Connect public, paid and private patent data with Google Patents Public Datasets

Gene relating to estimation of postoperative prognosis for breast cancer

Download PDF


Publication number
US20110009284A1 US12785213 US78521310A US20110009284A1 US 20110009284 A1 US20110009284 A1 US 20110009284A1 US 12785213 US12785213 US 12785213 US 78521310 A US78521310 A US 78521310A US 20110009284 A1 US20110009284 A1 US 20110009284A1
Grant status
Patent type
Prior art keywords
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Application number
Mitsuru Emi
Masamitsu Onda
Hisaki Nagai
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Mitsubishi Rayon Co Ltd
Nippon Medical School Foundation
Original Assignee
Mitsubishi Rayon Co Ltd
Nippon Medical School Foundation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date




    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Hybridisation probes
    • C12Q1/6883Hybridisation probes for diseases caused by alterations of genetic material
    • C12Q1/6886Hybridisation probes for diseases caused by alterations of genetic material for cancer
    • G01N33/00Investigating or analysing materials by specific methods not covered by the preceding groups
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay
    • G01N33/574Immunoassay; Biospecific binding assay for cancer
    • G01N33/57407Specifically defined cancers
    • G01N33/57415Specifically defined cancers of breast
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/118Prognosis of disease development


It is intended to provide a system of predicting the postoperative prognosis in a patient with breast cancer from the viewpoint of gene expression based on the data obtained by genome-wide and comprehensive analysis on gene expression in breast cancer. Expression of human genes is comprehensively analyzed by using a DNA microarray and gene expression functions in various breast cancer conditions are compared, thereby establishing a system of predicting the postoperative prognosis of breast cancer.


  • [0001]
    This application is a divisional application of U.S. application Ser. No. 10/590,219, filed on Jan. 17, 2007, which is currently pending. This application claims priority to U.S. application Ser. No. 10/590,219, to International Application No. PCT/JP04/12455, filed on Aug. 24, 2004, and to Japanese Patent Application No. JP 2004-048593, filed on Feb. 24, 2004. The contents of all priority applications are incorporated by reference herein in their entireties.
  • [0002]
    The present invention relates to a gene correlated with prediction of the postoperative prognosis of breast cancer. Further, the present invention relates to a method of inspecting the postoperative prognosis of breast cancer using this gene, a method of screening cancer therapeutic medicines for controlling the postoperative prognosis of breast cancer, and a diagnosis kit for the postoperative prognosis of breast cancer.
  • [0003]
    Breast cancer is a disease situated as a superior cause for female lethality due to cancer, however, there are found still no dominant reasons for determining the grade of malignancy and survival prognosis from the biological standpoint.
  • [0004]
    The condition of an estrogen receptor (ER) is one determining element for clinical and biological symptoms of human breast cancer. Adjuvant hormone therapeutics is usually effective in ER-positive breast cancer patients irrespective of age, condition in the menopause, correlation with axillary nodes, and tumor diameter. However, ER-negative breast cancer is resistance to this therapeutic method (J Clin Oncology (2001) 19, 3817-1827, Breast Cancer (2001) 8, 298-304). Patients having an ER-negative tumor do not necessarily show the same response to chemical therapy. Since existent indices cannot classify breast cancer of this type depending on clinical symptom, the postoperative prognosis is recognized to be various (J Natl Inst (1991) 83, 154-155, J Natl Cancer Inst (2000) 93, 979-989).
  • [0005]
    Prognosis of breast cancer patients with no lymph node metastasis (node-negative breast cancer; n0) is better than that of metastatic breast cancer patients. However, in Japan, the present inventors have found that 16% of node-negative breast cancer patients replapse within 5 years after the initial operation (Clin Cancer Res (2000) 6, 3193-3198).
  • [0006]
    Prediction of the postoperative prognosis of breast cancer patients shows increasing in importance from the standpoint of adjuvant therapeutics currently utilizable. A gene marker which is useful in identifying patients showing a possibility of relapsing after an operation gives a merit which suitable preoperative adjuvant therapeutics can be applied to a high risk patient, and enables prevention of occurrence of unnecessary, complicated and uncomfortable side effects.
  • [0007]
    Conventionally, postoperative procedures for individual patients are determined depending on tumor diameter and the stage, metastasis to a lymph node, diagnosis by clinicopathological factors, search of a hormone receptor, and the like, however, they are not critical methods (Cancer (1982) 50, 2131-2138, Histopathology (1991) 19, 403-410, Int J Cancer (1996) 69, 135-141, Am J Clin Oncol (1997) 20, 546-551, Eur J Cancer (2002) 38, 1329-1334, Jpn J Cancer Res (2000) 91, 293-300).
  • [0008]
    Recently, there is a prognosis marker for postoperative breast cancer patients, intending determination of an importance of mutations of genes. These gene mutations include a mutation of p53 (Breast Cancer Res Treat (2001) 69, 65-68), loss of heterozygosity in several alleles (Int J Clin Oncol (2001) 6, 6-12), and abnormal expressions of a BRCA2 gene (Int J Cancer (2002) 198, 879-882), WTI gene (Clin Cancer Res (2002) 8, 1167-1171), HER2/neu gene (Arch Surg (2000) 135, 1469-1474) and Ki-67 gene (J Pathol (1999) 187, 207-216). However, these would not be recognized as effective prognosis predicting means when taking into consideration a fact which a cancer is a disease owing to accumulation of abnormalities of multiple genes.
  • [0009]
    Further, in these years, genome projects in various organisms are being progressed, and a lot of genes and their base sequences typically including a human gene are being clarified quickly. The function of a gene having a clarified sequence can be checked by various methods. As one of the effective methods, known is a gene expression analysis method utilizing clarified base sequence information. For example, there are developed methods utilizing various nucleic acid-nucleic acid hybridization reactions and various PCR reactions as typified by Northern Hybridization, and relations between various genes and expressions of their organism functions can be checked by these methods. Though the number of applicable genes is limited in these methods, there have been developed a methodology and a novel analysis method called DNA microarray method (DNA chip method) enabling lump expression analysis of multiple genes, for carrying out comprehensive and systemic analysis of extremely many genes such as one individual level, as being clarified recently through genome projects.
  • [0010]
    As the DNA microarray, a lot of shapes are known such as that in which DNA synthesis is conducted on many discrete cells applying a lithography technology (U.S. Pat. No. 5,445,934), that in which cells composed of grooves or holes are formed on a board and a probe is fixed to the inner wall of the cell (Tokkyo KOKAI (unexamined Japanese patent application) Nos. 11-108928, 2000-78998), a microarray in which a probe is fixed to a gel such as acrylamide and the like for increasing the amount of a probe to be fixed on a chip (U.S. Pat. No. 5,770,721, Tokkyo KOKAI No. 2000-60554), and the like.
  • [0011]
    Also known is a microarray obtained by fabricating a nucleic acid fixed gel retaining fiber array which retains a nucleic acid fixed gel, and cutting this array along a direction crossing the fiber axis of the array (Tokkyo KOKAI Nos. 2000-270878, 2000-270879).
  • [0012]
    Recent studies have found that a cDNA microarray technology is effective for identification of a novel gene marker for cancer diagnosis. To date, some researchers have carried out microarray analysis of breast cancer, however, there is no description about data of breast cancer gene expression property capable of predicting the postoperative prognosis of breast cancer (Proc Natl Acad Sci USA (1999) 96, 9212-9217, Nature (2000) 406, 747-752, Proc Natl Acad Sci USA (2001) 98, 11462-11467, Cancer Res (2001) 61, 5979-5984, Cancer Res (2000) 60, 2232-2238, Cancer Res (2001) 61, 5168-5178, Proc Natl Acad Sci USA (2001) 98, 10869-10874). As one exception, it is shown that a specific profile of a lymph node metastasis negative tumor gives a prediction of a short interval before progressing to distant metastasis (N Engl J Med (2002) 347, 1999-2009).
  • [0013]
    The present invention has an object of providing innovative means for predicting the postoperative prognosis of breast cancer patients from the standpoint of gene expression, based on results obtained by genome-wide and comprehensive analysis on gene expression in breast cancer.
  • [0014]
    The present inventors have comprehensively analyzed gene expression of a human gene by a DNA microarray and compared gene expression functions of breast cancers in various conditions, thereby, establishing a system for predicting the postoperative prognosis of breast cancer.
  • [0015]
    That is, the present invention provides the following genes (groups) (1) to (8).
  • [0016]
    (1) A gene consisting of at least one of the following definitions correlated with prediction of the postoperative prognosis of breast cancer;
  • [0017]
    1) a marker gene group capable of establishing classification of genes from breast cancer patients died within 5 years after a surgical operation (5y-D group) and genes from patients survived free of disease for several years or more after the operation (5y-S group), depending on their expression functions, in estrogen receptor-negative breast cancer,
  • [0018]
    2) a marker gene group capable of establishing classification of genes from n0 breast cancer patients recurred within 5 years after an operation (5Y-R group) and genes from patients survived free of disease for 5 years or more after the operation (5Y-F group), depending on their expression functions, in (node-negative)(n0) breast cancer with no metastasis to a lymph node in the operation,
  • [0019]
    3) a marker gene group capable of establishing classification of genes from breast cancer patients died within 5 years after a surgical operation (5D group) and genes from patients survived free of disease for several years or more after the operation (5S group), depending on their expression functions, in primary breast cancer.
  • [0020]
    (2) A gene selected from the following sequences correlated with prediction of the postoperative prognosis of primary breast cancer;
    • pro-alpha-1 type 3 collagen (PIIIP),
    • complement component Clr,
    • dihydropyrimidinase-like 3 (DPYSL3),
    • protein tyrosine kinase 9-like (PTK9L),
    • carboxypeptidase E (CPE),
    • alpha-tubulin,
    • beta-tubulin,
    • heat shock protein HSP 90-alpha gene,
    • malate dehydrogenase,
    • NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 3 (NDUFB3).
  • [0031]
    (3) A gene selected from the following sequences highly expressed in a group of good prognosis correlated with prediction of the postoperative prognosis of primary breast cancer;
    • pro-alpha-1 type 3 collagen (PIIIP),
    • complement component Clr,
    • dihydropyrimidinase-like 3 (DPYSL3),
    • protein tyrosine kinase 9-like (PTK9L),
    • carboxypeptidase E (CPE),
    • alpha-tubulin,
    • beta-tubulin.
  • [0039]
    (4) A gene selected from the following sequences highly expressed in a group of bad prognosis correlated with prediction of the postoperative prognosis of primary breast cancer;
    • heat shock protein HSP 90-alpha gene,
    • malate dehydrogenase,
    • NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 3 (NDUFB3).
  • [0043]
    (5) A gene selected from the following sequences correlated with prediction of the postoperative prognosis, in (node-negative)(n0) breast cancer with no metastasis to a lymph node in operation;
    • AF058701/DNA polymerase zeta catalytic subunit (REV3),
    • AI066764/lectin, galactoside-binding, souble, 1 (galectin 1),
    • x15940/ribosomal protein L31,
    • Hs.94653/neurochondrin (KIAA0607),
    • M13436/ovarian beta-A-inhibin,
    • Hs.5002/copper chaperone for superoxide dismutase; CCS,
    • D67025/proteasome (prosome, macropain) 26S subunit, non-ATPase, 3,
    • M80469/MHC class I HLA-J gene,
    • Hs.4864/ESTs,
    • Hs.106326/ESTs.
  • [0054]
    (6) A gene selected from the following sequences highly expressed in a group of bad prognosis correlated with prediction of the postoperative prognosis, in (node-negative)(n0) breast cancer with no metastasis to a lymph node in operation;
    • AF058701/DNA polymerase zeta catalytic subunit (REV3),
    • AI066764/lectin, galactoside-binding, soluble, 1 (galectin 1),
    • x15940/ribosomal protein L31.
  • [0058]
    (7) A gene selected from the following sequences highly expressed in a group of good prognosis correlated with prediction of the postoperative prognosis, in (node-negative)(n0) breast cancer with no metastasis to a lymph node in operation;
    • Hs.94653/neurochondrin (KIAA0607),
    • M13436/ovarian beta-A-inhibin,
    • Hs.5002/copper chaperone for superoxide dismutase; CCS,
    • D67025/proteasome (prosome, macropain) 26S subunit, non-ATPase, 3,
    • M80469/MHC class I HLA-J gene,
    • Hs.4864/ESTs,
    • Hs.106326/ESTs.
  • [0066]
    (8) A gene selected from the following sequences correlated with prediction of the postoperative prognosis, in estrogen receptor-negative breast cancer;
    • Hs.108504/FLJ20113/ubiquitin-specific protease otubain 1
    • Hs.146550/MYH9/myosin, heavy polypeptide 9, non-muscle
    • Hs.194691/RAI3/retinoic acid induced 3
    • Hs.1975/TDRD3/tudor domain containing 3
    • Hs.203952/TRRAP/transformation/transcription domain-associated protein
    • Hs.278607/GSA7/ubiquitin activating enzyme E1-like protein
    • Hs.429/ATP5G3/
  • [0074]
    ATP synthase, H+ transporting, mitochondrial F0complex, subunitc (subunit9) isoform3
    • Hs.75305/AIP/aryl hydrocarbon receptor interacting protein
    • Hs.81170/PIM1/pim-1 oncogene
    • Hs.99987/ERCC2/
  • [0078]
    excision repaircross-complementingrodentrepairdeficiency, complementationgroup2
    • Y12781/Transducin (beta) like 1 protein
    • Hs.104417/KIAA1205 protein
    • c1.21783/Hypothetical protein
    • Hs.112628/Hypothetical protein: MGC43581
    • Hs.170345/Hypothetical protein FLJ13710
    • Hs.53996/weakly similar to zinc finger protein 135
    • Hs.55422/Hypothetical protein
    • Hs.112718/EST
    • Hs.115880/EST
    • Hs.126495/EST
  • [0089]
    The present invention also provides a gene selected from the above-mentioned (8), as a gene highly expressed in a group of bad prognosis.
  • [0090]
    Further, the present invention provides a DNA microarray carrying thereon the gene according to any one of the above-mentioned (1) to (8) and/or a probe specific to the gene, and preferably, the DNA microarray is a fiber type microarray.
  • [0091]
    The above-mentioned gene and/or probe specific to the gene can be used as a marker in a method of inspecting the postoperative prognosis of breast cancer. Further, it can be also used as a marker for cancer therapeutic medicines for controlling the postoperative prognosis of breast cancer. The above-mentioned microarray can be used in a method of inspecting the postoperative prognosis of breast cancer.
  • [0092]
    Further, the present invention provides a method of screening cancer therapeutic medicines for controlling the postoperative prognosis of breast cancer using as a marker the above-mentioned gene and/or probe specific to the gene. The above-mentioned microarray can be used in the above-mentioned screening method.
  • [0093]
    The marker can be included as a reagent, and can be used as a diagnosis kit for the postoperative prognosis of breast cancer. The reagent kit includes a DNA microarray carrying thereon a marker, preferably, a fiber type microarray.
  • [0094]
    According to the means of the present invention, completely novel breast cancer correlated genes have been found and simultaneously, it has been found that these genes are correlated deeply with malignant degeneration of breast cancer and finally, exert an influence on the prognosis of breast cancer patients. Further, by establishing a mathematical formula for evaluating expression condition of the found gene, a completely novel and effective breast cancer postoperative prognosis predicting system has been developed. The system of the present invention from the standpoint of gene expression is believed to be an innovative prognosis predicting system arresting the biological essentiality of a cancer, utterly different from conventional prognosis evaluation methods, when taking into consideration a fact which a cancer is a disease owing to abnormality of a gene.
  • [0095]
    The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the office upon request and payment of the necessary fee.
  • [0096]
    FIG. 1 is a photograph showing a gene group (A) manifesting increase and a gene group (B) manifesting decrease in expression in 5y-D group as compared with 5y-S group.
  • [0097]
    FIG. 2 is a photograph showing analysis results of semi-quantitative RT-PCR of RNAs derived from 5y-S group and 5y-D group.
  • [0098]
    FIG. 3 shows prognosis scores in individual patients.
  • [0099]
    FIG. 4 is a photograph showing analysis results of semi-quantitative RT-PCR of RNAs derived from 5Y-F group and 5Y-R group.
  • [0100]
    FIG. 5 is a photograph showing analysis results of semi-quantitative RT-PCR of RNAs derived from 5Y-F group and 5Y-R group.
  • [0101]
    FIG. 6 shows prognosis scores in individual patients.
  • [0102]
    FIG. 7 is a photograph showing analysis results of semi-quantitative PCR of 7 genes highly expressed in 5S tumor.
  • [0103]
    M: marker ladder
  • [0104]
    S1-S10: newly inspected tissues of patients survived free of disease for 5 years or more after operation.
  • [0105]
    D1-D10: newly inspected cases of patients died of breast cancer within 5 years after operation.
  • [0106]
    Difference in expression strength was evaluated by Student's t-test; when p value is 0.05 or less, statistical significance is believed to be present.
  • [0107]
    FIG. 8 is a photograph showing analysis results of semi-quantitative PCR of 3 genes highly expressed in 5D group. For explanation of marks, please see explanation in FIG. 7.
  • [0108]
    FIG. 9 shows results illustrating prognosis indices (PI) of newly inspected 20 cases. The indices of all 10 patients survived free of disease for 5 years or more were higher than 7. On the other hand, the indices of patients died of breast cancer within 5 years after operation were lower than 7. Distribution of two groups is statistically significant (p=0.0002).
  • [0109]
    The marker gene group correlated with prediction of the postoperative prognosis of breast cancer as one aspect of the present invention is obtained by analysis by cDNA microarray of the expression functions of genes from patients manifesting death or recurring within 5 years after a surgical operation and patients survived for 5 years or more after the operation, in estrogen receptor-negative breast cancer, node-negative breast cancer and primary breast cancer.
  • [0110]
    Specifically, one aspect of the present invention is a gene consisting of at least one of the following definitions selected from known sequences correlated with prediction of the postoperative prognosis of breast cancer;
  • [0111]
    1) a marker gene group capable of establishing classification of genes from breast cancer patients died within 5 years after a surgical operation (5y-D group) and genes from patients survived free of disease for several years or more after the operation (5y-S group), depending on their expression functions, in estrogen receptor-negative breast cancer,
  • [0112]
    2) a marker gene group capable of establishing classification of genes from n0 breast cancer patients recurred within 5 years after an operation (5Y-R group) and genes from patients survived free of disease for 5 years or more after the operation (5Y-F group), depending on their expression functions, in (node-negative)(n0) breast cancer with no metastasis to a lymph node in the operation,
  • [0113]
    3) a marker gene group capable of establishing classification of genes from breast cancer patients died within 5 years after a surgical operation (5D group) and genes from patients survived free of disease for several years or more after the operation (5S group), depending on their expression functions, in primary breast cancer.
  • [0114]
    The gene correlated with prediction of the postoperative prognosis of breast cancer of the present invention is obtained by evaluating the data of a cDNA microarray using a Random-permutation test and a Mann-Whitney test. The present invention presents an approach more useful at clinical level, by evaluating gene expression functions by a combination of a cDNA microarray and a semi-quantitative PCR experiment.
  • [0115]
    In the present invention, a gene correlated with prediction of the postoperative prognosis of primary breast cancer has been identified by evaluating gene expression functions in breast cancer patients.
  • [0116]
    Specifically, one aspect of the present invention is a gene selected from the following sequences selected from known sequences correlated with prediction of the postoperative prognosis of primary breast cancer;
    • pro-alpha-1 type 3 collagen (PIIIP),
    • complement component Clr,
    • dihydropyrimidinase-like 3 (DPYSL3),
    • protein tyrosine kinase 9-like (PTK9L),
    • carboxypeptidase E (CPE),
    • alpha-tubulin,
    • beta-tubulin,
    • heat shock protein HSP 90-alpha gene,
    • malate dehydrogenase,
    • NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 3 (NDUFB3).
  • [0127]
    In the present invention, “high expression” means that the expression level of a subject gene is, when compared with the average value of the expression levelss of the same gene in a parent population, higher than the average value, for example, 2-fold or more of the average value.
  • [0128]
    In the present invention, “low expression” means that the expression level of a subject gene is, when compared with the average value of the expression levels of the same gene in a parent population, lower than the average value, for example, 2-fold or less of the average value.
  • [0129]
    Some of the above-mentioned genes are believed to be correlated with proliferation or distant metastasis of tumor cells, and for example, a heat shock protein HSP 90-alpha is a chaperone for a lot of kinases, and has a possibility of promoting growth of cancer cells (Neckers, L (2002) Trends Mol Med 8, S55-61). Malate dehydrogenase is an important enzyme correlated with energy accompanying aerobic or anaerobic metabolism, and the activity of malate dehydrogenase is correlated with a tumor marker for squamous cell carcinoma (Ross, C. D., et al. (2000) Otolaryngol Head Neck Surg 122, 195-200). NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 3(NDUFB3) belongs to an mitochondorial electron transport chain, and chromosome abnormality in a region containing NDUFB3 is remarkable in a breast cancer cell line MDA-MB-231 (Xie, D., et al. (2002) Int J Oncol 21, 499-507).
  • [0130]
    The above-mentioned 10 genes correlated with prediction of the postoperative prognosis of primary breast cancer show different expressions in a group of good prognosis (5S group) and a group of bad prognosis (5Y group), and 7 genes among the 10 genes are genes highly expressed in a group of good prognosis (5S group).
  • [0131]
    Namely, one aspect of the present invention is a gene selected from the following sequences highly expressed in a group of good prognosis selected from known sequences correlated with prediction of the postoperative prognosis of primary breast cancer;
    • pro-alpha-1 type 3 collagen (PIIIP),
    • complement component Clr,
    • dihydropyrimidinase-like 3 (DPYSL3),
    • protein tyrosine kinase 9-like (PTK9L),
    • carboxypeptidase E (CPE),
    • alpha-tubulin,
    • beta-tubulin.
  • [0139]
    3 genes among the 10 genes correlated with prediction of the postoperative prognosis of primary breast cancer are genes highly expressed in a group of bad prognosis (5Y group). Namely, one aspect of the present invention is a gene selected from the following sequences highly expressed in a group of bad prognosis selected from known sequences correlated with prediction of the postoperative prognosis of primary breast cancer;
    • heat shock protein HSP 90-alpha gene,
    • malate dehydrogenase,
    • NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 3 (NDUFB3).
  • [0143]
    Here, the prediction index (PI) for primary breast cancer is defined as described below and can be used for prediction of the postoperative prognosis of breast cancer.
  • [0000]

    Prediction index (PI)=(total of normalized expression ratios of the above-mentioned 7 genes highly expressed in a group of good prognosis in breast cancer tissue)−(total of normalized expression ratios of the above-mentioned 3 genes highly expressed in a group of bad prognosis in breast cancer tissue)
  • [0144]
    In the present invention, gene expression functions in breast cancer patients have been evaluated and 10 genes correlated with prediction of the postoperative prognosis of node-negative breast cancer have been identified.
  • [0145]
    Specifically, one aspect of the present invention is a gene selected from the following sequences selected from known sequences correlated with prediction of the postoperative prognosis, in (node-negative)(n0) breast cancer with no metastasis to a lymph node in operation;
    • AF058701/DNA polymerase zeta catalytic subunit (REV3),
    • AI066764/lectin, galactoside-binding, soluble, 1 (galectin 1),
    • x15940/ribosomal protein L31,
    • Hs.94653/neurochondrin (KIAA0607),
    • M13436/ovarian beta-A-inhibin,
    • Hs.5002/copper chaperone for superoxide dismutase; CCS,
    • D67025/proteasome (prosome, macropain) 26S subunit, non-ATPase, 3,
    • M80469/MHC class I HLA-J gene,
    • Hs.4864/ESTs,
    • Hs.106326/ESTs.
  • [0156]
    The above-mentioned genes correlated with prediction of the postoperative prognosis of node-negative breast cancer include genes correlated with proliferation and distant metastasis of tumor cells. For example, galectin 1 is an autocrine type cancer repressor for regulating cell differentiation (Axel H, et al. (2003) Int. J. Cancer, 103: 370-379). Further, a gene activating cancer metastasis is included.
  • [0157]
    The above-mentioned 10 genes correlated with prediction of the postoperative prognosis of node-negative breast cancer show different expressions in a group of good prognosis (5Y-F group) and a group of bad prognosis (5Y-R group), and 3 genes among the 10 genes are genes highly expressed in a group of bad prognosis (5Y-R group). Namely, one aspect of the present invention is a gene selected from the following sequences highly expressed in a group of bad prognosis selected from known sequences correlated with prediction of the postoperative prognosis, in node-negative breast cancer in operation;
    • AF058701/DNA polymerase zeta catalytic subunit (REV3),
    • AI066764/lectin, galactoside-binding, soluble, 1 (galectin 1),
    • x15940/ribosomal protein L31.
  • [0161]
    7 genes among the 10 genes correlated with prediction of the postoperative prognosis of node-negative breast cancer are genes highly expressed in a group of good prognosis (5Y-F group). Namely, one aspect of the present invention is a gene selected from the following sequences highly expressed in a group of good prognosis selected from known sequences correlated with prediction of the postoperative prognosis, in node-negative breast cancer;
    • Hs.94653/neurochondrin (KIAA0607),
    • M13436/ovarian beta-A-inhibin,
    • Hs.5002/copper chaperone for superoxide dismutase; CCS,
    • D67025/proteasome (prosome, macropain) 26S subunit, non-ATPase, 3,
    • M80469/MHC class I HLA-J gene,
    • Hs.4864/ESTs,
    • Hs.106326/ESTs.
  • [0169]
    Here, the prognosis score (PS) for node-negative breast cancer is defined as described below and can be used for prediction of the postoperative prognosis of breast cancer.
  • [0000]

    Prognosis score (PS)=(total of normalized expression ratios of the above-mentioned 3 genes highly expressed in a group of bad prognosis in breast cancer tissue)−(total of normalized expression ratios of the above-mentioned 7 genes highly expressed in a group of good prognosis in breast cancer tissue).
  • [0170]
    In the present invention, 20 genes correlated with prediction of the postoperative prognosis of estrogen receptor-negative breast cancer have been identified, by evaluating gene expression functions in breast cancer patients.
  • [0171]
    Specifically, one aspect of the present invention is a gene selected from the following sequences selected from known sequences correlated with prediction of the postoperative prognosis, in estrogen receptor-negative breast cancer;
    • Hs.108504/FLJ20113/ubiquitin-specific protease otubain 1
    • Hs.146550/MYH9/myosin, heavy polypeptide 9, non-muscle
    • Hs.194691/RAI3/retinoic acid induced 3
    • Hs.1975/TDRD3/tudor domain containing 3
    • Hs.203952/TRRAP/transformation/transcription domain-associated protein
    • Hs.278607/GSA7/ubiquitin activating enzyme E1-like protein
    • Hs.429/ATP5G3/ATP synthase, H+transporting,
    • mitochondrialF0complex, subunitc (subunit9) isoform3
    • Hs.75305/AIP/aryl hydrocarbon receptor interacting protein
    • Hs.81170/PIMI/pim-1 oncogene
    • Hs.99987/ERCC2/excisionrepaircross-complementingrodentrepairdeficiency,complementationgroup2
    • Y12781/Transducin (beta) like 1 protein
    • Hs.104417/KIAA1205 protein
    • cl.21783/Hypothetical protein
    • Hs.112628/Hypothetical protein: MGC43581
    • Hs.170345/Hypothetical protein FLJ13710
    • Hs.53996/weakly similar to zinc finger protein 135
    • Hs.55422/Hypothetical protein
    • Hs.112718/EST
    • Hs.115880/EST
    • Hs.126495/EST
  • [0193]
    The above-mentioned genes correlated with prediction of the postoperative prognosis of estrogen receptor-negative breast cancer include genes correlated with proliferation and distant metastasis of tumor cells. For example, PIM1 is serine/threonine kinase, and there is a correlation between clinical results of prostate cancer and the expression (Oesterreich, S., et al. (1996) Clin Cancer Res, 2, 1199-1206). TRRAP protein is a subunit of a mammal HTA complex, and antisense RNA against TRRAP inhibits estrogen-dependent growth of breast cancer cells.
  • [0194]
    The above-mentioned 20 genes correlated with prediction of the postoperative prognosis of estrogen receptor-negative breast cancer show high expression in a group of bad prognosis (5y-D group). Namely, one aspect of the present invention is a gene selected from known sequences correlated with prediction of the postoperative prognosis, in the above-mentioned estrogen receptor-negative breast cancer highly expressed in a group of bad prognosis.
  • [0195]
    Here, postoperative prognosis of breast cancer can be predicted as described below, based on the expression of the above-mentioned gene correlated with prediction of the postoperative prognosis of estrogen receptor-negative breast cancer;
  • [0196]
    (1) when the expression levels in breast cancer tissue of the above-mentioned 20 genes correlated with prediction of the postoperative prognosis of estrogen receptor-negative breast cancer are compared with the average value in a parent population, and if the expression level of each gene is 2-fold or more of the average value in a parent population, one point is imparted,
  • [0197]
    (2) when the procedure of (1) is carried out on 20 genes, and if the total point is 8 points or more, prognosis is decided to be bad.
  • [0198]
    The above-mentioned gene correlated with prediction of the postoperative prognosis of breast cancer can be used as a marker for inspection of breast cancer postoperative prognosis. Namely, one aspect of the present invention is a method of inspecting the postoperative prognosis of breast cancer using the above-mentioned gene as a marker.
  • [0199]
    The above-mentioned gene correlated with prediction of the postoperative prognosis of breast cancer can be used as a marker for screening of cancer therapeutic medicines for controlling the postoperative prognosis of breast cancer. Namely, one aspect of the present invention is a method of screening cancer therapeutic medicines for controlling the postoperative prognosis of breast cancer using the above-mentioned gene as a marker.
  • [0200]
    The above-mentioned gene correlated with prediction of the postoperative prognosis of breast cancer can be used as a marker for diagnosis of the postoperative prognosis of breast cancer. It is also possible to design probes specific to the above-mentioned gene and to use these probes as a marker. These probes can be designed, for example, by Probe Quest (registered trademark) manufactured by Dyna Com. Namely, one aspect of the present invention is a diagnosis kit for the postoperative prognosis of breast cancer containing a reagent using the above-mentioned gene as a marker.
  • [0201]
    The above-mentioned diagnosis kit can include a microarray. Namely, one aspect of the present invention is the diagnosis kit, wherein the diagnosis kit includes a microarray.
  • [0202]
    The microarray of the above-mentioned diagnosis kit including a microarray includes a fiber type microarray. Here, for a method of preparing a fiber type microarray, the above-mentioned patent documents 6 to 7 are cited. Namely, one aspect of the present invention is the above-mentioned diagnosis kit wherein the microarray is a fiber type microarray.
  • [0203]
    Next, aspects of the present invention will be specifically illustrated by examples, but the present invention is not limited to these examples.
  • Example 1
  • [0204]
    Evaluation of gene expression function for prediction of the postoperative prognosis in estrogen receptor-negative breast cancer
  • (Tissue Sample)
  • [0205]
    An informed consent was obtained according to a guide line accepted by an ethics committee of Cancer Society and by Nippon Medical School, then, primary breast cancer and tissue from adjacent normal mammary gland were collected from breast cancer patients who undergone an operation in 1995 to 1997 in Cancer Society attached hospital (Tokyo). The tissue was quickly frozen and preserved at −80° C. For 954 patients, all members were clinically traced during a period of 5 years or more or until death, and samples were selected from 10 estrogen receptor-negative breast cancer patients died within 5 years after the operation (5y-D) and 10 patients survived free of disease for 5 years or more after the operation (5y-S). The backgrounds of both the patient groups were allowed to coincide in age, lymph node metastasis, tumor diameter and tissue type (Table 1).
  • (Clinical Feature of 20 Cases of Breast Cancer)
  • [0206]
  • [0000]
    TABLE 1
    TNM classification b
    group Case No. ER condition Age Sex Process a Tumor Lymph node TTD c
    5y-D 3281 Negative 34 Female a2 T2 N1 b 9
    3459 Negative 64 Female a2 T4 N3 6
    3550 Negative 73 Female a2 T4 N1 b 12
    3892 Negative 62 Female a2 T2 N1 a 21
    3948 Negative 60 Female a2 T2 N1 a 51
    4020 Negative 50 Female a2 T2 N3 28
    3654 Negative 46 Female a2 T4 N1 b 19
    4118 Negative 53 Female a2 T1 N1 a 21
    4462 Negative 34 Female a1 T2 N1 a 24
    4126 Negative 51 Female b5 T4 N3 6
    5y-S 3656 Negative 31 Female a2 T2 N1 a >60
    3197 Negative 42 Female a1 T1 N1 a >60
    3662 Negative 58 Female a2 T2 N0 >60
    3241 Negative 47 Female a2 T2 N1 a >60
    3267 Negative 51 Female a2 T2 N1 a >60
    3329 Negative 60 Female a2 T2 N1 a >60
    3345 Negative 43 Female a1 T2 N2 >60
    3556 Negative 59 Female a2 T3 N0 >60
    3558 Negative 57 Female a2 T3 N1 b >60
    3658 Negative 42 Female a1 T2 N1 a >60
    a a1: invasive papillotubular carcinoma. a2: invasive solid-tubular carcinoma. b5: squamous cell carcinoma.
    b TNM classification: clinical classification by Japan Breast Cancer Society
    c TTD: time to death after surgery (months)
  • [0207]
    All patients underwent postoperative adjuvant therapy according to “Postoperative clinical protocol for breast cancer (nyugan no tameno shujutsugo no rinsho no purotokoru)” of Cancer Society attached hospital. In each case, selection of adjuvant therapy was determined strictly based on surgical operation type, lymph node involvement condition, and presence of local or distant metastasis. In the study of the present invention, all patients did not have distant metastasis before the adjuvant chemical therapy and did not undergo radiation therapy or chemical therapy before the surgical operation.
  • (Clinicopathological Parameter)
  • [0208]
    The following parameters were checked: tissue type, tumor diameter and invasion (t factor), lymph node involvement, and conditions of estrogen receptor (ER) and progesterone receptor (PgR). Tumors were classified into the following types according to TNM classification and to tissue classification of Japan Breast Cancer Society (1989); noninvasivetubular (1a), invasivepapillotubular (a1), invasive solid-tubular (a2), invasivescirrhouscarcinoma (a3), and other special types (b). The classification is basically the same as breast cancer tissue classification of WHO. t factors were classified into the following types according to histologial TNM classification; tumor with a maximum size of 2 cm or less (t1), tumor with no invasion into skin or pectoral muscle and with a maximum size of 2 cm or more (t2), and tumor with invasion into skin or pectoral muscle (t3).
  • [0000]
    (Design and Construction of cDNA Microarray)
  • [0209]
    From 25344 cDNAs selected from UniGene database, “genome wide cDNA microarray” was constructed. The cDNAs were made by RT-PCR using poly(A)+RNAs separated from various human organs. The PCR products were spotted on slide glasses of type 7 (Amersham Biosciences UK Limited, Buckinghamshire, UK) using Array Spotter Generation III (Amersham Biosciences). Each slide contains 384 house-keeping genes.
  • (Preparation and Proliferation of RNA)
  • [0210]
    A tumor raw material was quickly frozen at −80° C. immediately after collection. RNA was extracted using TRIzol (Invitrogen Inc., Carlsbad, Calif., USA), further, purified using RNeasykits (Quiagen Inc., Valencia, Calif.). The purity of each RNA was evaluated by a spectrophotometry and electrophoresis on 1.2% modified formamide gel. The high purity RNA was defined as a sample having an absorbance ratio (260 nm/280 nm) of 1.8 to 2.0 and in which 28S/18S liposomal bands show a ratio of 1.8 or more on formamide gel electrophoresis. After treating with 1 unit of DNaseI (Epicentre Technoloies, Madison, Wis.) (1 unit/μl), RNA amplification by T7RNA polymerase was carried out using 2 μg of RNA from each sample as a starting raw material. Amplification was carried out twice, and the amplified RNA (aRNA) was purified by RNeasykits (Quiagen Inc., Valencia, Calif.). The amount of each aRNA was measured by a spectrophotometer, and the quality was checked by formamide gel electrophoresis.
  • [0000]
    (Labeling of aRNA, Hybridization and Scanning)
  • [0211]
    cDNA for microarray analysis was prepared from aRNA. aRNAs (5 to 10 μg) from breast cancer and normal mammary gland tissue were labeled with Cy5 (cancer sample) and Cy3 (normal sample) using aminoallyl-cDNA labeling kits (Ambion, Austin, Tex.). The Cy3-labeled cDNA probe and the Cy5-labeled cDNA probe were mixed and heated at 95° C. for 5 minutes, then, quenched with ice for 30 seconds, and hybridized on a microarray. The mixed probes were added to formamide (Sigma-Aldrich Corp., St. Louis, Mo., USA) having a 50% final concentration of microarrayhybridization solution version 2 (Amersham Biosciences UK Limited, Buckinghamshire, UK). After hybridization at 40° C. for 15 hours, the microarray slides were washed first with 1×SSC and 0.2% SDS at 55° C. for 10 minutes, then, washed twice with 0.1×SSC/0.2% SDS each for 1 minute at room temperature. All treatments were carried out by Automated Slide Processor System (Amersham). The signal strength of each hybridization was scanned by Gene Pix 4000A (Axon Instruments, Inc., Foster City, Calif., USA), and evaluated by Gene Pix 3.0 (Axon Instruments) by a spectrophotometry. The scanned signals were normalized by a method described in the following literature (the total gene normalization method) (Yang Y H, Dudoit S, Luu P, et al. (2002) Nucleic Acids Res 30, e15; Manos E J, Jones D A. (2001) Cancer Res 61: 433-348).
  • (Signal Analysis and Selection of Genes Showing Different Expressions)
  • [0212]
    The signal strength of each hybridization was evaluated by a photometry by Gene Pix 3.0 (Axon Instruments, Inc., Foster City, Calif., USA). For normalizing mRNA expression levels between cancer and control, the Cy5:Cy3 ratio in each gene expression was adjusted. As a result, the averaged Log (Cy5:Cy3 ratio) of the house keeping genes was zero. 27 house keeping genes were adopted from a house-keeping panel in Web site For each microarray slide, the cut off value of (S/N) ratio was set at 3.0. Genes with signal strengths of Cy3 and Cy5 lower than the cut off value were excluded out of the investigation.
  • (Mann-Whitney Test)
  • [0213]
    For investigating genes showing apparently different expressions between 5y-D tumor and 5y-S tumor, Mann-Whitney test was applied to a series of samples X. X represents Cy5/Cy3 signal strength ratio of each gene and each sample (Ono K, Tanaka T, Tsunoda T, et al. (2000) Cancer Res 2000; 60: 5007-5011). The U value was calculated for genes imparting significant signals in at least 5 samples in both groups. Genes showing U values of lower than 23 or larger than 77 were selected. Since the U value is obtained by calculation for 5y-S group based on 5y-D group in each gene based on each X value, U values lower than 23 were evaluated to manifest higher expression in 5y-S group than in 5y-D group. However, genes with U values higher than 77 were evaluated to manifest higher expression in 5y-D group than in 5y-S group. Base on this criterion, 183 genes were highly expressed in 5y-S group and 31 genes were highly expressed in 5y-S group. Thus, only genes in which intermediate expression values show a difference of 2-fold or more between two groups (μXD/μXS≦0.5 or ≧2.0, μXD and μXS represent average X values in 5y-D and 5y-S group, respectively) were defined as genes correlated with prognosis. As a result, 110 genes in total were selected. Of them, 90 genes were expressed at higher level in 5y-D tumor group and 20 genes were expressed at higher level in 5y-S tumor group.
  • (Random-Permutation Test)
  • [0214]
    Further, for evaluating values of 110 genes selected by the Mann-Whitney test, a permutation test was carried out. A possibility, Ps of a gene for correlating with a group difference was also assumed. When each gene is represented by an expression vector v(g)=(X1, X2, - - - , X20) (Xi shows a gene expression level of i-th sample in the first sample group), an ideal expression pattern is expressed by c=(c1, c2, - - - , c20) (ci=+1 or 0, depending on whether i-th sample belongs to S group or D group).
  • [0215]
    Correlation between a gene and a group difference Pgc was defined as described below. That is, Pgc=(μS−μD)/(δXD); μSD) and δSD) show standard deviation of log2 X of the gene “g” of each sample in a newly defined S (or D) group.
  • [0216]
    The permutation test was carried out while substituting the coordinate of c. The correlation values, Pgc were calculated between all permutations. These procedures were repeated for 10000 times. Accidentally, the p value showing a possibility of a gene for classifying two groups was evaluated for each of 110 genes selected. Finally, 71 gene highly expressed in 5y-D case and 15 gene expressed low in 5y-S case were selected.
  • (Semi-Quantitative RT-PCR)
  • [0217]
    RNA (2 μg) was treated with DNase I (Epicentre Technologies, Madison, Wis., USA), and single-stranded cDNAs were subjected to reverse transcription using Reverscript IIreversetranscriptase (manufactured by Wako Pure Chemical Industries, Ltd., Osaka, Japan) and oligo (dT) 12-18 primer. Single-stranded cDNAs were adjusted in the concentration for the subsequent PCR amplification by monitoring expression of GAPD (glyceraldehyde-3-phosphatedehydrogenase) as a quantitative control. Each PCR was carried out under the following reaction conditions using Gene Amp PCR system 9700 (Applied Biosystems, Foster City, Calif., USA) at an amount of 1× PCR buffer of 30 μl.
  • [0218]
    94° C. 5 minutes,
  • [0219]
    (94° C. 30 seconds, 60° C. 30 seconds, and 72° C. 30 seconds) for 25 to 35 cycles.
  • [0220]
    Primer sequences used in RT-PCR are as described below:
  • [0000]
    SEQ ID No. 1 GAPD (control) forward,
    SEQ ID No. 2 reverse,
    SEQ ID No. 3 Hs.108504F,
    SEQ ID No. 4 Hs.108504R,
    SEQ ID No. 5 Hs.146550F,
    SEQ ID No. 6 Hs.146550R,
    SEQ ID No. 7 Hs.76607F,
    SEQ ID No. 8 Hs.76607R,
    SEQ ID No. 9 Hs.1975F,
    SEQ ID No. 10 Hs.1975R,
    SEQ ID No. 11 Hs.203952F,
    SEQ ID No. 12 Hs.203952R,
    SEQ ID No. 13 Hs.278607F,
    SEQ ID No. 14 Hs.278607R,
    SEQ ID No. 15 Hs.429F,
    SEQ ID No. 16 Hs.429R,
    SEQ ID No. 17 Hs.75305F,
    SEQ ID No. 18 Hs.75305R,
    SEQ ID No. 19 Hs.81170F,
    SEQ ID No. 20 Hs.81170R,
    SEQ ID No. 21 Hs.99987F,
    SEQ ID No. 22 Hs.99987R,
    SEQ ID No. 23 Y12781F,
    SEQ ID No. 24 Y12781R,
    SEQ ID No. 25 Hs.104417F,
    SEQ ID No. 26 Hs.104417R,
    SEQ ID No. 27 cl.21783F,
    SEQ ID No. 28 cl.21783R,
    SEQ ID No. 29 Hs.112628F,
    SEQ ID No. 30 Hs.112628R,
    SEQ ID No. 31 Hs.170345F,
    SEQ ID No. 32 Hs.170345R,
    SEQ ID No. 33 Hs.53996F,
    SEQ ID No. 34 Hs.53996R,
    SEQ ID No. 35 Hs.55422F,
    SEQ ID No. 36 Hs.55422R,
    SEQ ID No. 37 Hs.112718F,
    SEQ ID No. 38 Hs.112718R,
    SEQ ID No. 39 Hs.115880F,
    SEQ ID No. 40 Hs.115880R,
    SEQ ID No. 41 Hs.126495F,
    SEQ ID No. 42 Hs.126495R,
  • (Measurement of Signal Strength of RT-PCR Product and Calculation of Prognosis Score)
  • [0221]
    A PCR product was detected by 2% agarose gel electrophoresis and ethidium bromide staining. A gel was scanned by a digital image processing system (Alphalmager 3300; Alpha Innotech, San Leandro, Calif., USA) according to the Spot Density method. A two-dimensional region of each band was constructed, and pixel strength (gene expression) was obtained in which the density was defined as IDV (Integrated Density Value). Importance in a difference in IDV in each group was evaluated by the Student's t-test. As a result, 20 genes showing p values of 0.05 or lower in the t-test were selected as a candidate (Table 2). That is, expression levels of the 20 genes were significantly higher in the 5y-D group than in the 5y-S group. Base on this information, the present inventors have tried to establish a scoring system for predicting the postoperative prognosis. In this procedure, each gene was determined depending on whether the expression level of each sample was higher than the average expression level of 20 samples or not. When the expression level of a sample was 2-fold or more than the average, +1 point was imparted additionally. Next, points of all of the 20 genes were summed up for obtaining the total vote (prognosis score) for each sample. As a result, a case of a sample of 8 points or more was evaluated as an indication of bad prognosis. On the other hand, a case of a sample of 8 points or less was evaluated as an indication of preferable prognosis.
  • (20 Candidate Genes of Prognosis Scoring System)
  • [0222]
  • [0000]
    TABLE 2
    Hs./Accesion No. kind
    Hs.108504 FLJ20113: ubiquitin-specific protease otubain 1
    Hs.146550 MYH9: myosin, heavy polypeptide 9, non-muscle
    Hs.194691 RAI3: retinoic acid induced 3
    Hs.1975 TDRD3: tudor domain containing 3
    Hs.203952 TRRAP: transformation/transcription
    domain-associated protein
    Hs.278607 GSA7: ubiquitin activating enzyme E1-like protein
    Hs.429 ATP5G3: ATP synthase, H+ transporting,
    mitochondrial F0 complex, subunit c (subunit 9)
    isoform 3
    Hs.75305 AIP: aryl hydrocarbon receptor interacting protein
    Hs.81170 PIM1: pim-1 oncogene
    Hs.99987 ERCC2: excision repair cross-complementing rodent
    repair deficiency, complementation group 2
    Y12781 Transducin (beta)like 1 protein
    Hs.104417 KIAA1205 protein
    cl.21783 Hypothetical protein
    Hs.112628 Hypothetical protein: MGC43581
    Hs.170345 Hypothetical protein FLJ13710
    Hs.53996 weakly similar to zinc finger protein 135
    Hs.55422 Hypothetical protein
    Hs.112718 EST
    Hs.115880 EST
    Hs.126495 EST
  • (Result)
  • [0223]
    257 genes highly expressed significantly in estrogen receptor-negative breast cancer tissue were clarified, and 378 genes expressed low were clarified likewise. For identifying genes showing different expressions between the 5y-D group and the 5y-S group, the data of a microarray was analyzed by the Mann-Whitney test and the Random-permutation test. As a result, 71 genes in total (including 10 EST and 9 genes encoding virtual protein) in 5y-D tumor were classified in common into a group of higher expression. In contrast, 15 genes (including 3 EST) were classified in common into a group of lower expression (FIG. 1).
  • [0224]
    Genes highly expressed in the 5y-D group include the following genes correlated with proliferation and metastasis of cancer cells; matrix metalloproteinase 2 (MMP2), heat shock protein 27 HSPB1), Pim-1 oncogene (PIM1) and transformation/transcription domain-associated protein (TRRAP).
  • [0225]
    Genes expressed low in the 5y-D group include genes of HLA-C (major histocompatibility complex, class I, C) and specific kinase. A lot of genes having correlations with DNA repair, transcription, signal transduction, cytoskeleton and adhesiveness showed different expressions between two groups.
  • [0226]
    For confirming reliability of the data of a microarray, 20 genes highly expressed in the 5y-D group were selected (Hs.108504, Hs.146550, Hs.194691, Hs.1975, Hs.203952, Hs.278607, Hs.429, Hs.75305, Hs.81170, Hs.99987, Y12781, Hs.104417, c1.21783, Hs.112628, Hs.170345, Hs.53996, Hs.55422, Hs.112718, Hs.115880, and Hs.126495), and the expression levels of the genes were checked by semi-quantitative RT-PCR. The result coincided with the data of a microarray, and had a statistical significance for classifying the 5y-D group and the 5y-S group (typical data is shown in FIG. 2).
  • [0227]
    For constructing a scoring system for predicting the postoperative prognosis using the expression profile of a marker gene, prognosis score was calculated by the above-mentioned method. Briefly, a marker gene was selected according to the following standard.
  • [0228]
    (1) Higher signal strength than cut off level is shown in at least 60% of cases checked;
  • [0229]
    (2) |μD−μS| is 1.0 or less. Here, μDS) shows an average value derived from logarithm converted relative expression ratio in the case of 5y-D(5y-S).
  • [0230]
    Next, for identifying a marker gene capable of classifying the 5y-D group and the 5y-S group depending on the expression function, the Mann-Whitney test and the Random-permutation test were carried out. The result of a microarray correlated was confirmed by a semi-quantitative RT-PCR experiment. By the Student's t-test, 20 genes were selected as a prognosis marker (Table 2).
  • [0231]
    Depending on the prognosis score (PS) of the present invention, 20 patients were divided into 10 members predicted to show poor prognosis (PS is 11 or more) and 10 members predicted to show excellent prognosis (PS is less than 11). As a result, it was shown by comparison with the postoperative progress which the scoring system of the present invention has reliability with an accuracy of 80% in the 5y-D case and with an accuracy of 100% in the 5y-S case (FIG. 3A).
  • [0232]
    Using the prognosis scoring system of the present invention, additional 5 cases were checked (FIG. 3B). The system predicted poor prognosis in 2 cases (PS>11; patient TD-1 and patient TD-2), and excellent prognosis in 3 cases (PS<11; patients TD-3, TS-1 and TS-2). As a result, this scoring system showed an accuracy of 80% regarding actual clinical results of these 5 cases.
  • Example 2
  • [0233]
    Evaluation of gene expression function for prediction of the postoperative prognosis in node-negative breast cancer
  • (Tissue Sample)
  • [0234]
    A tissue sample was collected in the same manner as described in Example 1. Gene expression was investigated for tumors from 12 patients of node-negative (n0) cancer showed recurrence within 5 years after an operation (5Y-R) and 12 patients survived free of disease for 5 years or more after the operation (5Y-F). The clinical backgrounds of both the patient groups were allowed to coincide in age, lymph node metastasis, tumor diameter, condition of hormone receptor, and pathological tissue (Table 3). The follow up intermediate period was 7.8 years, and the average period between the initial operation and recurring was 2.7 years in the 5Y-R group. All patients underwent the adjuvant therapy described in Example 1.
  • (Clinical Pathological Data)
  • [0235]
  • [0000]
    TABLE 3
    Climacteric Histological Diameter TNM classification b
    Case Age condition classification a Position (mm) T N M Stage ER(+/−) PgR(+/−) D.F.I. c
    R-1 55 Post. a2 Rt. 25 2  1a 0 II + 12 m
    R-2 50 Pre. a3 Lt. 25 2  1a 0 II + + 16 m
    R-3 42 Pre. a2 Rt. 25 2 0 0 II + + 49 m
    R-4 39 Pre. a3 Rt. 35 2 0 0 II + 20 m
    R-5 38 Pre. a2 Lt. 30 2 0 0 II + + 52 m
    R-6 61 Post. a3 Lt. 34 2 0 0 II 14 m
    R-7 54 Post. b3 Lt. 30 2 0 0 II 24 m
    R-8 37 Pre. a2 Rt. 23 2 0 0 II 25 m
    R-9 54 Post. a3 Lt. 25 2  1a 0 II + + 47 m
    R-10 83 Post. a2 Rt. 28 2  1a 0 II + + 38 m
    R-11 62 Post. a2 Lt. 23 2 0 0 II + 40 m
    R-12 50 Post. a3 Lt. 35 2 0 0 II 25 m
    F-1 48 Pre. a2 Lt. 18 2 0 0 II + + 8 Y
    F-2 62 Post. a2 Rt. 25 2 0 0 II + 8 Y
    F-3 57 Post. a1 Rt. 20 1 0 0 I + + 7 Y 10 m
    F-4 61 Post. a2 Lt. 30 2  1a 0 II 7 Y 2 m
    F-5 42 Pre. a1 Lt. 12 1  1a 0 I + 7 Y 11 m
    F-6 51 Pre. a2 Rt. 28 2  1a 0 II 7 Y 10 m
    F-7 59 Post. a2 Rt. 40 3 0 0 II 7 Y 5 m
    F-8 57  Post.* a2 Rt. 45 3  1b 0 II 7 Y 5 m
    F-9 42 Pre. a1 Lt. 48 2  1a 0 II + 7 Y 3 m
    F-10 58 Post. a2 Lt. 13 2 0 0 II 7 Y 3 m
    F-11 50 Post. a2 Lt. 25 2 0 0 II + + 7 Y 8 m
    F-12 55 Post. a1 Rt. 35 2 0 0 II + + 7 Y 5 m
    a a1: invasive papillotubular carcinoma, a2: invasivesolid-tubularcarcinoma, a3: invasive schirrhous carcinoma
    b TNM classification: clinically classified according to TNM classification by Japan Breast Cancer Society
    c D.F.I.: period of no pathogeny (disease free interval)
  • (Clinicopathological Parameter)
  • [0236]
    The clinicopathological parameter was checked by the method described in Example 1. The histological grade was evaluated by a method of Elastonand Ellis (Abrams J S. Breast Cancer 2001; 8: 298-304). Lymphoduct invasion was evaluated to be deficient or positive (for example, evaluated to be positive when one or more cancer cells are present in lymphoducts around cancer). Fatinvasion was evaluated to be deficient or positive (for example, evaluated to be positive in the case of invasion into interstitial tissue).
  • [0000]
    (Preparation of cDNA Microarray)
  • [0237]
    “Genome wide cDNA microarray kit (Amersham Biosciences UK Limited, Buckinghamshire, UK)” with 25344 cDNAs was used. The PCR product was stopped on type 7 glass slides (Amersham Biosciences) using Array Spotter Generation III (Amersham Biosciences).
  • (Preparation and Proliferation of RNA)
  • [0238]
    Preparation and proliferation of RNA were carried out in the same method as described in Example 1.
  • [0000]
    (Labeling of aRNA, Hybridization and Scanning)
  • [0239]
    Labeling of aRNA, hybridization and scanning were carried out in the same method as described in Example 1.
  • (Mann-Whitney Test)
  • [0240]
    For identifying genes showing different expressions between a group of no disease and group of recurrence, normalized signals were analyzed by the Mann-Whitney test applied to a series of Xs. Here, X represents Cy5/Cy3 signal strength ratio of each gene and each sample. Genes showing a difference of 2-fold or more in expression strength between two groups were selected. Genes with signal-noise ratios of 3.0 or less were excluded from analysis.
  • [0241]
    The U value was calculated for genes imparting significant signals in at least 5 samples in both groups. Genes with U values of lower than 37 or larger than 107 were selected. Since the U value was obtained by calculation for 5Y-F group based on 5Y-R group in each gene based on each X value, genes with U values lower than 37 were evaluated to manifest higher expression in 5Y-F group than in 5Y-R group (first category). On the other hand, genes with U values higher than 107 were evaluated to manifest higher expression in 5Y-R group than in 5Y-F group (second category).
  • [0242]
    Based on this method, 78 genes were identified in the first category and 55 genes were identified in the second category. Thus, only genes showing a difference of 2-fold or more of the intermediate expression value between two groups (μXR/μXF≦0.5 or ≧2.0, μXR and μXF represent average X values in 5Y-R and 5Y-F group, respectively) were defined as genes correlated with prognosis. In total, 98 genes were selected, and of them, 64 genes showed higher expression level in 5Y-F tumor and 34 genes showed higher expression level in 5Y-R tumor.
  • (Random-Permutation Test)
  • [0243]
    For evaluating values of genes selected by the Mann-Whitney test, a permutation test was carried out, and correlation to group difference (Ps) of genes selected was evaluated. When each gene is represented by an expression vector v(g)=(X1, X2, - - - , X24) (Xi shows a gene expression level of i-th sample in the first sample set), an idealized expression pattern is expressed by c=(c1, c2, - - - , c24) (ci=+1 or 0, depending on whether i-th sample belongs to F group or R group).
  • [0244]
    Correlation between a gene and a group difference Pgc was defined as described below. That is, Pgc=(μF+μR)/(sF+sR); μF(μR) and sF(sR) show standard deviation of log2 X of the gene “g” of each sample in a newly defined “F” group or “R” group.
  • [0245]
    The permutation test was carried out while substituting the coordinate of c. The correlation values, Pgcs were calculated between all permutations. These procedures were repeated for 10000 times. Accidentally, the p value showing a possibility of a gene for classifying two groups was evaluated for each of 58 genes selected.
  • (Semi-Quantitative RT-PCR)
  • [0246]
    RNA (5 μg) was treated with DNase I (Epicentre Technologies, Madison, Wis., USA), then, single-stranded cDNAs were subjected to reverse transcription using Reverscript II reversetranscriptase (manufactured by Wako Pure Chemical Industries, Ltd., Osaka, Japan) and 0.5 μg/μl oligo (dT) 12-18 primer. The preparations of single-stranded cDNAs were diluted for the subsequent PCR amplification by monitoring GAPDH as a quantitative control. All PCRs were carried out under the following reaction conditions using Gene Amp PCR system 9700 (Applied Biosystems, Foster City, Calif., USA) at an amount of 1× PCR buffer of 30 μl.
  • [0247]
    94° C. 2 minutes,
  • [0248]
    (94° C. 30 seconds, 58-62° C. 30 seconds, and 72° C. 30 seconds) for 27 to 35 cycles
  • [0249]
    72° C. 5 minutes.
  • [0250]
    Primer sequences for RT-PCR of GAPDH are as described below:
  • [0000]
  • (Primer of Semi-Quantitative PCR (Gene Highly Expressed in Group of No Disease))
  • [0251]
  • [0000]
    TABLE 4A
    Ac./HS SEQ ID No. Forward SEQ ID No. Reverse
  • (Primer of Semi-Quantitative PCR (Gene Highly Expressed in Group of Recurrence))
  • [0252]
  • [0000]
    TABLE 4B
    Ac./HS SEQ ID No. Forward SEQ ID No. Reverse
  • (Measurement of Signal Strength of RT-PCR Product and Calculation of Prognosis Score)
  • [0253]
    The signal strength of the RT-PCR product was measured and evaluated in the same method as described in Example 1, and 10 genes with p values of 0.05 or lower in the t-test were selected as a candidate; of them, expression levels of 3 genes were higher in the 5y-R group than in the 5y-F group. The expression levels of 7 genes were higher in the 5y-F group than in the 5y-R group. Base on this information, the present inventors have tried to establish a scoring system for predicting the postoperative prognosis of node-negative breast cancer.
  • [0254]
    For obtaining expression level to be a subject of each gene, the expression ratio (ER) to the GAPDH expression was calculated according to the following formula:
  • [0000]

    ER of gene A=16 bit imaging score of semi-quantitative PCR (strength of band stained with ethidium bromide) of gene A of cancer sample X/16 bit imaging score of GAPDH of gene A of cancer sample X
  • (Definition of Scoring System for Predicting Postoperative Prognosis of Node-Negative Breast Cancer)
  • [0255]
    For obtaining the postoperative gene prognosis index of node-negative breast cancer, prognosis score (PS) was defined; (sum of normalized expression ratios of genes highly expressed in 5Y-R group as compared in 5Y-F group)−(sum of normalized expression ratios of genes highly expressed in 5Y-F group as compared in 5Y-R group)
  • [0256]
    A significance of the expression ratio between two groups was evaluated by the Student's t-test. All statistical methods were carried out by Statview version 5.0 (SAS Institute, Cary, N.C.).
  • (Result)
  • [0257]
    Clinicopathological findings of 24 breast cancer patients whose genome-wide gene expressions have been investigated are summarized in Table 3. The present inventors have investigated the gene expression by a cDNA microarray composed of 25344 human genes, for tumors from node-negative breast cancer patients of 12 cases showing survival free of disease for 5 years or more after an operation (5Y-F) and node-negative breast cancer patients of 12 cases showing recurrence of breast cancer within 5 years after a surgical operation (5Y-R). The clinical backgrounds were allowed to coincide in age, tumor diameter, estrogen receptor and progesterone receptor, and pathology between two groups.
  • [0258]
    The data of a cDNA microarray was analyzed by the Mann-Whitney test and the Random-permutation test, and genes showing different expressions between 5Y-R tumor and 5Y-F tumor were identified. Through this filter, 58 genes in total were selected, and of them, 21 genes showed significant strong expression in 5Y-R tumor. 37 genes showed higher expression in 5Y-F tumor.
  • [0259]
    The 37 genes showed higher expression in 5Y-F tumor as compared in 5Y-R tumor had six ESTs and one virtual protein (Table 5A, a difference in expression between groups is expresses as “foldchange”).
  • [0000]
    (Gene with Significant High Expression in 5Y-F Tumor as Compared in 5Y-R Tumor)
  • [0000]
    TABLE 5A
    Ac./HS kind fold change p value
    M90439 molecular marker (EPC-1) gene 2.324 0.0014
    AF047472 spleen mitotic checkpoint BUB3 (BUB3) 2.889 0.0021
    Hs.118251 ESTs 2.121 0.0031
    D26125 3 alpha-hydroxysteroid/dihydrodiol dehydrogenase DD4, partial cds 2.084 0.0038
    Hs.8619 SRY(sex determining region Y)-box 18 3.375 0.0041
    X16135 novel heterogeneous nuclear RNP protein, L protein 4.839 0.0042
    Hs.9006 VAMP(vesicle-associated membrane protein)-associated protein A, 33 kDa 3.807 0.0058
    M18963 islet of Langerhans regenerating protein (reg) 2.022 0.0060
    X07979 integrin beta 1 subunit 2.997 0.0068
    AF018080 PYRIN (MEFV) 4.016 0.0071
    Hs.58464 ESTs 5.415 0.0079
    S79867 type I keratin 16 [human, epidermal keratinocytes, mRNA Partial, 1422 nt] 2.254 0.0090
    J02854 myosin light chain (MLC-2) 2.668 0.0090
    Z35309 adenylate cyclaseB(brain) 2.264 0.0094
    Hs.83097 hypothetical protein FLJ22955 4.979 0.0096
    Hs.79137 protein-L isosparate(D-aspartate)o-metyltransferase 2.401 0.0105
    Hs.4864 ESTs 2.043 0.0107
    Y00052 Peptidylprolyl isomerase A(cyclophilin A) 2.966 0.0107
    Hs.5002 copper chaperone for superoxide dismutase; CCS 2.032 0.0114
    U43519 dystrophin-related protein 2 (DRP2) 2.022 0.0114
    Hs.106326 ESTs 4.733 0.0123
    Hs.94653 neurochondrin(KIAA0607) 2.08 0.0129
    M13436 ovarian beta-A-inhibin 2.946 0.0135
    X51441 serum amyloid A (SAA) protein partial, clone pAS3-alpha 2.383 0.0155
    Hs.108623 thrombospondin 2 2.019 0.0174
    Hs.5318 ESTs 4.38 0.0174
    Hs.69469 GA17 protein 2.279 0.0197
    AA777648 peripheral myelin protein 22 2.386 0.0209
    Hs.106131 ESTs 2.022 0.0213
    X54079 heat shock protein HSP27 5.637 0.0217
    D67025 proteasome (prosome, macropain) 26S Subunit, non-ATPase, 3 3.179 0.0359
    M80469 MHC class I HLA-J gene 3.572 0.0380
    AI041182 ov77e07.x1 Soares_testis_NHT Homo sapiens cDNA clone IMAGE: 1643364 2.321 0.0380
    AA148265 RIBOSOMAL PROTEIN L21. 2.019 0.0440
    Hs.4943 Inter-Alpha-Trypsin Inhibitor Heavy Chain LIKE gene 2.426 0.0442
    X99920 S100 calcium-binding protein A13 3.326 0.0456
    U22970 interferon-inducible peptide (6-16) gene 2.741 0.0465
  • [0260]
    In Table 5B, 21 genes highly expressed in the 5Y-R group are listed. Of them, five genes are ESTs and one gene encodes a virtual protein. From the panel including 58 genes, marker for postoperative prognosis were selected according to the following standard; (1) Having higher signal strength than cut off level situated in at least 60% of cases; (2) |μR−μF|>1.0. Here, μR(μF) shows an average value derived from logarithm converted expression ratio in the case of 5Y-R or 5Y-F.
  • [0000]
    (Gene with Significant High Expression in 5Y-R Tumor as Compared in 5Y-F Tumor)
  • [0000]
    TABLE 5B
    Ac./HS kind fold change p value
    X75252 Prostatic Binding protein 4.506 0.0011
    AA989127 major histocompatibility complex, class I, C 5.731 0.0060
    Hs.128520 ESTs 1.419 0.0067
    HSMLN50 ESTs 3.482 0.0071
    AF058701 DNA polymerase zeta catalytic subunit (REV3) 2.185 0.0085
    AF043473 delayed-rectifier K+ channel alpha subunit (KCNS1), Potassium 4.786 0.0144
    voltage-gated channel, delayed-rectifier, subfamily S, member 1
    Hs.26052 hypothetical protein MGC43306 4.829 0.0150
    Hs.77961 major histocompatibility complex, class I, B 5.775 0.0152
    Hs.26484 HIRA interacting protein 3 5.07 0.0157
    U44798 U1-snRNP binding protein homolog (70 kD) 2.615 0.0194
    Hs.77961 MHC class I HLA-Bw62 5.775 0.0209
    X64707 BBC1 mRNA(ribosomal protein L13) 2.758 0.0210
    Hs.6780 PTK9L protein tyrosine kinase 9-like (A6-related protein) 2.749 0.0220
    Hs.153428 Ests 3.164 0.0234
    AI066764 lectin, galactoside-binding, soluble, 1 (galectin 1) 2.606 0.0275
    cl.5994 ESTs 2.844 0.0286
    x16064 Tumor protein, translationally-controlled 1 3.567 0.0366
    E02628 polypeptide chain elongation factor-1 alpha 4.055 0.0427
    HUMTHYB4 thymosin beta-4 4.05 0.0436
    Hs.116922 ESTs 2.538 0.0494
    x15940 ribosomal protein L31 2.125 0.0499
  • [0261]
    7 genes highly expressed in 5Y-F tumor as compared in 5Y-R tumor (Hs.94653, M13436, Hs.5002, D67025, M80469, Hs.4864 and Hs.106326; p=0.0018, 0.0011, 0.001, 0.008, 0.0081, 0.0018 and 0.001; each according to Student's t-test) and 3 genes relatively highly expressed in 5Y-R tumor (AF058701, AI066764, and x15940; p=0.0351, 0.00161 and 0.0001; each according to Student's t-test) coincided with standards, and were selected as a prognosis marker (Table 6).
  • (Genes Selected as Prognosis Marker for Node-Negative Breast Cancer)
  • [0262]
  • [0000]
    TABLE 6
    AF058701 DNA polymerase zeta catalytic subunit (REV3)
    AI066764 lectin, galactoside-binding, soluble, 1 (galectin 1)
    x15940 ribosomal protein L31.
    Hs.94653 neurochondrin(KIAA0607)
    M13436 ovarian beta-A-inhibin
    Hs.5002 copper chaperone for superoxide dismutase; CCS
    D67025 proteasome (prosome, macropain) 26S subunit,
    non-ATPase, 3
    M80469 MHC class I HLA-J gene
    Hs.4864 ESTs
    Hs.106326 ESTs
  • [0263]
    Expressions of these markers were confirmed by a normalized semi-quantitative RT-PCR experiment for GAPDH expression. FIG. 3 shows results of RT-PCR of three marker genes highly expressed in samples from 12 patients showing recurrence of breast cancer (5Y-R group). FIG. 4 shows results of 7 marker genes highly expressed in the 5Y-F group (5 years survival). The expression ratios of these 10 genes were used for definition of prognosis index.
  • [0264]
    Prognosis score (PS) was defined as described below;
  • [0000]

    PS=(sum of normalized expression ratios of 3 genes highly expressed in 5Y-R tumor)−(sum of normalized expression ratios of 7 genes highly expressed in 5Y-F tumor)
  • [0265]
    The prognosis scores of 24 cases investigated are summarized in Table 7 together with the expression ratio of each marker gene. The PS system predicted poor prognosis of cases R1 to R12 having prognosis scores of more than 3. On the other hand, excellent prognosis was predicted for cases F1 to F 12 having scores of lower than −16. The predictions coincided with actual clinical results of them with an accuracy of 100% (FIG. 5). The average PS of the 5Y-R group was 9.44 and the average PS of the 5Y-F group was −28.92.
  • (Prognosis Score for Recurrence of Node-Negative Breast Cancer)
  • [0266]
  • [0000]
    TABLE 7
    No. x15940 AF058701 AI066764 Hs.5002 Hs.94653 M1 3436 M80469 D67025 Hs.4864 Hs.106326 PS
    1n 8.90 2.70 8.35 1.50 0.82 1.47 2.43 2.72 2.60 2.55 5.86
    2n 7.02 2.19 7.48 1.14 0.50 1.51 2.32 1.27 1.89 0.62 7.44
    3n 7.57 2.36 10.96 1.40 0.55 2.29 3.51 2.38 1.79 0.44 8.53
    4n 8.57 2.79 9.78 1.75 1.42 2.02 3.30 3.03 3.44 3.02 3.16
    5n 14.96 2.56 18.01 3.88 0.53 0.67 3.96 2.76 3.78 1.83 18.12
    6n 16.94 3.97 12.76 0.11 0.73 1.50 3.19 2.01 3.60 4.41 18.12
    7n 14.51 3.02 11.62 0.37 2.24 2.05 2.14 1.45 1.64 2.96 16.30
    8n 9.50 2.81 10.43 2.86 1.64 1.95 5.40 3.18 1.89 1.79 4.03
    9n 8.29 2.96 8.32 0.78 0.55 1.91 1.50 1.31 1.40 2.80 9.32
    10n 6.78 2.06 10.59 0.39 1.93 0.70 2.49 3.56 1.27 0.84 8.25
    11n 7.30 1.38 10.89 3.03 2.82 0.46 2.18 3.09 2.00 2.16 3.83
    12n 8.60 3.81 15.86 3.31 3.46 0.70 3.19 1.82 2.54 2.95 10.30
    1nR 4.67 0.81 4.69 4.13 2.98 3.80 7.78 5.34 7.59 8.47 −29.92
    2nR 4.32 0.63 3.88 2.82 2.68 2.89 4.51 3.74 4.86 9.28 −21.95
    3nR 10.54 0.56 7.28 2.40 2.06 2.10 8.18 6.02 6.02 8.55 −16.95
    4nR 5.59 0.56 4.85 3.22 3.69 2.89 11.18 3.31 6.39 11.36 −31.04
    5nR 5.56 0.18 4.97 5.57 4.57 1.15 3.18 4.85 5.56 12.68 −26.85
    6nR 4.50 0.51 4.01 6.81 2.54 5.45 6.61 7.49 7.16 6.18 −33.22
    7nR 5.09 0.97 4.72 3.14 3.74 5.57 7.95 3.94 7.90 9.71 −31.17
    8nR 4.93 0.54 4.46 7.53 4.95 5.93 11.03 1.96 6.21 7.75 −35.43
    9nR 5.25 1.17 5.15 3.09 3.39 3.30 10.05 2.66 4.76 10.82 −26.50
    10nR 5.36 0.59 5.96 3.67 2.78 2.47 4.66 3.12 10.63 8.27 −23.69
    11nR 4.99 1.02 5.71 7.48 4.51 6.22 4.61 4.28 10.65 9.20 −35.23
    12nR 4.84 0.30 4.98 7.57 6.07 5.04 7.05 3.07 7.42 8.98 −35.08
  • Example 3
  • [0267]
    Evaluation of gene expression function for prediction of the postoperative prognosis in primary breast cancer
  • (Tissue Sample)
  • [0268]
    A tissue sample was collected in the same manner as described in Example 1. Among 954 patients clinically traced during a period of 5 years or more or until death after an operation for breast cancer in a period from 1995 to 1997, 10 cases of death within 5 years after an operation and 10 cases of survival free of disease for 5 years or more after an operation were selected as a sample. The clinical backgrounds between two patient groups were allowed to coincide as strictly as possible regarding age, metastasis to lymph node, tumor diameter and tissue type (Table 8). The clinical backgrounds of additional 20 cases used for testing the final prediction system are summarized in Table 9.
  • (Clinical Profile of Patients Used for Microarray Analysis)
  • [0269]
  • [0000]
    TABLE 8
    Case T N M Stage Age NLa lyb fc ERd
    Survived MS1 2 1 0 II 52 4 1 2 P
    MS2 2 2 0 II 47 2 0 1 P
    MS3 2 2 0 II 40 5 0 1 N
    MS4 2 2 0 II 64 3 0 1 N/A
    Dead MD1 2 2 0 II 47 5 0 0 P
    MD2 2 2 0 II 34 3 3 0 N
    MD3 2 2 0 II 66 4 0 3 N
    MD4 2 0 0 II 71 2 0 1 P
    aNumber of lymph nodes involved.
    bLymph vessel invasion: 0, no cancer cells in vessels. 3, many cancer cells in vessels.
    cFat invasion: 0, no invasion to fat tissue; 3, severe invasion to fat tissue.
    dEstrogen receptor status: P, positive: N, negative; N/A, not available.
  • (Clinical Profile of Patients Used for RT-PCR Analysis)
  • [0270]
  • [0000]
    TABLE 9
    Case T N M Stage lya fb
    Survived S1 2 0 0 II 0 1
    S2 2 2 0 II 1 0
    S3 2 2 0 II 0 2
    S4 2 1 0 II 1 0
    S5 2 2 0 II 3 2
    S6 2 0 0 II 0 0
    S7 2 1 0 II 0 0
    S8 2 1 0 II 0 2
    S9 2 1 0 II 1 2
    S10 2 1 0 II 0 0
    Dead D1 2 1 0 II 0 1
    D2 2 2 0 II 0 0
    D3 2 2 0 II 3 0
    D4 2 2 0 II 0 3
    D5 2 2 0 II 1 3
    D6 2 1 0 II 0 1
    D7 2 0 0 II 0 1
    D8 2 1 0 II 0 0
    D9 2 4 0 IV 1 0
    D10 2 1 0 II 0 2
    Agec lymph node correlationd
    Survived 52.8 7.6
    Dead 56.0 5.4
    aLymph vessel invasion
    bFat infiltration
    cMean of age
    dAverage number of lymph nodes involved
  • (Clinicopathological Parameter)
  • [0271]
    The clinicopathological parameters were checked by the method described in Example 1.
  • [0000]
    (Preparation of cDNA Microarray)
  • [0272]
    A cDNA microarray was prepared by the method described in Example 2.
  • (RNA Extraction and RNA Amplification)
  • [0273]
    RNA was extracted using TRIzol (Invitrogen, Carlsbad, Calif., USA). For removing degenerate RNA, each extracted RNA (1 μg) was subjected to electrophoresis on 3.0% formaldehyde denatured gel. For removing DNA mixing, purification was carried out using RNeasy kit (QIAGEN, Valencia, Calif.). Amplification was carried out based on T7 RNA polymerase base by Messsage Amp aRNA kit (Ambion, Austin, Tex.), and RNA used for microarray analysis was prepared. In the first amplification, RNA (5 μg) was used as a template. Thereafter, the firstly amplified RNA (aRNA) (2 μg) was used as a template for the second amplification. The amplified aRNAs were purified by RNeasy purification kit, and the amount of each aRNA was measured by a spectrophotometer.
  • [0000]
    (Labeling of aRNA, Hybridization and Data Analysis)
  • [0274]
    A hybridization probe was produced using aRNA (5 μg) for producing fluorescent probe obtained by second amplification, using Amino Allyl-cDNA labeling kit (Ambion, Austin, Tex.). Probes derived from cancer RNA and normal control RNA were labeled with Cy5 or Cy3 Mono-Reactive Dye (Amersham Bioscience UK Limited, Buckinghamshire, UK), respectively.
  • [0275]
    For removing an unbound dye, a labeled probe was purified by QIA quick PCR purification kit (QIAGEN, Valencia, Calif.). Each 10 pmol of fluorescent labeled probes from tumor and normal RNA were mixed with 4× microarray hybridization buffer (Amersham (UK)) and de-ionized formamide. The probe mixture was hybridized to a cDNA array at 40° C. for 15 hours. Thereafter, the mixture was washed with 0.1×SSC containing 0.2% SDS once for 5 minutes, then, twice for 10 minutes. All procedures were carried out in Automated Slide Processor System (Amersham). The signal strength of each hybridization was read by Gene Pix 4000 (Amersham), and evaluated by Gene Pix Pro 3.0 (Axon Instruments, Inc., Foster City, Calif., USA). The read signals were normalized by the total gene normalization method (Yang, Y. H., Dudoit, S., Luu, P., Lin, D. M., Peng, V., Ngai, J., and Speed, T. P. (2002). Nucleic Acids Res 30, e15.; Manos, E. J., and Jones, D. A. (2001). Cancer Res 61, 433-438).
  • [0276]
    For confirming genes showing different expressions between a survival group and a dead group, normalized signals were analyzed by the Mann-Whitney test; the normalized signals were applied to a series of Xs. X represents Cy5/Cy3 signal strength ratio for each gene and each sample (Ono, K., et al. (2000). Cancer Res 60, 5007-5011). Genes showing a U value of 0 in the Mann-Whitney test and genes showing a difference of 2-fold or more in expression strength between two groups were selected. Genes with S/N ratios of less than 3.0 were excluded from investigation.
  • (Semi-Quantitative RT-PCR Experiment and Gene Expression Ratio)
  • [0277]
    For verifying the data of a microarray, the present inventors carried out a semi-quantitative RT-PCR experiment by reverse-transcribing RNA (10 μg). For adjusting the concentration of the transcribed cDNA, GAPDH was selected as an internal control, and semi-quantitative RT-PCR was carried out (Ono, K., et al. (2000). Cancer Res 60, 5007-5011). Primers for GAPDH were 5′-ggaaggtgaaggtcggagt-3 (Forward) and 5-tgggtggaatcatattggaa-3 (Reverse). After adjusting the concentration of the primer, semi-quantitative RT-PCR was carried out on selected genes in samples from the survival group and the dead group. Primers for the genes (Table 10) were designed based on sequence information of NCBIGen Bank ( and primer 3 on website ( Each semi-quantitative RT-PCR experiment was performed using, as a template, cDNA (1 μl) having been adjusted concentration, 5 U TakaraEXTaq (Takara, Otsu, Japan), 1× PCR buffer (10 mM Tris-HCl, 50 mM KCl, 1.5 mM MgCl2), and 10 nM dNTPs and 10 pmol of forward and reverse primers, in a total amount of 30 μl.
  • [0000]
    SEQ ID No. 160  ggaaggtgaaggtcggagt
    SEQ ID No. 161 tgggtggaatcatattggaa
  • (Primer of Semi-Quantitative PCR)
  • [0278]
  • [0000]
    TABLE 10
    gene SEQ ID No. Forward SEQ ID No. Reverse
  • [0279]
    For evaluating the strengths of gene expressions between the survival group and the dead group, each semi-quantitative PCR product (8 μl) was subjected to electrophoresis on 2.5% agarose gel, and stained with ethidium bromide. The concentration of each stained sample was measured by AlphaImager 3300 (Alpha Inonotech, San Leandro, Calif.) using background correction. For obtaining the expression level of each gene, the expression ratio was normalized with the expression level of GAPDH.
  • [0280]
    The expression ratio was defined by the following formula: Expression ratio of gene A=16 bit imaging score of semi-quantitative PCR (strength of band stained with ethidium bromide) of gene A in cancer sample X/16 bit imaging score of GAPDH in cancer sample X
  • (Definition of Prognosis Index (PI) of Primary Breast Cancer)
  • [0281]
    The present inventors defined the prognosis index (PI) of primary breast cancer by subtracting the sum of normalized expression ratios of genes highly expressed in the 5D group from the sum of normalized expression ratios of genes highly expressed in the 5S group. A significance of expression ratios between two groups was evaluated by the Student's t-test. Comparison of PI between the 5S group and the 5D group was carried out by the Mann-Whitney test. All the statistics were storaged using Statview version 5.0 (SASInstitute Inc., Cary, N.C.).
  • (Result)
  • [0282]
    On a cDNA microarray composed of 18432 human genes, genome-wide gene expression functions of tumors from 8 breast cancer patients were examined. Four patients survived free of disease for 5 year or more after an operation (5S), and four patients died of breast cancer within 5 years after the operation (5D). The clinical backgrounds between two patient groups were allowed to coincide as strictly as possible regarding age, tumor diameter, metastasis to lymph node, hormone receptor condition and tissue type (Table 8).
  • [0283]
    For identifying genes showing different expressions between the 5D group and the 5S group, the present inventors analyzed the data of the cDNA microarray by the Mann-Whitney test. 23 genes in total among which six genes are ESTs/virtual proteins are genes showing a U value of 0 in the Mann-Whitney test and highly expressed in the 5S group (Table 11).
  • Gene Group Highly Expressed in Survival Group by Microarray Analysis
  • [0284]
  • [0000]
    TABLE 11
    Gene name and detail Accession Number Fold change
    IMAGE: 39159 3′ similar to gb: J04173 PHOSPHOGLYCERATE MUTASE, BRAIN FORM R51864 4.304
    IMAGE: 22798 3′, MRNA sequence R39171 2.918
    cDNA clone IMAGE: 1693352 3′, MRNA sequence AI140851 2.891
    CCNDBP1 cyclin D-type binding-protein 1 AF082569 3.202
    ESTs AI446435 3.251
    pro-alpha-1 type 3 collagen X14420.1 3.394
    complement component C1r J04080.1 3.396
    DPYSL3 dihydropyrimidinase-like 3 D78014 3.625
    ribosomal protein L6 X69391.1 3.807
    PTK9L protein tyrosine kinase 9-like (A6-related protein) Y17169.1 4.143
    Homo sapiens full length insert cDNA YN88E09 AF075050.1 4.257
    somatostatin receptor isoform 2 (SSTR2) gene M81839.1 5.475
    CPE carboxy peptidase E NM 001873.1 5.807
    YR-29 hypothetical protein YR-29 AJ012409.1 6.333
    IMAGE: 4822062, mRNA BC034811 6.373
    KIAA1832 protein, partial cds AB058735.1 13.352
    CREG cellular repressor of E1A-stimulated genes AF084523.1 2.739
    Homo sapiens putative splice factor transformer2-beta mRNA, complete cds U61267.1 2.55
    Human N-acetyl-beta-glucosaminidase (HEXB) mRNA, 3′ end M13519.1 2.698
    Human cytochrome b5 mRNA, complete cds M22865.1 2.881
    Human pS2 mRNA induced by estrogen from human breast cancer cell line M CF-7 X00474.1 2.702
    Human alpha-tubulin mRNA, complete cds K00558 4.655
    Homo sapiens clone 24703 beta-tubulin mRNA, complete cds AF070561.1 3.917
  • [0285]
    Table 12 describes 21 genes highly expressed in general in the 5D tumor, including 6 ESTs/virtual proteins, and having a U value of 0 in the Mann-Whitney test. In the table, a difference in gene expression between two groups is shown as “foldchange”.
  • Gene Group Highly Expressed in Dead Group by Microarray Analysis
  • [0286]
  • [0000]
    TABLE 12
    Gene name and detail Accession Number Fold change
    Lyam-1 mRNA for leukocyte adhesion molecule-1 X16150.1 7.459
    APM2 adipose specific 2 NM_006829.1 4.853
    DNA polymerase gamma mRNA, nuclear gene encoding mitochondrial protein U60325.1 4.269
    FLJ22128 fis, clone HEP19543 AK025781 4.109
    actin related protein 2/3 complex, subunit 4, 20 kDa (RPC4) NM_005718.2 4.058
    Scd mRNA for stearoyl-CoA desaturase AB032261.1 3.794
    novel h eterogeneous nuclear RNP protein, L protein X16135.1 3.771
    ENSA endosulfine alpha AF157509.1 3.511
    IMAGE: 26483 5′ similar to gb: X15183_cds1 HEAT SHOCK PROTEIN HSP 90-ALPHA R12732 3.086
    malonyl-CoA decarboxylase (MYLCD) NM_012213 3.067
    anion exchanger 3 brain isoform (bAE3) U05596.1 2.889
    IMAGE: 43550 3′, MRNA sequence H05914 2.345
    cDNA FLJ23636 fis, clone CAS07176. AK074216 2.426
    IMAGE: 26366 3′ similar to gb: D16234 PROBABLE PROTEIN DISULFIDE ISOMERASE ER-60 R20554 2.519
    Similar to hypothetical protein PRO2831, clone MGC: 23813 IMAGE: 4273837, mRNA, complete cds BC017905.1 2.551
    FLJ40629 hypothetical protein FJL40629 AK097948.1 2.417
    ribosomal protein L29 (humrp129) mRNA, complete cds U10248.1 2.203
    EST, clone IMAGE: 745452, 3′ end AA325869 2.591
    KIAA1554 KIAA1554 protein AB046774.1 2.544
    IMAGE: 53316 3′ similar to SP: MDHC_MOUSE P14152 MALATE DEHYDROGENASE, R15814 2.867
    NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 3 (12 kD, B12), clone MGC: 9039 BC018183 4.972
    IMAGE: 3881592
  • [0287]
    From 23 genes highly expressed in the 5S group and 21 gene highly expressed in the 5D group, prediction markers for postoperative prognosis were selected according to the following standards; (1) In microarray analysis, a difference in the signal strength between 5S and 5D is larger than 2.0-fold in all cases; (2) The signal strength differs significantly between 5S and 5D in semi-quantitative PCR (p value<0.05 in Student's t-test); (3) The result of semi-quantitative PCR was re-confirmed by independent triple experiments. 7 genes highly expressed in the 5S tumor and 3 genes highly expressed in the 5D tumor satisfied these standards for selecting a prognosis marker.
  • [0288]
    7 genes highly expressed in the 5S group are constituted of genes encoding pro-alpha-1 type 3 collagen (PIIIP), complement component Clr, dihydropyrimidinase-like 3 (DPYSL3), proteintyrosinekinase 9-like (PTK9L), carboxy peptidase E (CPE), α-tubulin and β-tubulin. The p values in the Student's t-test of these marker genes were 0.00039, 0.0012, 0.0042, 0.036, 0.039, 0.034 and 0.00069, respectively.
  • [0289]
    3 marker genes highly expressed in the 5D group encoded heat shock protein HSP 90-alpha gene, malatedehydrogenase, and NADH dehydrogenase (ubiquinone) 1 beta subcomplex 3 (NDUFB3). The p values in the Student's t-test of these genes were 0.05, 0.0055 and 0.011, respectively.
  • [0290]
    The present inventors normalized the experiment results of semi-quantitative RT-PCR by GAPDH as an internal control and evaluated the results, verifying selection of marker genes.
  • [0291]
    The present inventors carried out semi-quantitative PCR for checking additional 20 cases randomly selected. 10 of these patients died of breast cancer within 5 years after an operation, and remaining 10 patients survived free of disease for 5 years or more after the operation. FIG. 7 shows the results of RT-PCR of 7 marker genes highly expressed in the 5S tumor. FIG. 8 shows the results of RT-PCR of 3 marker genes highly expressed in the 5D tumor.
  • [0292]
    The present inventors defined the prognosis index (PI) as described below: (sum of normalized expression ratios of genes highly expressed in 5S group)−(sum of normalized expression ratios of genes highly expressed in 5D group). The expression ratios of the selected marker genes are summarized together with prognosis indices for further test examples in Table 13.
  • Expression Ratio of Gene and Prognosis Index
  • [0293]
  • [0000]
    TABLE 13
    Gene highly expressed in 5S Gene highly expressed in 5D
    PIIIP C1r DPYSL3 PTK9L CPE A-tubulin B-tubulin HSP 90 MDH NDUFB3 Sum of S* Sum of D** PI+
    S1 1.8 4.0 2.1 3.3 2.4 0.8 2.5 1.5 0.2 1.5 16.9 3.2 13.7
    S2 5.7 3.5 3.3 3.4 6.0 1.2 5.1 2.2 0.6 2.2 28.1 5.0 23.1
    S3 3.1 5.8 2.2 3.4 8.1 1.8 5.3 1.5 0.4 1.5 29.7 3.5 26.2
    S4 7.1 10.2 8.6 6.0 16.0 4.1 8.0 3.4 4.8 3.4 60.0 11.5 48.5
    S5 6.8 7.4 7.2 6.9 11.2 2.7 7.0 5.5 3.6 5.5 49.1 14.6 34.5
    S6 4.0 4.2 1.7 2.2 3.6 0.9 6.0 2.9 0.9 2.9 22.7 6.6 16.1
    S7 2.3 4.0 1.1 1.6 0.6 0.7 3.4 0.4 0.3 0.4 13.7 1.1 12.6
    S8 3.3 3.6 1.1 0.7 0.8 1.3 5.0 2.3 1.4 2.3 15.9 6.0 9.8
    S9 3.1 3.9 2.7 3.7 2.9 1.6 4.1 1.0 1.2 1.0 21.9 3.2 18.8
    S10 2.9 3.0 0.9 1.5 1.2 1.0 1.7 1.3 0.4 1.3 12.2 3.0 9.2
    D1 0.1 2.9 0.4 1.9 2.9 0.7 0.8 3.4 3.0 3.4 9.6 9.7 −0.1
    D2 0.2 0.6 0.1 0.2 0.8 0.2 0.8 1.0 4.9 1.0 2.9 7.0 −4.1
    D3 0.2 3.7 0.2 1.0 0.6 0.6 2.8 3.6 6.6 3.6 9.0 13.8 −4.8
    D4 0.2 1.4 0.4 0.9 1.0 0.5 1.7 3.5 3.6 3.5 6.1 10.7 −4.6
    D5 0.1 1.3 0.1 0.9 0.6 0.5 1.0 3.2 0.3 3.2 4.5 6.7 −2.2
    D6 2.2 2.5 1.2 1.9 2.0 0.5 1.7 3.8 3.5 4.2 12.0 11.5 0.5
    D7 2.2 2.1 0.9 1.9 2.4 0.3 1.6 1.9 1.4 2.0 11.5 5.3 6.2
    D8 1.6 2.7 1.1 2.6 1.8 0.4 1.8 3.4 2.8 3.4 12.0 9.6 2.5
    D9 1.2 1.4 0.6 1.6 1.2 0.6 2.4 2.2 0.7 2.2 9.2 5.0 4.1
    D10 0.5 0.8 0.4 0.6 0.4 0.4 1.3 3.6 1.6 3.6 4.5 8.9 −4.4
    *Sum of ER of PIIP, C1r, DPYSL3, CPE, α and β-tubulin
    **Sum of ER of HSP 90, MDH and NDUFP3
    +PI: Sum of S − sum of D
  • [0294]
    PI predicted correctly the actual clinical results of higher prognosis indices (>7) of 10 cases (S1 to S10) in total in the 5S group and prognosis indices (<7) of 10 cases (D1 to D10) in total in the 5D group. PI of the 5S group was 21.2. PI of the 5D group was −0.7. Here, by a PI value of 7 the 5S tumor and the 5D tumor were apparently distinguished (p=0.0002).
  • [0295]
    The postoperative prognosis prediction system of the present invention is effective for prediction of postoperative risk of a breast cancer patient. Further, the wide-range gene expression list of breast cancer correlated genes of the present invention can provide various information on progress of breast cancer, and a latent target molecule for breast cancer therapy was be predicted by the list.

Claims (10)

1-19. (canceled)
20. A method for predicting a postoperative prognosis in node-negative (n0) breast cancer with no metastasis to a lymph node in operation, comprising measuring an expression of galectin 1 gene.
21. The method of claim 20, wherein the measurement is performed by using galectin 1 gene and/or a probe specific thereto.
22. The method of claim 21, wherein the galactin 1 gene/and or the probe are carried on a DNA microarray.
23. The method of claim 22, wherein the DNA microarray is a fiber type array.
24. The method of claim 21, wherein the measurement is performed using the galectin 1 gene.
25. The method of claim 21, wherein the measurement is performed using the probe to the galectin 1 gene and the galectin 1 gene.
26. The method of claim 22, wherein the galectin 1 gene is carried on the DNA microarray.
27. The method of claim 22, wherein the probe specific to the galectin 1 gene is carried on the DNA microarray.
28. The method of claim 22, wherein the galectin 1 gene and the probe specific to the galectin 1 gene are carried on the DNA microarray.
US12785213 2004-02-24 2010-05-21 Gene relating to estimation of postoperative prognosis for breast cancer Abandoned US20110009284A1 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
JP2004048593 2004-02-24
JP2004-048593 2004-02-24
PCT/JP2004/012455 WO2005080570A1 (en) 2004-02-24 2004-08-24 Gene relating to estimation of postoperative prognosis for breast cancer
US59021907 true 2007-01-17 2007-01-17
US12785213 US20110009284A1 (en) 2004-02-24 2010-05-21 Gene relating to estimation of postoperative prognosis for breast cancer

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US12785213 US20110009284A1 (en) 2004-02-24 2010-05-21 Gene relating to estimation of postoperative prognosis for breast cancer
US13737349 US9353416B2 (en) 2004-02-24 2013-01-09 Gene relating to estimation of postoperative prognosis for breast cancer

Related Parent Applications (3)

Application Number Title Priority Date Filing Date
PCT/JP2004/012455 Division WO2005080570A1 (en) 2004-02-24 2004-08-24 Gene relating to estimation of postoperative prognosis for breast cancer
US10590219 Division US20080026950A1 (en) 2004-02-24 2004-08-24 Gene Relating to Estimation of Postoperative Prognosis for Breast Cancer
US59021907 Division 2007-01-17 2007-01-17

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US13737349 Division US9353416B2 (en) 2004-02-24 2013-01-09 Gene relating to estimation of postoperative prognosis for breast cancer

Publications (1)

Publication Number Publication Date
US20110009284A1 true true US20110009284A1 (en) 2011-01-13



Family Applications (3)

Application Number Title Priority Date Filing Date
US10590219 Abandoned US20080026950A1 (en) 2004-02-24 2004-08-24 Gene Relating to Estimation of Postoperative Prognosis for Breast Cancer
US12785213 Abandoned US20110009284A1 (en) 2004-02-24 2010-05-21 Gene relating to estimation of postoperative prognosis for breast cancer
US13737349 Active US9353416B2 (en) 2004-02-24 2013-01-09 Gene relating to estimation of postoperative prognosis for breast cancer

Family Applications Before (1)

Application Number Title Priority Date Filing Date
US10590219 Abandoned US20080026950A1 (en) 2004-02-24 2004-08-24 Gene Relating to Estimation of Postoperative Prognosis for Breast Cancer

Family Applications After (1)

Application Number Title Priority Date Filing Date
US13737349 Active US9353416B2 (en) 2004-02-24 2013-01-09 Gene relating to estimation of postoperative prognosis for breast cancer

Country Status (2)

Country Link
US (3) US20080026950A1 (en)
WO (1) WO2005080570A1 (en)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005080570A1 (en) * 2004-02-24 2005-09-01 Mitsubishi Rayon Co., Ltd. Gene relating to estimation of postoperative prognosis for breast cancer
CN102435734A (en) * 2011-09-08 2012-05-02 大连医科大学 Kit used for evaluating ovarian cancer primary chemotherapeutic sensitivity, and application thereof
GB201206323D0 (en) * 2012-04-10 2012-05-23 Immunovia Ab Methods and arrays for use in the same

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20010041339A1 (en) * 1999-07-30 2001-11-15 Anderson Norman G. Microarrays and their manufacture
US20030087251A1 (en) * 2001-03-09 2003-05-08 Nurith Kurn Methods and compositions for amplification of RNA sequences

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB9704444D0 (en) * 1997-03-04 1997-04-23 Isis Innovation Non-invasive prenatal diagnosis
US6355623B2 (en) * 1998-09-24 2002-03-12 Hopital-Sainte-Justine Method of treating IBD/Crohn's disease and related conditions wherein drug metabolite levels in host blood cells determine subsequent dosage
WO2002046467A3 (en) 2000-12-08 2003-08-28 Ipsogen Gene expression profiling of primary breast carcinomas using arrays of candidate genes
WO2005080570A1 (en) * 2004-02-24 2005-09-01 Mitsubishi Rayon Co., Ltd. Gene relating to estimation of postoperative prognosis for breast cancer

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20010041339A1 (en) * 1999-07-30 2001-11-15 Anderson Norman G. Microarrays and their manufacture
US20030087251A1 (en) * 2001-03-09 2003-05-08 Nurith Kurn Methods and compositions for amplification of RNA sequences

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Ross and Fletcher (The Oncologist 1998 3:237-252) *

Also Published As

Publication number Publication date Type
WO2005080570A1 (en) 2005-09-01 application
US20080026950A1 (en) 2008-01-31 application
US20130203621A1 (en) 2013-08-08 application
US9353416B2 (en) 2016-05-31 grant

Similar Documents

Publication Publication Date Title
US20030219760A1 (en) Diagnostic and prognostic tests
US20020155440A1 (en) Using overexpression of laminin alpha 4 subunit as a diagnostic and prognostic indicator of malignant tumors
US20040157255A1 (en) Gene expression markers for response to EGFR inhibitor drugs
US20070231822A1 (en) Methods for the detection and treatment of cancer
US20050064455A1 (en) Gene expression markers for predicting response to chemotherapy
US20080176236A1 (en) Materials and methods for prognosing lung cancer survival
US20050164218A1 (en) Gene expression markers for response to EGFR inhibitor drugs
US20080145841A1 (en) Diagnostic Tool For Diagnosing Benign Versus Malignant Thyroid Lesions
US20060265138A1 (en) Expression profiling of tumours
WO2005100606A2 (en) Gene expression markers for predicting response to chemotherapy
US20030143539A1 (en) Gene expression profiling of primary breast carcinomas using arrays of candidate genes
US20050266420A1 (en) Multigene predictors of response to chemotherapy
WO2005076005A2 (en) A method for classifying a tumor cell sample based upon differential expression of at least two genes
WO2006016110A1 (en) Methods and kit for the prognosis of breast cancer
WO2008089577A1 (en) Breast cancer gene array
Yang et al. Enhancing detection of circulating tumor cells with activating KRAS oncogene in patients with colorectal cancer by weighted chemiluminescent membrane array method
US20100210738A1 (en) Prognostic biomarkers to predict overall survival and metastatic disease in patients with triple negative breast cancer
Rogers et al. Differentiating pancreatic lesions by microarray and QPCR analysis of pancreatic juice RNAs
WO1999060162A1 (en) A novel method of diagnosing, monitoring, and staging prostate cancer
EP2000543A2 (en) Method for the molecular diagnosis of prostate cancer and kit for implementing same
Rahbari et al. Identification of differentially expressed microRNA in parathyroid tumors
US7914988B1 (en) Gene expression profiles to predict relapse of prostate cancer
Nagahata et al. Expression profiling to predict postoperative prognosis for estrogen receptor‐negative breast cancers by analysis of 25,344 genes on a cDNA microarray
US20120071343A1 (en) Biomarkers for differentiating melanoma from benign nevus in the skin
US20060134622A1 (en) Amplified cancer target genes useful in diagnosis and thereapeutic screening