US20040186071A1 - Antisense modulation of CD40 expression - Google Patents

Antisense modulation of CD40 expression Download PDF


Publication number
US20040186071A1 US10698689 US69868903A US2004186071A1 US 20040186071 A1 US20040186071 A1 US 20040186071A1 US 10698689 US10698689 US 10698689 US 69868903 A US69868903 A US 69868903A US 2004186071 A1 US2004186071 A1 US 2004186071A1
Grant status
Patent type
Prior art keywords
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Application number
C. Bennett
Lex Cowsert
Leila Malik
Andrew Siwkowski
Anne Eldrup
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ionis Pharmaceuticals Inc
Original Assignee
Ionis Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date




    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/001Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof by chemical synthesis
    • C07K14/003Peptide-nucleic acids (PNAs)
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034Isolating an individual clone by screening libraries
    • C12N15/1048SELEX
    • A61K38/00Medicinal preparations containing peptides
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • B01J2219/00Chemical, physical or physico-chemical processes in general; Their relevant apparatus
    • B01J2219/00274Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
    • B01J2219/0068Means for controlling the apparatus of the process
    • B01J2219/007Simulation or vitual synthesis
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/318Chemical structure of the backbone where the PO2 is completely replaced, e.g. MMI or formacetal
    • C12N2310/3181Peptide nucleic acid, PNA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3212'-O-R Modification
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/351Conjugate
    • C12N2310/3513Protein; Peptide
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/50Physical structure
    • C12N2310/52Physical structure branched


Antisense compounds, compositions and methods are provided for modulating the expression of CD40. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding CD40. Methods of using these compounds for modulation of CD40 expression and for treatment of diseases associated with CD40 are provided.


