US20090305930A1 - Use of hydrophobin for hard surface soil-repellent treatment - Google Patents

Use of hydrophobin for hard surface soil-repellent treatment Download PDF

Info

Publication number
US20090305930A1
US20090305930A1 US11/887,129 US88712906A US2009305930A1 US 20090305930 A1 US20090305930 A1 US 20090305930A1 US 88712906 A US88712906 A US 88712906A US 2009305930 A1 US2009305930 A1 US 2009305930A1
Authority
US
United States
Prior art keywords
hydrophobin
hard surface
soil
cleaners
cleansing agent
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US11/887,129
Other languages
English (en)
Inventor
Heike Becker
Claus Bollschweiler
Thomas Subkowski
Ulf Baus
Hans-Georg Lemaire
Marvin Karos
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
BASF SE
Original Assignee
BASF SE
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from DE200510014844 external-priority patent/DE102005014844A1/de
Priority claimed from DE200510036341 external-priority patent/DE102005036341A1/de
Application filed by BASF SE filed Critical BASF SE
Assigned to BASF AKTIENGESELLSCHAFT reassignment BASF AKTIENGESELLSCHAFT ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: BAUS, ULF, BECKER, HEIKE, BOLLSCHWEILER, CLAUS, KAROS, MARVIN, LEMAIRE, HANS-GEORG, SUBKOWSKI, THOMAS
Publication of US20090305930A1 publication Critical patent/US20090305930A1/en
Assigned to BASF SE reassignment BASF SE CHANGE OF NAME (SEE DOCUMENT FOR DETAILS). Assignors: BASF AKTIENGESELLSCHAFT
Abandoned legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C11ANIMAL OR VEGETABLE OILS, FATS, FATTY SUBSTANCES OR WAXES; FATTY ACIDS THEREFROM; DETERGENTS; CANDLES
    • C11DDETERGENT COMPOSITIONS; USE OF SINGLE SUBSTANCES AS DETERGENTS; SOAP OR SOAP-MAKING; RESIN SOAPS; RECOVERY OF GLYCEROL
    • C11D3/00Other compounding ingredients of detergent compositions covered in group C11D1/00
    • C11D3/16Organic compounds
    • C11D3/38Products with no well-defined composition, e.g. natural products
    • CCHEMISTRY; METALLURGY
    • C09DYES; PAINTS; POLISHES; NATURAL RESINS; ADHESIVES; COMPOSITIONS NOT OTHERWISE PROVIDED FOR; APPLICATIONS OF MATERIALS NOT OTHERWISE PROVIDED FOR
    • C09DCOATING COMPOSITIONS, e.g. PAINTS, VARNISHES OR LACQUERS; FILLING PASTES; CHEMICAL PAINT OR INK REMOVERS; INKS; CORRECTING FLUIDS; WOODSTAINS; PASTES OR SOLIDS FOR COLOURING OR PRINTING; USE OF MATERIALS THEREFOR
    • C09D5/00Coating compositions, e.g. paints, varnishes or lacquers, characterised by their physical nature or the effects produced; Filling pastes
    • C09D5/16Antifouling paints; Underwater paints
    • CCHEMISTRY; METALLURGY
    • C09DYES; PAINTS; POLISHES; NATURAL RESINS; ADHESIVES; COMPOSITIONS NOT OTHERWISE PROVIDED FOR; APPLICATIONS OF MATERIALS NOT OTHERWISE PROVIDED FOR
    • C09DCOATING COMPOSITIONS, e.g. PAINTS, VARNISHES OR LACQUERS; FILLING PASTES; CHEMICAL PAINT OR INK REMOVERS; INKS; CORRECTING FLUIDS; WOODSTAINS; PASTES OR SOLIDS FOR COLOURING OR PRINTING; USE OF MATERIALS THEREFOR
    • C09D5/00Coating compositions, e.g. paints, varnishes or lacquers, characterised by their physical nature or the effects produced; Filling pastes

Definitions

  • the present invention concerns the use of hydrophobins for soil-repellent treatment of hard surfaces, in particular in combination with a cleansing of the surface, processes for soil-repellent treatment of hard surfaces, cleansing agents for hard surfaces and also hard surfaces with a soil-repellent coating comprising hydrophobins.
  • the coatings can be permanent soil-repellent coatings, for example coatings inspired by the lotus effect.
  • the coatings can also be temporary coatings.
  • Such a temporary soil-repellent effect can be achieved for example via substances in a cleanser formulation which are applied in the course of the surface being cleaned.
  • Significant fields of use for such cleansers are household applications, such as cleansers for the kitchen or sanitary areas, but also industrial applications, for example cleansers for car washing.
  • EP-A 467 472 discloses a composition for raising the hydrophilicity of hard surfaces, for example household surfaces, in order that easier cleaning in subsequent cleaning steps may be achieved.
  • the formulation comprises a water-soluble, ionic or nonionic polymer, for example a cationic polymer having quaternized ammonium alkyl methacrylate units.
  • the disclosed cleaner formulations comprise 0.02% to 5% by weight of the polymer.
  • WO 03/002620 discloses the use of dialkylaminoalkyl(meth)acrylates as soil release polymers for hard surfaces, for example fine-stone floors or stainless-steel surfaces.
  • the cleanser formulations disclosed comprise 0.1% to 5% by weight of the polymer.
  • DE-A 100 61 897 discloses cleaning compositions comprising hydrophilic, silicate-containing particles that lead to improved soil detachment coupled with reduced resoiling.
  • the particles are taken up by the surface of the substrates to be cleaned and accordingly affect the properties of the surface.
  • Hydrophobins are small proteins of about 100 to 150 amino acids that are characteristic of filamentous fungi, for example Schizophyllum commune . They generally have 8 cysteine units.
  • Hydrophobins have a marked affinity for interfaces and therefore are useful for coating surfaces. For instance, Teflon can be coated with hydrophobins to obtain a hydrophilic surface.
  • Hydrophobins can be isolated from natural sources. But it is also possible to synthesize non-naturally-occurring hydrophobins by means of chemical and/or biotechnological methods of production. Our prior application DE 102005007480.4 discloses a process for producing hydrophobins that do not occur in nature.
  • WO 96/41882 proposes the use of hydrophobins as emulgators, thickeners or surfactants, for giving hydrophilic properties to hydrophobic surfaces, for improving water-resistance of hydrophilic substrates, for preparing oil-in-water emulsions or water-in-oil emulsions. Further proposals include pharmaceutical applications such as the preparation of ointments or creams and also cosmetic applications such as skin protection or the production of shampoos or conditioners.
  • EP-A 1 252 516 discloses the coating of windows, contact lenses, biosensors, medical devices, containers for performing assays or for storage, ships hulls, solid particles or frame or body of passenger cars with a hydrophobin-containing solution at 30 to 80° C.
  • WO 03/53383 discloses the use of hydrophobin for treating keratin materials in cosmetic applications.
  • WO 03/10331 discloses a hydrophobin-coated sensor (a measuring electrode, for example) to which further substances, for example electro-active substances, antibodies or enzymes, are bound non-covalently.
  • the soil-repellent treatment is effected in combination with a cleansing of the surface.
  • the present invention provides a process for soil-repellent treatment of hard surfaces which comprises contacting the surface with a composition comprising at least one hydrophobin and also at least one solvent.
  • the present invention provides a cleansing agent for hard surfaces which comprises at least one hydrophobin, at least one surfactant and also at least one solvent.
  • the present invention concerns hard surfaces comprising a soil-repellent coating comprising hydrophobins.
  • Hard surfaces are surfaces which are only minimally compressible, if at all, in particular smooth surfaces, for example surfaces of glass, ceramic, metals, for example stainless steel or brass, enamel, plastic and/or lacquered surfaces.
  • lacquered surfaces comprise the surface of lacquered automobile bodies or the surface of household appliances.
  • Hard surfaces may comprise in particular typical household surfaces, for example the surface of tiles, floors, fittings, basins, shower baths, bath tubs, toilets, shower cabins, bathroom furniture, kitchen furniture such as tables, chairs, cupboards, working surfaces or other furniture, mirrors, windows, dishware, cutlery, glasses, porcelain articles or the surfaces of household appliances such as washing machines, dishwashers, cookers or fume extraction hoods.
  • soil-repellent is known to one skilled in the art.
  • a soil-repellent treatment of a surface controls its soiling and/or facilitates the detachment of soil from the surface.
  • Soil comprises in a known manner any kind of undesirable contamination of hard surfaces with solid and/or liquid entities.
  • Examples of soil comprise fats, oils, proteins, food leftovers, dust or dirt.
  • Soiling may also comprise lime deposits such as for example dried tracks of water which form owing to water hardness. Further examples comprise residues of personal care cleansing and care agents or else insoluble lime soaps which may form from such cleansing and care agents in conjunction with water hardness and which may become deposited on hard surfaces such as for example wash basins, shower enclosures or bath tubs.
  • At least one hydrophobin is used for the soil-repellent treatment of hard surfaces.
  • Just one hydrophobin can be used or a mixture of a plurality of different hydrophobins can be used.
  • hydrophobins as used herein shall refer hereinbelow to polypeptides of the general structural formula (I)
  • X may be any of the 20 naturally occurring amino acids (Phe, Leu, Ser, Tyr, Cys, Trp, Pro, His, Gln, Arg, Ile, Met, Thr, Asn, Lys, Val, Ala, Asp, Glu, Gly).
  • Each X may be the same or different.
  • the indices next to X indicate in each case the number of amino acids, C represents cysteine, alanine, serine, glycine, methionine or threonine subject to the proviso that at least four of the amino acids identified by C are cysteine, and the indices n and m are independently natural numbers in the range from 0 to 500 and preferably in the range from 15 to 300.
  • the polypeptides of formula (I) are further characterized by the property (after coating of a glass surface) of increasing the contact angle of a drop of water by at least 20°, preferably at least 25°, more preferably at least 30° and most preferably at least 35°, compared with the contact angle formed by a drop of water of the same size with the uncoated glass surface, each measurement being carried out at room temperature.
  • the amino acids denoted C 1 to C 8 are preferably cysteines; but they may also be replaced by other amino acids of similar bulk, preferably by alanine, serine, threonine, methionine or glycine. However, at least four, preferably at least 5, more preferably at least 6 and especially at least 7 of the C 1 to C 8 positions shall consist of cysteines. Cysteines in proteins used according to the present invention may be present in reduced form or form disulfide bridges with one another. Particular preference is given to intramolecular formation of C—C bridges, in particular that involving at least one, preferably 2, more preferably 3 and most preferably 4 intramolecular disulfide bridges. In the case of the above-described exchange of cysteines for amino acids of similar bulk, it is advantageous for such C-positions to be involved in a pairwise exchange as are able to form intramolecular disulfide bridges with each other.
  • cysteines When cysteines, serines, alanines, glycines, methionines or threonines are used in the positions designated X, the numbering of the individual C-positions in the general formulae may change accordingly.
  • X, C and the indices next to X are each as defined above
  • the indices n and m represent numbers in the range from 0 to 300
  • the proteins are further distinguished by the abovementioned contact angle change.
  • the proteins are further distinguished by the abovementioned contact angle change and furthermore at least six of the amino acids denoted C are cysteine. It is particularly preferable for all amino acids denoted C to be cysteine.
  • residues X n and X m may be peptide sequences which may be naturally linked to a hydrophobin. However, either or both of the residues X n and X m may be peptide sequences which are not naturally linked to a hydrophobin. This also includes X n and/or X m residues in which a peptide sequence naturally occurring in a hydrophobin is extended by a peptide sequence not naturally occurring in a hydrophobin.
  • X n and/or X m are peptide sequences which do not occur naturally in hydrophobins
  • the length of such sequences is generally at least 20 amino acids, preferably at least 35 amino acids, more preferably at least 50 amino acids and most preferably at least 100 amino acids.
  • a residue of this kind, which is not naturally linked to a hydrophobin, will also be referred to as a fusion partner portion hereinbelow. This is intended to articulate the fact that the proteins consist of a one hydrophobin portion and a fusion partner portion which do not occur together in this form in nature.
  • the fusion partner portion may be selected from a multiplicity of proteins. It is also possible for a plurality of fusion partner portions to be linked to one hydrophobin portion, for example to the amino terminus (X n ) or to the carboxy terminus (X m ) of the hydrophobin portion. But it is also possible, for example, to link two fusion partner portions to one position (X n or X m ) of the protein used according to the present invention.
  • fusion partner portions are polypeptides which occur naturally in microorganisms, in particular in E. coli or Bacillus subtilis .
  • fusion partner portions are the sequences yaad (SEQ ID NO:15 and 16), yaae (SEQ ID NO:17 and 18) and thioredoxin.
  • fragments or derivatives of the aforementioned sequences which comprise only a portion, preferably 70% to 99% and more preferably 80% to 98%, of the said sequences, or in which individual amino acids or nucleotides have been altered compared with the sequence mentioned.
  • Proteins used according to the present invention may additionally be modified in their polypeptide sequence, for example by glycosylation, acetylation or else by chemical crosslinking, for example with glutaraldehyde.
  • One property of the proteins used according to the present invention is the change in surface properties when the surfaces are coated with the proteins.
  • the change in surface properties can be determined experimentally by measuring the contact angle of a drop of water before and after coating of the surface with the protein and determining the difference between the two measurements.
  • the proteins used according to the present invention have the property of increasing the contact angle of a water droplet on a glass surface by at least 20°, preferably at least 25° and more preferably at least 30°.
  • the assembled membranes of class I hydrophobins are highly insoluble (even in a 1% by weight aqueous solution of sodium n-dodecyl sulfate (SDS) at an elevated temperature and can only be dissociated again by means of concentrated trifluoroacetic acid (TFA) or formic acid.
  • the assembled forms of class II hydrophobins are less stable. They can be dissolved again by means of just 60% by weight ethanol or 1% by weight SDS (at room temperature).
  • hydrophobins for embodying the present invention are those of the type dewA, rodA, hypA, hypB, sc3, basf1, basf2, which are structurally characterized in the sequence listing below. They may also be only parts or derivatives thereof. It is also possible to link a plurality of hydrophobin, preferably 2 or 3, of the same or a different structure together and to a corresponding suitable polypeptide sequence which is not naturally connected to a hydrophobin.
  • fusion proteins having the polypeptide sequences indicated in SEQ ID NO: 20, 22, 24 and also the nucleic acid sequences coding therefor, in particular the sequences according to SEQ ID NO: 19, 21, 23.
  • Particularly preferred embodiments further include proteins which, starting from the polypeptide sequences indicated in SEQ ID NO. 22, 22 or 24, result from the substitution, insertion or deletion of at least one, up to 10, preferably 5, more preferably 5% of all amino acids and which still possess at least 50% of the biological property of the starting proteins.
  • Biological property of the proteins used according to the present invention is herein to be understood as meaning the above-described change in the contact angle by at least 20°.
  • Polypeptides used according to the present invention are chemically preparable by familiar techniques of peptide synthesis, for example by Merrifield's solid phase synthesis.
  • Naturally occurring hydrophobins can be isolated from natural sources using suitable methods. As an example, see Wösten et. al., Eur. J. Cell Bio. 63, 122-129 (1994) or WO 96/41882.
  • Fusion proteins are preferably preparable by genetic engineering processes in which one nucleic acid sequence, in particular a DNA sequence, coding for the fusion partner and one nucleic acid sequence, in particular a DNA sequence, coding for the hydrophobin portion are combined such that the desired protein is generated in a host organism by gene expression of the combined nucleic acid sequence.
  • a method of making is disclosed in our prior application DE 102005007480.4.
  • Suitable host, or producer, organisms for the method of making mentioned include prokaryotes (including Archaea) or eukaryotes, particularly bacteria-including halobacteria and methanococci, fungi, insect cells, plant cells and mammalian cells, more preferably Escherichia coli, Bacillus subtilis, Bacillus megaterium, Aspergillus oryzea, Aspergillus nidulans, Aspergillus niger, Pichia pastoris, Pseudomonas spec., lactobacilli, Hansenula polymorpha, Trichoderma reesei , SF9 (or related cells), and so on.
  • prokaryotes including Archaea
  • eukaryotes particularly bacteria-including halobacteria and methanococci
  • fungi insect cells
  • plant cells and mammalian cells more preferably Escherichia coli, Bacillus subtilis, Bacillus megate
  • expression constructs obtained, under the genetic control of regulatory nucleic acid sequences, a nucleic acid sequence coding for a polypeptide used according to the present invention, and also vectors comprising at least one of these expression constructs can be used to prepare hydrophobins.
  • Expression constructs used preferably comprise a promoter 5′ upstream of the particular coding sequence and a terminator sequence 3′ downstream of the particular coding sequence and also, if appropriate, further customary regulatory elements, each operatively linked to the coding sequence.
  • “Operative linkage” refers to the sequential arrangement of promoter, coding sequence, terminator and, if appropriate, further regulatory elements such that each of the regulatory elements is able to fulfill its function as required in expressing the coding sequence.
  • operatively linkable sequences are targeting sequences and also enhancers, polyadenylation signals and the like.
  • Further regulatory elements comprise selectable markers, amplification signals, origins of replication and the like. Suitable regulatory sequences are described for example in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990).
  • the natural regulation of these sequences may still be present upstream of the actual structural genes and, if appropriate, may have been genetically modified such that the natural regulation has been switched off and the expression of the genes has been enhanced.
  • a preferred nucleic acid construct advantageously also comprises one or more of the aforementioned enhancer sequences which are functionally linked to the promoter and which enable an enhanced expression of the nucleic acid sequence. Additional advantageous sequences such as further regulatory elements or terminators may also be inserted at the 3′ end of the DNA sequences.
  • the nucleic acids may be present in the construct in one or more copies.
  • the construct may further comprise additional markers such as antibiotic resistances or auxotrophy-complementing genes, if appropriate for the purpose of selecting said construct.
  • Advantageous regulatory sequences for the process are present for example in promoters such as cos, tac, trp, tet, trp-tet, lpp, lac, lpp-lac, laclq-T7, T5, T3, gal, trc, ara, rhaP(rhaPBAD) SP6, lambda-PR or imlambda-P promoter, which promoters are advantageously used in Gram-negative bacteria.
  • Further advantageous regulatory sequences are present for example in the Gram-positive promoters amy and SP02, in the yeast or fungal promoters ADC1, MFalpha, AC, P-60, CYC1, GAPDH, TEF, rp28, ADH.
  • a vector for example a plasmid or phage, which permits optimal expression of the genes in the host.
  • Vectors, as well as plasmids and phages further include all other vectors known per se, i.e., for example viruses, such as SV40, CMV, baculovirus and adenovirus, transposons, IS elements, phasmids, cosmids, and linear or circular DNA, and also the Agrobacterium system.
  • vectors may be replicated autonomously in the host organism or chromosomally. These vectors constitute a further form of the invention.
  • suitable plasmids are, in E. coli , pLG338, pACYC184, pBR322, pUC18, pUC19, pKC30, pRep4, pHS1, pKK223-3, pDHE19.2, pHS2, pPLc236, pMBL24, pLG200, pUR290, pIN-III′′3-B1, tgt11 or pBdCI, in Streptomyces , pIJ101, pIJ364, pIJ702 or pIJ361, in Bacillus pUB110, pC194 or pBD214, in Corynebacterium pSA77 or pAJ667, in fungi pALS1, pIL2 or pBB116, in yeasts 2alpha, pAG-1, YE
  • the plasmids mentioned constitute a small selection of the possible plasmids. Further plasmids are known per se and are to be found for example in the book Cloning Vectors (Eds. Pouwels P. H. et al. Elsevier, Amsterdam-New York-Oxford, 1985, ISBN 0 444 904018).
  • the nucleic acid construct advantageously further comprises 3′- and/or 5′-terminal regulatory sequences to enhance expression which are selected for optimal expression according to the choice of host organism and gene or genes.
  • regulatory sequences are intended to enable the genes and protein expression to be specifically expressed. Depending on the host organism, this may mean for example that the gene is expressed or overexpressed only after induction, or that it is expressed and/or overexpressed immediately.
  • the expression of the genes which have been introduced which may be positively influenced and thereby enhanced by the regulatory sequences or factors.
  • the regulatory elements may thus be advantageously enhanced on the transcription level by using strong transcription signals such as promoters and/or enhancers.
  • strong transcription signals such as promoters and/or enhancers.
  • the vector comprising the nucleic acid construct or the nucleic acid may also advantageously be introduced into the microorganisms in the form of a linear DNA and be integrated into the genome of the host organism via heterologous or homologous recombination.
  • This linear DNA may consist of a linearized vector such as a plasmid or only of the nucleic acid construct or the nucleic acid.
  • An expression cassette is prepared by fusing a suitable promoter to a suitable coding nucleotide sequence and to a terminator or polyadenylation signal.
  • Common recombination and cloning techniques as described for example in T. Maniatis, E. F. Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. (1989) and also in T. J. Silhavy, M. L. Berman and L. W. Enquist, Experiments with Gene Fusions, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. (1984) and in Ausubel, F. M. et al., Current Protocols in Molecular Biology, Greene Publishing Assoc and Wiley Interscience (1987), are used for this purpose.
  • the recombinant nucleic acid construct, or gene construct is advantageously inserted into a host-specific vector which provides optimal expression of the genes in the host.
  • Vectors are known per se and may be taken for example from “Cloning Vectors” (Pouwels P. H. et al., Eds, Elsevier, Amsterdam-New York-Oxford, 1985).
  • recombinant microorganisms which are, for example, transformed with at least one vector and which may be used for producing the polypeptides used according to the invention.
  • the above-described recombinant constructs are introduced into a suitable host system and expressed.
  • familiar cloning and transfection methods known to the skilled worker such as, for example, coprecipitation, protoplast fusion, electroporation, retroviral transfection and the like, are preferably used in order to cause said nucleic acids to be expressed in the particular expression system. Suitable systems are described, for example, in Current Protocols in Molecular Biology, F.
  • a vector which comprises at least one section of a gene to be used according to the invention or of a coding sequence in which, if appropriate, at least one amino acid deletion, amino acid addition or amino acid substitution has been introduced in order to modify, for example functionally disrupt, the sequence is prepared.
  • the introduced sequence may, for example, also be a homolog from a related microorganism or be derived from a mammalian, yeast or insect source.
  • the vector used for homologous recombination may be designed in such a way that the endogenous gene is, in the case of homologous recombination, mutated or otherwise altered but still encodes the functional protein (e.g. the upstream regulatory region may have been altered in such a way that expression of the endogenous protein is thereby altered).
  • the altered section of the gene used according to the invention is in the homologous recombination vector.
  • the construction of vectors which are suitable for homologous recombination is described, for example, in Thomas, K. R. and Capecchi, M. R. (1987) Cell 51:503.
  • Recombinant host organisms suitable for the nucleic acid used according to the invention or the nucleic acid construct are in principle any prokaryotic or eukaryotic organisms.
  • microorganisms such as bacteria, fungi or yeasts are used as host organisms.
  • Gram-positive or Gram-negative bacteria preferably bacteria of the families Enterobacteriaceae, Pseudomonadaceae, Rhizobiaceae, Streptomycetaceae or Nocardiaceae, particularly preferably bacteria of the genera Escherichia, Pseudomonas, Streptomyces, Nocardia, Burkholderia, Salmonella, Agrobacterium or Rhodococcus , are advantageously used.
  • the organisms used in the process of preparing fusion proteins are, depending on the host organism, grown or cultured in a manner known to the skilled worker.
  • Microorganisms are usually grown in a liquid medium which comprises a carbon source, usually in the form of sugars, a nitrogen source, usually in the form of organic nitrogen sources such as yeast extract or salts such as ammonium sulfate, trace elements such as iron salts, manganese salts and magnesium salts and, if appropriate, vitamins, at temperatures of between 0° C. and 100° C., preferably between 10° C. and 60° C., while being supplied with oxygen.
  • the pH of the nutrient liquid may be kept at a fixed value, i.e. may or may not be regulated during cultivation.
  • the cultivation may be carried out batchwise, semibatchwise or continuously.
  • Nutrients may be initially introduced at the beginning of the fermentation or be fed in subsequently in a semicontinuous or continuous manner.
  • the enzymes may be isolated from the organisms by the process described in the examples or be used for the reaction as a crude extract.
  • polypeptides are also suitable in this way on an industrial scale if this is desired.
  • the recombinant microorganism may be cultured and fermented by known methods. Bacteria may, for example, be propagated in TB medium or LB medium and at a temperature of from 20 to 40° C. and a pH of from 6 to 9. Suitable culturing conditions are described in detail, for example, in T. Maniatis, E. F. Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. (1989).
  • the cells are then disrupted and the product is obtained from the lysate by known protein isolation processes.
  • the cells may be disrupted, as desired, by means of high-frequency ultrasound, by means of high pressure, such as, for example, in a French pressure cell, by means of osmolysis, by the action of detergents, lytic enzymes or organic solvents, by means of homogenizers or by a combination of two or more of the processes listed.
  • Polypeptides may be purified using known chromatographic methods such as molecular sieve chromatography (gel filtration), such as Q Sepharose chromatography, ion exchange chromatography and hydrophobic chromatography, and also using other customary methods such as ultrafiltration, crystallization, salting-out, dialysis and native gel electrophoresis. Suitable processes are described, for example, in Cooper, F. G., Biochemische Harvey Methoden, Verlag Walter de Gruyter, Berlin, New York or in Scopes, R., Protein Purification, Springer Verlag, N.Y., Heidelberg, Berlin.
  • tags acting as anchors, such as the modification known as the hexa-histidine anchor, or epitopes which can be recognized as antigens by antibodies (described, for example, in Harlow, E. and Lane, D., 1988, Antibodies: A Laboratory Manual. Cold Spring Harbor (N.Y.) Press).
  • Suitable tags are, for example, HA, calmodulin-BD, GST, MBD; chitin-BD, steptavidin-BD-avi-tag, Flag-tag, T7 etc.
  • anchors may be used for attaching the proteins to a solid support such as a polymer matrix, for example, which may, for example, be packed in a chromatography column, or may be used on a microtiter plate or on another support.
  • the corresponding purification protocols can be obtained from the commercial affinity tag suppliers.
  • the proteins prepared as described may be used either directly as fusion proteins or, after cleaving off and removing the fusion partner portion, as “pure” hydrophobins.
  • cleavage site specifically recognition site for proteases
  • Suitable cleavage sites include in particular those peptide sequences which otherwise occur neither in the hydrophobin portion nor in the fusion partner portion, as is readily determined by means of bioinformatics tools.
  • Particularly suitable are for example BrCN cleavage on methionine or protease-mediated cleavage with factor Xa, enterokinase cleavage, thrombin, TEV (tobacco etch virus protease) cleavage.
  • Hydrophobins can be used in substance when they are used according to the present invention for the soil-repellent treatment of hard surfaces.
  • the hydrophobins are used as formulations or compositions in at least one suitable solvent.
  • hydrophobins to embody the invention are not restricted. It is possible to use one hydrophobin or else a plurality of different ones. A person skilled in the art will make a suitable choice. For example, it is possible to use fusion proteins such as for example yaad-Xa-dewA-his (SEQ ID NO: 19) or yaad-Xa-rodA-his (SEQ ID NO: 21).
  • the solvents for formulations may comprise water and/or organic solvents. Solvent mixtures can also be used.
  • the identity of the solvent depends on the hydrophobin, the identity of the surface to be treated and also the use, and is appropriately selected by one skilled in the art. Generally, water or aqueous formulations are preferred for household applications. Aqueous, predominantly aqueous and nonaqueous formulations are suitable for industrial applications.
  • the solvent preferably comprises water or mixtures of water and water-miscible, organic solvents.
  • organic solvents comprise water-miscible monohydric or polyhydric alcohols, for example methanol, ethanol, n-propanol, i-propanol, ethylene glycol, propylene glycol or glycerol.
  • Ether alcohols are also a possibility.
  • examples comprise monoalkyl ethers of (poly)ethylene or (poly)propylene glycols such as ethylene glycol monobutyl ether.
  • the identity and amount of the water-soluble and of the organic solvents are chosen by one skilled in the art.
  • Aqueous mixtures preferably comprise at least 80% by weight of water based on the sum total of all solvents. Besides water, alcohols are preferred solvents.
  • composition used according to the present invention it may be preferable to employ the as-synthesized, as-isolated and/or as-purified aqueous hydrophobin solutions. These may still comprise, depending on their purity, residues of auxiliaries from the synthesis. But it is also possible to isolate the hydrophobins initially as substance, for example by freeze drying, and for them only to be formulated in a second step.
  • the amount of hydrophobin in the formulation can be determined by one skilled in the art according to the identity of the surface and/or the planned use. But even relatively small amounts will be sufficient to achieve a soil-repellent effect.
  • An amount of 0.0001% to 1% by weight based on the sum-total of all constituents of the formulation has been found satisfactory without the invention thereby being restricted to this range.
  • the amount is preferably in the range from 0.0005% to 0.5% by weight and more preferably in the range from 0.001% to 0.1% by weight.
  • the composition used comprises a cleansing agent, for example glass cleaners, floor cleaners, all purpose cleaners, bath cleaners, rinse aids, dishwashing agents for manual or machine cleaning of dishware, machine cleaners, metal degreasers, high pressure cleaners, alkaline cleaners, acid cleaners, point degreasers or dairy cleaners.
  • the cleansing agent of the present invention as well as a solvent and at least one hydrophobin, comprises in a manner which is known in principle one or more surfactants in effective amounts.
  • compositions may also comprise pre- or aftertreating agents for hard surfaces, in particular for glass, ceramics or floors.
  • Surfactants may comprise anionic, nonionic, amphoteric and/or cationic surfactants. Such surfactants and also their respective preferred use are known in principle to one skilled in the art.
  • anionic surfactants comprise fatty alcohol sulfates, alkyl ether sulfates, alkanesulfonates, alkylbenzenesulfonates or alkyl phosphates.
  • the free acids or salts thereof can be used.
  • nonionic surfactants comprise alkoxylated C 8 -C 22 alcohols such as fatty alcohol alkoxylates or oxo process alcohol alkoxylates, alkylphenol ethoxylates having C 6 -C 14 alkyl chains and 5 to 30 mol of ethylene oxide units, alkylpolyglucosides having 8 to 22 in the alkyl chain, alkylamine alkoxylates or alkylamide ethoxylates.
  • amphoteric surfactants comprise alkylbetaines, alkylamidebetaines, aminopropionates, aminoglycinates or amphoteric imidazolium compounds.
  • cationic surfactants comprise substituted or unsubstituted, straight-chain or branched quaternary ammonium salts, for example C 8-6 dialkyldimethylammonium halides, dialkoxydimethylammonium halides or imidazolium salts having a long-chain alkyl radical.
  • the formulation may optionally additionally comprise further components, for example admixture materials and/or assistants.
  • further components for example admixture materials and/or assistants.
  • Such components comprise acids or bases, for example carboxylic acids or ammonia, buffer systems, polymers, inorganic particles such as SiO 2 or silicates, dyes, fragrances or biocides.
  • Further examples of admixture materials are recited in DE-A 101 60 993, in particular sections [0074] to [0131]. A person skilled in the art will make a suitable selection with regard to the type and amount of additional components depending on the application.
  • hard surfaces are treated in a soil-repellent manner by contacting the hard surface with a composition comprising at least one hydrophobin and also at least one solvent.
  • the contacting is governed by the type of article. It may be effected for example by spraying, rinsing or wiping the surface with the composition or else by dipping the entire article into the formulation. The latter is naturally only possible with articles which have not been installed.
  • the treatment time is decided by one skilled in the art. It can take a few seconds to several hours. After treatment, the surface may be rinsed, with water for example, to remove excess treating solution.
  • the soil-repellent treatment can particularly advantageously be effected in combination with a cleaning i.e., in the course of the actual cleaning process itself. This is done using the cleaning composition comprising as described above at least one hydrophobin, at least one surfactant and also at least one solvent.
  • the treatment can be carried out at temperatures below room temperature, at room temperature or elevated temperatures, for example at 20 to 100° C., preferably 20 to 60° C.
  • the treatment is preferably carried out at temperatures of not more than 30° C., in particular from 20 to 30° C.
  • the treated surface After treatment with the composition, the treated surface is dried.
  • the drying of the treated surface can take place quasi of itself at room temperature, or drying can also be carried out at elevated temperatures.
  • the treatment and also, if appropriate, the drying of the surface may be followed by a thermal aftertreatment of the surface at elevated temperatures, for example at temperatures of up to 120° C.
  • the thermal aftertreatment can also be carried out combined with the drying.
  • the thermal aftertreatment temperatures are preferably in the range from 30 to 100° C., more preferably in the range from 40 to 80° C. and for example in the range from 50 to 70° C.
  • the treatment time is decided by one skilled in the art, it can be in the range from 1 min to 10 h for example.
  • the process of the present invention provides a hard surface which comprises a soil-repellent coating comprising at least one hydrophobin.
  • the coating generally comprises at least a monomolecular layer of hydrophobin on the surface.
  • the soil-repellent effect can be determined by means of methods known in principle, for example by comparing the detachability of soil by rinsing off with water for an untreated surface against a surface treated with hydrophobins.
  • Hydrophobins have a distinct effect even in small amounts. Treatment with a composition comprising just 0.01% by weight of hydrophobins will lead to distinctly improved soil release.
  • the soil-repellent treatment according to the present invention is particularly useful for ceramic surfaces, for example for tiles.
  • a distinct hydrophobicization of the surface can be achieved through the treatment as well as the soil-repellent effect. This is a significant advantage particularly in wet rooms, such as bathrooms for example.
  • a polymerase chain reaction was carried out with the aid of the oligonucleotides Hal570 and Hal571 (Hal 572/Hal 573).
  • the template DNA used was genomic DNA of the bacterium Bacillus subtilis .
  • the PCR fragment obtained comprised the coding sequence of the Bacillus subtilis yaaD/yaaE gene and, at their termini, in each case an NcoI and, respectively, BgIII restriction cleavage site.
  • the PCR fragment was purified and cut with the restriction endonucleases NcoI and BgIII.
  • This DNA fragment was used as insert and cloned into the vector pQE60 from Qiagen, which had previously been linearized with the restriction endonucleases NcoI and BgIII.
  • the vectors thus obtained, pQE60YAAD#2/pQE60YaaE#5 may be used for expressing proteins consisting of YAAD::HIS 6 and YAAE::HIS 6
  • Hal570 gcgcgcccatggctcaaacaggtactga
  • Hal571 gcagatctccagccgcgttcttgcatac
  • Hal572 ggccatgggattaacaataggtgtactagg
  • Hal573 gcagatcttacaagtgccttttgcttatattcc
  • a polymerase chain reaction was carried out with the oligonucleotide KaM 416 and KaM 417.
  • the template DNA used was genomic DNA of the mold Aspergillus nidulans .
  • the PCR fragment obtained comprised the coding sequence of the hydrophobin gene dewA and an N-terminal factor Xa proteinase cleavage site.
  • the PCR fragment was purified and cut with the restriction endonuclease BamHI. This DNA fragment was used as insert and cloned into the pQE60YAAD#2 vector previously linearized with the restriction endonuclease BgIII.
  • the vector thus obtained, #508, may be used for expressing a fusion protein consisting of YMD::Xa::dewA::HIS 6 .
  • KaM416 GCAGCCCATCAGGGATCCCTCAGCCTTGGTACCAGCGC
  • KaM417 CCCGTAGCTAGTGGATCCATTGAAGGCCGCATGAAGTTC TCCGTCTCCGC
  • the plasmid #513 was cloned analogously to plasmid #508, using the oligonucleotides KaM 434 and KaM 435.
  • KaM434 GCTAAGCGGATCCATTGAAGGCCGCATGAAGT TCTCCATTGCTGC KaM435: CCAATGGGGATCCGAGGATGGAGCCAAGGG
  • the plasmid #507 was cloned analogously to plasmid #508, using the oligonucleotides KaM 417 and KaM 418.
  • the template DNA employed was an artificially synthesized DNA sequence-hydrophobin BASF1 (see appendix).
  • KaM417 CCCGTAGCTAGTGGATCCATTGAAGGCCGCATGAAGTTC TCCGTCTCCGC
  • KaM418 CTGCCATTCAGGGGATCCCATATGGAGGAGGGAGACAG
  • the plasmid #506 was cloned analogously to plasmid #508, using the oligonucleotides KaM 417 and KaM 418.
  • the template DNA employed was an artificially synthesized DNA sequence-hydrophobin BASF2 (see appendix).
  • KaM417 CCCGTAGCTAGTGGATCCATTGAAGGCCGCATGAAGTTC TCCGTCTCCGC
  • KaM418 CTGCCATTCAGGGGATCCCATATGGAGGAGGGAGACAG
  • the plasmid #526 was cloned analogously to plasmid #508, using the oligonucleotides KaM464 and KaM465.
  • the template DNA employed was Schyzophyllum commune cDNA (see appendix).
  • KaM464 CGTTAAGGATCCGAGGATGTTGATGGGGGTGC
  • KaM465 GCTAACAGATCTATGTTCGCCCGTCTCCCCGTCGT
  • 100 g of cell pellet 100-500 mg of hydrophobin
  • 50 mM sodium phosphate buffer, pH 7.5 50 mM sodium phosphate buffer, pH 7.5, to a total volume of 200 ml and resuspended.
  • the suspension was treated with an Ultraturrax type T25 (Janke and Kunkel; IKA-Labortechnik) for 10 minutes and subsequently, for the purposes of degrading the nucleic acids, incubated with 500 units of benzonase (Merck, Darmstadt; order No. 1.01697.0001) at room temperature for 1 hour. Prior to cell disruption, a filtration was carried out using a glass cartridge (P1).
  • 50 ml of the hydrophobin-containing supernatant were applied to a 50 ml nickel-Sepharose High Performance 17-5268-02 column (Amersham) equilibrated with 50 mM Tris-Cl buffer, pH 8.0.
  • the column was washed with 50 mM Tris-Cl buffer, pH 8.0, and the hydrophobin was subsequently eluted with 50 mM Tris-Cl buffer, pH 8.0, comprising 200 mM imidazole.
  • the solution was dialyzed against 50 mM Tris-Cl buffer, pH 8.0.
  • FIG. 1 depicts the purification of the hydrophobin prepared:
  • Lane 1 solution applied to nickel-Sepharose column (1:10 dilution)
  • Lanes 3-5 OD 280 peaks of elution fractions
  • the hydrophobin of FIG. 1 has a molecular weight of approx. 53 kD. Some of the smaller bands represent degradation products of hydrophobin.
  • the samples are air dried (room temperature) and subjected at room temperature to a determination of the contact angle (in degrees) of a droplet of 5 ⁇ l of water.
  • the contact angle measurement was determined on a Dataphysics Contact Angle System OCA 15+, Software SCA 20.2.0. (November 2002). The measurement was carried out in accordance with the manufacturer's instructions.
  • Ceramic tile shiny white, 10 cm ⁇ 15 cm (from Novocker), wiped down with ethanol and water.
  • a tile had 2 g of the abovementioned, aqueous hydrophobin solution having a concentration of 100 ⁇ g/ml dripped onto it (1.3 ⁇ m of hydrophobin/cm 2 ) and gently distributed with a cloth to cover the entire surface. The tile was then left to lie to air dry for 24 h.
  • the tile was subsequently rinsed off with water and placed for 3 ⁇ 10 min in a glass beaker with water. Fresh water was used for each rinse. The tile was then left to air dry upright.
  • the treated tile gave a contact angle measurement against a water droplet (S ⁇ l, method as described above) of 56° (mean of 10 measurements).
  • S ⁇ l water droplet
  • an untreated tile has a contact angle of 20°.
  • the tile had thus been distinctly hydrophobicized.
  • the treated tile and, in comparison, an untreated tile were each spotted with 50, 100 and 200 ⁇ g of IKW ballast soil using a transfer pipette and left to dry at room temperature for one h.
  • the tiles were then rinsed 3 times with 500 ml of water each time. While this did not detach the soil from the untreated surface, partial soil detachment was observed for the hydrophobin-pretreated tile.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Materials Engineering (AREA)
  • Detergent Compositions (AREA)
  • Organic Low-Molecular-Weight Compounds And Preparation Thereof (AREA)
  • Cleaning And De-Greasing Of Metallic Materials By Chemical Methods (AREA)
US11/887,129 2005-03-30 2006-03-27 Use of hydrophobin for hard surface soil-repellent treatment Abandoned US20090305930A1 (en)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
DE200510014844 DE102005014844A1 (de) 2005-03-30 2005-03-30 Verwendung von Hydrophobinen zur schmutzabweisenden Behandlung von harten Oberflächen
DE102005014844.1 2005-03-30
DE200510036341 DE102005036341A1 (de) 2005-07-29 2005-07-29 Verwendung von Hydrophobinen zur schmutzabweisenden Behandlung von harten Oberflächen
DE102005036341.5 2005-07-29
PCT/EP2006/061069 WO2006103215A1 (de) 2005-03-30 2006-03-27 Verwendung von hydrophobinen zur schmutzabweisenden behandlung von harten oberflächen

Publications (1)

Publication Number Publication Date
US20090305930A1 true US20090305930A1 (en) 2009-12-10

Family

ID=36602657

Family Applications (1)

Application Number Title Priority Date Filing Date
US11/887,129 Abandoned US20090305930A1 (en) 2005-03-30 2006-03-27 Use of hydrophobin for hard surface soil-repellent treatment

Country Status (10)

Country Link
US (1) US20090305930A1 (https=)
EP (1) EP1866401B1 (https=)
JP (1) JP5064376B2 (https=)
KR (1) KR101250067B1 (https=)
AT (1) ATE483009T1 (https=)
BR (1) BRPI0609541A2 (https=)
CA (1) CA2602155A1 (https=)
DE (1) DE502006007963D1 (https=)
MX (1) MX2007012023A (https=)
WO (1) WO2006103215A1 (https=)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090041922A1 (en) * 2005-07-14 2009-02-12 Basf Aktiengesellschaft Aqueous monomer emulsions containing hydrophobin
US20090233110A1 (en) * 2005-03-31 2009-09-17 Basf Aktiengeselischaft Use of polypeptides in the form of adhesive agents
US20100240774A1 (en) * 2007-09-13 2010-09-23 Basf Se Use of hydrophobin polypeptides as penetration enhancers
US20100267096A1 (en) * 2009-03-09 2010-10-21 Basf Se Use of a synergistic mixture of water-soluble polymers and hydrophobins for thickening aqueous phases
US20100311629A1 (en) * 2007-09-28 2010-12-09 Basf Se Method for removing water-insoluble substances from substrate surfaces
US20120006354A1 (en) * 2010-07-07 2012-01-12 Basf Se Composition and method for cleaning surfaces
US20170327774A1 (en) * 2016-05-10 2017-11-16 The Procter & Gamble Company Cleaning composition

Families Citing this family (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006082251A2 (de) 2005-02-07 2006-08-10 Basf Aktiengesellschaft Neue hydrophobinfusionsproteine, deren herstellung und verwendung
WO2006103253A2 (de) 2005-04-01 2006-10-05 Basf Aktiengesellschaft Bohrspülung enthaltend hydrophobin
EA014384B1 (ru) 2005-04-01 2010-10-29 Басф Акциенгезелльшафт Промывочный буровой раствор, содержащий гидрофобин
DE102005027139A1 (de) * 2005-06-10 2006-12-28 Basf Ag Neue Cystein-verarmte Hydrophobinfusionsproteine, deren Herstellung und Verwendung
US20090101167A1 (en) * 2005-08-01 2009-04-23 Basf Aktiengesellschaft Use of Surface-Active Non-Enzymatic Proteins for Washing Textiles
DE102005048720A1 (de) 2005-10-12 2007-04-19 Basf Ag Verwendung von Proteinen als Antischaum-Komponente in Kraftstoffen
ES2374320T3 (es) 2006-08-15 2012-02-15 Basf Se Procedimiento para la producción de preparaciones de hidrofobina secas de flujo libre.
WO2008107439A1 (de) 2007-03-06 2008-09-12 Basf Se Mit hydrophobinen modifizierte offenzellige schaumstoffe
CA2679719C (en) * 2007-03-12 2015-04-28 Basf Se Method of treating cellulosic materials with hydrophobins
CA2687490A1 (en) * 2007-05-24 2008-11-27 Basf Se Use of hydrophobins as auxiliaries in the crystallization of solids
WO2010072665A1 (de) 2008-12-23 2010-07-01 Basf Se Modifizierung von nano- oder mesofasern oder textilen flächengebilden hergestellt mittels elektrospinnen mit amphiphilen proteinen
WO2011015530A2 (en) 2009-08-03 2011-02-10 Basf Se Process for deposition of thin layers of metal oxides
EP2371844A1 (en) 2010-03-25 2011-10-05 B.R.A.I.N. Biotechnology Research and Information Network AG Chimeric surface active proteins
EP2536744B1 (en) 2010-02-18 2018-10-17 B.R.A.I.N. Biotechnology Research And Information Network AG Chimeric surface active proteins
MX2012011056A (es) 2010-03-31 2012-10-10 Basf Se Stents revestidos y proceso para revestir con proteina.
WO2012049250A2 (de) 2010-10-13 2012-04-19 Basf Se Verfahren zum immobilisieren kationischer wirkstoffe auf oberflächen

Citations (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US2399161A (en) * 1942-06-30 1946-04-30 Claude R Wickard Process for producing glues and adhesives from keratin protein materials
US3751280A (en) * 1970-02-06 1973-08-07 Ici Ltd Method of producing a photographic film base having a subbing layer
US4129706A (en) * 1976-08-28 1978-12-12 Basf Aktiengesellschaft Manufacture of styrene suspension polymers
US4241191A (en) * 1976-03-05 1980-12-23 Basf Aktiengesellschaft Manufacture of styrene suspension polymers
US5015677A (en) * 1986-04-25 1991-05-14 Bio-Polymers, Inc. Adhesives derived from bioadhesive polyphenolic proteins
US5049504A (en) * 1986-11-24 1991-09-17 Genex Corporation Bioadhesive coding sequences
US5110835A (en) * 1990-08-06 1992-05-05 Basf Aktiengesellschaft Antistatic expandable styrene polymers in bead form
US5290819A (en) * 1992-06-20 1994-03-01 Basf Aktiengesellschaft Preparation of bead-form expandable styrene polymers
US5859198A (en) * 1994-09-12 1999-01-12 Haber; Meir Plant proteins
WO2001057528A1 (en) * 2000-02-04 2001-08-09 Applied Nanosystems, B.V. Method of treating a surface of an object with a hydrophobin-containing solution
US20030049726A1 (en) * 2000-09-06 2003-03-13 Holloway James L. Human phermone polypeptide
US20030113454A1 (en) * 2000-02-04 2003-06-19 De Vocht Marcel Leo Method of stabilizing a hydrophobin-containing solution and a method of coating a surface with a hydrophobin
US20030217419A1 (en) * 2001-12-14 2003-11-27 L'oreal Cosmetic use of at least one hydrophobin for treating keratin materials, and compositions used
US6784149B2 (en) * 2000-12-12 2004-08-31 Clariant Gmbh Laundry detergents and cleaners comprising microdisperse silicate-containing particles
US20040224137A1 (en) * 2001-07-23 2004-11-11 Rogalska Ewa Maria Method of binding a compound to a sensor surface
US20040254091A1 (en) * 1991-06-28 2004-12-16 Gerhard Crass Use of quaternized dialkylaminoalkyl (meth) acrylates as soil release polymers for hard surfaces, and a method for production thereof
US6977239B1 (en) * 1999-11-25 2005-12-20 Cognis Deutschland Gmbh & Co. Kg Detergent tablets
US20060040349A1 (en) * 2004-08-18 2006-02-23 Sweigard James A Thermophilic hydrophobin proteins and applications for surface modification
US20070077619A1 (en) * 2003-09-15 2007-04-05 Basf Aktiengesellscaft Secretion of proteins from yeasts

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU5914196A (en) * 1995-06-12 1997-01-09 Proefstation Voor De Champignoncultuur Hydrophobins from edible fungi, genes, nucleotide sequences and dna-fragments encoding for said hydrophobins, and expression thereof
WO2005068087A2 (en) * 2004-01-16 2005-07-28 Applied Nanosystems B.V. Method for coating an object with hydrophobin at low temperatures
CA2602158A1 (en) * 2005-03-30 2006-10-05 Basf Aktiengesellschaft Use of hydrophobins for the surface treatment of hardened mineral building materials, natural stone and ceramics

Patent Citations (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US2399161A (en) * 1942-06-30 1946-04-30 Claude R Wickard Process for producing glues and adhesives from keratin protein materials
US3751280A (en) * 1970-02-06 1973-08-07 Ici Ltd Method of producing a photographic film base having a subbing layer
US4241191A (en) * 1976-03-05 1980-12-23 Basf Aktiengesellschaft Manufacture of styrene suspension polymers
US4129706A (en) * 1976-08-28 1978-12-12 Basf Aktiengesellschaft Manufacture of styrene suspension polymers
US5015677A (en) * 1986-04-25 1991-05-14 Bio-Polymers, Inc. Adhesives derived from bioadhesive polyphenolic proteins
US5049504A (en) * 1986-11-24 1991-09-17 Genex Corporation Bioadhesive coding sequences
US5110835A (en) * 1990-08-06 1992-05-05 Basf Aktiengesellschaft Antistatic expandable styrene polymers in bead form
US20040254091A1 (en) * 1991-06-28 2004-12-16 Gerhard Crass Use of quaternized dialkylaminoalkyl (meth) acrylates as soil release polymers for hard surfaces, and a method for production thereof
US5290819A (en) * 1992-06-20 1994-03-01 Basf Aktiengesellschaft Preparation of bead-form expandable styrene polymers
US5859198A (en) * 1994-09-12 1999-01-12 Haber; Meir Plant proteins
US6977239B1 (en) * 1999-11-25 2005-12-20 Cognis Deutschland Gmbh & Co. Kg Detergent tablets
WO2001057528A1 (en) * 2000-02-04 2001-08-09 Applied Nanosystems, B.V. Method of treating a surface of an object with a hydrophobin-containing solution
US20030113454A1 (en) * 2000-02-04 2003-06-19 De Vocht Marcel Leo Method of stabilizing a hydrophobin-containing solution and a method of coating a surface with a hydrophobin
US20030134042A1 (en) * 2000-02-04 2003-07-17 De Vocht Marcel Leo Method of treating a surface of an object with a hydrophobin-containing solution
US20030049726A1 (en) * 2000-09-06 2003-03-13 Holloway James L. Human phermone polypeptide
US6784149B2 (en) * 2000-12-12 2004-08-31 Clariant Gmbh Laundry detergents and cleaners comprising microdisperse silicate-containing particles
US20040224137A1 (en) * 2001-07-23 2004-11-11 Rogalska Ewa Maria Method of binding a compound to a sensor surface
US20030217419A1 (en) * 2001-12-14 2003-11-27 L'oreal Cosmetic use of at least one hydrophobin for treating keratin materials, and compositions used
US20070077619A1 (en) * 2003-09-15 2007-04-05 Basf Aktiengesellscaft Secretion of proteins from yeasts
US20060040349A1 (en) * 2004-08-18 2006-02-23 Sweigard James A Thermophilic hydrophobin proteins and applications for surface modification

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090233110A1 (en) * 2005-03-31 2009-09-17 Basf Aktiengeselischaft Use of polypeptides in the form of adhesive agents
US8859106B2 (en) 2005-03-31 2014-10-14 Basf Se Use of polypeptides in the form of adhesive agents
US20090041922A1 (en) * 2005-07-14 2009-02-12 Basf Aktiengesellschaft Aqueous monomer emulsions containing hydrophobin
US20100240774A1 (en) * 2007-09-13 2010-09-23 Basf Se Use of hydrophobin polypeptides as penetration enhancers
US20100311629A1 (en) * 2007-09-28 2010-12-09 Basf Se Method for removing water-insoluble substances from substrate surfaces
US20100267096A1 (en) * 2009-03-09 2010-10-21 Basf Se Use of a synergistic mixture of water-soluble polymers and hydrophobins for thickening aqueous phases
US20120006354A1 (en) * 2010-07-07 2012-01-12 Basf Se Composition and method for cleaning surfaces
US20170327774A1 (en) * 2016-05-10 2017-11-16 The Procter & Gamble Company Cleaning composition
US10640737B2 (en) * 2016-05-10 2020-05-05 The Procter & Gamble Company Cleaning composition

Also Published As

Publication number Publication date
EP1866401A1 (de) 2007-12-19
WO2006103215A1 (de) 2006-10-05
KR101250067B1 (ko) 2013-04-03
JP5064376B2 (ja) 2012-10-31
CA2602155A1 (en) 2006-10-05
JP2008534726A (ja) 2008-08-28
KR20080000590A (ko) 2008-01-02
EP1866401B1 (de) 2010-09-29
ATE483009T1 (de) 2010-10-15
BRPI0609541A2 (pt) 2011-10-18
DE502006007963D1 (de) 2010-11-11
MX2007012023A (es) 2007-11-16

Similar Documents

Publication Publication Date Title
US20090305930A1 (en) Use of hydrophobin for hard surface soil-repellent treatment
US20090101167A1 (en) Use of Surface-Active Non-Enzymatic Proteins for Washing Textiles
US7910699B2 (en) Cysteine-depleted hydrophobin fusion proteins, their production and use thereof
KR101250105B1 (ko) 경화 광물 건축 재료, 천연석, 인조석 및 세라믹의 표면처리를 위한 하이드로포빈의 용도
US20080319168A1 (en) Method for Coating Surfaces with Hydrophobins
CA2596661C (en) Novel hydrophobin fusion products, production and use thereof
US8859106B2 (en) Use of polypeptides in the form of adhesive agents
US20090117796A1 (en) Method for coating fibre substrate surfaces
US20120006354A1 (en) Composition and method for cleaning surfaces
CN101151359B (zh) 疏水蛋白在硬表面防污处理中的用途
CN101151148B (zh) 多肽作为增附剂的用途
DE102005036341A1 (de) Verwendung von Hydrophobinen zur schmutzabweisenden Behandlung von harten Oberflächen
CN101151106A (zh) 疏水蛋白在处理固化矿物建材、天然石材、铸石及陶瓷表面中的用途
CN101180431A (zh) 纤维基质表面的涂布

Legal Events

Date Code Title Description
AS Assignment

Owner name: BASF AKTIENGESELLSCHAFT, GERMANY

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:BECKER, HEIKE;BOLLSCHWEILER, CLAUS;SUBKOWSKI, THOMAS;AND OTHERS;REEL/FRAME:019949/0313

Effective date: 20060413

AS Assignment

Owner name: BASF SE, GERMANY

Free format text: CHANGE OF NAME;ASSIGNOR:BASF AKTIENGESELLSCHAFT;REEL/FRAME:025113/0462

Effective date: 20080313

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION