US20070149769A1 - Endothelial cell-leukocyte adhesion molecules (ELAMs) and molecules involved in leukocyte adhesion (MILAs) - Google Patents

Endothelial cell-leukocyte adhesion molecules (ELAMs) and molecules involved in leukocyte adhesion (MILAs) Download PDF

Info

Publication number
US20070149769A1
US20070149769A1 US11/447,664 US44766406A US2007149769A1 US 20070149769 A1 US20070149769 A1 US 20070149769A1 US 44766406 A US44766406 A US 44766406A US 2007149769 A1 US2007149769 A1 US 2007149769A1
Authority
US
United States
Prior art keywords
cells
elam1
cell
vcam1
elam
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US11/447,664
Inventor
Catherine Hession
Roy Lobb
Susan Goelz
Laurelee Osborn
Christopher Benjamin
Margaret Rosa
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Biogen MA Inc
Original Assignee
Biogen Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=27407673&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=US20070149769(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Priority claimed from US07/345,151 external-priority patent/US5217870A/en
Priority claimed from US10/234,041 external-priority patent/US20030153731A1/en
Application filed by Biogen Inc filed Critical Biogen Inc
Priority to US11/447,664 priority Critical patent/US20070149769A1/en
Assigned to BIOGEN, INC. reassignment BIOGEN, INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: GOELZ, SUSAN E., HESSION, CATHERINE, LOBB, ROY R., ROSA, MARGARET D., OSBORN, LAURELEE, BENJAMIN, CHRISTOPHER D.
Assigned to BIOGEN IDEC MA INC. reassignment BIOGEN IDEC MA INC. CHANGE OF NAME (SEE DOCUMENT FOR DETAILS). Assignors: BIOGEN, INC.
Publication of US20070149769A1 publication Critical patent/US20070149769A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2866Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against receptors for cytokines, lymphokines, interferons
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6835Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site
    • A61K47/6849Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site the antibody targeting a receptor, a cell surface antigen or a cell surface determinant
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/7056Lectin superfamily, e.g. CD23, CD72
    • C07K14/70564Selectins, e.g. CD62
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • C07K16/2836Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against CD106
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2851Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the lectin superfamily, e.g. CD23, CD72
    • C07K16/2854Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the lectin superfamily, e.g. CD23, CD72 against selectins, e.g. CD62
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/42Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against immunoglobulins
    • C07K16/4208Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against immunoglobulins against an idiotypic determinant on Ig
    • C07K16/4241Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against immunoglobulins against an idiotypic determinant on Ig against anti-human or anti-animal Ig
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/42Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against immunoglobulins
    • C07K16/4208Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against immunoglobulins against an idiotypic determinant on Ig
    • C07K16/4241Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against immunoglobulins against an idiotypic determinant on Ig against anti-human or anti-animal Ig
    • C07K16/4258Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against immunoglobulins against an idiotypic determinant on Ig against anti-human or anti-animal Ig against anti-receptor Ig
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/76Antagonist effect on antigen, e.g. neutralization or inhibition of binding
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/30Non-immunoglobulin-derived peptide or protein having an immunoglobulin constant or Fc region, or a fragment thereof, attached thereto
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/12Type of nucleic acid catalytic nucleic acids, e.g. ribozymes
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • This invention relates to molecules involved in the adhesion of leukocytes to endothelial cells during inflammation and to DNA sequences that code on expression for them. More particularly, it relates to Endothelial Cell Adhesion Molecules (ELAMs), including ELAM1 and Vascular Cell Adhesion Molecule 1 and 1b (VCAM1 and VCAM1b). It also relates to molecules on the surface of leukocytes involved in leukocyte adhesion to endothelial cells (MILAs). These include CDX, a molecule involved in the ELAM1 adhesion pathway, and VLA4, the ligand of VCAM1 and VCAM1b. This invention also relates to clone 7.2 and clone 1.
  • DNA sequences encode protein 7.2 and protein 1, respectively, which are involved in the expression of CDX. These proteins appear to be 1,3-fucosyl transferases that glycosylate CDX.
  • This invention also relates to Pseudo-X and Pseudo-X 2 , proteins that appear on COS 7 and CHO cells, respectively, that have been transfected with clone 7.2. Cells expressing those proteins bind ELAM1 and are recognized by anti-CDX monoclonal antibodies.
  • This invention further relates to antibodies that recognize these adhesion molecules and anti-idiotype antibodies that recognize both those antibodies and the ligands or receptors for the adhesion molecules.
  • the invention also relates to antisense DNA and RNA molecules complementary to mRNA for such adhesion molecules and also relates to ribozymes which recognize mRNA for such molecules.
  • the invention also relates to methods for using the aforementioned molecules, DNA sequences, antibodies, anti-idiotype antibodies, antisense molecules and ribozymes, for example in developing diagnostic and therapeutic agents to detect or inhibit leukocyte adhesion to endothelial cells.
  • Inflammation is the response of vascularized tissues to infection or injury. Clinically it is accompanied by four classic signs: redness, heat, pain and swelling. Its course may be acute or chronic.
  • inflammation involves the adhesion of leukocytes (white blood cells) to the endothelial wall of blood vessels and their infiltration into the surrounding tissues.
  • leukocytes white blood cells
  • Acute inflammation is characterized by the adhesion and infiltration of polymorphonuclear leukocytes (PMNs).
  • PMNs polymorphonuclear leukocytes
  • PMN accumulation in the tissues reaches its peak between two and one half to four hours after an inflammatory stimulus and ceases by about twenty-eight hours.
  • chronic inflammation is characterized by the adhesion and infiltration of other leukocytes, especially monocytes and lymphocytes.
  • infiltrating leukocytes In normal inflammation, the infiltrating leukocytes phagocytize invading organisms or dead cells, and play a role in tissue repair and the immune response. However, in pathologic inflammation, infiltrating leukocytes can cause serious and sometimes deadly damage.
  • Rheumatoid arthritis and atherosclerosis are examples of chronic inflammatory diseases in which mononuclear leukocytes infiltrate the tissues and cause damage.
  • ARDS adult respiratory distress syndrome
  • ischemic reperfusion injury are acute inflammations in which infiltrating PMNs cause the damage (Harlan, 1987 and Malech and Gallin, 1987).
  • leukocyte infiltration is the cause of much inflammation-related pathology and that leukocyte adhesion is the first step in infiltration
  • investigators have recently focused attention on the mechanism of leukocyte binding to the endothelial cell surface.
  • binding is mediated by cell-surface molecules on both endothelial cells and leukocytes which act as receptor and ligand (Harlan et al., 1987; Dana et al., 1986; and Bevilacqua et al., 1987a).
  • inflammatory agents can act on the leukocytes, making them hyperadhesive for endothelium.
  • Known inflammatory agents include leukotriene-B4 (LTB4), complement factor 5a (C5a), and formyl-methionyl-leucyl-phenylalanine (FMLP).
  • LLB4 leukotriene-B4
  • C5a complement factor 5a
  • FMLP formyl-methionyl-leucyl-phenylalanine
  • LeuCAMs are dimers of the CD11 and CD18 proteins.
  • CD11a/CD18 also called LFA1
  • ICAM1 intercellular adhesion molecule 1
  • IL-1 interleukin-1
  • LT lymphotoxin
  • TNF tumor necrosis factor
  • LPS lipopolysaccharide
  • IL-1 has been shown to stimulate adhesion of PMNs, monocytes, and the related cell lines HL-60 (PMN-like) and U937 (monocyte-like), to human endothelial cell monolayers. The action is both time-dependent and protein-synthesis dependent.
  • ELAMs endothelial cell-leukocyte adhesion molecules
  • ICM1 intercellular adhesion molecule 1
  • ELAM1 endothelial cell-leukocyte adhesion molecule 1
  • ICAM1 is found on many cell types, and its expression on vascular endothelium is strongly upregulated both in vitro and in vivo by the inflammatory cytokines interleukin-1 (IL-1), tumor necrosis factor- ⁇ (TNF), and gamma interferon (IFN- ⁇ ).
  • IL-1 interleukin-1
  • TNF tumor necrosis factor- ⁇
  • IFN- ⁇ gamma interferon
  • ELAM1 was initially detected and characterized by a monoclonal antibody that partially blocked PMN adhesion to cytokine-treated human umbilical vein endothelial cells (HUVECs).
  • ELAM1 is a 116 kD cell surface glycoprotein rapidly synthesized by HUVECs in response to the inflammatory cytokines IL-1 or TNF, but not IFN- ⁇ . (Bevilacqua et al., 1987b.) Unlike ICAM1, ELAM1 appears to be expressed only in endothelium, and its expression is transient even in the continued presence of cytokine. Like ICAM1, ELAM1 is present at inflammatory sites in vivo.
  • ELAM1 appears to be a major mediator of PMN adhesion to the inflamed vascular wall in vivo. Importantly, the presence of ELAM1 on the cell surface follows the natural course of acute inflammation, appearing a few hours after stimulation and gradually dissipating within a day. (Bevilacqua et al., 1987b.)
  • VCAM1 and VCAM1b ELAMS
  • ELAMs accordingly may be regarded as a family of molecules.
  • ELAMs may play important roles in a wide range of pathological states involving cell-cell recognition, including tumor invasion, metastasis and viral infection.
  • LFA1 lymphocyte function associated antigen 1
  • PMN polymorphonuclear leukocyte
  • CDX is a protein of approximately 150 kD and was isolated from HL-60 cells. Monoclonal antibodies that recognize CDX inhibit the binding of PMNs and HL-60 cells to ELAM1-expressing cells. Furthermore, CDX is present on leukocyte cell types known to adhere to ELAM1 and is absent from leukocyte cell types and other cell types that do not adhere to ELAM1. Thus, CDX is a molecule expressed on certain leukocytes that plays an important role in ELAM1-mediated leukocyte-endothelial cell adhesion. We also report the isolation and sequencing of cDNA encoding molecules involved in CDX expression.
  • VCAM1 and VCAM1b ligand VLA4.
  • Antibodies specific for the ⁇ 4 and ⁇ 1 subunits of VLA4 completely eliminate binding of VLA4-expressing cells to VCAM1.
  • leukocyte adhesion to the vascular wall is the first step in inflammation
  • therapies directed to preventing this step are attractive for the treatment of pathologic inflammation.
  • Clinicians are already testing, with some success, therapies based on inhibiting leukocyte-mediated adhesion.
  • One such approach involves Moab binding to the leukocyte cell-surface complex, CD11/CD18, to inhibit PMN adhesion. (Arfors et al., 1987; Vedder et al., 1988; and Todd et al., 1989.)
  • ELAMs and MILAs including ELAM ligands
  • ELAMs and MILAs including ELAM ligands
  • the ELAM system is particularly appealing for two reasons: First, because ELAM expression on endothelial cells is induced rather than constitutive, ELAMs are concentrated at sites of inflammation and are limited in number. This means that adhesion inhibitors need act only locally and, consequently, would be effective at lower doses than inhibitors directed to constitutively expressed molecules. Second, ELAM binding is selective for different leukocyte classes. For example, ELAM1 binds PMNs, and VCAM1 binds lymphocytes. Therefore, these therapies would be specific for certain classes of leukocytes and would not affect the circulation or migration of other leukocyte classes. Furthermore, for the above reasons, such therapies may prove to be cheaper and less toxic.
  • ELAM-based approaches to therapy require, as starting materials, both ELAMs and MILAs in highly purified form, free of normally associated animal proteins. There is also a need for methods to produce these molecules.
  • This invention provides DNA sequences that code on expression for endothelial cell-leukocyte adhesion molecules (ELAMs), genomic DNA sequences for ELAMs (including ELAM expression control sequences), recombinant DNA molecules containing these DNA sequences, unicellular hosts transformed with these DNA molecules, processes for producing ELAMs, and ELAM proteins essentially free of normally associated animal proteins.
  • ELAMs endothelial cell-leukocyte adhesion molecules
  • genomic DNA sequences for ELAMs including ELAM expression control sequences
  • recombinant DNA molecules containing these DNA sequences unicellular hosts transformed with these DNA molecules, processes for producing ELAMs, and ELAM proteins essentially free of normally associated animal proteins.
  • the present invention also provides for antibody preparations reactive for ELAMs.
  • MILAs will include leukocyte surface molecules that bind directly to ELAMs, i.e., ELAM ligands. Monoclonal antibodies recognizing ELAM ligands can inhibit ELAM/ELAM ligand binding directly. MILAs will also include leukocyte surface molecules that are involved indirectly in adhesion, for example molecules that inhibit ELAM/ELAM ligand binding by interacting with a third molecule, such as a monoclonal antibody. Such molecules may act, for example, by changing the surface conformation of an ELAM ligand so that its affinity for the ELAM is reduced.
  • This invention also provides recombinant DNA molecules containing MILA DNA sequences and unicellular hosts transformed with them. It also provides for MILA proteins essentially free of normally associated animal proteins, methods for producing MILAs, and monoclonal antibodies that recognize MILAs, particularly CDX.
  • This invention provides DNA sequences encoding molecules that cause several cell lines, including COS, CHO and R1.1, both express surface glycoproteins that are recognized by anti-CDX ( ⁇ -CDX) antibodies and to bind to ELAM1.
  • This invention provides, in particular, clone 7.2 and clone 1, and protein 7.2 and protein 1, respectively. These proteins appear to be 1,3-fucosyl transferases.
  • This invention also provides the glycoproteins, Pseudo-X and Pseudo-X 2 , which cause COS cells and CHO cells, respectively, to bind ELAM1 and to be recognized by ⁇ -CDX antibodies.
  • This invention further provides methods for inhibiting PMN binding to endothelial cells involving the use of ELAMs, MILAs including ELAM ligands, or portions of those molecules to block receptors or ligands. It also relates to the use of antisense nucleic acids and ribozymes to inhibit ELAM expression.
  • the invention also relates to methods for identifying binding inhibitors by screening molecules for their ability to inhibit binding of an ELAM to its ligand. It provides methods for identifying ELAMs and their ligands. One such method involves using anti-idiotypic antibodies against antibodies that recognize ELAMs or ELAM ligands.
  • FIG. 1 depicts the composite ELAM1 cDNA sequence and deduced amino acid sequence derived from the DNA sequences of ELAM pCDM8 clone 6, pSQ148 and pSQ149.
  • the nucleotides are numbered from 1 to 3863.
  • coding DNA sequence of this figure as the DNA sequence for ELAM1.
  • ELAM1 the molecule comprising the amino acid sequence depicted in this figure as ELAM1.
  • FIG. 2 depicts the DNA sequence of the synthetic polylinker of pNN11.
  • FIG. 3 depicts the sequence of cDNA coding for VCAM1 and the deduced amino acid sequence of VCAM1 derived from AM pCDM8 clone 41.
  • the nucleotides are numbered 1 to 2811.
  • the coding DNA sequence of this figure as the DNA sequence for VCAM1.
  • VCAM1 the molecule comprising the amino acid sequence depicted in this figure as VCAM1.
  • FIG. 4 depicts the sequence of cDNA coding for VCAM1b and the deduced amino acid sequence of VCAM1b derived from VCAM1b pCDM8 clone 1E11.
  • the nucleotides are numbered 1 to 3080.
  • FIG. 5 depicts the domain structure of VCAM1.
  • the amino acids are indicated according to the one letter code used by the University of Wisconsin Genetics Computer Group. (Devereux et al., 1984.)
  • FIG. 6 depicts the domain structure of VCAM1b.
  • the amino acids are indicated according to the one letter code used by the University of Wisconsin Genetics Computer Group. (Devereux et al., 1984.)
  • FIG. 7 depicts the DNA sequence of portions of the 5′ untranslated and untranscribed region of ELAM1 derived from clone EL1-07.
  • FIG. 8 depicts the DNA sequence of portions of the 5′ untranslated and untranscribed region of VCAM1 derived from clone VC1-16.
  • FIG. 9 depicts the sequence of cDNA coding for protein 7.2 and the deduced amino acid sequence of protein 7.2 derived from pSQ219 and CDX pCDM8 clone 7.2.
  • the nucleotides are numbered 1-2175.
  • FIG. 10 depicts the sequence of cDNA coding for protein 1 derived from clone 1.
  • the nucleotides are numbered 1-2861.
  • the coding DNA sequence of this figure as the DNA sequence for clone 1.
  • the polypeptide comprising the amino acid sequence depicted in this figure as protein 1.
  • Expression control sequence A DNA sequence that controls and regulates the transcription and translation of another DNA sequence.
  • a DNA sequence is operatively linked to an expression control sequence when the expression control sequence controls and regulates the transcription and translation of that DNA sequence.
  • the term “operatively linked” includes having an appropriate start signal (e.g., ATG) in front of the DNA sequence to be expressed and maintaining the correct reading frame to permit expression of the DNA sequence under the control of the expression control sequence and production of the desired product encoded by the DNA sequence. If a gene that one desires to insert into a recombinant DNA molecule does not contain an appropriate start signal, such a start signal can be inserted in front of the gene.
  • Antibody An immunoglobulin molecule or functional fragment thereof, such as Fab, F(ab′) 2 or dAb.
  • An antibody preparation is reactive for a particular antigen when at least a portion of the individual immunoglobulin molecules in the preparation recognize (i.e., bind to) the antigen.
  • An antibody preparation is non-reactive for an antigen when binding of the individual immunoglobulin molecules in the preparation to the antigen is not detectable by commonly used methods.
  • Standard hybridization conditions salt and temperature conditions substantially equivalent to 5 ⁇ SSC and 65° C. for both hybridization and wash.
  • the DNA sequences of this invention will hybridize to other DNA sequences having sufficient homology, including homologous sequences from different species. It is understood that the stringency of hybridization conditions is a factor in the degree of homology required for hybridization.
  • DNA sequences refer to DNA sequences prepared or isolated using recombinant DNA techniques. These include cDNA sequences, DNA sequences isolated from their native genome, and synthetic DNA sequences. The term as used in the claims is not intended to include naturally occurring DNA sequences as they exist in Nature.
  • ELAM A molecule expressed on the surface of endothelial cells that mediates adhesion of leukocytes to endothelial cells.
  • MILA A molecule expressed on the surface of leukocytes that is involved in ELAM-mediated binding to endothelial cells. This includes ELAM ligands, i.e., molecules that bind directly to ELAMs.
  • Expression of recombinant DNA molecules according to this invention may involve post-translational modification of a resultant polypeptide by the host cell.
  • expression might include, among other things, glycosylation, lipidation or phosphorylation of a polypeptide, or cleavage of a signal sequence to produce a “mature” protein.
  • protein including ELAM, MILA, protein 1, protein 7.2, Pseudo-X and Pseudo-X 2 encompass full-length polypeptides and modifications or derivatives thereof, such as glycosylated versions of such polypeptides, mature proteins, polypeptides retaining a signal peptide, truncated polypeptides having comparable biological activity, and the like.
  • ELAMs are expressed on the surface of endothelial cells only during inflammation. We utilized this phenomenon to isolate ELAM cDNAs. We have designated the polypeptides encoded by our cDNA isolates ELAM1, VCAM1 and VCAM1b. The first step involved in the isolation was selection of cells that differentially expressed the ELAM molecules. We chose human umbilical vein endothelial cells because they produce ELAMs when induced by the inflammatory cytokine, IL-1 ⁇ . However, the practitioner is not limited to this cytokine, to this cell type, or even to human cells in particular. Other mammalian cells, e.g., baboon endothelial cells, are also known to produce ELAMs. (Cotran and Pober, 1988.)
  • the next step was to isolate mRNA from cells expressing ELAMS, in this case, IL-1 ⁇ -induced HUVECs, and to create a cDNA library from them.
  • ELAMS in this case, IL-1 ⁇ -induced HUVECs
  • Many methods are known for isolating mRNA and for producing cDNA from it. (See, e.g., Gubler and Hoffman, 1983 and Maniatis et al., 1982.)
  • clones that contained cDNA for ELAM sequences.
  • clones for expression of ELAM activity in an appropriate eukaryotic expression system.
  • direct expression techniques including antibody screening of fusion proteins encoded by cDNA cloned in ⁇ GT11 (Young and Davis, 1983; Young and Davis, 1984); or activity assay of oocyte-conditioned media after injection of mRNA from cloned cDNA, or from plasmid or phage DNA carrying SP6/T7 promoters.
  • Animal cells may be transfected with the library for transient or stable expression. Transfection can be accomplished by a variety of methods. For transient expression, investigators have used spheroplast fusion, DEAE dextran, and electroporation. For stable expression they have used calcium phosphate, spheroplast fusion, and electroporation. We used COS 7 cells, a transient expression system, transfected by spheroplast fusion. (Aruffo and Seed, 1987.)
  • ELAM expression was detected by testing the ability of transfected cells to bind either the human neutrophil-like cell line, HL-60 (Bevilacqua et al., 1985), or the human B-lymphocyte-like cell line, RAMOS (American Type Culture Collection, ATCC accession no. CRL 1596, human Burkitt lymphoma). We describe this in more detail below. Because the transfected cells were non-human, those producing human ELAM polypeptides did so in substantially purified form and essentially free of normally associated animal proteins. We picked cells that tested positive in this assay, collected the plasmid DNA, and isolated the inserts from them. These inserts contained DNA sequences encoding ELAM1 (selected by adhesion to HL-60 cells) and VCAM1 (selected by adhesion to RAMOS cells).
  • VCAM1b We isolated a cDNA for another VCAM, VCAM1b, by probing the IL-1 ⁇ -induced HUVEC cDNA library with a random-primed oligonucleotide 32 P-labeled probe derived from the VCAM1 cDNA sequence.
  • VCAM1b is larger than VCAM1.
  • genomic DNA sequences including transcriptional promoters, for the ELAM1 and VCAM1 and 1b genes.
  • ELAM1 and VCAM1 and 1b genes We have also isolated genomic DNA sequences, including transcriptional promoters, for the ELAM1 and VCAM1 and 1b genes.
  • ELAM1 and VCAM1 transcriptional promoters have a number of uses. First, they are useful to construct vectors inducible by cytokines (such as TNF or IL-1), and bacterial lipopolysaccharide (LPS), or any other agent found to induce expression of ELAMs in endothelial cells. Such vectors may be useful, for example, in gene transfer assays, wherein the inducible promoter is positioned so that it drives transcription of a reporter gene such as chloramphenicol acetyltransferase, beta-galactosidase, luciferase, etc. This construct will then be introduced transiently or stably into an appropriate mammalian cell line. Potential inhibitors or stimulators of induction can then be assayed by measuring their effect on induction by any or all of the inducers listed above.
  • cytokines such as TNF or IL-1
  • LPS bacterial lipopolysaccharide
  • VCAM1 is involved in T and B cell binding to endothelial cells.
  • T cells activated by lectin stimulation or by a specific antigen bind to HUVECs in vitro. This binding is mediated in part by the ICAM/LFA1 pathway, since monoclonal antibodies that bind to an inhibitory epitope on CD18 (the common B chain of LFA1) partially inhibit T cell binding. We found that anti-CD18 and anti-VCAM1 monoclonals completely inhibited binding.
  • VCAM1 is central to activated T cell migration in vivo.
  • VCAM1 serves to focus all activated T cells into an inflammatory site. Since the presence of activated T cells is the hallmark of numerous inflammatory and autoimmune diseases, this in turn implies that inappropriate expression of VCAM1 might be the fundamental pathochemical characteristic of such diseases. Therefore, the VCAM1 pathway may provide a key intervention point for diseases where activated T cell recruitment is involved, e.g., arthritis, lupus, multiple sclerosis, etc. Therefore, we disclose a therapeutic treatment to inhibit T cell binding to the endothelium by blocking the VCAM1 binding pathway. This may be accomplished by any of the means we describe herein.
  • VCAM1 The DNA sequence of VCAM1 reveals that the molecule has no structural similarity to ELAM1 but is a member of the immunoglobulin supergene family. Three of the Ig superfamily members are established cell-cell adhesion molecules. These are NCAM, CEA, and ICAM1. NCAM binds to itself on the surface of other cells (homotypic adhesion) thus promoting adhesion between cells of the same type. The function of CEA was unknown until recently, when it was discovered to function as an adhesion molecule, mediating homotypic aggregation of colon tumor cells as well as cells transfected with the cDNA for CEA.
  • ICAM1 is a ligand for the leukocyte surface protein, LFA1, and mediates both leukocyte-leukocyte and leukocyte-endothelial cell adhesion.
  • LFA1 leukocyte surface protein
  • ICAM1 and VCAM1 possess some functional similarities, e.g., both are induced in endothelial cells after treatment with cytokines, and both mediate adhesion of lymphocytes and related cell lines.
  • the ligand for ICAM1, LFA-1 has been well-characterized.
  • the ligand for VCAM1 has been identified as VLA4 (see, infra).
  • ICAM1 is believed to play a role not only in the migration of lymphocytes to sites of inflammation in vivo but also in numerous lymphocyte functions related to the immune response. Additionally, ICAM1 has recently been shown to be the receptor for many of the rhinoviruses. Receptors for other viruses (e.g., polio, HIV) are also members of the Ig superfamily. (White and Littman, 1989.) Thus, VCAM1 may play a critical role in both immune regulation and viral infection.
  • CEA has been used as a diagnostic marker for colon cancer for many years. Recent diagnostic techniques include the use of radioimmunoconjugates. in which anti-CEA antibodies are bound to radioactive markers and introduced into the patient. Using this method, clinicians have been able to identify tumors as small as three millimeters. (Goldenberg, 1989.)
  • Radioimmunotherapy involves the use of radioimmunoconjugates in which nuclides such as 125 I, 90 Y, 186 Re and the like are bound to antibodies recognizing a particular surface antigen.
  • Immunotoxins are antibodies conjugated with cell toxins, such as Pseudomonas exotoxin and the like. Upon injection, these conjugated antibodies target the toxic agents to cells expressing the antigen.
  • radioactive markers, nuclides and cellular toxins may be conjugated with VCAM1 and 1b or antibodies recognizing them to target cells expressing VCAM1 ligands (e.g., VLA4) or VCAM1.
  • TILs tumor infiltrating lymphocytes
  • TILs tumor infiltrating lymphocytes
  • modified TIL therapies in which infiltrated leukocyte cells are isolated, transfected for expression of a particular desired gene product, amplified and reintroduced to the patient are contemplated herein.
  • TIL therapy takes advantage of the fact that certain cell types, notably some forms of cancer cells, express ELAMs or MILAs.
  • ELAMs e.g., human monocytes
  • MILAs e.g., human monocytes
  • a therapy can be designed to enhance and improve the cytolytic activity of leukocytes by transfecting them to express surface ELAMs or MILAs, thereby improving their binding to target cells expressing the corresponding ligand.
  • cytolytic activity of a leukocyte cell type is increased as a function of stronger cell-cell adhesion, such a method would improve the ability of leukocytes to destroy targeted cells.
  • leukocytes infiltrating leukocytes, which already have an affinity for the target cancer cell
  • ELAM1 in the case of colon carcinoma
  • VCAM1 or VCAM1b in the case of melanoma
  • Introducing such leukocytes into the patient provides a population of leukocytes capable of homing in on the carcinoma or melanoma cells, respectively, which leukocytes have enhanced ability to adhere to those cells to produce the desired cytolytic effect.
  • VCAM1 expression about one-hundred percent over incubation with TNF alone.
  • Activated T cells secrete IFN- ⁇ , and therefore may promote their own recruitment to inflammatory sites through a positive feedback system: VCAM causes T cell binding, T cells further stimulate VCAM production via IFN- ⁇ secretion.
  • the treatment comprises inhibiting cytokines such as IL-1, TNF or IFN- ⁇ , for example with monoclonal antibodies, to block cytokine-stimulated production of VCAM.
  • MILA MILA
  • CDX a MILA, CDX
  • the isolation involved, as a first step, the production of monoclonal antibodies against the CDX molecule.
  • PMN-related cell line a PMN-related cell line, that was known to bind to ELAM1.
  • MILAs involved in adhesion to other ELAMS one could immunize with any cell line that binds to the appropriate ELAM.
  • isolating VCAM1 we have identified two such cell lines: The B-lymphocyte-like cell line, RAMOS, and the T-lymphocyte-like cell line, JURKAT.
  • hybridomas from spleen cells in a manner well known to the art. (Goding, 1983.) Then we identified those hybridomas that produced monoclonal antibodies against CDX by testing their ability in the adhesion assay to inhibit binding of HL-60 cells to induced HUVECs. We used several of these hybridomas to produce ascites fluid containing monoclonal antibodies.
  • CDX monoclonal antibodies against CDX possess the following characteristics: First, they inhibit binding of HL-60 cells or PMNs to cells that express ELAM1. Second, these antibodies exhibit a specific cell-binding pattern—they recognize cells that bind to ELAM1, but they do not recognize cells that do not bind to ELAM1. Third, they have a recognition pattern for human cell lines that is distinct from the pattern of antibodies against other cell-surface molecules, such as anti-LFA-1, anti-LFA-3, anti-CD44, anti-ICAM, anti-CD4, and anti-Leu8.
  • a 90 kD protein band was sometimes observed in the bound proteins from HL-60 cells and always in the proteins from neutrophils. We believe this 90 kD band represents a CDX degradation product. We also sometimes observed higher molecular weight bands (i.e., around 170 kD). These may be non-specific bands. When the isolated 150 kD protein was treated with N-glycanase, the molecular weight was reduced to approximately 70 kD. When the 150 kD band was treated with N-glycanase and O-glycanase, the molecular weight was not further reduced. We believe this represents the protein core of a very heavily glycosylated protein.
  • 1,3-fucosyl transferases are highly specific enzymes that function in the Golgi apparatus and endoplasmic reticulum to attach fucosyl moieties to appropriate acceptor carbohydrates through a 1,3 glycosidic linkage. The genetic structure of these sequences is consistent with that of other, known glycosyl transferases.
  • CHO cells transfected with clone 7.2 express fucosyl transferase activity.
  • COS 7 cells When COS 7 cells were transfected with either of these two clones, they behaved like cells expressing CDX, that is, they became “visible” to ELAM1 in that they were able to produce a surface glycoprotein to which ELAM1 binds and which are recognized by the ⁇ -CDX monoclonal, SGB 3 B 4 .
  • ⁇ -CDX monoclonals we immunoprecipitated a 130 kD glycoprotein from transfected COS cells, which we have designated Pseudo-X.
  • CHO cells transfected with clone 7.2 also became visible to ELAM1 and ⁇ -CDX. They express a 140 kD glycoprotein which we have designated Pseudo-X 2 .
  • Pseudo-X has a molecular weight of about 130 kD and Pseudo-X 2 of 140 kD.
  • CDX has a molecular weight of 150 kD.
  • Pseudo-X shifts to 110 kD.
  • Pseudo-X 2 shifts to approximately 120 kD.
  • CDX shifts to about 70 kD. Neither migrates at 46 kD or 59 kD, the predicted molecular weights of protein 7.2 and protein 1.
  • Pseudo-X and CDX also have different V8 and chymotrypsin digestion patterns.
  • clone 7.2 and clone 1 as follows: We created a cDNA library from mRNA of a human cell line, HL-60, that expresses CDX. We enriched this library by using subtraction techniques, as we describe below, with a human cell line that does not express CDX, in this case HeLa cells. This produced a subtracted library containing about 2100 clones. We transfected a monkey kidney cell line, COS 7, with the subtracted library which we assayed in a number of ways.
  • CDX-expressing cells are incubated with ⁇ -CDX Moabs and then the Moabs are labeled with, e.g., fluorescently tagged anti-mouse antibody.
  • Cells binding the fluorescent antibodies may then be sorted with a fluorescence activated cell sorter (FACS).
  • FACS fluorescence activated cell sorter
  • the DNA from the sorted cells may be used to transform a bacterial host such as E. coli .
  • DNA from the resulting colonies may then be used to transfect COS 7 cells, and this procedure may be repeated until a single CDX-expressing clone is identified.
  • a third method is to pan the transfected cells as described above on plates coated with recombinant soluble ELAM1 (rsELAM1).
  • rsELAM1 recombinant soluble ELAM1
  • Other soluble ELAMs can similarly be used to isolate cells expressing their ligands or MILAs involved in their adhesion pathways.
  • An expression library may also be created in E. coli .
  • a ⁇ ZAP® (Stratagene)/HL-60 library may be constructed and used to express the inserted DNA in E. coli .
  • the plaques can be directly screened with, e.g., radioactively labeled ⁇ -CDX monoclonals. (Young and Davis, 1983 and Young and Davis, 1984.) The plaques to which the monoclonals bind can be picked and the DNA insert isolated from them.
  • Another method we are using to identify ELAM ligands, not based on antibody recognition, is to transfect COS 7 cells with an appropriate library, that may be subtracted, and then pan them directly onto ELAM-expressing cells (such as induced HUVECS, ELAM-expressing COS 7 cells, or ELAM-expressing CHO cells). Once again, multiple rounds of panning are required to enrich the library sufficiently to isolate the pertinent clones.
  • ELAM-expressing cells such as induced HUVECS, ELAM-expressing COS 7 cells, or ELAM-expressing CHO cells.
  • Another technique for isolating the DNA sequences coding for CDX involves screening a cDNA library with oligonucleotide probes. By purifying a sufficient quantity of CDX, for example by affinity chromatography using immobilized antibody to CDX or immobilized ELAM1, one may determine a partial amino acid sequence and synthesize oligonucleotide probes that correspond to at least a portion of the CDX gene. These probes may then be used to screen the cDNA library. Alternatively, the oligonucleotides may be used as primers to generate long probes to be used in screening the library for CDX (MILA) genes.
  • MILA CDX
  • VCAM1 and VCAM1b have also identified a ligand for VCAM1 and VCAM1b. It is the integrin VLA4.
  • the integrins are a group of cell-extracellular matrix and cell-cell adhesion receptors exhibiting an ⁇ heterodimeric structure.
  • Hynes, 1987; Marcantonio and Hynes, 1988. Investigators have identified three subfamilies of integrins categorized according to the 8 subunit.
  • the VLA (Very Late Antigen) proteins belong to the ⁇ 1 subfamily, many of whose members are specialized for cell-extracellular matrix attachment.
  • VLA4 is expressed in relatively high levels on lymphoid cells (such as B and T cells) and myeloid cells, but is hardly detectable in other cells (Hemler et al., supra.)
  • the binding of B and T cells to the extracellular matrix is mediated by VLA4 and its ligand, human fibronectin (FN).
  • FN human fibronectin
  • ELAM and MILA DNA sequences and molecules in the present invention.
  • ELAMs and MILAs may be used in turn as therapeutic agents to inhibit leukocyte binding to endothelial cells.
  • a soluble form of ELAM soluble ELAM ligand, or fragments of either as binding inhibitors.
  • the ELAM peptides would bind to the ELAM ligand on leukocytes, and the ELAM ligand would bind to ELAM on endothelial cells. Both methods would thereby inhibit leukocyte binding to endothelial cells.
  • To produce recombinant soluble ELAM (rsELAM) or rsELAM ligand one preferably would alter a DNA encoding those molecules to eliminate the transmembrane region.
  • DNAs for soluble molecules would include all or part of the extracellular domain, perhaps attached to the cytoplasmic domain.
  • rsELAM/immunoglobulin fusion proteins will have greater plasma half-life than rsELAM alone.
  • Such fusion proteins are preferably produced with recombinant constructs, fusing a DNA sequence encoding the soluble molecule to a DNA sequence encoding the constant domain of an immunoglobulin molecule.
  • the recombinant DNA may then be expressed in an appropriate host cell, preferably an animal cell, to produce the fusion protein.
  • ELAM/immunoglobulin fusion proteins have another advantage. Because immunoglobulin molecules are normally bivalent (i.e., they have two binding sites) an ELAM/immunoglobulin fusion protein would have two ELAMs and so, two ELAM ligand binding sites. Therefore, one would expect them to have greater affinity or avidity for cells displaying ELAM ligands.
  • ELAMs such as anti-ELAM antibodies, or markers such as the ligand or fragments of it
  • an ELAM binds to its ligand through a carbohydrate moiety or some other post-translational modification, one could use ELAM to identify the carbohydrate on the ELAM ligand to which it bound.
  • ELAMs and MILAs as part of a system to screen small molecules for adhesion inhibitors.
  • LAI leukocyte adhesion inhibitor
  • VCAM/ICAM fusion proteins Sixth, one can generate VCAM/ICAM fusion proteins. We know that both proteins are composed of several structural domains. (Simmons et al., 1988.) DNA sequences encoding various domains of each protein are fused using, for example, the genetic fusion techniques we describe for making ELAM/immunoglobulin fusion proteins. The domains chosen are those having the ability to bind VCAM1 or VCAM1b ligands and ICAM1 ligands, respectively. Domains binding VLA4 and LFA1, the known ligands, are preferable. The polypeptides produced on expression of these DNA sequences are useful because they would block adhesion of any cell having a ligand to either VCAM1 or VCAM1b, or ICAM1 or both.
  • ELAM and ELAM ligand DNA sequences to produce nucleic acid molecules that intervene in ELAM or ELAM ligand expression at the translational level.
  • This approach utilizes antisense nucleic acid and ribozymes to block translation of a specific mRNA, either by masking that mRNA with an antisense nucleic acid or cleaving it with a ribozyme. These methods will be useful in treating inflammatory conditions.
  • Antisense nucleic acids are DNA or RNA molecules that are complementary to at least a portion of a specific mRNA molecule. (See Weintraub, 1990; Marcus-Sekura, 1988.) In the cell, they hybridize to that mRNA, forming a double stranded molecule. The cell does not translate an mRNA in this double-stranded form. Therefore, antisense nucleic acids interfere with the expression of mRNA into protein. Oligomers of about fifteen nucleotides and molecules that hybridize to the AUG initiation codon will be particularly efficient, since they are easy to synthesize and are likely to pose fewer problems than larger molecules when introducing them into ELAM-producing cells. Antisense methods have been used to inhibit the expression of many genes in vitro. (Marcus-Sekura, 1988; Hambor et al., 1988.)
  • Ribozymes are RNA molecules possessing the ability to specifically cleave other single stranded RNA molecules in a manner somewhat analogous to DNA restriction endonucleases. Ribozymes were discovered from the observation that certain mRNAs have the ability to excise their own introns. By modifying the nucleotide sequence of these RNAs, researchers have been able to engineer molecules that recognize specific nucleotide sequences in an RNA molecule and cleave it. (Cech, 1988.) Because they are sequence-specific, only mRNAs with particular sequences are inactivated.
  • Tetrahymena -type ribozymes recognize four-base sequences, while “hammerhead”-type recognize eleven- to eighteen-base sequences. The longer the recognition sequence, the more likely it is to occur exclusively in the target mRNA species. Therefore, hammerhead-type ribozymes are preferable to Tetrahymena -type ribozymes for inactivating a specific mRNA species, and eighteen-base recognition sequences are preferable to shorter recognition sequences.
  • DNA sequences described herein may thus be used to prepare antisense molecules against, and ribozymes that cleave, mRNAs for ELAM1, VCAM1 and VCAM1b, CDX and VLA4.
  • Antisense molecules and ribozymes may be used in methods to treat inflammation by introducing into cells molecules that interfere with the expression of adhesion molecules. Since ELAMs are induced on endothelial cells during inflammatory episodes, and since therapeutic agents can be delivered to vascular endothelium easily by intravenous injection, endothelial cells are attractive targets for such therapies, provided the antisense molecules or ribozymes can be delivered effectively to the appropriate cells.
  • This form of delivery would provide a negative feedback system, since appearance of an ELAM on a cell would make the cell a target for suppression; and successful penetration of the antisense or ribozyme component would halt ELAM production, thereby eliminating the cell as a target.
  • DNA sequences may be expressed by operatively linking them to an expression control sequence in an appropriate expression vector and employing that expression vector to transform an appropriate unicellular host.
  • Such operative linking of a DNA sequence of this invention to an expression control sequence includes, if not already part of the DNA sequence, the provision of an initiation codon, ATG, in the correct reading frame upstream of the DNA sequence.
  • a wide variety of host/expression vector combinations may be employed in expressing the DNA sequences of this invention.
  • Useful expression vectors may consist of segments of chromosomal, non-chromosomal and synthetic DNA sequences.
  • Suitable vectors include derivatives of SV40 and known bacterial plasmids, e.g., E.
  • coli plasmids col E1, PCR1, pBR322, pMB9 and their derivatives, plasmids such as RP4; phage DNAs, e.g., the numerous derivatives of phage A, e.g., NM989, and other phage DNA, e.g., M13 and Filamentous single stranded phage DNA; yeast plasmids such as the 2 ⁇ plasmid or derivatives thereof; vectors useful in eukaryotic cells, such as vectors useful in insect or mammalian cells; vectors derived from combinations of plasmids and phage DNAs, such as plasmids that have been modified to employ phage DNA or other expression control sequences; and the like.
  • phage DNAs e.g., the numerous derivatives of phage A, e.g., NM989, and other phage DNA, e.g., M13 and Filamentous single stranded phag
  • useful expression control sequences include, for example, the early and late promoters of SV40 or adenovirus, the lac system, the trp system, the TAC or TRC system, the major operator and promoter regions of phage ⁇ , the control regions of fd coat protein, the promoter for 3-phosphoglycerate kinase or other glycolytic enzymes, the promoters of acid phosphatase (e.g., PhoS), the promoters of the yeast ⁇ -mating factors, and other sequences known to control the expression of genes of prokaryotic or eukaryotic cells or their viruses, and various combinations thereof.
  • the early and late promoters of SV40 or adenovirus include, for example, the early and late promoters of SV40 or adenovirus, the
  • a wide variety of unicellular host cells are also useful in expressing the DNA sequences of this invention.
  • These hosts may include well known eukaryotic and prokaryotic hosts, such as strains of E. coli, Pseudomonas, Bacillus, Streptomyces , fungi such as yeasts, and animal cells, such as CHO, R1.1, B—W and L-M cells, African Green Monkey kidney cells (e.g., COS 1, COS 7, BSC1, BSC40, and BMT10), insect cells (e.g., Sf9), and human cells and plant cells in tissue culture.
  • E. coli E. coli
  • Pseudomonas Bacillus
  • Streptomyces fungi
  • animal cells such as CHO, R1.1, B—W and L-M cells
  • African Green Monkey kidney cells e.g., COS 1, COS 7, BSC1, BSC40, and BMT10
  • insect cells e.g., Sf9
  • Suitable unicellular hosts will be selected by consideration of, e.g., their compatibility with the chosen vector, their secretion characteristics, their ability to fold proteins correctly, and their fermentation requirements, as well as the toxicity to the host of the product encoded by the DNA sequences to be expressed, and the ease of purification of the expression products.
  • expression of the DNA sequences of the present invention may have different effects in different hosts.
  • expression of clone 7.2 in, e.g., prokaryotic host cells may have no similar effect, since prokaryotes lack internal cell structures (e.g., Golgi apparatus) that may be necessary for the biological functionality of protein 7.2.
  • prokaryotes lack internal cell structures (e.g., Golgi apparatus) that may be necessary for the biological functionality of protein 7.2.
  • host cells in which protein 7.2 does not have a function in the cellular biochemistry such as the catalytic role of a glycosyl transferase
  • the practitioner will be able to select the appropriate host cells and expression mechanisms for a particular purpose.
  • Several strategies are available for the isolation and purification of protein 7.2 and protein 1 after expression in a host system.
  • One method involves expressing the proteins in bacterial cells, lysing the cells, and purifying the protein by conventional means.
  • Colley et al. (1989) describe purifying a sialyltransferase by engineering the cleavable signal peptide of human gamma-interferon onto the DNA sequence for the transferase.
  • Larsen et al. (1990) fused the DNA sequence for protein A to the amino-terminal end of a fucosyl transferase gene and expressed it as an excreted fusion protein.
  • the 1,3-fucosyl transferases of this invention are useful for enzymatic synthesis of carbohydrates in vitro. Specifically, they are useful for catalyzing the linkage of fucose to appropriate acceptors through a 1,3 glycosidic bond.
  • suitable conditions for this catalysis in Example XII, relating to an assay for fucosyl transferase activity.
  • One skilled in the art will recognize other suitable conditions under which the 1,3 fucosyl transferases described herein may be advantageously employed.
  • CDX is important in ELAM1-mediated cell adhesion.
  • a molecule comprising the carbohydrate moiety of CDX, Pseudo-X or Pseudo-X 2 , or a fucose-containing portion of that moiety may be sufficient to function as an ELAM1 ligand.
  • Such molecules may be useful in methods, including therapies, directed to inhibiting ELAM1-mediated cell adhesion.
  • This invention is also directed to small molecules that inhibit the activity of the 1,3-fucosyl transferases described herein, including synthetic organic chemicals, natural fermentation products, peptides, etc. These molecules may be useful in therapies aimed at inhibiting ELAM1-mediated cell adhesion.
  • a test mixture by contacting together an inhibitor candidate, a fucose acceptor and a 1,3-fucosyl transferase.
  • the fucose acceptor is, preferably, LacNAc or 2′-fucosyllactose.
  • the 1,3-fucosyl transferase preferably is derived from an extract from a cell transformed with clone 7.2 or clone 1. Then one assays the test mixture for 1,3-fucosyl transferase activity, such as described in Example XII.
  • the existence of antibodies against ELAM1, VCAM1 and 1b, CDX and VLA4 makes possible another method for isolating other ELAMs and ELAM ligands.
  • the method takes advantage of an antibody characteristic known as idiotypy.
  • Each antibody contains a unique region that is specific for an antigen. This region is called the idiotype.
  • Antibodies, themselves, contain antigenic determinants; the idiotype of an antibody is an antigenic determinant unique to that molecule.
  • Antibodies that recognize them including antibodies that recognize the idiotype.
  • Antibodies that recognize the idiotype of another antibody are called anti-idiotypic antibodies.
  • anti-idiotypic antibodies mimic the shape of the original antigen that the antibody recognizes and are said to bear the “internal image” of the antigen.
  • antigen is a ligand
  • certain anti-idiotypes can bind to that ligand's receptor.
  • Investigators have identified several of these, including anti-idiotypes that bind to receptors for insulin, angiotensin II, adenosine I, ⁇ -adrenalin, and rat brain nicotine and opiate receptors. (Carlsson and Glad, 1989.)
  • ELAMs and ELAM ligands may be isolated using anti-idiotypic antibodies.
  • Anti-idiotypes may be used to screen for molecules binding to the original antigen. For example, one may use this technique to identify other ELAM ligands.
  • HUVECs human umbilical vein endothelial cells
  • Plaque Screens Buffer containing 10% dextran sulfate and 100 ⁇ g/ml yeast tRNA and approximately 1 ⁇ 10 7 cpm of the subtracted IL-1 ⁇ -induced HUVEC cDNA.
  • Plaque Screen® Buffer twice with Plaque Screen® Buffer, twice with 2 ⁇ SSC, 1% SDS, and twice with 1 ⁇ SSC, 1% SDS at 65° C.
  • a clone expressing ELAM1 In a first procedure we isolated from the enriched sublibrary a clone expressing ELAM1. We chose to transfect this sublibrary into a cell line competent for high-level transient expression, the African Green Monkey kidney cell line, COS 7. We plated the cells and transfected the sublibrary by spheroplast fusion. (Sandri-Goldin et al., 1981.) Forty-eight hours after transfection, we assayed the COS 7 cells for expression of ELAM1 by their ability to bind HL-60 cells, a cell line known to bind to endothelial cells stimulated with inflammatory agents.
  • the protein possesses a hydrophobic N-terminal sequence characteristic of a signal sequence. (von Heijne, 1986.) We have not yet determined the signal cleavage site and the mature N-terminus through protein sequencing, however based on von Heijne we predict that the mature N-terminal amino acid will be tryptophan, at nucleotide number 204 in FIG. 1 .
  • the extracellular domain of the polypeptide is approximately 554 amino acids including the signal sequence and is followed by a hydrophobic transmembrane region of 24 amino acids.
  • the protein possesses a short, charged cytoplasmic tail of 32 amino acids. We note that the protein is cysteine-rich and contains eleven potential N-glycosylation sites.
  • ELAM1 When we compared the amino acid sequence of ELAM1 to other proteins in the NBRF and NEW protein data bases we found significant homology with several proteins, including complement C2 precursor, ⁇ -2-glycoprotein I, C4b-binding protein, complement factor B, complement factor H, Drosophila notch protein, the IgE receptor Hepatic lectin, and Coagulation factors IX and X precursors.
  • complement C2 precursor ⁇ -2-glycoprotein I
  • C4b-binding protein complement factor B
  • complement factor H Drosophila notch protein
  • IgE receptor Hepatic lectin the IgE receptor Hepatic lectin
  • Coagulation factors IX and X precursors we can divide ELAM1 into at least three domains based on homology to the above-mentioned proteins: (1) a lectin-like domain (nucleotides 204-563 of FIG.
  • BB11 hybridoma clone
  • BB11 immunoprecipitates proteins with molecular weights of about 110 kD and 96 kD from ELAM1-expressing HUVECs and COS cells, representing variably glycosylated forms of ELAM1.
  • Bevilacqua et al., 1989. It also completely blocked adhesion of HL-60 cells to ELAM1-expressing COS and CHO cells. It produced immunoglobulins of the IgG 2 b class.
  • JURKAT binding was reduced but not completely eliminated at 4° C., and thus JURKAT exhibited both a temperature-sensitive and temperature-insensitive component.
  • Antisera from mice immunized with JURKAT cells inhibited binding from both JURKAT and RAMOS cells to HUVECs, indicating that RAMOS and JURKAT share a MILA.
  • RAMOS nor JURKAT bound to COS or CHO cells expressing ELAM1 indicating the presence of at least one other inducible ELAM on HUVECs, at 4 to 48 hours after induction.
  • plasmids were transfected individually into COS 7 cells, and a plasmid that tested positive for adhesion to RAMOS and JURKAT was identified.
  • the cDNA insert from this plasmid was excised, radioactively labeled, and used to probe a Northern blot according to the procedures of Lehrach (1979).
  • the probe hybridized to an RNA species approximately 3.4 kb in length.
  • the RNA was undetectable in uninduced HUVEC RNA, barely detectable at 5, 10, 30 or 60 minutes after treatment with IL-1 ⁇ , but abundant at 2, 24, 48 and 72 hours after treatment with IL-1 ⁇ .
  • other inflammatory agents such as TNF, LT, LPS, interferons, or combinations of such agents.
  • VCAM1 The protein derived from the cDNA sequence has been designated VCAM1, and the coding sequence has been designated the VCAM1 DNA sequence.
  • VCAM1 The putative amino acid sequence of VCAM1 is also indicated in FIG. 3 .
  • VCAM1b pCDM8 1E11 The entire DNA sequence for the insert of plasmid VCAM1b pCDM8 1E11 by the method of Maxam and Gilbert (1980). This sequence consists of 99 nucleotides of the 5′ untranslated region, 2217 nucleotides encoding 739 amino acids and 764 nucleotides of the 3′ untranslated region including a translational stop codon.
  • VCAM1b the mature protein derived from the cDNA sequence
  • VCAM1b DNA sequence The coding sequence as the VCAM1b DNA sequence.
  • FIG. 4 The cDNA sequence and putative amino acid sequence of VCAM1b in FIG. 4 .
  • VCAM1b contains an insertion of 276 nucleotides near the middle of the coding region. These nucleotides encode 92 additional amino acids which form an extra domain of 84 amino acids situated between the end of VCAM1 domain 3 and the beginning of VCAM1 domain 4. We discuss the significance of this domain, designated VCAM1 domain 3B, below.
  • the VCAM1 polypeptide possesses a hydrophobic N-terminal sequence characteristic of a signal sequence. (von Heijne, 1986.) We have not yet determined the signal cleavage site and the mature N-terminus through protein sequencing, however based on von Heijne we predict that the N-terminal amino acid of the mature protein will be phenylalanine, at nucleotide number 179 in FIG. 3 .
  • the extracellular domain of the polypeptide is approximately 606 amino acids including the signal sequence and is followed by a hydrophobic transmembrane region of 22 amino acids.
  • the protein possesses a short, charged cytoplasmic tail of 19 amino acids. We note that the protein contains six potential N-glycosylation sites.
  • the N-terminal amino acid of the mature VCAM1b protein should be the phenylalanine, at nucleotide number 172 of FIG. 4 .
  • the extracellular domain of the polypeptide, which is longer than VCAM1 is approximately 698 amino acids including the signal sequence and is followed by a hydrophobic transmembrane region of 22 amino acids.
  • the protein possesses a short, charged cytoplasmic tail of 19 amino acids. We note that the protein contains seven potential N-glycosylation sites.
  • NCA non-specific cross-reactive antigen
  • BG1 biliary glycoprotein 1
  • NCAM neural cell adhesion molecule
  • CEA carcinoembryonic antigen
  • TCR T cell receptor alpha and beta chain variable regions
  • MAG myelin associated glycoprotein
  • VCAM1 and 1b and the VCAM1 and 1b DNA sequences show no homology with, and are distinct from, the previously described ELAM1 (supra).
  • NCA, BG1, NCAM, CEA, MAG, and TCR are members of the immunoglobulin gene superfamily.
  • Members of this family are defined by the presence of one or more regions homologous to the basic structural unit of immunoglobulin (Ig) molecules, the Ig homology unit.
  • Ig immunoglobulin
  • These units are characterized by a primary amino acid sequence of about 70-110 residues in length, with an essentially invariant disulfide bridge spanning 50-70 residues, and several other relatively conserved residues involved in establishing a tertiary structure referred to as the “antibody fold”.
  • V, C1, and C2 Williams and Barclay, 1988
  • V, C, and H Haunkapiller and Hood, 1989
  • VCAM1b has seven domains. We have designated the additional domain as domain 3B. This domain is included in the additional 276 nucleotides of VCAM1b that begin at nucleotide 1027 and end at nucleotide 1305 of FIG. 4 .
  • the DNA sequence encompassing domains 1-3 is 72% homologous to the DNA sequence encompassing domains 3B-5. At the polypeptide level, there is significant homology between domains 1 and 3B, 2 and 4, and 3 and 5, respectively.
  • FIGS. 5 and 6 We present the domain structures of VCAM1 and VCAM1b in FIGS. 5 and 6 .
  • VCAM1 and VCAM1b could arise by two mechanisms: They could represent alternately spliced forms of the same gene product, or they could be the products of separate VCAM alleles.
  • VCAM1 and mRNA were prepared from umbilical cords from three different individuals, the cord samples being labeled #1, #2 and #3. Each preparation was split into four separate flasks for treatment with TNF for 0 (untreated), 2.5, 24, and 48 hours. Relative amounts of VCAM1 and VCAM1b mRNA were determined by Northern blotting and probing with synthetic oligonucleotides specific for each form.
  • VCAM1b was clearly the major mRNA present in all three umbilical cord preparations. VCAM1 was present in cords #1 and #3, most prominently at the 2.5 hour induction time-point, although in cord #3 VCAM1 was also present at 24 and 48 hours. Cord #12 cells had little or no VCAM1 mRNA, although amounts of VCAM1b mRNA were comparable to those in HUVECs from cords #1 and #3.
  • VCAM1 VCAM1-binding protein 1
  • Both forms when expressed transiently in COS 7 cells, bound RAMOS cells, and this binding was completely inhibited by Moab 14B9, indicating that the same epitope is relevant to binding in each case. Furthermore, we have shown that this epitope is located within the first three domains, which are common to both forms (see Example VIII, supra).
  • rsELAM1 recombinant soluble ELAM1
  • pSAB108 The rsELAM1 expressed by pSAB108 contains the portion of the extracellular domain of ELAM1 encoded by the DNA sequence of FIG. 1 from nucleotide 141 to nucleotide 1790.
  • pSAB108 To construct pSAB108 we first created a DNA fragment which encoded an rsELAM1. We digested ELAM pCDM8 clone 6 with Mlu I and Not I. This yielded a 3.8 kb DNA fragment including a DNA sequence encoding ELAM1. We subcloned this fragment into Not I-digested pNN11 that had been treated with calf intestinal alkaline phosphatase (described in Example III). We called this vector pNNELAM1.
  • pSV2-DHFR ATCC 37146, from the American Type Culture Collection, Bethesda, Md. (USA). (Subramani et al., 1981.) We digested this with Apa I and Eco RI and isolated the 4420 bp fragment. Then, we produced a synthetic double stranded DNA sequence having an Apa I overhang, a DNA sequence encoding nucleotides +190 to +233 of the human gastrin gene (Sato et al., 1986, FIG. 4 ), an Xho I site, and an Eco RI overhang. We ligated this oligonucleotide with the 4420 bp fragment of pSV2-DHFR and called the resulting plasmid pDT4. We digested this plasmid with Aat II and Xho I and isolated the 4391 bp fragment.
  • rsVCAM1b recombinant soluble VCAM1b
  • This vector was named pBN1006, and the rsVCAM1b expressed by pBN1006 contains the portion of the extracellular domain of VCAM1b encoded by the DNA sequence shown in FIG. 4 from nucleotide 107 to nucleotide 2193.
  • pJOD-s delta Not1 was linearized using Sal I and the 5′ termini were dephosphorylated using calf intestine alkaline phosphatase. The linearized DNA fragment was purified by LMA gel electrophoresis and ligated in the presence of phosphorylated oligonucleotide ACE 175 (5′ pTCGACGCGGCCGCG). The ligation mixture was transformed into E. coli JA221 and colonies were screened for the presence of a Not I site. The correct plasmid was named pMDR901.
  • Soluble VCAM1b was obtained by truncating VCAM1b clone 1E11 at nucleotide 2193 by digestion with Alu I, thus eliminating the transmembrane and intracellular portion as well as the 3′ untranslated region. A stop codon- Not I linker was added, and the insert was religated into pCDM8. The insert was excised from PCDM8 with Not I and ligated into pMDR901 at the Not I site. This construct, designated pBN1006, encodes full length soluble VCAM1b, having amino acids 1-698 as shown in FIG. 4 .
  • a soluble ELAM1 construct designated CH101 was prepared comprising the lectin-like domain of ELAM1.
  • CH101 was the expression product of a cDNA sequence including nucleotides 1-557 (coding for amino acids 1 through 139 of ELAM1) and a stop codon.
  • Another soluble construct designated CH102 was prepared comprising the lectin-like domain and the EGF-like domain of ELAM1.
  • CH102 was the expression product of a cDNA sequence that included nucleotides 1-671 (coding for amino acids 1 through 177 of ELAM1) and a stop codon.
  • the soluble ELAM1 construct CH102 was found to immunoprecipitate the anti-ELAM1 monoclonal antibody, BB11.
  • (A) domain 1 (nucleotides 1-430 of FIG. 3 , coding for amino acids 1-108);
  • VCAM1 constructs B, C, D, E and F (but not A) were immunoprecipitated with the anti-VCAM1 antibody 4B9.
  • Constructs B. D, E and F were also found to produce protein functional for cell adhesion.
  • Conditioned media containing protein encoded by constructs B, D, E and F were concentrated, passed over an immunoaffinity column of immobilized 4B9 antibody, and the bound protein eluted and neutralized as described for rsELAM1.
  • the eluted proteins were immobilized on plastic as described for rsELAM1 and found to support specific adhesion of RAMOS and JURKAT cells.
  • the 5′ flanking region displays a classical promoter structure including TATAAA and CAAT sequences. It also contains the sequence GGGGATTTCC about 95 base pairs upstream from the presumed start of transcription. This sequence is an NF- ⁇ B binding sequence identical to that found in the human ⁇ immunoglobulin (Ig) gene enhancer.
  • NF- ⁇ B is an inducible DNA binding protein known or suspected to stimulate transcription of a number of genes relevant to inflammation and the immune response (such as the immunoglobulins, the interleukin-2 receptor, and ⁇ -interferon, among others). It can be activated by TNF, IL-1, and LPS, the same inducers known to stimulate production of ELAM1, VCAM1, and ICAM1.
  • NF- ⁇ B DNA binding activity is stimulated in endothelial cells by IL-1 and TNF, and we are currently engaged in defining minimal DNA sequences necessary for inducible transcription from the ELAM1 promoter, by transfection of promoter/reporter gene constructs into endothelial and other cell types.
  • CDX a MILA involved in ELAM1-mediated adhesion.
  • monoclonal antibodies that recognized an antigen on the leukocyte cell surface and that interfered with leukocyte-endothelial cell binding.
  • hybridomas for those producing monoclonal antibodies that inhibited the binding of HL-60 cells to IL-1 ⁇ -induced HUVECs. In this way we identified hybridomas that produced monoclonal antibodies that recognized CDX. We used five of these hybridomas to produce ascites fluid. We deposited one of them, designated SGB 3 B 4 , under the Budapest Treaty with In Vitro International, Inc., Linthicum, Md. (USA) on Apr. 25, 1989. It is identified as:
  • Buffer A PBS®, 5% FCS, 0.1% azide
  • the ⁇ -CDX antibodies should inhibit binding of cells expressing CDX to ELAM1-expressing cells.
  • adhesion assay we showed that these monoclonals do indeed inhibit the binding of HL-60 cells and PMNs to IL-1 ⁇ -induced HUVECs and ELAM1-expressing COS 7 cells.
  • a monoclonal antibody against the ⁇ 2 integrin chain the only binding pathway for HL-60 cells and PMNs that is utilized in ELAM1-expressing COS 7 cells is ELAM1 itself. Therefore, antibody inhibition of cell-cell adhesion in this system must be through the ELAM1 pathway via CDX.
  • ⁇ -CDX monoclonals should recognize those cells that bind to ELAM1-expressing cells in an adhesion assay, but should not recognize those cells that do not bind to ELAM1 in this assay.
  • FACS analysis we determined the binding pattern of our Moabs. These monoclonals bound to the following cell types: HL-60, U937, HT-29, THP-1, SW620, SW948, SW1417, monocytes, eosinophils, and PMNs. They did not bind to these cells: RAJI, DAUDI, RAMOS, HeLa, or JY. (We isolated the non-transformed cells by fractionating peripheral blood leukocytes.) This binding pattern precisely parallels the binding of these cells to ELAM1-expressing COS 7 cells and to rsELAM1-coated plates.
  • ⁇ -CDX monoclonals should exhibit a different recognition pattern than monoclonals against other leukocyte cell-surface antigens, such as LFA-1, LFA-3, CD44, ICAM1 and CD4. In fact, no other monoclonal of which we are aware exhibits the same cell-recognition pattern as our antibodies.
  • CDX appeared on the autoradiograph as a single, diffuse band with molecular weight of approximately 150 kD.
  • CDX clone 1 We isolated several long inserts from the HL-60 library, transfected them into COS 7 cells, and selected clones that bound to ELAM1 and ⁇ -CDX. In this way we identified a 2.9 kb insert that could have come from the 3.0 kb message. We called it CDX clone 1.
  • the transfected COS cells also formed rosettes around Sepharose beads coated with recombinant soluble ELAM1 (rsELAM1); and the rosetting was cation dependent and was inhibited by both BB11 (anti-ELAM1 antibody) and ⁇ -CDX.
  • COS cells and CHO cells transfected with PCDM8 alone (without the inserted clone) did not rosette rsELAM1 beads.
  • the COS and CHO cells transfected with clone 7.2 did not rosette to beads coated with bovine serum albumin.
  • Clone 1 encodes a polypeptide of 530 amino acids (encoded by nucleotides. 174-1763 of FIG. 2 ).
  • Clone 7.2 encodes a 405-amino acid polypeptide (encoded by nucleotides 66-1280 in FIG. 1 ).
  • UWGCG Sequence Analysis Software Package version 6.1, August 1989
  • NBRF Protein database release 23, December 1989
  • FASTA FASTA for homology to other proteins.
  • GenBank release 63, March 1990
  • EMBL release 19, May 1989
  • the portion of the nucleotide sequence of clone 7.2 from nucleotide 9 to nucleotide 2162 ( FIG. 9 ) is identical to the portion of the sequence of clone 1 from nucleotide 492 to nucleotide 2645 ( FIG. 10 ).
  • the first methionine of protein 7.2 corresponds to the methionine at amino acid 126 of protein 1.
  • One explanation of this homology is that the two inserts represent different transcripts from the same DNA segment.
  • clone 7.2 and clone 1 encode 1,3-fucosyl transferases that glycosylate other proteins, such as CDX, Pseudo-X and Pseudo-X 2 , in a way that makes them “visible” (i.e., recognized by or able to bind to) ELAM1 or ⁇ -CDX.
  • DNA sequences of clone 1 and clone 7.2 share several structural features with the DNA sequences of known glycosyl transferases.
  • genes encoding known glycosyl transferases commonly have consecutive methionine start sites and are capable of producing more than one mRNA transcript.
  • clone 1 contains two codons that can serve as transcription start signals.
  • the clones have multiple SP1 enhancer sites. The nucleotide sequences for these sites are GGGCGG or CCGCCC; clone 1 has five such sites.
  • clones 7.2 and 1 are rich in guanine (G) and cytosine (C).
  • clone 1 is 75% GC rich in the 5′ region of the gene and 60% GC rich in the 3′ region of the gene.
  • Glycosyl transferases in addition are typically class II membrane proteins, in which the membrane-spanning domain is near the amino terminus and the extracellular portion is near the carboxy terminus.
  • Clone 1 and clone 7.2 encode a polypeptide having a hydrophobic region near the amino terminus.
  • Glycosyl transferases also tend to have molecular weights between 40 kD to 60 kD; clone 1 encodes a polypeptide of about 59 kD and clone 7.2 encodes a polypeptide of about 46 kD.
  • known glycosyl transferases usually have one to three N-glycosylation sites; clone 1 and clone 7.2 both encode two such sites.
  • enzyme assays performed on extracts from CHO cells transfected with clone 7.2 revealed the presence of fucosyl transferases not expressed in untransformed cells.
  • the assays tested the ability of the enzyme to link radioactively labelled fucose to an acceptor molecule.
  • 10 ⁇ acceptor contained, variously, 200 mM LacNAc, Lac-N-biose, or lactose, 250 mM phenyl- ⁇ -D-galactoside, or 50 mM 2′-fucosyllactose.
  • 100 mM LacNAc, Lac-N-biose, or lactose was incubated the assay samples for 1 hour at 37° C.
  • We stopped the reaction by addition of 20 ⁇ l ethanol.
  • the enzyme linked fucose to LacNAc, 2′-fucosyllactose and lactose, acceptors having GlcNAc or glucose moieties with free 3′ hydroxyls. It did not link fucose to LacNBiose, whose GlcNAc moiety does not have a free 3′ hydroxyl, or phenyl- ⁇ -D-galactoside, the negative control acceptor. Control samples from untransfected cells showed only insignificant linking of fucose to these acceptors.
  • Polyclonal antisera were obtained from three mice that had been immunized with whole JURKAT cells.
  • the serum from one mouse completely inhibited both RAMOS and JURKAT binding to 4 hour-induced HUVECs at room temperature.
  • the sera from the two other mice completely inhibited RAMOS but only partially inhibited JURKAT binding under the same conditions.
  • VLA4 is a VCAM1 Ligand
  • VLA4 is a VCAM1 ligand and that VLA4 has separate binding sites for VCAM1 and fibronectin.
  • VLA4 is composed of the subunits ⁇ 1 and ⁇ 4 .
  • B1E11 a monoclonal antibody against ⁇ 1
  • goat anti- ⁇ 1 heteroantiserum completely inhibited the adhesion of RAMOS cells to activated HUVECs and transfected COS cells.
  • a control antibody did not inhibit adhesion.
  • these antibodies inhibited the attachment of the VLA4-expressing T lymphoblastoid cell line HPB-ALL.
  • transfecting cells that do not ordinarily express VLA4 with ⁇ 4 enabled them to bind to VCAM1-expressing cells.
  • K-562 cells transfected with ⁇ 4 were now able to bind with a monolayer of VCAM1-transfected COS cells or TNF-activated HUVECs, but parent K-562 cells and K-562 ⁇ 2 -transfected cells were not.
  • monoclonal antibodies against ⁇ 4 or ⁇ 1 abolished the adhesion of ⁇ 4 -transfected K-562 cells (that normally express the subunit) to these VCAM1-expressing cells.
  • VLA4 mediates cell attachment to human plasma fibronectin (FN) through the FN CS-1 site.
  • FN human plasma fibronectin
  • FN-40 a soluble FN fragment
  • a first assay would test the ability of molecules to inhibit cell-cell adhesion.
  • a second assay would test the ability of a small molecule to inhibit cell binding to ELAM itself.
  • rsELAM1 which works in 96 well microtiter plates. These plates, made of bacteriologic plastic (e.g. Linbro/Titertek #76-232-05®), are incubated with 0.5 ⁇ g per well of rsELAM1 in 50 ⁇ l of 15 mM sodium carbonate/35 mM sodium bicarbonate, pH 9.2, overnight at 40.
  • HL-60 cells 2 ⁇ 10 6 /ml, 50 ⁇ l per well.
  • HL-60 cells bind well to rsELAM1, providing a convenient microassay for screening.
  • rsELAM1 rsELAM1
  • Another alternative assay in this category would examine the binding of a soluble ELAM or ELAM ligand to monolayers of cells stably expressing an ELAM ligand or ELAM, respectively.
  • the soluble molecule would be labeled with a reporter group (e.g., radioactivity, fluorescent probe, enzyme, etc.)
  • This assay tests the ability of a small molecule to inhibit the binding of an ELAM to its ligand.
  • One of the two molecules in soluble form e.g., a soluble ELAM
  • a soluble ELAM is immobilized in the wells of a 96-well microtiter plate, and adhesion is measured by binding of the other member of the pair, e.g., an ELAM ligand labeled with a reporter group.
  • the DNA sequence contains, from 5′ to 3′, VCAM1 domains 1-3 and the constant region of an IgG heavy chain gene.
  • the 3′-5′ primer had the sequence 5′ GA GCT CGA GGC CGC ACC ATG CCT GGG AAG ATG. It is complementary to nucleotides 100-114 in FIG. 3 and contains the VCAM1 initiation codon and recognition sites for Xho I and Not I.
  • the 5′-3′ primer had the sequence 5′ CT AGC TAG CGC GTT TTA CTT CAC. It is complementary to nucleotides 1016-1035 in FIG. 3 , at the end of domain 3, and contains an Nhe I recognition site.
  • Nhe I- Hind III linker having the following sequence: 5 ′ spl ice 5′ CTA GCT TTC CAA GGT GAG TCC TA 3′ 3′ GA AAG GTT CCA CTC AGG ATT CGA 5′
  • IgG heavy chain gene The DNA sequence of an IgG heavy chain gene is described in Ellison et al. (1982).
  • rsVCAM1/IgG fusion protein is expressed using this plasmid.
  • the plasmid is transfected into CHO cells for stable expression. After transcription of this gene, the mRNA is spliced to remove the introns and upon translation, the cell produces rsVCAM-IgG fusion protein.
  • an antisense nucleic acid against VCAM1 and a method for testing its ability to inhibit VCAM1 expression in induced HUVECs.
  • An effective nucleic acid sequence for an antisense nucleic acid is one that is complementary to the coding region of the mRNA and, more particularly, to either the initiation codon, AUG, or the splice sites. (Marcus-Sekura, 1988.) Also, oligomers of about 15 nucleotides are most preferred.
  • an effective antisense nucleic acid against VCAM1 is an oligomer with the DNA sequence 5′ CCC AGG CAT TTT AAG. This would bind to nucleotides 94-108 of FIG. 3 (CAT is the antisense initiation codon.) This DNA sequence is synthesized, for example, by an automated DNA synthesizer.
  • HUVECs are grown to confluence as in Example V except that the serum used for cell growth would be heat inactivated or 30 min. at 60° to inactivate nucleases.
  • Cells are preincubated with the oligomers at concentrations between 10 ⁇ M and 100 ⁇ M, most preferably the highest concentration having no effect on cell viability, for four to forty-eight hours. These ranges are required for effective inhibition. (Marcus-Sekura, 1988; Becker et al., 1989.)
  • the HUVECs are then treated with 10 ng/ml TNF to induce VCAM1. About four hours later the presence of VCAM1 on the surface of the cells is tested by the adhesion assay.
  • a hammerhead-type ribozyme which recognizes VCAM1 mRNA is prepared according to the rules of Haselhoff and Gerlach (1988) as follows. First, a cleavage site on the target mRNA is identified. Hammerhead ribozymes cleave after the sequence 5′ GUX, where X is any nucleotide. The first instance of this sequence in the coding region of VCAM1 mRNA is the sixth codon: 5′ AUG CCU GGG AAG AUG GUC GUG AUC CUU. An appropriate recognition sequence includes about six nucleotides of the 5′ and 3′ regions flanking the cleavage site. An eighteen-base recognition sequence which contains the cleavage site is 5′ AAG AUG GUC GUG AUC CUU.
  • a sequence for the catalytic “hammerhead” is 5′ AAG GAU CAC [CUGAUGAGUCCGUGAGGACGAA] AC CAU CUU.
  • the sequence in brackets generates the catalytic “hammerhead” and the 5′ and 3′ flanking sequences are complementary to and bind to the recognition sequence.
  • U937 cells which are monocyte-like
  • U937 binding is blocked, however, by a monoclonal antibody to CD29, the ⁇ 1 integrin subunit.
  • the new molecule is induced with a time-course similar to VCAM1, remaining at maximal levels 48 hours after induction.

Abstract

Antibodies specific for ELAMs are disclosed.

Description

    TECHNICAL FIELD OF INVENTION
  • This invention relates to molecules involved in the adhesion of leukocytes to endothelial cells during inflammation and to DNA sequences that code on expression for them. More particularly, it relates to Endothelial Cell Adhesion Molecules (ELAMs), including ELAM1 and Vascular Cell Adhesion Molecule 1 and 1b (VCAM1 and VCAM1b). It also relates to molecules on the surface of leukocytes involved in leukocyte adhesion to endothelial cells (MILAs). These include CDX, a molecule involved in the ELAM1 adhesion pathway, and VLA4, the ligand of VCAM1 and VCAM1b. This invention also relates to clone 7.2 and clone 1. These DNA sequences encode protein 7.2 and protein 1, respectively, which are involved in the expression of CDX. These proteins appear to be 1,3-fucosyl transferases that glycosylate CDX. This invention also relates to Pseudo-X and Pseudo-X2, proteins that appear on COS 7 and CHO cells, respectively, that have been transfected with clone 7.2. Cells expressing those proteins bind ELAM1 and are recognized by anti-CDX monoclonal antibodies. This invention further relates to antibodies that recognize these adhesion molecules and anti-idiotype antibodies that recognize both those antibodies and the ligands or receptors for the adhesion molecules. The invention also relates to antisense DNA and RNA molecules complementary to mRNA for such adhesion molecules and also relates to ribozymes which recognize mRNA for such molecules. The invention also relates to methods for using the aforementioned molecules, DNA sequences, antibodies, anti-idiotype antibodies, antisense molecules and ribozymes, for example in developing diagnostic and therapeutic agents to detect or inhibit leukocyte adhesion to endothelial cells.
  • BACKGROUND OF THE INVENTION
  • Inflammation is the response of vascularized tissues to infection or injury. Clinically it is accompanied by four classic signs: redness, heat, pain and swelling. Its course may be acute or chronic.
  • At the cellular level, inflammation involves the adhesion of leukocytes (white blood cells) to the endothelial wall of blood vessels and their infiltration into the surrounding tissues. (Harlan, 1985.) Acute inflammation is characterized by the adhesion and infiltration of polymorphonuclear leukocytes (PMNs). (Harlan, 1987 and Malech and Gallin, 1987.) PMN accumulation in the tissues reaches its peak between two and one half to four hours after an inflammatory stimulus and ceases by about twenty-eight hours. (Bevilacqua and Gimbrone, 1987.) In contrast, chronic inflammation is characterized by the adhesion and infiltration of other leukocytes, especially monocytes and lymphocytes.
  • In normal inflammation, the infiltrating leukocytes phagocytize invading organisms or dead cells, and play a role in tissue repair and the immune response. However, in pathologic inflammation, infiltrating leukocytes can cause serious and sometimes deadly damage. Rheumatoid arthritis and atherosclerosis are examples of chronic inflammatory diseases in which mononuclear leukocytes infiltrate the tissues and cause damage. (Hough and Sokoloff, 1985 and Ross, 1986.) Multiple organ failure syndrome, adult respiratory distress syndrome (ARDS), and ischemic reperfusion injury are acute inflammations in which infiltrating PMNs cause the damage (Harlan, 1987 and Malech and Gallin, 1987). In multiple organ failure syndrome, which can occur after shock such as that associated with severe burns, PMN-mediated damage exacerbates the injury. In ARDS, PMNs cause the lungs to fill with fluid, and the victim may drown. In ischemic reperfusion injury, which occurs when tissue cut off from the supply of blood is suddenly perfused with blood (for example after heart attack, stroke, or limb re-attachment), PMN adhesion causes serious tissue damage (Harlan, 1987).
  • Recognizing that leukocyte infiltration is the cause of much inflammation-related pathology and that leukocyte adhesion is the first step in infiltration, investigators have recently focused attention on the mechanism of leukocyte binding to the endothelial cell surface. Studies show that binding is mediated by cell-surface molecules on both endothelial cells and leukocytes which act as receptor and ligand (Harlan et al., 1987; Dana et al., 1986; and Bevilacqua et al., 1987a).
  • During the course of inflammation, certain inflammatory agents can act on the leukocytes, making them hyperadhesive for endothelium. Known inflammatory agents include leukotriene-B4 (LTB4), complement factor 5a (C5a), and formyl-methionyl-leucyl-phenylalanine (FMLP). These agents activate a group of proteins called LeuCAMs. The LeuCAMs are dimers of the CD11 and CD18 proteins. One of the LeuCAMs, CD11a/CD18 (also called LFA1) binds to a receptor on endothelial cells called ICAM1 (intercellular adhesion molecule 1). (Harlan, 1985 and Dana et al., 1986.) Investigators have shown that monoclonal antibodies (Moabs) to LeuCAMs inhibit PMN adhesion to endothelium both in vitro and in vivo. (Arfors, 1987; Vedder et al., 1988; and Todd, 1989.)
  • Other inflammatory agents act directly on endothelial cells to substantially augment leukocyte adhesion. These agents include the cytokines interleukin-1 (IL-1), lymphotoxin (LT) and tumor necrosis factor (TNF), as well as the bacterial endotoxin, lipopolysaccharide (LPS). For example, IL-1 has been shown to stimulate adhesion of PMNs, monocytes, and the related cell lines HL-60 (PMN-like) and U937 (monocyte-like), to human endothelial cell monolayers. The action is both time-dependent and protein-synthesis dependent. (Bevilacqua et al., 1987a; Bevilacqua et al., 1987b; and Bevilacqua et al., 1985.)
  • Current evidence indicates that these agents induce a group of molecules on the endothelial cell surface called ELAMs (endothelial cell-leukocyte adhesion molecules). To date investigators have identified two of these molecules, intercellular adhesion molecule 1 (ICAM1) and endothelial cell-leukocyte adhesion molecule 1 (ELAM1). (Simmons et al., 1988; Staunton et al., 1988; and Bevilacqua et al., 1987b.) ICAM1 is found on many cell types, and its expression on vascular endothelium is strongly upregulated both in vitro and in vivo by the inflammatory cytokines interleukin-1 (IL-1), tumor necrosis factor-α (TNF), and gamma interferon (IFN-γ). (Pober et al., 1986; Dustin and Springer, 1988; and Cotran and Pober, 1988.)
  • ELAM1 was initially detected and characterized by a monoclonal antibody that partially blocked PMN adhesion to cytokine-treated human umbilical vein endothelial cells (HUVECs). ELAM1 is a 116 kD cell surface glycoprotein rapidly synthesized by HUVECs in response to the inflammatory cytokines IL-1 or TNF, but not IFN-γ. (Bevilacqua et al., 1987b.) Unlike ICAM1, ELAM1 appears to be expressed only in endothelium, and its expression is transient even in the continued presence of cytokine. Like ICAM1, ELAM1 is present at inflammatory sites in vivo. Immunohistologic studies show that it exists at sites of acute, but not chronic, inflammation and is absent from the non-inflamed vessel wall. (Cotran et al., 1986 and Cotran and Pober, 1988.) Therefore, ELAM1 appears to be a major mediator of PMN adhesion to the inflamed vascular wall in vivo. Importantly, the presence of ELAM1 on the cell surface follows the natural course of acute inflammation, appearing a few hours after stimulation and gradually dissipating within a day. (Bevilacqua et al., 1987b.)
  • Indirect evidence suggests that other ELAMs exist. Although inflammatory agents induce binding of PMNs, monocytes, and lymphocytes to endothelium in vitro, Moabs against ELAM1 inhibit only the binding of PMNs and related cells. (Bevilacqua and Gimbrone, 1987.) Furthermore, maximal accumulation of lymphocytes and monocytes at sites of inflammation in vivo occurs at about twenty-four hours, when ELAM1 expression has returned to basal levels. On the basis of such information investigators inferred the presence of other ELAMs that mediate binding of these lymphocytes and monocytes. (Bevilacqua et al., 1987b.) As set forth in detail below, we have characterized and cloned two more ELAMS, designated VCAM1 and VCAM1b, that mediate binding of lymphocytes to endothelial cells. ELAMs accordingly may be regarded as a family of molecules.
  • A growing body of evidence indicates that ELAMs may play important roles in a wide range of pathological states involving cell-cell recognition, including tumor invasion, metastasis and viral infection. (Harlan, 1985; Wallis and Harlan, 1986; Bevilacqua et al., 1987a; and Cotran and Pober, 1988.)
  • The adhesion of leukocytes to cells expressing ELAMs suggests the existence on leukocytes of ELAM ligands. One such molecule is the ICAM1 ligand, lymphocyte function associated antigen 1 (LFA1). LFA1 is one of a trio of heterodimeric molecules known as the 82 integrins or the CD11/18 family. (Dustin et al., 1986; Rothlein et al., 1986; and Marlin and Springer, 1987.) Recent studies show that the ICAM1/LFA1 pathway plays a role in both lymphocyte and polymorphonuclear leukocyte (PMN) adhesion to endothelial cells in vitro. (Dustin and Springer, 1988; Smith et al., 1989.) We report here the isolation of a molecule involved in leukocyte adhesion to endothelial cells (MILA) which may prove to be an ELAM1 ligand. The molecule, designated CDX, is a protein of approximately 150 kD and was isolated from HL-60 cells. Monoclonal antibodies that recognize CDX inhibit the binding of PMNs and HL-60 cells to ELAM1-expressing cells. Furthermore, CDX is present on leukocyte cell types known to adhere to ELAM1 and is absent from leukocyte cell types and other cell types that do not adhere to ELAM1. Thus, CDX is a molecule expressed on certain leukocytes that plays an important role in ELAM1-mediated leukocyte-endothelial cell adhesion. We also report the isolation and sequencing of cDNA encoding molecules involved in CDX expression.
  • We also report the identification of a VCAM1 and VCAM1b ligand, VLA4. (Hemler and Takada, EP 330 506). Antibodies specific for the α4 and β1 subunits of VLA4 completely eliminate binding of VLA4-expressing cells to VCAM1.
  • Because leukocyte adhesion to the vascular wall is the first step in inflammation, therapies directed to preventing this step are attractive for the treatment of pathologic inflammation. Clinicians are already testing, with some success, therapies based on inhibiting leukocyte-mediated adhesion. One such approach involves Moab binding to the leukocyte cell-surface complex, CD11/CD18, to inhibit PMN adhesion. (Arfors et al., 1987; Vedder et al., 1988; and Todd et al., 1989.)
  • We believe that alternative therapies for preventing leukocyte adhesion, based on endothelial cell-mediated binding, and on ELAMs and MILAs (including ELAM ligands), in particular, are more promising. The ELAM system is particularly appealing for two reasons: First, because ELAM expression on endothelial cells is induced rather than constitutive, ELAMs are concentrated at sites of inflammation and are limited in number. This means that adhesion inhibitors need act only locally and, consequently, would be effective at lower doses than inhibitors directed to constitutively expressed molecules. Second, ELAM binding is selective for different leukocyte classes. For example, ELAM1 binds PMNs, and VCAM1 binds lymphocytes. Therefore, these therapies would be specific for certain classes of leukocytes and would not affect the circulation or migration of other leukocyte classes. Furthermore, for the above reasons, such therapies may prove to be cheaper and less toxic.
  • ELAM-based approaches to therapy require, as starting materials, both ELAMs and MILAs in highly purified form, free of normally associated animal proteins. There is also a need for methods to produce these molecules. These and other needs have now been met as described herein, by isolating DNA sequences that code on expression for particular adhesion molecules and by constructing recombinant DNA molecules and expression vehicles for their production.
  • SUMMARY OF THE INVENTION
  • It is the principal object of this invention to provide new means to study, diagnose, prevent and treat inflammation. More particularly, it is an object of this invention to provide molecules involved in leukocyte binding to endothelial cells and to isolate other molecules which are themselves useful in inhibiting the endothelial cell binding of leukocytes.
  • This invention provides DNA sequences that code on expression for endothelial cell-leukocyte adhesion molecules (ELAMs), genomic DNA sequences for ELAMs (including ELAM expression control sequences), recombinant DNA molecules containing these DNA sequences, unicellular hosts transformed with these DNA molecules, processes for producing ELAMs, and ELAM proteins essentially free of normally associated animal proteins. The present invention also provides for antibody preparations reactive for ELAMs.
  • This invention also provides DNA sequences that code on expression for molecules involved in leukocyte adhesion to endothelial cells (MILAs). MILAs will include leukocyte surface molecules that bind directly to ELAMs, i.e., ELAM ligands. Monoclonal antibodies recognizing ELAM ligands can inhibit ELAM/ELAM ligand binding directly. MILAs will also include leukocyte surface molecules that are involved indirectly in adhesion, for example molecules that inhibit ELAM/ELAM ligand binding by interacting with a third molecule, such as a monoclonal antibody. Such molecules may act, for example, by changing the surface conformation of an ELAM ligand so that its affinity for the ELAM is reduced. This invention also provides recombinant DNA molecules containing MILA DNA sequences and unicellular hosts transformed with them. It also provides for MILA proteins essentially free of normally associated animal proteins, methods for producing MILAs, and monoclonal antibodies that recognize MILAs, particularly CDX.
  • This invention provides DNA sequences encoding molecules that cause several cell lines, including COS, CHO and R1.1, both express surface glycoproteins that are recognized by anti-CDX (α-CDX) antibodies and to bind to ELAM1. This invention provides, in particular, clone 7.2 and clone 1, and protein 7.2 and protein 1, respectively. These proteins appear to be 1,3-fucosyl transferases.
  • This invention also provides the glycoproteins, Pseudo-X and Pseudo-X2, which cause COS cells and CHO cells, respectively, to bind ELAM1 and to be recognized by α-CDX antibodies.
  • This invention further provides methods for inhibiting PMN binding to endothelial cells involving the use of ELAMs, MILAs including ELAM ligands, or portions of those molecules to block receptors or ligands. It also relates to the use of antisense nucleic acids and ribozymes to inhibit ELAM expression. The invention also relates to methods for identifying binding inhibitors by screening molecules for their ability to inhibit binding of an ELAM to its ligand. It provides methods for identifying ELAMs and their ligands. One such method involves using anti-idiotypic antibodies against antibodies that recognize ELAMs or ELAM ligands.
  • BRIEF DESCRIPTION OF THE DRAWINGS
  • FIG. 1 depicts the composite ELAM1 cDNA sequence and deduced amino acid sequence derived from the DNA sequences of ELAM pCDM8 clone 6, pSQ148 and pSQ149. The nucleotides are numbered from 1 to 3863. Throughout this application we refer to the coding DNA sequence of this figure as the DNA sequence for ELAM1. We also refer to the molecule comprising the amino acid sequence depicted in this figure as ELAM1.
  • FIG. 2 depicts the DNA sequence of the synthetic polylinker of pNN11.
  • FIG. 3 depicts the sequence of cDNA coding for VCAM1 and the deduced amino acid sequence of VCAM1 derived from AM pCDM8 clone 41. The nucleotides are numbered 1 to 2811. In this application we refer to the coding DNA sequence of this figure as the DNA sequence for VCAM1. We also refer to the molecule comprising the amino acid sequence depicted in this figure as VCAM1.
  • FIG. 4 depicts the sequence of cDNA coding for VCAM1b and the deduced amino acid sequence of VCAM1b derived from VCAM1b pCDM8 clone 1E11. The nucleotides are numbered 1 to 3080. In this application we refer to the coding DNA sequence of this figure as the DNA sequence for VCAM1b. We also refer to the molecule comprising the amino acid sequence depicted in this figure as VCAM1b.
  • FIG. 5 depicts the domain structure of VCAM1. The amino acids are indicated according to the one letter code used by the University of Wisconsin Genetics Computer Group. (Devereux et al., 1984.)
  • FIG. 6 depicts the domain structure of VCAM1b. The amino acids are indicated according to the one letter code used by the University of Wisconsin Genetics Computer Group. (Devereux et al., 1984.)
  • FIG. 7 depicts the DNA sequence of portions of the 5′ untranslated and untranscribed region of ELAM1 derived from clone EL1-07.
  • FIG. 8 depicts the DNA sequence of portions of the 5′ untranslated and untranscribed region of VCAM1 derived from clone VC1-16.
  • FIG. 9 depicts the sequence of cDNA coding for protein 7.2 and the deduced amino acid sequence of protein 7.2 derived from pSQ219 and CDX pCDM8 clone 7.2. The nucleotides are numbered 1-2175. In this application we refer to the coding DNA sequence of this figure as the DNA sequence for clone 7.2. We also refer to the polypeptide comprising the amino acid sequence depicted in this figure as protein 7.2.
  • FIG. 10 depicts the sequence of cDNA coding for protein 1 derived from clone 1. The nucleotides are numbered 1-2861. In this application we refer to the coding DNA sequence of this figure as the DNA sequence for clone 1. We also refer to the polypeptide comprising the amino acid sequence depicted in this figure as protein 1.
  • DETAILED DESCRIPTION OF THE INVENTION
  • In accordance with this detailed description, the following definitions apply:
  • Expression control sequence—A DNA sequence that controls and regulates the transcription and translation of another DNA sequence.
  • Operatively linked—A DNA sequence is operatively linked to an expression control sequence when the expression control sequence controls and regulates the transcription and translation of that DNA sequence. The term “operatively linked” includes having an appropriate start signal (e.g., ATG) in front of the DNA sequence to be expressed and maintaining the correct reading frame to permit expression of the DNA sequence under the control of the expression control sequence and production of the desired product encoded by the DNA sequence. If a gene that one desires to insert into a recombinant DNA molecule does not contain an appropriate start signal, such a start signal can be inserted in front of the gene.
  • Antibody—An immunoglobulin molecule or functional fragment thereof, such as Fab, F(ab′)2 or dAb. An antibody preparation is reactive for a particular antigen when at least a portion of the individual immunoglobulin molecules in the preparation recognize (i.e., bind to) the antigen. An antibody preparation is non-reactive for an antigen when binding of the individual immunoglobulin molecules in the preparation to the antigen is not detectable by commonly used methods.
  • Standard hybridization conditions—salt and temperature conditions substantially equivalent to 5×SSC and 65° C. for both hybridization and wash. Under standard hybridization conditions the DNA sequences of this invention will hybridize to other DNA sequences having sufficient homology, including homologous sequences from different species. It is understood that the stringency of hybridization conditions is a factor in the degree of homology required for hybridization.
  • DNA sequences—The DNA sequences of this invention refer to DNA sequences prepared or isolated using recombinant DNA techniques. These include cDNA sequences, DNA sequences isolated from their native genome, and synthetic DNA sequences. The term as used in the claims is not intended to include naturally occurring DNA sequences as they exist in Nature.
  • ELAM—A molecule expressed on the surface of endothelial cells that mediates adhesion of leukocytes to endothelial cells.
  • MILA—A molecule expressed on the surface of leukocytes that is involved in ELAM-mediated binding to endothelial cells. This includes ELAM ligands, i.e., molecules that bind directly to ELAMs.
  • As described below, we have isolated and sequenced cDNAs from ELAM mRNAs, expressed ELAM molecules in an appropriate host, isolated and sequenced cDNAs encoding MILAs, and isolated and expressed DNA sequences for MILAs.
  • Expression of recombinant DNA molecules according to this invention may involve post-translational modification of a resultant polypeptide by the host cell. For example, in mammalian cells expression might include, among other things, glycosylation, lipidation or phosphorylation of a polypeptide, or cleavage of a signal sequence to produce a “mature” protein. Accordingly, as used herein, the term “protein”, including ELAM, MILA, protein 1, protein 7.2, Pseudo-X and Pseudo-X2 encompass full-length polypeptides and modifications or derivatives thereof, such as glycosylated versions of such polypeptides, mature proteins, polypeptides retaining a signal peptide, truncated polypeptides having comparable biological activity, and the like.
  • ELAMs are expressed on the surface of endothelial cells only during inflammation. We utilized this phenomenon to isolate ELAM cDNAs. We have designated the polypeptides encoded by our cDNA isolates ELAM1, VCAM1 and VCAM1b. The first step involved in the isolation was selection of cells that differentially expressed the ELAM molecules. We chose human umbilical vein endothelial cells because they produce ELAMs when induced by the inflammatory cytokine, IL-1β. However, the practitioner is not limited to this cytokine, to this cell type, or even to human cells in particular. Other mammalian cells, e.g., baboon endothelial cells, are also known to produce ELAMs. (Cotran and Pober, 1988.)
  • The next step was to isolate mRNA from cells expressing ELAMS, in this case, IL-1β-induced HUVECs, and to create a cDNA library from them. Many methods are known for isolating mRNA and for producing cDNA from it. (See, e.g., Gubler and Hoffman, 1983 and Maniatis et al., 1982.)
  • We then inserted the cDNA into an appropriate vector. We chose the eukaryotic expression vector pCDM8, described by Brian Seed. (Seed, 1987.) This plasmid has several advantages including a high copy number in E. coli, a eukaryotic promoter, and high level of expression in transient expression systems such as COS 7 cells. However, several other vector systems are available. (See, e.g., Cate et al., 1986.)
  • After constructing a cDNA library, the next step was to isolate from it clones containing ELAM cDNA sequences. There are currently many ways to isolate cDNA for a differentially expressed mRNA. These include, for example, (1) plus/minus screening with labeled cDNA; (2) production of subtracted cDNA libraries; and (3) screening with subtractive cDNA probes. (Davis, 1986; Sargent, 1987; Davis et al., 1985, Hedrick et al., 1984; and Duguid et al., 1988.) We chose the third technique, screening with subtractive cDNA probes, and produced a cDNA sublibrary enriched for ELAM sequences.
  • As we will describe in more detail below, we produced a subtractive cDNA probe enriched for mRNA produced by cytokine-induced, but not uninduced cells. Then we probed the cytokine-induced cDNA library with the subtracted cDNA probe using techniques well known to the art. This enabled us to isolate clones forming a sublibrary enriched for ELAM sequences.
  • At this point we used two techniques to identify clones that contained cDNA for ELAM sequences. In a first method, we tested clones for expression of ELAM activity in an appropriate eukaryotic expression system. One can use a variety of direct expression techniques, including antibody screening of fusion proteins encoded by cDNA cloned in λGT11 (Young and Davis, 1983; Young and Davis, 1984); or activity assay of oocyte-conditioned media after injection of mRNA from cloned cDNA, or from plasmid or phage DNA carrying SP6/T7 promoters. Alternatively, one can make libraries in plasmid, phage, and cosmid vectors containing a variety of promoter, selection and replication elements. Animal cells may be transfected with the library for transient or stable expression. Transfection can be accomplished by a variety of methods. For transient expression, investigators have used spheroplast fusion, DEAE dextran, and electroporation. For stable expression they have used calcium phosphate, spheroplast fusion, and electroporation. We used COS 7 cells, a transient expression system, transfected by spheroplast fusion. (Aruffo and Seed, 1987.)
  • Until recently, identification of cloned molecules by direct expression has required sensitive assays and has been restricted to lymphokines. However, cDNA cloning of single-chain cell-surface molecules in efficient transient expression vectors (see, e.g., Seed and Aruffo, 1987 and Seed, 1987), either by antibody “panning” technology (Wysocki and Sato, 1978) or by identification of functional molecules by FACS (Yamasaki et al., 1988), has expanded the range of cloned molecules that one can identify by direct expression. We have extended this technology by using an adhesion assay in that an appropriate cell type, expressing the ligand for the cloned molecule, is used to identify that molecule.
  • We detected ELAM expression by testing the ability of transfected cells to bind either the human neutrophil-like cell line, HL-60 (Bevilacqua et al., 1985), or the human B-lymphocyte-like cell line, RAMOS (American Type Culture Collection, ATCC accession no. CRL 1596, human Burkitt lymphoma). We describe this in more detail below. Because the transfected cells were non-human, those producing human ELAM polypeptides did so in substantially purified form and essentially free of normally associated animal proteins. We picked cells that tested positive in this assay, collected the plasmid DNA, and isolated the inserts from them. These inserts contained DNA sequences encoding ELAM1 (selected by adhesion to HL-60 cells) and VCAM1 (selected by adhesion to RAMOS cells).
  • In a second method, we identified cDNA inserts from the enriched sublibrary that hybridized on a Northern blot to a 4 kb band of induced, but not uninduced, mRNA. Two of these inserts contained DNA sequences for ELAM1. Other inserts from the sublibrary encode different induced mRNAs.
  • We isolated a cDNA for another VCAM, VCAM1b, by probing the IL-1β-induced HUVEC cDNA library with a random-primed oligonucleotide 32P-labeled probe derived from the VCAM1 cDNA sequence. VCAM1b is larger than VCAM1.
  • Using the clones identified by these three methods, we determined the sequences of cDNAs for ELAM1 and VCAM1 and 1b. It should be noted that due to the degeneracy of the genetic code, one may alter many of the nucleotides of these sequences and retain DNA sequences that code on expression for an amino acid sequence identical to those encoded by the DNA sequences we have presented in FIGS. 1, 3 and 4. Additionally, DNA sequences for fragments of the ELAM cDNA sequences, or DNA sequences that are substantially homologous to the ELAM cDNA sequences and that themselves encode ELAM polypeptides, would hybridize to the disclosed ELAM cDNA sequence under standard hybridization conditions.
  • From the DNA sequences described above, we deduced the amino acid sequences of ELAM1, VCAM1 and VCAM1b. It should be clear that given the current state of the protein-engineering art, an artisan could make purposeful alterations, insertions or deletions in these amino acid sequences and obtain a variety of molecules having substantially the same biological or immunological activities as those of the molecules we have disclosed herein.
  • We have also isolated genomic DNA sequences, including transcriptional promoters, for the ELAM1 and VCAM1 and 1b genes. We screened a human genomic library with 32P-labeled probes derived from the coding regions of the ELAM1 or VCAM1 DNA sequences. This yielded clones that contained portions of the 5′ untranscribed and untranslated regions of both the ELAM1 and VCAM1 gene.
  • ELAM1 and VCAM1 transcriptional promoters have a number of uses. First, they are useful to construct vectors inducible by cytokines (such as TNF or IL-1), and bacterial lipopolysaccharide (LPS), or any other agent found to induce expression of ELAMs in endothelial cells. Such vectors may be useful, for example, in gene transfer assays, wherein the inducible promoter is positioned so that it drives transcription of a reporter gene such as chloramphenicol acetyltransferase, beta-galactosidase, luciferase, etc. This construct will then be introduced transiently or stably into an appropriate mammalian cell line. Potential inhibitors or stimulators of induction can then be assayed by measuring their effect on induction by any or all of the inducers listed above.
  • We have also isolated a hybridoma producing monoclonal antibodies recognizing ELAM1, designated BB11. We describe its production in Example V, infra.
  • VCAM1 is involved in T and B cell binding to endothelial cells. T cells activated by lectin stimulation or by a specific antigen bind to HUVECs in vitro. This binding is mediated in part by the ICAM/LFA1 pathway, since monoclonal antibodies that bind to an inhibitory epitope on CD18 (the common B chain of LFA1) partially inhibit T cell binding. We found that anti-CD18 and anti-VCAM1 monoclonals completely inhibited binding. Coupled with the observations that humans deficient in CD18 exhibit normal recruitment of lymphocytes to sites of inflammation, and that activated T cells do not recirculate through the lymphatic system (i.e., they will not exit from the blood stream except at sites of inflammation), this implies that VCAM1 is central to activated T cell migration in vivo. Thus, VCAM1 serves to focus all activated T cells into an inflammatory site. Since the presence of activated T cells is the hallmark of numerous inflammatory and autoimmune diseases, this in turn implies that inappropriate expression of VCAM1 might be the fundamental pathochemical characteristic of such diseases. Therefore, the VCAM1 pathway may provide a key intervention point for diseases where activated T cell recruitment is involved, e.g., arthritis, lupus, multiple sclerosis, etc. Therefore, we disclose a therapeutic treatment to inhibit T cell binding to the endothelium by blocking the VCAM1 binding pathway. This may be accomplished by any of the means we describe herein.
  • The DNA sequence of VCAM1 reveals that the molecule has no structural similarity to ELAM1 but is a member of the immunoglobulin supergene family. Three of the Ig superfamily members are established cell-cell adhesion molecules. These are NCAM, CEA, and ICAM1. NCAM binds to itself on the surface of other cells (homotypic adhesion) thus promoting adhesion between cells of the same type. The function of CEA was unknown until recently, when it was discovered to function as an adhesion molecule, mediating homotypic aggregation of colon tumor cells as well as cells transfected with the cDNA for CEA. (Benchimol et al., 1989.) ICAM1 is a ligand for the leukocyte surface protein, LFA1, and mediates both leukocyte-leukocyte and leukocyte-endothelial cell adhesion. (Staunton et al., 1988.) ICAM1 and VCAM1 possess some functional similarities, e.g., both are induced in endothelial cells after treatment with cytokines, and both mediate adhesion of lymphocytes and related cell lines. The ligand for ICAM1, LFA-1, has been well-characterized. The ligand for VCAM1 has been identified as VLA4 (see, infra). ICAM1 is believed to play a role not only in the migration of lymphocytes to sites of inflammation in vivo but also in numerous lymphocyte functions related to the immune response. Additionally, ICAM1 has recently been shown to be the receptor for many of the rhinoviruses. Receptors for other viruses (e.g., polio, HIV) are also members of the Ig superfamily. (White and Littman, 1989.) Thus, VCAM1 may play a critical role in both immune regulation and viral infection.
  • Both CEA and ICAM1 are expressed on tumor cells. CEA has been used as a diagnostic marker for colon cancer for many years. Recent diagnostic techniques include the use of radioimmunoconjugates. in which anti-CEA antibodies are bound to radioactive markers and introduced into the patient. Using this method, clinicians have been able to identify tumors as small as three millimeters. (Goldenberg, 1989.)
  • Investigators are also exploring radioimmunotherapy and immunotoxin therapy. Radioimmunotherapy involves the use of radioimmunoconjugates in which nuclides such as 125I, 90Y, 186Re and the like are bound to antibodies recognizing a particular surface antigen. Immunotoxins are antibodies conjugated with cell toxins, such as Pseudomonas exotoxin and the like. Upon injection, these conjugated antibodies target the toxic agents to cells expressing the antigen. In accordance with this invention, radioactive markers, nuclides and cellular toxins may be conjugated with VCAM1 and 1b or antibodies recognizing them to target cells expressing VCAM1 ligands (e.g., VLA4) or VCAM1.
  • The discovery of new ELAMs or the future discovery of ELAMs or MILAs being expressed on other cells, such a tumor cells, also makes possible new TIL therapies. For example, where a tumor is discovered which expresses an ELAM on its surface, the tumor can be biopsied and infiltrated lymphocytes can be removed. A gene for a tumorcidal agent, such as TNF in a retroviral expression vector, is then used to transfect the tumor infiltrating lymphocytes (TILs), which are then expanded with IL-2. When the transfected TILs are injected back into the patient, the TILs are specifically directed to the original tumor and migrate back into the tumor, where the tumorcidal gene product is released for local effect. (See, Thomas and Sikora, 1989.) Since all ELAMs bind some form of leukocyte and thereby mediate infiltration, modified TIL therapies in which infiltrated leukocyte cells are isolated, transfected for expression of a particular desired gene product, amplified and reintroduced to the patient are contemplated herein.
  • An alternative TIL therapy takes advantage of the fact that certain cell types, notably some forms of cancer cells, express ELAMs or MILAs. For example, colon carcinomas are known to express CDX and melanomas express VLA4.
  • Employing the DNA sequences disclosed herein, a therapy can be designed to enhance and improve the cytolytic activity of leukocytes by transfecting them to express surface ELAMs or MILAs, thereby improving their binding to target cells expressing the corresponding ligand. Where the cytolytic activity of a leukocyte cell type is increased as a function of stronger cell-cell adhesion, such a method would improve the ability of leukocytes to destroy targeted cells. For example, in the case of colon carcinoma or melanoma, leukocytes (preferably infiltrating leukocytes, which already have an affinity for the target cancer cell) may be transfected with an expression vector including a gene for ELAM1 (in the case of colon carcinoma) or VCAM1 or VCAM1b (in the case of melanoma). Introducing such leukocytes into the patient provides a population of leukocytes capable of homing in on the carcinoma or melanoma cells, respectively, which leukocytes have enhanced ability to adhere to those cells to produce the desired cytolytic effect.
  • We have also found that incubating HUVECs with TNF and IFN-γ together increases VCAM1 expression about one-hundred percent over incubation with TNF alone. Activated T cells secrete IFN-γ, and therefore may promote their own recruitment to inflammatory sites through a positive feedback system: VCAM causes T cell binding, T cells further stimulate VCAM production via IFN-γ secretion. Thus, we have devised a new treatment for VCAM-dependent pathologies which involves inhibition of this feedback mechanism. The treatment comprises inhibiting cytokines such as IL-1, TNF or IFN-γ, for example with monoclonal antibodies, to block cytokine-stimulated production of VCAM.
  • We have also isolated a MILA, CDX, that is involved in ELAM1-mediated adhesion and, in fact, is probably the (or an) ELAM1 ligand. The isolation involved, as a first step, the production of monoclonal antibodies against the CDX molecule. We immunized mice with whole HL-60 cells, a PMN-related cell line, that was known to bind to ELAM1. Alternatively, one could immunize with any cell line that binds to ELAM1, including PMNs themselves and, as we shall show, U937 cells. In addition, to isolate MILAs involved in adhesion to other ELAMS, one could immunize with any cell line that binds to the appropriate ELAM. For example, in isolating VCAM1, we have identified two such cell lines: The B-lymphocyte-like cell line, RAMOS, and the T-lymphocyte-like cell line, JURKAT.
  • After finding that immune serum from the immunized mice inhibited binding of HL-60 cells to HUVECs in the adhesion assay we will describe, we created hybridomas from spleen cells in a manner well known to the art. (Goding, 1983.) Then we identified those hybridomas that produced monoclonal antibodies against CDX by testing their ability in the adhesion assay to inhibit binding of HL-60 cells to induced HUVECs. We used several of these hybridomas to produce ascites fluid containing monoclonal antibodies.
  • One can also generate monoclonal Fab fragments recognizing these antigens using the technique of Huse et al. (1989). (See also Skerra and Pluckthun, 1988.) Alternatively, one can produce single domain antibodies as described by Ward et al. (1989).
  • Our monoclonal antibodies against CDX possess the following characteristics: First, they inhibit binding of HL-60 cells or PMNs to cells that express ELAM1. Second, these antibodies exhibit a specific cell-binding pattern—they recognize cells that bind to ELAM1, but they do not recognize cells that do not bind to ELAM1. Third, they have a recognition pattern for human cell lines that is distinct from the pattern of antibodies against other cell-surface molecules, such as anti-LFA-1, anti-LFA-3, anti-CD44, anti-ICAM, anti-CD4, and anti-Leu8.
  • We used these Moabs to isolate CDX. We radioactively labeled HL-60 surface proteins and surface proteins from neutrophils (isolated from human blood) with iodine using a modification of a method described by Kurzinger (Kurzinger et al., 1981) or metabolically with 35S-methionine. We solubilized the membrane proteins and incubated them with an anti-CDX monoclonal bound through a μ-chain-specific rabbit anti-mouse IgG to Protein A sepharose (ARX), and then we isolated the antibody-bound protein. This protein is CDX isolated substantially free of normally associated animal proteins. The protein appears on SDS-PAGE as a single, diffuse band of about 150 kD. A 90 kD protein band was sometimes observed in the bound proteins from HL-60 cells and always in the proteins from neutrophils. We believe this 90 kD band represents a CDX degradation product. We also sometimes observed higher molecular weight bands (i.e., around 170 kD). These may be non-specific bands. When the isolated 150 kD protein was treated with N-glycanase, the molecular weight was reduced to approximately 70 kD. When the 150 kD band was treated with N-glycanase and O-glycanase, the molecular weight was not further reduced. We believe this represents the protein core of a very heavily glycosylated protein.
  • We have isolated two DNA sequences, clone 7.2 and clone 1, that appear to encode 1,3-fucosyl transferases that glycosylate the CDX polypeptide and impart to it the ability to bind ELAM1. 1,3-fucosyl transferases are highly specific enzymes that function in the Golgi apparatus and endoplasmic reticulum to attach fucosyl moieties to appropriate acceptor carbohydrates through a 1,3 glycosidic linkage. The genetic structure of these sequences is consistent with that of other, known glycosyl transferases. Furthermore, CHO cells transfected with clone 7.2 express fucosyl transferase activity.
  • Several 1,3-fucosyl transferases are known to the art. (Paulson and Colley, 1989 and Kukowska-Latallo et al., 1990.) These proteins of similar activity share little sequence homology between themselves or other glycosyl transferases. (Paulson and Colley, 1989 and Kukowska-Latallo et al., 1990.) Therefore, we would not expect these DNA sequences to share homology with the DNA sequences of this invention. However, other species are likely to contain homologous genes that share significant sequence homology with the DNA sequences disclosed here. One can isolate these homologous genes using the DNA sequences of this invention as probes under standard hybridization conditions. This invention specifically contemplates and encompasses such sequences.
  • When COS 7 cells were transfected with either of these two clones, they behaved like cells expressing CDX, that is, they became “visible” to ELAM1 in that they were able to produce a surface glycoprotein to which ELAM1 binds and which are recognized by the α-CDX monoclonal, SGB3B4. Using α-CDX monoclonals, we immunoprecipitated a 130 kD glycoprotein from transfected COS cells, which we have designated Pseudo-X. Similarly, CHO cells transfected with clone 7.2 also became visible to ELAM1 and α-CDX. They express a 140 kD glycoprotein which we have designated Pseudo-X2.
  • Neither Pseudo-X nor Pseudo-X2 are CDX. Pseudo-X has a molecular weight of about 130 kD and Pseudo-X2 of 140 kD. CDX has a molecular weight of 150 kD. When treated with N-glycanase or hydrofluoric acid (which removes all carbohydrate), Pseudo-X shifts to 110 kD. Pseudo-X2 shifts to approximately 120 kD. CDX shifts to about 70 kD. Neither migrates at 46 kD or 59 kD, the predicted molecular weights of protein 7.2 and protein 1. Pseudo-X and CDX also have different V8 and chymotrypsin digestion patterns.
  • We isolated clone 7.2 and clone 1 as follows: We created a cDNA library from mRNA of a human cell line, HL-60, that expresses CDX. We enriched this library by using subtraction techniques, as we describe below, with a human cell line that does not express CDX, in this case HeLa cells. This produced a subtracted library containing about 2100 clones. We transfected a monkey kidney cell line, COS 7, with the subtracted library which we assayed in a number of ways.
  • We incubated the transfected cells with the α-CDX monoclonal antibodies and panned them on plates coated with anti-mouse IgG or IgM (Wysocki and Sato, 1978); cells binding to the plates would be those expressing a molecule recognized by α-CDX Moabs. In this manner, we identified adherent cells transfected with a 2.1 kb DNA insert. We subcloned a portion of this sequence into a sequencing vector and designated it pSQ219. The DNA insert in the pCDM8 clone was designated clone 7.2. We also isolated a 2.9 kb insert by hybridization, which we designated clone 1. These two clones encode protein 7.2 and protein 1, respectively.
  • We are also isolating a DNA sequence that codes on expression for CDX using techniques known to the art. Some practical techniques involve using expression systems to express cloned DNA. As we have mentioned, a variety of eukaryotic expression systems are available.
  • One can isolate a DNA sequence encoding CDX using antibodies that recognize the CDX polypeptide, rather than the CDX glycoprotein. These antibodies are used to probe an HL-60 cDNA library like the one we described above.
  • Another method for isolating a DNA sequence encoding CDX (or another MILA) would employ fluorescent-antibody labeling. In this method, CDX-expressing cells are incubated with α-CDX Moabs and then the Moabs are labeled with, e.g., fluorescently tagged anti-mouse antibody. Cells binding the fluorescent antibodies may then be sorted with a fluorescence activated cell sorter (FACS). The DNA from the sorted cells may be used to transform a bacterial host such as E. coli. DNA from the resulting colonies may then be used to transfect COS 7 cells, and this procedure may be repeated until a single CDX-expressing clone is identified.
  • A third method is to pan the transfected cells as described above on plates coated with recombinant soluble ELAM1 (rsELAM1). We describe a method to coat plates with rsELAM1 in Example VIII. Cells binding to the plates will be those expressing CDX. Other soluble ELAMs can similarly be used to isolate cells expressing their ligands or MILAs involved in their adhesion pathways.
  • An expression library may also be created in E. coli. For example, a λ ZAP® (Stratagene)/HL-60 library may be constructed and used to express the inserted DNA in E. coli. After plating, the plaques can be directly screened with, e.g., radioactively labeled α-CDX monoclonals. (Young and Davis, 1983 and Young and Davis, 1984.) The plaques to which the monoclonals bind can be picked and the DNA insert isolated from them.
  • Another method we are using to identify ELAM ligands, not based on antibody recognition, is to transfect COS 7 cells with an appropriate library, that may be subtracted, and then pan them directly onto ELAM-expressing cells (such as induced HUVECS, ELAM-expressing COS 7 cells, or ELAM-expressing CHO cells). Once again, multiple rounds of panning are required to enrich the library sufficiently to isolate the pertinent clones.
  • Another technique for isolating the DNA sequences coding for CDX (or other MILAS) involves screening a cDNA library with oligonucleotide probes. By purifying a sufficient quantity of CDX, for example by affinity chromatography using immobilized antibody to CDX or immobilized ELAM1, one may determine a partial amino acid sequence and synthesize oligonucleotide probes that correspond to at least a portion of the CDX gene. These probes may then be used to screen the cDNA library. Alternatively, the oligonucleotides may be used as primers to generate long probes to be used in screening the library for CDX (MILA) genes.
  • We have also identified a ligand for VCAM1 and VCAM1b. It is the integrin VLA4. (Hemler, 1988; Hemler et al., 1987a; and Hemler et al., 1987b.) The integrins are a group of cell-extracellular matrix and cell-cell adhesion receptors exhibiting an αβ heterodimeric structure. (Hynes, 1987; Marcantonio and Hynes, 1988.) Investigators have identified three subfamilies of integrins categorized according to the 8 subunit. The VLA (Very Late Antigen) proteins belong to the β1 subfamily, many of whose members are specialized for cell-extracellular matrix attachment. (Hynes, 1987 and Ruoslahti, 1988.) VLA4 is expressed in relatively high levels on lymphoid cells (such as B and T cells) and myeloid cells, but is hardly detectable in other cells (Hemler et al., supra.) The binding of B and T cells to the extracellular matrix is mediated by VLA4 and its ligand, human fibronectin (FN). (Wayner et al., 198′.) The discovery that VLA4 is a ligand for VCAM1 is important because it now defines one binding pathway of B and T lymphocytes to activated endothelial cells. Therefore, we describe the use of VLA4 and VCAM1 and 1b as ligand and receptor in the methods described below.
  • We contemplate several uses for ELAM and MILA DNA sequences and molecules in the present invention. First, one may use ELAMs and MILAs to produce monoclonal antibody preparations that are reactive for these molecules. The Moabs may be used in turn as therapeutic agents to inhibit leukocyte binding to endothelial cells.
  • Second, one may use a soluble form of ELAM, soluble ELAM ligand, or fragments of either as binding inhibitors. The ELAM peptides would bind to the ELAM ligand on leukocytes, and the ELAM ligand would bind to ELAM on endothelial cells. Both methods would thereby inhibit leukocyte binding to endothelial cells. To produce recombinant soluble ELAM (rsELAM) or rsELAM ligand one preferably would alter a DNA encoding those molecules to eliminate the transmembrane region. Thus, DNAs for soluble molecules would include all or part of the extracellular domain, perhaps attached to the cytoplasmic domain. This approach has already been validated using soluble CD4, the surface protein on T-cells that binds to the AIDS virus. (Fisher et al., 1988.) This approach also avoids the problems of antibody therapy, since the polypeptides used would be less likely to induce an immune response.
  • One problem investigators have encountered with soluble recombinant molecules is a short in vivo plasma half-life. (Capon et al., 1989.) Because such molecules are quickly cleared from the system, large doses or frequent injections are necessary to have a therapeutic effect. Therefore, investigators have sought methods to increase the half-life of soluble molecules. A potential solution is to link the soluble molecule to another molecule known to have a longer half-life in the blood stream. Due to their long half life, immunoglobulin molecules are promising candidates. Capon et al. (1989) have described the linking of soluble CD4 to an immunoglobulin molecule using recombinant DNA techniques. In this approach, one replaces the variable region of an immunoglobulin molecule with the soluble protein, forming a protein/immunoglobulin fusion protein.
  • It is expected that the rsELAM/immunoglobulin fusion proteins will have greater plasma half-life than rsELAM alone. Such fusion proteins are preferably produced with recombinant constructs, fusing a DNA sequence encoding the soluble molecule to a DNA sequence encoding the constant domain of an immunoglobulin molecule. The recombinant DNA may then be expressed in an appropriate host cell, preferably an animal cell, to produce the fusion protein.
  • We expect ELAM/immunoglobulin fusion proteins to have another advantage. Because immunoglobulin molecules are normally bivalent (i.e., they have two binding sites) an ELAM/immunoglobulin fusion protein would have two ELAMs and so, two ELAM ligand binding sites. Therefore, one would expect them to have greater affinity or avidity for cells displaying ELAM ligands.
  • Third, one may use molecules binding to ELAMs (such as anti-ELAM antibodies, or markers such as the ligand or fragments of it) to detect inflammation. This involves, for example, making a molecule detectable by fluorescence or radioactivity, administering it to a patient and determining where in the body it accumulates. In this way one could also identify the type of inflammation. For example, binding to ELAM1 would indicate acute, as opposed to chronic inflammation.
  • Fourth, if an ELAM binds to its ligand through a carbohydrate moiety or some other post-translational modification, one could use ELAM to identify the carbohydrate on the ELAM ligand to which it bound.
  • Fifth, one could use ELAMs and MILAs as part of a system to screen small molecules for adhesion inhibitors. For example, one could create an assay system in which small molecules are tested for the ability to inhibit the interaction between CDX and ELAM1. Small molecule inhibitors identified in this way would provide candidates for anti-inflammatory drugs.
  • Sixth, one could use these molecules to identify endogenous proteins that inhibit leukocyte binding to ELAMs. Investigators have tentatively identified one such molecule, leukocyte adhesion inhibitor (LAI), that is involved in detaching bound PMNs from endothelium. (Wheeler et al., 1988.)
  • Seventh, one can generate VCAM/ICAM fusion proteins. We know that both proteins are composed of several structural domains. (Simmons et al., 1988.) DNA sequences encoding various domains of each protein are fused using, for example, the genetic fusion techniques we describe for making ELAM/immunoglobulin fusion proteins. The domains chosen are those having the ability to bind VCAM1 or VCAM1b ligands and ICAM1 ligands, respectively. Domains binding VLA4 and LFA1, the known ligands, are preferable. The polypeptides produced on expression of these DNA sequences are useful because they would block adhesion of any cell having a ligand to either VCAM1 or VCAM1b, or ICAM1 or both.
  • Finally, one could use ELAM and ELAM ligand DNA sequences to produce nucleic acid molecules that intervene in ELAM or ELAM ligand expression at the translational level. This approach utilizes antisense nucleic acid and ribozymes to block translation of a specific mRNA, either by masking that mRNA with an antisense nucleic acid or cleaving it with a ribozyme. These methods will be useful in treating inflammatory conditions.
  • Antisense nucleic acids are DNA or RNA molecules that are complementary to at least a portion of a specific mRNA molecule. (See Weintraub, 1990; Marcus-Sekura, 1988.) In the cell, they hybridize to that mRNA, forming a double stranded molecule. The cell does not translate an mRNA in this double-stranded form. Therefore, antisense nucleic acids interfere with the expression of mRNA into protein. Oligomers of about fifteen nucleotides and molecules that hybridize to the AUG initiation codon will be particularly efficient, since they are easy to synthesize and are likely to pose fewer problems than larger molecules when introducing them into ELAM-producing cells. Antisense methods have been used to inhibit the expression of many genes in vitro. (Marcus-Sekura, 1988; Hambor et al., 1988.)
  • Ribozymes are RNA molecules possessing the ability to specifically cleave other single stranded RNA molecules in a manner somewhat analogous to DNA restriction endonucleases. Ribozymes were discovered from the observation that certain mRNAs have the ability to excise their own introns. By modifying the nucleotide sequence of these RNAs, researchers have been able to engineer molecules that recognize specific nucleotide sequences in an RNA molecule and cleave it. (Cech, 1988.) Because they are sequence-specific, only mRNAs with particular sequences are inactivated.
  • Investigators have identified two types of ribozymes, Tetrahymena-type and “hammerhead”-type. (Hasselhoff and Gerlach, 1988.) Tetrahymena-type ribozymes recognize four-base sequences, while “hammerhead”-type recognize eleven- to eighteen-base sequences. The longer the recognition sequence, the more likely it is to occur exclusively in the target mRNA species. Therefore, hammerhead-type ribozymes are preferable to Tetrahymena-type ribozymes for inactivating a specific mRNA species, and eighteen-base recognition sequences are preferable to shorter recognition sequences.
  • The DNA sequences described herein may thus be used to prepare antisense molecules against, and ribozymes that cleave, mRNAs for ELAM1, VCAM1 and VCAM1b, CDX and VLA4.
  • Antisense molecules and ribozymes may be used in methods to treat inflammation by introducing into cells molecules that interfere with the expression of adhesion molecules. Since ELAMs are induced on endothelial cells during inflammatory episodes, and since therapeutic agents can be delivered to vascular endothelium easily by intravenous injection, endothelial cells are attractive targets for such therapies, provided the antisense molecules or ribozymes can be delivered effectively to the appropriate cells.
  • Investigators have suggested two approaches which could be used to deliver these molecules to target cells. The first involves transfecting the target cell with a vector that expresses the anti-ELAM antisense nucleic acid or the ELAM-specific ribozyme as an mRNA molecule. (Hambor et al., supra.) While this approach is very useful when dealing with cell lines in vitro, it may not be as effective in vivo. A second approach that is more promising for in vivo delivery involves loading liposomes with anti-ELAM antisense molecules, ELAM-specific ribozymes or vectors which express them. These liposomes could also contain anti-ELAM monoclonal antibodies to direct the liposome to sites of inflammation. This form of delivery would provide a negative feedback system, since appearance of an ELAM on a cell would make the cell a target for suppression; and successful penetration of the antisense or ribozyme component would halt ELAM production, thereby eliminating the cell as a target.
  • Another feature of this invention is the expression of the ELAM, MILA and other DNA sequences disclosed herein. As is well known in the art, DNA sequences may be expressed by operatively linking them to an expression control sequence in an appropriate expression vector and employing that expression vector to transform an appropriate unicellular host.
  • Such operative linking of a DNA sequence of this invention to an expression control sequence, of course, includes, if not already part of the DNA sequence, the provision of an initiation codon, ATG, in the correct reading frame upstream of the DNA sequence.
  • A wide variety of host/expression vector combinations may be employed in expressing the DNA sequences of this invention. Useful expression vectors, for example, may consist of segments of chromosomal, non-chromosomal and synthetic DNA sequences. Suitable vectors include derivatives of SV40 and known bacterial plasmids, e.g., E. coli plasmids col E1, PCR1, pBR322, pMB9 and their derivatives, plasmids such as RP4; phage DNAs, e.g., the numerous derivatives of phage A, e.g., NM989, and other phage DNA, e.g., M13 and Filamentous single stranded phage DNA; yeast plasmids such as the 2μ plasmid or derivatives thereof; vectors useful in eukaryotic cells, such as vectors useful in insect or mammalian cells; vectors derived from combinations of plasmids and phage DNAs, such as plasmids that have been modified to employ phage DNA or other expression control sequences; and the like.
  • Any of a wide variety of expression control sequences—sequences that control the expression of a DNA sequence operatively linked to it—may be used in these vectors to express the DNA sequences of this invention. Such useful expression control sequences include, for example, the early and late promoters of SV40 or adenovirus, the lac system, the trp system, the TAC or TRC system, the major operator and promoter regions of phage λ, the control regions of fd coat protein, the promoter for 3-phosphoglycerate kinase or other glycolytic enzymes, the promoters of acid phosphatase (e.g., PhoS), the promoters of the yeast α-mating factors, and other sequences known to control the expression of genes of prokaryotic or eukaryotic cells or their viruses, and various combinations thereof.
  • A wide variety of unicellular host cells are also useful in expressing the DNA sequences of this invention. These hosts may include well known eukaryotic and prokaryotic hosts, such as strains of E. coli, Pseudomonas, Bacillus, Streptomyces, fungi such as yeasts, and animal cells, such as CHO, R1.1, B—W and L-M cells, African Green Monkey kidney cells (e.g., COS 1, COS 7, BSC1, BSC40, and BMT10), insect cells (e.g., Sf9), and human cells and plant cells in tissue culture.
  • It will be understood that not all vectors, expression control sequences and hosts will function equally well to express the DNA sequences of this invention. Neither will all hosts function equally well with the same expression system. However, one skilled in the art will be able to select the proper vectors, expression control sequences, and hosts without undue experimentation to accomplish the desired expression without departing from the scope of this invention. For example, in selecting a vector, the host must be considered because the vector must function in it. The vector's copy number, the ability to control that copy number, and the expression of any other proteins encoded by the vector, such as antibiotic markers, will also be considered.
  • In selecting an expression control sequence, a variety of factors will normally be considered. These include, for example, the relative strength of the system, its controllability, and its compatibility with the particular DNA sequence or gene to be expressed, particularly as regards potential secondary structures. Suitable unicellular hosts will be selected by consideration of, e.g., their compatibility with the chosen vector, their secretion characteristics, their ability to fold proteins correctly, and their fermentation requirements, as well as the toxicity to the host of the product encoded by the DNA sequences to be expressed, and the ease of purification of the expression products.
  • It will also be recognized that expression of the DNA sequences of the present invention may have different effects in different hosts. For example, whereas clone 7.2 expressed in COS cells leads to the appearance of an ELAM1-binding surface molecule, expression of clone 7.2 in, e.g., prokaryotic host cells may have no similar effect, since prokaryotes lack internal cell structures (e.g., Golgi apparatus) that may be necessary for the biological functionality of protein 7.2. On the other hand, for isolation and purification of the clone 7.2 expression product intact, host cells in which protein 7.2 does not have a function in the cellular biochemistry (such as the catalytic role of a glycosyl transferase) may be preferred. The practitioner will be able to select the appropriate host cells and expression mechanisms for a particular purpose.
  • Considering these and other factors, a person skilled in the art will be able to construct a variety of vector/expression control sequence/host combinations that will express the DNA sequences of this invention on fermentation or in large scale animal culture.
  • Several strategies are available for the isolation and purification of protein 7.2 and protein 1 after expression in a host system. One method involves expressing the proteins in bacterial cells, lysing the cells, and purifying the protein by conventional means. Alternatively, one can engineer the DNA sequences for secretion from cells. For example, Colley et al. (1989) describe purifying a sialyltransferase by engineering the cleavable signal peptide of human gamma-interferon onto the DNA sequence for the transferase. Larsen et al. (1990) fused the DNA sequence for protein A to the amino-terminal end of a fucosyl transferase gene and expressed it as an excreted fusion protein. In these constructions, one can optionally remove the transmembrane region of these proteins that exist near the amino terminus. After secretion the proteins are purified from the medium. Similar strategies are available for bacteria.
  • Increasingly scientists are recognizing the value of enzymes as catalysts in organic synthesis. (Wong, 1989.) The 1,3-fucosyl transferases of this invention are useful for enzymatic synthesis of carbohydrates in vitro. Specifically, they are useful for catalyzing the linkage of fucose to appropriate acceptors through a 1,3 glycosidic bond. We describe one set of suitable conditions for this catalysis in Example XII, relating to an assay for fucosyl transferase activity. One skilled in the art will recognize other suitable conditions under which the 1,3 fucosyl transferases described herein may be advantageously employed.
  • It is now clear that the carbohydrate moiety of CDX is important in ELAM1-mediated cell adhesion. A molecule comprising the carbohydrate moiety of CDX, Pseudo-X or Pseudo-X2, or a fucose-containing portion of that moiety may be sufficient to function as an ELAM1 ligand. Such molecules may be useful in methods, including therapies, directed to inhibiting ELAM1-mediated cell adhesion.
  • This invention is also directed to small molecules that inhibit the activity of the 1,3-fucosyl transferases described herein, including synthetic organic chemicals, natural fermentation products, peptides, etc. These molecules may be useful in therapies aimed at inhibiting ELAM1-mediated cell adhesion. To identify such molecules, one produces a test mixture by contacting together an inhibitor candidate, a fucose acceptor and a 1,3-fucosyl transferase. The fucose acceptor is, preferably, LacNAc or 2′-fucosyllactose. The 1,3-fucosyl transferase preferably is derived from an extract from a cell transformed with clone 7.2 or clone 1. Then one assays the test mixture for 1,3-fucosyl transferase activity, such as described in Example XII.
  • The existence of antibodies against ELAM1, VCAM1 and 1b, CDX and VLA4 makes possible another method for isolating other ELAMs and ELAM ligands. The method takes advantage of an antibody characteristic known as idiotypy. Each antibody contains a unique region that is specific for an antigen. This region is called the idiotype. Antibodies, themselves, contain antigenic determinants; the idiotype of an antibody is an antigenic determinant unique to that molecule. By immunizing an organism with antibodies, one can raise “anti-antibodies” that recognize them, including antibodies that recognize the idiotype. Antibodies that recognize the idiotype of another antibody are called anti-idiotypic antibodies. Some anti-idiotypic antibodies mimic the shape of the original antigen that the antibody recognizes and are said to bear the “internal image” of the antigen. (Kennedy, 1986.) When the antigen is a ligand, certain anti-idiotypes can bind to that ligand's receptor. Investigators have identified several of these, including anti-idiotypes that bind to receptors for insulin, angiotensin II, adenosine I, β-adrenalin, and rat brain nicotine and opiate receptors. (Carlsson and Glad, 1989.)
  • Taking advantage of this phenomenon, other ELAMs and ELAM ligands may be isolated using anti-idiotypic antibodies. Anti-idiotypes may be used to screen for molecules binding to the original antigen. For example, one may use this technique to identify other ELAM ligands.
  • We have demonstrated that related ELAMs exist with similar domain structures (i.e., VCAM1 and VCAM1b.) As a result of gene shuffling, there may be several adhesion molecules on the cell surface that share one or more domains. Anti-idiotypic antibodies, which recognize any shared domains, are useful to isolate immunochemically ELAMs or ELAM-ligands not identified by bioassay, which relies on the protein's function, rather than structure.
  • In order that one may better understand this invention, we set forth the following examples. These examples are for purposes of illustration and are not to be construed as limiting the scope of the invention in any manner.
  • EXAMPLE I Preparation of a cDNA Sublibrary Enriched for ELAM Sequences
  • We prepared a cDNA sublibrary enriched for ELAM sequences as follows:
  • We isolated human umbilical vein endothelial cells (HUVECs) from umbilical cords, grew the cells in primary culture, and serially passaged them as described in Gimbrone (1976). We used HUVECs for library construction at passages 4 or 5. To induce the cells to produce mRNA for ELAMs we incubated confluent monolayers for 2.5 hours at 37° C. with recombinant human IL-1β (10 units/ml). We isolated the mRNA from these cells and reverse-transcribed it into cDNA using techniques well known to the art. (Gubler and Hoffman, 1983.) Using standard procedures, we ligated double stranded cDNA to a NotI-BstXI linker/adaptor having the following sequence:
    5′ GCG GCC GCT TTA GAG CAC A 3′
    3′ CGC CGG CGA AAT CTC       5′

    We then size-selected the cDNA on a 4.2 ml 5-20% potassium acetate gradient, 2 mM EDTA, 1 μg/ml ethidium bromide, in a Beckman® SW60 Rotor for 3 hours at 50,000 rpm at 22° C. according to the protocols of Brian Seed. (See also Maniatis, 1982, p. 278.) We pooled the cDNA fragments of greater than 500 base pairs. Then we prepared the vector, pCDM8 (a gift from Brian Seed). We digested this plasmid with BstXI. To remove the 400 base pair stuffer fragment we centrifuged the mixture on a potassium acetate gradient, as above, and isolated the large fragment. We further purified this fragment by agarose gel electrophoresis, and then ligated the cDNA to the vector. In this way we created recombinant DNA molecules containing DNA sequences for mRNA expressed in induced HUVECs. We used these plasmids to transform E. coli MC1061 P3. The result was a collection of over 7×106 recombinant clones comprising a cDNA library for IL-1β-induced HUVEC mRNA.
  • In order to prepare from this cDNA library a sublibrary enriched for ELAM cDNA sequences, we first prepared a subtracted probe enriched for ELAM sequences. We prepared cDNA as above from HUVECs induced with IL-1β and labeled it with 32P. (Davis, 1986.) Then we isolated mRNA from HUVECs that had not been induced. To subtract uninduced cDNA sequences from induced sequences we hybridized the mRNA with the cDNA and isolated cDNA that had not hybridized to mRNA, as described by Davis (1986). We subjected the isolated cDNA to another round of subtraction to increase the level of enrichment. In all, we prepared three batches of subtracted probes enriched for ELAM sequences.
  • We tested the level of purification of the probe by Northern blot. (Lehrach et al., 1977.) We ran a gel with parallel lanes of polyA+ mRNA from induced and uninduced HUVECs and blotted it on Gene Screen® (New England Nuclear). Hybridization and subsequent autoradiography revealed that the probe bound strongly to a 4 kb band in the induced lane but did not bind, beyond background, to the uninduced lane. Occasionally we noted less intense hybridization bands to other messages in the induced lane.
  • We used the subtracted probe to create a cDNA sublibrary in E. coli MC1061 P3 enriched for IL-1β induced sequences. We began by plating-out one million clones of the IL-1β-induced HUVEC cDNA library. We plated one million colonies on Gene Screen Plus® filters (New England Nuclear) on LB agar containing 12.5 μg/ml ampicillin and 7.5 μg/ml tetracycline, and grew them at 37° C. for 12 hours. We made two replicate filters (lifts) from each master. We grew these on LB agar containing 12.5 μg/ml ampicillin and 7.5 μg/ml tetracycline for 4 hours and amplified them on LB agar containing 250 μg/ml chloramphenicol for 16 hours. We lysed the filters according to manufacturer's protocol and then prehybridized them in Plaque Screen® Buffer (0.05M TRIS-HCl pH7.5, 1N NaCl, 1% SDS, 0.1% sodium pyrophosphate, 0.2% polyvinylpyrrolidone (PVP), 0.2% Ficoll-400, 0.2% BSA). We hybridized the filters at 65° C. for 40 hours in 50 ml Plaque Screens Buffer containing 10% dextran sulfate and 100 μg/ml yeast tRNA and approximately 1×107 cpm of the subtracted IL-1β-induced HUVEC cDNA. We then washed the filters twice with Plaque Screen® Buffer, twice with 2×SSC, 1% SDS, and twice with 1×SSC, 1% SDS at 65° C. We then exposed the filters to film for 5 days.
  • We selected colonies that hybridized to the probe by aligning the master filters with the autoradiographs and scraping the colonies off the filters with sterile toothpicks. We placed each scraping in one well of a 96-well microtiter plate filled with LB broth containing 7.5 μg/ml tetracycline and 12.5 μg/ml ampicillin. After inoculation, we incubated the microtiter plates overnight at 37° C. When the cells had grown we added glycerol to each well to a final concentration of 20% and stored the plates at −70° C. In this way we isolated from the master library filters 864 colonies comprising the cDNA sublibrary enriched for ELAM sequences. We point out that because of the plating density, not all the colonies of the enriched sublibrary were pure.
  • We carried out two sets of procedures in parallel with the enriched cDNA sublibrary.
  • EXAMPLE II Isolation of a Clone Expressing ELAM1
  • In a first procedure we isolated from the enriched sublibrary a clone expressing ELAM1. We chose to transfect this sublibrary into a cell line competent for high-level transient expression, the African Green Monkey kidney cell line, COS 7. We plated the cells and transfected the sublibrary by spheroplast fusion. (Sandri-Goldin et al., 1981.) Forty-eight hours after transfection, we assayed the COS 7 cells for expression of ELAM1 by their ability to bind HL-60 cells, a cell line known to bind to endothelial cells stimulated with inflammatory agents.
  • We performed the assay as follows: We labeled HL-60 cells with carboxyfluorescein diacetate according to the Brenan and Parish method. (Brenan and Parish, 1984.) Briefly, we resuspended HL-60 cells in RPMI/10% FCS at a concentration of 1×107 cells/ml, and added carboxyfluorescein diacetate to a final concentration of 0.1 mg/ml from a stock solution of 10 mg/ml in acetone. We incubated COS 7 cells with labeled HL-60 cells for 15 minutes at room temperature. We washed the cells 3-4 times with RPMI/1% FCS. We examined the petri dish by fluorescence microscopy for clusters of adherent HL-60 cells. We picked regions of the cell plates with clusters of HL-60 cells and lysed the cells in 0.6% SDS, 10 mM EDTA, pH 8, then rescued the plasmids according to the method of Hirt. (Hirt, 1967.) We used these pooled plasmids to transform E. coli MC1061 P3. We grew colonies from these transformants and performed a second round of spheroplast fusion with COS 7 cells with subsequent assay for HL-60 adhesion. From among the cells that were positive for adhesion we selected one and isolated the plasmid from it. We designated a culture containing this plasmid ELAM pCDM8 clone 6. We deposited this plasmid under the Budapest Treaty with In Vitro International, Inc., 611 P. Hammonds Ferry Rd., Linthicum, Md., 21090 (USA) on Apr. 20, 1989. It is identified as:
      • ELAM pCDM8 clone 6/E. coli MC1061 P3
      • Accession Number IVI-10204
    EXAMPLE III Isolation of cDNA Inserts for ELAM1 Sequences
  • In a second procedure, we isolated cDNA inserts for IL-1β-induced cDNA sequences. We selected at random twenty-four of the 864 colonies of the enriched library and isolated plasmids from them using the alkaline miniprep procedure of Maniatis.
  • (Maniatis, 1982.) We digested the plasmid DNA with XhoI or NotI and separated the fragments on 1% agarose gels. We identified from this gel two plasmids with inserts of greater than 3 kb, isolated these inserts and labeled them with 2P. (See, Feinberg and Vogelstein, 1983 and 1984.)
  • We then performed Northern blots with these inserts, as described above. Both inserts hybridized to bands at 4 kb in the induced HUVEC mRNA lane but did not hybridize to the uninduced HUVEC mRNA lane. The inserts cross-hybridized with the ELAM1 expressing plasmid ELAM pCDM8 clone 6 (described above) as well. We subcloned these inserts into NotI-digested pNN11 that had been treated with calf intestinal alkaline phosphatase. We constructed the sequencing plasmid pNN11 by removing the synthetic polylinker from the commercially available plasmid PUC8 (Pharmacia PL Biochemicals) by restriction digestion and replacing it with a new synthetic segment. The 2.5 kb backbone common to the pUC plasmids, that provides an origin of replication and confers ampicillin resistance, remained unchanged. The novel synthetic portion of pNN11 is shown in FIG. 2. We called these new constructs pSQ148 and pSQ149, respectively.
  • EXAMPLE IV A DNA Sequence for ELAM1
  • We determined the entire DNA sequence for the inserts of plasmids pSQ148 and pSQ149 and 624 nucleotides of the sequence at the 5′ end of the insert of ELAM pCDM8 clone 6. We used the Maxam-Gilbert method. (Maxam and Gilbert, 1980.) Because the sequences have significant overlap, we obtained a composite sequence of ELAM cDNA, a sequence of 3863 nucleotides. This sequence consists of 140 nucleotides of the 5′ untranslated region, 1830 nucleotides encoding 610 amino acids, and 1893 nucleotides of the 3′ untranslated region (including a translational stop codon and a polyadenylation signal). The mature protein derived from the deduced amino acid sequence has been designated ELAM1, and the coding sequence has been designated the ELAM1 DNA sequence. The cDNA sequence of ELAM1 is shown in FIG. 1.
  • A search of the Genbank Data Base, release 58, December 1988, revealed that the DNA sequence for ELAM1 has no significant homologies to known DNA sequences.
  • We used this cDNA sequence to deduce the ELAM1 amino acid sequence, that is also presented in FIG. 1. Our analysis of the sequence revealed the following properties: The protein possesses a hydrophobic N-terminal sequence characteristic of a signal sequence. (von Heijne, 1986.) We have not yet determined the signal cleavage site and the mature N-terminus through protein sequencing, however based on von Heijne we predict that the mature N-terminal amino acid will be tryptophan, at nucleotide number 204 in FIG. 1. The extracellular domain of the polypeptide is approximately 554 amino acids including the signal sequence and is followed by a hydrophobic transmembrane region of 24 amino acids. The protein possesses a short, charged cytoplasmic tail of 32 amino acids. We note that the protein is cysteine-rich and contains eleven potential N-glycosylation sites.
  • When we compared the amino acid sequence of ELAM1 to other proteins in the NBRF and NEW protein data bases we found significant homology with several proteins, including complement C2 precursor, β-2-glycoprotein I, C4b-binding protein, complement factor B, complement factor H, Drosophila notch protein, the IgE receptor Hepatic lectin, and Coagulation factors IX and X precursors. Thus, we can divide ELAM1 into at least three domains based on homology to the above-mentioned proteins: (1) a lectin-like domain (nucleotides 204-563 of FIG. 1); (2) an EGF-like domain (nucleotides 564-668); and (3) a consensus cysteine repeat unit of 59-63 amino acids containing six cysteine residues per repeat (nucleotides 669-1793). Other invariable amino acids in each repeat are proline, glycine, and tryptophan.
  • EXAMPLE V Monoclonal Antibodies Recognizing ELAM1
  • To make monoclonal antibodies that recognize ELAM1 we prepared hybridomas in essentially the same manner as we did in Example X, infra. However, we immunized the mice with ELAM1-expressing COS cells and identified mice producing anti-ELAM1 antibodies by testing their antiserum for the ability to block HL-60 cell adhesion to IL-1β induced HUVECs.
  • We screened hybridomas produced in this manner for those producing anti-ELAM1 monoclonals using several assays. First, we tested the culture supernatants for antibodies having the ability to bind to a cell line that stably expressed ELAM1. This cell line was a line of CHO-DHFR cells transfected with the ELAM1 animal cell expression vector, pBG341jod.ELAM. We created this plasmid by introducing the DNA sequence encoding ELAM1 from pCDM8 clone 6 into the NotI site of pBG341.jod (described in Example VIII, infra). The ELAM1 expressing CHO-DHFR derived cell line was detected using an adhesion assay to HL-60 cells.
  • Second, we screened hybridoma culture supernatants for the ability to bind cytokine-induced, but not control, HUVECs.
  • Third, we tested them for their ability to inhibit HL-60 cell adhesion to cytokine-induced HUVEC monolayers.
  • We identified one hybridoma clone, BB11, which produced a positive result in all three assays. BB11 immunoprecipitates proteins with molecular weights of about 110 kD and 96 kD from ELAM1-expressing HUVECs and COS cells, representing variably glycosylated forms of ELAM1. (Bevilacqua et al., 1989.) It also completely blocked adhesion of HL-60 cells to ELAM1-expressing COS and CHO cells. It produced immunoglobulins of the IgG2b class. We deposited a subclone of this hybridoma under the Budapest Treaty with In Vitro International, Inc., 611 P. Hammonds Ferry Rd., Linthicum, Md. 21090 (USA) on Dec. 13, 1989. It is identified as:
      • Monoclonal antibody CDB.BB11.BC6
      • Accession Number IVI-10220.
    EXAMPLE VI Isolation of Clones Expressing VCAM1 and VCAM1b
  • We have also characterized and cloned two different ELAMs that bind to lymphocytes and lymphocyte-like cell lines. As a first step, we characterized the binding pathways of RAMOS, a B-lymphocyte-like line, and JURKAT, a T-lymphocyte-like line, to HUVECs induced with IL-1β or TNF for 4, 24, or 48 hours. We found that both RAMOS and JURKAT binding was maximal at 4 hours after induction with either IL-1β or TNF, and binding was maintained at 24 hours and 48 hours after induction. RAMOS binding was temperature-sensitive, occurring at room temperature but not at 4° C. JURKAT binding was reduced but not completely eliminated at 4° C., and thus JURKAT exhibited both a temperature-sensitive and temperature-insensitive component. Antisera from mice immunized with JURKAT cells inhibited binding from both JURKAT and RAMOS cells to HUVECs, indicating that RAMOS and JURKAT share a MILA. Neither RAMOS nor JURKAT bound to COS or CHO cells expressing ELAM1, indicating the presence of at least one other inducible ELAM on HUVECs, at 4 to 48 hours after induction.
  • In order to isolate clones expressing the ELAMs involved in RAMOS and JURKAT binding to HUVECs, we screened the previously described ELAM-enriched HUVEC cDNA sublibrary by the method described in Example II, supra. We incubated carboxy-fluorescein diacetate-labeled RAMOS and JURKAT cells with sublibrary-transfected COS 7 cells. Regions of the cell plates with clusters of bound cells were picked and lysed, and the plasmids were rescued, transformed into E. coli, and reassayed in COS 7 cells as previously described. Plasmids were isolated from individual bacteria colonies from the transformants that were positive on reassay. These plasmids were transfected individually into COS 7 cells, and a plasmid that tested positive for adhesion to RAMOS and JURKAT was identified. The cDNA insert from this plasmid was excised, radioactively labeled, and used to probe a Northern blot according to the procedures of Lehrach (1979). The probe hybridized to an RNA species approximately 3.4 kb in length. The RNA was undetectable in uninduced HUVEC RNA, barely detectable at 5, 10, 30 or 60 minutes after treatment with IL-1β, but abundant at 2, 24, 48 and 72 hours after treatment with IL-1β.
  • We designated the plasmid AM pCDM8 clone 41. We deposited this plasmid under the Budapest Treaty with In Vitro International, Inc., Linthicum, Md. (USA) on May 24, 1989. It is identified as:
      • AM pCDM 8 clone 41/E. coli MC1061 P3
      • Accession Number IVI-10206
  • We have also isolated a cDNA for another VCAM. We screened the IL-1β-induced HUVEC cDNA library (Example I) with a labeled VCAM1-encoding insert from AM pCDM 8 clone 41. We sequenced one of these, clone 1E11. We found several clones that were longer than the clone 41 insert as analyzed by restriction mapping with XbaI. We sequenced one of these, clone 1E11. We deposited it under the Budapest Treaty with In Vitro International, Inc., Linthicum, Md. (USA) on Dec. 7, 1989. It is identified as:
      • VCAM 1B Clone 1E11 pCDM8/E. coli MC1061p3
      • Accession Number IVI-10216.
  • We are also isolating DNA sequences for other ELAMs. We are collecting mRNA from HUVECs around forty-eight hours after IL-1β induction. We will isolate the ELAM cDNA sequences in a manner similar to the one we used to isolate the cDNA sequences for ELAM1 and VCAM1 and 1b.
  • Alternatively, one may identify other ELAMs by inducing cells with other inflammatory agents, such as TNF, LT, LPS, interferons, or combinations of such agents.
  • EXAMPLE VII DNA Sequences for VCAM1 and VCAM1b
  • We determined the entire DNA sequence for the insert of plasmid AM pCDM8 clone 41 by the method of Maxam and Gilbert (1980). This sequence consists of 106 nucleotides of the 5′ untranslated region, 1941 nucleotides encoding 647 amino acids, and 764 nucleotides of the 3′ untranslated region including a translational stop codon. The protein derived from the cDNA sequence has been designated VCAM1, and the coding sequence has been designated the VCAM1 DNA sequence. We have presented the cDNA sequence of VCAM1 in FIG. 3. The putative amino acid sequence of VCAM1 is also indicated in FIG. 3.
  • We also determined the entire DNA sequence for the insert of plasmid VCAM1b pCDM8 1E11 by the method of Maxam and Gilbert (1980). This sequence consists of 99 nucleotides of the 5′ untranslated region, 2217 nucleotides encoding 739 amino acids and 764 nucleotides of the 3′ untranslated region including a translational stop codon. We have designated the mature protein derived from the cDNA sequence as VCAM1b and the coding sequence as the VCAM1b DNA sequence. We have presented the cDNA sequence and putative amino acid sequence of VCAM1b in FIG. 4.
  • Comparison of the DNA and amino acid sequences of VCAM1 and VCAM1b revealed that they are virtually identical except for one significant difference: VCAM1b contains an insertion of 276 nucleotides near the middle of the coding region. These nucleotides encode 92 additional amino acids which form an extra domain of 84 amino acids situated between the end of VCAM1 domain 3 and the beginning of VCAM1 domain 4. We discuss the significance of this domain, designated VCAM1 domain 3B, below.
  • Our analysis of the sequences revealed the following properties: The VCAM1 polypeptide possesses a hydrophobic N-terminal sequence characteristic of a signal sequence. (von Heijne, 1986.) We have not yet determined the signal cleavage site and the mature N-terminus through protein sequencing, however based on von Heijne we predict that the N-terminal amino acid of the mature protein will be phenylalanine, at nucleotide number 179 in FIG. 3. The extracellular domain of the polypeptide is approximately 606 amino acids including the signal sequence and is followed by a hydrophobic transmembrane region of 22 amino acids. The protein possesses a short, charged cytoplasmic tail of 19 amino acids. We note that the protein contains six potential N-glycosylation sites.
  • Similarly, the N-terminal amino acid of the mature VCAM1b protein should be the phenylalanine, at nucleotide number 172 of FIG. 4. The extracellular domain of the polypeptide, which is longer than VCAM1, is approximately 698 amino acids including the signal sequence and is followed by a hydrophobic transmembrane region of 22 amino acids. The protein possesses a short, charged cytoplasmic tail of 19 amino acids. We note that the protein contains seven potential N-glycosylation sites.
  • Comparison of the amino acid sequences of VCAM1 and VCAM1b with other proteins in the NBRF and NEW protein databases revealed significant homologies with several proteins, including non-specific cross-reactive antigen (NCA), biliary glycoprotein 1 (BG1), neural cell adhesion molecule (NCAM), carcinoembryonic antigen (CEA), immunoglobulin alpha chain constant region, the T cell receptor (TCR) alpha and beta chain variable regions, and myelin associated glycoprotein (MAG). Lesser homology is seen with myosin light chain kinase, ribulose biphosphate carboxylase, adenovirus E1A 28K protein, pseudouridine synthetase, and xylulokinase. VCAM1 and 1b and the VCAM1 and 1b DNA sequences show no homology with, and are distinct from, the previously described ELAM1 (supra).
  • Importantly, NCA, BG1, NCAM, CEA, MAG, and TCR are members of the immunoglobulin gene superfamily. (Williams and Barclay, 1988; Hunkapiller and Hood, 1989.) Members of this family are defined by the presence of one or more regions homologous to the basic structural unit of immunoglobulin (Ig) molecules, the Ig homology unit. (Hunkapiller and Hood, 1989.) These units are characterized by a primary amino acid sequence of about 70-110 residues in length, with an essentially invariant disulfide bridge spanning 50-70 residues, and several other relatively conserved residues involved in establishing a tertiary structure referred to as the “antibody fold”. These units may be further subdivided into three groups, i.e., V, C1, and C2 (Williams and Barclay, 1988), or V, C, and H (Hunkapiller and Hood, 1989), based on various criteria, including intercysteine spacing, number of beta strands, and type of conserved residues. When these criteria are applied to the predicted primary sequence of VCAM1, the sequence can be divided into six Ig units, designated domains 1-6, all of which fall into the C2 or H subset, each of about 100 amino acids in length. The invariant disulfide bridges of the six domains, referring to FIG. 3, occur between cysteines 47 and 95 (domain 1), 137 and 195 (domain 2), 246 and 291 (domain 3), 333 and 391 (domain 4), 442 and 487 (domain 5), and 531 and 576 (domain 6).
  • As we stated above, VCAM1b has seven domains. We have designated the additional domain as domain 3B. This domain is included in the additional 276 nucleotides of VCAM1b that begin at nucleotide 1027 and end at nucleotide 1305 of FIG. 4. The DNA sequence encompassing domains 1-3 is 72% homologous to the DNA sequence encompassing domains 3B-5. At the polypeptide level, there is significant homology between domains 1 and 3B, 2 and 4, and 3 and 5, respectively. We present the domain structures of VCAM1 and VCAM1b in FIGS. 5 and 6.
  • Messenger RNAs for VCAM1 and VCAM1b could arise by two mechanisms: They could represent alternately spliced forms of the same gene product, or they could be the products of separate VCAM alleles. To help distinguish between these possibilities, we examined VCAM1 and mRNA from three individuals, at different time-points after cytokine induction. HUVECs were prepared from umbilical cords from three different individuals, the cord samples being labeled #1, #2 and #3. Each preparation was split into four separate flasks for treatment with TNF for 0 (untreated), 2.5, 24, and 48 hours. Relative amounts of VCAM1 and VCAM1b mRNA were determined by Northern blotting and probing with synthetic oligonucleotides specific for each form. VCAM1b was clearly the major mRNA present in all three umbilical cord preparations. VCAM1 was present in cords #1 and #3, most prominently at the 2.5 hour induction time-point, although in cord #3 VCAM1 was also present at 24 and 48 hours. Cord #12 cells had little or no VCAM1 mRNA, although amounts of VCAM1b mRNA were comparable to those in HUVECs from cords #1 and #3. The mechanism by which these two products arise is still unclear, although alternate splicing seems likely because the two mRNAs are identical except for the deletion of one domain, at a point likely to be a splice junction, judging by its position between domains (Hunkapiller and Hood, 1989) and by the presence of the dinucleotide AG, typical of splice junctions (Breathnach and Chambon, 1981). Furthermore, alternate splicing is common among other members of the Ig gene superfamily to which VCAM1 is most clearly related. (Hunkapiller and Hood, 1989.)
  • Functionally, differences between the two forms of VCAM1 appear to be minimal. Both forms, when expressed transiently in COS 7 cells, bound RAMOS cells, and this binding was completely inhibited by Moab 14B9, indicating that the same epitope is relevant to binding in each case. Furthermore, we have shown that this epitope is located within the first three domains, which are common to both forms (see Example VIII, supra).
  • EXAMPLE VIII Recombinant Soluble ELAM1 and VCAM1b
  • We constructed a vector expressing recombinant soluble ELAM1 (rsELAM1). We called this vector pSAB108. The rsELAM1 expressed by pSAB108 contains the portion of the extracellular domain of ELAM1 encoded by the DNA sequence of FIG. 1 from nucleotide 141 to nucleotide 1790.
  • To construct pSAB108 we first created a DNA fragment which encoded an rsELAM1. We digested ELAM pCDM8 clone 6 with MluI and NotI. This yielded a 3.8 kb DNA fragment including a DNA sequence encoding ELAM1. We subcloned this fragment into NotI-digested pNN11 that had been treated with calf intestinal alkaline phosphatase (described in Example III). We called this vector pNNELAM1.
  • We used site specific mutagenesis to eliminate the transmembrane and intracellular regions of ELAM1. (Peden and Nathans, 1982; Kalderon et al., 1982; Oostra et al., 1983.) Accordingly, we digested a sample of pNNELAM1 with EcoRI and isolated the large fragment. We linearized another sample of pNNELAM1 with ScaI. Then we synthesized an oligonucleotide having the sequence 5′ TGT GAA GCT CCC TAA ATT CCC. When this sequence hybridizes to an ELAM1 antisense sequence it introduces a stop codon and a BamHI restriction site into the ELAM1 DNA sequence after nucleotide number 1790. We created a heteroduplex using these three fragments according to the methods of Morinaga et al. (1984) and Chang et al. (1984). We filled in the single stranded gaps with Klenow fragment and T4 ligase and used the mixture to transform E. coli MC1061. We screened the resulting colonies by checking for a BamHI site and selected mutagenized clones. Consequently on expression, the transmembrane region of the polypeptide is eliminated and the C-terminal amino acid is proline. We called this plasmid pSAB100.
  • Then we digested pSAB100 with AatII and NcoI and isolated the 5.2 kb fragment. We also digested pNNELAM1 with these two enzymes and isolated the 1.4 kb fragment. NcoI cuts at nucleotide 927 of FIG. 1, about the middle of the ELAM1 coding area. We ligated these two DNA fragments and called the plasmid pSAB108. We made this construction because site-directed mutagenesis sometimes causes mutations in other parts of the molecule and we wanted to avoid any such mutations in the coding region or rsELAM1. We digested pSAB108 with NotI and isolated the 3.8 kb fragment. We ligated this fragment to a 7819 bp fragment of pBG341.jod, created as follows.
  • First we obtained pSV2-DHFR, ATCC 37146, from the American Type Culture Collection, Bethesda, Md. (USA). (Subramani et al., 1981.) We digested this with ApaI and EcoRI and isolated the 4420 bp fragment. Then, we produced a synthetic double stranded DNA sequence having an ApaI overhang, a DNA sequence encoding nucleotides +190 to +233 of the human gastrin gene (Sato et al., 1986, FIG. 4), an XhoI site, and an EcoRI overhang. We ligated this oligonucleotide with the 4420 bp fragment of pSV2-DHFR and called the resulting plasmid pDT4. We digested this plasmid with AatII and XhoI and isolated the 4391 bp fragment.
  • Then we cleaved the Mullerian Inhibiting Substance expression vector pD1 (Cate et al., 1986) with AatII and SalI and isolated the 5462 bp fragment. We ligated this fragment with the 4391 bp fragment of pDT4 to make pJOD-10.
  • We digested pJOD-10 with HindIII and BstEII and isolated the large fragment which did not encode Mullerian Inhibiting Substance. We blunt-ended the fragment ends, ligated SalI linkers to the ends and self-ligated the vector. This produced pJOD-s.
  • Then we digested pJOD-s with AatI and NotI and isolated the 6750 bp fragment. We ligated this to a 1100 bp NotI fragment from pBG341, which we created as follows.
  • We created pBG341 by replacing the SmaI site of pBG312 (Cate et al., 1986) with a NotI site. We linearized pBG312 with BqlII, blunt-ended the fragment by filling in with Klenow, and self-ligated it. We linearized this plasmid with BamHI and again blunt-ended and self-ligated it. We linearized this plasmid with SmaI and ligated to the ends a NotI linker having the sequence 5′ GCGGCGC. We called the resulting plasmid pBG341.
  • We digested pBG341 with AatII and NotI and isolated the 1100 bp fragment. We ligated this fragment to a 6750 bp fragment of pJOD-s. We called the resulting plasmid pBG341.jod. This plasmid contains the SV40 early and the adenovirus major late promoter. Genes inserted into the plasmid at the NotI site are transcribed from either of these promoters.
  • Then we linearized pBG341.jod with NotI and isolated the linear 7819 bp fragment. We ligated this fragment with the 3.8 kb fragment of PSAB108, which encoded rsELAM1, generating plasmid pSAB110.
  • We transfected CHO-DHFR cells by electroporation with plasmid pSAB110 linearized with AatII. We performed electroporation with a Biorad® Gene Pulser at 270V and 960 μFD using 107 cells/ml in 20 mM HEPES pH 7.05, 137 mM NaCl, 5 mM KCl, 0.7 mM Na2HPO41 and 6 mM dextrose with 20 μg plasmid and 200 μg sonicated salmon sperm DNA. Following transfection we cultured the cells in selective medium, alpha MEM containing 500nM, methotrexate and 10% dialyzed FCS. We picked colonies, plated them onto 96-well cluster plates and detected rsELAM1-expressing cells using the monoclonal antibody BB11. After growing cells to confluence in complete medium containing 10% fetal calf serum (FCS) we maintained them in medium containing 2% FCS in which the cells produced rsELAM1. We harvested medium and replaced it with fresh 2% serum every three or four days.
  • We isolated rsELAM1 from this conditioned medium to at least 95% purity. This involved concentrating the medium and incubating it overnight with Moab BB11 (Example V) covalently coupled to Protein A sepharose. (Schneider et al., 1982.) Then we washed this resin with PBS to remove unbound protein, eluted bound material with 0.1 M glycine, pH 2.7, neutralized the eluate with sodium phosphate and dialyzed it against PBS. We further purified the rsELAM1 by chromatography with Protein A sepharose in PBS.
  • Using the following assay, we demonstrated that we had produced rsELAM1. To a 6 cm diameter Petri dish of bacteriologic plastic (e.g., Falcon #1007®) we added 2.5 ml of 50 mM Tris buffer, pH 9.5. To this we added 10 μg of pure rsELAM1. We incubated the plate for 60 minutes at room temperature to allow the rsELAM1 to bind to the plate. Then we aspirated the medium and replaced it with PBS containing 10 mg/ml bovine serum albumin. We incubated the plates overnight at 4° in this solution to block remaining protein binding sites on the plates. We warmed the plates to room temperature, washed them with medium containing 10% fetal calf serum, and incubated them with 2 ml of cells (2×106 ml−1) for 20 minutes. We aspirated the medium and washed the plates twice with 3 ml each of medium (RPMI 1640 with 10% serum). Then we examined the plates by microscopy.
  • We found that cells which bind ELAM1, such as HL-60 cells, bind to rsELAM1-coated plates, while cells which do not bind to ELAM1, e.g., the B cell line RAMOS, do not bind to these plates.
  • In addition, we found that the specific Moab BB11 blocks the binding of HL-60 cells to rsELAM1 coated plates. Together, these results show first, that we have produced rsELAM1, and, second, that like ELAM1, rsELAM1 possesses the ability to bind to leukocytes.
  • We also constructed a vector expressing recombinant soluble VCAM1b (rsVCAM1b). This vector was named pBN1006, and the rsVCAM1b expressed by pBN1006 contains the portion of the extracellular domain of VCAM1b encoded by the DNA sequence shown in FIG. 4 from nucleotide 107 to nucleotide 2193.
  • In order to generate a cell line capable of constitutively expressing full length soluble VCAM1b, we first created a vector derived from pJOD-s having a unique NotI site downstream from the adenovirus major late promoter, so that NotI fragments could be inserted into the expression vector. pJOD-s was linearized by NotI cleavage of the plasmid DNA. The protruding 5′ termini were blunt-ended using Mung-bean nuclease and the linearized DNA fragment was purified by low melting temperature agarose (LMA) gel electrophoresis. The DNA fragment was religated using T4 DNA ligase. The ligated molecules were then transformed into E. coli JA221 (ATCC accession no. 33875). Colonies were screened for the absence of a NotI site. The resulting vector was designated as pJOD-s delta Not1. pJOD-s delta Not1 was linearized using SalI and the 5′ termini were dephosphorylated using calf intestine alkaline phosphatase. The linearized DNA fragment was purified by LMA gel electrophoresis and ligated in the presence of phosphorylated oligonucleotide ACE 175 (5′ pTCGACGCGGCCGCG). The ligation mixture was transformed into E. coli JA221 and colonies were screened for the presence of a NotI site. The correct plasmid was named pMDR901.
  • Soluble VCAM1b was obtained by truncating VCAM1b clone 1E11 at nucleotide 2193 by digestion with AluI, thus eliminating the transmembrane and intracellular portion as well as the 3′ untranslated region. A stop codon-NotI linker was added, and the insert was religated into pCDM8. The insert was excised from PCDM8 with NotI and ligated into pMDR901 at the NotI site. This construct, designated pBN1006, encodes full length soluble VCAM1b, having amino acids 1-698 as shown in FIG. 4.
  • Using materials and methods already described, we have also constructed plasmids expressing truncated forms of the rsELAM1 and rsVCAM1b molecules described above. These truncated forms, comprising the amino acid sequences of one or more of the particular domains of the extracellular regions of ELAM1 and VCAM1b, were used to investigate which domain or domains are involved most directly in cell-to-cell adhesion. Our initial experiments have investigated the domains of ELAM1 and VCAM1 and 1b that are recognized by antibodies against those molecules, i.e., antibodies BB11 and 4B9, respectively.
  • A soluble ELAM1 construct designated CH101 was prepared comprising the lectin-like domain of ELAM1. Referring to FIG. 1, CH101 was the expression product of a cDNA sequence including nucleotides 1-557 (coding for amino acids 1 through 139 of ELAM1) and a stop codon. Another soluble construct designated CH102 was prepared comprising the lectin-like domain and the EGF-like domain of ELAM1. Referring to FIG. 1, CH102 was the expression product of a cDNA sequence that included nucleotides 1-671 (coding for amino acids 1 through 177 of ELAM1) and a stop codon. The soluble ELAM1 construct CH102 was found to immunoprecipitate the anti-ELAM1 monoclonal antibody, BB11.
  • The following soluble VCAM1 and 1b constructs were similarly prepared:
  • (A) domain 1 (nucleotides 1-430 of FIG. 3, coding for amino acids 1-108);
  • (B) domain 1+domain 2 (nucleotides 1-757 of FIG. 3, coding for amino acids 1-217);
  • (C) domain 1+domain 2+domain 3 (nucleotides 1-1036 of FIG. 3, coding for amino acids 1-310);
  • (D) domain 1+domain 2+domain 3 (from a hybrid of VCAM1 and VCAM1b cDNA, coding for amino acids 1-317 as depicted in FIG. 4);
  • (E) full length soluble VCAM1 (nucleotides 1-1924 of FIG. 3, coding form amino acids 1-606); and
  • (F) full length soluble VCAM1b (nucleotides 1-2193 of FIG. 4, coding for amino acids 1-698).
  • Of the foregoing VCAM1 constructs, B, C, D, E and F (but not A) were immunoprecipitated with the anti-VCAM1 antibody 4B9. Constructs B. D, E and F were also found to produce protein functional for cell adhesion. Conditioned media containing protein encoded by constructs B, D, E and F were concentrated, passed over an immunoaffinity column of immobilized 4B9 antibody, and the bound protein eluted and neutralized as described for rsELAM1. The eluted proteins were immobilized on plastic as described for rsELAM1 and found to support specific adhesion of RAMOS and JURKAT cells. These results indicate that the first two domains of VCAM1 are sufficient to support adhesion of certain VLA4-expressing human lymphoid cell lines.
  • EXAMPLE IX Isolation of the ELAM1 and VCAM1 Promoter
  • We have isolated and characterized genomic clones for the ELAM1 and VCAM1 genes. We isolated the ELAM1 clones as follows:
  • We selected as probes either the entire ELAM pCDM8 clone 6 insert or a 400 base pair fragment from its 5′ end. We labeled these molecules with 32P by random priming. Then we screened a human genomic EMBL3 library with the ELAM cDNA probes. We isolated and characterized a genomic ELAM1 clone from the library and designated it EL1-07. It includes approximately 15 kb of 5′ flanking sequence including the transcriptional promoter for ELAM1 and approximately 100 base pairs of coding sequence at the 5′ end of the gene. Current knowledge suggests that the relevant control sequences for induction will be included within the DNA sequence represented by this phage clone. (Leonardo and Baltimore, 1989.) We sequenced a region including 840 bp of 5′ flanking sequence and 720 bp of the 5′ end of the ELAM1 gene, including the first two exons, the first intron and part of the second intron. We present this sequence in FIG. 7. The 5′ flanking region displays a classical promoter structure including TATAAA and CAAT sequences. It also contains the sequence GGGGATTTCC about 95 base pairs upstream from the presumed start of transcription. This sequence is an NF-κB binding sequence identical to that found in the human κ immunoglobulin (Ig) gene enhancer. NF-κB is an inducible DNA binding protein known or suspected to stimulate transcription of a number of genes relevant to inflammation and the immune response (such as the immunoglobulins, the interleukin-2 receptor, and β-interferon, among others). It can be activated by TNF, IL-1, and LPS, the same inducers known to stimulate production of ELAM1, VCAM1, and ICAM1. (Lenardo and Baltimore, 1989; Osborn et al., 1989.) We have demonstrated that NF-κB DNA binding activity is stimulated in endothelial cells by IL-1 and TNF, and we are currently engaged in defining minimal DNA sequences necessary for inducible transcription from the ELAM1 promoter, by transfection of promoter/reporter gene constructs into endothelial and other cell types.
  • We deposited clone EL1-07 under the Budapest Treaty with In Vitro International, Inc., Linthicum, Md. (USA) on Dec. 7, 1989. It is identified as:
      • EL1-07
      • Accession Number IVI-10218.
  • We also isolated an EMBL3 genomic clone representing the VCAM1 gene by probing the previously mentioned EMBL3 human genomic library with a 32P-labeled 30 base oligomer probe homologous to the 5′ end of the VCAM1 cDNA. We designated this clone VC1-16 and deposited it under the Budapest Treaty with In Vitro International, Inc., Linthicum, Md. (USA) on Dec. 7, 1989. It is identified as:
      • VC1-16
      • Accession Number IVI-10217.
        We sequenced a region including approximately 300 bp of 5′ flanking sequence and 900 bp of the 5′ end of the VCAM1 gene, including the first exon, the first intron, and part of the second exon. We present this sequence in FIG. 8. The 5′ flanking region has a classical TATAAA sequence, and two NF-κB consensus sequences: AGGGATTTCC on the sense strand from about −63 to −54 from the start of transcription, and GGGGAAACCC on the reverse complement strand from about −69 to −78. This sequence will be used for studies analogous to those proposed for the ELAM1 promoter sequence.
    EXAMPLE X Antibodies Recognizing CDX
  • We isolated CDX, a MILA involved in ELAM1-mediated adhesion. As a first step, we prepared monoclonal antibodies that recognized an antigen on the leukocyte cell surface and that interfered with leukocyte-endothelial cell binding. In order to assure that the antigen that these monoclonals recognized was involved in ELAM1-mediated adhesion, we tested the monoclonals in systems in which ELAM1-mediated binding was the exclusive cell-cell binding pathway.
  • 1. Preparation and Analysis of Monoclonal Antibodies Against CDX
  • a. Adhesion Assay
  • To identify Moabs that inhibit leukocyte-endothelial cell binding, we developed an improved assay to detect endothelial cell-leukocyte adhesion. We performed this assay using HL-60 cells and HUVECs. It should be clear that one can perform such an assay using any cell line that expresses a MILA and with any cell line that expresses an ELAM. In 48-well tissue-culture plates we grew HUVECs to confluence (8×104 cells/well). We washed the cells once with RPMI/1% FCS and added 0.5 ml RPMI/1% FCS with 13 U/ml of IL-1β to each well (except the control wells). We incubated these cells for 4 hours at 37° C. Just before use, we washed them once with RPMI/1% FCS. The HL-60 cells we used in the assay had been labeled overnight with 1 μCi/ml of 35S-methionine. We washed these cells once and then resuspended them in RPMI/1% FCS at 5×106 cells/ml. We took 100 μl of the HL-60 cells and incubated them for 30 min at 0° C. with 50 μl of Moab (1 μg/ml). Then we added the 150 μl to each well of HUVECs. We allowed the cells to bind for 10 min at 20° C. and then washed the wells gently once with RPMI/1% FCS. We filled the wells with RPMI/1% FCS, sealed the plates, inverted them, and centrifuged them for 2 min at 500×g. We removed the media and washed the wells two more times with PBS=. (PBS= is PBS without Ca++ and without Mg++.) We determined the number of HL-60 cells bound to the HUVECs by solubilizing the cells in each well with 200 μl of 0.2N NaOH/1% SDS, adding 4.5 ml of scintillant (Ready Protein, Beckman), and counting with a scintillation counter.
  • b. Preparation of Hybridomas
  • To make monoclonal antibodies against CDX we prepared hybridomas in the following manner. We injected BALB C mice with whole, live HL-60 cells. Initially, each mouse received 2×107 cells in PBS= intraperitoneally (IP). We injected complete Freund's adjuvant intraperitoneally at a different site 2-24 hours later. We boosted the mice with 2×107 cells IP every second week for six weeks. Four days before fusing we injected the mice intravenously with 5×106 cells and IP with 5×106 cells.
  • We tested immune serum from these animals for the ability to inhibit binding of the HL-60 cells to IL-1β stimulated HUVECs by the adhesion assay described above. The immune serum tested positive after the third boost and we proceeded to produce hybridomas from the spleen cells of the immunized animals. We performed fusion of spleen cells and myeloma cells in a manner standard to the art. (See, Goding, 1983.)
  • Using the adhesion assay we described above, we screened the hybridomas for those producing monoclonal antibodies that inhibited the binding of HL-60 cells to IL-1β-induced HUVECs. In this way we identified hybridomas that produced monoclonal antibodies that recognized CDX. We used five of these hybridomas to produce ascites fluid. We deposited one of them, designated SGB3B4, under the Budapest Treaty with In Vitro International, Inc., Linthicum, Md. (USA) on Apr. 25, 1989. It is identified as:
      • SGB3B4
      • Accession number: IvI-10205
  • c. FACS Analysis
  • To identify to which cell types our monoclonals bound, we performed FACS analysis. This involved taking 2×105 cells, washing them one time with PBS=, and then blocking Fc receptors by incubation in 25 μl of RPMI, 1% FCS, 0.1 mg/ml human IgG, and 0.1% sodium azide for 10 min at 0° C. We then added antibody (25 μl at 1 μg/ml) and incubated the cells 30 min at 0° C. We centrifuged the cells at 250×g for 5 min, washed them two times with Buffer A (PBS®, 5% FCS, 0.1% azide) and resuspended them in 25 μl Buffer A containing 0.1 mg/ml human IgG. We added fluorescein-conjugated anti-mouse IgG (25 μl at 5 μg/ml in Buffer A (Cappel)) and incubated the mixture 30 min at 0° C. We centrifuged the cells, washed them once with Buffer A, and resuspended them in 250 μl Buffer A. Then we analyzed them on a Becton-Dickinson FACStar Cell Sorter.
  • We performed cell binding studies with the ELAM1-expressing COS cells essentially as described for the HL-60 cell-HUVEC adhesion assay.
  • 2. Demonstration That Hybridoma SGB3B Produced Monoclonal Antibodies That Recognize CDX
  • We have developed several lines of evidence that demonstrate that monoclonals from hybridoma SGB B specifically recognize a MILA involved in ELAM1-mediated binding, specifically, CDX.
  • First, the α-CDX antibodies should inhibit binding of cells expressing CDX to ELAM1-expressing cells. Using the adhesion assay, we showed that these monoclonals do indeed inhibit the binding of HL-60 cells and PMNs to IL-1β-induced HUVECs and ELAM1-expressing COS 7 cells. In the presence of 60.3, a monoclonal antibody against the β2 integrin chain, the only binding pathway for HL-60 cells and PMNs that is utilized in ELAM1-expressing COS 7 cells is ELAM1 itself. Therefore, antibody inhibition of cell-cell adhesion in this system must be through the ELAM1 pathway via CDX.
  • Second, α-CDX monoclonals should recognize those cells that bind to ELAM1-expressing cells in an adhesion assay, but should not recognize those cells that do not bind to ELAM1 in this assay. Using FACS analysis, we determined the binding pattern of our Moabs. These monoclonals bound to the following cell types: HL-60, U937, HT-29, THP-1, SW620, SW948, SW1417, monocytes, eosinophils, and PMNs. They did not bind to these cells: RAJI, DAUDI, RAMOS, HeLa, or JY. (We isolated the non-transformed cells by fractionating peripheral blood leukocytes.) This binding pattern precisely parallels the binding of these cells to ELAM1-expressing COS 7 cells and to rsELAM1-coated plates.
  • Third, α-CDX monoclonals should exhibit a different recognition pattern than monoclonals against other leukocyte cell-surface antigens, such as LFA-1, LFA-3, CD44, ICAM1 and CD4. In fact, no other monoclonal of which we are aware exhibits the same cell-recognition pattern as our antibodies.
  • Fourth, and most convincing, using these MoAbs we cloned a gene that can confer ELAM1 binding activity in cells that otherwise do not bind to ELAM1.
  • In sum, it is apparent that the monoclonals produced by hybridoma SGB3B4, and by other hybridomas we isolated, recognize CDX. Consequently, we used these monoclonals to isolate CDX itself.
  • EXAMPLE XI Isolation of CDX
  • 1. Iodination of HL-60 Cell Surface Proteins
  • We washed 1×107 HL-60 cells three times with PBS═, resuspended them in 0.5 ml PBS= and added them to a tube coated with 50 μg 1,3,4,6-tetrachloro-3α,6α-diphenylglycouril (Sigma Chemical Co.). To this we added 1 mCi of 125I. We incubated the mixture for 30 min at 0° C. We transferred labeled cells to a tube containing 10 ml of RPMI/10% FCS and centrifuged them at 1000×g for 5 min. Then we washed them first with another 10 ml of RPMI/10% FCS and second with 2 ml of PBS®. (Alternatively, we have labeled the cells metabolically with 35S-methionine or 5-cysteine.) We lysed the cells by addition of 1.0 ml PBS= containing 1% NP40, 2 mM PMSF, 1 mM EDTA, soybean Trypsin inhibitor (50 mg/ml), and Leupeptin (1 mM) (Sigma Chemical Co.). Then we incubated them for 30 min at 0° C. We centrifuged the lysate for 10 min at 10,000×g to remove particulate matter. We precleared the supernatant containing labeled solubilized membrane proteins with 10 μg of rabbit anti-mouse IgM (Jackson Immuno-Research Labs) and 50 μl of Protein A sepharose (Zymed, 2 mg Protein A/ml) for 2 hours at 0° C. We stored the lysate at 4° C.
  • 2. Immunoprecipitation of CDX
  • We purified CDX away from the other labeled proteins using the Moabs to immunoprecipitate it. We performed the immunoprecipitation as follows:
  • We incubated precleared lysate (50-100 μl) with 10λ of ARX beads for 2 hours at 4° C. We washed the sepharose four times with 2 ml PBS= containing 0.75% NP40, 0.2% DOC, and 1 mM EDTA. Then we resuspended the ARX beads in non-reducing SDS sample buffer. We heated the sample for 10 min at 85° C. and removed the supernatant. To this we added B-ME to 5%, heated for 5 min, and separated the molecules on a 10% SDS polyacrylamide gel. We dried the gel and autoradiographed it.
  • CDX appeared on the autoradiograph as a single, diffuse band with molecular weight of approximately 150 kD.
  • EXAMPLE XII Isolation and Characterization of Clone 7.2 and Clone 1
  • We prepared two cDNA libraries in the pCDM8 vector from two types of CDX-expressing cells, HL-60 cells and U937 cells. We isolated the mRNA from these cells and reverse-transcribed it into cDNA using techniques well known to the art. (Gubler and Hoffman, 1983.) Using standard procedures, we ligated double stranded cDNA to a NotI-BstXI linker/adaptor having the following sequence:
    5′ GCG GCC GCT TTA GAG CAC A 3′
    3′ CGC CGG CGA AAT CTC       5′

    We then size-selected the cDNA on a 4.2 ml 5-20% potassium acetate gradient, 2 mM EDTA, 1 μg/ml ethidium bromide, in a BECKMAN SW60 Rotor for 3 hours at 50,000 rpm at 22° C. according to the protocols of Brian Seed. (See also Maniatis, 1982, p. 278.) We pooled the cDNA fragments of greater than 500 base pairs. Then we prepared the vector, PCDM8 (a gift from Brian Seed). We digested this plasmid with BstXI. To remove the 400 base pair stuffer fragment we centrifuged the mixture on a potassium acetate gradient, as above, and isolated the large fragment. We further purified this fragment by agarose gel electrophoresis, and then ligated the cDNA to the vector.
  • We then prepared an enriched cDNA library by first creating a 32P-labeled cDNA probe from 1 microgram of HL-60 poly A+ mRNA, then subtracting non-CDX related cDNA sequences from the probe by hybridizing with 30 micrograms of poly A+ mRNA from HeLa cells, which do not express CDX. (See, Davis, 1986.) We used the subtracted probe to screen the pCDM8 cDNA library and thus created an enriched sublibrary from HL-60 cells in E. coli MC1061 P3. We grew about 2100 clones in twenty-two 96-well plates. A U937 enriched sublibrary was prepared in a similar manner, and 1400 clones were obtained.
  • We divided the colonies from our HL-60 enriched library into 22 pools for transfection of COS 7 cells by spheroplast fusion. (Sandri-Goldin et al. 1981.) We assayed transfected COS 7 cells for ELAM1-binding activity by panning with α-CDX monoclonal antibodies from hybridoma SGC2E5 (an antibody similar in function to SGB3B4) according to the method of Seed and Aruffo (1987). (See also Aruffo and Seed, 1987 and Wysocki and Sato, 1978). Pool #7 assayed positive, yielding two clones with a 2.1 kb cDNA insert. These were designated clones 7.1 and 7.2.
  • We obtained the DNA sequence of clone 7.2 by the Maxam and Gilbert technique (Maxim and Gilbert, 1980) from CDX pCDM8 clone 7.2 and from a portion of the 7.2 insert subcloned into the sequencing vector, pNN11. The latter plasmid was designated pSQ219. The DNA sequence obtained is set forth in FIG. 9.
  • We deposited a culture containing the plasmid CDX pCDM8 clone 7.2 under the Budapest Treaty with In Vitro International, Inc., 611 P. Hammonds Ferry Rd., Linthicum, Md. 21090 (USA) on Apr. 26, 1990. The deposit is identified as:
      • CDX pCDM8/E. coli MC1061 P3
      • Accession Number IVI-10242
  • We also performed a Northern blot on mRNA from HL-60 cells and probed it with clone 7.2. Clone 7.2 hybridized to three mRNA species, two prominent bands at 6.0 kb and 2.4 kb and another band at 3.0 kb. Clone 7.2, a cDNA of 2.1 kb, is not large enough to be a full length cDNA from the 3.0 kb and 6.0 kb species. Therefore, in order to identify DNA sequences for these messages, we probed the enriched cDNA sublibrary from both U937 and HL-60 cells with an oligonucleotide derived from clone 7.2. We isolated several long inserts from the HL-60 library, transfected them into COS 7 cells, and selected clones that bound to ELAM1 and α-CDX. In this way we identified a 2.9 kb insert that could have come from the 3.0 kb message. We called it CDX clone 1.
  • We determined the DNA sequence of CDX clone 1 by the Maxam and Gilbert technique. The DNA sequence obtained is set forth in FIG. 10.
  • We deposited a culture containing the plasmid CDX clone 1 under the Budapest Treaty with In Vitro International, Inc., 611 P. Hammonds Ferry Rd., Linthicum, Md. 21090 (USA) on Oct. 11, 1990. The deposit is identified as:
      • CDX clone 1 pCDM8/E. coli MC1061 P3
      • Accession Number IVI-10255.
  • We transfected clone 7.2 and clone 1 into COS 7 and CHO cells. At 48 hours after transfection these cells expressed a glycoprotein on their cell surfaces to which fluorescently labelled α-CDX antibodies bound, as assayed by FACS. These cell surface proteins could be labeled with 125I and immunoprecipitated with α-CDX Moabs. We designated the protein isolated from COS 7 cells, Pseudo-X and from CHO cells, Pseudo-X2. On SDS polyacrylamide gels, Pseudo-X and Pseudo-X2 were approximately 130 kD and 140 kD, respectively.
  • The transfected COS cells also formed rosettes around Sepharose beads coated with recombinant soluble ELAM1 (rsELAM1); and the rosetting was cation dependent and was inhibited by both BB11 (anti-ELAM1 antibody) and α-CDX. COS cells and CHO cells transfected with PCDM8 alone (without the inserted clone) did not rosette rsELAM1 beads. Also, the COS and CHO cells transfected with clone 7.2 did not rosette to beads coated with bovine serum albumin.
  • We further characterized clone 7.2 and clone 1 by DNA sequence analysis and enzyme assays. Clone 1 encodes a polypeptide of 530 amino acids (encoded by nucleotides. 174-1763 of FIG. 2). Clone 7.2 encodes a 405-amino acid polypeptide (encoded by nucleotides 66-1280 in FIG. 1). Using UWGCG Sequence Analysis Software Package (version 6.1, August 1989), we searched the NBRF Protein database (release 23, December 1989) using the program FASTA for homology to other proteins. We also searched GenBank (release 63, March 1990) and EMBL (release 19, May 1989) using TFASTA. In these searches we found short regions (e.g., about 23 amino acids) of homology to certain viral envelope proteins including Herpes simplex virus type 1, Dengue virus, yellow fever and other flaviviruses. In general the homology to known proteins was low, and we conclude that the polypeptides are novel.
  • The portion of the nucleotide sequence of clone 7.2 from nucleotide 9 to nucleotide 2162 (FIG. 9) is identical to the portion of the sequence of clone 1 from nucleotide 492 to nucleotide 2645 (FIG. 10). The first methionine of protein 7.2 corresponds to the methionine at amino acid 126 of protein 1. One explanation of this homology is that the two inserts represent different transcripts from the same DNA segment.
  • As we stated earlier, these clones do not code for CDX, Pseudo-X or Pseudo-X2—the polypeptides they encode are not the correct, size. Rather, the evidence strongly supports the conclusion that clone 7.2 and clone 1 encode 1,3-fucosyl transferases that glycosylate other proteins, such as CDX, Pseudo-X and Pseudo-X2, in a way that makes them “visible” (i.e., recognized by or able to bind to) ELAM1 or α-CDX. First, the DNA sequences of clone 1 and clone 7.2 share several structural features with the DNA sequences of known glycosyl transferases. For example, genes encoding known glycosyl transferases commonly have consecutive methionine start sites and are capable of producing more than one mRNA transcript. As mentioned above, we have identified three mRNA transcripts that hybridize to clone 7.2, and clone 1 contains two codons that can serve as transcription start signals. Also, like known glycosyl transferases, the clones have multiple SP1 enhancer sites. The nucleotide sequences for these sites are GGGCGG or CCGCCC; clone 1 has five such sites. Also, like known glycosyl transferases, clones 7.2 and 1 are rich in guanine (G) and cytosine (C). For example, clone 1 is 75% GC rich in the 5′ region of the gene and 60% GC rich in the 3′ region of the gene. Glycosyl transferases in addition are typically class II membrane proteins, in which the membrane-spanning domain is near the amino terminus and the extracellular portion is near the carboxy terminus. Clone 1 and clone 7.2 encode a polypeptide having a hydrophobic region near the amino terminus. Glycosyl transferases also tend to have molecular weights between 40 kD to 60 kD; clone 1 encodes a polypeptide of about 59 kD and clone 7.2 encodes a polypeptide of about 46 kD. Finally, known glycosyl transferases usually have one to three N-glycosylation sites; clone 1 and clone 7.2 both encode two such sites.
  • Second, enzyme assays performed on extracts from CHO cells transfected with clone 7.2 revealed the presence of fucosyl transferases not expressed in untransformed cells. The assays tested the ability of the enzyme to link radioactively labelled fucose to an acceptor molecule. We performed the assays as follows.
  • We prepared assay samples containing 10 μl enzyme, 8 μl cocktail and 2 μl 10× acceptor. We prepared the enzyme by isolating about 1.5 million CHO cells transfected with clone 7.2 and lysing them by sonication for 15 seconds in 150 μl ice-cold 1% Triton X-100 in water. The cocktail contained 75 μM 14C-GDP fucose, 100 mM ATP, 500 mM L-fucose, 1 M MnCl2 and 1 M cacodylate at pH 6.2. 10× acceptor contained, variously, 200 mM LacNAc, Lac-N-biose, or lactose, 250 mM phenyl-β-D-galactoside, or 50 mM 2′-fucosyllactose. We incubated the assay samples for 1 hour at 37° C. We stopped the reaction by addition of 20 μl ethanol. We diluted the sample with 560 μl water and centrifuged in an EPPENDORF centrifuge for 5 minutes at high speed.
  • We had prepared a DOWEX 1×2-400 column (Sigma Chemical Co.) to separate the unconverted 14C fucose-GDP from the converted. We loaded the matrix into a large column and washed it with 10 volumes of 1N NaOH, followed by 5 volumes of water, followed by 10 volumes of 5% concentrated formic acid. Then we repeated this wash cycle. We used this material to create small columns of 0.4 ml. We prepared the small columns for use by washing them with 10 volumes of water.
  • We loaded 200 μl of the sample onto the small column, collected the eluate, rinsed with 2 ml water and collected it into the eluate. We determined the radioactivity of this eluate by scintillation counting.
  • The results of this assay demonstrated that the induced enzyme is a 1,3-fucosyl transferase. (See Table 1.) The enzyme linked fucose to LacNAc, 2′-fucosyllactose and lactose, acceptors having GlcNAc or glucose moieties with free 3′ hydroxyls. It did not link fucose to LacNBiose, whose GlcNAc moiety does not have a free 3′ hydroxyl, or phenyl-β-D-galactoside, the negative control acceptor. Control samples from untransfected cells showed only insignificant linking of fucose to these acceptors.
    TABLE 1
    Efficiency of Fucosylation
    picomoles
    Acceptor mg Total protein · hr
    LacNAc 1110
    Lac-N-Biose 76
    2′- Fucosyllactose 151
    Lactose
    290
    PhβDgal Not detectable

    [The enzyme was freshly produced from transfected CHO cells.]
  • Therefore, both genetic and enzymatic evidence indicate that clone 7.2 and clone 1 encode 1,3-fucosyl transferases.
  • EXAMPLE XIII Antibodies Recognizing MILAs For VCAM1
  • Polyclonal antisera were obtained from three mice that had been immunized with whole JURKAT cells. The serum from one mouse completely inhibited both RAMOS and JURKAT binding to 4 hour-induced HUVECs at room temperature. The sera from the two other mice completely inhibited RAMOS but only partially inhibited JURKAT binding under the same conditions. These data indicate that RAMOS and JURKAT share a MILA, and that JURKAT exhibits at least one other MILA not shared by RAMOS.
  • To prepare Moabs to lymphocyte MILAs, we immunized mice against whole live RAMOS and JURKAT cells and performed fusion of spleen cells from JURKAT-immunized mice and myeloma cells in the manner described in Example VIII, above. We are screening the resulting hybridomas by the method described in Example VII, which we used successfully to obtain monoclonal antibodies to CDX. To date we have screened the conditioned medium from about 260 hybridomas for inhibition of RAMOS adhesion to HUVECs treated with TNF for 24 hours. About 25 hybridomas have shown consistent partial inhibition of adhesion, and these are currently being subcloned for re-screening. Such antibodies may be used to both isolate and clone lymphocyte MILAs.
  • EXAMPLE XIV Evidence that VLA4 is a VCAM1 Ligand
  • We and other colleagues have performed several studies that demonstrate that VLA4 is a VCAM1 ligand and that VLA4 has separate binding sites for VCAM1 and fibronectin.
  • First, we showed that monoclonal antibodies against the subunits of VLA4 inhibited the attachment of VLA4-expressing cells to activated HUVECs and to COS cells transfected with VCAM1. VLA4 is composed of the subunits β1 and α4. (Hemler, 1988.) We found that a monoclonal antibody against β1, designated B1E11, and goat anti-β1 heteroantiserum completely inhibited the adhesion of RAMOS cells to activated HUVECs and transfected COS cells. A control antibody did not inhibit adhesion. Furthermore, a monoclonal antibody against the α4 subunit, designated HP2/1, also blocked attachment of RAMOS to these cells. Similarly, these antibodies inhibited the attachment of the VLA4-expressing T lymphoblastoid cell line HPB-ALL.
  • Next, we showed that transfecting cells that do not ordinarily express VLA4 with α4 enabled them to bind to VCAM1-expressing cells. We transfected two sets of K-562 erythroleukemic cells. One set was transfected with a cDNA coding for α4. (Takada et al., 1989.) The other was transfected with α2, which is not part of VLA4. (Takada and Hemler, 1989.) We showed that K-562 cells transfected with α4 were now able to bind with a monolayer of VCAM1-transfected COS cells or TNF-activated HUVECs, but parent K-562 cells and K-562 α2-transfected cells were not. In addition, monoclonal antibodies against α4 or β1 abolished the adhesion of α4-transfected K-562 cells (that normally express the subunit) to these VCAM1-expressing cells.
  • Recent studies have shown that VLA4 mediates cell attachment to human plasma fibronectin (FN) through the FN CS-1 site. (Wayner et al., 1989.) We have shown that the VLA4 binding site for VCAM1 is different than its binding site for FN. First, we found that preincubation of RAMOS cells or α4-transfected K-652 cells with FN-40 (a soluble FN fragment) inhibited their binding with FN-40, but not with VCAM1-transfected COS cells or TNFα activated HUVECs. Second, we found that a monoclonal against VLA4, HP1/3, inhibited the binding of these cells to transfected COS cells or activated HUVECs, but not to FN-40.
  • EXAMPLE XV Inhibitor Screening
  • One can use ELAMs and their ligands in three basic adhesion assays to screen for potential inhibitors of adhesion, such as synthetic organic chemicals, natural fermentation products, peptides, etc.:
  • 1. Cell-Cell Adhesion Assays
  • A first assay would test the ability of molecules to inhibit cell-cell adhesion. One could perform this assay in 96-well microtiter plates. First, one creates a cell line that stably expresses an ELAM, for example, as described in Example V. Then one plates out these cells and adds HL-60 cells. Inhibitors are identified by their ability to inhibit HL-60 binding to the ELAM-expressing cells. One would perform an assay exactly as described for screening for monoclonal antibodies to the ELAM ligand.
  • 2. Cell-Adhesion Protein Assays
  • A second assay would test the ability of a small molecule to inhibit cell binding to ELAM itself. We have developed such an assay with rsELAM1 which works in 96 well microtiter plates. These plates, made of bacteriologic plastic (e.g. Linbro/Titertek #76-232-05®), are incubated with 0.5 μg per well of rsELAM1 in 50 μl of 15 mM sodium carbonate/35 mM sodium bicarbonate, pH 9.2, overnight at 40. The plates are then blocked for one hour at room temperature with PBS containing 10 mg/ml of bovine serum albumin, and then adhesion assays performed as described in Example VIII using, e.g., HL-60 cells, 2×106/ml, 50 μl per well. Under these conditions HL-60 cells bind well to rsELAM1, providing a convenient microassay for screening. One would identify inhibitors by their ability to inhibit HL-60 binding to the plate. Alternatively, one could use an ELAM ligand in this assay, using as the probe a cell line that stably expresses an ELAM.
  • Another alternative assay in this category would examine the binding of a soluble ELAM or ELAM ligand to monolayers of cells stably expressing an ELAM ligand or ELAM, respectively. The soluble molecule would be labeled with a reporter group (e.g., radioactivity, fluorescent probe, enzyme, etc.)
  • 3. Adhesion Protein-Adhesion Protein Assays
  • This assay tests the ability of a small molecule to inhibit the binding of an ELAM to its ligand. One of the two molecules in soluble form, e.g., a soluble ELAM, is immobilized in the wells of a 96-well microtiter plate, and adhesion is measured by binding of the other member of the pair, e.g., an ELAM ligand labeled with a reporter group.
  • In each of these three assays, one detects inhibitors by their ability to inhibit adhesion.
  • EXAMPLE XVI VCAM1/Immunoglobulin Construct
  • We have prepared a DNA sequence which, on expression, produces an rsVCAM1/immunoglobulin fusion protein. The DNA sequence contains, from 5′ to 3′, VCAM1 domains 1-3 and the constant region of an IgG heavy chain gene.
  • We produced a DNA fragment containing the VCAM1 domains 1-3 through nucleotide 1035 of FIG. 3 by polymerase chain reaction (PCR). (Sambrook et al., 1989) The 3′-5′ primer had the sequence 5′ GA GCT CGA GGC CGC ACC ATG CCT GGG AAG ATG. It is complementary to nucleotides 100-114 in FIG. 3 and contains the VCAM1 initiation codon and recognition sites for XhoI and NotI. The 5′-3′ primer had the sequence 5′ CT AGC TAG CGC GTT TTA CTT CAC. It is complementary to nucleotides 1016-1035 in FIG. 3, at the end of domain 3, and contains an NheI recognition site. We used these primers to amplify a segment from a plasmid containing VCAM1 coding region of AM pcDM8 clone 41. The product of this process was a DNA sequence encoding VCAM1 domains 1-3. We digested this DNA fragment with XhoI and NheI and inserted it into pAB53, which we made as follows.
  • We digested pJOD-s (Example VIII) with SalI and inserted a cDNA sequence encoding human rsCD4. We called this plasmid pJOD-rsT4. We partially digested pJOD-rsT4 with PvuII and SphI to delete the fragment containing the two SV40 enhancer repeats in the SV40 promoter which control transcription of the DHFR cDNA. We religated the plasmid and designated it pJOD-rsT4 delta E. Then we digested pJOD-rsT4 delta E with NheI and NotI and inserted two DNA fragments: first, an NheI-HindIII linker containing a 5′ mRNA splice site and second, a DNA fragment encoding the constant region of an IgG heavy chain gene. We obtained these fragments as follows.
  • We synthesized an NheI-HindIII linker having the following sequence:
                    5′ spl ice
    5′ CTA GCT TTC CAA GGT GAG TCC TA      3′
    3′      GA AAG GTT CCA CTC AGG ATT CGA 5′
  • The DNA sequence of an IgG heavy chain gene is described in Ellison et al. (1982). We isolated a fragment of this gene from an EMBL3 human genomic library (Example VIII) using an oligonucleotide probe. We digested the fragment with HindIII and NotI and isolated the fragment which included the constant heavy domains and the associated introns.
  • We ligated these two fragments into PJOD-rsT4 delta E and called the resulting plasmid pAB53. We digested pAB53 with XhoI and NheI to delete the rsT4 coding region. We inserted in its place the XhoI-NheI fragment encoding VCAM1 domains 1-3. We called this plasmid VCAM1-IgG1.
  • An rsVCAM1/IgG fusion protein is expressed using this plasmid. The plasmid is transfected into CHO cells for stable expression. After transcription of this gene, the mRNA is spliced to remove the introns and upon translation, the cell produces rsVCAM-IgG fusion protein.
  • EXAMPLE XVII Inhibiting VCAM1 Expression with an Antisense Nucleic Acid
  • We describe here an antisense nucleic acid against VCAM1 and a method for testing its ability to inhibit VCAM1 expression in induced HUVECs. An effective nucleic acid sequence for an antisense nucleic acid is one that is complementary to the coding region of the mRNA and, more particularly, to either the initiation codon, AUG, or the splice sites. (Marcus-Sekura, 1988.) Also, oligomers of about 15 nucleotides are most preferred. Thus, an effective antisense nucleic acid against VCAM1 is an oligomer with the DNA sequence 5′ CCC AGG CAT TTT AAG. This would bind to nucleotides 94-108 of FIG. 3 (CAT is the antisense initiation codon.) This DNA sequence is synthesized, for example, by an automated DNA synthesizer.
  • The ability of this antisense nucleic acid to inhibit VCAM1 expression is tested as follows. HUVECs are grown to confluence as in Example V except that the serum used for cell growth would be heat inactivated or 30 min. at 60° to inactivate nucleases. Cells are preincubated with the oligomers at concentrations between 10 μM and 100 μM, most preferably the highest concentration having no effect on cell viability, for four to forty-eight hours. These ranges are required for effective inhibition. (Marcus-Sekura, 1988; Becker et al., 1989.) The HUVECs are then treated with 10 ng/ml TNF to induce VCAM1. About four hours later the presence of VCAM1 on the surface of the cells is tested by the adhesion assay.
  • EXAMPLE XVIII A Hammerhead Ribozyme Which Recognizes VCAM1 mRNA
  • A hammerhead-type ribozyme which recognizes VCAM1 mRNA is prepared according to the rules of Haselhoff and Gerlach (1988) as follows. First, a cleavage site on the target mRNA is identified. Hammerhead ribozymes cleave after the sequence 5′ GUX, where X is any nucleotide. The first instance of this sequence in the coding region of VCAM1 mRNA is the sixth codon: 5′ AUG CCU GGG AAG AUG GUC GUG AUC CUU. An appropriate recognition sequence includes about six nucleotides of the 5′ and 3′ regions flanking the cleavage site. An eighteen-base recognition sequence which contains the cleavage site is 5′ AAG AUG GUC GUG AUC CUU.
  • Then, one designs an RNA sequence for the ribozyme containing the recognition sequence and a sequence for the catalytic “hammerhead.” Such a sequence is 5′ AAG GAU CAC [CUGAUGAGUCCGUGAGGACGAA] AC CAU CUU. The sequence in brackets generates the catalytic “hammerhead” and the 5′ and 3′ flanking sequences are complementary to and bind to the recognition sequence. In a similar way, one can also design shorter recognition sequences or those for other cleavage sites in VCAM1 mRNA or the other ELAM or ELAM ligand mRNAs.
  • EXAMPLE XIX Anti-Idiotypic Antibodies Recognizing ELAM1 Ligands
  • We have prepared anti-idiotypic antibodies against anti-ELAM1 antibodies that bind to the ligand of ELAM1 on HL-60 cells. We immunized rabbits with protein-A-purified CDB.BB11.BC6 monoclonal (Example V) emulsified 1:1 in complete Freund's adjuvant. Twenty-six days after immunization we bled the rabbits and analyzed the anti-sera for specific antibodies using FACS. We incubated the antibody preparation with either HL-60 cells, which express a ligand for ELAM1, or RAMOS cells, which do not. We found that this antibody preparation specifically bound to the HL-60 cells and not to the RAMOS cells, indicating that it contained antibodies that recognize the ELAM1 ligand. Control anti-serum did not react with either cell line.
  • EXAMPLE XX Evidence of a New ELAM
  • The binding of U937 cells (which are monocyte-like) to induced HUVECs is not blocked by specific Moabs to the ELAM1, VCAM1, and/or ICAM1 pathways. U937 binding is blocked, however, by a monoclonal antibody to CD29, the β1 integrin subunit. This leads us to postulate the existence of a new adhesion molecule on HUVECs that interacts with leukocytes via a β1 integrin. The new molecule is induced with a time-course similar to VCAM1, remaining at maximal levels 48 hours after induction. We have generated a subtracted library from 48-hour TNF-treated HUVECS, using the methods previously described for the 2.5-hour IL-1 induced HUVEC subtracted sublibrary. We are attempting to clone the new molecule using the direct expression protocol described previously.
  • While we have described herein a number of embodiments of this invention, it is apparent that one of skill in the art could alter our procedures to provide other embodiments that utilize the processes and compositions of this invention. Therefore, one will appreciate that the scope of this invention is to be defined by the claims appended hereto rather than by the specific embodiments that we have presented by way of example.
  • CITED PUBLICATIONS
    • Arfors, K.-E., et al., “A Monoclonal Antibody to the Membrane Glycoprotein Complex CD18 Inhibits Polymorphonuclear Leukocyte Accumulation and Plasma Leakage In Vivo”, Blood, 69, pp. 338-40 (1987)
    • Aruffo, A., and B. Seed, “Molecular Cloning of a CD28 cDNA by a High Efficiency COS Cell Expression System”, Proc. Natl. Acad. Sci. USA, 84, pp. 8573-77 (1987)
    • Becker, D., et al., “Proliferation of Human Malignant Melanomas Is Inhibited by Antisense Oligodeoxynucleotides Targeted Against Basic Fibroblast Growth Factor,” EMBO J., 8, pp. 3685-91 (1989)
    • Benchimol, S., et al., “Carcinoembryonic Antigen, A Human tumor Marker, Functions as an Intercellular Adhesion Molecule”, Cell, 57, pp. 327-34 (1989)
    • Bevilacqua, M. P., and M. A. Gimbrone, “Inducible Endothelial Functions in Inflammation and Coagulation”, Seminars in Thrombosis and Hemostasis, 13, pp. 425-33 (1987)
    • Bevilacqua, M. P., et al., “Interleukin 1 Acts on Cultured Human Vascular Endothelium to Increase the Adhesion of Polymorphonuclear Leukocytes, Monocytes, and Related Leukocyte Cell Lines”, J. Clin. Invest., 76, pp. 2003-11 (1985) (“Bevilacqua I”)
    • Bevilacqua, M. P., et al., “Endothelial-Dependent Mechanisms of Leukocyte Adhesion: Regulation by Interleukin-1 and Tumor Necrosis Factor”, Leukocyte Emigration and Its Sequelae (S. Karger A. G., Switzerland, 1987a), pp. 79-93 (“Bevilacqua II”)
    • Bevilacqua, M. P., et al., “Identification of an Inducible Endothelial-Leukocyte Adhesion Molecule”, Proc. Natl. Acad. Sci. USA, 84, pp. 9238-42 (1987b) (“Bevilacqua III”)
    • Bevilacqua, M. P., et al., “Endothelial Leukocyte Adhesion Molecule 1: An Inducible Receptor for Neutrophils Related to Complement Regulatory Proteins and Lectins”, Science, 243, pp. 1160-5 (1989) (“Bevilacqua IV”)
    • Breathnach, R. and P. Chambon, “Organization and Expression of Eucaryotic Split Genes Coding for Proteins”, Ann. Rev. Biochem., 50, pp. 349-83 (1981)
    • Brenan, M. and C. R. Parish, “Intracellular Fluorescent Labelling of Cells for Analysis of Lymphocyte Migration”, J. Immun. Meth., 74, pp. 31-38 (1984)
    • Capon, D. J., et al., “Designing CD4 Immunoadhesins for AIDS Therapy,” Nature, 337, pp. 525-31 (1989)
    • Carlsson, R., and C. Glad, “Monoclonal Antibodies into the '90s,” Bio/Technology, 7, pp. 567-73 (June 1989)
    • Cate, R., et al., “Isolation of the Bovine and Human Genes for Mullerian Inhibiting Substance and Expression of the Human Gene in Animal Cells”, Cell, 45, pp. 685-98 (1986)
    • Cech, T. R., “Ribozymes and Their Medical Implications,” J. Amer. Med. Assn., 260, pp. 3030-4 (1988)
    • Chang et al., “Recombination Following Transformation of Escherichia coli by Heteroduplex Plasmid DNA Molecules,” Gene, 29, pp. 255-61 (1984)
    • Colley, K. J., et al., “Conversion of a Golgi Apparatus Sialyltransferase to a Secretory Protein by Replacement of the NH2-terminal Signal Anchor with a Signal Peptide”, J. Biol. Sci., 264, pp. 17619-22 (1989).
    • Cotran, R. S., et al., “Induction and Detection of a Human Endothelial Activation Antigen In Vivo”, J. Exp. Med., 164, pp. 661-66 (1986)
    • Cotran, R. S., and J. S. Pober, “Endothelial Activation: Its Role in Inflammatory and Immune Reactions,” in Endothelial Cell Biology, Simionescu and Simionescu, Eds., Plenum Press, New York (1988), pp. 335-47
    • Dana, N., et al., “Mol Surface Glycoprotein: Structure, Function and Clinical Importance”, Pathol. Immunopathol. Res., 5, pp. 371-83 (1986)
    • Davis, M. M., “Substractive cDNA Hybridization and the T-cell Receptor Gene”, Handbook of Experimental Immunology In Four Volumes, 4th ed. Blackwell Scientific Publications, Oxford, England (1986), pp. 76.1-76.13
    • Davis, M. M., et al., “Cell Type-Specific cDNA Probes and the Murine I Region: The Localization and Orientation of Ad”, Proc. Natl. Acad. Sci. USA, 81, pp. 2194-98 (1984)
    • Devereux, J., et al., “A Comprehensive Set of Sequence Analysis Programs for the VAX,” Nucl. Acids Res., 12, pp. 387-95 (1984)
    • Duguid, J. R., et al., “Isolation of cDNAs of Scrapie-Modulated RNAs by Subtractive Hybridization of a cDNA Library”, Proc. Natl. Acad. Sci. USA, 85, pp. 5738-42 (1988)
    • Dustin, M. L., and T. A. Springer, “Lymphocyte Function-Associated Antigen-1 (LFA-1) Interaction with Intercellular Adhesion Molecule 1 (ICAM1) Is One of at Least Three Mechanisms for Lymphocyte Adhesion to Cultured Endothelial Cells,” J. Cell. Biol., 107, pp. 321-33 (1988)
    • Dustin, M. L., et al., “Induction by IL1 and Interferon-gamma: Tissue Distribution, Biochemistry, and Function of a Natural Adherence Molecule (ICAM-1), J. Immunol., 137, pp. 245-254 (1986)
    • Ellison, J. W., et al., “The Sequence of a Human Immunoglobulin C-gamma-1 Gene,” Nucl. Acids Res., 10, pp. 4071-79 (1982)
    • Feinberg, A. P., and B. Vogelstein, “A Technique for Radiolabeling DNA Restriction Endonuclease Fragments to High Specific Activity”, Anal. Biochem., 132, pp. 6-13 (1983)
    • Feinberg, A. P., and B. Vogelstein, “A Technique for Radiolabeling DNA Restriction Endonuclease Fragments to High Specific Activity”, Anal. Biochem., 137, pp. 266-67 (1984) (Addendum)
    • Fisher, R. A., et al., “HIV Infection Is Blocked In Vitro by Recombinant Soluble CD4”, Nature, 331, pp. 76-78 (1988)
    • Gimbrone, M. A., “Culture of Vascular Endothelium”, Prog. Hemostasis Thromb., 3, pp. 1-28 (1976)
    • Goding, W., ed., Monoclonal Antibodies: Principles and Practice, (Academic Press, New York, 1983)
    • Goldenberg, D. M., “Targeted Cancer Treatment,” Immunology Today, 10, pp. 286-88 (1989)
    • Gubler, U. and Hoffman, B. J., “A Simple and Very Efficient Method for Generating cDNA Libraries”, Gene, 25, pp. 263-69 (1983)
    • Hambor, J. E., et al., “Functional Consequences of Anti-Sense RNA-Mediated Inhibition of CD8 Surface Expression in a Human T Cell Clone,” J. Exp. Med., 168, pp. 1237-45 (1988)
    • Harlan, J. M., “Leukocyte-Endothelial Interactions,” Blood, 65, pp. 513-25 (1985) (“Harlan I”)
    • Harlan, J. M., “Neutrophil-Mediated Vascular Injury”, Acta Med. Scand. Suppl., 715, pp. 123-29 (1987) (“Harlan II”)
    • Harlan, J. M., et al., “The Role of Neutrophil Membrane Proteins in Neutrophil Emigration#” in Leukocyte Emigration and Its Sequelae, H. Movat, ed. (S. Karger A G, Basel, Switzerland, 1987), pp. 94-104
    • Haselhoff, J., and W. L. Gerlach, “Simple RNA Enzymes with New and Highly Specific Endoribonuclease Activities,” Nature, 334, pp. 585-591 (1988)
    • Hedrick, S. M., et al., “Isolation of cDNA Clones Encoding T Cell-Specific Membrane-Associated Proteins,” Nature, 308, pp. 149-53 (1984)
    • Hemler, M. E., “Adhesion Protein Receptors on Hematopoietic Cells”, Immunol. Today, 9, pp. 109-113 (1988)
    • Hemler, M. E., et al., “The VLA Protein Family (Characterization of Five Distinct Cell Surface Heterodimers Each with a Common 130,000 Molecular Weight β Subunit),” J. Biol. Chem., 262, pp. 3300-09 (1987a)
    • Hemler, M. E., et al., “Characterization of the Cell Surface Heterodimer VLA-4 and Related Peptides,” J. Biol. Chem., 262, pp. 11478-85 (1987b)
    • Hirt, B., “Selective Extraction of Polyoma DNA from Infected Mouse Cell Cultures”, J. Mol. Biol., 26, pp. 365-69 (1967)
    • Hough, A. and L. Sokoloff, “Pathology”, Chap. 4, Rheumatoid Arthritis, P. D. Ustinger, N. J. Zugifler, and Ehrlich, G. E., eds., (Lippencott, Philadelphia, 1985), pp. 49-69
    • Hunkapiller, T. and L. Hood, “Diversity of the Immunoglobulin Gene Superfamily”, Adv. Immunol., 44, pp. 1-63 (1989)
    • Huse, W. D., et al., “Generation of a Large Combinatorial Library of the Immunoglobulin Repertoire in Phage Lambda,” Science, 246, pp. 1275-81 (1989)
    • Hynes, R. O., “Integrins: A Family of Cell Surface Receptors”, Cell, 48, pp. 549-554 (1987)
    • Kalderon et al., Nucl. Acids Res., 10, pp. 5161-71 (1982)
    • Kennedy, R. C., et al., “Anti-idiotypes and Immunity,” Sci. Am., 255, pp. 48-56 (July 1986)
    • Kukowska-Latallo, J. F., et al., “A Cloned Human cDNA Determines Expression of a Mouse Stage-specific Embryonic Antigen and the Lewis Blood Group α(1,3/1,4) Fucosyltransferase”, Genes and Development, 4, pp. 1288-1303 (1990)
    • Kurzinger, K., et al., “A Novel Lymphocyte Function-Associated Antigen (LFA-1): Cellular Distribution, Quantitative Expression, and Structure”, J. Immunol., 127, pp. 596-602 (1981)
    • Larsen, R. D., et al., “Molecular Cloning, Sequence, and Expression of a Human GPD-L-Fucose:β-D-Galactoside 2-α-L-Fucosyltransferase cDNA That Can Form the H Blood Group Antigen”, Proc. Natl. Acad. Sci. USA, 87, pp. 6674-6678 (1990)
    • Lehrach, H., et al., “RNA Molecular Weight Determinations by Gel Electrophoresis under Denaturing Conditions, a Critical Reexamination”, Biochem., 16, pp. 4743-51 (1977)
    • Lenardo, M. J. and D. Baltimore, “NF-κB: A Pleiotropic Mediator of Inducible and Tissue Specific Gene Control,” Cell, 58, pp. 227-30 (1989)
    • Malech, H. L. and Gallin, J. I., “Neutrophils in Human Diseases”, N. Eng. J. Med., 317, pp. 687-94 (1987)
    • Maniatis, T., et al., Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 1982)
    • Marcantonio, E. E., and R. O. Hynes, “Antibodies to the Conserved Cytoplasmic Domain of the Integrin β-1 Subunit React with Proteins in Vertebrates, Invertebrates and Fungi,” J. Cell. Biol, 106, pp. 1765-72 (1988)
    • Marcus-Sekura, C. J., “Techniques for Using Antisense Oligonucleotides to Study Gene Expression,” Anal. Biochem., 172, pp. 289-95 (1988)
    • Marlin, S. D., and T. A. Springer, “Purified Intercellular Adhesion Molecule-1 (ICAM-1) Is a Ligand for Lymphocyte Function-Associated Antigen 1 (LFA-1),” Cell, 51, pp. 813-9 (1987)
    • Maxam, A. and W. Gilbert, “Sequencing End-Labeled DNA with Base-Specific Chemical Cleavages”, Methods in Enzymol., 65, pp. 499-560 (1980)
    • Morinaga et al., “Improvement of Oligonucleotide-Directed Site-Specific Mutagenesis Using Double-Stranded Plasmid DNA,” Bio/Technology, 2, pp. 636-9 (1984)
    • Oostra et al., “Transforming Activity of Polyoma Virus Middle-T Antigen Probed by Site-Directed Mutagenesis,” Nature, 304, pp. 456-60 (1983)
    • Osborn, L., et al., “Tumor Necrosis Factor α and Interleukin 1 Stimulate the Human Immunodeficiency Virus Enhancer by Activation of the Nucleus Factor κB,” Proc. Natl. Acad. Sci. U.S.A., 86, pp. 2336-40 (1989)
    • Paulson, J. C., and K. J. Colley, “Glycosyltransferases: Structure, Localization, and Control of Cell Type-specific Glycosylation”, J. Biol. Chem., 264, pp. 17615-17618 (1989)
    • Peden, K. W. C. and D. Nathans, “Local Mutagenesis Within Deletion Loops of DNA Heteroduplexes,” Proc. Natl. Acad. Sci., U.S.A., 79, 7214-17 (1982)
    • Pober, J. S., et al., “Overlapping Patterns of Activation of Human Endothelial Cells by Interleukin 1, Tumor Necrosis Factor, and Immune Interferon,” J. Immunol., 137, pp. 1895-6 (1986)
    • Ross, R., “The Pathogenesis of Atherosclerosis—An Update”, N. Eng. J. Med, 314, pp. 488-500 (1986)
    • Rothlein, R., et al., “A Human Intercellular Adhesion Molecule (ICAM-1) Distinct from LFA-1,” J. Immunol., 137, pp. 1270-4 (1986)
    • Ruoslahti, E., “Fibronectin and its Receptors”, Ann. Rev. Biochem., 57, pp. 375-413 (1988)
    • Sambrook, J., et al., “In Vitro Amplification of DNA by Polymerase Chain Reaction,” Chapter 14 in Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989)
    • Sandri-Goldin, R. M., et al., “High Frequency Transfer of Cloned Herpes Simplex Virus Type I Sequences to Mammalian Cells by Protoplast Fusion”, Molec. and Cell Biol., 1, pp. 743-52 (1981)
    • Sargent, T. D., “Isolation of Differentially Expressed Genes”, Methods in Enzymol., 152, pp. 423-47 (1987)
    • Sato, K., et al., “A Specific DNA Sequence Controls Termination of Transcription in the Gastrin Gene,” Molec. and Cell Biol., 6, pp. 1032-43 (1986)
    • Schneider, C., et al., “A One-Step Purification of Membrane Proteins Using a High Efficiency Immunomatrix” J. Biol. Chem., 257, pp. 10766-69 (1982)
    • Seed, B., “An LFA-3 cDNA Encodes a Phospholipid-Linked Membrane Protein Homologous to Its Receptor CD2”, Nature, 329, pp. 840-42 (1987)
    • Seed, B. and A. Aruffo, “Molecular Cloning of the CD2 Antigen, the T-cell Erythrocyte Receptor, by a Rapid Immunoselection Procedure”, Proc. Natl. Acad. Sci. USA, 84, pp. 3365-69 (1987)
    • Skerra, A. and A. Pluckthun, “Assembly of a Functional Immunoglobulin Fv Fragment in Escherichia coli,” Science, 240, pp. 1038-1043 (1988)
    • Simmons et al., “ICAM, an Adhesion Ligand of LFA-1, Is Homologous to the Neural Cell Adhesion Molecule NCAM,” Nature, 331, pp. 624-47 (1988)
    • Smith, C. W., et al., “Cooperative Interactions of LFA-1 and Mac-1 with Intercellular Adhesion Molecule 1 in Facilitating Adherence and Transendothelial Cell Migration of Human Neutrophils in Vitro,” J. Clin. Invest., 83, pp. 2008-17 (1989)
    • Springer, T. A., et al., “The Lymphocyte Function-Associated LFA-1, CD2, and LFA-3 Molecules: Cell Adhesion Receptors of the Immune System”, Ann. Rev. Immunol., 5, pp. 223-252 (1987)
    • Staunton, D. E., et al., “Primary Structure of ICAM-1 Demonstrates Interaction Between Members of the Immunoglobulin and Integrin Supergene Families”, Cell, 52, pp. 925-33 (1988)
    • Subramani, S., et al., “Expression of the Mouse Dihydrofolate Reductase Complementary Deoxyribonucleic Acid in Simian Virus 40 Vectors,” Molec. Cell. Biol., 1, pp. 854-64 (1981)
    • Takada, Y., and M. E. Hemler, “The Primary Structure of the VLA-2/Collagen Receptor α2 Subunit (Platelet GP Ia): Homology to Other Integrins and the Presence of a Possible Collagen-Binding Domain,” J. Cell. Biol., 109, pp. 397-407 (1989)
    • Takada, Y., et al., “The Primary Structure of the α4 Subunit of VLA-4: Homology to Other Integrins and a Possible Cell-Cell Adhesion Function,” EMBO J., 8, pp. 1361-68 (1989)
    • Thomas, H. and Sikora, K., “Biological Approaches to Cancer Therapy”, J. Intl. Med. Res., 17, pp. 191-204 (1989)
    • Todd III, R. F., et al., “The Anti-Inflammatory Properties of Monoclonal Anti-Mol (CD11B/CD18) Antibodies in Vitro and in Vivo,” in Structure and Function of Molecules Involved in Leukocyte Adhesion, Rosenthal et al., Eds., Springer-Verlag, New York (1989) in press
    • Vedder, N. B., et al., “A Monoclonal Antibody to the Adherence-Promoting Leukocyte Glycoprotein, CD18, Reduces organ Injury and Improves Survival from Hemorrhagic Shock and Resuscitation in Rabbits”, J. Clin. Invest., 81, pp. 939-44 (1988)
    • von Heijne, G., “A Method for Predicting Signal Sequence Cleavage Sites”, Nucl. Acids Res., 14, pp. 4693-90 (1986)
    • Ward, E. S., et al., “Binding Activities of a Repertoire of Single Immunoglobulin Variable Domains Secreted from Escherichia coli,” Nature, 341, pp. 544-46 (1989)
    • Wallis, W. J., and J. M. Harlan, “Effector Functions of Endothelium in Inflammatory and Immunologic Reactions,” Pathol. Immunopathol. Res., 5, pp. 73-103 (1986)
    • Wayner, E. A., et al., “Identification and Characterization of the Lymphocyte Adhesion Receptor for an Alternative Cell Attachment Domain in Plasma Fibronectin,” J. Cell. Biol., in press (1989)
    • Weintraub, H. M., “Antisense RNA and DNA,” Sci. Am., 262, pp. 40-46 (January 1990)
    • Wheeler, M. E., et al., “Cultured Human Endothelial Cells Stimulated with Cytokines or Endotoxin Produce an Inhibitor of Leukocyte Adhesion”, J. Clin. Invest., 82, pp. 1211-18 (1988)
    • White, J. and D. Littman, “Viral Receptors of the Immunoglobulin Superfamily”, Cell, 56, pp. 725-28 (1989)
    • Williams, A. and Barclay, A. N., “The Immunoglobulin Superfamily—Domains for Cell Surface Recognition”, Ann. Rev. Immunol., 6, pp. 381-405 (1988)
    • Wong, C.-H., “Enzymatic Catalysts in Organic Synthesis”, Science, 244, pp. 1145-1152 (1989)
    • Wysocki, L. J. and V. L. Sato, “‘Panning’ for Lymphocytes: A Method for Cell Selection”, Proc. Natl. Acad. Sci. USA, 75, pp. 2844-48 (1978)
    • Yamasaki, K., et al., “Cloning and Expression of the Human Interleukin-6 (BSF-2/IFNB2) Receptor”, Science, 241, pp. 825-28 (1988)
    • Young, R. A. and R. W. Davis, “Efficient Isolation of Genes by Using Antibody Probes”, Proc. Natl. Acad. Sci. USA, 80, pp. 1194-98 (1983) (“Young I”)
    • Young, R. A. and R. W. Davis, “Yeast RNA Polymerase II Genes: Isolation with Antibody Probes”, Science, 222, pp. 778-82 (1984) (“Young II”)
      Foreign Patent Application
    • Hemler, M. E. and Y. Takada, “VLA Proteins,” EP 330,506, published Aug. 30, 1989.

Claims (1)

1. An isolated antibody that specifically binds to VCAM1.
US11/447,664 1989-04-28 2006-06-06 Endothelial cell-leukocyte adhesion molecules (ELAMs) and molecules involved in leukocyte adhesion (MILAs) Abandoned US20070149769A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US11/447,664 US20070149769A1 (en) 1989-04-28 2006-06-06 Endothelial cell-leukocyte adhesion molecules (ELAMs) and molecules involved in leukocyte adhesion (MILAs)

Applications Claiming Priority (10)

Application Number Priority Date Filing Date Title
US07/345,151 US5217870A (en) 1989-04-28 1989-04-28 Monoclonal antibodies against CDX
US35951689A 1989-06-01 1989-06-01
US07/452,675 US5272263A (en) 1989-04-28 1989-12-18 DNA sequences encoding vascular cell adhesion molecules (VCAMS)
USPCT/US90/02357 1990-04-27
PCT/US1990/002357 WO1990013300A1 (en) 1989-04-28 1990-04-27 ENDOTHELIAL CELL-LEUKOCYTE ADHESION MOLECULES (ELAMs) AND MOLECULES INVOLVED IN LEUKOCYTE ADHESION (MILAs)
US60829890A 1990-10-31 1990-10-31
US34264294A 1994-11-21 1994-11-21
US47376495A 1995-06-07 1995-06-07
US10/234,041 US20030153731A1 (en) 1989-04-28 2002-09-03 Endothelial cell-leukocyte adhesion molecules (ELAMs) and molecules involved in leukocyte adhesion (MILAs)
US11/447,664 US20070149769A1 (en) 1989-04-28 2006-06-06 Endothelial cell-leukocyte adhesion molecules (ELAMs) and molecules involved in leukocyte adhesion (MILAs)

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US10/234,041 Continuation US20030153731A1 (en) 1989-04-28 2002-09-03 Endothelial cell-leukocyte adhesion molecules (ELAMs) and molecules involved in leukocyte adhesion (MILAs)

Publications (1)

Publication Number Publication Date
US20070149769A1 true US20070149769A1 (en) 2007-06-28

Family

ID=27407673

Family Applications (4)

Application Number Title Priority Date Filing Date
US07/452,675 Expired - Lifetime US5272263A (en) 1989-04-28 1989-12-18 DNA sequences encoding vascular cell adhesion molecules (VCAMS)
US08/035,674 Expired - Lifetime US5367056A (en) 1989-04-28 1993-03-23 Endothelial cell-leukocyte adhesion molecules (ELAMs) and molecules involved in leukocyte adhesion (MILAs)
US08/310,890 Expired - Lifetime US6252043B1 (en) 1989-04-28 1994-09-22 Vascular cell adhesion molecule (VCAM) polypeptides
US11/447,664 Abandoned US20070149769A1 (en) 1989-04-28 2006-06-06 Endothelial cell-leukocyte adhesion molecules (ELAMs) and molecules involved in leukocyte adhesion (MILAs)

Family Applications Before (3)

Application Number Title Priority Date Filing Date
US07/452,675 Expired - Lifetime US5272263A (en) 1989-04-28 1989-12-18 DNA sequences encoding vascular cell adhesion molecules (VCAMS)
US08/035,674 Expired - Lifetime US5367056A (en) 1989-04-28 1993-03-23 Endothelial cell-leukocyte adhesion molecules (ELAMs) and molecules involved in leukocyte adhesion (MILAs)
US08/310,890 Expired - Lifetime US6252043B1 (en) 1989-04-28 1994-09-22 Vascular cell adhesion molecule (VCAM) polypeptides

Country Status (13)

Country Link
US (4) US5272263A (en)
EP (3) EP0458911B1 (en)
JP (6) JPH04502859A (en)
KR (3) KR100186800B1 (en)
AT (3) ATE419275T1 (en)
AU (1) AU638041B2 (en)
CA (1) CA2031518C (en)
DE (3) DE69034261D1 (en)
DK (2) DK0807683T3 (en)
ES (1) ES2249791T3 (en)
MX (1) MX9203137A (en)
NO (1) NO905553L (en)
WO (1) WO1990013300A1 (en)

Families Citing this family (158)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5776775A (en) * 1989-02-21 1998-07-07 Dana-Farber Cancer Institute Anti-LAM 1-3 antibody and hybridoma
US5272263A (en) * 1989-04-28 1993-12-21 Biogen, Inc. DNA sequences encoding vascular cell adhesion molecules (VCAMS)
US6307025B1 (en) * 1989-04-28 2001-10-23 Biogen, Inc. VCAM fusion proteins and DNA coding therefor
EP0583799A1 (en) * 1989-05-23 1994-02-23 Otsuka Pharmaceutical Co., Ltd. Monoclonal antibodies to ELAM-1 sialoglycoprotein antigen on the surface of activated endothelial cells
US7238668B1 (en) 1989-09-01 2007-07-03 Fred Hutchinson Cancer Research Center Inhibition of lymphocyte adherence with CS-1-peptides and fragments thereof
US5730978A (en) * 1989-09-01 1998-03-24 Fred Hutchinson Cancer Research Center Inhibition of lymphocyte adherence with α4β1-specific antibodies
US6033665A (en) * 1989-09-27 2000-03-07 Elan Pharmaceuticals, Inc. Compositions and methods for modulating leukocyte adhesion to brain endothelial cells
US6753423B1 (en) 1990-01-11 2004-06-22 Isis Pharmaceuticals, Inc. Compositions and methods for enhanced biostability and altered biodistribution of oligonucleotides in mammals
US5514788A (en) * 1993-05-17 1996-05-07 Isis Pharmaceuticals, Inc. Oligonucleotide modulation of cell adhesion
US20040142899A1 (en) * 1990-01-11 2004-07-22 Isis Pharmaceuticals, Inc. Compositions and methods for enhanced biostability and altered biodistribution of oligonucleotides in mammals
US5595900A (en) * 1990-02-14 1997-01-21 The Regents Of The University Of Michigan Methods and products for the synthesis of oligosaccharide structures on glycoproteins, glycolipids, or as free molecules, and for the isolation of cloned genetic sequences that determine these structures
JPH05506856A (en) * 1990-03-02 1993-10-07 ブリガム・アンド・ウイメンズ・ホスピタル Mononuclear leukocyte-tropic endothelial adhesion molecules associated with atherosclerosis
WO1991016900A1 (en) * 1990-04-27 1991-11-14 Biogen, Inc. Fucosyl transferases involved in adhesion molecule expression
AU8007791A (en) * 1990-06-15 1992-01-07 Cytel Corporation Intercellular adhesion mediators
US5753631A (en) * 1990-06-15 1998-05-19 Cytel Corporation Intercellular adhesion mediators
US5576305A (en) * 1990-06-15 1996-11-19 Cytel Corporation Intercellular adhesion mediators
US6391857B1 (en) 1990-06-18 2002-05-21 Stanford University Methods and compositions for endothelial binding
US6387884B1 (en) 1990-06-18 2002-05-14 Stanford University Leukocyte homing modulation
DK162890D0 (en) * 1990-07-06 1990-07-06 Novo Nordisk As POLYPEPTIDE
US5211937A (en) * 1990-07-30 1993-05-18 Glycomed Incorporated Method of determining a site of inflammation utilizing elam-1 ligands
US5143712A (en) * 1990-07-30 1992-09-01 Glycomed Incorporated Method of determining a site of inflammation utilizing elam-1 ligands
US5211936A (en) * 1990-07-30 1993-05-18 Glycomed Incorporated Method of determining a cite of inflammation utilizing elam-1 ligands site
US5648344A (en) * 1990-07-30 1997-07-15 Glycomed Incorporated Methods of treating inflammation using selection binding compounds
US5827670A (en) * 1990-08-02 1998-10-27 Fred Hutchinson Cancer Research Center Methods of isolating and detecting bone marrow stromal cells with VCAM-1-specific antibodies
US7449186B1 (en) * 1990-08-02 2008-11-11 Fred Hutchinson Cancer Research Center Methods of blocking the interaction between stromal cells and hemopoietic cells with anti-VCAM-1 antibodies
US5843738A (en) * 1990-08-14 1998-12-01 Isis Pharmaceuticals, Inc. Oligonucleotide modulation of cell adhesion
JP2732544B2 (en) * 1990-08-14 1998-03-30 アイシス・ファーマシューティカルス・インコーポレーテッド Oligonucleotide modulation of cell adhesion
NZ240316A (en) * 1990-10-25 1996-12-20 Univ Michigan Compound for treating disease mediated by the elaboration of elam-1 on endothelial cells
WO1992009293A1 (en) * 1990-11-23 1992-06-11 The General Hospital Corporation Inhibition of cell adhesion protein-carbohydrate interactions
US5709859A (en) * 1991-01-24 1998-01-20 Bristol-Myers Squibb Company Mixed specificity fusion proteins
WO1992012729A1 (en) * 1991-01-24 1992-08-06 Cytel Corporation Monoclonal antibodies to elam-1 and their uses
US5807745A (en) * 1991-03-11 1998-09-15 New England Medical Center Hospitals, Inc. Method of inhibiting PADGEM-mediated or ELAM-1-mediated leukocyte adhesion using an inhibitor comprising a Lex core component
ATE338762T1 (en) * 1991-04-19 2006-09-15 Univ Leland Stanford Junior COMPOSITIONS AND METHODS FOR LINKING ENDOTHELIAL CELLS
US6121233A (en) 1991-04-19 2000-09-19 John L. Magnani Methods for the inhibition of cancer metastasis mediated by endothelial adhesion molecules
AU667813B2 (en) * 1991-05-03 1996-04-18 Rockefeller University, The Amino-acid sequence homologies between selectins and B pertussis toxin-peptides derived therefrom antibodies thereto pharmaceutical compositions
ES2201049T3 (en) * 1991-05-06 2004-03-16 Genentech, Inc. A BINDING OF SELECTINE.
US5318890A (en) * 1991-05-06 1994-06-07 The Regents Of The University Of California Assays for inhibitors of leukocyte adhesion
US5629162A (en) * 1991-06-11 1997-05-13 The Center For Blood Research Method of identifying agents which modulate ICAM-3 binding to LFA-1
GB9120767D0 (en) * 1991-09-30 1991-11-13 British Bio Technology Diagnostic and prognostic materials and methods
GB9120768D0 (en) * 1991-09-30 1991-11-13 British Bio Technology Diagnostic and prognastic materials and methods
US5871734A (en) * 1992-01-13 1999-02-16 Biogen, Inc. Treatment for asthma with VLA-4 blocking agents
US6100383A (en) * 1992-01-27 2000-08-08 Icos Corporation Fusion proteins comprising ICAM-R polypeptides and immunoglobulin constant regions
US6153395A (en) * 1992-01-27 2000-11-28 Icos Corporation ICAM-related protein
US5532127A (en) * 1992-01-27 1996-07-02 Icos Corporation Assay for 1-CAM related protein expression
US5753502A (en) * 1993-08-05 1998-05-19 Icos Corporation Neuron-specific ICAM-4 promoter
US6818743B1 (en) 1992-01-27 2004-11-16 Icos Corporation I-CAM related protein
US5811517A (en) * 1992-01-27 1998-09-22 Icos Corporation ICAM-related protein variants
US5700658A (en) * 1992-01-27 1997-12-23 Icos Corporation ICAM-4 materials and methods
US5989843A (en) * 1992-01-27 1999-11-23 Icos Corporation Methods for identifying modulators of protein kinase C phosphorylation of ICAM-related protein
US5837822A (en) * 1992-01-27 1998-11-17 Icos Corporation Humanized antibodies specific for ICAM related protein
US5702917A (en) * 1992-01-27 1997-12-30 Icos Corporation Polynucleotides encoding human ICAM-4
US5852170A (en) * 1992-01-27 1998-12-22 Icos Corporation ICAM-4 materials and methods
US5773293A (en) * 1992-01-27 1998-06-30 Icos Corporation Anti-ICAM-4 antibodies and hybridomas
WO1993014776A1 (en) * 1992-01-27 1993-08-05 Icos Corporation Icam-related protein
US5525487A (en) * 1992-01-27 1996-06-11 Icos Corporation DNA encoding I-CAM related protein
US5932214A (en) 1994-08-11 1999-08-03 Biogen, Inc. Treatment for inflammatory bowel disease with VLA-4 blockers
CA2452130A1 (en) * 1992-03-05 1993-09-16 Francis J. Burrows Methods and compositions for targeting the vasculature of solid tumors
US5877289A (en) * 1992-03-05 1999-03-02 The Scripps Research Institute Tissue factor compositions and ligands for the specific coagulation of vasculature
US6036955A (en) * 1992-03-05 2000-03-14 The Scripps Research Institute Kits and methods for the specific coagulation of vasculature
US5965132A (en) 1992-03-05 1999-10-12 Board Of Regents, The University Of Texas System Methods and compositions for targeting the vasculature of solid tumors
US6749853B1 (en) 1992-03-05 2004-06-15 Board Of Regents, The University Of Texas System Combined methods and compositions for coagulation and tumor treatment
US5660827A (en) * 1992-03-05 1997-08-26 Board Of Regents, The University Of Texas System Antibodies that bind to endoglin
US6093399A (en) * 1992-03-05 2000-07-25 Board Of Regents, The University Of Texas System Methods and compositions for the specific coagulation of vasculature
US6004555A (en) * 1992-03-05 1999-12-21 Board Of Regents, The University Of Texas System Methods for the specific coagulation of vasculature
US5728802A (en) * 1992-05-06 1998-03-17 Affymax Technologies N.V. Peptides and compounds that bind selectins including endothelium leukocyte adhesion molecule 1 (ELAM-1)
US5648458A (en) * 1992-05-06 1997-07-15 Affymax Technologies N.V. Peptides and compounds that bind to ELAM-1
US5643873A (en) * 1992-05-06 1997-07-01 Affymax Technologies N.V. Peptides and compounds that bind selectins including endothelial leukocyte adhesion molecule 1
EP0654077A4 (en) * 1992-07-17 1996-03-13 Ribozyme Pharm Inc Method and reagent for treatment of animal diseases.
US5585479A (en) * 1992-07-24 1996-12-17 The United States Of America As Represented By The Secretary Of The Navy Antisense oligonucleotides directed against human ELAM-I RNA
US5596090A (en) * 1992-07-24 1997-01-21 The United States Of America As Represented By The Secretary Of The Navy Antisense oligonucleotides directed against human VCAM-1 RNA
AU673193B2 (en) * 1992-09-02 1996-10-31 Isis Pharmaceuticals, Inc. Oligonucleotide modulation of cell adhesion
SG44845A1 (en) * 1993-01-12 1997-12-19 Biogen Inc Recombitant anti-vla4 antibody molecules
US5412123A (en) * 1993-02-08 1995-05-02 Glycomed Incorporated Anthraquinone and anthracene derivatives as inhibitors of the cell-adhesion molecules of the immune system
AU687790B2 (en) * 1993-02-09 1998-03-05 Biogen Idec Ma Inc. Treatment for insulin dependent diabetes
US5789385A (en) * 1993-06-16 1998-08-04 Glycomed Incorporated Sialyl Lewisx mimetics containing phenyl backbones
US5837689A (en) * 1993-06-16 1998-11-17 Glycomed Incorporated Sialyl lewis-x mimetics containing naphthyl backbones
US5658880A (en) * 1993-06-16 1997-08-19 Glycomed Incorporated Sialic acid/fucose based medicaments
US5508387A (en) * 1993-08-04 1996-04-16 Glycomed Incorporated Selectin binding glycopeptides
CA2175824A1 (en) * 1993-11-12 1995-05-18 Kenneth G. Draper Method and reagent for treatment of arthritic conditions
US5677291A (en) * 1993-12-10 1997-10-14 Hoechst Marion Roussel, Inc. Method of lowering serum cholesterol levels with 2,6-di-alkyl-4-silyl-phenols
US5681699A (en) * 1994-02-11 1997-10-28 Cedars-Sinai Medical Center Methods of diagnosing ulcerative colitis and Crohn's disease
US6884590B1 (en) 1994-02-11 2005-04-26 Cedars-Sinai Medical Center Methods of screening for ulcerative colitis and crohn's disease
US5691180A (en) * 1994-06-09 1997-11-25 The Regents Of The University Of Michigan DNA sequence encoding N-acetyl-galactosamine-transferase
US6152141A (en) * 1994-07-28 2000-11-28 Heartport, Inc. Method for delivery of therapeutic agents to the heart
US5807732A (en) * 1995-02-28 1998-09-15 Lowe; John B. GDP-L-fucose: β-D-galactoside 2-α-L-fucosyltransferases, DNA sequences encoding the same, method for producing the same and a method of genotyping a person
JP4347412B2 (en) * 1995-06-20 2009-10-21 ロッシュ ディアグノスティクス ゲゼルシャフト ミット ベシュレンクテル ハフツング Novel immunoregulatory protein LST-1
EP0750039A1 (en) * 1995-06-20 1996-12-27 Boehringer Mannheim Gmbh Immunoregulatory protein LST-1
US5770420A (en) * 1995-09-08 1998-06-23 The Regents Of The University Of Michigan Methods and products for the synthesis of oligosaccharide structures on glycoproteins, glycolipids, or as free molecules, and for the isolation of cloned genetic sequences that determine these structures
US6033663A (en) * 1996-04-10 2000-03-07 Neose Technologies, Inc. Nucleic acids encoding GDP-Fucose pyrophosphorylase
US5795876A (en) * 1996-04-30 1998-08-18 Hoechst Marion Rousssel, Inc. Method of inhibiting vascular cell adhesion molecule-1 and treating chronic inflammatory diseases with 2, 6-di-alkyl-4-silyl-phenols
US5608095A (en) * 1996-04-30 1997-03-04 Hoechst Marion Roussel, Inc. Alkyl-4-silyl-phenols and esters thereof as antiatherosclerotic agents
US6960656B1 (en) 1996-10-25 2005-11-01 Cedars Sinai Medical Center Nucleic acid encoding DS-CAM proteins and products related thereto
US6114572A (en) * 1996-11-20 2000-09-05 Hoechst Marion Roussel, Inc. Substituted phenols and thiophenols useful as antioxidant agents
US6121463A (en) * 1997-06-24 2000-09-19 Hoechst Marion Roussel, Inc. Alkyl-4-silylheterocyclic phenols and thiophenols useful as antioxidant agents
US6133467A (en) * 1997-06-25 2000-10-17 Hoechst Marion Roussel, Inc. 2,6-di-t-butyl-4-[(dimethyl-4-methoxyphenylsilyl)-methyl-oxy]phenol and 2,6-di-t-butyl-4-[(dimethyl-2-methoxy-phenylsilyl)methyloxy]phenol
WO1999012579A1 (en) 1997-09-08 1999-03-18 The General Hospital Corporation Imaging agents for early detection and monitoring of cardiovascular plaque
US6537520B1 (en) 1998-03-31 2003-03-25 Bristol-Myers Squibb Pharma Company Pharmaceuticals for the imaging of angiogenic disorders
US6548663B1 (en) 1998-03-31 2003-04-15 Bristol-Myers Squibb Pharma Company Benzodiazepine vitronectin receptor antagonist pharmaceuticals
US6524553B2 (en) 1998-03-31 2003-02-25 Bristol-Myers Squibb Pharma Company Quinolone vitronectin receptor antagonist pharmaceuticals
US6818213B1 (en) 1998-07-13 2004-11-16 Board Of Regents, The University Of Texas System Cancer treatment compositions comprising therapeutic conjugates that bind to aminophospholipids
WO2000002587A1 (en) 1998-07-13 2000-01-20 Board Of Regents, The University Of Texas System Cancer treatment methods using therapeutic conjugates that bind to aminophospholipids
CZ302997B6 (en) 1998-09-14 2012-02-15 Board Of Regents, The University Of Texas System Use of antibody or antigen-binding fragment thereof for preparing pharmaceutical composition
US7618630B2 (en) * 1998-09-14 2009-11-17 Board Of Regents, The University Of Texas System Methods of treating multiple myeloma and myeloma-induced bone resorption using integrin antagonists
US6511649B1 (en) 1998-12-18 2003-01-28 Thomas D. Harris Vitronectin receptor antagonist pharmaceuticals
EP1140864A2 (en) 1998-12-18 2001-10-10 Du Pont Pharmaceuticals Company Vitronectin receptor antagonist pharmaceuticals
US6794518B1 (en) 1998-12-18 2004-09-21 Bristol-Myers Squibb Pharma Company Vitronectin receptor antagonist pharmaceuticals
WO2000035492A2 (en) 1998-12-18 2000-06-22 Du Pont Pharmaceuticals Company Vitronectin receptor antagonist pharmaceuticals
US6569402B1 (en) 1998-12-18 2003-05-27 Bristol-Myers Squibb Pharma Company Vitronectin receptor antagonist pharmaceuticals
JP2003506491A (en) 1999-08-13 2003-02-18 バイオジェン インコーポレイテッド Cell adhesion inhibitor
DE60027907T2 (en) * 1999-09-14 2007-01-04 Biogen Idec Ma Inc., Cambridge THERAPIES FOR CHRONIC KIDNEY INUFFICIENCY USING ONE OR MORE INTEGRINANT AGONIST (DE)
JP2001104636A (en) * 1999-10-04 2001-04-17 Shinsedai Kk Cenesthesic ball game device
US20060115473A1 (en) * 2000-12-14 2006-06-01 Biogen Idec Ma Inc., A Massachusetts Corporation Methods of treating central nervous system ischemic or hemorrhagic injury using anti alpha4 integrin antagonists
US20020004247A1 (en) * 1999-12-23 2002-01-10 Genentech, Inc. Assay method
JP3459609B2 (en) * 2000-03-17 2003-10-20 三洋電機株式会社 Write cache circuit, recording device provided with write cache circuit, and write cache method
HUP0300810A2 (en) * 2000-07-20 2003-08-28 M.G.V.S. Ltd. Artifical vascular grafts, and methods of producing and using same
US7491506B2 (en) * 2001-06-21 2009-02-17 The Regents Of The University Of California Inhibition of B-cell maturation and antibody production
US7824680B2 (en) * 2001-08-06 2010-11-02 The Regents Of The University Of California Methods for inhibiting angiogenesis
US7056679B2 (en) * 2001-10-24 2006-06-06 Antyra, Inc. Target specific screening and its use for identifying target binders
US20030191075A1 (en) * 2002-02-22 2003-10-09 Cook Phillip Dan Method of using modified oligonucleotides for hepatic delivery
US9403908B2 (en) * 2003-09-29 2016-08-02 The Regents Of The University Of California Method for altering hematopoietic progenitor cell adhesion, differentiation, and migration
US7129042B2 (en) * 2003-11-03 2006-10-31 Diagnostic Hybrids, Inc. Compositions and methods for detecting severe acute respiratory syndrome coronavirus
CA2478458A1 (en) * 2004-08-20 2006-02-20 Michael Panzara Treatment of pediatric multiple sclerosis
US20090202527A1 (en) * 2004-11-19 2009-08-13 Biogen Idec Ma Inc. Treatment for multiple sclerosis
US7740856B2 (en) * 2005-12-20 2010-06-22 Isu Abxis Co., Ltd. Effect of BST2 on inflammation
US8329186B2 (en) * 2004-12-20 2012-12-11 Isu Abxis Co., Ltd Treatment of inflammation using BST2 inhibitor
US20080299128A1 (en) * 2006-06-20 2008-12-04 Myung Kim Effect of Bst2 on inflammation
US7728117B2 (en) 2005-09-02 2010-06-01 Glycomimetics, Inc. Heterobifunctional pan-selectin inhibitors
CN101278012A (en) 2005-09-28 2008-10-01 拜奥瓦斯库勒公司 Methods and compositions for blocking platelet and cell adhesion, cell migration and inflammation
US20110034396A1 (en) * 2005-09-28 2011-02-10 Biovascular, Inc. Methods and compositions for inhibiting cell migration and treatment of inflammatory conditions
US8808698B2 (en) * 2006-02-03 2014-08-19 The Regents Of The University Of California Methods for inhibition of lymphangiogenesis and tumor metastasis
WO2008116150A2 (en) 2007-03-21 2008-09-25 Cedars-Sinai Medical Center Ileal pouch-anal anastomosis (ipaa) factors in the treatment of inflammatory bowel disease
KR20160040739A (en) * 2007-11-07 2016-04-14 안트로제네시스 코포레이션 Use of umbilical cord blood in the treatment of premature birth complications
WO2009126556A1 (en) 2008-04-08 2009-10-15 Glycomimetics, Inc. Pan-selectin inhibitor with enhanced pharmacokinetic activity
WO2010062960A2 (en) 2008-11-26 2010-06-03 Cedars-Sinai Medical Center METHODS OF DETERMINING RESPONSIVENESS TO ANTI-TNFα THERAPY IN INFLAMMATORY BOWEL DISEASE
US9580752B2 (en) 2008-12-24 2017-02-28 Cedars-Sinai Medical Center Methods of predicting medically refractive ulcerative colitis (MR-UC) requiring colectomy
WO2010121141A1 (en) * 2009-04-17 2010-10-21 Biogen Idec Ma Inc. Compositions and methods to treat acute myelogenous leukemia
US8709801B2 (en) 2009-12-29 2014-04-29 Taipei Medical University Kit and method for the capture of tumor cells
TWI474000B (en) * 2009-12-30 2015-02-21 Univ Taipei Medical Kit and method for the capture of tumor cells
SG10201502967RA (en) 2010-04-16 2015-05-28 Biogen Ma Inc Anti-vla-4 antibodies
US8921328B2 (en) 2010-09-14 2014-12-30 Glycomimetics, Inc. E-selectin antagonists
CN103561761A (en) 2011-03-23 2014-02-05 加利福尼亚大学董事会 Methods and compositions for improving antiangiogenic therapy with anti-integrins
WO2013096926A1 (en) 2011-12-22 2013-06-27 Glycomimetics, Inc. E-selectin antagonist compounds, compositions, and methods of use
ES2668045T3 (en) 2012-12-07 2018-05-16 Glycomimetics, Inc. Compounds, compositions and methods that use E-selectin antagonists for the mobilization of hematopoietic cells
JP6671276B2 (en) 2013-03-27 2020-03-25 セダーズ−シナイ メディカル センター Alleviation and recovery of fibrosis and inflammation by suppression of TL1A function and related signaling pathways
EP3022295A4 (en) 2013-07-19 2017-03-01 Cedars-Sinai Medical Center Signature of tl1a (tnfsf15) signaling pathway
SI3227310T1 (en) 2014-12-03 2019-11-29 Glycomimetics Inc Heterobifunctional inhibitors of e-selectins and cxcr4 chemokine receptors
US10947311B2 (en) 2015-11-20 2021-03-16 The Board Of Trustees Of The Leland Stanford Junior University VCAM-1 mediated methods and compositions for treating aging-associated impairments
EP3405473A1 (en) 2016-01-22 2018-11-28 GlycoMimetics, Inc. Glycomimetic inhibitors of pa-il and pa-iil lectins
US11291678B2 (en) 2016-03-02 2022-04-05 Glycomimetics, Inc Methods for the treatment and/or prevention of cardiovascular disease by inhibition of E-selectin
KR102464372B1 (en) 2016-03-17 2022-11-04 세다르스-신나이 메디칼 센터 Methods of diagnosing inflammatory bowel disease through rnaset2
WO2018031445A1 (en) 2016-08-08 2018-02-15 Glycomimetics, Inc. Combination of t-cell checkpoint inhibitors with inhibitors of e-selectin or cxcr4, or with heterobifunctional inhibitors of both e-selectin and cxcr4
CA3037850A1 (en) 2016-10-07 2018-04-12 Glycomimetics, Inc. Highly potent multimeric e-selectin antagonists
CA3054605A1 (en) 2017-03-15 2018-09-20 Glycomimetics, Inc. Galactopyranosyl-cyclohexyl derivatives as e-selectin antagonists
WO2019108750A1 (en) 2017-11-30 2019-06-06 Glycomimetics, Inc. Methods of mobilizing marrow infiltrating lymphocytes and uses thereof
EP3732186A1 (en) 2017-12-29 2020-11-04 GlycoMimetics, Inc. Heterobifunctional inhibitors of e-selectin and galectin-3
AU2019230013A1 (en) 2018-03-05 2020-09-10 Glycomimetics, Inc. Methods for treating acute myeloid leukemia and related conditions
US11845771B2 (en) 2018-12-27 2023-12-19 Glycomimetics, Inc. Heterobifunctional inhibitors of E-selectin and galectin-3
JP7449390B2 (en) 2020-01-24 2024-03-13 ファイザー・インク Anti-E-selectin antibodies, compositions and methods of use

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5011778A (en) * 1989-05-23 1991-04-30 Otsuka Pharmaceutical Co., Ltd. Monoclonal antibodies directed to IL-1 activated endothelial cells and medicaments employing the monoclonal antibodies
US5367056A (en) * 1989-04-28 1994-11-22 Biogen, Inc. Endothelial cell-leukocyte adhesion molecules (ELAMs) and molecules involved in leukocyte adhesion (MILAs)
US5821340A (en) * 1989-02-14 1998-10-13 Brigham & Women's Hospital Inducible endothelial surface protein mediating lymphoid and tumor cell adhesion: antibodies and uses

Family Cites Families (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4769320A (en) * 1982-07-27 1988-09-06 New England Medical Center Hospitals, Inc. Immunoassay means and methods useful in human native prothrombin and human abnormal prothorombin determinations
US4752569A (en) 1984-06-21 1988-06-21 The Regents Of The University Of California Sialylated Lewisx epitope, antibodies and diagnosis
US4783330A (en) * 1984-11-15 1988-11-08 New England Medical Center Hospitals, Inc. Monoclonal antibodies to activated platelets
DE3642096A1 (en) * 1986-12-10 1988-06-16 Boehringer Ingelheim Int HORSE (GAMMA) INTERFERON
US5284931A (en) * 1987-05-04 1994-02-08 Dana Farber Cancer Institute Intercellular adhesion molecules, and their binding ligands
US4865971A (en) * 1987-06-30 1989-09-12 Coulter Corporation Monoclonal antibody specific to a common determinant site of neutrophils and eosinophils
US5019648A (en) * 1987-07-06 1991-05-28 Dana-Farber Cancer Institute Monoclonal antibody specific for the adhesion function domain of a phagocyte cell surface protein
EP0330506A3 (en) * 1988-02-26 1990-06-20 Dana Farber Cancer Institute Vla proteins
US5081034A (en) * 1988-11-14 1992-01-14 Brigham & Women's Hospital Cloned genes which encode elam-1
US5098833A (en) * 1989-02-23 1992-03-24 Genentech, Inc. DNA sequence encoding a functional domain of a lymphocyte homing receptor
US5225538A (en) * 1989-02-23 1993-07-06 Genentech, Inc. Lymphocyte homing receptor/immunoglobulin fusion proteins
EP0583799A1 (en) * 1989-05-23 1994-02-23 Otsuka Pharmaceutical Co., Ltd. Monoclonal antibodies to ELAM-1 sialoglycoprotein antigen on the surface of activated endothelial cells

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5821340A (en) * 1989-02-14 1998-10-13 Brigham & Women's Hospital Inducible endothelial surface protein mediating lymphoid and tumor cell adhesion: antibodies and uses
US6166179A (en) * 1989-02-14 2000-12-26 Brigham & Women's Hospital Inducible endothelial surface protein mediating melanoma cell adhesion, antibodies, and uses
US5367056A (en) * 1989-04-28 1994-11-22 Biogen, Inc. Endothelial cell-leukocyte adhesion molecules (ELAMs) and molecules involved in leukocyte adhesion (MILAs)
US5011778A (en) * 1989-05-23 1991-04-30 Otsuka Pharmaceutical Co., Ltd. Monoclonal antibodies directed to IL-1 activated endothelial cells and medicaments employing the monoclonal antibodies

Also Published As

Publication number Publication date
DK1616883T3 (en) 2009-05-11
KR920700286A (en) 1996-02-19
EP0807683B1 (en) 2005-09-21
US5272263A (en) 1993-12-21
JP2002065285A (en) 2002-03-05
EP0458911A1 (en) 1991-12-04
EP0458911A4 (en) 1992-09-09
EP0807683B8 (en) 2005-11-23
ATE162720T1 (en) 1998-02-15
EP0807683A3 (en) 1999-01-13
JP3408773B2 (en) 2003-05-19
JP2003050238A (en) 2003-02-21
MX9203137A (en) 1992-09-01
CA2031518A1 (en) 1990-10-29
ATE419275T1 (en) 2009-01-15
NO905553D0 (en) 1990-12-21
JP2004099616A (en) 2004-04-02
ES2249791T3 (en) 2006-04-01
EP0807683A2 (en) 1997-11-19
WO1990013300A1 (en) 1990-11-15
DK0807683T3 (en) 2008-01-02
KR100214156B1 (en) 1999-08-02
KR100214155B1 (en) 1999-08-02
NO905553L (en) 1991-02-27
EP0458911B1 (en) 1998-01-28
DE69034204T2 (en) 2006-06-22
EP1616883B1 (en) 2008-12-31
DE69034261D1 (en) 2009-02-12
US6252043B1 (en) 2001-06-26
JPH04502859A (en) 1992-05-28
JP2003210186A (en) 2003-07-29
ATE305038T1 (en) 2005-10-15
CA2031518C (en) 2004-06-29
DE69034204D1 (en) 2006-02-02
EP1616883A2 (en) 2006-01-18
JP3525128B2 (en) 2004-05-10
AU6049290A (en) 1990-11-29
JP3684228B2 (en) 2005-08-17
JP3513496B2 (en) 2004-03-31
KR100186800B1 (en) 1999-04-01
AU638041B2 (en) 1993-06-17
EP1616883A3 (en) 2006-07-26
US5367056A (en) 1994-11-22
JP2000050889A (en) 2000-02-22
DE69032007D1 (en) 1998-03-05

Similar Documents

Publication Publication Date Title
EP0807683B1 (en) Endothelial cell-leukocyte adhesion molecules (ELAMs) and molecules involved in leukocyte adhesion (MILAs)
US5217870A (en) Monoclonal antibodies against CDX
US20030153731A1 (en) Endothelial cell-leukocyte adhesion molecules (ELAMs) and molecules involved in leukocyte adhesion (MILAs)
Osborn et al. Direct expression cloning of vascular cell adhesion molecule 1, a cytokine-induced endothelial protein that binds to lymphocytes
Simmons et al. Molecular cloning of CD31, a putative intercellular adhesion molecule closely related to carcinoembryonic antigen.
EP0660721B1 (en) Monoclonal antibodies that block ligand binding to the cd22 receptor in mature b cells
Nakayama et al. Sequence of the Lyb-2 B-cell differentiation antigen defines a gene superfamily of receptors with inverted membrane orientation.
EP0568645A1 (en) Mixed specificity fusion proteins
GB2368064A (en) DNA element and associated protein
Lobb et al. Vascular cell adhesion molecule-1
US7399847B1 (en) Nucleic acids encoding artificial P-selectin ligands
WO1993006835A1 (en) Leukocyte adhesion molecule-1 (lam-1) and ligand thereof
Bogetto et al. Bidirectional induction of the cognate receptor-ligand α4/VCAM-1 pair defines a novel mechanism of tumor intravasation
CA2127532A1 (en) Antibodies recognizing the fourth immunoglobulin-like domain of vcam1
US5891645A (en) Porcine E-selectin
Sakai Inhibition of endothelial cell adhesion molecule expression with SJC13, an azaindolidine derivative, in vitro
US5708147A (en) Mononuclear leukocyte directed endothelial adhesion molecule associated with atherosclerosis
Kishimoto et al. Leukocyte adhesion, trafficking, and migration
De Fougerolles Characterization of leukocyte integrin LFA-1 (CD11a/CD18) counter-receptors: Intercellular adhesion molecules (ICAM)-2, and-3
WO1992020712A1 (en) Leukocyte-associated cell surface protein
Palecanda et al. Adhesion Molecules in Lymphocyte-Mediated Inflammation
MXPA99005066A (en) Antisense inhibition of human adhesion molecules

Legal Events

Date Code Title Description
AS Assignment

Owner name: BIOGEN, INC., MASSACHUSETTS

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:HESSION, CATHERINE;LOBB, ROY R.;GOELZ, SUSAN E.;AND OTHERS;REEL/FRAME:018520/0268;SIGNING DATES FROM 20020128 TO 20030218

AS Assignment

Owner name: BIOGEN IDEC MA INC., MASSACHUSETTS

Free format text: CHANGE OF NAME;ASSIGNOR:BIOGEN, INC.;REEL/FRAME:018817/0869

Effective date: 20031113

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION