US20060178326A1

US20060178326A1 - Ribozyme therapy for the treatment of proliferative skin and eye diseases

Info

Publication number: US20060178326A1
Application number: US10/753,718
Authority: US
Inventors: Joan Robbins; Richard Tritz
Original assignee: Individual
Current assignee: Individual
Priority date: 1999-10-26
Filing date: 2004-01-08
Publication date: 2006-08-10
Also published as: US6770633B1

Abstract

As an effective therapy for proliferative skin and eye diseases such as psoriasis and proliferative diabetic retinopathy, this invention provides ribozymes and ribozyme delivery systems which cleave RNA encoding cytokines involved in inflammation, matrix metalloproteinases, a cyclin, a cell-cycle dependent kinase, a growth factor, or a reductase.

Description

CROSS REFERENCE TO RELATED APPLICATION

This application claims the benefit of U.S. Provisional Patent Application No. 60/161,532 filed Oct. 26, 1999, where this provisional application is incorporated herein by reference in its entirety.

TECHNICAL FIELD

The present invention relates generally to therapeutics, and more specifically, to compositions and methods which may be utilized in the treatment and/or prevention of proliferative skin and eye diseases such as psoriasis and proliferative retinopathy. BACKGROUND OF THE INVENTION
Proliferative skin diseases such as psoriasis affect as many as 2 to 3% of the entire U.S. population, with more than 250,000 new cases being diagnosed each year. The cost of treating psoriasis in the United States alone is estimated to range between three and five billion dollars per year, thus representing a major health cost to the health care system. Although the cause of psoriasis is presently unknown, there is evidence which tends to suggest that it is a polygenetic autoimmune disorder.
Proliferative skin diseases such as psoriasis are characterized by itchy, inflamed, scaly lesions which bleed easily. Although there are a wide variety of topical treatments (e.g., coal tar preparations, steroid-based creams and ointments) and systemic treatments (e.g., ultraviolet radiation, PUVA, steroids, and chemotherapeutic agents such as methotrexate), at present there is no cure for psoriasis. Further, presently available treatments are generally unsatisfactory, in that remission rates are high and certain therapeutic regimens have potentially serious side effects.
Proliferative diseases of the eye such as proliferative diabetic retinopathy (PDR) affect as many as 700,000 in the U.S., with more than 65,000 new cases diagnosed each year. Annually, as many as 25,000 people go blind from the disorder, making it a leading cause of blindness among working-age Americans. The cost savings from successful intervention could be as high as 100 million dollars per year. The disease does not stem from a single retinal change. Rather, it may be triggered by a combination of biochemical, metabolic, and hematological abnormalities.
There are no early symptoms. There is no pain, no blurred vision, and no ocular inflammation. In fact, many people do not develop any visual impairment until the disease has advanced well into its proliferative stage. At this point, the vision that has been lost cannot be restored. Laser surgery, also called photocoagulation, is the only current therapy to treat PDR. At present there is no cure for this disease.
Scarring is a significant source of disfigurement, pain, and increased medical costs for affected patients. It is the result of abnormal events during wound healing that can result in tissue overgrowth characterized by hyperproliferation of fibroblasts and excessive deposition of matrix. In surgery, scar tissue formation and contraction is a major clinical problem. Likewise, scarring following accidental burning or other injuries or trauma often has serious results, causing impaired function and unsightly aesthetic effects. Currently, there are no satisfactory treatments to prevent scarring.
Thus, a need exists for an effective therapy to treat proliferative diseases (e.g., psoriasis, PDR and scarring). The present invention satisfies this need and further provides other related advantages as well.

SUMMARY OF THE INVENTION

Briefly stated, the present invention provides ribozymes and ribozyme delivery systems which are able to inhibit the mechanisms involved in proliferation of cells associated with proliferative skin and eye diseases such as psoriasis, PDR and scarring. Accordingly, the present invention ribozymes are provided which are suitable for treating scarring and proliferative diseases by inhibiting a cytokine involved in inflammation, a matrix metalloproteinase involved in extracellular matrix elaboration, a cyclin, a cell-cycle dependent kinase, a growth factor involved in cell cycle regulation, or a reductase.
Within one aspect of the invention, such methods generally comprise the step of administering to a patient a therapeutically effective amount of ribozyme which cleaves RNA encoding a cytokine involved in inflammation, a matrix metalloproteinase, a cyclin, a cell-cycle dependent kinase, a growth factor, or a reductase such that said proliferative skin disease is treated. Within a related aspect, methods of treating proliferative skin disease are provided comprising the step of administering to a patient an effective amount of nucleic acid molecule comprising a promoter operably linked to a nucleic acid segment encoding a ribozyme which cleaves RNA encoding a cytokine involved in inflammation, a matrix metalloproteinase, a cyclin, a cell-cycle dependent kinase, a growth factor, or a reductase such that said proliferative skin disease is treated. Representative examples of proliferative skin diseases include psoriasis, atopic dermatitis, actinic keratosis, squamous or basal cell carcinoma, viral or seborrheic wart.
Within other aspects, such methods generally comprise the step of administering to a patient a therapeutically effective amount of ribozyme which cleaves RNA encoding a cytokine involved in inflammation, a matrix metalloproteinase, a cyclin, a cell-cycle dependent kinase, or a growth factor such that said proliferative eye disease is treated. Within a related aspect, methods of treating proliferative eye disease are provided comprising the step of administering to a patient an effective amount of nucleic acid molecules comprising a promoter operably linked to a nucleic acid segment encoding a ribozyme which cleaves RNA encoding a cytokine involved in inflammation, a matrix metalloproteinase, a cyclin, a cell-cycle dependent kinase, a growth factor, or a reductase such that said proliferative eye disease is treated. Representative examples of proliferative eye diseases include proliferative diabetic retinopathy, proliferative vitreoretinopathy, proliferative sickle cell retinopathy, retinopathy of prematurity and retinal detachment.
Within other aspects, methods are provided for treating or preventing scarring, comprising administering to a patient a therapeutically effective amount of ribozyme which cleaves RNA encoding a cytokine involved in inflammation, a matrix metalloproteinase, a cyclin, a cell-cycle dependent kinase, a growth factor, or a reductase such that said scarring is treated or prevented. Within another related aspect, methods are provided for treating or preventing scarring, comprising administering to a patient an effective amount of nucleic acid molecule comprising a promoter operably linked to a nucleic acid segment encoding a ribozyme which cleaves RNA encoding a cytokine involved in inflammation, a matrix metalloproteinase, a cyclin, a cell-cycle dependent kinase, a growth factor, or a reductase such that said scarring is treated or prevented. Representative examples of diseases or injuries which cause scarring include keloids, adhesions (e.g., surgical adhesions), hypertrophic burn scars, and trauma (e.g., blunt trauma or surgical trauma).
Cyclins and cell-cycle dependent kinases are directly involved in the check point control of cell division leading to proliferation. Particularly preferred cyclins or cell-cycle dependent kinases include CDK1, CDK2, CDK4, Cyclin B 1, Cyclin D and PCNA.
Infection or injury induces a complex cascade of events including activation of the clotting pathway, adherence of immune cells to the endothelium, induction of proliferation and migration of cells into the injury site to rapidly repair the insult. These responses are mediated by certain cytokines and growth factors released from the injured tissue and by hematopoetic cells; Chronic inflammation develops when cytokines and growth factors continue to be produced, resulting in an exaggerated healing response. Particularly preferred cytokines include the inflammatory cytokines interleukin 1 alpha and beta, interleukin 2, interleukin 6, interleukin 8, interferon gamma, and tumor necrosis factor. Particularly preferred growth factors include vascular endothelial growth factor (VEGF), and platelet derived growth factor (PDGF).
Matrix metalloproteinases, along with their corresponding inhibitors, tissue inhibitors of metalloproteinases or TIMP, are involved in the repair of injured tissue. The balance between the proteinases and the inhibitors regulates the pattern and extent of wound healing. Excessive production of MMP or insufficient production of TIMP results in abnormal wound healing. Particularly preferred matrix metalloproteinases include MMP 1, MMP 2, MMP 3 and MMP 9.
Preferably, the ribozyme is a hammerhead or hairpin ribozyme, representative examples of which recognize the target site sequences set forth below and in the Examples. In preferred embodiments, the present invention also provides nucleic acid molecule encoding such ribozymes; further preferably, the nucleic acid is DNA or cDNA. Even further preferably, the nucleic acid molecule is under the control of a promoter to transcribe the nucleic acid.
In one embodiment of the invention, nucleic acid molecules are described which encode the ribozymes provided herein. Preferably, the vector is a plasmid, a virus, retrotransposon, a cosmid or a retrovirus. In one embodiment where the vector is a retroviral vector, the nucleic acid molecule encoding the ribozyme under the control of a promoter, which is preferably a pol III promoter, further preferably a human tRNA^Va1promoter or an adenovirus VA1 promoter, is inserted between the 5′ and 3′ long terminal repeat sequences of the retrovirus.
These and other aspects of the present invention will become evident upon reference to the following detailed description and attached drawings. In addition, various references are set forth herein that describe in more detail certain procedures or compositions (e.g., plasmids, etc.), and are therefore incorporated by reference in their entirety as if each were individually noted for incorporation.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 is a schematic illustration of which shows the general structure of a chimeric DNA/RNA ribozyme (SEQ ID NOs: 4385 and 4386).
FIG. 2 is a photograph of a gel which shows the stability of chimeric ribozymes PN30003, 30004, and 30005 in human vascular smooth muscle cell lysate.
FIG. 3 is a photograph of a gel which shows the stability of chimeric ribozymes PN30003 and 30005 in serum.
FIG. 4 is a schematic illustration of a propanediol linker.
FIG. 5 is a schematic illustration of vector pLNT-Rz.
FIG. 6 is a schematic illustration of a representative hairpin ribozyme (SEQ ID NOs: 4387 and 4388).
FIG. 7 is a photograph of treated and control skin from a porcine model of scar formation.
FIGS. 8A-8C are photographs of control eyes and eyes treated with chimeric PCNA targeted ribozyme from a rabbit dispase model of proliferative vitreoretinopathy.
FIG. 9 is a chart of the cumulative transdermal absorption of ³²P-ribozyme presented as the percent of the applied dose recovered in the reservoir of diffusion chambers.
FIG. 10 is a chart of the cumulative transdermal absorption of ³²P-ribozyme presented as total micrograms recovered in the reservoir of diffusion chambers.
FIG. 11 is a chart of the localization of ³²P-ribozyme in various skin compartments presented as percent of the applied dose recovered in each compartment.
FIG. 12 is a chart of the localization of ³²P-ribozyme in various skin compartments presented as total micrograms in each compartment.
FIG. 13 is a chart of histopathologic scoring of chimeric PCNA targeted ribozyme versus control treated rabbit eyes. Scoring is based on a modified Fastenberg scale (Table 22) and performed blindly by two trained observers. P is less than 0.0008 by T test.
FIG. 14A and FIG. 14B are two photographs of a surgical wound model in pig skin. FIG. 14A shows the dimensions of the wound (approximately 3 cm long, 5 mm deep and 6 mm wide). FIG. 14B shows excision of the skin and closure with a single suture.

DETAILED DESCRIPTION OF THE INVENTION

DEFINITIONS

Prior to setting forth the invention, it may be helpful to an understanding thereof to first set forth definitions of certain terms that will be used hereinafter.
“Ribozyme” refers to a nucleic acid molecule which is capable of cleaving a specific nucleic acid sequence. Ribozymes may be composed of RNA, DNA, nucleic acid analogues (e.g., phosphorothioates), or any combination of these (e.g., DNA/RNA chimerics). Within particularly preferred embodiments, a ribozyme should be understood to refer to RNA molecules that contain anti-sense sequences for specific recognition, and an RNA-cleaving enzymatic activity.
“Ribozyme gene” refers to a nucleic acid molecule (e.g., DNA) consisting of the ribozyme sequence which, when transcribed into RNA, will yield the ribozyme.
“Vector” refers to an assembly which is capable of expressing a ribozyme of interest. The vector may be composed of either deoxyribonucleic acids (“DNA” ) or ribonucleic acids (“RNA”). Optionally, the vector may include a polyadenylation sequence, one or more restriction sites, as well as one or more selectable markers such as neomycin phosphotransferase, hygromycin phosphotransferase or puromycin-N-acetyl-transferase. Additionally, depending on the host cell chosen and the vector employed, other genetic elements such as an origin of replication, additional nucleic acid restriction sites, enhancers, sequences conferring inducibility of transcription, and selectable markers, may also be incorporated into the vectors described herein.
“Nucleic acid” or “nucleic acid molecule” refers to any of deoxyribonucleic acid (DNA), ribonucleic acid (RNA), oligonucleotides, fragments generated by the polymerase chain reaction (PCR), and fragments generated by any of ligation, scission, endonuclease action, and exonuclease action. Nucleic acids can be composed of monomers that are naturally-occurring nucleotides (such as deoxyribonucleotides and ribonucleotides), or analogs of naturally-occurring nucleotides (e.g., α-enantiomeric forms of naturally-occurring nucleotides), or a combination of both. Modified nucleotides can have modifications in sugar moieties and/or in pyrimidine or purine base moieties. Sugar modifications include, for example, replacement of one or more hydroxyl groups with halogens, alkyl groups, amines, and azido groups, or sugars can be functionalized as ethers or esters. Moreover, the entire sugar moiety can be replaced with sterically and electronically similar structures, such as aza-sugars and carbocyclic sugar analogs. Examples of modifications in a base moiety include alkylated purines and pyrimidines, acylated purines or pyrimidines, or other well-known heterocyclic substitutes. Nucleic acid monomers can be linked by phosphodiester bonds or analogs of such linkages. Analogs of phosphodiester linkages include phosphorothioate, phosphorodithioate, phosphoroselenoate, phosphorodiselenoate, phosphoroanilothioate, phosphoranilidate, phosphoramidate, and the like. The term “nucleic acid” also includes so-called “peptide nucleic acids,” which comprise naturally-occurring or modified nucleic acid bases attached to a polyamide backbone. Nucleic acids can be either single stranded or double stranded.
“Isolated nucleic acid molecule” is a nucleic acid molecule that is not integrated in the genomic DNA of an organism. For example, a DNA molecule that encodes a gene that has been separated from the genomic DNA of a eukaryotic cell is an isolated DNA molecule. Another example of an isolated nucleic acid molecule is a chemically-synthesized nucleic acid molecule that is not integrated in the genome of an organism.
“Promoter” is a nucleotide sequence that directs the transcription of a structural gene. Typically, a promoter is located in the 5′ region of a gene, proximal to the transcriptional start site of a structural gene. If a promoter is an inducible promoter, then the rate of transcription increases in response to an inducing agent. In contrast, the rate of transcription is not regulated by an inducing agent if the promoter is a constitutive promoter.
As noted above, proliferative diseases such as psoriasis, PDR, and scarring affect many individuals and represent a major cost to the health care system. As discussed in more detail below, by interfering with cell-cycle control of cells which might otherwise proliferate, proliferative diseases such as psoriasis or PDR can be effectively treated. This invention accomplishes such by providing ribozymes and methods of using ribozymes that inhibit the activity of cytokines which are involved in inflammation, matrix metalloproteinases, cyclins, cell-cycle dependent kinases, growth factors, reductases, all of which directly or indirectly contribute to proliferation.
Cyclins and cell-cycle dependent kinases are directly involved in the signaling and synthesis that results in cells progressing through the cell cycle to replicate. Representative examples of suitable ribozyme targets include cdk1 ribozyme binding sites (SEQ ID NOS: 1-149); cdk2 ribozyme binding sites (SEQ ID NOS: 150-3010); cdk3 ribozyme binding sites (SEQ ID NOS: 302-405); cdk4 ribozyme binding sites (SEQ ID NOS: 406-526); cdk6 ribozyme binding sites (SEQ ID NOS: 527-665); cdk7 ribozyme binding sites (SEQ ID NOS: 666-866); cdk8 ribozyme binding sites (SEQ ID NOS: 867-1112); cdk-we-hu ribozyme binding sites (SEQ ID NOS: 1113-1408); cyclin A2 ribozyme binding sites (SEQ ID NOS: 1409-1614); cyclin C ribozyme binding sites (SEQ ID NOS: 1615-1819); cyclin D1 ribozyme binding sites (SEQ ID NOS: 1820-1889); cyclin D2 ribozyme binding sites (SEQ ID NOS: 1890-1975); cyclin D3 ribozyme binding sites (SEQ ID NOS: 1976-2053); cyclin E ribozyme binding sites (SEQ ID NOS: 2054-2318); cyclin F ribozyme binding sites (SEQ ID NOS: 2319-2561); cyclin G1 ribozyme binding sites (SEQ ID NOS: 2562-2787); cyclin H ribozyme binding sites (SEQ ID NOS: 2788-2964); cyclin A1 ribozyme binding sites (SEQ ID NOS: 2965-3257); cyclin B1 ribozyme binding sites (SEQ ID NOS: 3258-3478); cdc25 hs ribozyme binding sites (SEQ ID NOS: 3479-3854); PCNA HH ribozyme binding sites (SEQ ID NOS: 3855-4115); and chimeric hairpin ribozymes: SEQ ID NOS: 4116-4119).
As noted above, infection or injury induces a complex cascade of events including activation of the clotting pathway, adherence of immune cells to the endothelium, induction of proliferation and migration of cells into the injury site to rapidly repair the insult. These responses are mediated by certain cytokines and growth factors released from the injured tissue and by hematopoetic cells. Chronic inflammation develops when cytokines and growth factors continue to be produced, resulting in an exaggerated healing response. Particularly preferred cytokines include the inflammatory cytokines interleukin 1 alpha and beta, interleukin 2, interleukin 6, interleukin 8, interferon gamma, and tumor necrosis factor. Particularly preferred growth factors include vascular endothelial growth factor (VEGF), and platelet derived growth factor (PDGF).
Matrix metalloproteinases, along with their corresponding inhibitors, tissue inhibitors of metalloproteinases or TIMP, are involved in a the repair of injured tissue. The balance between the proteinases and the inhibitors regulates the pattern and extent of wound healing. Excessive production of MMP or insufficient production of TIMP results in abnormal wound healing. Particularly preferred matrix metalloproteinases include MMP 1, MMP 2, MMP 3 and MMP 9.

RIBOZYMES

As noted above, the present invention provides ribozymes having the ability to cleave or otherwise inhibit nucleic acid molecules which are either directly, or indirectly (e.g., they encode proteins) involved in cell-cycle control. Several different types of ribozymes may be constructed for use within the present invention, including for example, hammerhead ribozymes (Rossi, J. J. et al., Pharmac. Ther. 50:245-254, 1991) (Forster and Symons, Cell 48:211-220, 1987; Haseloff and Gerlach, Nature 328:596-600, 1988; Walbot and Bruening, Nature 334:196, 1988; Haseloff and Gerlach, Nature 334:585, 1988; Haseloff et al., U.S. Pat. No. 5,254,678), hairpin ribozymes (Hampel et al., Nucl. Acids Res. 18:299-304, 1990, and U.S. Pat. No. 5,254,678), hepatitis delta virus ribozymes (Perrotta and Been, Biochem. 31:16, 1992), Group I intron ribozymes (Cech et al., U.S. Pat. No. 4,987,071) and RNase P ribozymes (Takada et al., Cell 35:849, 1983); (see also, WO 95/29241, entitled “Ribozymes with Product Ejection by Strand Displacement”; and WO 95/31551, entitled “Novel Enzymatic RNA Molecules.”
Cech et al. (U.S. Pat. No.4,987,071, issued Jan. 22, 1991) has disclosed the preparation and use of ribozymes which are based on the properties of the Tetrahymena ribosomal RNA self-splicing reaction. These ribozymes require an eight base pair target site and free guanosine (or guanosine derivatives). A temperature optimum of 50° C. is reported for the endoribonuclease activity. The fragments that arise from cleavage contain 5′-phosphate and 3′-hydroxyl groups and a free guanosine nucleotide added to the 5′-end of the cleaved RNA.
In contrast to the ribozymes of Cech et al., particularly preferred ribozymes of the present invention hybridize efficiently to target sequences at physiological temperatures, making them suitable for use in vivo, and not merely as research tools (see column 15, lines 18 to 42, of Cech et al., U.S. Pat. No. 4,987,071). Thus, particularly preferred ribozymes for use within the present invention include hairpin ribozymes (for example, as described by Hampel et al., European Patent Publication No. 0 360 257, published Mar. 26, 1990) and hammerhead ribozymes. Briefly, the sequence requirement for the hairpin ribozyme is any RNA sequence consisting of NNNBN*GUC(N)_x(Sequence ID Nos. 4120-4124) (where x is any number from 6 to 10, N*G is the cleavage site, B is any of G, C, or U, and N is any of G, U, C, or A). Representative examples of recognition or target sequences for hairpin ribozymes are set forth below in the Examples. Additionally, the backbone or common region of the hairpin ribozyme can be designed using the nucleotide sequence of the native hairpin ribozyme (Hampel et al., Nucl. Acids Res. 18:299-304, 1990) or it can be modified to include a “tetraloop” structure that increases stability and catalytic activity (see Example 2; see also Yu et al., Virology 206:381-386, 1995; Cheong et al., Nature 346:680-682, 1990; Anderson et al., Nucl. Acids Res. 22:1096-1100, 1994).
The sequence requirement at the cleavage site for the hammerhead ribozyme is any RNA sequence consisting of NUH (where N is any of G, U, C, or A and H represents C, U, or A) can be targeted. Accordingly, the same target within the hairpin leader sequence, GUC, is useful for the hammerhead ribozyme. The additional nucleotides of the hammerhead ribozyme or hairpin ribozyme is determined by the target flanking nucleotides and the hammerhead consensus sequence (see Ruffner et al., Biochemistry 29:10695-10702, 1990). This information, along with the sequences and disclosure provided herein, enables the production of hairpin ribozymes of this invention.
The ribozymes of this invention, as well as DNA encoding such ribozymes and other suitable nucleic acid molecules, described in more detail below, can be chemically synthesized using methods well known in the art for the synthesis of nucleic acid molecules (see e.g., Heidenreich et al., J. FASEB 70(1):90-6, 1993; Sproat, Curr. Opin. Biotechnol. 4(1):20-28, 1993). Alternatively, commercial suppliers such as Promega, Madison, Wis., USA, provide a series of protocols suitable for the production of nucleic acid molecules such as ribozymes.
Within one aspect of the present invention, ribozymes are prepared from a DNA molecule or other nucleic acid molecule (which, upon transcription, yields an RNA molecule) operably linked to an RNA polymerase promoter, e.g., the promoter for T7 RNA polymerase or SP6 RNA polymerase. Accordingly, also provided by this invention are nucleic acid molecules, e.g., DNA or cDNA, coding for the ribozymes of this invention. When the vector also contains an RNA polymerase promoter operably linked to the DNA molecule, the ribozyme can be produced in vitro upon incubation with the RNA polymerase and appropriate nucleotides. In a separate embodiment, the DNA may be inserted into an expression cassette, such as described in Cotten and Bimstiel, EMBO J. 8(12):3861-3866, 1989, and in Hempel et al., Biochemistry 28:4929-4933, 1989. A more detailed discussion of molecular biology methodology is disclosed in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, 1989.
During synthesis, the ribozyme can be modified by ligation to a DNA molecule having the ability to stabilize the ribozyme and make it resistant to RNase (Rossi et al., Pharmac. Ther. 50:245-254, 1991). In another embodiment, the ribozyme can be modified to a phosphothio-analog for use in liposome delivery systems. This modification also renders the ribozyme resistant to endonuclease activity. In yet another embodiment, the ribozyme can be modified to contain propanediol linkages or to incorporate 2′-O-methylated nucleotides.

VECTORS

Use of ribozymes to treat proliferative skin diseases such as psoriasis or eczema involves introduction of functional ribozyme to the infected cell of interest. This can be accomplished by either synthesizing functional ribozyme in vitro prior to delivery, or, by delivery of DNA capable of driving ribozyme synthesis in vivo.
More specifically, within other aspects of the invention the ribozyme gene may be constructed within a vector which is suitable for introduction to a host cell (e.g., prokaryotic or eukaryotic cells in culture or in the cells of an organism). Appropriate prokaryotic and eukaryotic cells can be transfected with an appropriate transfer vector containing the nucleic acid molecule encoding a ribozyme of this invention.
To produce the ribozymes with a vector in vivo, nucleotide sequences coding for ribozymes are preferably placed under the control of a eukaryotic promoter such as pol III (e.g., tRNA or VA-1 from adenovirus), CMV, SV40 late, or SV40 early promoters. Within certain embodiments, the promoter may be a tissue or cell-specific promoter. Ribozymes may thus be produced directly from the transfer vector in vivo.
A wide variety of vectors may be utilized within the context of the present invention, including for example, plasmids, viruses, retrotransposons and cosmids. Representative examples include adenoviral vectors (e.g., WO 94/26914, WO 93/9191; Yei et al., Gene Therapy 1:192-200, 1994; Kolls et al., PNAS 91(1):215-219, 1994; Kass-Eisler et al., PNAS 90(24):11498-502, 1993; Guzman et al., Circulation 88(6):2838-48, 1993; Guzman et al., Cir. Res. 73(6):1202-1207, 1993; Zabner et al., Cell 75(2):207-216, 1993; Li et al., Hum Gene Ther. 4(4):403-409, 1993; Caillaud et al., Eur. J. Neurosci. 5(10):1287-1291, 1993), adeno-associated type I (“AAV-1”) or adeno-associated type 2 (“AAV-2”) vectors (see WO 95/13365; Flotte et al., PNAS 90(22):10613-10617, 1993), hepatitis delta vectors, live, attenuated delta viruses and herpes viral vectors (e.g., U.S. Pat. No. 5,288,641), as well as vectors which are disclosed within U.S. Pat. No. 5,166,320. Other representative vectors include retroviral vectors (e.g., EP 0 415 731; WO 90/07936; WO 91/02805; WO 94/03622; WO 93/25698; WO 93/25234; U.S. Pat. No. 5,219,740; WO 93/11230; WO 93/10218). General methods of using such vectors in gene therapy are well known in the art (see, for example, Larrick, J. W. and Burck, K. L., Gene Therapy: Application of Molecular Biology, Elsevier Science Publishing Co., Inc., New York, N.Y., 1991 and Kreigler, M., Gene Transfer and Expression: A Laboratory Manual, W. H. Freeman and Company, New York, 1990).
Further provided by this invention are vectors having more than one nucleic acid molecule encoding a ribozyme of this invention, each molecule under the control of a separate eukaryotic promoter (or, an Internal Ribosome Entry Site or “IRES”) or alternatively, under the control of single eukaryotic promoter. Representative examples of other nucleic acid molecules which may be delivered by the vectors of the present invention include therapeutic molecules such as interferon (e.g., alpha, beta or gamma), as well as a wide variety of other cytokines or growth factors, and facilitators which assist or aid ribozymes in cleaving a target sequence by unwinding or otherwise limiting secondary folding which might otherwise inhibit the ribozyme. These vectors provide the advantage of providing multi-functional therapy against Psoriasis, preferably with the various therapies working together in synergy.
Host prokaryotic and eukaryotic cells stably harboring the vectors described above also are provided by this invention. Suitable host cells include bacterial cells, rat cells, mouse cells, and human cells.

DELIVERY

Within certain aspects of the invention, ribozyme molecules, or nucleic acid molecules which encode the ribozyme, may be introduced into a host cell or administered to a patient utilizing a vehicle, or by various physical methods. Representative examples of such methods include transformation using calcium phosphate precipitation (Dubensky et al., PNAS 81:7529-7533, 1984), direct microinjection of such nucleic acid molecules into intact target cells (Acsadi et al., Nature 352:815-818, 1991), and electroporation whereby cells suspended in a conducting solution are subjected to an intense electric field in order to transiently polarize the membrane, allowing entry of the nucleic acid molecules. Other procedures include the use of nucleic acid molecules linked to an inactive adenovirus (Cotton et al., PNAS 89:6094, 1990), lipofection (Felgner et al., Proc. Natl. Acad. Sci. USA 84:7413-7417, 1989), microprojectile bombardment (Williams et al., PNAS 88:2726-2730, 1991), polycation compounds such as polylysine, receptor specific ligands, liposomes entrapping the nucleic acid molecules, spheroplast fusion whereby E. coli containing the nucleic acid molecules are stripped of their outer cell walls and fused to animal cells using polyethylene glycol, viral transduction, (Cline et al., Pharmac. Ther 29:69, 1985; and Friedmann et al., Science 244:1275, 1989), and DNA ligand (Wu et al, J. of Biol. Chem. 264:16985-16987, 1989). In one embodiment, the ribozyme is introduced into the host cell using a liposome.
Within further embodiments of the invention, additional therapeutic molecules (e.g., interferon) or facilitators may be delivered utilizing the methods described herein. Such delivery may be either simultaneous to, or before or after the delivery of a ribozyme or vector expressing ribozymes.

PHARMACEUTICAL COMPOSITIONS

As noted above, pharmaceutical compositions (or “medicaments”) also are provided by this invention. These compositions contain any of the above described ribozymes, DNA molecules, vectors or host cells, along with a pharmaceutically or physiologically acceptable carrier, excipient, or, diluent. Generally, such carriers should be nontoxic to recipients at the dosages and concentrations employed. Ordinarily, the preparation of such compositions entails combining the therapeutic agent with buffers, antioxidants such as ascorbic acid, low molecular weight (less than about 10 residues) polypeptides, proteins, amino acids, carbohydrates including glucose, sucrose or dextrins, chelating agents such as EDTA, glutathione and other stabilizers and excipients. Neutral buffered saline or saline mixed with nonspecific serum albumin are exemplary appropriate diluents. Particularly preferred carriers include cholesterols such as DOTAP:cholesterol.
Additional ingredients added to the compositions for the express purpose of inhibiting endogenous ribonucleases include reducing agents such as dithiothreitol, detergents such as sodium dodecyl sulfate, and other agents such as vanidyl nucleotides, aurin tricarbocylic acid, hydrogen peroxide and RNA decoys such as tRNA.
Pharmaceutical compositions of the present invention may also be prepared to contain, or express (e.g., if a vector), one or more additional therapeutic molecules (e.g., interferon) or facilitators.
The pharmaceutical compositions of the present invention may be prepared for administration by a variety of different routes, including for example, topically, intradermally, or intraocullarly. In addition, pharmaceutical compositions of the present invention may be placed within containers, along with packaging material which provides instructions regarding the use of such pharmaceutical compositions. Generally, such instructions will include a tangible expression describing the reagent concentration, as well as within certain embodiments, relative amounts of excipient ingredients or diluents (e.g., water, saline or PBS) which may be necessary to reconstitute the pharmaceutical composition Pharmaceutical compositions of the present invention are useful for both diagnostic and therapeutic purposes.

THERAPEUTIC METHODS

Methods of treating proliferative diseases such as psoriasis or PDR are also provided by this invention. More specifically, within one aspect of the present invention proliferative diseases such as psoriasis or PDR may be treated by administering to a warm-blooded animal (e.g., a human) a therapeutically effective amount of ribozyme, and/or, nucleic acid molecule or vector which encodes the ribozyme.
Briefly, cells in response to injury or other insult typically follow at least one of two possible pathways: normal wound healing or exaggerated growth. For normal wound healing accelerated growth and maturation of cells occurs in order to allow healing of the wound as soon as possible.
Proliferative diseases such as psoriasis, scarring and PDR are similar in many respects to the process of wound healing. Namely, cells are created and migrate in a relatively short period of time. However, if the proliferation is too rapid or the signals to proliferate continue for too long a period of time, the cells build up to form thickened lesions. This growth is supported by new blood vessels, as well as the infiltration of a variety of lymphocytes which produce a wide variety of growth factors (that further increases the proliferation of the cells). These cells can produce tissue degrading enzymes which cause the destruction of surrounding tissue. In some cases, the thickened lesions contract, distorting the surface of the skin or retina. The result of the exaggerated growth is the clinical symptoms associated with the proliferative disease.
The present invention provides the treatment of proliferative skin and eye diseases by contacting desired cells with an effective amount of ribozyme of this invention or, alternatively, by transducing the cell with an effective amount of vector having a nucleic acid molecule encoding the ribozyme. A suitable “therapeutically effective amount” will depend on the nature and extent of diseased tissue being treated, or, if a medical procedure is contemplated in which abnormal proliferation can be expected, prevented. Such “therapeutically effective amounts” can be readily determined by those of skill in the art using well known methodology, and suitable animal models (e.g. a rat, rabbit, or porcine model), or, based upon clinical trials. As utilized herein, a patient is deemed to be “treated” if the proliferative skin or eye disease is reversed or inhibited in a patient in a quantifiable manner. Further, a therapeutically effective amount or regimen of treatment should result in: (1) decrease in the frequency, severity, or, duration of clinical symptoms (e.g., inflammation, thickening of the tissue, contraction, scaling, “burning”, or itching); (2) increase of time in the period of remission; (3) a change in pathological symptoms (e.g., inhibition of keratinocyte, fibroblast, glia, or retinal pigment epithelium proliferation); (4) prevention of retinal detachment; and/or (5) prevention of visual impairment.
When exogenously delivering the ribozyme, the RNA molecule can be embedded within a stable RNA molecule or in another form of protective environment, such as a liposome. Alternatively, the RNA can be embedded within RNase-resistant DNA counterparts. Cellular uptake of the exogenous ribozyme can be enhanced by attaching chemical groups to the DNA ends, such as cholesteryl moieties (Letsinger et al., P.N.A.S., U.S.A., 1989).
In another aspect of the invention, the target cell is transduced under conditions favoring insertion of the vector into the target cell and stable expression of the nucleic acid encoding the ribozyme. The target cell can include but is not limited to cells found in the skin basal level, dermis, or epidermis; the vitreous of the eye, and the retinal and pigment epithelium layers of the eye.
In addition, the ribozyme, ribozyme gene or vector may be readily incorporated into a biodegradable polymer, sphere, pleuroinc gel, or the like to aid incorporation into cells.
The ribozyme (or nucleic acid molecule or vector encoding the ribozyme) can be administered in any manner sufficient to achieve the above therapeutic results, but preferred methods include topical and systemic administration. Patients with localized disease can be administered ribozymes (or a nucleic acid molecule or vector) in a topical cream, ointment or emollient applied directly to skin lesions. For example, a topical cream containing 100 milligrams ribozymes by weight can be administered depending upon severity of the disease and the patient's response to treatment. In a preferred embodiment, a topical preparation containing ribozymes 100 milligrams by weight would be administered to psoriatic lesions. Alternatively, direct intracutaneous or intraocular injection of ribozymes in a suitable pharmaceutical vehicle can be used for the management of individual lesions.
The ribozyme may be formulated along with a liquid (e.g., DOTAP:cholesterol). In addition, the ribozyme may be formulated with ribonuclease inhibitors, including, but not limited to, reducing agent (e.g., dithiothreitol), detergent (e.g., sodium dodecyl sulfate), vanidyl nucleotides, aurin tricarboxcylic acid, hydrogen peroxide, and RNA decoys (e.g., tRNAs).
The following examples are offered by way of illustration, and not by way of limitation.

EXAMPLES

Example 1

Criteria for Ribozyme Site Selection

A. Selection of Sites for Hairpin Ribozymes
Hairpin ribozymes suitable for use within the present invention preferably recognize the following sequence of RNA: NNNBNGUCNNNNNNNN (SEQ ID NO:4122) wherein the ribozyme is constructed so as to be complementary to the underlined sequences, and wherein B is C, G or U. The sequence GUC must be conserved for all hairpin ribozymes described below. Other nucleotides (“N” as underlined above) preferably have a high degree of sequence conservation in order to limit the need for multiple ribozymes against the same target site.
Selection of Cleavage Sites for Hammerhead Ribozymes
Hammerhead ribozymes suitable for use within the present invention preferably recognize NUH, wherein N is any of G, U, C, or A and H is C, U, or A. The hairpin recognition sites GUC are a subset of the hammerhead recognition sites NUH. Therefore, all hairpin sites are by definition also hammerhead sites, although the converse is not true. Representative GUC hairpin/hammerhead ribozyme recognition sites for various genes are provided below in Tables 1-16. Hammerhead only sites are shown in Table 18.

TABLE 1

Hairpin/Hammerhead Ribozyme

Recognition Sites for cdc 2 kinase

NUCL. POS. SEQUENCE (5′ to 3′) I.D. No.

175 ACTTCGTCATCCAAAT 4125

189 ATATAGTCAGTCTTCA 4126

193 AGTCAGTCTTCAGGAT 4127

289 TCCTGGTCAGTACATG 4128

355 GTTTTGTCACTCTAGA 4129

530 CTGGGGTCAGCTCGTT 4130

TABLE 2


Hairpin/Hammerhead Ribozyme
Recognition Sites for Cyclin B1

NUCL. POS.	SEQUENCE (5′ to 3′)	I.D. No.

13	TCCGAGTCACCAGGAA	4131

282	CCAGTGTCTGAGCCAG	4132

428	CCTGTGTCAGGCTTTC	4133

559	AAGCAGTCAGACCAAA	4134

581	ACTGGGTCGGGAAGTC	4135

679	TGACTGTCTCCATTAT	4136

745	TTGGTGTCACTGCCAT	4137

887	CTTTGGTCTGGGTCGG	4138

893	TCTGGGTCGGCCTCTA	4139

1107	TACCTGTCATATACTG	4140

1162	ATGTAGTCATGGTAAA	4141

1198	TGACTGTCAAGAACAA	4142

TABLE 3


Hairpin/Hammerhead Ribozyme
Recognition Sites for PCNA

UCL. POS.	SEQUENCE (5′ to 3′)	I.D. No.

−131	GAGTGGTCGTTGTCTT	4143

−125	TCGTTGTCTTTCTAGG	4144

19	GCCTGGTCCAGGGCTC	4145

126	GACTCGTCCCACGTCT	4146

159	CTGCGGTCTGAGGGCT	4147

546	AAATTGTCACAGACAA	4148

868	TTTCTGTCACCAAATT	4149

983	ATCTGGTCTAGTTAAC	4150

1008	TTTTTGTCTCTTAGAA	4151

1047	AAAGGGTCTTGACTCT	4152

TABLE 4


Hairpin/Hammerhead Ribozyme
Recognition Sites for MMP-1

NUCL. POS.	SEQUENCE (5′ to 3′)	I.D. No.

48	GTGG TGTC TCACAGCT	4389

301	AGTT TGTC CTCACTGA	4390

454	CCAA GGTC TCTGAGGG	4391

464	TGAG GGTC AAGCAGAC	4392

799	ATCC TGTC CAGCCCAT	4393

1446	TGTG AGTC CAAAGAAG-	4394

1475	GAAC TGTC TATTTTCT	4395

1488	TCTC AGTC ATTTTTAA	4396

1507	CTAG AGTC ACTGATAC	4397

1766	CATG AGTC TTTGCCGG	4398

TABLE 5


Hairpin/Hammerhead Ribozyme
Recognition Sites for IL-1 beta

UCL. POS.	SEQUENCE (5′ to 3′)	I.D. No.

13	caag tgtctgaagcag	4399

195	gccg cgtcagttgttg	4400

408	gtga tgtctggtccat	4401

413	gtct ggtccatatgaa	4402

480	tcca tgtcctttgtac	4403

555	tacc tgtcctgcgtgt	4404

646	gatt tgtcttcaacaa	4405

687	tttg agtctgcccagt	4406

782	tgcc cgtcttcctggg	4407

801	tttg tgtcttcctaaa	4408

830	agag agtcctgtgctg	4409

921	ctgt tgtctacaccaa	4410

TABLE 6


Hairpin/Hammerhead Ribozyme
Recognition Sites for VEGF

UCL. POS.	SEQUENCE (5′ to 3′)	I.D. No.

83	CTGCTgtcTTGGGTGC	4411

136	AAGTGgtcCCAGGCTG	4412

364	GAGGAgtcCAACATCA	4413

TABLE 7


Hairpin/Hammerhead Ribozyme
Recognition Sites for IL2

UCL. POS.	SEQUENCE (5′ to 3′)	I.D. No.

68	caactcctgtcttgcattgca	4414

96	ttgcacttgtcacaaacagtg	4415

289	gcttcagtgtctagaagaaga	4416

450	taccttttgtcaaagcatcat	4417

TABLE 8


Hairpin/Hammerhead Ribozyme
Recognition Sites for IFN gamma

UCL. POS.	SEQUENCE (5′ to 3′)	I.D. No.

246	gccaaattgtctccttttact	4418

458	gctgaactgtcgccagcagct	4419

493	aaaaaggagtcagatgctgtt	4420

534	gtaatggttgtcctgcctgcaa	4421

718	ctgtgactgtctcacttaatc	4422

958	ttgaatgtgtcaggtgaccct	4423

TABLE 9


Hairpin/Hammerhead Ribozyme
Recognition Sites for IL 1 alpha

UCL. POS.	SEQUENCE (5′ to 3′)	I.D. No.

19	GCGTTTGAGTCAGCAAAGAAG	4424

120	GATCATCTGTCTCTGAATCAG	4425

192	CAATCTGTGTCTCTGAGTATC	4426

860	GGTCTGGAGTCTCACTTGTCT	4427

869	TCTCACTTGTCTCACTTGTGC	4428

938	TACTGTTAGTCATTTGCTGAG	4429

1624	GCATTTTGGTCCAAGTTGTGC	4430

1729	AGTAATTGGTCCGATCTTTGA	4431

1921	CCGTGCTGGTCTCGAACTTCT	4432

2063	AATCCTCAGTCAGCCGTGTTT	4433

2404	TTCTTGTCCCAAATAAAA	4434

TABLE 10


Hairpin/Hammerhead Ribozyme
Recognition Sites for IL6

NUCL. POS.	SEQUENCE (5′ to 3′)	I.D. No.

79	CGCCTTCGGTCCAGTTGCCTT	4435

403	CATCACTGGTCTTTTGGAGTT	4436

659	TTCCTGCAGTCCAGCCTGAGG	4437

736	TTCTTCTGGTCAGAAACCTGT	4438

747	AGAAACCTGTCCACTGGGCAC	4439

TABLE 11


Hairpin/Hammerhead Ribozyme
Recognition Sites for IL8

NUCL. POS.	SEQUENCE (5′ to 3′)	I.D. No.

493	ttgtgtgggtctgttgtaggg	4440

832	agagctctgtctggaccccaa	4441

873	caaccctagtctgctagccag	4442

TABLE 12


Hairpin/Hammerhead Ribozyme
Recognition Sites for MMP2

UCL. POS.	SEQUENCE (5′ to 3′)	I.D. No.

46	GCCGCGCCGTCGCCCATCATC	4443

614	GCCAAGTGGTCCGTGTGAAGT	4444

774	CGGCTTCTGTCCCCATGAAGC	4445

1001	CCCCCTGTGTCTTCCCCTTCA	4446

1248	GAACTTCCGTCTGTCCCAGGA	4447

1252	TTCCGTCTGTCCCAGGATGAC	4448

1343	TGGGCCCTGTCACTCCTGAGA	4449

1811	TGGATGCCGTCGTGGACCTGC	4450

1832	GGGCGGCGGTCACAGCTACTT	4451

2312	TGGAGACTGTCTCAAGAGGGC	4452

2472	TTCTTTGGGTCTTGTTTTTTT	4453

TABLE 13


Hairpin/Hammerhead Ribozyme
Recognition Sites for MMP3

UCL. POS.	SEQUENCE (5′ to 3′)	I.D. No.

8	atgaagagtcttccaatcct	4454

173	ggacagtggtcctgttgttaa	4455

293	tgacgttggtcacttcagaac	4456

674	ctccctgggtctctttcactc	4457

753	ttccgcctgtctcaagatgat	4458

780	ggcattcagtccctctatgga	4459

838	cggaacctgtccctccagaac	4460

882	cctgctttgtcctttgatgct	4461

895	ttgatgctgtcagcactctga	4462

TABLE 14


Hairpin/Hammerhead Ribozyme
Recognition Sites for MMP 9

UCL. POS.	SEQUENCE (5′ to 3′)	I.D. No.

41	agcccctggtcctggtgctcc	4463

94	cagcgccagtccacccttgtg	4464

208	cgtggagagtcgaaatctctg	4465

253	aagcaactgtccctgcccgag	4466

320	ggtgcggggtcccagacctgg	4467

518	cagacatcgtcatccagtttg	4468

533	agtttggtgtcgcggagcacg	4469

649	gagttgtggtccctgggcaag	4470

665	gcaagggcgtcgtggttccaa	4471

762	caccgacggtcgctccgacgg	4472

936	cacggacggtcgctccgacgg	4473

1061	agctgtgcgtcttccccttca	4474

1350	cctctatggtcctcgccctga	4475

1418	ccccgacggtctgccccaccg	4476

1442	cccccactgtccacccctcag	4477

1548	gcctttgagtccggtggacga	4478

1727	tggactcggtctttgaggagc	4479

1798	acaggcgcgtcggtgctgggc	4480

1818	cccgaggcgtctggacaagct	4481

2151	gggctcccgtcctgctttgca	4482

TABLE 15


Hairpin/Hammerhead Ribozyme
Recognition Sites for PDGF A

UCL. POS.	SEQUENCE (5′ to 3′)	I.D. No.

29	ccggccgggtcgctcctgaag	4483

125	ccccttccgtccccaccccca	4484

241	cgggcgccgtccgccagctcc	4485

494	ggcccgcagtcagatccacag	4486

589	ctcacggggtccatgccacta	4487

661	aggaagctgtccccgctgtct	4488

670	tccccgctgtctgcaagacca	4489

688	ccaggacggtcatttacgaga	4490

710	tcctcggagtcaggtcgaccc	4491

799	cgagcagtgtcaagtgccagc	4492

820	cctcccgcgtccaccaccgca	4493

835	accgcagcgtcaaggtggcca	4494

981	cctagggagtcaggtaaaaaa	4495

1140	agtgtgcggtctttgttctcc	4496

1168	aaaactgtgtccgagaacact	4497

1269	gcttccttgtcaaaaagagag	4498

TABLE 16


Hairpin/Hammerhead Ribozyme
Recognition Sites for PDGF B

UCL. POS.	SEQUENCE (5′ to 3′)	I.D. No.

106	aggttggagtcccctgggcgc	4499

437	ggcccggagtcggcatgaatc	4500

469	ctcttcctgtctctctgctgc	4501

489	ctacctgcgtctggtcagcgc	4502

494	tgcgtctggtcagcgccgagg	4503

893	tgcgacctgtccaggtgagaa	4504

1085	cggtgcgagtccgccggcccc	4505

1265	tttccctcgtccgtctgtctc	4506

1269	cctcgtccgtctgtctcgatg	4507

1273	gtccgtctgtctcgatgcctg	4508

1325	ctccacgtgtccgtccaccct	4509

1329	acgtgtccgtccacccttcca	4510

1349	atcagcgggtctcctcccag	4511

1476	ctgatggggtcgctctttggg	4512

1545	tgtggactgtcctgaggagcc	4513

TABLE 17


Further Ribozyme Recognition Sites

TARGET SITE	I.D. No.

cdk1 ribozyme binding sites:	1-149

cdk2 ribozyme binding sites:	150-301

cdk3 ribozyme binding sites:	302-405

cdk4 ribozyme binding sites:	406-526

cdk6 ribozyme binding sites:	527-665

cdk7 ribozyme binding sites:	666-866

cdk8 ribozyme binding sites:	867-1112

cdk-we-hu ribozyme binding sites:	1113-1408

cyclin A2 ribozyme binding sites:	1409-1614

cyclin C ribozyme binding sites:	1615-1819

cyclin D1 ribozyme binding sites:	1820-1889

cyclin D2 ribozyme binding sites:	1890-1975

cyclin D3 ribozyme binding sites:	1976-2053

cyclin E ribozyme binding sites:	2054-2318

cyclin F ribozyme binding sites:	2319-2561

cyclin G1 ribozyme binding sites:	2562-2787

cyclin H ribozyme binding sites:	2788-2964

cyclin A1 ribozyme binding sites:	2965-3257

cyclin B1 ribozyme binding sites:	3258-3478

cdc25 hs ribozyme binding sites:	3479-3854

PCNA HH ribozyme binding sites:	3855-4115

Example chimeric hairpin ribozymes:	4116-4119

TABLE 18


Hammerhead Ribozyme Recognition Sites for VEGF

UCL. POS.	SEQUENCE (5′ to 3′)	I.D. No.

118	TGCTGCTCtACCTCCACCATG	4514

206	TCATGGATGtCTATCAGCGC	4515

254	GGACATCTtCCAGGAGTAC	4516

287	GTACATCTtCAAGCCATCC	4517

386	CATGCAGATtATGCGGATC	4518

402	ATCAAACCtCACCAAGGCC	4519

434	GATGAGCTtCCTACAGCAC	4520

451	AGAAAAAAAAtCAGTTCGAGG	4521

541	GCAAGAAAtCCCGGTATAA	4522

663	GTACAAGAtCCGCAGACGT	4523

Example 2

Construction of Hairpin Ribozymes

Two single-stranded DNA oligonucleotides are chemically synthesized such that, when combined and converted into double-stranded DNA, they contain the entire hairpin ribozyme, including nucleotides complementary to the target site. In addition, restriction enzyme recognition sites may be placed on either end to facilitate subsequent cloning. More specifically, the oligonucleotides are hybridized together and converted to double-stranded DNA using either Klenow DNA polymerase or Taq DNA polymerase. The resulting DNA is cleaved with restriction enzymes BamHI and MluI, purified and cloned into vectors for in vitro transcription (pGEM, ProMega, Madison, Wis.) or for retrovirus production and mammalian expression (pLNL/MJT backbone). Representative hairpin ribozymes are set forth below (note that the underlined sequences indicate the sites wherein the ribozyme binds the target sequence):

cdc-2 530

(Sequence I.D. No. 4378)

5′

AACGAGCT AGAACCAGACCAGAGAAACACACGTTGTGGTATATTACCTGG

TA

3′

Cyclin B1 281

(Sequence I.D. No. 4379)

5′

CTGGCTCA AGAACTGGACCAGAGAAACACACGTTGTGGTATATTACCTGG

TA

3′

PCNA 158

(Sequence 1.D. No. 4381)

5′

AGCCCTCA AGAAGCAGACCAGAGAAACACACGTTGTGGTATATTACCTGG

TA

3′
Defective ribozymes for use as controls may be constructed as described above, with the exception that the sequence AAA is changed to a UGC as shown in FIG. 1.

Example 3

Construction of Hammerhead Ribozymes

Chimeric hammerhead ribozymes (i.e., RNA/DNA hybrids) are designed to have an appropriate NUH sequence for ribozyme cleavage. Ribozymes are chemically synthesized with the general structure shown in FIG. 1. The binding arms bases and stem loop comprise DNA, and the catalytic domain comprises RNA and/or 2′O methyl RNA bases. Specific examples of synthetic human hammerhead ribozymes targeting PCNA are shown below (DNA bases shown in upper case, RNA bases as lower case, 2′ O methyl RNA as lower case italics, and propanediol shown as pr pr pr pr):


Sequence ID No. 4382: PN30003 PCN1-HH Length: 40
5′ GAGCCCTG cugaugag CAATTTTTTG cgaaa ACCAGGCGC 3′

Sequence ID No. 4383: PN30004 OptPCN1-ome HH Length: 38
5′ AGCCC ug cuga u g agg CCGTAAGG cc ga a a cc AGGCGC 3′

Sequence ID No. 4384: PN30005 StabPCN1-ome HH Length: 38
5′ AGCCC ugcu ga u g agg CCGTAAGG cc ga a a cc AGGCGC 3′

Sequence ID No. 4385: PN30006 PCN1-ome HH p4 Length: 28
5′ AGCCC ug cuga u g ag pr pr pr pr c ga a a cc AGGCGC 3′

Alteration of the base composition at the stem loop and catalytic domain increases the catalytic activity of the chimeric ribozyme as assayed by in vitro cleavage (EXAMPLE 5). The substitution of 2′ O methyl bases for RNA bases enhances the stability of the chimeric ribozymes. The assay consists of incubating 10 μg of ribozyme with 100 μl of cell lysate at 37° C. for times ranging from 30 seconds to 240 minutes, then separating the intact ribozyme from degradation products on a 15% PAGE, staining with SYBRgreen (Molecular Probes, Eugene, Oreg.), and quantifying by phosphorimager analysis (Molecular Dynamics).
By making specific base modifications to the structure of the ribozymes, the half-life in cell lysate was increased sequentially from approximately 2.5 hours for PN30003, to 3.5 hours for PN30004, and to greater than 10 hours for PN30005 (FIG. 2). In serum, the half-life of PN30003 is less than 30 seconds. Specific base modifications to ribozyme PN30005 increased the half-life in serum to greater than 4 hours (FIG. 3). The internal stem loop structure can be substituted with a propanediol linkage to shorten the molecule, facilitating delivery, and enhancing catalytic activity (FIG. 4).
A scrambled sequence polynucleotide including the same composition of ribonucleotides and deoxyribonucleotides is also synthesized for each ribozyme to serve as a control with no catalytic activity. Lipofectin may be utilized to enhance the uptake of ribozyme into the cells.

Example 4

Construction of Ribozyme Mammalian Expression Vectors

Plasmid pMJT (Yu et al., Proc. Nat'l Acad. Sci. USA 90:6340-6344, 1993), which contains the anti-U5 HIV ribozyme driven by the tRNA^Va1RNA pol III promoter, is digested with BamHI and MluI, and the vector purified from the ribozyme fragment. The hairpin ribozymes, as described above, are excised from the pGem vector with BamHI and MluI, purified, and ligated into the empty pMJT vector. The resulting vector is designated pLNT-Rz (see FIG. 5, and contains the Moloney LTR driving the neomycin resistance gene and the tRNA^Va1RNA pol III promoter driving expression of the ribozyme.

Example 5

In Vitro Cleavage Assays

Hairpin or hammerhead ribozymes are tested for cleavage activity in an in vitro assay. Ribozyme and substrate synthesis is achieved by a new method of plasmid-independent in vitro transcription (Welch et al 1997). Briefly, oligonucleotides are synthesized (Retrogen, San Diego CA) with the T7 RNA polymerase promoter sequence contiguous with the ribozyme or substrate sequences, to allow for in vitro transcription of annealed oligonucleotides without the need for plasmid cloning. In vitro cleavage is tested in two hour time course reactions in 40 mM Tris pH 7.5, 10 mM MgC₂, 2 mM spermidine, at 37° C. (Welch et al 1997). Reaction products are analyzed by polyacrylamide gel electrophoresis (PAGE) and quantified by phosphorimager analysis (Molecular Dynamics). The Michaelis constant (K_m ^app) and k₂are determined for each ribozyme by performing single turnover kinetic experiments with ribozyme concentrations of 2-4 nM and substrate concentrations ranging from 2-200 nM, with analysis as above. The K_m ^appand k₂for the ribozymes is estimated for a Hanes plot with R2>0.90. Catalytic efficiency is calculated as k₂/K_m ^app. In vitro cleavage data for several representative ribozymes targeting specific sites in the CDK4, CDK2, CDC2, cyclin B1, and MMP-1 genes is shown in Table 19.

TABLE 19


Summary of kinetics data for additional hairpin (HP) and
hammerhead (HH) ribozyme candidates.

	HH k₂/K_m ^app	HP k₂/K_m ^app

CDK4

	cdk4-4 8.9	8.33
	cdk4-4,8g6		7.3
	cdk4-1 7.9	6.61
	CDC2
	cdc2-6/7,8 g7h	14.4 pig,
		31.9 human
	cdc2-6,8g7h		6.25
	CDK2
	CDK2-4/7,9	27.37
	CDK2-4,7		10.76
	CYCB1
	CycB

8,8	9.7
	MMP-1

	ColR3-9,8	0.46 pig,
		0.24 human
	ColR9-7,9	4615.00
	ColR1086-9,8	52.5

Example 6

In Vivo Use of Ribozymes

A. Experimental Protocols
All animals are treated according to the guidelines of the Public Health Service Policy on Humane Care and Use of Laboratory Animals.
1. Porcine Scar Model
Domestic pigs of approximately 35 kg are acclimatized for 14 days to the laboratory environment. Cutaneous lesions are created surgically in five places on the flanks of each pig. Each lesion is 3 cm long×5 mm deep, with a 2 mm slice removed from each lesion site. The wound edges may be sealed by electrocautery. Alternatively, lesions can be created utilizing a 6 mm punch biopsy.
The wound is treated daily by dermal application to each lesion of the desired test substance (with at least 2 untreated control sites per pig). Sites may be bandaged at the direction of the attending veterinarian. All sites are treated identically. Pigs wear protective ‘jackets’ to prevent mechanical irritation of the lesion sites.
The healing process is scored subjectively on a daily basis (1=fresh lesion, 5=fully healed), and the study terminated when control (untreated) sites score as fully healed.
2. Rabbit Disease Model
Dutch belted rabbits of approximately 2 kg are acclimatized for about 14 days in the laboratory environment. 0.06 Units of dispase is injected intravitreally in order to induce disease. Proliferative vitreoretinopathy (PVR) is then scored on days 1, 7, 14, 28 and 48 (1=0, 5=retinal detachment). Typical digital pictures of the process are taken by fundoscopy.
The rabbits are treated on day 21 by injection of either ribozyme or control. The study is terminated when the control (vehicle) sites score as fully detached. Treatment group may be continued if detachment not evident.
B. In Vivo Results
An example of the use of the PCNA targeted ribozymes in the porcine scar model is shown in FIG. 7. Panel A shows the effect of vehicle control on two 6 mm punch biopsies after 14 days. Panel B shows the effect of ribozyme treatment on two 6 mm punch biopsies after 14 days. The wound is healed in the treated sample and the extent of scarring is diminished in this example.
An example of the use of the PCNA targeted ribozymes formulated in DOTAP:cholesterol in the rabbit dispase model is shown in FIGS. 8A-8C. Panel A shows the normal eye. Panel B shows the effect of dispase followed by treatment with vehicle after 31 days. Panel C shows the effect of dispase followed by treatment with ribozyme after 31 days. The retina is complete detached in the vehicle treated eye. The extent of proliferative vitreoretinopathy is diminished and no retinal detachment is evident in the ribozyme treated eye.
From the foregoing, it will be appreciated that, although specific embodiments of the invention have been described herein for purposes of illustration, various modifications may be made without deviating from the spirit and scope of the invention. Accordingly, the invention is not limited except as by the appended claims.

Example 7

In Vitro Percutaneous Absorption of [³²P]-Ribozyme in Human Cadaver Skin

The example was to evaluate the in vitro percutaneous absorption of eight test formulations of ³²P-labeled ribozyme (PN30006) in tape-stripped and intact human cadaver skin. Cumulative transdermal absorption of radiolabeled drug was measured at 1 and 24 hours. Tissue compartment (stratum comeum, epidermis, dermis) recovery was measured at 24 hours.

Experimental Design:



				Reservoir	Tissue
Group #		Formulation	Ribozyme	Samples	Recovery
(n = 6)	Skin	Lot #	(% w/w)	(Hrs)	(Hrs)

1	stripped	360-34A	0.5%	1, 24	24
2	stripped	360-34B	0.5%	1, 24	24
3	stripped	360-34C	0.5%	1, 24	24
4	stripped	360-34D	0.5%	1, 24	24
5	stripped	360-35E	0.5%	1, 24	24
6	stripped	360-35F	0.5%	1, 24	24
7	stripped	360-35G	0.5%	1, 24	24
8	stripped	360-35H	0.5%	1, 24	24
9	Intact	360-35G	0.5%	1, 24	24

Materials

Ribozyme Formulations



360-34A	5 mg/ml ribozyme in 10 mM DTT, 1.5% HEC
360-34B	5 mg/ml ribozyme in 0.1% SDS, 1.5% HEC
360-34C	5 mg/ml ribozyme in 5% DMSO, 1.5% HEC
360-34D	5 mg/ml ribozyme in 15% PG, 1.5% HEC
360-35E	5 mg/ml ribozyme in 10 mM DTT, 0.1% SDS, 1.5% HEC
360-35F	5 mg/ml ribozyme in 5% DMSO, 15% PG, 1.5% HEC
360-35G	5 mg/ml ribozyme in 10 mM DTT, 0.1% SDS, 5% DMSO,
	1.5% HEC
360-35H	5 mg/ml ribozyme in 10 mM DTT, 5% DMSO, 15% PG,
	1.5% HEC

Key to Abbreviations:

- DTT Dithiotheitol (reducing agent)
- HEC Hydroxyethylcellulose (gelling agent)
- SDS Sodium docedyl sulfate (penetration enhancer)
- DMSO Dimethyl sulfoxide (penetration enhancer)
- PG Propylene glycol (penetration enhancer)

Human Skin:
Human cadaver skin was obtained from a single donor. The skin was dermatomed to approximately 200 micron thickness. Skin was excluded if it was damaged, had irregularities (scar tissue, holes, birthmarks, etc.) or was from donors with infectious disease. Skin samples were frozen until use. Skin specimens were thawed overnight in the refrigerator in plastic sealed bags prior to the experiment.
Spiking Test Formulations:
Test formulations were spiked with [³²P]-ribozyme prior to the experiment. 15 íl of the radiolabeled solution was added to 1.0 gram (ml) of the formulation and spatulated.
To assay the final specific activity of the spiked test formulation, approximately 10-30 mg of the formulation was weighed (n=3), 100 μl samples were placed in 10 ml of Ecoscint® scintillation fluor (National Diagnostics #LS275) and counted in a Beckman Model LS 3801 liquid scintillation counter with a pre-calibrated quench curve for ³²P. Thirty (30) mg of spiked formulation was applied to each chamber. The total DPM of the applied dose was calculated by determining the total DPM applied in the 30 mg dose and subtracting the DPM of the application tips.
Equipment:
A total of 54 Franz static diffusion glass diffusion chambers (Crown Glass Cat #FDC-100) with a magnetic stirrer mounted on a 9-position Franz diffusion cell drive console with acrylic blocks, magnetic stirrers, and stainless steel manifolds (Crown #FDCD-9-LV) was used for the study. The reservoir volume (6-11 ml) of each cell was pre-calibrated.
Equipment Set-Up:
The diffusion cells were filled with 4% bovine serum album (BSA, Fraction V) (Sigma Cat. #A2153) in isotonic buffered (pH 7.04) saline (PBS Fisher Cat #C5551-20 Celline II isotonic saline solution) with care to avoid bubbles at the skin interface. The diffusion cells were equilibrated for 1-2 hours to a temperature of 37° C. by a circulating water pump (Haake) prior to applying skin specimens.
Application of Drug to Skin:
The intact or prior tape-stripped dermatomed human cadaver skin was placed on the chamber and sealed with an O-ring. The skin surface area exposed to the test formulations was 1.77 cm². The skin was equilibrated for 30 minutes at 37° C. on the diffusion cell prior to applying test formulation. A total of 30 mg of the spiked formulation was applied to the skin surface using a Gilson Microman® positive displacement pipette and gently rubbed into the skin using the pipette tip. The dispensing tips were retained and counted. The mean DPM retained by the dispensing tips was calculated and subtracted from the theoretical DPM to determine the mean total DPM applied to each chamber.
Sample Collection:
Reservoir:
At 1 and 24 hours a 1.0 ml sample was removed from the reservoir using a calibrated Gilson P1000 Pipetteman® micropipette, and the volume replaced with 1.0 ml BSA-saline solution. The samples were placed in a scintillation vial containing Ecoscint® scintillation fluor (National Diagnostics #LS-275) and equilibrated overnight in the dark before counting.
Washes and Gauze Wipes:
At 24 hours the skin surface was washed three times with 1.0 ml 2% Oleth-20 (Croda, Inc. #9004-98-2) in water, followed by 2 washes with 1.0 ml of 5% Span 80 in isopropanol. The wash solutions were collected for recovery counts. The dispensing tips used for the washing procedure were also counted and included in the “wash” compartment. After washing, the skin surface was wiped with 3 sequential cotton gauze cloths, which were saved for recovery counts in the “Gauze” compartment.
Tape Stripping (Stratum Corneum):
The skin specimens were either tape-stripped prior to drug application or following the gauze wiping. The skin was placed dermis side down onto a flat surface. The stratum corneum was removed by tape-stripping the skin with cellophane tape until “glistening” (approximately 22 strips) or until epidermal separation started to occur. The first two strips that remove the excess drug adhering to the outer surface of the stratum corneum were counted separately. These counts were included in total recovery (SC Surface) but excluded from stratum corneum compartment recovery. Four groups each consisting of five consecutive tape strips were placed in a scintillation vial containing Scintilene® (Fisher #SX2-4).
Epidermis and Dermis:
After tape-stripping the intact skin or after removing the tape-stripped skin from the chamber, the dermis and epidermis were separated by microwave technique (2-5 sec.). The separated epidermis was placed in a vial containing 1 ml of Soluene 350 (Packard, Inc #6003038), and dermis in vial containing 2 ml Soluene 350. The tissues were then digested in a 60° C. oven for 4 hours. Hionic-Fluor (Packard, Inc #6013319) was added to the digested tissues, counted in a Beckman LSC and corrected for quenching.
Recovery:
The percent of ³²P-ribozyme recovered in the reservoir, washes, gauze wipes, and skin compartments (stratum corneum, epidermis, dermis) was determined by calculating the percent of the total applied DPM recovered in the respective compartments.
The total micrograms of drug recovered in each compartment was obtained by multiplying the % recovery by the total amount (micrograms) of drug applied to each chamber.
Data Entry/Calculations:
The DPM data from the LSC tapes, measurements for cell volume, and quantity of drug applied were entered into a standardized Quattro Pro spreadsheet. The data were calculated after discarding outlier values for each compartment. A value was considered to be an “outlier” if the questionable value differed from the re-calculated average by more than four times the average deviation of the remaining values (Skoog & West, Analytical Chemistry).
Results
The total DPM applied to each cell ranged from 12-15×10⁶. The cumulative transdermal absorption of ³²P-ribozyme is presented as the percent of the applied dose recovered in the reservoir at each time point (FIG. 9). The transdermal absorption of ³²P-ribozyme is also presented as total micrograms recovered in the reservoir (FIG. 10). The total 24 hr flux in the tape-stripped skin ranged from 5-12% compared to 0.2% in the intact skin.
The localization of ³²P-ribozyme in the various skin compartments is presented as both percent of the applied dose (DPM) recovered in each compartment (FIG. 11) and total micrograms in each compartment (FIG. 12). The recovery of the formulations in the dermal tissues was similar in the tape-stripped skin, ranging from 0.5-1.0% of the applied dose compared to 0.1% in the intact skin. The recovery of all formulations was high in the epidermis in the tape-stripped skin ranging from 3-10% compared to 0.2% in the intact skin.

Tables 20 and 21 rank the absorption (%, íg) of the test formulations for the sum of the recoveries in the reservoir, epidermis and dermis.

TABLE 20


Overall effectiveness (percent)

					SUM
Relative					(Reservior,
Effective-		Formulation	Ribozyme	Descrip-	Epi. Dermis)
ness	Skin	Lot #	(% w/w)	tion	%

1	stripped	360-34A	0.5	Cream	23.1
2	stripped	360-34B	0.5	Cream	20.1
3	stripped	360-34C	0.5	Cream	20.0
4	stripped	360-34D	0.5	Cream	17.0
5	stripped	360-35E	0.5	Cream	16.2
6	stripped	360-35F	0.5	Cream	15.7
7	stripped	360-35G	0.5	Cream	14.6
8	stripped	360-35H	0.5	Cream	11.7
9	Intact	360-35G	0.5	Cream	0.5

TABLE 21


Overall effectiveness (micrograms)

					SUM
Relative					(Reservior,
Effective-		Formulation	Ribozyme	Descrip-	Epi. Dermis)
ness	Skin	Lot #	(% w/w)	tion	%

1	stripped	360-34A	0.5	Cream	34.7
2	stripped	360-34B	0.5	Cream	30.1
3	stripped	360-34C	0.5	Cream	29.9
4	stripped	360-34D	0.5	Cream	25.5
5	stripped	360-35E	0.5	Cream	24.3
6	stripped	360-35F	0.5	Cream	23.6
7	stripped	360-35G	0.5	Cream	21.8
8	stripped	360-35H	0.5	Cream	17.5
9	Intact	360-35G	0.5	Cream	0.8

Exmaple 8

Inhibition of Experimental PVR by Ribozymes Targeting Rabbit PCNA

A. Experimental PVR treated with Ribozyme:Lipid Complex
Experimental Design
The rabbit model involves the injection of dispase into the vitreal space without the need to introduce retinal tears. Prior models have relied on exogenous cells such as fibroblasts to induce disease. In the dispase model, no assumptions are made as to the type of endogenous cells involved in the formation of disease. The severity of PVR correlated with the dose of dispase injected. The optimal dose of dispase has been determined to minimize interfering complications such as cataract and hemorrhage. This model uses intravitreal rather than subretinal injection. The timing and complexity of the cellular response correspond to the human disease. These advantages make this model particularly attractive. The single disadvantage of relatively long timeframe is easily overcome by extending the period of observation. This model was used to test the efficacy of the chimeric PCNA targeted ribozyme.
A selected lot of dispase was tested in the rabbit eye to titrate the dose and time frame for disease development and aliquots frozen for all remaining experiments (Frenzel E M, Neely K A, Walsh A W, Cameron J D, Gregerson D S. 1998. A new model of proliferative vitreoretinopathy. IOVS 39:2157-2164). Twelve 1-2 Kg Dutch Belted rabbits received a single intravitreal injection of 0.06, 0.07, or 0.08 U dispase (Boehringer Mannheim, Indianapolis, Ind.) on day 0 (four rabbits each dose). Rabbits were anesthetized with ketamine/xylazine, their eyes dilated with 2.5% phenylephrine and 1% tropicamide, and a local anesthetic, proparacain HCI applied. 0.1 cc of dispase was injected into the right eye of each rabbit with a 30 gauge needle, delivering the dispase into the vitreous cavity directly in front of the retina without traumatizating the retina, under direct visualization with a dissecting microscope equipped with floating Charles' lens. Left eyes serve as controls. Rabbits were followed for progression of disease by fundoscopy at days 1, 7, 14, 21, 28, and 48. A generous timeframe was allocated to maximize the probability of disease development in the dispase treated groups. Fundoscopic evaluation was by two independent, trained observers for this and the following experiments. In this experiment, a dose of 0.07 U dispase resulted in uniform PVR development by 21 days.
Following the same protocol, a second experiment was performed with eight rabbits given 0.07 U dispase in the right eye on day 0. At 7-14 days post-injection, all eyes had vitreous and pre-retinal hemorrhage. At 21 days 7 of 8 rabbits had early PVR characterized by fibroglial proliferation. Before a retinal detachment was noted in any eyes, the control group of rabbits (n=4) was treated with an intravitreal injection of 0.1 cc DOTAP:cholesterol vehicle. The experimental group (n=4) was given an intravitreal injection of 0.1 cc chimeric PCNA targeted ribozyme (PN30006).
Fundoscopic Analysis
Fundoscopic evaluation of chimeric PCNA targeted ribozyme versus control treated rabbit eyes is the same as shown in FIGS. 8A-8C. By day 35, all rabbits in the control group developed significant retinal detachment. Three of four in the chimeric PCNA targeted ribozyme treated group did not develop a retinal detachment, while one developed a small local detachment, which did not progress over the 60 day follow-up period. These data suggest that inhibiting proliferation of cells causative of PVR with chimeric ribozyme to PCNA may have a therapeutic or preventative role.

All eyes were scored by two independent trained observers on a scale of 1-6 as per Table 22 (Fastenberg et al. 1982. A comparison of different cellular inocula in an experimental model of massive periretinal proliferation. Am J Ophthalmol. 93:559-56; Sakamoto et al. 1995. Inhibition of experimental proliferative vitreoretinopathy by retroviral vector-mediated transfer of suicide gene. Ophthalmology 102:1417-1424). The scale is based on inflammation, hemorrhage, distortion, intravitreal haze and membranes, and formation of retinal breaks, traction, and detachments. The results (FIG. 13) indicate that the chimeric ribozyme is effective in preventing or retarding the development of PVR.

TABLE 22


Histopathologic scoring of PVR

	Score	Histopathologic Evaluation

	0	Normal eye
	1	Hemorrhage/preretinal
		gliotic changes
	2	Focal Retration
	3	Extensive PVR with focal
		traction

	4	PVR with focal retinal
		detachments of medullary
		ray

	5	Extensive peripapillary
		retinal detachments
	6	Total retinal detachments

Histopathologic Analysis

Treated and control eyes were enucleated, fixed in 4% paraformaldehyde, embedded in paraffin, and sectioned for histopathologic evaluation. Selected gross specimens were photographed before sectioning. Histologic examination was performed after hematoxylin and eosin staining. Histopathologic analyses correlated with the gross pathological findings and confirmed the clinical diagnoses of PVR and retinal detachment.
The ability of this chimeric ribozyme complex to prevent or lessen the degree of damage due to aberrant proliferation of cells in the eye could be a significant advancement in the treatment of PVR. This type of therapy may be especially well suited for use in patients facing vision loss due to the failure of traditional surgical treatment (McCormack P, Simcock P R, Charteris D, Lavin M J. 1994. Is surgery for proliferative vitreoretinopathy justifiable? Eye 8:75-76.).
B. Experimental PVR Treated with Ribozyme Alone

Three additional experiments in the PVR model were carried out. Experiment 2 was a repeat of the first experiment described above (i.e., Example 8, Section A) with the addition of a control group with scrambled sequence (random specificity) ribozyme complexed to the lipid. The other two experiments were done using the ribozyme alone at 10 mg/ml without the addition of the DOTAP:cholesterol lipid. These were done due to an observed precipitate that took greater than 2 weeks to clear. The precipitate was not observed when lipid was absent. Experiment 3 repeated the timing of the first two experiments, with ribozyme treatment on day 20. Experiment 4 was performed with treatment on day 7 to represent a prophylactic approach. The overall severity of the PVR has decreased over time even in the control group consistent with loss of activity of the dispase. The results are shown in table 23 where two independent assessments were made by trained observers using a modified Fastenberg et al. (1982) scoring system (i e., Table 22).

TABLE 23


Scoring of ribozyme and control treated rabbit eyes
with Dispase induced PVR.

					Treat-	Assess-
					ment	ment	Ave.
Exp #		Ribozyme	Lipid	N	Day	Day	Score

2	Treated	PN30004	+	4	20	35	3.1 ± 1.3
	Control	Scrambled		4			5.3 ± 1.2
		Dextrose		4			4.5 ± 1
3	Treated	PN30006	−	4	20	49	1.8 ± 1.7
	Control	Dextrose			3			3.7 ± 0.6
		no injection		2			2.5 ± 0.7
4	Treated	PN30006	−	6	7	28	0.7 ± 0.8
	Control	Dextrose			6			2.2 ± 0.4

The results show a consistent decrease in severity of PVR following treatment with active chimeric PCNA targeted ribozyme compared to untreated or scrambled ribozyme controls.

Example 9

Effects of PCNA Targeted Ribozyme on Scar Formation in the Pig

A chimeric PCNA targeted ribozyme (PN30006) has been tested in a pig model of scarring due to surgical incision. Briefly, two female commercial pigs underwent surgical creation of wounds followed by administration of the test or vehicle article into selected wounds for three consecutive days. Crescent shaped wound sites (5 on each side), each measuring approximately 3 cm long×5 mm deep×6 mm wide, were made on the back of each animal (FIG. 14A). Each wound was sutured once (FIG. 14B). This type of wound was made to replicate excisional wounding. Wounds were dressed with an Op-site bandage immediately after instillation of the test article on Days 1, 2 and 3. Animals were bandaged and dressed in restraining jackets to prevent mechanical irritation of the surgical sites (as necessary).
Visual observations made in the in-life phase were scored as follows: 1 completely healed/scarred, 2 scab exfoliating, 3 wound scabbing, 4 open wound. Histopathologic evaluation was done at 36 days, and included scoring for: epithelialization, inflammation, scar tissue, and connective tissue.
There were no treatment related clinical signs following instillation of the test or vehicle articles into selected wound sites for 3 consecutive days. All clinical signs that were observed (red skin, exudate, scabbing) were considered to be part of the normal healing process for surgical wounds of the type created on this study.

All wound sites were prepared for histopathological examination by embedding in paraffin wax, sectioning and staining with hematoxylin and eosin/phloxine. Histopathological examination was conducted on all wound sites from both animals to evaluate the following parameters:



a. Re-epithelialization	Present, partial, or absent epithelializa-
	tion of the surface epithelium.
b. Inflammation	Degree of severity, cell type and distri-
	bution.
c. Scar Tissue Formation	Presence or absence of scar tissue,
	extent, size, depth and severity of
	scarring.
d. Connective Tissue Formation	Presence or absence of collagen and
	connective tissue associated with
	normal healing, the extent, size and
	depth (as opposed to scar tissue
	formation).

Scarring in comparison to healing was differentiated by the amount of connective tissue, the amount of neovascularity, inflammation, and amount of normal subcutaneous collagen present. In the scarred lesions, there was more connective tissue and the plug area was clearly differentiated from the adjacent normal tissue, while in the more healed or drug treated lesions, the plug area was almost contiguous with the adjacent tissue and difficult to differentiate from the adjacent tissue.
Histopathological examination failed to detect any negative long term consequences on epithelialization by drug treatment since complete healing occurred at all wound sites. Additionally, there was no correlation between treatment and inflammation. Histopathological examination of wound sites 36 days after wounding revealed that chimeric PCNA targeted ribozyme treated wounds were more completely healed and less scarred than untreated wounds or wounds treated with the vehicle article.

Claims

1-105. (canceled)

106. A method of treating a proliferative skin disease or scarring, comprising administering to a patient a therapeutically effective amount of a ribozyme which cleaves RNA encoding a cyclin PCNA, such that said proliferative skin disease or scarring is treated, said RNA comprising SEQ ID NO: 4145, wherein the binding arms of said ribozyme bind to SEQ ID NO:4145.

107. The method of claim 106, wherein said administration is local.

108. The method of claim 106, wherein said scar is a keloid.

109. The method of claim 106, wherein said scar is an adhesion.

110. The method of claim 106, wherein said scar is a hypertrophic scar.

111. The method of claim 106, wherein said scar is a hypertrophic burn scar.

112. The method of claim 106, wherein said scar is caused by trauma.

113. The method of claim 106, wherein said ribozyme is a hammerhead or hairpin ribozyme.

114. The method of claim 106, wherein said ribozyme is formulated within a solution.

115. The method of claim 106 wherein said ribozyme is formulated along with a lipid.

116. The method of claim 115, wherein said lipid is DOTAP: cholesterol.

117. The method of claim 106, wherein said ribozyme is formulated with ribonuclease inhibitors.

118. The method of claim 117, wherein said ribonuclease inhibitor is a reducing agent.

119. The method of claim 118, wherein the reducing agent is dithiothreitol.

120. The method of claim 117, wherein said ribonuclease inhibitor is a detergent.

121. The method of claim 120, wherein the detergent is sodium dodecyl sulfate.

122. The method of claim 117, wherein said ribonuclease inhibitor is vanidyl nucleotides.

123. The method of claim 117, wherein said ribonuclease inhibitor is aurin tricarboxcylic acid.

124. The method of claim 117, wherein said ribonuclease inhibitor is hydrogen peroxide.

125. The method of claim 117, wherein said ribonuclease inhibitor is an RNA decoy.

126. The method according to claim 97 wherein said RNA decoy is a tRNA.

127. The method of claim 106, wherein said ribozyme comprises ribonucleic acids.

128. The method of claim 106, wherein said ribozyme comprises deoxyribonucleic acids and ribonucleic acids.

129. The method of claim 106, wherein said ribozyme comprises nucleic acids having phosphothioate linkages.

130. The method of claim 106, wherein said ribozyme is administered topically.

131. The method of claim 106, wherein said ribozyme is administered intradermally.

132. The method of claim 106, wherein said ribozyme is formulated within a cream, ointment or lotion.

133. The method of claim 106, wherein said ribozyme comprises a sequence selected from the group consisting of SEQ ID NOS: 4383 and 4385.

134. The method of claim 133, wherein said sequence is SEQ ID NO: 4385.

135. The method of claim 106, wherein said proliferative skin disease is psoriasis.

136. The method of claim 106, wherein said proliferative skin disease is dermatitis.

137. The method of claim 106, wherein said proliferative skin disease is keratosis.

138. The method of claim 106, wherein said proliferative skin disease is basal cell carcinoma.

139. The method of claim 106, wherein said proliferative skin disease is viral or seborrheic wart.