New! Search for patents from more than 100 countries including Australia, Brazil, Sweden and more

US20110123996A1 - Methods and compositions to evaluate antibody treatment response - Google Patents

Methods and compositions to evaluate antibody treatment response Download PDF


Publication number
US20110123996A1 US12/858,343 US85834310A US2011123996A1 US 20110123996 A1 US20110123996 A1 US 20110123996A1 US 85834310 A US85834310 A US 85834310A US 2011123996 A1 US2011123996 A1 US 2011123996A1
United States
Prior art keywords
amino acid
acid residue
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Application number
Herve Watier
Guillaume Cartron
Philippe Colombat
Original Assignee
Herve Watier
Guillaume Cartron
Philippe Colombat
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
Priority to EP01402718.9 priority Critical
Priority to EP01402718 priority
Priority to US10/492,183 priority patent/US7858300B2/en
Priority to PCT/EP2002/011397 priority patent/WO2003035904A2/en
First worldwide family litigation filed litigation Critical "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Application filed by Herve Watier, Guillaume Cartron, Philippe Colombat filed Critical Herve Watier
Priority to US12/858,343 priority patent/US20110123996A1/en
Publication of US20110123996A1 publication Critical patent/US20110123996A1/en
Application status is Abandoned legal-status Critical




    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6881Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for tissue or cell typing, e.g. human leukocyte antigen [HLA] probes
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/106Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers


The present invention relates to methods and compositions to evaluate or assess the response of a subject to particular therapeutic treatment. More particularly, the invention provides methods to determine the response of subjects, or to adapt the treatment protocol of subjects treated with therapeutic antibodies. The invention is based on a determination of the FCGR3A genotype of a subject. The invention can be used for patients with malignancies, particularly lymphoma, and is suited to select best responders and/or adjust treatment condition or protocol for low responders.


  • The present invention relates to methods and compositions to evaluate or assess the response of a subject to particular therapeutic treatment. More particularly, the invention provides methods to determine the response of subjects, or to adapt the treatment protocol of subjects treated with therapeutic antibodies. The invention can be used for patients with malignancies, particularly lymphoma, and is suited to select best responders and/or adjust treatment condition or protocol for low responders.
  • Various therapeutic strategies in human beings are based on the use of therapeutic antibodies. This includes, for instance, the use of therapeutic antibodies developed to deplete target cells, particularly diseased cells such as virally-infected cells, tumor cells or other pathogenic cells, including allogenic immunocompetent cells. Such antibodies are typically monoclonal antibodies, of IgG species, typically IgG1 and IgG3. These antibodies can be recombinant antibodies and humanized antibodies, comprising functional domains from various species or origin or specificity. A particular example of such therapeutic antibodies is rituximab (Mabthera®, Rituxan®), which is a chimeric anti-CD20 IgG1 monoclonal antibody made with human γ1 and κ constant regions linked to murine variable domains1. For a few years, rituximab has been considerably modifying the therapeutical strategy against B lymphoproliferative malignancies, particularly non-Hodgkin's lymphomas (NHL). Other examples of intact humanized IgG1 antibodies include alemtuzumab (Campath-1H®), which is used in the treatment of B cell malignancies or trastuzumab (Herceptin®, which is used in the treatment of breast cancer. Additional examples of therapeutic antibodies under development are disclosed in the art.
  • While these antibodies represent a novel efficient approach to human therapy, particularly for treatment of tumors, they do not always exhibit a strong efficacy and their use could be improved by evaluating the response of subjects thereto. For instance, while rituximab, alone or in combination with chemotherapy was shown to be effective in the treatment of both low-intermediate2-8 and high-grade NHL6, 9, 30% to 50% of patients with low grade NHL have no clinical response to rituximab4, 5. It has been suggested that the level of CD20 expression on lymphoma cells2, the presence of high tumor burden at the time of treatment6 or low serum rituximab concentrations2 may explain the lack of efficacy of rituximab in some patients. Nevertheless, the actual causes of treatment failure remain largely unknown.
  • The availability of methods allowing the evaluation of patient response to antibody treatment would greatly enhance the therapeutic efficacy of these products. However, the precise mode of action in vivo of such therapeutic antibodies is not clearly documented. Indeed, while in vitro studies suggest various possible modes of action of rituximab (antibody-dependant cell-mediated cytotoxicity (ADCC)10, 11, complement-dependant cytotoxicity10, 12, 13, direct signalling leading to apoptosis14, 15, etc.), the clear action of these target cell-depleting antibodies in vivo is not documented in humans. Furthermore, while ADCC is an important effector mechanism in the eradication of intracellular pathogens and tumor cells, the role of an ADCC is still controversial12, 13.
  • The present invention now proposes novel methods and compositions to assess the therapeutic response of a subject to a therapeutic antibody. The invention also proposes methods to select patients having best responding profile to therapeutic antibody treatment. The invention also relates to methods of treating patients with therapeutic antibodies, comprising a prior step of evaluating the patient's response. The invention also relates to compositions and kits suitable to perform the invention. The invention may as well be used in clinical trials or experimental settings, to assess or monitor a subject's response, or to verify the mode of action of an antibody.
  • The invention is based, in part, on the demonstration of a correlation between the genotype of a subject and its ability to respond to therapeutic antibody treatment. More specifically, the invention shows that the genotype of the FcγRIIIa receptor directly correlates with the subject's response to therapeutic antibody treatment.
  • Three classes of FcγR (FcγRJ, FcγRII and FcγRIII) and their subclasses are encoded by eight genes in humans, all located on the long arm of chromosome 1. Some of these genes display a functional allelic polymorphism generating allotypes with different receptor properties. These polymorphisms have been identified as genetic factors increasing the susceptibility to autoimmune or infectious diseases19-21. One of these genetic factors is a gene dimorphism in FCGR3A, which encodes FcγRIIIa with either a phenylalanine (F) or a valine (V) at amino-acid position 15822,23. This residue directly interacts with the lower hinge region of IgG1 as recently shown by IgG1-FcγRIII co-cristallization24. It has been clearly demonstrated that human IgG1 binds more strongly to homozygous FcγRIIIa-158V natural killer cells (NK) than to homozygous FcγRIIIa-158F or heterozygous NK cells22, 23.
  • We undertook to evaluate a possible correlation between the FCGR3A genotype and a patient response to therapeutic antibody treatment in vivo. Our invention stems in part from the unexpected discovery that a very strong correlation exists between said genotype and said response profile, the presence of a valine residue at position 158 being indicative of a high response rate. More specifically, the genotyping of FCGR3A was performed in patients with previously untreated follicular NHL who had received rituximab alone, a particular situation in which the response rate is very high5. The FCGR2A-131H/R was also determined as control since this gene co-localizes with FCGR3A on chromosome 1q22 and encodes the macrophage FcγRIIa receptor.
  • The FCGR3A-158V/F genotype was determined in 47 patients having received rituximab for a previously untreated follicular non-Hodgkin's lymphoma. Clinical and molecular response were evaluated at two months (M2) and at one year (M12). Positive molecular response was defined as a disappearance of the BCL2-JH gene rearrangement in both peripheral blood and bone marrow. FCGR3A-158V homozygous patients were 21% whereas FCGR3A-158F homozygous and heterozygous patients (FCGR3A-158F carriers) were 34% and 45%, respectively. The objective response rates at M2 and M12 were 100% and 90% in FCGR3A-158V homozygous patients compared with 65% (p=0.02) and 51% (p=0.03) in FCGR3A-158F carriers. A positive molecular response was observed at M12 in 5/6 of homozygous FCGR3A-158V patients compared with 5/16 of FCGR3A-158F carriers (p=0.04). Furthermore, the homozygous FCGR3A-158V genotype was confirmed to be the single parameters associated with clinical and molecular responses in multivariate analysis and was also associated with a lower rate of disease progression (p=0.05).
  • Accordingly, the present invention establishes, for the first time, an association between the FCGR3A genotype and clinical and molecular responses to therapeutic antibodies. The invention thus provides a first unique marker that can be used to monitor, evaluate or select a patient's response. This invention thus introduces new pharmacogenetical approaches in the management of patients with malignancies, viral infections or other diseases related to the presence of pathological cells in a subject, particularly non-Hodgkin's lymphoma.
  • An object of this invention resides in a method of assessing the response of a subject to a therapeutic antibody treatment, comprising determining in vitro the FCGR3A genotype and/or the presence of a polymorphism in the FcγRIIIa receptor of said subject. More specifically, the method comprises determining in vitro the FCGR3A158 genotype of said subject.
  • A further object of this invention is a method of selecting patients for therapeutic antibody treatment, the method comprising determining in vitro the FCGR3A genotype and/or the presence of a polymorphism in the FcγRIIIa receptor of said subject. More specifically, the method comprises determining in vitro the FCGR3A 158 genotype of said subject.
  • An other object of this invention is a method of improving the efficacy or treatment condition or protocol of a therapeutic antibody treatment in a subject, comprising determining in vitro the FCGR3A genotype and/or the presence of a polymorphism in the FcγRIIIa receptor of said subject. More specifically, the method comprises determining in vitro the FCGR3A 158 genotype of said subject.
  • More specifically, determining in vitro the FCGR3A 158 genotype of a subject comprises determining amino acid residue at position 158 of FcγRIIIa receptor (or corresponding codon in the FCGR3A gene), a valine at position 158 being indicative of a better response to said treatment and a phenylalanine at position 158 being indicative of a lower response to said treatment.
  • Within the context of this invention, the term “therapeutic antibody or antibodies” designates more specifically any antibody that functions to deplete target cells in a patient. Specific examples of such target cells include tumor cells, virus-infected cells, allogenic cells, pathological immunocompetent cells (e.g., B lymphocytes, T lymphocytes, antigen-presenting cells, etc.) involved in allergies, autoimmune diseases, allogenic reactions, etc., or even healthy cells (e.g., endothelial cells in an anti-angiogenic therapeutic strategy). Most preferred target cells within the context of this invention are tumor cells and virus-infected cells. The therapeutic antibodies may, for instance, mediate a cytotoxic effect or a cell lysis, particularly by antibody-dependant cell-mediated cytotoxicity (ADCC). ADCC requires leukocyte receptors for the Fc portion of IgG (FcγR) whose function is to link the IgG-sensitized antigens to FcγR-bearing cytotoxic cells and to trigger the cell activation machinery. While this mechanism of action has not been evidenced in vivo in humans, it may account for the efficacy of such target cell-depleting therapeutic antibodies. The therapeutic antibodies may by polyclonal or, preferably, monoclonal. They may be produced by hybridomas or by recombinant cells engineered to express the desired variable and constant domains. The antibodies may by single chain antibodies or other antibody derivatives retaining the antigen specificity and the lower hinge region or a variant thereof. These may be polyfunctional antibodies, recombinant antibodies, ScFv, humanized antibodies, or variants thereof. Therapeutic antibodies are specific for surface antigens, e.g., membrane antigens. Most preferred therapeutic antibodies are specific for tumor antigens (e.g., molecules specifically expressed by tumor cells), such as CD20, CD52, ErbB2 (or HER2/Neu), CD33, CD22, CD25, MUC-1, CEA, KDR, αVβ3, etc., particularly lymphoma antigens (e.g., CD20). The therapeutic antibodies are preferably IgG1 or IgG3, more preferably IgG1.
  • Typical examples of therapeutic antibodies of this invention are rituximab, alemtuzumab and trastuzumab. Such antibodies may be used according to clinical protocols that have been authorized for use in human subjects. Additional specific examples of therapeutic antibodies include, for instance, epratuzumab, basiliximab, daclizumab, cetuximab, labetuzumab, sevirumab, tuvurimab, palivizumab, infliximab, omalizumab, efalizumab, natalizumab, clenoliximab, etc., as listed in the following table:
  • Ab specificity DCI Commercial name Typical Indications
    Anti-CD20 rituximab MabThera ®, LNH B
    Rituxan ®
    Anti-CD52 alemtuzumab CAMPATH-1H ® LLC, allograft
    Anti-CD33 Zamyl ™ Acute myeloid Leukemia
    Anti-HLA- Remitogen ™ LNH B
    Anti-CD22 epratuzumab LymphoCide ™ LNH B
    Anti-erbB2 trastuzumab Herceptin ®, Metastatic breast cancer
    Anti-EGFR cetuximab ORL and colorectal Cancers
    Anti-MUC-1 Therex ® Breast and epithelial cancers
    Anti-CEA labetuzumab CEA-Cide ™
    Anti-αVβ3 Vitaxin Cancers (anti-angiogenic)
    Anti-KDR Cancers (anti-angiogenic)
    anti-VRS palivizumab Synagis ® Viral diseases
    fusion protein
    anti-VRS Numax ™
    fusion protein
    CMV sevirumab Protovir CMV Infection
    HBs tuvirumab Ostavir ™ Hepatitis B
    Anti-CD25 basiliximab Simulect ® Prevention/treatment allograft
    Anti-CD25 daclizumab Zénapax ® Prevention/treatment allograft
    anti-TNF-α infliximab Remicade ™ Crohn disease, polyarthrite
    anti-IgE omalizumab Xolair ™ Asthma
    anti-integrin efalizumab Xanelim ™ psoriasis
    αL (CD11a,
    anti-CD4 keliximab
    anti-CD2 siplizumab
    Anti-CD64 anemia
    anti-CD147 GvH
    anti-integrin natalizumab Antegren ® Sclerosis, Crohn
    α4 (α4β1-α4β7)
    Anti-integrin Crohn, RCH
    anti-CD4* clenoliximab
  • Within the context of the present invention, a subject or patient includes any mammalian subject or patient, more preferably a human subject or patient.
  • According to the invention the term FCGR3A gene refers to any nucleic acid molecule encoding a FcγRIIIa polypeptide in a subject. This term includes, in particular, genomic DNA, cDNA, RNA (pre-rRNA, messenger RNA, etc.), etc. or any synthetic nucleic acid comprising all or part of the sequence thereof. Synthetic nucleic acid includes cDNA, prepared from RNAs, and containing at least a portion of a sequence of the FCGR3A genomic DNA as for example one or more introns or a portion containing one or more mutations. Most preferably, the term FCGR3A gene refers to genomic DNA, cDNA or mRNA, typically genomic DNA or mRNA. The FCGR3A gene is preferably a human FCGRIIIa gene or nucleic acid, i.e., comprises the sequence of a nucleic acid encoding all or part of a FcγRIIIa polypeptide having the sequence of human FcγRIIIa polypeptide. Such nucleic acids can be isolated or prepared according to known techniques. For instance, they may be isolated from gene libraries or banks, by hybridization techniques. They can also be genetically or chemically synthesized. The genetic organization of a human FCGRIIIa gene is depicted on FIG. 2. The amino acid sequence of human FcγRIIIa is represented FIG. 3. Amino acid position 158 is numbered from residue 1 of the mature protein. It corresponds to residue 176 of the pre-protein having a signal peptide. The sequence of a wild type FCGR3A gene is represented on FIG. 4 (see also Genbank accession Number AL590385 or NM000569 for partial sequence).
  • Within the context of this invention, a portion or part means at least 3 nucleotides (e.g., a codon), preferably at least 9 nucleotides, even more preferably at least 15 nucleotides, and can contain as much as 1000 nucleotides. Such a portion can be obtained by any technique well known in the art, e.g., enzymatic and/or chemical cleavage, chemical synthesis or a combination thereof. The sequence of a portion of a FCGR3A gene encoding amino acid position 158 is represented below, for sake of clarity:
  • cDNA 540       550       560       570       580
    genomic DNA    4970      4980      4990      5000.
    158F allele tcctacttctgcagggggctttttgggagtaaaaatgtgtcttca
     S  Y  F  C  R  G  L   F   G  S  K  N  V  S  S
    158V allele tcctacttctgcagggggcttgttgggagtaaaaatgtgtcttca
     S  Y  F  C  R  G  L   V   G  S  K  N  V  S  S
  • As indicated above, the invention comprises a method of determining in vitro the FCGR3A158 genotype of said subject. This more particularly comprises determining the nature of amino acid residue present (or encoded) at position 158 of the FcγRIIIa polypeptide.
  • Genotyping the FCGR3A gene or corresponding polypeptide in said subject may be achieved by various techniques, comprising analysing the coding nucleic acid molecules or the encoded polypeptide. Analysis may comprise sequencing, migration, electrophoresis, immuno-techniques, amplifications, specific digestions or hybridisations, etc.
  • In a particular embodiment, determining amino acid residue at position 158 of FcγRIIIa receptor comprises a step of sequencing the FCGR3A receptor gene or RNA or a portion thereof comprising the nucleotides encoding amino acid residue 158.
  • In an other particular embodiment, determining amino acid residue at position 158 of FcγRIIIa receptor comprises a step of amplifying the FCGR3A receptor gene or RNA or a portion thereof comprising the nucleotides encoding amino acid residue 158. Amplification may be performed by polymerase chain reaction (PCR), such as simple PCR, RT-PCR or nested PCR, for instance, using conventional methods and primers.
  • In this regard, amplification primers for use in this invention more preferably contain less than about 50 nucleotides even more preferably less than 30 nucleotides, typically less than about 25 or 20 nucleotides. Also, preferred primers usually contain at least 5, preferably at least 8 nucleotides, to ensure specificity. The sequence of the primer can be prepared based on the sequence of the FCGR3A gene, to allow full complementarity therewith, preferably. The probe may be labelled using any known techniques such as radioactivity, fluorescence, enzymatic, chemical, etc. This labeling can use for example Phosphor 32, biotin (16-dUTP), digoxygenin (11-dUTP). It should be understood that the present invention shall not be bound or limited by particular detection or labelling techniques. The primers may further comprise restriction sites to introduce allele-specific restriction sites in the amplified nucleic acids, as disclosed below.
  • Specific examples of such amplification primers are, for instance, SEQ ID NO: 1-4.
  • It should be understood that other primers can be designed by the skilled artisan, such as any fragment of the FCGR3A gene, for use in the amplification step and especially a pair of primers comprising a forward sequence and a reverse sequence wherein said primers of said pair hybridize with a region of a FCGR3A gene and allow amplification of at least a portion of the FCGR3A gene containing codon 158. In a preferred embodiment, each pair of primers comprises at least one primer that is complementary, and overlaps with codon 158, and allows to discriminate between 158V (gtt) and 158F (ttt). The amplification conditions may also be adjusted by the skilled person, based on common general knowledge and the guidance contained in the specification.
  • In a particular embodiment, the method of the present invention thus comprises a PCR amplification of a portion of the FCGR3a mRNA or gDNA with specific oligonucleotide primers, in the cell or in the biological sample, said portion comprising codon 158, and a direct or indirect analysis of PCR products, e.g., by electrophoresis, particularly Denaturing Gel Gradient Electrophoresis (DGGE).
  • In an other particular embodiment, determining amino acid residue at position 158 of FcγRIIIa receptor comprises a step of allele-specific restriction enzyme digestion. This can be done by using restriction enzymes that cleave the coding sequence of a particular allele (e.g., the 158V allele) and that do not cleave the other allele (e.g., the 158F allele, or vice versa). Where such allele-specific restriction enzyme sites are not present naturally in the sequence, they may be introduced therein artificially, by amplifying the nucleic acid with allele-specific amplification primers containing such a site in their sequence. Upon amplification, determining the presence of an allele may be carried out by analyzing the digestion products, for instance by electrophoresis. This technique also allows to discriminate subjects that are homozygous or heterozygous for the selected allele.
  • Examples of allele-specific amplification primers include for instance SEQ ID NO: 3. SEQ ID NO:3 introduces the first 3 nucleotides of the NlaIII site (5′-CATG-3). Cleavage occurs after G. This primer comprises 11 bases that do not hybridise with FCGR3A, that extend the primer in order to facilitate electrophoretic analysis of the amplification products) and 21 bases that hybridise to FCGR3A, except for nucleotide 31 (A) which creates the restriction site.
  • In a further particular embodiment, determining amino acid residue at position 158 of FcγRIIIa receptor comprises a step of hybridization of the FCGR3A receptor gene or RNA or a portion thereof comprising the nucleotides encoding amino acid residue 158, with a nucleic acid probe specific for the genotype Valine or Phenylalanine, and determining the presence or absence of hybrids.
  • It should be understood that the above methods can be used either alone or in various combinations. Furthermore, other techniques known to the skilled person may be used as well to determine the FCGR3A158 genotype, such as any method employing amplification (e.g. PCR), specific primers, specific probes, migration, etc., typically quantitative RT-PCR, LCR (Ligase Chain Reaction), TMA (Transcription Mediated Amplification), PCE (an enzyme amplified immunoassay) and bDNA (branched DNA signal amplification) assays.
  • In a preferred embodiment of this invention, determining amino acid residue at position 158 of FcγRIIIa receptor comprises:
      • Obtaining genomic DNA from a biological sample,
      • Amplifying the FcγRIIIa receptor gene or a portion thereof comprising the nucleotides encoding amino acid residue 158, and
      • determining amino acid residue at position 158 of said FcγRIIIa receptor gene.
  • Amplification can be accomplished with any specific technique such as PCR, including nested PCR, using specific primers as described above. In a most preferred embodiment, determining amino acid residue at position 158 is performed by allele-specific restriction enzyme digestion. In that case, the method comprises:
      • Obtaining genomic DNA from a biological sample,
      • Amplifying the FcγRIIIa receptor gene or a portion thereof comprising the nucleotides encoding amino acid residue 158,
      • Introducing an allele-specific restriction site,
      • Digesting the nucleic acids with the enzyme specific for said restriction site and,
      • Analysing the digestion products, i.e., by electrophoresis, the presence of digestion products being indicative of the presence of the allele.
  • In an other particular embodiment, the genotype is determined by a method comprising: total (or messenger) RNA extraction from cell or biological sample or biological fluid in vitro or ex vivo, optionally cDNA synthesis, (PCR) amplification with FCGR3A-specific oligonucleotide primers, and analysis of PCR products.
  • The method of this invention may also comprise determining amino acid residue at position 158 of FcγRIIIa receptor directly by sequencing the FcγRIIIa receptor polypeptide or a portion thereof comprising amino acid residue 158 or by using reagents specific for each allele of the FcγRIIIa polypeptide. This can be determined by any suitable technique known to the skilled artisan, including by immuno-assay (ELISA, EIA, RIA, etc.). This can be made using any affinity reagent specific for a FcγRIIIa158 polypeptide, more preferably any antibody or fragment or derivative thereof. In a particular embodiment, the FcγRIIIa158 polypeptide is detected with an anti-FcγRIIIa158 antibody (or a fragment thereof) that discriminates between FcγRIIIa158V and FcγRIIIa158F, more preferably a monoclonal antibody. The antibody (or affinity reagent) may be labelled by any suitable method (radioactivity, fluorescence, enzymatic, chemical, etc.). Alternatively, FcγRIIIa158 antibody immune complexes may be revealed (and/or quantified) using a second reagent (e.g., antibody), labelled, that binds to the anti-FcγRIIIa158 antibody, for instance.
  • The above methods are based on the genotyping of FCGR3A158 in a biological sample of the subject. The biological sample may be any sample containing a FCGR3A gene or corresponding polypeptide, particularly blood, bone marrow, lymph node or a fluid, particularly blood or urine, that contains a FCGR3A158 gene or polypeptide. Furthermore, because the FCGR3A 158 gene is generally present within the cells, tissues or fluids mentioned above, the method of this invention usually uses a sample treated to render the gene or polypeptide available for detection or analysis. Treatment may comprise any conventional fixation techniques, cell lysis (mechanical or chemical or physical), or any other conventional method used in immunohistology or biology, for instance.
  • The method is particularly suited to determine the response of a subject to an anti-tumor therapeutic antibody treatment. In this regard, in a particular embodiment, the subject has a tumor and the therapeutic antibody treatment aims at reducing the tumor burden, particularly at depleting the tumor cells. More preferably, the tumor is a lymphoma, such as more preferably a B lymphoma, particularly a NHL. As indicated above, the antibody is preferably an IgG1 or an IgG3, particularly an anti-CD20 IgG1 or IgG3, further preferably a humanized antibody, for instance rituximab.
  • The invention also relates to a bispecific antibody, wherein said bispecific antibody specifically binds CD16 and a tumor antigen, for instance a CD20 antigen. The invention also encompasses pharmaceutical compositions comprising such a bispecific antibody and a pharmaceutically acceptable excipient or adjuvant.
  • Further aspects and advantages of this invention will be disclosed in the following examples, which should be regarded as illustrative and not limiting the scope of this application.
  • FIG. 1: Adjusted KAPLAN-METER estimates of progression-free survival after rituximab treatment according to FcγR3a-158V/F genotype (p=0.05).
  • FIG. 2: Genetic organization of the human FCGR3A gene
  • FIG. 3: Amino acid sequences of human FcγRIIIa158F (SEQ ID NO:7)
  • FIG. 4: Nucleic acid sequence of human FCGR3A158F (SEQ ID NO:8)
  • MATERIALS AND METHODS Patients and Treatment
  • Clinical trial design, eligibility criteria and end-point assessment have been previously reported.5 In brief, patients were eligible for inclusion in this study if they had previously untreated follicular CD20 positive NHL according to the REAL classification.26 Patients were required to present with stage II to IV disease according to Ann-Arbor classification and at least one measurable disease site. All patients were required to have low tumor burden according to the GELF criteria.27 A total of four 375 mg/m2 doses of rituximab (Roche, Neuilly, France) were administered by intravenous infusion (days 1, 8, 15, 22). The management of infusion and adverse events has already been reported.5 The study protocol was approved by an ethics committee, and all patients gave their informed consent.
  • Monitoring and Endpoints
  • Baseline evaluation included clinical examination, chest X-ray, computed tomography (CT) of the chest, abdomen and pelvis, and unilateral bone marrow biopsy. Response was assessed by an independent panel of radiologists who reviewed all the CT scans of the included patients. The primary efficacy endpoint was the objective response rate, i.e the proportion of patients achieving either complete remission (CR), unconfirmed CR (CRu) or partial response (PR) according to the criteria recently proposed by an international expert committee.28 Clinical response was evaluated at days 50 and 78. Only the maximum response was taken into account and that assessment time point named M2. All patients were evaluated for progression at one year (M12). Patients in CR or CRu with disappearance of bone marrow infiltration at M2 and reappearance of lymphoma cells in bone marrow at M12 were considered “progressive”; patients in PR with negative bone marrow biopsy at M2 and positive biopsy at M12 were considered in PR.
  • Molecular analysis of BCL2-JH gene rearrangement was performed by PCR, as previously described,5 on a lymph node obtained at diagnosis and on both peripheral blood and bone marrow at diagnosis, M2 and M12.
  • FCGR3A-158V/F Genotyping
  • Out of the 50 patients included in the clinical trial, one patient was excluded after histological review and DNA was not available for two other patients. Forty seven patients were therefore available for FCGR3A genotype analysis. All samples were analysed in the same laboratory and DNA was extracted using standard procedures including precautions to avoid cross-contamination. DNA was isolated from peripheral blood (n=43), bone marrow (n=3) or lymph node (n=1). Genotyping of FCGR3A-158V/F polymorphism was performed as described by Koene et al22 with a nested PCR followed by an allele-specific restriction enzyme digestion. Briefly, two FCGR3A specific primers (5′-ATATTTACAGAATGGCACAGG-3′, SEQ ID NO: 1; 5′-GACTTGGTACCCAGGTTGAA-3′, SEQ ID NO: 2) (Eurobio, Les Ulis, France) were used to amplify a 1.2 kb fragment containing the polymorphic site. The PCR assay was performed with 1.25 μg of genomic DNA, 200 ng of each primer, 200 μmol/L of each dNTP (MBI Fermentas, Vilnius, Lithuania) and 1 U of Taq DNA polymerase (Promega, Charbonnière, France) as recommended by the manufacturer. This first PCR consisted in 10 min at 95° C., then 35 cycles (each consisting in 3 steps at 95° C. for 1 min, 57° C. for 1.5 min, 72° C. for 1.5 min) and 8 min at 72° C. to achieve complete extension. The second PCR used primers (5′-ATCAGATTCGATCCTACTTCTGCAGGGGGCAT-3′ SEQ ID NO: 3; 5′-ACGTGCTGAGCTTGAGTGATGGTGATGTTCAC-3′ SEQ ID NO: 4) (Eurobio) amplifying a 94 bp fragment and creating a NlaIII restriction site only in the FCGR3A-158V allele. This nested PCR was performed with 1 μL of the amplified DNA, 150 ng of each primer, 200 μmol/L of each dNTP and 1 U of Taq DNA polymerase. The first cycle consisted in 5 min at 95° C. then 35 cycles (each consisting in 3 steps at 95° C. for 1 min, 64° C. for 1 min, 72° C. for 1 min) and 9.5 min at 72° C. to complete extension. The amplified DNA (10 μL) was then digested with 10 U of NlaIII (New England Biolabs, Hitchin, England) for 12 h at 37° C. and separated by electrophoresis on a 8% polyacrylamide gel. After staining with ethidium bromide, DNA bands were visualized with UV light. For homozygous FCGR3A-158F patients, only one undigested band (94 bp) was visible. Three bands (94 bp, 61 bp and 33 bp) were seen in heterozygous individuals whereas for homozygous FCGR3A-158V patients, only two digested bands (61 bp and 33 bp) were obtained.
  • FCGR2A-131H/R Genotyping
  • Genotyping of FCGR2A-1311-1/R was done by PCR followed by an allele-specific restriction enzyme digestion according to Liang et al28. The sense primer (5′-GGAAAATCCCAGAAATTCTCGC-3′ SEQ ID NO: 5) (Eurobio) has been modified to create a BstUI restriction site in case of R allele whereas the antisense primer (5′-CAACAGCCTGACTACCTATTACGCGGG-3′ SEQ ID NO: 6) (Eurobio) has been modified to carry a second BstUI restriction site that served as an internal control. PCR amplification was performed in a 50 μL reaction with 1.25 μg genomic DNA, 170 ng of each primer, 200 μmol/L of each dNTP, 0.5 U of Taq DNA polymerase, and the manufacturer's buffer. The first cycle consisted of 3 minutes at 94° C. followed by 35 cycles (each consisting in 3 steps at 94° C. for 15 seconds, 55° C. for 30 seconds, 72° C. for 40 seconds) and 7 min at 72° C. to complete extension. The amplified DNA (7 μL) were then digested with 20 U of BstUI (New England Biolabs) for 12 h at 60° C. Further analysis was performed as described for FCGR3A genotyping. The FCGR2A-131H and -131R alleles were visualized as a 337 bp and 316 bp DNA fragments, respectively.
  • Statistical Analysis
  • Clinical and biological characteristics as well as clinical and molecular responses of the patients in the different genotypic groups were compared using a Chi-squared test or by Fisher's exact test when appropriated. A logistic regression analysis including: sex, age (> or ≦60 years), number of extra-nodal sites involved (≧ or <2), bone marrow involvement, BCL2 JH rearrangement status at diagnosis and FCGR3A genotype was used to identify independent prognostic variables influencing clinical and molecular responses. Progression-free survival was calculated according to the method of Kaplan and Meier29 and was measured from the start of treatment until progression/relapse or death. Comparison of the progression-free survival by FCGR3A genotype was performed using the log-rank test. P<0.05 was considered as statistically significant.
  • Results Clinical Response
  • Out of the 49 patients tested for the FCGR3A-158V/F polymorphism, 10 (20%) and 17 (35%) were homozygous for FCGR3A-158V and FCGR3A-158F, respectively, and 22 (45%) were heterozygous. The three groups were not different in terms of sex, disease stage, bone marrow involvement, number of extra-nodal sites involved or presence of BCL2-JH rearrangement in peripheral blood and bone marrow at diagnosis (Table 1). No difference was found when homozygous FCGR3A-158V patients were compared with FCGR3A-158F carriers (FCGR3A-158F homozygous and heterozygous patients) or when homozygous FCGR3A-158F patients were compared with FCGR3A-158V carriers (FCGR3A-158V homozygous and heterozygous patients). The objective response rate at M2 was 100% (CR+CRu=40%), 70% (CR+CRu=29%) and 64% (CR+CRu=18%) in FCGR3A-158V homozygous, FCGR3A-158F homozygous and heterozygous patients respectively (P=0.09). A significant difference in objective response rate was observed between FCGR3A-158V homozygous patients and FCGR3A-158F carriers with 67% (CR+CRu=23%) objective response rate for this latter group (relative risk 1.5; 95% CI, 1.2-1.9; P=0.03) (Table 2). No difference was observed between FCGR3A-158F homozygous patients and FCGR3A-158V carriers. At M12, the objective response rate was 90% (CR+CRu=70%), 59% (CR+CRu=35%) and 45% (CR+CRu=32%) in FCGR3A-158V homozygous, FCGR3A-158F homozygous and heterozygous patients respectively (P=0.06). The difference in objective response rate was still present one year after treatment between FCGR3A-158V homozygous group and FCGR3A-158F carriers with 51% (CR+CRu=33%) objective response rate for this latter group (relative risk=1.7; 95% CI, 1.2-2.5; P=0.03). The logistic regression analysis showed that the homozygous FCGR3A-158V genotype was the only predictive factor for clinical response both at M2 (P=0.02) and at M12 (P=0.01). The progression-free survival at 3 years (median follow-up: 35 months; 31-41)(FIG. 1) was 56% in FCGR3A-158V homozygous patients and 35% in FCGR3A-158F carriers (ns). Out of the 45 patients analyzed for FCGR2A-131H/R polymorphism, 9 (20%) and 13 (29%) were homozygous for FCGR2A-131R and FCGR2A-131H, respectively, while 23 (51%) were heterozygous. There was no difference in the characteristics at inclusion or clinical response to rituximab treatment for these three groups or for homozygous FCGR2A-131H patients and FCGR2A-131R carriers, or for homozygous FCGR2A-131R patients and FCGR2A-131H carriers (data not shown).
  • Molecular Response
  • At diagnosis, BCL2-JH rearrangement was detected in both peripheral blood and in bone marrow in 30 (64%) patients, enabling further follow-up. Twenty-five patients (six FCGR3A-158V homozygous patients and 19 FCGR3A-158F carriers) and 23 patients (six FCGR3A-158V homozygous patients and 17 FCGR3A-158F carriers) were analysed for BCL2 JH rearrangement in both peripheral blood and bone marrow at M2 and at M12 (Table 3). At M2, a cleaning of BCL2-JH rearrangement was observed in 3/6 of the FCGR3A-158V homozygous patients and in 5/19 of the FCGR3A-158F carriers (ns). In contrast, the rate of BCL2-JH rearrangement cleaning at M12 was higher (5/6) in the FCGR3A-158V homozygous patients than in the FCGR3A-158F carriers (5/17) (relative risk=2.8; 95% CI, 1.2-6.4; P=0.03). The logistic regression analysis showed that the FCGR3A-158V homozygous genotype was the only factor associated with a greater probability of exhibiting BCL2 JH rearrangement cleaning at M12 (P=0.04). The single homozygous FCGR3A-158V patient still presenting with BCL2 JH rearrangement in peripheral blood and bone marrow at M12 was in CR 23 months after rituximab treatment. In contrast, the molecular responses at M2 and M12 were not influenced by the FCGR2A-131H/R polymorphism (data not shown).
  • Because of the increasing use of rituximab in B cell lymphoproliferative malignancies, enhanced understanding of treatment failures and of the mode of action of rituximab is required. In this regard, we genotyped FCGR3A in follicular NHL patients with well-defined clinical and laboratory characteristics and treated with rituximab alone.5 In particular, all the patients included in this study had a low tumor burden NHL and a molecular analysis of BCL2-JH at diagnosis and during follow-up. The FCGR3A allele frequencies in this population were similar to those of a general caucasian population.23,24 Our results show an association between the FCGR3A genotype and the response to rituximab. Indeed, homozygous FCGR3A-158V patients, who account for one fifth of the population, had a greater probability of experiencing clinical response, with 100% and 90% objective response rates at M2 and M12, respectively. Moreover, five of the six FCGR3A-158V homozygous patients analysed for BCL2-JH rearrangement showed molecular response at M12, compared to 5 of the 17 FCGR3A-158F carriers. FCGR3A-158V homozygosity was the only factor associated with the clinical and molecular responses. However, these higher clinical and molecular responses were still insufficient to significantly improve the progression-free survival in homozygous FCGR3A-158V patients.
  • This is the first report of an easily assessable genetic predictive factor for both clinical and molecular responses to rituximab. However, the genetic association does not demonstrate the mode of action of rituximab involves FcγRIIIa. The association observed between FCGR3A genotype and response to rituximab might be due to another genetic polymorphism in linkage disequilibrium. Those polymorphisms could be located in FCGR3A itself like the triallelic FCGR3A-48L/H/R polymorphism31 or in other FcγR-coding genes, since FCGR3A is located on the long arm of chromosome 1, which includes the three FCGR2 genes and FCGR3B.32 A linkage disequilibrium has been reported between FCGR2A and FCGR3B.33 However, the fact that FCGR2A-131H/R polymorphism was not associated with a better response to rituximab strongly supports the fact that a gene very close to FCGR3A or FCGR3A itself is directly involved.
  • Several in vitro studies argue in favor of direct involvement of FCGR3A-158V/F polymorphism. First, Koene et a/23 have shown that the previously reported differences in IgG binding among the three FcγRIIIa-48L/H/R isoforms31 are a consequence of the linked FcγRIIIa-158V/F polymorphism and several teams have demonstrated that NK cells from individuals homozygous for the FCGR3A-158V allotype have a higher affinity for human complexed IgG1 and are more cytotoxic towards IgG1-sensitized targets 23,24,34 Our present results establish that FCGR3A-158V homozygous patients have a better response to rituximab, which is probably due to a better in vivo binding of that chimeric human IgG1 to FcγRIIIa. Secondly, NK cell- and macrophage-mediated ADCC is one of the mechanisms triggered by anti-CD20 antibodies in vitro8,11,12 as well as in murine models in vivo, 17-19 and rituximab-mediated apoptosis is amplified by FcγR-expressing cells.15,16 Out of all FcγR, FcγRIIIa is the only receptor shared by NK cells and macrophages. We thus postulate that FCGR3A-158V patients show a better response to rituximab because they have better ADCC activity against lymphoma cells. The fact that more than 50% of the FCGR3A-158F carriers nonetheless present a clinical response to rituximab could be explained by lower, but still sufficient, ADCC activity or, more likely, by other mechanisms operating in vivo such as complement-dependent cytotoxicity, complement-dependent cell-mediated cytotoxicity11,13,14 and/or apoptosis.15,16 ADCC could then be viewed as an additional mechanism in the response to rituximab that is particularly effective in FCGR3A-158V homozygous patients.
  • The in vitro studies suggest a “gene-dose” effect with a level of IgG1 binding to NK cells from FCGR3A heterozygous donors intermediate between that observed with NK cells from FCGR3A-158V and FCGR3A-158F homozygotes23. However, the clinical response of heterozygous patients appears similar to that of FCGR3A-158F homozygous patients. Further studies with larger groups of patients will be required to conclude against a “gene-dose” effect in vivo.
  • Since FcγRIIIa is strongly associated with a better response to rituximab, it needs to be taken into account in the development of new drugs targetting the CD20 antigen. For example, it may be possible to use engineered rituximab to treat FCGR3A-158F-carrier patients with B cell lymphomas. Indeed, by modifying various residues in the IgG1 lower hinge region, Shields et al have recently obtained IgG1 mutants which bind more strongly to FcγRIIIa-158F than native IgG134.
  • Taken together, these results allow to set up new therapeutic strategies against B lymphoproliferative disorders based upon prior determination of the patients FCGR3A genotype. Since this polymorphism has the same distribution in various ethnic population, including blacks and Japanese, such a strategy may be applied worldwide.23,35,36 Furthermore, such a pharmacogenetic approach may also be applied to other intact humanized IgG1 antibodies used in the treatment of B cell malignancies, such as Campath-1H, or those used in the treatment of other malignancies, such as trastuzumab (Herceptin®). Even more generally, this approach may apply to other intact (humanized) therapeutic (IgG1) antibodies developed to deplete target cells.
    • 1. Maloney D G, Liles T M, Czerwinski D K, et al.: Phase I clinical trial using escalating single-dose infusion of chimeric anti-CD20 monoclonal antibody (IDEC-C2B8) in patients with recurrent B-cell lymphoma. Blood. 1994; 84:2457-2466.
    • 2. McLaughlin P, Grillo-Lopez A J, Link B K, et al.: Rituximab chimeric anti-CD20 monoclonal antibody therapy for relapsed indolent lymphoma: half of patients respond to a four-dose treatment program. J Clin Oncol. 1998; 16:2825-2833.
    • 3. Maloney D G, Grillo-Lopez A J, White C A, et al.: IDEC-C2B8 (Rituximab) anti-CD20 monoclonal antibody therapy in patients with relapsed low-grade non-Hodgkin's lymphoma. Blood. 1997; 90:2188-2195.
    • 4. Hainsworth J D, Burris H A, 3rd, Morrissey L H, et al.: Rituximab monoclonal antibody as initial systemic therapy for patients with low-grade non-Hodgkin lymphoma. Blood. 2000; 95:3052-3056.
    • 5. Colombat P, Salles G, Brousse N, et al.: Rituximab (anti-CD20 monoclonal antibody) as first-line therapy of follicular lymphoma patients with low tumor burden: clinical and molecular evaluation. Blood. 2001; 97:101-106.
    • 6. Coiffier B, Haioun C, Ketterer N, et al.: Rituximab (anti-CD20 monoclonal antibody) for the treatment of patients with relapsing or refractory aggressive lymphoma a multicenter phase II study. Blood. 1998; 92:1927-1932.
    • 7. Foran J M, Rohatiner A Z, Cunningham D, et al.: European phase II study of rituximab (chimeric anti-CD20 monoclonal antibody) for patients with newly diagnosed mantle-cell lymphoma and previously treated mantle-cell lymphoma, immunocytoma, and small B-cell lymphocytic lymphoma. J Clin Oncol. 2000; 18:317-324.
    • 8. Anderson D R, Grillo-Lopez A, Yarns C, Chambers K S, Hanna N: Targeted anti-cancer therapy using rituximab, a chimaeric anti-CD20 antibody (IDEC-C2B8) in the treatment of non-Hodgkin's B-cell lymphoma. Biochem Soc Trans. 1997; 25:705-708.
    • 9. Vose J, Link B, Grossbard M, et al.: Phase II study of rituximab in combination with CHOP chemotherapy in patients with previously untreated intermediate or high-grade non-Hodgkin's lymphoma (NHL). Ann Oncol. 1999; 10:58.
    • 10. Berinstein N L, Grillo-Lopez A J, White C A, et al.: Association of serum Rituximab (IDEC-C2B8) concentration and anti-tumor response in the treatment of recurrent low-grade or follicular non-Hodgkin's lymphoma. Ann Oncol. 1998; 9:995-1001.
    • 11. Harjunpaa A, Junnikkala S, Men S: Rituximab (anti-CD20) therapy of B-cell lymphomas: direct complement killing is superior to cellular effector mechanisms. Scand J Immunol. 2000; 51:634-641.
    • 12. Reff M E, Carner K, Chambers K S, et al.: Depletion of B cells in vivo by a chimeric mouse human monoclonal antibody to CD20. Blood. 1994; 83:435-445.
    • 13. Idusogie E E, Presta L G, Gazzano-Santoro H, et al.: Mapping of the C1q binding site on rituxan, a chimeric antibody with a human IgG1 Fc. J Immunol. 2000; 164:4178-4184.
    • 14. Golay J, Zaffaroni L, Vaccari T, et al.: Biologic response of B lymphoma cells to an ti-CD20 monoclonal antibody rituximab in vitro: CD55 and CD59 regulate complement-mediated cell lysis. Blood. 2000; 95:3900-3908.
    • 15. Shan D, Ledbetter J A, Press O W: Apoptosis of malignant human B cells by ligation of CD20 with monoclonal antibodies. Blood. 1998; 91:1644-1652.
    • 16. Shan D, Ledbetter J A, Press O W: Signaling events involved in anti-CD20-induced apoptosis of malignant human B cells. Cancer Immunol Immunother. 2000; 48:673-683.
    • 17. Hooijberg E, Sein J J, van den Berk P C, et al.: Eradication of large human B cell tumors in nude mice with unconjugated CD20 monoclonal antibodies and interleukin 2. Cancer Res. 1995; 55:2627-2634.
    • 18. Funakoshi S, Longo D L, Murphy W J: Differential in vitro and in vivo antitumor effects mediated by anti-CD40 and anti-CD20 monoclonal antibodies against human B-cell lymphomas. J Immunother Emphasis Tumor Immunol. 1996; 19:93-101.
    • 19. Clynes R A, Towers T L, Presta L G, Ravetch J V: Inhibitory Fc receptors modulate in vivo cytoxicity against tumor targets. Nat Med. 2000; 6:443-446.
    • 20. Fijen C A, Bredius R G, Kuijper E J, et al.: The role of Fcγ receptor polymorphisms and C3 in the immune defence against Neisseria meningitidis in complement-deficient individuals. Clin Exp Immunol. 2000; 120:338-345.
    • 21. Dijstelbloem H M, Scheepers R H, Oost W W, et al.: Fcγ receptor polymorphisms in Wegener's granulomatosis: risk factors for disease relapse. Arthritis Rheum. 1999; 42:1823-1827.
    • 22. Myhr K M, Raknes G, Nyland H, Vedeler C: Immunoglobulin G Fc-receptor (FcγR) IIA and IIIB polymorphisms related to disability in MS. Neurology. 1999; 52:1771-1776.
    • 23. Koene H R, Kleijer M, Algra J, Roos D, von dem Borne AE, de Haas M: Fc γRIIIa-158V/F polymorphism influences the binding of IgG by natural killer cell Fc γRIIIa, independently of the Fc γRIIIa-48L/R/H phenotype. Blood. 1997; 90:1109-1114.
    • 24. Wu J, Edberg J C, Redecha P B, et al.: A novel polymorphism of FcγRIIIa (CD16) alters receptor function and predisposes to autoimmune disease. J Clin Invest. 1997; 100:1059-1070.
    • 25. Sondermann P, Huber R, Oosthuizen V, Jacob U: The 3.2-A crystal structure of the human IgG1 Fc fragment-Fc γRIII complex. Nature. 2000; 406:267-273.
    • 26. Harris N L, Jaffe E S, Stein H, et al.: A revised European-American classification of lymphoid neoplasms: a proposal from the International Lymphoma Study Group. Blood. 1994; 84:1361-1392.
    • 27. Brice P, Bastion Y, Lepage E, et al.: Comparison in low-tumor-burden follicular lymphomas between an initial no-treatment policy, prednimustine, or interferon alfa: a randomized study from the Groupe d'Etude des Lymphomes Folliculaires. Groupe d'Etude des Lymphomes de l'Adulte. J Clin Oncol. 1997; 15:1110-1117.
    • 28. Cheson B D, Homing S J, Coiffier B, et al.: Report of an international workshop to standardize response criteria for non-Hodgkin's lymphomas. NCI Sponsored International Working. J Clin Oncol. 1999; 17:1244.
    • 29. Jiang X M, Arepally G, Poncz M, McKenzie S E: Rapid detection of the Fc γ RIIA-H/R 131 ligand-binding polymorphism using an allele-specific restriction enzyme digestion (ASRED). J Immunol Methods. 1996; 199:55-59.
    • 30. Kaplan E, Meier P: Nonparametric estimation from incomplete observations. J Am Stat Assoc. 1958; 53:457-481.
    • 31. de Haas M, Koene H R, Kleijer M, et al.: A triallelic Fc γ receptor type IIIA polymorphism influences the binding of human IgG by NK cell Fc γ RIIIa. J Immunol. 1996; 156:3948-3955.
    • 32. Peltz G A, Grundy H O, Lebo R V, Yssel H, Barsh G S, Moore K W: Human Fc γ RIII: cloning, expression, and identification of the chromosomal locus of two Fc receptors for IgG. Proc Natl Acad Sci USA. 1989; 86:1013-1017.
    • 33. Schnackenberg L, Flesch B K, Neppert J: Linkage disequilibria between Duffy blood groups, Fc γ IIa and Fc γ IIIb allotypes. Exp Clin Immunogenet. 1997; 14:235-242.
    • 34. Shields R L, Namenuk A K, Hong K, et al.: High resolution mapping of the binding site on human IgG1 for Fc γ RI, Fc γ RII, Fc γ RIII and FcRn and design of IgG1 variants with improved binding to the Fc γ R. J Biol Chem. 2001; 276:6591-6604.
    • 35. Leppers-van de Straat F G, van der Pol W, Jansen M D, et al.: A novel PCR-based method for direct Fcγ receptor IIIa (CD16) allotyping. J Immunol Methods. 2000; 242:127-132.
    • 36. Lehrnbecher T, Foster C B, Zhu S, et al.: Variant genotypes of the low-affinity Fcγ receptors in two control populations and a review of low-affinity Fcγ receptor polymorphisms in control and disease populations. Blood. 1999; 94:4220-4232.
  • TABLE 1
    158VV 158VF 158FF p*
    n (%) 10 (20%) 22 (45%) 17 (35%)
    M 3 12 10 ns
    F 7 10 7
    Disease stage
    II-III 3 6 6 ns
    IV 7 16 11
    Bone marrow involvement
    yes 7 16 9 ns
    no 3 6 8
    Extra-nodal sites involved
    <2 8 20 13 ns
    ≧2 2 2 4
    BCL2-JH rearrangement 8 12 11 ns
    in peripheral blood
    BCL2-JH rearrangement 7 12 11 ns
    in bone marrow
    *Satistical comparisons of the three groups of homozygous FCGR3A-158V patients vs FCGR3A-158F carriers and of homozygous FCGRA-158F patients against FCGR3A/158V carriers.
  • TABLE 2
    FCGR3A-158VV carriers p*
    Clinical response at M2
    Objective response 10 (100%) 26 (67%) 0.03
    complete remission 3 7
    complete remission 1 2
    partial response 6 17
    No response 0 (0%) 13 (33%)
    no change 0 10
    progressive disease 0 3
    Clinical response at M12
    Objective response 9 (90%) 20 (51%) 0.03
    complete remission 6 11
    complete remission 1 2
    partial response 2 7
    No response 1 (10%) 19 (49%)
    no change 0 2
    progressive disease 1 17
    *Satistical comparison of homozygous FCGR3A-158V patients against FCGR3A-158F carriers. Data concerning the three genotype subgroups are given in the text.
  • TABLE 3
    FCGR3A-158VV carriers p
    Molecular response at M2 ns
    Cleaning of BCL2-JH 3 5
    Persistent BCL2-JH 3 14
    Molecular response at M12 0.03
    Cleaning of BCL2-JH 5 5
    Persistent BCL2-JH 1 12

Claims (19)

1. A method of assessing the response of a subject to a therapeutic antibody treatment, comprising determining in vitro the FCGR3A158 genotype of said subject.
2. A method of selecting patients for therapeutic antibody treatment, the method comprising determining in vitro the FCGR3A158 genotype of said subject.
3. A method of improving the efficacy or treatment condition or protocol of a therapeutic antibody treatment in a subject, comprising determining in vitro the FCGR3A158 genotype of said subject.
4. The method of claim 1, comprising determining amino acid residue at position 158 of FcγRIIIa receptor, a Valine at position 158 being indicative of a better response to said treatment and a phenylalanine at position 158 being indicative of a lower response to said treatment.
5. The method of claim 1, wherein determining amino acid residue at position 158 of FcγRIIIa receptor comprises a step of sequencing the FcγRIIIa receptor gene or RNA or a portion thereof comprising the nucleotides encoding amino acid residue 158.
6. The method of claim 1, wherein determining amino acid residue at position 158 of FcγRIIIa receptor comprises a step of amplifying the FcγRIIIa receptor gene or RNA or a portion thereof comprising the nucleotides encoding amino acid residue 158.
7. The method of claim 6, wherein amplification is performed by polymerase chain reaction (PCR), such as PCR, RT-PCR and nested PCR.
8. The method of claim 1, wherein determining amino acid residue at position 158 of FcγRIIIa receptor comprises a step of allele-specific restriction enzyme digestion.
9. The method of claim 1, wherein determining amino acid residue at position 158 of FcγRIIIa receptor comprises a step of hybridization of the FcγRIIIa receptor gene or RNA or a portion thereof comprising the nucleotides encoding amino acid residue 158, with a nucleic acid probe specific for the genotype Valine or Phenylalanine.
10. The method of claim 1, wherein determining amino acid residue at position 158 of FcγRIIIa receptor comprises:
Obtaining genomic DNA from a biological sample,
Amplifying the FcγRIIIa receptor gene or a portion thereof comprising the nucleotides encoding amino acid residue 158, and
determining amino acid residue at position 158 of said FcγRIIIa receptor gene.
11. The method of claim 1, wherein determining amino acid residue at position 158 of FcγRIIIa receptor comprises:
Obtaining genomic DNA from a biological sample,
Amplifying the FcγRIIIa receptor gene or a portion thereof comprising the nucleotides encoding amino acid residue 158,
Introducing an allele-specific restriction site,
Digesting the nucleic acids with the enzyme specific for said restriction site and,
Analysing the digestion products, i.e., by electrophoresis, the presence of digestion products being indicative of the presence of the allele.
12. The method of claim 1, wherein determining amino acid residue at position 158 of FcγRIIIa receptor comprises: total (or messenger) RNA extraction from cell or biological sample or biological fluid in vitro or ex vivo, optionally cDNA synthesis, (PCR) amplification with specific FCGRIIIa oligonucleotide primers, and analysis of PCR products.
13. The method of claim 1, wherein determining amino acid residue at position 158 of FcγRIIIa receptor comprises a step of sequencing the FcγRIIIa receptor polypeptide or a portion thereof comprising amino acid residue 158.
14. The method. of claim 1, wherein the subject is a human subject.
15. The method of claim 14, wherein the subject has a tumor, a viral infection, or a disease condition associated with allogenic or pathological immunocompetent cells.
16. The method of claim 15, wherein the subject has a tumor and the therapeutic antibody treatment aims at reducing the tumor burden.
17. The method of claim 16, wherein the tumor is a lymphoma, particularly a NHL.
18. The method of claim 1, wherein the antibody is an IgG1 or an IgG3.
19. The method of claim 18, wherein the antibody is an anti-CD20 antibody, particularly rituximab.
US12/858,343 2001-10-19 2010-08-17 Methods and compositions to evaluate antibody treatment response Abandoned US20110123996A1 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
EP01402718.9 2001-10-19
EP01402718 2001-10-19
US10/492,183 US7858300B2 (en) 2001-10-19 2002-10-11 Methods and compositions to evaluate antibody treatment response
PCT/EP2002/011397 WO2003035904A2 (en) 2001-10-19 2002-10-11 Methods and compositions to evaluate antibody treatment response
US12/858,343 US20110123996A1 (en) 2001-10-19 2010-08-17 Methods and compositions to evaluate antibody treatment response

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US12/858,343 US20110123996A1 (en) 2001-10-19 2010-08-17 Methods and compositions to evaluate antibody treatment response
US14/142,175 US20150017633A1 (en) 2001-10-19 2013-12-27 Methods and compositions to evaluate antibody treatment response

Related Parent Applications (2)

Application Number Title Priority Date Filing Date
US10/492,183 Continuation US7858300B2 (en) 2001-10-19 2002-10-11 Methods and compositions to evaluate antibody treatment response
PCT/EP2002/011397 Continuation WO2003035904A2 (en) 2001-10-19 2002-10-11 Methods and compositions to evaluate antibody treatment response

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US14/142,175 Continuation US20150017633A1 (en) 2001-10-19 2013-12-27 Methods and compositions to evaluate antibody treatment response

Publications (1)

Publication Number Publication Date
US20110123996A1 true US20110123996A1 (en) 2011-05-26



Family Applications (3)

Application Number Title Priority Date Filing Date
US10/492,183 Expired - Fee Related US7858300B2 (en) 2001-10-19 2002-10-11 Methods and compositions to evaluate antibody treatment response
US12/858,343 Abandoned US20110123996A1 (en) 2001-10-19 2010-08-17 Methods and compositions to evaluate antibody treatment response
US14/142,175 Abandoned US20150017633A1 (en) 2001-10-19 2013-12-27 Methods and compositions to evaluate antibody treatment response

Family Applications Before (1)

Application Number Title Priority Date Filing Date
US10/492,183 Expired - Fee Related US7858300B2 (en) 2001-10-19 2002-10-11 Methods and compositions to evaluate antibody treatment response

Family Applications After (1)

Application Number Title Priority Date Filing Date
US14/142,175 Abandoned US20150017633A1 (en) 2001-10-19 2013-12-27 Methods and compositions to evaluate antibody treatment response

Country Status (11)

Country Link
US (3) US7858300B2 (en)
EP (1) EP1436427B1 (en)
JP (1) JP4216720B2 (en)
CN (1) CN1329524C (en)
AT (1) AT403750T (en)
AU (1) AU2002346999B2 (en)
CA (1) CA2463746C (en)
DE (2) DE02782887T1 (en)
DK (1) DK1436427T3 (en)
ES (1) ES2311634T3 (en)
WO (1) WO2003035904A2 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070190657A1 (en) * 2004-06-15 2007-08-16 Universite Francois Rabelais Methods of assessing susceptibility to drug-induced thrombocytopenia
US9213032B2 (en) 2012-07-23 2015-12-15 Samsung Electronics Co., Ltd. Use of LRIG1 as a biomarker for identifying a subject for application of anti-c-Met antibodies

Families Citing this family (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AT403750T (en) * 2001-10-19 2008-08-15 Chru Tours Methods and compositions for the measurement of antibody treatments
AU2003257110A1 (en) * 2002-07-31 2004-02-16 University Of Southern California Polymorphisms for predicting disease and treatment outcome
BRPI0412890A (en) * 2003-07-24 2006-10-03 Innate Pharma method of treating a disease in a human subject in need thereof, pharmaceutical composition, and methods of selecting a compound for administration in conjunction with a therapeutic antibody, and to increase the efficiency of a treatment involving the administration of a therapeutic antibody that can be CD16 bound by an individual in
GB0324778D0 (en) * 2003-10-23 2003-11-26 Forinnova As Method
MY162179A (en) * 2004-04-01 2017-05-31 Elan Pharm Inc Steroid sparing agents and methods of using same
EP1732939A4 (en) * 2004-04-07 2008-09-17 Novartis Vaccines & Diagnostic Nucleic acid based assays for identification of fc receptor polymorphisms
CA2569196A1 (en) * 2004-06-01 2005-12-15 Centre Hospitalier Regional Et Universitaire De Tours Fcgr3a gebotype and methods for evaluating treatment response to non-depleting antibodies
US9109255B2 (en) * 2004-06-18 2015-08-18 The Board Of Trustees Of The Leland Stanford Junior University Methods and compositions for determining responsiveness to antibody therapy
US20060115827A1 (en) * 2004-07-01 2006-06-01 University Of Southern California Genetic markers for predicting disease and treatment outcome
GB0510790D0 (en) 2005-05-26 2005-06-29 Syngenta Crop Protection Ag Anti-CD16 binding molecules
CN101325970B (en) * 2005-11-01 2013-08-14 诺华有限公司 Application of anti-cd40 antibody
CA2627891A1 (en) * 2005-11-01 2007-05-10 Novartis Ag Uses of anti-cd40 antibodies
EP1960549A4 (en) * 2005-11-30 2010-01-13 Univ Southern California Fc polymorphisms for predicting disease and treatment outcome
EP3026123A1 (en) * 2006-04-27 2016-06-01 Klaritos, Inc. Method and kit for predicting antibody therapy
WO2008088854A2 (en) * 2007-01-18 2008-07-24 University Of Southern California Genetic markers for predicting responsiveness to combination therapy
WO2009026502A1 (en) * 2007-08-22 2009-02-26 Wyeth Nested pcr-based method for specific genotyping of the fc-gamma receptor iiia gene
US20120070432A1 (en) * 2009-05-28 2012-03-22 Amgen Inc. Treatment of pancreatic cancer using a dr5 agonist in combination with gemcitabine
EP2383572A1 (en) * 2010-04-28 2011-11-02 Assistance Publique Hôpitaux de Marseille Cellular humoral activation test (CHAT)
US9213031B2 (en) 2012-07-23 2015-12-15 Samsung Electronics Co., Ltd. Use of Cbl as biomarker for identifying subject suitable for treatment with anti-c-Met antibody
FR3037340A1 (en) 2015-06-09 2016-12-16 Univ Montpellier Prediction Method of lymphoid hematological
WO2018183717A1 (en) * 2017-03-30 2018-10-04 Robert Russell Pet waste disposable glove

Citations (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4446314A (en) * 1980-09-30 1984-05-01 Cutter Laboratories, Inc. Fractionation of heparin
US5552526A (en) * 1993-05-14 1996-09-03 Cancer Institute MDC proteins and DNAS encoding the same
US5830652A (en) * 1994-08-30 1998-11-03 New York Society For The Ruptured And Crippled Maintaining The Hospital For Special Surgery Method for determining predisposition to severe forms of autoimmune disease by determining Fcy receptor allelic patterns
US5866337A (en) * 1995-03-24 1999-02-02 The Trustees Of Columbia University In The City Of New York Method to detect mutations in a nucleic acid using a hybridization-ligation procedure
US5958953A (en) * 1996-06-27 1999-09-28 Pfizer Inc Substituted indazole derivatives
US5985561A (en) * 1996-06-03 1999-11-16 New York Society For The Relief Of The Ruptured And Crippled Maintaining The Hospital For Special Surgery FC receptor polymorphism
US6294347B1 (en) * 1988-05-27 2001-09-25 Applied Research Systems Ars Holding N.V. Human FCγ receptor III
US20020076702A1 (en) * 2000-02-17 2002-06-20 Rakesh Anand Methods
US6444789B1 (en) * 1995-05-03 2002-09-03 Applied Research Systems Ars Holding N.V. CD16-II variants
US6676927B1 (en) * 1999-01-20 2004-01-13 The Rockefeller University Animal model and methods for its use in the selection of cytotoxic antibodies
US20050064417A1 (en) * 2001-10-19 2005-03-24 Herve Watier Methods and compositions to evaluate antibody treatment response
US20070190657A1 (en) * 2004-06-15 2007-08-16 Universite Francois Rabelais Methods of assessing susceptibility to drug-induced thrombocytopenia
US20070231813A1 (en) * 2004-06-01 2007-10-04 Centre Hospitalier Regional Et Universitaire De Tours Fcgr3a Gebotype and Methods for Evaluating Treatment Response to Non-Depleting Antibodies

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB9919194D0 (en) 1999-08-14 1999-10-20 Univ Leeds Genetic marker for rheumatoid arthritis

Patent Citations (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4446314A (en) * 1980-09-30 1984-05-01 Cutter Laboratories, Inc. Fractionation of heparin
US6294347B1 (en) * 1988-05-27 2001-09-25 Applied Research Systems Ars Holding N.V. Human FCγ receptor III
US5552526A (en) * 1993-05-14 1996-09-03 Cancer Institute MDC proteins and DNAS encoding the same
US5830652A (en) * 1994-08-30 1998-11-03 New York Society For The Ruptured And Crippled Maintaining The Hospital For Special Surgery Method for determining predisposition to severe forms of autoimmune disease by determining Fcy receptor allelic patterns
US5866337A (en) * 1995-03-24 1999-02-02 The Trustees Of Columbia University In The City Of New York Method to detect mutations in a nucleic acid using a hybridization-ligation procedure
US6444789B1 (en) * 1995-05-03 2002-09-03 Applied Research Systems Ars Holding N.V. CD16-II variants
US5985561A (en) * 1996-06-03 1999-11-16 New York Society For The Relief Of The Ruptured And Crippled Maintaining The Hospital For Special Surgery FC receptor polymorphism
US5958953A (en) * 1996-06-27 1999-09-28 Pfizer Inc Substituted indazole derivatives
US6676927B1 (en) * 1999-01-20 2004-01-13 The Rockefeller University Animal model and methods for its use in the selection of cytotoxic antibodies
US20020076702A1 (en) * 2000-02-17 2002-06-20 Rakesh Anand Methods
US20050064417A1 (en) * 2001-10-19 2005-03-24 Herve Watier Methods and compositions to evaluate antibody treatment response
US20070231813A1 (en) * 2004-06-01 2007-10-04 Centre Hospitalier Regional Et Universitaire De Tours Fcgr3a Gebotype and Methods for Evaluating Treatment Response to Non-Depleting Antibodies
US20070190657A1 (en) * 2004-06-15 2007-08-16 Universite Francois Rabelais Methods of assessing susceptibility to drug-induced thrombocytopenia

Non-Patent Citations (9)

* Cited by examiner, † Cited by third party
Carlotti et al Haematologica 2007 92(8):1127-1130 *
Dornan et al Blood 2010 116(20);4212-4222 *
Etienne-Grimaldi et al Br J Clin Pharmacol 2012 73(5):776-785 *
Ghesquieres et al Blood 2012 120(13)2650-2657 *
Hurvitz et al. Clin Cancer Res 2012 120(13):2650-2657. *
Mellor et al. Journal of Hematology and Oncology 2013 Vol 6 No 1 pages 1-10 *
Paez et al Cancer Sci 2010 101(9):2048-2053 *
Prochazka et al. Neoplasma 2011 58(3):263-270. *
Tamura et al. Ann Oncol 2011 22(6):1302-1307 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070190657A1 (en) * 2004-06-15 2007-08-16 Universite Francois Rabelais Methods of assessing susceptibility to drug-induced thrombocytopenia
US9213032B2 (en) 2012-07-23 2015-12-15 Samsung Electronics Co., Ltd. Use of LRIG1 as a biomarker for identifying a subject for application of anti-c-Met antibodies

Also Published As

Publication number Publication date
CN1329524C (en) 2007-08-01
JP4216720B2 (en) 2009-01-28
US20150017633A1 (en) 2015-01-15
CA2463746A1 (en) 2003-05-01
US7858300B2 (en) 2010-12-28
DK1436427T3 (en) 2008-12-08
AT403750T (en) 2008-08-15
WO2003035904A3 (en) 2003-10-16
EP1436427B1 (en) 2008-08-06
US20050064417A1 (en) 2005-03-24
DE02782887T1 (en) 2005-01-13
AU2002346999B2 (en) 2007-11-08
JP2005506093A (en) 2005-03-03
DE60228108D1 (en) 2008-09-18
CA2463746C (en) 2014-09-02
EP1436427A2 (en) 2004-07-14
WO2003035904A2 (en) 2003-05-01
CN1571850A (en) 2005-01-26
ES2311634T3 (en) 2009-02-16

Similar Documents

Publication Publication Date Title
Neri et al. p53 gene mutations in multiple myeloma are associated with advanced forms of malignancy
Meetei et al. X-linked inheritance of Fanconi anemia complementation group B
Provan et al. Eradication of polymerase chain reaction-detectable chronic lymphocytic leukemia cells is associated with improved outcome after bone marrow transplantation
Tohma et al. PTEN (MMAC1) mutations are frequent in primary glioblastomas (de novo) but not in secondary glioblastomas
Otsu et al. Refinement of diagnostic assays for a probable causal mutation for porcine and human malignant hyperthermia
Corradini et al. Molecular monitoring of minimal residual disease in follicular and mantle cell non-Hodgkin's lymphomas treated with high-dose chemotherapy and peripheral blood progenitor cell autografting
van Meerten et al. Complement-induced cell death by rituximab depends on CD20 expression level and acts complementary to antibody-dependent cellular cytotoxicity
Dall’Ozzo et al. Rituximab-dependent cytotoxicity by natural killer cells: influence of FCGR3A polymorphism on the concentration-effect relationship
US6416948B1 (en) Methods for detection of rearranged DNA
Diepstra et al. Association with HLA class I in Epstein-Barr-virus-positive and with HLA class III in Epstein-Barr-virus-negative Hodgkin's lymphoma
Carroll et al. p53 oncogene mutations in three human prostate cancer cell lines
Kong et al. Consistent detection of TLS/FUS-ERG chimeric transcripts in acute myeloid leukemia with t (16; 21)(p11; q22) and identification of a novel transcript
Alfarano et al. An alternatively spliced form of CD79b gene may account for altered B-cell receptor expression in B-chronic lymphocytic leukemia
Blank et al. Decreased transcription of the human FCGR2B gene mediated by the-343 G/C promoter polymorphism and association with systemic lupus erythematosus
Boross et al. Mechanisms of action of CD20 antibodies
Lens et al. p53 abnormalities in CLL are associated with excess of prolymphocytes and poor prognosis
Mellor et al. A critical review of the role of Fc gamma receptor polymorphisms in the response to monoclonal antibodies in cancer
Moroni et al. Gene copy number for epidermal growth factor receptor (EGFR) and clinical response to antiEGFR treatment in colorectal cancer: a cohort study
Bowles et al. Anti-CD20 monoclonal antibody with enhanced affinity for CD16 activates NK cells at lower concentrations and more effectively than rituximab
Kim et al. FCGR3A gene polymorphisms may correlate with response to frontline R-CHOP therapy for diffuse large B-cell lymphoma
Van Dongen et al. Standardized RT-PCR analysis of fusion gene transcripts from chromosome aberrations in acute leukemia for detection of minimal residual disease
Chao et al. Anti-CD47 antibody synergizes with rituximab to promote phagocytosis and eradicate non-Hodgkin lymphoma
Bibeau et al. Impact of FcγRIIa-FcγRIIIa polymorphisms and KRAS mutations on the clinical outcome of patients with metastatic colorectal cancer treated with cetuximab plus irinotecan
Rozzo et al. Evidence for an interferon-inducible gene, Ifi202, in the susceptibility to systemic lupus
WO2003026493A2 (en) Diagnosis and treatment of diseases caused by mutations in cd72