US20110184050A1 - Methods and means for treating dna repeat instability associated genetic disorders - Google Patents

Methods and means for treating dna repeat instability associated genetic disorders Download PDF

Info

Publication number
US20110184050A1
US20110184050A1 US12852057 US85205710A US20110184050A1 US 20110184050 A1 US20110184050 A1 US 20110184050A1 US 12852057 US12852057 US 12852057 US 85205710 A US85205710 A US 85205710A US 20110184050 A1 US20110184050 A1 US 20110184050A1
Authority
US
Grant status
Application
Patent type
Prior art keywords
oligonucleotide
preferably
repeat
base
nucleotides
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
US12852057
Other versions
US8263760B2 (en )
Inventor
Josephus Johannes De Kimpe
Gerardus Johannes Platenburg
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
BioMarin Technologies BV
Original Assignee
PROSENSA HOLDING BV
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering N.A.
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3212'-O-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/33Chemical structure of the base
    • C12N2310/331Universal or degenerate base
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/346Spatial arrangement of the modifications having a combination of backbone and sugar modifications

Abstract

The current invention provides for methods and medicaments that apply an oligonucleotide comprising aninosine and/or an uracile and/or a nucleotide containing a base able to form a wobble base pair, said oligonucleotide being preferably RNAse H substantially independent and being complementary only to a repetitive sequence in a human gene transcript, for the manufacture of a medicament for the diagnosis, treatment or prevention of a cis-element repeat instability associated genetic disorders in humans. The invention hence provides a method of treatment for cis-element repeat instability associated genetic disorders. The invention also pertains to a modified oligonucleotide which can be applied in a method of the invention to prevent the accumulation and/or translation of repeat expanded transcripts in cells.

Description

    FIELD OF THE INVENTION
  • [0001]
    The current invention relates to the field of medicine, in particular to the treatment of genetic disorders associated with genes that have unstable repeats in their coding or non-coding sequences, most in particular unstable repeats in the human Huntington disease causing HD gene or the myotonic dystrophy type 1 causing DMPK gene.
  • BACKGROUND OF THE INVENTION
  • [0002]
    Instability of gene-specific microsatellite and minisatellite repetitive sequences, leading to increase in length of the repetitive sequences in the satellite, is associated with about 35 human genetic disorders. Instability of trinucleotide repeats is for instance found in genes causing X-linked spinal and bulbar muscular atrophy (SBMA), myotonic dystrophy type 1 (DM1), fragile X syndrome (FRAX genes A, E, F), Huntington's disease (HD) and several spinocerebellar ataxias (SCA gene family). Unstable repeats are found in coding regions of genes, such as the Huntington's disease gene, whereby the phenotype of the disorder is brought about by alteration of protein function and/or protein folding. Unstable repeat units are also found in untranslated regions, such as in myotonic dystrophy type 1 (DM1) in the 3′ UTR or in intronic sequences such as in myotonic dystrophy type 2 (DM2). The normal number of repeats is around 5 to 37 for DMPK, but increases to premutation and full disease state two to ten fold or more, to 50, 100 and sometimes 1000 or more repeat units. For DM2/ZNF9 increases to 10,000 or more repeats have been reported. (Cleary and Pearson, Cytogenet. Genome Res. 100: 25-55, 2003).
  • [0003]
    The causative gene for Huntington's disease, HD, is located on chromosome 4. Huntington's disease is inherited in an autosomal dominant fashion. When the gene has more than 35 CAG trinucleotide repeats coding for a polyglutamine stretch, the number of repeats can expand in successive generations. Because of the progressive increase in length of the repeats, the disease tends to increase in severity and presents at an earlier age in successive generations, a process called anticipation. The product of the HD gene is the 348 kDa cytoplasmic protein huntingtin. Huntingtin has a characteristic sequence of fewer than 40 glutamine amino acid residues in the normal form; the mutated huntingtin causing the disease has more than 40 residues. The continuous expression of mutant huntingtin molecules in neuronal cells results in the formation of large protein deposits which eventually give rise to cell death, especially in the frontal lobes and the basal ganglia (mainly in the caudate nucleus). The severity of the disease is generally proportional to the number of extra residues.
  • [0004]
    DM1 is the most common muscular dystrophy in adults and is an inherited, progressive, degenerative, multisystemic disorder of predominantly skeletal muscle, heart and brain. DM1 is caused by expansion of an unstable trinucleotide (CTG)n repeat in the 3′ untranslated region of the DMPK gene (myotonic dystrophy protein kinase) on human chromosome 19q (Brook et al, Cell, 1992). Type 2 myotonic dystrophy (DM2) is caused by a CCTG expansion in intron 1 of the ZNF9 gene, (Liguori et al, Science 2001). In the case of myotonic dystrophy type 1, the nuclear-cytoplasmic export of DMPK transcripts is blocked by the increased length of the repeats, which form hairpin-like secondary structures that accumulate in nuclear foci. DMPK transcripts bearing a long (CUG)n tract can form hairpin-like structures that bind proteins of the muscleblind family and subsequently aggregate in ribonuclear foci in the nucleus. These nuclear inclusions are thought to sequester muscleblind proteins, and potentially other factors, which then become limiting to the cell. In DM2, accumulation of ZNF9 RNA carrying the (CCUG)n expanded repeat form similar foci. Since muscleblind proteins are splicing factors, their depletion results in a dramatic rearrangement in splicing of other transcripts. Transcripts of many genes consequently become aberrantly spliced, for instance by inclusion of fetal exons, or exclusion of exons, resulting in non-functional proteins and impaired cell function.
  • [0005]
    The observations and new insights above have led to the understanding that unstable repeat diseases, such as myotonic dystrophy type 1, Huntington's disease and others can be treated by removing, either fully or at least in part, the aberrant transcript that causes the disease. For DM1, the aberrant transcript that accumulates in the nucleus could be down regulated or fully removed. Even relatively small reductions of the aberrant transcript could release substantial and possibly sufficient amounts of sequestered cellular factors and thereby help to restore normal RNA processing and cellular metabolism for DM (Kanadia et al., PNAS 2006). In the case of HD, a reduction in the accumulation of huntingtin protein deposits in the cells of an HD patient can ameliorate the symptoms of the disease.
  • [0006]
    A few attempts have been made to design methods of treatment and medicaments for unstable repeat disease myotonic dystrophy type 1 using antisense nucleic acids, RNA interference or ribozymes.
  • [0007]
    (i) Langlois et al. (Molecular Therapy, Vol. 7 No. 5, 2003) designed a ribozyme capable of cleaving DMPK mRNA. The hammerhead ribozyme is provided with a stretch RNA complementary to the 3′ UTR of DMPK just before the CUG repeat. In vivo, vector transcribed ribozyme was capable of cleaving and diminishing in transfected cells both the expanded CUG repeat containing mRNA as well as the normal mRNA species with 63 and 50% respectively. Hence, also the normal transcript is gravely affected by this approach and the affected mRNA species with expanded repeats are not specifically targeted.
  • [0008]
    (ii) Another approach was taken by Langlois et al., (Journal Biological Chemistry, vol 280, no. 17, 2005) using RNA interference. A lentivirus-delivered short-hairpin RNA (shRNA) was introduced in DM1 myoblasts and demonstrated to down regulate nuclear retained mutant DMPK mRNAs. Four shRNA molecules were tested, two were complementary against coding regions of DMPK, one against a unique sequence in the 3′ UTR and one negative control with an irrelevant sequence. The first two shRNAs were capable of down regulating the mutant DMPK transcript with the amplified repeat to about 50%, but even more effective in down regulating the cytoplasmic wildtype transcript to about 30% or less. Equivalent synthetic siRNA delivered by cationic lipids was ineffective. The shRNA directed at the 3′ UTR sequence proved to be ineffective for both transcripts. Hence, also this approach is not targeted selectively to the expanded repeat mRNA species.
  • [0009]
    (iii) A third approach by Furling et al. (Gene Therapy, Vol. 10, p 795-802, 2003) used a recombinant retrovirus expressing a 149-bp long antisense RNA to inhibit DMPK mRNA levels in human DM1 myoblasts. A retrovirus was designed to provide DM1 cells with the 149 bp long antisense RNA complementary to a 39 bp-long (CUG)13 repeat and a 110 bp region following the repeat to increase specificity. This method yielded a decrease in mutated (repeat expanded) DMPK transcript of 80%, compared to a 50% reduction in the wild type DMPK transcript and restoration of differentiation and functional characteristics in infected DM1 myoblasts. Hence, also this approach is not targeted selectively to the expanded repeat mRNA species, it depends on a very long antisense RNA and can only be used in combination with recombinant viral delivery techniques.
  • DETAILED DESCRIPTION OF THE INVENTION
  • [0010]
    The methods and techniques described above provide nucleid acid based methods that cause non-selective breakdown of both the affected repeat expanded allele and unaffected or normal allele for genetic diseases that are associated with repeat instability and/or expansion. Moreover, the art employs sequences specific for the gene associated with the disease and does not provide a method that is applicable to several genetic disorders associated with repeat expansion. Finally, the art only teaches methods that involve use of recombinant DNA vector delivery systems, which need to be adapted for each oligonucleotide and target cell and which still need to be further optimised.
  • [0011]
    The current invention provides a solution for these problems by using a short nucleic acid molecule or oligonucleotide comprising or containing an inosine and/or uracile and/or a nucleotide containing a base able to form a wobble base pair, said nucleic acid molecule comprising or consisting of a sequence, which is complementary to the expanded repeat region only, i.e. it does not rely on hybridisation to unique sequences in exons or introns of the repeat containing gene. A second solution consists in using a short nucleic acid molecule that comprises or consists of a sequence, which is complementary to the expanded repeat region only and that is substantially not able to recruit and/or activate RNAse H; i.e. a RNAse H substantially independent nucleic acid molecule. Both solutions may also be combined: the invention provides the use of an oligonucleotide or nucleic acid molecule comprising an inosine and/or an uracile and/or a nucleotide containing a base able to form a wobble base pair, said oligonucleotide being substantially not able to recruit and/or activate RNAse H.
  • [0012]
    Without wishing to be bound by theory, the current invention may cause a decrease in transcript levels by alterations in posttranscriptional processing and/or splicing of the premature RNA. A decrease in transcript levels via alternative splicing and/or posttranscriptional processing may result in transcripts lacking the overly expanded or instable (tri)nucleotide repeat, but still possessing functional activities. In addition or alternatively, the stability of the mRNA may be decreased by the initiation or activation of breakdown mechanisms after binding to the target sequence in the mRNA. The reduction of aberrant transcripts by altered RNA processing and/or splicing and/or RNA stability may prevent accumulation and/or translation of aberrant, repeat expanded transcripts in cells.
  • [0013]
    Without wishing to be bound by theory the method of the current invention is also thought to provide specificity for the affected transcript with the expanded repeat because the kinetics for hybridisation to the expanded repeat are more favourable. The likelihood that a repeat specific complementary nucleic acid oligonucleotide molecule will hybridise to a complementary stretch in an RNA or DNA molecule increases with the size of the repetitive stretch. RNA molecules and in particular RNA molecules comprising repetitive sequences are normally internally paired, forming a secondary structure comprising open loops and closed hairpin parts. Only the open parts are relatively accessible for complementary nucleic acids. The short repeat stretches of a wild type transcript not associated with disease is often only 5 to about 20-40 repeats and due to the secondary structure relatively inaccessible for base pairing with a complementary nucleic acid. In contrast, the repeat units of the expanded repeat and disease associated allele is normally at least 2 fold expanded but usually even more, 3, 5, 10 fold, up to 100 or even more than 1000 fold expansion for some unstable repeat disorders. This expansion increases the likelihood that part of the repeat is, at least temporarily, in an open loop structure and thereby more accessible to base pairing with a complementary nucleic acid molecule, relative to the wild type allele. So despite the fact that the oligonucleotide is complementary to a repeat sequence present in both wild type and repeat-expanded transcripts and could theoretically hybridise to both transcripts, the current invention teaches that oligonucleotides complementary to a repetitive tract preferably hybridise to the disease-associated or disease-causing transcripts and leave the function of normal transcripts relatively unaffected. This selectivity is beneficial for treating diseases associated with repeat instability irrespective of the mechanism of reduction of the aberrant transcript. In addition, the 2 fold expanded but usually even more, 3, 5, 10 fold, up to 100 or even more than 1000 fold expansion allows for binding of more oligonucleotides, which may have additive effect on the mechanisms by which mutant transcripts are decreased. In the context of the invention, an oligonucleotide as designed herein is able to reduce “the repeat containing gene transcription” and/or to “treat any unstable cis-element DNA repeat associated genetic disorder” in a cell of a patient, in a tissue of a patient and/or in a patient. It preferably means that it reduces the detectable amount of disease-associated or disease-causing or mutant transcript containing an extending or unstable number of repetitive repeats in a cell of said patient, in a tissue of said patient and/or in a patient. Alternatively or in combination with previous sentence, said oligonucleotide may reduce the translation of said mutant transcript.
  • [0014]
    The invention thus provides a method for the treatment of unstable cis-element DNA repeat associated genetic disorders, by providing a nucleic acid molecule that is complementary to and/or capable of hybridising to the repetitive sequences only. This method thereby preferentially targets the expanded repeat transcripts and leaves the transcripts of the normal, wild type allele relatively unaffected. This is advantageous since the normal allele can thereby provide for the normal function of the gene, which is at least desirable and, depending on the particular gene with unstable DNA repeats, may in many cases be essential for the cell and/or individual to be treated. Therefore in the context of the invention, an oligonucleotide as designed herein can be used to treat any “cis-element repeat instability associated genetic disorder”. Said disorder is preferably any disease wherein an allele of a given gene comprises a repetitive sequence which is a so-called unstable repetitive sequence, since the number of repeats present in said repetitive sequence will increase or expand in time during the development of said disease. Said increase or expand of the number of repeats occurs in one given individual and/or in successive generations (off-spring) of a given individual.
  • [0015]
    Furthermore, this approach is not limited to a particular unstable DNA repeat associated genetic disorder, but may be applied to any of the known unstable DNA repeat diseases, such as, but not limited to: coding regions repeat diseases having a polyglutamine (CAG) repeat: Huntington's disease, Haw River syndrome, Kennedy's disease/spinobulbar muscular atrophy, spino-cerebellar ataxia, or diseases having polyalanine (GCG) repeats such as: infantile spasm syndrome, deidocranial dysplasia, blepharophimosis/ptosis/epicanthus invensus syndrome, hand-foot-genital syndrome, synpolydactyl), oculopharyngeal muscular dystrophy, holoprosencephaly. Diseases with repeats in non-coding regions of genes to be treated according to the invention comprise the trinucleotide repeat disorders (mostly CTG and/or CAG and/or CCTG repeats): myotonic dystrophy type 1, myotonic dystrophy type 2, Friedreich's ataxia (mainly GAA), spino-cerebellar ataxia, autism. Furthermore, a method of the invention can be applied to fragile site associated repeat disorder comprising various fragile X-syndromes, Jacobsen syndrome and other unstable repetitive element disorders such as myoclonus epilepsy, facioscapulohumeral dystrophy and certain forms of diabetes mellitus type 2.
  • [0016]
    Another advantage of the current invention is that an oligonucleotide specific for a repeat region may be administered directly to a cell and it does not rely on a vector-based delivery system. The techniques described in the prior art, for instance those mentioned above for treatment of DM1 and removal of DMPK transcripts from cells, require the use of vector based delivery systems to administer sufficient levels of oligonucleotides to the cell. The use of plasmid or viral vectors is yet less desirable for therapeutic purposes because of current strict safety regulations for therapeutic recombinant DNA vectors, the production of sufficient recombinant vectors for broad clinical application and the limited control and reversibility of an exaggerated (or non-specific) response after application. Nevertheless, optimisation in future is likely in these areas and viral delivery of plasmids could yield an advantageous long lasting effect. The current inventors have surprisingly found that an oligonucleotide comprising an inosine and/or an uracile and/or a nucleotide containing a base able to form a wobble base pair, said oligonucleotide comprising or consisting of a sequence that is complementary to repetitive sequences of expanded repeat transcripts, due to the expansion of their molecular target for hybridisation, has a much increased affinity and/or avidity for its target in comparison to an oligonucleotide that is specific for a unique sequence in a transcript. Because of this high affinity and avidity for the repeat expanded target transcript, lower amounts of said oligonucleotide suffice to yield sufficient inhibition and/or reduction of the repeat expanded allele by RNase H degradation, RNA interference degradation or altered post-transcriptional processing (comprising but not limited to splicing or exon skipping) activities. An oligonucleotide comprising an inosine and/or an uracile and/or a nucleotide containing a base able to form a wobble base pair, said oligonucleotide being complementary to repetitive sequences only, may be produced synthetically and is potent enough to be effective when delivered directly to a cell using commonly applied techniques for direct delivery of oligonucleotides to cells and/or tissues. Recombinant vector delivery systems may, when desired, be circumvented by using a method and an oligonucleotide of the current invention. The use of an oligonucleotide comprising an inosine and/or an uracile and/or a nucleotide containing a base able to form a wobble base pair is very attractive as explained below. Inosine for example is a known modified base, which can pair with three bases: uracil, adenine, and cytosine. Inosine is a nucleoside that is formed when hypoxanthine is attached to a ribose ring (also known as a ribofuranose) via a β-N-9-glycosidic bond. Inosine is commonly found in tRNAs and is essential for proper translation of the genetic code in wobble base pairs. A wobble base pair is a G-U and I-U/I-A/I-C pair fundamental in RNA secondary structure. Its thermodynamic stability is comparable to that of the Watson-Crick base pair. Wobble base pairs are critical for the proper translation of the genetic code. The genetic code makes up for disparities in the number of amino acids (20) for triplet codons (64), by using modified base pairs in the first base of the anti-codon. Similarly, when designing primers for polymerase chain reaction, inosine is useful in that it will indiscriminately pair with adenine, thymine, or cytosine. This allows one to design a primer that spans a single nucleotide polymorphism, without worry that the polymorphism will disrupt the primer's annealing efficiency. In the present invention, an inosine and/or an uracile and/or a nucleotide containing a base able to form a wobble base pair as present in an oligonucleotide as defined herein is preferably present in the part of said oligonucleotide which is complementary to a repetitive sequence as defined herein. However, an inosine and/or an uracile and/or a nucleotide containing a base able to form a wobble base pair may also be present in a part of said oligonucleotide which is not complementary to a repetitive sequence, for example in a targeting ligand as later identified herein.
  • [0017]
    In the current invention, expression of (triplet) nucleotide repeat expansion in mRNA can result in various diseases dependent on the triplet nucleotide repeat sequence and the gene involved. For instance, DM1 is caused by a (CUG)n repeat in exon 15 from the DMPK transcript, while HD is caused by a (CAG)n repeat in exon 1 from the huntingtin transcript. Specifically targeting these expansion repeats would require two oligonucleotides, however, employing an oligonucleotide comprising an inosine can lead to the design of one single oligonucleotide that is active against both transcripts, i.e. comprising or consisting of (CIG)n, (IGC)n or (GCI)n, preferably with a total nucleotide length between 9 and 50, more preferably between 12 and 40, most preferably between 15 and 30. Within the context of the whole application, the skilled person will understand that n is an integer which is preferably 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more. However, the length of said oligonucleotide is not per se a multiple of 3. In an embodiment, an oligonucleotide of the invention has a length which is a multiple of 3. Therefore, using an inosine and/or an uracile and/or a nucleotide containing a base able to form a wobble base pair may lead to a reduction in the number of nucleic acid molecules that have to be designed and developed, for being potentially used as a medicament against several diseases. Table 2 illustrates how to design an oligonucleotide comprising an inosine and/or an uracile against each of the known repeats.
  • [0018]
    In a first aspect, the current invention discloses and teaches the use of an oligonucleotide, preferably comprising an inosine and/or an uracile and/or a nucleotide containing a base able to form a wobble base pair, said oligonucleotide being preferably substantially RNAse H independent and said oligonucleotide comprising or consisting of a sequence that is complementary only to a repetitive sequence in a human gene transcript for the manufacture of a medicament for the diagnosis, treatment or prevention of a cis-element repeat instability associated genetic disorders in humans. The invention hence provides a method of treatment for cis-element repeat instability associated genetic disorders.
  • [0019]
    In a second aspect, the invention also pertains to an oligonucleotide, preferably comprising an inosine and/or an uracile and/or a nucleotide containing a base able to form a wobble base pair, said oligonucleotide being preferably substantially RNAse H independent and said oligonucleotide being preferably used in the first aspect of the invention and/or applied in method of the invention to prevent the accumulation and/or translation of repeat expanded transcripts in cells.
  • [0020]
    An oligonucleotide preferably comprising an inosine and/or an uracile and/or a nucleotide containing a base able to form a wobble base pair is preferably RNAse H substantially independent and may comprise a sequence that is complementary only to a repetitive sequence as defined below. It means that said oligonucleotide may further comprise an additional part which is not complementary to a sequence present in a cell to be treated. This additional part may for example been added during cloning procedures, and/or be a targeting part as later defined herein.
  • [0021]
    In an alternative embodiment, it may mean that a oligonucleotide may further comprise an additional part which is complementary to a sequence present in a cell to be treated. This additional part may for example be a sequence flanking the repetitive region. Or, this additional part may for example be a sequence not directly flanking the repetitive region. Or, this additional part may for example be a sequence not directly flanking the repetitive region and contain a functional motif (e.g., but not limited, to an ESE). Or, this additional part may for example be a sequence not directly flanking the repetitive region but in proximity because of the secondary or tertiary structure. Preferably, the repetitive sequence is at least 50% of the length of the oligonucleotide of the invention, more preferably at least 60%, even more preferably at least 70%, even more preferably at least 80%, even more preferably at least 90% or more. In a most preferred embodiment, the oligonucleotide of the invention consists of a sequence that is complementary only to a repetitive sequence as defined below. For example, an oligonucleotide may comprise a sequence that is complementary only to a repetitive sequence as defined below and a targeting part, which is later on called a targeting ligand.
  • [0022]
    A repeat or repetitive element or repetitive sequence or repetitive stretch is herein defined as a consecutive repetition of at least 3, 4, 5, 10, 100, 1000 or more, of a repetitive unit or repetitive nucleotide unit or repeat nucleotide unit comprising a trinucleotide repetitive unit, or alternatively a 4, 5 or 6 nucleotide repetitive unit, in a transcribed gene sequence in the genome of a subject, including a human subject.
  • [0023]
    An oligonucleotide of the invention preferably contains or comprises an inosine and/or an uracile and/or a nucleotide containing a base able to form a wobble base pair. More preferably said oligonucleotide comprises an inosine and/or an uracile. In the context of the invention, contains preferably means comprises. An oligonucleotide comprising an inosine and/or an uracile and/or a nucleotide containing a base able to form a wobble base pair may be defined as an oligonucleotide wherein at least one nucleotide has been substituted with an inosine and/or an uracile and/or a nucleotide containing a base able to form a wobble base pair. The skilled person knows how to test whether a nucleotide contains a base able to form a wobble base pair. Since for example inosine can form a base pair with uracil, adenine, and/or cytosine, it means that at least one nucleotide able to form a base pair with uracil, adenine and/or cytosine has been substituted with inosine. However, in order to safeguard specificity, the inosine containing oligonucleotide preferably comprises the substitution of at least one nucleotide able to form a base pair with uracil or adenine or cytosine. More preferably, all nucleotides able to form a base pair with uracil or adenine or cytosine are substituted with inosine. For example an inosine containing oligonucleotide complementary to a repetitive element (CAG)n or (CUG)n will comprise or consist of (CIG)n, or (IGC)n, or (GCI)n. Examples of inosine and/or uracil containing oligonucleotides complementary to (CAG)n, (CUG)n, (CGG)n, (GCG)n, (GAA)n, (GCC)n or (CCUG)n are presented in table 2. For convenience in this table n is taken as being 2. The skilled person will understand that for an oligonucleotide of the invention, n is an integer being preferably comprised between 3 and 17 as defined later herein. It is also obvious for the skilled person that a specific oligonucleotide can be designed by starting or finishing at any position in a given repeat sequence (or motif) without prejudice that one or the other resulting sequences could be more efficient. For example an inosine containing oligonucleotide complementary to a repetitive element (CAG)n or (CUG)n will comprise or consist of (CIG)n, or (IGC)n, or (GCI)n. It is also to be encompassed by the present invention that since at least one nucleotide has been substituted by inosine and/or uracile and/or a nucleotide containing a base able to form a wobble base pair in an oligonucleotide as defined herein, that an oligonucleotide complementary to a repetitive element such as (CAG)n may comprise or consist of (CIG)n. As indicated above, said complementary oligonucleotide may also comprise or consist of (IGC)n or (GCI)n. If one takes (CIG)n as example, having n as 3 as example, the invention encompasses any possible oligonucleotide based on a given formula such as (CIG)3 comprising 1 or 2 or 3 inosine(s) at the indicated position: (CTG)(CIG)(CTG), (CIG)(CTG)(CTG), (CIG)(CTG)(CIG), (CIG)(CIG)(CTG), (CIG)(CIG)(CIG).
  • [0024]
    An oligonucleotide which comprises an inosine and/or an uracile and/or a nucleotide containing a base able to form a wobble base pair said oligonucleotide being preferably RNAse H substantially independent may be single stranded or double stranded. Double stranded means that the oligonucleotide is an heterodimer made of two complementary strands, such as in a siRNA. In a preferred embodiment, an oligonucleotide is single stranded. The skilled person will understand that it is however possible that a single stranded oligonucleotide may form an internal double stranded structure. However, this oligonucleotide is still named as a single stranded oligonucleotide in the context of this invention. A single stranded oligonucleotide has several advantages compared to a double stranded siRNA oligonucleotide: (i) its synthesis is expected to be easier than two complementary siRNA strands; (ii) there is a wider range of chemical modifications possible to optimise more effective uptake in cells, a better (physiological) stability and to decrease potential generic adverse effects; (iii) siRNAs have a higher potential for non-specific effects (including off-target genes) and exaggerated pharmacology (e.g. less control possible of effectiveness and selectivity by treatment schedule or dose) and (iv) siRNAs are less likely to act in the nucleus and cannot be directed against introns. Therefore, in a preferred embodiment of the first aspect, the invention relates to the use of a single stranded oligonucleotide preferably comprising an inosine and/or an uracile and/or a nucleotide containing a base able to form a wobble base pair, said oligonucleotide being preferably RNAse H substantially independent and said oligonucleotide comprising or consisting of a sequence that is complementary only to a repetitive sequence in a human gene transcript for the manufacture of a medicament for the diagnosis, treatment or prevention of a cis-element repeat instability associated genetic disorders in humans.
  • [0025]
    Said oligonucleotide preferably comprises at least 9 to about 50 consecutive nucleotides complementary to a repetitive element, or at least 9 to 50 consecutive nucleotides complementary to a repetitive element, more preferably 12 to 45 nucleotides, even more preferably 12 to 40 nucleotides, even more preferably 12 to 30, even more preferably 15 to 30 nucleotides and most preferably 12 to 25 nucleotides complementary to a repetitive stretch, preferably having a trinucleotide repeat unit or a tetranucleotide repeat unit. The oligonucleotide preferably comprising an inosine and/or an uracile and/or a nucleotide containing a base able to form a wobble base pair and being preferably RNAse H substantially independent may be complementary to and/or capable of hybridizing to a repetitive stretch in a coding region of a transcript, preferably a polyglutamine (CAG) or a polyalanine (GCG) coding tract. The oligonucleotide may also be complementary to and/or capable of hybridizing to a non-coding region for instance 5′ or 3′ untranslated regions, or intronic sequences present in precursor RNA molecules.
  • [0026]
    In a preferred embodiment, an oligonucleotide preferably comprising an inosine and/or an uracile and/or a nucleotide containing a base able to form a wobble base pair and being preferably RNAse H substantially independent and to be used in a method of the invention comprises or consists of a sequence that is complementary to a repetitive element having as repetitive nucleotide unit a repetitive nucleotide unit selected from the group consisting of (CAG)n, (GCG)n, (CUG)n, (CGG)n (GAA)n, (GCC)n and (CCUG)n. Said oligonucleotide may be a single or double stranded oligonucleotide. In a preferred embodiment, the oligonucleotide is double stranded. Since a oligonucleotide preferably comprises at least 9 to about 50 consecutive nucleotides complementary to a repetitive element, more preferably comprises at least 9 to 50 consecutive nucleotides complementary to a repetitive element, it means n is an integer comprised between 3 and 17, more preferably between 4 and 15, even more preferably between 4 and 14, even more preferably between 4 and 13, even more preferably between 4 and 10, even more preferably between 5 and 10, and most preferably between 4 and 8 or between 4 and 9.
  • [0027]
    The use of an oligonucleotide preferably comprising an inosine and/or an uracile and/or a nucleotide containing a base able to form a wobble base pair, being preferably RNAse H substantially independent and comprising or consisting of a sequence that is complementary to a polyglutamine (CAG)n tract in a transcript is particularly useful for the diagnosis, treatment and/or prevention of the human disorders Huntington's disease, several forms of spino-cerebellar ataxia or Haw River syndrome, X-linked spinal and bulbar muscular atrophy and/or dentatorubral-pallidoluysian atrophy caused by repeat expansions in the HD, HDL2/JPH3, SBMA/AR, SCA1/ATX1, SCA2/ATX2, SCA3/ATX3, SCA6/CACNAIA, SCA7, SCA17, AR or DRPLA human genes. Such an oligonucleotide, preferably such an oligonucleotide comprising an inosine preferably comprises or consists of (CIG)n, or (IGC)n, or (GCI)n. For other preferred possibilities see table 2.
  • [0028]
    The use of an oligonucleotide preferably comprising an inosine and/or an uracile and/or a nucleotide containing a base able to form a wobble base pair, being preferably RNAse H substantially independent and comprising or consisting of a sequence that is complementary to a polyalanine (GCG)n tract in a transcript is particularly useful for the diagnosis, treatment and/or prevention of the human disorders: infantile spasm syndrome, deidocranial dysplasia, blepharophimosis, hand-foot-genital disease, synpolydactyl), oculopharyngeal muscular dystrophy and/or holoprosencephaly, which are caused by repeat expansions in the ARX, CBFA1, FOXL2, HOXA13, HOXD13, OPDM/PABP2, TCFBR1 or ZIC2 human genes. For preferred oligonucleotides, see table 2.
  • [0029]
    The use of an oligonucleotide preferably comprising an inosine and/or an uracile and/or a nucleotide containing a base able to form a wobble base pair being preferably RNAse H substantially independent and comprising or consisting of a sequence that is complementary to a (CUG)n repeat in a transcript and is particularly useful for the diagnosis, treatment and/or prevention of the human genetic disorder myotonic dystrophy type 1, spino-cerebrellar ataxia 8 and/or Huntington's disease-like 2 caused by repeat expansions in the DM1/DMPK, SCA8 or JPH3 genes respectively. Preferably, these genes are from human origin. Such an oligonucleotide, preferably such an inosine containing oligonucleotides preferably comprises or consists of (CIG)n, or (IGC)n, or (GCI)n. For other preferred oligonucleotides, see table 2.
  • [0030]
    The use of an oligonucleotide preferably comprising an inosine and/or an uracile and/or a nucleotide containing a base able to form a wobble base pair, being preferably RNAse H substantially independent and comprising or consisting of a sequence that is complementary to a (CCUG)n repeat in a transcript is particularly useful for the diagnosis, treatment and/or prevention of the human genetic disorder myotonic dystrophy type 2, caused by repeat expansions in the DM2/ZNF9 gene. For preferred oligonucleotides, see table 2.
  • [0031]
    The use of an oligonucleotide preferably comprising an inosine and/or an uracile and/or a nucleotide containing a base able to form a wobble base pair being preferably RNAse H substantially independent and comprising or consisting of a sequence that is complementary to a (CGG)n repeat in a transcript is particularly useful for the diagnosis, treatment and/or prevention of human fragile X syndromes, caused by repeat expansion in the FRAXA/FMR1, FRAXE/FMR2 and FRAXF/FAM11A genes. For preferred oligonucleotides see table 2.
  • [0032]
    The use of an oligonucleotide preferably comprising an inosine and/or an uracile and/or a nucleotide containing a base able to form a wobble base pair being preferably RNAse H substantially independent and comprising or consisting of a sequence that is complementary to a (CCG)n repeat in a transcript is particularly useful for the diagnosis, treatment and/or prevention of the human genetic disorder Jacobsen syndrome, caused by repeat expansion in the FRA11B/CBL2 gene. For preferred oligonucleotides, see table 2.
  • [0033]
    The use of an oligonucleotide preferably comprising an inosine and/or an uracile and/or a nucleotide containing a base able to form a wobble base pair being preferably RNAse H substantially independent and comprising or consisting of a sequence that is complementary to a (GAA)n repeat in a transcript is particularly useful for the diagnosis, treatment and/or prevention of the human genetic disorder Friedreich's ataxia. For preferred oligonucleotides, see table 2.
  • [0034]
    The use of an oligonucleotide preferably comprising an inosine and/or an uracile and/or a nucleotide containing a base able to form a wobble base pair being preferably RNAse H substantially independent and comprising or consisting of a sequence that is complementary to a (ATTCT)n repeat in an intron is particularly useful for the diagnosis, treatment and/or prevention of the human genetic disorder Spinocerebellar ataxia type 10 (SCA10). For preferred oligonucleotides, see table 2.
  • [0035]
    The repeat-complementary oligonucleotide or oligonucleotide to be used in a method of the invention may comprise or consist of RNA, DNA, Locked nucleic acid (LNA), peptide nucleic acid (PNA), morpholino phosphorodiamidates (PMO), ethylene bridged nucleic acid (ENA) or mixtures/hybrids thereof that comprise combinations of naturally occurring DNA and RNA nucleotides and synthetic, modified nucleotides. The skilled person will understand that any human nucleotide bases, but also any other natural or synthetic nucleotide bases or their derivatives can be used such as for instance: 2-aminopurine, thymidine instead of uracile, 5-methylcytosine, 5-methylinosine, 7-methylguanosine or diaminoadenine. A person skilled in the art will also recognize that there are many synthetic derivatives of oligonucleotides. Therefore, “Oligonucleotide” includes, but is not limited to phosphodiesters, phosphotriesters, phosphorothioates, phosphodithioates, phosphorothiodiamidate and H-phosphonates derivatives. It encompasses also both naturally occurring and synthetic oligonucleotide derivatives.
  • [0036]
    In such oligonucleotides, the phosphodiester backbone chemistry may further be replaced by other modifications, such as phosphorothioates or methylphosphonates. Other oligonucleotide modifications exist and new ones are likely to be developed and used in practice. However, all such oligonucleotides have the character of an oligomer with the ability of sequence specific binding to RNA. Therefore in a preferred embodiment, the oligonucleotide comprises or consists of RNA nucleotides, 2′O-substituted RNA nucleotides, DNA nucleotides, locked nucleic acid (LNA) nucleotides, peptide nucleic acid (PNA) nucleotides, morpholino phosphorodiamidates, ethylene-bridged nucleic acid (ENA) nucleotides or mixtures thereof with or without phosphorothioate containing backbones.
  • [0037]
    Oligonucleotides containing at least in part naturally occurring DNA nucleotides are useful for inducing degradation of DNA-RNA hybrid molecules in the cell by RNase H activity (EC.3.1.26.4).
  • [0038]
    Naturally occurring RNA ribonucleotides or RNA-like synthetic ribonucleotides comprising oligonucleotides may be applied in the method of the invention to form double stranded RNA-RNA hybrids that act as enzyme-dependent antisense through the RNA interference or silencing (RNAi/siRNA) pathways, involving target RNA recognition through sense-antisense strand pairing followed by target RNA degradation by the RNA-induced silencing complex (RISC).
  • [0039]
    Alternatively or in addition, steric blocking antisense oligonucleotides (RNase-H independent antisense) interfere with gene expression or other precursor RNA or messenger RNA-dependent cellular processes, in particular but not limited to RNA splicing and exon skipping, by binding to a target sequence of RNA transcript and getting in the way of processes such as translation or blocking of splice donor or splice acceptor sites. Alteration of splicing and exon skipping techniques using modified antisense oligonucleotides are well documented, known to the skilled artisan and may for instance be found in U.S. Pat. No. 6,210,892, WO9426887, WO04/083446 and WO02/24906. Moreover, steric hindrance may inhibit the binding of proteins, nuclear factors and others and thereby contribute to the decrease in nuclear accumulation or ribonuclear foci in diseases like DM1.
  • [0040]
    An oligonucleotide as defined herein, which may comprise synthetic or modified nucleotides, complementary to (expanded) repetitive sequences is useful in a method of the invention for reducing or inactivating repeat containing transcripts via the siRNA/RNA interference or silencing pathway.
  • [0041]
    Single or double stranded oligonucleotides to be used in a method of the invention may comprise or consist of DNA nucleotides, RNA nucleotides, 2′-O substituted ribonucleotides (preferably 2′-O-substituted RNA phosphorothioate nucleotides), including alkyl and methoxy ethyl substitutions (including 2′-4′ constrained variants as identified herein), peptide nucleic acid (PNA), locked nucleic acid (LNA) and morpholino (PMO) antisense oligonucleotides and ethylene-bridged nucleotides (ENA) and combinations thereof, optionally chimeras with RNAse H dependent antisense. A preferred oligonucleotide comprises 2′-O-substituted RNA phosphorothioate nucleotides, preferably wherein the 2′-O-substitution is a methoxy ethyl (MOE) and/or methyl (Me) and/or 2′O,4′C methylene bridge (LNA) and/or 2′O, 4′C constrained ethyl (cEt) and/or 2′O, 4′C constrained methoxyethyl (cMOEt) (reference: Short Antisense Oligonucleotides with Novel 2′-4′ Conformationaly Restricted Nucleoside Analogues Analogues Show Improved Potency without Increased Toxicity in Animals. Punit P. Seth, Andrew Siwkowski, Charles R. Allerson, Guillermo Vasquez, Sam Lee, Thazha P. Prakash, Edward V. Wancewicz, Donna Witchell, and Eric E. Swayze J. Med. Chem., 2009, 52 (1), 10-13). Integration of locked nucleic acids in the oligonucleotide changes the conformation of the helix after base pairing and increases the stability of the duplex. Integration of LNA bases into the oligonucleotide sequence can therefore be used to increase the ability of complementary oligonucleotides of the invention to be active in vitro and in vivo to increase RNA degradation inhibit accumulation of transcripts or increase exon skipping capabilities. Peptide nucleic acids (PNAs), an artificial DNA/RNA analog, in which the backbone is a pseudopeptide rather than a sugar, have the ability to form extremely stable complexes with complementary DNA oligomers, by increased binding and a higher melting temperature. Also PNAs are superior reagents in antisense and exon skipping applications of the invention. More preferably, an oligonucleotide to be used in a method of this invention comprises, at least in part or fully, 2′-O-methoxy ethyl phosphorothioate RNA nucleotides, 2′-O-methyl phosphorothioate RNA nucleotides and/or locked nucleic acids (LNA). Even more preferably, an oligonucleotide comprises or consists of LNA and 2′-O-methyl phosphorothioate RNA nucleotides. In another preferred embodiment, an oligonucleotide comprises or consists of LNA and phosphorothioate DNA nucleotides. In another preferred embodiment, an oligonucleotide comprises or consists of LNA and 2′-O-methyl phosphorothioate RNA nucleotides and phosphorothioate DNA nucleotides. In another preferred embodiment, an oligonucleotide comprises or consists of LNA and 2′-O-methoxy ethyl phosphorothioate RNA nucleotides. In another more preferred embodiment, an oligonucleotide consists of a PMO oligonucleotide. In another preferred embodiment, an oligonucleotide consists of 2′-O-methyl phosphorothioate RNA nucleotides. Most preferably these modifications will be employed in a configuration that will allow the breakdown or inhibition of mutant mRNA by other mechanisms than RNAse H. Oligonucleotides comprising or consisting of a sequence that is complementary to a repetitive sequence selected from the group consisting of (CAG)n, (GCG)n, (CUG)n, (CGG)n, (CCG)n, (GAA)n, (GCC)n and (CCUG)n having a length of 9 to 50, more preferably 12 to 40, most preferably 12 to 25 nucleotides, and comprising 2′-β-methoxyethyl phosphorothioate RNA nucleotides, 2′-O-methyl phosphorothioate RNA nucleotides, LNA nucleotides or PMO nucleotides are most preferred for use in the invention for the diagnosis, treatment of prevention of cis-element repeat instability genetic disorders.
  • [0042]
    Alternatively or in combination with one or more of the earlier defined preferred embodiments, the invention further specifically provides an oligonucleotide that comprises or consists of a sequence that is complementary only to a repetitive sequence in a gene transcript and its use for the manufacture of a medicament for the treatment or prevention of human cis-element repeat instability associated genetic disorders and which is a RNAse H susbtantially independent oligonucleotide.
  • [0043]
    A RNAse H substantially independent oligonucleotide is preferably defined as an oligonucleotide which is not able to substantially recruit and/or activate RNAse H after binding to a targeted RNA. The recruitment and/or activation of RNAse H may be assessed using a standard RNAse H digestion assay after having contacted a RNAse H, preferably from E. coli, a targeted RNA and an oligonucleotide to be tested. Such assay is known to the skilled person and may be carried out as described in Honcharenko D et al or Kurreck J et al (Honcharenko D et al, (2007), Biochemistry, 46:5635-5646, and Kurreck J et al (2002), Nucl. Ac. Res., 30:1911-1918). In the context of the invention, an oligonucleotide or a given dose or concentration of an oligonucleotide is preferably said not to be able to substantially recruit and/or activate RNAse H and/or said substantially RNAse H independent when in at least one of the two assays as defined above, less than 50% of a targeted RNA has been digested. More preferably, less than 45% of a targeted RNA has been digested, even more preferably less than 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5% or less. Most preferably, an oligonucleotide or a given dose or concentration of said oligonucleotide is not able to recruit and/or activate RNAse H. In a preferred embodiment, it is expected that when an olignucleotide is used in a concentration range wherein said oligonucleotide acts as a medicament for said disease as identified herein, said oligonucleotide will not to be able to substantially recruit and/or activate RNAse H and/or will be said substantially RNAse H independent. In this case, in such assay, there is preferably no detection of a digestion of a targeted RNA. Such an oligonucleotide is a RNAse H independent oligonucleotide. Many forms of antisenses have been described so far including enzyme-dependent mechanisms to degrade target mRNA such as RNase H activity. RNAse H cleaves only in RNA-DNA duplexes and therefore in order to down regulate mRNA the antisense oligonucleotide should contain deoxyribose (DNA) nucleotides. Slight modifications such as the use of phosphorothioate deoxyribose nucleotides are allowed to retain this RNAse H activity. Chimeric oligonucleotides (or oligomers) have been used because of their stabilising properties (enhancing physicological stability or half life), such as the application of 2′O-alkyl and 2′O-methoxy ethyl modifications at the 3′ and 5′ end of the oligonucleotide. However, a stretch of deoxyribose nucleotides is still required for the recruitment of RNase H by the oligonucleotide-target RNA duplex. These chimeric oligonucleotides (with or without phosphorothioate backbone modifications) have been referred to as gapmers (see WO 2007/089611). It is believed that such (deoxyribose) gap should be preferably at least 6 nucleotides and more preferably 10 nucleotides long in order to be able to recruit and/or activate RNAse H.
  • [0044]
    Therefore, in a preferred embodiment of the invention, an oligonucleotide is designed that substantially does not recruit and/or activate RNAse H after binding to a targeted RNA. The present invention preferably employs oligonucleotides (oligomers) that are preferably susbtantially not able to recruit and/or activate RNAse H. Such oligonucleotides may comprise for instance 2′-O backbone modifications, preferably 2′O-alkyl or 2′O-methoxy ethyl, peptide nucleic acid (PNA), locked nucleic acid (LNA) or morpholino antisense. Such oligonucleotides could even be a chimeric molecule containing deoxy nucleotides, but with preferably less than 9 or most preferably with less than 6 deoxy nucleotides next to each other (consecutive deoxy nucleotide).
  • [0045]
    Surprisingly, the present invention demonstrates that a RNAse H substantially independent oligonucleotide can be used for the manufacture of a medicament for the treatment or prevention of human cis-element repeat instability associated genetic disorders. Said RNAse H substantially independent oligonucleotide is more attractive than a corresponding classical RNAse H dependent oligonucleotide since we can reasonably expect that such RNAse H substantially independent oligonucleotide is easier to be synthetised, is less toxic and more stabile than its corresponding RNAse H dependent counterpart.
  • [0046]
    Therefore, in a preferred embodiment, there is provided an oligonucleotide and its use, wherein the use is as earlier herein defined and wherein said oligonucleotide has a length of about 9 to about 50 nucleotides, is substituted at least one of its 5′ or 3′ ends and comprises less than 9, more preferably less than 6 consecutive deoxyriboses in the rest of its sequence. More preferred lengths of an oligonucleotide have already been defined herein. A preferred substitution includes a phosphorothioate containing backbone. A preferred phosphorothioate containing backbone includes 2′-O-substituted RNA phosphorothioate nucleotides. Preferred 2′-O-substituted RNA phosphorothioate nucleotides include 2′-O-substituted methoxy ethyl and/or methyl and/or 2′O,4′C methylene bridge (LNA) and/or 2′O, 4′C constrained ethyl (cEt) and/or 2′O, 4′C constrained methoxyethyl (cMOEt).
  • [0047]
    As herein defined, an oligonucleotide is substituted at least one of its 5′ or 3′ ends and comprises less than 9, more preferably less than 6 consecutive deoxyriboses in the rest of its sequence. The rest of the sequence is preferably the center of the sequence. An oligonucleotide substituted at both of its 5′ or 3′ ends as defined herein and comprising 9 or more consecutive deoxyriboses in the center of its sequence is called a gapmer. Gapmers have been extensively described in WO 2007/089611. Gapmers are designed to enable the recruitment and/or activation of RNAse H. Without wishing to be bound by theory, it is believed that RNAse H is recruited and/or activated via binding to the central region of the gapmer made of deoxyriboses. Oligonucleotides of the invention which are substantially independent of RNAse H are designed in order to have a central region which is susbtantially not able to recruit and/or activate RNAse H. In a preferred embodiment, the rest of the sequence of the oligonucleotide of the invention, more preferably its central part comprises less than 9, 8, 7, 6, 5, 4, 3, 2, 1, or no deoxyribose. Accordingly this oligonucleotide of the invention, is preferably partly till fully substituted as earlier defined herein. Partly substituted preferably means that the oligonucleotide comprises at least 50% of its nucleotides that have been substituted, at least 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% (i.e. fully) substituted.
  • [0048]
    Accordingly, in a preferred embodiment, an oligonucleotide comprising an inosine and/or an uracile and/or a nucleotide containing a base able to form a wobble base pair, being preferably RNAse H susbstantially independent and being used in the invention comprises or consists of a sequence that is complementary to a repetitive sequence selected from the group consisting of (CAG)n, (GCG)n, (CUG)n, (CGG)n, (GAA)n, (GCC)n and (CCUG)n, has a length of 9 to 50 nucleotides and is further characterized by:
      • a) comprising 2′-O-substituted RNA phosphorothioate nucleotides such as 2′-O-methyl or 2′-O-methoxy ethyl or 2′-O 4′C ethylene (cEt), 2′-O 4′C methoxyethylene (cMOE) RNA phosphorothiote nucleotides, LNA nucleotides, or PMO nucleotides. The nucleotides could be used in any combination and/or with DNA phosphorothioate or RNA nucleotides; and/or
      • b) being a single stranded oligonucleotide.
  • [0051]
    Accordingly, in another preferred embodiment, an oligonucleotide comprising an inosine and/or an uracile and/or a nucleotide containing a base able to form a wobble base pair, being preferably RNAse H susbstantially independent and being used in the invention comprises or consists of a sequence that is complementary to a repetitive sequence selected from the group consisting of (CAG)n, (GCG)n, (CUG)n, (CGG)n, (GAA)n, (GCC)n and (CCUG)n, has a length of 9 to 50 nucleotides and is further characterized by:
      • a) comprising 2′-O-substituted RNA phosphorothioate nucleotides such as 2′-O-methyl or 2′-O-methoxy ethyl or 2′-O 4′C ethylene or 2′-O 4′C methoxyethylene RNA phosphorothioate nucleotides, LNA nucleotides, or PMO nucleotides. The nucleotides could be used in combination and/or with DNA phosphorothioate or RNA nucleotides; and/or b) being a double stranded oligonucleotide.
  • [0053]
    In a further preferred embodiment, the above preferred modifications will be employed in a configuration that will allow the breakdown of mutant mRNA by other mechanisms than RNAse H.
  • [0054]
    In case, the invention relates to a double stranded oligonucleotide with two complementary strands, the antisense strand, complementary only to a repetitive sequence in a human gene transcript, this double stranded oligonucleotide is preferably not the siRNA with antisense RNA strand (CUG)7 and sense RNA strand (GCA)7 applied to cultured monkey fibroblast (COS-7) or human neuroblastoma (SH-SY5Y) cell lines with or without transfection with a human Huntington gene exon 1 fused to GFP and as depicted in Wanzhao Liu et al (Wanzhao Liu et al, (2003), Proc. Japan Acad, 79: 293-298). More preferably, the invention does neither relate to the double stranded oligonucleotide siRNA (with antisense strand (CUG)7 and sense strand (GCA)7) nor to its use for the manufacture of a medicament for the treatment or prevention of Huntington disease, even more preferably for the treatment or prevention of Huntington disease gene exon 1 containing construct.
  • [0055]
    Although use of a single oligonucleotide may be sufficient for reducing the amount of repeat expanded transcripts, such as nuclear accumulated DMPK or ZNF9 transcripts or segments thereof or sufficient reduction of accumulation of repeat expanded HD protein, it is also within the scope of the invention to combine 2, 3, 4, 5 or more oligonucleotides. An oligonucleotide comprising or consisting of a sequence that is complementary to a repetitive part of a transcript may be advantageously combined with another oligonucleotide that comprise or consist of sequences that are complementary to and/or capable of hybridizing with unique sequences in a repeat containing transcript. As earlier defined herein, the invention encompasses the use of an oligonucleotide containing an inosine and/or an uracile and/or a nucleotide containing a base able to form a wobble base pair and being preferably a RNAse H substantially independent oligonucleotide. It is also encompassed by the invention to combine the use of an oligonucleotide comprising an inosine and/or an uracile and/or a nucleotide containing a base able to form a wobble base pair containing oligonucleotide with another oligonucleotide being a RNAse H substantially independent oligonucleotide. The method of the invention and the medicaments of the invention comprising repeat specific oligonucleotides may also be combined with any other treatment or medicament for cis-element repeat instability genetic disorders. For diagnostic purposes the oligonucleotide comprising an inosine and/or an uracile and/or a nucleotide containing a base able to form a wobble base pair being preferably RNAse H substantially independent and being used in a method of the invention may be provided with a radioactive label or fluorescent label allowing detection of transcripts in samples, in cells in situ in vivo, ex vivo or in vitro. For myotonic dystrophy, labelled oligonucleotides may be used for diagnostic purposes, for visualisation of nuclear aggregates of DMPK or ZNF9 RNA transcript molecules with associated proteins. Fluorescent labels may comprise Cy3, Cy5, FITC, TRITC, Rhodamine, GFP and the like. Radioactive labels may comprise 3H, 35S, 32/33P, 125I. Enzymes and/or immunogenic haptens such as digoxigenin, biotin and other molecular tags (HA, Myc, FLAG, VSV, lexA) may also be used. Accordingly, in a further aspect, the invention discloses an vitro or ex vivo detection and/or diagnostic method wherein an oligonucleotide comprising aminosine and/or an uracile and/or a nucleotide containing a base able to form a wobble base pair being preferably RNAse H substantially independent as defined above is used.
  • [0056]
    The oligonucleotide comprising an inosine and/or an uracile and/or a nucleotide containing a base able to form a wobble base pair being preferably RNAse H substantially independent and being for use according to the invention is suitable for direct administration to a cell, tissue and/or organ in vivo of an individual affected by or at risk of developing a cis-element repeat instability disorder, and may be administered directly in vivo, ex vivo or in vitro. Alternatively, said oligonucleotide may be provided by a nucleic acid vector capable of conferring expression of said oligonucleotide in human cells, in order to allow a sustainable source of said oligonucleotides. Oligonucleotide molecules according to the invention may be provided to a cell, tissue, organ and/or subject to be treated in the form of an expression vector that is capable of conferring expression of the oligonucleotide in human cells. The vector is preferably introduced in a cell by a gene delivery vehicle. Preferred vehicles for delivery are viral vectors such as retroviral vectors, adeno-associated virus vectors (AAV), adenoviral vectors, Semliki Forest virus vectors (SFV), EBV vectors and the like. Also plasmids, artificial chromosomes, plasmids suitable for targeted homologous recombination and integration in the human genome of cells may be suitably applied for delivery of oligonucleotides. Preferred for the current invention are those vectors wherein transcription is driven from polIII promoters, and/or wherein transcripts are in the form fusions with U1 or U7 transcripts, which yield good results for delivering small transcripts.
  • [0057]
    In a preferred embodiment, a concentration of an oligonucleotide comprising an inosine and/or an uracile and/or a nucleotide containing a base able to form a wobble base pair being preferably RNAse H substantially independent is ranged between about 0.1 nM and about 1 μM is used. More preferably, the concentration used is ranged between about 0.3 to about 400 nM, even more preferably between about 1 to about 200 nM. Preferred concentrations are between 0.1 nM and 1 μM. More preferably, the concentration used is ranged between 0.3 to 400 nM, even more preferably between 1 to 200 nM. If several oligonucleotides are used, this concentration may refer to the total concentration of oligonucleotides or the concentration of each oligonucleotide added. The ranges of concentration of oligonucleotide(s) as given above are preferred concentrations for in vitro or ex vivo uses. The skilled person will understand that depending on the oligonucleotide(s) used, the target cell to be treated, the gene target and its expression levels, the medium used and the transfection and incubation conditions, the concentration of oligonucleotide(s) used may further vary and may need to be optimised any further.
  • [0058]
    More preferably, the oligonucleotide comprising an inosine and/or an uracile and/or a nucleotide containing a base able to form a wobble base pair, being preferably RNAse H substantially independent and used in the invention to prevent, treat or diagnose cis-element repeat instability disorders is synthetically produced and administered directly to a cell, a tissue, an organ and/or a patient or an individual or a subject in a formulated form in a pharmaceutically acceptable composition. The delivery of said pharmaceutical composition to the subject is preferably carried out by one or more parenteral injections, e.g. intravenous and/or subcutaneous and/or intramuscular and/or intrathecal and/or intraventricular administrations, preferably injections, at one or at multiple sites in the human body. An intrathecal or intraventricular administration (in the cerebrospinal fluid) is preferably realized by introducing a diffusion pump into the body of a subject. Several diffusion pumps are known to the skilled person.
  • [0059]
    Pharmaceutical compositions that are to be used to target an oligonucleotide molecules comprising or consisting of a sequence that is complementary to repetitive sequences as defined herein may comprise various excipients such as diluents, fillers, preservatives, solubilisers and the like, which may for instance be found in Remington: The Science and Practice of Pharmacy, 20th Edition. Baltimore, Md.: Lippincott Williams & Wilkins, 2000.
  • [0060]
    Particularly preferred for a method of the invention is the use of an excipient that will aid in delivery of said oligonucleotide to a cell and into a cell, in particular excipients capable of forming complexes, vesicles and/or liposomes that deliver substances and/or oligonucleotide(s) complexed or trapped in the vesicles or liposomes through a cell membrane. Many of these substances are known in the art. Suitable substances comprise polyethylenimine (PEI), ExGen 500, synthetic amphiphils (SAINT-18), Lipofectin™, DOTAP and/or viral capsid proteins that are capable of self assembly into particles that can deliver said oligonucleotide to a cell. Lipofectin represents an example of liposomal transfection agents. It consists of two lipid components, a cationic lipid N-[1-(2,3 dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA) (cp. DOTAP which is the methylsulfate salt) and a neutral lipid dioleoylphosphatidylethanolamine (DOPE). The neutral component mediates the intracellular release. Another group of delivery systems are polymeric nanoparticles. Polycations such like diethylaminoethylaminoethyl (DEAE)-dextran, which are well known as DNA transfection reagent can be combined with butylcyanoacrylate (PBCA) and hexylcyanoacrylate (PHCA) to formulate cationic nanoparticles that can deliver oligonucleotides across cell membranes into cells. In addition to these common nanoparticle materials, the cationic peptide protamine offers an alternative approach to formulate oligonucleotides as colloids. This colloidal nanoparticle system can form so called proticles, which can be prepared by a simple self-assembly process to package and mediate intracellular release of an oligonucleotide as defined herein. The skilled person may select and adapt any of the above or other commercially available alternative excipients and delivery systems to package and deliver an oligonucleotide for use in the current invention to deliver such oligonucleotide for the treatment of cis-element repeat instability disorders in humans.
  • [0061]
    In addition, an oligonucleotide comprising an inosine and/or an uracile and/or a nucleotide containing a base able to form a wobble base pair being preferably RNAse H substantially independent could be covalently or non-covalently linked to a targeting ligand specifically designed to facilitate the uptake in to the cell, cytoplasm and/or its nucleus. Such ligand could comprise (i) a compound (including but not limited to a peptide(-like) structure) recognising cell, tissue or organ specific elements facilitating cellular uptake and/or (ii) a chemical compound able to facilitate the uptake in to a cell and/or the intracellular release of an oligonucleotide from vesicles, e.g. endosomes or lysosomes. Such targeting ligand would also encompass molecules facilitating the uptake of oligonucleotides into the brain through the blood brain barrier.
  • [0062]
    Therefore, in a preferred embodiment, an oligonucleotide comprising an inosine and/or an uracile and/or a nucleotide containing a base able to form a wobble base pair being preferably RNAse H substantially independent is part of a medicament or is considered as being a medicament and is provided with at least an excipient and/or a targeting ligand for delivery and/or a delivery device of said oligonucleotide to a cell and/or enhancing its intracellular delivery. Accordingly, the invention also encompasses a pharmaceutically acceptable composition comprising an oligonucleotide of the invention and further comprising at least one excipient and/or a targeting ligand for delivery and/or a delivery device of said oligonucleotide to a cell and/or enhancing its intracellular delivery.
  • [0063]
    The invention also pertains to a method for the reduction of repeat containing gene transcripts in a cell comprising the administration of a single strand or double stranded oligonucleotide comprising an inosine and/or an uracile and/or a nucleotide containing a base able to form a wobble base pair being preferably RNAse H substantially independent and preferably comprising 2′-O-substituted RNA phosphorothioate nucleotides such as 2′-O-methyl or 2′-O-methoxy ethyl RNA phosphorothioate nucleotides or LNA or cET or cMOE nucleotides or PMO nucleotides, and having a length of 9 to 50 nucleotides that are complementary to the repetitive sequence only. The nucleotides could be used in combination and/or with DNA phosphorothioate nucleotides.
  • [0064]
    In this document and in its claims, the verb “to comprise” and its conjugations is used in its non-limiting sense to mean that items following the word are included, but combinations and/or items not specifically mentioned are not excluded.
  • [0065]
    In addition the verb “to consist” may be replaced by “to consist essentially of” meaning that a molecule or a viral-based vector or a composition as defined herein may comprise additional component(s) than the ones specifically identified, said additional component(s) not altering the unique characteristic of the invention.
  • [0066]
    The word “about” or “approximately” when used in association with a numerical value (about 10) preferably means that the value may be the given value of 10 more or less 1% of the value.
  • [0067]
    In addition, reference to an element by the indefinite article “a” or “an” does not exclude the possibility that more than one of the element is present, unless the context clearly requires that there be one and only one of the elements. The indefinite article “a” or “an” thus usually means “at least one”.
  • [0068]
    The present invention is further described by the following examples which should not be construed as limiting the scope of the invention.
  • FIGURE LEGENDS
  • [0069]
    FIG. 1: shows the concentration response curves in DM500 myotubes after treatment with various concentrations of oligonucleotide PS58 or PS142. Oligo(ribo)nucleotide PS58 exhibits a full length 2′O-methyl phosphorothioate modified backbone and oligo(deoxyribose)nucleotide PS142 a full length phosphorothioate DNA backbone. The PS58 is more efficiently inhibiting mutant expanded hDMPK transcript than PS142. PS58, unlike PS142, contains the 2′OMe modification that prevents RNAseH mediated breakdown of target mRNA by oligonucleotides. The expression of hDMPK was quantified via Northern blot analysis followed by phosphoimager analysis. The signal was normalised to the GAPDH signal and expressed relative to the response after mock treatment.
  • [0070]
    FIG. 2:
  • [0071]
    RT-PCR analsysis was performed on GM00305 fibroblasts from a male patient with Huntington's Disease after treatment with oligonucleotide PS57 (CUG)7 or PS261 (CIG)7 at various concentrations. Analysis of GM00305 shows two RT-PCR products representing the transcripts of both the mutant (expanded disease) allele and the normal allele. PS57 and PS261 show a dose dependent inhibition of the mutant transcript.
  • [0072]
    FIG. 3:
  • [0073]
    RT-PCR analsysis was performed on GM00305 fibroblasts from a male patient with Huntington's Disease or PAFC1 fibroblasts from a healthy volunteer after treatment with oligonucleotide PS262 (UGC)7 at various concentrations. Analysis of control treated GM00305 shows two RT-PCR products representing the transcripts of both the mutant (expanded disease) allele and the normal allele, while analysis of PAFC1 cells shows one RT-PCR products representing the transcripts of both normal alleles. PS262 shows a more efficient inhibition of the mutant transcript in GM00305 than the normal transcript in GM00305 or PAFC1.
  • [0074]
    FIG. 4.
  • [0075]
    The levels of RT-PCR products (from experiments also depicted in FIGS. 2 and 3) was determined for the mutant transcript as a ratio to the normal transcript and expressed as percentage of control treatment (which was set to 100%). The figure depicts concentration dependent decrease of the mutant-to-normal allele transcript in GM00305 cells after treatment with PS262 (squares), PS57 (circles) and PS261 (triangles) at different concentrations.
  • [0076]
    FIG. 5.
  • [0077]
    RT-PCR analysis was performed on GM00305 fibroblasts from a male patient with Huntington's Disease after a 4 h treatment with oligonucleotide PS57. Cells were harvested at 24 h (circles) or 48 h (diamonds) after the start of treatment. The levels of RT-PCR products was determined for the mutant transcript as a ratio to the normal transcript and expressed as percentage of control treatment (which was set to 100%). The figure depicts concentration dependent decrease of the mutant-to-normal allele transcript at 24 h (circles) or 48 h (diamonds) after the start of a 4 h treatment period with PS57.
  • [0078]
    FIG. 6.
  • [0079]
    RT-PCR analysis is presented from GM00305 fibroblast cells from a male patient with Huntington's Disease after treatment with oligonucleotide PS278 or PS277 or control. PS278 and PS277 are both gapmers (chimera's comprising 2′O-methyl substitutions only on the 3′ and 5′ end of the oligonucleotides) in prinicple capable of activating RNAseH upon binding to target mRNA. PS277 contains a single mismatch. Analysis of GM00305 shows two RT-PCR products representing the transcripts derived from the mutant (expanded disease) allele and the normal allele.
  • [0080]
    FIG. 7.
  • [0081]
    The levels of RT-PCR products (from experiments also depicted in FIGS. 2 and 6) in GM00305 was determined for the mutant transcript as a ratio to the normal transcript and expressed as percentage of control treatment (which was set to 100%). The figure depicts concentration dependent decrease of the mutant-to-normal allele transcript after treatment with 50 nM of PS57 (closed), PS278 (stippled column) and PS261 (striped column).
  • [0082]
    FIG. 8 shows the hDMPK mRNA levels (solid bars) in DM500 myotubes after treatment with 200 nM oligonucleotide PS259 (with an alternative starting nucleotide) or 200 nM oligonucleotide PS261 (comprising inosine (I) nucleotides instead of adenosine(A)). The expression of hDMPK was quantified via Northern blot analysis followed by phosphoimager analysis. The signal was normalised to the GAPDH signal and expressed relative to the response after mock treatment. Treatment with PS259 or PS261 resulted in decrease hDMPK mRNA levels. Solid bars depict hDMPK and open bars depict m (murine) DMPK; mDMPK does not contain a triplet nucleotide repeat region.
  • [0083]
    FIG. 9. shows the hDMPK mRNA levels in DM500 myotubes after treatment with double stranded siRNA oligonucleotide combinations PI-01 or PI-02 after transfection with PEI (200 nM oligonucleotide) or alternatively with lipofectamine2000 (50 nM oligonucleotide). The hDMPK signal after treatment has been depicted in FIG. 8 showing a lack of inhibition by the siRNA oligonucleotides compared to PS58. The expression of hDMPK was quantified via Northern blot analysis followed by phosphoimager analysis. The signal was normalised to the GAPDH signal and expressed relative to the response after mock treatment. Treatment with PI-01 or PI-02, both directed exclusively to the repetive repeat sequence, did not resulted in a decrease hDMPK mRNA levels compared to effective oligonucleotide PS58.
  • EXAMPLES Example 1
  • [0084]
    Immortomyoblast cell lines were derived from DM500 mice using standard techniques known to the skilled person. DM500 mice were derived from mice obtained from de Gourdon group in Paris. Immortomyoblast cell lines DM500 with variable (CTG)n repeat length of approximately 500 in the DMPK gene were grown subconfluent and maintained in a 5% CO2 atmosphere at 33° C. on 0.1% gelatin coated dishes. Myoblast cells were grown subconfluent in DMEM supplemented with 20% FCS, 50 μg/ml gentamycin and 20 units of γ-interferon/ml. Myotube formation was induced by growing myoblast cells on Matrigel (BD Biosciences) coated dishes and placing a confluent myoblast culture at 37° C. and in DMEM supplemented with 5% horse serum and 50 μg/ml gentamycin. After five days on this low serum media contracting myotubes arose in culture and were transfected with the desired oligonucleotides. For transfection NaCl (500 mM, filter sterile), oligonucleotide and transfection reagens PEI (ExGen 500, Fermentas) were added in this specific order and directly mixed. The oligonucleotide transfection solution contained a ratio of 5 μl ExGen500 per ug oligonucleotide which is according to the instructions (ExGen 500, Fermentas). After 15 minutes of incubation at room temperature the oligonucleotide transfection solution was added to the low serum medium with the cultured myotubes and gently mixed. The final oligonucleotide concentration ranged from 10 pM to 600 nM. Mock control treatment is carried out with transfection solution without an oligonucleotide. After four hours of incubation at 37° C., fresh medium was added to the culture (resulting in a dilution of approximately 2.3×) and incubation was extended overnight at 37° C. The next day the medium containing the oligonucleotide was removed and fresh low serum medium was added to the myotubes which were kept in culture at 37° C. for another day. Fourty eight hours after the addition of oligonucleotide to the myotube culture (which is seven days after switching to low serum conditions to induced myotube formation), RNA was isolated with the “Total RNA mini kit” (Bio-Rad) and prepared for Northern blot and RT-PCR analysis. The Northern blot was hybridized with a radioactive human DMPK (hDMPK) probe and a mouse GAPDH probe. The probe used for DMPK is a human DMPK cDNA consisting of the DMPK open reading frame with full 3′ UTR and 11 CTGs.
  • [0085]
    The human and mouse DMPK signal were quantified by phosphoimager analysis and normalized to the GAPDH signal.
  • [0086]
    FIG. 1 depicts the concentration dependent inhibition of the hDMPK signal of oligonucleotide PS58 and PS142. PS58, a fully modified 2′O-methyl phosphorothioate oligonucleotide unable to activate RNAseH after binding to the target mRNA, was effective at approximately 3000× fold lower concentration than the DNA phosphorothioate oligonucleotide PS142.
  • Example 2
  • [0087]
    Fibroblasts (GM 00305) from a male patient with Huntington's Disease were obtained from Coriell Cell Repository (Camden, N.J., US) and cultured according to the accompanying instructions and standard techniques known to the skilled person in the art. Huntington patients carry one healthy and one disease-causing allele of the Huntington gene resulting in the expression of both mRNAs with respectively a normal number and an expanded number of (CAG) repeats, respectively. Control fibroblasts (PAFC1) were obtained from a healthy volunteer with normal repeat length in both huntingtin alleles.
  • [0088]
    The fibroblasts were transfected with oligonucleotides PS57, PS261, PS262, PS277 and PS278, all directed to the complementary (CAG) triplet repeat in Huntingtin transcripts. A transfection was applied at several concentration levels using PEI as indicated by the manufacturer. Four hours after the start of treatment, the cells were washed and fresh medium was applied. Twenty four hours or eighty four hours after the start of transfection, the cells were harvested and total RNA was isolated and analysed by RT-PCR. Reversed transcription was carried out at 55° C. using random hexamers.
  • [0089]
    The Huntingtin transcript was determined using primers flanking the repeat expansion region in exon 1 (Forward: 5′ ATGGCGACCCTGGAAAAGCTG 3′ and 5′ TGAGGCAGCAGCGGCTGT 3′). This method detects both types of Huntington mRNAs, the normal and also the mutant transcript with the additional (CAG) expansion which can be seperately analyzed on a 2% agarose gels for qualitative evaluation or for quantification on the Agilent 2100 Bioanalyzer or Caliper LabChip90. The quantitative results for the RT-PCR product for the mutant transcript are expressed relative to those of for the normal transcript and expressed as percentage from the vehicle control treatment (without oligonucleotide) from the same patient fibroblasts (which was set to 100%).
  • [0090]
    The results of the experiments are depicted in FIGS. 2-7. FIGS. 1 to 3 show that three different oligonucleotides, (CUG)7, (UCG)7 or (CIG)7, which are all directed to specifically to the repeat sequence, can efficiently inhibit the mutant huntingtin transcripts with the expanded (CAG) repeat. These compounds are more effective against the mutant huntingtin transcript with a high number of disease causing (CAG) repeats than the normal transcript carrying a lower number of (CAG) repeats. This is demonstrated in the GM00305 cells derived from a Huntigton patient, but also confirmed in a control cell from a healthy volunteer (PAFC1). The PCR products were confirmed by sequencing. FIG. 5 shows that the effect is not only present at 24 h after a 4 h treatment period but also after 48 h. This latter time point appears to be more optimal than 24 h as a clear inhibition starts already at a lower concentration. These results indicate that the effect will probably be maintained over a much longer period, despite a short 4 h treatment period.
  • [0091]
    Finally, FIGS. 7 and 8 depicts the results of two chimeric olignucleotides. The nucleotides at the 3′ and 5′ end of the oligonucleotide have been modified with a 2′O-methyl substitution, but not the 10 nucleotides in the centre, resulting in a so-called gapmer. To a skilled person, a 2′O-methyl substitution (or the use of other modifications including 2′O-methoxy ethyl or locked nucleic acides) is known to limit RNAseH mediated breakdown after binding to the target mRNA. Such RNAseH mediated breakdown mechanism as a means of mRNA inhibition can be preserved by maintaining a stretch of (phosphorothioate) DNA nucleotides in the oligonucleotide (“the gap”). The results in FIGS. 7 and 8 however clearly indicate that the fully modified PS57 oligonucleotide is much more effective, effectively inhibiting the mutant HD transcript levels at the employed concentrations with equivocal or no inhibition by oligonucleotides PS278 or PS277.
  • Example 3
  • [0092]
    According to the methods described in example 1, myotubes derived from DM500 cells were treated with 200 nM oligonucleotide PS259 (with an alternative starting nucleotide compared to PS58) or 200 nM oligonucleotide PS261 (comprising inosine (I) nucleotides instead of adenosine(A)). The hDMPK signal (solid bars) after treatment has been depicted in FIG. 8 demonstrating effective inhibition by the oligonucleotides.
  • Example 4
  • [0093]
    According to the methods described in example 1, myotubes derived from DM500 cells were treated with double stranded siRNA oligonucleotide combinations PI-01 or PI-02 after transfection with PEI (200 nM oligonucleotide) or alternatively with lipofectamine200° (according to instructions of the manufacturer with 50 nM oligonucleotide). Oligonucleotide combinations (siRNA) PI-01 or PI-02 are complementary to the repetitive sequence only. The transfection protocol was performed twice during the treatment incubation period. The hDMPK signal after treatment has been depicted in FIG. 8 showing a lack of inhibition by the siRNA oligonucleotides compared to PS58.
  • [0000]
    TABLE 1 
    Overview oligonucleotides employed 
    in the examples
    Oligo Backbone
    name Modification Sequence
    PS57 2′OMe RNA CUGCUGCUGCUGCUGCUGCUG
    phosphorothioate
    (with or without
    fluorescent 
    FAM label)
    PS58 2′OMe RNA CAGCAGCAGCAGCAGCAGCAG
    phosphorothioate
    (with or without
    fluorescent
    FAM label)
    PS142 DNA CAGCAGCAGCAGCAGCAGCAG
    phosphorothioate
    PS259 2′OMe RNA ACGACGACGACGACGACGACG
    phosphorothioate
    PS261 2′OMe RNA CIGCIGCIGCIGCIGCIGCIG
    phosphorothioate
    PS262 2′OMe RNA UCGUCGUCGUCGUCGUCGUCG
    phosphorothioate
    PS277 Capitals: 2′OMe RNA Gapmer:
    phosphorothioate CUGCUgctgttgctgCUGCU
    Lower case: DNA 
    phosphorothioate
    PS278 Capitals: 2′OMe RNA Gapmer:
    phosphorothioate CUGCUgctgctgctgCUGCU
    Lower case: DNA 
    phosphorothioate
    PI-01 Double stranded RNA 5′-CAGCAGCAGCAGCAGCA
    (siRNA) GCAG-3′
    3′-UCGUCGUCGUCGUCGUC
    GUCG-5′C
    PI-02 Double stranded RNA 5′-GCAGCAGCAGCAGCAGC
    (siRNA) AGCA-3′
    3′-GUCGUCGUCGUCGUCGU
    CGUC-5′C
  • [0000]
    TABLE 2
    preferred oligonucleotides containing
    inosine and/or an uracile
    (i.e. a nucleotide containing a base 
    able to form a wobble base pair)
    repeat C A G C A G
    oligo G U C G U C 5′*
    G U U G U U 5′
    G I C G I C 5′
    G I U G I U 5′
    I U C I U C 5′
    I U U I U U 5′
    I I C I I C 5′
    I I U I I U 5′
    repeat C U G C U G
    oligo G A C G A C 5′
    G A U G A U 5′
    G I C G I C 5′
    G I U G I U 5′
    I A C I A C 5′
    I A U I A U 5′
    I I C I I C 5′
    I I U I I U 5′
    repeat C G G C G G
    oligo G C C G C C 5′
    G C U G C U 5′
    G U C G U C 5′
    G U U G U U 5′
    I C C I C C 5′
    I C U I C U 5′
    I U C I U C 5′
    I U U I U U 5′
    repeat G C G G C G
    oligo C G C C G C 5′
    C G U C G U 5′
    C I C C I C 5′
    C I U C I U 5′
    U G C U G C 5′
    U G U U G U 5′
    U I C U I C 5′
    U I U U I U 5′
    repeat G A A G A A
    oligo  C U U C U U 5′
    C U I C U I 5′
    C I U C I U 5′
    C I I C I I 5′
    U U U U U U 5′
    U U I U U I 5′
    U I U U I U 5′
    U I I U I I 5′
    repeat G C C G C C
    oligo C G G C G G 5′
    C G I C G I 5′
    C I G C I G 5′
    C I I C I I 5′
    U G G U G G 5′
    U G I U G I 5′
    U I G U I G 5′
    U I I U I I 5′
    repeat C C U G C C U G
    oligo G G A C G G A C 5′
    G G A U G G A U 5′
    G G I C G G I C 5′
    G G I U G G I U 5′
    G I A C G I A C 5′
    G I A U G I A U 5′
    G I I C G I I C 5′
    G I I U G I I U 5′
    I G A C I G A C 5′
    I G A U I G A U 5′
    I G I C I G I C 5′
    I G I U I G I U 5′
    I I A C I I A C 5′
    I I A U I I A U 5′
    I I I C I I I C 5′
    I I I U I I I U 5′
    *all the oligonucleotide sequences as given in these tables are to be read from right to left.

Claims (17)

  1. 1. Use of an oligonucleotide comprising an inosine and/or an uracile and/or a nucleotide containing a base able to form a wobble base pair, said oligonucleotide comprising or consisting of a sequence that is complementary only to a repetitive sequence in a gene transcript for the manufacture of a medicament for the treatment or prevention of human cis-element repeat instability associated genetic disorders.
  2. 2. A use according to claim 1, wherein the inosine and/or an uracile and/or a nucleotide containing a base able to form a wobble base pair containing oligonucleotide is a single stranded oligonucleotide.
  3. 3. A use according to claim 1 or 2, wherein the repetitive element is present in a coding or in a non-coding sequence of the gene transcript.
  4. 4. A use according to any of the preceding claims wherein the oligonucleotide comprises or consists of a sequence that is complementary to a repetitive element selected from (CAG)n, (GCG)n, (CUG)n, (CGG)n, (CCG)n, (GAA)n, (GCC)n and (CCUG)n.
  5. 5. A use according to any of the preceding claims wherein the oligonucleotide has a length of about 9 to about 50 nucleotides, preferably 12 to 40 nucleotides, more preferably 15 to 30.
  6. 6. A use according to any of the preceding claims, wherein the oligonucleotide comprises or consists of RNA nucleotides, DNA nucleotides, locked nucleic acid (LNA) nucleotides, peptide nucleic acid (PNA) nucleotides, morpholino phosphorodiamidates, ethylene-bridged nucleic acid (ENA) nucleotides or mixtures thereof with or without a phosphorothioate containing backbone.
  7. 7. A use according to claim 6, wherein the oligonucleotide comprises 2′-O— substituted RNA phosphorothioate nucleotides, preferably wherein the 2′-O-substitution is a methoxy ethyl and/or methyl and/or 2′O,4′C methylene bridge (LNA) and/or 2′O, 4′C constrained ethylene (cEt) and/or 2′O, 4′C constrained methoxyethylene (cMOEt).
  8. 8. A use preferably according any of the preceding claims wherein the oligonucleotide comprises or consists of a sequence that is complementary only to a repetitive sequence in a gene transcript for the manufacture of a medicament for the treatment or prevention of human cis-element repeat instability associated genetic disorders and wherein the oligonucleotide is a RNAse H substantially independent oligonucleotide and preferably wherein the oligonucleotide has a length of 9 to 50 nucleotides, is substituted as defined in claim 6 in at least one of its 5′ or 3′ end and comprises less than 9, more preferably less than 6 consecutive deoxyriboses in the rest of its sequence.
  9. 9. A use according to claim 8, wherein the oligonucleotide comprises no deoxyribose and the backbone is fully modified as defined in claim 6.
  10. 10. A use according to any of the preceding claims wherein the oligonucleotide in the medicament is provided by a nucleic acid vector capable of conferring expression of the oligonucleotide and/or wherein the oligonucleotide in the medicament is provided with at least an excipient and/or targeting ligand for delivery of the oligonucleotide to cells and/or enhancing its intracellular delivery.
  11. 11. An oligonucleotide comprising an inosine and/or an uracile and/or a nucleotide containing a base able to form a wobble base pair, wherein said oligonucleotide comprises or consists of a sequence that is complementary to a repetitive sequence selected from the group consisting of (CAG)n, (GCG)n, (CUG)n, (CGG)n, (GAA)n, (GCC)n and (CCUG)n, and has a length of 9 to 50 nucleotides.
  12. 12. An oligonucleotide preferably according to claim 11, comprising or consisting of a sequence that is complementary to a repetitive sequence selected from the group consisting of (CAG)n, (GCG)n, (CUG)n, (CGG)n, (GAA)n, (GCC)n and (CCUG)n, having a length of 9 to 50 nucleotides and wherein the oligonucleotide is a RNAse H substantially independent oligonucleotide.
  13. 13. An oligonucleotide according to claim 11 or 12 and further as defined in any one of claims 1 to 10 and which is preferably provided with a radioactive label or fluorescent label.
  14. 14. A pharmaceutically acceptable composition comprising an oligonucleotide as defined in any of claims 11 to 13 and preferably further comprising at least one excipient and/or targeting ligand for delivery of the oligonucleotide to the cell and/or enhancing its intracellular delivery.
  15. 15. A nucleic acid vector, preferably a viral vector, capable of conferring expression of an oligonucleotide as defined in any of claims 11 to 13 in human cells.
  16. 16. An in vitro method for the reduction of repeat containing gene transcripts in a cell comprising the administration of an oligonucleotide as defined in any one of claims 11 to 13 or a pharmaceutically acceptable composition as defined in claim 14, or a nucleic acid vector as defined in claim 15.
  17. 17. In vitro or ex vivo detection and/or diagnostic method wherein the oligonucleotide according to any of claims 11 to 13 is used.
US12852057 2008-02-08 2010-08-06 Methods and means for treating DNA repeat instability associated genetic disorders Active US8263760B2 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
EP08151228 2008-02-08
EP08151228 2008-02-08
EP08151228.7 2008-02-08
PCT/NL2009/050049 WO2009099326A1 (en) 2008-02-08 2009-02-05 Methods and means for treating dna repeat instability associated genetic disorders

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
PCT/NL2009/050049 Continuation WO2009099326A1 (en) 2008-02-08 2009-02-05 Methods and means for treating dna repeat instability associated genetic disorders

Publications (2)

Publication Number Publication Date
US20110184050A1 true true US20110184050A1 (en) 2011-07-28
US8263760B2 US8263760B2 (en) 2012-09-11

Family

ID=39761095

Family Applications (1)

Application Number Title Priority Date Filing Date
US12852057 Active US8263760B2 (en) 2008-02-08 2010-08-06 Methods and means for treating DNA repeat instability associated genetic disorders

Country Status (6)

Country Link
US (1) US8263760B2 (en)
EP (1) EP2249874A1 (en)
JP (1) JP2011510678A (en)
CN (1) CN101980726A (en)
CA (1) CA2714120A1 (en)
WO (1) WO2009099326A1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015023937A1 (en) * 2013-08-16 2015-02-19 Rana Therapeutics, Inc. Heterochromatin forming non-coding rnas
US20150148404A1 (en) * 2012-04-23 2015-05-28 Prosensa Technologies B.V. RNA Modulating Oligonucleotides with Improved Characteristics for the Treatment of Neuromuscular Disorders

Families Citing this family (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9181551B2 (en) 2002-02-20 2015-11-10 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US9657294B2 (en) 2002-02-20 2017-05-23 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
CA2660523A1 (en) 2006-08-11 2008-02-14 Prosensa Technologies B.V. Methods and means for treating dna repeat instability associated genetic disorders
ES2639852T3 (en) 2007-10-26 2017-10-30 Academisch Ziekenhuis Leiden Means and methods to counter muscle disorders
EP2119783A1 (en) 2008-05-14 2009-11-18 Prosensa Technologies B.V. Method for efficient exon (44) skipping in Duchenne Muscular Dystrophy and associated means
EP2473623B1 (en) * 2009-08-31 2015-07-08 Centre National de la Recherche Scientifique (CNRS) Purification process of nascent dna
WO2011103528A3 (en) * 2010-02-22 2012-01-19 Opko Curna Llc Treatment of pyrroline-5-carboxylate reductase 1 (pycr1) related diseases by inhibition of natural antisense transcript to pycr1
JP6059141B2 (en) 2010-07-19 2017-01-11 アイオーニス ファーマシューティカルズ, インコーポレーテッドIonis Pharmaceuticals,Inc. Regulation of the nuclear anchoring rna
CN107267517A (en) 2011-04-22 2017-10-20 比奥马林技术公司 New compounds for treating, delaying and/or preventing a human genetic disorder such as myotonic dystrophy type 1 (DM1)
EP2841579A1 (en) 2012-04-25 2015-03-04 Regulus Therapeutics Inc Microrna compounds and methods for modulating mir-21 activity
CA2885605A1 (en) 2012-10-09 2014-04-17 Regulus Therapeutics Inc. Methods for treatment of alport syndrome
WO2017060317A1 (en) * 2015-10-05 2017-04-13 Proqr Therapeutics Ii B.V. Use of single-stranded antisense oligonucleotide in prevention or treatment of genetic diseases involving a trinucleotide repeat expansion

Citations (60)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5034506A (en) * 1985-03-15 1991-07-23 Anti-Gene Development Group Uncharged morpholino-based polymers having achiral intersubunit linkages
US5418139A (en) * 1993-02-10 1995-05-23 University Of Iowa Research Foundation Method for screening for cardiomyopathy
US5541308A (en) * 1986-11-24 1996-07-30 Gen-Probe Incorporated Nucleic acid probes for detection and/or quantitation of non-viral organisms
US5593974A (en) * 1991-06-28 1997-01-14 Massachusetts Institute Of Technology Localized oligonucleotide therapy
US5608046A (en) * 1990-07-27 1997-03-04 Isis Pharmaceuticals, Inc. Conjugated 4'-desmethyl nucleoside analog compounds
US5627263A (en) * 1993-11-24 1997-05-06 La Jolla Cancer Research Foundation Integrin-binding peptides
US5658764A (en) * 1992-01-28 1997-08-19 North Shore University Hospital Research Corp. Method and kits for detection of fragile X specific, GC-rich DNA sequences
US5741645A (en) * 1993-06-29 1998-04-21 Regents Of The University Of Minnesota Gene sequence for spinocerebellar ataxia type 1 and method for diagnosis
US5766847A (en) * 1988-10-11 1998-06-16 Max-Planck-Gesellschaft Zur Forderung Der Wissenschaften E.V. Process for analyzing length polymorphisms in DNA regions
US5853995A (en) * 1997-01-07 1998-12-29 Research Development Foundation Large scale genotyping of diseases and a diagnostic test for spinocerebellar ataxia type 6
US5869252A (en) * 1992-03-31 1999-02-09 Abbott Laboratories Method of multiplex ligase chain reaction
US5962332A (en) * 1994-03-17 1999-10-05 University Of Massachusetts Detection of trinucleotide repeats by in situ hybridization
US5968909A (en) * 1995-08-04 1999-10-19 Hybridon, Inc. Method of modulating gene expression with reduced immunostimulatory response
US6124100A (en) * 1998-02-26 2000-09-26 Samsung Fine Chemicals Co. Ltd. Diagnostic method and kit for neuropsychiatric diseases using trinucleotide repeats sequence
US6130207A (en) * 1997-11-05 2000-10-10 South Alabama Medical Science Foundation Cell-specific molecule and method for importing DNA into a nucleus
US6133031A (en) * 1999-08-19 2000-10-17 Isis Pharmaceuticals Inc. Antisense inhibition of focal adhesion kinase expression
US6172216B1 (en) * 1998-10-07 2001-01-09 Isis Pharmaceuticals Inc. Antisense modulation of BCL-X expression
US6251589B1 (en) * 1996-07-18 2001-06-26 Srl, Inc. Method for diagnosing spinocerebellar ataxia type 2 and primers therefor
US6280938B1 (en) * 1997-08-19 2001-08-28 Regents Of The University Of Minnesota SCA7 gene and method of use
US6300060B1 (en) * 1995-11-09 2001-10-09 Dana-Farber Cancer Institute, Inc. Method for predicting the risk of prostate cancer morbidity and mortality
US6322978B1 (en) * 1998-04-20 2001-11-27 Joslin Diabetes Center, Inc. Repeat polymorphism in the frataxin gene and uses therefore
US6329501B1 (en) * 1997-05-29 2001-12-11 Auburn University Methods and compositions for targeting compounds to muscle
US20010056077A1 (en) * 1999-05-21 2001-12-27 Jcr Pharmaceuticals Co., Ltd Pharmaceutical composition for treatment of duchenne muscular dystrophy
US6355690B1 (en) * 1998-01-26 2002-03-12 Niigata University Remedy for CAG repeat expansion diseases
US6355481B1 (en) * 1999-06-18 2002-03-12 Emory University Hybridoma cell line and monoclonal antibody for huntingtin protein
US6369038B1 (en) * 1991-04-25 2002-04-09 Genset Closed antisense and sense oligonucleotides and their applications
US20020049173A1 (en) * 1999-03-26 2002-04-25 Bennett C. Frank Alteration of cellular behavior by antisense modulation of mRNA processing
US6379698B1 (en) * 1999-04-06 2002-04-30 Isis Pharmaceuticals, Inc. Fusogenic lipids and vesicles
US20020055481A1 (en) * 2000-08-25 2002-05-09 Jcr Pharmaceuticals Co., Ltd. Pharmaceutical composition for treatment of Duchenne muscular dystrophy
US6399575B1 (en) * 1998-11-10 2002-06-04 Auburn University Methods and compositions for targeting compounds to the central nervous system
US20020115824A1 (en) * 2000-11-30 2002-08-22 Engler Jeffrey A. Receptor-mediated uptake of peptides that bind the human transferrin receptor
US20020165150A1 (en) * 1998-09-25 2002-11-07 Children's Medical Center Corporation Tissue remodeling
US6514755B1 (en) * 1998-08-18 2003-02-04 Regents Of The University Of Minnesota SCA7 gene and methods of use
US20030073215A1 (en) * 1997-03-31 2003-04-17 Genentech, Inc. Secreted and transmembrane polypeptides and nucleic acids encoding the same
US20030109476A1 (en) * 2001-08-07 2003-06-12 Kmiec Eric B. Compositions and methods for the prevention and treatment of Huntington's disease
US20030124523A1 (en) * 2000-06-22 2003-07-03 Asselbergs Fredericus Alphonsus Maria Organic compounds
US20030134790A1 (en) * 2002-01-11 2003-07-17 University Of Medicine And Dentistry Of New Jersey Bone Morphogenetic Protein-2 And Bone Morphogenetic Protein-4 In The Treatment And Diagnosis Of Cancer
US6623927B1 (en) * 2000-11-08 2003-09-23 Council Of Scientific And Industrial Research Method of detection of allelic variants of SCA2 gene
US6653467B1 (en) * 2000-04-26 2003-11-25 Jcr Pharmaceutical Co., Ltd. Medicament for treatment of Duchenne muscular dystrophy
US20030235845A1 (en) * 2000-09-21 2003-12-25 Van Ommen Garrit-Jan Boudewijn Induction of exon skipping in eukaryotic cells
US20030236214A1 (en) * 1999-06-09 2003-12-25 Wolff Jon A. Charge reversal of polyion complexes and treatment of peripheral occlusive disease
US6670461B1 (en) * 1997-09-12 2003-12-30 Exiqon A/S Oligonucleotide analogues
US20040101852A1 (en) * 2002-11-21 2004-05-27 Isis Pharmaceuticals Inc. Modulation of CGG triplet repeat binding protein 1 expression
US6794192B2 (en) * 2000-06-29 2004-09-21 Pfizer Inc. Target
US20040226056A1 (en) * 1998-12-22 2004-11-11 Myriad Genetics, Incorporated Compositions and methods for treating neurological disorders and diseases
US20050096284A1 (en) * 2002-02-20 2005-05-05 Sirna Therapeutics, Inc. RNA interference mediated treatment of polyglutamine (polyQ) repeat expansion diseases using short interfering nucleic acid (siNA)
US6902896B2 (en) * 2001-05-11 2005-06-07 Regents Of The University Of Minnesota Intron associated with myotonic dystrophy type 2 and methods of use
US20050222009A1 (en) * 2003-10-14 2005-10-06 Itschak Lamensdorf Dual phase - PNA conjugates for the delivery of PNA through the blood brain barrier
US20050246794A1 (en) * 2002-11-14 2005-11-03 Dharmacon Inc. Functional and hyperfunctional siRNA
US20050277133A1 (en) * 2001-05-18 2005-12-15 Sirna Therapeutics, Inc. RNA interference mediated treatment of polyglutamine (polyQ) repeat expansion diseases using short interfering nucleic acid (siNA)
US6982150B2 (en) * 2002-02-11 2006-01-03 Sheetz Michael P System and method for identifying proteins involved in force-initiated signal transduction
US20060074034A1 (en) * 2001-09-17 2006-04-06 Collins Douglas A Cobalamin mediated delivery of nucleic acids, analogs and derivatives thereof
US20060148740A1 (en) * 2005-01-05 2006-07-06 Prosensa B.V. Mannose-6-phosphate receptor mediated gene transfer into muscle cells
US7189530B2 (en) * 1998-09-01 2007-03-13 Genentech, Inc. Secreted and transmembrane polypeptides and nucleic acids encoding the same
US7202210B2 (en) * 2001-02-08 2007-04-10 Wyeth Modified and stabilized GDF propeptides and uses thereof
US20070082861A1 (en) * 2002-11-25 2007-04-12 Masafumi Matsuo Ena nucleic acid drugs modifying splicing in mrna precursor
US7250404B2 (en) * 1989-03-21 2007-07-31 Vical Incorporated Lipid-mediated polynucleotide administration to deliver a biologically active peptide and to induce a cellular immune response
US20070275914A1 (en) * 2003-03-07 2007-11-29 Muthiah Manoharan Therapeutic Compositions
US20070292408A1 (en) * 2004-12-03 2007-12-20 University Of Massachusetts Spinal Muscular Atrophy (SMA) treatment via targeting of SMN2 splice site inhibitory sequences
US20080015158A1 (en) * 2003-05-14 2008-01-17 Kanazawa Ichiro Inhibition of the Expression of Huntingtin Gene

Family Cites Families (43)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE3834636C2 (en) 1988-10-11 1992-02-20 Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften Ev, 3400 Goettingen, De
WO1993001286A3 (en) 1991-06-28 1993-04-01 Massachusetts Inst Technology Localized oligonucleotide therapy
CA2116280A1 (en) 1993-03-05 1994-09-06 Marcy E. Macdonald Huntingtin dna, protein and uses thereof
DE4342605A1 (en) 1993-12-14 1995-06-22 Buna Gmbh Functionalized olefin homopolymers and copolymers
WO1995030774A1 (en) * 1994-05-05 1995-11-16 Beckman Instruments, Inc. Oligonucleotide repeat arrays
US5854223A (en) 1995-10-06 1998-12-29 The Trustees Of Columbia University In The City Of New York S-DC28 as an antirestenosis agent after balloon injury
CN1214688A (en) 1996-02-14 1999-04-21 伊希斯药物有限公司 Sugar-modified gapped oligonucleotides
WO1998018920A1 (en) 1996-10-30 1998-05-07 Srl, Inc. cDNA FRAGMENTS OF GENE CAUSATIVE OF SPINOCEREBELLAR ATAXIA TYPE 2
WO1998049345A1 (en) 1997-04-29 1998-11-05 Trustees Of Boston University Methods and compositions for targeted dna differential display
EP1133993A1 (en) 2000-03-10 2001-09-19 Yvonne Hofmann Substances for the treatment of spinal muscular atrophy
US20020187931A1 (en) 2000-04-13 2002-12-12 Michael Hayden Modulating cell survival by modulating huntingtin function
DE60139394D1 (en) 2000-04-28 2009-09-10 Asklepios Biopharmaceutical In For the dystrophin minigene coding DNA sequences and methods for their use
WO2001085751A1 (en) 2000-05-09 2001-11-15 Reliable Biopharmaceutical, Inc. Polymeric compounds useful as prodrugs
CN1326990A (en) 2000-06-07 2001-12-19 上海博德基因开发有限公司 New polypeptide-human DNA-like CGG repeative conjugated protein 16.17 and polynucleotide for encoding such polypeptide
RU2165149C1 (en) 2000-07-03 2001-04-20 Шапошников Валерий Геннадьевич "sugar wool" products forming and packaging method
US6869777B2 (en) 2000-10-06 2005-03-22 Regents Of The University Of Michigan Mini-dystrophin nucleic acid sequences
EP1627061B1 (en) 2001-05-18 2009-08-12 Sirna Therapeutics, Inc. RNA INTERFERENCE MEDIATED INHIBITION OF GENE EXPRESSION USING CHEMICALLY MODIFIED SHORT INTERFERING NUCLEIC ACID (siNA)
WO2005105995A3 (en) 2004-04-14 2005-12-29 James Mcswiggen RNA INTERFERENCE MEDIATED TREATMENT OF POLYGLUTAMINE (POLYQ) REPEAT EXPANSION DISEASES USING SHORT INTERFERING NUCLEIC ACID (siNA)
KR20030035047A (en) 2001-10-29 2003-05-09 (주)바이오코돈 Use of BMP-4 gene and its gene product for treatment and diagnosis of Lichen Planus
CN1649625A (en) 2002-03-01 2005-08-03 图兰恩教育基金管理人 Conjugates of therapeutic or cytotoxic agents and biologically active peptides
EP1501931B1 (en) 2002-05-08 2009-11-18 Universita' Degli Studi Di Roma "La Sapienza" Chimeric snrna molecules carrying antisense sequences against the splice junctions of the dystrophin gene and their therapeutic applications
EP1380644A1 (en) 2002-07-08 2004-01-14 Kylix B.V. The use of specified TCF target genes to identify drugs for the treatment of cancer, in particular colorectal cancer, in which TCF/beta-catenin/WNT signalling plays a central role
US7589059B2 (en) 2002-07-26 2009-09-15 Roche Madison Inc. Delivery of molecules and complexes to mammalian cells in vivo
US20050255086A1 (en) * 2002-08-05 2005-11-17 Davidson Beverly L Nucleic acid silencing of Huntington's Disease gene
CA2596588C (en) * 2005-01-31 2017-06-27 University Of Iowa Research Foundation Nucleic acid silencing of huntington's disease gene
US20060058253A1 (en) 2002-08-12 2006-03-16 Benoit Chabot Methods to reprogram splice site selection in pre-messenger rnas
GB0219143D0 (en) 2002-08-16 2002-09-25 Univ Leicester Modified tailed oligonucleotides
US7892793B2 (en) * 2002-11-04 2011-02-22 University Of Massachusetts Allele-specific RNA interference
GB0228079D0 (en) 2002-12-02 2003-01-08 Laxdale Ltd Huntington's Disease
CA2524255C (en) 2003-03-21 2014-02-11 Academisch Ziekenhuis Leiden Modulation of exon recognition in pre-mrna by interfering with the secondary rna structure
JP5110877B2 (en) 2003-06-02 2012-12-26 ワイス・エルエルシー For the treatment of neuromuscular disorders, myostatin in combination with corticosteroids (gdf8) use of inhibitors
ES2302898T3 (en) 2003-07-11 2008-08-01 Lbr Medbiotech B.V. Gene transfer to muscle cells mediated by receptor mannose 6-phosphate.
US20050191636A1 (en) 2004-03-01 2005-09-01 Biocept, Inc. Detection of STRP, such as fragile X syndrome
JPWO2005116204A1 (en) 2004-05-11 2008-06-19 株式会社アルファジェン Polynucleotide causing Rna interference, and the gene silencing method using the same
EP1766010B1 (en) 2004-06-28 2011-02-16 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
EP1618881A1 (en) 2004-07-20 2006-01-25 Santhera Pharmaceuticals (Schweiz) GmbH Use of non-glucocorticoid steroids for the treatment of muscular dystrophy
WO2006054262A3 (en) 2004-11-18 2006-10-05 Univ Roma Use of phage display technique for identifying peptides capable of binding progenitor/stem cells, peptides thereby obtained and uses thereof
WO2006121960B1 (en) 2005-05-06 2007-04-12 Medtronic Inc Methods and sequences to suppress primate huntington gene expression
EP1896586A2 (en) 2005-06-28 2008-03-12 Medtronic, Inc. Methods and sequences to preferentially suppress expression of mutated huntingtin
EP2422819B1 (en) 2006-01-26 2017-03-01 Ionis Pharmaceuticals, Inc. Compositions and their uses directed to Huntingtin
EP1857548A1 (en) 2006-05-19 2007-11-21 Academisch Ziekenhuis Leiden Means and method for inducing exon-skipping
US7855053B2 (en) 2006-07-19 2010-12-21 The Regents Of The University Of California Methods for detecting the presence of expanded CGG repeats in the FMR1 gene 5′ untranslated region
CA2660523A1 (en) * 2006-08-11 2008-02-14 Prosensa Technologies B.V. Methods and means for treating dna repeat instability associated genetic disorders

Patent Citations (64)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5034506A (en) * 1985-03-15 1991-07-23 Anti-Gene Development Group Uncharged morpholino-based polymers having achiral intersubunit linkages
US5541308A (en) * 1986-11-24 1996-07-30 Gen-Probe Incorporated Nucleic acid probes for detection and/or quantitation of non-viral organisms
US5766847A (en) * 1988-10-11 1998-06-16 Max-Planck-Gesellschaft Zur Forderung Der Wissenschaften E.V. Process for analyzing length polymorphisms in DNA regions
US7250404B2 (en) * 1989-03-21 2007-07-31 Vical Incorporated Lipid-mediated polynucleotide administration to deliver a biologically active peptide and to induce a cellular immune response
US5608046A (en) * 1990-07-27 1997-03-04 Isis Pharmaceuticals, Inc. Conjugated 4'-desmethyl nucleoside analog compounds
US6369038B1 (en) * 1991-04-25 2002-04-09 Genset Closed antisense and sense oligonucleotides and their applications
US5593974A (en) * 1991-06-28 1997-01-14 Massachusetts Institute Of Technology Localized oligonucleotide therapy
US5658764A (en) * 1992-01-28 1997-08-19 North Shore University Hospital Research Corp. Method and kits for detection of fragile X specific, GC-rich DNA sequences
US5869252A (en) * 1992-03-31 1999-02-09 Abbott Laboratories Method of multiplex ligase chain reaction
US5418139A (en) * 1993-02-10 1995-05-23 University Of Iowa Research Foundation Method for screening for cardiomyopathy
US5741645A (en) * 1993-06-29 1998-04-21 Regents Of The University Of Minnesota Gene sequence for spinocerebellar ataxia type 1 and method for diagnosis
US5627263A (en) * 1993-11-24 1997-05-06 La Jolla Cancer Research Foundation Integrin-binding peptides
US5962332A (en) * 1994-03-17 1999-10-05 University Of Massachusetts Detection of trinucleotide repeats by in situ hybridization
US5968909A (en) * 1995-08-04 1999-10-19 Hybridon, Inc. Method of modulating gene expression with reduced immunostimulatory response
US6300060B1 (en) * 1995-11-09 2001-10-09 Dana-Farber Cancer Institute, Inc. Method for predicting the risk of prostate cancer morbidity and mortality
US6251589B1 (en) * 1996-07-18 2001-06-26 Srl, Inc. Method for diagnosing spinocerebellar ataxia type 2 and primers therefor
US5853995A (en) * 1997-01-07 1998-12-29 Research Development Foundation Large scale genotyping of diseases and a diagnostic test for spinocerebellar ataxia type 6
US20030073215A1 (en) * 1997-03-31 2003-04-17 Genentech, Inc. Secreted and transmembrane polypeptides and nucleic acids encoding the same
US20030082766A1 (en) * 1997-03-31 2003-05-01 Genentech, Inc. Secreted and transmembrane polypeptides and nucleic acids encoding the same
US20030082763A1 (en) * 1997-03-31 2003-05-01 Genentech, Inc. Secreted and transmembrane polypeptides and nucleic acids encoding the same
US6329501B1 (en) * 1997-05-29 2001-12-11 Auburn University Methods and compositions for targeting compounds to muscle
US6280938B1 (en) * 1997-08-19 2001-08-28 Regents Of The University Of Minnesota SCA7 gene and method of use
US7118893B2 (en) * 1997-08-19 2006-10-10 Regents Of The University Of Minnesota SCA7 gene and methods of use
US6670461B1 (en) * 1997-09-12 2003-12-30 Exiqon A/S Oligonucleotide analogues
US6130207A (en) * 1997-11-05 2000-10-10 South Alabama Medical Science Foundation Cell-specific molecule and method for importing DNA into a nucleus
US6355690B1 (en) * 1998-01-26 2002-03-12 Niigata University Remedy for CAG repeat expansion diseases
US6124100A (en) * 1998-02-26 2000-09-26 Samsung Fine Chemicals Co. Ltd. Diagnostic method and kit for neuropsychiatric diseases using trinucleotide repeats sequence
US6322978B1 (en) * 1998-04-20 2001-11-27 Joslin Diabetes Center, Inc. Repeat polymorphism in the frataxin gene and uses therefore
US6514755B1 (en) * 1998-08-18 2003-02-04 Regents Of The University Of Minnesota SCA7 gene and methods of use
US7189530B2 (en) * 1998-09-01 2007-03-13 Genentech, Inc. Secreted and transmembrane polypeptides and nucleic acids encoding the same
US20020165150A1 (en) * 1998-09-25 2002-11-07 Children's Medical Center Corporation Tissue remodeling
US6172216B1 (en) * 1998-10-07 2001-01-09 Isis Pharmaceuticals Inc. Antisense modulation of BCL-X expression
US6399575B1 (en) * 1998-11-10 2002-06-04 Auburn University Methods and compositions for targeting compounds to the central nervous system
US20040226056A1 (en) * 1998-12-22 2004-11-11 Myriad Genetics, Incorporated Compositions and methods for treating neurological disorders and diseases
US20020049173A1 (en) * 1999-03-26 2002-04-25 Bennett C. Frank Alteration of cellular behavior by antisense modulation of mRNA processing
US6379698B1 (en) * 1999-04-06 2002-04-30 Isis Pharmaceuticals, Inc. Fusogenic lipids and vesicles
US20010056077A1 (en) * 1999-05-21 2001-12-27 Jcr Pharmaceuticals Co., Ltd Pharmaceutical composition for treatment of duchenne muscular dystrophy
US6653466B2 (en) * 1999-05-21 2003-11-25 Jcr Pharmaceuticals Co., Ltd. Pharmaceutical composition for treatment of duchenne muscular dystrophy
US20030236214A1 (en) * 1999-06-09 2003-12-25 Wolff Jon A. Charge reversal of polyion complexes and treatment of peripheral occlusive disease
US6355481B1 (en) * 1999-06-18 2002-03-12 Emory University Hybridoma cell line and monoclonal antibody for huntingtin protein
US6133031A (en) * 1999-08-19 2000-10-17 Isis Pharmaceuticals Inc. Antisense inhibition of focal adhesion kinase expression
US6653467B1 (en) * 2000-04-26 2003-11-25 Jcr Pharmaceutical Co., Ltd. Medicament for treatment of Duchenne muscular dystrophy
US20030124523A1 (en) * 2000-06-22 2003-07-03 Asselbergs Fredericus Alphonsus Maria Organic compounds
US6794192B2 (en) * 2000-06-29 2004-09-21 Pfizer Inc. Target
US20020055481A1 (en) * 2000-08-25 2002-05-09 Jcr Pharmaceuticals Co., Ltd. Pharmaceutical composition for treatment of Duchenne muscular dystrophy
US20030235845A1 (en) * 2000-09-21 2003-12-25 Van Ommen Garrit-Jan Boudewijn Induction of exon skipping in eukaryotic cells
US6623927B1 (en) * 2000-11-08 2003-09-23 Council Of Scientific And Industrial Research Method of detection of allelic variants of SCA2 gene
US20020115824A1 (en) * 2000-11-30 2002-08-22 Engler Jeffrey A. Receptor-mediated uptake of peptides that bind the human transferrin receptor
US7202210B2 (en) * 2001-02-08 2007-04-10 Wyeth Modified and stabilized GDF propeptides and uses thereof
US6902896B2 (en) * 2001-05-11 2005-06-07 Regents Of The University Of Minnesota Intron associated with myotonic dystrophy type 2 and methods of use
US20050277133A1 (en) * 2001-05-18 2005-12-15 Sirna Therapeutics, Inc. RNA interference mediated treatment of polyglutamine (polyQ) repeat expansion diseases using short interfering nucleic acid (siNA)
US20030109476A1 (en) * 2001-08-07 2003-06-12 Kmiec Eric B. Compositions and methods for the prevention and treatment of Huntington's disease
US20060074034A1 (en) * 2001-09-17 2006-04-06 Collins Douglas A Cobalamin mediated delivery of nucleic acids, analogs and derivatives thereof
US20030134790A1 (en) * 2002-01-11 2003-07-17 University Of Medicine And Dentistry Of New Jersey Bone Morphogenetic Protein-2 And Bone Morphogenetic Protein-4 In The Treatment And Diagnosis Of Cancer
US6982150B2 (en) * 2002-02-11 2006-01-03 Sheetz Michael P System and method for identifying proteins involved in force-initiated signal transduction
US20050096284A1 (en) * 2002-02-20 2005-05-05 Sirna Therapeutics, Inc. RNA interference mediated treatment of polyglutamine (polyQ) repeat expansion diseases using short interfering nucleic acid (siNA)
US20050246794A1 (en) * 2002-11-14 2005-11-03 Dharmacon Inc. Functional and hyperfunctional siRNA
US20040101852A1 (en) * 2002-11-21 2004-05-27 Isis Pharmaceuticals Inc. Modulation of CGG triplet repeat binding protein 1 expression
US20070082861A1 (en) * 2002-11-25 2007-04-12 Masafumi Matsuo Ena nucleic acid drugs modifying splicing in mrna precursor
US20070275914A1 (en) * 2003-03-07 2007-11-29 Muthiah Manoharan Therapeutic Compositions
US20080015158A1 (en) * 2003-05-14 2008-01-17 Kanazawa Ichiro Inhibition of the Expression of Huntingtin Gene
US20050222009A1 (en) * 2003-10-14 2005-10-06 Itschak Lamensdorf Dual phase - PNA conjugates for the delivery of PNA through the blood brain barrier
US20070292408A1 (en) * 2004-12-03 2007-12-20 University Of Massachusetts Spinal Muscular Atrophy (SMA) treatment via targeting of SMN2 splice site inhibitory sequences
US20060148740A1 (en) * 2005-01-05 2006-07-06 Prosensa B.V. Mannose-6-phosphate receptor mediated gene transfer into muscle cells

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150148404A1 (en) * 2012-04-23 2015-05-28 Prosensa Technologies B.V. RNA Modulating Oligonucleotides with Improved Characteristics for the Treatment of Neuromuscular Disorders
US9745576B2 (en) * 2012-04-23 2017-08-29 Biomarin Technologies B.V. RNA modulating oligonucleotides with improved characteristics for the treatment of neuromuscular disorders
WO2015023937A1 (en) * 2013-08-16 2015-02-19 Rana Therapeutics, Inc. Heterochromatin forming non-coding rnas

Also Published As

Publication number Publication date Type
CA2714120A1 (en) 2009-08-13 application
CN101980726A (en) 2011-02-23 application
US8263760B2 (en) 2012-09-11 grant
WO2009099326A1 (en) 2009-08-13 application
JP2011510678A (en) 2011-04-07 application
EP2249874A1 (en) 2010-11-17 application

Similar Documents

Publication Publication Date Title
Agrawal Importance of nucleotide sequence and chemical modifications of antisense oligonucleotides
US20070117772A1 (en) Methods for slowing familial ALS disease progression
US6372427B1 (en) Cooperative oligonucleotides
US20090192106A1 (en) MODULATION OF eIF4E EXPRESSION
US20040180351A1 (en) Interfering RNA molecules
US5976879A (en) Antisense oligonucleotides which combat aberrant splicing and methods of using the same
Lee et al. RNase H-mediated degradation of toxic RNA in myotonic dystrophy type 1
WO2007002390A2 (en) Compositions and methods for modulation of smn2 splicing
US20090082300A1 (en) Modulation of transthyretin expression
WO2013075035A1 (en) Rnai agents, compositions and methods of use thereof for treating transthyretin (ttr) associated diseases
WO2010148249A1 (en) Compositions and methods for modulation of smn2 splicing in a subject
WO2013112053A1 (en) Rna modulating oligonucleotides with improved characteristics for the treatment of duchenne and becker muscular dystrophy
Brysch et al. Design and application of antisense oligonucleotides in cell culture, in vivo, and as therapeutic agents
US20140113955A1 (en) METHODS AND MEANS FOR EFFICIENT SKIPPING OF EXON 45 IN DUCHENNE MUSCULAR DYSTROPHY PRE-mRNA
EP2607484A1 (en) Methods and means for efficient skipping of exon 45 in Duchenne Muscular Dystrophy pre-mRNA
WO1994011494A1 (en) Antisense oligonucleotides to inhibit expression of mutated and wild type genes for collagen
WO2010120820A1 (en) Compositions and methods for modulation of smn2 splicing
WO2007115168A2 (en) Compositions and methods for inhibiting expression of eg5 gene
US20050196787A1 (en) Modulation of eIF4E-BP2 expression
US20070299027A1 (en) Compositions and their uses directed to huntingtin
WO2007047913A2 (en) Compositions and methods for modulation of lmna expression
US7307069B2 (en) Antisense oligonucleotide modulation of STAT3 expression
Sobczak et al. RNA interference targeting CUG repeats in a mouse model of myotonic dystrophy
WO2008018795A1 (en) Methods and means for treating dna repeat instability associated genetic disorders
WO2013040429A1 (en) Multimeric oligonucleotide compounds

Legal Events

Date Code Title Description
AS Assignment

Owner name: PROSENSA HOLDING BV, NETHERLANDS

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:DE KIMPE, JOSEPHUS JOHANNES;PLATENBURG, GERARDUS JOHANNES;REEL/FRAME:025347/0993

Effective date: 20100915

AS Assignment

Owner name: PROSENSA TECHNOLOGIES B.V., NETHERLANDS

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:PROSENSA HOLDING N.V.;REEL/FRAME:034115/0924

Effective date: 20140828

Owner name: PROSENSA HOLDING N.V., NETHERLANDS

Free format text: CHANGE OF NAME;ASSIGNOR:PROSENSA HOLDING B.V.;REEL/FRAME:034115/0965

Effective date: 20140828

AS Assignment

Owner name: BIOMARIN TECHNOLOGIES B.V., NETHERLANDS

Free format text: CHANGE OF NAME;ASSIGNOR:PROSENSA TECHNOLOGIES B.V.;REEL/FRAME:036732/0042

Effective date: 20150908

FPAY Fee payment

Year of fee payment: 4