US20060257937A1 - Focused libraries of genetic packages - Google Patents

Focused libraries of genetic packages Download PDF

Info

Publication number
US20060257937A1
US20060257937A1 US11/416,460 US41646006A US2006257937A1 US 20060257937 A1 US20060257937 A1 US 20060257937A1 US 41646006 A US41646006 A US 41646006A US 2006257937 A1 US2006257937 A1 US 2006257937A1
Authority
US
United States
Prior art keywords
equimolar mixture
dna sequences
amino acid
acid residues
display
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US11/416,460
Inventor
Robert Ladner
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Dyax Corp
Original Assignee
Dyax Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to US11/416,460 priority Critical patent/US20060257937A1/en
Application filed by Dyax Corp filed Critical Dyax Corp
Assigned to PAUL ROYALTY FUND HOLDINGS II reassignment PAUL ROYALTY FUND HOLDINGS II SECURITY AGREEMENT Assignors: DYAX CORP.
Publication of US20060257937A1 publication Critical patent/US20060257937A1/en
Assigned to DYAX CORP. reassignment DYAX CORP. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: LADNER, ROBERT CHARLES
Assigned to DYAX CORP. reassignment DYAX CORP. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: LADNER, ROBERT C.
Assigned to DYAX CORP., A DELAWARE CORPORATION reassignment DYAX CORP., A DELAWARE CORPORATION RELEASE BY SECURED PARTY (SEE DOCUMENT FOR DETAILS). Assignors: PAUL ROYALTY FUND HOLDINGS II
Assigned to COWEN HEALTHCARE ROYALTY PARTNERS, L.P. reassignment COWEN HEALTHCARE ROYALTY PARTNERS, L.P. SECURITY AGREEMENT Assignors: DYAX CORP., A DELAWARE CORPORATION
Assigned to COWEN HEALTHCARE ROYALTY PARTNERS, L.P. reassignment COWEN HEALTHCARE ROYALTY PARTNERS, L.P. SECURITY AGREEMENT Assignors: DYAX CORP., A DELAWARE CORPORATION
Priority to US12/762,051 priority patent/US8895475B2/en
Priority to US13/161,441 priority patent/US8399384B2/en
Priority to US13/161,445 priority patent/US8466091B2/en
Priority to US13/250,520 priority patent/US8258082B2/en
Priority to US13/571,661 priority patent/US9617536B2/en
Assigned to DYAX CORP., A DELAWARE CORPORATION reassignment DYAX CORP., A DELAWARE CORPORATION RELEASE BY SECURED PARTY (SEE DOCUMENT FOR DETAILS). Assignors: HEALTHCARE ROYALTY PARTNERS, L.P. F/K/A COWEN HEALTHCARE ROYALTY PARTNERS, L.P.
Assigned to LFRP INVESTORS, L.P., A DELAWARE LIMITED PARTNERSHIP reassignment LFRP INVESTORS, L.P., A DELAWARE LIMITED PARTNERSHIP SECURITY AGREEMENT Assignors: DYAX CORP., A DELAWARE CORPORATION
Priority to US13/754,261 priority patent/US9803190B2/en
Assigned to DYAX CORP. reassignment DYAX CORP. RELEASE BY SECURED PARTY (SEE DOCUMENT FOR DETAILS). Assignors: LFRP INVESTORS, L.P.
Priority to US15/797,927 priority patent/US10604753B2/en
Priority to US16/789,468 priority patent/US20200325469A1/en
Abandoned legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C40—COMBINATORIAL TECHNOLOGY
    • C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B40/00—Libraries per se, e.g. arrays, mixtures
    • C40B40/04—Libraries containing only organic compounds
    • C40B40/06—Libraries containing nucleotides or polynucleotides, or derivatives thereof
    • C40B40/08—Libraries containing RNA or DNA which encodes proteins, e.g. gene libraries
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034—Isolating an individual clone by screening libraries
    • C12N15/1037—Screening libraries presented on the surface of microorganisms, e.g. phage display, E. coli display
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/005—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies constructed by phage libraries
    • C—CHEMISTRY; METALLURGY
    • C40—COMBINATORIAL TECHNOLOGY
    • C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B40/00—Libraries per se, e.g. arrays, mixtures
    • C40B40/02—Libraries contained in or displayed by microorganisms, e.g. bacteria or animal cells; Libraries contained in or displayed by vectors, e.g. plasmids; Libraries containing only microorganisms or vectors
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/565—Complementarity determining region [CDR]
    • C—CHEMISTRY; METALLURGY
    • C40—COMBINATORIAL TECHNOLOGY
    • C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B40/00—Libraries per se, e.g. arrays, mixtures
    • C40B40/04—Libraries containing only organic compounds
    • C40B40/10—Libraries containing peptides or polypeptides, or derivatives thereof

Definitions

  • the present invention relates to focused libraries of genetic packages that each display, display and express, or comprise a member of a diverse family of peptides, polypeptides or proteins and collectively display, display and express, or comprise at least a portion of the focused diversity of the family.
  • the focused diversity of the libraries of this invention comprises both sequence diversity and length diversity.
  • the focused diversity of the libraries of this invention is biased toward the natural diversity of the selected family.
  • the libraries are biased toward the natural diversity of human antibodies and are characterized by variegation in their heavy chain and light chain complementarity determining regions (“CDRs”).
  • the present invention further relates to vectors and genetic packages (e.g., cells, spores or viruses) for displaying, or displaying and expressing a focused diverse family of peptides, polypeptides or proteins.
  • the genetic packages are filamentous phage or phagemids or yeast.
  • the focused diversity of the family comprises diversity in sequence and diversity in length.
  • Peptide, polypeptide or protein libraries have been produced in several ways in the prior art. See e.g., Knappik et al., J. Mol. Biol., 296, pp. 57-86 (2000), which is incorporated herein by references.
  • One method is to capture the diversity of native donors, either naive or immunized.
  • Another way is to generate libraries having synthetic diversity.
  • a third method is a combination of the first two.
  • the diversity produced by these methods is limited to sequence diversity, i.e., each member of the library differs from the other members of the family by having different amino acids or variegation at a given position in the peptide, polypeptide or protein chain.
  • Naturally diverse peptides, polypeptides or proteins are not limited to diversity only in their amino acid sequences.
  • human antibodies are not limited to sequence diversity in their amino acids, they are also diverse in the lengths of their amino acid chains.
  • V genes For antibodies, diversity in length occurs, for example, during variable region rearrangements. See e.g., Corbett et al., J. Mol. Biol., 270, pp. 587-97 (1997).
  • the joining of V genes to J genes results in the inclusion of a recognizable D segment in CDR3 in about half of the heavy chain antibody sequences, thus creating regions encoding varying lengths of amino acids.
  • Libraries that contain only amino acid sequence diversity are, thus, disadvantaged in that they do not reflect the natural diversity of the peptide, polypeptide or protein that the library is intended to mimic. Further, diversity in length may be important to the ultimate functioning of the protein, peptide or polypeptide. For example, with regard to a library comprising antibody regions, many of the peptides, polypeptides, proteins displayed, displayed and expressed, or comprised by the genetic packages of the library may not fold properly or their binding to an antigen may be disadvantaged, if diversity both in sequence and length are not represented in the library.
  • Another object of this invention is focused libraries of genetic packages that display, display and express, or comprise a member of a diverse family of peptides, polypeptides and proteins and collectively display, display and express, or comprise at least a portion of the focused diversity of the family.
  • These libraries are diverse not only in their amino acid sequences, but also in their lengths. And, their diversity is focused so as to more closely mimic or take into account the naturally-occurring diversity of the specific family that the library represents.
  • Another object of this invention is diverse, but focused, populations of DNA sequences encoding peptides, polypeptides or proteins suitable for display or display and expression using genetic packages (such as phage or phagemids) or other regimens that allow selection of specific binding components of a library.
  • genetic packages such as phage or phagemids
  • a further object of this invention is focused libraries comprising the CDRs of human antibodies that are diverse in both their amino acid sequence and in their length (examples of such libraries include libraries of single chain Fv (scFv), Fv, Fab, whole antibodies or minibodies (i.e., dimers that consist of V H linked to V L )).
  • Such regions may be from the heavy or light chains or both and may include one or more of the CDRs of those chains. More preferably, the diversity or variegation occurs in all of the heavy chain and light chain CDRs.
  • a focused library of vectors or genetic packages that display, display and express, or comprise a member of a diverse family of human antibody related peptides, polypeptides and proteins and collectively display, display and express, or comprise at least a portion of the diversity of the antibody family, the vectors or genetic packages being characterized by variegated DNA sequences that encode a heavy chain CDR1 selected from the group consisting of:
  • a focused library of vectors or genetic packages that display, display and express, or comprise a member of a diverse family of human antibody related peptides, polypeptides and proteins and collectively display, display and express, or comprise at least a portion of the diversity of the antibody facility, the vectors or genetic packages being characterized by variegated DNA sequences that encode a heavy chain CDR2 selected from the group consisting of:
  • a focused library of vectors or genetic packages that display, display and express, or comprise a member of a diverse family of human antibody related peptides, polypeptides and proteins and collectively display, display and express, or comprise at least a portion of the diversity of the antibody family, the vectors or genetic packages being characterized by variegated DNA sequences that encode a heavy chain CDR3 selected from the group consisting of:
  • 1 in one or all of HC CDR3s (1) through (8) is 0.095 of each of G and Y and 0.048 of each of A, D, E, F, H, I, K, L, M, N, P, Q, R, S, T, V, and W.
  • a focused library of vectors or genetic packages that display, display and express, or comprise a member of a diverse family of human antibody related peptides, polypeptides and proteins and collectively display, display and express, or comprise at least a portion of the diversity of the antibody family, the vectors or genetic packages being characterized by variegated DNA sequences that encodes a kappa light chain CDR1 selected from the group consisting of:
  • a focused library of vectors or genetic packages that display, display and express, or comprise a member of a diverse family of human antibody related peptides, polypeptides and proteins and collectively display, display and express, or comprise at least a portion of the diversity of the antibody family, the vectors or genetic packages being characterized by variegated DNA sequences that encode a kappa light chain CDR2 having the sequence:
  • a focused library of vectors or genetic packages that display, display and express, or comprise a member of a diverse family of human antibody related peptides, polypeptides and proteins and collectively display, display and express, or comprise at least a portion of the diversity of the antibody family, the vectors or genetic packages being characterized by variegated DNA sequences that encode a kappa light chain CDR3 selected from the groups consisting of:
  • a focused library of vectors or genetic packages that display, display and express, or comprise a member of a diverse family of human antibody related peptides, polypeptides and proteins and collectively display, display and express, or comprise at least a portion of the diversity of the antibody family, the vectors or genetic packages being characterized by variegated DNA sequences that encode a lambda light chain CDR1 selected from the group consisting of:
  • a focused library of vectors or genetic packages that display, display and express, or comprise a member of a diverse family of human antibody related peptides, polypeptides and proteins and collectively display, display and express, or comprise at least a portion of the diversity of the antibody family, the vectors or genetic packages being characterized by variegated DNA sequences that encode a lambda light chain CDR2 has the sequence:
  • a focused library comprising variegated DNA sequences that encode a heavy chain CDR selected from the group consisting of:
  • the focused library comprising one or more of the variegated DNA sequences that encodes a heavy chain CDR of paragraphs 1, 2 and 3 and further comprising variegated DNA sequences that encodes a light chain CDR selected from the group consisting of
  • a population of vectors comprising the variegated DNA sequences as described in paragraphs 1-11 above.
  • Antibodies concentrate their diversity into those regions that are involved in determining affinity and specificity of the Ab for particular targets. These regions may be diverse in sequence or in length. Generally, they are diverse in both ways. However, within families of human antibodies the diversities, both in sequence and in length, are not truly random. Rather, some amino acid residues are preferred at certain positions of the CDRs and some CDR lengths are preferred. These preferred diversities account for the natural diversity of the antibody family.
  • libraries of vectors and genetic packages that more closely mirror the natural diversity, both in sequence and in length, of antibody families, or portions thereof are prepared and used.
  • JH4 YFDYWGQGTLVTUSS
  • JH3 AFDYWGQGTMVTVSS
  • the preferred HC CDR1 is 5 amino acids, with less preferred CDR is having lengths of 7 and 14. In the most preferred libraries of this invention, all three lengths are used in proportions similar to those found in natural antibodies.
  • GLGs provide CDR2s only of the lengths 15-19, but mutations during maturation may result in CDR2s of lengths from 16 to 28 amino acids.
  • the lengths 16 and 17 predominate in mature Ab genes. Accordingly, length 17 is the preferred length for HC CDR2 of the present invention. Less preferred HC CDR2s of this invention have lengths 16 and 19. In the most preferred focused libraries of this invention, all three lengths are included in proportions similar to those found in natural antibody families.
  • both types of HC CDR3s are used.
  • the structure is V::nz::JHn where JH is usually edited at the 51 end.
  • the structure is V::nz::D::ny::JHn.
  • each of these positions may be selected from any of the native amino acid residues, except cysteine (“C”).
  • C cysteine
  • Cysteine can form disulfide bonds, which are an important component of the canonical Ig fold. Having free thiol groups could, thus, interfere with proper folding of the HC and could lead to problems in production or manipulation of selected Abs.
  • cysteine is excluded from positions 1, 3 and 5 of the preferred 5 amino acid CDR1s.
  • the other 19 natural amino acids residues may be used at positions 1, 3 and 5.
  • each is present in equimolar ratios in the variegated libraries of this invention.
  • residue 4 is preferably Met because it is likely to fit very well into the framework of 3-23. With other frameworks, a similar fit consideration is used to assign residue 4.
  • the most preferred HC CDR1 of this invention consists of the amino acid sequence ⁇ 1>Y ⁇ 1>M ⁇ 1>where ⁇ 1> can be any one of amino acid residues: A, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T,. V, W, Y (not C), preferably present at each position in an equimolar amount.
  • This diversity is shown in the context of a framework 3-23:JH4 in Table 1. It has a diversity of 6859-fold.
  • the two less preferred HC CDR1s of this invention have length 7 and length 14.
  • a preferred variegation is (S/T) 1 (S/G/ ⁇ 1>) 2 (S/G/ ⁇ 1>) 3 Y 4 Y 5 W 6 (S/G/ ⁇ 1>) 7 ;
  • (S/T) indicates an equimolar mixture of Ser and Thr codons;
  • (S/G/ ⁇ 1>) indicates a mixture of 0.2025 S, 0.2025 G, and 0.035 for each of A, D, E, F, H, I, K, L, M, N, P, Q, R, T, V, W, Y.
  • This design gives a predominance of Ser and Gly at positions 2, 3, and 7, as occurs in mature HC genes.
  • a preferred variegation is VSGGSIS ⁇ 1> ⁇ 1> ⁇ 1>YYW ⁇ 1>, where ⁇ 1> is an equimolar mixture of the 19 native amino acid residues, except Cys (C).
  • the diversity oligonucleotide (ON) is preferably synthesized from BspEI to BstXI (as shown in Table 1) and can, therefore, be incorporated either by PCR synthesis using overlapping ONs or introduced by ligation of BspEI/BstXI-cut fragments.
  • Table 2 shows the oligonucleotides that embody the specified variegations of the preferred length 5 HC CDR1s of this invention.
  • ON-R1V1vg ON-R1top, and ON-R1bot gives a dsDNA product of 73 base pairs
  • cleavage with BspEI and BstXI trims 11 and 13 bases from the ends and provides cohesive ends that can be ligated to similarly cut vector having the 3-23 domain shown in Table 1.
  • Replacement of ON-R1V1vg with either ONR1V2vg or ONR1V3vg allows synthesis of the two alternative diversity patterns—the 7 residue length and the 14 residue length HC CDR1.
  • HC CDR2 Diversity in HC CDR2 was designed with the same considerations as for HC CDR1: GLG sequences, mature sequences and 3D structure.
  • a preferred length for CDR2 is 17, as shown in Table 1.
  • the preferred variegation in accordance with the invention is: ⁇ 2>I ⁇ 2> ⁇ 3>SGG ⁇ 1>T ⁇ 1>YADSVKG, where ⁇ 2>indicates any amino acid residue selected from the group of Y, R, W, V, G and S (equimolar mixture), ⁇ 3> is P, S and G or P and S only (equimolar mixture), and ⁇ 1> is any native amino acid residue except C (equimolar mixture).
  • ON-R2V1vg shown in Table 3 embodies this diversity pattern. It is preferably synthesized so that fragments of dsDNA containing the BstXI and XbaI site can be generated by PCR. PCR with ON-R2V1vg, ON-R2top, and ONR2bot gives a dsDNA product of 122 base pairs. Cleavage with BstXI and XbaI removes about 10 bases from each end and produces cohesive ends that can be ligated to similarly cut vector that contains the 3-23gene shown in Table 1.
  • HC CDR2 In an alternative embodiment for a 17 length HC CDR2, the following variegation may be used: ⁇ 1>I ⁇ 4> ⁇ 1> ⁇ 1>G ⁇ 5> ⁇ 1> ⁇ 1> ⁇ 1>YADSVKG, where ⁇ 1> is as described above for the more preferred alternative of HC CDR2; ⁇ 4> indicates an equimolar mixture of DINSWY, and ⁇ 5> indicates an equimolar mixture of SGDN.
  • This diversity pattern is embodied in ON-R2V2vg shown in Table 3.
  • the two embodiments are used in equimolar mixtures in the libraries of this invention.
  • HC CDR2s have lengths 16 and 19.
  • Length 16 ⁇ 1>I ⁇ 4> ⁇ 1> ⁇ 1>G ⁇ 5 ⁇ 1> ⁇ 1>YNPSLKG;
  • Length 19 ⁇ 1>I ⁇ 8>S ⁇ 1> ⁇ 1> ⁇ 1>GGYY ⁇ 1>YAASVKG, wherein ⁇ 1> is an equimolar mixture of all native amino acid residues except C;
  • ⁇ 4> is a equimolar mixture of DINSWY;
  • ⁇ 5> is an equimolar mixture of SGDN; and
  • ⁇ 8> is 0.27 R and 0.027 of each of residues ADEFGHIKLMNPQSTVWY.
  • Table 3 shows ON-R2V3vg which embodies a preferred CDR2 variegation of length 16 and ON-R2V4vg which embodies a preferred CDR2 variegation of length 19.
  • ON-R2V3vg may be PCR amplified with ON-R2top and ON-R2bo3 and ON-R2V4vg may be PCR amplified with ON-R2top and ON-R2-bo4.
  • all three HC CDR2 lengths are used. Preferably, they are present in a ratio 17:16:19::579:464:31::0.54:0.43:0.03.
  • the preferred libraries of this invention comprise several HC CDR3 components. Some of these will have only sequence diversity. Others will have sequence diversity with embedded D segments to extend the length, while also incorporating sequences known to allow Igs to fold.
  • the HC CDR3 components of the preferred libraries of this invention and their diversities are depicted in Table 4: Components 1-8.
  • Component 1 represents all the genes having lengths 0 to 8 (counting from the YYCAR motif at the end of FR3 to the WG dipeptide motif near the start of the J region, i.e., FR4).
  • Component 2 corresponds the all the genes having lengths 9 or 10.
  • Component 3 corresponds to the genes having lengths 11 or 12 plus half the genes having length 13.
  • Component 4 corresponds to those having length 14 plus half those having length 13.
  • Component 5 corresponds to the genes having length 15 and half of those having length 16.
  • Component 6 corresponds to genes of length 17 plus half of those with length 16.
  • Component 7 corresponds to those with length 18.
  • Component 8 corresponds to those having length 19 and greater. See Table 4.
  • equimolar ratios are preferably not used. Rather, the following ratios are used 0.095 [G and Y] and 0.048 [A, D, E, F, H, I, K, L, M, N, P, Q, R, S, T, V, and W].
  • G and Y the ratios are used 0.095 [G and Y] and 0.048 [A, D, E, F, H, I, K, L, M, N, P, Q, R, S, T, V, and W].
  • the residues are present in equimolar mixtures.
  • the eight components are present in the following fractions: 1 (0.10), 2 (0.14), 3 (0.25), 4 (0.13), 5 (0.13), 6 (0.11), 7 (0.04) and 8 (0.10). See Table 4.
  • the amounts of the eight components is adjusted because the first component is not complex enough to justify including it as 10% of the library. For example, if the final library were to have 1 ⁇ 10 9 members, then 1 ⁇ 10 8 sequences would come from component 1, but it has only 2.6 ⁇ 10 5 CDR3 sequences so that each one would occur in ⁇ 385 CDR1/2 contexts. Therefore, the more preferred amounts of the eight components are 1(0.02), 2(0.14), 3(0.25), 4(0.14), 5(0.14), 6(0.12), 7(0.08), 8(0.11). In accordance with the more preferred embodiment component 1 occurs in ⁇ 77 CDR1/2 contexts and the other, longer CDR3s occur more often.
  • Table 5 shows vgDNA that embodies each of the eight HC CDR3 components shown in Table 4.
  • the oligonucleotides (ON) Ctop25, CtprmA, CBprmB, and CBot25 allow PCR amplification of each of the variegated ONs (vgDNA): C1t08, C2t10, C3t12, C4t14, C5t15, C6t17, C7t18, and C8t19.
  • the dsDNA can be cleaved with AflII and BstEII (or KpnI) and ligated to similarly cleaved vector that contains the remainder of the 3-23 domain.
  • this vector already contains diversity in one, or both, of CDR1 and CDR2 as disclosed herein. Most preferably, it contains diversity in both the CDR1 and CDR2 regions. It is, of course, to be understood that the various diversities can be incorporated into the vector in any order.
  • the recipient vector originally contains a stuffer in place of CDR1, CDR2 and CDR3 so that there will be no parental sequence that would then occur in the resulting library.
  • Table 6 shows a version of the V3-23 gene segment with each CDR replaced by a short segment that contains both stop codons and restriction sites that will allow specific cleavage of any vector that does not have the stuffer removed.
  • the stuffer can either be short and contain a restriction enzyme site that will not occur in the finished library, allowing removal of vectors that are not cleaved by both AflII and BstEII (or KpnI) and religated.
  • the stuffer could be 200-400 bases long so that uncleaved or once cleaved vector can be readily separated from doubly cleaved vector.
  • the kappa light chain is built in an A27 framework with a JK1 region. These are the most common V and J regions in the native genes. Other frameworks, such as 012, L2, and A11, and other J regions, such as JK4, however, may be used without departing from the scope of this invention.
  • LC CDR1s of length 11 and 12 are used in an and mixture similar to that observed in native antibodies), length 11 being most preferred.
  • Length 11 has the following sequence: RASQ ⁇ 1>V ⁇ 2> ⁇ 2> ⁇ 3>LA and Length 12 has the following sequence: RASQ ⁇ 1>V ⁇ 2> ⁇ 2> ⁇ 2> ⁇ 3>LA, wherein ⁇ 1> is an equimolar mixture of all of the native amino acid residues, except C, ⁇ 2> is 0.2 S and 0.044 of each of ADEFGHIKLMNPQRTVWY, and ⁇ 3> is 0.2 Y and 0.044 each of A, D, E, F, G, H, I, K, L, M, N, P, Q, R, T, V, W and Y. In the most preferred embodiment of this invention, both CDR1 lengths are used. Preferably, they are present in a ratio of 11:12::154:73::0.68:0.32.
  • CDR2 exhibits only length 7. This length is used in the preferred embodiments of this invention. It has the sequence ⁇ 1>AS ⁇ 2>R ⁇ 4> ⁇ 1>, wherein ⁇ 1> is an equimolar mixture of amino acid residues ADEFGHIKLMNPQRSTVWY; ⁇ 2> is 0.2 S and 0.004 of each of ADEFGHIKLMNPQRTVWY; and ⁇ 4> is 0.2 A and 0.044 of each of DEFGHIKLMNPQRSTUWY.
  • CDR3 exhibits lengths of 1, 4, 6, 7, 8, 9, 10, 11, 12, 13, and 19. While any of these lengths and mixtures of them can be employed in this invention, we prefer lengths 8, 9 and 10, length 9 being more preferred.
  • the sequence is QQ ⁇ 3> ⁇ 1> ⁇ 1>P ⁇ 1>T, wherein ⁇ 1> is an equimolar mixture of amino acid residues ADEFGHIKLMNPQRSTVWY and ⁇ 3> is 0.2 Y and 0.044 each of ADEFGHIKLMNPQRSVW.
  • Length 8 is preferably QQ33111P and Length 10 is preferably QQ3211PP1T, wherein 1 and 3 are as defined for Length 9 and 2 is S (0.2) and 0.044 each of ADEFGHIKLMNPQRTVWY. A mixture of all 3 lengths being most preferred (ratios as in native antibodies), i.e., 8:9:10::28:166:63::0.1:0.65:0.25.
  • Table 7 shows a kappa chain gene of this invention, including a PlacZ promoter, a ribosome-binding site, and signal sequence (M13 III signal).
  • the DNA sequence encodes the GLG amino acid sequence, but does not comprise the GLG DNA sequence. Restriction sites are designed to fall within each framework region so that diversity can be cloned into the CDRs.
  • XmaI and EspI are in FR1
  • SexAI is in FR2
  • RsrII is in FR3
  • KpnI (or Acc65I) are in FR4. Additional sites are provided in the constant kappa chain to facilitate construction of the gene.
  • Table 7 also shows a suitable scheme of variegation for kappa.
  • CDR1 the most preferred length 11 is depicted. However, most preferably both lengths 11 and 12 are used. Length 12 in CDR1 can be construed by introducing codon 51 as ⁇ 2> (i.e. a Ser-biased mixture).
  • CDR2 of kappa is always 7 codons.
  • Table 7 shows a preferred variegation scheme for CDR2.
  • Table 7 shows a variegation scheme for the most preferred CDR3 (length 9). Similar variegations can be used for CDRs of length 8 and 10. In the preferred embodiment of this invention, those three lengths (8, 9 and 10) are included in the libraries of this invention in the native ratios, as described above.
  • Table 9 shows series of diversity oligonucleotides and primers that may be used to construct the kappa chain diversities depicted in Table 7.
  • the lambda chain is preferably built in a 2a2 framework with an L2J region. These are the most common V and J regions in the native genes. Other frameworks, such as 31, 4b, 1a and 6a, and other J regions, such as L1J, L3J and L7J, however, may be used without departing from the scope of this invention.
  • CDR1s with length 14 predominate lengths 11, 12 and 13 also occur. While any of these can be used in this invention, lengths 11 and 14 are preferred.
  • length 11 the sequence is: TG ⁇ 2> ⁇ 4>L ⁇ 4> ⁇ 4> ⁇ 4> ⁇ 3> ⁇ 4> ⁇ 4>and for Length 14 the sequence is: TG ⁇ 1>5S ⁇ 2>VG ⁇ 1> ⁇ 3> ⁇ 2> ⁇ 3>VS, wherein ⁇ 1> is 0.27 T, 0.27 G and 0.027 each of ADEFHIKLMNPQRSVWY; ⁇ 2> is 0.27 D, 0.27 N and 0.027 each of AEFGHIKLMPQRSTVWY; ⁇ 3> is 0.36 Y and 0.0355 each of ADEFGHIKLMNPQRSTVW; and ⁇ 4> is an equimolar mixture of amino acid residues ADEFGHIKLMNPQRSTVWY. Most preferably, mixtures (similar to those occurring in native antibodies) preferably
  • CDR2s with length 7 are by far the most common. This length is preferred in this invention.
  • the sequence of this Length 7 CDR2 is ⁇ 4> ⁇ 4> ⁇ 4> ⁇ 2>RPS, wherein ⁇ 2> is 0.27 D, 0.27 N, and 0.027 each of AEFGHIKLMPQRSTVWY and ⁇ 4> is an equimolar mixture of amino acid residues ADEFGHIKLMNPQRSTVW.
  • Length 11 is preferred and mixtures of 10 and 11 more preferred.
  • the sequence of Length 11 is ⁇ 4> ⁇ 5> ⁇ 4> ⁇ 2> ⁇ 4>S ⁇ 4> ⁇ 4> ⁇ 4>V, where ⁇ 2> and ⁇ 4> are as defined for the lambda CDR1 and ⁇ 5> is 0.36 S and 0.0355 each of ADFFGHIKLMNPQRTVWY.
  • the sequence of Length 10 is ⁇ 5>SY ⁇ 1> ⁇ 5>S ⁇ 5> ⁇ 1> ⁇ 4>V, wherein ⁇ 1> is an equimolar mixture of ADEFGHIKLMNPQRSTVWY; and ⁇ 4> and ⁇ 5> are as defined for Length 11.
  • the preferred mixtures of this invention comprise an equimolar mixture of Length 10 and Length 11.
  • Table 8 shows a preferred focused lambda light chain diversity in accordance with this invention.
  • Table 9 shows a series of diversity oligonucleotides and primers that may be used to construct the lambda chain diversities depicted in Table 7.
  • the diversities of heavy chain and the kappa and lambda light chains are best constructed in separate vectors.
  • a synthetic gene is designed to embody each of the synthetic variable domains.
  • the light chains are bounded by restriction sites for ApaLI (positioned at the very end of the signal sequence) and AscI (positioned afer the stop codon).
  • the heavy chain is bounded by SfiI (positioned within the Pe1B signal sequence) and NotI (positioned in the linker between CH1 and the anchor protein).
  • Signal sequences other than Pe1B may also need, e.g., a M13 pIII signal sequence.
  • the initial genes are made with “stuffer” sequences in place of the desired CDRs.
  • a “Stuffer” is a sequence that is to be cut away and replaced by diverse DNA but which does not allow expression of a functional antibody gene.
  • the stuffer may contain several stop codons and restriction sites that will not occur in the correct finished library vector.
  • the stuffer for CDR1 of kappa A27 contains a StuI site.
  • the vgDNA for CDR1 is introduced as a cassette from EspI, XmaI, or AflII to either SexAI or KasI. After the ligation, the DNA is cleaved with StuI; there should be no StuI sites in the desired vectors.
  • the sequences of the heavy chain gene with stuffers is depicted in Table 6.
  • the sequences of the kappa light chain gene with stuffers is depicted in Table 10.
  • the sequence of the lambda light chain gene with stuffers is depicted in Table 11.
  • the display is had on the surface of a derivative of M13 phage.
  • the most preferred vector contains all the genes of M13, an antibiotic resistance gene, and the display cassette.
  • the preferred vector is provided with restriction sites that allow introduction and excision of members of the diverse family of genes, as cassettes.
  • the preferred vector is stable against rearrangement under the growth conditions used to amplify phage.
  • the diversity captured by the methods of the present invention may be displayed and/or expressed in a phagemid vector (e.g., pCES1) that displays and/or expresses the peptide, polypeptide or protein.
  • a phagemid vector e.g., pCES1
  • Such vectors may also be used to store the diversity for subsequent display and/or expression using other vectors or phage.
  • the diversity captured by the methods of the present invention may be displayed and/or expressed in a yeast vector.
  • a M A E V Q L L E S G ctgtctgaac cc atg gcc gaa
  • KpnI BstEII ⁇ 1> Codons for ADEFGHIKLMNPQRSTVWY (equimolar mixture)
  • ⁇ 2> Codons for YRWVGS (equimolar mixture)
  • ⁇ 3> Codons for PS or PS and G (equimolar mixture)
  • CBprmB [RC]: 5′-
  • CBot25 [RC]: 5′-
  • the 20 bases at 3′ end of CtprmA are identical to the most 5′ 20 bases of each of the vgDNA molecules.
  • Ctop25 is identical to the most 5′ 25 bases of CtprmA.
  • CBprmB The 23 most 3′ bases of CBprmB are the reverse complement of the most 3′ 23 bases of each of the vgDNA molecules.
  • CBot25 is identical to the 25 bases at the 5′ end of CBprmB.
  • CDR3 (Length 8): QQ33111P 1 and 3 as defined for Length 9

Abstract

Focused libraries of vectors or genetic packages that display, display and express, or comprise a member of a diverse family of antibody peptides, polypeptides or proteins and collectively display, display and express, or comprise at least a portion of the focused diversity of the family. The libraries have length and sequence diversities that mimic that found in native human antibodies.

Description

  • This application claims the benefit under 35 USC § 120 of U.S. provisional application 60/256,380, filed Dec. 18, 2001. The provisional application and the Tables attached to it are specifically incorporated by reference herein.
  • The present invention relates to focused libraries of genetic packages that each display, display and express, or comprise a member of a diverse family of peptides, polypeptides or proteins and collectively display, display and express, or comprise at least a portion of the focused diversity of the family. The focused diversity of the libraries of this invention comprises both sequence diversity and length diversity. In a preferred embodiment, the focused diversity of the libraries of this invention is biased toward the natural diversity of the selected family. In a more preferred embodiment, the libraries are biased toward the natural diversity of human antibodies and are characterized by variegation in their heavy chain and light chain complementarity determining regions (“CDRs”).
  • The present invention further relates to vectors and genetic packages (e.g., cells, spores or viruses) for displaying, or displaying and expressing a focused diverse family of peptides, polypeptides or proteins. In a preferred embodiment the genetic packages are filamentous phage or phagemids or yeast. Again, the focused diversity of the family comprises diversity in sequence and diversity in length.
  • The present invention further relates to methods of screening the focused libraries of the invention and to the peptides, polypeptides and proteins identified by such screening.
    • BACKGROUND OF THE INVENTION
  • It is now common practice in the art to prepare libraries of genetic packages that individually display, display and express, or comprise a member of a diverse family of peptides, polypeptides or proteins and collectively display, display and express, or comprise at least a portion of the amino acid diversity of the family. In many common libraries, the peptides, polypeptides or proteins are related to antibodies (e.g., single chain Fv (scFv), Fv, Fab, whole antibodies or minibodies (i.e., dimers that consist of VH linked to VL)). Often, they comprise one or more of the CDRs and framework regions of the heavy and light chains of human antibodies.
  • Peptide, polypeptide or protein libraries have been produced in several ways in the prior art. See e.g., Knappik et al., J. Mol. Biol., 296, pp. 57-86 (2000), which is incorporated herein by references. One method is to capture the diversity of native donors, either naive or immunized. Another way is to generate libraries having synthetic diversity. A third method is a combination of the first two. Typically, the diversity produced by these methods is limited to sequence diversity, i.e., each member of the library differs from the other members of the family by having different amino acids or variegation at a given position in the peptide, polypeptide or protein chain. Naturally diverse peptides, polypeptides or proteins, however, are not limited to diversity only in their amino acid sequences. For example, human antibodies are not limited to sequence diversity in their amino acids, they are also diverse in the lengths of their amino acid chains.
  • For antibodies, diversity in length occurs, for example, during variable region rearrangements. See e.g., Corbett et al., J. Mol. Biol., 270, pp. 587-97 (1997). The joining of V genes to J genes, for example, results in the inclusion of a recognizable D segment in CDR3 in about half of the heavy chain antibody sequences, thus creating regions encoding varying lengths of amino acids. The following also may occur during joining of antibody gene segments: (i) the end of the V gene may have zero to several bases deleted or changed; (ii) the end of the D segment may have zero to many bases removed or changed; (iii) a number of random bases may be inserted between V and D or between D and J; and (iv) the 5′ end of J may be edited to remove or to change several bases. These rearrangements result in antibodies that are diverse both in amino acid sequence and in length.
  • Libraries that contain only amino acid sequence diversity are, thus, disadvantaged in that they do not reflect the natural diversity of the peptide, polypeptide or protein that the library is intended to mimic. Further, diversity in length may be important to the ultimate functioning of the protein, peptide or polypeptide. For example, with regard to a library comprising antibody regions, many of the peptides, polypeptides, proteins displayed, displayed and expressed, or comprised by the genetic packages of the library may not fold properly or their binding to an antigen may be disadvantaged, if diversity both in sequence and length are not represented in the library.
  • An additional disadvantage of prior art libraries of genetic packages that display, display and express, or comprise peptides, polypeptides and proteins is that they are not focused oh those members that are based on natural occurring diversity and thus on members that are most likely to be functional. Rather, the prior art libraries, typically, attempt to include as much diversity or variegation at every amino acid residue as possible. This makes library construction time-consuming and less efficient than possible. The large number of members that are produced by trying to capture complete diversity also makes screening more cumbersome than it needs to be. This is particularly true given that many members of the library will not be functional.
    • SUMMARY OF THE INVENTION
  • One objective of this invention is focused libraries of vectors or genetic packages that encode members of a diverse family of peptides, polypeptides or proteins wherein the libraries encode populations that are diverse in both length and sequence. The diverse length comprising components that contain motifs that are likely to fold and function in the context of the parental peptide, polypeptide or protein.
  • Another object of this invention is focused libraries of genetic packages that display, display and express, or comprise a member of a diverse family of peptides, polypeptides and proteins and collectively display, display and express, or comprise at least a portion of the focused diversity of the family. These libraries are diverse not only in their amino acid sequences, but also in their lengths. And, their diversity is focused so as to more closely mimic or take into account the naturally-occurring diversity of the specific family that the library represents.
  • Another object of this invention is diverse, but focused, populations of DNA sequences encoding peptides, polypeptides or proteins suitable for display or display and expression using genetic packages (such as phage or phagemids) or other regimens that allow selection of specific binding components of a library.
  • A further object of this invention is focused libraries comprising the CDRs of human antibodies that are diverse in both their amino acid sequence and in their length (examples of such libraries include libraries of single chain Fv (scFv), Fv, Fab, whole antibodies or minibodies (i.e., dimers that consist of VH linked to VL)). Such regions may be from the heavy or light chains or both and may include one or more of the CDRs of those chains. More preferably, the diversity or variegation occurs in all of the heavy chain and light chain CDRs.
  • It is another object of this invention to provide methods of making and screening the above libraries and the peptides, polypeptides and proteins obtained in such screening.
  • Among the preferred embodiments of this invention are the following:
  • 1. A focused library of vectors or genetic packages that display, display and express, or comprise a member of a diverse family of human antibody related peptides, polypeptides and proteins and collectively display, display and express, or comprise at least a portion of the diversity of the antibody family, the vectors or genetic packages being characterized by variegated DNA sequences that encode a heavy chain CDR1 selected from the group consisting of:
      • (1) <1>1Y2<1>3M4<1>5, wherein <1> is an equimolar mixture of each of amino acid residues A, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W, and Y;
      • (2) (S/T)1(S/G/X)2(S/G/X)3Y4Y5W6(S/G/X)7, wherein (S/T) is a 1:1 mixture of S and T residues, (S/G/X) is a mixture of 0.2025 S, 0.2025 G and 0.035 of each of amino acid residues A, D, E, F, H, I, K, L, M, N, P, Q, R, T, V, W, and Y;
      • (3) V1S2G3G4S5I6S7<1>8<1>9<1>10Y11Y12W13<1>14, wherein <1> is an equimolar mixture of each of amino acid residues A, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W, and Y; and
      • (4) mixtures of vectors or genetic packages characterized by any of the above DNA sequences, preferably in the ratio: HC CDR1s (1):(2):(3)::0.80:0.17:0.02.
  • 2. A focused library of vectors or genetic packages that display, display and express, or comprise a member of a diverse family of human antibody related peptides, polypeptides and proteins and collectively display, display and express, or comprise at least a portion of the diversity of the antibody facility, the vectors or genetic packages being characterized by variegated DNA sequences that encode a heavy chain CDR2 selected from the group consisting of:
      • (1) <2>I<2><3>SGG<1>T<1>YADSVKG, wherein <1> is an equimolar mixture of each of amino acid residues A, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W, and Y; <2> is an equimolar mixture of each of amino acid residues Y, R, W, V, G, and S; and <3> is an equimolar mixture of each of amino acid residues P, S, and G or an equimolar mixture of P and S;
      • (2) <1>I<4><1><1><G><5><1><1><1>YADSVKG, herein <1> is an equimolar mixture of each of amino acid residues A, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W, and Y; <4> is an equimolar mixture of residues D, I, N, S, W, Y; and <5> is an equimolar mixture of residues S, G, D and N;
      • (3) <1>I<4><1><1>G<5><1><1>YNPSLKG, wnerein <1> is an equimolar mixture of each of amino acid residues A, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W and Y; and <4> and <5> are as defined above;
      • (4) <1>I<8>S<1><1><1>GGYY<1>YAASVKG, wherein <1> is an equimolar mixture of each amino acid residues A, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W and Y; <8> is 0.27 R and 0.027 of each of ADEFGHIKLMNPQSTVWY; and
      • (5) mixtures of vectors or genetic packages characterized by any of the above DNA sequences, preferably in the ratio: HC CDR2s: (1)/(2) (equimolar): (3):(4)::0.54:0.43:0.03.
  • 3. A focused library of vectors or genetic packages that display, display and express, or comprise a member of a diverse family of human antibody related peptides, polypeptides and proteins and collectively display, display and express, or comprise at least a portion of the diversity of the antibody family, the vectors or genetic packages being characterized by variegated DNA sequences that encode a heavy chain CDR3 selected from the group consisting of:
      • (1) YYCA21111YFDYWG, wherein 1 is an equimolar mixture of each amino acid residues A, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W and Y; and 2 is an equimolar mixture of K and R;
      • (2) YYCA2111111YFDYWG, wherein 1 is an equimolar mixture of each amino acid residues A, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W and Y; and 2 is an equimolar mixture of K and R;
      • (3) YYCA211111111YFDAYTG, wherein 1 is an equimolar mixture of each amino acid residues A, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W and Y; and 2 is an equimolar mixture of K and R;
      • (4) YYCAR111S2S3111YFDYWG, wherein 1 is an equimolar mixture of each amino acid residues A, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W and Y; and 2 is an equimolar mixture of S and G; and 3 is an equimolar mixture of Y and W;
      • (5) YYCA2111CSG11CY1YFDYWG, wherein 1 is an equimolar mixture of each amino acid residues A, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W and Y; and 2 is an equimolar mixture of K and R;
      • (6) YYCA211S1TIFG11111YFDYWG, wherein 1 is an equimolar mixture of each amino acid residues A, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W and Y; and 2 is an equimolar mixture of K and R;
      • (7) YYCAR111YY2S3344111YFDYWG, wherein 1 is an equimolar mixture of each amino acid residues A, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W and Y; 2 is an equimolar mixture of D and S; and 3 is an equimolar mixture of S and G;
      • (8) YYCAR1111YC2231CY111YFDYWG, wherein 1 is an equimolar mixture of each amino acid residues A, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W and Y; 2 is an equimolar mixture of S and G; and 3 is an equimolar mixture of T, D and G; and
      • (9) mixtures of vectors or genetic packages characterized by any of the above DNA sequences, preferably the HC CDR3s (1) through (8) are in the following proportions in the mixture:
      • (1) 0.10
      • (2) 0.14
      • (3) 0.25
      • (4) 0.13
      • (5) 0.13
      • (6) 0.11
  • (7) 0.04 and
      • (8) 0.10; and more preferably the HC CDR3s (1) through (8) are in the following proportions in the mixture:
      • (1) 0.02
      • (2) 0.14
      • (3) 0.25
      • (4) 0.14
      • (5) 0.14
      • (6) 0.12
      • (7) 0.08 and
      • (8) 0.11.
  • Preferably, 1 in one or all of HC CDR3s (1) through (8) is 0.095 of each of G and Y and 0.048 of each of A, D, E, F, H, I, K, L, M, N, P, Q, R, S, T, V, and W.
  • 4. A focused library of vectors or genetic packages that display, display and express, or comprise a member of a diverse family of human antibody related peptides, polypeptides and proteins and collectively display, display and express, or comprise at least a portion of the diversity of the antibody family, the vectors or genetic packages being characterized by variegated DNA sequences that encodes a kappa light chain CDR1 selected from the group consisting of:
      • (1) RASQ<1>V<2><2><3>LA
      • (2) RASQ<1>V<2><2><2><3>LA;
        wherein <1> is an equimolar mixture of amino acid residues ADEFGHIKLMNPQRSTVWY; <2> is 0.2 S and 0.044 of each of ADEFGHIKLMNPQRTVWY; and <3> is 0.2Y and 0.044 each of ADEFGHIKLMNPQRTVW and Y; and
      • (3) mixtures of vectors or genetic packages characterized by any of the above DNA sequences, preferably in the ratio CDR1s (1):(2)::0.68:0.32.
  • 5. A focused library of vectors or genetic packages that display, display and express, or comprise a member of a diverse family of human antibody related peptides, polypeptides and proteins and collectively display, display and express, or comprise at least a portion of the diversity of the antibody family, the vectors or genetic packages being characterized by variegated DNA sequences that encode a kappa light chain CDR2 having the sequence:
      • <1>AS<2>R<4><1>,
        wherein <1> is an equimolar mixture of amino acid residues ADEFGHIKLMNPQRSTVWY; <2> is 0.2 S and 0.044 of each of ADEFGHIKLMNPQRTVWY; and <4> is 0.2 A and) 0.044 each of DEFGHIKLMNPQRSTVWY.
  • 6. A focused library of vectors or genetic packages that display, display and express, or comprise a member of a diverse family of human antibody related peptides, polypeptides and proteins and collectively display, display and express, or comprise at least a portion of the diversity of the antibody family, the vectors or genetic packages being characterized by variegated DNA sequences that encode a kappa light chain CDR3 selected from the groups consisting of:
      • (1) QQ<3><1><1><1>P<1>T,
        wherein <1> is an equimolar mixture of amino acid residues ADEFGHIKLMNPQRSTVWY; <3> is 0.2 Y and 0.044 each of ADEFGHIKLMNPQRTVW;
      • (2) QQ33111P, wherein 1 and 3 are as defined in (1) above;
      • (3) QQ3211PP1T, wherein 1 and 3 are as defined in (1) above and 2 is 0.2 S and 0.044 each of ADEFGHIKLMNPQRTVWY; and
      • (4) mixtures of vectors or genetic packages characterized by any of the above DNA sequences, preferably in the ratio CDR3s (1):(2):(3)::0.65:0.1:0.25.
  • 7. A focused library of vectors or genetic packages that display, display and express, or comprise a member of a diverse family of human antibody related peptides, polypeptides and proteins and collectively display, display and express, or comprise at least a portion of the diversity of the antibody family, the vectors or genetic packages being characterized by variegated DNA sequences that encode a lambda light chain CDR1 selected from the group consisting of:
      • (1) TG<1>SS<2>VG<1><3><2><3>VS,
        wherein <1> is 0.27 T, 0.27 G and 0.027 each of ADEFHIKLMNPQRSVWY, <2> is 0.27 D, 0.27 N and 0.027 each of AEFGHIKLMPQRSTVWY, and <3> is 0.36 Y and 0.036 each of ADEFGHIKLMNPQRSTVW;
      • (2) G<2><4>L<4><4><4><3><4><4>,
        wherein <2> is as defined in (1) above and <4> is an equimolar mixture of amino acid residues ADEFGHIKLMNPQRSTVWY; and
      • (3) mixtures of vectors or genetic packages characterized by any of the above DNA sequences, preferably in the ratio CDR1s (1):(2)::0.67:0.33.
  • 8. A focused library of vectors or genetic packages that display, display and express, or comprise a member of a diverse family of human antibody related peptides, polypeptides and proteins and collectively display, display and express, or comprise at least a portion of the diversity of the antibody family, the vectors or genetic packages being characterized by variegated DNA sequences that encode a lambda light chain CDR2 has the sequence:
      • <4><4><4><2>RPS,
        wherein <2> is 0.27 D, 0.27 N, and 0.027 each of AEFGHIKLMPQRSTVWY and <4> is an equimolar mixture of amino acid residues ADEFGHIKLMNPQRSTVW.
  • 9. A focused library of vectors or genetic packages that display, display and express, or comprise a member of a diverse family of human antibody related peptides, polypeptides and proteins and collectively display, display and express, or comprise at least a portion of the diversity of the antibody family, the vectors or genetic packages being characterized by variegated DNA sequences that encode a lambda light chain CDR3 selected from the group consisting of:
      • (1) <4><5><4><2><4>S<4><4><4><4>V,
        wherein <2> is 0.27 D, 0.27 N, and 0.027 each of AEFGHIKLMPQRSTVWY; <4> is an equimolar mixture of amino acid residues ADEFGHIKLMNPQRSTVW; and <5> is 0.36 S and 0.0355 each of ADEFGHIKLMNPQRTVWY;
      • (2) <5>SY<1><5>S<5><1><4>V, wherein <1> is an equimolar mixture of ADEFGHIKLMNPQRSTVWY; and <4> and <5> are as defined in (1) above; and
      • (3) mixtures of vectors or genetic packages characterized by any of the above DNA sequences, preferably in the ratio CDR3s (1):(2)::1:1.
  • 10. A focused library comprising variegated DNA sequences that encode a heavy chain CDR selected from the group consisting of:
      • (1) one or more of the heavy chain CDR1s of paragraph 1 above;
      • (2) one or more of the heavy chain CDR2s of paragraph 2 above;
      • (3) one or more of the heavy chain CDR3s of paragraph 3 above; and
      • (4) mixtures of vectors or genetic packages characterized by (1), (2) and (3).
  • 11. The focused library comprising one or more of the variegated DNA sequences that encodes a heavy chain CDR of paragraphs 1, 2 and 3 and further comprising variegated DNA sequences that encodes a light chain CDR selected from the group consisting of
      • (1) one or more the kappa light chain CDR1s of paragraph 4;
      • (2) the kappa light chain CDR2 of paragraph 5;
      • (3) one or more of the kappa light chain CDR3s of paragraph 6;
      • (4) one or more of the kappa light chain CDR1s of paragraph 7;
      • (5) the lambda light chain CDR2 of paragraph 8;
      • (6) one or more of the lambda light chain CDR3s of paragraph 9; and
      • (7) mixtures of vectors and genetic packages characterized by one or more of (1) through (6).
  • 12. A population of variegated DNA sequences as described in paragraphs 1-11 above.
  • 13. A population of vectors comprising the variegated DNA sequences as described in paragraphs 1-11 above.
    • DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
  • Antibodies (“Ab”) concentrate their diversity into those regions that are involved in determining affinity and specificity of the Ab for particular targets. These regions may be diverse in sequence or in length. Generally, they are diverse in both ways. However, within families of human antibodies the diversities, both in sequence and in length, are not truly random. Rather, some amino acid residues are preferred at certain positions of the CDRs and some CDR lengths are preferred. These preferred diversities account for the natural diversity of the antibody family.
  • According to this invention, and as more fully described below, libraries of vectors and genetic packages that more closely mirror the natural diversity, both in sequence and in length, of antibody families, or portions thereof are prepared and used.
  • Human Antibody Heavy Chain Sequence and Length Diversity
  • (a) Framework
  • The heavy chain (“HC”) Germ-Line Gene (GLG) 3-23 (also known as VP-47) accounts for about 12% of all human Abs and is preferred as the framework in the preferred embodiment of the invention. It should, however, be understood that other well-known frameworks, such as 4-34, 3-30, 3-30.3 and 4-30.1, may also be used without departing from the principles of the focused diversities of this invention.
  • In addition, JH4 (YFDYWGQGTLVTUSS) occurs more often than JH3 in native antibodies. Hence, it is preferred for the focused libraries of this invention. However, JH3 (AFDIWGQGTMVTVSS) could as well be used.
  • (b) Focused Length Diversity: CDR1, 2 and 3
  • (i) CDR1
  • For CDR1, GLGs provide CDR1s only of the lengths 5, 6, and 7. Mutations during the maturation of the V-domain gene, however, can lead to CDR1s having lengths as short as 2 and as long as 16. Nevertheless, length 5 predominates. Accordingly, in the preferred embodiment of this invention, the preferred HC CDR1 is 5 amino acids, with less preferred CDR is having lengths of 7 and 14. In the most preferred libraries of this invention, all three lengths are used in proportions similar to those found in natural antibodies.
  • (ii) CDR2
  • GLGs provide CDR2s only of the lengths 15-19, but mutations during maturation may result in CDR2s of lengths from 16 to 28 amino acids. The lengths 16 and 17 predominate in mature Ab genes. Accordingly, length 17 is the preferred length for HC CDR2 of the present invention. Less preferred HC CDR2s of this invention have lengths 16 and 19. In the most preferred focused libraries of this invention, all three lengths are included in proportions similar to those found in natural antibody families.
  • (iii) CDR3
  • HC CDR3s vary in length. About half of human HCs consist of the components: V::nz::D::ny::JHn where V is a V gene, nz is a series of bases (mean 12) that are essentially random, D is a D segment, often with heavy editing at both ends, ny is a series of bases (mean 6) that are essentially random, and JH is one of the six JH segments, often with heavy editing at the 5′ end. The D segments appear to provide spacer segments that allow folding of the IgG. The greatest diversity is at the junctions of V with D and of D with JH.
  • In the preferred libraries of this invention both types of HC CDR3s are used. In HC CDR3s that have no identifiable D segment, the structure is V::nz::JHn where JH is usually edited at the 51 end. In HC CDR3s that have an identifiable D segment, the structure is V::nz::D::ny::JHn.
  • (c) Focused Sequence Diversity: CDR1, 2 and 3
  • (i) CDR1
  • In 5 amino acid length CDR1, examination of a 3D model of a humanized Ab showed that the side groups of residues 1, 3, and 5 were directed toward the combining pocket. Consequently, in the focused libraries of this invention, each of these positions may be selected from any of the native amino acid residues, except cysteine (“C”). Cysteine can form disulfide bonds, which are an important component of the canonical Ig fold. Having free thiol groups could, thus, interfere with proper folding of the HC and could lead to problems in production or manipulation of selected Abs. Thus, in the focused libraries of this invention cysteine is excluded from positions 1, 3 and 5 of the preferred 5 amino acid CDR1s. The other 19 natural amino acids residues may be used at positions 1, 3 and 5. Preferably, each is present in equimolar ratios in the variegated libraries of this invention.
  • 3D modeling also suggests that the side groups of residue 2 in a 5 amino acid CDR1 are directed away from the combining-pocket. Although this position shows substantial diversity, both in GLG and mature genes, in the focused libraries of this invention this residue is preferably Tyr (Y) because it occurs in 681/820 mature antibody genes. However, any of the other native amino acid residues, except Cys (C), could also be used at this position.
  • For position 4, there is also some diversity in GLG and mature antibody genes. However, almost all mature genes have uncharged hydrophobic amino acid residues: A, G, L, P, F, M, W, I, V, at this position. Inspection of a 3D model also shows that the side group of residue 4 is packed into the innards of the HC. Thus, in the preferred embodiment of this invention which uses framework 3-23, residue 4 is preferably Met because it is likely to fit very well into the framework of 3-23. With other frameworks, a similar fit consideration is used to assign residue 4.
  • Thus, the most preferred HC CDR1 of this invention consists of the amino acid sequence <1>Y<1>M<1>where <1> can be any one of amino acid residues: A, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T,. V, W, Y (not C), preferably present at each position in an equimolar amount. This diversity is shown in the context of a framework 3-23:JH4 in Table 1. It has a diversity of 6859-fold.
  • The two less preferred HC CDR1s of this invention have length 7 and length 14. For length 7, a preferred variegation is (S/T)1(S/G/<1>)2(S/G/<1>)3Y4Y5W6(S/G/<1>)7; where (S/T) indicates an equimolar mixture of Ser and Thr codons; (S/G/<1>) indicates a mixture of 0.2025 S, 0.2025 G, and 0.035 for each of A, D, E, F, H, I, K, L, M, N, P, Q, R, T, V, W, Y. This design gives a predominance of Ser and Gly at positions 2, 3, and 7, as occurs in mature HC genes. For length 14, a preferred variegation is VSGGSIS<1><1><1>YYW<1>, where <1> is an equimolar mixture of the 19 native amino acid residues, except Cys (C).
  • The DNA that encodes these preferred HC CDR1s is preferably synthesized using trinucleotide building blocks so that each amino acid residue is present in essentially equimolar or other described amounts. The preferred codons for the <1> amino acid residues are gct, gat, gag, ttt, ggt, cat, att, aag, ctt, atg, aat, cct, cag, cgt, tct, act, gtt, tgg, and tat. Of course, other codons for the chosen amino acid residue could also be used.
  • The diversity oligonucleotide (ON) is preferably synthesized from BspEI to BstXI (as shown in Table 1) and can, therefore, be incorporated either by PCR synthesis using overlapping ONs or introduced by ligation of BspEI/BstXI-cut fragments. Table 2 shows the oligonucleotides that embody the specified variegations of the preferred length 5 HC CDR1s of this invention. PCR using ON-R1V1vg, ON-R1top, and ON-R1bot gives a dsDNA product of 73 base pairs, cleavage with BspEI and BstXI trims 11 and 13 bases from the ends and provides cohesive ends that can be ligated to similarly cut vector having the 3-23 domain shown in Table 1. Replacement of ON-R1V1vg with either ONR1V2vg or ONR1V3vg (see Table 2) allows synthesis of the two alternative diversity patterns—the 7 residue length and the 14 residue length HC CDR1.
  • The more preferred libraries of this invention comprise the 3 preferred HC CDR1 length diversities. Most preferably, the 3 lengths should be incorporated in approximately the ratios in which they are observed in antibodies selected without reference to the length of the CDRs. For example, one sample of 1095 HC genes have the three lengths present in the ratio: L=5:L=7:L=14::820:175:23::0.80:0.17:0.02. This is the preferred ratio in accordance with this invention.
  • (ii) CDR2
  • Diversity in HC CDR2 was designed with the same considerations as for HC CDR1: GLG sequences, mature sequences and 3D structure. A preferred length for CDR2 is 17, as shown in Table 1. For this preferred 17 length CDR2, the preferred variegation in accordance with the invention is: <2>I<2><3>SGG<1>T<1>YADSVKG, where <2>indicates any amino acid residue selected from the group of Y, R, W, V, G and S (equimolar mixture), <3> is P, S and G or P and S only (equimolar mixture), and <1> is any native amino acid residue except C (equimolar mixture).
  • ON-R2V1vg shown in Table 3 embodies this diversity pattern. It is preferably synthesized so that fragments of dsDNA containing the BstXI and XbaI site can be generated by PCR. PCR with ON-R2V1vg, ON-R2top, and ONR2bot gives a dsDNA product of 122 base pairs. Cleavage with BstXI and XbaI removes about 10 bases from each end and produces cohesive ends that can be ligated to similarly cut vector that contains the 3-23gene shown in Table 1.
  • In an alternative embodiment for a 17 length HC CDR2, the following variegation may be used: <1>I<4><1><1>G<5><1><1><1>YADSVKG, where <1> is as described above for the more preferred alternative of HC CDR2; <4> indicates an equimolar mixture of DINSWY, and <5> indicates an equimolar mixture of SGDN. This diversity pattern is embodied in ON-R2V2vg shown in Table 3. Preferably, the two embodiments are used in equimolar mixtures in the libraries of this invention.
  • Other preferred HC CDR2s have lengths 16 and 19. Length 16: <1>I<4><1><1>G<5<1><1>YNPSLKG; Length 19: <1>I<8>S<1><1><1>GGYY<1>YAASVKG, wherein <1> is an equimolar mixture of all native amino acid residues except C; <4> is a equimolar mixture of DINSWY; <5> is an equimolar mixture of SGDN; and <8> is 0.27 R and 0.027 of each of residues ADEFGHIKLMNPQSTVWY. Table 3 shows ON-R2V3vg which embodies a preferred CDR2 variegation of length 16 and ON-R2V4vg which embodies a preferred CDR2 variegation of length 19. To prepare these variegations ON-R2V3vg may be PCR amplified with ON-R2top and ON-R2bo3 and ON-R2V4vg may be PCR amplified with ON-R2top and ON-R2-bo4. See Table 3. In the most preferred embodiment of this invention, all three HC CDR2 lengths are used. Preferably, they are present in a ratio 17:16:19::579:464:31::0.54:0.43:0.03.
  • (iii) CDR3
  • The preferred libraries of this invention comprise several HC CDR3 components. Some of these will have only sequence diversity. Others will have sequence diversity with embedded D segments to extend the length, while also incorporating sequences known to allow Igs to fold. The HC CDR3 components of the preferred libraries of this invention and their diversities are depicted in Table 4: Components 1-8.
  • This set of components was chosen after studying the sequences of 1383 human HC sequences. The proposed components are meant to fulfill the following goals:
  • 1) approximately the same distribution of lengths as seen in native Ab genes;
  • 2) high level of sequence diversity at places having high diversity in native Ab genes; and
  • 3) incorporation of constant sequences often seen in native Ab genes.
  • Component 1 represents all the genes having lengths 0 to 8 (counting from the YYCAR motif at the end of FR3 to the WG dipeptide motif near the start of the J region, i.e., FR4). Component 2 corresponds the all the genes having lengths 9 or 10. Component 3 corresponds to the genes having lengths 11 or 12 plus half the genes having length 13. Component 4 corresponds to those having length 14 plus half those having length 13. Component 5 corresponds to the genes having length 15 and half of those having length 16. Component 6 corresponds to genes of length 17 plus half of those with length 16. Component 7 corresponds to those with length 18. Component 8 corresponds to those having length 19 and greater. See Table 4.
  • For each HC CDR3 residue having the diversity <1>, equimolar ratios are preferably not used. Rather, the following ratios are used 0.095 [G and Y] and 0.048 [A, D, E, F, H, I, K, L, M, N, P, Q, R, S, T, V, and W]. Thus, there is a double dose of G and Y with the other residues being in equimolar ratios. For the other diversities, e.g., KR or SG, the residues are present in equimolar mixtures.
  • In the preferred libraries of this invention the eight components are present in the following fractions: 1 (0.10), 2 (0.14), 3 (0.25), 4 (0.13), 5 (0.13), 6 (0.11), 7 (0.04) and 8 (0.10). See Table 4.
  • In the more preferred embodiment of this invention, the amounts of the eight components is adjusted because the first component is not complex enough to justify including it as 10% of the library. For example, if the final library were to have 1×109 members, then 1×108 sequences would come from component 1, but it has only 2.6×105 CDR3 sequences so that each one would occur in ˜385 CDR1/2 contexts. Therefore, the more preferred amounts of the eight components are 1(0.02), 2(0.14), 3(0.25), 4(0.14), 5(0.14), 6(0.12), 7(0.08), 8(0.11). In accordance with the more preferred embodiment component 1 occurs in ˜77 CDR1/2 contexts and the other, longer CDR3s occur more often.
  • Table 5 shows vgDNA that embodies each of the eight HC CDR3 components shown in Table 4. In Table 5, the oligonucleotides (ON) Ctop25, CtprmA, CBprmB, and CBot25 allow PCR amplification of each of the variegated ONs (vgDNA): C1t08, C2t10, C3t12, C4t14, C5t15, C6t17, C7t18, and C8t19. After amplification, the dsDNA can be cleaved with AflII and BstEII (or KpnI) and ligated to similarly cleaved vector that contains the remainder of the 3-23 domain. Preferably, this vector already contains diversity in one, or both, of CDR1 and CDR2 as disclosed herein. Most preferably, it contains diversity in both the CDR1 and CDR2 regions. It is, of course, to be understood that the various diversities can be incorporated into the vector in any order.
  • Preferably, the recipient vector originally contains a stuffer in place of CDR1, CDR2 and CDR3 so that there will be no parental sequence that would then occur in the resulting library. Table 6 shows a version of the V3-23 gene segment with each CDR replaced by a short segment that contains both stop codons and restriction sites that will allow specific cleavage of any vector that does not have the stuffer removed. The stuffer can either be short and contain a restriction enzyme site that will not occur in the finished library, allowing removal of vectors that are not cleaved by both AflII and BstEII (or KpnI) and religated. Alternatively, the stuffer could be 200-400 bases long so that uncleaved or once cleaved vector can be readily separated from doubly cleaved vector.
  • Human Antibody Light Chain: Sequence and Length Diversity
  • (i) Kappa Chain
  • (a) Framework
  • In the preferred embodiment of this invention, the kappa light chain is built in an A27 framework with a JK1 region. These are the most common V and J regions in the native genes. Other frameworks, such as 012, L2, and A11, and other J regions, such as JK4, however, may be used without departing from the scope of this invention.
  • (b) CDR1
  • In native human kappa chains, CDR1s with lengths of 11, 12, 13, 16, and 17 were observed with length 11 being predominant and length 12 being well represented. Thus, in the preferred embodiments of this invention LC CDR1s of length 11 and 12 are used in an and mixture similar to that observed in native antibodies), length 11 being most preferred. Length 11 has the following sequence: RASQ<1>V<2><2><3>LA and Length 12 has the following sequence: RASQ<1>V<2><2><2><3>LA, wherein <1> is an equimolar mixture of all of the native amino acid residues, except C, <2> is 0.2 S and 0.044 of each of ADEFGHIKLMNPQRTVWY, and <3> is 0.2 Y and 0.044 each of A, D, E, F, G, H, I, K, L, M, N, P, Q, R, T, V, W and Y. In the most preferred embodiment of this invention, both CDR1 lengths are used. Preferably, they are present in a ratio of 11:12::154:73::0.68:0.32.
  • (c) CDR2
  • In native kappa, CDR2 exhibits only length 7. This length is used in the preferred embodiments of this invention. It has the sequence <1>AS<2>R<4><1>, wherein <1> is an equimolar mixture of amino acid residues ADEFGHIKLMNPQRSTVWY; <2> is 0.2 S and 0.004 of each of ADEFGHIKLMNPQRTVWY; and <4> is 0.2 A and 0.044 of each of DEFGHIKLMNPQRSTUWY.
  • (d) CDR3
  • In native kappa, CDR3 exhibits lengths of 1, 4, 6, 7, 8, 9, 10, 11, 12, 13, and 19. While any of these lengths and mixtures of them can be employed in this invention, we prefer lengths 8, 9 and 10, length 9 being more preferred. For the preferred Length 9, the sequence is QQ<3><1><1><1>P<1>T, wherein <1> is an equimolar mixture of amino acid residues ADEFGHIKLMNPQRSTVWY and <3> is 0.2 Y and 0.044 each of ADEFGHIKLMNPQRSVW. Length 8 is preferably QQ33111P and Length 10 is preferably QQ3211PP1T, wherein 1 and 3 are as defined for Length 9 and 2 is S (0.2) and 0.044 each of ADEFGHIKLMNPQRTVWY. A mixture of all 3 lengths being most preferred (ratios as in native antibodies), i.e., 8:9:10::28:166:63::0.1:0.65:0.25.
  • Table 7 shows a kappa chain gene of this invention, including a PlacZ promoter, a ribosome-binding site, and signal sequence (M13 III signal). The DNA sequence encodes the GLG amino acid sequence, but does not comprise the GLG DNA sequence. Restriction sites are designed to fall within each framework region so that diversity can be cloned into the CDRs. XmaI and EspI are in FR1, SexAI is in FR2, RsrII is in FR3, and KpnI (or Acc65I) are in FR4. Additional sites are provided in the constant kappa chain to facilitate construction of the gene.
  • Table 7 also shows a suitable scheme of variegation for kappa. In CDR1, the most preferred length 11 is depicted. However, most preferably both lengths 11 and 12 are used. Length 12 in CDR1 can be construed by introducing codon 51 as <2> (i.e. a Ser-biased mixture). CDR2 of kappa is always 7 codons. Table 7 shows a preferred variegation scheme for CDR2. Table 7 shows a variegation scheme for the most preferred CDR3 (length 9). Similar variegations can be used for CDRs of length 8 and 10. In the preferred embodiment of this invention, those three lengths (8, 9 and 10) are included in the libraries of this invention in the native ratios, as described above.
  • Table 9 shows series of diversity oligonucleotides and primers that may be used to construct the kappa chain diversities depicted in Table 7.
  • (ii) Lambda Chain
  • (a) Framework
  • The lambda chain is preferably built in a 2a2 framework with an L2J region. These are the most common V and J regions in the native genes. Other frameworks, such as 31, 4b, 1a and 6a, and other J regions, such as L1J, L3J and L7J, however, may be used without departing from the scope of this invention.
  • (b) CDR1
  • In native human lambda chains, CDR1s with length 14 predominate, lengths 11, 12 and 13 also occur. While any of these can be used in this invention, lengths 11 and 14 are preferred. For length 11 the sequence is: TG<2><4>L<4><4><4><3><4><4>and for Length 14 the sequence is: TG<1>5S<2>VG<1><3><2><3>VS, wherein <1> is 0.27 T, 0.27 G and 0.027 each of ADEFHIKLMNPQRSVWY; <2> is 0.27 D, 0.27 N and 0.027 each of AEFGHIKLMPQRSTVWY; <3> is 0.36 Y and 0.0355 each of ADEFGHIKLMNPQRSTVW; and <4> is an equimolar mixture of amino acid residues ADEFGHIKLMNPQRSTVWY. Most preferably, mixtures (similar to those occurring in native antibodies) preferably, the ratio is 11:14::23:46::0.33: 0.67 of the three lengths are used.
  • (c) CDR2
  • In native human lambda chains, CDR2s with length 7 are by far the most common. This length is preferred in this invention. The sequence of this Length 7 CDR2 is <4><4><4><2>RPS, wherein <2> is 0.27 D, 0.27 N, and 0.027 each of AEFGHIKLMPQRSTVWY and <4> is an equimolar mixture of amino acid residues ADEFGHIKLMNPQRSTVW.
  • (d) CDR3
  • In native human lambda chains, CDR3s of length 10 and 11 predominate, while length 9 is also common. Any of these three lengths can be used in the invention. Length 11 is preferred and mixtures of 10 and 11 more preferred. The sequence of Length 11 is <4><5><4><2><4>S<4><4><4><4>V, where <2> and <4> are as defined for the lambda CDR1 and <5> is 0.36 S and 0.0355 each of ADFFGHIKLMNPQRTVWY. The sequence of Length 10 is <5>SY<1><5>S<5><1><4>V, wherein <1> is an equimolar mixture of ADEFGHIKLMNPQRSTVWY; and <4> and <5> are as defined for Length 11. The preferred mixtures of this invention comprise an equimolar mixture of Length 10 and Length 11. Table 8 shows a preferred focused lambda light chain diversity in accordance with this invention.
  • Table 9 shows a series of diversity oligonucleotides and primers that may be used to construct the lambda chain diversities depicted in Table 7.
  • Method of Construction of the Genetic Package
  • The diversities of heavy chain and the kappa and lambda light chains are best constructed in separate vectors. First a synthetic gene is designed to embody each of the synthetic variable domains. The light chains are bounded by restriction sites for ApaLI (positioned at the very end of the signal sequence) and AscI (positioned afer the stop codon). The heavy chain is bounded by SfiI (positioned within the Pe1B signal sequence) and NotI (positioned in the linker between CH1 and the anchor protein). Signal sequences other than Pe1B may also need, e.g., a M13 pIII signal sequence.
  • The initial genes are made with “stuffer” sequences in place of the desired CDRs. A “Stuffer” is a sequence that is to be cut away and replaced by diverse DNA but which does not allow expression of a functional antibody gene. For example, the stuffer may contain several stop codons and restriction sites that will not occur in the correct finished library vector. For example, in Table 10, the stuffer for CDR1 of kappa A27 contains a StuI site. The vgDNA for CDR1 is introduced as a cassette from EspI, XmaI, or AflII to either SexAI or KasI. After the ligation, the DNA is cleaved with StuI; there should be no StuI sites in the desired vectors.
  • The sequences of the heavy chain gene with stuffers is depicted in Table 6. The sequences of the kappa light chain gene with stuffers is depicted in Table 10. The sequence of the lambda light chain gene with stuffers is depicted in Table 11.
  • In another embodiment of the present intention the diversities of heavy chain and the kappa or lambda light chains are constructed in a single vector or genetic packages (e.g., for display or display and expression) having appropriate restriction sites that allow cloning of these chains. The processes to construct such vectors are well known and widely used in the art. Preferably, a heavy chain and Kappa light chain library and a heavy chain and lambda light chain library would be prepared separately. The two libraries, most preferably, will then be mixed in equimolar amounts to attain maximum diversity.
  • Most preferably, the display is had on the surface of a derivative of M13 phage. The most preferred vector contains all the genes of M13, an antibiotic resistance gene, and the display cassette. The preferred vector is provided with restriction sites that allow introduction and excision of members of the diverse family of genes, as cassettes. The preferred vector is stable against rearrangement under the growth conditions used to amplify phage.
  • In another embodiment of this invention, the diversity captured by the methods of the present invention may be displayed and/or expressed in a phagemid vector (e.g., pCES1) that displays and/or expresses the peptide, polypeptide or protein. Such vectors may also be used to store the diversity for subsequent display and/or expression using other vectors or phage.
  • In another embodiment of this invention, the diversity captured by the methods of the present invention may be displayed and/or expressed in a yeast vector.
    TABLE 1
    3-23:JH4 CDR1/2 diversity = 1.78 × 108
                                    FR1 (VP47/V3-23).......
              20 21 22              23  24  25  26  27  28  29  30
               A  M  A               E   V   Q   L   L   E   S   G
    ctgtctgaac cc atg gcc           gaa|gtt|caa|ttg|tta|gag|tct|ggt|
    Scab...... NcoI....                      MfeI
    -------------FR1---------------------------------
    31  32  33  34  35  36  37  38  39  40  41  42  43  44  45
     G   G   L   V   Q   P   G   G   S   L   R   L   S   C   A
    |ggc|ggt|cct|gtt|cag|cct|ggt|ggt|tct|tta|cgt|ctt|tct|tgc|gtc|
        Sites of variegation    <1>        <1> <1> <1>            6859-fold diversity
    ----FR1------------------->|.....CDR1..................|---FR2------
    46  47  48  49  50  51  52  53  54  55  56  57  58  59  60
     A   S   G   F   T   F   S   -  Y  -   M   -   W  V  R
    |gct|tcc|gga|ttc|act|ttc|tct|-|tac|-|atg|-|tgg|gtt|cgc|
          BspEI                   BsiWI                   BstXI.
                          Sites of variegation-><2>    <2> <3>
    -------FR2-------------------------------->|...CDR2..........
    61  62  63  64  65  66  67  68  69  70  71  72  73  74  75
     Q   A   P   G   K   G   L   E   W   V   S   -   I   -   -
    |caa|gct|cct|ggt|aaa|ggt|ttg|gag|tgg|gtt|tct| - |atc| - | - |
    ...BstXI
                <1>     <1>  25992-fold diversity in CDR2
    ....CDR2............................................|---FR3---
     76  77  78  79  80  81  82  83  84  85  86  87  88  89  90
      S   G   G   -   T   -   Y   A   D   S   V   K   G   R   F
    |tct|ggt|ggc| - |act| - |tat|gct|gac|tcc|gtt|aaa|ggt|cgc|ttc|
    -------FR3---------------------------------------------------
     91  92  93  94  95  96  97  98  99  100 101 102 103 104 105
     T   I   S   R   D   N   S   K   N   T   L   Y   L   Q   M
    |act|atc|tct|aga|gac|aac|tct|aag|aat|act|ctc|tac|ttg|cag|atg|
             XbaI
    ---FR3---------------------------------------------------->|
     106 107 108 109 110 111 112 113 114 115 116 117 118 119 120
      N   S   L   R   A   E   D   T   A   V   Y   Y   C   A   K
    |aac|agc|tta|agg|gct|gag|tac|acc|gct|gtc|tac|tac|tgc|gcc|aaa|
            AflII
    .......CDR3.................| Replaced by the various components!
     121 122 123 124 125 126 127
      D   Y   E   G   T   G   Y
    |gac|tat|gaa|ggt|act|ggt|tat|
    |------FRV----(JH4)------------------------------------------
      Y   F   D   Y   W   G   Q   G   T   L   V   T   V   S   S
    |tat|ttc|gat|tat|tgg|ggt|caa|ggt|acc|ctg|gtc|acc|gtc|tct|agt|...
                                 KpnI       BstEII

