US20050197310A1 - Oligoribonucleotides and methods of use thereof for treatment of fibrotic conditions and other diseases - Google Patents

Oligoribonucleotides and methods of use thereof for treatment of fibrotic conditions and other diseases Download PDF

Info

Publication number
US20050197310A1
US20050197310A1 US11045780 US4578005A US2005197310A1 US 20050197310 A1 US20050197310 A1 US 20050197310A1 US 11045780 US11045780 US 11045780 US 4578005 A US4578005 A US 4578005A US 2005197310 A1 US2005197310 A1 US 2005197310A1
Authority
US
Grant status
Application
Patent type
Prior art keywords
compound
tgaseii
fibrosis
cross sp
patient
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US11045780
Inventor
Orna Mor
Elena Feinstein
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
QUARK PHARMACUTICALS Inc
Original Assignee
Quark Biotech Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07HSUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • C07H21/04Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with deoxyribosyl as saccharide radical
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/40Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against enzymes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/1025Acyltransferases (2.3)
    • C12N9/104Aminoacyltransferases (2.3.2)
    • C12N9/1044Protein-glutamine gamma-glutamyltransferase (2.3.2.13), i.e. transglutaminase or factor XIII
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y203/00Acyltransferases (2.3)
    • C12Y203/02Aminoacyltransferases (2.3.2)
    • C12Y203/02013Protein-glutamine gamma-glutamyltransferase (2.3.2.13), i.e. transglutaminase or factor XIII
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/20Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/21Immunoglobulins specific features characterized by taxonomic origin from primates, e.g. man
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/76Antagonist effect on antigen, e.g. neutralization or inhibition of binding
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • C12N2310/111Antisense spanning the whole gene, or a large part of it
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering N.A.
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3212'-O-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3222'-R Modification

Abstract

The invention relates to a double-stranded compound, preferably an oligoribonucleotide (siRNA), which down-regulates the expression of a human TGaseII gene at the post-transcriptional level. The invention also relates to a pharmaceutical composition comprising the compound, or a vector capable of expressing the oligoribonucleotide compound, and a pharmaceutically acceptable carrier. The present invention also contemplates a method of treating a patient suffering from a fibrotic disease such as pulmonary, kidney and liver fibrosis or ocular, scarring comprising administering to the patient the pharmaceutical composition in a therapeutically effective dose so as to thereby treat the patient. The invention also relates to treatment of fibrotic and other diseases by use of antibodies to TGaseII polypeptide.

Description

  • This application claims priority of U.S. Provisional patent applications No. 60/540,687, filed Jan. 30, 2004 and No. 60/641,522, filed Jan. 4, 2005, both of which are hereby incorporated by reference in their entirety.
  • Throughout this application various patent and scientific publications are cited. The disclosures of these publications in their entireties are hereby incorporated by reference into this application to more fully describe the state of the art to which this invention pertains.
  • BACKGROUND OF THE INVENTION
  • siRNAs and RNA interference
  • RNA interference (RNAi) is a phenomenon involving double-stranded (ds) RNA-dependent gene specific posttranscriptional silencing. Originally, attempts to study this phenomenon and to manipulate mammalian cells experimentally were frustrated by an active, non-specific antiviral defense mechanism which was activated in response to long dsRNA molecules; see Gil et al. 2000, Apoptosis, 5:107-114. Later it was discovered that synthetic duplexes of 21 nucleotide RNAs could mediate gene specific RNAi in mammalian cells, without the stimulation of the generic antiviral defence mechanisms see Elbashir et al. Nature 2001, 411:494-498 and Caplen et al. Proc Natl Acad Sci 2001, 98:9742-9747. As a result, small interfering RNAs (siRNAs), which are short double-stranded RNAs, have become powerful tools in attempting to understand gene
  • Thus, RNA interference (RNAi) refers to the process of sequence-specific post-transcriptional gene silencing in mammals mediated by small interfering RNAs (siRNAs) (Fire et al, 1998, Nature 391, 806) or microRNAs (miRNAs) (Ambros V. Nature 431:7006,350-355(2004); and Bartel D P. Cell. 2004 Jan. 23; 116(2): 281-97 MicroRNAs. genomics, biogenesis, mechanism, and function). The corresponding process in plants is commonly referred to as specific post-transcriptional gene silencing or RNA silencing and is also referred to as quelling in fungi. An siRNA is a double-stranded RNA molecule which down-regulates or silences (prevents) the expression of a gene/mRNA of its endogenous (cellular) counterpart. RNA interference is based on the ability of dsRNA species to enter a specific protein complex, where it is then targeted to the complementary cellular RNA and specifically degrades it. Thus, the RNA interference response features an endonuclease complex containing an siRNA, commonly referred to as an RNA-induced silencing complex (RISC), which mediates cleavage of single-stranded RNA having a sequence complementary to the antisense strand of the siRNA duplex. Cleavage of the target RNA may take place in the middle of the region complementary to the antisense strand of the siRNA duplex (Elbashir et al 2001, Genes Dev., 15, 188). In more detail, longer dsRNAs are digested into short (17-29 bp) dsRNA fragments (also referred to as short inhibitory PNAs—“siRNAs”) by type III RNAses (DICER, DROSHA, etc., Bernstein et al., Nature, 2001, v.409, p.363-6; Lee et al., Nature, 2003, 425, p.415-9). The RISC protein complex recognizes these fragments and complementary mRNA. The whole process is culminated by endonuclease cleavage of target mRNA (McManus&Sharp, Nature Rev Genet , 2002, v.3, p.737-47; Paddison &Hannon, Curr Opin Mol Ther. 2003 June; 5(3): 217-24). For information on these terms and proposed mechanisms, see Bernstein E., Denli A M. Hannon G J: 2001 The rest is silence. RNA. I; 7(11): 1509-21; Nishikura K.: 2001 A short primer on RNAi. RNA-directed RNA polymerase acts as a key catalyst. Cell. I 16; 107(4): 415-8 and PCT publication WO 01/36646 (Glover et al).
  • The selection and synthesis of siRNA corresponding to known genes has been widely reported; see for example Chalk A M, Wahlestedt C, Sonnhammer E L. 2004 Improved and automated prediction of effective siRNA Biochem. Biophys. Res. Commun. Jun. 18; 319(1): 264-74; Sioud M, Leirdal M., 2004, Potential design rules and enzymatic synthesis of siRNAs, Methods Mol Biol.; 252:457-69; Levenkova N, Gu Q, Rux J. J. 2004 Gene specific siRNA selector Bioinformatics. I 12; 20(3): 430-2. and Ui-Tei K, Naito Y, Takahashi F, Haraguchi T, Ohki-Hamazaki H, Juni A, Ueda R, Saigo K., Guidelines for the selection of highly effective siRNA sequences for mammalian and chick RNA interference Nucleic Acids Res. 2004 I 9;32(3):936-48.Se also Liu Y, Braasch D A, Nulf C J, Corey D R. Efficient and isoform-selective inhibition of cellular gene expression by peptide nucleic acids, Biochemistry, 2004 I 24;43(7):1921-7. See also PCT publications WO 2004/015107 (Atugen) and WO 02/44321 (Tuschl et al), and also Chiu Y L, Rana T M. siRNA function in RNAi. a chemical modification analysis, RNA 2003 September;9(9):1034-48 and I Patent Nos.5898031 and 6107094 (Crooke) for production of modified/ more stable siRNAs.
  • Several groups have described the development of DNA-based vectors capable of generating siRNA within cells. The method generally involves transcription of short hairpin RNAs that are efficiently processed to form siRNAs within cells. Paddison et al. PNAS 2002, 99:1443-1448; Paddison et al. Genes & Dev 2002, 16:948-958; Sui et al. PNAS 2002, 8:5515-5520; and Brummelkamp et al. Science 2002, 296:550-553. These reports describe methods to generate siRNAs capable of specifically targeting numerous endogenously and exogenously expressed genes.
  • siRNA has recently been successfully used for inhibition in primates; for further details see Tolentino et al., Retina 24(1) February 2004 1 132-138.
  • Transglutaminase (TGase) Family
  • Transglutaminases (EC 2.3.2.13) are a family of enzymes that catalyze the crosslinking of proteins by epsilon-gamma glutamyl lysine isopeptide bonds. The family comprises 9 different enzymes among which are the factor XIIIa (plasma transglutaminase), keratinocyte transglutaminase (TGasel), epidermal transglutaminase (TGaseIII), prostate transglutaminase (TGaseIV), and tissue-type transglutaminase (TGaseII). Although the overall primary structure of these enzymes is different, they all share a common amino acid sequence at the active site (Y-G-Q-C-W) and a strict calcium dependence for their activity (Lesort M, Tucholski J, Miller M L, Johnson G V, Tissue transglutaminase: a possible role in neurodegenerative diseases. Prog Neurobiol. 2000 August; 61(5):439-63).
  • Transglutaminase II. Transglutaminase II (TGaseII) also known as Protein-glutamine gamma-glutamyltransferase, TGase C, TGC, TG(C), and tissue-type transglutaminase, is a unique multifunctional enzyme with dual enzymatic activity:
    • I) The enzyme acts as a TGase protein (Ca2+ activated, GTP-inactivated) with crosslinking activities (i.e. it catalyzes reactions resulting in protein cross-links and/or covalent incorporation of biogenic amines). TGase further catalyzes the formation of a covalent glutamyl—lysyl bond, a unique isopeptide bond that is highly resistant to proteolysis and denaturants and that cannot be disrupted by any known vertebrate endopeptidase.
    • 2) The enzyme also acts as a GTP-binding protein that transduces the activating signal from alpha 1 B and alpha 1 D adrenergic receptors, from TP alpha thromboxane A2 receptor and from oxytocin receptor to phospholipase C delta 1 (i.e. it activates inositol phosphate production, Ca2+ mobilization etc.). It has been shown that both alpha ID adrenergic receptor and PLC act as guanine nucleotide exchanging factor for transglutaminase 11 (Baek K J, Kang S, Damron D, Im M, Phospholipase C-delta1 is a guanine nucleotide exchanging factor for transglutaminase II (G alpha h) and promotes alpha 1B-adrenoreceptor-mediated GTP binding and intracellular calcium release. J Biol Chem. 2001 Feb. 23;276(8):5591-7).
  • The dual function of this enzyme is separate and the active sites are located at different positions (Im M. J, Russell M A, Feng J F, Transglutaminase II. a new class of GTP-binding protein with new biological functions. Cell Signal. 1997 November;9(7):477-82), and inhibition of crosslinking activity of TGaseII may be achieved without the interference with its G-protein function.
  • TGaseII: Subcellular Localization and Fibrosis Related Intracellular Signaling Activity
  • TgaseII is ubiquitously expressed and can be found in association with ECM and intracellularly, both as membrane bound and as cytosolic protein. The GTP-binding activity is higher in the membrane fraction of TGase and the cross-linking activity is higher in the cytosolic and extracellular fraction. On the cell surface, TGase binds to fibronectin via its 42 kDa gelatin-binding domain. The cross-linking of fibronectin with collagen contributes to structural stabilization of the ECM rendering the matrix resistant to proteolysis by matrix mettaloproteinases. Thus TGaseII, by favoring deposition of extracellular proteins and inhibiting breakdown of said proteins, contributes to ECM accumulation, a phenomenon that is central to the formation of tissue fibrosis.
  • In addition, TGase mediates the binding of latent TGF-beta to the ECM, a required step for a proper subsequent processing of this pro-fibrotic factor, which finally results in the release of active TGF-beta (Le et al., Connect Tissue Res. 2001;42(4):245-53. Rosenthal et al., Arthritis Rheum. 2000 August;43(8): 1729-33).
  • In the cytoplasm, TGaseII may activate RhoA, a small G protein of the ras family known to have an important role in cytoskeletal rearrangement, regulation of cell morphology and differentiation. Activation of TGaseII results in an increased transamidation of RhoA, which then functions as a constitutively active G-protein showing increased binding to and activation of its downstream target ROCK-2 (Rho-associated kinase) (Singh et al. EMBO J. 2001 May 15;20(10):2413-23). The specific ROCK kinase inhibitor, Y-27632, showed anti-fibrotic effect in UUO model of renal fibrosis as well as in the models of liver or lung fibrosis (Nagatoya K, Moriyama T, Kawada N, Takeji M, Oseto S, Murozono T, Ando A, Imai E, Hori M. Y-27632 was found to prevent tubulointerstitial fibrosis in mouse kidneys with unilateral urethral obstruction. Kidney Int. 2002 May;61(5):1684-95; Murata T, Arii S, Nakamura T, Mori A, Kaido T, Furuyama H, Furumoto K, Nakao T, Isobe N, Imamura M, Inhibitory effect of Y-27632, a ROCK inhibitor, on progression of rat liver fibrosis in association with inactivation of hepatic stellate cells. J Hepatol. 2001 October;35(4):474-81; Shimizu Y, Dobashi K, lizuka K, Horie T, Suzuki K, Tukagoshi H, Nakazawa T, Nakazato Y, Mori M, Contribution of small GTPase Rho and its target protein ROCK in a murine model of lung fibrosis. Am J Respir Crit Care Med. 2001 January;163(1):210-7). Recently, a unique function of TGaseII contributing to activation of NFkB, a transcription factor with a well-documented pro-fibrotic activity was described (Baud et al., J Soc Biol. 2002;196(4):269-73, Lee at al. J Biol Chem. 2004 Dec. 17;279(51):53725-35).
  • Fibrotic Diseases
  • Fibrotic diseases are all characterized by the excess deposition of a fibrous material within the extracellular matrix, which contributes to abnormal changes in tissue architecture and interferes with normal organ function. Unfortunately, although fibrosis is widely prevalent, debilitating and often life threatening, there is no effective treatment currently available.
  • All tissues damaged by trauma respond by the initiation of a wound-healing program. Fibrosis, a type of disorder characterized by excessive scarring, occurs when the normal self-limiting process of wound healing response is disturbed, and causes excessive production and deposition of collagen. As a result, normal organ tissue is replaced with scar tissue, which eventually leads to the functional failure of the organ.
  • Fibrosis may be initiated by diverse causes and in various organs. Liver cirrhosis, pulmonary fibrosis, sarcoidosis, keloids and kidney fibrosis are all chronic conditions associated with progressive fibrosis, thereby causing a continuous loss of normal tissue function.
  • Acute fibrosis (usually with a sudden and severe onset and of short duration) occurs as a common response to various forms of trauma including accidental injuries (particularly injuries to the spine and central nervous system), infections, surgery, ischemic illness (e.g. cardiac scarring following heart attack), burns, environmental pollutants, alcohol and other types of toxins, acute respiratory distress syndrome, radiation and chemotherapy treatments).
  • For further information on different types of fibrosis see: Molina V, Blank M, Shoenfeld Y. (2002), “Fibrotic diseases”, Harefuah, 141(11): 973-8, 1009; Yu L, Noble NA, Border WA (2002), “Therapeutic strategies to halt renal fibrosis”, Curr Opin Pharmacol. 2(2):177-81; Keane W F, Lyle P A. (2003), “Recent advances in management of type 2 diabetes and nephropathy: lessons from the RENAAL study”, Am J Kidney Dis. 41(3 Suppl 2): S22-5; Bohle A, Kressel G, Muller C A, Muller G A. (1989), “The pathogenesis of chronic renal failure”, Pathol Res Pract. 185(4):421-40; Kikkawa R, Togawa M, Isono M, Isshiki K, Haneda M. (1997), “Mechanism of the progression of diabetic nephropathy to renal failure”, Kidney Int Suppl. 62:S39-40; Bataller R, Brenner D A. (2001), “Hepatic stellate cells as a target for the treatment of liver fibrosis”, Semin Liver Dis. 21(3):437-51; Gross T J, Hunninghake G W, (2001) “Idiopathic pulmonary fibrosis”, N Engl J Med. 345(7):517-25; Frohlich E D. (2001) “Fibrosis and ischemia: the real risks in hypertensive heart disease”, Am J Hypertens;14(6 Pt 2):194S-199S.
  • Liver Fibrosis
  • Liver fibrosis (LF) is a generally irreversible consequence of hepatic damage of several etiologies. In the Western world, the main etiologic categories are: alcoholic liver disease (30-50%), viral hepatitis (30%), biliary disease (5-10%), primary hemochromatosis (5%), and drug-related and cryptogenic cirrhosis of unknown etiology(10-15%). Wilson's disease, α1-antitrypsin deficiency and other rare diseases also have liver fibrosis as one of the symptoms Scheinberg IH, Sternlieb I., Wilson disease and idiopathic copper toxicosis. Am J Clin Nutr 1996 May;63(5):842S-5S; Parfrey H, Mahadeva R, Lomas D A., Alpha(I)-antitrypsin deficiency, liver disease and emphysema. Int J Biochem Cell Biol. 2003 July;35(7):1009-14.
  • Liver cirrhosis, the end stage of liver fibrosis, frequently requires liver transplantation and is among the top ten causes of death in the Western world.
  • Anti-inflammatory agents, which cause inhibition of activation of hepatic stellate cells, stimulation of growth of hepatocytes and inhibition of post translational modification of collagen have all been used to treat liver fibrosis. However, due to the lack of selective targeting, these treatments suffer from, inter alia, the drawbacks of severe side effects,.
  • For more information see Friedman S L. (2003), “Liver fibrosis—from bench to bedside”, J Hepatol. 38 Suppl 1:S38-53; Albanis E, Safadi R, Friedman S L. (2003), “Treatment of hepatic fibrosis: almost there”, Curr Gastroenterol Rep. 5(1):48-56. See also Grenard P, Bresson-Hadni S, El Alaoui S, Chevallier M, Vuitton D A, Ricard-Blum S., Transglutaminase-mediated cross-linking is involved in the stabilization of extracellular matrix in human liver fibrosis. J Hepatol. 2001 September;35(3):367-75 ;Mirza A, Liu S L, Frizell E, Zhu J, Maddukuri S, Martinez J, Davies P, Schwarting R, Norton P, Zern M A., A role for tissue transglutaminase in hepatic injury and fibrogenesis, and its regulation by NF-kappaB. Am J Physiol. 1997 February;272(2 Pt I ):G28 1-8).
  • Kidney Fibrosis and Related Conditions
  • Chronic Renal Failure (CRF)
  • Chronic renal failure is a gradual and progressive loss of the ability of the kidneys to excrete wastes, concentrate urine, and conserve electrolytes. CRF is slowly progressive. It most often results from any disease that causes gradual loss of kidney function, and fibrosis is the main pathology that produces CRF.
  • Diabetic Nephropathy
  • Diabetic nephropathy, hallmarks of which are glomerulosclerosis and tubulointerstitial fibrosis, is the single most prevalent cause of end-stage renal disease in the modern world, and diabetic patients constitute the largest population on dialysis. Such therapy is costly and far from optimal. Transplantation offers a better outcome but suffers from a severe shortage of donors. More targeted therapies against diabetic nephropathy (as well as against other types of kidney pathologies) are not developed, since molecular mechanisms underlying these pathologies are largely unknown. Identification of an essential functional target gene that is modulated in the disease and affects the severity of the outcome of diabetes nephropathy has a high diagnostic as well as therapeutic value.
  • Origins of kidney Pathology
  • Many pathological processes in the kidney ( e.g., glomerular nephritis, physical obstructions, toxic injuries, metabolic and immunological diseases) eventually culminate in similar or identical morphological changes, namely glomerulosclerosis and tubulointerstitial fibrosis. Thus, different types of insults converge on the same single genetic program resulting in two hallmarks of fibrosis: the proliferation of fibroblasts and overproduction by them of various protein components of connective tissue. In addition, thickening of the basal membrane in the glomeruli accompanies interstitial fibrosis and culminates in glomerulosclerosis. See also Johnson TS, Skill NJ, El Nahas A M, Oldroyd S D, Thomas G L, Douthwaite J A, Haylor J L, Griffin M, Transglutaminase transcription and antigen translocation in experimental renal scarring. J Am Soc Nephrol. 1999 October;10(10):2146-57; Johnson T S, Griffin M, Thomas G L, Skill J, Cox A, Yang B, Nicholas B, Birckbichler P J, Muchaneta-Kubara C, Meguid El Nahas A, The role of transglutaminase in the rat subtotal nephrectomy model of renal fibrosis. J Clin Invest. 1997 Jun. 15;99(12):2950-60).
  • Pulmonary Fibrosis
  • Interstitial pulmonary fibrosis (IPF) is scarring of the lung caused by a variety of inhaled agents including mineral particles, organic dusts, and oxidant gases, or by unknown reasons (idiopathic lung fibrosis). The disease afflicts millions of individuals worldwide, and there are no effective therapeutic approaches. A major reason for the lack of useful treatments is that few of the molecular mechanisms of disease have been defined sufficiently to design appropriate targets for therapy (Lasky . J A., Brody A R. (2000), “Interstitial fibrosis and growth factors”, Environ Health Perspect.; 108 Suppl 4:751-62).
  • The cellular substrate of pathogenesis of pulmonary fibrosis includes endothelial and epithelial cell injury, production of inflammatory cells and their mediators, and fibroblast activation., Fibrosis is believed to be related to a dysregulation in cross-talk between inflammatory and structural cells, mediated by various cytokines, chemokines and growth factors, which are responsible for the maintenance of tissue homeostasis and which coordinate the response to injury (Kelly M, Kolb M, Bonniaud P, Gauldie J. (2003), “Re-evaluation of fibrogenic cytokines in lung fibrosis“Curr Pharm Des. 9(1):39-49).
  • Conventional therapy consisting of glucocorticoids or cytotoxic drugs is usually ineffective in preventing progression of the disease. It is believed that further understanding of the molecular mechanisms of endothelial and epithelial cell injury, inflammatory reaction, fibroblast proliferation, collagen deposition and lung repair, is necessary for the development of effective treatments against pulmonary fibrosis (Kuwano K, Hagimoto N, Hara N. (2001), “Molecular mechanisms of pulmonary fibrosis and current treatment”, Curr Mol Med. 1(5):551-73). See also Griffin M, Smith L L, Wynne J., Changes in transglutaminase activity in an experimental model of pulmonary fibrosis induced by Paraquat. Br. J. Exp. Pathol. 1979 December; 60(6):653-61).
  • Cardiac Fibrosis
  • Heart failure is unique among the major cardiovascular disorders in that it alone is increasing in prevalence while there has been a striking decrease in other conditions. Some of this can be attributed to the aging of the populations of the United States and Europe. The ability to salvage patients with myocardial damage is also a major factor, as these patients may develop progression of left ventricular dysfunction due to deleterious remodelling of the heart.
  • The normal myocardium is composed of a variety of cells, cardiac myocytes and noncardiomyocytes, which include endothelial and vascular smooth muscle cells and fibroblasts. (Weber KT. (2000), “Fibrosis and hypertensive heart disease”, Curr Opin Cardiol. 15(4):264-72).
  • Structural remodeling of the ventricular wall is a key determinant of clinical outcome in heart disease. Such remodeling involves the production and destruction of extracellular matrix proteins, cell proliferation and migration, and apoptotic and necrotic cell death. Cardiac fibroblasts are crucially involved in these processes, producing growth factors and cytokines that act as autocrine and paracrine factors, as well as extracellular matrix proteins and proteinases. Recent studies have shown that the interactions between cardiac fibroblasts and cardiomyocytes are essential for the progression of cardiac remodeling of which the net effect is deterioration in cardiac function and the onset of heart failure (Manabe I, Shindo T, Nagai R. (2002), “Gene expression in fibroblasts and fibrosis: involvement in cardiac hypertrophy”, Circ Res. 13;91(12):1103-13).
  • The use of agents to block the renin-angiotensin-aldosterone and sympathetic nervous systems has been shown to inhibit (and sometimes even reverse) cardiac remodelling and to improve the clinical course of patients with cardiac dysfunction. However, drugs aiming at direct inhibition or reduction of fibrosis are not yet available. See also Greenberg B. (2001), “Treatment of heart failure: state of the art and prospectives”, J Cardiovasc Pharmacol. 38 Suppl 2:S59-63, Zhang Z, Vezza R, Plappert T, McNamara P, Lawson J A, Austin S, Pratico D, Sutton M S, FitzGerald G A, COX-2-dependent cardiac failure in Gh/tTG transgenic mice. Circ Res. 2003 May 30;92(10):1153-61. Epub 2003 Apr. 17; Hwang K C, Gray C D, Sweet W E, Moravec C S, Im M J., Alpha I-adrenergic receptor coupling with Gh in the failing human heart. Circulation. 1996 Aug. 15;94(4):718-26.
  • Neurological Diseases
  • Polyglutamine diseases are a group of neurological diseases that are caused by expansion of CAG trinucleotide repeats coding for polyglutamine insert. Polyglutamine diseases include Huntington's disease (HD), spinobulbar muscular atrophy, dentatorubral-pallidoluysian atrophy and spinocerebellar ataxias (SCAs) 1, 2, 3, 6, 7 and 17. All these diseases are characterized by the presence of expansion of polyglutamine stretches (exceeding 35-40 glutamines), thus forming intranuclear aggregates, which leads to neuronal death. Alzheimer's disease (AD) is the most common cause of cognitive impairment in older patients and is expected to increase greatly in prevalence. Neurofibrillary degeneration, associated with the formation of paired helical filaments (PHF), is one of the critical neuropathological hallmarks of Alzheimer's disease (AD). Parkinson disease is a neurodegenerative disorder of aging characterized by a selective and progressive loss of dopaminergic neurons within the substantia nigra. See also Mastroberardino P G, Iannicola C, Nardacci R, Bernassola F, De Laurenzi V, Melino G, Moreno S, Pavone F, Oliverio S, Fesus L, Piacentini M. Tissue transglutaminase ablation reduces neuronal death and prolongs survival in a mouse model of Huntington's disease. Cell Death Differ. 2002 September;9(9):873-80; Karpuj M V, Becher M W, Springer .I E, Chabas D, Youssef S, Pedotti R, Mitchell D, Steinman L., Prolonged survival and decreased abnormal movements in transgenic model of Huntington disease, with administration of the transglutaminase inhibitor cystamine. Nat Med. 2002 February;8(2):143-9; Citron B A, Suo Z, SantaCruz K, Davies P J, Qin F, Festoff B W., Protein crosslinking, tissue transglutaminase, alternative splicing and neurodegeneration. Neurochem Int. 2002 January;40(1):69-78; Chen J S, Mehta K., Tissue transglutaminase: an enzyme with a split personality. Int J Biochem Cell Biol. 1999 Aug.;31(8):817-36.
  • Osteoarthritis
  • Among the main characteristics of osteoarthritis are the degradation of articular cartilage and the formation of new bone at the joint edges, so-called osteophytes. See Van den Berg W B., Growth factors in experimental osteoarthritis: transforming growth factor beta pathogenic? J Rheumatol Suppl. 1995 February;43.143-5; Scharstuhl A, Glansbeek H L, Van Beuningen H M, Vitters E L, Van der Kraan P M:, Van den Berg W B., Inhibition of endogenous TGF-beta during experimental osteoarthritis prevents osteophyte formation and impairs cartilage repair. J Immunol. 2002 Jul. 1; 169(1):507-14; Karpouzas G A, Terkeltaub R A., New developments in the pathogenesis of articular cartilage calcification. Curr Rheumatol Rep. 1999 Dec; 1(2):121-7.
  • Ocular Diseases
  • Age-related cataracts: Cataracts are characterized by aggregation and covalent cross-linking of the crystallins, the major structural proteins of the eye lens, resulting in increase light scattering, opacification and cataract. Disturbance of calcium homeostasis in the tissue is one of the factors implicated in cataractogenesis. see Shridas et al., FEBS Lett. 2001 Jun. 22;499(3):245-50; Shin et al, J Biol Chem. 2004 Apr. 9;279(15):15032-9; Wan et al., Br J Ophthalmol. 2002 November;86(11):1293-8. and Takeuchi N, Kamei A. Biol Pharm Bull. 2000 March;23(3):283-90.
  • Proliferative vitreoretinopathy Proliferative vitreoretinopathy (PVR) is the most common complication following retinal detachment and associated with a retinal hole or break. PVR refers to the growth of cellular membranes within the vitreous cavity and on the front and back surfaces of the retina containing retinal pigment epithelial (RPE) cells. These membranes, which are essentially scar tissues, exert traction on the retina and may result in recurrences of retinal detachment, even after an initially successful retinal detachment procedure.
  • Migration and adhesion of dislocated retinal pigment epithelial (RPE) cells to a fibronectin-rich extracellular matrix is an initial step in proliferative vitreoretinopathy (PVR). See also Casaroli-Marano R P et al Invest Ophthalmol Vis Sci. 1999 August;40(9):2062-72). and Priglinger S et al, Invest Ophthalmol Vis Sci. 2004 March;45(3):955-63; Priglinger et al., Invest Ophthalmol Vis Sci. 2003 January;44(1):355-64.
  • Fibrosis following glaucoma filtering operation. The goal of the glaucoma filtration procedure is to create a new passageway by which aqueous fluid inside the eye can escape, thereby lowering the pressure. The filter, therefore, allows the drainage of fluid from inside the anterior chamber of the eye to a “pocket” created between the conjuctiva, which is the outermost covering of the eye, and the sclera, which is the underlying white anatomical structure of the eye. The fluid is eventually absorbed by blood vessels. Unfortunately, due to postoperational scarring, the generated drainage system may be blocked requiring additional surgical intervention(s).
  • Current anti-scarring regimens (Mitomycin C or 5FU) are limited due to the complications involved (e.g. blindness) e.g. see Cordeiro M F, Gay J A, Khaw P T., Human anti-transforming factor-beta2 antibody: a new glaucoma anti-scarring agent Invest Ophthalmol Vis Sci. 1999 September;40(10):2225-34.
  • In conclusion, there are no effective modes of therapy for the diseases described above, and there is a need, therefore, to develop novel effective compounds and methods of treatment for these purposes.
  • SUMMARY OF THE INVENTION
  • The invention provides novel double stranded oligoribonucleotides. These oligoribonucleotides inhibit human TGaseII via the mechanism of RNA interference. The invention also provides a pharmaceutical composition comprising such an oligoribonucleotide, and a vector capable of expressing the oligoribonucleotide. The present invention also provides a method of treating a patient suffering from a fibrosis-related pathology comprising administering to the patient the oligoribonucleotide typically as a pharmaceutical composition, in a therapeutically effective dose so as to thereby treat the patient. The present invention also contemplates treating other diseases and conditions. The invention also relates to treatment of fibrotic and other diseases by use of an antibody to TGaseII polypeptide.
  • BRIEF DESCRIPTION OF THE FIGURES
  • FIG. 1. This figure sets forth the nucleotide sequence of the human TGaseII cDNA-(gi|13653650|ref|XM 009482.3|-ORF)-SEQ ID NO:1.
  • FIG. 2. This figure sets forth the amino acid sequence of the human TGaseII corresponding polypeptide—SEQ ID NO:2.
  • FIG. 3. Western Blot results demonstrating the effect of various TGaseII siRNAs on human TGaseII polypeptide expression.
  • The figure demonstrates the activity of various siRNAs in reducing expression of human TGase polypeptide in HeLa cells, 72 hr following siRNA transfection. GAPDH expression serves as control for protein loading. The numbers 15 and 30 represent concentration of the oligonucleotide in nM. “Cells” (first lane in each panel) stands for—nontransfected control cells. The last lane in each panel contains protein extracts from HeLa cells transfected with non-relevant (NR) siRNA, to ensure that the decrease in TGaseII expression is specific to the anti TGase siRNAs activity.
  • DETAILED DESCRIPTION OF THE INVENTION
  • The present invention provides a method for treatment of various pathologies, as recited below, in a subject in need of such treatment which comprises: administering to the subject an amount of an inhibitor of TGaseII polypeptide sufficient to effect a substantial inhibition of the TGaseII activity so as to thereby treat the subject. The TGaseII inhibitor may be L683685, an antibody to TGaseII polypeptide or an siRNA to TGaseII RNA or any of the TGaseII inhibitors known in the art (for further information on such inhibitors see for example: U.S. Pat. No. 5,021,440; 4,968,713 and 5,098,707). In particular the present invention relates to specific siRNAs targeting TGaseII RNA and the use thereof. The use of neutralizing antibodies against TGaseII is also disclosed. The present invention relates generally to compounds which down-regulate expression of the human TGaseII gene particularly to novel small interfering RNAs (siRNAs), and to the use of these novel siRNAs in the treatment of various diseases and medical conditions in particular fibrotic diseases, diseases related to fibrotic scarring and other diseases related to aberrant expression of Transglutaminase II.
  • The present invention provides methods and compositions for inhibiting expression of the target TGaseII gene in vivo. In general, the method includes administering oligoribonucleotides, such as small interfering RNAs (i.e., siRNAs) that are targeted to a particular mRNA and hybridize to, or interact with, it under biological conditions (within the cell), or a nucleic acid material that can produce siRNA in a cell, in an amount sufficient to down-regulate expression of a target gene by an RNA interference mechanism. In particular, the subject method can be used to inhibit expression of the TGaseII gene for treatment of disease.
  • Thus, the inhibitor of TGaseII expression (transcription or translation) or polypeptide activity may be inner alia siRNA, antibodies, preferably neutralizing antibodies or fragments thereof, including single chain antibodies, antisense oligonucleotides, antisense DNA or RNA molecules, proteins, polypeptides and peptides including peptido-mimetics and dominant negatives, and also expression vectors expressing all the above. Additional inhibitors may be small chemical molecules, which generally have a molecular weight of less than 2000 daltons, more preferably less than 1000 daltons, even more preferably less than 500 daltons. These inhibitors may act as follows: small molecules may affect expression and/or activity; antibodies may affect activity; all kinds of antisense may affect TGaseII expression; and dominant negative polypeptides and peptidomimetics may affect activity; expression vectors may be used inter alia for delivery of antisense or dominant-negative polypeptides or antibodies.
  • In accordance with the present invention, the siRNA molecules or inhibitors of Transglutaminase II, such as antibodies, may be used as drugs to treat various pathologies including fibrosis related pathologies (as defined below) and also to treat ocular diseases including cataract, cardiovascular diseases, neurological diseases, polyglutamine diseases (including Huntington's disease (HD), spinobulbar muscular atrophy, dentatorubral-pallidoluysian atrophy and spinocerebellar ataxias (SCAs) 1, 2, 3, 6, 7 and 17), Alzheimer's and Parkinson's disease and osteoarthritis.
  • As used herein, the term “Transglutaminase II gene ”, or “TGaseII gene”, or “TGase gene” is defined as any homolog of TGaseII gene having preferably 90% homology, more preferably 95% homology, and even more preferably 98% homology to the amino acid encoding region of SEQ ID NO:1, or nucleic acid sequences which bind to the TGaseII gene under conditions of highly stringent hybridization, which are well-known in the art (for example, see Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Md. (1988), updated in 1995 and 1998).
  • As used herein, the term “Transglutaminase II polypeptide ”, or “TGaseII polypeptide”, or “TGase” is defined as any homolog of TGaseII polypeptide having preferably 90% homology, more preferably 95% homology, and even more preferably 98% homology to SEQ ID NO:2, as either full-length or fragments or a domain thereof, as a mutant of the polypeptide encoded by a spliced variant nucleic acid sequence, as a chimera with other polypeptides, provided that any of the above has the same or substantially the same biological function as the TGaseII polypeptide. TGaseII polypeptide, or a TGaseII polypeptide homolog, may be present in different forms, including but not limited to soluble protein, membrane-bound (either in purified membrane preparations or on a cell surface), bead-bound, or any other form presenting TGaseII protein or fragments and polypeptides derived thereof.
  • As used herein, an “interactor” is a molecule with which TGaseII binds or interacts or activates in nature; for example, a molecule on the surface of a TGaseII polypeptide expressing cell, a molecule on the surface of a second cell or a cytoplasmic molecule. An interactor may be a ligand that is activated by TGaseII alone or by TGaseII as part of a complex with other components. An interactor may be a component of a signal transduction pathway that facilitates transduction of an extracellular signal from TGaseII through the cell membrane and into the cell. An interactor, for example, can be a second intercellular protein that mediates downstream signaling from TGaseII. The interactor is a molecule with which TGase binds in competition with a known TGase substrate (e.g. fibronectin).
  • As used herein, the term “lysyl donor” or “K donor” is defined as any polypeptide having the ability to donate a lysyl side chain to allow the formation of gamma-glutamyl-lysine bonds during transglutamination process.
  • As used herein, the term “glutamyl donor” or “Q donor” is defined as any polypeptide having the ability to donate glutamine side chain to allow the formation of gamma-glutamyl-lysine bonds during transglutamination process.
  • The present invention provides double-stranded oligoribonucleotides (siRNAs), which down-regulate the expression of TGaseII. The downregulation of the expression of transglutaminase II can be measured by e.g., measuring the amount of the lysyl-glutamyl crosslinked material produced in the presence of the siRNAs or by direct assessment of the amounts of TGaseII mRNA or polypeptide. The amount of TGaseII mRNA may be measured by e.g., by Northern blotting, RNase protection, RT-PCR or real-time PCR. The amount of TGaseII polypeptide may be measured by immunoblotting or by immunoprecipitation or by ELISA with TGaseII-specific antibodies.
  • An siRNA of the invention is a duplex oligoribonucleotide in which the sense strand is derived From the mRNA sequence of gene TGaseII, and the antisense strand is complementary to the sense strand. In general, some deviation from the target mRNA sequence is tolerated without compromising the siRNA activity (see e.g. Czauderna et al 2003 Nucleic Acids Research 31(11), 2705-2716). An siRNA of the invention inhibits gene expression on a post-transcriptional level with or without destroying the mRNA. Without being bound by theory, siRNA may target the mRNA for specific cleavage and degradation and/or may inhibit translation from the targeted message.
  • There are at least two variant TGaseII polypeptides, for which the GeneBank references are variant 2 NM198951.1 GI:39777598 and variant 1NM004613.2 GI:39777596. The sequence given in FIG. 1 is the nucleotide sequence of variant 2 (GI:39777598). Both variants and any other similar minor variants are included in the definition of TGaseII polypeptide and in the definition of the TGaseII genes encoding them.
  • As used herein, the term ” TGaseII gene” is defined as the naturally-occurring human gene including any allelic variant thereof as well as any homolog of the TGaseII gene having preferably 90%, homology, more preferably 95% homology, and even more preferably 98% homology to the amino acid encoding region of SEQ ID NO: 1 or nucleic acid sequences which bind to the TGaseII gene under conditions of highly stringent hybridization, which are well-known in the art (for example, see Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Md. (1988), updated in 1995 and 1998.
  • As used herein, the term “TGaseII ”, or “TGaseII polypeptide” is defined as the naturally-occurring polypeptide product of the gene including any allelic variant thereof as well as any homolog of the TGaseII polypeptide having preferably 90% homology, more preferably 95% homology, and even more preferably 98% homology to SEQ ID NO:2, as either full-length or a fragment or a domain thereof, as a mutant or the polypeptide encoded by a spliced variant nucleic acid sequence, as a chimera with other polypeptides, provided that any of the above has the same or substantially the same biological function as the TGaseII polypeptide. More particularly, the invention provides a compound having the structure:
    5′(N)x −Z 3′ (antisense strand)
    3′Z−(N′)y5′ (sense strand)
      • wherein each N and N′ is a ribonucleotide which may be modified or unmodified in its sugar residue and (N)x and (N′ )y is oligomer in which each consecutive N or N′ is joined to the next N or N′ by a covalent bond;
      • wherein each of x and y is an integer between 19 and 40;
      • wherein each of Z and Z′ may be present or absent, but if present is dTdT and is covalently attached at the 3′ terminus of the strand in which it is present;
      • and wherein the sequence of (N)x comprises any one of the antisense sequences present in Tables A, B and C
  • It will be readily understood by those skilled in the art that the compounds of the present invention consist of a plurality of nucleotides which are linked through covalent linkages. Each Such covalent linkage may be a phosphodiester linkage, a phosphothioate linkage, or a combination of both, along the length of the nucleotide sequence of the individual strand. Other possible backbone modifications are described inter alia in U.S. Pat. Nos. 5,587,361; 6,242,589; 6,277,967; 6,326,358; 5,399,676; 5,489,677; and 5,596,086.
  • In particular embodiments, x and y are preferably an integer between about 19 to about 27, most preferably from about 19 to about 23. In a particular embodiment of the compound of the invention, x may be equal to y (viz., x=y) and in preferred embodiments x=y=19 or x=y=21. In a particularly preferred embodiment x=y=19.
  • In one embodiment of the compound of the invention, Z and Z′ are both absent; in another embodiment one of Z or Z′ is present.
  • In one embodiment of the compound of the invention, all of the ribonucleotides of the compound are unmodified in their sugar residues.
  • In some embodiments of the compound of the invention, at least one ribonucleotide is modified in its sugar residue, preferably a modification at the 2′ position. The modification at the 2′ position results in the presence of a moiety which is preferably selected from the group comprising amino, fluoro, methoxy, alkoxy and alkyl groups. In a presently most preferred embodiment the moiety at the 2′ position is methoxy (2′-O-methyl).
  • In some embodiments of the invention, alternating ribonucleotides are modified in both the antisense and the sense strands of the compound.
  • In particularly preferred embodiments of the invention, the antisense strand is phophorylated at the 5′terminus, and may or may not be phophorylated at the 3′terminus;and the sense strand may or may not be phophorylated at the 5′terminus and at the 3′terminus.
  • In another embodiment of the compound of the invention, the ribonucleotides at the 5′ and 3′ termini of the antisense strand are modified in their sugar residues, and the ribonucleotides at the 5′ and 3′ termini of the sense strand are unmodified in their sugar residues.
  • The invention further provides a vector capable of expressing any of the aforementioned oligoribonucleotides in unmodified form in a cell after which appropriate modification may be made.
  • The invention also provides a composition comprising one or more of the compounds of the invention in a carrier, preferably a pharmaceutically acceptable carrier.
  • The invention also provides a composition comprising a carrier and one or more of the compounds of the invention in an amount effective to down-regulate expression in a cell of a human TGaseII gene, which compound comprises a sequence substantially complementary to the Sequence of (N)x.
  • The invention also provides a method of down-regulating the expression of a human TGaseII gene by at least 50% as compared to a control comprising contacting an mRNA transcript of the gene with one or more of the compounds of the invention.
  • In one embodiment the compound is down-regulating TGaseII, whereby the down-regulation of TGaseII is selected from the group comprising down-regulation of TGaseII function (which may be examined by an enzymatic assay or a binding assay with a known interactor of the native gene/polypeptide, inter alia), down-regulation of TGaseII protein (which may be examined by Western blotting, ELISA or immuno-precipitation, inter alia) and down-regulation of TGaseII mRNA expression (which may be examined by Northern blotting, quantitative RT-PCR, in-situ hybridisation or microarray hybridisation, inter alia).
  • The invention also provides a method of treating a patient suffering from fibrosis or a fibrosis-related pathology, comprising administering to the patient a composition of the invention in a therapeutically effective dose so as to thereby treat the patient.
  • The invention also provides a method of treating a patient suffering from a pathology related to aberrant cross-linking of cellular proteins via Transglutaminase II comprising administering to the patient a composition of the invention in a therapeutically effective dose so as to thereby treat the patient.
  • The invention also provides a use of a therapeutically effective dose of one or more compounds of the invention for the preparation of a composition for promoting recovery in a patient suffering from fibrosis or a fibrosis-related pathology or a pathology related to aberrant crosslinking of cellular proteins via Transglutaminase II.
  • Fibrotic diseases or diseases in which fibrosis is evident (fibrosis-related pathology) include both acute and chronic forms of fibrosis of organs, including all etiological variants of the following: pulmonary fibrosis, including interstitial lung disease and fibrotic lung disease, liver fibrosis, cardiac fibrosis including myocardial fibrosis, kidney fibrosis including chronic renal failure, skin fibrosis including scleroderma, keloids and hypertrophic scars; myelofibrosis (bone marrow fibrosis); all types of ocular scarring including proliferative vitreoretinopathy (PVR) and scarring resulting from surgery to treat cataract or glaucoma; inflammatory bowel disease of variable etiology, macular degeneration, Grave's ophthalmopathy, drug induced ergotism, psoriasis, glioblastoma in Li-Fraumeni syndrome, sporadic glioblastoma, myleoid leukemia, acute myelogenious leukemia, myelodysplastic syndrome, myeloproferative syndrome, gynecological cancel-, Kaposi's sarcoma, Hansen's disease, and collagenous colitis .
  • The compounds of the invention may be used to treat many other diseases and conditions apart from fibrotic diseases. Other indications may be ocular diseases including cataract, cardiovascular diseases especially cardiac hypertrophy, atherosclerosis/restenosis, neurological diseases, including polyglutamine diseases (such as Huntington's disease), spinobulbar muscular atrophy, dentatorubral-pallidoluysian atrophy and spinocerebellar ataxias (SCAs) 1, 2, 3, 6, 7 and 17, Alzheimer's disease and Parkinson's disease.
  • The compound may have homologs wherein up to two of the ribonucleotides in each terminal region a base is altered; the terminal region refers to the four terminal ribonucleotides e.g. refers to bases 1-4 and/or 16-19 in a 19-mer sequence and to bases 1-4 and/or 18-21 in a 21-mer sequence.
  • The preferred oligonucleotides of the invention are the oligonucleotides listed in Tables A, B and C, preferably the oligonucleotides targeting human cDNA. The most preferred oligonucleotides of the invention are the oligonucleotides having inhibitory activity as demonstrated in Table D, preferably oligonucleotides targeting human TGaseII cDNA.
  • The presently most preferred compound of the invention is a blunt-ended 19-mer oligonucleotide, i.e. x=y=19 and Z and Z′ are both absent; the oligonucleotide is phosphorylated at the 5′position of the antisense strand and at the 3′ position of the sense strand wherein alternating ribonucleotides are modified at the 2′ position in both the antisense and the sense strands, wherein the moiety at the 2′ position is methoxy (2′-0-methyl) and wherein the ribonucleotides at the 5′ and 3′ termini of the antisense strand are modified in their sugar residues, and the ribonucleotides it the 5′ and 3′ termini of the sense strand are unmodified in their sugar residues. The presently most preferred such compound is TG_HMRG1. The antisense strand of TG_HMRG1 has SEQ ID NO: 22 and the sense strand has SEQ ID NO: 4. Other preferred compounds are TG_HMG1 and TG_HM1, which have the antisense strand represented by SEQ ID NOS: 23 and 25 respectively and the sense strand represented by SEQ ID NO: 5 and 7 respectively.
  • In one aspect of the invention the oligonucleotide comprises a double-stranded structure, whereby such double-stranded structure comprises
      • a first strand and a second strand, whereby
      • the first strand comprises a first stretch of contiguous nucleotides and the second strand comprises a second stretch of contiguous nucleotides, whereby
      • the first stretch is either complementary or identical to a nucleic acid sequence coding for TGaseII and whereby the second stretch is either identical or complementary to a nucleic acid sequence coding for TGaseII.
  • In an embodiment the first stretch and/or the second stretch comprises from about 14 to 40 nucleotides, preferably about 18 to 30 nucleotides, more preferably from about 19 to 27 nucleotides and most preferably from about 19 to 23 nucleotides, in particular from about 19 to 21 nucleotides. In such an aspect the oligonucleotide may be from 17-40 nucleotides in length. Additionally, further nucleic acids according to the present invention comprise at least 14 contiguous nucleotides of any one of the SEQ. ID. NO.3 to SEQ ID NO: 416 and more preferably 14 contiguous nucleotide base pairs at any end of the double-stranded structure comprised of the first stretch and second stretch as described above.
  • The term “treatment” as used herein refers to administration of a therapeutic substance effective to ameliorate symptoms associated with a disease or condition, to lessen the severity or cure the disease or condition, or to prevent the disease or condition from occurring.
  • In a particular embodiment, the administration comprises intravenous administration. In another particular embodiment the administration comprises topical or local administration.
  • Additionally, the present invention provides a method of regulating a pathology or disease (as recited above) in a patient in need of such treatment by administering to a patient a therapeutically effective dose of at least one antisense (AS) oligonucleotide or at least one siRNA against the nucleic acid sequences or a dominant negative peptide directed against the TGaseII sequences or TGaseII proteins or an antibody directed against the TGaseII polypeptide.
  • Delivery: Delivery systems aimed specifically at the enhanced and improved delivery of siRNA into mammalian cells have been developed, see, for example, Shen et al (FEBS letters 539: 111-114 (2003)), Xia et al., Nature Biotechnology 20: 1006-1010 (2002), Reich et al., Molecular Vision 9: 210-216 (2003), Sorensen et al. (J.Mol.Biol. 327: 761-766 (2003), Lewis et al., Nature Genetics 32: 107-108 (2002) and Simeoni et al., Nucleic Acids Research 31, 11: 2717-2724 (2003). siRNA has recently been successfully used for inhibition in primates; for further details see Tolentino et al., Retina 24(1) February 2004 I 132-138.Respiratory formulations for siRNA are described in U.S. patent application No. 2004/0063654 of Davis et al. Cholesterol-conjugated siRNAs (and other steroid and lipid conjugated siRNAs) can been used for delivery (see Soutschek et al Nature 432: 173-177(2004) Therapeutic silencing of an endogenous gene by systemic administration of modified siRNAs; and Lorenz et al. Bioorg. Med. Chemistry. Lett. 14:4975-4977 (2004) Steroid and lipid conjugates of siRNAs to enhance cellular uptake and gene silencing in liver cells.
  • The siRNAs or pharmaceutical compositions of the present invention are administered and dosed in accordance with good medical practice, taking into account the clinical condition of the individual patient, the disease to be treated, the site and method of administration, scheduling of administration, patient age, sex, body weight and other factors known to medical practitioners.
  • The “therapeutically effective dose” for purposes herein is thus determined by such considerations as are known in the art. The dose must be effective to achieve improvement including but not limited to improved survival rate or more rapid recovery, or improvement or elimination of symptoms and other indicators as are selected as appropriate measures by those skilled in the art. The compounds of the present invention can be administered by any of the conventional routes of administration. It should be noted that the compound can be administered as the compound or as pharmaceutically acceptable salt and can be administered alone or as an active ingredient in combination with pharmaceutically acceptable carriers, solvents, diluents, excipients, adjuvants and vehicles. The compounds can be administered orally, subcutaneously or parenterally including intravenous, intraarterial, intramuscular, intraperitoneally, and intranasal administration as well as intrathecal and infusion techniques. Implants of the compounds are also useful. Liquid forms may be prepared for injection, the term including subcutaneous, transdermal, intravenous, intramuscular, intrathecal, and other parental routes of administration. The liquid compositions include aqueous solutions, with and without organic cosolvents, aqueous or oil suspensions, emulsions with edible oils, as well as similar pharmaceutical vehicles. In addition, under certain circumstances the compositions for use in the novel treatments of the present invention may be formed as aerosols, for intranasal and like administration. The patient being treated is a warm-blooded animal and, in particular, mammals including man. The pharmaceutically acceptable carriers, solvents, diluents, excipients, adjuvants and vehicles as well as implant carriers generally refer to inert, non-toxic solid or liquid fillers, diluents or encapsulating material not reacting with the active ingredients of the invention and they include liposomes and microspheres. Examples of delivery systems useful in the present invention include U. S. Pat. Nos. 5,225,182; 5,169,383; 5,167,616; 4,959,217; 4,925,678; 4,487,603; 4,486,194; 4,447,233; 4,447,224; 4,439,196; and 4,475,196. Many other such implants, delivery systems, and modules are well known to those skilled in the art. In one specific embodiment of this invention topical and transdermal formulations are particularly preferred.
  • In general, the active dose of compound for humans is in the range of from 1 ng/kg to about 20-100 mg/kg body weight per day, preferably about 0.01 mg to about 2-10 mg/kg body weight per day, in a regimen of one dose per day or twice or three or more times per day for a period of 1-4 weeks or longer. Treatment for many years or even lifetime treatment is also envisaged for some of the indications disclosed herein.
  • The present invention also provides for a process of preparing a pharmaceutical composition, which comprises:
      • obtaining at least one double stranded siRNA compound of the invention; and
      • admixing said compound with a pharmaceutically acceptable carrier.
  • The present invention also provides for a process of preparing a pharmaceutical composition, which comprises admixing a compound of the present invention with a pharmaceutically acceptable carrier.
  • In a preferred embodiment, the compound used in the preparation of a pharmaceutical composition is admixed with a carrier in a pharmaceutically effective dose. In a particular embodiment the compound of the present invention is conjugated to a steroid or to a lipid or to another suitable molecule e.g. to cholesterol.
  • Modifications or analogs of nucleotides can be introduced to improve the therapeutic properties of the nucleotides. Improved properties include increased nuclease resistance and/or increased ability to permeate cell membranes.
  • Accordingly, the present invention also includes all analogs of, or modifications to, a oligonucleotide of the invention that does not substantially affect the function of the polynucleotide or oligonucleotide. In a preferred embodiment such modification is related to the base moiety of the nucleotide, to the sugar moiety of the nucleotide and/or to the phosphate moiety of the nucleotide.
  • In embodiments of the invention, the nucleotides can be selected from naturally occurring or synthetically modified bases. Naturally occurring bases include adenine, guanine, cytosine, thymine and uracil. Modified bases of the oligonucleotides include inosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl-, 2-propyl- and other alkyl- adenines, 5-halo uracil, 5-halo cytosine, 6-aza cytosine and 6-aza thymine, pseudo uracil, 4-thiuracil, 8-halo adenine, 8-aminoadenine, 8-thiol adenine, 8-thiolalkyl adenines, 8-hydroxyl adenine and other 8-substituted adenines, 8-halo guanines, 8-amino guanine, 8-thiol guanine, 8-thioalkyl guanines, 8-hydroxyl guanine and other substituted guanines, other aza and deaza adenines, other aza and deaza guanines, 5-trifluoromethyl uracil and 5-trifluoro cytosine.
  • In addition, analogs of nucleotides can be prepared wherein the structures of the nucleotides are fundamentally altered and are better suited as therapeutic or experimental reagents. An example of a nucleotide analog is a peptide nucleic acid (PNA) wherein the deoxyribose (or ribose) phosphate backbone in DNA (or RNA) is replaced with a polyamide backbone similar to that found in peptides. PNA analogs have been shown to be resistant to degradation by enzymes and to have extended lives in vivo and in vitro. Further, PNAs have been shown to bind more strongly to a complementary DNA sequence than to a DNA molecule. This observation is attributed to the lack of charge repulsion between the PNA strand and the DNA strand. Other modifications that can be made to oligonucleotides include polymer backbones, cyclic backbones, or acyclic backbones.
  • In one embodiment the modification is a modification of the phosphate moiety, whereby the modified phosphate moiety is selected from the group comprising phosphothioate.
  • The compounds of the present invention can be synthesized by any of the methods that are well-known in the art for synthesis of ribonucleic (or deoxyribonucleic) oligonucleotides. Such synthesis is, among others, described in Beaucage S. L. and Iyer R. P., Tetrahedron 1992; 48: 2223-2311, Beaucage S. L. and Iyer R. P., Tetrahedron 1993; 49: 6123-6194 and Caruthers M. H. et. al., Methods Enzymol. 1987; 154: 287-313, the synthesis of thioates is, among others, described in Eckstein F., Annu. Rev. Biochem. 1985; 54: 367-402, the synthesis of RNA molecules is described in Sproat B., in Humana Press 2005 Edited by Herdewijn P.; Kap. 2: 17-31 and respective downstream processes are, among others, described in Pingoud A. et. al., in IRL Press 1989 Edited by Oliver R. W. A.; Kap. 7: 183-208 and Sproat B., in Humana Press 2005 Edited by Herdewijn P.; Kap. 2: 17-31 (supra).
  • Other synthetic procedures are known in the art e.g. the procedures as described in Usman et al., 1987,.J. Am. Chem. Soc., 109, 7845; Scaringe et al., 1990, Nucleic Acids Res., 18, 5433; Wincott et al., 1995, Nucleic Acids Res. 23, 2677-2684; and Wincott et al., 1997, Methods Mol. Bio., 74, 59, and these procedures may make use of common nucleic acid protecting and coupling groups, such as dimethoxytrityl at the 5′-end, and phosphoramidites at the 3′-end. The modified (e.g. 2′-O-methylated) nucleotides and unmodified nucleotides are incorporated as desired.
  • The oligonucleotides of the present invention can be synthesized separately and joined together post-synthetically, for example, by ligation (Moore et al., 1992 Science 256, 9923; Draper et al., International PCT publication No. WO93/23569; Shabarova et al., 1991, Nucleic Acids Research 19, 4247; Bellon et al., 1997, Nucleosides & Nucleotides, 16, 951; Bellon et al., 1997, Bioconjugate Chem. 8, 204), or by hybridization following synthesis and/or deprotection.
  • It is noted that a commercially available machine (available, inter alia, from Applied Biosystems) can be used; the oligonucleotides are prepared according to the sequences disclosed herein. Overlapping pairs of chemically synthesized fragments can be ligated using methods well known in the art (e.g., see U.S. Pat. No. 6,121,426). The strands are synthesized separately and then are annealed to each other in the tube. Then, the double-stranded siRNAs are separated from the single-stranded oligonucleotides that were not annealed (e.g. because of the excess of one of them) by HPLC. In relation to the siRNAs or siRNA fragments of the present invention, two or more such sequences can be synthesized and linked together for use in the present invention.
  • The compounds of the invention can also be synthesized via a tandem synthesis methodology, as described in US patent application publication No. US2004/0019001 (McSwiggen), wherein both siRNA strands are synthesized as a single contiguous oligonucleotide fragment or strand separated by a cleavable linker which is subsequently cleaved to provide separate siRNA fragments or strands that hybridize and permit purification of the siRNA duplex. The linker can be a polynucleotide linker or a non-nucleotide linker.
  • The compounds of the present invention can be delivered either directly or with viral or non-viral vectors. When delivered directly the sequences are generally rendered nuclease resistant.
  • Alternatively the sequences can be incorporated into expression cassettes or constructs such that the sequence is expressed in the cell as discussed herein below. Generally the construct contains the proper regulatory sequence or promoter to allow the sequence to be expressed in the targeted cell. Vectors optionally used for delivery of the compounds of the present invention are commercially available, and may be modified for the purpose of delivery of the compounds of the present invention by methods known to one of skill in the art.
  • It is also envisaged that a long double stranded oligonucleotide (typically 25-500 nucleotides in length) comprising one or more of the sequences of the oligonucleotides of the invention may be delivered and may be processed intracellularly by endogenous cellular complexes (e.g. by DICER as described above) to produce smaller double stranded oligonucleotides which are oligonucleotides of the invention.
  • As used herein, the term “polypeptide” refers to, in addition to a polypeptide, an oligopeptide, peptide and a full protein.
  • Animal model systems: Testing the active siRNAs of the invention may be done in predictive animal models. Several models for kidney fibrosis are described in Example 3.
  • Two models of liver fibrosis in rats are the Bile Duct Ligation (BDL) with sham operation as controls, and CCl4 poisoning, with olive oil fed animals as controls, as described in the following references: Lotersztajn S, Julien B, Teixeira-Clerc F, Grenard P, Mallat A, Hepatic Fibrosis: Molecular Mechanisms and Drug Targets. Annu Rev Pharmacol Toxicol. 2004 Oct. 07; Uchio K, Graham M, Dean N M, Rosenbaum J, Desmouliere A., Down-regulation of connective tissue growth factor and type I collagen mRNA expression by connective tissue growth factor antisense oligonucleotide during experimental liver fibrosis. Wound Repair Regen. 2004 January-February; 12(1):60-6. ;and. Xu X Q, Leow C K, Lu X, Zhang X, Liu J S, Wong W H, Asperger A, Deininger S, Eastwood Leung H C., Molecular classification of liver cirrhosis in a rat model by proteomics and bioinformatics Proteomics. 2004 October;4(10):3235-45.
  • Models for ocular scarring are well known in the art e.g. Sherwood M B et al., J Glaucoma. 2004 October;13(5):407-12. A new model of glaucoma filtering surgery in the rat; Miller M H et al., Ophthalmic Surg. 1989 May;20(5):350-7. Wound healing in an animal model of glaucoma fistulizing surgery in the rabbit, vanBockxmeer F M et al., Retina. 1985 Fall-Winter; 5(4): 239-52. Models for assessing scar tissue inhibitors; Wiedemann P et al., J Pharmacol Methods. 1984 August; 12(1): 69-78. Proliferative vitreoretinopathy: the rabbit cell injection model for screening of antiproliferative drugs.
  • Models of cataract are described in the following publications: The role of Src family kinases in cortical cataract formation. Zhou J, Menko AS.Invest Ophthalmol Vis Sci. 2002 July;43(7):2293-300; Bioavailability and anticataract effects of a topical ocular drug delivery system containing disulfiram and hydroxypropyl-beta-cyclodextrin on selenite-treated rats.Wang S, Li D, Ito Y, Nabekura T, Wang S, Zhang J, Wu C. Curr Eye Res. 2004 July;29(1):51-8; and Long-term organ culture system to study the effects of UV-Airradiation on lens transglutaminase. Weinreb O, Dovrat A.; Curr Eye Res. 2004 July;29(1):51-8.
  • Antibody Production
  • By the term “antibody” as used in the present invention is meant both poly- and mono-clonal complete antibodies as well as fragments thereof, such as Fab, F(ab′)2, and Fv, which are capable of binding the epitopic determinant. These antibody fragments retain the ability to selectively bind with its antigen or receptor and are exemplified as follows, inter alia:
    • (1) Fab, the fragment which contains a monovalent antigen-binding fragment of an antibody molecule can be produced by digestion of whole antibody with the enzyme papain to yield a light chain and a portion of the heavy chain;
    • (2) (Fab′)2, the fragment of the antibody that can be obtained by treating whole antibody with the enzyme pepsin without subsequent reduction; F(ab′2) is a dimer of two Fab fragments held together by two disulfide bonds;
    • (3) Fv, defined as a genetically engineered fragment containing the variable region of the light chain and the variable region of the heavy chain expressed as two chains; and
    • (4) Single chain antibody (SCA), defined as a genetically engineered molecule containing the variable region of the light chain and the variable region of the heavy chain linked by a suitable polypeptide linker as a genetically fused single chain molecule.
  • Such fragments having antibody functional activity can be prepared by methods known to those skilled in the art (e.g. Bird et al. (1988) Science 242:423-426)
  • Conveniently, antibodies may be prepared against the immunogen or portion thereof, for example, a synthetic peptide based on the sequence, or prepared recombinantly by cloning techniques or the natural gene product and/or portions thereof may be isolated and used as the immunogen. Immunogens can be used to produce antibodies by standard antibody production technology well known to those skilled in the art, as described generally in Harlow and Lane (1988), Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., and Borrebaeck (1992), Antibody Engineering—A Practical Guide, W. H. Freeman and Co., NY.
  • For producing polyclonal antibodies a host, such as a rabbit or goat, is immunized with the immunogen or immunogen fragment, generally with an adjuvant and, if necessary, coupled to a carrier; antibodies to the immunogen are collected from the sera. Further, the polyclonal antibody can be absorbed such that it is monospecific; that is, the sera can be absorbed against related immunogens so that no cross-reactive antibodies remain in the sera, rendering it monospecific.
  • For producing monoclonal antibodies the technique involves hyperimmunization of an appropriate donor with the immunogen, generally a mouse, and isolation of splenic antibody-producing cells. These cells are fused to an immortal cell, such as a myeloma cell, to provide a fused cell hybrid that is immortal and secretes the required antibody. The cells are then cultured, in bulk, and the monoclonal antibodies harvested from the culture media for use.
  • For producing recombinant antibody see generally Huston et al. (1991) “Protein engineering of single-chain Fv analogs and fusion proteins” in Methods in Enzymology (JJ Langone, ed., Academic Press, New York, N.Y.) 203:46-88; Johnson and Bird (1991) “Construction of single-chain Fvb derivatives of monoclonal antibodies and their production in Escherichia coli in Methods in Enzymology (JJ Langone, ed.; Academic Press, New York, N.Y.) 203:88-99; Mernaugh and Mernaugh (1995) “An overview of phage-displayed recombinant antibodies” in Molecular Methods In Plant Pathology (RP Singh and US Singh, eds.; CRC Press Inc., Boca Raton, Fla.:359-365). In particular scFv antibodies are described in WO 2004/007553 (Tedesco and Marzari). Additionally, messenger RNAs from antibody-producing B-lymphocytes of animals, or hybridoma can be reverse-transcribed to obtain complementary DNAs (cDNAs). Antibody cDNA, which can be full or partial length, is amplified and cloned into a phage or a plasmid. The cDNA can be a partial length of heavy and light chain cDNA, separated or connected by a linker. The antibody, or antibody fragment, is expressed using a suitable expression system to obtain recombinant antibody. Antibody cDNA can also be obtained by screening pertinent expression libraries.
  • The antibody can be bound to a solid support substrate or conjugated with a detectable moiety or be both bound and conjugated as is well known in the art. (For a general discussion of conjugation of fluorescent or enzymatic moieties see Johnstone & Thorpe (1982.), Immunochemistry in Practice, Blackwell Scientific Publications, Oxford). The binding of antibodies to a solid support substrate is also well known in the art (for a general discussion, see Harlow & Lane (1988) Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Publications, New York; and Borrebaeck (1992), Antibody Engineering—A Practical Guide, W. H. Freeman and Co.). The detectable moieties contemplated with the present invention can include, but are not limited to, fluorescent, metallic, enzymatic and radioactive markers such as biotin, gold, ferritin, alkaline phosphatase, β-galactosidase, peroxidase, urease, fluorescein, rhodamine, tritium, 14C and iodination.
  • Additional compounds which are also considered to be useful in the treatment of the diseases and disorders discussed herein may be antisense DNA molecules (which can be generated using the sequence in FIG. 1 by methods known in the art), catalytic RNAs such as ribozymes, polypeptides such as dominant negative peptides (which can be generated using the sequence in FIG. 2 by methods known in the art) or other polypeptide inhibitors. Antisense DNA molecules which comprise the siRNA sequences disclosed herein (with the appropriate nucleic acid modifications stemming from the differences between DNA and RNA) are particularly desirable and may be used in the same capacity as their corresponding siRNAs for all uses and methods disclosed herein.
  • Screening of TGase Inactivating Compounds
  • Some of the compounds and compositions of the present invention may be used in a screening assay for identifying and isolating compounds that modulate the activity of TGaseII, in particular compounds that modulate fibrotic disease or fibrosis-related pathology. The compounds to be screened comprise inter alia substances such as small chemical molecules, antibodies especially neutralizing antibodies, inhibitory polypeptides and dominant negative peptides.
  • The inhibitory activity of the compounds of the present invention on TGaseII polypeptide enzymatic activity or binding of the compounds of the present invention to TGaseII may be used to determine the interaction of an additional compound with the TGaseII polypeptide, e.g., if the additional compound competes with the antibodies or dominant-negative peptides of the present invention for TGaseII inhibition, or if the additional compound rescues said inhibition. The inhibition or activation can be tested by various means, such as, inter alia, assaying for the product of the activity of the TGaseII polypeptide or displacement of binding compound from the TGaseII polypeptide in radioactive or fluorescent competition assays.
  • The present invention additionally provides for a process of obtaining a compound capable of inhibiting the enzymatic activity of a TGaseII polypeptide, preferably a human TGaseII polypeptide, that comprises the steps of:
      • (i) contacting the TGaseII polypeptide or cells expressing the TGaseII polypeptide with the compound, a lysyl donor and with a glutamyl donor which is a biological molecule;
      • (ii) removing excess lysyl donor from the mixture of step (i);
      • (iii) measuring the amount of the lysyl-glutamyl crosslinked material produced in the presence of the compound;
      • (iv) comparing the amount of lysyl-glutamyl crosslinked material measured in step (iii) to that measured in the absence of the compound under controlled conditions, wherein a decrease in the amount of lysyl-glutamyl crosslinked material is indicative of inhibition of the TGaseII polypeptide activity by the compound; and
      • (v) identifying the compound as an inhibitor of TGaseII polypeptide activity.
  • In one embodiment of all the processes described herein, the TGaseII polypeptide used in such process comprises consecutive amino acids, the sequence of which is set forth in SEQ ID NO: 2.
  • In another embodiment, the lysyl donor of step (i) is tagged and the measurement in step (iii) is of the tag related read-out, and wherein, a decrease in the read-out level is indicative of inhibition of the TGaseII polypeptide activity by the compound.
  • The glutamyl donor which is a biological molecule may be e.g. fibronectin. or collagen.
  • In another embodiment, the lysyl donor used in such process is cadaverin tagged with a dansyl fluorescent tag.
  • In another embodiment the lysyl donor used in such process is tagged with biotin, and in a specific embodiment, the lysyl donor is biotin cadaverine. Biotin is detected by streptavidin (or a modified streptavidin such as nutravidin) conjugated to readouts known in the art (e.g. conjugated to horseradish peroxidase, wherein the amount of horseradish peroxidase is quantified using tetramethylbenzidine as a substrate).
  • in yet another embodiment of the invention, the glutamyl donor in the provided process may be an extra-cellular matrix protein or a cellular protein. The extra cellular matrix protein is selected from the group consisting of: fibronectin, collagen, osteonectin, ECM-gel (e.g. Sigma E-1270), and the intracellular protein is selected inter alia from the group consisting of: RhoA, fialmin, spectrin, vimentin, HSP90, HSP60, (see Orru S, Caputo I, D'Amato A, Ruoppolo M, Esposito C Proteomics identification of acyl-acceptor and acyl-donor substrates for transglutaminase in a human intestinal epithelial cell line. Implications for celiac disease. J Biol Chem. 2003 Aug. 22;278(34):31766-73).
  • In a different embodiment, the compound is contacted with cells expressing the TGaseII polypeptide. The cells that may be used in such process may either be separated or present in a tissue. The cells may express the TGaseII polypeptide naturally or as a result of having been transfected with TGaseII gene, either transiently or stably or may over-express the TGaseII gene and the activity of TGaseII will be compared between over-expressors to normal TGaseII expressing cells. In a further embodiment, the glutamyl donor is either a natural product of the cells or it is added from outside.
  • In a different embodiment, the TGaseII polypeptide is contacted with the compound. The TGaseII polypeptide can be either immobilized or free in a solution. In an embodiment of the provided screening process the glutamyl donor is immobilized.
  • In a further embodiment, the processes provided for obtaining a compound capable of inhibiting the activity of human TGaseII may comprise a further step in which prior to step (i) TGaseII is contacted with a second compound known to bind TGaseII.
  • In one embodiment of the invention, the tag read-out in the provided processes described herein is the interaction of biotin with neutravidin conjugated to horseradish peroxidase, wherein the amount of cell-bound horseradish peroxidase is quantified using TMB (tetramethylbenzidine) as a substrate.
  • In yet a further embodiment, the compound obtained by the provided process inhibits the activity of the TGaseII polypeptide at least 2-fold more effectively than it inhibits the activity of at least one other member of the TGase family, and more preferably the inhibition is at least 10- fold, 50-fold and even 100-fold more effective. In such process, either the TGaseII polypeptide or the second compound may be immobilized.
  • In one another embodiment, the compound obtained by any of the provided processes is an antibody.
  • The invention further provides a process of obtaining a compound which modulates the activity of a TGaseII polypeptide, preferably a human TGaseII polypeptide, which comprises the steps of:
      • (i) contacting the TGaseII polypeptide with an interactor with which the TGaseII polypeptide interacts specifically in vivo;
      • (ii) contacting the TGaseII polypeptide or the interactor with said compound; and
      • (iii) measuring the effect of the compound on the interaction between TGaseII polypeptide and the interactor by measuring a parameter related to fibrosis; and
      • (iv) comparing the effect measured in step (iii) with the effect measured in the absence of the compound, a change in the effect measured indicating that the compound modulates the activity of the human TGaseII polypeptide.
  • In one embodiment of the invention the compound obtained by the provided process inhibits the activity of a human TGaseII polypeptide.
  • In another embodiment of the invention the TGaseII polypeptide in such process comprises consecutive amino acids, the sequence of which is set forth in SEQ ID NO: 2. In a further embodiment either the TGaseII polypeptide or the interactor are immobilized.
  • In a further embodiment of the invention, the parameter measured in any of the provided processes is related to a pathology characterized by TGaseII up-regulation in general and to fibrosis related pathologies as defined above, and also to cataract, cardiovascular diseases, neurological disorders, polyglutamine diseases including Huntington's disease (HD), spinobulbar muscular atrophy, dentatorubral-pallidoluysian atrophy and spinocerebellar ataxias (SCAs) 1, 2, 3, 6, 7 and 17), Alzheimer's and Parkinson's disease, coeliac disease and osteoarthritis. It is another object of the present invention to provide a process of obtaining a compound capable of inhibiting the activity of a human TGaseII polypeptide that comprises the steps of:
      • (i) contacting the TGaseII polypeptide or cells expressing the TGaseII polypeptide with a plurality of compounds, a tagged lysyl donor and with a glutamyl donor which is a biological molecule;
      • (ii) washing excess tagged lysyl donor from the mixture of step (i); and
      • (iii) measuring the tag related read-out in the presence of the plurality of compounds;
      • (iv) comparing the tag read-out measured in step (iii) to that measured in the absence of the plurality of compounds under controlled conditions, wherein a decrease in the read-out level is indicative of inhibition of the TGaseII polypeptide activity by the plurality of compounds;
      • (v) separately determining which compound or compounds present in the plurality inhibit the activity of a human TGaseII.
      • It is another aspect of the present invention to provide a cell-based process of obtaining a compound capable of inhibiting the activity of a TGaseII polypeptide, preferably human TGaseII polypeptide, that comprises the steps of:
    • (i) contacting cells expressing active TGaseII polypeptide with the compound and with a lysyl donor;
    • (ii) removing excess lysyl donor from the mixture of step (i);
    • (iii) measuring the amount of lysyl-glutamyl crosslinked material produced in the presence of the compound;
    • (iv) comparing the amount of lysyl-glutamyl crosslinked material measured in step (iii) to that measured in the absence of the compound under controlled conditions, wherein a decrease in the amount of lysyl-glutamyl crosslinked material is indicative of inhibition of the TGaseII polypeptide activity by the compound; and
    • (v) identifying the compound as an inhibitor of TGaseII polypeptide
  • It is another aspect of the present invention to provide a cell-based process of obtaining a compound capable of inhibiting the activity of a human TGaseII polypeptide that comprises the steps of:
      • a. contacting cells expressing the TGaseII polypeptide with a plurality of compounds and with a lysyl donor;
      • b. removing excess lysyl donor from the mixture of step (i); and
      • c. measuring the amount of the lysyl-glutamyl crosslinked material produced in the presence of the plurality of compounds;
      • d. comparing the amount of lysyl-glutamyl crosslinked material measured in step (iii) to that measured in the absence of the plurality of compounds under controlled conditions, wherein a decrease in the amount of lysyl-glutamyl crosslinked material is indicative of inhibition of the TGaseII polypeptide activity by the plurality of compounds; and
      • (e) separately determining which compound or compounds present in the plurality inhibit the activity of a human TGaseII.
        Methods
        General Methods in Molecular Biology
  • Standard molecular biology techniques known in the art and not specifically described were generally followed as in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York (1989), and as in Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Md. (1989) and as in Perbal, A Practical Guide to Molecular Cloning, John Wiley & Sons, New York (1988), and as in Watson et al., Recombinant DNA, Scientific American Books, New York and in Birren et al (eds) Genome Analysis: A Laboratory Manual Series, Vols. 1-4 Cold Spring Harbor Laboratory Press, New York (1998) and methodology as set forth in U.S. Pat. Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057 and incorporated herein by reference. Polymerase chain reaction (PCR) was carried out generally as in PCR Protocols: A Guide To Methods And Applications, Academic Press, San Diego, Calif. (1990). In situ (in cell) PCR in combination with Flow Cytometry can be used for detection of cells containing specific DNA and mRNA sequences (e.g. Testoni et al., 1996, Blood 87:3822.) Methods of performing RT-PCR are also well known in the art.
  • The present invention is illustrated in detail below with reference to Examples, but is not to be construed as being limited thereto.
  • EXAMPLES Example 1
  • Design of Active siRANA Compounds
  • Using proprietary algorithms and the known sequence of cDNA of TGaseII (SEQ ID NO:1), the sequences of many potential siRNAs were generated. These are shown in the Tables below. Note that the abbreviations for species are: H: human; M: mouse; R: rat; G: guinea pig; C: cow.
  • Table A shows 18 siRNAs that have so far been chemically synthesized and tested for activity (see Example 2). All these siRNAs are 19-mers. In Table A the sense strands of siRNAs 1-18 have SEQ ID NOS: 3-20 respectively, and the antisense strands of siRNAs 1-18 have SEQ ID NOS: 21-38 respectively.
  • Table B below shows 153 additional 19-mer siRNAs, which have been generated by the proprietary algorithms but not yet tested for activity. In Table B, the sense strands of siRNAs I-153 have SEQ ID NOS: 39-191, respectively, and the antisense strands of siRNAs 1-153 have SEQ ID NOS: 192-344 respectively.
  • Table C below shows 36 additional 21-mer siRNAs that have been generated by the proprietary algorithms. In Table C, the sense strands of siRNAs 1-36 have SEQ ID NOS: 345-380 respectively, and the antisense strands of siRNAs 1-36 have SEQ ID NOS: 381-416, respectively.
    TABLE A
    NM_198951 NM_009373 NM_198851 M19646.1
    No. name Sense strand Antisense strand Species (human) (mouse) (RAT) (GP)
    1 TG_HMR1 ACAAGAGCGAGAUGAUCUG CAGAUCAUCUCGCUCUUGU hum_mus_rat [1077- [1069- [1033-
    1095] 1087] 1051]
    2 TG_HMRG1 AGAGCGAGAUGAUCUGGAA UUCCAGAUCAUCUCGCUCU hum_mus_rat_GP [1080- [1072- [1036- [1048-
    1098] 1090] 1054] 1066]
    3 TG_HMG1 ACCCCAAGUUCCUGAAGAA UUCUUCAGGAACUUGGGGU hum_mus_GP [699-717] [691-709] [667-685]
    4 TG_HMG2 GCGAGAUGAUCUGGAACUU AAGUUCCAGAUCAUCUCGC hum_mus_GP [1083- [1075- [1051-
    1101] 1093] 1069]
    5 TG_HM1 CAAAUCCAUCAACCGUUCC GGAACGGUUGAUGGAUUUG hum_mus [1339- [1331-
    1357] 1349]
    6 TG_M1 GAACAUCCAUGAGAAACUU AAGUUUCUCAUGGAUGUUC mus 2599-2617
    7 TG_M2 CGACCUAUGCCAAGAGAAA UUUCUCUUGGCAUAGGUCG mus 164-182
    8 TG_M3 GGUGUGAUUUGGAGAUUCA UGAAUCUCCAAAUCACACC mus 118-136
    9 TG_M4 CCAACCACCUGAACAAACU AGUUUGUUCAGGUGGUUGG mus_rat [1468- [1432-
    1486] 1450]
    10 TG_M5 GAACAAACUGGCAGAGAAA UUUCUCUGCCAGUUUGUUC mus_rat [1478- [1442-
    1496] 1460]
    11 TG_M6 GCUCUGUCAAGUUCAUCAA UUGAUGAACUUGACAGAGC mus_rat 601-619
    12 TG_M7 GAUCCCUACUCUGAGAACA UGUUCUCAGAGUAGGGAUC mus_rat 1692-1637
    13 TG_M8 CCAGAGUGGUGACCAACUA UAGUUGGUCACCACUCUGG mus_rat [976-994] [940-958]
    14 TG_M9 GCAACAAGAGCGAGAUGAU AUCAUCUCGCUCUUGUUGC mus_rat [1066- [1030-
    1084] 1048]
    15 TG_M10 GCAACCUGCUCAUCGAGUA UACUCGAUGAGCAGGUUGC mus_rat [1018- [982-
    1036] 1000]
    16 TG_H1 GUGACCUAACCACUUAGCA UGCUAAGUGGUUAGGUCAC hum 1773-1791
    17 TG_H2 GUAGUGACCUAACCACUUA UAAGUGGUUAGGUCACUAC hum 1770-1788
    18 TG_HG1 GACGCUGGGACAACAACUA UAGUUGUUGUCCCAGCGUC hum_GP [816-834] [784-802]
  • TABLE B
    Guinea-
    human GI Mouse GI Rat GI pig GI Cow GI
    No. Method Sense siRNA AntiSense siRNA 39777598 31543859 42476286 387604 31343554 species
    1 Cross Sp UUCCACUGCUGGGUGGAGU ACUCCACCCAGCAGUGGAA 1100- 1092- 1056- 1068- 1046- hmrgc
    1118 1110 1074 1086 1064
    2 Cross Sp AAGAGCGAGAUGAUCUGGA UCCAGAUCAUCUCGCUCUU 1079- 1071- 1035- 1047- 1025- hmrgc
    1097 1089 1053 1065 1043
    3 Cross Sp CAAGAGCGAGAUGAUCUGG CCAGAUCAUCUCGCUCUUG 1078- 1070- 1034- 1046- 1024- hmrgc
    1096 1088 1052 1064 1042
    4 Cross Sp AACCACCUGAACAAACUGG CCAGUUUGUUCAGGUGGUU 1478- 1470- 1434- 1424- hmr
    1496 1488 1452 1442
    5 Cross Sp ACCACCUGAACAAACUGGC GCCAGUUUGUUCAGGUGGU 1479- 1471- 1435- 1425- hmr
    1497 1489 1453 1442
    6 Cross Sp CUGGAACUUCCACUGCUGG CCAGCAGUGGAAGUUCCAG 1093- 1085- 1049- 1061- 1039- hm
    1111 1103 1067 1079 1057
    7 Cross Sp AACUUCCACUGCUGGGUGG CCACCCAGCAGUGGAAGUU 1097- 1089- 1056- 1065- 1043- hm
    1115 1107 1071 1083 1061
    8 Cross Sp AGGAGAAGAGCGAAGGGAC GUCCCUUCGCUCUUCUCCU 1185- 1177- 1141- 1131- hm
    1203 1195 1156 1149
    9 Cross Sp UGAUCUGGAACUUCCACUG CAGUGGAAGUUCCAGAUCA 1089- 1081- 1057- 1035- hm
    1107 1099 1075 1053
    10 Cross Sp GAGCGAGAUGAUCUGGAAC GUUCCAGAUCAUCUCGCUC 1081- 1073- 1037- 1049- 1027- hm
    1099 1091 1054 1067 1045
    11 Cross Sp UCUGGAACUUCCACUGCUG CAGCAGUGGAAGUUCCAGA 1092- 1084- 1048- 1060- 1038- hm
    1110 1102 1066 1078 1056
    12 Cross Sp GAUCUGGAACUUCCACUGC GCAGUGGAAGUUCCAGAUC 1090- 1082- 1058- 1036- hm
    1108 1100 1076 1054
    13 Cross Sp GAGAUGAUCUGGAACUUCC GGAAGUUCCAGAUCAUCUC 1085- 1077- 1041- 1053- 1031- hm
    1103 1095 1059 1071 1049
    14 Cross Sp AGCGAGAUGAUCUGGAACU AGUUCCAGAUCAUCUCGCU 1082- 1074- 1038- 1050- 1028- hm
    1100 1092 1054 1068 1046
    15 Cross Sp AGAUGAUCUGGAACUUCCA UGGAAGUUCCAGAUCAUCU 1086- 1078- 1042- 1054- 1032- hm
    1104 1096 1060 1072 1050
    16 Cross Sp CCCCAAGUUCCUGAAGAAC GUUCUUCAGGAACUUGGGC 700-718 692-710 656-671 668-685 646-659 hm
    17 Cross Sp AUCUGGAACUUCCACUGCU AGCAGUGGAAGUUCCAGAU 1091- 1083- 1059- 1037- hm
    1109 1101 1077 1055
    18 Cross Sp AGCUUUGUGCUGGGCCACU AGUGGCCCAGCACAAAGCU 485-503 477-495 hm
    19 Cross Sp AACCCCAAGUUCCUGAAGA UCUUCAGGAACUUGGGGUU 698-716 690-708 654-671 666-684 644-659 hm
    20 Cross Sp CAGGAGAAGAGCGAAGGGA UCCCUUCGCUCUUCUCCUG 1184- 1176- 1140- 1152- 1130- hm
    1202 1194 1156 1170 1148
    21 Cross Sp UUGUGCUGGGCCACUUCAU AUGAAGUGGCCCAGCACAA 489-507 481-499 462-475 hm
    22 Cross Sp GAACUUCCACUGCUGGGUG CACCCAGCAGUGGAAGUUC 1096- 1088- 1056- 1064- 1042- hm
    1114 1106 1070 1082 1060
    23 Cross Sp GGAACUUCCACUGCUGGGU ACCCAGCAGUGGAAGUUCC 1095- 1087- 1051- 1063- 1041- hm
    1113 1105 1069 1081 1059
    24 Cross Sp ACUUCCACUGCUGGGUGGA UCCACCCAGCAGUGGAAGU 1098- 1090- 1056- 1066- 1044- hm
    1116 1108 1072 1084 1062
    25 Cross Sp CGAGAUGAUCUGGAACUUC GAAGUUCCAGAUCAUCUCG 1084- 1076- 1040- 1052- 1030- hm
    1102 1094 1054 1070 1048
    26 Cross Sp AUGAUCUGGAACUUCCACU AGUGGAAGUUCCAGAUCAU 1088- 1080- 1044- 1056- 1034- hm
    1106 1098 1062 1074 1052
    27 Cross Sp UUUGUGCUGGGCCACUUCA UGAAGUGGCCCAGCACAAA 488-506 480-498 462-474 hm
    28 Cross Sp GAUGAUCUGGAACUUCCAC GUGGAAGUUCCAGAUCAUC 1087- 1079- 1043- 1055- 1033- hm
    1105 1097 1061 1073 1051
    29 Cross Sp UGGAAGUUCCACUGCUGGG CCCAGCAGUGGAAGUUCCA 1094- 1086- 1050- 1062- 1040- hm
    1112 1104 1068 1080 1058
    30 Cross Sp CUUUGUGCUGGGCCACUUC GAAGUGGCCCAGCACAAAG 487-505 479-497 462-473 hm
    31 Cross Sp GCUUUGUGCUGGGCCACUU AAGUGGCCCAGCACAAAGC 486-504 478-496 462-472 hm
    32 Cross Sp UCAGCACUAAGAGCGUGGG CCCACGCUCUUAGUGCUGA 1377- 1369- 1333- hr
    1395 1387 1351
    33 Cross Sp AGAUCAGCACUAAGAGCGU ACGCUCUUAGUGCUGAUCU 1374- 1366- 1330- hr
    1392 1381 1348
    34 Cross Sp GAAGAUCAGCACUAAGAGC GCUCUUAGUGCUGAUCUUC 1372- 1364- 1328- 1318- hr
    1390 1381 1346 1329
    35 Cross Sp GAUCAGCACUAAGAGCGUG CACGCUCUUAGUGCUGAUC 1375- 1367- 1331- hr
    1393 1381 1349
    36 Cross Sp AGUAUGGCCAGUGCUGGGU ACCCAGCACUGGCCAUACU 918-936 918-928 874-892 886-904 864-882 hr
    37 Cross Sp AAGUAUGGCCAGUGCUGGG CCCAGCACUGGCCAUACUU 917-935 873-891 885-903 863-881 hr
    38 Cross Sp AUCAGCACUAAGAGCGUGG CCACGCUCUUAGUGCUGAU 1376- 1368- 1332- hr
    1394 1386 1350
    39 Cross Sp AAGAUCAGCACUAAGAGCG CCCUCUUAGUGCUGAUCUU 1373- 1365- 1329- 1319- hr
    1391 1381 1347 1329
    40 Cross Sp GGAUCCUAGACAUCUGCCU AGGCAGAUGUCUAGGAUCC 663-681 609-627 hc
    41 Cross Sp CGCUGGGACAACAACUACG CGUAGUUGUUGUCCCAGCG 818-836 810-826 774-787 786-803 764-782 hc
    42 Cross Sp CUUGGAAUUUUGGGCAGUU AACUGCCCAAAAUUCCAAG 636-654 628-646 592-610 582-600 hc
    43 Cross Sp GUCAACUGCAACGAUGACC GGUCAUCGUUGCAGUUGAC 782-800 774-792 738-756 750-760 728-746 hc
    44 Cross Sp CAAGAACAUACCUUGGAAU AUUCCAAGGUAUGUUCUUG 625-643 599-610 571-589 hc
    45 Cross Sp CUCAUCGAGUACUUCCGCA UGCGGAAGUACUCGAUGAG 1034- 1026- 990- 1002- 980-998 hc
    1052 1042 1006 1018
    46 Cross Sp GCAUGGUCAACUGCAACGA UCGUUGCAGUUGACCAUGC 777-795 770-784 733-748 746-760 723-741 hc
    47 Cross Sp CGGAUGCUGUGUACCUGGA UCCAGGUACACAGCAUCCG 534-552 480-498 hc
    48 Cross Sp CCAUGACCAGAACAGCAAC GUUGCUGUUCUGGUCAUGG 1012- 1008- 972-986 984-998 958-976 hc
    1030 1022
    49 Cross Sp ACAUACCUUGGAAUUUUGG CCAAAAUUCCAAGGUAUGU 630-648 599-610 576-594 hc
    50 Cross Sp UCGAGUACUUCCGCAAUGA UCAUUGCGGAAGUACUCGA 1038- 1030- 994- 1006- 984- hc
    1056 1048 1006 1018 1002
    51 Cross Sp AUGGUCAACUGCAACGAUG CAUCGUUGCAGUUGACCAU 779-797 771-789 735-753 747-760 725-743 hc
    52 Cross Sp ACCUUGGAAUUUUGGGCAG CUGCCCAAAAUUCCAAGGU 634-652 580-598 hc
    53 Cross Sp CAAGUUCAUCAAGAACAUA UAUGUUCUUGAUGAACUUG 616-634 608-621 572-585 584-595 562-580 hc
    54 Cross Sp UUCAUCAAGAACAUACCUU AAGGUAUGUUCUUGAUGAA 620-638 566-584 hc
    55 Cross Sp AUACCUUGGAAUUUUGGGC GCCCAAAAUUCCAAGGUAU 632-650 600-610 578-596 hc
    56 Cross Sp AGUACUUCCGCAAUGAGUU AACUCAUUGCGGAAGUACU 1041- 987- hc
    1059 1005
    57 Cross Sp UGGGUGGAGUCGUGGAUGA UCAUCCACGACUCCACCCA 1109- 1101- 1065- 1077- 1055- hc
    1127 1119 1083 1095 1073
    58 Cross Sp CCCAUGACCAGAACAGCAA UUGCUGUUCUGGUCAUGGG 1011- 1003- 967-985 979-997 957-975 hc
    1029 1021
    59 Cross Sp CCAAGUUCAUCAAGAACAU AUGUUCUUCAUGAACUUGG 615-633 608-621 572-585 583-595 561-579 hc
    60 Cross Sp GUCAACCCCAAGUUCCUGA UCAGGAACUUGGGGUUGAC 695-713 690-705 654-669 665-681 641-659 hc
    61 Cross Sp AUCAAGAACAUACCUUGGA UCCAAGGUAUGUUCUUGAU 623-641 599-609 569-587 hc
    62 Cross Sp UGGUCAACUGCAACGAUGA UCAUGGUUGCAGUUGACCA 780-798 772-790 736-754 748-760 726-744 hc
    63 Cross Sp CAUGGUCAACUGCAACGAU AUCGUUGCAGUUGACCAUG 778-796 770-784 734-748 746-760 724-742 hc
    64 Cross Sp UGGAAUUUUGGGCAGUUUG CAAACUGCCCAAAAUUCCA 638-656 630-646 594-612 584-602 hc
    65 Cross Sp ACUGCAACGAUGACCAGGG CCCUGGUCAUCGUUGCAGU 786-804 778-796 742-760 732-750 hc
    66 Cross Sp AUCCUAGACAUCUGCCUGA UCAGGCAGAUGUCUAGGAU 665-683 611-629 hc
    67 Cross Sp CAACUGCAACGAUGACCAG CUGGUCAUCGUUGCAGUUG 784-802 730-748 hc
    68 Cross Sp GGAAUUUUGGGCAGUUUGA UCAAACUGCCCAAAAUUCC 639-657 631-646 595-613 615-625 585-603 hc
    69 Cross Sp AGCGGAUGCUGUGUACCUG CAGGUACACAGCAUCCGCU 532-550 500-511 478-496 hc
    70 Cross Sp UUUGCCCACAUCACCAACA UGUUGGUGAUGUGGGCAAA 1574- 1566- 1530- 1520- hc
    1592 1577 1541 1538
    71 Cross Sp AAGAACAUACCUUGGAAUU AAUUCCAAGGUAUGUUCUU 626-644 599-610 572-590 hc
    72 Cross Sp UCCUAGACAUCUGCCUGAU AUCAGGCAGAUGUCUAGGA 666-684 612-630 hc
    73 Cross Sp CGAGUACUUCCGCAAUGAG CUCAUUGCGGAAGUACUCG 1039- 1031- 995- 1007- 985- hc
    1057 1049 1006 1018 1003
    74 Cross Sp UGUCAACCCCAAGUUCCUG CAGGAACUUGGGGUUGACA 694-712 690-704 654-668 665-680 640-658 hc
    75 Cross Sp GACGUCUUUGCCCACAUCA UGAUGUGGGCAAAGACGUC 1568- 1560- 1524- 1514- hc
    1586 1577 1541 1532
    76 Cross Sp GAUGCUGUGUACCUGGACU AGUCCAGGUACACACCAUC 536-554 —482-500 hc
    77 Cross Sp AGAACAUACCUUGGAAUUU AAAUUCCAAGGUAUGUUCU 627-645 599-610 573-591 hc
    78 Cross Sp ACGUCUUUGCCCACAUCAC GUGAUGUGGGCAAAGACGU 1569- 1561- 1525- 1515- hc
    1587 1577 1541 1533
    79 Cross Sp AUCGAGUACUUCCGCAAUG CAUUGCGGAAGUACUCGAU 1037- 1029- 993- 1005- 983- hc
    1055 1047 1006 1018 1001
    80 Cross Sp AAGUUCAUCAAGAACAUAC GUAUGUUCUUGAUGAACUU 617-635 609-621 573-585 585-595 563-581 hc
    81 Cross Sp UGGAGUCGUGGAUGACCAG CUGGUCAUCCACGACUCCA 1113- 1105- 1069- 1081- 1059- hc
    1131 1123 1087 1099 1077
    82 Cross Sp GUGACAAGAGCGAGAUGAU AUCAUCUCGCUCUUGUCAC 1074- 1069- 1033- 1045- 1020- hc
    1092 1084 1048 1060 1038
    83 Cross Sp UCAUCGAGUACUUCCGCAA UUGCGGAAGUACUCGAUGA 1035- 1027- 991- 1003- 981-999 hc
    1053 1042 1006 1018
    84 Cross Sp GUUCGUGCCAUCAAGGAGG CCUCCUUGAUGGCACGAAC 1226- 1224- 1188- 1194- 1172- hc
    1244 1236 1200 1212 1190
    85 Cross Sp CAUCAAGAACAUACCUUGG CCAAGGUAUGUUCUUGAUG 622-640 568-586 hc
    86 Cross Sp UACCUUGGAAUUUUGGGCA UGCCCAAAAUUCCAAGGUA 633-651 579-597 hc
    87 Cross Sp GACAAGAGCGAGAUGAUCU AGAUCAUCUCGCUCUUGUC 1076- 1069- 1033- 1045- 1022- hc
    1094 1086 1050 1062 1040
    88 Cross Sp CGUCUUUGCCCACAUCACG GGUGAUGUGGGCAAAGACG 1570- 1566- 1530- 1516- hc
    1588 1577 1541 1534
    89 Cross Sp AUGCUGUGUACCUGGACUC GAGUCCAGGUACACAGCAU 537-555 483-501 hc
    90 Cross Sp UUGGAAUUUUGGGCAGUUU AAACUGCCCAAAAUUCCAA 637-655 629-646 593-611 583-601 hc
    91 Cross Sp GCCAAGUUCAUCAAGAACA UGUUCUUGAUGAACUUGGC 614-632 608-621 572-585 582-595 560-578 hc
    92 Cross Sp AGUUCAUCAAGAACAUACC GGUAUGUUCUUGAUGAACU 618-636 610-621 574-585 564-582 hc
    93 Cross Sp GUCUUUGCCCACAUCACCA UGGUGAUGUGGGCAAAGAC 1571- 1566- 1530- 1517- hc
    1589 1577 1541 1535
    94 Cross Sp GGGAUCCUAGACAUCUGCC GGCAGAUGUCUAGGAUCCC 662-680 608-626 hc
    95 Cross Sp GAUCCUAGACAUCUGCCUG CAGGCAGAUGUCUAGGAUC 664-682 610-628 hc
    96 Cross Sp AUGUCAACCCCAAGUUCCU AGGAACUUGGGGUUGACAU 693-711 690-703 649-667 665-679 639-657 hc
    97 Cross Sp UCAUCAAGAACAUACCUUG CAAGGUAUGUUCUUGAUGA 621-639 567-585 hc
    98 Cross Sp UCAAGAACAUACCUUGGAA UUCCAAGGUAUGUUCUUGA 624-642 599-610 570-588 hc
    99 Cross Sp CAUCGAGUACUUCCGCAAU AUUGCGGAAGUACUCGAUG 1036- 1028- 992- 1004- 982- hc
    1054 1042 1005 1018 1000
    100 Cross Sp GGAUGCUGUGUACCUGGAC GUCCAGGUACACAGGAUCC 535-553 481-499 hc
    101 Cross Sp GAUGUCAACCCCAAGUUCC GGAACUUGGGGUUGACAUC 692-710 690-702 648-666 665-678 638-656 hc
    102 Cross Sp CAUGACCAGAACAGCAACC GGUUGCUGUUCUGGUCAUG 1013- 1008- 972-987 984-999 959-977 hc
    1031 1023
    103 Cross Sp GCCCAUGACCAGAACAGCA UGCUGUUCUGGUCAUGGGC 1010- 1002- 966-984 978-996 956-974 hc
    1028 1020
    104 Cross Sp GAACAUACCUUGGAAUUUU AAAAUUCCAAGGUAUGUUC 628-646 599-610 574-592 hc
    105 Cross Sp GUGGAGUCGUGGAUGACCA UGGUCAUCCACGACUCCAC 1112- 1080- 1058- hc
    1130 1098 1076
    106 Cross Sp UCAACUGCAACGAUGACCA UGGUCAUCGUUGCAGUUGA 783-801 729-747 hc
    107 Cross Sp AUUUUGGGCAGUUUGAAGA UCUUCAAACUGCCCAAAAU 642-660 636-646 600-613 615-628 588-606 hc
    108 Cross Sp AACAUACCUUGGAAUUUUG CAAAAUUCCAAGGUAUGUU 629-647 599-610 575-593 hc
    109 Cross Sp UGACAAGAGCGAGAUGAUC GAUCAUCUCGCUCUUGUCA 1075- 1069- 1033- 1045- 1021- hc
    1093 1085 1049 1061 1039
    110 Cross Sp UUCGUGCCAUCAAGGAGGG CCCUCCUUGAUGGCACGAA 1227- 1224- 1188- 1195- 1173- hc
    1245 1237 1201 1213 1191
    111 Cross Sp UCAGCCCCAUGUCCUGGAU AUCCAGGACAUGGGGCUGA 846-864 814-832 792-810 hc
    112 Cross Sp GGUCAACUGCAACGAUGAC GUCAUCGUUGCAGUUGACC 781-799 773-791 737-755 749-760 727-745 hc
    113 Cross Sp AAUUUUGGGCAGUUUGAAG CUUCAAACUGCCCAAAAUU 641-659 636-646 600-613 615-627 587-605 hc
    114 Cross Sp CAGCGGAUGCUGUGUACCU AGGUACACAGCAUCCGCUG 531-549 499-511 477-495 hc
    115 Cross Sp AACUGCAACGAUGACCAGG CCUGGUCAUCGUUGCAGUU 785-803 731-749 hc
    116 Cross Sp AUGACCAGAACAGCAACCU AGGUUGCUGUUCUGGUCAU 1014- 1008- 972-988 984- 960-978 hc
    1032 1024 1000
    117 Cross Sp CAUACCUUGGAAUUUUGGG CCCAAAAUUCCAAGGUAUG 631-649 599-610 577-595 hc
    118 Cross Sp CUUUGCCCACAUCACCAAC GUUGGUGAUGUGGGCAAAG 1573- 1566- 1530- 1519- hc
    1591 1577 1541 1537
    119 Cross Sp GAGUACUUCCGCAAUGAGU ACUCAUUGCGGAAGUACUC 1040- 1032- 996- 1008- 986- hc
    1058 1050 1006 1018 1004
    120 Cross Sp GGCAUGGUCAACUGCAACG CGUUGCAGUUGACCAUGCC 776-794 770-784 732-748 746-760 722-740 hc
    121 Cross Sp UCUUUGCCCACAUCACCAA UUGGUGAUGUGGGCAAAGA 1572- 1566- 1530- 1518- hc
    1590 1577 1541 1536
    122 Cross Sp GAAUUUUGGGCAGUUUGAA UUCAAACUGCCCAAAAUUC 640-658 636-646 600-613 615-626 586-604 hc
    123 Cross Sp CCUUGGAAUUUUGGGCAGU ACUGCCCAAAAUUCCAAGG 635-653 581-599 hc
    124 Cross Sp GUUCAUCAAGAACAUACCU AGGUAUGUUCUUGAUGAAC 619-637 611-621 575-585 565-583 hc
    125 Cross Sp UGUAUCGCCUCAGCCUGGA UCCAGGCUGAGGCGAUACA 441-459 402-415 409-427 3571- hg
    3582
    126 Cross Sp GCUCGGCCAAGUUCAUCAA UUGAUGAACUUGGCCGAGC 609-627 608-619 572-583 577-595 555-573 hg
    127 Cross Sp GGCUCGGCCAAGUUCAUCA UGAUGAACUUGGCCGAGCC 608-626 608-618 572-582 576-594 554-572 hg
    128 Cross Sp GGACGCUGGGACAACAACU AGUUGUUGUCCCAGCGUCC 815-833 810-825 774-787 783-801 764-779 hg
    129 Cross Sp GGCAGUUUGAAGAUGGGAU AUCCCAUCUUCAAACUGCC 648-666 616-634 594-612 hg
    130 Cross Sp AGUUUGAAGAUGGGAUCCU AGGAUCCCAUCUUCAAACU 651-669 607-625 619-637 hg
    131 Cross Sp CAGUUUGAAGAUGGGAUCC GGAUCCCAUCUUCAAACUG 650-668 618-636 596-614 hg
    132 Cross Sp AGGGCUCGGCCAAGUUCAU AUGAACUUGGCCGAGCCCU 606-624 574-592 552-570 hg
    133 Cross Sp GCAGUUUGAAGAUGGGAUC GAUCCCAUCUUCAAACUGC 649-667 617-635 595-613 hg
    134 Cross Sp CAACCCCAAGUUCCUGAAG CUUCAGGAACUUGGGGUUG 697-715 690-707 654-671 665-683 643-659 hg
    135 Cross Sp GGGCAGUUUGAAGAUGGGA UCCCAUCUUCAAACUGCCC 647-665 603-621 615-633 593-611 hg
    136 Cross Sp ACGCUGGGACAACAACUAC GUAGUUGUUGUCCCAGCGU 817-835 810-826 774-787 785-803 764-781 hg
    137 Cross Sp UACUGCUGUGGCCCAGUUC GAACUGGGCCACAGCAGUA 1205- 1197- 1161- 1173- 1151- hg
    1223 1213 1177 1191 1169
    138 Single UUGCCCACAUCACCAACAA UUGUUGGUGAUGUGGGCAA 1575- 1567- 1531- 1521- h
    Sp 1593 1577 1541 1538
    139 Single CCAAGUACCUGCUCAACCU AGGUUGAGCAGGUACUUGG 1677- 1660- h
    Sp 1695 1672
    140 Single CGGCCAAGUUCAUCAAGAA UUCUUGAUGAACUUGGCCG 612-630 608-621 572-585 580-595 560-576 h
    Sp
    141 Single CGAUGGGUCUGUGCACAAA UUUGUGCACAGACCCAUCG 1324- 1317- 1281- h
    Sp 1342 1334 1298
    142 Single CAGUGACUUUGACGUCUUU AAAGACGUCAAAGUCACUG 1558- 1517- 1535- h
    Sp 1576 1528 1553
    143 Single GCAUGAACAUGGGCAGUGA UCACUGCCCAUGUUCAUGC 1545- 1530-1540 h
    Sp 1563 1540
    144 Single CAACUACGAGGCCAGUGUA UACACUGGCCUCGUAGUUG 244-262 239-250 h
    Sp
    145 Single CAUGGGCAGUGACUUUGAC GUCAAAGUCACUGCCCAUG 1552- 1530- h
    Sp 1570 1547
    146 Single GCCCACAUCACCAACAACA UGUUGUUGGUGAUGUGGGC 1577- 1523- h
    Sp 1595 1538
    147 Single CGAACCACCUGAACAAACU AGUUUGUUCAGGUGGUUCG 1476- 1470- 1434- 1424- h
    Sp 1494 1486 1450 1440
    148 Single GGCCCGUUUUCCACUAAGA UCUUAGUGGAAAACGGGCC 322-340 h
    Sp
    149 Single UGACGUCUUUGCCCACAUC GAUGUGGGCAAAGACGUCA 1567- 1560- 1523- 1514- h
    Sp 1585 1577 1541 1531
    150 Single GAACAUGGGCAGUGACUUU AAAGUCACUGCCCAUGUUC 1549- 1530- h
    Sp 1567 1544
    151 Single GCAGUGACUUUGACGUCUU AAGACGUCAAAGUCACUGC 1557- 1517- 1534- h
    Sp 1575 1528 1552
    152 Single CUGUGUUCCUGGAGCAUUU AAAUGCUCCACGAACACAG 1724- h
    Sp 1742
    153 Single CAACCUGGAGCCUUUCUCU AGAGAAAGGCUCCAGGUUG 1696- 1105- h
    Sp 1714 1115
  • TABLE C
    Guinea-
    human mouse rat pig Cow
    No Method Sense siRNA AntiSense siRNA 39777598 31543859 42476286 387604 31343554 file
    1 Single Sp CUAGACAUCUGCCUGAUCCUU AAGGAUCAGGCAGAUGUCUAG 668-688 614-630 hmrgc
    2 Single Sp CAACUGACAACAUGCUAGGUA UACCUAGCAUGUUGUCAGUUG 1752- hmrgc
    1172
    3 Single Sp CCAAGUUCAUCAAGAACAUAC GUAUGUUCUUGAUGAACUUGG 615-635 608-621 572-585 583-595 561-581 hmrgc
    4 Single Sp CCUGAUCCUUCUAGAUGUCAA UUCACAUCUAGAAGGAUCAGG 679-699 hmrgc
    5 Cross Sp ACAAGAGCGAGAUGAUCUGGA UCCAGAUCAUCUCGCUCUUGU 1077- 1069- 1033- 1045- 1023- hmrgc
    1097 1089 1053 1065 1043
    6 Single Sp CAAGAACAUACCUUGGAAUUU AAAUUCCAAGGUAUGUUCUUG 625-645 599-610 571-591 hmrgc
    7 Single Sp CGGCCAAGUUCAUCAAGAACA UGUUCUUGAUGAACUUGGCCG 612-632 608-621 572-585 580-595 560-578 hmrgc
    8 Single Sp CUGUGUUCCUGGAGCAUUUGU ACAAAUGCUCCAGGAACACAG 1724- hmrgc
    1744
    9 Cross Sp CAAGAGCGAGAUGAUCUGGAA UUCCAGAUCAUCUCGCUCUUG hmrgc
    10 Single Sp CAACUACGAGGCCAGUGUAGA UCUACACUGGCCUCGUAGUUG 244-264 239-250 hmrgc
    11 Single Sp GGCCCGUUUUCCACUAAGAGA UCUCUUAGUGGAAAACGGGCC 322-342 hmrgc
    12 Single Sp GCAACCUUCUCAUCGAGUACU AGUACUCGAUGAGAAGGUUGC 1026- 1018- 982- 994- 972-992 hmrgc
    1046 1038 1002 1014
    13 Cross Sp CGAGAUGAUCUGGAACUUCCA UGGAAGUUCCAGAUCAUCUCG 1084- 1076- 1040- 1052- 1030- hm
    1104 1096 1060 1072 1050
    14 Cross Sp ACUUCCACUGCUGGGUGGAGU ACUCCACCCAGCAGUGGAAGU 1098- 1090- 1056- 1066- 1044- hm
    1118 1110 1074 1086 1064
    15 Cross Sp AACCCCAAGUUCCUGAAGAAC GUUCUUCAGGAACUUGGGGUU 698-718 690-710 654-671 666-685 644-659 hm
    16 Cross Sp AUGAUCUGGAACUUCCACUGC GCAGUGGAAGUUCCAGAUCAU 1088- 1080- 1044- 1056- 1034- hm
    1108 1100 1064 1076 1054
    17 Cross Sp GAACUUCCACUGCUGGGUGGA UCCACCCAGCAGUGGAAGUUC 1096- 1088- 1056- 1064- 1042- hm
    1116 1108 1072 1084 1062
    18 Cross Sp UGGAACUUCCACUGCUGGGUG CACCCAGCAGUGGAAGUUCCA 1094- 1086- 1050- 1062- 1040- hm
    1114 1106 1070 1082 1060
    19 Cross Sp AGCGAGAUGAUCUGCAACUUC GAAGUUCCAGAUCAUCUCGCU 1082- 1074- 1038- 1050- 1028- hm
    1102 1094 1054 1070 1048
    20 Cross Sp GAUGAUCUGGAACUUCCACUG CAGUGGAAGUUCCAGAUCAUC 1087- 1079- 1043- 1055- 1033- hm
    1107 1099 1063 1075 1053
    21 Cross Sp AGAGCGAGAUGAUCUGGAACU AGUUCCAGAUCAUCUCGCUCU 1080- 1072- 1036- 1048- 1026- hm
    1100 1092 1054 1068 1046
    22 Cross Sp CUGGAACUUCCACUGCUGGGU ACCCAGCAGUGGAAGUUCCAG 1093- 1085- 1049- 1061- 1039- hm
    1113 1105 1069 1081 1059
    23 Cross Sp UGAUCUGGAACUUCCACUGCU AGCAGUGGAAGUUCCAGAUCA 1089- 1081- 1057- 1035- hm
    1109 1101 1077 1055
    24 Cross Sp AAGAGCGAGAUGAUCUGGAAC GUUCCAGAUCAUCUCGCUCUU 1079- 1071- 1035- 1047- 1025- hm
    1099 1091 2054 1067 1045
    25 Cross Sp CAGCUUUGUGCUGGGCCACUU AAGUGGCCCAGCACAAAGCUG 484-504 476-496 452-472 hm
    26 Cross Sp GCUUUGUGCUGGGCCACUUCA UGAAGUGGCCCAGCACAAAGC 486-506 478-498 462-474 hm
    27 Cross Sp AGAUGAUCUGGAACUUCCACU AGUGGAAGUUCCAGAUCAUCU 1086- 1078- 1042- 1054- 1032- hm
    1106 1098 1062 1074 1052
    28 Cross Sp CUUUGUGCUGGGCCACUUCAU AUGAAGUGGCCCAGCACAAAG 487-507 479-499 462-475 hm
    29 Cross Sp GCGAGAUGAUCUGGAACUUCC GGAAGUUCCAGAUCAUCUCGC 1083- 1075- 1039- 1051- 1029- hm
    1103 1095 1059 1071 1049
    30 Cross Sp AUCUGGAACUUCCACUGCUGG CCAGCAGUGGAAGUUCCAGAU 1091- 1083- 1047- 1059- 1037- hm
    1111 1103 1067 1079 1057
    31 Cross Sp UCUGGAACUUCCACUGCUGGG CCCAGCAGUGGAAGUUCCAGA 1092- 1084- 1048- 1060- 1038- hm
    1112 1104 1068 1080 1058
    32 Cross Sp GAUCUGGAACUUCCACUGCUG CAGCAGUGGAAGUUCCAGAUC 1090- 1082- 1046- 1058- 1036- hm
    1110 1102 1066 1078 1056
    33 Cross Sp GAGAUGAUCUGGAACUUCCAC GUGGAAGUUCCAGAUCAUCUC 1085- 1077- 1041- 1053- 1031- hm
    1105 1097 1061 1073 1051
    34 Cross Sp AGCUUUGUGCUGGGCCACUUC GAAGUGGCCCAGCACAAAGCU 485-505 477-497 453-473 hm
    35 Cross Sp GAGCGAGAUGAUCUGGAACUU AAGUUCCAGAUCAUCUCGCUC 1081- 1073- 1037- 1049- 1027- hm
    1101 1093 1054 1069 1047
    36 Cross Sp AACUUCCACUGCUGGGUGGAG CUCCACCCAGCAGUGGAAGUU 1097- 1089- 1056- 1065- 1043- hm
    1117 1109 1073 1085 1063
  • Example 2
  • Testing the siRNA Compounds for Anti-TGaseII Activity
  • 1. Preparation of working solutions of siRNAs (double-stranded oligonucleotides)
  • Lyophilized oligonucleotides were dissolved in RNAse-free double-distilled water to produce a final concentration of 100 uM. The diluted oligonucleotides were kept at room temperature for 15 min and immediately frozen in liquid nitrogen. The oligonucleotides were stored at −80° C. and diluted before use with PBS.
  • II. Establishment of NRK49 cell line stably overexpressing rat TGaseII
  • The full length cDNA of rat TGaseII cloned in PLXSN vector (CLONTECH) was used for transfection into a Rat1 fibroblast cell line. Lipofectamine reagent (Invitrogen) was used as the transfection reagent using the protocol described below. 48 hr following transfection, selection of stable clones was performed using G418 antibiotic (neomycin). The stable overexpression of TGaseII in this polyclonal population was verified by Western blotting and TGaseII activity assay. The cells were designated as NRK49-TGaseII (TGASE-OE®).
  • III Activity assay for TGaseII in NRK49
  • 4×103NRK49-rat TGASE-OE cells were seeded per well in a 96 well plate. TGaseII activity was measured using a cell-based assay for TGaseII activity. Briefly, the growth medium was replaced with cell labeling medium (DMEM in 0.1% BSA, 25 uM BC, 10 uM Calcimycin, 16.2 mM CaCl2) for 45 min at 37° C. 45 min later, the cells were fixed with 4% formaldehyde, treated with 0.6% H2O2 and stained with Netravidin-HRP Ab in order to test the cross-linking of biotin-labeled cadaverin. The absorbance was read at λ=450 nm. For normalization, the cells were stained with Hoechst dye solution. The activity of TGaseII is 75 fold higher in NRK49-TGaseII cells compared to NRK49 control cells.
  • IV. Transfection by siRNA oligonucleotides using Lipofectamine2000 reagent
  • 2×105 cells were seeded per well in 6 well-plates. After 24 hrs, the cells were transfected with TGaseII specific siRNA oligonucleotides using Lipofectamine2000 reagent (Invitrogen) according to the following procedure:
      • 1. Before transfection, the cell medium was replaced with 1500 ul of fresh medium without antibiotics.
      • 2. In a sterile plastic tube, Lipofectamine2000 reagent (the amount is calculated according to 5 ul per well) was added to 250 ul of serum-free medium, and incubated for 5 min at room temperature.
      • 3. In another tube, the siRNA oligonucleotides (varying amounts to fit the desired final concentration per well) were added to 250 ul of serum-free medium.
  • 4. Lipofectamine2000 complex was combined with the siRNA solution and incubated for 20 min at room temperature.
      • 5. The resulting mixture was added dropwise to the cells, and the cells were incubated at 37° C. until analysis of siRNA activity.
  • V. Testing the activity of anti TGaseII siRNAs in transfected human, mouse and rat cells
  • The activity of TGaseII siRNAs listed in Table A was tested in 3 different cell lines originating from different species:
      • 1. Mouse-specific TGaseII siRNAs were tested in mouse cells, which express mouse TGaseII-NMUMG cells.
      • 2. Human-specific TGaseII siRNA were tested in human HeLa cells which express human TgaseII;see FIG. 3.
      • 3. Rat-specific TGaseII siRNAs were tested in NRK49 overexpressing rat TGaseII (TGASE-OE® cells).
  • 48 h to 6 days after transfection of siRNAs, the cells were harvested and expression of TGaseII protein was examined by Western blot analysis with specific antibodies. The decrease in TGaseII polypeptide expression in the cells transfected with siRNA oligonucleotides specific to TGaseII as compared to controls indicated that siRNAs elicited inhibitory effect on TGaseII protein expression, which can be quantified.
  • Table D below summarizes the information about TGaseII inhibitory activity of each siRNA oligonucleotide. The names of oligonucleotides in Table D correspond to the names used in Table A. Note that the comparison is to the activity in each cell line transfected by different siRNAs, and not between cell lines. The presently most preferred human siRNA is TG_HMRG1, which elicited high TGaseII inhibitory effect and also inhibited mouse, rat and guinea pig TGaseII. Other preferred human siRNAs are TG_HMG1 and TG_HM1.
    TABLE D
    Human Mouse Rat
    name Species TGII TGII TGII
    TG_HMR1 hum_mus_rat + +
    TG_HMRG1 hum_mus_rat_GP ++++ +++ ++++
    TG_HMG1 hum_mus_GP ++++ + ND
    TG_HMG2 hum_mus_GP ++++ ++++ ND
    (toxic) (toxic)
    TG_HM1 hum_mus ++++ + ND
    TG_M1 Mus + +++ ND
    TG_M2 Mus +++ ND
    TG_M3 Mus +++ ++++ ND
    TG_M4 mus_rat ND ++ ++
    TG_M5 mus_rat +++ +++ +++
    TG_M6 mus_rat ND ++ +++
    TG_M7 mus_rat ND ++ ++++
    TG_M8 mus_rat ND ++ ++
    TG_M9 mus_rat +++ +++ +++
    TG_M10 mus_rat ND + +++
    TG_H1 Hum ND ND
    TG_H2 Hum ND ND
    TG_HG1 hum_GP ++ ND ND
  • Example 3
  • Animal Models of Kidney Fibrosis
  • Testing of the in vivo therapeutic activity of anti-TGaseII siRNAs, or of neutralizing antibodies against TGaseII or of other TGaseII inhibitors may be done in the following animal models of kidney fibrosis in which disease-associated overexpression of TGaseII was found (as detected by in situ hybridization; see below).
  • A. Rat Diabetic and Aging Models of Kidney Fibrosis
  • Al. ZDF Rats
  • Kidney samples of 9-month-old ZDF rats (Zucker diabetic fatty rats) presented hydronephrotic changes with dilated calyces. Microscopically these samples displayed the features of glomerulosclerosis and tubulointerstitial fibrosis. In accordance with these morphological changes, the expression of fibrosis marker genes (osteopontin (OPN), transforming growth factor β1 (TGF-β1) and procollagen α1(1) (Coll)), as measured by in situ hybridization, was significantly increased compared to normal kidneys. Strong OPN expression was detectable in all tubular structures in both kidney cortex and medulla. TGF-β1 expression was widespread throughout interstitial cells. Some epithelial cells also showed TGF-β1 expression. Coll expression was detectable by in situ hybridization in most interstitial cells within the medulla, while cortical expression was “focal”.
  • A2. Aged fa/fa (Obese Zucker) Rats
  • Fa/fa rats are are genetically deficient for leptin receptor; and, as a result, develop insulin resistant diabetes (type II diabetes) with progressive diabetic nephropathy, Kidney samples of 12-month-old fa/fa rats presented with high degree glomerulosclerosis and diffuse tubulointerstitial fibrosis throughout both the cortex and the medulla. The pattern of fibrosis marker gene expression corresponded to the morphological changes. OPN was expressed in tubular structures in the cortex and in the medulla. Multiple interstitial cells expressed TGF-β1. Significantly, multiple foci and single interstitial cells showed strong Coll expression in both cortex and medulla so that the number of Coll-expressing cells appeared to be higher in fa/fa kidney samples than in ZDF samples.
  • A3. Aged Sprague-Dawley (SD) (Normal) Rats
  • Kidney samples of aged SD rats also showed increased accumulation of collagen in glomeruli and interstitial space and increased expression of fibrosis marker genes. Significantly, the intensity of fibrotic changes varied among samples. Thus, one of the four samples studied displayed very few changes compared with young animals; in the second sample, fibrotic changes were confined only to “polar” regions, and the remaining two samples displayed uniform accumulation of collagen and elevated expression of marker genes throughout the sections
  • A4. Goto Kakizaki (GK)48-week-old Rats
  • GK rats are an inbred strain derived from Wistar rats, selected for spontaneous development of NIDDM (diabetes type II). Kidney samples from both GK and control Wistar 48-week-old rats showed accumulation of collagen in glomeruli and interstitial space. This accumulation was more pronounced in the GK samples.
  • TGaseII Hybridization Pattern
  • TGaseII-specific hybridization signal was associated with fibrotic phenotype (diffuse or focal) in kidneys of both healthy and diabetic rats. Non-fibrotic kidney samples demonstrate a diffuse, low but detectable TGaseII-specific hybridisation signal over proximal tubules. By 12 months of age, a stronger signal is concentrated over interstitial cells and epithelial lining of distended tubules that show clear signs of atrophy. In chronic renal failure sample (kidney from two years old rat), a strong TGaseII expression is visible in tubular profiles lined by atrophic or proliferating epithelium cells within surrounding interstitium. Similarily, ZDF samples showed intensification of the hybridization signal along with the progression of the fibrosis (or aging).
  • B. Induced Models of Kidney Fibrosis
  • B. Permanent Unilateral Ureteral Obstruction (UUO) Model
  • Unilateral ureteral obstruction (UUO) is a model of acute interstitial fibrosis occurring in healthy non-diabetic animals. Renal fibrosis develops within days following the obstruction.
  • To produce the model, rats were anaesthetized with Ketamin/Xylazine and the abdominal cavity was opened. After exposure, the right ureter was ligated with a suture at the level of the lower kidney pole. In sham-operated rats, the ureter was exposed but not ligated. The study was terminated at different timepoints following ureteral obstruction (e.g., at 24 hr, 5 days, 10 days, 15 days, 20 days and 25 days), and the kidneys were removed and examined.
  • Histological examination revealed that permanent UUO results in a rapid activation of collagen synthesis by interstitial cells in both medulla and cortex. By 20-25 days of UUO, significant amounts of interstitial collagen were deposited in the interstitial space, whereas glomerular accumulation of collagen was confined to the outer capsule.
  • situ hybridization analysis of obstructed kidney samples indicated rapid and significant changes in the pattern of TGaseII expression dependent on the duration of UUO. After 24 hours of UUO, a very strong hybridization signal was detected over cortical tubular epithelium, whereas medullar epithelial cells showed much weaker signal. At 5 and 10 days of UUO, the “foci” of strong hybridization signal were associated with the areas of developing tubulointerstitial fibrosis where the signal was located to both epithelial and interstitial cells. Similar results were observed in mice exposed to the same UUO model.
  • B2. 5/6 Nephrectomy
  • 5/6 nephrectomy is another useful animal model for chronic renal insufficiency (CRI) in which fibrosis is evident.
  • In summary, the results suggest that an increase in TGaseII expression and activity level accompanies fibrotic changes in the kidneys.
  • Example 4
  • Establishment of TGaseII Role in Renal Fibrosis Employing the UUO Model Using TGaseII Knock-out Mice
  • TgaseII knock-out mice were obtained from Dr. Melino (De Laurenzi V, Melino G., Gene disruption of tissue transglutaminase, Mol Cell Biol. 2001 January;21(1):148-55). The mice appeared phenotypically normal. Also no morphological changes were observed in kidneys obtained from these mice. TGaseII KO mice were then used for the analysis of the development of kidney fibrosis following induction of UUO by assessing kidney collagen accumulation compared to normal mice The results clearly demonstrated that disruption of TGaseII results in statistically significant reduced collagen accumulation following both three (3) and seven (7) days of obstruction, as compared to collagen accumulation in obstructed kidneys of wild type mice, thus implicating TGaseII as a functionally important factor in kidney fibrosis. It is thus suggested that inhibition of TGaseII activity may have an anti-fibrotic therapeutic effect.
  • Example 5
  • Inhibition of TGaseII Activity Using Monoclonal Neutralizing Antibodies
  • Recombinant monoclonal human-anti-human antibodies against TGaseII were obtained by screening of a phage display library. 720 clones were screened for binding human TGaseII. Seven (7) clones were selected which showed intense binding to the enzyme. The activity assay demonstrated that these antibodies inhibited the crosslinking activity of human TGaseII enzyme at a range of concentrations (1-5 nM).

Claims (26)

  1. 1. A compound having the structure:

    5′(N)x−Z 3′ (antisense strand)
    3′Z′-(N′)y5′ (sense strand)
    wherein each N and N′ is a ribonucleotide which may be modified or unmodified in its sugar residue and (N)x and (N′)y is an oligomer in which each consecutive N or N′ is joined to the next N or N′ by a covalent bond;
    wherein each of x and y is an integer between 19 and 40;
    wherein each of Z and Z′ may be present or absent, but if present is dTdT and is covalently attached at the 3′ terminus of the strand in which it is present; and wherein the sequence of (N)x comprises any one of the sequences set forth in SEQ ID NOS: 21-38, 192-344 and 381-416.
  2. 2. The compound of claim 1, wherein the covalent bond is a phosphodiester bond.
  3. 3. The compound of claim 2, wherein x=y.
  4. 4. The compound of claim 3, wherein x=y=19.
  5. 5. The compound of claim 1 wherein Z and Z′ are both absent.
  6. 6. The compound of claim 1 wherein one of Z or Z′ is present.
  7. 7. The compound of claim 1 wherein all of the ribonucleotides are unmodified in their sugar residues.
  8. 8. The compound of claim 1 wherein at least one ribonucleotide is modified in its sugar residue.
  9. 9. The compound of claim 8, wherein the modification of the sugar residue comprises a modification at the 2′ position.
  10. 10. The compound of claim 9, wherein the modification at the 2′ position results in the presence of a moiety selected from the group comprising amino, fluoro, methoxy, alkoxy and alkyl groups.
  11. 11. The compound of claim 10, wherein the moiety at the 2′ position is methoxy (2′-0-methyl).
  12. 12. The compound of claim 1 wherein alternating ribonucleotides are modified in both the antisense and the sense strands.
  13. 13. The compound of claim 1 wherein the ribonucleotides at the 5′ and 3′ termini of the antisense strand are modified in their sugar residues, and the ribonucleotides at the 5′ and 3′ termini of the sense strand are unmodified in their sugar residues.
  14. 14. The compound of claim 1 wherein the antisense strand is phophorylated at the 5′ terminus, and may or may not be phophorylated at the 3′ terminus; and
    wherein the sense strand may or may not be phophorylated at the 5′ terminus and at the 3′ terminus.
  15. 15. A vector capable of expressing the compound of claim 1.
  16. 16. A composition comprising the compound of claim 1 in an amount effective to inhibit human TGaseII and a carrier.
  17. 17. A method of treating a patient suffering from a disorder comprising administering to the patient an inhibitor of human TGaseII in a therapeutically effective dose so as to thereby treat the patient.
  18. 18. The method of claim 17, where the inhibitor is an siRNA.
  19. 19. The method of claim 17, where the inhibitor is an antibody.
  20. 20. (canceled)
  21. 21. The method of claim 17, wherein the disorder is a fibrosis-related pathology.
  22. 22. The method of claim 21, wherein the fibrosis-related pathology is kidney fibrosis, liver fibrosis, pulmonary fibrosis or ocular scarring.
  23. 23. The method of claim 17, wherein the disorder is any one of an ocular disease especially cataract, a cardiovascular disease especially cardiac hypertrophy, atherosclerosis/restenosis, a neurological disease, including polyglutamine disease, spinobulbar muscular atrophy, dentatorubral-pallidoluysian atrophy, spinocerebellar ataxias (SCAs) 1, 2, 3, 6, 7 and 17, Alzheimer's disease or Parkinson's disease.
  24. 24. A composition comprising the vector of claim 15 in an amount effective to inhibit human TGaseII and a carrier.
  25. 25. A method of treating a patient suffering from a disorder comprising administering to the patient the compounds of claim 1 in a therapeutically effective dose so as to thereby treat the patient.
  26. 26. A method of treating a patient suffering from a disorder comprising administering to the patient the vector of claim 15 in a therapeutically effective dose so as to thereby treat the patient.
US11045780 2004-01-30 2005-01-27 Oligoribonucleotides and methods of use thereof for treatment of fibrotic conditions and other diseases Abandoned US20050197310A1 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
US54068704 true 2004-01-30 2004-01-30
US64152205 true 2005-01-04 2005-01-04
US11045780 US20050197310A1 (en) 2004-01-30 2005-01-27 Oligoribonucleotides and methods of use thereof for treatment of fibrotic conditions and other diseases

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US11045780 US20050197310A1 (en) 2004-01-30 2005-01-27 Oligoribonucleotides and methods of use thereof for treatment of fibrotic conditions and other diseases
US12072941 US7939652B2 (en) 2004-01-30 2008-02-28 Oligoribonucleotides and methods of use thereof for treatment of fibrotic conditions and other diseases
US13092501 US8198258B2 (en) 2004-01-30 2011-04-22 Oligoribonucleotides and methods of use thereof for treatment of fibrotic conditions and other diseases

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US12072941 Continuation US7939652B2 (en) 2004-01-30 2008-02-28 Oligoribonucleotides and methods of use thereof for treatment of fibrotic conditions and other diseases

Publications (1)

Publication Number Publication Date
US20050197310A1 true true US20050197310A1 (en) 2005-09-08

Family

ID=34830511

Family Applications (3)

Application Number Title Priority Date Filing Date
US11045780 Abandoned US20050197310A1 (en) 2004-01-30 2005-01-27 Oligoribonucleotides and methods of use thereof for treatment of fibrotic conditions and other diseases
US12072941 Active 2028-06-21 US7939652B2 (en) 2004-01-30 2008-02-28 Oligoribonucleotides and methods of use thereof for treatment of fibrotic conditions and other diseases
US13092501 Active US8198258B2 (en) 2004-01-30 2011-04-22 Oligoribonucleotides and methods of use thereof for treatment of fibrotic conditions and other diseases

Family Applications After (2)

Application Number Title Priority Date Filing Date
US12072941 Active 2028-06-21 US7939652B2 (en) 2004-01-30 2008-02-28 Oligoribonucleotides and methods of use thereof for treatment of fibrotic conditions and other diseases
US13092501 Active US8198258B2 (en) 2004-01-30 2011-04-22 Oligoribonucleotides and methods of use thereof for treatment of fibrotic conditions and other diseases

Country Status (5)

Country Link
US (3) US20050197310A1 (en)
EP (2) EP1758998B1 (en)
JP (1) JP4755113B2 (en)
DE (1) DE602005025347D1 (en)
WO (1) WO2005072057A3 (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080279844A1 (en) * 2006-10-18 2008-11-13 Kapil Mehta Methods for Treating Cancer Targeting Transglutaminase
US20080287386A1 (en) * 2004-01-30 2008-11-20 Quark Biotech, Inc. Oligoribonucleotides and methods of use thereof for treatment of fibrotic conditions and other diseases
WO2008152636A2 (en) * 2007-06-15 2008-12-18 Quark Pharmaceuticals, Inc. Compositions and methods for inhibiting nadph oxidase expression
WO2009132351A2 (en) * 2008-04-25 2009-10-29 University Of Medicine And Dentistry Of New Jersey Anti-sense microrna expression vectors

Families Citing this family (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006131925A3 (en) * 2005-06-10 2007-08-02 Elena Feinstein Oligoribonucleotides and methods of use thereof for treatment of fibrotic conditions and other diseases
JP2010507387A (en) * 2006-10-25 2010-03-11 クアーク・ファーマスーティカルス、インコーポレイテッドQuark Pharmaceuticals,Inc. New siRNA and methods of use thereof
WO2012108841A1 (en) * 2011-02-09 2012-08-16 Singapore Health Services Pte. Ltd. Transglutaminase-2 inhibitors and uses thereof
US9580708B2 (en) * 2011-09-14 2017-02-28 Rana Therapeutics, Inc. Multimeric oligonucleotides compounds
US9732101B2 (en) 2012-01-18 2017-08-15 Wisconsin Alumni Research Foundation Bioreversible boronates for delivery of molecules into cells
US9234048B2 (en) 2012-01-18 2016-01-12 Wisconsin Alumni Research Foundation Boronate-mediated delivery of molecules into cells
WO2013142514A1 (en) * 2012-03-19 2013-09-26 Isis Pharmaceuticals, Inc. Methods and compositions for modulating alpha-1-antitrypsin expression
US20150247141A1 (en) 2012-09-14 2015-09-03 Rana Therapeutics, Inc. Multimeric oligonucleotide compounds
KR101881662B1 (en) * 2016-05-12 2018-07-26 강원대학교산학협력단 Pharmaceutical composition for prevention or treatment of diabetic complications and screening method for agent for preventing or treating diabetic complications

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6506559B1 (en) * 1997-12-23 2003-01-14 Carnegie Institute Of Washington Genetic inhibition by double-stranded RNA
US20030143732A1 (en) * 2001-04-05 2003-07-31 Kathy Fosnaugh RNA interference mediated inhibition of adenosine A1 receptor (ADORA1) gene expression using short interfering RNA
US6773916B1 (en) * 1999-01-05 2004-08-10 The Flinders University Of South Australia Agents and methods for treatment and diagnosis of ocular disorders

Family Cites Families (39)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4475196A (en) 1981-03-06 1984-10-02 Zor Clair G Instrument for locating faults in aircraft passenger reading light and attendant call control system
US4447233A (en) 1981-04-10 1984-05-08 Parker-Hannifin Corporation Medication infusion pump
US4439196A (en) 1982-03-18 1984-03-27 Merck & Co., Inc. Osmotic drug delivery system
US4447224A (en) 1982-09-20 1984-05-08 Infusaid Corporation Variable flow implantable infusion apparatus
US4487603A (en) 1982-11-26 1984-12-11 Cordis Corporation Implantable microinfusion pump system
US4486194A (en) 1983-06-08 1984-12-04 James Ferrara Therapeutic device for administering medicaments through the skin
US4666828A (en) 1984-08-15 1987-05-19 The General Hospital Corporation Test for Huntington's disease
US4683202B1 (en) 1985-03-28 1990-11-27 Cetus Corp
US4801531A (en) 1985-04-17 1989-01-31 Biotechnology Research Partners, Ltd. Apo AI/CIII genomic polymorphisms predictive of atherosclerosis
US4959217A (en) 1986-05-22 1990-09-25 Syntex (U.S.A.) Inc. Delayed/sustained release of macromolecules
US4925678A (en) 1987-04-01 1990-05-15 Ranney David F Endothelial envelopment drug carriers
US5080646A (en) 1988-10-03 1992-01-14 Alza Corporation Membrane for electrotransport transdermal drug delivery
US5272057A (en) 1988-10-14 1993-12-21 Georgetown University Method of detecting a predisposition to cancer by the use of restriction fragment length polymorphism of the gene for human poly (ADP-ribose) polymerase
US5270030A (en) 1988-12-29 1993-12-14 Bio-Technology General Corp. Fibrin binding domain polypeptide and method of producing
US4968713A (en) 1989-07-31 1990-11-06 Merck & Co., Inc. Certain imidazole compounds as transglutaminase inhibitors
US5021440A (en) 1989-07-31 1991-06-04 Merck & Co., Inc. Imidazole compounds and their use as transglutaminase inhibitors
US5098707A (en) 1989-07-31 1992-03-24 Merck & Co., Inc. Imidazole compounds and their use as transglutaminase inhibitors
US5192659A (en) 1989-08-25 1993-03-09 Genetype Ag Intron sequence analysis method for detection of adjacent and remote locus alleles as haplotypes
US5399676A (en) 1989-10-23 1995-03-21 Gilead Sciences Oligonucleotides with inverted polarity
US5167616A (en) 1989-12-14 1992-12-01 Alza Corporation Iontophoretic delivery method
US5587361A (en) 1991-10-15 1996-12-24 Isis Pharmaceuticals, Inc. Oligonucleotides having phosphorothioate linkages of high chiral purity
US5489677A (en) 1990-07-27 1996-02-06 Isis Pharmaceuticals, Inc. Oligonucleoside linkages containing adjacent oxygen and nitrogen atoms
JPH06505704A (en) 1990-09-20 1994-06-30
US5225182A (en) 1991-10-31 1993-07-06 Sharma Yash P Vectored drug delivery system using a cephaloplastin linking agent and a methed of using the system
JPH08500481A (en) 1992-05-11 1996-01-23 リボザイム・ファーマシューティカルズ・インコーポレーテッド Methods and agents for inhibiting the replication of the virus
US5898031A (en) 1996-06-06 1999-04-27 Isis Pharmaceuticals, Inc. Oligoribonucleotides for cleaving RNA
WO1998004245A1 (en) * 1996-07-25 1998-02-05 The Victoria University Of Manchester Use of transglutaminase modulators to promote wound healing
US6242589B1 (en) 1998-07-14 2001-06-05 Isis Pharmaceuticals, Inc. Phosphorothioate oligonucleotides having modified internucleoside linkages
US6277967B1 (en) 1998-07-14 2001-08-21 Isis Pharmaceuticals, Inc. Carbohydrate or 2′-modified oligonucleotides having alternating internucleoside linkages
DE19956568A1 (en) 1999-01-30 2000-08-17 Roland Kreutzer Method and medicament for the inhibition of expression of a given gene
GB9927444D0 (en) 1999-11-19 2000-01-19 Cancer Res Campaign Tech Inhibiting gene expression
EP2348133B1 (en) * 2000-12-01 2014-07-16 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. RNA interference mediating small RNA molecules
WO2002085308A3 (en) 2001-04-24 2002-12-19 Douglas Aguilar Antisense and anti-inflammatory based compositions to treat respiratory disorders
US20040063654A1 (en) 2001-11-02 2004-04-01 Davis Mark E. Methods and compositions for therapeutic use of RNA interference
EP1499631A4 (en) * 2002-02-20 2006-01-25 Sirna Therapeutics Inc Rna interference mediated inhibition of tgf-beta and tgf-beta receptor gene expression using short interfering nucleic acid (sina)
US20040019001A1 (en) 2002-02-20 2004-01-29 Mcswiggen James A. RNA interference mediated inhibition of protein typrosine phosphatase-1B (PTP-1B) gene expression using short interfering RNA
US7148342B2 (en) 2002-07-24 2006-12-12 The Trustees Of The University Of Pennyslvania Compositions and methods for sirna inhibition of angiogenesis
US8574827B2 (en) * 2002-10-29 2013-11-05 Rigel Pharmaceuticals, Inc. Modulators of angiogenesis and tumorigenesis
WO2004113496A3 (en) * 2003-06-20 2007-11-29 Isis Pharmaceuticals Inc Double stranded compositions comprising a 3’-endo modified strand for use in gene modulation

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6506559B1 (en) * 1997-12-23 2003-01-14 Carnegie Institute Of Washington Genetic inhibition by double-stranded RNA
US6773916B1 (en) * 1999-01-05 2004-08-10 The Flinders University Of South Australia Agents and methods for treatment and diagnosis of ocular disorders
US20030143732A1 (en) * 2001-04-05 2003-07-31 Kathy Fosnaugh RNA interference mediated inhibition of adenosine A1 receptor (ADORA1) gene expression using short interfering RNA

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080287386A1 (en) * 2004-01-30 2008-11-20 Quark Biotech, Inc. Oligoribonucleotides and methods of use thereof for treatment of fibrotic conditions and other diseases
US20110201670A1 (en) * 2004-01-30 2011-08-18 Quark Pharmaceuticals, Inc. Oligoribonucleotides and methods of use thereof for treatment of fibrotic conditions and other diseases
US8198258B2 (en) 2004-01-30 2012-06-12 Quark Pharmaceuticals Inc. Oligoribonucleotides and methods of use thereof for treatment of fibrotic conditions and other diseases
US7939652B2 (en) 2004-01-30 2011-05-10 Quark Pharmaceuticals Inc. Oligoribonucleotides and methods of use thereof for treatment of fibrotic conditions and other diseases
US20080279844A1 (en) * 2006-10-18 2008-11-13 Kapil Mehta Methods for Treating Cancer Targeting Transglutaminase
US8299040B2 (en) * 2006-10-18 2012-10-30 Board Of Regents, The University Of Texas System Methods for treating cancer targeting transglutaminase
WO2008152636A3 (en) * 2007-06-15 2010-02-25 Quark Pharmaceuticals, Inc. Compositions and methods for inhibiting nadph oxidase expression
US20100273854A1 (en) * 2007-06-15 2010-10-28 Hagar Kalinski Compositions and methods for inhibiting nadph oxidase expression
WO2008152636A2 (en) * 2007-06-15 2008-12-18 Quark Pharmaceuticals, Inc. Compositions and methods for inhibiting nadph oxidase expression
WO2009132351A2 (en) * 2008-04-25 2009-10-29 University Of Medicine And Dentistry Of New Jersey Anti-sense microrna expression vectors
WO2009132351A3 (en) * 2008-04-25 2009-12-30 University Of Medicine And Dentistry Of New Jersey Anti-sense microrna expression vectors
US9051568B2 (en) 2008-04-25 2015-06-09 Rutgers, The State University Of New Jersey Anti-sense microrna expression vectors

Also Published As

Publication number Publication date Type
EP1758998A4 (en) 2008-02-20 application
EP2330111A2 (en) 2011-06-08 application
EP2330111A3 (en) 2011-08-17 application
US20110201670A1 (en) 2011-08-18 application
US20080287386A1 (en) 2008-11-20 application
WO2005072057A2 (en) 2005-08-11 application
JP2011172579A (en) 2011-09-08 application
EP1758998A2 (en) 2007-03-07 application
JP4755113B2 (en) 2011-08-24 grant
EP1758998B1 (en) 2010-12-15 grant
DE602005025347D1 (en) 2011-01-27 grant
JP2007528216A (en) 2007-10-11 application
US8198258B2 (en) 2012-06-12 grant
WO2005072057A3 (en) 2007-07-19 application
US7939652B2 (en) 2011-05-10 grant

Similar Documents

Publication Publication Date Title
Csiszar et al. Proinflammatory phenotype of coronary arteries promotes endothelial apoptosis in aging
US6171795B1 (en) Nucleic acid ligands to CD40ligand
Lee et al. ADAMTS1 mediates the release of antiangiogenic polypeptides from TSP1 and 2
LIPOWSKY et al. Coordination of tRNA nuclear export with processing of tRNA
US20090162365A1 (en) Novel siRNAS and methods of use thereof
US20040077574A1 (en) Modulation of biological signal transduction by RNA interference
WO2007146511A2 (en) Compounds and methods for modulating gene expression
WO2007058384A1 (en) Method of suppressing replication of hepatitis c virus, inhibitor of replication of the virus and method of screening for the same
WO2005079363A2 (en) Aptamer therapeutics useful in the treatment of complement-related disorders
Seemayer et al. Cartilage destruction mediated by synovial fibroblasts does not depend on proliferation in rheumatoid arthritis
WO2005079533A2 (en) Methods and compositions for mediating gene silencing
US20090269356A1 (en) Complement Binding Aptamers and Anti-C5 Agents Useful in the Treatment of Ocular Disorders
US20070238682A1 (en) Heat shock rna and its use in activation of heat shock transcription factor and treatment of cancer, inflammation, ischemia, neurodegeneration, age-related diseases, hiv infection, deafness, and related disorders
WO2005079815A2 (en) Methods and reagents for treating autosomal dominant diseases of the eye
WO2007084684A2 (en) Therapeutic uses of inhibitors of rtp801
WO2011084193A1 (en) Oligonucleotide compounds comprising non-nucleotide overhangs
WO2012170957A2 (en) Retinoid-liposomes for enhancing modulation of hsp47 expression
US20070098812A1 (en) Annexin II and uses thereof
WO2006023544A2 (en) Therapeutic uses of inhibitors of rtp801
US20080269156A1 (en) Inhibitors of RTP801 and their use in disease treament
US20080003570A1 (en) Translation enhancer elements of genes encoding human Tau protein and human alpha-synuclein protein
EP1778837B1 (en) Treatment of neurodegenerative diseases by the use of scd4 inhibitors
Sternberger et al. GeneBlocs are powerful tools to study and delineate signal transduction processes that regulate cell growth and transformation
WO2008152636A2 (en) Compositions and methods for inhibiting nadph oxidase expression
US7919473B2 (en) IRNA agents targeting VEGF

Legal Events

Date Code Title Description
AS Assignment

Owner name: QUARK BIOTECH, INC., CALIFORNIA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:MOR, ORNA;FEINSTEIN, ELENA;REEL/FRAME:016493/0728

Effective date: 20050207

AS Assignment

Owner name: QUARK PHARMACUTICALS, INC., CALIFORNIA

Free format text: CHANGE OF NAME;ASSIGNOR:QUARK BIOTECH, INC.;REEL/FRAME:020206/0703

Effective date: 20070601

Owner name: QUARK PHARMACUTICALS, INC.,CALIFORNIA

Free format text: CHANGE OF NAME;ASSIGNOR:QUARK BIOTECH, INC.;REEL/FRAME:020206/0703

Effective date: 20070601