  • [0001]
    This application is a continuation-in-part of U.S. application Ser. No. 10/261,382 filed Sep. 30, 2002 and International Patent Application No. PCT/US03/31166 filed Sep. 30, 2003. This application is also a continuation-in-part of U.S. application Ser. No. 09/067,638, filed on Apr. 28, 1998, which claims priority to U.S. application Ser. No. 60/081,483, filed on Apr. 13, 1998. All of the foregoing are incorporated by reference herein in their entirety.
  • [0002]
    The present invention provides compositions and methods of modulating the expression of CD40. In particular, this invention relates to antisense compounds, particularly oligonucleotides, that are specifically hybridizable with nucleic acids encoding human CD40. Such oligonucleotides have been shown to modulate the expression of CD40.
  • [0003]
    The immune system serves a vital role in protecting the body against infectious agents. It is well established, however, that a number of disease states and/or disorders are a result of either abnormal or undesirable activation of immune responses. Common examples include graft versus host disease (GVHD), graft rejection, inflammation, and autoimmune linked diseases such as multiple sclerosis (MS), systemic lupus erythematosus (SLE), and certain forms of arthritis.
  • [0004]
    In general, an immune response is activated as a result of either tissue injury or infection. Both cases involve the recruitment and activation of a number of immune system effector cells (i.e. B- and T-lymphocytes, macrophages, eosinophils, neutrophils) in a process coordinated through a series of complex cell-cell interactions. A typical scenario by which an immune response is mounted against a foreign protein is as follows: Foreign proteins captured by antigen presenting cells (APC's) such as macrophages or dendritic cells are processed and displayed on the cell surface of the APC. Circulating T-helper cells which express an immunoglobulin that recognizes (i.e. binds) the displayed antigen undergo activation by the APC. These activated T-helpers in turn activate appropriate B-cell clones to proliferate and differentiate into plasma cells that produce and secrete humoral antibodies targeted against the foreign antigen. The secreted humoral antibodies are free to circulate and bind to any cells expressing the foreign protein on their cell surface, in effect marking the cell for destruction by other immune effector cells. In each of the stages described above, direct cell-cell contact between the involved cell types is required in order for activation to occur [Gruss et al., Leuk. Lymphoma, 24, 393 (1997)]. In recent years, a number of cell surface receptors that mediate these cell-cell contact dependent activation events have been identified. Among these cell surface receptors is CD40 and its physiological ligand, CD40 Ligand (CD40L).
  • [0005]
    CD40 was first characterized as a receptor expressed on B-lymphocytes. It was later found that engagement of B-cell CD40 with CD40L expressed on activated T-cells is essential for T-cell dependent B-cell activation (i.e. proliferation, immunoglobulin secretion, and class switching. It was subsequently revealed that functional CD40 is expressed on a variety of cell types other than B-cells, including macrophages, dendritic cells, thymic epithelial cells, Langerhans cells, and endothelial cells. These studies have led to the current belief that CD40 plays a broad role in immune regulation by mediating interactions of T-cells with B-cells as well as other cell types. In support of this notion, it has been shown that stimulation of CD40 in macrophages and dendritic results is required for T-cell activation during antigen presentation [Gruss et al., Leuk. Lymphoma, 24, 393 (1997)]. Recent evidence points to a role for CD40 in tissue inflammation as well. Production of the inflammatory mediators IL-12 and nitric oxide by macrophages have been shown to be CD40 dependent [Buhlmann and Noelle, J. Clin. Immunol., 16, 83 (1996)]. In endothelial cells, stimulation of CD40 by CD40L has been found to induce surface expression of E-selectin, ICAM-1, and VCAM-1, promoting adhesion of leukocytes to sites of inflammation [Buhlmann and Noelle, J. Clin. Immunol., 16, 83 (1996); Gruss et al., Leuk. Lymphoma, 24, 393 (1997)]. Finally, a number of reports have documented overexpression of CD40 in epithelial and hematopoietic tumors as well as tumor infiltrating endothelial cells, indicating that CD40 may play a role in tumor growth and/or angiogenesis as well [Gruss et al., Leuk. Lymphoma, 24, 393 (1997); Kluth et al., Cancer Res., 57, 891 (1997)].
  • [0006]
    Due to the pivotal role that CD40 plays in humoral immunity, the potential exists that therapeutic strategies aimed at downregulating CD40 or interfering with CD40 signaling may provide a novel class of agents useful in treating a number of immune associated disorders, including but not limited to graft-versus-host disease (GVHD), graft rejection, and autoimmune diseases such as multiple sclerosis (MS), systemic lupus erythematosus (SLE), and certain forms of arthritis. Inhibitors of CD40 may also prove useful as anti-inflammatory compounds, and could therefore be useful as treatment for a variety of inflammatory and allergic conditions such as asthma, rheumatoid arthritis, allograft rejections, inflammatory bowel disease, autoimmune encephalomyelitis, thyroiditis, various dermatological conditions, and psoriasis. Recently, both CD40 and CD154 have been shown to be expressed on vascular endothelial cells, vascular smooth muscle cells and macrophages present in atherosclerotic plaques, suggesting that inflammation and immunity contribute to the atherogenic process. That this process involves CD40 signaling is suggested by several studies in mouse models in which disruption of CD154 (by knockout or by monoclonal antibody) reduced the progression or size of atherosclerotic lesions. Mach et al., 1998, Nature, 394, 200-3, Lutgens et al., 1999, Nat Med. 5, 1313-6.
  • [0007]
    Finally, as more is learned of the association between CD40 overexpression and tumor growth, inhibitors of CD40 may prove useful as anti-tumor agents and inhibitors of other hyperproliferative conditions as well.
  • [0008]
    Currently, there are no known therapeutic agents which effectively inhibit the synthesis of CD40. To date, strategies aimed at inhibiting CD40 function have involved the use of a variety of agents that disrupt CD40/CD40L binding. These include monoclonal antibodies directed against either CD40 or CD40L, soluble forms of CD40, and synthetic peptides derived from a second CD40 binding protein, A20. The use of neutralizing antibodies against CD40 and/or CD40L in animal models has provided evidence that inhibition of CD40 signaling would have therapeutic benefit for GVHD, allograft rejection, rheumatoid arthritis, SLE, MS, and B-cell lymphoma [Buhlmann and Noelle, J. Clin. Immunol, 16, 83 (1996)]. Clinical investigations were initiated using CD154 monoclonal antibody in patients with lupus nephritis. However, studies were terminated due to the development of thrombotic events. Boumpas et al., 2003, Arthritis Rheum. Mar;48, 719-27.
  • [0009]
    Due to the problems associated with the use of large proteins as therapeutic agents, there is a long-felt need for additional agents capable of effectively inhibiting CD40 function. Antisense oligonucleotides avoid many of the pitfalls of current agents used to block CD40/CD40L interactions and may therefore prove to be uniquely useful in a number of therapeutic, diagnostic and research applications. U.S. Pat. No. 6,197,584 (Bennett and Cowsert) discloses antisense compounds targeted to CD40.
  • [0010]
    Peptide nucleic acids, alternately referenced as PNAs, are known to be useful as oligonucleotide mimetics. In PNAs, both the sugar and the internucleoside linkage, i.e., the backbone, of the nucleotide units of oligonucleotides are replaced with novel groups. The sugar-backbone of an oligonucleotide is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. The base units, i.e., nucleobases, are maintained for hybridization with an appropriate nucleic acid target compound.
  • [0011]
    PNAs have been shown to have excellent hybridization properties as well as other properties useful for diagnostics, therapeutics and as research reagents. They are particularly useful as antisense reagents. Other uses include monitoring telomere length, screening for genetic mutations and for affinity capture of nucleic acids. As antisense reagents they can be used for transcriptional and translational blocking of genes and to effect alternate splicing. Further they can be used to bind to double stranded nucleic acids. Each of these uses are known and have been published in either the scientific or patent literature.
  • [0012]
    The synthesis of and use of PNAs has been extensively described. Representative United States patents that teach the preparation of and use of PNA compounds include, but are not limited to, U.S. Pat. Nos. 5,539,082; 5,5539,083; 5,641,625; 5,714,331; 5,719,262; 5,766,855; 5,773,571; 5,786,461; 5,831,014; 5,864,010; 5,986,053; 6,201,103; 6,204,326; 6,210,892; 6,228,982; 6,350,853; 6,414,112; 6,441,130; and 6,451,968, each of which is herein incorporated by reference. Additionally PNA compounds are described in numerous published PCT patent applications including WO 92/20702. Further teaching of PNA compounds can be found in scientific publications. The first such publication was Nielsen et al., Science, 1991, 254, 1497-1500.
  • [0013]
    Depending on sequence, the solubility of PNAs can differ and, as such, some PNA sequences are not soluble as might be desirable for a particular use. It was suggested in Karras, et al., Biochemistry, 2001, 40, 7853-7859, that PNAs could mediate splicing activity in cells. They compared a PNA 15mer (a PNA having 15 monomeric units) to the same PNA having a single lysine amino acid jointed to its C terminus. They suggested that the attached, i.e., conjugated, lysine residue might improve the cellular uptake. However, they concluded that their present data “do not show a clear difference in activity between the PNA 15mer with and without a C-terminal lysine.”
  • [0014]
    In published application US-2002-0049173-A1, published Apr. 25, 2002, it was suggested that antisense compounds might have one or more cationic tails, preferable positively charged amino acids such as lysine or arginine, conjugated thereto. It was further suggested that one or more lysine or arginine residues might be conjugated to the C-terminal end of a PNA compound. No discrimination was made between the effects resulting from the conjugation of one lysine or arginine versus more than one of these lysine or arginine residues.
  • [0015]
    U.S. Pat. No. 6,593,292 suggests using guanidine or amidine moieties for uptake of various compounds including macromolecules. PNA is a suggested macromolecule. In one instance this patent suggests that the guanidine or amidine moieties comprise non-peptide backbones but in a further instance it suggested that the guanidine moiety will exist as a polyarginine molecule. However, no data is shown wherein any of these moieties are actually conjugated to a macromolecule and uptake is achieved.
  • [0016]
    In a transgenic mouse model, a 4-lysine conjugated PNA targeted to β-globin was demonstrated to provide efficacy in a range of tisues (Sazani et al., 2002, Nature Biotech. 20, 1228-1233).
  • [0017]
    The present invention is directed to antisense compounds, particularly oligonucleotides, that are targeted to a nucleic acid encoding CD40, and that modulate the expression of CD40. Pharmaceutical and other compositions comprising the antisense compounds of the invention are also provided. Further provided are methods of modulating the expression of CD40 in cells or tissues comprising contacting said cells or tissues with one or more of the antisense compounds or compositions of the invention. Further provided are methods of treating an animal, particularly a human, suspected of having or being prone to a disease or condition associated with expression of CD40 by administering a therapeutically or prophylactically effective amount of one or more of the antisense compounds or compositions of the invention.
  • [0018]
    A. Overview of the Invention
  • [0019]
    The present invention employs antisense compounds, preferably oligonucleotides and similar species for use in modulating the function or effect of nucleic acid molecules encoding CD40. This is accomplished by providing oligonucleotides which specifically hybridize with one or more nucleic acid molecules encoding CD40. As used herein, the terms “target nucleic acid” and “nucleic acid molecule encoding CD40” have been used for convenience to encompass DNA encoding CD40, RNA (including pre-mRNA and mRNA or portions thereof) transcribed from such DNA, and also cDNA derived from such RNA. The hybridization of a compound of this invention with its target nucleic acid is generally referred to as “antisense”. Consequently, the preferred mechanism believed to be included in the practice of some preferred embodiments of the invention is referred to herein as “antisense inhibition.” Such antisense inhibition is typically based upon hydrogen bonding-based hybridization of oligonucleotide strands or segments such that at least one strand or segment is cleaved, degraded, or otherwise rendered inoperable. In this regard, it is presently preferred to target specific nucleic acid molecules and their functions for such antisense inhibition.
  • [0020]
    The functions of DNA to be interfered with can include replication and transcription. Replication and transcription, for example, can be from an endogenous cellular template, a vector, a plasmid construct or otherwise. The functions of RNA to be interfered with can include functions such as translocation of the RNA to a site of protein translation, translocation of the RNA to sites within the cell which are distant from the site of RNA synthesis, translation of protein from the RNA, splicing of the RNA to yield one or more RNA species, and catalytic activity or complex formation involving the RNA which may be engaged in or facilitated by the RNA. One preferred result of such interference with target nucleic acid function is modulation of the expression of CD40. In the context of the present invention, “modulation” and “modulation of expression” mean either an increase (stimulation) or a decrease (inhibition) in the amount or levels of a nucleic acid molecule encoding the gene, e.g., DNA or RNA. Inhibition is often the preferred form of modulation of expression and mRNA is often a preferred target nucleic acid.
  • [0021]
    In the context of this invention, “hybridization” means the pairing of complementary strands of oligomeric compounds. In the present invention, the preferred mechanism of pairing involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleoside or nucleotide bases (nucleobases) of the strands of oligomeric compounds. For example, adenine and thymine are complementary nucleobases which pair through the formation of hydrogen bonds. Hybridization can occur under varying circumstances.
  • [0022]
    An antisense compound is specifically hybridizable when binding of the compound to the target nucleic acid interferes with the normal function of the target nucleic acid to cause a loss of activity, and there is a sufficient degree of complementarity to avoid non-specific binding of the antisense compound to non-target nucleic acid sequences under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays or therapeutic treatment, and under conditions in which assays are performed in the case of in vitro assays.
  • [0023]
    In the present invention the phrase “stringent hybridization conditions” or “stringent conditions” refers to conditions under which a compound of the invention will hybridize to its target sequence, but to a minimal number of other sequences. Stringent conditions are sequence-dependent and will be different in different circumstances and in the context of this invention, “stringent conditions” under which oligomeric compounds hybridize to a target sequence are determined by the nature and composition of the oligomeric compounds and the assays in which they are being investigated.
  • [0024]
    “Complementary,” as used herein, refers to the capacity for precise pairing between two nucleobases of an oligomeric compound. For example, if a nucleobase at a certain position of an oligonucleotide (an oligomeric compound), is capable of hydrogen bonding with a nucleobase at a certain position of a target nucleic acid, said target nucleic acid being a DNA, RNA, or oligonucleotide molecule, then the position of hydrogen bonding between the oligonucleotide and the target nucleic acid is considered to be a complementary position. The oligonucleotide and the further DNA, RNA, or oligonucleotide molecule are complementary to each other when a sufficient number of complementary positions in each molecule are occupied by nucleobases which can hydrogen bond with each other. Thus, “specifically hybridizable” and “complementary” are terms which are used to indicate a sufficient degree of precise pairing or complementarity over a sufficient number of nucleobases such that stable and specific binding occurs between the oligonucleotide and a target nucleic acid.
  • [0025]
    It is understood in the art that the sequence of an antisense compound need not be 100% complementary to that of its target nucleic acid to be specifically hybridizable. Moreover, an oligonucleotide may hybridize over one or more segments such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure or hairpin structure). It is preferred that the antisense compounds of the present invention comprise at least 70%, or at least 75%, or at least 80%, or at least 85% sequence complementarity to a target region within the target nucleic acid, more preferably that they comprise at least 90% sequence complementarity and even more preferably comprise at least 95% or at least 99% sequence complementarity to the target region within the target nucleic acid sequence to which they are targeted. For example, an antisense compound in which 18 of 20 nucleobases of the antisense compound are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity. In this example, the remaining noncomplementary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases. As such, an antisense compound which is 18 nucleobases in length having 4 (four) noncomplementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid and would thus fall within the scope of the present invention. Percent complementarity of an antisense compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656).
  • [0026]
    Percent homology, sequence identity or complementarity, can be determined by, for example, the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482-489). In some preferred embodiments, homology, sequence identity or complementarity, between the oligomeric and target is between about 50% to about 60%. In some embodiments, homology, sequence identity or complementarity, is between about 60% to about 70%. In preferred embodiments, homology, sequence identity or complementarity, is between about 70% and about 80%. In more preferred embodiments, homology, sequence identity or complementarity, is between about 80% and about 90%. In some preferred embodiments, homology, sequence identity or complementarity, is about 90%, about 92%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or about 100%.
  • [0027]
    B. Compounds of the Invention
  • [0028]
    According to the present invention, antisense compounds include antisense oligomeric compounds, antisense oligonucleotides, ribozymes, external guide sequence (EGS) oligonucleotides, alternate splicers, primers, probes, and other oligomeric compounds which hybridize to at least a portion of the target nucleic acid. As such, these compounds may be introduced in the form of single-stranded, double-stranded, circular or hairpin oligomeric compounds and may contain structural elements such as internal or terminal bulges or loops. Once introduced to a system, the compounds of the invention may elicit the action of one or more enzymes or structural proteins to effect modification of the target nucleic acid.
  • [0029]
    One non-limiting example of such an enzyme is RNAse H, a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex. It is known in the art that single-stranded antisense compounds which are “DNA-like” elicit RNAse H. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of oligonucleotide-mediated inhibition of gene expression. Similar roles have been postulated for other ribonucleases such as those in the RNase III and ribonuclease L family of enzymes.
  • [0030]
    While the preferred form of antisense compound is a single-stranded antisense oligonucleotide, in many species the introduction of double-stranded structures, such as double-stranded RNA (dsRNA) molecules, has been shown to induce potent and specific antisense-mediated reduction of the function of a gene or its associated gene products. The first evidence that dsRNA could lead to gene silencing in animals came in 1995 from work in the nematode, Caenorhabditis elegans (Guo and Kempheus, Cell, 1995, 81, 611-620). Montgomery et al. have shown that the primary interference effects of dsRNA are posttranscriptional (Montgomery et al., Proc. Natl. Acad. Sci. USA, 1998, 95, 15502-15507). The posttranscriptional antisense mechanism defined in Caenorhabditis elegans resulting from exposure to double-stranded RNA (dsRNA) has since been designated RNA interference (RNAi). This term has been generalized to mean antisense-mediated gene silencing involving the introduction of dsRNA leading to the sequence-specific reduction of endogenous targeted mRNA levels (Fire et al., Nature, 1998, 391, 806-811). Recently, it has been shown that it is, in fact, the single-stranded RNA oligomers of antisense polarity of the dsRNAs which are the potent inducers of RNAi (Tijsterman et al., Science, 2002, 295, 694-697).
  • [0031]
    In the context of this invention, the term “oligomeric compound” refers to a polymer or oligomer comprising a plurality of monomeric units. In the context of this invention, the term “oligonucleotide” refers to an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or mimetics, chimeras, analogs and homologs thereof. This term includes oligonucleotides composed of naturally occurring nucleobases, sugars and covalent internucleoside (backbone) linkages as well as oligonucleotides having non-naturally occurring portions which function similarly. Such modified or substituted oligonucleotides are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for a target nucleic acid and increased stability in the presence of nucleases.
  • [0032]
    While oligonucleotides are a preferred form of the antisense compounds of this invention, the present invention comprehends other families of antisense compounds as well, including but not limited to oligonucleotide analogs and mimetics such as those described herein.
  • [0033]
    The antisense compounds in accordance with this invention preferably comprise from about 8 to about 80 nucleobases (i.e. from about 8 to about 80 linked nucleosides). One of ordinary skill in the art will appreciate that the invention embodies compounds of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 nucleobases in length.
  • [0034]
    In one preferred embodiment, the antisense compounds of the invention are 12 to 50 nucleobases in length. One having ordinary skill in the art will appreciate that this embodies compounds of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleobases in length.
  • [0035]
    In another preferred embodiment, the antisense compounds of the invention are 15 to 30 nucleobases in length. One having ordinary skill in the art will appreciate that this embodies compounds of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length.
  • [0036]
    Particularly preferred compounds are oligonucleotides from about 12 to about 50 nucleobases, even more preferably those comprising from about 15 to about 30 nucleobases.
  • [0037]
    Antisense compounds 8-80 nucleobases in length comprising a stretch of at least eight (8) consecutive nucleobases selected from within the illustrative antisense compounds are considered to be suitable antisense compounds as well.
  • [0038]
    Exemplary preferred antisense compounds include oligonucleotide sequences that comprise at least the 8 consecutive nucleobases from the 5′-terminus of one of the illustrative preferred antisense compounds (the remaining nucleobases being a consecutive stretch of the same oligonucleotide beginning immediately upstream of the 5′-terminus of the antisense compound which is specifically hybridizable to the target nucleic acid and continuing until the oligonucleotide contains about 8 to about 80 nucleobases). Similarly preferred antisense compounds are represented by oligonucleotide sequences that comprise at least the 8 consecutive nucleobases from the 3′-terminus of one of the illustrative preferred antisense compounds (the remaining nucleobases being a consecutive stretch of the same oligonucleotide beginning immediately downstream of the 3′-terminus of the antisense compound which is specifically hybridizable to the target nucleic acid and continuing until the oligonucleotide contains about 8 to about 80 nucleobases). It is also understood that preferred antisense compounds may be represented by oligonucleotide sequences that comprise at least 8 consecutive nucleobases from an internal portion of the sequence of an illustrative preferred antisense compound, and may extend in either or both directions until the oligonucleotide contains about 8 to about 80 nucleobases.
  • [0039]
    One having skill in the art armed with the preferred antisense compounds illustrated herein will be able, without undue experimentation, to identify further preferred antisense compounds.
  • [0040]
    C. Targets of the Invention
  • [0041]
    “Targeting” an antisense compound to a particular nucleic acid molecule, in the context of this invention, can be a multistep process. The process usually begins with the identification of a target nucleic acid whose function is to be modulated. This target nucleic acid may be, for example, a cellular gene (or mRNA transcribed from the gene) whose expression is associated with a particular disorder or disease state, or a nucleic acid molecule from an infectious agent. In the present invention, the target nucleic acid encodes CD40.
  • [0042]
    The targeting process usually also includes determination of at least one target region, segment, or site within the target nucleic acid for the antisense interaction to occur such that the desired effect, e.g., modulation of expression, will result. Within the context of the present invention, the term “region” is defined as a portion of the target nucleic acid having at least one identifiable structure, function, or characteristic. Within regions of target nucleic acids are segments. “Segments” are defined as smaller or sub-portions of regions within a target nucleic acid. “Sites,” as used in the present invention, are defined as positions within a target nucleic acid.
  • [0043]
    Since, as is known in the art, the translation initiation codon is typically 5′-AUG (in transcribed mRNA molecules; 5′-ATG in the corresponding DNA molecule), the translation initiation codon is also referred to as the “AUG codon,” the “start codon” or the “AUG start codon”. A minority of genes have a translation initiation codon having the RNA sequence 5′-GUG, 5′-UUG or 5′-CUG, and 5′-AUA, 5′-ACG and 5′-CUG have been shown to function in vivo. Thus, the terms “translation initiation codon” and “start codon” can encompass many codon sequences, even though the initiator amino acid in each instance is typically methionine (in eukaryotes) or formylmethionine (in prokaryotes). It is also known in the art that eukaryotic and prokaryotic genes may have two or more alternative start codons, any one of which may be preferentially utilized for translation initiation in a particular cell type or tissue, or under a particular set of conditions. In the context of the invention, “start codon” and “translation initiation codon” refer to the codon or codons that are used in vivo to initiate translation of an mRNA transcribed from a gene encoding CD40, regardless of the sequence(s) of such codons. It is also known in the art that a translation termination codon (or “stop codon”) of a gene may have one of three sequences, i.e., 5′-UAA, 5′-UAG and 5′-UGA (the corresponding DNA sequences are 5′-TAA, 5′-TAG and 5′-TGA, respectively).
  • [0044]
    The terms “start codon region” and “translation initiation codon region” refer to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5′ or 3′) from a translation initiation codon. Similarly, the terms “stop codon region” and “translation termination codon region” refer to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5′ or 3′) from a translation termination codon. Consequently, the “start codon region” (or “translation initiation codon region”) and the “stop codon region” (or “translation termination codon region”) are all regions which may be targeted effectively with the antisense compounds of the present invention.
  • [0045]
    The open reading frame (ORF) or “coding region,” which is known in the art to refer to the region between the translation initiation codon and the translation termination codon, is also a region which may be targeted effectively. Within the context of the present invention, a preferred region is the intragenic region encompassing the translation initiation or termination codon of the open reading frame (ORF) of a gene.
  • [0046]
    Other target regions include the 5′ untranslated region (5′UTR), known in the art to refer to the portion of an mRNA in the 5′ direction from the translation initiation codon, and thus including nucleotides between the 5′ cap site and the translation initiation codon of an mRNA (or corresponding nucleotides on the gene), and the 3′ untranslated region (3′UTR), known in the art to refer to the portion of an mRNA in the 3′ direction from the translation termination codon, and thus including nucleotides between the translation termination codon and 3′ end of an mRNA (or corresponding nucleotides on the gene). The 5′ cap site of an mRNA comprises an N7-methylated guanosine residue joined to the 5′-most residue of the mRNA via a 5′-5′ triphosphate linkage. The 5′ cap region of an mRNA is considered to include the 5′ cap structure itself as well as the first 50 nucleotides adjacent to the cap site. It is also preferred to target the 5′ cap region.
  • [0047]
    Although some eukaryotic mRNA transcripts are directly translated, many contain one or more regions, known as “introns,” which are excised from a transcript before it is translated. The remaining (and therefore translated) regions are known as “exons” and are spliced together to form a continuous mRNA sequence. Targeting splice sites, i.e., intron-exon junctions or exon-intron junctions, may also be particularly useful in situations where aberrant splicing is implicated in disease, or where an overproduction of a particular splice product is implicated in disease. Aberrant fusion junctions due to rearrangements or deletions are also preferred target sites. mRNA transcripts produced via the process of splicing of two (or more) mRNAs from different gene sources are known as “fusion transcripts”. It is also known that introns can be effectively targeted using antisense compounds targeted to, for example, DNA or pre-mRNA.
  • [0048]
    It is also known in the art that alternative RNA transcripts can be produced from the same genomic region of DNA. These alternative transcripts are generally known as “variants”. More specifically, “pre-mRNA variants” are transcripts produced from the same genomic DNA that differ from other transcripts produced from the same genomic DNA in either their start or stop position and contain both intronic and exonic sequence.
  • [0049]
    Upon excision of one or more exon or intron regions, or portions thereof during splicing, pre-mRNA variants produce smaller “mRNA variants”. Consequently, mRNA variants are processed pre-mRNA variants and each unique pre-mRNA variant must always produce a unique mRNA variant as a result of splicing. These mRNA variants are also known as “alternative splice variants”. If no splicing of the pre-mRNA variant occurs then the pre-mRNA variant is identical to the mRNA variant.
  • [0050]
    It is also known in the art that variants can be produced through the use of alternative signals to start or stop transcription and that pre-mRNAs and mRNAs can possess more that one start codon or stop codon. Variants that originate from a pre-mRNA or mRNA that use alternative start codons are known as “alternative start variants” of that pre-mRNA or mRNA. Those transcripts that use an alternative stop codon are known as “alternative stop variants” of that pre-mRNA or mRNA. One specific type of alternative stop variant is the “polyA variant” in which the multiple transcripts produced result from the alternative selection of one of the “polyA stop signals” by the transcription machinery, thereby producing transcripts that terminate at unique polyA sites. Within the context of the invention, the types of variants described herein are also preferred target nucleic acids.
  • [0051]
    The locations on the target nucleic acid to which the preferred antisense compounds hybridize are hereinbelow referred to as “preferred target segments.” As used herein the term “preferred target segment” is defined as at least an 8-nucleobase portion of a target region to which an active antisense compound is targeted. While not wishing to be bound by theory, it is presently believed that these target segments represent portions of the target nucleic acid which are accessible for hybridization.
  • [0052]
    While the specific sequences of certain preferred target segments are set forth herein, one of skill in the art will recognize that these serve to illustrate and describe particular embodiments within the scope of the present invention. Additional preferred target segments may be identified by one having ordinary skill.
  • [0053]
    Target segments 8-80 nucleobases in length comprising a stretch of at least eight (8) consecutive nucleobases selected from within the illustrative preferred target segments are considered to be suitable for targeting as well.
  • [0054]
    Target segments can include DNA or RNA sequences that comprise at least the 8 consecutive nucleobases from the 5′-terminus of one of the illustrative preferred target segments (the remaining nucleobases being a consecutive stretch of the same DNA or RNA beginning immediately upstream of the 5′-terminus of the target segment and continuing until the DNA or RNA contains about 8 to about 80 nucleobases). Similarly preferred target segments are represented by DNA or RNA sequences that comprise at least the 8 consecutive nucleobases from the 3′-terminus of one of the illustrative preferred target segments (the remaining nucleobases being a consecutive stretch of the same DNA or RNA beginning immediately downstream of the 3′-terminus of the target segment and continuing until the DNA or RNA contains about 8 to about 80 nucleobases). It is also understood that preferred antisense target segments may be represented by DNA or RNA sequences that comprise at least 8 consecutive nucleobases from an internal portion of the sequence of an illustrative preferred target segment, and may extend in either or both directions until the oligonucleotide contains about 8 to about 80 nucleobases. One having skill in the art armed with the preferred target segments illustrated herein will be able, without undue experimentation, to identify further preferred target segments.
  • [0055]
    Once one or more target regions, segments or sites have been identified, antisense compounds are chosen which are sufficiently complementary to the target, i.e., hybridize sufficiently well and with sufficient specificity, to give the desired effect.
  • [0056]
    The oligomeric antisense compounds may also be targeted to regions of the target nucleobase sequence (e.g., such as those disclosed in Example 9) comprising nucleobases 1-80, 81-160, 161-240, 241-320, 321-400, 401-480, 481-560, 561-640, 641-720, 721-800, 801-880, 881-960, 961-1004, or any combination thereof.
  • [0057]
    D. Screening and Target Validation
  • [0058]
    In a further embodiment, the “preferred target segments” identified herein may be employed in a screen for additional compounds that modulate the expression of CD40. “Modulators” are those compounds that decrease or increase the expression of a nucleic acid molecule encoding CD40 and which comprise at least an 8-nucleobase portion which is complementary to a preferred target segment. The screening method comprises the steps of contacting a preferred target segment of a nucleic acid molecule encoding CD40 with one or more candidate modulators, and selecting for one or more candidate modulators which decrease or increase the expression of a nucleic acid molecule encoding CD40. Once it is shown that the candidate modulator or modulators are capable of modulating (e.g. either decreasing or increasing) the expression of a nucleic acid molecule encoding CD40, the modulator may then be employed in further investigative studies of the function of CD40, or for use as a research, diagnostic, or therapeutic agent in accordance with the present invention.
  • [0059]
    The preferred target segments of the present invention may be also be combined with their respective complementary antisense compounds of the present invention to form stabilized double-stranded (duplexed) oligonucleotides.
  • [0060]
    Such double stranded oligonucleotide moieties have been shown in the art to modulate target expression and regulate translation as well as RNA processing via an antisense mechanism. Moreover, the double-stranded moieties may be subject to chemical modifications (Fire et al., Nature, 1998, 391, 806-811; Timmons and Fire, Nature 1998, 395, 854; Timmons et al., Gene, 2001, 263, 103-112; Tabara et al., Science, 1998, 282, 430-431; Montgomery et al., Proc. Natl. Acad. Sci. USA, 1998, 95, 15502-15507; Tuschl et al., Genes Dev., 1999, 13, 3191-3197; Elbashir et al., Nature, 2001, 411, 494-498; Elbashir et al., Genes Dev. 2001, 15, 188-200). For example, such double-stranded moieties have been shown to inhibit the target by the classical hybridization of antisense strand of the duplex to the target, thereby triggering enzymatic degradation of the target (Tijsterman et al., Science, 2002, 295, 694-697).
  • [0061]
    The antisense compounds of the present invention can also be applied in the areas of drug discovery and target validation. The present invention comprehends the use of the compounds and preferred target segments identified herein in drug discovery efforts to elucidate relationships that exist between CD40 and a disease state, phenotype, or condition. These methods include detecting or modulating CD40 comprising contacting a sample, tissue, cell, or organism with the compounds of the present invention, measuring the nucleic acid or protein level of CD40 and/or a related phenotypic or chemical endpoint at some time after treatment, and optionally comparing the measured value to a non-treated sample or sample treated with a further compound of the invention. These methods can also be performed in parallel or in combination with other experiments to determine the function of unknown genes for the process of target validation or to determine the validity of a particular gene product as a target for treatment or prevention of a particular disease, condition, or phenotype.
  • [0062]
    E. Kits, Research Reagents, Diagnostics, and Therapeutics
  • [0063]
    The antisense compounds of the present invention can be utilized for diagnostics, therapeutics, prophylaxis and as research reagents and kits. Furthermore, antisense oligonucleotides, which are able to inhibit gene expression with exquisite specificity, are often used by those of ordinary skill to elucidate the function of particular genes or to distinguish between functions of various members of a biological pathway.
  • [0064]
    For use in kits and diagnostics, the compounds of the present invention, either alone or in combination with other compounds or therapeutics, can be used as tools in differential and/or combinatorial analyses to elucidate expression patterns of a portion or the entire complement of genes expressed within cells and tissues.
  • [0065]
    As one nonlimiting example, expression patterns within cells or tissues treated with one or more antisense compounds are compared to control cells or tissues not treated with antisense compounds and the patterns produced are analyzed for differential levels of gene expression as they pertain, for example, to disease association, signaling pathway, cellular localization, expression level, size, structure or function of the genes examined. These analyses can be performed on stimulated or unstimulated cells and in the presence or absence of other compounds which affect expression patterns.
  • [0066]
    Examples of methods of gene expression analysis known in the art include DNA arrays or microarrays (Brazma and Vilo, FEBS Lett., 2000, 480, 17-24; Celis, et al., FEBS Lett., 2000, 480, 2-16), SAGE (serial analysis of gene expression) (Madden, et al., Drug Discov. Today, 2000, 5, 415-425), READS (restriction enzyme amplification of digested cDNAs) (Prashar and Weissman, Methods Enzymol., 1999, 303, 258-72), TOGA (total gene expression analysis) (Sutcliffe, et al., Proc. Natl. Acad. Sci. U.S.A., 2000, 97, 1976-81), protein arrays and proteomics (Celis, et al., FEBS Lett., 2000, 480, 2-16; Jungblut, et al., Electrophoresis, 1999, 20, 2100-10), expressed sequence tag (EST) sequencing (Celis, et al., FEBS Lett., 2000, 480, 2-16; Larsson, et al., J. Biotechnol., 2000, 80, 143-57), subtractive RNA fingerprinting (SuRF) (Fuchs, et al., Anal. Biochem., 2000, 286, 91-98; Larson, et al., Cytometry, 2000, 41, 203-208), subtractive cloning, differential display (DD) (Jurecic and Belmont, Curr. Opin. Microbiol., 2000, 3, 316-21), comparative genomic hybridization (Carulli, et al., J. Cell Biochem. Suppl., 1998, 31, 286-96), FISH (fluorescent in situ hybridization) techniques (Going and Gusterson, Eur. J. Cancer, 1999, 35, 1895-904) and mass spectrometry methods (To, Comb. Chem. High Throughput Screen, 2000, 3, 235-41).
  • [0067]
    The antisense compounds of the invention are useful for research and diagnostics, because these compounds hybridize to nucleic acids encoding CD40. For example, oligonucleotides that are shown to hybridize with such efficiency and under such conditions as disclosed herein as to be effective CD40 inhibitors will also be effective primers or probes under conditions favoring gene amplification or detection, respectively. These primers and probes are useful in methods requiring the specific detection of nucleic acid molecules encoding CD40 and in the amplification of said nucleic acid molecules for detection or for use in further studies of CD40. Hybridization of the antisense oligonucleotides, particularly the primers and probes, of the invention with a nucleic acid encoding CD40 can be detected by means known in the art. Such means may include conjugation of an enzyme to the oligonucleotide, radiolabelling of the oligonucleotide or any other suitable detection means. Kits using such detection means for detecting the level of CD40 in a sample may also be prepared.
  • [0068]
    The specificity and sensitivity of antisense is also harnessed by those of skill in the art for therapeutic uses. Antisense compounds have been employed as therapeutic moieties in the treatment of disease states in animals, including humans. Antisense oligonucleotide drugs, including ribozymes, have been safely and effectively administered to humans and numerous clinical trials are presently underway. It is thus established that antisense compounds can be useful therapeutic modalities that can be configured to be useful in treatment regimes for the treatment of cells, tissues and animals, especially humans.
  • [0069]
    For therapeutics, an animal, preferably a human, suspected of having a disease or disorder which can be treated by modulating the expression of CD40 is treated by administering antisense compounds in accordance with this invention. For example, in one non-limiting embodiment, the methods comprise the step of administering to the animal in need of treatment, a therapeutically effective amount of a CD40 inhibitor. The CD40 inhibitors of the present invention effectively inhibit the activity of the CD40 protein or inhibit the expression of the CD40 protein. In one embodiment, the activity or expression of CD40 in an animal is inhibited by about 10%. Preferably, the activity or expression of CD40 in an animal is inhibited by about 30%. More preferably, the activity or expression of CD40 in an animal is inhibited by 50% or more. Thus, the oligomeric antisense compounds modulate expression of CD40 mRNA by at least 10%, by at least 20%, by at least 25%, by at least 30%, by at least 40%, by at least 50%, by at least 60%, by at least 70%, by at least 75%, by at least 80%, by at least 85%, by at least 90%, by at least 95%, by at least 98%, by at least 99%, or by 100%.
  • [0070]
    For example, the reduction of the expression of CD40 may be measured in serum, adipose tissue, liver or any other body fluid, tissue or organ of the animal. Preferably, the cells contained within said fluids, tissues or organs being analyzed contain a nucleic acid molecule encoding CD40 protein and/or the CD40 protein itself.
  • [0071]
    The antisense compounds of the invention can be utilized in pharmaceutical compositions by adding an effective amount of a compound to a suitable pharmaceutically acceptable diluent or carrier. Use of the compounds and methods of the invention may also be useful prophylactically.
  • [0072]
    F. Modifications
  • [0073]
    As is known in the art, a nucleoside is a base-sugar combination. The base portion of the nucleoside is normally a heterocyclic base sometimes referred to as a “nucleobase” or simply a “base”. The two most common classes of such heterocyclic bases are the purines and the pyrimidines. Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to either the 2′, 3′ or 5′ hydroxyl moiety of the sugar. In forming oligonucleotides, the phosphate groups covalently link adjacent nucleosides to one another to form a linear polymeric compound. In turn, the respective ends of this linear polymeric compound can be further joined to form a circular compound, however, linear compounds are generally preferred. In addition, linear compounds may have internal nucleobase complementarity and may therefore fold in a manner as to produce a fully or partially double-stranded compound. Within oligonucleotides, the phosphate groups are commonly referred to as forming the internucleoside backbone of the oligonucleotide. The normal linkage or backbone of RNA and DNA is a 3′ to 5′ phosphodiester linkage.
  • [0074]
    Modified Internucleoside Linkages (Backbones)
  • [0075]
    Specific examples of preferred antisense compounds useful in this invention include oligonucleotides containing modified backbones or non-natural internucleoside linkages. As defined in this specification, oligonucleotides having modified backbones include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone. For the purposes of this specification, and as sometimes referenced in the art, modified oligonucleotides that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides.
  • [0076]
    Preferred modified oligonucleotide backbones containing a phosphorus atom therein include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkyl-phosphotriaminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3′-alkylene phosphonates, 5′-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3′-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, selenophosphates and boranophosphates having normal 3′-5′ linkages, 2′-5′ linked analogs of these, and those having inverted polarity wherein one or more internucleotide linkages is a 3′ to 3′, 5′ to 5′ or 2′ to 2′ linkage. Preferred oligonucleotides having inverted polarity comprise a single 3′ to 3′ linkage at the 3′-most internucleotide linkage i.e. a single inverted nucleoside residue which may be abasic (the nucleobase is missing or has a hydroxyl group in place thereof). Various salts, mixed salts and free acid forms are also included.
  • [0077]
    Representative United States patents that teach the preparation of the above phosphorus-containing linkages include, but are not limited to, U.S. Pat. Nos. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111; 5,563,253; 5,571,799; 5,587,361; 5,194,599; 5,565,555; 5,527,899; 5,721,218; 5,672,697 and 5,625,050, certain of which are commonly owned with this application, and each of which is herein incorporated by reference.
  • [0078]
    Preferred modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; riboacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts.
  • [0079]
    Representative United States patents that teach the preparation of the above oligonucleosides include, but are not limited to, U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; 5,792,608; 5,646,269 and 5,677,439, certain of which are commonly owned with this application, and each of which is herein incorporated by reference.
  • [0080]
    Modified Sugar and Internucleoside Linkages-Mimetics
  • [0081]
    In other preferred antisense compounds, e.g., oligonucleotide mimetics, both the sugar and the internucleoside linkage (i.e. the backbone), of the nucleotide units are replaced with novel groups. The nucleobase units are maintained for hybridization with an appropriate target nucleic acid. One such compound, an oligonucleotide mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar-backbone of an oligonucleotide is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Representative United States patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Pat. Nos. 5,539,082; 5,714,331; and 5,719,262, each of which is herein incorporated by reference. Further teaching of PNA compounds can be found in Nielsen et al., Science, 1991, 254, 1497-1500.
  • [0082]
    Preferred embodiments of the invention are oligonucleotides with phosphorothioate backbones and oligonucleosides with heteroatom backbones, and in particular —CH2—NH—O—CH2—, —CH2—N(CH3)—O—CH2— [known as a methylene(methylimino) or MMI backbone], —CH2—O—N(CH3)—CH2—, —CH2—N(CH3)—N(CH3)—CH2— and —O—N(CH3)—CH2—CH2— [wherein the native phosphodiester backbone is represented as —O—P—O—CH2—] of the above referenced U.S. Pat. No. 5,489,677, and the amide backbones of the above referenced U.S. Pat. No. 5,602,240. Also preferred are oligonucleotides having morpholino backbone structures of the above-referenced U.S. Pat. No. 5,034,506.
  • [0083]
    Modified Sugars
  • [0084]
    Modified antisense compounds may also contain one or more substituted sugar moieties. Preferred are antisense compounds, preferably antisense oligonucleotides, comprising one of the following at the 2′ position: OH; F; O—, S—, or N-alkyl; O—, S—, or N-alkenyl; O—, S— or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted C1 to C10 alkyl or C2 to C10 alkenyl and alkynyl. Particularly preferred are O[(CH2)nO]mCH3, O(CH2)nOCH3, O(CH2)nNH2, O(CH2)nCH3, O)CH2)nONH2, and O(CH2)nON[(CH2)nCH3]2, where n and m are from 1 to about 10. Other preferred oligonucleotides comprise one of the following at the 2′ position: C1 to C10 lower alkyl, substituted lower alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide, and other substituents having similar properties. A preferred modification includes 2′-methoxyethoxy(2′-O—CH2CH2O CH3, also known as 2′-O-(2-methoxyethyl) or 2′-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78, 486-504) i.e., an alkoxyalkoxy group. A further preferred modification includes 2′-dimethylaminooxyethoxy, i.e., a O(CH2)2O N(CH3)2 group, also known as 2′-DMAOE, as described in examples hereinbelow, and 2′-dimethylaminoethoxyethoxy (also known in the art as 2′-O-dimethyl-amino-ethoxy-ethyl or 2′-DMAEOE), i.e., 2′-O—CH2—O—CH2—N(CH3)2, also described in examples hereinbelow.
  • [0085]
    Other preferred modifications include 2′-methoxy(2′-O—CH3), 2′-aminopropoxy(2′-OCH2CH2CH2NH2), 2′-allyl(2′-CH2—CH═CH2), 2′-O-allyl(2′-O—CH2—CH═CH2) and 2′-fluoro(2′-F). The 2′-modification may be in the arabino (up) position or ribo (down) position. A preferred 2′-arabino modification is 2′-F. Similar modifications may also be made at other positions on the oligonucleotide, particularly the 3′ position of the sugar on the 3′ terminal nucleotide or in 2′-5′ linked oligonucleotides and the 5′ position of 5′ terminal nucleotide. Antisense compounds may also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. Representative United States patents that teach the preparation of such modified sugar structures include, but are not limited to, U.S. Pat. Nos. 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; 5,792,747; and 5,700,920, certain of which are commonly owned with the instant application, and each of which is herein incorporated by reference in its entirety.
  • [0086]
    A further preferred modification of the sugar includes Locked Nucleic Acids (LNAs) in which the 2′-hydroxyl group is linked to the 3′ or 4′ carbon atom of the sugar ring, thereby forming a bicyclic sugar moiety. The linkage is preferably a methylene(—CH2—)n group bridging the 2′ oxygen atom and the 4′ carbon atom wherein n is 1 or 2. LNAs and preparation thereof are described in WO 98/39352 and WO 99/14226.
  • [0087]
    Natural and Modified Nucleobases
  • [0088]
    Antisense compounds may also include nucleobase (often referred to in the art as heterocyclic base or simply as “base”) modifications or substitutions. As used herein, “unmodified” or “natural” nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine(5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl(—C≡C—CH3)uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil(pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine. Further modified nucleobases include tricyclic pyrimidines such as phenoxazine cytidine(1H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one), phenothiazine cytidine(1H-pyrimido[5,4-b][1,4]benzothiazin-2(3H)-one), G-clamps such as a substituted phenoxazine cytidine (e.g. 9-(2-aminoethoxy)-H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one), carbazole cytidine(2H-pyrimido[4,5-b]indol-2-one), pyridoindole cytidine(H-pyrido[3′,2′:4,5]pyrrolo[2,3-d]pyrimidin-2-one). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Further nucleobases include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. I., ed. John Wiley & Sons, 1990, those disclosed by Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, and those disclosed by Sanghvi, Y. S., Chapter 15, Antisense Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B. ed., CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the compounds of the invention. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2° C. and are presently preferred base substitutions, even more particularly when combined with 2′-O-methoxyethyl sugar modifications.
  • [0089]
    Representative United States patents that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include, but are not limited to, the above noted U.S. Pat. No. 3,687,808, as well as U.S. Pat. Nos. 4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,645,985; 5,830,653; 5,763,588; 6,005,096; and 5,681,941, certain of which are commonly owned with the instant application, and each of which is herein incorporated by reference, and U.S. Pat. No. 5,750,692, which is commonly owned with the instant application and also herein incorporated by reference.
  • [0090]
  • [0091]
    Another modification of the antisense compounds of the invention involves chemically linking to the antisense compound one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the oligonucleotide. These moieties or conjugates can include conjugate groups covalently bound to functional groups such as primary or secondary hydroxyl groups. Conjugate groups of the invention include intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, polyethers, groups that enhance the pharmacodynamic properties of oligomers, and groups that enhance the pharmacokinetic properties of oligomers. Typical conjugate groups include cholesterols, lipids, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes. Groups that enhance the pharmacodynamic properties, in the context of this invention, include groups that improve uptake, enhance resistance to degradation, and/or strengthen sequence-specific hybridization with the target nucleic acid. Groups that enhance the pharmacokinetic properties, in the context of this invention, include groups that improve uptake, distribution, metabolism or excretion of the compounds of the present invention. Representative conjugate groups are disclosed in International Patent Application PCT/US92/09196, filed Oct. 23, 1992, and U.S. Pat. No. 6,287,860, the entire disclosure of which are incorporated herein by reference. Conjugate moieties include but are not limited to lipid moieties such as a cholesterol moiety, cholic acid, a thioether, e.g., hexyl-S-tritylthiol, a thiocholesterol, an aliphatic chain, e.g., dodecandiol or undecyl residues, a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate, a polyamine or a polyethylene glycol chain, or adamantane acetic acid, a palmityl moiety, or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety. Antisense compounds of the invention may also be conjugated to active drug substances, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indomethicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic. Oligonucleotide-drug conjugates and their preparation are described in U.S. patent application Ser. No. 09/334,130 (filed Jun. 15, 1999) which is incorporated herein by reference in its entirety.
  • [0092]
    Representative United States patents that teach the preparation of such oligonucleotide conjugates include, but are not limited to, U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731; 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941, certain of which are commonly owned with the instant application, and each of which is herein incorporated by reference.
  • [0093]
    Chimeric Compounds
  • [0094]
    It is not necessary for all positions in a given compound to be uniformly modified, and in fact more than one of the aforementioned modifications may be incorporated in a single compound or even at a single nucleoside within an oligonucleotide.
  • [0095]
    The present invention also includes antisense compounds which are chimeric compounds. “Chimeric” antisense compounds or “chimeras,” in the context of this invention, are antisense compounds, particularly oligonucleotides, which contain two or more chemically distinct regions, each made up of at least one monomer unit, i.e., a nucleotide in the case of an oligonucleotide compound. Chimeric antisense oligonucleotides are thus a form of antisense compound. These oligonucleotides typically contain at least one region wherein the oligonucleotide is modified so as to confer upon the oligonucleotide increased resistance to nuclease degradation, increased cellular uptake, increased stability and/or increased binding affinity for the target nucleic, acid. An additional region of the oligonucleotide may serve as a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids. By way of example, RNAse H is a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of oligonucleotide-mediated inhibition of gene expression. The cleavage of RNA:RNA hybrids can, in like fashion, be accomplished through the actions of endoribonucleases, such as RNAseL which cleaves both cellular and viral RNA. Cleavage of the RNA target can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known in the art.
  • [0096]
    Chimeric antisense compounds of the invention may be formed as composite structures of two or more oligonucleotides, modified oligonucleotides, oligonucleosides and/or oligonucleotide mimetics as described above. Such compounds have also been referred to in the art as hybrids or gapmers. Representative United States patents that teach the preparation of such hybrid structures include, but are not limited to, U.S. Pat. Nos. 5,013,830; 5,149,797; 5,220,007; 5,256,775; 5,366,878; 5,403,711; 5,491,133; 5,565,350; 5,623,065; 5,652,355; 5,652,356; and 5,700,922, certain of which are commonly owned with the instant application, and each of which is herein incorporated by reference in its entirety.
  • [0097]
    G. Formulations
  • [0098]
    The compounds of the invention may also be admixed, encapsulated, conjugated or otherwise associated with other molecules, molecule structures or mixtures of compounds, as for example, liposomes, receptor-targeted molecules, oral, rectal, topical or other formulations, for assisting in uptake, distribution and/or absorption. Representative United States patents that teach the preparation of such uptake, distribution and/or absorption-assisting formulations include, but are not limited to, U.S. Pat. Nos. 5,108,921; 5,354,844; 5,416,016; 5,459,127; 5,521,291; 5,543,158; 5,547,932; 5,583,020; 5,591,721; 4,426,330; 4,534,899; 5,013,556; 5,108,921; 5,213,804; 5,227,170; 5,264,221; 5,356,633; 5,395,619; 5,416,016; 5,417,978; 5,462,854; 5,469,854; 5,512,295; 5,527,528; 5,534,259; 5,543,152; 5,556,948; 5,580,575; and 5,595,756, each of which is herein incorporated by reference.
  • [0099]
    The antisense compounds of the invention encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other compound which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof.
  • [0100]
    The term “pharmaceutically acceptable salts” refers to physiologically and pharmaceutically acceptable salts of the compounds of the invention: i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto. For oligonucleotides, preferred examples of pharmaceutically acceptable salts and their uses are further described in U.S. Pat. No. 6,287,860, which is incorporated herein in its entirety.
  • [0101]
    The present invention also includes pharmaceutical compositions and formulations which include the antisense compounds of the invention. The pharmaceutical compositions of the present invention may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including ophthalmic and to mucous membranes including vaginal and rectal delivery), pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal), oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., intrathecal or intraventricular, administration. Oligonucleotides with at least one 2′-O-methoxyethyl modification are believed to be particularly useful for oral administration. Pharmaceutical compositions and formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable. Coated condoms, gloves and the like may also be useful.
  • [0102]
    The pharmaceutical formulations of the present invention, which may conveniently be presented in unit dosage form, may be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general, the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.
  • [0103]
    The compositions of the present invention may be formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, gel capsules, liquid syrups, soft gels, suppositories, and enemas. The compositions of the present invention may also be formulated as suspensions in aqueous, non-aqueous or mixed media. Aqueous suspensions may further contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran. The suspension may also contain stabilizers.
  • [0104]
    Pharmaceutical compositions of the present invention include, but are not limited to, solutions, emulsions, foams and liposome-containing formulations. The pharmaceutical compositions and formulations of the present invention may comprise one or more penetration enhancers, carriers, excipients or other active or inactive ingredients.
  • [0105]
    Emulsions are typically heterogenous systems of one liquid dispersed in another in the form of droplets usually exceeding 0.1 μm in diameter. Emulsions may contain additional components in addition to the dispersed phases, and the active drug which may be present as a solution in either the aqueous phase, oily phase or itself as a separate phase. Microemulsions are included as an embodiment of the present invention. Emulsions and their uses are well known in the art and are further described in U.S. Pat. No. 6,287,860, which is incorporated herein in its entirety.
  • [0106]
    Formulations of the present invention include liposomal formulations. As used in the present invention, the term “liposome” means a vesicle composed of amphiphilic lipids arranged in a spherical bilayer or bilayers. Liposomes are unilamellar or multilamellar vesicles which have a membrane formed from a lipophilic material and an aqueous interior that contains the composition to be delivered. Cationic liposomes are positively charged liposomes which are believed to interact with negatively charged DNA molecules to form a stable complex. Liposomes that are pH-sensitive or negatively-charged are believed to entrap DNA rather than complex with it. Both cationic and noncationic liposomes have been used to deliver DNA to cells.
  • [0107]
    Liposomes also include “sterically stabilized” liposomes, a term which, as used herein, refers to liposomes comprising one or more specialized lipids that, when incorporated into liposomes, result in enhanced circulation lifetimes relative to liposomes lacking such specialized lipids. Examples of sterically stabilized liposomes are those in which part of the vesicle-forming lipid portion of the liposome comprises one or more glycolipids or is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety. Liposomes and their uses are further described in U.S. Pat. No. 6,287,860, which is incorporated herein in its entirety.
  • [0108]
    The pharmaceutical formulations and compositions of the present invention may also include surfactants. The use of surfactants in drug products, formulations and in emulsions is well known in the art. Surfactants and their uses are further described in U.S. Pat. No. 6,287,860, which is incorporated herein in its entirety.
  • [0109]
    In one embodiment, the present invention employs various penetration enhancers to effect the efficient delivery of nucleic acids, particularly oligonucleotides. In addition to aiding the diffusion of non-lipophilic drugs across cell membranes, penetration enhancers also enhance the permeability of lipophilic drugs. Penetration enhancers may be classified as belonging to one of five broad categories, i.e., surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants. Penetration enhancers and their uses are further described in U.S. Pat. No. 6,287,860, which is incorporated herein in its entirety.
  • [0110]
    One of skill in the art will recognize that formulations are routinely designed according to their intended use, i.e. route of administration.
  • [0111]
    Preferred formulations for topical administration include those in which the oligonucleotides of the invention are in admixture with a topical delivery agent such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents and surfactants. Preferred lipids and liposomes include neutral (e.g. dioleoylphosphatidyl DOPE ethanolamine, dimyristoylphosphatidyl choline DMPC, distearolyphosphatidyl choline) negative (e.g. dimyristoylphosphatidyl glycerol DMPG) and cationic (e.g. dioleoyltetramethylaminopropyl DOTAP and dioleoylphosphatidyl ethanolamine DOTMA).
  • [0112]
    For topical or other administration, oligonucleotides of the invention may be encapsulated within liposomes or may form complexes thereto, in particular to cationic liposomes. Alternatively, oligonucleotides may be complexed to lipids, in particular to cationic lipids. Preferred fatty acids and esters, pharmaceutically acceptable salts thereof, and their uses are further described in U.S. Pat. No. 6,287,860, which is incorporated herein in its entirety. Topical formulations are described in detail in U.S. patent application Ser. No. 09/315,298 filed on May 20, 1999, which is incorporated herein by reference in its entirety.
  • [0113]
    Compositions and formulations for oral administration include powders or granules, microparticulates, nanoparticulates, suspensions or solutions in water or non-aqueous media, capsules, gel capsules, sachets, tablets or minitablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders may be desirable. Preferred oral formulations are those in which oligonucleotides of the invention are administered in conjunction with one or more penetration enhancers surfactants and chelators. Preferred surfactants include fatty acids and/or esters or salts thereof, bile acids and/or salts thereof. Preferred bile acids/salts and fatty acids and their uses are further described in U.S. Pat. No. 6,287,860, which is incorporated herein in its entirety. Also preferred are combinations of penetration enhancers, for example, fatty acids/salts in combination with bile acids/salts. A particularly preferred combination is the sodium salt of lauric acid, capric acid and UDCA. Further penetration enhancers include polyoxyethylene-9-lauryl ether, polyoxyethylene-20-cetyl ether. Oligonucleotides of the invention may be delivered orally, in granular form including sprayed dried particles, or complexed to form micro or nanoparticles. Oligonucleotide complexing agents and their uses are further described in U.S. Pat. No. 6,287,860, which is incorporated herein in its entirety. Oral formulations for oligonucleotides and their preparation are described in detail in U.S. applications Ser. Nos. 09/108,673 (filed Jul. 1, 1998), 09/315,298 (filed May 20, 1999) and 10/071,822, filed Feb. 8, 2002, each of which is incorporated herein by reference in their entirety.
  • [0114]
    Compositions and formulations for parenteral, intrathecal or intraventricular administration may include sterile aqueous solutions which may also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.
  • [0115]
    Certain embodiments of the invention provide pharmaceutical compositions containing one or more oligomeric compounds and one or more other chemotherapeutic agents which function by a non-antisense mechanism. Examples of such chemotherapeutic agents include but are not limited to cancer chemotherapeutic drugs such as daunorubicin, daunomycin, dactinomycin, doxorubicin, epirubicin, idarubicin, esorubicin, bleomycin, mafosfamide, ifosfamide, cytosine arabinoside, bis-chloroethylnitrosurea, busulfan, mitomycin C, actinomycin D, mithramycin, prednisone, hydroxyprogesterone, testosterone, tamoxifen, dacarbazine, procarbazine, hexamethylmelamine, pentamethylmelamine, mitoxantrone, amsacrine, chlorambucil, methylcyclohexylnitrosurea, nitrogen mustards, melphalan, cyclophosphamide, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-azacytidine, hydroxyurea, deoxycoformycin, 4-hydroxyperoxycyclophosphoramide, 5-fluorouracil (5-FU), 5-fluorodeoxyuridine (5-FUdR), methotrexate (MTX), colchicine, taxol, vincristine, vinblastine, etoposide (VP-16), trimetrexate, irinotecan, topotecan, gemcitabine, teniposide, cisplatin and diethylstilbestrol (DES). When used with the compounds of the invention, such chemotherapeutic agents may be used individually (e.g., 5-FU and oligonucleotide), sequentially (e.g., 5-FU and oligonucleotide for a period of time followed by MTX and oligonucleotide), or in combination with one or more other such chemotherapeutic agents (e.g., 5-FU, MTX and oligonucleotide, or 5-FU, radiotherapy and oligonucleotide). Anti-inflammatory drugs, including but not limited to nonsteroidal anti-inflammatory drugs and corticosteroids, and antiviral drugs, including but not limited to ribivirin, vidarabine, acyclovir and ganciclovir, may also be combined in compositions of the invention. Combinations of antisense compounds and other non-antisense drugs are also within the scope of this invention. Two or more combined compounds may be used together or sequentially.
  • [0116]
    In another related embodiment, compositions of the invention may contain one or more antisense compounds, particularly oligonucleotides, targeted to a first nucleic acid and one or more additional antisense compounds targeted to a second nucleic acid target. Alternatively, compositions of the invention may contain two or more antisense compounds targeted to different regions of the same nucleic acid target. Numerous examples of antisense compounds are known in the art. Two or more combined compounds may be used together or sequentially.
  • [0117]
    H. Dosing
  • [0118]
    The formulation of therapeutic compositions and their subsequent administration (dosing) is believed to be within the skill of those in the art. Dosing is dependent on severity and responsiveness of the disease state to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of the disease state is achieved. Optimal dosing schedules can be calculated from measurements of drug accumulation in the body of the patient. Persons of ordinary skill can easily determine optimum dosages, dosing methodologies and repetition rates. Optimum dosages may vary depending on the relative potency of individual oligonucleotides, and can generally be estimated based on EC50s found to be effective in in vitro and in vivo animal models. In general, dosage is from 0.01 ug to 100 g per kg of body weight, and may be given once or more daily, weekly, monthly or yearly, or even once every 2 to 20 years. Persons of ordinary skill in the art can easily estimate repetition rates for dosing based on measured residence times and concentrations of the drug in bodily fluids or tissues. Following successful treatment, it may be desirable to have the patient undergo maintenance therapy to prevent the recurrence of the disease state, wherein the oligonucleotide is administered in maintenance doses, ranging from 0.01 ug to 100 g per kg of body weight, once or more daily, to once every 20 years.
  • [0119]
    While the present invention has been described with specificity in accordance with certain of its preferred embodiments, the following examples serve only to illustrate the invention and are not intended to limit the same. Each of the references, GenBank accession numbers, and the like recited in the present application is incorporated herein by reference in its entirety.
  • EXAMPLES Example 1 Synthesis of Nucleoside Phosphoramidites
  • [0120]
    The following compounds, including amidites and their intermediates were prepared as described in U.S. Pat. No. 6,426,220 and published as WO 02/36743; 5′-O-Dimethoxytrityl-thymidine intermediate for 5-methyl dC amidite, 5′-O-Dimethoxytrityl-2′-deoxy-5-methylcytidine intermediate for 5-methyl-dC amidite, 5′-O-Dimethoxytrityl-2′-deoxy-N4-benzoyl-5-methylcytidine penultimate intermediate for 5-methyl dC amidite, [5′-O-(4,4′-Dimethoxytriphenylmethyl)-2′-deoxy-N4-benzoyl-5-methylcytidin-3′-O-yl]-2-cyanoethyl-N,N-diisopropylphosphoramidite(5-methyl dC amidite), 2′-Fluorodeoxyadenosine, 2′-Fluorodeoxyguanosine, 2′-Fluorouridine, 2′-Fluorodeoxycytidine, 2′-O-(2-Methoxyethyl) modified amidites, 2′-O-(2-methoxyethyl)-5-methyluridine intermediate, 5′-O-DMT-2′-O-(2-methoxyethyl)-5-methyluridine penultimate intermediate, [5′-O-(4,4′-Dimethoxytriphenylmethyl)-2′-O-(2-methoxyethyl)-5-methyluridin-3′-O-yl]-2-cyanoethyl-N,N-diisopropylphosphoramidite(MOE T amidite), 5′-O-Dimethoxytrityl-2′-O-(2-methoxyethyl)-5-methylcytidine intermediate, 5′-O-dimethoxytrityl-2′-O-(2-methoxyethyl)-N4-benzoyl-5-methyl-cytidine penultimate intermediate, [5′-O-(4,4′-Dimethoxytriphenylmethyl)-2′-O-(2-methoxyethyl)-N4-benzoyl-5-methylcytidin-3′-O-yl]-2-cyanoethyl-N,N-diisopropylphosphoramidite(MOE 5-Me-C amidite), [5′-O-(4,4′-Dimethoxytriphenylmethyl)-2′-O-(2-methoxyethyl)-N6-benzoyladenosin-3′-O-yl]-2-cyanoethyl-N,N-diisopropylphosphoramidite(MOE A amdite), [5′-O-(4,4′-Dimethoxytriphenylmethyl)-2′-O-(2-methoxyethyl)-N4-isobutyrylguanosin-3′-O-yl]-2-cyanoethyl-N,N-diisopropylphosphoramidite(MOE G amidite), 2′-O-(Aminooxyethyl)nucleoside amidites and 2′-O-(dimethylamino-oxyethyl)nucleoside amidites, 2′-(Dimethylaminooxyethoxy)nucleoside amidites, 5′-O-tert-Butyldiphenylsilyl-O2-2′-anhydro-5-methyluridine, 5′-O-tert-Butyldiphenylsilyl-21-O-(2-hydroxyethyl)-5-methyluridine, 2′-O-([2-phthalimidoxy)ethyl]-5′-t-butyldiphenylsilyl-5-methyluridine, 5′-O-tert-butyldiphenylsilyl-2′-O-[(2-formadoximinooxy)ethyl]-5-methyluridine, 5′-O-tert-Butyldiphenylsilyl-2′-O-[N,N dimethylaminooxyethyl]-5-methyluridine, 2′-O-(dimethylaminooxyethyl)-5-methyluridine, 5′-O-DMT-2′-O-(dimethylaminooxyethyl)-5-methyluridine, 5′-O-DMT-2′-O-(2-N,N-dimethylaminooxyethyl)-5-methyluridine-3′-[(2-cyanoethyl)-N,N-diisopropylphosphoramidite], 2′-(Aminooxyethoxy)nucleoside amidites, N2-isobutyryl-6-O-diphenylcarbamoyl-2′-O-(2-ethylacetyl)-5′-O-(4,4′-dimethoxytrityl)guanosine-3′-[(2-cyanoethyl)-N,N-diisopropylphosphoramidite], 2′-dimethylaminoethoxyethoxy (2′-DMAEOE)nucleoside amidites, 2′-O-[2(2-N,N-dimethylaminoethoxy)ethyl]-5-methyl uridine, 5′-O-dimethoxytrityl-2′-O-[2(2-N,N-dimethylaminoethoxy)-ethyl)]-5-methyl uridine and 5′-O-Dimethoxytrityl-2′-O-[2(2-N,N-dimethylaminoethoxy)-ethyl)]-5-methyl uridine-3′-O-(cyanoethyl-N,N-diisopropyl)phosphoramidite.
  • Example 2 Oligonucleotide and oligonucleoside synthesis
  • [0121]
    The antisense compounds used in accordance with this invention may be conveniently and routinely made through the well-known technique of solid phase synthesis. Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, Calif.). Any other means for such synthesis known in the art may additionally or alternatively be employed. It is well known to use similar techniques to prepare oligonucleotides such as the phosphorothioates and alkylated derivatives.
  • [0122]
    Oligonucleotides: Unsubstituted and substituted phosphodiester (P═O) oligonucleotides are synthesized on an automated DNA synthesizer (Applied Biosystems model 394) using standard phosphoramidite chemistry with oxidation by iodine.
  • [0123]
    Phosphorothioates (P═S) are synthesized similar to phosphodiester oligonucleotides with the following exceptions: thiation was effected by utilizing a 10% w/v solution of 3,H-1,2-benzodithiole-3-one 1,1-dioxide in acetonitrile for the oxidation of the phosphite linkages. The thiation reaction step time was increased to 180 sec and preceded by the normal capping step. After cleavage from the CPG column and deblocking in concentrated ammonium hydroxide at 55° C. (12-16 hr), the oligonucleotides were recovered by precipitating with >3 volumes of ethanol from a 1 M NH4OAc solution. Phosphinate oligonucleotides are prepared as described in U.S. Pat. No. 5,508,270, herein incorporated by reference.
  • [0124]
    Alkyl phosphonate oligonucleotides are prepared as described in U.S. Pat. No. 4,469,863, herein incorporated by reference.
  • [0125]
    3′-Deoxy-3′-methylene phosphonate oligonucleotides are prepared as described in U.S. Pat. Nos. 5,610,289 or 5,625,050, herein incorporated by reference.
  • [0126]
    Phosphoramidite oligonucleotides are prepared as described in U.S. Pat. No. 5,256,775 or U.S. Pat. No. 5,366,878, herein incorporated by reference.
  • [0127]
    Alkylphosphonothioate oligonucleotides are prepared as described in published PCT applications PCT/US94/00902 and PCT/US93/06976 (published as WO 94/17093 and WO 94/02499, respectively), herein incorporated by reference.
  • [0128]
    3′-Deoxy-3′-amino phosphoramidate oligonucleotides are prepared as described in U.S. Pat. No. 5,476,925, herein incorporated by reference.
  • [0129]
    Phosphotriester oligonucleotides are prepared as described in U.S. Pat. No. 5,023,243, herein incorporated by reference.
  • [0130]
    Borano phosphate oligonucleotides are prepared as described in U.S. Pat. Nos. 5,130,302 and 5,177,198, both herein incorporated by reference.
  • [0131]
    Oligonucleosides: Methylenemethylimino linked oligonucleosides, also identified as MMI linked oligonucleosides, methylenedimethylhydrazo linked oligonucleosides, also identified as MDH linked oligonucleosides, and methylenecarbonylamino linked oligonucleosides, also identified as amide-3 linked oligonucleosides, and methyleneaminocarbonyl linked oligonucleosides, also identified as amide-4 linked oligonucleosides, as well as mixed backbone compounds having, for instance, alternating MMI and P═O or P═S linkages are prepared as described in U.S. Pat. Nos. 5,378,825, 5,386,023, 5,489,677, 5,602,240 and 5,610,289, all of which are herein incorporated by reference.
  • [0132]
    Formacetal and thioformacetal linked oligonucleosides are prepared as described in U.S. Pat. Nos. 5,264,562 and 5,264,564, herein incorporated by reference.
  • [0133]
    Ethylene oxide linked oligonucleosides are prepared as described in U.S. Pat. No. 5,223,618, herein incorporated by reference.
  • Example 3 RNA Synthesis
  • [0134]
    In general, RNA synthesis chemistry is based on the selective incorporation of various protecting groups at strategic intermediary reactions. Although one of ordinary skill in the art will understand the use of protecting groups in organic synthesis, a useful class of protecting groups includes silyl ethers. In particular bulky silyl ethers are used to protect the 5′-hydroxyl in combination with an acid-labile orthoester protecting group on the 2′-hydroxyl. This set of protecting groups is then used with standard solid-phase synthesis technology. It is important to lastly remove the acid labile orthoester protecting group after all other synthetic steps. Moreover, the early use of the silyl protecting groups during synthesis ensures facile removal when desired, without undesired deprotection of 2′ hydroxyl.
  • [0135]
    Following this procedure for the sequential protection of the 5′-hydroxyl in combination with protection of the 2′-hydroxyl by protecting groups that are differentially removed and are differentially chemically labile, RNA oligonucleotides were synthesized.
  • [0136]
    RNA oligonucleotides are synthesized in a stepwise fashion. Each nucleotide is added sequentially (3′- to 5′-direction) to a solid support-bound oligonucleotide. The first nucleoside at the 3′-end of the chain is covalently attached to a solid support. The nucleotide precursor, a ribonucleoside phosphoramidite, and activator are added, coupling the second base onto the 5′-end of the first nucleoside. The support is washed and any unreacted 5′-hydroxyl groups are capped with acetic anhydride to yield 5′-acetyl moieties. The linkage is then oxidized to the more stable and ultimately desired P(V) linkage. At the end of the nucleotide addition cycle, the 5′-silyl group is cleaved with fluoride. The cycle is repeated for each subsequent nucleotide.
  • [0137]
    Following synthesis, the methyl protecting groups on the phosphates are cleaved in 30 minutes utilizing 1 M disodium-2-carbamoyl-2-cyanoethylene-1,1-dithiolate trihydrate (S2Na2) in DMF. The deprotection solution is washed from the solid support-bound oligonucleotide using water. The support is then treated with 40% methylamine in water for 10 minutes at 55° C. This releases the RNA oligonucleotides into solution, deprotects the exocyclic amines, and modifies the 2′-groups. The oligonucleotides can be analyzed by anion exchange HPLC at this stage.
  • [0138]
    The 2′-orthoester groups are the last protecting groups to be removed. The ethylene glycol monoacetate orthoester protecting group developed by Dharmacon Research, Inc. (Lafayette, Colo.), is one example of a useful orthoester protecting group which, has the following important properties. It is stable to the conditions of nucleoside phosphoramidite synthesis and oligonucleotide synthesis. However, after oligonucleotide synthesis the oligonucleotide is treated with methylamine which not only cleaves the oligonucleotide from the solid support but also removes the acetyl groups from the orthoesters. The resulting 2-ethyl-hydroxyl substituents on the orthoester are less electron withdrawing than the acetylated precursor. As a result, the modified orthoester becomes more labile to acid-catalyzed hydrolysis. Specifically, the rate of cleavage is approximately 10 times faster after the acetyl groups are removed. Therefore, this orthoester possesses sufficient stability in order to be compatible with oligonucleotide synthesis and yet, when subsequently modified, permits deprotection to be carried out under relatively mild aqueous conditions compatible with the final RNA oligonucleotide product.
  • [0139]
    Additionally, methods of RNA synthesis are well known in the art (Scaringe, S. A. Ph.D. Thesis, University of Colorado, 1996; Scaringe, S. A., et al., J. Am. Chem. Soc., 1998, 120, 11820-11821; Matteucci, M. D. and Caruthers, M. H. J. Am. Chem. Soc., 1981, 103, 3185-3191; Beaucage, S. L. and Caruthers, M. H. Tetrahedron Lett., 1981, 22, 1859-1862; Dahl, B. J., et al., Acta Chem. Scand,. 1990, 44, 639-641; Reddy, M. P., et al., Tetrahedrom Lett., 1994, 25, 4311-4314; Wincott, F. et al., Nucleic Acids Res., 1995, 23, 2677-2684; Griffin, B. E., et al., Tetrahedron, 1967, 23, 2301-2313; Griffin, B. E., et al., Tetrahedron, 1967, 23, 2315-2331).
  • [0140]
    RNA antisense compounds (RNA oligonucleotides) of the present invention can be synthesized by the methods herein or purchased from Dharmacon Research, Inc (Lafayette, Colo.). Once synthesized, complementary RNA antisense compounds can then be annealed by methods known in the art to form double stranded (duplexed) antisense compounds. For example, duplexes can be formed by combining 30 μl of each of the complementary strands of RNA oligonucleotides (50 uM RNA oligonucleotide solution) and 15 μl of 5× annealing buffer (100 mM potassium acetate, 30 mM HEPES-KOH pH 7.4, 2 mM magnesium acetate) followed by heating for 1 minute at 90° C., then 1 hour at 37° C. The resulting duplexed antisense compounds can be used in kits, assays, screens, or other methods to investigate the role of a target nucleic acid, or for diagnostic or therapeutic purposes.
  • Example 4 Synthesis of Chimeric Compounds
  • [0141]
    Chimeric oligonucleotides, oligonucleosides or mixed oligonucleotides/oligonucleosides of the invention can be of several different types. These include a first type wherein the “gap” segment of linked nucleosides is positioned between 5′ and 3′ “wing” segments of linked nucleosides and a second “open end” type wherein the “gap” segment is located at either the 3′ or the 5′ terminus of the oligomeric compound. Oligonucleotides of the first type are also known in the art as “gapmers” or gapped oligonucleotides. Oligonucleotides of the second type are also known in the art as “hemimers” or “wingmers”.
  • [2′-O-Me]-[2′-deoxy]-[2′-O-Me]Chimeric Phosphorothioate Oligonucleotides
  • [0142]
    Chimeric oligonucleotides having 2′-O-alkyl phosphorothioate and 2′-deoxy phosphorothioate oligonucleotide segments are synthesized using an Applied Biosystems automated DNA synthesizer Model 394, as above. Oligonucleotides are synthesized using the automated synthesizer and 2′-deoxy-5′-dimethoxytrityl-3′-O-phosphor-amidite for the DNA portion and 5′-dimethoxytrityl-2′-O-methyl-3′-O-phosphoramidite for 5′ and 3′ wings. The standard synthesis cycle is modified by incorporating coupling steps with increased reaction times for the 5′-dimethoxytrityl-2′-O-methyl-3′-O-phosphoramidite. The fully protected oligonucleotide is cleaved from the support and deprotected in concentrated ammonia (NH4OH) for 12-16 hr at 55° C. The deprotected oligo is then recovered by an appropriate method (precipitation, column chromatography, volume reduced in vacuo and analyzed spetrophotometrically for yield and for purity by capillary electrophoresis and by mass spectrometry.
  • [2′-O-(2-Methoxyethyl)]-[2′-deoxy]-[2′-O-(Methoxyethyl)]Chimeric Phosphorothioate Oligonucleotides
  • [0143]
    [2′-O-(2-methoxyethyl)]-[2′-deoxy]-[-2′-O-(methoxyethyl)]chimeric phosphorothioate oligonucleotides were prepared as per the procedure above for the 2′-O-methyl chimeric oligonucleotide, with the substitution of 2′-O-(methoxyethyl)amidites for the 2′-O-methyl amidites.
  • [2′-O-(2-Methoxyethyl)Phosphodiester]-[2′-deoxy Phosphorothioate]-[2′-O-(2-Methoxyethyl)Phosphodiester]Chimeric Oligonucleotides
  • [0144]
    [2′-O-(2-methoxyethyl phosphodiester]-[2′-deoxy phosphorothioate]-[2′-O-(methoxyethyl) phosphodiester] chimeric oligonucleotides are prepared as per the above procedure for the 2′-O-methyl chimeric oligonucleotide with the substitution of 2′-O-(methoxyethyl) amidites for the 2′-O-methyl amidites, oxidation with iodine to generate the phosphodiester internucleotide linkages within the wing portions of the chimeric structures and sulfurization utilizing 3,H-1,2 benzodithiole-3-one 1,1 dioxide (Beaucage Reagent) to generate the phosphorothioate internucleotide linkages for the center gap.
  • [0145]
    Other chimeric oligonucleotides, chimeric oligonucleosides and mixed chimeric oligonucleotides/oligonucleosides are synthesized according to U.S. Pat. No. 5,623,065, herein incorporated by reference.
  • Example 5 Design and Screening of Duplexed Antisense Compounds Targeting CD40
  • [0146]
    In accordance with the present invention, a series of nucleic acid duplexes comprising the antisense compounds of the present invention and their complements can be designed to target CD40. The nucleobase sequence of the antisense strand of the duplex comprises at least an 8-nucleobase portion of an oligonucleotide in Table 1. The ends of the strands may be modified by the addition of one or more natural or modified nucleobases to form an overhang. The sense strand of the dsRNA is then designed and synthesized as the complement of the antisense strand and may also contain modifications or additions to either terminus. For example, in one embodiment, both strands of the dsRNA duplex would be complementary over the central nucleobases, each having overhangs at one or both termini.
  • [0147]
    For example, a duplex comprising an antisense strand having the sequence CGAGAGGCGGACGGGACCG and having a two-nucleobase overhang of deoxythymidine(dT) would have the following structure:
      cgagaggcggacgggaccgTT Antisense Strand
    TTgctctccgcctgccctggc Complement
  • [0148]
    In another embodiment, a duplex comprising an antisense strand having the same sequence CGAGAGGCGGACGGGACCG may be prepared with blunt ends (no single stranded overhang) as shown:
    cgagaggcggacgggaccg Antisense Strand
    gctctccgcctgccctggc Complement
  • [0149]
    RNA strands of the duplex can be synthesized by methods disclosed herein or purchased from Dharmacon Research Inc., (Lafayette, Colo.). Once synthesized, the complementary strands are annealed. The single strands are aliquoted and diluted to a concentration of 50 uM. Once diluted, 30 uL of each strand is combined with 15uL of a 5× solution of annealing buffer. The final concentration of said buffer is 100 mM potassium acetate, 30 mM HEPES-KOH pH 7.4, and 2mM magnesium acetate. The final volume is 75 uL. This solution is incubated for 1 minute at 90° C. and then centrifuged for 15 seconds. The tube is allowed to sit for 1 hour at 37° C. at which time the dsRNA duplexes are used in experimentation. The final concentration of the dsRNA duplex is 20 uM. This solution can be stored frozen (−20° C.) and freeze-thawed up to 5 times.
  • [0150]
    Once prepared, the duplexed antisense compounds are evaluated for their ability to modulate CD40 expression.
  • [0151]
    When cells reached 80% confluency, they are treated with duplexed antisense compounds of the invention. For cells grown in 96-well plates, wells are washed once with 200 μL OPTI-MEM-1 reduced-serum medium (Gibco BRL) and then treated with 130 μL of OPTI-MEM-1 containing 12 μg/mL LIPOFECTIN (Gibco BRL) and the desired duplex antisense compound at a final concentration of 200 nM. After 5 hours of treatment, the medium is replaced with fresh medium. Cells are harvested 16 hours after treatment, at which time RNA is isolated and target reduction measured by RT-PCR.
  • Example 6 Oligonucleotide Isolation
  • [0152]
    After cleavage from the controlled pore glass solid support and deblocking in concentrated ammonium hydroxide at 55° C. for 12-16 hours, the oligonucleotides or oligonucleosides are recovered by precipitation out of 1 M NH4OAc with >3 volumes of ethanol. Synthesized oligonucleotides were analyzed by electrospray mass spectroscopy (molecular weight determination) and by capillary gel electrophoresis and judged to be at least 70% full length material. The relative amounts of phosphorothioate and phosphodiester linkages obtained in the synthesis was determined by the ratio of correct molecular weight relative to the −16 amu product (±32 ±48). For some studies oligonucleotides were purified by HPLC, as described by Chiang et al., J. Biol. Chem. 1991, 266, 18162-18171. Results obtained with HPLC-purified material were similar to those obtained with non-HPLC purified material.
  • Example 7 Oligonucleotide Synthesis—96 Well Plate Format
  • [0153]
    Oligonucleotides were synthesized via solid phase P(III) phosphoramidite chemistry on an automated synthesizer capable of assembling 96 sequences simultaneously in a 96-well format. Phosphodiester internucleotide linkages were afforded by oxidation with aqueous iodine. Phosphorothioate internucleotide linkages were generated by sulfurization utilizing 3,H-1,2 benzodithiole-3-one 1,1 dioxide (Beaucage Reagent) in anhydrous acetonitrile. Standard base-protected beta-cyanoethyl-diiso-propyl phosphoramidites were purchased from commercial vendors (e.g. PE-Applied Biosystems, Foster City, Calif., or Pharmacia, Piscataway, N.J.). Non-standard nucleosides are synthesized as per standard or patented methods. They are utilized as base protected beta-cyanoethyldiisopropyl phosphoramidites.
  • [0154]
    Oligonucleotides were cleaved from support and deprotected with concentrated NH40H at elevated temperature (55-60° C.) for 12-16 hours and the released product then dried in vacuo. The dried product was then re-suspended in sterile water to afford a master plate from which all analytical and test plate samples are then diluted utilizing robotic pipettors.
  • Example 8 Oligonucleotide Analysis—96-Well Plate Format
  • [0155]
    The concentration of oligonucleotide in each well was assessed by dilution of samples and UV absorption spectroscopy. The full-length integrity of the individual products was evaluated by capillary electrophoresis (CE) in either the 96-well format (Beckman P/ACE™ MDQ) or, for individually prepared samples, on a commercial CE apparatus (e.g., Beckman P/ACE™ 5000, ABI 270). Base and backbone composition was confirmed by mass analysis of the compounds utilizing electrospray-mass spectroscopy. All assay test plates were diluted from the master plate using single and multi-channel robotic pipettors. Plates were judged to be acceptable if at least 85% of the compounds on the plate were at least 85% full length.
  • Example 9 Antisense Sequences Targeted to Human CD40
  • [0156]
    In accordance with the present invention, a series of antisense sequences were designed to target different regions of the human CD40 mRNA, using published sequences [Stamenkovic et al., EMBO J., 8, 1403 (1989); GenBank accession number X60592]. The sequences are shown in Table 1.
    TABLE 1
    Antisense sequences targeted to
    human CD40 mRNA
    18627 Coding 49 GCAGAGGCAGACGAACCA 5
    18628 Coding 73 GCAAGCAGCCCCAGAGGA 6
    18629 Coding 78 GGTCAGCAAGCAGCCCCA 7
    18630 Coding 84 GACAGCGGTCAGCAAGCA 8
    18631 Coding 88 GATGGACAGCGGTCAGCA 9
    18632 Coding 92 TCTGGATGGACAGCGGTC 10
    18633 Coding 98 GGTGGTTCTGGATGGACA 11
    18634 Coding 101 GTGGGTGGTTCTGGATGG 12
    18635 Coding 104 GCAGTGGGTGGTTCTGGA 13
    18636 Coding 152 CACAAAGAACAGCACTGA 14
    18637 Coding 156 CTGGCACAAAGAACAGCA 15
    18638 Coding 162 TCCTGGCTGGCACAAAGA 16
    18639 Coding 165 CTGTCCTGGCTGGCACAA 17
    18640 Coding 176 CTCACCAGTTTCTGTCCT 18
    18641 Coding 179 TCACTCACCAGTTTCTGT 19
    18642 Coding 185 GTGCAGTCACTCACCAGT 20
    18643 Coding 190 ACTCTGTGCAGTCACTCA 21
    18644 Coding 196 CAGTGAACTCTGTGCAGT 22
    18645 Coding 205 ATTCCGTTTCAGTGAACT 23
    18646 Coding 211 GAAGGCATTCCGTTTCAG 24
    18647 Coding 222 TTCACCGCAAGGAAGGCA 25
    18648 Coding 250 CTCTGTTCCAGGTGTCTA 26
    18649 Coding 267 CTGGTGGCAGTGTGTCTC 27
    18650 Coding 286 TGGGGTCGCAGTATTTGT 28
    18651 Coding 289 GGTTGGGGTCGCAGTATT 29
    18652 Coding 292 CTAGGTTGGGGTCGCAGT 30
    18653 Coding 318 GGTGCCCTTCTGCTGGAC 31
    18654 Coding 322 CTGAGGTGCCCTTCTGCT 32
    18655 Coding 332 GTGTCTGTTTCTGAGGTG 33
    18656 Coding 334 TGGTGTCTGTTTCTGAGG 34
    18657 Coding 345 ACAGGTGCAGATGGTGTC 35
    18658 Coding 348 TTCACAGGTGCAGATGGT 36
    18659 Coding 360 GTGCCAGCCTTCTTCACA 37
    18660 Coding 364 TACAGTGCCAGCCTTCTT 38
    18661 Coding 391 GGACACAGCTCTCACAGG 39
    18662 Coding 395 TGCAGGACACAGCTCTCA 40
    18663 Coding 401 GAGCGGTGCAGGACACAG 41
    18664 Coding 416 AAGCCGGGCGAGCATGAG 42
    18665 Coding 432 AATCTGCTTGACCCCAAA 43
    18666 Coding 446 GAAACCCCTGTAGCAATC 44
    18667 Coding 452 GTATCAGAAACCCCTGTA 45
    18668 Coding 463 GCTCGCAGATGGTATCAG 46
    18669 Coding 468 GCAGGGCTCGCAGATGGT 47
    18670 Coding 471 TGGGCAGGGCTCGCAGAT 48
    18671 Coding 474 GACTGGGCAGGGCTCGCA 49
    18672 Coding 490 CATTGGAGAAGAAGCCGA 50
    18673 Coding 497 GATGACACATTGGAGAAG 51
    18674 Coding 500 GCAGATGACACATTGGAG 52
    18675 Coding 506 TCGAAAGCAGATGACACA 53
    18676 Coding 524 GTCCAAGGGTGACATTTT 54
    18677 Coding 532 CACAGCTTGTCCAAGGGT 55
    18678 Coding 539 TTGGTCTCACAGCTTGTC 56
    18679 Coding 546 CAGGTCTTTGGTCTCACA 57
    18680 Coding 558 CTGTTGCACAACCAGGTC 58
    18681 Coding 570 GTTTGTGCCTGCCTGTTG 59
    18682 Coding 575 GTCTTGTTTGTGCCTGCC 60
    18683 Coding 590 CCACAGACAACATCAGTC 61
    18684 Coding 597 CTGGGGACCACAGACAAC 62
    18685 Coding 607 TCAGCCGATCCTGGGGAC 63
    18686 Coding 621 CACCACCAGGGCTCTCAG 64
    18687 Coding 626 GGGATCACCACCAGGGCT 65
    18688 Coding 657 GAGGATGGCAAACAGGAT 66
    18689 Coding 668 ACCAGCACCAAGAGGATG 67
    18690 Coding 679 TTTTGATAAAGACCAGCA 68
    18691 Coding 703 TATTGGTTGGCTTCTTGG 69
    18692 Coding 729 GGGTTCCTGCTTGGGGTG 70
    18693 Coding 750 GTCGGGAAAATTGATCTC 71
    18694 Coding 754 GATCGTCGGGAAAATTGA 72
    18695 Coding 765 GGAGCCAGGAAGATCGTC 73
    18696 Coding 766 TGGAGCCAGGAAGATCGT 74
    18697 Coding 780 TGGAGCAGCAGTGTTGGA 75
    18698 Coding 796 GTAAAGTCTCCTGCACTG 76
    18699 Coding 806 TGGCATCCATGTAAAGTC 77
    18700 Coding 810 CGGTTGGCATCCATGTAA 78
    18701 Coding 834 CTCTTTGCCATCCTCCTG 79
    18702 Coding 861 CTGTCTCTCCTGCACTGA 80
    18703 Stop 873 GGTGCAGCCTCACTGTCT 81
    18704 3′ UTR 910 AACTGCCTGTTTGCCCAC 82
    18705 3′ UTR 954 CTTCTGCCTGCACCCCTG 83
    18706 3′ UTR 976 ACTGACTGGGCATAGCTC 84
  • Example 10 Cell Culture and Oligonucleotide Treatment
  • [0157]
    The effect of antisense compounds on target nucleic acid expression can be tested in any of a variety of cell types provided that the target nucleic acid is present at measurable levels. This can be routinely determined using, for example, PCR or Northern blot analysis. The following four cell types are provided for illustrative purposes, but other cell types can be routinely used.
  • [0158]
    T-24 Cells:
  • [0159]
    The transitional cell bladder carcinoma cell line T-24 was obtained from the American Type Culture Collection (ATCC) (Manassas, Va.). T-24 cells were routinely cultured in complete McCoy's 5A basal media (Gibco/Life Technologies, Gaithersburg, Md.) supplemented with 10% fetal calf serum (Gibco/Life Technologies, Gaithersburg, Md.), penicillin 100 units per mL, and streptomycin 100 micrograms per mL (Gibco/Life Technologies, Gaithersburg, Md.). Cells were routinely passaged by trypsinization and dilution when they reached 90% confluence. Cells were seeded into 96-well plates (Falcon-Primaria #3872) at a density of 7000 cells/well for use in real-time quantitative polymerase chain reaction (PCR).
  • [0160]
    For Northern blotting or other analysis, cells may be seeded onto 100 mm or other standard tissue culture plates and treated similarly, using appropriate volumes of medium and oligonucleotide.
  • [0161]
    A549 cells:
  • [0162]
    The human lung carcinoma cell line A549 was obtained from the American Type Culture Collection (ATCC) (Manassas, Va.). A549 cells were routinely cultured in DMEM basal media (Gibco/Life Technologies, Gaithersburg, Md.) supplemented with 10% fetal calf serum (Gibco/Life Technologies, Gaithersburg, Md.), penicillin 100 units per mL, and streptomycin 100 μg/mL (Gibco/Life Technologies, Gaithersburg, Md.). Cells were routinely passaged by trysinization and dilution when they reached 90% confluence.
  • NHDF Cells:
  • [0163]
    Human neonatal dermal fibroblast (NHDF)cells were obtained from the Clonetics Corporation (Walkersville, Md.). NHDFs were routinely maintained in Fibroblast Growth Medium (Clonetics Corporation, Walkersville, Md.) as recommended by the supplier. Cells were maintained for up to 10 passages as recommended by the supplier.
  • [0164]
    HEK Cells:
  • [0165]
    Human embryonic keratinocytes (HEK) were obtained from the Clonetics Corporation (Walkersville, Md.). HEKs were routinely maintained in Keratinocyte Growth Medium (Clonetics Corporation, Walkersville, Md.) formulated as recommended by the supplier. Cell were routinely maintained for up to 10 passages as recommended by the supplier.
  • [0166]
    Treatment with Antisense Compounds:
  • [0167]
    When cells reached 80% confluency, they were treated with oligonucleotide. For cells grown in 96-well plates, wells were washed once with 200 μl Opti-MEM™-1 reduced-serum medium (Gibco BRL) and then treated with 130 μl of Opti-MEM™-1 containing 3.75 μg/mL LIPOFECTIN™ (Gibco BRL) and the desired oligonucleotide at a final concentration of 150 nM. After 4 hours of treatment, the medium was replaced with fresh medium. Cells were harvested 16 hours after oligonucleotide treatment.
  • Example 11 Analysis of Oligonucleotide Inhibition of CD40 Expression
  • [0168]
    Antisense modulation of CD40 expression can be assayed in a variety of ways known in the art. For example, CD40 mRNA levels can be quantitated by, e.g., Northern blot analysis, competitive PCR, or real-time PCR. Real-time quantitative PCR is presently preferred. RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. For real-time quantitative PCR, poly(A)+ mRNA is preferred. Methods of RNA isolation are taught in, for example, Ausubel, F. M. et al., Current Protocols in Molecular Biology, Volume 1, pp.4.1.1-4.2.9 and 4.5.1-4.5.3, John Wiley & Sons, Inc., (1993). Northern blot analysis is routine in the art and is taught in, for example, Ausubel, F. M. et al., Current Protocols in Molecular Biology, Volume 1, pp. 4.2.1-4.2.9, John Wiley & Sons, Inc., (1996). Real-time quantitative polymerase chain reaction (PCR) can be conveniently accomplished using the commercially available ABI PRISM™ 7700 Sequence Detection System, available from PE-Applied Biosystems, Foster City, Calif. and used according to manufacturer's instructions. Other methods of PCR are also known in the art.
  • [0169]
    CD40 protein levels can be quantitated in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), ELISA or fluorescence-activated cell sorting (FACS). Antibodies directed to CD40 can be identified and obtained from a variety of sources, such as those identified in the MSRS catalog of antibodies, (Aerie Corporation, Birmingham, Mich. or via the internet at, or can be prepared via conventional antibody generation methods. Methods for preparation of polyclonal antisera are taught in, for example, Ausubel, F. M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 11.12.1-11.12.9, John Wiley & Sons, Inc., (1997). Preparation of monoclonal antibodies is taught in, for example, Ausubel, F. M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 11.4.1-11.11.5, John Wiley & Sons, Inc., (1997)
  • [0170]
    Immunoprecipitation methods are standard in the art and can be found at, for example, Ausubel, F. M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 10.16.1-10.16.11, John Wiley & Sons, Inc., (1998). Western blot (immunoblot) analysis is standard in the art and can be found at, for example, Ausubel, F. M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 10.8.1-10.8.21, John Wiley & Sons, Inc., (1997). Enzyme-linked immunosorbent assays (ELISA) are standard in the art and can be found at, for example, Ausubel, F. M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 11.2.1-11.2.22, John Wiley & Sons, Inc., (1991).
  • Example 12 Poly(A)+ mRNA Isolation
  • [0171]
    Poly(A)+ mRNA was isolated according to Miura et al., Clin. Chem., 42, 1758 (1996). Other methods for poly(A)+ mRNA isolation are taught in, for example, Ausubel, F. M. et al., Current Protocols in Molecular Biology, Volume 1, pp. 4.5.1-4.5.3, John Wiley & Sons, Inc., (1993). Briefly, for cells grown on 96-well plates, growth medium was removed from the cells and each well was washed with 200 μl cold PBS. 60 μl lysis buffer (10 mM Tris-HCl, pH 7.6, 1 mM EDTA, 0.5 M NaCl, 0.5% NP-40, 20 mM vanadyl-ribonucleoside complex) was added to each well, the plate was gently agitated and then incubated at room temperature for five minutes. 55 μl of lysate was transferred to Oligo d(T) coated 96-well plates (AGCT Inc., Irvine Calif.). Plates were incubated for 60 minutes at room temperature, washed 3 times with 200 μl of wash buffer (10 mM Tris-HCl pH 7.6, 1 mM EDTA, 0.3 M NaCl). After the final wash, the plate was blotted on paper towels to remove excess wash buffer and then air-dried for 5 minutes. 60 μl of elution buffer (5 mM Tris-HCl pH 7.6), preheated to 70° C. was added to each well, the plate was incubated on a 90° hot plate for 5 minutes, and the eluate was then transferred to a fresh 96-well plate.
  • [0172]
    Cells grown on 100 mm or other standard plates may be treated similarly, using appropriate volumes of all solutions.
  • Example 13 Northern Blot Analysis of CD40 mRNA Levels
  • [0173]
    Eighteen hours after oligonucleotide treatment monolayers were washed twice with cold PBS and lysed in 0.5 mL RNAzo™ (TEL-TEST “B” Inc., Friendswood, Tex.). Total RNA was prepared following manufacturer's recommended protocols. Approximately ten μg of total RNA was fractionated by electrophoresis through 1.2% agarose gels containing 1.1% formaldehyde using a MOPS buffer system (Life Technologies, Inc., Rockville, Md.). RNA was transferred from the gel to Hybond™−N+ nylon membranes (Amersham Pharmacia Biotech, Piscataway, N.J.) by overnight capillary transfer using a Northern/Southern Transfer buffer system (TEL-TEST “B” Inc., Friendswood, Tex.). RNA transfer was confirmed by UV visualization. Membranes were fixed by UV cross-linking using a Stratalinker™ UV Crosslinker 2400 (Stratagene, Inc, La Jolla, Calif.).
  • [0174]
    Membranes were probed using QuickHyb™ hybridization solution (Stratagene, La Jolla, Calif.) using manufacturer's recommendations for stringent conditions with a CD40 specific probe prepared by PCR using the forward primer CAGAGTTCACTGAAACGGAATGC (SEQ ID No. 86) and the reverse primer GGTGGCAGTGTGTCTCTCTGTTC (SEQ ID No. 87). To normalize for variations in loading and transfer efficiency membranes were stripped and probed for glyceraldehyde-3-phosphate dehydrogenase (G3PDH) RNA (Clontech, Palo Alto, Calif.). Hybridized membranes were visualized and quantitated using a PhosphorImager™ and ImageQuant Software V3.3 (Molecular Dynamics, Sunnyvale, Calif.). Data was normalized to G3PDH levels in untreated controls.
  • Example 14 Real-time Quantitative PCR Analysis of CD40 mRNA Levels
  • [0175]
    Quantitation of CD40 mRNA levels was conducted by real-time quantitative PCR using the ABI PRISM™ 7700 Sequence Detection System (PE-Applied Biosystems, Foster City, Calif.) according to manufacturer's instructions. This is a closed-tube, non-gel-based, fluorescence detection system which allows high-throughput quantitation of polymerase chain reaction (PCR) products in real-time. As opposed to standard PCR, in which amplification products are quantitated after the PCR is completed, products in real-time quantitative PCR are quantitated as they accumulate. This is accomplished by including in the PCR reaction an oligonucleotide probe that anneals specifically between the forward and reverse PCR primers, and contains two fluorescent dyes. A reporter dye (e.g., JOE or FAM, PE-Applied Biosystems, Foster City, Calif.) is attached to the 5′ end of the probe and a quencher dye (e.g., TAMRA, PE-Applied Biosystems, Foster City, Calif.) is attached to the 3′ end of the probe. When the probe and dyes are intact, reporter dye emission is quenched by the proximity of the 3′ quencher dye. During amplification, annealing of the probe to the target sequence creates a substrate that can be cleaved by the 5′-exonuclease activity of Taq polymerase. During the extension phase of the PCR amplification cycle, cleavage of the probe by Taq polymerase releases the reporter dye from the remainder of the probe (and hence from the quencher moiety) and a sequence-specific fluorescent signal is generated. With each cycle, additional reporter dye molecules are cleaved from their respective probes, and the fluorescence intensity is monitored at regular (six-second) intervals by laser optics built into the ABI PRISMS™ 7700 Sequence Detection System. In each assay, a series of parallel reactions containing serial dilutions of mRNA from untreated control samples generates a standard curve that is used to quantitate the percent inhibition after antisense oligonucleotide treatment of test samples.
  • [0176]
    PCR reagents were obtained from PE-Applied Biosystems, Foster City, Calif. Reverse transcriptase PCR reactions were carried out by adding 25 μl PCR cocktail (1× Taqman™ buffer A, 5.5 mM MgCl2, 300 μM each of dATP, dCTP and dGTP, 600 μM of dUTP, 100 nM each of forward primer, reverse primer, and probe, 20 units RNAse inhibitor, 1.25 units AmpliTaq Gold™, and 12.5 units Moloney Murine Leukemia Virus (MuLV) Reverse Transcriptase to 96 well plates containing 25 μl poly(A) mRNA solution. The RT reaction was carried out by incubation for 30 minutes at 48° C. following a 10 minute incubation at 95° C. to activate the AmpliTaq Gold™, 40 cycles of a two-step PCR protocol were carried out: 95° C. for 15 seconds (denaturation) followed by 60° C. for one minute (annealing/extension).
  • [0177]
    For CD40, the PCR primers were: forward primer: CAGAGTTCACTGAAACGGAATGC (SEQ ID No. 86) reverse primer: GGTGGCAGTGTGTCTCTCTGTTC (SEQ ID No. 87) and the PCR probe was: FAM-TTCCTTGCGGTGAAAGCGAATTCCT-TAMRA (SEQ ID No. 88) where FAM (PE-Applied Biosystems, Foster City, Calif.) is the fluorescent reporter dye) and TAMRA (PE-Applied Biosystems, Foster City, Calif.) is the quencher dye.
  • [0178]
    For GAPDH the PCR primers were: forward primer: GAAGGTGAAGGTCGGAGTC (SEQ ID No. 89) reverse primer: GAAGATGGTGATGGGATTTC (SEQ ID No. 90) and the PCR probe was: 5′ JOE-CAAGCTTCCCGTTCTCAGCC-TAMRA 3′ (SEQ ID No. 91) where JOE (PE-Applied Biosystems, Foster City, Calif.) is the fluorescent reporter dye) and TAMRA (PE-Applied Biosystems, Foster City, Calif.) is the quencher dye.
  • Example 15 Western Blot Analysis of CD40 Protein Levels
  • [0179]
    Western blot analysis (immunoblot analysis) is carried out using standard methods. Cells are harvested 16-20 hr after oligonucleotide treatment, washed once with PBS, suspended in Laemmli buffer (100 μl/well), boiled for 5 minutes and loaded on a 16% SDS-PAGE gel. Gels are run for 1.5 hours at 150 V, and transferred to membrane for western blotting. Appropriate primary antibody directed to CD40 is used, with a radiolabelled or fluorescently labeled secondary antibody directed against the primary antibody species. Bands are visualized using a PhosphorImager™ (Molecular Dynamics, Sunnyvale Calif.).
  • Example 16 Antisense Inhibition of CD40 Expression by Phosphorothioate Oligodeoxynucleotides
  • [0180]
    In accordance with the present invention, a series of oligonucleotides were designed to target different regions of the human CD40 mRNA, using published sequences [Stamenkovic et al., EMBO J., 8, 1403 (1989); GenBank accession number X60592, incorporated herein as SEQ ID NO: 85]. The oligonucleotides are shown in Table 2. Target sites are indicated by the 5′ most nucleotide to which the oligonucleotide hybridizes on the CD40 mRNA sequence. Nucleotide numbers are as given in the sequence source reference (Genbank accession no. X60592, incorporated herein as SEQ ID NO: 85). All compounds in Table 2 are oligodeoxynucleotides with phosphorothioate backbones (internucleoside linkages) throughout. The compounds were analyzed for effect on CD40 mRNA levels by real-time PCR quantitation of RNA as described in Example 14. Data are averages from three experiments.
    TABLE 2
    Inhibition of CD40 mRNA levels by
    phosphorothioate oligodeoxynucleotides
    18623 5′ UTR 18 CCAGGCGGCAGGACCACT 30.71 1
    18624 5′ UTR 20 GACCAGGCGGCAGGACCA 28.09 2
    18625 5′ UTR 26 AGGTGAGACCAGGCGGCA 21.89 3
    18626 AUG 48 CAGAGGCAGACGAACCAT 0.00 4
    18627 Coding 49 GCAGAGGCAGACGAACCA 0.00 5
    18628 Coding 73 GCAAGCAGCCCCAGAGGA 0.00 6
    18629 Coding 78 GGTCAGCAAGCAGCCCCA 29.96 7
    18630 Coding 84 GACAGCGGTCAGCAAGCA 0.00 8
    18631 Coding 88 GATGGACAGCGGTCAGCA 0.00 9
    18632 Coding 92 TCTGGATGGACAGCGGTC 0.00 10
    18633 Coding 98 GGTGGTTCTGGATGGACA 0.00 11
    18634 Coding 101 GTGGGTGGTTCTGGATGG 0.00 12
    18635 Coding 104 GCAGTGGGTGGTTCTGGA 0.00 13
    18636 Coding 152 CACAAAGAACAGCACTGA 0.00 14
    18637 Coding 156 CTGGCACAAAGAACAGCA 0.00 15
    18638 Coding 162 TCCTGGCTGGCACAAAGA 0.00 16
    18639 Coding 165 CTGTCCTGGCTGGCACAA 4.99 17
    18640 Coding 176 CTCACCAGTTTCTGTCCT 0.00 18
    18641 Coding 179 TCACTCACCAGTTTCTGT 0.00 19
    18642 Coding 185 GTGCAGTCACTCACCAGT 0.00 20
    18643 Coding 190 ACTCTGTGCAGTCACTCA 0.00 21
    18644 Coding 196 CAGTGAACTCTGTGCAGT 5.30 22
    18645 Coding 205 ATTCCGTTTCAGTGAACT 0.00 23
    18646 Coding 211 GAAGGCATTCCGTTTCAG 9.00 24
    18647 Coding 222 TTCACCGCAAGGAAGGCA 0.00 25
    18648 Coding 250 CTCTGTTCCAGGTGTCTA 0.00 26
    18649 Coding 267 CTGGTGGCAGTGTGTCTC 0.00 27
    18650 Coding 286 TGGGGTCGCAGTATTTGT 0.00 28
    18651 Coding 289 GGTTGGGGTCGCAGTATT 0.00 29
    18652 Coding 292 CTAGGTTGGGGTCGCAGT 0.00 30
    18653 Coding 318 GGTGCCCTTCTGCTGGAC 19.67 31
    18654 Coding 322 CTGAGGTGCCCTTCTGCT 15.63 32
    18655 Coding 332 GTGTCTGTTTCTGAGGTG 0.00 33
    18656 Coding 334 TGGTGTCTGTTTCTGAGG 0.00 34
    18657 Coding 345 ACAGGTGCAGATGGTGTC 0.00 35
    18658 Coding 348 TTCACAGGTGCAGATGGT 0.00 36
    18659 Coding 360 GTGCCAGCCTTCTTCACA 5.67 37
    18660 Coding 364 TACAGTGCCAGCCTTCTT 7.80 38
    18661 Coding 391 GGACACAGCTCTCACAGG 0.00 39
    18662 Coding 395 TGCAGGACACAGCTCTCA 0.00 40
    18663 Coding 401 GAGCGGTGCAGGACACAG 0.00 41
    18664 Coding 416 AAGCCGGGCGAGCATGAG 0.00 42
    18665 Coding 432 AATCTGCTTGACCCCAAA 5.59 43
    18666 Coding 446 GAAACCCCTGTAGCAATC 0.10 44
    18667 Coding 452 GTATCAGAAACCCCTGTA 0.00 45
    18668 Coding 463 GCTCGCAGATGGTATCAG 0.00 46
    18669 Coding 468 GCAGGGCTCGCAGATGGT 34.05 47
    18670 Coding 471 TGGGCAGGGCTCGCAGAT 0.00 48
    18671 Coding 474 GACTGGGCAGGGCTCGCA 2.71 49
    18672 Coding 490 CATTGGAGAAGAAGCCGA 0.00 50
    18673 Coding 497 GATGACACATTGGAGAAG 0.00 51
    18674 Coding 500 GCAGATGACACATTGGAG 0.00 52
    18675 Coding 506 TCGAAAGCAGATGACACA 0.00 53
    18676 Coding 524 GTCCAAGGGTGACATTTT 8.01 54
    18677 Coding 532 CACAGCTTGTCCAAGGGT 0.00 55
    18678 Coding 539 TTGGTCTCACAGCTTGTC 0.00 56
    18679 Coding 546 CAGGTCTTTGGTCTCACA 6.98 57
    18680 Coding 558 CTGTTGCACAACCAGGTC 18.76 58
    18681 Coding 570 GTTTGTGCCTGCCTGTTG 2.43 59
    18682 Coding 575 GTCTTGTTTGTGCCTGCC 0.00 60
    18683 Coding 590 CCACAGACAACATCAGTC 0.00 61
    18684 Coding 597 CTGGGGACCACAGACAAC 0.00 62
    18685 Coding 607 TCAGCCGATCCTGGGGAC 0.00 63
    18686 Coding 621 CACCACCAGGGCTCTCAG 23.31 64
    18687 Coding 626 GGGATCACCACCAGGGCT 0.00 65
    18688 Coding 657 GAGGATGGCAAACAGGAT 0.00 66
    18689 Coding 668 ACCAGCACCAAGAGGATG 0.00 67
    18690 Coding 679 TTTTGATAAAGACCAGCA 0.00 68
    18691 Coding 703 TATTGGTTGGCTTCTTGG 0.00 69
    18692 Coding 729 GGGTTCCTGCTTGGGGTG 0.00 70
    18693 Coding 750 GTCGGGAAAATTGATCTC 0.00 71
    18694 Coding 754 GATCGTCGGGAAAATTGA 0.00 72
    18695 Coding 765 GGAGCCAGGAAGATCGTC 0.00 73
    18696 Coding 766 TGGAGCCAGGAAGATCGT 0.00 74
    18697 Coding 780 TGGAGCAGCAGTGTTGGA 0.00 75
    18698 Coding 796 GTAAAGTCTCCTGCACTG 0.00 76
    18699 Coding 806 TGGCATCCATGTAAAGTC 0.00 77
    18700 Coding 810 CGGTTGGCATCCATGTAA 0.00 78
    18701 Coding 834 CTCTTTGCCATCCTCCTG 4.38 79
    18702 Coding 861 CTGTCTCTCCTGCACTGA 0.00 80
    18703 Stop 873 GGTGCAGCCTCACTGTCT 0.00 81
    18704 3′ UTR 910 AACTGCCTGTTTGCCCAC 33.89 82
    18705 3′ UTR 954 CTTCTGCCTGCACCCCTG 0.00 83
    18706 3′ UTR 976 ACTGACTGGGCATAGCTC 0.00 84
  • [0181]
    As shown in Table 2, SEQ ID NOs 1, 2, 7, 47 and 82 demonstrated at least 25% inhibition of CD40 expression in this assay and are therefore preferred.
  • Example 17 Antisense Inhibition of CD40 Expression by Phosphorothioate 2′-MOE Gapmer Oligonucleotides
  • [0182]
    In accordance with the present invention, a second series of oligonucleotides targeted to human CD40 were synthesized. The oligonucleotides are shown in Table 3. Target sites are indicated by nucleotide numbers, as given in the sequence source reference (Stamenkovic et al., EMBO J., 8, 1403 (1989); Genbank accession no. X60592), to which the oligonucleotide binds.
  • [0183]
    All compounds in Table 3 are chimeric oligonucleotides (“gapmers”) 18 nucleotides in length, composed of a central “gap” region consisting of ten 2′-deoxynucleotides, which is flanked on both sides (5′ and 3′ directions) by four-nucleotide “wings.” The wings are composed of 2′-methoxyethyl(2′-MOE)nucleotides. The internucleoside (backbone) linkages are phosphorothioate (P═S) throughout the oligonucleotide. Cytidine residues in the 2′-MOE wings are 5-methylcytidines.
  • [0184]
    Data were obtained by real-time quantitative PCR as described in Example 14 and are averaged from three experiments. “ND” indicates a value was not determined.
    TABLE 3
    Inhibition of CD40 mRNA levels by chimeric
    phosphorothioate oligonucleotides having
    2′-MOE wings and a deoxy gap
    19211 5′ UTR 18 CCAGGCGGCAGGACCACT 75.71 1
    19212 5′ UTR 20 GACCAGGCGGCAGGACCA 77.23 2
    19213 5′ UTR 26 AGGTGAGACCAGGCGGCA 80.82 3
    19214 AUG 48 CAGAGGCAGACGAACCAT 23.68 4
    19215 Coding 49 GCAGAGGCAGACGAACCA 45.97 5
    19216 Coding 73 GCAAGCAGCCCCAGAGGA 65.80 6
    19217 Coding 78 GGTCAGCAAGCAGCCCCA 74.73 7
    19218 Coding 84 GACAGCGGTCAGCAAGCA 67.21 8
    19219 Coding 88 GATGGACAGCGGTCAGCA 65.14 9
    19220 Coding 92 TCTGGATGGACAGCGGTC 78.71 10
    19221 Coding 98 GGTGGTTCTGGATGGACA 81.33 11
    19222 Coding 101 GTGGGTGGTTCTGGATGG 57.79 12
    19223 Coding 104 GCAGTGGGTGGTTCTGGA 73.70 13
    19224 Coding 152 CACAAAGAACAGCACTGA 40.25 14
    19225 Coding 156 CTGGCACAAAGAACAGCA 60.11 15
    19226 Coding 162 TCCTGGCTGGCACAAAGA 10.18 16
    19227 Coding 165 CTGTCCTGGCTGGCACAA 24.37 17
    19228 Coding 176 CTCACCAGTTTCTGTCCT 22.30 18
    19229 Coding 179 TCACTCACCAGTTTCTGT 40.64 19
    19230 Coding 185 GTGCAGTCACTCACCAGT 82.04 20
    19231 Coding 190 ACTCTGTGCAGTCACTCA 37.59 21
    19232 Coding 196 CAGTGAACTCTGTGCAGT 40.26 22
    19233 Coding 205 ATTCCGTTTCAGTGAACT 56.03 23
    19234 Coding 211 GAAGGCATTCCGTTTCAG 32.21 24
    19235 Coding 222 TTCACCGCAAGGAAGGCA 61.03 25
    19236 Coding 250 CTCTGTTCCAGGTGTCTA 62.19 26
    19237 Coding 267 CTGGTGGCAGTGTGTCTC 70.32 27
    19238 Coding 286 TGGGGTCGCAGTATTTGT 0.00 28
    19239 Coding 289 GGTTGGGGTCGCAGTATT 19.40 29
    19240 Coding 292 CTAGGTTGGGGTCGCAGT 36.32 30
    19241 Coding 318 GGTGCCCTTCTGCTGGAC 78.91 31
    19242 Coding 322 CTGAGGTGCCCTTCTGCT 69.84 32
    19243 Coding 332 GTGTCTGTTTCTGAGGTG 63.32 33
    19244 Coding 334 TGGTGTCTGTTTCTGAGG 42.83 34
    19245 Coding 345 ACAGGTGCAGATGGTGTC 73.31 35
    19246 Coding 348 TTCACAGGTGCAGATGGT 47.72 36
    19247 Coding 360 GTGCCAGCCTTCTTCACA 61.32 37
    19248 Coding 364 TACAGTGCCAGCCTTCTT 46.82 38
    19249 Coding 391 GGACACAGCTCTCACAGG 0.00 39
    19250 Coding 395 TGCAGGACACAGCTCTCA 52.05 40
    19251 Coding 401 GAGCGGTGCAGGACACAG 50.15 41
    19252 Coding 416 AAGCCGGGCGAGCATGAG 32.36 42
    19253 Coding 432 AATCTGCTTGACCCCAAA 0.00 43
    19254 Coding 446 GAAACCCCTGTAGCAATC 0.00 44
    19255 Coding 452 GTATCAGAAACCCCTGTA 36.13 45
    19256 Coding 463 GCTCGCAGATGGTATCAG 64.65 46
    19257 Coding 468 GCAGGGCTCGCAGATGGT 74.95 47
    19258 Coding 471 TGGGCAGGGCTCGCAGAT 0.00 48
    19259 Coding 474 GACTGGGCAGGGCTCGCA 82.00 49
    19260 Coding 490 CATTGGAGAAGAAGCCGA 41.31 50
    19261 Coding 497 GATGACACATTGGAGAAG 13.81 51
    19262 Coding 500 GCAGATGACACATTGGAG 78.48 52
    19263 Coding 506 TCGAAAGCAGATGACACA 59.28 53
    19264 Coding 524 GTCCAAGGGTGACATTTT 70.99 54
    19265 Coding 532 CACAGCTTGTCCAAGGGT 0.00 55
    19266 Coding 539 TTGGTCTCACAGCTTGTC 45.92 56
    19267 Coding 546 CAGGTCTTTGGTCTCACA 63.95 57
    19268 Coding 558 CTGTTGCACAACCAGGTC 82.32 58
    19269 Coding 570 GTTTGTGCCTGCCTGTTG 70.10 59
    19270 Coding 575 GTCTTGTTTGTGCCTGCC 68.95 60
    19271 Coding 590 CCACAGACAACATCAGTC 11.22 61
    19272 Coding 597 CTGGGGACCACAGACAAC 9.04 62
    19273 Coding 607 TCAGCCGATCCTGGGGAC 0.00 63
    19274 Coding 621 CACCACCAGGGCTCTCAG 23.08 64
    19275 Coding 626 GGGATCACCACCAGGGCT 57.94 65
    19276 Coding 657 GAGGATGGCAAACAGGAT 49.14 66
    19277 Coding 668 ACCAGCACCAAGAGGATG ND 67
    19278 Coding 679 TTTTGATAAAGACCAGCA 30.58 68
    19279 Coding 703 TATTGGTTGGCTTCTTGG 49.26 69
    19280 Coding 729 GGGTTCCTGCTTGGGGTG 13.95 70
    19281 Coding 750 GTCGGGAAAATTGATCTC 54.78 71
    19282 Coding 754 GATCGTCGGGAAAATTGA 0.00 72
    19283 Coding 765 GGAGCCAGGAAGATCGTC 69.47 73
    19284 Coding 766 TGGAGCCAGGAAGATCGT 54.48 74
    19285 Coding 780 TGGAGCAGCAGTGTTGGA 15.17 75
    19286 Coding 796 GTAAAGTCTCCTGCACTG 30.62 76
    19287 Coding 806 TGGCATCCATGTAAAGTC 65.03 77
    19288 Coding 810 CGGTTGGCATCCATGTAA 34.49 78
    19289 Coding 834 CTCTTTGCCATCCTCCTG 41.84 79
    19290 Coding 861 CTGTCTCTCCTGCACTGA 25.68 80
    19291 Stop 873 GGTGCAGCCTCACTGTCT 76.27 81
    19292 3′ UTR 910 AACTGCCTGTTTGCCCAC 63.34 82
    19293 3′ UTR 954 CTTCTGCCTGCACCCCTG 0.00 83
    19294 3′ UTR 976 ACTGACTGGGCATAGCTC 11.55 84
  • [0185]
    As shown in Table 3, SEQ ID NO: 1, 2, 3, 6, 7, 8, 9, 10, 11, 12, 13, 15, 20, 23, 25, 26, 27, 31, 32, 33, 35, 37, 40, 41, 46, 47, 49, 52, 53, 54, 57, 58, 59, 60, 65, 71, 73, 74, 77, 81 and 82 demonstrated at least 50% inhibition of CD40 expression in this experiment and are therefore preferred.
  • Example 18: Correlation of Quantitative Real-time PCR Measurements of RNA Levels with Northern Analysis of RNA Levels
  • [0186]
    The reduction of CD40 mRNA levels by the oligonucleotide compounds in Tables 2 and 3 was also demonstrated by Northern blot analysis of CD40 mRNA from oligonucleotide treated cells, as described in Example 13. The RNA measurements made by Northern analysis were compared to the RNA measurements obtained using quantitative real-time PCR, using averaged data from three experiments in each case.
  • [0187]
    When the phosphorothioate oligodeoxynucleotides shown in Table 2 were tested by Northern blot analysis, SEQ ID Nos 1, 2, 3, 7, 25, 31, 32, 37, 43, 47, 58, 64 and 82 were determined to reduce CD40 mRNA levels by at least 75% and are therefore preferred. Of these, SEQ ID Nos 1, 64 and 82 reduced CD40 mRNA levels by at least 80%.
  • [0188]
    The correlation coefficient for the results of quantitative real-time PCR vs. Northern blot analysis for the phosphorothioate oligodeoxynucleotides was found to be 0.67.
  • [0189]
    When the phosphorothioate 2′-MOE chimeric oligonucleotides shown in Table 3 were tested by Northern blot analysis, SEQ ID Nos 1, 2, 3, 5, 7, 10, 20, 25, 26, 27, 31, 32, 33, 35, 37, 40, 46, 47, 49, 52, 54, 58, 59, 60, 73, 81 and 82 were determined to reduce CD40 mRNA levels by at least 90% and are therefore preferred. Of these, SEQ ID Nos 1, 2, 20, 31 and 58 reduced CD40 mRNA levels by at least 95%.
  • [0190]
    The correlation coefficient for quantitative real-time PCR vs Northern blot results for the phosphorothioate 2′-MOE chimeric oligonucleotides was 0.78.
  • EXAMPLE 19 Oligonucleotide-Sensitive Sites of the CD40 Target Nucleic Acid
  • [0191]
    As the data presented in the preceding examples shows, several sequences were present in preferred compounds of two distinct oligonucleotide chemistries. Specifically, compounds having SEQ ID NOS: 1, 2, 7, 47 and 82 are preferred in both instances. These compounds are believed to define accessible sites of the target nucleic acid to various antisense compositions and are therefore preferred. For example, SEQ ID NOS: 1 and 2 overlap each other and both map to the 5-untranslated region (5′-UTR) of CD40. Accordingly, this region of CD40 is particularly preferred for modulation via sequence-based technologies. Similarly, SEQ ID NOS: 7 and 47 map to the open reading frame of CD40, whereas SEQ ID NO: 82 maps to the 3′-untranslated region (3′-UTR). Thus, the ORF and 3′-UTR of CD40 may be targeted by sequence-based technologies as well.
  • [0192]
    It has been shown, furthermore, that certain target sequences on the CD40 mRNA are particularly suitable to antisense targeting. The reverse complements of the active CD40 compounds, e.g., the sequence on the CD40 nucleic acid target to which the active antisense compounds are complementary, are easily determined by those skilled in the art and may be assembled to yield nucleotide sequences corresponding to favorable sites on the target nucleic acid. For example, when the antisense sequences shown in Tables 1-3 were mapped onto the CD40 mRNA sequence [Stamenkovic et al., EMBO J., 8, 1403 (1989); GenBank accession number X60592], in some instances it was found in some cases that all the oligonucleotides targeted to a particular sequence region of CD40 (usually called a “footprint”) were active. Therefore, this footprint region is particularly preferred for antisense targeting, and oligonucleotide sequences hybridizable to this footprint are preferred compounds of the invention. A library of this information is compiled and may be used by those skilled in the art in a variety of sequence-based technologies to study the molecular and biological functions of CD40 and to investigate or confirm its role in various diseases and disorders.
  • [0193]
    An example of such a compilation is shown in Table 4, in which the antisense sequences shown in Tables 1-3 are mapped onto the CD40 mRNA sequence [Stamenkovic et al., EMBO J., 8, 1403 (1989); GenBank accession number X60592]. The antisense sequences (SEQ ID NO: 1, 2, 3, 6, 7, 8, 9, 10, 11, 12, 13, 15, 20, 23, 25, 26, 27, 31, 32, 33, 35, 37, 40, 41, 46, 47, 49, 52, 53, 54, 57, 58, 59, 60, 65, 71, 73, 74, 77, 81 and 82) which were determined by real-time quantitative PCR assay to be active as inhibitors of CD40 are shown in bold. Examples of “footprint” sequences on the CD40 mRNA sequence to which a series of active oligonucleotides bind are also shown in bold. These “footprint” sequences and antisense compounds binding to them (including those not shown herein) are preferred for targeting.
    TABLE 4
    CD40 Antisense Sequence Alignment
    SEQ ID
    NO: 1            15 16           30 31           45 46           60 61           75 76           90
     9 --------------- --------------- --------------- --------------- --------------- ------------TGC
     8 --------------- --------------- --------------- --------------- --------------- --------TGCTTGC
     7 --------------- --------------- --------------- --------------- --------------- --TGGGGCTGCTTGC
     6 --------------- --------------- --------------- --------------- ------------TCC TCTCGGGCTGCTTGC
     5 --------------- --------------- --------------- ---TGGTTCGTCTGC CTCTGC--------- ---------------
     4 --------------- --------------- --------------- --ATGGTTCGTCTGC CTCTG---------- ---------------
     3 --------------- ----------TGCCG CCTGGTCTCACCT-- --------------- --------------- ---------------
     2 --------------- ----TGGTCCTGCCG CCTGGTC-------- --------------- --------------- ---------------
     1 --------------- --AGTGGTCCTGCCG CCTGG---------- --------------- --------------- ---------------
    91          105 106         120 121         135 136         150 151         165 166         180
    19 --------------- --------------- --------------- --------------- --------------- -------------AC
    18 --------------- --------------- --------------- --------------- --------------- ----------AGGAC
    17 --------------- --------------- --------------- --------------- --------------T TGTGCCAGCCAGGAC
    16 --------------- --------------- --------------- --------------- -----------TCTT TGTGCCAGCCAGGA-
    15 --------------- --------------- --------------- --------------- -----TGCTGTTCTT TGTGCCAG-------
    14 --------------- --------------- --------------- --------------- -TCAGTGCTGTTCTT TGTG-----------
    13 -------------TC CAGAACCACCCACTG C-------------- --------------- --------------- ---------------
    12 ----------CCATC CAGAACCACCCAC-- --------------- --------------- --------------- ---------------
    11 -------TGTCCATC CAGAACCACC----- --------------- --------------- --------------- ---------------
    10 -GACCGCTGTCCATC CAGA----------- --------------- --------------- --------------- ---------------
     9 TGACCGCTGTCCATC --------------- --------------- --------------- --------------- ---------------
     8 TGACCGCTGTC---- --------------- --------------- --------------- --------------- ---------------
     7 TGACC---------- --------------- --------------- --------------- --------------- ---------------
    181         195 196         210 211         225 226         240 241         255 256         270
    27 --------------- --------------- --------------- --------------- --------------- -----------GAGA
    26 --------------- --------------- --------------- --------------- ---------TAGACA CCTGGAACAGAG---
    25 --------------- --------------- -----------TGCC TTCCTTGCGGTGAA- --------------- ---------------
    24 --------------- --------------- CTGAAACGGAATGCC TTC------------ --------------- ---------------
    23 --------------- ---------AGTTCA CTGAAACGGAAT--- --------------- --------------- ---------------
    22 --------------- ACTGCACAGAGTTCA CTG------------ --------------- --------------- ---------------
    21 ---------TGAGTG ACTGCACAGAGT--- --------------- --------------- --------------- ---------------
    20 ----ACTGGTGAGTG ACTGCAC-------- --------------- --------------- --------------- ---------------
    19 AGAAACTGGTGAGTG A-------------- --------------- --------------- --------------- ---------------
    18 AGAAACTGGTGAG-- --------------- --------------- --------------- --------------- ---------------
    17 AG------------- --------------- --------------- --------------- --------------- ---------------
    271         285 286         300 301         315 316         330 331         345 346         360
    37 --------------- --------------- --------------- --------------- --------------- --------------T
    36 --------------- --------------- --------------- --------------- --------------- --ACCATCTGCACCT
    35 --------------- --------------- --------------- --------------- --------------G ACACCATCTGCACCT
    34 --------------- --------------- --------------- --------------- ---CCTCAGAAACAG ACACCA---------
    33 --------------- --------------- --------------- --------------- -CACCTCAGAAACAG ACAC-----------
    32 --------------- --------------- --------------- ------AGCAGAAGG GCACCTCAG------ ---------------
    31 --------------- --------------- --------------- --GTCCAGCAGAAGG GCACC---------- ---------------
    30 --------------- ------ACTGCGACC CCAACCTAG------ --------------- --------------- ---------------
    29 --------------- ---AATACTGCGACC CCAACC--------- --------------- --------------- ---------------
    28 --------------- ACAAATACTGCGACC CCA------------ --------------- --------------- ---------------
    27 CACACTGCCACCAG- --------------- --------------- --------------- --------------- ---------------
    361         375 376         390 391         405 406         420 421         435 436         450
    44 --------------- --------------- --------------- --------------- --------------- ----------GATTG
    43 --------------- --------------- --------------- --------------- -----------TTTG GGGTCAAGCAGATT-
    42 --------------- --------------- --------------- ----------CTCAT GCTCGCCCGGCTT-- ---------------
    41 --------------- --------------- ----------CTGTG TCCTGCACCGCTC-- --------------- ---------------
    40 --------------- --------------- ----TGAGAGCTGTG TCCTGCA-------- --------------- ---------------
    39 --------------- --------------- CCTGTGAGAGCTGTG TCC------------ --------------- ---------------
    38 ---AAGAAGGCTGGC ACTGTA--------- --------------- --------------- --------------- ---------------
    37 GTGAAGAAGGCTGGC AC------------- --------------- --------------- --------------- ---------------
    36 GTGAA---------- --------------- --------------- --------------- --------------- ---------------
    35 GT------------- --------------- --------------- --------------- --------------- ---------------
    451         465 466         480 481         495 496         510 511         525 526         540
    56 --------------- --------------- --------------- --------------- --------------- -------------GA
    55 --------------- --------------- --------------- --------------- --------------- ------ACCCTTGGA
    54 --------------- --------------- --------------- --------------- -------------AA AATGTCACCCTTGGA
    53 --------------- --------------- --------------- ----------TGTGT CATCTGCTTTCGA-- ---------------
    52 --------------- --------------- --------------- ----CTCCAATGTGT CATCTGC-------- ---------------
    51 --------------- --------------- --------------- -CTTCTCCAATGTGT CATC----------- ---------------
    50 --------------- --------------- ---------TCGGCT TCTTCTCCAATG--- --------------- ---------------
    49 --------------- --------TGCGAGC CCTGCCCAGTC---- --------------- --------------- ---------------
    48 --------------- -----ATCTGCGAGC CCTGCCCA------- --------------- --------------- ---------------
    47 --------------- --ACCATCTGCGAGC CCTGC---------- --------------- --------------- ---------------
    46 ------------CTG ATACCATCTGCGAGC --------------- --------------- --------------- ---------------
    45 -TACAGGGGTTTCTG ATAC----------- --------------- --------------- --------------- ---------------
    44 CTACAGGGGTTTC-- --------------- --------------- --------------- --------------- ---------------
    541         555 556         570 571         585 586         600 601         615 616         630
    65 --------------- --------------- --------------- --------------- --------------- ----------AGCCC
    64 --------------- --------------- --------------- --------------- --------------- -----CTGAGAGCCC
    63 --------------- --------------- --------------- --------------- ------GTCCCCAGG ATCGGCTGA------
    62 --------------- --------------- --------------- -----------GTTG TCTGTGGTCCCCAG- ---------------
    61 --------------- --------------- --------------- ----GACTGATGTTG TCTGTGG-------- ---------------
    60 --------------- --------------- ----GGCAGGCACAA ACAAGAC-------- --------------- ---------------
    59 --------------- --------------C AACAGGCAGGCACAA AC------------- --------------- ---------------
    58 --------------- --GACCTGGTTGTGC AACAG---------- --------------- --------------- ---------------
    57 -----TGTGAGACCA AAGACCTG------- --------------- --------------- --------------- ---------------
    56 CAAGCTGTGAGACCA A-------------- --------------- --------------- --------------- ---------------
    55 CAAGCTGTG------ --------------- --------------- --------------- --------------- ---------------
    54 C-------------- --------------- --------------- --------------- --------------- ---------------
    631         645 646         660 661         675 676         690 691         705 706         720
    69 --------------- --------------- --------------- --------------- ------------CCA AGAAGCCAACCAATA
    68 --------------- --------------- --------------- ---TGCTGGTCTTTA TCAAAA--------- ---------------
    67 --------------- --------------- -------CATCCTCT TGGTGCTGGT----- --------------- ---------------
    66 --------------- -----------ATCC TGTTTGCCATCCTC- --------------- --------------- ---------------
    65 TGGTGGTGATCCC-- --------------- --------------- --------------- --------------- ---------------
    64 TGGTGGTG------- --------------- --------------- --------------- --------------- ---------------
    721         735 736         750 751         765 766         780 781         795 796         810
    78 --------------- --------------- --------------- --------------- --------------- --------------T
    77 --------------- --------------- --------------- --------------- --------------- ----------GACTT
    76 --------------- --------------- --------------- --------------- --------------- CAGTGCAGGAGACTT
    75 --------------- --------------- --------------- --------------T CCAACACTGCTGCTC CA-------------
    74 --------------- --------------- --------------- ACGATCTTCCTGGCT CCA------------ ---------------
    73 --------------- --------------- --------------G ACGATCTTCCTCGCT CC------------- ---------------
    72 --------------- --------------- ---TCAATTTTCCCG ACGATC--------- --------------- ---------------
    71 --------------- --------------G AGATCAATTTTCCCG AC------------- --------------- ---------------
    70 --------CACCCCA AGCAGGAACCC---- --------------- --------------- --------------- ---------------
    811         825 826         840 841         855 856         870 871         885 886         900
    81 --------------- --------------- --------------- --------------- --AGACAGTGAGGCT GCACC----------
    80 --------------- --------------- --------------- -----TCAGTGCAGG AGAGACAG------- ---------------
    79 --------------- --------CAGGAGG ATGGCAAAGAG---- --------------- --------------- ---------------
    78 TACATGGATGCCAAC CG------------- --------------- --------------- --------------- ---------------
    77 TACATGGATGCCA-- --------------- --------------- --------------- --------------- ---------------
    86 TAC------------ --------------- --------------- --------------- --------------- ---------------
    901         915 916         930 931         945 946         960 961         975 976         990
    84 --------------- --------------- --------------- --------------- --------------- GAGCTATGCCCAGTC
    83 --------------- --------------- --------------- --------CAGGGGT GCAGGCAGAAG---- ---------------
    82 ---------GTGGGC AAACAGGCAGTT--- --------------- --------------- --------------- ---------------
    991        1004
    84 AGT------------
  • Example 20 PNA Synthesis
  • [0194]
    Peptide nucleic acids (PNAs) can be prepared in accordance with any of the various procedures referred to in Peptide Nucleic Acids (PNA): Synthesis, Properties and Potential Applications, Bioorganic & Medicinal Chemistry, 1996, 4, 5-23. They may also be prepared in accordance with U.S. Pat. Nos. 5,539,082, 5,700,922, 5,719,262 and 6,395,474, herein incorporated by reference.
  • Method A
  • [0195]
    PNA oligomers are synthesized in 10 μmol scale on a 433A Applied Biosystems Peptide Synthesizer using commercially available t-butyloxycarbonyl/benzyloxycarbonyl (Boc/Cbz)-protected monomers (Applied Biosystems) and synthesis protocols based on previously published procedures. The coupling efficiency is monitored by qualitative Kaisertest.
  • Method B
  • [0196]
    PNA oligomers were synthesized manually using a LabMate 24 parallel synthesizer (Advanced Chemtech) as described for single compound synthesis (Christensen et al, 1995, Koch et al, 1997). Synthesis was performed on solid phase, in 10 μmol scale using a preloaded Boc-Lys(2-Cl-Z)—OH MBHA resin LL (NovaBiochem, 01-64-0006) and commercially available tert-butyloxycarbonyl/benzyloxycarbonyl (Boc/Cbz) protected PNA monomers (Perseptive Biosystems, GEN063010, GEN063011, GEN063012, GEN063013). The MBHA resin was downloaded by preactivition with HBTU (14 eq), N-methyl morpholine (14 eq) and Boc-Lysine (2-Cl-Z)—OH (7 eq) in NMP and loading subsequently determined using standard loading determination via Fmoc measurement (Nova Biochem Catalog, 2003). Completion of coupling was verified by randomized sampling and qualitative Kaiser test. An additional coupling step was included when Kaiser test was non-conclusive. PNAs were deprotected and cleaved in parallel using methods previously applied to single compound synthesis (Christensen et al, 1995; Koch et al, 1997). Purification was performed on a Gilson HPLC system (215 liquid handler, 155 UV/VIS and 321 pump), by reverse phase high performance liquid chromatography (RP-HPLC), using a DELTA PAK (C-18, 15 μm, 300 Å, 300×7.8 mm, 3 mL/min). A linear gradient from solvent A: 0.1% trifluoroacetic acid (Aldrich, T6,220-6) in water to B: 0.1 % trifluoroacetic acid in acetonitrile (Burdick & Jackson, AH015-4) was used as the liquid phase. Purity was determined by analytical HPLC (0.1% trifluoroacetic acid in acetonitrile) and composition confirmed by mass spectrometry. A purity level of greater than 95% was generally accomplished. Samples were lyophilized on a FreezeZone 6 (LABCONCO, equipped with a chamber to accommodate racks).
  • Example 21 Cationic Conjugated PNA Method A
  • [0197]
    PNA-lysine conjugates were synthesized in 10 μmol scale in parallel on a LabMate 24 parallel synthesizer (Advanced Chemtech) using a solid support bound PNA that was synthesized as described above (Christensen et al, 1995, Koch et al, 1997). The quality of the PNA synthesis was checked prior to peptide conjugation by cleavage and QC of a fraction of the PNA from the support. Peptide synthesis was performed by standard solid-phase tert-butoxycarbonyl (Boc) strategy on support bound PNA, leading to lysine conjugation at the N-terminal end of the PNA. In addition to the N-terminal cationic conjugate each PNA also may contain one or more amino acids, as for example a further lysine unit, at the C-terminus due to the fact that synthesis is performed on Boc-Lys(Z-Cl-Z)OH MBHA resin. The PNA-peptide constructs were synthesized, deprotected and cleaved in parallel. Purification was performed by reversed phase high performance liquid chromatography (RP-HPLC). Purity and composition were determined/confirmed by electrospray ionization mass spectrometry. Synthesis on a 10 μmol scale typically yields>20 mg of PNA oligomer with a purity level of greater than 95%. Samples were lyophilized on a FreezeZone 6 (LABCONCO, equipped with a chamber to accommodate racks).
  • Method B
  • [0198]
    The PNA part of the conjugates is assembled using an automated 433 A peptide synthesizer (Applied Biosystems) and commercially available tert-butyloxycarbonyl/benzyloxycarbonyl (Boc/Cbz) protected PNA monomers (Applied Biosystems) according to the published procedures of L. Christensen, et al. (1995), J. Pept. Sci. 1, 175-183; and T. Koch, et al. (1997), J. Pept. Res. 49, 80-88, for PNA synthesis (Boc chemistry). The synthesis is performed in a 400 μmol scale on MBHA LL polystyrene resin (NovaBiochem), pre-loaded with Boc-Lys(2-Cl-Z)-OH (NovaBiochem) to about 0.1-0.2 mmol/g.
  • [0199]
    The synthesis of the peptide part of the conjugate is carried out by either Fmoc- or Boc-chemistry, according to standard procedures for solid phase peptide synthesis. For deprotection and cleavage one vol. of a solution of TFA/DMS/m-cresol (1:3:1) is mixed with one vol. of TFA/TFMSA (9:1) and added to the resin. After 1 h of shaking the resin is washed with TFA and one vol. of TFA/TFMSA/m-cresol (8:2:1) was added and the suspension is shaken for another 1.5-6 h. The filtrate is then added to a 10-fold volume of cold diethylether, mixed and centrifuged. The supernatant is removed and the pellet is resuspended in ether. This is repeated three times. The pellet is dried and re-dissolved in water or 0.1% TFA for HPLC purification.
  • [0200]
    Purification is performed on a Gilson HPLC system (215 liquid handler, 155 UV/VIS and 321 pump), by reverse phase high performance liquid chromatography (RP-HPLC), using a Zorbax (C-3, 5 μm, 300 Å, 250×7.8 mm, 4 mL/min). A linear gradient from solvent A: 0.1% heptafluorobutyric acid in water to B: acetonitrile is used as the liquid phase. Purity is determined by analytical HPLC and composition confirmed by electrospray mass spectrometry. Samples are lyophilized and stored at −20° C. prior to use.
  • [0201]
    PNA oligomeric conjugates incorporating D-lysine, L-dimethylysine, D-dimethylysine, L-histidine, D-histidine, L-ornithine, D-ornithine, L-homoarginine, D-homoarginine, L-norarginine, D-norarginine, L-homohomoarginine, D-homohomo-arginine, lysine peptoid, 2,4-diamino butyric acid, homolysine or beta-lysine are prepared in like manner using Boc blocked histidine, ornithine, arginine, D-lysine, diaminobutyric and arginine amino acids precursors except as outlined below in the remainder of this example. Other blocking groups can also be selected to protect the amino acid units during synthesis of the conjugate groups.
  • [0202]
    PNA-Peptoid Conjugates
  • [0203]
    Oligomers of N-substituted glycines, or “peptoids” are a class of unnatural peptide analogs that resist protease degradation. For the monomer synthesis N-Z-1.4 diaminobutane (5 g, 19.3 mmole) was dissolved in 200 ml dry pyridine and 20 ml DMSO were added. To this solution triethylamine (66.5 mmole, 9.24 ml) was added. Methylbromoacetate (0.871 ml, 9.5 mmole) was diluted in 50 ml dry DMF and added dropwise to the mixture over 3 h, which was then stirred for another 16 h. Di-tert-butyl dicarbonate (29 mmole, 6.33 g dissolved in 20 ml DCM) was added dropwise under stirring and was allowed to react overnight. The resulting compound was extracted with ethyl acetate and identified by TLC. After evaporating the solvents, the compound was saponified with LiOH (0.5 M, THF/MeOH/H2O 1:1:1). The solution was acidified with HCl (3 M) and was extracted with DCM and identified by TLC, Proton NMR and LC-MS. The PNA-peptoid-conjugates were synthesized, deprotected, purified and characterized as described above.
  • [0204]
    PNA-Peptide Conjugates Containing L-Homo-Arginine and L-Bis homo Arginine
  • [0205]
    Bis homoarginine is also known and described in this application as homohomoarginine. For the synthesis of L-homo-arginine- and L-bishomo-arginine-conjugated PNA, Boc-L-lysine(Fmoc)-OH and Boc-L-homo lysine(Fmoc)-OH were used as the initial building blocks and were converted postsynthetically into L-homo-arginine and L-bishomo arginine, respectively. The PNA-Peptide-conjugates were synthesized using Boc-chemistry as described above in this example. After synthesis the Fmoc-protecting groups of the peptide were removed with 20% Piperidine in DMF. The free Amino-groups of the peptide-carrier were guanidinylated by adding a solution of pyrazole carboxamidine-HCl (0.27 g) in 0.363 ml DIEA and 0.637 ml DMF to the peptide conjugate on the resin and reacting at 55° C. for 24 h. Subsequently, the PNA-Peptide conjugates were deprotected, purified and characterized as described above.
  • [0206]
    Disulfide-Containing Conjugates The peptide part of the conjugate (H-dK)8-Cys-NH2) was synthesized by solid phase synthesis on a Sieber Amide Resin (NovaBiochem) using standard peptide synthesis conditions (Fmoc chemistry). After acidic cleavage from the resin (TFA/m-cresol/triisopropylsilane/H2O, 94:2,5:1:2.5) for 1 h at room temperature, the peptide was precipitated into ice-cold diethylether, the precipitate spun down and washed with ether and dried at 55° C. A solution containing 2,2-Dipyridyl-disulfide (300 μmol) in AcCN (1500 μL) was prepared. To a separate solution of 20% pyridine/H2O (3000 μL) was added the peptide H-(dK)8-Cys-NH2(61 μmol) followed by 1% TEA/H2O to obtain a pH of roughly 8.7. The solution containing the peptide was immediately added to the dipyridyl-disulfide solution. The reaction mixture was allowed to stir for 18 h. The solvents were removed in vacuo and the desired peptide containing a pyridyldisulfide-activated thiol group was purified by RP-HPLC.
  • [0207]
    The PNA part of the conjugates were synthesized on a previously prepared Boc-PNA-K-MBHA polystyrene resin. Fmoc chemistry was utilized to install the ethylene oxide spacer (O) and the cysteine or penicillamine residue. The resulting thiol-containing compound was cleaved from the resin using the above-described Hi/Low TFMSA cleavage conditions and purified using RP-HPLC as described above. For conjugation, the activated peptide was dissolved in 10% pyridine/H2O (10 mM, 1.5 mL) and the thiol-containing PNA was dissolved in 20% pyridine/H2O (0.1 mM, 7.5 mL) and the pH was adjusted to 10 using 1% TEA/H2O (2 mL). The two solutions were immediately combined while shaking. The pH of the combined solution was 8.2. The reaction was allowed to continue for 18 h. The solvents were removed in vacuo and the desired conjugates were purified by RP-HPLC as described above.
  • Example 22 Cell Culture, Harvest and Transfection
  • [0208]
    BCL1 cells were obtained from the American Type Culture Collection and grown in normal growth medium (Dulbecco's modified Eagle medium, supplemented with 10% fetal bovine serum, and antibiotics). Cells were incubated in a humidified chamber at 37° C., containing 5% CO2. Antisense agents were delivered to cells by electroporation (200 V, 13 W, 1000 mFa) using 0.4 cm gap width cuvettes and a BTX electroporator source. Cells were re-plated in normal growth medium and re-incubated for the indicated times prior to harvest.
  • [0209]
    Primary thioglycollate-elicited macrophages were isolated by peritoneal lavage from 6-8 week old female C57Bl/6 mice that had been injected with 1 mL 3% thioglycollate broth 4 days previously. PNAs were delivered to unpurified peritoneal cells by a single 6 ms pulse, 90V, on a BTX square wave electroporator in 1 mm cuvettes. After electroporation, the cells were plated for 1 hour in serum-free RPMI 1640 (supplemented with 10 mM HEPES) at 37° C., 5% CO2 to allow the macrophages to attach. Non-adherent cells were then washed away and the media was replaced with complete RPMI 1640 (10% FBS, 10 mM HEPES). Primary macrophages were activated by treatment with 100 ng/mL rIFN-g (R&D Systems) for 4 hours, followed by 10 μg/mL anti-CD40 antibody (clone 3/23, BD Pharmingen) for the indicated timepoints.
  • Example 23 Flow Cytometry Analysis
  • [0210]
    Cells were detached from culture plates with 0.25% trypsin. Trypsin was neutralized with an equal volume of normal growth medium and cells were pelleted. Cell pellets were resuspended in 200 μL staining buffer (phosphate buffered saline containing 2% bovine serum albumin and 0.2% NaN3) containing 1 μg either FITC labeled isotype control antibody or FITC labeled anti-CD40 antibody (clone HM40-3, BD Biosciences). Cells were stained for one hour, washed once with staining buffer, and re-suspended in PBS. Where indicated, cells were resuspended in PBS containing 5 μg/mL propidium iodide to allow for gating only cells that excluded the dye. CD40 surface expression level was determined using a FACScan flow cytometer (Becton Dickinson).
  • Example 24 Toxicity Assay
  • [0211]
    Approximately 104 cells/well were seeded in 96-well plates for 24 h. Media was then replaced with 100 μl media containing increasing amounts of free oligonucleotide. After 24 h, MTS (Promega, Madison, Wis.) was added directly to the culture wells as indicated by the manufacturer and the plates were incubated at 37° C. for 2 h. Absorbance at 490 nm was measured and compared with that of mock-treated samples.
  • Example 25 Isolation of Total RNA and RT-PCR
  • [0212]
    Total RNA was isolated using an RNeasy Mini Kit (Qiagen). Two-step RT-PCR was performed using primers complementary to sequences of the CD40 gene (Genbank accession#M83312, incorporated herein as SEQ ID NO: 92). Reverse transcription was performed using a reverse primer (5′-TGATATAGAGAAACACCCCGAAAATGG-3′; SEQ ID NO: 93) complementary to sequence in exon 7. The resulting cDNA was subjected to 35 cycles of PCR using a forward primer consisting of a sequence span identical to that found in exon 5 of the gene (5′-GCCACTGAGACCACTGATACCGTCTGT-3′; SEQ ID NO: 94) as well as the reverse primer used for cDNA generation. The resulting PCR products were separated on a 1.6% agarose gel. PCR products were excised and the DNA purified. The resulting products were sequenced using primers used in PCR. Real-time quantitative RT-PCR was performed on total RNA from BCL1 or primary macrophages using an ABI Prism® 7700. Primer and dual labeled probe sequences were as follows:
    Mouse IL-12 p40:
    forward 5′-GCCAGTACACCTGCCACAAA- 3′, SEQ ID No. 95
    Mouse CD18:
    Mouse CD40, Type 1:
    Mouse CD40, Type 2:
    Mouse CD40:
    Reverse 5′-GCTTCCTGGCTGGCACAA-3′ SEQ ID No. 108
    Mouse cyclophilin:
    Forward 5′-TCGCCGCTTGCTGCA-3′ SEQ ID No. 110
    Reverse 5′-ATCGGCCGTGATGTCGA-3′ SEQ ID No. 111
  • Example 26 Western Blot
  • [0213]
    Cells were harvested in RIPA buffer (phosphate buffered saline containing 1% NP40, 0.1% SDS, and 0.5% sodium deoxycholate). Total protein concentrations were determined by Lowry assay (BioRad) and equal quantities were precipitated with cold acetone by centrifugation. Protein pellets were vacuum dried and resuspended in load dye (Invitrogen) containing 5% mercaptoethanol. Samples were heated to 92° C. for 10 minutes prior to gel loading. Protein samples were separated on 10% PAGE Tris-glycine gels and transferred to PVDF membranes. Membranes were blocked with blocking solution (TBS-T containing 5% non-fat dry milk) and blotted with appropriate antibody. The polyclonal CD40 antibody was obtained from Calbiochem. G3PDH monoclonal antibody was obtained from Advanced Immunochemical, TRADD antibody was obtained from Cell Signalling, and HRP-conjugated secondary antibodies were obtained from Jackson Immunoresearch. Protein bands were visualized using ECL-Plus (Amersham-Pharmacia).
  • Example 27 ELISA Assay
  • [0214]
    Levels of mouse IL-12 in the supernatants of activated macrophages were measured with mouse IL-12 p40+p70 ELISA kit (Biosource), according to the manufacturer's instructions.
  • Example 28 Identification of Specific PNA and MOE Inhibitors of CD40 Expression
  • [0215]
    A panel of oligomers containing either MOE and PNA backbones was synthesized and are shown in Table 5.
    TABLE 5
    Sequences of Uniform 2′-MOEs and PNAs
    targeting the murine CD40 pre-mRNA
    ISIS No. Sequence of Target Target ID
    PNA MOE PNA/MOE Region site NO.
    208518 208342 GCTAGTCACTGAGCA 5′-UTR 389 113
    208519 208343 CAAAGTCCCTGCTAG 5′-UTR 460 114
    208520 208344 AGCCACAAGTCACTC 5′-UTR 475 115
    208521 208345 AGACACCATCGCAG Start 529 116
    208522 208346 GCGAGATCAGAAGAG 5′-UTR 513 117
    208523 208347 CGCTGTCAACAAGCA 3′-Exon 1 570 118
    208524 208348 CTGCCCTAGATGGAC 5′-Exon 2 60 119
    208525 208349 CTGGCTGGCACAAAT 3′-Exon 2 124 120
    208526 208350 TGGGTTCACAGTGTC 3′-Exon 3 250 121
    208527 208351 CATCTCCATAACTCC 3′-Exon 4 396 122
    208528 208352 CTTGTCCAGGGATAA 3′-Exon 5 491 123
    208529 208353 CACAGATGACATTAG 3′-Exon 6 553 124
    208530 208354 TGATATAGAGAAACA 3′-Exon 7 640 125
    208531 208355 TCTTGACCACCTTTT 5′-Exon 8 655 126
    208532 208356 CTCATTATCCTTTGG 3′-Exon 9 672 127
    208533 208357 GGTTCAGACCAGG Stop codon 869 128
    208534 208358 AAACTTCAAAGGTCA 3′-UTR 914 129
    208535 208359 TTTATTTAGCCAGTA 3′-UTR 1175 130
    208536 208360 AGCCCCACGCACTGG Intron 3 805 131
  • [0216]
    Table 5 shows Peptide Nucleic Acid (PNA) and 2′-O-methoxyethyl phosphorothioate oligonucleotide (MOE) sequences, their corresponding ISIS numbers, and their placement on the murine CD40 genome (Genbank Accession No. M94129, provided herein as SEQ ID NO: 132). Sequences are provided in generic form. For PNAs, sequences read from the aminoterminal (H—) to the carboxamide (—NH2). Lysine inserted at the carboxamide terminal for all sequences (hence for ISIS 208518, full sequences should read H-GCTAGTCACTGAGCA-Lys-NH2). For MOEs, sequences read from 5′ to 3′. Purity generally exceeded 95% as assessed by analytical HPLC (UV 260 nm).
  • [0217]
    These oligomers were designed to regions of the murine CD40 pre-mRNA that could potentially either alter splicing or inhibit translation, both of which are validated non-RNase dependent mechanisms (Sazani et al., Taylor et al., Baker et al. 1991, Chiang et al. 1991, Karras et al.). The MOE and PNA oligomers were delivered by electroporation into BCL1 cells, a mouse B cell line that constitutively expresses high levels of CD40. Following a 48 hour incubation period, cells were harvested and analyzed for surface expression of CD40 by flow cytometry. The activities of the PNA oligomers were compared to those of the-MOE oligomers of identical sequence and length. Isis 29848 (NNNNNNNNNNNNNNNNNNNN; SEQ ID NO: 133) and ISIS 117886 (TCTCACTCCTATCCCAGT; SEQ ID NO: 134; a 2′-MOE gapmer with phosphorothioate backbone, targeted to murine CD40. 2′ MOE shown in bold) were included in each screen as negative and positive controls, respectively, for RNase H-mediated CD40 inhibition. The results are shown in Table 6 expressed as percent of control (no oligo treatment).
    TABLE 6
    Effect of PNA and Uniform 2′ MOE Oligomers
    on CD40 expression
    CD40 Expression CD40 Expression
    MOE (% of control) PNA (% of control)
    no oligomer 100 no oligomer 100
    29848 89  29848 100
    117886 32 117886 38
    208342 90 208518 114
    208343 88 208519 96
    208344 86 208520 82
    208345 64 208521 61
    208346 79 208522 92
    208347 40 208523 50
    208348 48 208524 71
    208349 61 208525 77
    208350 90 208526 105
    208360 75 208536 98
    208351 90 208527 128
    208352 50 208528 58
    208353 26 208529 34
    208354 50 208530 49
    208355 66 208531 86
    208356 42 208532 62
    208357 86 208533 78
    208358 92 208534 116
    208359 62 208535 103
  • [0218]
    Sequences (SEQ ID NO: 116, 117, 118, 119, 120, 123, 124, 125, 127, 128, 130, 131) of compounds showing over 20% inhibition of CD40 expression (levels of 80% or less in Table 6) are preferred.
  • [0219]
    There was a strong correlation between the activities of PNA and MOE oligomers designed to the same target sites, as demonstrated by both paired sample t-test and Spearman rank correlation (p<0.001, in both cases). These results demonstrate that the sequence dependence of CD40 inhibitory activity is similar for MOE and PNA based inhibitors. Inhibitors based on MOE and PNA backbone chemistry were found to be of equal efficacy as determined by the flow cytometry. A PNA targeted towards the 3′ end of exon 6, ISIS 208529 (SEQ ID NO: 124), was found to be the most active sequence. The corresponding MOE sequence, ISIS 208353 was also the most active within the series of MOE compounds. To further assess the specificity of ISIS 208529, CD40 levels were measured by western blot from BCl1, cells electroporated with either the parent PNA (ISIS 208529), a PNA containing a four base mismatch (ISIS 256644; CACTGATCAGATAAG; SEQ ID NO: 135), or one of two PNAs of unrelated sequences (ISIS 256645; ACTAGTGCTAGCGTC; SEQ ID NO:136, and ISIS 256646; CGTCATGATACCGAT; SEQ ID NO: 137). In each case, protein was harvested and analyzed 48 hours after electroporation. Using an antibody specific for the C-terminal region of the CD40 Protein, western blot analysis showed that none of the three mismatched PNAs affected CD40 expression, whereas the inhibition of CD40 expression by ISIS 208529 was confirmed.
  • Example 29 Mode of Action of the PNA Inhibitor ISIS 208529
  • [0220]
    The target sequence for ISIS 208529 is located on the 3′ end of exon 6 of the primary murine CD40 transcript, abutting the splice junction, and is therefore likely to affect splicing. The naturally occurring splice forms of murine CD40 have been previously described (Tone, M., Tone, Y., Fairchild, P. J., Wykes, M., and Waldmann, H. (2001) Proc. Natl Acad. Sci. U.S.A. 98, 1751-1756). The type 1 transcript, which retains exon 6, is the predominant form. Its translation product is the canonical membrane-bound, signaling-competent CD40 protein. The type 2 transcript is lower in abundance and does not contain exon 6. The omission of exon 6 causes a frame shift in codons contained in exons 7, 8, and 9, and leads to mistranslation of the sequence encoding for the transmembrane domain and truncation of the protein due to a now in-frame stop codon in exon 8. The presence of the type 2 transcript interferes with CD40 signaling. Tone et al., 2001. In order to verify the mechanism by which ISIS 208529 reduces the expression of cell surface CD40 expression, RT-PCR was performed on RNA isolated from both treated and untreated cells using primers seated in exons 5 and 7. A sequence specific, PNA mediated shift in the relative abundance of the two splice forms was observed upon treatment with ISIS 208529. No change in relative abundance in splice forms was observed in cells treated with the four base mismatched PNA, ISIS 256644. The identities of the splice forms were verified by sequencing of the two RT-PCR products.
  • Example 30 Evaluation of PNAs Targeting Sequences Surrounding the Binding Site for ISIS 208529
  • [0221]
    Further optimization of inhibitor binding was performed by designing additional PNA oligomers targeted to sites adjacent to the ISIS 208529 binding site. The PNA oligomers were designed to bind to 15 nt spans of target RNA within a range of 10 nt upstream and downstream of the ISIS 208529 binding site on the primary transcript as shown in Table 7.
    TABLE 7
    Optimization of PNA oligomers
    targeted to CD40
    Isis # Sequence SEQ ID No.
    208529 H-CACAGATGACATTAG-Lys-NH2 124
    256634 H-ATTAGTCTGACTCGT-Lys-NH2 138
    256635 H-ACATTAGTCTGACTC-Lys- 139
    256636 H-TGACATTAGTCTGAC-Lys- 140
    256637 H-GATGACATTAGTCTG-Lys- 141
    256638 H-CAGATGACATTAGTC-Lys- 142
    256639 H-CTGGACTCACCACAG-Lys- 143
    256640 H-GGACTCACCACAGAT-Lys- 144
    256641 H-ACTCACCACAGATGA-Lys- 145
    256642 H-TCACCACAGATGACA-Lys- 146
    256643 H-ACCACAGATGACATT-Lys- 147
    256644 H-CACTGATCAGATAAG-Lys- 135
    256645 H-ACTAGTGCTAGCGTC-Lys- 136
    256646 H-CGTCATGATACCGAT-Lys- 137
    286242 H-ACATTAG-Lys- 148
    286243 H-GACATTAG-Lys- 149
    286244 H-TGACATTAG-Lys- 150
    286245 H-ATGACATTAG-Lys- 151
    286246 H-GATGACATTAG-Lys- 152
    286247 H-AGATGACATTAG-Lys- 153
    286248 H-CAGATGACATTAG-Lys- 154
    286249 H-ACAGATGACATTAG-Lys- 155
    298841 H-CCACAGATGACATTAG-Lys- 156
    298842 H-ACCACAGATGACATTAG-Lys- 157
    298843 H-CACCACAGATGACATTAG-Lys- 158
  • [0222]
    The sequences align as shown below.
    Figure US20040186071A1-20040923-C00001
  • [0223]
    The activities of the resulting ten PNAs, as well as that of ISIS 208529, were evaluated in parallel by western blot. Eight of the ten PNAs (SEQ ID NO: 138, 139, 142, 143, 144, 145, 146, and 147) demonstrated a level of activity similar to that of ISIS 208529, and are therefore preferred. Two PNAs, ISIS 256636 and ISIS 256637 (SEQ ID NO: 140 and 141), positioned slightly upstream from the 3′ exon 6 splice site, failed to inhibit CD40 expression. Examination of the primary sequences of the two inactive PNAs did not reveal any obvious features, such as a high guanosine content, that might promote the formation of undesirable secondary structure. Likewise, the RP-HPLC elution profiles for these two compounds did not indicate a tendency for self-aggregation. Furthermore, examination of the target RNA sequence did not reveal secondary structure that might limit target accessibility.
  • Example 31 The Effect of PNA Length on CD40 Inhibitory Activity
  • [0224]
    The effect of PNA length on activity was assessed by systematic variation of length of the PNA inhibitor from 7 to 20 monomer units. For the initial examination of length effects, 13 PNAs were designed and synthesized (Table 3). The first set, consisting of PNAs of 7 to 14 units in length, were all targeted to portions of the binding site of ISIS 208529. Each of these compounds as well as the 15-mer parent, ISIS 208529, were electroporated into BCL1 cells at a final concentration of 10 μM. Three days following delivery, the cells were harvested and analyzed by western blot for CD40. G3PDH protein levels were also measured to verify equal protein loading. While no apparent reduction in CD40 levels was observed in cells treated with compounds ranging from 7-11 units in length, inhibition of CD40 expression was observed with compounds ranging from 12-15 units in length. The efficacy of the PNA inhibitors was found to increase with increasing length, up to a PNA length of about 14 units, where efficacy reached a level similar to that displayed by the lead 15-mer PNA, ISIS 208529. Subsequently, a second set of PNAs was examined covering a range of 12 to 20 units in length. PNAs were electroporated into BCL1 cells at various concentrations to determine their relative potencies. Compounds were evaluated for their ability to inhibit CD40 cell surface expression by flow cytometry. Potency was found to increase with increasing length, reaching a plateau at 14 unit length, beyond which no additional gain was detected upon increasing length. This observation suggests that the potency of ISIS 208529 is not limited by its length, and that potency cannot be improved by increasing the length of this PNA. At this target site, EC50 values were in the range of 0.6 to 0.9 μM for all PNAs of 14 units or longer as is shown in Table 8 where EC50 values and 95% confidence intervals were determined by nonlinear regression analysis using a defined top and bottom of 400 and 100, respectively.
    TABLE 8
    Effect of length on PNA oligomer inhibitory activity
    Length ISIS NO. EC50 95% confidence interval
    12 286247 21.1 13.0 to 34.4
    13 286248 1.85 1.59 to 2.16
    14 286249 0.90 0.78 to 1.04
    15 208529 0.87 0.75 to 1.00
    16 298841 0.58 0.40 to 0.83
    17 298842 0.79 0.50 to 1.23
    18 298843 0.86 0.71 to 1.03
    19 298844 0.57 0.44 to 0.74
    20 298845 0.71 0.52 to 0.97
  • Example 32 Dose and time Dependence of CD40 Inhibitory Activity by ISIS 208529
  • [0225]
    The dose dependent reduction of cell surface CD40 protein upon treatment of BCL1cells with ISIS 208529 (SEQ ID NO: 124) was evaluated by flow cytometry and was further supported by verification of CD40 protein depletion by western blot. Specificity was verified by inclusion of a PNA containing a four base mismatch (ISIS 256644; SEQ ID NO: 135). ISIS 208529 showed an increasing dose response curve across a concentration range of 16, 8, 4, 2, 1, 0.5 and 0.25 μM range where as the mismatch compound did not. In order to assess the effect of ISIS 208529 over time, western blot analysis was applied to study the effect of a single dose (10 μM) of ISIS 208529 for eight days following electroporation. Maximal inhibition of CD40 expression was observed four days post treatment and persisted for at least five days. At day eight, the level of CD40 expression was back to values found for the no-treatment control. No change in CD40 expression levels was observed in cells treated with the four base mismatched PNA (ISIS 256644).
  • Example 33 Inhibitory Activity of ISIS 208529 on CD40 Dependent IL-12 Production in Primary Murine Macrophages
  • [0226]
    The functional consequences of PNA-induced alternative splicing in primary murine macrophages were examined. Thioglycollate-elicited mouse peritoneal cells were electroporated with various doses of ISIS 208529 (SEQ ID NO: 124) or with the PNA containing a four base mismatch, ISIS 256644 (SEQ ID NO: 135). After electroporation, macrophages were selected by adherence to tissue culture plates and treated with IFN-α for 4 hours to induce CD40 cell surface expression, and then stimulated with an activating CD40 antibody for 24 hours. CD40 signaling in macrophages results in production of multiple cytokines, including IL-12. The level of IL-12 in the supernatant of PNA-treated macrophages after CD40 activation was examined by an ELISA assay. Electroporation of the macrophages with ISIS 208529 resulted in a dose-dependent reduction in IL-12 production. Delivery of 3 μM ISIS 208529 to macrophages by electroporation resulted in 75% inhibition of IL-12 production compared to macrophages electroporated with no PNA. A maximal inhibition of 85% relative to the untreated control was obtained with 10 μM ISIS 208529. Macrophages electroporated with the mismatch control PNA (ISIS 256644) showed no decrease in IL-12 production in response to PNA treatment. Examination of the level of CD40 protein by western blot showed a dose dependent reduction in CD40 protein following treatment with ISIS 208529, which correlated to the decrease in IL-12 production. No reduction in CD40 protein was found after treatment with the mismatch control ISIS 256644. Examination of the CD40 splice forms by quantitative RT-PCR showed a 70% decrease in the predominant type 1 splice form, and a 2-fold increase in the alternative type 2 splice form, at 3 μM ISIS 208529. The four base mismatch control, ISIS 256644, had no significant effect on the relative abundance of the CD40 splice forms, indicating that inhibitory activity was dependent on Watson-Crick complementarity.
  • Example 34 Effect of ISIS 208529 Peptide Conjugation on CD40 Cell Surface Expression in BCL1 Cells and in Macrophages
  • [0227]
    In order to obtain a PNA with potential to act without the use of a delivery vehicle, the active PNA, ISIS 208529 (SEQ ID NO: 124), was conjugated with eight lysines at the N-terminus to give ISIS 278647. In BCL1 cells that were treated with ISIS 278647 at 10 μM, the relative abundance of the CD40 type 1 transcript was decreased and the abundance of the type 2 transcript was increased as determined by standard RT-PCR and real-time quantitative RT-PCR. ISIS 278647 caused an 85% decrease in the type 1 transcript and a greater than 3 fold increase in the type 2 transcript. Neither the unconjugated lead PNA (ISIS 208529) nor an eight lysine conjugated, four base mismatched PNA (ISIS 287294; SEQ ID NO: 135) had any effect on the relative abundance of either splice variant or on total CD40 transcript, relative to the untreated control. Analysis of the protein lysates by western blot, using an antibody that recognizes the C-terminal region of the canonical CD40 protein, showed that ISIS 278647 promotes CD40 protein depletion, whereas the unconjugated PNA, ISIS 208529, and the four base mismatched control, ISIS 287294, do not. These results demonstrate that redirection of splicing and loss of the CD40 protein encoded by the type 1 transcript variant is dependent on both PNA sequence and inclusion of the eight lysine carrier when no delivery vehicle is used.
  • [0228]
    The effect of lysine conjugation of ISIS 208529 (SEQ ID NO: 124) on CD40 expression, and on the relative abundance of the type 1 and type 2 transcripts, was also examined in primary murine macrophages. Adherent peritoneal macrophages were incubated in with various concentrations of unconjugated or conjugated PNA for 16 hours and CD40 expression then induced by IFN-α. The reduction of CD40 protein in the PNA treated cells was examined by western blot. No reduction in CD40 protein was observed after treatment with ISIS 208529, while a modest reduction in CD40 protein was observed in macrophages treated with a 4 lysine conjugated PNA of the same sequence (ISIS 278643; SEQ ID NO: 124). In contrast, treatment with the eight lysine conjugated CD40 PNA of the same sequence (ISIS 278647) resulted in a dramatic, dose-dependent decrease in CD40 protein. Treatment with ISIS 278647 at 10 μM resulted in reduction of CD40 protein to levels undetectable by western blot, indicating that the eight lysine conjugated PNA was readily taken up by the primary macrophages and that carrier conjugation did not prevent the PNA from binding to its target and from attenuating CD40 protein expression. Under similar conditions, an eight lysine conjugated four base mismatch control PNA (ISIS 287294; SEQ ID NO: 135) caused no reduction in CD40 protein, indicating that the observed reduction in CD40 protein is sequence specific. Analysis of the CD40 splice forms by quantitative RT-PCR demonstrated that the eight lysine conjugated CD40 PNA (ISIS 278647) caused a substantial reduction in CD40 type 1 mRNA with a concomitant 5-fold induction of the CD40 type 2 transcript. The eight lysine conjugated four base mismatch PNA (ISIS 287294) had no significant effect on the relative levels of the type 1 and type 2 splice forms.
  • Example 35 Inhibitory Activity of Further PNA Cationic Conjugate Compounds Against CD40
  • [0229]
    A series of PNA conjugate compounds of identical sequence to ISIS 208529, i.e., CACAGATGACATTAC; Seq ID NO. 124, were prepared and tested in BCL-1 cells using flow cytometry for free uptake at 10 μM (FACS). The following abbreviations are used to identify the components of each of the conjugates: (C)=C-terminal, (N)=N-terminal, aca=6-aminocaproic acid, aoc=aminooctanoic acid, βA=beta-alanine, βK=beta-lysine, aca=amino hexanoic acid, adc=amino dodecanoic acid, O=8-amino-3,6-dioxaoctanoic acid, Dab=L-2-4-diaminobutyric acid, Ci=L-citrulline, ab=4-aminobutyric acid, hR=L-homo arginine, hhR=L-homohomo arginine, norR=L-nor arginine, G=glycine, pK=lysine-peptoid, H=L-histidine, DhR=D-homo arginine, dR=d-arginine, inp=isonipecotic acid, amc=4-aminomethyl-cyclohexane carboxylic acid, dmK=L-dimethyl lysine, Pen=penicillamine, Ada=adamantane acetyl, Pam=palmityl, Ibu=(S)-(+)-ibuprofen, CHA=cholic acid, Chol=cholesteryl formyl, mm=mismatch PNA.
  • [0230]
    The compounds and test results are as are shown in Table 9.
    TABLE 9
    Additional PNA Cationic Conjugate Compounds of SEQ ID NO: 124
    Est. t1/2 [h] in
    N-terminal C-terminal CD40 Protein t1/2 [h] in 25% 100% mouse
    Isis #-Lot# modification modification notes (% UTC @ 10 μM) mouse serum serum
    208529-1 K 80, 98, 100 stable stable
    278640-1 K K 80 n.d.
    278641-1 K2 K 90 n.d.
    278642-1 K3 K 80 n.d.
    278643-1 K4 (SEQ ID NO: 161) K 100 n.d.
    278644-1 K5 (SEQ ID NO: 162) K 70 n.d.
    278645-1 K6 (SEQ ID NO: 163) K 50 n.d.
    278646-1 K7 (SEQ ID NO: 164) K 30 n.d.
    278647-1 K8 (SEQ ID NO: 165) K 20, 30, 35, 30, 15 5.7 1.4
    287294-1 K8 K 4 mm 100 n.d.
    287293-1 K6 K 4 mm 100 n.d.
    284381-1 K2 95 n.d.
    279866-1 K4 85 6.5 1.6
    284375-1 K8 40, 35, 35, 40, 35, 45, 73, 68 1 0.25
    290075-1 R K 100 n.d.
    290076-1 R2 K 90 n.d.
    290077-1 R3 K 90 n.d.
    290078-1 R4 (SEQ ID NO: 166) K 80 n.d.
    290079-1 R5 (SEQ ID NO: 167) K 80 n.d.
    297780-1 R6 (SEQ ID NO: 168) K 75 n.d.
    290081-1 R7 (SEQ ID NO: 169) K 70 n.d.
    290082-2 R8 (SEQ ID NO: 170) K 60 3.2 0.8
    301010-1 D-R8 K 49 n.d.
    299870-1 K5RK2 (SEQ ID 48 n.d.
    NO: 171)
    299871-1 D(K5RK2)(SEQ 53 n.d.
    ID NO: 172)
    284382-1 K2 K2 85 n.d.
    279867-1 K4 K4 75 n.d.
    284383-1 Ada-O K2 80 n.d.
    284384-1 Ada-O-K2 K2 85 n.d.
    279975-1 Ada-O K4 95 n.d.
    279976-1 Ada-O-K4 K4 75 n.d.
    284376-1 Ada-O K8 40 n.d.
    284385-1 Pam-O K2 n/a tox. n.d.
    284386-1 Pam-O-K2 K2 n/a tox. n.d.
    283582-1 Pam-O K4 70 n.d.
    283583-1 Pam-O-K4 K4 60 n.d.
    284377-1 Pam-O K8 n/a tox. n.d.
    290061-1 Ibu-O K2 80 n.d.
    287086-1 Ibu-O K8 30 1 0.25
    311573-1 Ibu-O-K8 K n.d. n.d.
    290063-1 CHA-O K2 95 n.d.
    290064-1 Chol-O- K2 n/a tox. n.d.
    292097-1 CHA-Q-K8 K 55 n.d.
    292098-1 Chol-O-K8 K n/a tox. n.d.
    298110-1 Branch1-K K 60 n.d.
    298111-1 Branch3-K K 85 n.d.
    298112-1 Branch4-K K 60 n.d.
    298113-1 Branch5-K K 75 n.d.
    298114-1 Branch6-K K 70 n.d.
    298116-1 Branch2-K K 40 n.d.
    303537-1 RacaRRacaRRacaRR K 23, 29 2 0.5
    303540-1 KacaKKacaKKacaKK K 70 n.d.
    303538-1 RacaRacaRacaRacaRacaRacaR K 40 n.d.
    309743-1 dR.aca.dR.dR.aca.dR.dR. K 35 n.d.
    303539-1 KacaKacaKacaKacaKacaKacaK K 61 n.d.
    291341-1 KGKKGKGK (SEQ ID K 87 n.d.
    NO: 173)
    291342-1 KaocKKaocKaocK K 79 n.d.
    330890-1 hR-O-hR-hR-O-hR-hR- K 25 at 3 uM 59 12
    338896-1 hR-O-R-hR-O-R-hR-O- K 49 2 0.5
    338897-1 R-O-hR-R-O-hR-R-O- K 54 4 1
    315570-1 RacaRRacaRRacaRR- K 25 n.d.
    315571-1 RacaRRacaRRacaRR- K 41 n.d.
    315650-1 PKKKRKV- K 44 n.d.
    315573-1 KKVKPKR- K 31 n.d.
    309860-1 R-βA-RR-βA-RRβA- K 27 n.d.
    309883-1 R-abu-RR-abu-RR-abu- K 26 n.d.
    309861-1 R-aoc-RR-aoc-RR-aoc- K 25 n.d.
    309864-1 R-aca-RR-aca-RR-aca- K 20 n.d.
    309862-1 R-O-RR-O-RR-O-RR K 24 2 0.5
    309865-1 RR-aca-RR-aca-RR K 40 n.d.
    309866-1 R-aca-RR-aca-RR K 58 n.d.
    309884-1 R-inp-RR-inp-RR-inp- K 29 n.d.
    309885-1 R-amc-RR-amc-RR- K 27 n.d.
    291350-2 (βK)8 K 66 n.d.
    309843-1 βK-βK-KKKK-βK-βK K 52 n.d.
    309844-1 (K-βK)4 K 62 n.d.
    309845-1 KK-βK-KK-βK-KK K 61 n.d.
    303536-1 D-(Orn)8 K 67 n.d.
    303327-1 (Orn)8 64 n.d.
    301011-2 (Orn)8 K 77 >48 >12
    309143-1 Orn-Orn-KKKK-Orn- K 52 n.d.
    309144-1 (K-Orn)4 K 42 n.d.
    309145-1 KK-Orn-KK-Orn-KK K 34 19 4.75
    311069-1 KKKKK-Orn-KK K 50 n.d.
    311070-1 KK-Orn-KKKKK K 53 n.d.
    287292-2 (dK)8 K 54 stable >48
    305390-1 dKdK-KKKK-dKdK K 60 n.d.
    305391-1 K-dK-K-dK-K-dK-K- K 69 n.d.
    305392-1 KK-dK-KK-dK-KK K 62 stable >48
    311071-1 KKKKK-dK-KK K 61 n.d.
    311072-1 KK-dK-KKKKK K 59 n.d.
    305393-1 RRKKKKKRR (SEQ K 65 n.d.
    ID NO: 174)
    305394-1 KRKRKRKR (SEQ ID K 52 n.d.
    NO: 175)
    305395-1 KKRKKRKK (SEQ ID K 43 2.5 0.6
    NO: 176)
    308579-1 (hK)8 K 31 18 4.5
    308580-1 hKhK-KKKK-hKhK K 34 n.d.
    308581-1 K-hK-K-hK-K-hK-K- K 32 n.d.
    308582-1 KK-hK-KK-hK-KK K 31 7.5 1.9
    316409-1 (Dab)8 K 77 >48 >12
    316410-1 (Dab)2-K-(Dab)2-K- K 64 n.d.
    316411-1 (Dab-K)4 K 52 n.d.
    316412-1 KK-Dab-KK-Dab-KK K 38 40 10
    316427-1 (K-ab)8 K 47 n.d.
    316428-1 (K-(K-ab))4 K 41 n.d.
    316429-1 KK-(K-ab)-KK-(K-ab)- K 39 n.d.
    316430-1 (K-ab)2-K-(K-ab)2-K- K 55 n.d.
    325598-1 (dmK)8 K 71 stable
    325599-1 (K-dmK)4 K 53 n.d.
    325600-1 KK-dmK-KK-dmK-KK K 41 23 5.8
    325601-1 (dmK)2-K-(dmK)2-K- K 63 n.d.
    326744-1 (hR)8 K 30, 20 15.4 3.9
    (hhR)8 K n/a stable stable
    333677-1 (K-hR)4 K 44 n.d.
    333678-1 KK-hR-KK-hR-KK K 36 n.d.
    338894-1 (DhR)8 K n/a tox. n.d.
    338895-1 RR-DhR-RR-DhR-RR K 67 23.6 5.9
    326746-1 (norR)8 K 90 at 3 uM >48 >12
    333674-1 G(pK)8 K 56 >48 >12
    333675-1 (K-pK)4 K 70 n.d.
    333676-1 KK-pK-KK-pK-KK K 60 29 7.25
    332593-1 (H)8 (SEQ ID NO: 177) K 64 44.5 11
    332672-1 (KH)4 (SEQ ID K 73 n.d.
    NO: 178)
    332673-1 KKHKKHKK (SEQ ID K 52 5.7 1.4
    NO: 179)
    332674-1 KKGKKGKK (SEQ ID K 59 n.d.
    NO: 180)
    313685-1 K7-Ci K 65 n.d.
    313686-1 K6-Ci-K K 59 n.d.
    313687-1 K5-Ci-K2 K 53 n.d.
    313688-1 K4-Ci-K3 K 52 n.d.
    313689-1 K3-C-K4 K 57 n.d.
    313690-1 K2-Ci-K5 K 55 n.d.
    313691-1 K-Ci-K6 K 57 n.d.
    313692-1 Ci-K7 K 52 n.d.
    313693-1 KK-Ci-KK-Ci-KK K 65, 67 n.d.
    310755-1 K8-βA K 43 n.d.
    310756-1 K8-aca K 48 n.d.
    310757-1 K8-aoc K 54 n.d.
    310758-1 K8-adc K 68 n.d.
    291335-2 K8-aoc-aoc K 62 n.d.
    310753-1 K8-O K 44 n.d.
    310754-1 K8-O-O K 46 n.d.
    330775-1 (dK)8-FRGO K 46 2.8 0.7
    330776-1 (dK)8-dF-dRGO K 54 n.d.
    330777-1 (dK)8-ALALGO K 37 8.7 2.2
    330778-1 (dK)8-dA-dLdAdLGO K 36 n.d.
    335296-1 (dK)8-WEHDLO K 59 >48 .12
    335299-1 (dK)8-dW-dE-dH-dD- K 64 n.d.
    335297-1 (dK)8-D-E-V-D-L-O K 90 >48 >12
    335300-1 (dK)8-dD-dE-dV-dD- K 89 n.d.
    330781-1 (dK)8-G-F-L-G-O K 38 >48 >12
    330782-1 (dK)8-G-dF-dL-G-O K 39 n.d.
    339746-1 dK8-Cys-disulfide-Cys-O K 41 17 4.25
    339747-1 dK8-Cys-disulfide-Pen-O K 35 30 7.5
  • [0231]
    The Branch conjugates have the following structures:
    Figure US20040186071A1-20040923-C00002
    Figure US20040186071A1-20040923-C00003
  • Example 36 Design of Phenotypic Assays for the use of CD40 Inhibitors
  • [0232]
    Once CD40 inhibitors have been identified by the methods disclosed herein, the compounds are further investigated in one or more phenotypic assays, each having measurable endpoints predictive of efficacy in the treatment of a particular disease state or condition.
  • [0233]
    Phenotypic assays, kits and reagents for their use are well known to those skilled in the art and are herein used to investigate the role and/or association of CD40 in health and disease. Representative phenotypic assays, which can be purchased from any one of several commercial vendors, include those for determining cell viability, cytotoxicity, proliferation or cell survival (Molecular Probes, Eugene, Oreg.; PerkinElmer, Boston, Mass.), protein-based assays including enzymatic assays (Panvera, LLC, Madison, Wis.; BD Biosciences, Franklin Lakes, N.J.; Oncogene Research Products, San Diego, Calif.), cell regulation, signal transduction, inflammation, oxidative processes and apoptosis (Assay Designs Inc., Ann Arbor, Mich.), triglyceride accumulation (Sigma-Aldrich, St. Louis, Mo.), angiogenesis assays, tube formation assays, cytokine and hormone assays and metabolic assays (Chemicon International Inc., Temecula, Calif.; Amersham Biosciences, Piscataway, N.J.).
  • [0234]
    In one non-limiting example, cells determined to be appropriate for a particular phenotypic assay (i.e., MCF-7 cells selected for breast cancer studies; adipocytes for obesity studies) are treated with CD40 inhibitors identified from the in vitro studies as well as control compounds at optimal concentrations which are determined by the methods described above. At the end of the treatment period, treated and untreated cells are analyzed by one or more methods specific for the assay to determine phenotypic outcomes and endpoints.
  • [0235]
    Phenotypic endpoints include changes in cell morphology over time or treatment dose as well as changes in levels of cellular components such as proteins, lipids, nucleic acids, hormones, saccharides or metals. Measurements of cellular status which include pH, stage of the cell cycle, intake or excretion of biological indicators by the cell, are also endpoints of interest.
  • [0236]
    Analysis of the genotype of the cell (measurement of the expression of one or more of the genes of the cell) after treatment is also used as an indicator of the efficacy or potency of the CD40 inhibitors. Hallmark genes, or those genes suspected to be associated with a specific disease state, condition, or phenotype, are measured in both treated and untreated cells.
  • 0
    <160> NUMBER OF SEQ ID NOS: 248
    <210> SEQ ID NO 1
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 1
    ccaggcggca ggaccact 18
    <210> SEQ ID NO 2
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 2
    gaccaggcgg caggacca 18
    <210> SEQ ID NO 3
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 3
    aggtgagacc aggcggca 18
    <210> SEQ ID NO 4
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 4
    cagaggcaga cgaaccat 18
    <210> SEQ ID NO 5
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 5
    gcagaggcag acgaacca 18
    <210> SEQ ID NO 6
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 6
    gcaagcagcc ccagagga 18
    <210> SEQ ID NO 7
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 7
    ggtcagcaag cagcccca 18
    <210> SEQ ID NO 8
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 8
    gacagcggtc agcaagca 18
    <210> SEQ ID NO 9
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 9
    gatggacagc ggtcagca 18
    <210> SEQ ID NO 10
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 10
    tctggatgga cagcggtc 18
    <210> SEQ ID NO 11
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 11
    ggtggttctg gatggaca 18
    <210> SEQ ID NO 12
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 12
    gtgggtggtt ctggatgg 18
    <210> SEQ ID NO 13
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 13
    gcagtgggtg gttctgga 18
    <210> SEQ ID NO 14
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 14
    cacaaagaac agcactga 18
    <210> SEQ ID NO 15
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 15
    ctggcacaaa gaacagca 18
    <210> SEQ ID NO 16
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 16
    tcctggctgg cacaaaga 18
    <210> SEQ ID NO 17
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 17
    ctgtcctggc tggcacaa 18
    <210> SEQ ID NO 18
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 18
    ctcaccagtt tctgtcct 18
    <210> SEQ ID NO 19
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 19
    tcactcacca gtttctgt 18
    <210> SEQ ID NO 20
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 20
    gtgcagtcac tcaccagt 18
    <210> SEQ ID NO 21
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 21
    actctgtgca gtcactca 18
    <210> SEQ ID NO 22
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 22
    cagtgaactc tgtgcagt 18
    <210> SEQ ID NO 23
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 23
    attccgtttc agtgaact 18
    <210> SEQ ID NO 24
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 24
    gaaggcattc cgtttcag 18
    <210> SEQ ID NO 25
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 25
    ttcaccgcaa ggaaggca 18
    <210> SEQ ID NO 26
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 26
    ctctgttcca ggtgtcta 18
    <210> SEQ ID NO 27
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 27
    ctggtggcag tgtgtctc 18
    <210> SEQ ID NO 28
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 28
    tggggtcgca gtatttgt 18
    <210> SEQ ID NO 29
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 29
    ggttggggtc gcagtatt 18
    <210> SEQ ID NO 30
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 30
    ctaggttggg gtcgcagt 18
    <210> SEQ ID NO 31
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 31
    ggtgcccttc tgctggac 18
    <210> SEQ ID NO 32
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 32
    ctgaggtgcc cttctgct 18
    <210> SEQ ID NO 33
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 33
    gtgtctgttt ctgaggtg 18
    <210> SEQ ID NO 34
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 34
    tggtgtctgt ttctgagg 18
    <210> SEQ ID NO 35
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 35
    acaggtgcag atggtgtc 18
    <210> SEQ ID NO 36
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 36
    ttcacaggtg cagatggt 18
    <210> SEQ ID NO 37
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 37
    gtgccagcct tcttcaca 18
    <210> SEQ ID NO 38
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 38
    tacagtgcca gccttctt 18
    <210> SEQ ID NO 39
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 39
    ggacacagct ctcacagg 18
    <210> SEQ ID NO 40
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 40
    tgcaggacac agctctca 18
    <210> SEQ ID NO 41
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 41
    gagcggtgca ggacacag 18
    <210> SEQ ID NO 42
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 42
    aagccgggcg agcatgag 18
    <210> SEQ ID NO 43
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 43
    aatctgcttg accccaaa 18
    <210> SEQ ID NO 44
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 44
    gaaacccctg tagcaatc 18
    <210> SEQ ID NO 45
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 45
    gtatcagaaa cccctgta 18
    <210> SEQ ID NO 46
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 46
    gctcgcagat ggtatcag 18
    <210> SEQ ID NO 47
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 47
    gcagggctcg cagatggt 18
    <210> SEQ ID NO 48
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 48
    tgggcagggc tcgcagat 18
    <210> SEQ ID NO 49
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 49
    gactgggcag ggctcgca 18
    <210> SEQ ID NO 50
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 50
    cattggagaa gaagccga 18
    <210> SEQ ID NO 51
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 51
    gatgacacat tggagaag 18
    <210> SEQ ID NO 52
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 52
    gcagatgaca cattggag 18
    <210> SEQ ID NO 53
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 53
    tcgaaagcag atgacaca 18
    <210> SEQ ID NO 54
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 54
    gtccaagggt gacatttt 18
    <210> SEQ ID NO 55
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 55
    cacagcttgt ccaagggt 18
    <210> SEQ ID NO 56
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 56
    ttggtctcac agcttgtc 18
    <210> SEQ ID NO 57
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 57
    caggtctttg gtctcaca 18
    <210> SEQ ID NO 58
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 58
    ctgttgcaca accaggtc 18
    <210> SEQ ID NO 59
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 59
    gtttgtgcct gcctgttg 18
    <210> SEQ ID NO 60
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 60
    gtcttgtttg tgcctgcc 18
    <210> SEQ ID NO 61
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 61
    ccacagacaa catcagtc 18
    <210> SEQ ID NO 62
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 62
    ctggggacca cagacaac 18
    <210> SEQ ID NO 63
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 63
    tcagccgatc ctggggac 18
    <210> SEQ ID NO 64
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 64
    caccaccagg gctctcag 18
    <210> SEQ ID NO 65
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 65
    gggatcacca ccagggct 18
    <210> SEQ ID NO 66
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 66
    gaggatggca aacaggat 18
    <210> SEQ ID NO 67
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 67
    accagcacca agaggatg 18
    <210> SEQ ID NO 68
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 68
    ttttgataaa gaccagca 18
    <210> SEQ ID NO 69
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 69
    tattggttgg cttcttgg 18
    <210> SEQ ID NO 70
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 70
    gggttcctgc ttggggtg 18
    <210> SEQ ID NO 71
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 71
    gtcgggaaaa ttgatctc 18
    <210> SEQ ID NO 72
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 72
    gatcgtcggg aaaattga 18
    <210> SEQ ID NO 73
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 73
    ggagccagga agatcgtc 18
    <210> SEQ ID NO 74
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 74
    tggagccagg aagatcgt 18
    <210> SEQ ID NO 75
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 75
    tggagcagca gtgttgga 18
    <210> SEQ ID NO 76
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 76
    gtaaagtctc ctgcactg 18
    <210> SEQ ID NO 77
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 77
    tggcatccat gtaaagtc 18
    <210> SEQ ID NO 78
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 78
    cggttggcat ccatgtaa 18
    <210> SEQ ID NO 79
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 79
    ctctttgcca tcctcctg 18
    <210> SEQ ID NO 80
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 80
    ctgtctctcc tgcactga 18
    <210> SEQ ID NO 81
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 81
    ggtgcagcct cactgtct 18
    <210> SEQ ID NO 82
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 82
    aactgcctgt ttgcccac 18
    <210> SEQ ID NO 83
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 83
    cttctgcctg cacccctg 18
    <210> SEQ ID NO 84
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 84
    actgactggg catagctc 18
    <210> SEQ ID NO 85
    <211> LENGTH: 1004
    <212> TYPE: DNA
    <213> ORGANISM: Homo sapiens
    <301> AUTHORS: Stamenkovic et al.
    <302> TITLE: A B-lymphocyte activation molecule related to the nerve
    growth factor receptor and induced by cytokines in carcinomas
    <303> JOURNAL: EMBO J.
    <304> VOLUME: 8
    <305> ISSUE: 5
    <306> PAGES: 1403-1410
    <307> DATE: 1989
    <309> DATABASE ENTRY DATE: 1997-11-14
    <313> RELEVANT RESIDUES: (1)..(1004)
    <400> SEQUENCE: 85
    gcctcgctcg ggcgcccagt ggtcctgccg cctggtctca cctcgccatg gttcgtctgc 60
    ctctgcagtg cgtcctctgg ggctgcttgc tgaccgctgt ccatccagaa ccacccactg 120
    catgcagaga aaaacagtac ctaataaaca gtcagtgctg ttctttgtgc cagccaggac 180
    agaaactggt gagtgactgc acagagttca ctgaaacgga atgccttcct tgcggtgaaa 240
    gcgaattcct agacacctgg aacagagaga cacactgcca ccagcacaaa tactgcgacc 300
    ccaacctagg gcttcgggtc cagcagaagg gcacctcaga aacagacacc atctgcacct 360
    gtgaagaagg ctggcactgt acgagtgagg cctgtgagag ctgtgtcctg caccgctcat 420
    gctcgcccgg ctttggggtc aagcagattg ctacaggggt ttctgatacc atctgcgagc 480
    cctgcccagt cggcttcttc tccaatgtgt catctgcttt cgaaaaatgt cacccttgga 540
    caagctgtga gaccaaagac ctggttgtgc aacaggcagg cacaaacaag actgatgttg 600
    tctgtggtcc ccaggatcgg ctgagagccc tggtggtgat ccccatcatc ttcgggatcc 660
    tgtttgccat cctcttggtg ctggtcttta tcaaaaaggt ggccaagaag ccaaccaata 720
    aggcccccca ccccaagcag gaaccccagg agatcaattt tcccgacgat cttcctggct 780
    ccaacactgc tgctccagtg caggagactt tacatggatg ccaaccggtc acccaggagg 840
    atggcaaaga gagtcgcatc tcagtgcagg agagacagtg aggctgcacc cacccaggag 900
    tgtggccacg tgggcaaaca ggcagttggc cagagagcct ggtgctgctg ctgcaggggt 960
    gcaggcagaa gcggggagct atgcccagtc agtgccagcc cctc 1004
    <210> SEQ ID NO 86
    <211> LENGTH: 23
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <400> SEQUENCE: 86
    cagagttcac tgaaacggaa tgc 23
    <210> SEQ ID NO 87
    <211> LENGTH: 23
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <400> SEQUENCE: 87
    ggtggcagtg tgtctctctg ttc 23
    <210> SEQ ID NO 88
    <211> LENGTH: 25
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <400> SEQUENCE: 88
    ttccttgcgg tgaaagcgaa ttcct 25
    <210> SEQ ID NO 89
    <211> LENGTH: 19
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <400> SEQUENCE: 89
    gaaggtgaag gtcggagtc 19
    <210> SEQ ID NO 90
    <211> LENGTH: 20
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <400> SEQUENCE: 90
    gaagatggtg atgggatttc 20
    <210> SEQ ID NO 91
    <211> LENGTH: 20
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <400> SEQUENCE: 91
    caagcttccc gttctcagcc 20
    <210> SEQ ID NO 92
    <211> LENGTH: 1579
    <212> TYPE: DNA
    <213> ORGANISM: Mus musculus
    <400> SEQUENCE: 92
    tgccctgcat ggtgtctttg cctcggctgt gcgcgctatg gggctgcttg ttgacagcgg 60
    tccatctagg gcagtgtgtt acgtgcagtg acaaacagta cctccacgat ggccagtgct 120
    gtgatttgtg ccagccagga agccgactga caagccactg cacagctctt gagaagaccc 180
    aatgccaccc atgtgactca ggcgaattct cagcccagtg gaacagggag attcgctgtc 240
    accagcacag acactgtgaa cccaatcaag ggcttcgggt taagaaggag ggcaccgcag 300
    aatcagacac tgtctgtacc tgtaaggaag gacaacactg caccagcaag gattgcgagg 360
    catgtgctca gcacacgccc tgtatccctg gctttggagt tatggagatg gccactgaga 420
    ccactgatac cgtctgtcat ccctgcccag tcggcttctt ctccaatcag tcatcacttt 480
    tcgaaaagtg ttatccctgg acaagctgtg aggataagaa cttggaggtc ctacagaaag 540
    gaacgagtca gactaatgtc atctgtggtt taaagtcccg gatgcgagcc ctgctggtca 600
    ttcctgtcgt gatgggcatc ctcatcacca ttttcggggt gtttctctat atcaaaaagg 660
    tggtcaagaa accaaaggat aatgagatgt taccccctgc ggctcgacgg caagatcccc 720
    aggagatgga agattatccc ggtcataaca ccgctgctcc agtgcaggag acactgcacg 780
    ggtgtcagcc tgtcacacag gaggatggta aagagagtcg catctcagtg caggagcggc 840
    aggtgacaga cagcatagcc ttgaggcccc tggtctgaac cctggaactg ctttggaggc 900
    gatggctgct tgctgacctt tgaagtttga gatgagccaa gacagagccc agtgcagcta 960
    actctcatgc ctgccccctg tcatttctca acttgctttt taaggatgga gggaaagctc 1020
    gggcatcggg aggtccacag tgatatctac caagtgcagc agtgcaggac ccagagttgt 1080
    cttgctgcgg cgttcactgt aaggagtcgt ggctacagga gtccgtggcc cgcagcttgt 1140
    gctcgtagag ggcacctggt tgccatcagc agggtactgg ctaaataaat ctgtaattat 1200
    ttatacaatg gcatctcaga aactctagca ggtggggcag aaaacaggta gtggaatgat 1260
    gggtagagaa acagctttta aaacacattc caaggcaggt aagatggctt ttgtgggtaa 1320
    aggagcttgc tgcccaaacc cggttacctg attttgatcc ctgggacttc atggtaaaag 1380
    ggagagaacc aaatccagag ggttgtcatt tgacctccat gtgtgctctg tggtaatgta 1440
    ccccgtgtgt gcacatgtgc acatatccta aaatggatgt ggtggtgtat tgtagaaatt 1500
    atttaatccg ccctgggttt ctacctgtgt gttaccattt agttcttgaa taaagacaca 1560
    ctcaaccttt atatttaca 1579
    <210> SEQ ID NO 93
    <211> LENGTH: 27
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <400> SEQUENCE: 93
    tgatatagag aaacaccccg aaaatgg 27
    <210> SEQ ID NO 94
    <211> LENGTH: 27
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <400> SEQUENCE: 94
    gccactgaga ccactgatac cgtctgt 27
    <210> SEQ ID NO 95
    <211> LENGTH: 20
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <400> SEQUENCE: 95
    gccagtacac ctgccacaaa 20
    <210> SEQ ID NO 96
    <211> LENGTH: 24
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <400> SEQUENCE: 96
    gaccaaattc cattttcctt cttg 24
    <210> SEQ ID NO 97
    <211> LENGTH: 28
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <400> SEQUENCE: 97
    aggcgagact ctgagccact cacatctg 28
    <210> SEQ ID NO 98
    <211> LENGTH: 20
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <400> SEQUENCE: 98
    ctgcatgtcc ggaggaaatt 20
    <210> SEQ ID NO 99
    <211> LENGTH: 19
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <400> SEQUENCE: 99
    agccatcgtc tgtggcaaa 19
    <210> SEQ ID NO 100
    <211> LENGTH: 22
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <400> SEQUENCE: 100
    ctggcgcaat gtcacgaggc tg 22
    <210> SEQ ID NO 101
    <211> LENGTH: 23
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <400> SEQUENCE: 101
    cactgatacc gtctgtcatc cct 23
    <210> SEQ ID NO 102
    <211> LENGTH: 25
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <400> SEQUENCE: 102
    agttcttatc ctcacagctt gtcca 25
    <210> SEQ ID NO 103
    <211> LENGTH: 31
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <400> SEQUENCE: 103
    agtcggcttc ttctccaatc agtcatcact t 31
    <210> SEQ ID NO 104
    <211> LENGTH: 23
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <400> SEQUENCE: 104
    cactgatacc gtctgtcatc cct 23
    <210> SEQ ID NO 105
    <211> LENGTH: 25
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <400> SEQUENCE: 105
    ccacatccgg gactttaaac cttgt 25
    <210> SEQ ID NO 106
    <211> LENGTH: 27
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <400> SEQUENCE: 106
    ccagtcggct tcttctccaa tcagtca 27
    <210> SEQ ID NO 107
    <211> LENGTH: 24
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <400> SEQUENCE: 107
    tgtgttacgt gcagtgacaa acag 24
    <210> SEQ ID NO 108
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <400> SEQUENCE: 108
    gcttcctggc tggcacaa 18
    <210> SEQ ID NO 109
    <211> LENGTH: 23
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <400> SEQUENCE: 109
    cctccacgat cgccagtgct gtg 23
    <210> SEQ ID NO 110
    <211> LENGTH: 15
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <400> SEQUENCE: 110
    tcgccgcttg ctgca 15
    <210> SEQ ID NO 111
    <211> LENGTH: 17
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <400> SEQUENCE: 111
    atcggccgtg atgtcga 17
    <210> SEQ ID NO 112
    <211> LENGTH: 23
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <400> SEQUENCE: 112
    ccatggtcaa ccccaccgtg ttc 23
    <210> SEQ ID NO 113
    <211> LENGTH: 15
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 113
    gctagtcact gagca 15
    <210> SEQ ID NO 114
    <211> LENGTH: 15
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 114
    caaagtccct gctag 15
    <210> SEQ ID NO 115
    <211> LENGTH: 15
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 115
    agccacaagt cactc 15
    <210> SEQ ID NO 116
    <211> LENGTH: 14
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 116
    agacaccatc gcag 14
    <210> SEQ ID NO 117
    <211> LENGTH: 15
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 117
    gcgagatcag aagag 15
    <210> SEQ ID NO 118
    <211> LENGTH: 15
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 118
    cgctgtcaac aagca 15
    <210> SEQ ID NO 119
    <211> LENGTH: 15
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 119
    ctgccctaga tggac 15
    <210> SEQ ID NO 120
    <211> LENGTH: 15
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 120
    ctggctggca caaat 15
    <210> SEQ ID NO 121
    <211> LENGTH: 15
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 121
    tgggttcaca gtgtc 15
    <210> SEQ ID NO 122
    <211> LENGTH: 15
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 122
    catctccata actcc 15
    <210> SEQ ID NO 123
    <211> LENGTH: 15
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 123
    cttgtccagg gataa 15
    <210> SEQ ID NO 124
    <211> LENGTH: 15
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: PNA Oligomer
    <400> SEQUENCE: 124
    cacagatgac attag 15
    <210> SEQ ID NO 125
    <211> LENGTH: 15
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 125
    tgatatagag aaaca 15
    <210> SEQ ID NO 126
    <211> LENGTH: 15
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 126
    tcttgaccac ctttt 15
    <210> SEQ ID NO 127
    <211> LENGTH: 15
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 127
    ctcattatcc tttgg 15
    <210> SEQ ID NO 128
    <211> LENGTH: 13
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 128
    ggttcagacc agg 13
    <210> SEQ ID NO 129
    <211> LENGTH: 15
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 129
    aaacttcaaa ggtca 15
    <210> SEQ ID NO 130
    <211> LENGTH: 15
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 130
    tttatttagc cagta 15
    <210> SEQ ID NO 131
    <211> LENGTH: 15
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 131
    agccccacgc actgg 15
    <210> SEQ ID NO 132
    <211> LENGTH: 938
    <212> TYPE: DNA
    <213> ORGANISM: Mus musculus
    <400> SEQUENCE: 132
    gcctcctggc ccttcagctg tggtctttcc cgttttctga ctttgcggtg acactgggga 60
    cttccttaga cctctctgga gacgctttcg gttctgcaga gattcccagg ggtattgtgg 120
    gtggggtggg gtaacaatag tgtccctgtg gcgctcccag tccctatagt aatccttcac 180
    ccctctgcta tcttgcaatc aggagagtcc ttagccctgc tataggtggc ttttgaggtc 240
    ctggatgcga ggagggggac tggggggtgg gtcgggtaat gtaagaaaag ggctcctttt 300
    gggaccctgg ctcctccagc caccttggtg cccatccctt aaactcttgg ggacaatcag 360
    actcctggga aggtcctggg gaaatccctg ctcagtgact agccataggc ccaccgcgat 420
    tggtgcccga agaccccgcc ctcttcctgg gcgggactcc tagcagggac tttggagtga 480
    cttgtggctt cagcaggagc cctgtgattt ggctcttctg atctcgccct gcgatggtgt 540
    ctttgcctcg gctgtgcgcg ctatggggct gcttgttgac agcggtgagt ggcttgtgtt 600
    ctaacctcca agggagttag ggcttagaga gtgagagatg gaaagaggaa agaggagaca 660
    agactttgga gatgagagat cttcctactg gaagcggcgg ttagtaggat gggcaagatc 720
    tctcgcgtct tgacacacac acacacacac acaaatgagg tgggctgctc ctctttcctt 780
    ccagaaggtc ggggttctgt tccacgaagc ccacagggaa ccttagggag ggcattcctc 840
    cacagcggtg cctggacagc tttgtctgac ccaagccttg ctccggagct gactgcagag 900
    actggaaagg gttagcagac aggaagcctg gctggggg 938
    <210> SEQ ID NO 133
    <211> LENGTH: 20
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Oligonucleotide Primer
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: (1)..(20)
    <223> OTHER INFORMATION: n is a, c, g, or t
    <400> SEQUENCE: 133
    nnnnnnnnnn nnnnnnnnnn 20
    <210> SEQ ID NO 134
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Oligonucleotide Primer
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: (1)..(4)
    <223> OTHER INFORMATION: 2′-O-methoxyethyl gapmer with phosphorothioate
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: (15)..(18)
    <223> OTHER INFORMATION: 2′-O-methoxyethyl gapmer with phosphorothioate
    <400> SEQUENCE: 134
    tctcactcct atcccagt 18
    <210> SEQ ID NO 135
    <211> LENGTH: 15
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Oligonucleotide Primer
    <400> SEQUENCE: 135
    cactgatcag ataag 15
    <210> SEQ ID NO 136
    <211> LENGTH: 15
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: PNA Oligomer
    <400> SEQUENCE: 136
    actagtgcta gcgtc 15
    <210> SEQ ID NO 137
    <211> LENGTH: 15
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Oligonucleotide Primer
    <400> SEQUENCE: 137
    cgtcatgata ccgat 15
    <210> SEQ ID NO 138
    <211> LENGTH: 15
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: PNA Oligomer
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: (1)..(1)
    <223> OTHER INFORMATION: L-histidine
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: (15)..(15)
    <223> OTHER INFORMATION: Lysine-NH2
    <400> SEQUENCE: 138
    attagtctga ctcgt 15
    <210> SEQ ID NO 139
    <211> LENGTH: 15
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: PNA Oligomer
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: (1)..(1)
    <223> OTHER INFORMATION: L-histidine
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: (15)..(15)
    <223> OTHER INFORMATION: Lysine-NH2
    <400> SEQUENCE: 139
    acattagtct gactc 15
    <210> SEQ ID NO 140
    <211> LENGTH: 15
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: PNA Oligomer
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: (1)..(1)
    <223> OTHER INFORMATION: L-histidine
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: (15)..(15)
    <223> OTHER INFORMATION: Lysine
    <400> SEQUENCE: 140
    tgacattagt ctgac 15
    <210> SEQ ID NO 141
    <211> LENGTH: 15
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: PNA Oligomer
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: (1)..(1)
    <223> OTHER INFORMATION: L-histidine
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: (15)..(15)
    <223> OTHER INFORMATION: Lysine
    <400> SEQUENCE: 141
    gatgacatta gtctg 15
    <210> SEQ ID NO 142
    <211> LENGTH: 15
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: PNA Oligomer
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: (1)..(1)
    <223> OTHER INFORMATION: L-histidine
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: (15)..(15)
    <223> OTHER INFORMATION: Lysine
    <400> SEQUENCE: 142
    cagatgacat tagtc 15
    <210> SEQ ID NO 143
    <211> LENGTH: 15
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: PNA Oligomer
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: (1)..(1)
    <223> OTHER INFORMATION: L-histidine
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: (15)..(15)
    <223> OTHER INFORMATION: Lysine
    <400> SEQUENCE: 143
    ctggactcac cacag 15
    <210> SEQ ID NO 144
    <211> LENGTH: 15
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: PNA Oligomer
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: (1)..(1)
    <223> OTHER INFORMATION: L-histidine
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: (15)..(15)
    <223> OTHER INFORMATION: Lysine
    <400> SEQUENCE: 144
    ggactcacca cagat 15
    <210> SEQ ID NO 145
    <211> LENGTH: 15
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: PNA Oligomer
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: (1)..(1)
    <223> OTHER INFORMATION: L-histidine
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: (15)..(15)
    <223> OTHER INFORMATION: Lysine
    <400> SEQUENCE: 145
    actcaccaca gatga 15
    <210> SEQ ID NO 146
    <211> LENGTH: 15
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: PNA Oligomer
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: (1)..(1)
    <223> OTHER INFORMATION: L-histidine
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: (15)..(15)
    <223> OTHER INFORMATION: Lysine
    <400> SEQUENCE: 146
    tcaccacaga tgaca 15
    <210> SEQ ID NO 147
    <211> LENGTH: 15
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: PNA Oligomer
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: (1)..(1)
    <223> OTHER INFORMATION: L-histidine
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: (15)..(15)
    <223> OTHER INFORMATION: Lysine
    <400> SEQUENCE: 147
    accacagatg acatt 15
    <210> SEQ ID NO 148
    <211> LENGTH: 7
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: PNA Oligomer
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: (1)..(1)
    <223> OTHER INFORMATION: L-histidine
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: (7)..(7)
    <223> OTHER INFORMATION: Lysine
    <400> SEQUENCE: 148
    acattag 7
    <210> SEQ ID NO 149
    <211> LENGTH: 8
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: PNA Oligomer
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: (1)..(1)
    <223> OTHER INFORMATION: L-histidine
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: (8)..(8)
    <223> OTHER INFORMATION: Lysine
    <400> SEQUENCE: 149
    gacattag 8
    <210> SEQ ID NO 150
    <211> LENGTH: 9
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: PNA Oligomer
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: (1)..(1)
    <223> OTHER INFORMATION: L-histidine
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: (9)..(9)
    <223> OTHER INFORMATION: Lysine
    <400> SEQUENCE: 150
    tgacattag 9
    <210> SEQ ID NO 151
    <211> LENGTH: 10
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: PNA Oligomer
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: (1)..(1)
    <223> OTHER INFORMATION: L-histidine
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: (10)..(10)
    <223> OTHER INFORMATION: Lysine
    <400> SEQUENCE: 151
    atgacattag 10
    <210> SEQ ID NO 152
    <211> LENGTH: 11
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: PNA Oligomer
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: (1)..(1)
    <223> OTHER INFORMATION: L-histidine
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: (11)..(11)
    <223> OTHER INFORMATION: Lysine
    <400> SEQUENCE: 152
    gatgacatta g 11
    <210> SEQ ID NO 153
    <211> LENGTH: 12
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: PNA Oligomer
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: (1)..(1)
    <223> OTHER INFORMATION: L-histidine
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: (12)..(12)
    <223> OTHER INFORMATION: Lysine
    <400> SEQUENCE: 153
    agatgacatt ag 12
    <210> SEQ ID NO 154
    <211> LENGTH: 13
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: PNA Oligomer
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: (1)..(1)
    <223> OTHER INFORMATION: L-histidine
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: (13)..(13)
    <223> OTHER INFORMATION: Lysine
    <400> SEQUENCE: 154
    cagatgacat tag 13
    <210> SEQ ID NO 155
    <211> LENGTH: 14
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: PNA Oligomer
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: (1)..(1)
    <223> OTHER INFORMATION: L-histidine
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: (14)..(14)
    <223> OTHER INFORMATION: Lysine
    <400> SEQUENCE: 155
    acagatgaca ttag 14
    <210> SEQ ID NO 156
    <211> LENGTH: 16
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: PNA Oligomer
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: (1)..(1)
    <223> OTHER INFORMATION: L-histidine
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: (16)..(16)
    <223> OTHER INFORMATION: Lysine
    <400> SEQUENCE: 156
    ccacagatga cattag 16
    <210> SEQ ID NO 157
    <211> LENGTH: 17
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: PNA Oligomer
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: (1)..(1)
    <223> OTHER INFORMATION: L-histidine
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: (17)..(17)
    <223> OTHER INFORMATION: Lysine
    <400> SEQUENCE: 157
    accacagatg acattag 17
    <210> SEQ ID NO 158
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: PNA Oligomer
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: (1)..(1)
    <223> OTHER INFORMATION: L-histidine
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: (18)..(18)
    <223> OTHER INFORMATION: Lysine
    <400> SEQUENCE: 158
    caccacagat gacattag 18
    <210> SEQ ID NO 159
    <211> LENGTH: 19
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: PNA Oligomer
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: (1)..(1)
    <223> OTHER INFORMATION: L-histidine
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: (19)..(19)
    <223> OTHER INFORMATION: Lysine
    <400> SEQUENCE: 159
    tcaccacaga tgacattag 19
    <210> SEQ ID NO 160
    <211> LENGTH: 20
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: PNA Oligomer
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: (1)..(1)
    <223> OTHER INFORMATION: L-histidine
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: (20)..(20)
    <223> OTHER INFORMATION: Lysine
    <400> SEQUENCE: 160
    ctcaccacag atgacattag 20
    <210> SEQ ID NO 161
    <211> LENGTH: 19
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 161
    cgagaggcgg acgggaccg 19
    <210> SEQ ID NO 162
    <211> LENGTH: 21
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: (20)..(21)
    <223> OTHER INFORMATION: two-nucleobase overhang of deoxythymidine (dT)
    <400> SEQUENCE: 162
    cgagaggcgg acgggaccgt t 21
    <210> SEQ ID NO 163
    <211> LENGTH: 21
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <220> FEATURE:
    <221> NAME/KEY: misc_feature
    <222> LOCATION: (20)..(21)
    <223> OTHER INFORMATION: two-nucleobase ovrhang of deoxythymidine (dT)
    <400> SEQUENCE: 163
    cggtcccgtc cgcctctcgt t 21
    <210> SEQ ID NO 164
    <211> LENGTH: 19
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 164
    cggtcccgtc cgcctctcg 19
    <210> SEQ ID NO 165
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 165
    agtggtcctg ccgcctgg 18
    <210> SEQ ID NO 166
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 166
    tggtcctgcc gcctggtc 18
    <210> SEQ ID NO 167
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 167
    tgccgcctgg tctcacct 18
    <210> SEQ ID NO 168
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 168
    atggttcgtc tgcctctg 18
    <210> SEQ ID NO 169
    <211> LENGTH: 17
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 169
    tggttcgtct gctctgc 17
    <210> SEQ ID NO 170
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 170
    tcctctgggg ctgcttgc 18
    <210> SEQ ID NO 171
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 171
    tggggctgct tgctgacc 18
    <210> SEQ ID NO 172
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 172
    tgcttgctga ccgctgtc 18
    <210> SEQ ID NO 173
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 173
    tgctgaccgc tgtccatc 18
    <210> SEQ ID NO 174
    <211> LENGTH: 19
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 174
    gaccgctgtc cactccaga 19
    <210> SEQ ID NO 175
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 175
    tgtccatcca gaaccacc 18
    <210> SEQ ID NO 176
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 176
    ccatccagaa ccacccac 18
    <210> SEQ ID NO 177
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 177
    tccagaacca cccactgc 18
    <210> SEQ ID NO 178
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 178
    tcagtgctgt tctttgtg 18
    <210> SEQ ID NO 179
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 179
    tgctgttctt tgtgccag 18
    <210> SEQ ID NO 180
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 180
    tctttgtgcc agccagga 18
    <210> SEQ ID NO 181
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 181
    ttgtgccagc caggacag 18
    <210> SEQ ID NO 182
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 182
    aggacagaaa ctggtgag 18
    <210> SEQ ID NO 183
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 183
    acagaaactg gtgagtga 18
    <210> SEQ ID NO 184
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 184
    actggtgagt gactgcac 18
    <210> SEQ ID NO 185
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 185
    tgagtgactg cacagagt 18
    <210> SEQ ID NO 186
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 186
    actgcacaga gttcactg 18
    <210> SEQ ID NO 187
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 187
    agttcactga aacggaat 18
    <210> SEQ ID NO 188
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 188
    ctgaaacgga atgccttc 18
    <210> SEQ ID NO 189
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 189
    tgccttcctt gcggtgaa 18
    <210> SEQ ID NO 190
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 190
    tagacacctg gaacagag 18
    <210> SEQ ID NO 191
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 191
    gagacacact gccaccag 18
    <210> SEQ ID NO 192
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 192
    acaaatactg cgacccca 18
    <210> SEQ ID NO 193
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 193
    aatactgcga ccccaacc 18
    <210> SEQ ID NO 194
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 194
    actgcgaccc caacctag 18
    <210> SEQ ID NO 195
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 195
    gtccagcaga agggcacc 18
    <210> SEQ ID NO 196
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 196
    agcagaaggg cacctcag 18
    <210> SEQ ID NO 197
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 197
    cacctcagaa acagacac 18
    <210> SEQ ID NO 198
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 198
    cctcagaaac agacacca 18
    <210> SEQ ID NO 199
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 199
    gacaccatct gcacctgt 18
    <210> SEQ ID NO 200
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 200
    accatctgca cctgtgaa 18
    <210> SEQ ID NO 201
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 201
    tgtgaagaag gctggcac 18
    <210> SEQ ID NO 202
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 202
    aagaaggctg gcactgta 18
    <210> SEQ ID NO 203
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 203
    cctgtgagag ctgtgtcc 18
    <210> SEQ ID NO 204
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 204
    tgagagctgt gtcctgca 18
    <210> SEQ ID NO 205
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 205
    ctgtgtcctg caccgctc 18
    <210> SEQ ID NO 206
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 206
    ctcatgctcg cccggctt 18
    <210> SEQ ID NO 207
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 207
    tttggggtca agcagatt 18
    <210> SEQ ID NO 208
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 208
    gattgctaca ggggtttc 18
    <210> SEQ ID NO 209
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 209
    tacaggggtt tctgatac 18
    <210> SEQ ID NO 210
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 210
    ctgataccat ctgcgagc 18
    <210> SEQ ID NO 211
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 211
    accatctgcg agccctgc 18
    <210> SEQ ID NO 212
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 212
    atctgcgagc cctgccca 18
    <210> SEQ ID NO 213
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 213
    tgcgagccct gcccagtc 18
    <210> SEQ ID NO 214
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 214
    tcggcttctt ctccaatg 18
    <210> SEQ ID NO 215
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 215
    cttctccaat gtgtcatc 18
    <210> SEQ ID NO 216
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 216
    ctccaatgtg tcatctgc 18
    <210> SEQ ID NO 217
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 217
    tgtgtcatct gctttcga 18
    <210> SEQ ID NO 218
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 218
    aaaatgtcac ccttggac 18
    <210> SEQ ID NO 219
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 219
    acccttggac aagctgtg 18
    <210> SEQ ID NO 220
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 220
    gacaagctgt gagaccaa 18
    <210> SEQ ID NO 221
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 221
    tgtgagacca aagacctg 18
    <210> SEQ ID NO 222
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 222
    gacctggttg tgcaacag 18
    <210> SEQ ID NO 223
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 223
    caacaggcag gcacaaac 18
    <210> SEQ ID NO 224
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 224
    ggcaggcaca aacaagac 18
    <210> SEQ ID NO 225
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 225
    gactgatgtt gtctgtgg 18
    <210> SEQ ID NO 226
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 226
    gttgtctgtg gtccccag 18
    <210> SEQ ID NO 227
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 227
    gtccccagga tcggctga 18
    <210> SEQ ID NO 228
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 228
    ctgagagccc tggtggtg 18
    <210> SEQ ID NO 229
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 229
    agccctggtg gtgatccc 18
    <210> SEQ ID NO 230
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 230
    atcctgtttg ccatcctc 18
    <210> SEQ ID NO 231
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 231
    catcctcttg gtgctggt 18
    <210> SEQ ID NO 232
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 232
    tgctggtctt tatcaaaa 18
    <210> SEQ ID NO 233
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 233
    ccaagaagcc aaccaata 18
    <210> SEQ ID NO 234
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 234
    caccccaagc aggaaccc 18
    <210> SEQ ID NO 235
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 235
    gagatcaatt ttcccgac 18
    <210> SEQ ID NO 236
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 236
    tcaattttcc cgacgatc 18
    <210> SEQ ID NO 237
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 237
    gacgatcttc ctggctcc 18
    <210> SEQ ID NO 238
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 238
    acgatcttcc tggctcca 18
    <210> SEQ ID NO 239
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 239
    tccaacactg ctgctcca 18
    <210> SEQ ID NO 240
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 240
    cagtgcagga gactttac 18
    <210> SEQ ID NO 241
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 241
    gactttacat ggatgcca 18
    <210> SEQ ID NO 242
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 242
    ttacatggat gccaaccg 18
    <210> SEQ ID NO 243
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 243
    caggaggatg gcaaagag 18
    <210> SEQ ID NO 244
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 244
    tcagtgcagg agagacag 18
    <210> SEQ ID NO 245
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 245
    agacagtgag gctgcacc 18
    <210> SEQ ID NO 246
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 246
    gtgggcaaac aggcagtt 18
    <210> SEQ ID NO 247
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 247
    caggggtgca ggcagaag 18
    <210> SEQ ID NO 248
    <211> LENGTH: 18
    <212> TYPE: DNA
    <213> ORGANISM: Artificial Sequence
    <220> FEATURE:
    <223> OTHER INFORMATION: Synthetic Construct
    <400> SEQUENCE: 248
    gagctatgcc cagtcagt 18

Claims (69)

    What is claimed is:
  1. 1. An antisense compound 8 to 80 nucleobases in length targeted to a nucleic acid molecule encoding CD40, wherein said compound is at least 70% complementary to said nucleic acid molecule encoding CD40, and wherein said compound inhibits the expression of CD40 mRNA by at least 10%.
  2. 2. The antisense compound of claim 1 comprising 12 to 50 nucleobases in length.
  3. 3. The antisense compound of claim 2 comprising 15 to 30 nucleobases in length.
  4. 4. The antisense compound of claim 1 comprising an oligonucleotide.
  5. 5. The antisense compound of claim 4 comprising a DNA oligonucleotide.
  6. 6. The antisense compound of claim 4 comprising an RNA oligonucleotide.
  7. 7. The antisense compound of claim 4 comprising a chimeric oligonucleotide.
  8. 8. The antisense compound of claim 4 wherein at least a portion of said compound hybridizes with RNA to form an oligonucleotide-RNA duplex.
  9. 9. The antisense compound of claim 1 having at least 80% complementarity with said nucleic acid molecule encoding CD40.
  10. 10. The antisense compound of claim 1 having at least 90% complementarity with said nucleic acid molecule encoding CD40.
  11. 11. The antisense compound of claim 1 having at least 95% complementarity with said nucleic acid molecule encoding CD40.
  12. 12. The antisense compound of claim 1 having at least 99% complementarity with said nucleic acid molecule encoding CD40.
  13. 13. The antisense compound of claim 1 having at least one modified internucleoside linkage, sugar moiety, or nucleobase.
  14. 14. The antisense compound of claim 1 having at least one 2′-O-methoxyethyl sugar moiety.
  15. 15. The antisense compound of claim 1 having at least one phosphorothioate internucleoside linkage.
  16. 16. The antisense compound of claim 1 wherein at least one cytosine is a 5-methylcytosine.
  17. 17. A method of inhibiting the expression of CD40 in a cell or tissue comprising contacting said cell or tissue with the antisense compound of claim 1 so that expression of CD40 is inhibited.
  18. 18. The method of claim 17 wherein said cells are B-cells or macrophages.
  19. 19. A method of screening for a modulator of CD40, the method comprising the steps of:
    contacting a preferred target segment of a nucleic acid molecule encoding CD40 with one or more candidate modulators of CD40, and
    identifying one or more modulators of CD40 expression which modulate the expression of CD40.
  20. 20. The method of claim 19 wherein the modulator of CD40 expression comprises an oligonucleotide, an antisense oligonucleotide, a DNA oligonucleotide, an RNA oligonucleotide, an RNA oligonucleotide having at least a portion of said RNA oligonucleotide capable of hybridizing with RNA to form an oligonucleotide-RNA duplex, or a chimeric oligonucleotide.
  21. 21. A diagnostic method for identifying a disease state comprising identifying the presence of CD40 in a sample using at least one of the primers comprising SEQ ID NOs 86 or 87, or the probe comprising SEQ ID NO: 88.
  22. 22. A kit or assay device comprising the antisense compound of claim 1.
  23. 23. A method of treating an animal having a disease or condition associated with CD40 comprising administering to said animal a therapeutically or prophylactically effective amount of the antisense compound of claim 1 so that expression of CD40 is inhibited.
  24. 24. The method of claim 23 wherein the disease or condition is an immune-associated disorder, an inflammatory condition or a hyperproliferative condition.
  25. 25. The method of claim 24 wherein the immune-associated disorder is graft-versus-host disease, allograft rejection or an autoimmune disease or condition.
  26. 26. The method of claim 24 wherein the inflammatory condition is asthma, rheumatoid arthritis, allograft rejection, inflammatory bowel disease or psoriasis.
  27. 27. The method of claim 24 wherein the hyperproliferative condition is atherosclerosis, cancer or a tumor.
  28. 28. The antisense compound of claim 1, wherein said antisense compound comprises at least an 8-nucleobase portion of SEQ ID NOs 1, 2, 3, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 20, 23, 25, 26, 27, 31, 32, 33, 35, 37, 40, 41, 43, 46, 47, 49, 52, 53, 54, 57, 58, 59, 60, 64, 65, 71, 73, 74, 77, 81 or 82.
  29. 29. The antisense compound of claim 28, wherein said antisense compound has a sequence selected from the group consisting of SEQ ID NOs 1, 2, 3, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 20, 23, 25, 26, 27, 31, 32, 33, 35, 37, 40, 41, 43, 46, 47, 49, 52, 53, 54, 57, 58, 59, 60, 64, 65, 71, 73, 74, 77, 81 and 82.
  30. 30. The antisense compound of claim 1, wherein said antisense compound comprises at least an 8-nucleobase portion of SEQ ID NO 116, 117, 118, 119, 120, 123, 124, 125, 127, 128, 130, 131, 134, 138, 139, 142, 143, 144, 145, 146, 147, 153, 154, 155, 156, 157, 158, 159 or 160.
  31. 31. The antisense compound of claim 30, wherein said antisense compound has a sequence selected from the group consisting of SEQ ID NOs 116, 117, 118, 119, 120, 123, 124, 125, 127, 128, 130, 131, 134, 138, 139, 142, 143, 144, 145, 146, 147, 153, 154, 155, 156, 157, 158, 159 and 160.
  32. 32. The antisense compound of claim 1, wherein said antisense compound comprises an antisense nucleic acid molecule that is specifically hybridizable with a 5′-untraslated region (5′ UTR) of a nucleic acid molecule encoding CD40.
  33. 33. The antisense compound of claim 1, wherein said antisense compound comprises an antisense nucleic acid molecule that is specifically hybridizable with a start region of a nucleic acid molecule encoding CD40.
  34. 34. The antisense compound of claim 1, wherein said antisense compound comprises an antisense nucleic acid molecule that is specifically hybridizable with a coding region of a nucleic acid molecule encoding CD40.
  35. 35. The antisense compound of claim 1, wherein said antisense compound comprises an antisense nucleic acid molecule that is specifically hybridizable with a stop region of a nucleic acid molecule encoding CD40.
  36. 36. The antisense compound of claim 1, wherein said antisense compound comprises an antisense nucleic acid molecule that is specifically hybridizable with a 3′-untranslated region of a nucleic acid molecule encoding CD40.
  37. 37. The antisense compound of claim 1 which does not elicit RNase H cleavage of its RNA target in an antisense compound-target RNA duplex.
  38. 38. The antisense compound of claim 14 wherein every sugar moiety is a 2′-O-methoxyethyl sugar moiety.
  39. 39. The antisense compound of claim 1 which is a peptide-nucleic acid antisense compound.
  40. 40. The antisense compound of claim 39 wherein the peptide-nucleic acid antisense compound has at least one cationic moiety conjugated thereto.
  41. 41. The antisense compound of claim 40 wherein at least one cationic moiety is conjugated to the C-terminal end of the peptide-nucleic acid antisense compound.
  42. 42. The antisense compound of claim 40 wherein at least one cationic moiety is conjugated to the N-terminal end of the peptide-nucleic acid antisense compound.
  43. 43. The antisense compound of claim 40 wherein at least one cationic moiety is conjugated to the N-terminal end and at least one cationic moiety is conjugated to the C-terminal end of the peptide-nucleic acid antisense compound.
  44. 44. The antisense compound of claim 40 wherein the cationic moiety comprises a cationic amino acid.
  45. 45. The antisense compound of claim 44 wherein the cationic amino acid is L-lysine, D-lysine, L-dimethylysine, D-dimethylysine, L-histidine, D-histidine, L-ornithine, D-ornithine, L-arginine, L-homoarginine, D-homoarginine, L-norarginine, D-norarginine, L-homohomoarginine, D-homohomoarginine, lysine peptoid, 2,4-diamino butyric acid, homolysine or β-lysine.
  46. 46. The antisense compound of claim 45 wherein the cationic amino acid is L-lysine or L-arginine.
  47. 47. The antisense compound of claim 40 wherein the peptide-nucleic acid antisense compound has at least two cationic moieties conjugated thereto.
  48. 48. The antisense compound of claim 47 wherein the peptide-nucleic acid antisense compound has at least three cationic moieties conjugated thereto.
  49. 49. The antisense compound of claim 48 wherein the peptide-nucleic acid antisense compound has at least four cationic moieties conjugated thereto.
  50. 50. The antisense compound of claim 49 wherein the peptide-nucleic acid antisense compound has at least five cationic moieties conjugated thereto.
  51. 51. The antisense compound of claim 50 wherein the peptide-nucleic acid antisense compound has at least six cationic moieties conjugated thereto.
  52. 52. The antisense compound of claim 51 wherein the peptide-nucleic acid antisense compound has at least seven cationic moieties conjugated thereto.
  53. 53. The antisense compound of claim 52 wherein the peptide-nucleic acid antisense compound has at least eight cationic moieties conjugated thereto.
  54. 54. The antisense compound of claim 39 wherein the peptide-nucleic acid antisense compound is at least 12 nucleobases in length.
  55. 55. The antisense compound of claim 54 wherein the peptide-nucleic acid antisense compound is at least 14 nucleobases in length
  56. 56. The antisense compound of claim 1 wherein said CD40 is human or mouse CD40.
  57. 57. An antisense compound of claim 37 which causes redirection of splicing of CD40 RNA.
  58. 58. The antisense compound of claim 57 wherein the ratio of CD40 Type 2 transcript is increased relative to the CD40 Type 1 transcript.
  59. 59. the antisense compound of claim 58 wherein the expression of cell surface-associated CD40 is reduced.
  60. 60. The antisense compound of claim 1 which reduces CD40 signaling.
  61. 61. The antisense compound of claim 60 which reduces CD40-dependent IL-12 cytokine production.
  62. 62. A method of redirecting splicing of CD40 RNA in a cell or tissue comprising contacting said cell or tissue with an antisense compound of claim 57, so that the ratio of CD40 splice products is altered.
  63. 63. The method of claim 62 wherein the ratio of CD40 Type 2 transcript is increased relative to the CD40 Type 1 transcript.
  64. 64. The method of claim 63 wherein CD40 signaling is reduced.
  65. 65. The method of claim 64 wherein IL-12 cytokine production is reduced.
  66. 66. A method of reducing CD40 signaling in a cell or tissue comprising contacting said cell or tissue with an antisense compound of claim 57, so that the ratio of CD40 splice products is altered and CD40 signaling is reduced.
  67. 67. A method of reducing IL-12 cytokine production in a cell or tissue comprising contacting said cell or tissue with an antisense compound of claim 57, so that the ratio of CD40 splice products is altered and IL-12 cytokine production is reduced.
  68. 68. An immunomodulatory agent comprising an antisense compound of claim 1.
  69. 69. An immunomodulatory agent comprising an antisense compound of claim 57.
US10698689 1998-04-13 2003-10-31 Antisense modulation of CD40 expression Abandoned US20040186071A1 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
US8148398 true 1998-04-13 1998-04-13
US09067638 US7321828B2 (en) 1998-04-13 1998-04-28 System of components for preparing oligonucleotides
US10261382 US20040063618A1 (en) 2002-09-30 2002-09-30 Peptide nucleic acids having improved uptake and tissue distribution
PCT/US2003/031166 WO2004029075A3 (en) 2002-09-30 2003-09-30 Peptide nucleic acids having improved uptake and tissue distribution
US10698689 US20040186071A1 (en) 1998-04-13 2003-10-31 Antisense modulation of CD40 expression

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US10698689 US20040186071A1 (en) 1998-04-13 2003-10-31 Antisense modulation of CD40 expression
US11466369 US7745609B2 (en) 1998-04-13 2006-08-22 Antisense modulation of CD40 expression

Related Parent Applications (3)

Application Number Title Priority Date Filing Date
US09067638 Continuation-In-Part US7321828B2 (en) 1998-04-13 1998-04-28 System of components for preparing oligonucleotides
US10261382 Continuation-In-Part US20040063618A1 (en) 2002-09-30 2002-09-30 Peptide nucleic acids having improved uptake and tissue distribution
PCT/US2003/031166 Continuation-In-Part WO2004029075A3 (en) 2002-09-30 2003-09-30 Peptide nucleic acids having improved uptake and tissue distribution

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US11466369 Continuation US7745609B2 (en) 1998-04-13 2006-08-22 Antisense modulation of CD40 expression

Publications (1)

Publication Number Publication Date
US20040186071A1 true true US20040186071A1 (en) 2004-09-23



Family Applications (2)

Application Number Title Priority Date Filing Date
US10698689 Abandoned US20040186071A1 (en) 1998-04-13 2003-10-31 Antisense modulation of CD40 expression
US11466369 Active 2018-07-22 US7745609B2 (en) 1998-04-13 2006-08-22 Antisense modulation of CD40 expression

Family Applications After (1)

Application Number Title Priority Date Filing Date
US11466369 Active 2018-07-22 US7745609B2 (en) 1998-04-13 2006-08-22 Antisense modulation of CD40 expression

Country Status (1)

Country Link
US (2) US20040186071A1 (en)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060018971A1 (en) * 2004-05-12 2006-01-26 Terrence Scott Nucleic acid microspheres, production and delivery thereof
US20060024240A1 (en) * 2004-05-12 2006-02-02 Brown Larry R Delivery of as-oligonucleotide microspheres to induce dendritic cell tolerance for the treatment of autoimmune type 1 diabetes
US20060216343A1 (en) * 2004-11-05 2006-09-28 Steffen Panzner Pharmaceutical compositions comprising an oligonucleotide as an active agent
US20090017124A1 (en) * 2007-04-17 2009-01-15 Baxter International Inc. Nucleic Acid Microparticles for Pulmonary Delivery
US20110076322A1 (en) * 2005-09-15 2011-03-31 Steffen Panzner Amphoteric liposomes
US7964574B2 (en) 2006-08-04 2011-06-21 Baxter International Inc. Microsphere-based composition for preventing and/or reversing new-onset autoimmune diabetes
EP2222851B1 (en) * 2007-11-20 2017-06-28 Ionis Pharmaceuticals, Inc. Modulation of cd40 expression

Families Citing this family (49)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007087113A3 (en) * 2005-12-28 2008-12-24 Scripps Research Inst Natural antisense and non-coding rna transcripts as drug targets
CA2641303C (en) * 2006-01-31 2013-05-14 The University Of Toledo Na/k-atpase ligand
WO2008054792A3 (en) 2006-10-31 2008-12-04 Univ Toledo Na+/k+-atpase-specific peptide inhibitors/activators of src and src family kinases
RU2604489C2 (en) * 2008-10-03 2016-12-10 КьюРНА,Инк.,US Treatment of apolipoprotein-a1 related diseases by inhibition of natural antisense transcript to apolipoprotein-a1
JP6091752B2 (en) 2008-12-04 2017-03-08 クルナ・インコーポレーテッド Treatment of native erythropoietin by suppressing the antisense transcript (epo) related diseases for Epo
EP2370581B1 (en) 2008-12-04 2016-08-03 CuRNA, Inc. Treatment of vascular endothelial growth factor (vegf) related diseases by inhibition of natural antisense transcript to vegf
EP3009150A1 (en) 2009-02-12 2016-04-20 CuRNA, Inc. Treatment of brain derived neurotrophic factor (bdnf) related diseases by inhibition of natural antisense transcript to bdnf
CA2755409A1 (en) 2009-03-16 2010-09-23 Joseph Collard Treatment of nuclear factor (erythroid-derived 2)-like 2 (nrf2) related diseases by inhibition of natural antisense transcript to nrf2
US9708604B2 (en) 2009-03-17 2017-07-18 Curna, Inc. Treatment of delta-like 1 homolog (DLK1) related diseases by inhibition of natural antisense transcript to DLK1
JP5883782B2 (en) 2009-05-06 2016-03-15 クルナ・インコーポレーテッド Treatment of lipid transport metabolic gene associated disease by suppressing the natural antisense transcript on lipid transport metabolism genes
ES2609655T3 (en) 2009-05-06 2017-04-21 Curna, Inc. Treatment related tristetraprolina (TTP) diseases by inhibiting antisense transcript naturally TTP
ES2618572T3 (en) 2009-05-08 2017-06-21 Curna, Inc. Treatment related to the family of dystrophin diseases by inhibiting a natural antisense transcript for the family of dmd
CA2762369A1 (en) 2009-05-18 2010-11-25 Joseph Collard Treatment of reprogramming factor related diseases by inhibition of natural antisense transcript to a reprogramming factor
CN102549158B (en) 2009-05-22 2017-09-26 库尔纳公司 By inhibiting transcription factor for e3 (tfe3) natural antisense transcript treating TFE3 protein and insulin receptor substrate 2 (irs2) related diseases
US8791085B2 (en) 2009-05-28 2014-07-29 Curna, Inc. Treatment of antiviral gene related diseases by inhibition of natural antisense transcript to an antiviral gene
ES2629339T3 (en) 2009-06-16 2017-08-08 Curna, Inc. Treatment related Paraoxonase1 (PON1) diseases by inhibiting antisense transcript naturally PON1
US8859515B2 (en) 2009-06-24 2014-10-14 Curna, Inc. Treatment of tumor necrosis factor receptor 2 (TNFR2) related diseases by inhibition of natural antisense transcript to TNFR2
CN102482672B (en) 2009-06-26 2016-11-09 库尔纳公司 By suppressing natural antisense transcript Down's syndrome gene therapy Down's syndrome gene-related diseases
WO2011017516A3 (en) 2009-08-05 2011-07-28 Opko Curna, Llc Treatment of insulin gene (ins) related diseases by inhibition of natural antisense transcript to an insulin gene (ins)
JP6189594B2 (en) 2009-08-11 2017-08-30 クルナ・インコーポレーテッド Treatment of adiponectin adiponectin by suppressing the natural antisense transcript for (adipoq) (adipoq) related disease
WO2011022606A3 (en) 2009-08-21 2011-08-11 Opko Curna, Llc Treatment of 'c terminus of hsp70-interacting protein' (chip) related diseases by inhibition of natural antisense transcript to chip
WO2011031482A3 (en) 2009-08-25 2011-08-04 Opko Curna, Llc Treatment of 'iq motif containing gtpase activating protein' (iqgap) related diseases by inhibition of natural antisense transcript to iqgap
US20120302630A1 (en) 2009-09-16 2012-11-29 Chinese Academy Of Medical Sciences Na/K-ATPase Ligands, Ouabain Antagonists, Assays and Uses Thereof
EP2480667A4 (en) * 2009-09-25 2013-07-03 Isis Pharmaceuticals Inc Modulation of ttc39 expression to increase hdl
ES2661813T3 (en) 2009-12-16 2018-04-04 Curna, Inc. Treatment related transcription factor peptidase membrane, site 1 (mbtps1) by inhibiting natural antisense transcript to mbtps1 gene diseases
DK2516648T3 (en) 2009-12-23 2018-02-12 Curna Inc Treatment of hepatocytvækstfaktor- (HGF) related diseases by inhibition of the natural antisense transcript against HGF
US9068183B2 (en) 2009-12-23 2015-06-30 Curna, Inc. Treatment of uncoupling protein 2 (UCP2) related diseases by inhibition of natural antisense transcript to UCP2
CN102770540B (en) 2009-12-29 2017-06-23 库尔纳公司 63 is by inhibiting tumor protein (p63) of a natural antisense transcript treating p63 associated diseases
CN102782134B (en) 2009-12-29 2017-11-24 库尔纳公司 By inhibiting NRF 1 (nrf1) natural antisense transcripts treating related diseases NRF1
WO2011082281A3 (en) 2009-12-31 2012-04-12 Opko Curna, Llc Treatment of insulin receptor substrate 2 (irs2) related diseases by inhibition of natural antisense transcript to irs2 and transcription factor e3 (tfe3)
DK2521784T3 (en) 2010-01-04 2018-03-12 Curna Inc Treatment of interferon regulatory factor 8- (irf8) related diseases by inhibition of the natural antisense transcript against irf8
RU2612161C2 (en) 2010-01-06 2017-03-02 Курна, Инк. Treatment of pancreatic developmental gene related diseases by inhibition of natural antisense transcript to pancreatic developmental gene
CA2786535A1 (en) 2010-01-11 2011-07-14 Curna, Inc. Treatment of sex hormone binding globulin (shbg) related diseases by inhibition of natural antisense transcript to shbg
WO2011088208A1 (en) 2010-01-13 2011-07-21 The University Of Toledo Materials and methods related to sodium/potassium adenosine triphosphase and cholesterol
CN102782135A (en) 2010-01-25 2012-11-14 库尔纳公司 Treatment of RNase H1 related diseases by inhibition of natural antisense transcript to RNase H1
WO2011103528A3 (en) 2010-02-22 2012-01-19 Opko Curna Llc Treatment of pyrroline-5-carboxylate reductase 1 (pycr1) related diseases by inhibition of natural antisense transcript to pycr1
ES2657969T3 (en) 2010-04-02 2018-03-07 Curna, Inc. Treatment related colony stimulating factor 3 (CSF3) by inhibition of the natural antisense transcript to CSF3 diseases
RU2610661C2 (en) 2010-04-09 2017-02-14 Курна, Инк. Treatment of fibroblast growth factor 21 (fgf21) related diseases by inhibition of natural antisense transcript to fgf21
CN107988228A (en) 2010-05-03 2018-05-04 库尔纳公司 By inhibiting sirtuin (SIRT) natural antisense transcripts treating sirtuin (SIRT) related disease
KR101844091B1 (en) 2010-05-14 2018-03-30 큐알엔에이, 인크. Treatment of par4 related diseases by inhibition of natural antisense transcript to par4
EP2576784B1 (en) 2010-05-26 2017-11-15 CuRNA, Inc. Treatment of methionine sulfoxide reductase a (msra) related diseases by inhibition of natural antisense transcript to msra
RU2585229C2 (en) 2010-05-26 2016-05-27 Курна, Инк. Treatment of diseases associated with atonal homolog 1 (aton1) by inhibiting natural antisense transcript of gene aton1
WO2011163499A3 (en) 2010-06-23 2012-04-12 Opko Curna, Llc Treatment of sodium channel, voltage-gated, alpha subunit (scna) related diseases by inhibition of natural antisense transcript to scna
US8980860B2 (en) 2010-07-14 2015-03-17 Curna, Inc. Treatment of discs large homolog (DLG) related diseases by inhibition of natural antisense transcript to DLG
RU2624048C2 (en) 2010-10-06 2017-06-30 Курна, Инк. Treatment of diseases associated with the sialidase 4 (neu4) gene, by gene neu4 natural antisense transcript inhibition
CN103180445B (en) 2010-10-22 2018-02-16 库尔纳公司 By inhibiting α-L- iduronic acid enzyme (IDUA) natural antisense transcripts treating related diseases IDUA
CA2818824A1 (en) 2010-11-23 2012-05-31 Joseph Collard Treatment of nanog related diseases by inhibition of natural antisense transcript to nanog
CA2838588A1 (en) 2011-06-09 2012-12-13 Curna, Inc. Treatment of frataxin (fxn) related diseases by inhibition of natural antisense transcript to fxn
KR20170134766A (en) * 2012-05-25 2017-12-06 더 리젠츠 오브 더 유니버시티 오브 캘리포니아 Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription

Citations (93)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US651826A (en) * 1899-06-24 1900-06-19 Thomas J Ryan Automatic system of refrigeration.
US4587044A (en) * 1983-09-01 1986-05-06 The Johns Hopkins University Linkage of proteins to nucleic acids
US4667025A (en) * 1982-08-09 1987-05-19 Wakunaga Seiyaku Kabushiki Kaisha Oligonucleotide derivatives
US4800159A (en) * 1986-02-07 1989-01-24 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences
US4806463A (en) * 1986-05-23 1989-02-21 Worcester Foundation For Experimental Biology Inhibition of HTLV-III by exogenous oligonucleotides
US4824941A (en) * 1983-03-10 1989-04-25 Julian Gordon Specific antibody to the native form of 2'5'-oligonucleotides, the method of preparation and the use as reagents in immunoassays or for binding 2'5'-oligonucleotides in biological systems
US4828979A (en) * 1984-11-08 1989-05-09 Life Technologies, Inc. Nucleotide analogs for nucleic acid labeling and detection
US4835263A (en) * 1983-01-27 1989-05-30 Centre National De La Recherche Scientifique Novel compounds containing an oligonucleotide sequence bonded to an intercalating agent, a process for their synthesis and their use
US4904582A (en) * 1987-06-11 1990-02-27 Synthetic Genetics Novel amphiphilic nucleic acid conjugates
US4981957A (en) * 1984-07-19 1991-01-01 Centre National De La Recherche Scientifique Oligonucleotides with modified phosphate and modified carbohydrate moieties at the respective chain termini
US5013830A (en) * 1986-09-08 1991-05-07 Ajinomoto Co., Inc. Compounds for the cleavage at a specific position of RNA, oligomers employed for the formation of said compounds, and starting materials for the synthesis of said oligomers
US5023243A (en) * 1981-10-23 1991-06-11 Molecular Biosystems, Inc. Oligonucleotide therapeutic agent and method of making same
US5082830A (en) * 1988-02-26 1992-01-21 Enzo Biochem, Inc. End labeled nucleotide probe
US5109124A (en) * 1988-06-01 1992-04-28 Biogen, Inc. Nucleic acid probe linked to a label having a terminal cysteine
US5112963A (en) * 1987-11-12 1992-05-12 Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften E.V. Modified oligonucleotides
US5118802A (en) * 1983-12-20 1992-06-02 California Institute Of Technology DNA-reporter conjugates linked via the 2' or 5'-primary amino group of the 5'-terminal nucleoside
US5118800A (en) * 1983-12-20 1992-06-02 California Institute Of Technology Oligonucleotides possessing a primary amino group in the terminal nucleotide
US5177198A (en) * 1989-11-30 1993-01-05 University Of N.C. At Chapel Hill Process for preparing oligoribonucleoside and oligodeoxyribonucleoside boranophosphates
US5177196A (en) * 1990-08-16 1993-01-05 Microprobe Corporation Oligo (α-arabinofuranosyl nucleotides) and α-arabinofuranosyl precursors thereof
US5185444A (en) * 1985-03-15 1993-02-09 Anti-Gene Deveopment Group Uncharged morpolino-based polymers having phosphorous containing chiral intersubunit linkages
US5188897A (en) * 1987-10-22 1993-02-23 Temple University Of The Commonwealth System Of Higher Education Encapsulated 2',5'-phosphorothioate oligoadenylates
US5214134A (en) * 1990-09-12 1993-05-25 Sterling Winthrop Inc. Process of linking nucleosides with a siloxane bridge
US5214136A (en) * 1990-02-20 1993-05-25 Gilead Sciences, Inc. Anthraquinone-derivatives oligonucleotides
US5216141A (en) * 1988-06-06 1993-06-01 Benner Steven A Oligonucleotide analogs containing sulfur linkages
US5218105A (en) * 1990-07-27 1993-06-08 Isis Pharmaceuticals Polyamine conjugated oligonucleotides
US5220007A (en) * 1990-02-15 1993-06-15 The Worcester Foundation For Experimental Biology Method of site-specific alteration of RNA and production of encoded polypeptides
US5223618A (en) * 1990-08-13 1993-06-29 Isis Pharmaceuticals, Inc. 4'-desmethyl nucleoside analog compounds
US5276019A (en) * 1987-03-25 1994-01-04 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
US5278302A (en) * 1988-05-26 1994-01-11 University Patents, Inc. Polynucleotide phosphorodithioates
US5292873A (en) * 1989-11-29 1994-03-08 The Research Foundation Of State University Of New York Nucleic acids labeled with naphthoquinone probe
US5317098A (en) * 1986-03-17 1994-05-31 Hiroaki Shizuya Non-radioisotope tagging of fragments
US5319080A (en) * 1991-10-17 1994-06-07 Ciba-Geigy Corporation Bicyclic nucleosides, oligonucleotides, process for their preparation and intermediates
US5321131A (en) * 1990-03-08 1994-06-14 Hybridon, Inc. Site-specific functionalization of oligodeoxynucleotides for non-radioactive labelling
US5378825A (en) * 1990-07-27 1995-01-03 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogs
US5386023A (en) * 1990-07-27 1995-01-31 Isis Pharmaceuticals Backbone modified oligonucleotide analogs and preparation thereof through reductive coupling
US5391723A (en) * 1989-05-31 1995-02-21 Neorx Corporation Oligonucleotide conjugates
US5399676A (en) * 1989-10-23 1995-03-21 Gilead Sciences Oligonucleotides with inverted polarity
US5403711A (en) * 1987-11-30 1995-04-04 University Of Iowa Research Foundation Nucleic acid hybridization and amplification method for detection of specific sequences in which a complementary labeled nucleic acid probe is cleaved
US5405939A (en) * 1987-10-22 1995-04-11 Temple University Of The Commonwealth System Of Higher Education 2',5'-phosphorothioate oligoadenylates and their covalent conjugates with polylysine
US5405938A (en) * 1989-12-20 1995-04-11 Anti-Gene Development Group Sequence-specific binding polymers for duplex nucleic acids
US5407794A (en) * 1992-09-08 1995-04-18 Cytocolor Inc. Oxazine stained lymphocytes and method
US5414077A (en) * 1990-02-20 1995-05-09 Gilead Sciences Non-nucleoside linkers for convenient attachment of labels to oligonucleotides using standard synthetic methods
US5416203A (en) * 1989-06-06 1995-05-16 Northwestern University Steroid modified oligonucleotides
US5484908A (en) * 1991-11-26 1996-01-16 Gilead Sciences, Inc. Oligonucleotides containing 5-propynyl pyrimidines
US5486603A (en) * 1990-01-08 1996-01-23 Gilead Sciences, Inc. Oligonucleotide having enhanced binding affinity
US5489677A (en) * 1990-07-27 1996-02-06 Isis Pharmaceuticals, Inc. Oligonucleoside linkages containing adjacent oxygen and nitrogen atoms
US5491133A (en) * 1987-11-30 1996-02-13 University Of Iowa Research Foundation Methods for blocking the expression of specifically targeted genes
US5502177A (en) * 1993-09-17 1996-03-26 Gilead Sciences, Inc. Pyrimidine derivatives for labeled binding partners
US5508270A (en) * 1993-03-06 1996-04-16 Ciba-Geigy Corporation Nucleoside phosphinate compounds and compositions
US5507796A (en) * 1994-04-28 1996-04-16 Hasson; Harrith M. Method of suspending a pelvic organ and instrument for performing the method
US5510475A (en) * 1990-11-08 1996-04-23 Hybridon, Inc. Oligonucleotide multiple reporter precursors
US5512439A (en) * 1988-11-21 1996-04-30 Dynal As Oligonucleotide-linked magnetic particles and uses thereof
US5512667A (en) * 1990-08-28 1996-04-30 Reed; Michael W. Trifunctional intermediates for preparing 3'-tailed oligonucleotides
US5514785A (en) * 1990-05-11 1996-05-07 Becton Dickinson And Company Solid supports for nucleic acid hybridization assays
US5519126A (en) * 1988-03-25 1996-05-21 University Of Virginia Alumni Patents Foundation Oligonucleotide N-alkylphosphoramidates
US5519134A (en) * 1994-01-11 1996-05-21 Isis Pharmaceuticals, Inc. Pyrrolidine-containing monomers and oligomers
US5591584A (en) * 1994-08-25 1997-01-07 Chiron Corporation N-4 modified pyrimidine deoxynucleotides and oligonucleotide probes synthesized therewith
US5591722A (en) * 1989-09-15 1997-01-07 Southern Research Institute 2'-deoxy-4'-thioribonucleosides and their antiviral activity
US5594121A (en) * 1991-11-07 1997-01-14 Gilead Sciences, Inc. Enhanced triple-helix and double-helix formation with oligomers containing modified purines
US5595726A (en) * 1992-01-21 1997-01-21 Pharmacyclics, Inc. Chromophore probe for detection of nucleic acid
US5596091A (en) * 1994-03-18 1997-01-21 The Regents Of The University Of California Antisense oligonucleotides comprising 5-aminoalkyl pyrimidine nucleotides
US5596086A (en) * 1990-09-20 1997-01-21 Gilead Sciences, Inc. Modified internucleoside linkages having one nitrogen and two carbon atoms
US5597909A (en) * 1994-08-25 1997-01-28 Chiron Corporation Polynucleotide reagents containing modified deoxyribose moieties, and associated methods of synthesis and use
US5597696A (en) * 1994-07-18 1997-01-28 Becton Dickinson And Company Covalent cyanine dye oligonucleotide conjugates
US5599923A (en) * 1989-03-06