US20070270363A1 - Modulation of telomere length by oligonucleotides having a G-core sequence - Google Patents

Modulation of telomere length by oligonucleotides having a G-core sequence Download PDF

Info

Publication number
US20070270363A1
US20070270363A1 US11/502,008 US50200806A US2007270363A1 US 20070270363 A1 US20070270363 A1 US 20070270363A1 US 50200806 A US50200806 A US 50200806A US 2007270363 A1 US2007270363 A1 US 2007270363A1
Authority
US
United States
Prior art keywords
oligonucleotide
oligonucleotides
telomere length
method
modified
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US11/502,008
Inventor
C. Bennett
David Ecker
Timothy Vickers
Jacqueline Wyatt
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ionis Pharmaceuticals Inc
Original Assignee
Ionis Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to US95418592A priority Critical
Priority to PCT/US1993/009297 priority patent/WO1994008053A1/en
Priority to US08/403,888 priority patent/US5952490A/en
Priority to US29905899A priority
Priority to US10/038,335 priority patent/US7067497B2/en
Priority to US11/436,901 priority patent/US20070015723A1/en
Application filed by Ionis Pharmaceuticals Inc filed Critical Ionis Pharmaceuticals Inc
Priority to US11/502,008 priority patent/US20070270363A1/en
Assigned to ISIS PHARMACEUTICALS, INC. reassignment ISIS PHARMACEUTICALS, INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: ECKER, DAVID J., BENNETT, C. FRANK, VICKERS, TIMOTHY, WYATT, JACQUELINE R.
Publication of US20070270363A1 publication Critical patent/US20070270363A1/en
Application status is Abandoned legal-status Critical

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07HSUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1131Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses
    • C12N15/1133Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses against herpetoviridae, e.g. HSV
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/115Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/117Nucleic acids having immunomodulatory properties, e.g. containing CpG-motifs
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701Specific hybridization probes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y207/00Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/07Nucleotidyltransferases (2.7.7)
    • C12Y207/07049RNA-directed DNA polymerase (2.7.7.49), i.e. telomerase or reverse-transcriptase
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y301/00Hydrolases acting on ester bonds (3.1)
    • C12Y301/01Carboxylic ester hydrolases (3.1.1)
    • C12Y301/01004Phospholipase A2 (3.1.1.4)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/15Nucleic acids forming more than 2 strands, e.g. TFOs
    • C12N2310/151Nucleic acids forming more than 2 strands, e.g. TFOs more than 3 strands, e.g. tetrads, H-DNA
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/18Type of nucleic acid acting by a non-sequence specific mechanism
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3212'-O-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/341Gapmers, i.e. of the type ===---===
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/346Spatial arrangement of the modifications having a combination of backbone and sugar modifications

Abstract

Modified oligonucleotides having a GGG motif sequence and a sufficient number of flanking nucleotides to modulate the telomere length of a chromosome are provided. Methods of modulating telomere length of a mammalian chromosome in vitro and in vivo are also provided, as are methods for inhibiting the division of a malignant mammalian cell and for modulating the effects of cellular aging.

Description

    CROSS-REFERENCE TO RELATED APPLICATIONS
  • The present application is a continuation in part of U.S. application Ser. No. 11/436,901 filed May 17, 2006, which is a continuation-in-part of U.S. application Ser. No. 10/038,335, filed Jan. 2, 2002, which is U.S. Pat. No. 7,067,497 and which is a continuation-in-part of U.S. application Ser. No. 09/299,058, filed Apr. 23, 1999, now abandoned, which is a continuation of U.S. application Ser. No. 08/403,888 filed Jun. 12, 1995, which is U.S. Pat. No. 5,952,490, the U.S. national phase of PCT Application Serial No. PCT/US93/09297 filed Sep. 29, 1993, which is a continuation-in-part of U.S. application Ser. No. 07/954,185 filed Sep. 29, 1992, now abandoned, each of which is incorporated herein by reference in its entirety.
  • FIELD OF THE INVENTION
  • This invention relates to the design and synthesis of oligonucleotides which can be used to modulate telomere length in vivo or in vitro. These compounds can be used prophylactically or therapeutically for diseases associated with abnormal telomere length, such as aging and hyperproliferative conditions, e.g., cancer. Methods for the treatment of cancer and to retard aging are also contemplated by this invention.
  • BACKGROUND OF THE INVENTION
  • Modulation of Telomere Length
  • It has been recognized that telomeres, long chains of repeated nucleotides located at the tip of each chromosome, play a role in the protection and organization of the chromosome. In human cells, the sequence TTAGGG is repeated hundreds to thousands of times at both ends of every chromosome, depending on cell type and age. Harley, C. B. et al., Nature, 1990, 345, 458-460; Hastie, N. D. et al., Nature, 1990, 346,866-868. Telomeres also appear to have a role in cell aging which has broad implications for the study of aging and cell immortality that is manifested by cancerous cells.
  • Researchers have determined that telomere length is reduced whenever a cell divides and it has been suggested that telomere length controls the number of divisions before a cell's innate lifespan is spent. Harley, C. B. et al., Nature, 1990, 345, 458-460; Hastie, N. D. et al., Nature, 1990, 346,866-868. For example, normal human cells divide between 70-100 times and appear to lose about 50 nucleotides of their telomeres with each division. Some researchers have suggested that there is a strong correlation between telomere length and the aging of the entire human being. Greider, C. W., Curr. Opinion Cell Biol., 1991, 3, 444-451. Other studies have shown that telomeres undergo a dramatic transformation during the genesis and progression of cancer. Hastie, N. D. et al., Nature 1990, 346, 866-868. For example, it has been reported that when a cell becomes malignant, the telomeres become shortened with each cell division. Hastie, N. D. et al., Nature 1990, 346, 866-868. Experiments by Greider and Bacchetti and their colleagues have shown that at a very advanced and aggressive stage of tumor development, telomere shrinking may cease or even reverse. Counter, C. M. et al., EMBO J. 1992, 11, 1921-1929. It has been suggested, therefore, that telomere blockers may be useful for cancer therapy. In vitro studies have also shown that telomere length can be altered by electroporation of linearized vector containing human chromosome fragments into hybrid human-hamster cell lines. Chromosome fragments consisted of approximately 500 base pairs of the human telomeric repeat sequence TTAGGG and related variants such as TTGGGG, along with adjacent GC-rich repetitive sequences. Farr, C. et al., Proc. Natl. Acad. Sci. USA 1992, 88, 7006-7010. While this research suggests that telomere length affects cell division, no effective method for control of the aging process or cancer has been discovered. Therefore, there is an unmet need to identify effective modulators of telomere length.
  • Guanosine nucleotides, both as mononucleotides and in oligonucleotides or polynucleotides, are able to form arrays known as guanine quartets or G-quartets. For review, see Williamson, J. R., (1993) Curr. Opin. Struct. Biol. 3:357-362. G-quartets have been known for years, although interest has increased in the past several years because of their possible role in telomere structure and function.
  • In addition to their natural role (in telomeres, for example, though there may be others), oligonucleotides which have a GGGG motif or one or more GGG motifs are useful for inhibiting viral gene expression and viral growth and for inhibiting PLA2 enzyme activity and have long been believed to be useful as modulators of telomere length. Chemical modification of the oligonucleotides for such use is desirable and, in some cases, necessary for maximum activity.
  • It has now been clearly demonstrated both in vitro and in vivo that oligonucleotides containing a GGG motif are capable of modulating telomere length on mammalian chromosomes. Herbert et al., 1999, Proceedings Natl. Acad. Sci., USA, 96, 14276-14281.
  • SUMMARY OF THE INVENTION
  • It has been discovered that oligonucleotides containing at least one GGG motif are effective inhibitors of telomere length on chromosomes.
  • The formula for an active sequence is generally (NXG3-4)QNX wherein each X is independently 1-8 and Q is 1-6. The sequence (NXG4NY)Q or (G3-4NXG3-4)Q wherein X and Y are 1-8, and Q is 1-4 is also believed to be useful in some embodiments of the invention. Compositions and methods for modulating, preferably shortening, telomere length are provided. Preferably the telomeres are mammalian telomeres, i.e., found on mammalian chromosomes, and more preferably are human telomeres. Methods of modulating mammalian telomere length are also provided, as are methods for inhibiting the division of a malignant mammalian cell and for modulating cellular aging.
  • DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS
  • It has been discovered that oligonucleotides containing one or more GGG motifs, or G-cores, wherein G is a guanine-containing nucleotide or analog, are effective inhibitors of telomere length on chromosomes. Although the GGG core sequence(s) or G pharmacophore is necessary, sequences flanking the GGG sequence have been found to play an important role in inhibitory activity because it has been found that activity can be modulated by substituting or deleting the surrounding sequences. In the context of this invention, the term “modulate” means to increase or decrease.
  • In the context of this invention, the term “oligonucleotide” refers to an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or mimetics thereof. This term includes oligonucleotides composed of naturally-occurring nucleobases, sugars and covalent internucleoside (backbone) linkages as well as oligonucleotides having non-naturally-occurring portions which function similarly. Such modified or substituted oligonucleotides are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target and increased stability in the presence of nucleases.
  • As is known in the art, a nucleoside is a base-sugar combination. The base portion of the nucleoside is normally a heterocyclic base. The two most common classes of such heterocyclic bases are the purines and the pyrimidines. Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to the 2′, 3′ or 5′ hydroxyl moiety of the sugar. In forming oligonucleotides, the phosphate groups covalently link adjacent nucleosides to one another to form a linear polymeric compound. In turn the respective ends of this linear polymeric structure can be further joined to form a circular structure, however, open linear structures are generally preferred. Within the oligonucleotide structure, the phosphate groups are commonly referred to as forming the internucleoside backbone of the oligonucleotide. The normal linkage or backbone of RNA and DNA is a 3′ to 5′ phosphodiester linkage.
  • Specific examples of preferred compounds useful in this invention include oligonucleotides containing modified backbones or non-natural internucleoside linkages. As defined in this specification, oligonucleotides having modified backbones include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone. For the purposes of this specification, and as sometimes referenced in the art, modified oligonucleotides that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides.
  • Preferred modified oligonucleotide backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3′-alkylene phosphonates, 5′-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3′-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, selenophosphates and boranophosphates having normal 3′-5′ linkages, 2′-5′ linked analogs of these, and those having inverted polarity wherein one or more internucleotide linkages is a 3′ to 3′, 5′ to 5′ or 2′ to 2′ linkage. Preferred oligonucleotides having inverted polarity comprise a single 3′ to 3′ linkage at the 3′-most internucleotide linkage i.e., a single inverted nucleoside residue which may be a basic (the nucleobase is missing or has a hydroxyl group in place thereof). Various salts, mixed salts and free acid forms are also included.
  • Representative United States patents that teach the preparation of the above phosphorus-containing linkages include, but are not limited to, U.S. Pat. Nos.: 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111; 5,563,253; 5,571,799; 5,587,361; 5,194,599; 5,565,555; 5,527,899; 5,721,218; 5,672,697 and 5,625,050, certain of which are commonly owned with this application, and each of which is herein incorporated by reference in its entirety.
  • Preferred modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; riboacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts.
  • Representative United States patents that teach the preparation of the above oligonucleosides include, but are not limited to, U.S. Pat. Nos.: 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; 5,792,608; 5,646,269 and 5,677,439, certain of which are commonly owned with this application, and each of which is herein incorporated by reference in its entirety.
  • In other preferred oligonucleotide mimetics, both the sugar and the internucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with novel groups. The base units are maintained for hybridization with an appropriate nucleic acid target compound. One such oligomeric compound, an oligonucleotide mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar-backbone of an oligonucleotide is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Representative United States patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Pat. Nos.: 5,539,082; 5,714,331; and 5,719,262, each of which is herein incorporated by reference in its entirety. Further teaching of PNA compounds can be found in Nielsen et al., Science, 1991, 254, 1497-1500.
  • Most preferred embodiments of the invention are oligonucleotides with phosphorothioate backbones and oligonucleosides with heteroatom backbones, and in particular —CH2—NH—O—CH2—, —CH2—N(CH3)—O—CH2— (known as a methylene (methylimino) or MMI backbone), —CH2—O—N(CH3)—CH2—, —CH2—N(CH3)—N(CH3)—CH2— and —O—N(CH3)—CH2—CH2— (wherein the native phosphodiester backbone is represented as —O—P—O—CH2—) of the above referenced U.S. Pat. No. 5,489,677, and the amide backbones of the above referenced U.S. Pat. No. 5,602,240. Also preferred are oligonucleotides having morpholino backbone structures of the above-referenced U.S. Pat. No. 5,034,506.
  • Modified oligonucleotides may also contain one or more substituted sugar moieties. Preferred oligonucleotides comprise one of the following at the 2′ position: OH; F; O—, S—, or N-alkyl; O—, S—, or N-alkenyl; O—, S— or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted C1 to C10 alkyl or C2 to C10 alkenyl and alkynyl. Particularly preferred are O((CH2)nO)mCH3, O(CH2)nOCH3, O(CH2)nNH2, O(CH2)nCH3, O(CH2)nONH2, and O(CH2)nON((CH2)nCH3))2, where n and m are from 1 to about 10. Other preferred oligonucleotides comprise one of the following at the 2′ position: C1 to C10 lower alkyl, substituted lower alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide, and other substituents having similar properties. A preferred modification includes 2′-methoxyethoxy (2′-O—CH2CH2OCH3, also known as 2′-O-(2-methoxyethyl) or 2′-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78, 486-504) i.e., an alkoxyalkoxy group. A further preferred modification includes 2′-dimethylaminooxyethoxy, i.e., a O(CH2)2ON(CH3)2 group, also known as 2′-DMAOE, as described in examples herein below, and 2′-dimethylaminoethoxyethoxy (also known in the art as 2′-O-dimethylaminoethoxyethyl or 2′-DMAEOE), i.e., 2′-O—CH2—O—CH2—N(CH2)2, also described in examples hereinbelow.
  • A further preferred modification includes Locked Nucleic Acids (LNAs) in which the 2′-hydroxyl group is linked to the 3′ or 4′ carbon atom of the sugar ring thereby forming a bicyclic sugar moiety. The linkage is preferably a methylene (—CH2—)n group bridging the 2′ oxygen atom and the 4′ carbon atom wherein n is 1 or 2. LNAs and preparation thereof are described in WO 98/39352 and WO 99/14226.
  • Other preferred modifications include 2′-methoxy (2′-O—CH3), 2′-aminopropoxy (2′-OCH2CH2CH2NH2), 2′-allyl (2′-CH2—CH═CH2), 2′-O-allyl (2′-O—CH2—CH═CH2) and 2′-fluoro (2′-F). The 2′-modification may be in the arabino (up) position or ribo (down) position. A preferred 2′-arabino modification is 2′-F. Similar modifications may also be made at other positions on the oligonucleotide, particularly the 3′ position of the sugar on the 3′ terminal nucleotide or in 2′-5′ linked oligonucleotides and the 5′ position of 5′ terminal nucleotide. Oligonucleotides may also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. Representative United States patents that teach the preparation of such modified sugar structures include, but are not limited to, U.S. Pat. Nos.: 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; 5,792,747; and 5,700,920, certain of which are commonly owned with the instant application, and each of which is herein incorporated by reference in its entirety.
  • Oligonucleotides may also include nucleobase (often referred to in the art simply as “base”) modifications or substitutions. As used herein, “unmodified” or “natural” nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (—C≡C—CH3) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine. Further modified nucleobases include tricyclic pyrimidines such as phenoxazine cytidine(1H-pyrimido(5,4-b)(1,4)benzoxazin-2(3H)-one), phenothiazine cytidine (1H-pyrimido(5,4-b)(1,4)benzothiazin-2(3H)-one), G-clamps such as a substituted phenoxazine cytidine (e.g. 9-(2-aminoethoxy)-H-pyrimido(5,4-b)(1,4)benzoxazin-2(3H)-one), carbazole cytidine (2H-pyrimido(4,5-b)indol-2-one), pyridoindole cytidine (H-pyrido(3′,2′:4,5)pyrrolo(2,3-d)pyrimidin-2-one). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deazaadenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Further nucleobases include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. I., ed. John Wiley & Sons, 1990, those disclosed by Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, and those disclosed by Sanghvi, Y. S., Chapter 15, Antisense Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., ed., CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds of the invention. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2° C. (Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are presently preferred base substitutions, even more particularly when combined with 2′-O-methoxyethyl sugar modifications.
  • Representative United States patents that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include, but are not limited to, the above noted U.S. Pat. No. 3,687,808, as well as U.S. Pat. Nos.: 4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,645,985; 5,830,653; 5,763,588; 6,005,096; and 5,681,941, certain of which are commonly owned with the instant application, and each of which is herein incorporated by reference in its entirety, and U.S. Pat. No. 5,750,692, which is commonly owned with the instant application and also herein incorporated by reference in its entirety.
  • Another modification of the oligonucleotides of the invention involves chemically linking to the oligonucleotide one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the oligonucleotide. The compounds of the invention can include conjugate groups covalently bound to functional groups such as primary or secondary hydroxyl groups. Conjugate groups of the invention include intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, polyethers, groups that enhance the pharmacodynamic properties of oligomers, and groups that enhance the pharmacokinetic properties of oligomers. Typical conjugate groups include cholesterols, lipids, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes. Groups that enhance the pharmacodynamic properties, in the context of this invention, include groups that improve oligomer uptake, enhance oligomer resistance to degradation, and/or strengthen sequence-specific hybridization with RNA. Groups that enhance the pharmacokinetic properties, in the context of this invention, include groups that improve oligomer uptake, distribution, metabolism or excretion. Representative conjugate groups are disclosed in International Patent Application PCT/US92/09196, filed Oct. 23, 1992, the entire disclosure of which is incorporated herein by reference in its entirety. Conjugate moieties include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Let., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kadbanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937. Oligonucleotides of the invention may also be conjugated to active drug substances, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indomethicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic. Oligonucleotide-drug conjugates and their preparation are described in U.S. patent application Ser. No. 09/334,130 (filed Jun. 15, 1999) which is incorporated herein by reference in its entirety.
  • Representative United States patents that teach the preparation of such oligonucleotide conjugates include, but are not limited to, U.S. Pat. Nos.: 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731; 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941, certain of which are commonly owned with the instant application, and each of which is herein incorporated by reference in its entirety.
  • It is not necessary for all positions in a given compound to be uniformly modified, and in fact more than one of the aforementioned modifications may be incorporated in a single compound or even at a single nucleoside within an oligonucleotide. The present invention also includes oligonucleotides which are chimeric compounds. “Chimeric” oligonucleotides or “chimeras,” in the context of this invention, are oligonucleotides which contain two or more chemically distinct regions, each made up of at least one monomer unit, i.e., a nucleotide in the case of an oligonucleotide compound. These oligonucleotides typically contain at least one region wherein the oligonucleotide is modified so as to confer upon the oligonucleotide increased resistance to nuclease degradation, increased cellular uptake, and/or increased binding affinity for the target nucleic acid. An additional region of the oligonucleotide may serve as a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids. By way of example, RNase H is a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of oligonucleotide inhibition of gene expression. Consequently, comparable results can often be obtained with shorter oligonucleotides when chimeric oligonucleotides are used, compared to phosphorothioate deoxyoligonucleotides hybridizing to the same target region. Cleavage of the RNA target can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known in the art.
  • Chimeric oligonucleotides of the invention may be formed as composite structures of two or more oligonucleotides, modified oligonucleotides, oligonucleosides and/or oligonucleotide mimetics as described above. Such compounds have also been referred to in the art as hybrids or gapmers. Representative United States patents that teach the preparation of such hybrid structures include, but are not limited to, U.S. Pat. Nos.: 5,013,830; 5,149,797; 5,220,007; 5,256,775; 5,366,878; 5,403,711; 5,491,133; 5,565,350; 5,623,065; 5,652,355; 5,652,356; and 5,700,922, certain of which are commonly owned with the instant application, and each of which is herein incorporated by reference in its entirety.
  • The oligonucleotides in accordance with this invention preferably comprise from about 6 to about 27 nucleic acid base units. It is preferred that such oligonucleotides have from about 6 to 24 nucleic acid base units. As will be appreciated, a nucleic acid base unit is a base-sugar combination suitably bound to adjacent nucleic acid base unit through phosphodiester or other bonds.
  • The oligonucleotides used in accordance with this invention may be conveniently and routinely made through the well-known technique of solid phase synthesis. Equipment for such synthesis is sold by several vendors including Applied Biosystems. Any other means for such synthesis may also be employed, however the actual synthesis of the oligonucleotides are well within the talents of the routineer. It is also well known to use similar techniques to prepare other oligonucleotides such as the phosphorothioates and alkylated derivatives.
  • The essential feature of the invention is a conserved G3 or G4 core sequence and a sufficient number of additional flanking bases to significantly inhibit activity. It has also been discovered that chemical modifications are tolerated in the oligonucleotide. For example, phosphorothioate and 2′-O-methyl modifications have been incorporated.
  • The formula for an active sequence is: (NXG3-4)QNX wherein each X is independently 1-8 and Q is 1-6.
  • In some embodiments of the present invention, the sequence
    (Nx G4 Ny)Q or (G4 Nx G4)Q
    where G=a guanine-containing nucleotide or analog,
  • N=any nucleotide,
  • X=1-8,
  • Y=1-8,
  • and Q=1-4 is believed to be active.
  • Modulation of Telomere Length
  • Oligonucleotides capable of modulating telomere length are contemplated by this invention. In human cells, the sequence TTAGGG is repeated from hundreds to thousands of times at both ends of every chromosome, depending on cell type and age. It is believed that oligonucleotides having a sequence (NXG3-4)QNx wherein each X is independently 1-8 and Q is 1-6 would be useful for modulating telomere length.
  • Since telomeres appear to have a role in cell aging, i.e., telomere length decreases with each cell division, it is believed that such oligonucleotides would be useful for modulating the cell's aging process. Altered telomeres are also found in cancerous cells; it is therefore also believed that such oligonucleotides would be useful for controlling malignant cell growth. Therefore, modulation of telomere length using oligonucleotides of the present invention could prove useful for the treatment of cancer or in controlling the aging process.
  • It has now been demonstrated that oligonucleotides having a sequence (NXG3-4)QNX wherein each X is independently 1-8 and Q is 1-6 are able to modulate telomere length. Herbert et al. (Herbert et al., Proc. Natl. Acad. Sci. USA, 1999, 96, 14276-14281) have demonstrated telomere shortening in human mammary epithelial (HME) cells and prostate tumor-derived DU145 cells treated with a 2′-O-methyl chimeric oligonucleotide having the sequence CAGUUAGGGUUAG (SEQ ID NO: 1). Telomere length was reduced from 2000 to 1700 base pairs in HME cells (60 day treatment) and from 3600 base pairs to 2200 base pairs in DU145 cells (76 day treatment). Treatment of DU145 cells with a peptide nucleic acid of the sequence Gly-CAGTTAGGGTTAG-Lys (SEQ ID NO:2 with a glycine residue covalently attached to the N-terminus and a lysine residue covalently attached to the C-terminus) caused similar telomere shortening to that caused by the 2′-O-methyl oligonucleotide.
  • Telomere shortening has also been demonstrated in mice treated with an 2′-O-methyl oligonucleotide, ISIS 24691, having the sequence CAGTTAGGGTTAG (SEQ ID NO:2) and a 2′O-methyl sugar modification at every position and a phosphorothioate backbone throughout.
  • The following examples are provided for illustrative purposes only and are not intended to limit the invention.
  • EXAMPLES Example 1 Oligonucleotide Synthesis
  • Oligonucleotides may be purchased commercially or synthesized as follows. DNA synthesizer reagents, controlled-pore glass (CPG)-bound and B-cyanoethyldiisopropylphosphoramidites were purchased from Applied Biosystems (Foster City, Calif.). 2′-O-Methyl B-cyanoethyldiisopropylphosphoramidites were purchased from Chemgenes (Needham, Mass.). Phenoxyacetyl-protected phosphoramadites for RNA synthesis were purchased from BioGenex (Hayward, Calif.).
  • Oligonucleotides were synthesized on an automated DNA synthesizer (Applied Biosystems model 380B). 2′-O-Methyl oligonucleotides were synthesized using the standard cycle for unmodified oligonucleotides, except the wait step after pulse delivery of tetrazole and base was increased to 360 seconds. The 3′ base bound to the CPG used to start the synthesis was a 2′-deoxyribonucleotide. After cleavage from the CPG column and deblocking in concentrated ammonium hydroxide at 55° C. (18 hours), the oligonucleotides were purified by precipitation two times out of 0.5 M NaCl solution with 2.5 volumes ethanol. Analytical gel electrophoresis was accomplished in 20% acrylamide, 8 M urea, 45 mM Tris-borate buffer, pH=7.0. Oligonucleotides were judged from polyacrylamide gel electrophoresis to be greater than 85% full length material.
  • Example 2 Modulation of Telomere Length by G4 Phosphorothioate Oligonucleotides
  • The amount and length of telomeric DNA in human fibroblasts has been shown to decrease during aging as a function of serial passage in vitro. To examine the effect of G4 phosphorothioate oligonucleotides on this process, human skin biopsy fibroblasts are grown as described in Harley, C. B., Meth. Molec. Biol. 1990, 5, 25-32. Cells are treated with the oligonucleotides shown in Table 1, by adding the oligonucleotide to the medium to give a final concentration of 1 μM, 3 μM or 10 μM; control cells receive no oligonucleotide. Population doublings are counted and DNA is isolated at regular intervals. Telomere length is determined by Southern blot analysis and plotted against number of population doublings as described in Harley, C. B. et al., Nature 1990, 345, 458-460. The slope of the resulting linear regression lines indicates a loss of approximately 50 bp of telomere DNA per mean population doubling in untreated fibroblasts. Harley, C. B. et al., Nature 1990, 345, 458-460. Treatment with oligonucleotides of Table 1 is expected to result in modulation of telomere length.
    TABLE 1
    Effect of G4 Phosphorothioate Oligonucleotides
    on Telomere Length in Aging Fibroblasts
    ISIS NO. SEQUENCE SEQ ID NO:
    TT AGGG
    5739 TT GGGG
    5756 TT AGGG TT
    5320 TT GGGG TT
    5675 TT GGGG TT GGGG TT 3
    5651 TT GGGG TT GGGG TT GGGG TT 4
    GGGG
    TTTT GGGG
    TTTA GGGG
    5673 GGGG
  • Example 3 Chimeric 2′-O-methyl G4 Oligonucleotides with Deoxy Gaps
  • A series of phosphorothioate oligonucleotides were synthesized having a 2′-O-methyl substitution on the sugar of each nucleotide in the flanking regions, and 2′-deoxynucleotides in the center portion of the oligonucleotide (referred to as the “deoxy gap”). Deoxy gaps varied from zero to seven nucleotides in length. Additional chimeric oligonucleotides were synthesized having the sequences GTTGGAGACCGGGGTTGGGG (SEQ ID NO:5) and CACGGGGTCGCCGATGAACC (SEQ ID NO:6). These oligonucleotides were 2′-O-methyl oligonucleotides with deoxy gaps as described above, but instead of a uniform phosphorothioate backbone, these compounds had phosphorothioate internucleotide linkages in the deoxy gap region and phosphodiester linkages in the flanking region.
  • Additional oligonucleotides were synthesized with 2′-O-propyl modifications. 2′-O-propyl oligonucleotides were prepared from 2′-deoxy-2′-O-propyl ribosides of nucleic acid bases A, G, U(T), and C which were prepared by modifications of literature procedures described by B. S. Sproat, et al., Nucleic Acids Research 18:41-49 (1990) and H. Inoue, et al., Nucleic Acids Research 15:6131-6148 (1987). ISIS 7114 is a phosphorothioate which has SEQ ID NO:6, and has a 2′-O-propyl modification on each sugar. ISIS 7171 is a phosphorothioate gapped 2′-O-propyl oligonucleotide with the same sequence, and 2′-O-propyl modifications at positions 1-7 and 14-20 (6-deoxy gap).
  • Example 4 Cell Lines
  • Cell lines were produced and grown as described in Herbert et al., 1999, Proc. Natl. Acad. Sci. USA, 96, 14276-14281. Briefly, spontaneously immortalized human mammary epithelial (HME) cells were grown in supplemented serum-free medium and used between population doublings 100 and 150. Prostate tumor-derived DU145 cells were maintained in DMEM containing fetal calf serum and antibiotics.
  • Example 5 Oligonucleotides
  • The oligonucleotides are fully described in Herbert et al., 1999, Proc. Natl. Acad. Sci. USA, 96, 14276-14281. 2′-O-methyl oligonucleotides were purchased from Oligos Etc. and Oligo Therapeutics (Wilsonville Oreg.). The “match” phosphorothioate modified 2′-O-methyl RNA oligonucleotide has the sequence CAGUUAGGGUUAG (SEQ ID NO:1) wherein the bold nucleotides have phosphorothioate linkages. The mismatch 2′-O-methyl oligonucleotide is CAGUUAGAAUUAG (SEQ ID NO:7). Match and mismatch PNAs were synthesized automatically with a PerSeptive Biosystems (Framingham Mass.) Expedite 8909 Synthesizer using Fmoc protocols and reagents obtained from PE Biosystems. PNAs were purified by HPLC and characterized by matrix-assisted laser desorption time-of-flight mass spectrometry. The match PNA has the sequence Gly-CAGTTAGGGTTAG-Lys (SEQ ID NO:2 with a glycine residue covalently attached to the N-terminus and a lysine residue covalently attached to the C-terminus); the mismatch is Gly-CAGTTAGAATTAG-Lys (SEQ ID NO:8 with a glycine residue covalently attached to the N-terminus and a lysine residue covalently attached to the C-terminus). DNA oligonucleotides used for transfection of PNA/DNA complexes were obtained from Life Technologies (Gaithersburg, Md.). The DNA oligonucleotide complexed to the match PNA has the sequence TCTAACCCTAA (SEQ ID NO:9); the DNA oligonucleotide complexed to the mismatch PNA has the sequence TCTAATTCTAA (SEQ ID NO: 10).
  • Example 6 Transfection of Cells with Oligonucleotides
  • Cells were transfected as described in Herbert et al., 1999, Proc. Natl. Acad. Sci. USA, 96, 14276-14281. Briefly, HME cells were transfected with 2′-O-methyl RNA and mismatch control oligonucleotides using the FuGENE6 Transfection Reagent protocol (Roche Molecular Biochemicals). DU145 cells were plated at 25,000 cells per well in a 24 well plate. For DNA/PNA transfections, 100 μM PNA was hybridized with 109 μM of the appropriate DNA oligonucleotide in 0.5×PBS. Cells were allowed to adhere and transfected with 2.0 μl (7 μg/ml) of Lipofectamine (Life Technologies) and 0.5 μM 2′-O-methyl RNA oligonucleotide or 1 μM PNA/DNA complex in 200 μl total Opti-MEM (Life Technologies) according to the manufacturer's instructions. Cells were transfected with oligonucleotides at 3 to 4 day intervals for 120 days.
  • Example 7 Measurement of Reduction of Telomere Length in Cell Culture by Oligonucleotide Treatment
  • Telomere length was measured as described by Herbert et al., 1999, Proc. Natl. Acad. Sci. USA, 96, 14276-14281. Briefly, mean telomere length was evaluated by using telomere restriction fragment analysis, a variation of standard Southern analysis, and was quantitated as described by Shay et al., 1994, Methods Mol. Genet., 5, 263-268. Digested samples were resolved on a 0.7% agarose gel and hybridized to a telomeric probe ((32P)(TTAGGG)4 oligonucleotide).
  • Within 60 days of treatment, the mean telomere length of HME-50 cells treated with the 2′-O-methyl RNA G-core oligonucleotide of sequence CAGUUAGGGUUAG (SEQ ID NO:1) was reduced from 2000 to 1700 base pairs. This decrease in measured telomere restriction fragment length may be an underestimate of the total loss of telomere length because little telomeric DNA remained to hybridize with the labeled probe. The telomere restriction fragment length of cells treated with the mismatch 2′-O-methyl RNA oligonucleotide lacking the GGG sequence was unchanged at 2000 base pairs.
  • DU145 cells have longer telomeres than HME-50 cells. In DU145 cells treated with the 2′-O-methyl G-core oligonucleotide of sequence CAGUUAGGGUUAG (SEQ ID NO:1) for 76 days, the mean telomere restriction fragment length decreased from 3600 base pairs to 2200 base pairs. Again the signal was greatly reduced due to reduction in telomere repeat number.
  • A PNA oligonucleotide of sequence Gly-CAGTTAGGGTTAG-Lys (SEQ ID NO:2 with an amino acid residue tethered to each end) caused telomere shortening in DU145 cells similar to that caused by the 2′-O-methyl oligonucleotide.
  • The above-described results are shown in FIG. 4 of Herbert et al., 1999, Proc. Natl. Acad. Sci. USA. 96, 14276-14281.
  • Example 8 Measurement of Reduction of Telomere Length in vivo by Oligonucleotide Treatment
  • Du145 xenografts were implanted in seven nude mice. Mice were injected on bilateral flanks with 3 million DU145 cells. Once tumors reached 100-500 mm3, mice were injected intraperitoneally with either PBS (control) or ISIS 24691 antisense oligonucleotide. Mice 1-3 were controls, mice 4-7 were treated long-term with 2′-O-methyl oligonucleotide ISIS 24691 (CAGTTAGGGTTAG; SEQ ID NO:2). This oligonucleotide has a 2′-O-methyl sugar modification at every position and a phosphorothioate backbone throughout. The C residue is a 5-methyl C residue.
  • The results are shown in Table 2.
    TABLE 2
    Approximate Telomere
    Mouse length (bp) Treatment
    1 4400 Control
    2 3900 Control
    3 3900 Control
    4 2200 ISIS 24691
    5 2800 ISIS 24691
    6 3000 ISIS 24691
    7 3800 ISIS 24691
  • As shown in the table, the average telomere length was approximately 4067 for control mice and 2950 for oligonucleotide treated mice, a reduction in telomere length of 27.5% after oligonucleotide treatment.

Claims (12)

1. A method of modulating telomere length of a mammalian chromosome comprising contacting a mammalian chromosome with a chemically modified oligonucleotide having no more than 27 nucleic acid base units, said oligonucleotide having the sequence (NXG3-4)QNX wherein each X is independently 1 to 8 and Q is 1 to 6, wherein said oligonucleotide modulates mammalian telomere length.
2. The method of claim 1 which is carried out in vitro.
3. The method of claim 1 which is carried out in vivo.
4. The method of claim 1 wherein the oligonucleotide chemical modifications are selected from the group consisting of a modified internucleoside linkage, a modified sugar and a modified base.
5. A method for inhibiting the division of a malignant mammalian cell comprising contacting said malignant mammalian cell with a chemically modified oligonucleotide having no more than 27 nucleic acid base units, said oligonucleotide having the sequence (NXG3-4)QNX wherein each X is independently 1 to 8 and Q is 1 to 6, wherein said oligonucleotide modulates mammalian telomere length.
6. The method of claim 5 which is carried out in vitro.
7. The method of claim 5 which is carried out in vivo.
8. The method of claim 5 wherein the oligonucleotide chemical modifications are selected from the group consisting of a modified internucleoside linkage, a modified sugar and a modified base.
9. A method for inhibiting the division of a malignant mammalian cell comprising contacting said malignant mammalian cell with a chemically modified oligonucleotide having no more than 27 nucleic acid base units, said oligonucleotide comprising the sequence (NxG3-4)QNx wherein X is 1 to 8 and Q is 1 to 6, wherein said oligonucleotide modulates mammalian telomere length.
10. The method of claim 9 which is carried out in vitro.
11. The method of claim 9 which is carried out in vivo.
12. The method of claim 9 wherein the oligonucleotide chemical modifications are selected from the group consisting of a modified internucleoside linkage, a modified sugar and a modified base.
US11/502,008 1992-09-29 2006-08-09 Modulation of telomere length by oligonucleotides having a G-core sequence Abandoned US20070270363A1 (en)

Priority Applications (7)

Application Number Priority Date Filing Date Title
US95418592A true 1992-09-29 1992-09-29
PCT/US1993/009297 WO1994008053A1 (en) 1992-09-29 1993-09-29 Oligonucleotides having a conserved g4 core sequence
US08/403,888 US5952490A (en) 1992-09-29 1993-09-29 Oligonucleotides having a conserved G4 core sequence
US29905899A true 1999-04-23 1999-04-23
US10/038,335 US7067497B2 (en) 1992-09-29 2002-01-02 Modulation of telomere length by oligonucleotides having a G-core sequence
US11/436,901 US20070015723A1 (en) 1992-09-29 2006-05-17 Antiviral oligonucleotides having a conserved G4 core sequence
US11/502,008 US20070270363A1 (en) 1992-09-29 2006-08-09 Modulation of telomere length by oligonucleotides having a G-core sequence

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
US11/502,008 US20070270363A1 (en) 1992-09-29 2006-08-09 Modulation of telomere length by oligonucleotides having a G-core sequence

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US11/436,901 Continuation-In-Part US20070015723A1 (en) 1992-09-29 2006-05-17 Antiviral oligonucleotides having a conserved G4 core sequence

Publications (1)

Publication Number Publication Date
US20070270363A1 true US20070270363A1 (en) 2007-11-22

Family

ID=25495059

Family Applications (5)

Application Number Title Priority Date Filing Date
US08/128,011 Expired - Lifetime US5523389A (en) 1992-09-29 1993-09-28 Inhibitors of human immunodeficiency virus
US08/403,888 Expired - Lifetime US5952490A (en) 1992-09-29 1993-09-29 Oligonucleotides having a conserved G4 core sequence
US11/436,901 Abandoned US20070015723A1 (en) 1992-09-29 2006-05-17 Antiviral oligonucleotides having a conserved G4 core sequence
US11/502,008 Abandoned US20070270363A1 (en) 1992-09-29 2006-08-09 Modulation of telomere length by oligonucleotides having a G-core sequence
US12/849,886 Abandoned US20110124715A1 (en) 1992-09-29 2010-08-04 Antiviral Oligonucleotides Having a Conserved G4 Core Sequence

Family Applications Before (3)

Application Number Title Priority Date Filing Date
US08/128,011 Expired - Lifetime US5523389A (en) 1992-09-29 1993-09-28 Inhibitors of human immunodeficiency virus
US08/403,888 Expired - Lifetime US5952490A (en) 1992-09-29 1993-09-29 Oligonucleotides having a conserved G4 core sequence
US11/436,901 Abandoned US20070015723A1 (en) 1992-09-29 2006-05-17 Antiviral oligonucleotides having a conserved G4 core sequence

Family Applications After (1)

Application Number Title Priority Date Filing Date
US12/849,886 Abandoned US20110124715A1 (en) 1992-09-29 2010-08-04 Antiviral Oligonucleotides Having a Conserved G4 Core Sequence

Country Status (14)

Country Link
US (5) US5523389A (en)
EP (2) EP1016715A1 (en)
JP (1) JP2818031B2 (en)
AT (1) AT222290T (en)
AU (1) AU668604B2 (en)
BR (1) BR1100614A (en)
CA (1) CA2145664C (en)
DE (2) DE69332206D1 (en)
FI (1) FI951467A0 (en)
HU (1) HUT70965A (en)
IL (1) IL107150D0 (en)
NO (1) NO951191D0 (en)
NZ (2) NZ256787A (en)
WO (1) WO1994008053A1 (en)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030138814A1 (en) * 2001-03-23 2003-07-24 Sergei Gryaznov Oligonucleotide conjugates
US20050113325A1 (en) * 2003-09-09 2005-05-26 Sergei Gryaznov Modified oligonucleotides for telomerase inhibition
US20100016407A1 (en) * 2006-10-30 2010-01-21 Geron Corporation Combined Telomerase Inhibitor and Gemcitabine for the Treatment of Cancer
US20100104586A1 (en) * 2007-03-09 2010-04-29 Geron Corporation Treatment of Carcinomas with a Combination of EGF-Pathway and Telomerase Inhibitors
US20100113571A1 (en) * 2007-01-30 2010-05-06 Gryaznov Sergei M Compounds having anti-adhesive effects on cancer cells
US9375485B2 (en) 2012-12-07 2016-06-28 Geron Corporation Use of telomerase inhibitors for the treatment of myeloproliferative disorders and myeloproliferative neoplasms
EP3124609A1 (en) * 2015-07-29 2017-02-01 IFOM Fondazione Istituto Firc di Oncologia Molecolare Therapeutics oligonucleotides
US9796747B2 (en) 2014-05-01 2017-10-24 Geron Corporation Oligonucleotide compositions and methods of making the same

Families Citing this family (88)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7119184B2 (en) 1991-08-12 2006-10-10 Isis Pharmaceuticals, Inc. Oligonucleotides having A-DNA form and B-DNA form conformational geometry
US5514577A (en) * 1990-02-26 1996-05-07 Isis Pharmaceuticals, Inc. Oligonucleotide therapies for modulating the effects of herpes viruses
US5869641A (en) * 1990-06-11 1999-02-09 Nexstar Pharmaceuticals, Inc. High affinity nucleic acid ligands of CD4
US6007989A (en) * 1992-05-13 1999-12-28 Board Of Regents, The University Of Texas System Methods of screening for compounds that derepress or increase telomerase activity
US5629154A (en) * 1993-11-12 1997-05-13 Geron Corporation Telomerase activity assays
US5989807A (en) 1992-05-13 1999-11-23 Geron Corporation & Board Of Regents Detecting cancerous conditions by assaying for telomerase activity
US5837453A (en) * 1992-05-13 1998-11-17 Geron Corporation Telomerase activity assays
US5645986A (en) * 1992-05-13 1997-07-08 Board Of Reagents, The University Of Texas System Therapy and diagnosis of conditions related to telomere length and/or telomerase activity
US5804380A (en) * 1993-11-12 1998-09-08 Geron Corporation Telomerase activity assays
US5863726A (en) * 1993-11-12 1999-01-26 Geron Corporation Telomerase activity assays
US5648215A (en) * 1992-05-13 1997-07-15 Board Of Regents, The University Of Texas System Telomerase diagnostic methods
US5489508A (en) * 1992-05-13 1996-02-06 University Of Texas System Board Of Regents Therapy and diagnosis of conditions related to telomere length and/or telomerase activity
WO1995013382A1 (en) * 1993-11-12 1995-05-18 Geron Corporation Therapy and diagnosis of conditions related to telomere length and/or telomerase activity
US5686306A (en) * 1992-05-13 1997-11-11 Board Of Regents, The University Of Texas System Methods and reagents for lengthening telomeres
US5830644A (en) * 1992-05-13 1998-11-03 Geron Corporation Method for screening for agents which increase telomerase activity in a cell
US7067497B2 (en) * 1992-09-29 2006-06-27 Isis Pharmaceuticals, Inc. Modulation of telomere length by oligonucleotides having a G-core sequence
IL107150D0 (en) * 1992-09-29 1993-12-28 Isis Pharmaceuticals Inc Oligonucleotides having a conserved g4 core sequence
US5567604A (en) * 1993-04-23 1996-10-22 Aronex Pharmaceuticals, Inc. Anti-viral guanosine-rich oligonucleotides
EP0971944A4 (en) * 1997-02-04 2005-01-26 Aronex Pharmaceuticals Inc Anti-viral guanosine-rich tetrad forming oligonucleotides
US6288042B1 (en) 1993-04-23 2001-09-11 Aronex Pharmaceuticals, Inc. Anti-viral guanosine-rich tetrad forming oligonucleotides
CA2227867A1 (en) * 1995-07-19 1997-02-06 Michael E. Hogan Anti-viral guanosine-rich oligonucleotides
US6323185B1 (en) 1993-04-23 2001-11-27 The United States Of America As Represented By The Department Of Health And Human Services Anti-viral guanosine-rich oligonucleotides and method of treating HIV
EP0713705A4 (en) * 1994-03-25 1998-09-02 Akira Kaji Novel anti-hiv drug
WO1996011266A2 (en) * 1994-10-05 1996-04-18 Amgen Inc. Method for inhibiting smooth muscle cell proliferation and oligonucleotides for use therein
US5698686A (en) * 1994-10-20 1997-12-16 Arch Development Corporation Yeast telomerase compositions
EP0743318A4 (en) * 1994-12-02 1998-09-02 Akira Kaji Novel anti-hiv agent
US20030032610A1 (en) 1996-06-03 2003-02-13 Gilchrest Barbara A. Method to inhibit cell growth using oligonucleotides
US5741677A (en) * 1995-06-07 1998-04-21 Geron Corporation Methods for measuring telomere length
US6004939A (en) * 1995-07-06 1999-12-21 Ctrc Research Foundation Board Of Regents Methods for modulation and inhibition of telomerase
US6054442A (en) * 1995-07-06 2000-04-25 Board Of Regents, University Of Texas System Methods and compositions for modulation and inhibition of telomerase in vitro
US6093816A (en) 1996-06-27 2000-07-25 Isis Pharmaceuticals, Inc. Cationic lipids
US5691145A (en) * 1996-08-27 1997-11-25 Becton, Dickinson And Company Detection of nucleic acids using G-quartets
US5849902A (en) * 1996-09-26 1998-12-15 Oligos Etc. Inc. Three component chimeric antisense oligonucleotides
US6958239B2 (en) 1996-11-21 2005-10-25 Oligos Etc Inc. Three component chimeric antisense oligonucleotides
US6576752B1 (en) 1997-02-14 2003-06-10 Isis Pharmaceuticals, Inc. Aminooxy functionalized oligomers
US6127533A (en) * 1997-02-14 2000-10-03 Isis Pharmaceuticals, Inc. 2'-O-aminooxy-modified oligonucleotides
US6172209B1 (en) 1997-02-14 2001-01-09 Isis Pharmaceuticals Inc. Aminooxy-modified oligonucleotides and methods for making same
US5902881A (en) 1997-03-03 1999-05-11 Isis Pharmaceuticals, Inc. Reagent useful for synthesizing sulfurized oligonucleotide analogs
US5760209A (en) * 1997-03-03 1998-06-02 Isis Pharmaceuticals, Inc. Protecting group for synthesizing oligonucleotide analogs
US6489304B2 (en) * 1997-05-01 2002-12-03 Hybridon, Inc. Hyperstructure-forming carriers
ES2326848T3 (en) 1997-06-06 2009-10-20 Dynavax Technologies Corporation Inhibitors activity immunostimulatory DNA sequences.
DE69834038D1 (en) 1997-07-01 2006-05-18 Isis Pharmaceutical Inc Compositions and methods of administration of oligonucleotides via the esophagus
ES2138924B1 (en) * 1998-01-23 2000-10-01 Consejo Superior Investigacion Promoter and regulatory sequences of Ha ds10 G1: a gene expressed exclusively read sunflower seeds from the maturation phase.
US7321828B2 (en) * 1998-04-13 2008-01-22 Isis Pharmaceuticals, Inc. System of components for preparing oligonucleotides
US20040186071A1 (en) 1998-04-13 2004-09-23 Bennett C. Frank Antisense modulation of CD40 expression
AU753270B2 (en) * 1998-05-21 2002-10-10 Isis Pharmaceuticals, Inc. Compositions and methods for topical delivery of oligonucleotides
EP1469009A2 (en) 1998-05-21 2004-10-20 Isis Parmaceuticals, Inc. Compositions and methods for non-parenteral delivery of oligonucleotides
WO1999063975A2 (en) 1998-06-10 1999-12-16 Biognostik Gesellschaft für Biomolekulare Diagnostik mbH A method for stimulating the immune system
US6242589B1 (en) 1998-07-14 2001-06-05 Isis Pharmaceuticals, Inc. Phosphorothioate oligonucleotides having modified internucleoside linkages
US6277967B1 (en) 1998-07-14 2001-08-21 Isis Pharmaceuticals, Inc. Carbohydrate or 2′-modified oligonucleotides having alternating internucleoside linkages
US6867294B1 (en) 1998-07-14 2005-03-15 Isis Pharmaceuticals, Inc. Gapped oligomers having site specific chiral phosphorothioate internucleoside linkages
US6492111B1 (en) 1998-11-25 2002-12-10 Isis Pharmaceuticals, Inc. In situ binary synthesis of biologically effective molecules
CN1273478C (en) 1999-02-12 2006-09-06 三共株式会社 Novel nucleosides and oligonucleotide analogues
US7960540B2 (en) * 1999-04-08 2011-06-14 Advanced Cancer Therapeutics, Llc Antiproliferative activity of G-rich oligonucleotides and method of using same to bind to nucleolin
US8114850B2 (en) * 1999-04-08 2012-02-14 Advanced Cancer Therapeutics, Llc Antiproliferative activity of G-rich oligonucleotides and method of using same to bind to nucleolin
US7314926B1 (en) 1999-04-08 2008-01-01 Antisoma Research Limited Antiproliferative activity of g-rich oligonucleotides and method of using same to bind to nucleolin
US20080318889A1 (en) * 1999-04-08 2008-12-25 Antisoma Research Limited Antiproliferative activity of G-rich oligonucleotides and method of using same to bind to nucleolin
US20080318890A1 (en) * 1999-04-08 2008-12-25 Antisoma Research Limited Antiproliferative activity of G-rich oligonucleotides and method of using same to bind to nucleolin
US6369209B1 (en) 1999-05-03 2002-04-09 Isis Pharmaceuticals, Inc. Oligonucleotides having A-DNA form and B-DNA form conformational geometry
JP4151751B2 (en) * 1999-07-22 2008-09-17 第一三共株式会社 New bicycloalkyl nucleoside analogues
US6147200A (en) * 1999-08-19 2000-11-14 Isis Pharmaceuticals, Inc. 2'-O-acetamido modified monomers and oligomers
US6849610B1 (en) * 1999-11-24 2005-02-01 The Regents Of The University Of California Polynucleotide ligands as anti-viral agents
US20020091095A1 (en) 1999-12-13 2002-07-11 Phillips Nigel C. Modulation of Fas and FasL expression
DE60043759D1 (en) 1999-12-13 2010-03-11 Bioniche Life Sciences Inc Therapeutically useful synthetic oligonucleotides
AU6886301A (en) * 2000-08-29 2002-03-13 Bioniche Life Sciences Inc Modulation of fas and fasl expression
WO2001085996A1 (en) * 2000-05-09 2001-11-15 Isis Pharmaceuticals, Inc. Methods of obtaining active antisense compounds
WO2002002172A1 (en) * 2000-06-30 2002-01-10 Univ Jefferson Dna palindrome - oligoguanylic acid compositions and uses thereof
DE10051628B4 (en) * 2000-10-18 2007-06-06 Fresenius Hemocare Beteiligungs Gmbh Single-stranded oligonucleotide and the use thereof
CA2498777C (en) * 2002-09-13 2015-01-13 Replicor, Inc. Non-sequence complementary antiviral oligonucleotides
AU2005297376A1 (en) * 2004-10-19 2006-04-27 Replicor Inc. Antiviral oligonucleotides
US20050196382A1 (en) * 2002-09-13 2005-09-08 Replicor, Inc. Antiviral oligonucleotides targeting viral families
CA2502015A1 (en) 2002-12-11 2004-06-24 Coley Pharmaceutical Group, Inc. 5' cpg nucleic acids and methods of use
EP1625850B1 (en) 2003-05-15 2012-02-29 Japan Science and Technology Agency Immunostimulating agents
US20050026198A1 (en) * 2003-06-27 2005-02-03 Tamara Balac Sipes Method of selecting an active oligonucleotide predictive model
NZ546275A (en) 2003-10-30 2009-05-31 Coley Pharm Gmbh C-class oligonucleotides analogs with enhanced immunostimulatory potency
AU2005328382C1 (en) * 2004-07-21 2013-01-24 Alnylam Pharmaceuticals, Inc. Oligonucleotides comprising a modified or non-natural nucleobase
US20080213891A1 (en) * 2004-07-21 2008-09-04 Alnylam Pharmaceuticals, Inc. RNAi Agents Comprising Universal Nucleobases
WO2006133099A2 (en) * 2005-06-03 2006-12-14 The Cbr Institute For Biomedical Research, Inc. Sirna microbicides for preventing and treating viral diseases
US8153604B2 (en) * 2006-04-24 2012-04-10 Geron Corporation CNS-tumor treatment method and composition
WO2008139262A2 (en) * 2006-10-26 2008-11-20 Coley Pharmaceutical Gmbh Oligoribonucleotides and uses thereof
US20090131351A1 (en) * 2007-11-16 2009-05-21 Antisoma Research Limited Methods, compositions, and kits for modulating tumor cell proliferation
USRE47320E1 (en) 2007-11-20 2019-03-26 Ionis Pharmaceuticals, Inc. Modulation of CD40 expression
EP2236141A1 (en) * 2009-04-01 2010-10-06 Universität Zürich siDNA oligonucleotide as antiviral agent against Herpes virus Infections
FR2946881B1 (en) * 2009-06-17 2013-04-26 Univ Victor Segalen Bordeaux 2 multimodal activity of oligonucleotides g-quartet and microbicidal compositions.
KR100998365B1 (en) * 2009-06-29 2010-12-06 압타바이오 주식회사 Novel guanosine rich modified oligonucleotides and antiproliferative activity thereof
AU2011268127B2 (en) * 2010-06-18 2016-01-14 Whitehead Institute For Biomedical Research PLA2G16 as a target for antiviral compounds
EP3147364A1 (en) * 2015-09-28 2017-03-29 Institut d'Investigacions Biomédiques August Pi i Sunyer (IDIBAPS) Antiviral agents comprising an oligonucleotide-lipid conjugate forming g-quadruplex
US9758786B2 (en) 2016-02-09 2017-09-12 Autotelic, Llc Compositions and methods for treating pancreatic cancer

Citations (61)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3687808A (en) * 1969-08-14 1972-08-29 Univ Leland Stanford Junior Synthetic polynucleotides
US4587044A (en) * 1983-09-01 1986-05-06 The Johns Hopkins University Linkage of proteins to nucleic acids
US4605735A (en) * 1983-02-14 1986-08-12 Wakunaga Seiyaku Kabushiki Kaisha Oligonucleotide derivatives
US4667025A (en) * 1982-08-09 1987-05-19 Wakunaga Seiyaku Kabushiki Kaisha Oligonucleotide derivatives
US4762779A (en) * 1985-06-13 1988-08-09 Amgen Inc. Compositions and methods for functionalizing nucleic acids
US4824941A (en) * 1983-03-10 1989-04-25 Julian Gordon Specific antibody to the native form of 2'5'-oligonucleotides, the method of preparation and the use as reagents in immunoassays or for binding 2'5'-oligonucleotides in biological systems
US4835263A (en) * 1983-01-27 1989-05-30 Centre National De La Recherche Scientifique Novel compounds containing an oligonucleotide sequence bonded to an intercalating agent, a process for their synthesis and their use
US4876335A (en) * 1986-06-30 1989-10-24 Wakunaga Seiyaku Kabushiki Kaisha Poly-labelled oligonucleotide derivative
US4904582A (en) * 1987-06-11 1990-02-27 Synthetic Genetics Novel amphiphilic nucleic acid conjugates
US4958013A (en) * 1989-06-06 1990-09-18 Northwestern University Cholesteryl modified oligonucleotides
US5013830A (en) * 1986-09-08 1991-05-07 Ajinomoto Co., Inc. Compounds for the cleavage at a specific position of RNA, oligomers employed for the formation of said compounds, and starting materials for the synthesis of said oligomers
US5082830A (en) * 1988-02-26 1992-01-21 Enzo Biochem, Inc. End labeled nucleotide probe
US5112963A (en) * 1987-11-12 1992-05-12 Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften E.V. Modified oligonucleotides
US5149797A (en) * 1990-02-15 1992-09-22 The Worcester Foundation For Experimental Biology Method of site-specific alteration of rna and production of encoded polypeptides
US5196305A (en) * 1989-09-12 1993-03-23 Eastman Kodak Company Diagnostic and amplification methods using primers having thymine at 3' end to overcome primer-target mismatch at the 3' end
US5214136A (en) * 1990-02-20 1993-05-25 Gilead Sciences, Inc. Anthraquinone-derivatives oligonucleotides
US5220007A (en) * 1990-02-15 1993-06-15 The Worcester Foundation For Experimental Biology Method of site-specific alteration of RNA and production of encoded polypeptides
US5245022A (en) * 1990-08-03 1993-09-14 Sterling Drug, Inc. Exonuclease resistant terminally substituted oligonucleotides
US5254469A (en) * 1989-09-12 1993-10-19 Eastman Kodak Company Oligonucleotide-enzyme conjugate that can be used as a probe in hybridization assays and polymerase chain reaction procedures
US5256775A (en) * 1989-06-05 1993-10-26 Gilead Sciences, Inc. Exonuclease-resistant oligonucleotides
US5258506A (en) * 1984-10-16 1993-11-02 Chiron Corporation Photolabile reagents for incorporation into oligonucleotide chains
US5262536A (en) * 1988-09-15 1993-11-16 E. I. Du Pont De Nemours And Company Reagents for the preparation of 5'-tagged oligonucleotides
US5264618A (en) * 1990-04-19 1993-11-23 Vical, Inc. Cationic lipids for intracellular delivery of biologically active molecules
US5272250A (en) * 1992-07-10 1993-12-21 Spielvogel Bernard F Boronated phosphoramidate compounds
US5292873A (en) * 1989-11-29 1994-03-08 The Research Foundation Of State University Of New York Nucleic acids labeled with naphthoquinone probe
US5317098A (en) * 1986-03-17 1994-05-31 Hiroaki Shizuya Non-radioisotope tagging of fragments
US5371241A (en) * 1991-07-19 1994-12-06 Pharmacia P-L Biochemicals Inc. Fluorescein labelled phosphoramidites
US5391723A (en) * 1989-05-31 1995-02-21 Neorx Corporation Oligonucleotide conjugates
US5403711A (en) * 1987-11-30 1995-04-04 University Of Iowa Research Foundation Nucleic acid hybridization and amplification method for detection of specific sequences in which a complementary labeled nucleic acid probe is cleaved
US5451463A (en) * 1989-08-28 1995-09-19 Clontech Laboratories, Inc. Non-nucleoside 1,3-diol reagents for labeling synthetic oligonucleotides
US5489508A (en) * 1992-05-13 1996-02-06 University Of Texas System Board Of Regents Therapy and diagnosis of conditions related to telomere length and/or telomerase activity
US5491133A (en) * 1987-11-30 1996-02-13 University Of Iowa Research Foundation Methods for blocking the expression of specifically targeted genes
US5510475A (en) * 1990-11-08 1996-04-23 Hybridon, Inc. Oligonucleotide multiple reporter precursors
US5512667A (en) * 1990-08-28 1996-04-30 Reed; Michael W. Trifunctional intermediates for preparing 3'-tailed oligonucleotides
US5565350A (en) * 1993-12-09 1996-10-15 Thomas Jefferson University Compounds and methods for site directed mutations in eukaryotic cells
US5565552A (en) * 1992-01-21 1996-10-15 Pharmacyclics, Inc. Method of expanded porphyrin-oligonucleotide conjugate synthesis
US5574142A (en) * 1992-12-15 1996-11-12 Microprobe Corporation Peptide linkers for improved oligonucleotide delivery
US5578718A (en) * 1990-01-11 1996-11-26 Isis Pharmaceuticals, Inc. Thiol-derivatized nucleosides
US5585481A (en) * 1987-09-21 1996-12-17 Gen-Probe Incorporated Linking reagents for nucleotide probes
US5587371A (en) * 1992-01-21 1996-12-24 Pharmacyclics, Inc. Texaphyrin-oligonucleotide conjugates
US5591607A (en) * 1994-03-18 1997-01-07 Lynx Therapeutics, Inc. Oligonucleotide N3→P5' phosphoramidates: triplex DNA formation
US5595726A (en) * 1992-01-21 1997-01-21 Pharmacyclics, Inc. Chromophore probe for detection of nucleic acid
US5597696A (en) * 1994-07-18 1997-01-28 Becton Dickinson And Company Covalent cyanine dye oligonucleotide conjugates
US5599928A (en) * 1994-02-15 1997-02-04 Pharmacyclics, Inc. Texaphyrin compounds having improved functionalization
US5623065A (en) * 1990-08-13 1997-04-22 Isis Pharmaceuticals, Inc. Gapped 2' modified oligonucleotides
US5652356A (en) * 1995-08-17 1997-07-29 Hybridon, Inc. Inverted chimeric and hybrid oligonucleotides
US5652355A (en) * 1992-07-23 1997-07-29 Worcester Foundation For Experimental Biology Hybrid oligonucleotide phosphorothioates
US5688941A (en) * 1990-07-27 1997-11-18 Isis Pharmaceuticals, Inc. Methods of making conjugated 4' desmethyl nucleoside analog compounds
US5700922A (en) * 1991-12-24 1997-12-23 Isis Pharmaceuticals, Inc. PNA-DNA-PNA chimeric macromolecules
US5837857A (en) * 1994-07-07 1998-11-17 Geron Corporation Mammalian telomerase
US5945290A (en) * 1998-09-18 1999-08-31 Isis Pharmaceuticals, Inc. Antisense modulation of RhoA expression
US5952490A (en) * 1992-09-29 1999-09-14 Isis Pharmaceuticals, Inc. Oligonucleotides having a conserved G4 core sequence
US5958680A (en) * 1994-07-07 1999-09-28 Geron Corporation Mammalian telomerase
US5968506A (en) * 1995-08-04 1999-10-19 Geron Corporation Purified telomerase
US6015710A (en) * 1996-04-09 2000-01-18 The University Of Texas System Modulation of mammalian telomerase by peptide nucleic acids
US6017895A (en) * 1992-02-10 2000-01-25 Genzyme Corporation Oligonucleotides possessing zwitterionic moieties
US6608036B1 (en) * 1999-09-10 2003-08-19 Geron Corporation Oligonucleotide N3′→P5′ thiophosphoramidates: their synthesis and administration to treat neoplasms
US20030175906A1 (en) * 2001-07-03 2003-09-18 Muthiah Manoharan Nuclease resistant chimeric oligonucleotides
US20040009156A1 (en) * 2001-10-12 2004-01-15 Christoph Reinhard Antisense therapy using oligonucleotides that target human kinesin genes for treatment of cancer
US20060052323A1 (en) * 1995-06-06 2006-03-09 Gilchrest Barbara A Method to inhibit cell growth using oligonucleotides
US7067497B2 (en) * 1992-09-29 2006-06-27 Isis Pharmaceuticals, Inc. Modulation of telomere length by oligonucleotides having a G-core sequence

Family Cites Families (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5034506A (en) * 1985-03-15 1991-07-23 Anti-Gene Development Group Uncharged morpholino-based polymers having achiral intersubunit linkages
US5194428A (en) * 1986-05-23 1993-03-16 Worcester Foundation For Experimental Biology Inhibition of influenza virus replication by oligonucleotide phosphorothioates
US5176996A (en) * 1988-12-20 1993-01-05 Baylor College Of Medicine Method for making synthetic oligonucleotides which bind specifically to target sites on duplex DNA molecules, by forming a colinear triplex, the synthetic oligonucleotides and methods of use
FR2648045B1 (en) * 1989-06-13 1991-09-27 Centre Nat Rech Scient OLIGONUCLEOTIDE alpha anomeric compounds inhibiting the replication of retroviruses
US5514577A (en) * 1990-02-26 1996-05-07 Isis Pharmaceuticals, Inc. Oligonucleotide therapies for modulating the effects of herpes viruses
HUT62658A (en) * 1990-03-21 1993-05-28 Isis Pharmaceuticals Inc Reagent and process for modifying expression of gene by imitating rna
KR970004802B1 (en) * 1990-04-30 1997-04-04 케이. 미라벨리 크리스토퍼 Oligonucleotide modulation of arachidonic acid metabolism
US5166195A (en) * 1990-05-11 1992-11-24 Isis Pharmaceuticals, Inc. Antisense inhibitors of the human immunodeficiency virus phosphorothioate oligonucleotides
BR9106747A (en) * 1990-08-14 1993-07-20 Isis Pharmaceuticals Inc Oligonucleotide or oligonucleotide analog and method for treating an animal suspected of being infected with influenza virus
US5175266A (en) * 1991-04-19 1992-12-29 Triplex Pharmaceutical Corporation Nucleosides and oligonucleosides with a phosphate-free internucleoside backbone and process for preparing the same
WO1992021690A1 (en) * 1991-06-05 1992-12-10 Triplex Pharmaceutical Corporation Purine base modified 2'-deoxyribonucleosides, use in triplex forming oligonucleotides and process for preparing the same
WO1993009788A1 (en) * 1991-11-13 1993-05-27 Baylor College Of Medicine Triplex forming oligonucleotide reagents targeted to the neu oncogene promoter and method of use
WO1993018187A1 (en) * 1992-03-13 1993-09-16 California Institute Of Technology Triple helix recognition of dna
US5633360A (en) * 1992-04-14 1997-05-27 Gilead Sciences, Inc. Oligonucleotide analogs capable of passive cell membrane permeation
DE69316369D1 (en) * 1992-07-27 1998-02-19 Hybridon Inc Oligonukleotid alkylphosphonothiate
WO1994007367A1 (en) * 1992-09-29 1994-04-14 Apollon, Inc. Anti-viral oligomers that bind polypurine tracts of single-stranded rna or rna-dna hybrids

Patent Citations (66)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3687808A (en) * 1969-08-14 1972-08-29 Univ Leland Stanford Junior Synthetic polynucleotides
US4667025A (en) * 1982-08-09 1987-05-19 Wakunaga Seiyaku Kabushiki Kaisha Oligonucleotide derivatives
US4789737A (en) * 1982-08-09 1988-12-06 Wakunaga Seiyaku Kabushiki Kaisha Oligonucleotide derivatives and production thereof
US4835263A (en) * 1983-01-27 1989-05-30 Centre National De La Recherche Scientifique Novel compounds containing an oligonucleotide sequence bonded to an intercalating agent, a process for their synthesis and their use
US4605735A (en) * 1983-02-14 1986-08-12 Wakunaga Seiyaku Kabushiki Kaisha Oligonucleotide derivatives
US4824941A (en) * 1983-03-10 1989-04-25 Julian Gordon Specific antibody to the native form of 2'5'-oligonucleotides, the method of preparation and the use as reagents in immunoassays or for binding 2'5'-oligonucleotides in biological systems
US4587044A (en) * 1983-09-01 1986-05-06 The Johns Hopkins University Linkage of proteins to nucleic acids
US5258506A (en) * 1984-10-16 1993-11-02 Chiron Corporation Photolabile reagents for incorporation into oligonucleotide chains
US4762779A (en) * 1985-06-13 1988-08-09 Amgen Inc. Compositions and methods for functionalizing nucleic acids
US5317098A (en) * 1986-03-17 1994-05-31 Hiroaki Shizuya Non-radioisotope tagging of fragments
US4876335A (en) * 1986-06-30 1989-10-24 Wakunaga Seiyaku Kabushiki Kaisha Poly-labelled oligonucleotide derivative
US5013830A (en) * 1986-09-08 1991-05-07 Ajinomoto Co., Inc. Compounds for the cleavage at a specific position of RNA, oligomers employed for the formation of said compounds, and starting materials for the synthesis of said oligomers
US4904582A (en) * 1987-06-11 1990-02-27 Synthetic Genetics Novel amphiphilic nucleic acid conjugates
US5585481A (en) * 1987-09-21 1996-12-17 Gen-Probe Incorporated Linking reagents for nucleotide probes
US5112963A (en) * 1987-11-12 1992-05-12 Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften E.V. Modified oligonucleotides
US5403711A (en) * 1987-11-30 1995-04-04 University Of Iowa Research Foundation Nucleic acid hybridization and amplification method for detection of specific sequences in which a complementary labeled nucleic acid probe is cleaved
US5491133A (en) * 1987-11-30 1996-02-13 University Of Iowa Research Foundation Methods for blocking the expression of specifically targeted genes
US5082830A (en) * 1988-02-26 1992-01-21 Enzo Biochem, Inc. End labeled nucleotide probe
US5262536A (en) * 1988-09-15 1993-11-16 E. I. Du Pont De Nemours And Company Reagents for the preparation of 5'-tagged oligonucleotides
US5599923A (en) * 1989-03-06 1997-02-04 Board Of Regents, University Of Tx Texaphyrin metal complexes having improved functionalization
US5391723A (en) * 1989-05-31 1995-02-21 Neorx Corporation Oligonucleotide conjugates
US5256775A (en) * 1989-06-05 1993-10-26 Gilead Sciences, Inc. Exonuclease-resistant oligonucleotides
US5416203A (en) * 1989-06-06 1995-05-16 Northwestern University Steroid modified oligonucleotides
US4958013A (en) * 1989-06-06 1990-09-18 Northwestern University Cholesteryl modified oligonucleotides
US5451463A (en) * 1989-08-28 1995-09-19 Clontech Laboratories, Inc. Non-nucleoside 1,3-diol reagents for labeling synthetic oligonucleotides
US5196305A (en) * 1989-09-12 1993-03-23 Eastman Kodak Company Diagnostic and amplification methods using primers having thymine at 3' end to overcome primer-target mismatch at the 3' end
US5254469A (en) * 1989-09-12 1993-10-19 Eastman Kodak Company Oligonucleotide-enzyme conjugate that can be used as a probe in hybridization assays and polymerase chain reaction procedures
US5292873A (en) * 1989-11-29 1994-03-08 The Research Foundation Of State University Of New York Nucleic acids labeled with naphthoquinone probe
US5578718A (en) * 1990-01-11 1996-11-26 Isis Pharmaceuticals, Inc. Thiol-derivatized nucleosides
US5366878A (en) * 1990-02-15 1994-11-22 The Worcester Foundation For Experimental Biology Method of site-specific alteration of RNA and production of encoded polypeptides
US5149797A (en) * 1990-02-15 1992-09-22 The Worcester Foundation For Experimental Biology Method of site-specific alteration of rna and production of encoded polypeptides
US5220007A (en) * 1990-02-15 1993-06-15 The Worcester Foundation For Experimental Biology Method of site-specific alteration of RNA and production of encoded polypeptides
US5214136A (en) * 1990-02-20 1993-05-25 Gilead Sciences, Inc. Anthraquinone-derivatives oligonucleotides
US5264618A (en) * 1990-04-19 1993-11-23 Vical, Inc. Cationic lipids for intracellular delivery of biologically active molecules
US5688941A (en) * 1990-07-27 1997-11-18 Isis Pharmaceuticals, Inc. Methods of making conjugated 4' desmethyl nucleoside analog compounds
US5245022A (en) * 1990-08-03 1993-09-14 Sterling Drug, Inc. Exonuclease resistant terminally substituted oligonucleotides
US5567810A (en) * 1990-08-03 1996-10-22 Sterling Drug, Inc. Nuclease resistant compounds
US5623065A (en) * 1990-08-13 1997-04-22 Isis Pharmaceuticals, Inc. Gapped 2' modified oligonucleotides
US5512667A (en) * 1990-08-28 1996-04-30 Reed; Michael W. Trifunctional intermediates for preparing 3'-tailed oligonucleotides
US5510475A (en) * 1990-11-08 1996-04-23 Hybridon, Inc. Oligonucleotide multiple reporter precursors
US5371241A (en) * 1991-07-19 1994-12-06 Pharmacia P-L Biochemicals Inc. Fluorescein labelled phosphoramidites
US5700922A (en) * 1991-12-24 1997-12-23 Isis Pharmaceuticals, Inc. PNA-DNA-PNA chimeric macromolecules
US5595726A (en) * 1992-01-21 1997-01-21 Pharmacyclics, Inc. Chromophore probe for detection of nucleic acid
US5587371A (en) * 1992-01-21 1996-12-24 Pharmacyclics, Inc. Texaphyrin-oligonucleotide conjugates
US5565552A (en) * 1992-01-21 1996-10-15 Pharmacyclics, Inc. Method of expanded porphyrin-oligonucleotide conjugate synthesis
US6017895A (en) * 1992-02-10 2000-01-25 Genzyme Corporation Oligonucleotides possessing zwitterionic moieties
US5489508A (en) * 1992-05-13 1996-02-06 University Of Texas System Board Of Regents Therapy and diagnosis of conditions related to telomere length and/or telomerase activity
US5272250A (en) * 1992-07-10 1993-12-21 Spielvogel Bernard F Boronated phosphoramidate compounds
US5652355A (en) * 1992-07-23 1997-07-29 Worcester Foundation For Experimental Biology Hybrid oligonucleotide phosphorothioates
US5952490A (en) * 1992-09-29 1999-09-14 Isis Pharmaceuticals, Inc. Oligonucleotides having a conserved G4 core sequence
US7067497B2 (en) * 1992-09-29 2006-06-27 Isis Pharmaceuticals, Inc. Modulation of telomere length by oligonucleotides having a G-core sequence
US5574142A (en) * 1992-12-15 1996-11-12 Microprobe Corporation Peptide linkers for improved oligonucleotide delivery
US5565350A (en) * 1993-12-09 1996-10-15 Thomas Jefferson University Compounds and methods for site directed mutations in eukaryotic cells
US5599928A (en) * 1994-02-15 1997-02-04 Pharmacyclics, Inc. Texaphyrin compounds having improved functionalization
US5591607A (en) * 1994-03-18 1997-01-07 Lynx Therapeutics, Inc. Oligonucleotide N3→P5' phosphoramidates: triplex DNA formation
US5837857A (en) * 1994-07-07 1998-11-17 Geron Corporation Mammalian telomerase
US5958680A (en) * 1994-07-07 1999-09-28 Geron Corporation Mammalian telomerase
US5597696A (en) * 1994-07-18 1997-01-28 Becton Dickinson And Company Covalent cyanine dye oligonucleotide conjugates
US20060052323A1 (en) * 1995-06-06 2006-03-09 Gilchrest Barbara A Method to inhibit cell growth using oligonucleotides
US5968506A (en) * 1995-08-04 1999-10-19 Geron Corporation Purified telomerase
US5652356A (en) * 1995-08-17 1997-07-29 Hybridon, Inc. Inverted chimeric and hybrid oligonucleotides
US6015710A (en) * 1996-04-09 2000-01-18 The University Of Texas System Modulation of mammalian telomerase by peptide nucleic acids
US5945290A (en) * 1998-09-18 1999-08-31 Isis Pharmaceuticals, Inc. Antisense modulation of RhoA expression
US6608036B1 (en) * 1999-09-10 2003-08-19 Geron Corporation Oligonucleotide N3′→P5′ thiophosphoramidates: their synthesis and administration to treat neoplasms
US20030175906A1 (en) * 2001-07-03 2003-09-18 Muthiah Manoharan Nuclease resistant chimeric oligonucleotides
US20040009156A1 (en) * 2001-10-12 2004-01-15 Christoph Reinhard Antisense therapy using oligonucleotides that target human kinesin genes for treatment of cancer

Cited By (24)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030138814A1 (en) * 2001-03-23 2003-07-24 Sergei Gryaznov Oligonucleotide conjugates
US7563618B2 (en) 2001-03-23 2009-07-21 Geron Corporation Oligonucleotide conjugates
US20100016416A1 (en) * 2001-03-23 2010-01-21 Geron Corporation Oligonucleotide Conjugates
US9072790B2 (en) 2001-03-23 2015-07-07 Geron Corporation Oligonucleotide conjugates
US9572891B2 (en) 2001-03-23 2017-02-21 Geron Corporation Oligonucleotide conjugates
US8440635B2 (en) 2001-03-23 2013-05-14 Geron Corporation Oligonucleotide conjugates
US20050113325A1 (en) * 2003-09-09 2005-05-26 Sergei Gryaznov Modified oligonucleotides for telomerase inhibition
US7494982B2 (en) 2003-09-09 2009-02-24 Geron Corporation Modified oligonucleotides for telomerase inhibition
US9404112B2 (en) 2003-09-09 2016-08-02 Geron Corporation Modified oligonucleotides for telomerase inhibition
US9388415B2 (en) 2003-09-09 2016-07-12 Geron Corporation Modified oligonucleotides for telomerase inhibition
US9388416B2 (en) 2003-09-09 2016-07-12 Geron Corporation Modified oligonucleotides for telomerase inhibition
US9657296B2 (en) 2003-09-09 2017-05-23 Geron Corporation Modified oligonucleotides for telomerase inhibition
US10196641B2 (en) 2003-09-09 2019-02-05 Geron Corporation Modified oligonucleotides for telomerase inhibition
US20100016407A1 (en) * 2006-10-30 2010-01-21 Geron Corporation Combined Telomerase Inhibitor and Gemcitabine for the Treatment of Cancer
US7989428B2 (en) 2006-10-30 2011-08-02 Geron Corporation Combined telomerase inhibitor and gemcitabine for the treatment of cancer
US20100113571A1 (en) * 2007-01-30 2010-05-06 Gryaznov Sergei M Compounds having anti-adhesive effects on cancer cells
US8785409B2 (en) 2007-01-30 2014-07-22 Geron Corporation Compounds having anti-adhesive effects on cancer cells
US9732114B2 (en) 2007-01-30 2017-08-15 Geron Corporation Compounds having anti-adhesive effects on cancer cells
US20100104586A1 (en) * 2007-03-09 2010-04-29 Geron Corporation Treatment of Carcinomas with a Combination of EGF-Pathway and Telomerase Inhibitors
US9155753B2 (en) 2007-03-09 2015-10-13 Geron Corporation Treatment of carcinomas with a combination of EGF-pathway and telomerase inhibitors
US9375485B2 (en) 2012-12-07 2016-06-28 Geron Corporation Use of telomerase inhibitors for the treatment of myeloproliferative disorders and myeloproliferative neoplasms
US9796747B2 (en) 2014-05-01 2017-10-24 Geron Corporation Oligonucleotide compositions and methods of making the same
WO2017017253A1 (en) * 2015-07-29 2017-02-02 Ifom - Fondazione Istituto Firc Di Oncologia Molecolare Therapeutic oligonucleotides
EP3124609A1 (en) * 2015-07-29 2017-02-01 IFOM Fondazione Istituto Firc di Oncologia Molecolare Therapeutics oligonucleotides

Also Published As

Publication number Publication date
FI951467A0 (en) 1995-03-28
BR1100614A (en) 2000-04-11
EP0672193B1 (en) 2002-08-14
FI951467A (en) 1995-03-28
NZ256787A (en) 1997-04-24
AT222290T (en) 2002-08-15
EP1016715A1 (en) 2000-07-05
EP0672193A4 (en) 1995-11-22
IL107150D0 (en) 1993-12-28
DE69332206T2 (en) 2003-05-28
NO951191D0 (en) 1995-03-28
AU668604B2 (en) 1996-05-09
US5952490A (en) 1999-09-14
HU9500911D0 (en) 1995-05-29
JP2818031B2 (en) 1998-10-30
HUT70965A (en) 1995-11-28
NO951191L (en) 1995-03-28
CA2145664A1 (en) 1994-04-14
JPH08500738A (en) 1996-01-30
FI951467D0 (en)
WO1994008053A1 (en) 1994-04-14
EP0672193A1 (en) 1995-09-20
AU5167393A (en) 1994-04-26
CA2145664C (en) 2002-08-20
US20110124715A1 (en) 2011-05-26
US5523389A (en) 1996-06-04
US20070015723A1 (en) 2007-01-18
NZ314251A (en) 1999-05-28
DE69332206D1 (en) 2002-09-19

Similar Documents

Publication Publication Date Title
US6133031A (en) Antisense inhibition of focal adhesion kinase expression
JP4929288B2 (en) Compositions and methods for inhibiting the expression of Nav1.8 gene
JP5425474B2 (en) To huntingtin pairs, compositions and uses thereof
Crooke Therapeutic applications of oligonucleotides
US7629321B2 (en) Oligoribonucleotides and ribonucleases for cleaving RNA
KR101900770B1 (en) Modulation of dystrophia myotonica-protein kinase (dmpk) expression
JP5507617B2 (en) Regulation of stat3 expression by antisense oligonucleotide null Credo tide
US20040161844A1 (en) Sugar and backbone-surrogate-containing oligomeric compounds and compositions for use in gene modulation
US8410074B2 (en) Modulation of eIF4E expression
AU2004270741B2 (en) Gapped oligomeric compounds having linked bicyclic sugar moieties at the termini
ES2546360T3 (en) Antisense modulation of the expression of apolipoprotein B
US6410323B1 (en) Antisense modulation of human Rho family gene expression
CA2345354C (en) Antisense modulation of bcl-x expression
AU2010202724B2 (en) Modulation of survivin expression
CN102264374B (en) 5' and 2' bis-substituted nucleosides and oligomeric compounds prepared therefrom
US6001992A (en) Antisense modulation of novel anti-apoptotic bcl-2-related proteins
US20120149755A1 (en) Antisense oligonucleotide modulation of raf gene expression
US8466120B2 (en) Oligomeric compounds and compositions for use in modulation of pri-miRNAs
US6444650B1 (en) Antisense compositions for detecting and inhibiting telomerase reverse transcriptase
US5914269A (en) Oligonucleotide inhibition of epidermal growth factor receptor expression
Morvan et al. Comparative evaluation of seven oligonucleotide analogs as potential antisense agents
US20050019915A1 (en) Antisense modulation of superoxide dismutase 1, soluble expression
US8067386B2 (en) Modulation of eIF4E-BP2 expression
US20020151511A1 (en) Antisense oligonucleotide modulation of human MDM2 expression
US20040033978A1 (en) Compositions and methods for treatment of Hepatitis C virus-associated diseases

Legal Events

Date Code Title Description
AS Assignment

Owner name: ISIS PHARMACEUTICALS, INC., CALIFORNIA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:BENNETT, C. FRANK;ECKER, DAVID J.;VICKERS, TIMOTHY;AND OTHERS;REEL/FRAME:018557/0407;SIGNING DATES FROM 20061009 TO 20061128