    <1> = Codons for ADEFGHIKLMNPQRSTVWY (equimolar mixture)

    <2> = Codons for YRWVGS (equimolar mixture)

    <3> = Codons for PS or PS and G (equimolar mixture)
  • TABLE 2
    OligoNucleotides used to variegate CDR1 of human HC
    CDR1 - 5 residues
    (ON-R1V1vg): 5′ct|tcc|gga|ttc|act|ttc|tct|<1>|tac|<1>|atg|<1>|tgg|gtt|cgc|caa|gct|cct|gg|-3′
    (ON-R1top): 5′-cctactgtct|tcc|gga|ttc|act|ttc|tct-3′
    (ON-R1bot) [RC]: 5′-tgg|gtt|cgc|caa|gct|cct|ggttgctcactc-3′
    CDR1 - 7 residues
    (ON-R1V2vg): 5′-ct|tcc|gga|ttc|act|ttc|tct|<6>|<7>|<7>|tac|tac|tgg|<7>|tgg|gtt|cgc|caa|gct|
    cct|gg-3′
    CDR1 - 14 residues
    (ON-R1V3vg): 5′-ct|tcc|gga|ttc|act|ttc|tct|atc|agc|ggt|ggt|tct|atc|tcc|<1>|<1>|<1>|-
    tac|tac|tgg|<1>|tgg|gtt|cgc|caa|gct|cct|gg-3′

    <1> = Codons of ADEFGHIKLMNPQRSTVWY 1:1

    <6> = Codons for ST, 1:1

    <7> = 0.2025 (Codons for SG) + 0.035 (Codons for ADEFHIKLMNPQRTVWY)

    <1> = Codons for ADEFGHIKLMNPQRSTVWY 1:1
  • TABLE 3
    Oligonucleotides used to variegate CDR2 of human HC
    CDR2 - 17 residues
    (ON-R2V1vg): 5′-ggt|ttg|gag|tgg|gtt|tct|<2>|atc|<2>|<3>|tct|ggt|ggc|<1>|act|<1>|tat|gct|-
    gac|tcc|gtt|aaa|gg-3′
    (ON-R2top): 5′-ct|tgg|gtt|cgc|caa|gct|cct|ggt|aaa|ggt|ttg|gag|tgg|gtt|tct-3′
    (ON-R2bot) [RC]: 5′-tat|gct|gac|tcc|gtt|aaa|ggt|cgc|ttc|act|atc|tct|aga|ttcctgtcac-3′
    (ON-R2V2vg): 5′-ggt|ttg|gag|tgg|gtt|tct|<1>|atc|<4>|<1>|<1>|ggt|<5>|<1>|<1>|<1>|tat|gct|-
    gac|tcc|gtt|aaa|gg-3′
    CDR2 - 16 residues
    (ON-R2V3vg): 5′-ggt|ttg|gag|tgg|gtt|tct|<1>|atc|<4>|<1>|<1>|ggt|
    <5>|<1>|<1>|tat|aac|cct|tcc|ctt|aag|gg-3′
    (ON-R2bo3) [RC]: 5′-tat|aac|cct|tcc|ctt|aag|ggt|cgc|ttc|act|tct|aga|ttcctgtcac-3′
    CDR2 - 19 residues
    (ON-R2V4vg): 5′-fft|ttg|gag|tgg|gtt|tct|<1>|atc|<8|agt|<1>|<1>|
    <1>|ggt|ggt|act|act|<1>|tat|gcc|gct|tcc|gtt|aag|gg-3′
    (ON-R2bo4) [RC]: 5′-tat|gcc|gct|tcc|gtt|aag|ggt|cgc|ttc|act|atc|tct|aga|ttcctgtcac-3′

    <1> = Codons for A, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W and Y (equimolar mixture)

    <2> = Codons for Y, R, W, V, G and S (equimolar mixture)

    <3> = Codons for P and S (equimolar mixture) or P, S and G (equimolar mixture)

    <4> =Codons for DINSWY (equimolar mixture)

    <5> =Codons for SGDN, (equimolar mixture)

    <1>, <2>, <3>, <4> and <5> are as defined above

    <8> is 0.27 R and 0.027 each of ADEFGHIKLMNPQSTVWY
  • TABLE 4
    Preferred Components of HC CDR3
    Preferred
    Fraction of Adjusted
    Component Length Complexity Library Fraction
    1 YYCA21111YFDYWG. 8 2.6 × 105 .10 .02
    (1 = any amino acid residue, except C; 2 = K and R)
    2 YYCA2111111YFDYWG. 10 9.4 × 107 .14 .14
    (1 = any amino acid residue, except C; 2 = K and R
    3 YYCA211111111YFDYTG. 12 3.4 × 1010 .25 .25
    (1 = any amino acid residue, except C; 2 = K and R
    4 YYCAR111S2S3111YFDYWG. 14 1.9 × 108 .13 .14
    (1 = any amino acid residue, except C; 2 = S and G 3 = Y and W)
    5 YYCA2111CSG11CY1YFDYWG. 15 9.4 × 107 .13 .14
    (1 = any amino acid residue, except C; 2 = K and R
    6 YYCA211S1TIFG11111YFDYWG. 17 1.7 × 1010 .11 .12
    (1 = any amino acid residue, except C; 2 = K and R
    7 YYCAR111YY2S33YY111YFDYWG. 18 3.8 × 108 .04 .08
    (1 = any amino acid residue, except C; 2 = D or G; 3 = S and G)
    8 YYCAR1111YC2231CY111YFDYWG. 19 2.0 × 1011 .10 .11
    (1 = any amino acid residue, except C; 2 = S and G; 3 = T, D and G)
  • TABLE 5
    Oligonucleotides used to variegate the eight components of HC CDR3
    (Ctop25): 5′-gctctggtcaac|tta|agg|gct|gag|g-3′
    (CtprmA): 5′-gctctggtcaac|tta|agg|gct|gag|gac|acc|gct|gtc|tac|tac|tgc|gcc-3′
                  AflII...
    (CBprmB) [RC]: 5′-|tac|ttc|gat|tac|tgg|ggc|caa|ggt|acc|ctg|gtc|acc|tcgctccacc-3′
                                              BstEII...
    (CBot25) [RC]: 5′-|ggt|acc|ctg|gtc|acc|tcgctccacc-3′
    The 20 bases at 3′ end of CtprmA are identical to the most 5′ 20 bases
    of each of the vgDNA molecules.
    Ctop25 is identical to the most 5′ 25 bases of CtprmA.
    The 23 most 3′ bases of CBprmB are the reverse complement of the
    most 3′ 23 bases of each of the vgDNA molecules.
    CBot25 is identical to the 25 bases at the 5′ end of CBprmB.
    Component 1
    (C1t08): 5′-cc|gct|gtc|tac|tac|tgc|ggc|<2>|<1>|<1>|<1>|<1>|tac|ttc|gat|tac|tgg|ggc|caa|gg-3′
    Component 2
    (C2t10): 5′-cc|gct|gtc|tac|tac|tgc|gcc|<2>|<1>|<1>|<1>|<1>|<1>|<1>|tac|ttc|gat|tac|tgg|ggc|caa|gg-3′
    Component 3
    (C3t12): 5′-cc|gct|gtc|tac|tac|tgc|gcc|<2>|<1>|<1>|<1>|<1>|<1>|<1>|<1>|<1>|tac|ttc||gat|tac|-
    tgg|ggc|caa|gg-3′
    Component 4
    (C4t140): 5′-cc|gct|gtc|tac|tac|tgc|gcc|cgt|<1>|<1>|<1>|tct|<2>|tct|<3>|<1>|<1>|<1>|tac|ttc|gat|-
    tac|tgg|ggc|caa|gg-3′
    Component 5
    (C5t15): 5′-cc|gct|gtc|tac|tac|tgc|gcc|<2>|<1>|<1>|<1>|tgc|tct|ggt|<1>|<1>|tgc|tat|<1>|tac|-
    ttc|gat|tac|tgg|ggc|caa|gg-3′
    Component 6
    (C6t17): 5′-cc|gct|gtc|tac|tac|tgc|gcc|<2>|<1>|<1>|tct<1>|act|atc|ttc|ggt|<1>|<1>|<1>|<1>|-
    <1>|tac|ttc|gat|tac|tgg|ggc|caa|gg-3′
    Component 7
    (C7t18): 5′-cc|gct|gtc|tac|tac|tgc|ggc|cgt|<1>|<1>|<1>|tat|tac|<2>|tct|<3>|<3>|tac|tat|-
    <1>|<1>|<1>|tac|ttc|gat|tac|tgg|ggc|caa|gg-3′
    Component 8
    (c8t19): 5′-cc|gct|gtc|tac|tac|tgc|gcc|cgt|<1>|<1>|<1>|<1>|tat|tgc|<2>|<2>|<3>|<1>|tgc|tat|-
    <1>|<1>|<1>|tac|ttc|gat|tac|tgg|ggc|caa|gg-3′

    <1> = 0.095 Y + 0.095 G + 0.048 each of the residues ADEFHIKLMNPQRSTVW, no C;

    <2> = K and R (equimolar mixture)

    <1> = 0.095 Y + 0.095 G + 0.048 each of ADEFHIKLMNPQRSTVW, no C;

    <2> = K and R (equimolar mixture)

    <1> = 0.095 Y + 0.095 G + 0.048 each of ADEFHIKLMNPQRSTVW, no C;

    <2> = K and R (equimolar mixture)

    <1> = 0.095 Y + 0.095 G + 0.048 each of ADEFHIKLMNPQRSTVW, no C;

    <2> = S and G (equimolar mixture);

    <3> = Y and W (equimolar mixture)

    <1> = 0.095 Y + 0.095 G + 0.048 each of ADEFHIKLMNPQRSTVW, no C;

    <2> = K and R (equimolar mixture)

    <1> = 0.095 Y + 0.095 G + 0.048 each of ADEFHIKLMNPQRSTVW, no C;

    <2> = K and R (equimolar mixture)

    <1> = 0.095 Y + 0.095 G + 0.048 each of ADEFHIKLMNPQRSTVW, no C;

    <2> = D and G (equimolar mixture);

    <3> = S and G (equimolar mixture)

    <1> = 0.095 Y + 0.095 G + 0.048 each of ADEFHIKLMNPQRSTVW, no C;

    <2> = S and G (equimolar mixture);

    <3> = TDG (equimolar mixture);
  • TABLE 6
    3-23::JH4 Stuffers in place of CDRs
                                     FR1 (DP47/V3-23)
              20  21  22             23  24  25  26  27  28  29  30
               A   M   A             E   V   Q   L   L   E   S   G
    ctgtctgaac cc atg gcc           gaa|gtt|caa|ttg|tta|gag|tct|ggt|
    Scab...... NcoI....                      MfeI
    --------------FR1--------------------------------------------
     31  32  33  34  35  36  37  38  39  40  41  42  43  44  45
      G   G   L   V   Q   P   G   G   S   L   R   L   S   C   A
    |ggc|ggt|ctt|gtt|cag|cct|ggt|ggt|tct|tta|cgt|ctt|tct|tgc|gct|
    ----FR1-------------------->|...CDR1 stuffer....|---FR2------
     46  47  48  49  50  51  52  53  54  55  56  57  58  59  60
      A   S   G   F   T   F   S   S   Y   A   |   |   W   V   R
    |gct|tcc|gaa|ttc|act|ttc|tct|tcg|tac|gct|tag|taa|tgg|gtt|cgc|
          BspEI                     BsiWI                       BstXI.
     -------FR2-------------------------------->|...CDR2 stuffer.
     61  62  63  64  65  66  67  68  69  70  71  72  73  74  75
      Q   A   P   G   K   G   L   E   W   V   S   |   p   r   |
    |caa|gct|cct|ggt|aaa|ggt|ttg|gag|tgg|gtt|tct|taa|cct|agg|tag|
    ... BstXI                                        AvrII..
    ...CDR2 stuffer....................................|---FR3---
      91  92  93  94  95  96  97  98  99 100 101 102 103 104 105
      T   I   S   R   D   N   S   K   N   T   L   Y   L   Q   M
    |act|atc|tct|aga|gac|aac|tct|aag|aat|act|ctc|tac|ttg|cag|atg|
              XbaI
    ---FR3-----------..> CDR3 Stuffer------------->|
     106 107 108 109 110
      N   S   L   R   A
    |aac|agc|tta|agg|gct|tag taa agg cct taa
            AflII                StuI...
    |----- FR4 ---(JH4)------------------------------------------
      Y   F   D   Y   W   G   Q   G   T   L   V   T   V   S   S
    |tat|ttc|gat|tat|tgg|ggt|caa|ggt|acc|ctg|gtc|acc|gtc|tct|agt|
                                  KpnI       BstEII
  • TABLE 7
    A27:JH1 Human Kappa light chain gene
    gaggacc attgggcccc ctccgagact ctcgagcgca
    Scab...... Eco0109I           XhoI..
               ApaI.
    acgcaattaa tgtgagttag ctcactcatt aggcacccca ggctttacac tttatgcttc
          ..-35..          Plac                    ..-10.
    cggctcgtat gttgtgtgga attgtgagcg gataacaatt tcacacagga
    aacagctatg accatgatta
    cgccaagctt tggagccttt tttttggaga ttttcaac
      Pf1MI.......
          Hind III
    M13 III signal sequence (AA se|)-------------------------->
     1   2   3   4   5   6   7   8   9  10  11  12  13  14  15
     M   K   K   L   L   F   A   I   P   L   V   V   P   F   Y
    gtg aag aag ctc cta ttt gct atc ccg ctt gtc gtt ccg ttt tac
    -- Signal-->FR1------------------------------------------>
     16  17  18  19  20  21  22  23  24  25  26  27  28  29  30
      S   H   S   A   Q   S   V   L   T   Q   S   P   G   T   L
    |agc|cat|agt|gca|caa|tcc|gtc|ctt|act|caa|tct|cct|ggc|act|ctt|
              ApaLI...
    ----- FR1 ------------------------------------->| CDR1------>
     31  32  33  34  35  36  37  38  39  40  41  42  43  44  45
      S   L   S   P   G   E   R   A   T   L   S   C   R   A   S
    |tcg|cta|agc|ccg|ggt|gaa|cgt|gct|acc|tta|agt|tgc|cgt|gct|tcc|
       EspI.....                       AflII...
               XmaI....
    (CDR1 installed as AflII-(SexAI or KasI) cassette.) For the most
    preferred 11 length codon 51 (XXX) is omitted; for the preferred
    12 length this codon is <2>
    -------- CDR1 --------------------->|--- FR2 -------------->
         <1>     <2> <2> xxx <3>
     46  47  48  49  50  51  52  53  54  55  56  57  58  59  60
      Q   -   V   -   -   -   -  L   A   W   Y   Q   Q   K   P
    |cag| - |gtt| - | - | - | - |ctt|gct|tgg|tat|caa|cag|aaa|cct|
                                                          SexAI...
    CDR2 installed as (SexAI or KasI) to (BamHI or RsrII)
    cassette.)
    ---- FR2 ------------------------->|------- CDR2 ---------->
                                       <1>          <2>     <4>
     61  62  63  64  65  66  67  68  69  70  71  72  73  74  75
      G   Q   A   P   R   L   L   I   Y   -   A   S   -   R   -
    |ggt|cag|gcg|ccg|cgt|tta|ctt|att|tat| - |gct|tct| - |cgc| - |
    SexAI....  KasI....
    CDR2-->|--- FR3 ------------------------------------------->
     <1>
     76  77  78  79  80  81  82  83  84  85  86  87  88  89  90
      -   G   I   P   D   R   F   S   G   S   G   S   G   T   D
    | - |ggg|atc|ccg|gac|cgt|ttc|tct|ggc|tct|ggt|tca|ggt|act|gac|
          BamHI...
                 RsrII.....
    ------ FR3 ------------------------------------------------>
     91  92  93  94  95  96  97  98  99 100 101 102 103 104 105
      F   T   L   T   I   S   R   L   E   P   E   D   F   A   V
    |ttt|acc|ctt|act|att|tct|aga|ttg|gaa|cct|gaa|gac|ttc|gct|gtt|
                         XbaI...
    For CDR3 (Length 8): QQ33111P
    1 and 3 as defined for Length 9
    For CDR3 (Length 10): QQ3211PP1T
    1 and 3 as defined for Length 9
    2 S (0.2) and 0.044 each of ADEFGHIKLMNPQRTVWY
    CDR3 installed as XbaI to (StyI or BsiWI) cassette.
    ----------->|----CDR3-------------------------->|-----FR4--->
                         <3> <1> <1> <1>     <1>
    106 107 108 109 110 111 112 113 114 115 116 117 118 119 120
      Y   Y   C   Q   Q   -   -   -   -   P   -   T   F   G   Q
    |tat|tat|tgc|caa|cag| - | - | - | - |cct| - |act|ttc|ggt|caa|
               BstXI..........
    -----FR4------------------->|      <-------- Ckappa -----------
    121 122 123 124 125 126 127        128 129 130 131 132 133 134
      G   T   K   V   E   I   K         R   T   V   A   A   P   S
    |gt|acc|aag|gtt|gaa|atc|aag|      |cgt|acg|gtt|gcc|gct|cct|agt|
         StyI....                      BsiWI..
    135 136 137 138 139 140 141 142 143 144 145 146 147 148 149
      V   F   I   F   P   P   S   D   E   Q   L   K   S   G   T
    |gtg|ttt|atc|ttt|cct|cct|tct|gac|gaa|caa|ttg|aag|tca|ggt|act|
                                         MfeI...
    150 151 152 153 154 155 156 157 158 159 160 161 162 163 164
      A   S   V   V   C   L   L   N   N   F   Y   P   R   E   A
    |gct|tct|gtc|gta|tgt|ttg|ctc|aac|aat|ttc|tac|cct|cgt|gaa|gct|
                                                  BssSI...
    165 166 167 168 169 170 171 172 173 174 175 176 177 178 179
      K   V   Q   W   K   V   D   N   A   L   Q   S   G   N   S
    |aaa|gtt|cag|tgg|aaa|gtc|gat|aac|gcg|ttg|cag|tcg|ggt|aac|agt|
                                  MluI....
    180 181 182 183 184 185 186 187 188 189 190 191 192 193 194
      Q   E   S   V   T   E   Q   D   S   K   D   S   T   Y   S
    |caa|gaa|tcc|gtc|act|gaa|cag|gat|agt|aag|gac|tct|acc|tac|tct|
    195 196 197 198 199 200 201 202 203 204 205 206 207 208 209
      L   S   S   T   L   T   L   S   K   A   D   Y   E   K   H
    |ttg|tcc|tct|act|ctt|act|tta|tca|aag|gct|gat|tat|gag|aag|cat|
    210 211 212 213 214 215 216 217 218 219 220 221 222 223 224
      K   V   Y   A   C   E   V   T   H   Q   G   L   S   S   P
    |aag|gtc|tat|GCt|TGC|gaa|gtt|acc|cac|cag|ggt|ctg|agc|tcc|cct|
                                                   SacI....
    225 226 227 228 229 230 231 232 233 234
      V   T   K   S   F   N   R   G   E   C   .   .
    |gtt|acc|aaa|agt|ttc|aac|cgt|ggt|gaa|tgc|taa|tag ggcgcgcc
                           DsaI....                  AscI....
                                                      BssHII
    acgcatctctaa gcggccgc aacaggaggag
                 NotI....

    For CDR1:

    <1> ADEFGHIKLMNPQRSTVWY 1:1

    <2> S (0.2) ADEFGHIKLMNPQRTVWY (0.044 each)

    <3> Y (0.2) ADEFGHIKLMNPQRSTVW (0.044 each)

    For CDR2:

    <1> ADEFGHIKLMNPQRSTVWY 1:1

    <2> S (0.2) ADEFGHIKLMNPQRTVWY (0.044 each)

    <4> A (0.2) DEFGHIKLMNPQRSTVWY (0.044 each)

    For CDR3 (Length 9):

    <1> ADEFGHIKLMNPQRSTVWY 1:1

    <3> Y (0.2) ADEFGHIKLMNPQRTVW (0.044 each)
  • TABLE 8
    2a2 JH2 Human lambda-chain gene
    gaggaccatt gggcccc ttactccgtgac
    Scab...... Eco0109I
               ApaI..
            -----------FR1-------------------------------------------->
             1   2   3   4   5   6   7   8   9  10  11  12  13  14  15
     S   A   Q   S   A   L   T   Q   P   A   S   V   S   G   S   P   G
    agt|gca|caa|tcc|gct|ctc|act|cag|cct|gct|agc|gtt|tcc|ggg|tca|cct|ggt|
     ApaLI...                           NheI...          BstEII...
                                                              SexAI.....
                                  T   G  <1>  S   S  <2>  V   G
    ------FR1------------------> |-----CDR1--------------------
     16  17  18  19  20  21  22  23  24  25  26  27  28  29  30
      Q   S   I   T   I   S   C   T   G   -   S   S   -   V   G
    |caa|agt|atc|act|att|tct|tgt|aca|ggt| - |tct|tct| - gtt|ggc|
                             BsrGI..
     <1> <3> <2> <3>  V   S = vg Scheme #1, length = 14
     -----CDR1------------->|--------FR2-------------------------
     31  32  33  34  35  36  37  38  39  40  41  42  43  44  45
      -   -   -   -   V   S   W   Y   Q   Q   H   P   G   K   A
    | - | - | - | - |gtt|tct|tgg|tat|caa|caa|cac|ccg|ggc|aag|gcg|
                                               XmaI....    KasI
                                               AvaI....
                             <4> <4> <4> <2>  R   P   S
    --FR2------------------> |------CDR2--------------->|----FR3-
     46  47  48  49  50  51  52  53  54  55  56  57  58  59  60
      P   K   L   M   I   Y   -   -   -   -   R   P   S   G   V
    |ccg|aag|ttg|atg|atc|tac| - | - | - | - |cgt|cct|tct|ggt|gtt|
    KasI....
    FR3
     61  62  63  64  65  66  67  68  69  70  71  72  73  74  75
      S   N   R   F   S   G   S   K   S   G   N   T   A   S   L
    |agc|aat|cgt|ttc|tcc|gga|tct|aaa|tcc|ggt|aat|acc|gca|agc|tta|
                     BspEI..                           HindIII.
                          BsaBI........(blunt)
    -------FR3------------------------------------------------->1
     76  77  78  79  80  81  82  83  84  85  86  87  88  89  90
      T   I   S   G   L   Q   A   E   D   E   A   D   Y   Y   C
    |act|atc|tct|ggt|ctg|cag|gct|gaa|gac|gag|gct|gac|tac|tat|tgt|
                     PstI...
    <4> <5> <4> <2> <4> S <4> <4> <4> <4> V
    -----CDR3-------------------------------->|---FR4----------
     91  92  93  94  95  96  97  98  99 100 101 102 103 104 105
      -   -   -   -   -   S   -   -   -   -   V   F   G   G   G
    | - | - | - | - | - |tct| - | - | - | - |gtc|ttc|ggc|ggt|ggt|
                                                             KpnI...
    ------FR4-------------->
    106 107 108 109 110 111 112 113 114 115 116 117 118 119 120
      T   K   L   T   V   L   G   Q   P   K   A   A   P   S   V
    |acc|aaa|ctt|act|gtc|ctc|ggt|caa|cct|aag|gct|gct|cct|tcc|gtt|
    KpnI...                   HincII..
                                    Bsu36I...
    121 122 123 124 125 126 127 128 129 130 131 132 133 134 135
      T   L   F   P   P   S   S   E   E   L   Q   A   N   K   A
    |act|ctc|ttc|cct|cct|agt|tct|gaa|gag|ctt|caa|gct|aac|aag|gct|
                                 SapI......
    136 137 138 139 140 141 142 143 144 145 146 147 148 149 150
      T   L   V   C   L   I   S   D   F   Y   P   G   A   V   T
    |act|ctt|gtt|tgc|ttg|atc|agt|gac|ttt|tat|cct|ggt|gct|gtt|act|
                      BclI....
    151 152 153 154 155 156 157 158 159 160 161 162 163 164 165
      V   A   W   K   A   D   S   S   P   V   K   A   G   V   E
    |gtc|gct|tgg|aaa|gcc|gat|tct|tct|cct|gtt|aaa|gct|ggt|gtt|gag|
                                                             BsmBI...
    166 167 168 169 170 171 172 173 174 175 176 177 178 179 180
      T   T   T   P   S   K   Q   S   N   N   K   Y   A   A   S
    |acg|acc|act|cct|tct|aaa|caa|tct|aac|aat|aag|tac|gct|gcg|agc|
    BsmBI....                                              SacI....
    181 182 183 184 185 186 187 188 189 190 191 192 193 194 195
      S   Y   L   S   L   T   P   E   Q   W   K   S   H   K   S
    |tct|tat|ctt|tct|ctc|acc|cct|gaa|caa|tgg|aag|tct|cat|aaa|tcc|
    SacI...
    196 197 198 199 200 201 202 203 204 205 206 207 208 209 210
      Y   S   C   Q   V   T   H   E   G   S   T   V   E   K   T
    |tat|tcc|tgt|caa|gtt|act|cat|gaa|ggt|tct|acc|gtt|gaa|aag|act|
                          BspHI...
    211 212 213 214 215 216 217 218 219
      V   A   P   T   E   C   S   .   .
    |gtt|gcc|cct|act|gag|tgt|tct|tag|tga|ggcgcgcc
                                        AscI....
                                         BssHII
    aacgatgttc aag gcggccgc aacaggaggag
                   NotI.... Scab.......

    For CDR1 (length 14):

    <1> = 0.27 T, 0.27 G, 0.027 each of ADEFHIKLMNPQRSVWY, no C

    <2> = 0.27 D, 0.27 N, 0.027 each of AEFGHIKLMPQRSTVWY, no C

    <3> = 0.36 Y, 0.0355 each of ADEFGHIKLMNPQRSTVW, no C

    A second Vg scheme for CDR1 gives segments of length 11: T22G<2><4>L<4><4><4><3><4><4> where

    <4> 32 e|uimolar mixture of each of ADEFGHIKLMNPQRSTVWY, no C

    <3> 32 as defined above for the alternative CDR1

    For CDR2:

    <2> and <4> are the same variegation as for CDR1

    CDR3 (Length 11):

    <2> and <4>are the same variegation as for CDR1

    <5> = 0.36 S, 0.0355 each of ADEFGHIKLMNPQRTVWY no C

    CDR3 (Length 10): <5> SY <1> <5> S <5> <1> <4> V

    <1> is an equimolar mixture of ADEFGHIKLMNPQRSTVWY, no C

    <4> and <5> are as defined for Length 11
  • TABLE 9
    Oligonucleotides For Kappa and Lambda Light Chain Variegation
    (Ctop25): 5′-gctctggtcaac|tta|agg|gct|gag|g-3′
    (CtprmA): 5′-gctctggtcaac|tta|agg|gct|gag|gac|acc|gct|gtc|tac|tac|tgc|gcc-3′
                  AflII...
    (CBprmB) [RC]: 5′-|tac|ttc|gat|tac|ttg|ggc|caa|ggt|acc|ctg|gtc|acc|tcgctccacc-3′
                                              BstEII...
    (CBot25) [RC]: 5′-|ggt|acc|ctg|gtc|acc|tcgctccacc-3′
    Kappa chains: CDR1 (“1”), CDR2 (“2”), CDR3 (“3”)
    CDR1
    (Ka1Top610): 5′-ggtctcagttg|cta|agc|ccg|ggt|gaa|cgt|gct|acc|tta|agt|tgc|cgt|gct|tcc|cag-3′
    (Ka1STp615): 5′-ggtctcagttg|cta|agc|ccg|ggt|g-3′
    (Ka1Bot620) [RC]: 5′-ctt|gct|tgg|tat|caa|cag|aaa|cct|ggt|cag|gcg|ccaagtcgtgtc-3′
    (Ka1SB625) [RC]: 5′-cct|ggt|cag|gcg|ccaagtcgtgtc-3′
    (Ka1vg600): 5′-gct|acc|tta|agt|tgc|cgt|gct|tcc|cag-
    |<1>|gtt|<2>|<2>|<3>|ctt|gct|tgg|tat|caa|cag|aaa|cc-3′
    (Ka1vg600-12): 5′-gct|acc|tta|agt|tgc|cgt|gct|tcc|cag-
    |<1>|gtt<2>|<2>|<2>|<3>|ctt|gct|tgg|tat|caa|cag|aaa|cc-3′
    CDR2
    (Ka2Tshort657): 5′-cacgagtccta|cct|ggt|cag|gc-3′
    (Ka2Tlong655): 5′-cacgagtccta|cct|ggt|cag|gdg|ccg|cgt|tta|ctt|att|tat-3′
    (Ka2Bshort660): [RC]: 5′-|gac|cgt|ttc|tct|ggt|tctcacc-3′
    |cgc|<4>|<1>|ggg|atc|ccg|gac|cgt|ttc|tct|ggt|tctcacc-3′
    CDR3
    (Ka3Tlon672): 5′-gacgagtccttct|aga|ttg|gaa|cct|gaa|gac|ttc|gct|gtt|tat|tat|tgc|caa|c-3′
    (Ka3BotL682) [RC]: 5′-act|ttc|ggt|caa|ggt|acc|aag|gtt|gaa|atc|aag|cgt|acg|tcacaggtgag-3′
    (Ka3Bsho694) [RC]: 5′-gaa|atc|aag|cgt|acg|tcacaggtgag-3′
    (Ka3vg670): 5′-gac|ttc|gct|gtt|-
    |tat|tat|tgc|caa|cag|<3>|<1>|<1>a<1>|cct|<1>|act|ttc|ggt|caa|-
    |ggt|acc|aag|gtt|g-3′
    (Ka3vg670-8): 5′-gac|ttc|gct|gtt|-
    |tat|tat|tgc|caa|cag|<3>|<3>|<1>|<1>|<1>|cct|ttc|ggt|caa|-
    |ggt|acc|aag|gtt|g-3′
    (Ka3vg670-10): 5′-gac|ttc|gct|gtt|tat|-
    |tat|tgc|caa|cag|<3>|<2>|<1>|<1>|cct|cct|<1>|act|ttc|ggt|caa|-
    |ggt|acc|aag|gtt|g-3′
    Lambda Chains: CDR1 (“1”), CDR2 (“2”), CDR3 (“3”)
    CDR1
    (Lm1TPri75): 5′-gacgagtcctgg|tca|cct|ggt|-3′
    (Lm1tlo715): 5′-gacgagtcctgg|tca|cct|ggt|caa|agt|atc|act|att|tct|tgt|aca|ggt-3′
    (Lm1blo724) [rc]: 5′-gtt|tct|tgg|tat|caa|caa|cac|ccg|ggc|aag|gcg|agatcttcacaggtgag-3′
    (Lm1bsh737) [rc]: 5′-gc|aag|gcg|agatcttcacaggtgag-3′
    (Lm1vh710b): 5′-gt|atc|act|att|tct|tgt|aca|ggt|<2>|<4>|ctc|<4>|<4>|<4>|-
    |<3>|<4>|<4>|tgg|tat|caa|caa|cac|cc-3-′
    (Lm1vh710): 5′-gt|atc|act|att|tct|tgt|aca|ggt|<1>|tct|tct|<2>|gtt|ggc|-
    |<1>|<3>|<2>|<3>|gtt|tct|tgg|tat|caa|caa|cac|cc-3′
    CDR2
    (Lm2TSh757): 5′-gagcagaggac|ccg|ggc|aag|gc-3′
    (Lm2TLo753): 5′-gagcagaggac|ccg|ggc|aag|gcg|ccg|aag|ttg|atg|atc|tac|-3′
    (Lm2BLo762) [RC]: 5′-cgt|cct|tct|ggt|gtc|agc|aat|cgt|ttc|tcc|gga|tcacaggtgag-3′
    (Lm2BSh765) [RC]: 5′-cgt|ttc|tcc|gga|tcacaggtgag-3′
    (Lm2vg750): 5′-g|ccg|aag|ttg|atg|atc|tac|-
    <4>|<4>|<4>|<2>|cgt|cct|tct|ggt|gtc|agc|aat|c-3′
    CDR3
    (Lm3TSh822): 5′-ctg|cag|gct|gaa|gac|gag|gct|gac-3′
    (Lm3TLo819): 5′-ctg|cag|gct|gaa|gac|gag|gct|gac|tac|tat|tgt|-3′
    (Lm3BLo825) [RC]: 5′-gtc|ttc|ggc|ggt|ggt|acc|aaa|ctt|act|gtc|ctc|ggt|caa|cct|aag|g-
    acacaggtgag-3′
    (Lm3BSh832) [RC]: 5′-c|ggt|caa|cct|aag|gacacaggtgag-3′
    (Lm3vg817): 5′-gac|gag|gct|gac|tac|tat|tgt|-
    |<4>|<5>|<4>|<2>|<4>|tct|<4>|<4>|<4>|<4>|-
    Gtc|ttc|ggc|ggt|ggt|acc|aaa|ctt|ac-3′
    (Lm3vg817-10): 5′- gac|gag|gct|gac|tac|tat|tgt|-
    |<5>|agc|tat|<1>|<5>|tct<5>|<1>|<4>|gtc|ttc|ggc|ggt|ggt|-
    |acc|aaa|ctt|ac-3′
  • TABLE 10
    A27:JH1 Kappa light chain gene with stuffers in place of CDRs
    Each stuffer contains at least one stop codon and a
    restriction site that will be uni|ue within the diversity vector.
    gaggacc attgggcccc ctccgagact ctcgagcgca
      Scab.....Eco0109I
               ApaI.
                                 XhoI..
    acgcaattaa tgtgagttag ctcactcatt aggcacccca ggctttacac tttatgcttc
          ..-35..          Plac                    ..-10.
    cggctcgtat gttgtgtgga attgtgagcg gataacaatt tcacacagga aacagctatgac
    catgatta cgccaagctt tggagccttt tttttggaga ttttcaac
              PflMI.......
                Hind3.
    M13 III signal se|uence (AA se|)-------------------------->
     1   2   3   4   5   6   7   8   9  10  11  12  13  14  15
     M   K   K   L   L   F   A   I   P   L   V   V   P   F   Y
    gtg aag aag ctc cta ttt gct atc ccg ctt gtc gtt ccg ttt tac
    --Signal-->  FR1------------------------------------------->
     16  17  18  19  20  21  22  23  24  25  26  27  28  29  30
      S   H   S   A   Q   S   V   L   T   Q   S   P   G   T   L
    |agc|cat|agt|gca|caa|tcc|gtc|ctt|act|caa|tct|cct|ggc|act|ctt|
              ApaLI...
    ----- FR1 --------------------------------->|-------Stuffer->
     31  32  33  34  35  36  37  38  39  40  41  42  43
      S   L   S   P   G   E   R   A   T   L   S   |   |
    |tcg|cta|agc|ccg|ggt|gaa|cgt|gct|acc|tta|agt|tag|taa|gct|ccc|
       EspI.....                       AflII...
               XmaI....
    - Stuffer for CDR1-->FR2 --------- FR2 ------>|-----------Stuffer for CDR2
                            59  60  61  62  63  64  65  66
                             K   P   G   Q   A   P   R
    |agg|cct|actt|tga|tct|g|aaa|cct|ggt|cag|gcg|ccg|cgt|taa|tga|aagcgctaatggccaacagtg
     StuI...                  SexAI...    KasI....              AfeI..   MscI..
    Stuffer-->|--- FR3 ----------------------------------------->
     76  77  78  79  80  81  82  83  84  85  86  87  88  89  90
      T   G   I   P   D   R   F   S   G   S   G   S   G   T   D
    |act|ggg|atc|ccg|gac|ccgt|ttc|tct|ggc|tct|ggt|tca|ggt|act|gac|
         BamHI...
                RsrII.....
    ------ FR3 ----->----------------STUFFER for CDR3----------------->
     91  92  93  94  95  96  97
      F   T   L   T   I   S   R   |   |
    |ttt|acc|ctt|act|att|tct|aga|taa|tga| gttaac tag acc tacgta acc tag
                         XbaI...          HpaI..         SnaBI.
    -----------------CDR3 stuffer------------------>|-----FR4--->
                                                    118 119 120
                                                      F   G   Q
                                                    |ttc|ggt|caa|
    -----FR4------------------->|     <------ Ckappa -------------
    121 122 123 124 125 126 127       128 129 130 131 132 133 134
      G   T   K   V   E   I   K        R   T   V   A   A   P   S
    |ggt|acc|aag|gtt|gaa|atc|aag|    |cgt|acg|gtt|gcc|gct|cct|agt|
          StyI....                    BsiWI..
    135 136 137 138 139 140 141 142 143 144 145 146 147 148 149
      V   F   I   F   P   P   S   D   E   Q   L   K   S   G   T
    |gtg|ttt|atc|ttt|cct|cct|tct|gac|gaa|caa|ttg|aag|tca|ggt|act|
                                         MfeI...
    acgcatctctaa gcggccgc aacaggaggag
                NotI....
                 EagI..
  • TABLE 11
    2a2:JH2 Human lambda-chain gene with stuffers in place of CDRs
    gaggaccatt gggcccc ttactccgtgac
    Scab...... Eco0109I
               ApaI..
             ----------FR1-------------------------------------------->
             1   2   3   4   5   6   7   8   9  10  11  12  13  14  15
     S   A   Q   S   A   L   T   Q   P   A   S   V   S   G   S   P   G
    agt|gca|caa|tcc|gct|ctc|act|cag|cct|gct|agc|gtt|tcc|ggg|tca|cct|ggt|
     ApaLI...                           NheI...          BstEII...
                                                              SexAI....
    ------FR1------------------> |-----stuffer for CDR1---------
     16  17  18  19  20  21  22  23
      Q   S   I   T   I   S   C   T
    |caa|agt|atc|act|att|tct|tgt|aca|tct tag tga ctc
                             BsrGI..
    -----Stuffer--------------------------->-------FR2---------->
     31  32  33  34  35  36  37  38  39  40  41  42  43  44  45
      R   S   |   |   P   |                   H   P   G   K   A
    aga tct taa tga ccg tag                 cac|ccg|ggc|aag|gcg|
    BglII                                     XmaI....     KasI.....
                                              AvaI....
          --|--------------Stuffer for CDR2 ----------------------------->
           P
         |ccg|taa|tga|atc tcg tac g                        ct|ggt|gtt|
    KasI....               BsiWI...
    -------FR3----------------------------------------------------
     61  62  63  64  65  66  67  68  69  70  71  72  73  74  75
      S   N   R   F   S   G   S   K   S   G   N   T   A   S   L
    |agc|aat|cgt|ttc|tcc|gga|tct|aaa|tcc|ggt|aat|acc|gca|agc|tta|
                     BspEI..                           HindIII.
                          BsaBI........(blunt)
    -------FR3------------->|--Stuffer for CDR3---------------->|
     76  77  78  79  80  81  82  83  84  85  86  87  88  89  90
      T   I   S   G   L   Q
    |act|atc|tct|ggt|ctg|caglgtt ctg tag ttc caattg ctt tag tga ccc
                     PstI...                 MfeI..
    -----Stuffer------------------------------->|---FR4---------
                                                    103 104 105
                                                     G   G   G
                                                   |ggc|ggt|ggt|
                                                             KpnI...
    ---------FR4-------------->
       106 107 108 109 110 111 112 113 114 115 116 117 118 119 120
         T   K   L   T   V   L   G   Q   P   K   A   A   P   S   V
       |acc|aaa|ctt|act|gtc|ctc|ggt|caa|cct|aag|gct|gct|cct|tcc|gtt|
    KpnI...                      HincII..
                                        Bsu36I...
     121 122 123 124 125 126 127 128 129 130 131 132 133 134 135
      T   L   F   P   P   S   S   E   E   L   Q   A   N   K   A
    |act|ctc|ttc|cct|cct|agt|tct|gaa|gag|ctt|caa|gct|aac|aag|gct|
                                 SapI.....
     136 137 138 139 140 141 142 143 144 145 146 147 148 149 150
      T   L   V   C   L   I   S   D   F   Y   P   G   A   V   T
    |act|ctt|gtt|tgc|ttg|atc|agt|gac|ttt|tat|cct|ggt|gct|gtt|act|
                      BclI....

Claims (43)

1. A focused library of vectors or genetic packages that display, display and express, or comprise a member of a diverse family of human antibody related peptides, polypeptides and proteins and collectively display, display and express, or comprise at least a portion of the diversity of the antibody family, the vectors or genetic packages being characterized by variegated DNA sequences that encode a heavy chain CDR1 selected from the group consisting of:
(1) <1>1Y2<1>3M4<1>5, wherein <1> is an equimolar mixture of each of amino acid residues A, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W, and Y;
(2) (S/T)1(S/G/X)2(S/G/X)3Y4Y5W6(S/G/X)7. wherein (S/T) is a 1:1 mixture of S and T residues, (S/G/X) is a mixture of 0.2025 S, 0.2025, G and 0.035 of each of amino acid residues A, D, E, F, H, I, K, L, M, N, P, Q, R, T, V, W, and Y;
(3) V1S2G3G4S5I6S7<<1>8<1>9<1>10Y11Y12W13<1>14, wherein <1> is an equimolar mixture of each of amino acid residues A, D, E, F, G, H,. I, K, L, M, N, P, Q, R, S, T, V, W, and Y; and
(4) mixtures of vectors or genetic packages characterized by any of the above DNA sequences.
2. The focused library according to claim 1, wherein HC CDR1s (1), (2) and (3) are present in the library in the ratio 0.80:0.17:0.02.
3. A focused library of vectors or genetic packages that display, display and express, or comprise a member of a diverse family of human antibody related peptides, polypeptides and proteins and collectively display, display and express, or comprise at least a portion of the diversity of the antibody facility, the vectors or genetic packages being characterized by variegated DNA sequences that encode a heavy chain CDR2 selected from the group consisting of:
(1) <2>I<2><3>SGG<1>T<1>YADSVKG, wherein <1> is an equimolar mixture of each of amino acid residues A, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W, and Y; <2> is an equimolar mixture of each of amino acid residues Y, R, W, V, G, and S; and <3> is an equimolar mixture of each of amino acid residues P, S, and G or an equimolar mixture of P and S;
(2) <1>I<4><1><1><G><5><1><1><1>YADSVKG, wherein <1> is an equimolar mixture of each of amino acid residues A, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W, and Y; <4> is an equimolar mixture of residues D, I, N, S, W, Y; and <5> is an equimolar mixture of residues S, G, D and N;
(3) <1>I<4><1><1>G<5><1><1>YNPSLKG, wherein <1> is an equimolar mixture of each of amino acid residues A, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W and Y; and <4> and <5> are as defined above;
(4) <1>I<8>S<1><1><1>GGYY<1>YAASVKG, wherein <1> is an equimolar mixture of each amino acid residues A, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W and Y; <8> is 0.27 R and 0.027 of each of ADEFGHIKLMNPQSTVWY; and
(5) mixtures of vectors or genetic packages characterized by any of the above DNA sequences.
4. The focused library according to claim 3 wherein a mixture of HC CDR2s (1)/(2) (equimolar), (3) and (4) are present in the library in a ratio of 0.54:0.43:0.03.
5. A focused library of vectors or genetic packages that display, display and express, or comprise a member of a diverse family of human antibody related peptides, polypeptides and proteins and collectively display, display and express, or comprise at least a portion of the diversity of the antibody family, the vectors or genetic packages being characterized by variegated DNA sequences that encode a heavy chain CDR3 selected from the group consisting of:
(1) YYCA21111YFDYWG, wherein 1 is an equimolar mixture of each amino acid residues A, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W and Y; and 2 is an equimolar mixture of K and R;
(2) YYCA2111111YFDYWG, wherein 1 is an equimolar mixture of each amino acid residues A, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W and Y; and 2 is an equimolar mixture of K and R;
(3) YYCA211111111YFDAYTG, wherein 1 is an equimolar mixture of each amino acid residues A, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W and Y; and 2 is an equimolar mixture of K and R;
(4) YYCAR111S2S3111YFDYWG, wherein 1 is an equimolar mixture of each amino acid residues A, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W and Y; and 2 is an equimolar mixture of S and G; and 3 is an equimolar mixture of Y and W;
(5) YYCA2111CSG11CY1YFDYWG, wherein 1 is an equimolar mixture of each amino acid residues A, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W and Y; and 2 is an equimolar mixture of K and R;
(6) YYCA211S1TIFG11111YFDYWG, wherein 1 is an equimolar mixture of each amino acid residues A, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W and Y; and 2 is an equimolar mixture of K and R;
(7) YYCAR111YY2S3344111YFDYWG, wherein 1 is an equimolar mixture of each amino acid residues A, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W and Y; 2 is an equimolar mixture of D and S; and 3 is an equimolar mixture of S and G;
(8) YYCAR1111YC2231CY111YFDYWG, wherein 1 is an equimolar mixture of each amino acid residues A, D, E, F, G, H, I, K, L, M, N, P,. Q, R, S, T, V, W and Y; 2 is an equimolar mixture of S and G; and 3 is an equimolar mixture of T, D and G; and
(9) mixtures of vectors or genetic packages characterized by any of the above DNA sequences.
6. The focused library according to claim 5, wherein 1 in one or all of HC CDR3s (1) through (8) is 0.095 of each of G and Y and 0.048 of each of A, D, E, F, H, I, K, L, M, N, P, Q, R, S, T, V, and W.
7. The focused library according to claim 5 or 6, wherein HC CDR3s (1) through (8) are present in the library in the following proportions:
(1) 0.10
(2) 0.14
(3) 0.25
(4) 0.13
(5) 0.13
(6) 0.11
(7) 0.04 and
(8) 0.10
8. The focused library according to claim 5 or 6, wherein the HC CDR3s (1) through (8) are present in the library in the following proportions:
(1) 0.02
(2) 0.14
(3) 0.25
(4) 0.14
(5) 0.14
(6) 0.12
(7) 0.08 and
(8) 0.11
9. A focused library of vectors or genetic packages that display, display and express, or comprise a member of a diverse family of human antibody related peptides, polypeptides and proteins and collectively display, display and express, or comprise at least a portion of the diversity of the antibody family, the vectors or genetic packages being characterized by variegated DNA sequences that encodes a kappa light chain CDR1 selected from the group consisting of:
(1) RASQ<1>V<2><2><3>LA
(2) RASQ<1>V<2><2><2><3>LA;
wherein <1> is an equimolar mixture of amino acid residues ADEFGHIKLMNPQRSTVWY; <2> is 0.2 S and 0.044 of each of ADEFGHIKLMNPQRTVWY; and <3> is 0.2Y and 0.044 each of ADEFGHIKLMNPQRTVW and Y; and
(3) mixtures of vectors or genetic packages characterized by any of the above DNA sequences.
10. The focused library of claim 9, wherein CDR1s (1) and (2) are present in the library in a ratio of 0.68:0.32.
11. A focused library of vectors or genetic packages that display, display and express, or comprise a member of a diverse family of human antibody related peptides, polypeptides and proteins and collectively display, display and express, or comprise at least a portion of the diversity of the antibody family, the vectors or genetic packages being characterized by variegated DNA sequences that encode a kappa light chain CDR2 having the sequence:
<1>AS<2>R<4><1>,
wherein <1> is an equimolar mixture of amino acid residues ADEFGHIKLMNPQRSTVWY; <2> is 0.2 S and 0.044 of each of ADEFGHIKLMNPQRTVWY; and <4> is 0.2 A and) 0.044 each of DEFGHIKLMNPQRSTVWY.
12. A focused library of vectors or genetic packages that display, display and express, or comprise a member of a diverse family of human antibody related peptides, polypeptides and proteins and collectively display, display and express, or comprise at least a portion of the diversity of the antibody family, the vectors or genetic packages being characterized by variegated DNA sequences that encode a kappa light chain CDR3 selected from the groups consisting of:
(1) QQ<3><1><1><1>P<1>T,
wherein <1> is an equimolar mixture of amino acid residues ADEFGHIKLMNPQRSTVWY; <3> is 0.2 Y and 0.044 each of ADEFGHIKLMNPQRTVW;
(2) QQ33111P, wherein 1 and 3 are as defined in (1) above;
(3) QQ3211PP1T, wherein 1 and 3 are as defined in (1) above and 2 is 0.2 S and 0.044 each of ADEFGHIKLMNPQRTVWY; and
(4) mixtures of vectors or genetic packages characterized by any of the above DNA sequences.
13. The focused library according to claim 12, wherein CDR3s (1), (2) and (3) are present in the library in a ratio of 0.65:0.1:0.25.
14. A focused library of vectors or genetic packages that display, display and express, or comprise a member of a diverse family of human antibody related peptides, polypeptides and proteins and collectively display, display and express, or comprise at least a portion of the diversity of the antibody family, the vectors or genetic packages being characterized by variegated DNA sequences that encode a lambda light chain CDR1 selected from the group consisting of:
(1) TG<1>SS<2>VG<1><3><2><3>VS,
wherein <1> is 0.27 T, 0.27 G and 0.027 each of ADEFHIKLMNPQRSVWY, <2> is 0.27 D, 0.27 N and 0.027 each of AEFGHIKLMPQRSTVWY, and <3> is 0.36 Y and 0.036 each of ADEFGHIKLMNPQRSTVW;
(2) G<2><4>L<4><4><4><3><4><4>, wherein <2> is as defined in (1) above and <4> is an equimolar mixture of amino acid residues ADEFGHIKLMNPQRSTVWY; and
(3) mixtures of vectors or genetic packages characterized by any of the above DNA sequences.
15. The focused library according to claim 14, where CDR1s (1) and (2) are present in the library in a ratio of 0.67:0.33.
16. A focused library of vectors or genetic packages that display, display and express, or comprise a member of a diverse family of human antibody related peptides, polypeptides and proteins and collectively display, display and express, or comprise at least a portion of the diversity of the antibody family, the vectors or genetic packages being characterized by variegated DNA sequences that encode a lambda light chain CDR2 has the sequence:
<4><4><4><2>RPS,
wherein <2> is 0.27 D, 0.27 N, and 0.027 each of AEFGHIKLMPQRSTVWY and <4> is an equimolar mixture of amino acid residues ADEFGHIKLMNPQRSTVW.
17. A focused library of vectors or genetic packages that display, display and express, or comprise a member of a diverse family of human antibody related peptides, polypeptides and proteins and collectively display, display and express, or comprise at least a portion of the diversity of the antibody family, the vectors or genetic packages being characterized by variegated DNA sequences that encode a lambda light chain CDR3 selected from the group consisting of:
(1) <4><5><4><2><4>S<4><4><4><4>V,
wherein <2> is 0.27 D, 0.27 N, and 0.027 each of AEFGHIKLMPQRSTVWY; <4> is an equimolar mixture of amino acid residues ADEFGHIKLMNPQRSTVW; and <5> is 0.36 S and 0.0355 each of ADEFGHIKLMNPQRTVWY;
(2) <5>SY<1><5>S<5><1><4>V, wherein <1> is an equimolar mixture of ADEFGHIKLMNPQRSTVWY; and <4> and <5> are as defined in (1) above; and
(3) mixtures of vectors or genetic packages characterized by any of the above DNA sequences.
18. The focused library according to claim 17, wherein CDR3s (1) and (2) are present in the library in an equimolar mixture.
19. The focused library according to claim 1 or 2 further comprising variegated DNA sequences that encode a heavy chain CDR selected from the group consisting of:
(1) one or more of the heavy chain CDR2s defined in claim 3 or 4;
(2) one or more of the heavy chain CDR3s defined in claims 5, 6, 7, or 8; and
(3) mixtures of vectors or genetic packages characterized by (1) and (2).
20. The focused library according to claim 3 further comprising variegated DNA sequences that encodes one or more heavy chain CDR3s selected from the group defined in claims 5, 6, 7 or 8.
21. The focused library according to claim 19 or 20, further comprising variegated DNA sequences that encodes a light chain CDR selected from the group consisting of
(1) one or more the kappa light chain CDR1s defined in claim 9 or 10;
(2) the kappa light chain CDR2 defined in claim 11;
(3) one or more of the kappa light chain CDR3s defined in claim 12 or 13;
(4) one or more of the kappa light chain CDR1s defined in claim 14 or 15;
(5) the lambda light chain CDR2 defined in claim 16;
(6) one or more of the lambda light chain CDR3s defined in claim 17 or 18; and
(7) mixtures of vectors and genetic packages characterized by one or more of (1) through (6).
22. A population of variegated DNA sequences that encode a heavy chain CDR1 selected from the group consisting of:
(1) <1>1Y2<1>3M4<1>5, wherein <1> is an equimolar mixture of each of amino acid residues A, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W, and Y;
(2) (S/T)1(S/G/X)2 (S/G/X)3Y4Y5W6(S/G/X)7 wherein (S/T) is a 1:1 mixture of S and T residues, (S/G/X) is a mixture of 0.2025 S, 0.2025 G and 0.035 of each of amino acid residues A, D, E, F, H, I, K, L, M, N, P, Q, R, T, V, W, and Y;
(3) V1S2G3G4S5I6S7<1>8<1>9<1>10Y11Y12W13<1>14, wherein <1> is an equimolar mixture of each of amino acid residues A, D, E, F, G, H, I, K, L, M,. N, P, Q, R, S, T, V, W, and Y; and
(4) mixtures of variegated DNA sequences characterized by any of the above DNA sequences.
23. The population of variegated DNA sequences according to claim 22, wherein HC CDR1s (1), (2) and (3) are present in the population in the ratio 0.80:0.17:0.02.
24. A population of variegated DNA sequences that encode a heavy chain CDR2 selected from the group consisting of:
(1) <2>I<2><3>SGG<1>T<1>YADSVKG, wherein <1> is an equimolar mixture of each of amino acid residues A, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W, and Y; <2> is an equimolar mixture of each of amino acid residues Y, R, W, V, G, and S; and <3> is an equimolar mixture of each of amino acid residues P, S, and G or an equimolar mixture of P and S;
(2) <1>I<4><1><1><G><5><1><1><1>YADSVKG, wherein <1> is an equimolar mixture of each of amino acid residues A, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W, and Y; <4> is an equimolar mixture of residues D, I, N, S, W, Y; and <5> is an equimolar mixture of residues S, G, D and N;
(3) <1>I<4><1><1>G<5><1><1>YNPSLKG, wherein <1> is an equimolar mixture of each of amino acid residues A, D, E, F, G, H, I, K, L, M, N, P,. Q, R, S, T, V, W and Y; and <4>and <5> are as defined above;
(4) <1>I<8>S<1><1><1>GGYY<1>YAASVKG, wherein <1> is an equimolar mixture of each amino acid residues A, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W and Y; <8> is 0.27 R and 0.027 of each of ADEFGHIKLMNPQSTVWY; and
(5) mixtures of variegated DNA sequences characterized by any of the above DNA sequences.
25. The population of variegated DNA sequences according to claim 24, wherein a mixture of HC CDR2s (1)/(2) (equimolar), (3) and (4) are present in the population in a ratio of 0.54:0.43:0.03.
26. A population of variegated DNA sequences that encode a heavy chain CDR3 selected from the group consisting of:
(1) YYCA21111YFDYWG, wherein 1 is an equimolar mixture of each amino acid residues A, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W and Y; and 2 is an equimolar mixture of K and R;
(2) YYCA2111111YFDYWG, wherein 1 is an equimolar mixture of each amino acid residues A, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W and Y; and 2 is an equimolar mixture of K and R;
(3) YYCA211111111YFDAYTG, wherein 1 is an equimolar mixture of each amino acid residues A, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W and Y; and 2 is an equimolar mixture of K and R;
(4) YYCAR111S2S3111YFDYWG, wherein 1 is an equimolar mixture of each amino acid residues A, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W and Y; and 2 is an equimolar mixture of S and G; and 3 is an equimolar mixture of Y and W;
(5) YYCA2111CSG11CY1YFDYWG, wherein 1 is an equimolar mixture of each amino acid residues A, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W and Y; and 2 is an equimolar mixture of K and R;
(6) YYCA211S1TIFG11111YFDYWG, wherein 1 is an equimolar mixture of each amino acid residues A, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W and Y; and 2 is an equimolar mixture of K and R;
(7) YYCAR111YY2S3344111YFDYWG, wherein 1 is an equimolar mixture of each amino acid residues A, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W and Y; 2 is an equimolar mixture of D and S; and 3 is an equimolar mixture of S and G;
(8) YYCAR1111YC2231CY111YFDYWG, wherein 1 is an equimolar mixture of each amino acid residues A, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W and Y; 2 is an equimolar mixture of S and G; and 3 is an equimolar mixture of T, D and G; and
(9) mixtures of variegated DNA sequences characterized by any of the above DNA sequences.
27. The population of variegated DNA according to claim 26, wherein 1 in one or all of HC CDR3s (1) through (8) is 0.095 of each of G and Y and 0.048 of each of A, D, E, F, H, I, K, L, M, N, P, Q, R, S, T, V, and W.
28. The population of variegated DNA sequences according to claim 26 or 27, wherein HC CDR3s (1) through (8) are present in the population in the following proportions:
(1) 0.10
(2) 0.14
(3) 0.25
(4) 0.13
(5) 0.13
(6) 0.11
(7) 0.04 and
(8) 0.10
29. The population of variegated DNA sequences according to claim 26 or 27, wherein the HC CDR3s (1) through (8) are present in the population in the following proportions:
(1) 0.02
(2) 0.14
(3) 0.25
(4) 0.14
(5) 0.14
(6) 0.12
(7) 0.08 and
(8) 0.11
30. A population of variegated DNA sequences that encode a kappa light chain CDR1 selected from the group consisting of:
(1) RASQ<1>V<2><2><3>LA
(2) RASQ<1>V<2><2><2><3>LA;
wherein <1> is an equimolar mixture of amino acid residues ADEFGHIKLMNPQRSTVWY; <2> is 0.2 S and 0.044 of each of ADEFGHIKLMNPQRTVWY; and <3> is 0.2Y and 0.044 each of ADEFGHIKLMNPQRTVW and Y; and
(3) mixtures of variegated DNA sequences characterized by any of the above DNA sequences.
31. The population of variegated DNA sequences of claim 30, wherein CDR1s (1) and (2) are present in the population in a ratio of 0.68:0.32.
32. A population of variegated DNA sequences that encode a kappa light chain CDR2 having the sequence:
<1>AS<2>R<4><1>,
wherein <1> is an equimolar mixture of amino acid residues ADEFGHIKLMNPQRSTVWY; <2> is 0.2 S and 0.044 of each of ADEFGHIKLMNPQRTVWY; and <4> is 0.2 A and) 0.044 each of DEFGHIKLMNPQRSTVWY.
33. A population of variegated DNA sequences that encode a kappa light chain CDR3 selected from the groups consisting of:
(1) QQ<3><1><1><1>P<1>T,
wherein <1> is an equimolar mixture of amino acid residues ADEFGHIKLMNPQRSTVWY; <3> is 0.2 Y and 0.044 each of ADEFGHIKLMNPQRTVW;
(2) QQ33111P, wherein 1 and 3 are as defined in (1) above;
(3) QQ3211PPlT, wherein 1 and 3 are as defined in (1) above and 2 is 0.2 S and 0.044 each of ADEFGHIKLMNPQRTVWY; and
(4) mixtures of variegated DNA sequences characterized by any of the above DNA sequences.
34. The population of variegated DNA sequences according to claim 33, wherein CDR3s (1) , (2) and (3) are present in the population in a ratio of 0.65:0.1:0.25.
35. A population of variegated DNA sequences that encode a lambda light chain CDR1 selected from the group consisting of:
(1) TG<1>SS<2>VG<1><3><2><3>VS,
wherein <1> is 0.27 T, 0.2.7 G and 0.027 each of ADEFHIKLMNPQRSVWY, <2> is 0.27 D, 0.27 N and 0.027 each of AEFGHIKLMPQRSTVWY, and <3> is 0.36 Y and 0.036 each of ADEFGHIKLMNPQRSTVW;
(2) G<2><4>L<4><4><4><3><4><4>,
wherein <2> is as defined in (1) above and <4> is an equimolar mixture of amino acid residues ADEFGHIKLMNPQRSTVWY; and
(3) mixtures of variegated DNA sequences characterized by any of the above DNA sequences.
36. The population of variegated DNA sequences according to claim 35, where CDR1s (1) and (2) are present in the population in a ratio of 0.67:0.33.
37. A population of variegated DNA sequences that encode a lambda light chain CDR2 has the sequence:
<4><4><4><2>RPS,
wherein <2> is 0.27 D, 0.27 N, and 0.027 each of AEFGHIKLMPQRSTVWY and <4> is an equimolar mixture of amino acid residues ADEFGHIKLMNPQRSTVW.
38. A population of variegated DNA sequences that encode a lambda light chain CDR3 selected from the group consisting of:
(1) <4><5><4><2><4>S<4><4><4><4>V,
wherein <2> is 0.27 D, 0.27 N, and 0.027 each of AEFGHIKLMPQRSTVWY; <4> is an equimolar mixture of amino acid residues ADEFGHIKLMNPQRSTVW; and <5> is 0.36 S and 0.0355 each of ADEFGHIKLMNPQRTVWY;
(2) <5>SY<1><5>S<5><1><4>V, wherein <1> is an equimolar mixture of ADEFGHIKLMNPQRSTVWY; and <4> and <5> are as defined in (1) above; and
(3) mixtures of variegated. DNA sequence characterized by any of the above DNA sequences.
39. The population of variegated DNA sequences according to claim 38, wherein CDR3s (1) and (2) are present in the population in an equimolar mixture.
40. The population of variegated DNA sequences according to claim 22 or 23 further comprising variegated DNA sequences that encode a heavy chain CDR selected from the group consisting of:
(1) one or more of the heavy chain CDR2s defined in claim 24 or 25;
(2) one or more of the heavy chain CDR3s defined in claims 26, 27, 28 or 29; and
(3) mixtures of variegated DNA sequence characterized by (1) and (2).
41. The population of variegated DNA sequences according to claim 24 further comprising variegated DNA sequences that encodes one or more heavy chain CDR3s selected from the group defined in claims 26, 27, 28 or 29.
42. The population of variegated DNA sequences according to claim 40 or 41 further comprising variegated DNA sequences that encodes a light chain CDR selected from the group consisting of (1) one or more the kappa light chain CDR1s defined in claim 30 or 31;
(2) the kappa light chain CDR2 defined in claim 32;
(3) one or more of the kappa light chain CDR3s defined in claim 33 or 34;
(4) one or more of the kappa light chain CDR1s defined in claim 35 or 36;
(5) the lambda light chain CDR2 defined in claim 37;
(6) one or more of the lambda light chain CDR3s defined in claim 38 or 39; and
(7) mixtures of variegated DNA sequences characterized by one or more of (1) through (6).
43. A population of vectors comprising the variegated DNA sequences of any one of claims 22-42.
US11/416,460 2000-12-18 2006-05-01 Focused libraries of genetic packages Abandoned US20060257937A1 (en)

Priority Applications (9)

Application Number Priority Date Filing Date Title
US11/416,460 US20060257937A1 (en) 2000-12-18 2006-05-01 Focused libraries of genetic packages
US12/762,051 US8895475B2 (en) 2000-12-18 2010-04-16 Focused libraries of genetic packages
US13/161,445 US8466091B2 (en) 2000-12-18 2011-06-15 Focused libraries of genetic packages
US13/161,441 US8399384B2 (en) 2000-12-18 2011-06-15 Focused libraries of genetic packages
US13/250,520 US8258082B2 (en) 2000-12-18 2011-09-30 Focused libraries of genetic packages
US13/571,661 US9617536B2 (en) 2000-12-18 2012-08-10 Focused libraries of genetic packages
US13/754,261 US9803190B2 (en) 2000-12-18 2013-01-30 Focused libraries of genetic packages
US15/797,927 US10604753B2 (en) 2000-12-18 2017-10-30 Focused libraries of genetic packages
US16/789,468 US20200325469A1 (en) 2000-12-18 2020-02-13 Focused libraries of genetic packages

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US25638000P 2000-12-18 2000-12-18
US10/026,925 US20030119056A1 (en) 2000-12-18 2001-12-18 Focused libraries of genetic packages
US11/416,460 US20060257937A1 (en) 2000-12-18 2006-05-01 Focused libraries of genetic packages

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US10/026,925 Continuation US20030119056A1 (en) 2000-12-18 2001-12-18 Focused libraries of genetic packages

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US12/762,051 Continuation US8895475B2 (en) 2000-12-18 2010-04-16 Focused libraries of genetic packages

Publications (1)

Publication Number Publication Date
US20060257937A1 true US20060257937A1 (en) 2006-11-16

Family

ID=22972033

Family Applications (10)

Application Number Title Priority Date Filing Date
US10/026,925 Abandoned US20030119056A1 (en) 2000-12-18 2001-12-18 Focused libraries of genetic packages
US11/416,460 Abandoned US20060257937A1 (en) 2000-12-18 2006-05-01 Focused libraries of genetic packages
US12/762,051 Expired - Lifetime US8895475B2 (en) 2000-12-18 2010-04-16 Focused libraries of genetic packages
US13/161,441 Expired - Lifetime US8399384B2 (en) 2000-12-18 2011-06-15 Focused libraries of genetic packages
US13/161,445 Expired - Lifetime US8466091B2 (en) 2000-12-18 2011-06-15 Focused libraries of genetic packages
US13/250,520 Expired - Lifetime US8258082B2 (en) 2000-12-18 2011-09-30 Focused libraries of genetic packages
US13/571,661 Expired - Lifetime US9617536B2 (en) 2000-12-18 2012-08-10 Focused libraries of genetic packages
US13/754,261 Expired - Lifetime US9803190B2 (en) 2000-12-18 2013-01-30 Focused libraries of genetic packages
US15/797,927 Expired - Lifetime US10604753B2 (en) 2000-12-18 2017-10-30 Focused libraries of genetic packages
US16/789,468 Abandoned US20200325469A1 (en) 2000-12-18 2020-02-13 Focused libraries of genetic packages

Family Applications Before (1)

Application Number Title Priority Date Filing Date
US10/026,925 Abandoned US20030119056A1 (en) 2000-12-18 2001-12-18 Focused libraries of genetic packages

Family Applications After (8)

Application Number Title Priority Date Filing Date
US12/762,051 Expired - Lifetime US8895475B2 (en) 2000-12-18 2010-04-16 Focused libraries of genetic packages
US13/161,441 Expired - Lifetime US8399384B2 (en) 2000-12-18 2011-06-15 Focused libraries of genetic packages
US13/161,445 Expired - Lifetime US8466091B2 (en) 2000-12-18 2011-06-15 Focused libraries of genetic packages
US13/250,520 Expired - Lifetime US8258082B2 (en) 2000-12-18 2011-09-30 Focused libraries of genetic packages
US13/571,661 Expired - Lifetime US9617536B2 (en) 2000-12-18 2012-08-10 Focused libraries of genetic packages
US13/754,261 Expired - Lifetime US9803190B2 (en) 2000-12-18 2013-01-30 Focused libraries of genetic packages
US15/797,927 Expired - Lifetime US10604753B2 (en) 2000-12-18 2017-10-30 Focused libraries of genetic packages
US16/789,468 Abandoned US20200325469A1 (en) 2000-12-18 2020-02-13 Focused libraries of genetic packages

Country Status (12)

Country Link
US (10) US20030119056A1 (en)
EP (2) EP2316940B1 (en)
JP (2) JP4860098B2 (en)
AT (1) ATE498718T1 (en)
AU (1) AU2002249854B2 (en)
CA (2) CA2432377C (en)
DE (1) DE60144063D1 (en)
DK (2) DK1360288T3 (en)
ES (2) ES2430857T3 (en)
HK (1) HK1156660A1 (en)
PT (2) PT2316940E (en)
WO (1) WO2002061071A2 (en)

Cited By (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030232333A1 (en) * 2000-04-17 2003-12-18 Dyax Corp. Novel methods of constructing librabries comprising displayed and/or expressed members of a diverse family of peptides, polypeptides or proteins and the novel librabries
US20060166252A1 (en) * 2000-04-17 2006-07-27 Ladner Robert C Novel methods of constructing libraries of genetic packages that collectively display the members of a diverse family of peptides, polypeptides or proteins
US20060234302A1 (en) * 2005-02-01 2006-10-19 Dyax Corp. Libraries and methods for isolating antibodies
US20090088346A1 (en) * 2005-12-20 2009-04-02 Morphosys Ag Novel collection of hcdr3 regions and uses therefor
WO2009114815A1 (en) * 2008-03-13 2009-09-17 Dyax Corp Libraries of genetic packages comprising novel hc cdr3 designs
WO2010105256A1 (en) 2009-03-13 2010-09-16 Adimab, Inc. Rationally designed, synthetic antibody libraries and uses therefor
US20100292103A1 (en) * 2000-12-18 2010-11-18 Dyax Corp. Focused libraries of genetic packages
US20110082054A1 (en) * 2009-09-14 2011-04-07 Dyax Corp. Libraries of genetic packages comprising novel hc cdr3 designs
US20110172125A1 (en) * 2008-04-24 2011-07-14 Dyax Corp. Libraries of genetic packages comprising novel hc cdr1, cdr2, and cdr3 and novel lc cdr1, cdr2, and cdr3 designs
US8691730B2 (en) 2007-09-14 2014-04-08 Adimab, Llc Rationally designed, synthetic antibody libraries and uses therefor
US9354228B2 (en) 2010-07-16 2016-05-31 Adimab, Llc Antibody libraries
US9464286B2 (en) 2002-08-12 2016-10-11 Adimab, Llc High throughput generation and affinity maturation of humanized antibody
EP3293293A1 (en) 2016-09-08 2018-03-14 Italfarmaco SpA Hc-cdr3-only libraries with reduced combinatorial redundancy and optimized loop length distribution

Families Citing this family (50)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB0230203D0 (en) * 2002-12-27 2003-02-05 Domantis Ltd Fc fusion
GB0230201D0 (en) * 2002-12-27 2003-02-05 Domantis Ltd Retargeting
US7785903B2 (en) 2004-04-09 2010-08-31 Genentech, Inc. Variable domain library and uses
MX2007000103A (en) * 2004-07-06 2007-05-11 Bioren Inc Universal antibody libraries.
ES2577292T3 (en) * 2005-11-07 2016-07-14 Genentech, Inc. Binding polypeptides with diversified VH / VL hypervariable sequences and consensus
EP1973951A2 (en) * 2005-12-02 2008-10-01 Genentech, Inc. Binding polypeptides with restricted diversity sequences
RU2470941C2 (en) * 2005-12-02 2012-12-27 Дженентек, Инк. Binding polypeptides and use thereof
CN101370832B (en) * 2005-12-02 2014-07-02 健泰科生物技术公司 Binding polypeptides and uses thereof
US20080014205A1 (en) * 2006-05-15 2008-01-17 Lawrence Horowitz Neutralizing Antibodies to Influenza Viruses
US8148085B2 (en) 2006-05-15 2012-04-03 Sea Lane Biotechnologies, Llc Donor specific antibody libraries
JP6253986B2 (en) 2010-11-19 2017-12-27 モルフォシス・アーゲー Collection and its usage
EP2744931B1 (en) * 2011-08-18 2018-05-02 Affinity Biosciences Pty Ltd Soluble polypeptides
ES2865473T3 (en) 2013-07-10 2021-10-15 Sutro Biopharma Inc Antibodies Comprising Multiple Site-Specific Unnatural Amino Acid Residues, Methods for Their Preparation, and Methods of Use
UA119551C2 (en) 2014-02-10 2019-07-10 Філіп Морріс Продактс С.А. Cartridge with a heater assembly for an aerosol-generating system
DK3126384T3 (en) 2014-04-01 2021-01-18 Adimab Llc MULTISPECIFIC ANTIBODY ANALOGS INCLUDING A COMMON LIGHT CHAIN, AND METHODS FOR THEIR PREPARATION AND USE
TWI695011B (en) 2014-06-18 2020-06-01 美商梅爾莎納醫療公司 Monoclonal antibodies against her2 epitope and methods of use thereof
WO2016014434A2 (en) 2014-07-22 2016-01-28 Sutro Biopharma, Inc. Anti-cd74 antibodies, compositions comprising anti-cd74 antibodies and methods of using anti-cd74 antibodies
JP6962819B2 (en) 2015-04-10 2021-11-05 アディマブ， エルエルシー Method for Purifying Heterodimer Multispecific Antibody from Parent Homodimer Antibody Species
EP3821730B1 (en) 2015-07-09 2023-06-14 Philip Morris Products S.A. Heater assembly for an aerosol-generating system
WO2017087901A2 (en) 2015-11-19 2017-05-26 Sutro Biopharma, Inc. Anti-lag3 antibodies, compositions comprising anti-lag3 antibodies and methods of making and using anti-lag3 antibodies
RU2018130757A (en) 2016-01-27 2020-02-27 Сутро Биофарма, Инк. ANTIBODY CONJUGATES TO CD74, COMPOSITIONS CONTAINING AN ANTIBODY CONJUGATES TO CD74, AND METHODS FOR USING ANTIBODY ANTIBODIES TO CD74
JP7137474B2 (en) 2016-03-15 2022-09-14 メルサナ セラピューティクス，インコーポレイティド NaPi2b targeting antibody-drug conjugates and methods of use thereof
WO2017218698A1 (en) 2016-06-15 2017-12-21 Sutro Biopharma, Inc. Antibodies with engineered ch2 domains, compositions thereof and methods of using the same
EP3526254A1 (en) 2016-10-12 2019-08-21 Sutro Biopharma, Inc. Anti-folate receptor antibodies, compositions comprising anti-folate receptor antibodies and methods of making and using anti-folate receptor antibodies
JOP20190100A1 (en) 2016-11-19 2019-05-01 Potenza Therapeutics Inc Anti-gitr antigen-binding proteins and methods of use thereof
JOP20190134A1 (en) 2016-12-23 2019-06-02 Potenza Therapeutics Inc Anti-neuropilin antigen-binding proteins and methods of use thereof
WO2018156785A1 (en) 2017-02-22 2018-08-30 Sutro Biopharma, Inc. Pd-1/tim-3 bi-specific antibodies, compositions thereof, and methods of making and using the same
JOP20190203A1 (en) 2017-03-30 2019-09-03 Potenza Therapeutics Inc Anti-tigit antigen-binding proteins and methods of use thereof
EP3630292A2 (en) 2017-05-24 2020-04-08 Sutro Biopharma, Inc. Pd-1/lag3 bi-specific antibodies, compositions thereof, and methods of making and using the same
TWI820031B (en) 2017-07-11 2023-11-01 美商坎伯斯治療有限責任公司 Agonist antibodies that bind human cd137 and uses thereof
WO2019023316A1 (en) 2017-07-26 2019-01-31 Sutro Biopharma, Inc. Methods of using anti-cd74 antibodies and antibody conjugates in treatment of t-cell lymphoma
MX2020000957A (en) 2017-07-26 2020-07-22 Forty Seven Inc Anti-sirp-alpha antibodies and related methods.
US10596270B2 (en) 2017-09-18 2020-03-24 Sutro Biopharma, Inc. Anti-folate receptor antibody conjugates, compositions comprising anti-folate receptor antibody conjugates, and methods of making and using anti-folate receptor antibody conjugates
WO2019089753A2 (en) 2017-10-31 2019-05-09 Compass Therapeutics Llc Cd137 antibodies and pd-1 antagonists and uses thereof
US11851497B2 (en) 2017-11-20 2023-12-26 Compass Therapeutics Llc CD137 antibodies and tumor antigen-targeting antibodies and uses thereof
US20220153871A1 (en) 2018-01-04 2022-05-19 Iconic Therapeutics, Inc. Anti-Tissue Factor Antibodies, Antibody-Drug Conjugates, and Related Methods
EP3774901A1 (en) 2018-03-26 2021-02-17 Sutro Biopharma, Inc. Anti-bcma receptor antibodies, compositions comprising anti bcma receptor antibodies and methods of making and using anti-bcma antibodies
JP2022500454A (en) 2018-09-17 2022-01-04 ストロ バイオファーマ インコーポレーテッド Combination therapy with antifolate receptor antibody conjugate
PE20211767A1 (en) 2018-09-27 2021-09-07 Tizona Therapeutics ANTI-HLA-G ANTIBODIES, COMPOSITIONS INCLUDING ANTI-HLA-G ANTIBODIES AND METHODS OF USE OF ANTI-HLA-G ANTIBODIES
JP2022507253A (en) 2018-11-13 2022-01-18 コンパス セラピューティクス リミテッド ライアビリティ カンパニー Multispecific binding constructs for checkpoint molecules and their use
WO2020172597A1 (en) 2019-02-21 2020-08-27 Tizona Therapeutics Combination therapy involving anti-cd39 antibodies and anti-pd-1 or anti-pd-l1 antibodies
MX2021013391A (en) 2019-05-03 2022-01-26 Celgene Corp Anti-bcma antibody conjugate, compositions comprising the same, and methods of making and using the same.
EP3962951A1 (en) 2019-05-03 2022-03-09 Sutro Biopharma, Inc. Anti-bcma antibody conjugates
JP2022536490A (en) 2019-06-10 2022-08-17 ストロ バイオファーマ インコーポレーテッド 5H-pyrrolo[3,2-d]pyrimidine-2,4-diamino compounds and antibody conjugates thereof
US20220259202A1 (en) 2019-06-17 2022-08-18 Sutro Biopharma, Inc. 1-(4-(aminomethyl)benzyl)-2-butyl-2h-pyrazolo[3,4-c]quinolin-4-amine derivatives and related compounds as toll-like receptor (tlr) 7/8 agonists, as well as antibody drug conjugates thereof for use in cancer therapy and diagnosis
WO2022232488A1 (en) 2021-04-30 2022-11-03 Celgene Corporation Combination therapies using an anti-bcma antibody drug conjugate (adc) in combination with a gamma secretase inhibitor (gsi)
WO2022245978A1 (en) 2021-05-19 2022-11-24 Sutro Biopharma, Inc. Anti-folate receptor conjugate combination therapy with bevacizumab
WO2023028501A1 (en) 2021-08-23 2023-03-02 Immunitas Therapeutics, Inc. Anti-cd161 antibodies and uses thereof
WO2023102077A1 (en) 2021-12-01 2023-06-08 Sutro Biopharma, Inc. Anti-folate receptor conjugate cancer therapy
WO2023104904A2 (en) 2021-12-08 2023-06-15 Genclis The sars-cov-2 and variants use two independent cell receptors to replicate

Citations (52)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5223409A (en) * 1988-09-02 1993-06-29 Protein Engineering Corp. Directed evolution of novel binding proteins
US5380833A (en) * 1984-10-16 1995-01-10 Chiron Corporation Polynucleotide reagents containing selectable cleavage sites
US5565332A (en) * 1991-09-23 1996-10-15 Medical Research Council Production of chimeric antibodies - a combinatorial approach
US5618920A (en) * 1985-11-01 1997-04-08 Xoma Corporation Modular assembly of antibody genes, antibodies prepared thereby and use
US5658727A (en) * 1991-04-10 1997-08-19 The Scripps Research Institute Heterodimeric receptor libraries using phagemids
US5688666A (en) * 1988-10-28 1997-11-18 Genentech, Inc. Growth hormone variants with altered binding properties
US5723323A (en) * 1985-03-30 1998-03-03 Kauffman; Stuart Alan Method of identifying a stochastically-generated peptide, polypeptide, or protein having ligand binding property and compositions thereof
US5733743A (en) * 1992-03-24 1998-03-31 Cambridge Antibody Technology Limited Methods for producing members of specific binding pairs
US5739281A (en) * 1993-02-04 1998-04-14 Denzyme Aps Interative method of at least three cycles for the refolding of proteins
US5750373A (en) * 1990-12-03 1998-05-12 Genentech, Inc. Enrichment method for variant proteins having altered binding properties, M13 phagemids, and growth hormone variants
US5780279A (en) * 1990-12-03 1998-07-14 Genentech, Inc. Method of selection of proteolytic cleavage sites by directed evolution and phagemid display
US5798208A (en) * 1990-04-05 1998-08-25 Roberto Crea Walk-through mutagenesis
US5830663A (en) * 1991-08-10 1998-11-03 Medical Research Council In situ recombinant PCR within single cells
US5837242A (en) * 1992-12-04 1998-11-17 Medical Research Council Multivalent and multispecific binding proteins, their manufacture and use
US5840479A (en) * 1990-02-01 1998-11-24 Behring Diagnostics Gmbh Preparation and use of gene banks of synthetic human antibodies ("synthetic human-antibody libraries")
US5858657A (en) * 1992-05-15 1999-01-12 Medical Research Council Methods for producing members of specific binding pairs
US5858671A (en) * 1996-11-01 1999-01-12 The University Of Iowa Research Foundation Iterative and regenerative DNA sequencing method
US5872215A (en) * 1991-12-02 1999-02-16 Medical Research Council Specific binding members, materials and methods
US5871907A (en) * 1991-05-15 1999-02-16 Medical Research Council Methods for producing members of specific binding pairs
US5885793A (en) * 1991-12-02 1999-03-23 Medical Research Council Production of anti-self antibodies from antibody segment repertoires and displayed on phage
US5962255A (en) * 1992-03-24 1999-10-05 Cambridge Antibody Technology Limited Methods for producing recombinant vectors
US5969108A (en) * 1990-07-10 1999-10-19 Medical Research Council Methods for producing members of specific binding pairs
US5994519A (en) * 1996-07-08 1999-11-30 Cambridge Antibody Technology Limited Labelling and selection of molecules
US6017732A (en) * 1993-06-30 2000-01-25 Medical Research Council Bacteriophage library displaying immunoglobulin repertoires with a chemical moiety covalently bound within the binding site: production and selection thereof
US6057098A (en) * 1997-04-04 2000-05-02 Biosite Diagnostics, Inc. Polyvalent display libraries
US6140471A (en) * 1992-03-24 2000-10-31 Cambridge Antibody Technology, Ltd. Methods for producing members of specific binding pairs
US6172197B1 (en) * 1991-07-10 2001-01-09 Medical Research Council Methods for producing members of specific binding pairs
US6225447B1 (en) * 1991-05-15 2001-05-01 Cambridge Antibody Technology Ltd. Methods for producing members of specific binding pairs
US6248516B1 (en) * 1988-11-11 2001-06-19 Medical Research Council Single domain ligands, receptors comprising said ligands methods for their production, and use of said ligands and receptors
US6291159B1 (en) * 1989-05-16 2001-09-18 Scripps Research Institute Method for producing polymers having a preselected activity
US6291160B1 (en) * 1989-05-16 2001-09-18 Scripps Research Institute Method for producing polymers having a preselected activity
US6291158B1 (en) * 1989-05-16 2001-09-18 Scripps Research Institute Method for tapping the immunological repertoire
US6291161B1 (en) * 1989-05-16 2001-09-18 Scripps Research Institute Method for tapping the immunological repertiore
US6300064B1 (en) * 1995-08-18 2001-10-09 Morphosys Ag Protein/(poly)peptide libraries
US6319690B1 (en) * 1990-02-01 2001-11-20 Dade Behring Marburg Gmbh Preparation and use of gene banks of human antibodies (“human-antibody libraries”)
US6420113B1 (en) * 1997-04-04 2002-07-16 Biosite Diagnostics, Inc. Chimeric polyclonal antibodies
US6492123B1 (en) * 1992-12-04 2002-12-10 Medical Research Council Multivalent and multispecific binding proteins and their use
US6492160B1 (en) * 1991-05-15 2002-12-10 Cambridge Antibody Technology Limited Methods for producing members of specific binding pairs
US6492107B1 (en) * 1986-11-20 2002-12-10 Stuart Kauffman Process for obtaining DNA, RNA, peptides, polypeptides, or protein, by recombinant DNA technique
US6531580B1 (en) * 1999-06-24 2003-03-11 Ixsys, Inc. Anti-αvβ3 recombinant human antibodies and nucleic acids encoding same
US6589527B1 (en) * 1993-09-22 2003-07-08 Medical Reseach Council Retargetting antibodies
US20030148372A1 (en) * 1997-10-20 2003-08-07 Ian Tomlinson Method to screen phage display libraries with different ligands
US20030232333A1 (en) * 2000-04-17 2003-12-18 Dyax Corp. Novel methods of constructing librabries comprising displayed and/or expressed members of a diverse family of peptides, polypeptides or proteins and the novel librabries
US6680192B1 (en) * 1989-05-16 2004-01-20 Scripps Research Institute Method for producing polymers having a preselected activity
US6696248B1 (en) * 1995-08-18 2004-02-24 Morphosys Ag Protein/(poly)peptide libraries
US20040038921A1 (en) * 2001-10-26 2004-02-26 Ribopharma Ag Composition and method for inhibiting expression of a target gene
US6753136B2 (en) * 1999-07-20 2004-06-22 Morphosys Ag Methods for displaying (poly) peptides/proteins on bacteriophage particles via disulfide bonds
US20040157214A1 (en) * 1990-07-10 2004-08-12 Cambridge Antibody Technology Limited Methods for producing members of specific binding pairs
US6969586B1 (en) * 1989-05-16 2005-11-29 Scripps Research Institute Method for tapping the immunological repertoire
US7063943B1 (en) * 1990-07-10 2006-06-20 Cambridge Antibody Technology Methods for producing members of specific binding pairs
US20060166252A1 (en) * 2000-04-17 2006-07-27 Ladner Robert C Novel methods of constructing libraries of genetic packages that collectively display the members of a diverse family of peptides, polypeptides or proteins
US20070031879A1 (en) * 2000-06-19 2007-02-08 Ley Arthur C Novel enterokinase cleavage sequences

Family Cites Families (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ATE167520T1 (en) 1990-04-18 1998-07-15 Gist Brocades Nv MUTATED BETA-LACTAMACYLASE GENES
JPH08502260A (en) 1992-09-30 1996-03-12 ザ スクリップス リサーチ インスティテュート Human neutralizing monoclonal antibody against human immunodeficiency virus
FR2741892B1 (en) 1995-12-04 1998-02-13 Pasteur Merieux Serums Vacc METHOD FOR PREPARING A MULTI-COMBINED BANK OF ANTIBODY GENE EXPRESSION VECTORS, BANK AND COLICLONAL ANTIBODY EXPRESSION SYSTEMS
US6747136B2 (en) 1996-04-19 2004-06-08 Karolinska Innovations Ab Human monoclonal antibodies specific for hepatitis C virus (HCV) E2 antigen
US6300065B1 (en) 1996-05-31 2001-10-09 Board Of Trustees Of The University Of Illinois Yeast cell surface display of proteins and uses thereof
DE19624562A1 (en) 1996-06-20 1998-01-02 Thomas Dr Koehler Determination of the concentration ratio of two different nucleic acids
US7038020B1 (en) 1996-06-24 2006-05-02 Zlb Behring Ag Polypeptides capable of forming antigen binding structures with specificity for the Rhesus D antigens, the DNA encoding them and the process for their preparation and use
US20030044772A1 (en) 1997-08-04 2003-03-06 Applied Molecular Evolution [Formerly Ixsys] Methods for identifying ligand specific binding molecules
EP1007967A2 (en) * 1997-08-04 2000-06-14 Ixsys, Incorporated Methods for identifying ligand specific binding molecules
US7244826B1 (en) 1998-04-24 2007-07-17 The Regents Of The University Of California Internalizing ERB2 antibodies
US6794128B2 (en) 1998-04-24 2004-09-21 The Regents Of The University Of California Methods of selecting internalizing antibodies
EP1115854A1 (en) 1998-09-25 2001-07-18 G.D. Searle & Co. Method of producing permuteins by scanning permutagenesis
KR101287395B1 (en) 2000-06-16 2014-11-04 휴먼 게놈 사이언시즈, 인코포레이티드 Antibodies that immunospecifically bind to BLyS
AU2002249854B2 (en) 2000-12-18 2007-09-20 Dyax Corp. Focused libraries of genetic packages
EP1558741B1 (en) 2002-06-14 2008-02-20 Dyax Corporation Recombination of nucleic acid library members
MX2010002661A (en) * 2007-09-14 2010-05-20 Adimab Inc Rationally designed, synthetic antibody libraries and uses therefor.

Patent Citations (88)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5380833A (en) * 1984-10-16 1995-01-10 Chiron Corporation Polynucleotide reagents containing selectable cleavage sites
US5814476A (en) * 1985-03-30 1998-09-29 Stuart Kauffman Process for the production of stochastically-generated transcription or translation products
US6569641B1 (en) * 1985-03-30 2003-05-27 Stuart Kauffman Process for obtaining DNA, RNA, peptides, polypeptides, or protein by recombinant DNA technique
US5723323A (en) * 1985-03-30 1998-03-03 Kauffman; Stuart Alan Method of identifying a stochastically-generated peptide, polypeptide, or protein having ligand binding property and compositions thereof
US5976862A (en) * 1985-03-30 1999-11-02 Ixsys Corporation Process for obtaining DNA, RNA, peptides, polypeptides, or proteins, by recombinant DNA technique
US5824514A (en) * 1985-03-30 1998-10-20 Stuart A. Kauffman Process for the production of expression vectors comprising at least one stochastic sequence of polynucleotides
US5817483A (en) * 1985-03-30 1998-10-06 Stuart Kauffman Process for the production of stochastically-generated peptides,polypeptides or proteins having a predetermined property
US5618920A (en) * 1985-11-01 1997-04-08 Xoma Corporation Modular assembly of antibody genes, antibodies prepared thereby and use
US6492107B1 (en) * 1986-11-20 2002-12-10 Stuart Kauffman Process for obtaining DNA, RNA, peptides, polypeptides, or protein, by recombinant DNA technique
US5223409A (en) * 1988-09-02 1993-06-29 Protein Engineering Corp. Directed evolution of novel binding proteins
US5688666A (en) * 1988-10-28 1997-11-18 Genentech, Inc. Growth hormone variants with altered binding properties
US20030114659A1 (en) * 1988-11-11 2003-06-19 Medical Research Council Single domain ligands, receptors comprising said ligands, methods for their production, and use of said ligands and receptors
US20040110941A2 (en) * 1988-11-11 2004-06-10 Medical Research Council Single domain ligands, receptors comprising said ligands, methods for their production, and use of said ligands and receptors
US6248516B1 (en) * 1988-11-11 2001-06-19 Medical Research Council Single domain ligands, receptors comprising said ligands methods for their production, and use of said ligands and receptors
US6545142B1 (en) * 1988-11-11 2003-04-08 Medical Research Council Of The United Kingdom Single domain ligands, receptors comprising said ligands, methods for their production, and use of said ligands and receptors
US20030130496A1 (en) * 1988-11-11 2003-07-10 Medical Research Council Single domain ligands, receptors comprising said ligands, methods for their production, and use of said ligands and receptors
US6969586B1 (en) * 1989-05-16 2005-11-29 Scripps Research Institute Method for tapping the immunological repertoire
US7189841B2 (en) * 1989-05-16 2007-03-13 Scripps Research Institute Method for tapping the immunological repertoire
US6291159B1 (en) * 1989-05-16 2001-09-18 Scripps Research Institute Method for producing polymers having a preselected activity
US6291160B1 (en) * 1989-05-16 2001-09-18 Scripps Research Institute Method for producing polymers having a preselected activity
US6291161B1 (en) * 1989-05-16 2001-09-18 Scripps Research Institute Method for tapping the immunological repertiore
US20060019260A1 (en) * 1989-05-16 2006-01-26 Lerner Richard A Method for tapping the immunological repertoire
US6680192B1 (en) * 1989-05-16 2004-01-20 Scripps Research Institute Method for producing polymers having a preselected activity
US6291158B1 (en) * 1989-05-16 2001-09-18 Scripps Research Institute Method for tapping the immunological repertoire
US5840479A (en) * 1990-02-01 1998-11-24 Behring Diagnostics Gmbh Preparation and use of gene banks of synthetic human antibodies ("synthetic human-antibody libraries")
US6319690B1 (en) * 1990-02-01 2001-11-20 Dade Behring Marburg Gmbh Preparation and use of gene banks of human antibodies (“human-antibody libraries”)
US5798208A (en) * 1990-04-05 1998-08-25 Roberto Crea Walk-through mutagenesis
US6916605B1 (en) * 1990-07-10 2005-07-12 Medical Research Council Methods for producing members of specific binding pairs
US5969108A (en) * 1990-07-10 1999-10-19 Medical Research Council Methods for producing members of specific binding pairs
US20040157214A1 (en) * 1990-07-10 2004-08-12 Cambridge Antibody Technology Limited Methods for producing members of specific binding pairs
US20040157215A1 (en) * 1990-07-10 2004-08-12 Cambridge Antibody Technology Limited Methods for producing members of specific binding pairs
US6806079B1 (en) * 1990-07-10 2004-10-19 Medical Research Council Methods for producing members of specific binding pairs
US7063943B1 (en) * 1990-07-10 2006-06-20 Cambridge Antibody Technology Methods for producing members of specific binding pairs
US5750373A (en) * 1990-12-03 1998-05-12 Genentech, Inc. Enrichment method for variant proteins having altered binding properties, M13 phagemids, and growth hormone variants
US5821047A (en) * 1990-12-03 1998-10-13 Genentech, Inc. Monovalent phage display
US5780279A (en) * 1990-12-03 1998-07-14 Genentech, Inc. Method of selection of proteolytic cleavage sites by directed evolution and phagemid display
US6040136A (en) * 1990-12-03 2000-03-21 Genentech, Inc. Enrichment method for variant proteins with altered binding properties
US5846765A (en) * 1990-12-03 1998-12-08 Genentech, Inc. Identification of novel substrates
US5658727A (en) * 1991-04-10 1997-08-19 The Scripps Research Institute Heterodimeric receptor libraries using phagemids
US6225447B1 (en) * 1991-05-15 2001-05-01 Cambridge Antibody Technology Ltd. Methods for producing members of specific binding pairs
US6492160B1 (en) * 1991-05-15 2002-12-10 Cambridge Antibody Technology Limited Methods for producing members of specific binding pairs
US5871907A (en) * 1991-05-15 1999-02-16 Medical Research Council Methods for producing members of specific binding pairs
US6291650B1 (en) * 1991-05-15 2001-09-18 Cambridge Antibody Technology, Ltd. Methods for producing members of specific binding pairs
US6172197B1 (en) * 1991-07-10 2001-01-09 Medical Research Council Methods for producing members of specific binding pairs
US5830663A (en) * 1991-08-10 1998-11-03 Medical Research Council In situ recombinant PCR within single cells
US5565332A (en) * 1991-09-23 1996-10-15 Medical Research Council Production of chimeric antibodies - a combinatorial approach
US5872215A (en) * 1991-12-02 1999-02-16 Medical Research Council Specific binding members, materials and methods
US5885793A (en) * 1991-12-02 1999-03-23 Medical Research Council Production of anti-self antibodies from antibody segment repertoires and displayed on phage
US20030190674A1 (en) * 1991-12-02 2003-10-09 Medical Research Council Production of anti-self antibodies from antibody segment repertoires and displayed on phage
US6521404B1 (en) * 1991-12-02 2003-02-18 Medical Research Council Production of anti-self antibodies from antibody segment repertoires and displayed on phage
US6593081B1 (en) * 1991-12-02 2003-07-15 Medical Research Council Production of anti-self antibodies from antibody segment repertoires and displayed on phage
US6544731B1 (en) * 1991-12-02 2003-04-08 Medical Research Council Production of anti-self antibodies from antibody segment repertories and displayed on phage
US6582915B1 (en) * 1991-12-02 2003-06-24 Medical Research Council Production of anti-self bodies from antibody segment repertories and displayed on phage
US6555313B1 (en) * 1991-12-02 2003-04-29 Medical Research Council Production of anti-self antibodies from antibody segment repertoires and displayed on phage
US6140471A (en) * 1992-03-24 2000-10-31 Cambridge Antibody Technology, Ltd. Methods for producing members of specific binding pairs
US5733743A (en) * 1992-03-24 1998-03-31 Cambridge Antibody Technology Limited Methods for producing members of specific binding pairs
US5962255A (en) * 1992-03-24 1999-10-05 Cambridge Antibody Technology Limited Methods for producing recombinant vectors
US5858657A (en) * 1992-05-15 1999-01-12 Medical Research Council Methods for producing members of specific binding pairs
US6010884A (en) * 1992-12-04 2000-01-04 Medical Research Council Recombinant binding proteins and peptides
US6492123B1 (en) * 1992-12-04 2002-12-10 Medical Research Council Multivalent and multispecific binding proteins and their use
US5837242A (en) * 1992-12-04 1998-11-17 Medical Research Council Multivalent and multispecific binding proteins, their manufacture and use
US5739281A (en) * 1993-02-04 1998-04-14 Denzyme Aps Interative method of at least three cycles for the refolding of proteins
US5917018A (en) * 1993-02-04 1999-06-29 Denzyme Aps Iterative method of at least five cycles for the refolding of proteins
US6017732A (en) * 1993-06-30 2000-01-25 Medical Research Council Bacteriophage library displaying immunoglobulin repertoires with a chemical moiety covalently bound within the binding site: production and selection thereof
US6589527B1 (en) * 1993-09-22 2003-07-08 Medical Reseach Council Retargetting antibodies
US6706484B1 (en) * 1995-08-18 2004-03-16 Morphosys Ag Protein/(poly)peptide libraries
US6300064B1 (en) * 1995-08-18 2001-10-09 Morphosys Ag Protein/(poly)peptide libraries
US20060003334A1 (en) * 1995-08-18 2006-01-05 Morphosys Ag Protein (poly)peptides libraries
US6696248B1 (en) * 1995-08-18 2004-02-24 Morphosys Ag Protein/(poly)peptide libraries
US6828422B1 (en) * 1995-08-18 2004-12-07 Morphosys Ag Protein/(poly)peptide libraries
US20020004215A1 (en) * 1996-07-08 2002-01-10 Cambridge Antibody Technology, Ltd. Labelling and selection of molecules
US5994519A (en) * 1996-07-08 1999-11-30 Cambridge Antibody Technology Limited Labelling and selection of molecules
US6180336B1 (en) * 1996-07-08 2001-01-30 Cambridge Antibody Technology Limited Labelling and selection of molecules
US6489123B2 (en) * 1996-07-08 2002-12-03 Cambridge Antibody Technology Limited Labelling and selection of molecules
US6342588B1 (en) * 1996-07-08 2002-01-29 Cambridge Antibody Technology Limited Labelling and selection of molecules
US5858671A (en) * 1996-11-01 1999-01-12 The University Of Iowa Research Foundation Iterative and regenerative DNA sequencing method
US6057098A (en) * 1997-04-04 2000-05-02 Biosite Diagnostics, Inc. Polyvalent display libraries
US6420113B1 (en) * 1997-04-04 2002-07-16 Biosite Diagnostics, Inc. Chimeric polyclonal antibodies
US20030148372A1 (en) * 1997-10-20 2003-08-07 Ian Tomlinson Method to screen phage display libraries with different ligands
US6696245B2 (en) * 1997-10-20 2004-02-24 Domantis Limited Methods for selecting functional polypeptides
US6846634B1 (en) * 1997-10-20 2005-01-25 Domantis Limited Method to screen phage display libraries with different ligands
US20050202512A1 (en) * 1997-10-20 2005-09-15 Domantis Limited Method to screen phage display libraries with different ligands
US6531580B1 (en) * 1999-06-24 2003-03-11 Ixsys, Inc. Anti-αvβ3 recombinant human antibodies and nucleic acids encoding same
US6753136B2 (en) * 1999-07-20 2004-06-22 Morphosys Ag Methods for displaying (poly) peptides/proteins on bacteriophage particles via disulfide bonds
US20060166252A1 (en) * 2000-04-17 2006-07-27 Ladner Robert C Novel methods of constructing libraries of genetic packages that collectively display the members of a diverse family of peptides, polypeptides or proteins
US20030232333A1 (en) * 2000-04-17 2003-12-18 Dyax Corp. Novel methods of constructing librabries comprising displayed and/or expressed members of a diverse family of peptides, polypeptides or proteins and the novel librabries
US20070031879A1 (en) * 2000-06-19 2007-02-08 Ley Arthur C Novel enterokinase cleavage sequences
US20040038921A1 (en) * 2001-10-26 2004-02-26 Ribopharma Ag Composition and method for inhibiting expression of a target gene

Cited By (46)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030232333A1 (en) * 2000-04-17 2003-12-18 Dyax Corp. Novel methods of constructing librabries comprising displayed and/or expressed members of a diverse family of peptides, polypeptides or proteins and the novel librabries
US20060166252A1 (en) * 2000-04-17 2006-07-27 Ladner Robert C Novel methods of constructing libraries of genetic packages that collectively display the members of a diverse family of peptides, polypeptides or proteins
US8901045B2 (en) 2000-04-17 2014-12-02 Dyax Corp. Methods of constructing libraries comprising displayed and/or expressed members of a diverse family of peptides, polypeptides or proteins and the novel libraries
US8288322B2 (en) 2000-04-17 2012-10-16 Dyax Corp. Methods of constructing libraries comprising displayed and/or expressed members of a diverse family of peptides, polypeptides or proteins and the novel libraries
US20090162835A9 (en) * 2000-04-17 2009-06-25 Dyax Corp. Novel methods of constructing libraries comprising displayed and/or expressed members of a diverse family of peptides, polypeptides or proteins and the novel libraries
US10829541B2 (en) 2000-04-17 2020-11-10 Dyax Corp. Methods of constructing libraries comprising displayed and/or expressed members of a diverse family of peptides, polypeptides or proteins and the novel libraries
US9683028B2 (en) 2000-04-17 2017-06-20 Dyax Corp. Methods of constructing libraries comprising displayed and/or expressed members of a diverse family of peptides, polypeptides or proteins and the novel libraries
US9382535B2 (en) 2000-04-17 2016-07-05 Dyax Corp. Methods of constructing libraries of genetic packages that collectively display the members of a diverse family of peptides, polypeptides or proteins
US9803190B2 (en) 2000-12-18 2017-10-31 Dyax Corp. Focused libraries of genetic packages
US20100292103A1 (en) * 2000-12-18 2010-11-18 Dyax Corp. Focused libraries of genetic packages
US10604753B2 (en) 2000-12-18 2020-03-31 Dyax Corp. Focused libraries of genetic packages
US8399384B2 (en) 2000-12-18 2013-03-19 Dyax Corp. Focused libraries of genetic packages
US8466091B2 (en) 2000-12-18 2013-06-18 Dyax Corp. Focused libraries of genetic packages
US9617536B2 (en) 2000-12-18 2017-04-11 Dyax Corp. Focused libraries of genetic packages
US8895475B2 (en) 2000-12-18 2014-11-25 Robert Charles Ladner Focused libraries of genetic packages
US10329555B2 (en) 2002-08-12 2019-06-25 Adimab, Llc High throughput generation and affinity maturation of humanized antibody
US9464286B2 (en) 2002-08-12 2016-10-11 Adimab, Llc High throughput generation and affinity maturation of humanized antibody
US8551920B2 (en) 2005-02-01 2013-10-08 Morpho Sys AG Libraries and methods for isolating antibodies
US20060234302A1 (en) * 2005-02-01 2006-10-19 Dyax Corp. Libraries and methods for isolating antibodies
US8273688B2 (en) 2005-12-20 2012-09-25 Morphosys Ag Collection of HCDR3 regions and uses therefor
US20090088346A1 (en) * 2005-12-20 2009-04-02 Morphosys Ag Novel collection of hcdr3 regions and uses therefor
US10189894B2 (en) 2007-09-14 2019-01-29 Adimab, Llc Rationally designed, synthetic antibody libraries and uses therefor
EP3753947A1 (en) 2007-09-14 2020-12-23 Adimab, LLC Rationally designed, synthetic antibody libraries and uses therefor
US11008383B2 (en) 2007-09-14 2021-05-18 Adimab, Llc Rationally designed, synthetic antibody libraries and uses therefor
US8877688B2 (en) 2007-09-14 2014-11-04 Adimab, Llc Rationally designed, synthetic antibody libraries and uses therefor
EP3124497A2 (en) 2007-09-14 2017-02-01 Adimab, LLC Rationally designed, synthetic antibody libraries and uses therefor
US8691730B2 (en) 2007-09-14 2014-04-08 Adimab, Llc Rationally designed, synthetic antibody libraries and uses therefor
US11008568B2 (en) 2007-09-14 2021-05-18 Adimab, Llc Rationally designed, synthetic antibody libraries and uses therefor
US10196635B2 (en) 2007-09-14 2019-02-05 Adimab, Llc Rationally designed, synthetic antibody libraries and uses therefor
US9873957B2 (en) 2008-03-13 2018-01-23 Dyax Corp. Libraries of genetic packages comprising novel HC CDR3 designs
US11926926B2 (en) 2008-03-13 2024-03-12 Takeda Pharmaceutical Company Limited Libraries of genetic packages comprising novel HC CDR3 designs
WO2009114815A1 (en) * 2008-03-13 2009-09-17 Dyax Corp Libraries of genetic packages comprising novel hc cdr3 designs
US10718066B2 (en) 2008-03-13 2020-07-21 Dyax Corp. Libraries of genetic packages comprising novel HC CDR3 designs
US20110118147A1 (en) * 2008-03-13 2011-05-19 Ladner Robert C Libraries of genetic packages comprising novel hc cdr3 designs
US10683342B2 (en) 2008-04-24 2020-06-16 Dyax Corp. Libraries of genetic packages comprising novel HC CDR1, CDR2, and CDR3 and novel LC CDR1, CDR2, and CDR3 designs
US20110172125A1 (en) * 2008-04-24 2011-07-14 Dyax Corp. Libraries of genetic packages comprising novel hc cdr1, cdr2, and cdr3 and novel lc cdr1, cdr2, and cdr3 designs
US9388510B2 (en) 2008-04-24 2016-07-12 Dyax Corp. Libraries of genetic packages comprising novel HC CDR1, CDR2, and CDR3 and novel LC CDR1, CDR2, and CDR3 designs
US11598024B2 (en) 2008-04-24 2023-03-07 Takeda Pharmaceutical Company Limited Libraries of genetic packages comprising novel HC CDR1, CDR2, and CDR3 and novel LC CDR1, CDR2, and CDR3 designs
WO2010105256A1 (en) 2009-03-13 2010-09-16 Adimab, Inc. Rationally designed, synthetic antibody libraries and uses therefor
US20110082054A1 (en) * 2009-09-14 2011-04-07 Dyax Corp. Libraries of genetic packages comprising novel hc cdr3 designs
WO2011032181A3 (en) * 2009-09-14 2011-06-03 Dyax Corp. Libraries of genetic packages comprising novel hc cdr3 designs
US10138478B2 (en) 2010-07-16 2018-11-27 Adimab, Llc Antibody libraries
US9354228B2 (en) 2010-07-16 2016-05-31 Adimab, Llc Antibody libraries
US10889811B2 (en) 2010-07-16 2021-01-12 Adimab, Llc Antibody libraries
WO2018046525A1 (en) 2016-09-08 2018-03-15 Italfarmaco S.P.A. Hc-cdr3-only libraries with reduced combinatorial redundancy and optimized loop length distribution
EP3293293A1 (en) 2016-09-08 2018-03-14 Italfarmaco SpA Hc-cdr3-only libraries with reduced combinatorial redundancy and optimized loop length distribution

Also Published As

Publication number Publication date
US20120028841A1 (en) 2012-02-02
PT2316940E (en) 2013-10-16
CA2784251A1 (en) 2002-08-08
US9617536B2 (en) 2017-04-11
EP1360288A2 (en) 2003-11-12
US8895475B2 (en) 2014-11-25
US20120302463A1 (en) 2012-11-29
PT1360288E (en) 2011-03-07
US8466091B2 (en) 2013-06-18
JP4860098B2 (en) 2012-01-25
ATE498718T1 (en) 2011-03-15
ES2360479T3 (en) 2011-06-06
US8399384B2 (en) 2013-03-19
JP2008183014A (en) 2008-08-14
DE60144063D1 (en) 2011-03-31
JP2004518432A (en) 2004-06-24
JP4855436B2 (en) 2012-01-18
US20120021952A1 (en) 2012-01-26
US20130178396A1 (en) 2013-07-11
HK1156660A1 (en) 2012-06-15
US20120028840A1 (en) 2012-02-02
US20100292103A1 (en) 2010-11-18
DK2316940T3 (en) 2013-11-04
US20140018261A9 (en) 2014-01-16
DK1360288T3 (en) 2011-06-14
AU2002249854B2 (en) 2007-09-20
EP1360288B1 (en) 2011-02-16
ES2430857T3 (en) 2013-11-22
WO2002061071A2 (en) 2002-08-08
US10604753B2 (en) 2020-03-31
EP2316940A1 (en) 2011-05-04
US9803190B2 (en) 2017-10-31
US20180291368A1 (en) 2018-10-11
US8258082B2 (en) 2012-09-04
CA2432377C (en) 2012-10-09
CA2432377A1 (en) 2002-08-08
US20200325469A1 (en) 2020-10-15
EP2316940B1 (en) 2013-07-24
WO2002061071A3 (en) 2003-09-12
US20030119056A1 (en) 2003-06-26

Similar Documents

Publication Publication Date Title
US20060257937A1 (en) Focused libraries of genetic packages
AU2002249854A1 (en) Focused libraries of genetic packages
EP0866136B1 (en) Recombinant library screening methods
EP2281078B1 (en) Libraries of genetic packages comprising novel hc cdr1, cdr2, and cdr3 and novel lc cdr1, cdr2, and cdr3 designs
WO1997008320A1 (en) Protein/(poly)peptide libraries
CA2773564A1 (en) Libraries of genetic packages comprising novel hc cdr3 designs
AU2011223997B2 (en) Focused Libraries of Genetic Packages
AU2007214299A1 (en) Focused Libraries of Genetic Packages

Legal Events

Date Code Title Description
AS Assignment

Owner name: PAUL ROYALTY FUND HOLDINGS II,CALIFORNIA

Free format text: SECURITY AGREEMENT;ASSIGNOR:DYAX CORP.;REEL/FRAME:018160/0726

Effective date: 20060823

Owner name: PAUL ROYALTY FUND HOLDINGS II, CALIFORNIA

Free format text: SECURITY AGREEMENT;ASSIGNOR:DYAX CORP.;REEL/FRAME:018160/0726

Effective date: 20060823

AS Assignment

Owner name: DYAX CORP., MASSACHUSETTS

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:LADNER, ROBERT CHARLES;REEL/FRAME:019499/0553

Effective date: 20020416

AS Assignment

Owner name: DYAX CORP., MASSACHUSETTS

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:LADNER, ROBERT C.;REEL/FRAME:020202/0284

Effective date: 20020416

AS Assignment

Owner name: DYAX CORP., A DELAWARE CORPORATION, MASSACHUSETTS

Free format text: RELEASE BY SECURED PARTY;ASSIGNOR:PAUL ROYALTY FUND HOLDINGS II;REEL/FRAME:021355/0408

Effective date: 20080805

Owner name: DYAX CORP., A DELAWARE CORPORATION,MASSACHUSETTS

Free format text: RELEASE BY SECURED PARTY;ASSIGNOR:PAUL ROYALTY FUND HOLDINGS II;REEL/FRAME:021355/0408

Effective date: 20080805

AS Assignment

Owner name: COWEN HEALTHCARE ROYALTY PARTNERS, L.P., CONNECTIC

Free format text: SECURITY AGREEMENT;ASSIGNOR:DYAX CORP., A DELAWARE CORPORATION;REEL/FRAME:021354/0324

Effective date: 20080805

Owner name: COWEN HEALTHCARE ROYALTY PARTNERS, L.P.,CONNECTICU

Free format text: SECURITY AGREEMENT;ASSIGNOR:DYAX CORP., A DELAWARE CORPORATION;REEL/FRAME:021354/0324

Effective date: 20080805

AS Assignment

Owner name: COWEN HEALTHCARE ROYALTY PARTNERS, L.P., CONNECTIC

Free format text: SECURITY AGREEMENT;ASSIGNOR:DYAX CORP., A DELAWARE CORPORATION;REEL/FRAME:022408/0768

Effective date: 20090318

Owner name: COWEN HEALTHCARE ROYALTY PARTNERS, L.P.,CONNECTICU

Free format text: SECURITY AGREEMENT;ASSIGNOR:DYAX CORP., A DELAWARE CORPORATION;REEL/FRAME:022408/0768

Effective date: 20090318

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION

AS Assignment

Owner name: DYAX CORP., A DELAWARE CORPORATION, MASSACHUSETTS

Free format text: RELEASE BY SECURED PARTY;ASSIGNOR:HEALTHCARE ROYALTY PARTNERS, L.P. F/K/A COWEN HEALTHCARE ROYALTY PARTNERS, L.P.;REEL/FRAME:028827/0906

Effective date: 20120822

Owner name: LFRP INVESTORS, L.P., A DELAWARE LIMITED PARTNERSH

Free format text: SECURITY AGREEMENT;ASSIGNOR:DYAX CORP., A DELAWARE CORPORATION;REEL/FRAME:028828/0517

Effective date: 20120822

AS Assignment

Owner name: DYAX CORP., MASSACHUSETTS

Free format text: RELEASE BY SECURED PARTY;ASSIGNOR:LFRP INVESTORS, L.P.;REEL/FRAME:036902/0703

Effective date: 20151028