expression system using various techniques, while other steps may use biosynthesis techniques.
  9. 9) Producing compositions (e.g. tinctures, balms, capsules, tablets, concentrates, edibles, topicals) that use claims 1 to 8, whether they are classified as pharmaceuticals or not.
  10. 10) Producing compositions that contain combinations of certain compounds for certain therapeutic and non-therapeutic applications, as listed in table 1.
  11. 11) To claim 10, compositions that have added cofactors for better efficacy, absorption, etc, for our compounds of interest. These include terpenes, sequiterpenes, vitamins, and other cofactors.
  12. 12) cDNA sequences of enzymes and organisms in the pathways and processes listed in FIGS. 1-7 for biosynthesis of compounds of interest using cheap and readily available starting materials, including mRNA's, tRNA's, vectors, and other genetic coding molecules needed for process of claims 1 to 8.
  13. 13) A method for the efficient and cheap biosynthesis of CBGA, THCA, CBDA, CBCA, CBDVA, THCVA, CBGVA, and CBCVA utilizing manipulation of any ERG, IDI, gal80p, upc2-1, HMGR, tHMGR, ALD6, DPP1, and ADH2 genes that result in exogenous sterol mutations for the uptake of exogenous sterols, more permeable cell membrane for easy inward flow of exogenous materials while easy outward flow of our compounds of interest, and carbon flux manipulation and blocking of other pathways for many fold higher yields in S. Cerevisiae and P. Pastoris.
US15096164 2015-04-09 2016-04-11 Novel Method for the cheap, efficient, and effective production of pharmaceutical and therapeutic api's intermediates, and final products Pending US20160298151A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US201562145430 true 2015-04-09 2015-04-09
US15096164 US20160298151A1 (en) 2015-04-09 2016-04-11 Novel Method for the cheap, efficient, and effective production of pharmaceutical and therapeutic api's intermediates, and final products

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US15096164 US20160298151A1 (en) 2015-04-09 2016-04-11 Novel Method for the cheap, efficient, and effective production of pharmaceutical and therapeutic api's intermediates, and final products
US15719430 US20180155748A1 (en) 2015-04-09 2017-09-28 Fusion proteins useful ln the production of cannabinoids

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US15719430 Continuation US20180155748A1 (en) 2015-04-09 2017-09-28 Fusion proteins useful ln the production of cannabinoids

Publications (1)

Publication Number Publication Date
US20160298151A1 true true US20160298151A1 (en) 2016-10-13

Family

ID=57112506

Family Applications (2)

Application Number Title Priority Date Filing Date
US15096164 Pending US20160298151A1 (en) 2015-04-09 2016-04-11 Novel Method for the cheap, efficient, and effective production of pharmaceutical and therapeutic api's intermediates, and final products
US15719430 Pending US20180155748A1 (en) 2015-04-09 2017-09-28 Fusion proteins useful ln the production of cannabinoids

Family Applications After (1)

Application Number Title Priority Date Filing Date
US15719430 Pending US20180155748A1 (en) 2015-04-09 2017-09-28 Fusion proteins useful ln the production of cannabinoids

Country Status (1)

Country Link
US (2) US20160298151A1 (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150128301A1 (en) * 2009-08-12 2015-05-07 National Research Council Of Canada Aromatic prenyltransferase from cannabis
US20150342922A1 (en) * 2015-08-06 2015-12-03 Joshua E. Ankner Cannabinod formulation for the sedation of a human or animal
US20160010126A1 (en) * 2014-07-14 2016-01-14 Librede Inc. Production of cannabinoids in yeast

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150128301A1 (en) * 2009-08-12 2015-05-07 National Research Council Of Canada Aromatic prenyltransferase from cannabis
US20160010126A1 (en) * 2014-07-14 2016-01-14 Librede Inc. Production of cannabinoids in yeast
US20150342922A1 (en) * 2015-08-06 2015-12-03 Joshua E. Ankner Cannabinod formulation for the sedation of a human or animal

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
Moosmann et al. (Forensic Sci. Int'l., vol. 220, 2012, pages e17-e22) *

Also Published As

Publication number Publication date Type
US20180155748A1 (en) 2018-06-07 application

Similar Documents

Publication Publication Date Title
Johnson et al. Astaxanthin from microbial sources
Zhang et al. Engineering tropane biosynthetic pathway in Hyoscyamus niger hairy root cultures
Wang et al. Two‐stage Hydrolysis of Invasive Algal Feedstock for Ethanol Fermentation F
Mizusawa et al. The role of lipids in photosystem II
Tambasco-Studart et al. Vitamin B6 biosynthesis in higher plants
US7939710B1 (en) Trophic conversion of obligate phototrophic algae through metabolic engineering
Webster et al. Introduction to fungi
Tian et al. Characterization of a second carotenoid β-hydroxylase gene from Arabidopsis and its relationship to the LUT1 locus
Maes et al. Dissection of the phytohormonal regulation of trichome formation and biosynthesis of the antimalarial compound artemisinin in Artemisia annua plants
Zhang et al. Expression of the Grifola frondosa trehalose synthase gene and improvement of drought‐tolerance in sugarcane (Saccharum officinarum L.)
US20030162273A1 (en) Modulation of sulfate permease for photosynthetic hydrogen production
EP0284176A2 (en) Process for production of avermectins and cultures therefor
Williamson et al. Spiroplasma poulsonii sp. nov., a new species associated with male-lethality in Drosophila willistoni, a neotropical species of fruit fly
US20110158946A1 (en) Methods and Compositions for control of disease in aquaculture
Kang et al. Description of a new planktonic mixotrophic dinoflagellate Paragymnodinium shiwhaense n. gen., n. sp. from the coastal waters off western Korea: morphology, pigments, and ribosomal DNA gene sequence
Han et al. Astaxanthin in microalgae: pathways, functions and biotechnological implications
Cunningham et al. Carotenoid biosynthesis in the primitive red alga Cyanidioschyzon merolae
Neumann et al. A flavin-dependent halogenase catalyzes the chlorination step in the biosynthesis of Dictyostelium differentiation-inducing factor 1
Josefsen et al. Autophagy provides nutrients for nonassimilating fungal structures and is necessary for plant colonization but not for infection in the necrotrophic plant pathogen Fusarium graminearum
Duan et al. A two‐component histidine kinase S hk1 controls stress response, sclerotial formation and fungicide resistance in S clerotinia sclerotiorum
Maresca et al. Dimorphism in Histoplasma capsulatum and Blastomyces dermatitidis
ZHANG et al. Metabolic engineering of tropane alkaloid biosynthesis in plants
CN103125275A (en) Cultivation method of cordyceps militaris
Yang et al. Improvement of Tropane Alkaloids Production in Hairy Root Cultures of'Atropa belladonna'by Overexpressing pmt and h6h Genes
WO2001027286A1 (en) Process for producing ubiquinone-10