US20050192428A1 - Mutated recombinant collagens - Google Patents

Mutated recombinant collagens Download PDF

Info

Publication number
US20050192428A1
US20050192428A1 US10/720,831 US72083103A US2005192428A1 US 20050192428 A1 US20050192428 A1 US 20050192428A1 US 72083103 A US72083103 A US 72083103A US 2005192428 A1 US2005192428 A1 US 2005192428A1
Authority
US
United States
Prior art keywords
site
collagen
procollagen
recombinant
chain
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US10/720,831
Inventor
Richard Berg
Paul Toman
Donald Wallace
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Surgical Specialties US Corp
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US08/183,648 external-priority patent/US5667839A/en
Application filed by Individual filed Critical Individual
Priority to US10/720,831 priority Critical patent/US20050192428A1/en
Publication of US20050192428A1 publication Critical patent/US20050192428A1/en
Assigned to ANGIOTECH BIOMATERIALS CORPORATION reassignment ANGIOTECH BIOMATERIALS CORPORATION CHANGE OF NAME (SEE DOCUMENT FOR DETAILS). Assignors: COHESION TECHNOLOGIES, INC.
Assigned to ANGIOTECH PHARMACEUTICALS (US), INC. reassignment ANGIOTECH PHARMACEUTICALS (US), INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: ANGIOTECH BIOMATERIALS CORPORATION
Assigned to CREDIT SUISSE, AS COLLATERAL AGENT reassignment CREDIT SUISSE, AS COLLATERAL AGENT SECURITY AGREEMENT Assignors: ANGIOTECH PHARMACEUTICALS (US), INC.
Assigned to ANGIOTECH PHARMACEUTICALS (US), INC. reassignment ANGIOTECH PHARMACEUTICALS (US), INC. RELEASE BY SECURED PARTY (SEE DOCUMENT FOR DETAILS). Assignors: CREDIT SUISSE
Abandoned legal-status Critical Current

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23CDAIRY PRODUCTS, e.g. MILK, BUTTER OR CHEESE; MILK OR CHEESE SUBSTITUTES; MAKING THEREOF
    • A23C9/00Milk preparations; Milk powder or milk powder preparations
    • A23C9/20Dietetic milk products not covered by groups A23C9/12 - A23C9/18
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00Rearing or breeding animals, not otherwise provided for; New breeds of animals
    • A01K67/027New breeds of vertebrates
    • A01K67/0275Genetically modified vertebrates, e.g. transgenic
    • A01K67/0278Humanized animals, e.g. knockin
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23JPROTEIN COMPOSITIONS FOR FOODSTUFFS; WORKING-UP PROTEINS FOR FOODSTUFFS; PHOSPHATIDE COMPOSITIONS FOR FOODSTUFFS
    • A23J1/00Obtaining protein compositions for foodstuffs; Bulk opening of eggs and separation of yolks from whites
    • A23J1/20Obtaining protein compositions for foodstuffs; Bulk opening of eggs and separation of yolks from whites from milk, e.g. casein; from whey
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23JPROTEIN COMPOSITIONS FOR FOODSTUFFS; WORKING-UP PROTEINS FOR FOODSTUFFS; PHOSPHATIDE COMPOSITIONS FOR FOODSTUFFS
    • A23J3/00Working-up of proteins for foodstuffs
    • A23J3/04Animal proteins
    • A23J3/06Gelatine
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/78Connective tissue peptides, e.g. collagen, elastin, laminin, fibronectin, vitronectin, cold insoluble globulin [CIG]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/8509Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2207/00Modified animals
    • A01K2207/15Humanized animals
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00Genetically modified animals
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00Genetically modified animals
    • A01K2217/05Animals comprising random inserted nucleic acids (transgenic)
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00Animals characterised by species
    • A01K2227/10Mammal
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00Animals characterised by species
    • A01K2227/10Mammal
    • A01K2227/105Murine
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00Animals characterised by purpose
    • A01K2267/01Animal expressing industrially exogenous proteins
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23CDAIRY PRODUCTS, e.g. MILK, BUTTER OR CHEESE; MILK OR CHEESE SUBSTITUTES; MAKING THEREOF
    • A23C2230/00Aspects relating to animal feed or genotype
    • A23C2230/05Milk or milk products from transgenic animals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides

Definitions

  • the field of this invention is recombinant procollagens containing novel cleavage sites.
  • Collagen has provided a number of commercial applications including use as a convenient substrate for cell culture, as well as in the manufacture of biocompatible materials (e.g., artificial skin) having a variety of therapeutic applications in humans.
  • Commercially available collagens are primarily isolated from freshly killed farm animals (e.g., cows, pigs, chickens) in polymerized form or in soluble form derived by enzymatic or chemical treatment of polymerized collagen.
  • polymerized collagens, and soluble collagens derived from polymerized collagens are of limited usefulness due to the presence of natural crosslinks within the collagen.
  • non-human collagens can provoke undesirable immune responses when administered to human subjects.
  • human collagen can be purified from human sources such as human placenta, as described in U.S. Pat. No. 5,002,071 (Research Development Foundation) and in copending U.S. application Ser. No. 07/921,810 (Collagen Corporation).
  • human sources such as human placenta
  • U.S. Pat. No. 5,002,071 Search Development Foundation
  • U.S. application Ser. No. 07/921,810 Cold-tosese, Y.
  • the methods for recovering collagen from these sources bias the type of collagen recovered.
  • collagen is derived from naturally crosslinked tissues, the collagen recovered is not entirely homogenous.
  • Another approach to the production of human collagen is the expression of recombinant human collagen in the milk of transgenic animals, as described in copending U.S. application Ser. Nos. 08/183,648 and 08/011,643 (Collagen Corporation).
  • this approach subjects the recombinant collagen to any host deficiencies in translational processing.
  • collagen refers to a type of protein that encompasses a class of structurally related polypeptides consisting of helical collagen chains and homo- and heteromeric polymers thereof.
  • Collagen chains often contain both long helical domains and non-helical extensions, or telopeptides.
  • the helical domains comprise -(GXY) n — repeats, where X and/or Y are frequently proline or hydroxyproline.
  • Collagen polypeptide chains are encoded by a number of related genes, See, Adams, S. L. Amer J Respir Cell and Mol Biol (1989) 1:161-168; Mayne and Brewton (1993) Current Opinion in Cell Biology 5:883-890; van der Rest and Bruckner (1993) Current Opinion in Structural Biology 3:430-436.
  • Collagen-encoding transcripts are initially translated into procollagen chains which undergo a variety of post-translational events such as processing, secretion and assembly (e.g. disulfide exchange, prolyl residue hydroxylation, glycosylation, and crosslinking of the helical chains; see, for example, Prockop et al.
  • procollagens contain N- and C-terminal propeptides that facilitate collagen formation. See, for example, Lee et al. (1992) J Biol Chem 267, 24126-24133.
  • procollagen propeptides are cleaved from the procollagens by tissue-specific procollagen N- and C-terminal proteases. Accordingly, recombinant production of collagen has been severely restricted by the inability of conventional cellular expression systems to efficiently post-translationally modify procollagen to form functionally mature collagen.
  • the invention provides recombinant procollagen chains having a natural collagen polypeptide chain separated from a propeptide by a non-natural site-specific proteolytic agent recognition site (i.e. the site is not naturally present at that location of a natural procollagen chain).
  • the propeptide is often a C-terminal propeptide and, frequently, a natural procollagen C-terminal propeptide.
  • the recombinant procollagen chains may further comprise a second propeptide separated from the opposite end of the natural collagen chain by a second non-natural site-specific proteolytic agent recognition site.
  • propeptides and site-specific proteolytic agent recognition sites may be used.
  • the propeptide is capable of increasing the yield of at least one of secreted procollagen (trimeric procollagen chains) or collagen monomers (trimeric collagen chains) from cells expressing procollagen chains comprising the propeptide, as compared with cells expressing the same collagen chains alone, without the propeptide.
  • the non-natural site-specific proteolytic agent recognition site is generally selected to provide a substrate for a convenient site-specific proteolytic agent.
  • the agent is commonly a protease or a chemical agent which selectively cleaves at accessible and preferentially labile peptide bonds. Where two site-specific proteolytic agent recognition sites and two propeptides are present, the recognition sites may have the same or different amino acid sequences with the same or different site-specific proteolytic agent affinities and specificities.
  • the subject procollagen chains may be constructed such that the site-specific proteolytic agent cleavage site is a peptide bond that separates the collagen chain and/or the propeptide from the remainder of the procollagen chain.
  • the cleavage site may be a peptide bond that separates, from the remainder of the procollagen chain, the collagen chain (or propeptide) joined to at least one amino acid which is not naturally present at that location of a natural collagen chain (or propeptide).
  • the invention provides collagens produced by contacting the subject recombinant procollagen with site-specific proteolytic agents capable of selectively cleaving the procollagen chains at the site-specific proteolytic agent recognition sites, wherein the resulting chains comprise terminal peptides which may have non-natural amino acid sequences (i.e. not naturally present at that location of a natural collagen chain).
  • the resulting collagen may be employed directly (e.g. to coat cell culture dishes or cultureware) or further polymerized and/or provided in sterile, nontoxic, biocompatible collagen compositions suitable for administration to humans.
  • the invention also provides nucleic acids encoding the subject procollagen chains, as well as vectors and cells comprising such nucleic acids operably linked to transcription regulatory elements not naturally linked to such nucleic acids.
  • the invention provides processes for the production of recombinant procollagen and/or collagen chains in and from such cells.
  • the invention also provides methods of utilizing the resulting procollagen and collagen, for example, coating cultureware and augmenting localized tissue in a host by, for example, subcutaneous administration.
  • FIG. 1 shows a three-dimensional computer model of the N-terminal propeptide-telopeptide region of human procollagen type I (a triple helix of two ⁇ 1 chains and one ⁇ 2 chain).
  • the structure was produced on a Silicon Graphics workstation using Biosym software.
  • the energy minimized structure is produced after manual chain pull-ins to speed the process of computing the energy minimums. Points of cleavage with N-pro-peptidase are marked with a “ ⁇ ”.
  • FIG. 2 shows a three-dimensional computer model of the C-terminal propeptide-telopeptide region of human procollagen type I (a triple helix of two ⁇ 1 chains and one ⁇ 2 chain).
  • the structure was produced on a Silicon Graphics workstation using Biosym software.
  • the energy minimized structure is produced after manual chain pull-ins to speed the process of computing the energy minimums. Points of cleavage of the extra-helical peptide from the C-terminal pro-region are marked with a “ ⁇ ”. In the two ⁇ 1 chains, this is before Gly 38; in the ⁇ 2 chain, it is before Glu 27.
  • FIG. 3 shows a three-dimensional computer model of the N-terminal propeptide-telopeptide region of a mutant human procollagen type I containing the DDDK insertion.
  • the structure was produced on a Silicon Graphics workstation using Biosym software.
  • the energy minimized structure is produced after manual chain pull-ins to speed the process of computing the energy minimums.
  • the insertional loop members are marked with a “ ⁇ ”.
  • FIG. 4 shows the proteolytic cleavage site of the mutant human procollagen type I containing the DDDK insertion. Points of cleavage of N-propeptidase are marked with a “ ⁇ ”. Regions in whichc the ⁇ 1 chains are “coiled” are disignated with a “10”.
  • the invention provides recombinant procollagen chains comprising a natural collagen chain, a propeptide, and a non-natural site-specific proteolytic agent recognition site (i.e. not naturally present at that location of a natural collagen chain) located between the collagen chain and the propeptides.
  • the propeptide increases the yield of at least one of secreted procollagen (trimeric procollagen chains) or collagen monomers (trimeric collagen chains) recoverable from cells expressing the subject recombinant procollagen chains, as compared with cells expressing the collagen chains alone, without the propeptide.
  • the yield is enhanced by at least 50%, preferably at least about 100%, more preferably at least about 200%, and most preferably at least about 1,000% in at least one expression system.
  • Collagen refers to a variety of helical arrays of collagen chains and includes both polymerized and monomeric collagen.
  • the propeptides are believed to improve collagen and/or procollagen yields by facilitating or increasing at least one of proper expression, processing, secretion, or polymerization of the procollagen chain, the collagen chain, and/or a collagen monomer.
  • the function of the propeptide is readily monitored by comparing the yields of recoverable collagen and/or procollagen with and without the presence of the propeptide in in vitro or in vivo expression systems including lysates, transformed or transfected cells (such as mammalian cells or yeast), transgenic animals, etc. Specific examples of assays for propeptides are described below.
  • the propeptide may take a wide variety of forms and sizes: it may be a natural procollagen propeptide, or a propeptide not naturally present as a propeptide in a procollagen chain, as long as it provides the procollagen with the requisite collagen yield. Generally, propeptides are at least 10, preferably at least about 25, more preferably at least about 75, and most preferably at least about 200 amino acids in length. The propeptide is generally located at the C-terminus or N-terminus of the procollagen chain, or the procollagen chain may have propeptides at both termini. Where the recombinant procollagen chains contain both C- and N-terminal propeptides, the chains often comprise a second (and often non-natural) site-specific proteolytic agent recognition site located between the collagen chain and the second propeptide.
  • Preferred procollagen chains comprise at least a C-terminal propeptide, frequently a natural C-terminal portion of a protein with collagen-like repeats and/or a helical, especially triple-helical, polymeric form, such as complement protein C1q-C, acetocholine esterase, or lung surfactant protein.
  • natural procollagen C-terminal propeptides such as collagen Type I, II, III, IV, V and XI C-terminal propeptides.
  • Preferred N-terminal propeptides comprise at least one globular domain and often consist essentially of a single globular domain.
  • natural procollagen N-terminal propeptides such as collagen type I, II, III, IV, V, and XI N-terminal propeptides.
  • the propeptides are preferably purified out of the collagen composition.
  • the propeptides are preferably selected such that, if small quantities of the propeptides remain in the collagen composition after processing, the residual propeptides do not interfere with the intended application of the resulting composition.
  • the composition should not contain contaminants present in an amount sufficient to cause a toxic or immunogenic response or reaction in the patient.
  • the recognition site is non-natural to a natural procollagen chain, meaning that the site occupies a portion of the procollagen chain not naturally occupied by the recognition site. Frequently, the site is not naturally present anywhere in the natural counterpart of the procollagen chain.
  • the site generally comprises one or more amino acid residues or derivatives thereof.
  • the recognition site may comprise a modified (e.g., methylated) residue, especially for some chemical proteolytic agents.
  • These sites are selected to provide substrates for at least one convenient site-specific proteolytic agent, preferably a commercially available site-specific proteolytic agent.
  • the precise site selection will depend on the selected expression system, the selected propeptide, and the availability of the site-specific proteolytic agent.
  • the site should provide a highly selective target for the selected site-specific proteolytic agent, such that the target site (or both target sites) is cleaved while minimizing hydrolysis of peptide bonds within the collagen chain.
  • a large number of site-specific proteolytic agents and their recognition sites are known and/or commercially available. See, for example, Carter (1990, supra), Saito et al. (1987) J. Biochem 101, 123-134, etc.
  • chemical cleavage agents and their recognition sites are known, e.g. hydroxylamine: N ⁇ G; formic acid: D ⁇ P; acetic acid: D ⁇ P; cyanogen bromide: M ⁇ ; BNPS-skatole: W ⁇ ; o-iodosobenzoic acid: W ⁇ ; N-chlorosuccinimide: W ⁇ ; etc.
  • natural or synthetic proteases e.g. catalytic antibodies, etc. may be used.
  • proteases and their recognition sites include: chymotrypsin: W ⁇ and Y ⁇ and F ⁇ ; collagenase: P-X ⁇ G-P, endoproteinase Lys-C: K ⁇ ; enterokinase: D-D-D-K ⁇ (SEQ ID NO: 1:), Factor X a : I-E-G-R ⁇ (SEQ ID NO:2:); kallikrein: P—F—R ⁇ ; renin: Y-I-H—P—F—H-L ⁇ L (SEQ ID NO:3:), H64A subtilisin BPN: A-A-H—Y ⁇ (SEQ ID NO:4:), thrombin: R-G-P—R ⁇ ( SEQ ID NO:5:); trypsin: R ⁇ and K ⁇ ; ubiquitin protein peptidase: ubiquitin ⁇ ; etc.
  • a wide variety of methods may be used to increase the efficiency of cleavage at a target site (e.g. the provision of flanking poly-glycine peptides to enhance accessibility) and/or to reduce non-target site cleavage (e.g. optimizing concentration ratios and reaction conditions).
  • Preferred site/site-specific proteolytic agent combinations yield a collagen product that is conveniently adapted to the ultimate intended application.
  • any residual non-natural terminal residues should not interfere with and, preferably, enhance the performance (e.g. the promotion of cell growth or adherence to coated cultureware) of the resulting collagen product vis-a-vis the natural collagen counterpart.
  • the resulting collagen should not be immunologically reactive in the host from which the collagen chain is derived.
  • immunological non-reactivity is effected by minimizing the number of non-collagen chain amino acid residues which remain joined to the collagen chain after site-specific proteolytic agent cleavage.
  • Preferred site/site-specific proteolytic agent combinations yield collagen chains with fewer than 75, preferably fewer than 25, more preferably fewer than 10, most preferably fewer than 5 and, especially, zero, non-natural collagen chain terminal amino acid residues.
  • preferred sites and site-specific proteolytic agents provide cleavage at or near the junction with natural collagen chain residues.
  • the site-specific proteolytic agent recognition sites may have the same or different amino acid sequences, with the same or different site-specific proteolytic agent affinities and specificities.
  • the site-specific proteolytic agent recognition site(s) generally, but need not, abut both the collagen chain and respective propeptide; i.e. the subject procollagen chains may also have a natural or non-natural (i.e. not naturally present at that location of a natural procollagen chain) amino acid sequence between the site-specific proteolytic agent recognition site and the collagen chain, and/or between the site-specific proteolytic agent recognition site and the propeptide.
  • the resulting (after cleavage) recombinant collagen chains may comprise one or both terminal peptides having a non-natural amino acid sequence.
  • the invention provides recombinant collagen chains produced by contacting the subject recombinant procollagen chains with site-specific proteolytic agents capable of selectively cleaving the procollagen chain at site-specific proteolytic agent recognition sites.
  • Useful collagen compositions produced by such methods may retain residual site-specific proteolytic agents, wherein the site-specific proteolytic agents are present at concentrations that may exceed 1 picogram, frequently exceed 1 nanogram, and more frequently exceed 1 microgram per gram of collagen protein.
  • Resulting collagen compositions may be subjected to conditions known in the art to be conducive to higher-order polymerization of the collagen, for example, fibril formation.
  • Monomeric or polymeric collagen compositions may be further subjected to a wide variety of manipulations depending on the intended application.
  • the collagen may be diluted in an solvent for optimal adsorption to solid substrates (e.g. glass or plastics such as polystyrene, polyethylene, polypropylene, acetate, nylon, etc.) useful in tissue or cell culture, or purified and sterilized (e.g. filter sterilization) for use in vivo, such as for tissue augmentation.
  • solid substrates e.g. glass or plastics such as polystyrene, polyethylene, polypropylene, acetate, nylon, etc.
  • purified and sterilized e.g. filter sterilization
  • the invention provides nucleic acids encoding the subject recombinant procollagen chains. These nucleic acids may have a wide variety of forms and sizes and frequently comprise non-coding sequences which facilitate transcription of the encoded procollagen chains. Constructs comprising such nucleic acids operably linked to transcription regulatory elements are spliced into replication and/or transfection vectors, which are then used to transfect/transform cells.
  • Nucleic acids encoding the collagen chain portions e.g. collA1, col1A2 and col3A1
  • the site-specific proteolytic agent recognition portions of the subject nucleic acids are readily available, for example, through published sequences, including electronic databases (e.g., Genbank, the National Center for Biotechnology Information at the National Library for Medicine, etc.), through commercial vendors, through library hybridization with otherwise available collagen-encoding nucleic acids, or through known molecular cloning techniques.
  • Materials and methods for constructing (e.g., recombinantly or synthetically) the subject procollagen-encoding nucleic acids, expression vectors, transformed and transfected cells, processes for producing a recombinant procollagen chain including selection from a wide variety of cells, e.g., cultured mammalian cells such as fibroblasts, CHO cells, yeast, mammary gland cells of transgenic mammals, etc.), transfecting/transforming and culturing the cells under conditions suitable for the expression of the nucleic acid, and recovering and purifying recombinant procollagen chains are disclosed herein or otherwise known in the art.
  • construct design is effected by first preparing a three-dimensional model of a procollagen helix at the propeptide-telopeptide junction, then introducing amino acid substitutions that would allow cleavage with specific proteolytic enzymes.
  • FIGS. 1 and 2 depict the structures of the N- and C-terminal propeptide-telopeptide regions of human type I procollagen, respectively. The structures are energy minimized and the native cleavage sites are marked. Molecular modeling is performed to ensure that the substitutions do not disrupt the folding of this region so as to inhibit processing, secretion, helical formation, or site-specific proteolytic agent accessibility.
  • Molecular constructs are then generated by either mutating procollagen-encoding cDNAs or splicing nucleic acids encoding the selected collagen chain with nucleic acids encoding the selected site-specific proteolytic agent recognition site. Mutation may be effected by site-directed mutagenesis, nucleotide insertion or substitution (e.g., by PCR-based mutagenesis) or replacement of oligonucleotides by cloning.
  • the insertion site is preferably at or within 100, preferably within 30, more preferably within 10 nucleotides distal to the procollagen site-specific proteolytic agent cleavage site encoding sequence.
  • the substituted nucleotides are within 60, preferably within 36, preferably within 18, nucleotides distal to the procollagen site-specific proteolytic agent cleave site encoding sequence.
  • Preferred constructs additionally comprise nucleic acids including a promoter region necessary for the expression of the encoded procollagen in an appropriate host.
  • Preferred promoters that are constitutive in cultured cells include cytomegalovirus (CMV), simian virus (SV), and Rous sarcoma virus (RSV) promoters.
  • Preferred promoters for tissue-specific expression (e.g., in mammary gland cells) of transgenic animals include casein or acid whey protein promoters.
  • Preferred promoters for expression in yeast include phosphoglycerol kinase (PKG), alcohol dehydrogenase (ADH), and galactose (GAL).
  • the construct is then transfected into and expressed in a cellular expression system, preferably an expression system wherein the mutated procollagen is secreted.
  • the recombinant PROcollagen is not sufficiently secreted, and recovery entails lysing the cells and centrifuging the lysate to remove cellular debris.
  • the cells are selected or engineered to express both the recombinant procollagen and a site-specific proteolytic agent capable of specifically cleaving the procollagen at the recognition site.
  • the appropriate site-specific proteolytic agents are introduced in an amount sufficient to cleave the propeptides from the procollagen molecules prior to fibrillogenesis in the processing steps.
  • Collagen chains are purified from the medium by methods known in the art. See, for example, Miller and Rhodes (1982) Methods in Enzymology 82:33-64; Sage and Bernstein (1982) Methods in Enzymology 82:96-127.
  • Resulting collagen compositions may be sterilized, for example, by passage through 0.2 ⁇ m filters, (e.g., Millipore filters). Sterility may be confirmed by, for example, culturing aliquots on nutrient agar for at least 72 hours at 25 and 37° C.
  • the invention provides a wide variety of applications of the subject recombinant procollagens and collagens in tissue and cell culture and therapy.
  • the subject procollagens and collagens are used to promote adhesion and growth of cells on a wide variety of solid substrates in various forms, such as slides, filaments, sheets, plates, flasks, bottles, fibers, etc., and compositions such as plastics, glass, metals, saccharide-based polymers, etc.
  • the collagens provide a wide range of therapeutic applications such as use in biodegradable sutures, synthetic dermal skin, biodegradable hemostatic sponges, tissue augmentation (including modifying localized soft tissue appearance), etc.
  • FIGS. 1 and 2 depict the energy minimized structures of the N- and C-terminal propeptide/telopeptide regions of human type I procollagen, respectively. Substitutions were then inserted at the N-terminal cleavage junction site to generate a non-natural site-specific proteolytic agent recognition site and new models prepared to determine their affects on procollagen folding.
  • FIG. 3 depicts an N-terminal fragment containing a DDDK (SEQ ID NO:1:) insertion in all three chains, introducing a recognition and cleavage site for enterokinase into the propeptide-telopeptide junction region.
  • the proteolytic cleavage site of this mutant is particularly accessible in the energy-minimized structure.
  • a cDNA clone containing the entire coding region of human ⁇ 1(I) procollagen is obtained from the Whitehead Institute (Cambridge, Mass.). The description of the cDNA is described in Stacy, et al, J Virol. 61: 2549 (1987). The nucleotide sequence of this clone (pHUC) is described in Tromp, et al, Biochem. J. 253:919 (1988), and also under Accession No. X07884 (Genbank, Los Alamos, N.Mex.). A cDNA clone (pSTL14) containing the entire coding region of human ⁇ 2(I) procollagen is described in Lee, et al, J. Biol. Chem.
  • a specialized cloning vector (pPL1) is created by isolating the AflIII/SspI region of Bluescript II KSM13+ from nucleotide position 1153 to 2850 (Stratagene Cloning Systems, La Jolla, Calif.) and inserting a double-stranded deoxyoligonucleotide polylinker containing the restriction sites (in order) HindIII, PvuII, DraIII, and BamHI.
  • a 618 nt region of the 5′ end of the cDNA is amplified by the Polymerase Chain Reaction (Perkin Elmer Cetus, Norwalk, Conn., according to the manufacturer's instructions) using the oligodeoxynucleotide primer #1 ACGCCAAGCTTGGCTGCAGGTCGA (SEQ ID NO:22:) and primer #2 pCTGTTTATCATCGTCGGGAGCAAAGTTTCCTCC (SEQ ID NO:23:).
  • the underlined nucleotide sequence in primer #2 codes for the amino acid recognition site (DDDK) (SEQ ID NO:1:) for the proteolytic enzyme enterokinase.
  • the 610 nt DNA fragment generated by the PCR reaction is cleaved with the restriction enzyme HindIII, and cloned into pPL1 at the HindIII/PvuII sites, creating pPL1-1.
  • the PvuII/DraIII fragment from the human ⁇ 1(I) procollagen cDNA (nt 858 to nt 1797) is cloned into pPL1-1 at the PvuII/DraIII sites, creating pPL1-2.
  • the next step is to insert the PvuII/PvuII (nt 569 to nt858) fragment of the human ⁇ 1(I) procollagen cDNA into pPL1-2 at the PvuII site, creating pPL1-3.
  • This PvuII/PvuII fragment inserts itself into the vector in either orientation, so clones which contain the orientation identical to the human ⁇ 1(I) procollagen cDNA are identified by DNA sequence analysis following the manufacturer's protocol (using SequenaseTM DNA sequencing kit by U.S. Biochemicals, Cleveland, Ohio, and the deoxynucleotide GAGTCACCCACCGACCAAGA (SEQ ID NO:24:) as the primer).
  • the cDNA fragment from the human ⁇ 1(I) procollagen cDNA from the DraIII site at position 1797 to the BamHI site at position 2886 is cloned into pPL1-3 at the DraIII/BamHI site, creating pPL1-4.
  • the product of these steps is the continuous region of the human ⁇ 1(I) procollagen cDNA from the 5′ end of the cDNA to the BamHI site at position 2886 with the introduction of a coding region for the amino acids DDDK, which is the amino acid recognition site for enterokinase.
  • pPL2 Another specialized cloning vector (pPL2) is created by the following procedure described above, but using a polylinker which contains the recognition sites for the restriction enzymes (in order) SalI, HindIII, BamHI, BspEII, and SspI.
  • a fragment of the human ⁇ 1(I) procollagen cDNA from the BamHI site at position 2886 to the BspEI site at position 3817 is cloned into the vector at the BamHI/BspEI site, creating pPL2-1.
  • pPL2-1 is digested with the restriction enzymes Eco47III and XhoI, and the 106 bp fragment is discarded.
  • a double-stranded deoxyoligonucleotide with the sequence GCTGGTTTCGACTTCAGCTTCCTCCC CCAGCCACCTCAAGAGAAGGCTCACGATGGTGGC CGCTACTACCGGGCTTGGGATGATGCCAATGTGGTTCGTGACCGTGACC (SEQ ID NO:25:) is inserted into pPL2-1 at the Eco47III/XhoI site, creating pPL2-2.
  • This double-stranded deoxyoligonucleotide contains three additional (underlined) deoxynucleotides (as compared to the human ⁇ 1(I) procollagen cDNA in this region) which code for the amino acid tryptophan.
  • a fragment of the human ⁇ 1(I) procollagen cDNA from nt 3818 to 4611 is removed by the restriction enzymes BspEI and SspI and inserted into pPL2-2 at the BspEI/SspI site, creating pPL2-3.
  • the human ⁇ 1(I) procollagen cDNA containing additional nucleotide sequences within the cDNA, which code for additional amino acid(s) at the N-terminal propeptide-telopeptide and C-terminal telopeptide-propeptide junctions, is created by removal of the HindIII/BamHI fragment from pPL1-4 containing the 5′ region of the human ⁇ 1(I) procollagen cDNA, as described in section B above, and inserting this fragment into the HindIII/BamHI sites of pPL2-3 containing the 3′ region of the human ⁇ 1(I) procollagen cDNA, creating pM ⁇ 1(I).
  • a specialized cloning vector (pPL3) is created as described in section B, but using a polylinker which contains the restriction sites (in order) SaII, SphI, PmII, MscI, and Sse83871.
  • the human ⁇ 2(I) procollagen cDNA is excised from pSTL14 using SphI and SmaI restriction enzymes.
  • the resulting DNA fragment is treated with T4 DNA polymerase in the presence of deoxynucleotides to make a blunt end at the 5′ end of the cDNA. This fragment is subcloned into the Bluescript II vector at the EcoRV and Smal sites.
  • the ⁇ 2(I) procollagen cDNA fragment inserts itself into the vector in either orientation, so clones in which the Smal site is reconstituted are selected and given the name of p ⁇ 2(I) .
  • Polymerase Chain Reaction is performed according to the manufacturer's instructions (Perkin Elmer Cetus, Norwalk, Conn.) using Saccharomyces cerevisiae genomic DNA as template and the phosphorylated deoxyoligonucleotides pGTGGTATGCAAATTTTTGTCAAGACTTTGACTG (SEQ ID NO:26:) and pCCACCTCTCAATCTCAAGACT (SEQ ID NO:27:) as primers to isolate a fragment of the yeast gene UBI1 (ubiquitin) described in Oezkaynak et al, EMBO J.
  • the 232 bp DNA fragment is subcloned into the vector at the PmlI/MscI site, creating pPL3-1. This fragment inserts itself into the vector in either orientation, such that clones which contain the orientation identical to that of the human ⁇ 2(I) procollagen cDNA are identified by digestion with the restrictin enzymes PmlI and MscI.
  • a second PCR reaction is performed using p ⁇ 2(I) DNA as the template and the two deoxyoligonucleotides pCCAGTATGATGGAAAAGGAGTT (SEQ ID NO:28:) and CGAGCACCTGCAGGACCAGTT (SEQ ID NO:29:) as the primers for this reaction.
  • the 159 bp DNA fragment is digested with Sse83871 and subcloned into pPL3-1 at the MscI/Sse83871 sites, creating pPL3-2.
  • p ⁇ 2(I) is digested with SalI and PmlI, and the 199 nt fragment is isolated and inserted into pPL3-2 at the SalI and PmlI sites, creating pPL3-3.
  • p ⁇ 2(I) is digested with SalI and Sse8387I, and the 475 bp fragment is discarded.
  • pPL3-3 is digested with SalI and Sse83871, and the 600 bp DNA fragment is isolated and cloned into p ⁇ 2(I) at the SalI and Sse83871 sites, creating pPL3-4.
  • the human ⁇ 2(I) procollagen can be cleaved at the N-propeptide-N-telopeptide junction with a ubiquitin-specific processing protease, as described in Tobias and Varshavsky, J. Biol. Chem. 266: 12021 (1991).
  • ⁇ 2(I) is digested with AvrII and EcoRI, and the 909 bp DNA fragment is discarded.
  • Polymerase Chain Reaction is performed according to the manufacturer's instructions using p ⁇ 2(I) as template and the deoxyoligonucleotides TGGTCCTAGGGGCCCTGCTGGTCCTT (SEQ ID NO:30:) and pTCTACCTTCTATAGCCCTGTAGAAGTCTCCATCGTA (SEQ ID NO:31:) as primers.
  • the underlined nucleotide sequence in the second primer codes for the amino acid recognition site (IEGR) (SEQ ID NO:02:) for Factor X a
  • IEGR amino acid recognition site
  • a second PCR reaction is performed using RT-PCR according to the manufacturer's instructions (Perkin Elmer Cetus, Norwalk, Conn.) using as template total RNA isolated from mouse spleen by the procedure of Han, et al, Biochem. 26, 1617 (1987). Random hexamers are used as primers for the reverse transcription of mouse RNA.
  • the two PCR primers in the PCR reaction are pAAACAGAAGCACCAGTCGGTATTCA (SEQ ID NO:32:) and ATATGAATTCTCAGGTGCACGCACAGGTTGGCCGTA (SEQ ID NO:33:).
  • a DNA product of 215 bp which encodes the C-terminus of mouse complement C1q-C subunit (see Petry et al., Eur. J.
  • Biochem. (1992) 209:129 and Genbank Accession No. X66295) is isolated and digested with EcoRI.
  • the two digested PCR products are ligated into p ⁇ 2(I) previously digested with AvrII and EcoRI as described above, creating pPL4-1.
  • These steps create a human ⁇ 2(I) procollagen cDNA having the mouse complement C1q-C subunit C-terminus, which replaces the human ⁇ 2(I) procollagen C-propeptide and introduces a IEGR (SEQ ID NO:2:) recognition site for the protease Factor X a at the junction of the C-telopeptide and C-propeptide.
  • the human ⁇ 2(I) procollagen cDNA containing ubiquitin in place of the endogenous N-propeptide and the C-terminus of complement C1q-C subunit instead of the endogenous C-propeptide is created by removing the 2850 bp XhoI/XhoI fragment from PL3-4 (described in section E), inserting this DNA fragment into PL4-1 (described in section F) digested with XhoI, and discarding the 2725 bp fragment, creating pM ⁇ 2(I).
  • the XhoI fragment from pPL3-4 can insert itself into pPL4-1 in either orientation. The orientation which places the translation start codon toward the 5′ end of the construction is selected using DNA sequence analysis.
  • pSV-SPORT1 (Life Technologies, Ind., Gaithersburg, Md.) is used as the expression vector for the mutated ⁇ 1(I)procollagen cDNA (pM ⁇ 1(I) from example 2D) and the mutated ⁇ 2(I) procollagen cDNA (pM ⁇ 2(I) from Example 2G).
  • pSV-SPORT1 is digested with the restriction enzymes SalI and SspI.
  • the fragment containing the mutated ⁇ 1(I) procollagen cDNA is ligated into pSV-SPORT1 at the SalI and SnaBI sites, creating PSV-M ⁇ 1(I).
  • pM ⁇ 2(I) is digested with SalI and SmaI.
  • the fragment containing the mutated ⁇ 2(I) procollagen is ligated into pSV-SPORT1 at the SalI and SnaBI sites, creating pSV-M ⁇ 2(I).
  • Either pSV-M ⁇ 1(I) or pSV-M ⁇ 2(I) is co-transfected with pRSV neo into HT1080 cells (American Type Culture Collection, Rockville, Md.) using Lipofectamine Reagent (Life Technologies, Gaithersburg, Md.) and following the manufacturer's protocol for stable transfection of adherent cells.
  • the mutated procollagen product from HT1080 cells transfected with either pSV-M ⁇ 1(I) or pSV-M ⁇ 2(I) is secreted into the medium as homotrimeric molecules.
  • the medium is collected and protease inhibitors are added to a final concentration of 10 mM N-ethylmaleimide, 1 mM PMSF, and 25 mM EDTA.
  • Ammonium sulfate is added to the medium to a final concentration of 30%, and the medium is stored at 4° C. for 16 hours.
  • the medium is centrifuged at 4000 rpm for 10 minutes at 4° C.
  • the pellet is resuspended in 50 mM Tris, pH 7.4, 150 mM NaCl, and protease inhibitors at the concentrations listed above, or in the appropriate buffer for cleavage of one or both of the propeptides from the collagen molecule.
  • Recombinant human collagen produced as described in Example 3 is adjusted to a collagen concentration of 10 mg/ml by addition of 0.13 M phosphate buffer at pH 7.2 under conditions favoring fiber formation.
  • the resulting suspension of fibrillar collagen is centrifuged at 10,000 ⁇ g to concentrate the collagen, which is subsequently rediluted to a concentration of 35 mg/ml by the addition of phosphate buffer.
  • the resulting fibrillar collagen suspension is aliquotted into syringes for use in soft tissue augmentation.
  • a physician attaches a 25-guage or smaller needle to a syringe containing the recombinant human fibrillar collagen suspension prepared as described above. After attaching the needle to the collagen-containing syringe, the physician injects the collagen subcutaneously into the dermis, using multiple serial punctures, to soft tissue sites in need of augmentation, such as acne scars and wrinkles. Collagen is injected to a particular soft tissue site until the previously depressed area is even with the surface of the surrounding normal skin.
  • Recombinant human collagens are assayed and compared with purified human placental, bovine hide, and rat tail collagens for their ability to support gel contraction by human dermal fibroblasts.
  • Recombinant human collagens are prepared as described in Example 3. Human collagen is purified from human placenta by extraction with 0.1 M acetic acid, followed by precipitation of type I collagen by the addition of 1 M NaCl. Bovine hide and rat tail collagens are commercially obtained in soluble form (e.g., Vitrogen).
  • Rates of contraction are measured each day by placing the culture dish containing the contracted cell matrix over a template containing circles of varying diameter, then estimating the diameter of the contracted cell matrix by comparison with the circles on the template.
  • Recombinant human collagens prepared as described in Example 2 are shown to promote fibroblast contraction at rates at least comparable to those obtained using rat tail, purified. human placental, and bovine hide collagens.

Abstract

The invention provides recombinant procollagen chains having a natural collagen chain separated from one or two propeptide by one or two non-natural site-specific proteolytic agent (e.g., protease) recognition sites. A wide variety of propeptides and site-specific proteolytic agent recognition sites may be used: the selection of particular site-specific proteolytic agent/recognition site pairs is based on the conformation of the resulting procollagen, the availability of the site-specific proteolytic agent, the compatibility of the proteolysis with production of mature collagen, among other factors. Recombinant collagens chains are produced by contacting the subject recombinant procollagen chains with the appropriate site-specific proteolytic agents. Nucleic acids encoding the subject procollagen chains operably linked to transcription regulatory elements are used in vectors and cells for the production of recombinant collagen. Such collagen is used in tissue and cell cultureware and therapeutically, such as in biodegradable surgical materials and for tissue augmentation.

Description

    CROSS-REFERENCE TO RELATED APPLICATIONS
  • This is a continuation of and claims priority under 35 U.S.C.§ 120 to U.S. Ser. No. 08/278,774, filed Jul. 22, 1994, now U.S. Pat. No. 6,653,450, which is a continuation-in-part of U.S. Ser. No. 08/183,648, filed Jan. 18, 1994, now U.S. Pat. No. 5,667,839, which is a continuation-in-part of U.S. Ser. No. 08/011,643 filed Jan. 28, 1993, abandoned, all of which are incorporated herein by reference.
  • FIELD OF THE INVENTION
  • The field of this invention is recombinant procollagens containing novel cleavage sites.
  • BACKGROUND OF THE INVENTION
  • Collagen has provided a number of commercial applications including use as a convenient substrate for cell culture, as well as in the manufacture of biocompatible materials (e.g., artificial skin) having a variety of therapeutic applications in humans. Commercially available collagens are primarily isolated from freshly killed farm animals (e.g., cows, pigs, chickens) in polymerized form or in soluble form derived by enzymatic or chemical treatment of polymerized collagen. However, polymerized collagens, and soluble collagens derived from polymerized collagens, are of limited usefulness due to the presence of natural crosslinks within the collagen. Furthermore, non-human collagens can provoke undesirable immune responses when administered to human subjects.
  • As one alternative, human collagen can be purified from human sources such as human placenta, as described in U.S. Pat. No. 5,002,071 (Research Development Foundation) and in copending U.S. application Ser. No. 07/921,810 (Collagen Corporation). In addition to source limitations and the risk of contamination by human pathogens such as Hepatitis viruses and HIV, the methods for recovering collagen from these sources bias the type of collagen recovered. Furthermore, because collagen is derived from naturally crosslinked tissues, the collagen recovered is not entirely homogenous. Another approach to the production of human collagen is the expression of recombinant human collagen in the milk of transgenic animals, as described in copending U.S. application Ser. Nos. 08/183,648 and 08/011,643 (Collagen Corporation). However, this approach subjects the recombinant collagen to any host deficiencies in translational processing.
  • The term collagen refers to a type of protein that encompasses a class of structurally related polypeptides consisting of helical collagen chains and homo- and heteromeric polymers thereof. Collagen chains often contain both long helical domains and non-helical extensions, or telopeptides. The helical domains comprise -(GXY)n— repeats, where X and/or Y are frequently proline or hydroxyproline.
  • Collagen polypeptide chains are encoded by a number of related genes, See, Adams, S. L. Amer J Respir Cell and Mol Biol (1989) 1:161-168; Mayne and Brewton (1993) Current Opinion in Cell Biology 5:883-890; van der Rest and Bruckner (1993) Current Opinion in Structural Biology 3:430-436. Collagen-encoding transcripts are initially translated into procollagen chains which undergo a variety of post-translational events such as processing, secretion and assembly (e.g. disulfide exchange, prolyl residue hydroxylation, glycosylation, and crosslinking of the helical chains; see, for example, Prockop et al. (1984) New England J Med 3111:376-386) to form mature collagen chain helices. In addition, procollagens contain N- and C-terminal propeptides that facilitate collagen formation. See, for example, Lee et al. (1992) J Biol Chem 267, 24126-24133.
  • Many of these post-translational events are catalyzed by enzymes thought to be expressed only in or by cells which naturally produce collagen. For example, the procollagen propeptides are cleaved from the procollagens by tissue-specific procollagen N- and C-terminal proteases. Accordingly, recombinant production of collagen has been severely restricted by the inability of conventional cellular expression systems to efficiently post-translationally modify procollagen to form functionally mature collagen.
  • Site-specific proteolysis of unrelated fusion proteins is reported by Paul Carter in (1990), Protein Purification: From Molecular Mechanisms to Large-Scale Processes, p. 181-193, American Chemical Society Research Symposium #47; Brenner and Fuller (1992) PNAS 89:922-926; and Seeboth, et al. (1992) Appl Microbiol Biotechnol 37:621-625; Liu and Miller (1989) WO 89/12678. Chemical cleavage is described in Fontana and Gross (1986), Chapter 2 of In Practical Protein Chemistry—A Handbook, Darby, Ed; John Wiley and Sons, London.
  • SUMMARY OF THE INVENTION
  • The invention provides recombinant procollagen chains having a natural collagen polypeptide chain separated from a propeptide by a non-natural site-specific proteolytic agent recognition site (i.e. the site is not naturally present at that location of a natural procollagen chain). The propeptide is often a C-terminal propeptide and, frequently, a natural procollagen C-terminal propeptide. Alternatively, the recombinant procollagen chains may further comprise a second propeptide separated from the opposite end of the natural collagen chain by a second non-natural site-specific proteolytic agent recognition site.
  • A wide variety of propeptides and site-specific proteolytic agent recognition sites may be used. The propeptide is capable of increasing the yield of at least one of secreted procollagen (trimeric procollagen chains) or collagen monomers (trimeric collagen chains) from cells expressing procollagen chains comprising the propeptide, as compared with cells expressing the same collagen chains alone, without the propeptide. The non-natural site-specific proteolytic agent recognition site is generally selected to provide a substrate for a convenient site-specific proteolytic agent. The agent is commonly a protease or a chemical agent which selectively cleaves at accessible and preferentially labile peptide bonds. Where two site-specific proteolytic agent recognition sites and two propeptides are present, the recognition sites may have the same or different amino acid sequences with the same or different site-specific proteolytic agent affinities and specificities.
  • The subject procollagen chains may be constructed such that the site-specific proteolytic agent cleavage site is a peptide bond that separates the collagen chain and/or the propeptide from the remainder of the procollagen chain. Alternatively, the cleavage site may be a peptide bond that separates, from the remainder of the procollagen chain, the collagen chain (or propeptide) joined to at least one amino acid which is not naturally present at that location of a natural collagen chain (or propeptide).
  • The invention provides collagens produced by contacting the subject recombinant procollagen with site-specific proteolytic agents capable of selectively cleaving the procollagen chains at the site-specific proteolytic agent recognition sites, wherein the resulting chains comprise terminal peptides which may have non-natural amino acid sequences (i.e. not naturally present at that location of a natural collagen chain). The resulting collagen may be employed directly (e.g. to coat cell culture dishes or cultureware) or further polymerized and/or provided in sterile, nontoxic, biocompatible collagen compositions suitable for administration to humans.
  • The invention also provides nucleic acids encoding the subject procollagen chains, as well as vectors and cells comprising such nucleic acids operably linked to transcription regulatory elements not naturally linked to such nucleic acids. The invention provides processes for the production of recombinant procollagen and/or collagen chains in and from such cells. The invention also provides methods of utilizing the resulting procollagen and collagen, for example, coating cultureware and augmenting localized tissue in a host by, for example, subcutaneous administration.
  • BRIEF DESCRIPTION OF THE DRAWINGS
  • FIG. 1 shows a three-dimensional computer model of the N-terminal propeptide-telopeptide region of human procollagen type I (a triple helix of two α1 chains and one α2 chain). The structure was produced on a Silicon Graphics workstation using Biosym software. The energy minimized structure is produced after manual chain pull-ins to speed the process of computing the energy minimums. Points of cleavage with N-pro-peptidase are marked with a “▾”.
  • FIG. 2 shows a three-dimensional computer model of the C-terminal propeptide-telopeptide region of human procollagen type I (a triple helix of two α1 chains and one α2 chain). The structure was produced on a Silicon Graphics workstation using Biosym software. The energy minimized structure is produced after manual chain pull-ins to speed the process of computing the energy minimums. Points of cleavage of the extra-helical peptide from the C-terminal pro-region are marked with a “▾”. In the two α1 chains, this is before Gly 38; in the α2 chain, it is before Glu 27.
  • FIG. 3 shows a three-dimensional computer model of the N-terminal propeptide-telopeptide region of a mutant human procollagen type I containing the DDDK insertion. The structure was produced on a Silicon Graphics workstation using Biosym software. The energy minimized structure is produced after manual chain pull-ins to speed the process of computing the energy minimums. The insertional loop members are marked with a “▾”.
  • FIG. 4 shows the proteolytic cleavage site of the mutant human procollagen type I containing the DDDK insertion. Points of cleavage of N-propeptidase are marked with a “▾”. Regions in whichc the α1 chains are “coiled” are disignated with a “10”.
  • DETAILED DESCRIPTION OF PARTICULAR EMBODIMENTS OF THE INVENTION
  • The invention provides recombinant procollagen chains comprising a natural collagen chain, a propeptide, and a non-natural site-specific proteolytic agent recognition site (i.e. not naturally present at that location of a natural collagen chain) located between the collagen chain and the propeptides.
  • The propeptide increases the yield of at least one of secreted procollagen (trimeric procollagen chains) or collagen monomers (trimeric collagen chains) recoverable from cells expressing the subject recombinant procollagen chains, as compared with cells expressing the collagen chains alone, without the propeptide. Generally, the yield is enhanced by at least 50%, preferably at least about 100%, more preferably at least about 200%, and most preferably at least about 1,000% in at least one expression system.
  • Collagen refers to a variety of helical arrays of collagen chains and includes both polymerized and monomeric collagen. The propeptides are believed to improve collagen and/or procollagen yields by facilitating or increasing at least one of proper expression, processing, secretion, or polymerization of the procollagen chain, the collagen chain, and/or a collagen monomer. The function of the propeptide is readily monitored by comparing the yields of recoverable collagen and/or procollagen with and without the presence of the propeptide in in vitro or in vivo expression systems including lysates, transformed or transfected cells (such as mammalian cells or yeast), transgenic animals, etc. Specific examples of assays for propeptides are described below.
  • The propeptide may take a wide variety of forms and sizes: it may be a natural procollagen propeptide, or a propeptide not naturally present as a propeptide in a procollagen chain, as long as it provides the procollagen with the requisite collagen yield. Generally, propeptides are at least 10, preferably at least about 25, more preferably at least about 75, and most preferably at least about 200 amino acids in length. The propeptide is generally located at the C-terminus or N-terminus of the procollagen chain, or the procollagen chain may have propeptides at both termini. Where the recombinant procollagen chains contain both C- and N-terminal propeptides, the chains often comprise a second (and often non-natural) site-specific proteolytic agent recognition site located between the collagen chain and the second propeptide.
  • Preferred procollagen chains comprise at least a C-terminal propeptide, frequently a natural C-terminal portion of a protein with collagen-like repeats and/or a helical, especially triple-helical, polymeric form, such as complement protein C1q-C, acetocholine esterase, or lung surfactant protein. Especially preferred are natural procollagen C-terminal propeptides, such as collagen Type I, II, III, IV, V and XI C-terminal propeptides. Preferred N-terminal propeptides comprise at least one globular domain and often consist essentially of a single globular domain. Especially preferred are natural procollagen N-terminal propeptides, such as collagen type I, II, III, IV, V, and XI N-terminal propeptides.
  • After cleavage from the collagen chain, the propeptides are preferably purified out of the collagen composition. The propeptides are preferably selected such that, if small quantities of the propeptides remain in the collagen composition after processing, the residual propeptides do not interfere with the intended application of the resulting composition. For example, for in vivo use, the composition should not contain contaminants present in an amount sufficient to cause a toxic or immunogenic response or reaction in the patient.
  • A wide variety of site-specific proteolytic agent recognition sites may be used. The recognition site is non-natural to a natural procollagen chain, meaning that the site occupies a portion of the procollagen chain not naturally occupied by the recognition site. Frequently, the site is not naturally present anywhere in the natural counterpart of the procollagen chain. The site generally comprises one or more amino acid residues or derivatives thereof. The recognition site may comprise a modified (e.g., methylated) residue, especially for some chemical proteolytic agents. These sites are selected to provide substrates for at least one convenient site-specific proteolytic agent, preferably a commercially available site-specific proteolytic agent. The precise site selection will depend on the selected expression system, the selected propeptide, and the availability of the site-specific proteolytic agent. For example, the site should provide a highly selective target for the selected site-specific proteolytic agent, such that the target site (or both target sites) is cleaved while minimizing hydrolysis of peptide bonds within the collagen chain.
  • A large number of site-specific proteolytic agents and their recognition sites are known and/or commercially available. See, for example, Carter (1990, supra), Saito et al. (1987) J. Biochem 101, 123-134, etc. For example, a wide variety chemical cleavage agents and their recognition sites are known, e.g. hydroxylamine: N↓G; formic acid: D↓P; acetic acid: D↓P; cyanogen bromide: M↓; BNPS-skatole: W↓; o-iodosobenzoic acid: W↓; N-chlorosuccinimide: W↓; etc. Alternatively, natural or synthetic proteases (e.g. catalytic antibodies, etc.) may be used. Examples of proteases and their recognition sites include: chymotrypsin: W↓ and Y↓ and F↓; collagenase: P-X↓G-P, endoproteinase Lys-C: K↓; enterokinase: D-D-D-K↓ (SEQ ID NO: 1:), Factor Xa: I-E-G-R↓ (SEQ ID NO:2:); kallikrein: P—F—R↓; renin: Y-I-H—P—F—H-L↓L (SEQ ID NO:3:), H64A subtilisin BPN: A-A-H—Y↓ (SEQ ID NO:4:), thrombin: R-G-P—R↓ ( SEQ ID NO:5:); trypsin: R↓ and K↓; ubiquitin protein peptidase: ubiquitin↓; etc. A wide variety of methods may be used to increase the efficiency of cleavage at a target site (e.g. the provision of flanking poly-glycine peptides to enhance accessibility) and/or to reduce non-target site cleavage (e.g. optimizing concentration ratios and reaction conditions).
  • Preferred site/site-specific proteolytic agent combinations yield a collagen product that is conveniently adapted to the ultimate intended application. For example, any residual non-natural terminal residues should not interfere with and, preferably, enhance the performance (e.g. the promotion of cell growth or adherence to coated cultureware) of the resulting collagen product vis-a-vis the natural collagen counterpart. For in vivo use, the resulting collagen should not be immunologically reactive in the host from which the collagen chain is derived. Generally, immunological non-reactivity is effected by minimizing the number of non-collagen chain amino acid residues which remain joined to the collagen chain after site-specific proteolytic agent cleavage. Preferred site/site-specific proteolytic agent combinations yield collagen chains with fewer than 75, preferably fewer than 25, more preferably fewer than 10, most preferably fewer than 5 and, especially, zero, non-natural collagen chain terminal amino acid residues. Hence, preferred sites and site-specific proteolytic agents provide cleavage at or near the junction with natural collagen chain residues.
  • Where two site-specific proteolytic agent recognition sites and two propeptides are present, the site-specific proteolytic agent recognition sites may have the same or different amino acid sequences, with the same or different site-specific proteolytic agent affinities and specificities. The site-specific proteolytic agent recognition site(s) generally, but need not, abut both the collagen chain and respective propeptide; i.e. the subject procollagen chains may also have a natural or non-natural (i.e. not naturally present at that location of a natural procollagen chain) amino acid sequence between the site-specific proteolytic agent recognition site and the collagen chain, and/or between the site-specific proteolytic agent recognition site and the propeptide. Accordingly, depending on the selected recognition site, site-specific proteolytic agent, and presence or absence of residues separating the cleavage site from the collagen chain, the resulting (after cleavage) recombinant collagen chains may comprise one or both terminal peptides having a non-natural amino acid sequence. By way of example:
      • for human α1(I) collagen, a preferred N-terminal peptide is NH2—X1X2X3X4X5X6X7X8X9X10X11X12X13X14X15QLSYGYDEKSTGGISVP (SEQ ID NO:6:), where “X1—X15” is other than PGPPGPPGLGGNFAP (SEQ ID NO:7:); and a preferred C-terminal peptide is PPQEKAHDGGRYYRA(SEQ ID NO:8:) X1X2X3X4X5X6X7X8X9X10X11X12X13X14X15, where “X1—X15” is other than DDANVVRDRDLEVDT (SEQ ID NO:9:);
      • for human α2(I) collagen, a preferred N-terminal peptide is NH2—X1X2X3X4X5X6X7X8X9X10X11X12X13X14X15QYDGKGVGLGP (SEQ ID NO:10:), where “X1—X15” is other than PGPPGPPGLGGNFAA (SEQ ID NO:11:); and a preferred C-terminal peptide is GGGYDFGYDGDFYRA(SEQ ID NO:12:)X1X2X3X4X5X6X7X8X9X10X11X12X13X14X15, where “X1—X15” is other than DQPRSAPSLRPKDYE (SEQ ID NO: 13:);
      • for human α1(II) collagen, a preferred N-terminal peptide is NH2—X1X2X3X4X5X6X7X8X9X10X11X12X13X14X15QMAGGFDEKAGGAQMGVQM (SEQ ID NO:14:), where “X1—X15” is other than PGPPGPPGLGGNFAA (SEQ ID NO:15:); and a preferred C-terminal peptide is GPREKGPDPMQYMRA(SEQ ID NO:16:)X1X2X3X4X5X6X7X8X9X10X11X12X13X14X15, where “X1—X15” is other than DEADSTLRQHDVEVD (SEQ ID NO:17:);
      • for human α1(III) collagen, a preferred N-terminal peptide is NH2—X1X2X3X4X5X6X7X8X9X10X11X12X13X14X15QYDSYDVKSGVAVG (SEQ ID NO:18:), where “X1—X15” is other than GICESCPTGPQNYSP (SEQ ID NO:19:); and a preferred C-terminal peptide is GIGGEKAGGFAPYYG(SEQ ID NO:20:)X1X2X3X4X5X6X7X8X9X10X11X12X13X14X15, where “X1—X15” is other than DEPMDFKINTDEIMT (SEQ ID NO:21:).
  • The invention provides recombinant collagen chains produced by contacting the subject recombinant procollagen chains with site-specific proteolytic agents capable of selectively cleaving the procollagen chain at site-specific proteolytic agent recognition sites. Useful collagen compositions produced by such methods may retain residual site-specific proteolytic agents, wherein the site-specific proteolytic agents are present at concentrations that may exceed 1 picogram, frequently exceed 1 nanogram, and more frequently exceed 1 microgram per gram of collagen protein. Resulting collagen compositions may be subjected to conditions known in the art to be conducive to higher-order polymerization of the collagen, for example, fibril formation. Monomeric or polymeric collagen compositions may be further subjected to a wide variety of manipulations depending on the intended application. For example, the collagen may be diluted in an solvent for optimal adsorption to solid substrates (e.g. glass or plastics such as polystyrene, polyethylene, polypropylene, acetate, nylon, etc.) useful in tissue or cell culture, or purified and sterilized (e.g. filter sterilization) for use in vivo, such as for tissue augmentation.
  • The invention provides nucleic acids encoding the subject recombinant procollagen chains. These nucleic acids may have a wide variety of forms and sizes and frequently comprise non-coding sequences which facilitate transcription of the encoded procollagen chains. Constructs comprising such nucleic acids operably linked to transcription regulatory elements are spliced into replication and/or transfection vectors, which are then used to transfect/transform cells.
  • Nucleic acids encoding the collagen chain portions (e.g. collA1, col1A2 and col3A1) and the site-specific proteolytic agent recognition portions of the subject nucleic acids are readily available, for example, through published sequences, including electronic databases (e.g., Genbank, the National Center for Biotechnology Information at the National Library for Medicine, etc.), through commercial vendors, through library hybridization with otherwise available collagen-encoding nucleic acids, or through known molecular cloning techniques. Materials and methods for constructing (e.g., recombinantly or synthetically) the subject procollagen-encoding nucleic acids, expression vectors, transformed and transfected cells, processes for producing a recombinant procollagen chain (including selection from a wide variety of cells, e.g., cultured mammalian cells such as fibroblasts, CHO cells, yeast, mammary gland cells of transgenic mammals, etc.), transfecting/transforming and culturing the cells under conditions suitable for the expression of the nucleic acid, and recovering and purifying recombinant procollagen chains are disclosed herein or otherwise known in the art. See, for example, Molecular Cloning, A Laboratory Manual (2nd Ed., Sambrook, Fritsch and Maniatis, Cold Spring Harbor), Current Protocols in Molecular Biology (Eds. Aufubel, Brent, Kingston, More, Feidman, Smith and Stuhl, Greene Publ. Assoc., Wiley-Interscience, NY, N.Y., 1992).
  • In a preferred embodiment, construct design is effected by first preparing a three-dimensional model of a procollagen helix at the propeptide-telopeptide junction, then introducing amino acid substitutions that would allow cleavage with specific proteolytic enzymes. For example, FIGS. 1 and 2 depict the structures of the N- and C-terminal propeptide-telopeptide regions of human type I procollagen, respectively. The structures are energy minimized and the native cleavage sites are marked. Molecular modeling is performed to ensure that the substitutions do not disrupt the folding of this region so as to inhibit processing, secretion, helical formation, or site-specific proteolytic agent accessibility.
  • Molecular constructs are then generated by either mutating procollagen-encoding cDNAs or splicing nucleic acids encoding the selected collagen chain with nucleic acids encoding the selected site-specific proteolytic agent recognition site. Mutation may be effected by site-directed mutagenesis, nucleotide insertion or substitution (e.g., by PCR-based mutagenesis) or replacement of oligonucleotides by cloning. The insertion site is preferably at or within 100, preferably within 30, more preferably within 10 nucleotides distal to the procollagen site-specific proteolytic agent cleavage site encoding sequence. The substituted nucleotides are within 60, preferably within 36, preferably within 18, nucleotides distal to the procollagen site-specific proteolytic agent cleave site encoding sequence. Preferred constructs additionally comprise nucleic acids including a promoter region necessary for the expression of the encoded procollagen in an appropriate host. Preferred promoters that are constitutive in cultured cells include cytomegalovirus (CMV), simian virus (SV), and Rous sarcoma virus (RSV) promoters. Preferred promoters for tissue-specific expression (e.g., in mammary gland cells) of transgenic animals include casein or acid whey protein promoters. Preferred promoters for expression in yeast include phosphoglycerol kinase (PKG), alcohol dehydrogenase (ADH), and galactose (GAL).
  • The construct is then transfected into and expressed in a cellular expression system, preferably an expression system wherein the mutated procollagen is secreted. In less preferred embodiments, the recombinant PROcollagen is not sufficiently secreted, and recovery entails lysing the cells and centrifuging the lysate to remove cellular debris. In one embodiment, the cells are selected or engineered to express both the recombinant procollagen and a site-specific proteolytic agent capable of specifically cleaving the procollagen at the recognition site. Alternatively, the appropriate site-specific proteolytic agents are introduced in an amount sufficient to cleave the propeptides from the procollagen molecules prior to fibrillogenesis in the processing steps.
  • Collagen chains are purified from the medium by methods known in the art. See, for example, Miller and Rhodes (1982) Methods in Enzymology 82:33-64; Sage and Bernstein (1982) Methods in Enzymology 82:96-127. Resulting collagen compositions may be sterilized, for example, by passage through 0.2 μm filters, (e.g., Millipore filters). Sterility may be confirmed by, for example, culturing aliquots on nutrient agar for at least 72 hours at 25 and 37° C. For therapeutic uses, it is desirable to ensure the non-toxicity, biocompatibility and non-immunogenicity of the resulting recombinant collagen compositions. For example, non-immunogenicity in humans is confirmed by dermal sensitivity testing.
  • The invention provides a wide variety of applications of the subject recombinant procollagens and collagens in tissue and cell culture and therapy. For example, the subject procollagens and collagens are used to promote adhesion and growth of cells on a wide variety of solid substrates in various forms, such as slides, filaments, sheets, plates, flasks, bottles, fibers, etc., and compositions such as plastics, glass, metals, saccharide-based polymers, etc. The collagens provide a wide range of therapeutic applications such as use in biodegradable sutures, synthetic dermal skin, biodegradable hemostatic sponges, tissue augmentation (including modifying localized soft tissue appearance), etc.
  • Tissue argumentation using collagen compositions has been thoroughly studied, documented, and implemented in wide-spread clinical settings. See, for example, DeLustro et al. (1986) J Biomed Mater Res, 20, 109-120; Elson M L (1989) J Dermatol Surg Oncol, 15, 301-303; Elson M L (1992) Am J Cosmetic Surg 9, 267-271; Klein et al. (1985) J Dermatol Surg Oncol, 11, 337-339; Klein et al. (1989) Geriatric Dermatology: Clinical Diagnosis and Practical Therapy, chapter 8, pp 47-49, Igaku-Shoin (publ) New York; Kligman A M (1988) J Dermatol Surg Oncol 14 (suppl I), 35-38; Kligman et al. (1986) J Dermatol Surg Oncol, 12, 351-357; Kligman et al. (1988) J Dermatol Surg Oncol, 14 (suppl I), 10-12; Knapp et al. (1977) Plas Reconstr Surg, 60, 398-405; Knapp et al. (1977) J Surg Res, 23, 96-105; Varnavides et al. (1987) Br J Dermatol 116, 199-206; etc.
  • EXAMPLES
  • The following examples are offered by way of illustration and not by way of limitation.
  • Example 1 Three-Dimensional Computer Modeling of Single Site-Specific Protease Recognition Site Insertion
  • Three-dimensional models for the N- and C-terminal propeptide-telopeptide regions were performed as outlined above. FIGS. 1 and 2 depict the energy minimized structures of the N- and C-terminal propeptide/telopeptide regions of human type I procollagen, respectively. Substitutions were then inserted at the N-terminal cleavage junction site to generate a non-natural site-specific proteolytic agent recognition site and new models prepared to determine their affects on procollagen folding.
  • FIG. 3 depicts an N-terminal fragment containing a DDDK (SEQ ID NO:1:) insertion in all three chains, introducing a recognition and cleavage site for enterokinase into the propeptide-telopeptide junction region. As shown in FIG. 4, the proteolytic cleavage site of this mutant is particularly accessible in the energy-minimized structure.
  • Example 2 Generation of Molecular Constructs for Recombinant Human Procollagens
  • A. cDNA Clones Encoding Human α1(I) and α2(I) Procollagens
  • A cDNA clone containing the entire coding region of human α1(I) procollagen is obtained from the Whitehead Institute (Cambridge, Mass.). The description of the cDNA is described in Stacy, et al, J Virol. 61: 2549 (1987). The nucleotide sequence of this clone (pHUC) is described in Tromp, et al, Biochem. J. 253:919 (1988), and also under Accession No. X07884 (Genbank, Los Alamos, N.Mex.). A cDNA clone (pSTL14) containing the entire coding region of human α2(I) procollagen is described in Lee, et al, J. Biol. Chem. 263:13414 (1988). The nucleotide sequence of human α2(I) procollagen is listed under Accession No. J03464 (Genbank), and the numbering system used assigns nt 1 to the transcription start point, according to Dickson et al., Nucl. Acids Res. 13:3427 (1985).
  • B. Introduction of Cleavage Site into the Junction of N-Propeptide and N-Telopeptide of the Human α1(I) Procollagen cDNA
  • A specialized cloning vector (pPL1) is created by isolating the AflIII/SspI region of Bluescript II KSM13+ from nucleotide position 1153 to 2850 (Stratagene Cloning Systems, La Jolla, Calif.) and inserting a double-stranded deoxyoligonucleotide polylinker containing the restriction sites (in order) HindIII, PvuII, DraIII, and BamHI. Using pHUC as a template, a 618 nt region of the 5′ end of the cDNA is amplified by the Polymerase Chain Reaction (Perkin Elmer Cetus, Norwalk, Conn., according to the manufacturer's instructions) using the oligodeoxynucleotide primer #1 ACGCCAAGCTTGGCTGCAGGTCGA (SEQ ID NO:22:) and primer #2 pCTGTTTATCATCGTCGGGAGCAAAGTTTCCTCC (SEQ ID NO:23:). The underlined nucleotide sequence in primer #2 codes for the amino acid recognition site (DDDK) (SEQ ID NO:1:) for the proteolytic enzyme enterokinase. The 610 nt DNA fragment generated by the PCR reaction is cleaved with the restriction enzyme HindIII, and cloned into pPL1 at the HindIII/PvuII sites, creating pPL1-1. Next, the PvuII/DraIII fragment from the human α1(I) procollagen cDNA (nt 858 to nt 1797) is cloned into pPL1-1 at the PvuII/DraIII sites, creating pPL1-2. The next step is to insert the PvuII/PvuII (nt 569 to nt858) fragment of the human α1(I) procollagen cDNA into pPL1-2 at the PvuII site, creating pPL1-3. This PvuII/PvuII fragment inserts itself into the vector in either orientation, so clones which contain the orientation identical to the human α1(I) procollagen cDNA are identified by DNA sequence analysis following the manufacturer's protocol (using Sequenase™ DNA sequencing kit by U.S. Biochemicals, Cleveland, Ohio, and the deoxynucleotide GAGTCACCCACCGACCAAGA (SEQ ID NO:24:) as the primer). The cDNA fragment from the human α1(I) procollagen cDNA from the DraIII site at position 1797 to the BamHI site at position 2886 is cloned into pPL1-3 at the DraIII/BamHI site, creating pPL1-4. The product of these steps is the continuous region of the human α1(I) procollagen cDNA from the 5′ end of the cDNA to the BamHI site at position 2886 with the introduction of a coding region for the amino acids DDDK, which is the amino acid recognition site for enterokinase.
  • C. Introduction of Cleavage Site into the Junction of C-Telopeptide and C-Propeptide of the Human α1(I) Procollagen cDNA
  • Another specialized cloning vector (pPL2) is created by the following procedure described above, but using a polylinker which contains the recognition sites for the restriction enzymes (in order) SalI, HindIII, BamHI, BspEII, and SspI. First, a fragment of the human α1(I) procollagen cDNA from the BamHI site at position 2886 to the BspEI site at position 3817 is cloned into the vector at the BamHI/BspEI site, creating pPL2-1. pPL2-1 is digested with the restriction enzymes Eco47III and XhoI, and the 106 bp fragment is discarded. A double-stranded deoxyoligonucleotide with the sequence GCTGGTTTCGACTTCAGCTTCCTCCC CCAGCCACCTCAAGAGAAGGCTCACGATGGTGGC CGCTACTACCGGGCTTGGGATGATGCCAATGTGGTTCGTGACCGTGACC (SEQ ID NO:25:) is inserted into pPL2-1 at the Eco47III/XhoI site, creating pPL2-2. This double-stranded deoxyoligonucleotide contains three additional (underlined) deoxynucleotides (as compared to the human α1(I) procollagen cDNA in this region) which code for the amino acid tryptophan. Next, a fragment of the human α1(I) procollagen cDNA from nt 3818 to 4611 is removed by the restriction enzymes BspEI and SspI and inserted into pPL2-2 at the BspEI/SspI site, creating pPL2-3.
  • D. Assembly of Human α1(I) Procollagen cDNA with Non-Natural Cleavage Sites at the Propeptide-Telopeptide Junctions
  • The human α1(I) procollagen cDNA containing additional nucleotide sequences within the cDNA, which code for additional amino acid(s) at the N-terminal propeptide-telopeptide and C-terminal telopeptide-propeptide junctions, is created by removal of the HindIII/BamHI fragment from pPL1-4 containing the 5′ region of the human α1(I) procollagen cDNA, as described in section B above, and inserting this fragment into the HindIII/BamHI sites of pPL2-3 containing the 3′ region of the human α1(I) procollagen cDNA, creating pM α1(I). This results in an α1(I) procollagen cDNA that codes for a polypeptide which can be cleaved at the N-terminal propeptide-telopeptide junction with enterokinase, leaving no additional terminal amino acids, and at the C-terminal telopeptide-propeptide with N-chlorosuccinimide, leaving the terminal amino acid tryptophan, according to the method described in Saito et al, J. Biochem. 101: 123 (1987).
  • E. Use of Heterologous N-Propeptide and Introduction of Cleavage Site into the Junction of N-Propeptide and N-Telopeptide of the Human α2(I) Procollagen cDNA
  • A specialized cloning vector (pPL3) is created as described in section B, but using a polylinker which contains the restriction sites (in order) SaII, SphI, PmII, MscI, and Sse83871. The human α2(I) procollagen cDNA is excised from pSTL14 using SphI and SmaI restriction enzymes. The resulting DNA fragment is treated with T4 DNA polymerase in the presence of deoxynucleotides to make a blunt end at the 5′ end of the cDNA. This fragment is subcloned into the Bluescript II vector at the EcoRV and Smal sites. The α2(I) procollagen cDNA fragment inserts itself into the vector in either orientation, so clones in which the Smal site is reconstituted are selected and given the name of p α2(I) . Polymerase Chain Reaction is performed according to the manufacturer's instructions (Perkin Elmer Cetus, Norwalk, Conn.) using Saccharomyces cerevisiae genomic DNA as template and the phosphorylated deoxyoligonucleotides pGTGGTATGCAAATTTTTGTCAAGACTTTGACTG (SEQ ID NO:26:) and pCCACCTCTCAATCTCAAGACT (SEQ ID NO:27:) as primers to isolate a fragment of the yeast gene UBI1 (ubiquitin) described in Oezkaynak et al, EMBO J.6: 1429 and listed under Accession No. X05728 (Genbank). The 232 bp DNA fragment is subcloned into the vector at the PmlI/MscI site, creating pPL3-1. This fragment inserts itself into the vector in either orientation, such that clones which contain the orientation identical to that of the human α2(I) procollagen cDNA are identified by digestion with the restrictin enzymes PmlI and MscI. A second PCR reaction is performed using p α2(I) DNA as the template and the two deoxyoligonucleotides pCCAGTATGATGGAAAAGGAGTT (SEQ ID NO:28:) and CGAGCACCTGCAGGACCAGTT (SEQ ID NO:29:) as the primers for this reaction. The 159 bp DNA fragment is digested with Sse83871 and subcloned into pPL3-1 at the MscI/Sse83871 sites, creating pPL3-2. p α2(I) is digested with SalI and PmlI, and the 199 nt fragment is isolated and inserted into pPL3-2 at the SalI and PmlI sites, creating pPL3-3. p α2(I) is digested with SalI and Sse8387I, and the 475 bp fragment is discarded. pPL3-3 is digested with SalI and Sse83871, and the 600 bp DNA fragment is isolated and cloned into p α2(I) at the SalI and Sse83871 sites, creating pPL3-4. This creates human α2(I) procollagen cDNA which contains the endogenous signal sequence, but codes for the yeast ubiquitin polypeptide, which replaces the endogenous N-propeptide. The human α2(I) procollagen can be cleaved at the N-propeptide-N-telopeptide junction with a ubiquitin-specific processing protease, as described in Tobias and Varshavsky, J. Biol. Chem. 266: 12021 (1991).
  • F. Use of Heterologous C-Propeptide and Introduction of Cleavage Site into the Junction of C-Telopeptide and C-Propeptide of the Human α2(I) Procollagen cDNA
  • α2(I) is digested with AvrII and EcoRI, and the 909 bp DNA fragment is discarded. Next, Polymerase Chain Reaction is performed according to the manufacturer's instructions using p α2(I) as template and the deoxyoligonucleotides TGGTCCTAGGGGCCCTGCTGGTCCTT (SEQ ID NO:30:) and pTCTACCTTCTATAGCCCTGTAGAAGTCTCCATCGTA (SEQ ID NO:31:) as primers. The underlined nucleotide sequence in the second primer codes for the amino acid recognition site (IEGR) (SEQ ID NO:02:) for Factor Xa A DNA product of 220 bp is isolated and then digested with AvrII. A second PCR reaction is performed using RT-PCR according to the manufacturer's instructions (Perkin Elmer Cetus, Norwalk, Conn.) using as template total RNA isolated from mouse spleen by the procedure of Han, et al, Biochem. 26, 1617 (1987). Random hexamers are used as primers for the reverse transcription of mouse RNA. The two PCR primers in the PCR reaction are pAAACAGAAGCACCAGTCGGTATTCA (SEQ ID NO:32:) and ATATGAATTCTCAGGTGCACGCACAGGTTGGCCGTA (SEQ ID NO:33:). A DNA product of 215 bp which encodes the C-terminus of mouse complement C1q-C subunit (see Petry et al., Eur. J. Biochem. (1992) 209:129 and Genbank Accession No. X66295) is isolated and digested with EcoRI. The two digested PCR products are ligated into p α2(I) previously digested with AvrII and EcoRI as described above, creating pPL4-1. These steps create a human α2(I) procollagen cDNA having the mouse complement C1q-C subunit C-terminus, which replaces the human α2(I) procollagen C-propeptide and introduces a IEGR (SEQ ID NO:2:) recognition site for the protease Factor Xa at the junction of the C-telopeptide and C-propeptide.
  • G. Assembly of Human α2(I) Procollagen cDNA with Non-Natural Propeptide Domains and Non-Natural Cleavage Sites at the Propeptide-Telopeptide Junctions
  • The human α2(I) procollagen cDNA containing ubiquitin in place of the endogenous N-propeptide and the C-terminus of complement C1q-C subunit instead of the endogenous C-propeptide is created by removing the 2850 bp XhoI/XhoI fragment from PL3-4 (described in section E), inserting this DNA fragment into PL4-1 (described in section F) digested with XhoI, and discarding the 2725 bp fragment, creating pM α2(I). The XhoI fragment from pPL3-4 can insert itself into pPL4-1 in either orientation. The orientation which places the translation start codon toward the 5′ end of the construction is selected using DNA sequence analysis. This results in a α2(I) procollagen cDNA which can be cleaved at the N-terminal propeptide-telopeptide junction with ubiquitin specific processing protease, and at the C-terminal telopeptide-propeptide junction with Factor Xa, leaving the terminal amino acids IEGR (SEQ ID NO:2:).
  • Example 3 Production of Recombinant Human Collagen
  • pSV-SPORT1 (Life Technologies, Ind., Gaithersburg, Md.) is used as the expression vector for the mutated α1(I)procollagen cDNA (pM α1(I) from example 2D) and the mutated α2(I) procollagen cDNA (pM α2(I) from Example 2G). pSV-SPORT1 is digested with the restriction enzymes SalI and SspI. The fragment containing the mutated α1(I) procollagen cDNA is ligated into pSV-SPORT1 at the SalI and SnaBI sites, creating PSV-M α1(I). pM α2(I) is digested with SalI and SmaI. The fragment containing the mutated α2(I) procollagen is ligated into pSV-SPORT1 at the SalI and SnaBI sites, creating pSV-M α2(I).
  • Either pSV-M α1(I) or pSV-M α2(I) is co-transfected with pRSV neo into HT1080 cells (American Type Culture Collection, Rockville, Md.) using Lipofectamine Reagent (Life Technologies, Gaithersburg, Md.) and following the manufacturer's protocol for stable transfection of adherent cells. The mutated procollagen product from HT1080 cells transfected with either pSV-M α1(I) or pSV-M α2(I) is secreted into the medium as homotrimeric molecules. After 24 hours, the medium is collected and protease inhibitors are added to a final concentration of 10 mM N-ethylmaleimide, 1 mM PMSF, and 25 mM EDTA. Ammonium sulfate is added to the medium to a final concentration of 30%, and the medium is stored at 4° C. for 16 hours. The medium is centrifuged at 4000 rpm for 10 minutes at 4° C. The pellet is resuspended in 50 mM Tris, pH 7.4, 150 mM NaCl, and protease inhibitors at the concentrations listed above, or in the appropriate buffer for cleavage of one or both of the propeptides from the collagen molecule. See the following sources for specific cleavage agents and reaction conditions: for enterokinase, Sigma Chemical Company, St. Louis, Mo.; for tryptophan chemical cleavage, Saito et al., J. Biochem. (1987) 101:1230134; for ubiquitin specific processing enzyme, Tobias and Varshavsky, J. Biol. Chem. (1991) 266:12021; for Factor Xa, New England Biolabs, Beverly, Mass.
  • Example 4 Use of Recombinant Human Collagen in Soft Tissue Augmentation
  • Recombinant human collagen produced as described in Example 3 is adjusted to a collagen concentration of 10 mg/ml by addition of 0.13 M phosphate buffer at pH 7.2 under conditions favoring fiber formation. The resulting suspension of fibrillar collagen is centrifuged at 10,000×g to concentrate the collagen, which is subsequently rediluted to a concentration of 35 mg/ml by the addition of phosphate buffer. The resulting fibrillar collagen suspension is aliquotted into syringes for use in soft tissue augmentation.
  • A physician attaches a 25-guage or smaller needle to a syringe containing the recombinant human fibrillar collagen suspension prepared as described above. After attaching the needle to the collagen-containing syringe, the physician injects the collagen subcutaneously into the dermis, using multiple serial punctures, to soft tissue sites in need of augmentation, such as acne scars and wrinkles. Collagen is injected to a particular soft tissue site until the previously depressed area is even with the surface of the surrounding normal skin.
  • Example 5 Cultureware Coating Assay: Human Dermal Fibroblast Contraction Assay
  • Recombinant human collagens are assayed and compared with purified human placental, bovine hide, and rat tail collagens for their ability to support gel contraction by human dermal fibroblasts. Recombinant human collagens are prepared as described in Example 3. Human collagen is purified from human placenta by extraction with 0.1 M acetic acid, followed by precipitation of type I collagen by the addition of 1 M NaCl. Bovine hide and rat tail collagens are commercially obtained in soluble form (e.g., Vitrogen).
  • Primary human dermal fibroblasts obtained from American Type Tissue Culture Collection are suspended in DMEM containing 10% (v/v) fetal calf serum at 1.0-1.4×105 cells/ml. One (1) milliliter of cell suspension and 2 ml of the same culture medium are added to 1 ml of recombinant collagen at a concentration of 2.5 mg/ml in 10 mM acetic acid. The cell suspension-collagen solution is poured into a 35-mm polystyrene petri dish (Costar) and incubated in a 37° C. tissue culture incubator in 5% CO2 for 5 days to allow contraction to occur.
  • Rates of contraction are measured each day by placing the culture dish containing the contracted cell matrix over a template containing circles of varying diameter, then estimating the diameter of the contracted cell matrix by comparison with the circles on the template. Recombinant human collagens prepared as described in Example 2 are shown to promote fibroblast contraction at rates at least comparable to those obtained using rat tail, purified. human placental, and bovine hide collagens.
  • All publications and patent applications cited in this specification are herein incorporated by reference, as if each individual publication or patent application were specifically and individually indicated to be incorporated by reference. Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be readily apparent to those of ordinary skill in the art, in light of the teachings of this invention, that certain changes and modifications may be made thereto without departing from the spirit or scope of the appended claims.

Claims (20)

1. A recombinant procollagen polypeptide chain comprising a natural collagen polypeptide chain, a first propeptide, and a first non-natural site-specific proteolytic agent recognition site, wherein said first non-natural site-specific proteolytic agent recognition site is located between said collagen chain and said first propeptide.
2. A recombinant procollagen chain according to claim 1, wherein said first non-natural site-specific proteolytic agent recognition site is a site-specific protease recognition site.
3. A recombinant procollagen chain according to claim 1, wherein said first non-natural site-specific proteolytic agent recognition site comprises a peptide bond labile to chemical hydrolysis.
4. A recombinant procollagen chain according to claim 1, wherein said first propeptide is a C-terminal propeptide.
5. A recombinant procollagen chain according to claim 1, wherein said first propeptide is a natural procollagen C-terminal propeptide.
6. A recombinant procollagen chain according to claim 1, further comprising a second propeptide and a second non-natural site-specific proteolytic agent recognition site, wherein said second non-natural site-specific proteolytic agent recognition site is located between said collagen chain and said second propeptide.
7. A recombinant procollagen chain according to claim 6, wherein said first and said second non-natural site-specific proteolytic agent recognition sites are different.
8. A recombinant procollagen chain according to claim 1, further comprising a non-natural amino acid sequence between said first site-specific proteolytic agent recognition site and said collagen chain.
9. A recombinant procollagen chain according to claim 1, further comprising a non-natural amino acid sequence between said first site-specific proteolytic agent recognition site and said first propeptide.
10. A nucleic acid encoding a recombinant procollagen chain according to claim 1.
11. A vector comprising the nucleic acid sequence of claim 10 operably linked to a transcription regulatory element not naturally linked to said nucleic acid.
12. A cell comprising a nucleic acid according to claim 10 operably linked to a transcription regulatory element not naturally linked to said nucleic acid.
13. A recombinant collagen polypeptide chain comprising a terminal decapeptide having a non-natural amino acid sequence.
14. A recombinant collagen polypeptide chain produced by contacting a recombinant procollagen chain according to claim 1 with a first site-specific proteolytic agent capable of selectively cleaving said procollagen chain at said first site-specific proteolytic agent recognition site.
15. A collagen composition comprising a plurality of recombinant collagen chains according to claim 14, wherein said chains are polymerized.
16. A sterile, nontoxic, biocompatible collagen composition comprising a recombinant collagen chain according to claim 14.
17. A process for the production of a recombinant procollagen polypeptide chain, said process comprising the steps of:
culturing a cell according to claim 12 under conditions suitable for the expression of said nucleic acid; and
recovering said recombinant procollagen chain.
18. A process for the production of a recombinant collagen polypeptide chain, said process comprising the steps of:
contacting a recombinant procollagen chain according to claim 1 with a site-specific proteolytic agent capable of selectively cleaving said recombinant procollagen chain at said first site-specific proteolytic agent recognition site under conditions wherein said first site-specific proteolytic agent selectively cleaves said procollagen chain at said first site-specific proteolytic agent recognition site, whereby a collagen chain is produced; and recovering said collagen chain.
19. A method of promoting the growth of cultured cells on a solid substrate or the adherence of cultured cells to a solid substrate, said method comprising contacting said solid substrate with a composition according to claim 16.
20. A method of augmenting localized tissue in a host, said method comprising the step of subcutaneously administering to a host a collagen composition according to claim 16.
US10/720,831 1993-01-28 2003-11-24 Mutated recombinant collagens Abandoned US20050192428A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US10/720,831 US20050192428A1 (en) 1993-01-28 2003-11-24 Mutated recombinant collagens

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US1164393A 1993-01-28 1993-01-28
US08/183,648 US5667839A (en) 1993-01-28 1994-01-18 Human recombinant collagen in the milk of transgenic animals
US08/278,774 US6653450B1 (en) 1993-01-28 1994-07-22 Mutated recombinant collagens
US10/720,831 US20050192428A1 (en) 1993-01-28 2003-11-24 Mutated recombinant collagens

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US08/278,774 Continuation US6653450B1 (en) 1993-01-28 1994-07-22 Mutated recombinant collagens

Publications (1)

Publication Number Publication Date
US20050192428A1 true US20050192428A1 (en) 2005-09-01

Family

ID=23066311

Family Applications (2)

Application Number Title Priority Date Filing Date
US08/278,774 Expired - Lifetime US6653450B1 (en) 1993-01-28 1994-07-22 Mutated recombinant collagens
US10/720,831 Abandoned US20050192428A1 (en) 1993-01-28 2003-11-24 Mutated recombinant collagens

Family Applications Before (1)

Application Number Title Priority Date Filing Date
US08/278,774 Expired - Lifetime US6653450B1 (en) 1993-01-28 1994-07-22 Mutated recombinant collagens

Country Status (3)

Country Link
US (2) US6653450B1 (en)
EP (1) EP0699752B1 (en)
DE (1) DE69531813D1 (en)

Cited By (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8852214B2 (en) 2011-02-04 2014-10-07 University Of Utah Research Foundation System for tissue fixation to bone
US8858577B2 (en) 2010-05-19 2014-10-14 University Of Utah Research Foundation Tissue stabilization system
US8945156B2 (en) 2010-05-19 2015-02-03 University Of Utah Research Foundation Tissue fixation
US9427309B2 (en) 2012-07-30 2016-08-30 Conextions, Inc. Soft tissue repair devices, systems, and methods
US9629632B2 (en) 2012-07-30 2017-04-25 Conextions, Inc. Soft tissue repair devices, systems, and methods
US10219804B2 (en) 2012-07-30 2019-03-05 Conextions, Inc. Devices, systems, and methods for repairing soft tissue and attaching soft tissue to bone
US10390935B2 (en) 2012-07-30 2019-08-27 Conextions, Inc. Soft tissue to bone repair devices, systems, and methods
US10835241B2 (en) 2012-07-30 2020-11-17 Conextions, Inc. Devices, systems, and methods for repairing soft tissue and attaching soft tissue to bone
US10973509B2 (en) 2017-12-20 2021-04-13 Conextions, Inc. Devices, systems, and methods for repairing soft tissue and attaching soft tissue to bone
US11253252B2 (en) 2012-07-30 2022-02-22 Conextions, Inc. Devices, systems, and methods for repairing soft tissue and attaching soft tissue to bone
US11547397B2 (en) 2017-12-20 2023-01-10 Conextions, Inc. Devices, systems, and methods for repairing soft tissue and attaching soft tissue to bone
US11583384B2 (en) 2014-03-12 2023-02-21 Conextions, Inc. Devices, systems, and methods for repairing soft tissue and attaching soft tissue to bone
US11696822B2 (en) 2016-09-28 2023-07-11 Conextions, Inc. Devices, systems, and methods for repairing soft tissue and attaching soft tissue to bone
WO2024029529A1 (en) * 2022-08-02 2024-02-08 株式会社 UniBio Collagen production method
US11944531B2 (en) 2012-07-30 2024-04-02 Conextions, Inc. Devices, systems, and methods for repairing soft tissue and attaching soft tissue to bone
US11957334B2 (en) 2022-09-13 2024-04-16 Conextions, Inc. Devices, systems, and methods for repairing soft tissue and attaching soft tissue to bone

Families Citing this family (45)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0718309B1 (en) * 1994-12-23 1999-04-07 Roche Diagnostics GmbH Antigens and antibodies for the detection of collagen I
GB9704305D0 (en) * 1997-03-01 1997-04-23 Univ Manchester Procollagen assembly
AU9312598A (en) * 1997-09-10 1999-03-29 Allegheny University Of The Health Sciences Inhibitors of collagen assembly
EP0913692A1 (en) * 1997-10-31 1999-05-06 Bayer Ag An immunoassay for procollagen-III-C-terminal propeptide
US6602980B1 (en) 1998-06-19 2003-08-05 Washington Research Foundation Collagen type III synthetic peptides for collagen resorption assays
EP1088228B1 (en) 1998-06-19 2005-08-24 Washington Research Foundation Cartilage resorption assays
US6916903B2 (en) 1998-06-19 2005-07-12 Washington Research Foundation Collagen type III synthetic peptides for collagen resorption assays
US6348320B1 (en) 1998-06-19 2002-02-19 Washington Research Foundation Cartilage resorption assays measuring type II collagen fragments
DK1210606T3 (en) * 1999-06-17 2005-01-31 Washington Res Found Cartilage resorption assays
GB0413346D0 (en) * 2004-06-15 2004-07-21 Theryte Ltd Treating cancer
US20070224237A1 (en) * 2006-03-24 2007-09-27 Julia Hwang Barbed sutures having a therapeutic agent thereon
US20080081353A1 (en) * 2006-09-29 2008-04-03 Universite Laval Production of recombinant human collagen
US8933290B2 (en) * 2007-06-26 2015-01-13 Sofradim Production Sas Mesh implant
US9308068B2 (en) 2007-12-03 2016-04-12 Sofradim Production Implant for parastomal hernia
US9242026B2 (en) 2008-06-27 2016-01-26 Sofradim Production Biosynthetic implant for soft tissue repair
FR2949688B1 (en) 2009-09-04 2012-08-24 Sofradim Production FABRIC WITH PICOTS COATED WITH A BIORESORBABLE MICROPOROUS LAYER
US9732321B2 (en) 2010-02-16 2017-08-15 The General Hospital Corporation Engineered craniofacial constructs with composite scaffold
FR2972626B1 (en) 2011-03-16 2014-04-11 Sofradim Production PROSTHETIC COMPRISING A THREE-DIMENSIONAL KNIT AND ADJUSTED
FR2977789B1 (en) 2011-07-13 2013-07-19 Sofradim Production PROSTHETIC FOR UMBILIC HERNIA
FR2977790B1 (en) 2011-07-13 2013-07-19 Sofradim Production PROSTHETIC FOR UMBILIC HERNIA
WO2013046058A2 (en) 2011-09-30 2013-04-04 Sofradim Production Reversible stiffening of light weight mesh
FR2985271B1 (en) 2011-12-29 2014-01-24 Sofradim Production KNITTED PICOTS
FR2985170B1 (en) 2011-12-29 2014-01-24 Sofradim Production PROSTHESIS FOR INGUINAL HERNIA
FR2994185B1 (en) 2012-08-02 2015-07-31 Sofradim Production PROCESS FOR THE PREPARATION OF A POROUS CHITOSAN LAYER
FR2995779B1 (en) 2012-09-25 2015-09-25 Sofradim Production PROSTHETIC COMPRISING A TREILLIS AND A MEANS OF CONSOLIDATION
FR2995778B1 (en) 2012-09-25 2015-06-26 Sofradim Production ABDOMINAL WALL REINFORCING PROSTHESIS AND METHOD FOR MANUFACTURING THE SAME
FR2995788B1 (en) 2012-09-25 2014-09-26 Sofradim Production HEMOSTATIC PATCH AND PREPARATION METHOD
AU2013322268B2 (en) 2012-09-28 2017-08-31 Sofradim Production Packaging for a hernia repair device
FR3006578B1 (en) 2013-06-07 2015-05-29 Sofradim Production PROSTHESIS BASED ON TEXTILE FOR LAPAROSCOPIC PATHWAY
FR3006581B1 (en) 2013-06-07 2016-07-22 Sofradim Production PROSTHESIS BASED ON TEXTILE FOR LAPAROSCOPIC PATHWAY
EP3000489B1 (en) 2014-09-24 2017-04-05 Sofradim Production Method for preparing an anti-adhesion barrier film
EP3000433B1 (en) 2014-09-29 2022-09-21 Sofradim Production Device for introducing a prosthesis for hernia treatment into an incision and flexible textile based prosthesis
EP3000432B1 (en) 2014-09-29 2022-05-04 Sofradim Production Textile-based prosthesis for treatment of inguinal hernia
EP3029189B1 (en) 2014-12-05 2021-08-11 Sofradim Production Prosthetic porous knit, method of making same and hernia prosthesis
EP3059255B1 (en) 2015-02-17 2020-05-13 Sofradim Production Method for preparing a chitosan-based matrix comprising a fiber reinforcement member
EP3085337B1 (en) 2015-04-24 2022-09-14 Sofradim Production Prosthesis for supporting a breast structure
ES2676072T3 (en) 2015-06-19 2018-07-16 Sofradim Production Synthetic prosthesis comprising a knitted fabric and a non-porous film and method of forming it
EP3195830B1 (en) 2016-01-25 2020-11-18 Sofradim Production Prosthesis for hernia repair
EP3312325B1 (en) 2016-10-21 2021-09-22 Sofradim Production Method for forming a mesh having a barbed suture attached thereto and the mesh thus obtained
EP3398554A1 (en) 2017-05-02 2018-11-07 Sofradim Production Prosthesis for inguinal hernia repair
US11180541B2 (en) 2017-09-28 2021-11-23 Geltor, Inc. Recombinant collagen and elastin molecules and uses thereof
EP3653171A1 (en) 2018-11-16 2020-05-20 Sofradim Production Implants suitable for soft tissue repair
EP3953380A4 (en) 2019-04-12 2023-01-25 Geltor, Inc. Recombinant elastin and production thereof
BR112022014586A2 (en) 2020-01-24 2022-09-13 Geltor Inc DIETARY COLLAGEN NOT DERIVED FROM ANIMALS
CN114106150B (en) * 2021-12-03 2022-08-16 江苏创健医疗科技有限公司 Recombinant collagen, preparation method and application thereof

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB8708009D0 (en) 1987-04-03 1987-05-07 Clayton Found Res Injectable soft tissue augmentation materials
US5108919A (en) 1988-06-24 1992-04-28 Genentech, Inc. Dna sequences encoding yeast ubiquitin hydrolase
ES2143478T5 (en) * 1991-10-23 2006-05-16 Thomas Jefferson University SYNTHESIS OF PROCOLAGENS AND HUMAN COLLAGENS IN RECOMBINATION DNA SYSTEMS.

Cited By (23)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9451961B2 (en) 2010-05-19 2016-09-27 University Of Utah Research Foundation Tissue stabilization system
US8858577B2 (en) 2010-05-19 2014-10-14 University Of Utah Research Foundation Tissue stabilization system
US8945156B2 (en) 2010-05-19 2015-02-03 University Of Utah Research Foundation Tissue fixation
US9381019B2 (en) 2011-02-04 2016-07-05 University Of Utah Research Foundation System for tissue fixation to bone
US8852214B2 (en) 2011-02-04 2014-10-07 University Of Utah Research Foundation System for tissue fixation to bone
US10660643B2 (en) 2012-07-30 2020-05-26 Conextions, Inc. Soft tissue repair devices, systems, and methods
US11253252B2 (en) 2012-07-30 2022-02-22 Conextions, Inc. Devices, systems, and methods for repairing soft tissue and attaching soft tissue to bone
US9655625B2 (en) 2012-07-30 2017-05-23 Conextions, Inc. Soft tissue repair devices, systems, and methods
US10219804B2 (en) 2012-07-30 2019-03-05 Conextions, Inc. Devices, systems, and methods for repairing soft tissue and attaching soft tissue to bone
US10390935B2 (en) 2012-07-30 2019-08-27 Conextions, Inc. Soft tissue to bone repair devices, systems, and methods
US9427309B2 (en) 2012-07-30 2016-08-30 Conextions, Inc. Soft tissue repair devices, systems, and methods
US10660642B2 (en) 2012-07-30 2020-05-26 Conextions, Inc. Soft tissue repair devices, systems, and methods
US10835241B2 (en) 2012-07-30 2020-11-17 Conextions, Inc. Devices, systems, and methods for repairing soft tissue and attaching soft tissue to bone
US11944531B2 (en) 2012-07-30 2024-04-02 Conextions, Inc. Devices, systems, and methods for repairing soft tissue and attaching soft tissue to bone
US9629632B2 (en) 2012-07-30 2017-04-25 Conextions, Inc. Soft tissue repair devices, systems, and methods
US11446024B2 (en) 2012-07-30 2022-09-20 Conextions, Inc. Devices, systems, and methods for repairing soft tissue and attaching soft tissue to bone
US11701218B2 (en) 2012-07-30 2023-07-18 Conextions, Inc. Soft tissue to bone repair devices, systems, and methods
US11583384B2 (en) 2014-03-12 2023-02-21 Conextions, Inc. Devices, systems, and methods for repairing soft tissue and attaching soft tissue to bone
US11696822B2 (en) 2016-09-28 2023-07-11 Conextions, Inc. Devices, systems, and methods for repairing soft tissue and attaching soft tissue to bone
US11547397B2 (en) 2017-12-20 2023-01-10 Conextions, Inc. Devices, systems, and methods for repairing soft tissue and attaching soft tissue to bone
US10973509B2 (en) 2017-12-20 2021-04-13 Conextions, Inc. Devices, systems, and methods for repairing soft tissue and attaching soft tissue to bone
WO2024029529A1 (en) * 2022-08-02 2024-02-08 株式会社 UniBio Collagen production method
US11957334B2 (en) 2022-09-13 2024-04-16 Conextions, Inc. Devices, systems, and methods for repairing soft tissue and attaching soft tissue to bone

Also Published As

Publication number Publication date
US6653450B1 (en) 2003-11-25
EP0699752B1 (en) 2003-09-24
EP0699752A2 (en) 1996-03-06
DE69531813D1 (en) 2003-10-30
EP0699752A3 (en) 1997-03-05

Similar Documents

Publication Publication Date Title
US6653450B1 (en) Mutated recombinant collagens
Olsen et al. Recombinant collagen and gelatin for drug delivery
CA2045869C (en) Fusion proteins with immunoglobulin portions, the preparation and use thereof
US7253264B1 (en) Immunoglobulin fusion proteins, their production and use
US5354736A (en) Synthetic compounds and compositions with enhanced cell binding
EP0112849B1 (en) A process for the preparation of chymosin
US6130318A (en) hIL-4 mutant proteins used as antagonists or partial agonists of human interleukin 4
JP2002523036A5 (en)
JP2006223316A (en) Recombinant fibrin chains, fibrin and fibrin-homologs
AU6031794A (en) Production of human recombinant collagen in the milk of transgenic animals
JPH06504036A (en) Expression of recombinant polypeptides with improved purification
EP0338634B1 (en) Viper venom polypeptides and genetic expression
KR950001992B1 (en) Method of producing peptides
US5935815A (en) Process for micro biological production of proteins
JP2000125872A (en) Trimer chimeric protein and collagen matrix containing chimeric protein
CA2273196A1 (en) Isolated mammalian monocyte cell genes; related reagents
JPH04228066A (en) Culture cell for expressing exogenote
EP0487617B1 (en) Synthetic peptides that enhance cell binding
US5460955A (en) Fibronectin purification vector
JP3550409B2 (en) Dipeptidyl aminopeptidase of dictyosterium
EP0119247A1 (en) Production of mature proteins in transformed yeast
JP2002325584A (en) Recombinant human iv type collagen peptide and method for producing the same
JPH09505998A (en) DNA sequence encoding porcine pancreatic carboxypeptidase B
JPH0898693A (en) Production of recombinant human matrilysin
JPH03175976A (en) Secretive production of animal protein by schizosaccharomyces pombe

Legal Events

Date Code Title Description
AS Assignment

Owner name: ANGIOTECH PHARMACEUTICALS (US), INC., WASHINGTON

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:ANGIOTECH BIOMATERIALS CORPORATION;REEL/FRAME:017325/0364

Effective date: 20051102

Owner name: ANGIOTECH BIOMATERIALS CORPORATION, CALIFORNIA

Free format text: CHANGE OF NAME;ASSIGNOR:COHESION TECHNOLOGIES, INC.;REEL/FRAME:017325/0370

Effective date: 20041220

AS Assignment

Owner name: CREDIT SUISSE, AS COLLATERAL AGENT, NEW YORK

Free format text: SECURITY AGREEMENT;ASSIGNOR:ANGIOTECH PHARMACEUTICALS (US), INC.;REEL/FRAME:017448/0600

Effective date: 20060323

AS Assignment

Owner name: ANGIOTECH PHARMACEUTICALS (US), INC., WASHINGTON

Free format text: RELEASE BY SECURED PARTY;ASSIGNOR:CREDIT SUISSE;REEL/FRAME:018606/0616

Effective date: 20061211

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION