New! View global litigation for patent families

US20040076956A1 - Diagnosis of diseases associated with dna repair - Google Patents

Diagnosis of diseases associated with dna repair Download PDF

Info

Publication number
US20040076956A1
US20040076956A1 US10240589 US24058903A US20040076956A1 US 20040076956 A1 US20040076956 A1 US 20040076956A1 US 10240589 US10240589 US 10240589 US 24058903 A US24058903 A US 24058903A US 20040076956 A1 US20040076956 A1 US 20040076956A1
Authority
US
Grant status
Application
Patent type
Prior art keywords
dna
according
repair
genes
sequences
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US10240589
Inventor
Alexander Olek
Christian Piepenbrock
Kurt Berlin
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Epigenomics AG
Original Assignee
Epigenomics AG
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Hybridisation probes
    • C12Q1/6883Hybridisation probes for diseases caused by alterations of genetic material
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702Regulators; Modulating activity
    • C07K14/4703Inhibitors; Suppressors
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/82Translation products from oncogenes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Hybridisation probes
    • C12Q1/6883Hybridisation probes for diseases caused by alterations of genetic material
    • C12Q1/6886Hybridisation probes for diseases caused by alterations of genetic material for cancer
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/154Methylation markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers

Abstract

Chemically modified genomic sequences of genes associated with DNA repair, to oligonucleotides and/or PNA-oligomers for detecting the cytosine methylation state of genes associated with DNA repair which are directed against the sequence are disclosed. In addition, a method for ascertaining genetic and/or epigenetic parameters of genes associated with DNA repair is disclosed.

Description

  • [0001]
    The levels of observation that have been well studied by the methodological developments of recent years in molecular biology, are the genes themselves, the translation of these genes into RNA, and the resulting proteins. The question of which gene is switched on at which point in the course of the development of an individual, and how the activation and inhibition of specific genes in specific cells and tissues are controlled is correlatable to the degree and character of the methylation of the genes or of the genome. In this respect, pathogenic conditions may manifest themselves in a changed methylation pattern of individual genes or of the genome.
  • [0002]
    The present invention relates to nucleic acids, oligonucleotides, PNA-oligomers and to a method for the diagnosis and/or therapy of diseases which have a connection with the genetic and/or epigenetic parameters of genes associated with DNA repair and, in particular, with the methylation status thereof.
  • PRIOR ART
  • [0003]
    The ability to repair DNA damage is an essential component of the genetic mechanisms conserving genomic fidelity. DNA damage may take several forms, including single- and double-strand breaks, inter-and intrastrand crosslinks and different kinds of base modifications. DNA damage may be the result of a variety of factors. Common exogenous sources of DNA damage include, chemical compounds and irradiation. Endogenous sources include spontaneous chemical conversion (e.g. deamination or depurination), the effect of oxygen and free radicals (causing base damage and DNA strand breaks), and malfunctions in DNA replication mechanisms (causing base mismatches and deletions). At the cellular level DNA damage may affect functions such as transcription, DNA replication, cell cycle, apoptosis and mutagenesis. At the phenotypic level this can lead to the development of diseases such as cancer and ageing. Each cell has several complex methods in place to deal with both single base, or structural mismatches. Common repair pathways for double stranded breaks are homologous recombination based mechanisms. Another common mechanism for double stranded DNA break repair is non-homologous end joining. The mechanisms of double stranded break repair, and the diseases associated with them have been reviewed by Khanna and Jackson “DNA double-strand breaks: signalling, repair and the cancer connection.” Nature Genetics March 2001 ;27(3):247-254.
  • [0004]
    Small base mismatches are generally removed by base excision repair mechanisms, these comprise specific glycosylases that remove bases, followed by polymerases and ligases that fill in the gap left by the excision. Nucleotide excision repair (NER) removes a wide diversity of lesions, which include UV-induced lesions, bulky chemical adducts, several forms of base mismatches and some forms of oxidative damage. Several variations on the pathway exist, such as global genome nucleotide excision repair and transcription-coupled nucleotide excision repair. The generalised NER process involves the action of at least 30 proteins in a mechanism involving damage identification, localised unwinding of the DNA helix, excision of the damaged portion of DNA, synthesis of a new strand and subsequent ligation. The consequences of a defect in one of the NER proteins are apparent from three rare recessive photosensitive syndromes: xeroderma pigmentosum (XP), CS and the photosensitive form of the brittle hair disorder trichothiodystrophy (TTD), see below for further references. A further overview of DNA repair mechanisms is available from standard molecular biology textbooks such as Alberts et. al. ‘Molecular biology of the cell’ Garland Publishing.
  • [0005]
    That these mechanisms are highly conserved between species highlights their importance. Malfunctions in DNA repair pathways have been implicated in a number of diseases, including cancer and ageing. Diseases associated with DNA repair mechanisms include the following:
  • [0006]
    Ataxia telangiectasia: Allen et. al. ‘Ataxia telangiectasia mutated is essential during adult neurogenesis.’ Genes and Development Mar. 1, 2001;15(5):554-566.
  • [0007]
    Ageing: Martin et. al. ‘Genetic analysis of ageing: role of oxidative damage and environmental stresses’ Nature Genetics May 1996; 13 (1): 25.
  • [0008]
    Bloom's Syndrome: Karow et. al. ‘The Bloom's syndrome gene product promotes branch migration of holliday junctions.’ Proc Natl Acad Sci U S A Jun. 6, 2000;97(12):6504-8.
  • [0009]
    Immunodeficiency: Gennery et. al. ‘Immunodeficiency associated with DNA repair defects.’ Clin Exp Immunol July 2000;121(1):1-7.
  • [0010]
    Cockayne syndrome: Hanawalt ‘DNA repair: The bases for Cockayne syndrome’ Nature 405,(2000): 415-416.
  • [0011]
    Nijmegen breakage syndrome: Digweed et. al. ‘Nijmegen breakage syndrome: consequences of defective DNA double strand break repair.’ Bioessays August 1999;21(8):649-56.
  • [0012]
    Trichothiodystrophy:Vermeulen et. al. ‘Sublimiting concentration of TFIIH transcription/DNA repair factor causes TTD-A trichothiodystrophy disorder.’ Nature Genet November 2000;26(3):307-13.
  • [0013]
    Fanconi Anaemia: Thyagarajan and Campbell ‘Elevated homologous recombination activity in fanconi anemia fibroblasts.’: J Biol Chem Sep. 12, 1997;272(37):23328-33.
  • [0014]
    Werner Syndrome: Kamath-Loeb et. al. ‘Functional interaction between the Werner Syndrome protein and DNA polymerase delta.’ Proc Natl Acad Sci U S A Apr. 25, 2000;97(9):4603-8.
  • [0015]
    Breast cancer: Bertwistle et. al. ‘The pathology of familial breast cancer How do the functions of BRCA1 and BRCA2 relate to breast tumour pathology?’ Breast Cancer Res 1999;1(1):41-47.
  • [0016]
    Lung cancer:Spitz et. al. ‘Modulation of nucleotide excision repair capacity by XPD polymorphisms in lung cancer patients.’ Cancer Res Feb. 15, 2001;61(4):1354-7.
  • [0017]
    Skin cancer: Tomescu et. al. ‘Nucleotide excision repair gene XPD polymorphisms and genetic predisposition to melanoma.’ Carcinogenesis March 2001;22(3):403-408.
  • [0018]
    Disruptions in DNA repair pathways have been found to be involved in some of the most important genes concerned with cancer such as p53, BRCA1 and BRCA2.
  • [0019]
    The complexities of the pathways leading to DNA repair allow for many mechanisms by which it can be diverted. In addition to genomic mutations, the epigenetic control of genes has been implicated in disruptions to DNA repair pathways. The epigenetic parameter that has been best characterised is DNA methylation. Methylation of DNA repair genes has been implicated as a factor in tumorigenesis ‘Promoter hypermethylation patterns of p16, O6-methylguanine-DNA-methyltransferase, and death-associated protein kinase in tumors and saliva of head and neck cancer patients.’ Cancer Res Feb. 1, 2001;61(3):939-42. The identification of methylation of DNA repair genes as a factor in tumor malignancy opens up the possibility of creating alternative methods of treatment. Methylation based therapies could have considerable advantages over current methods of treatment such as chemotherapy, surgery and radiotherapy. Furthermore, as suggested by Rosas et. al. DNA methylation analysis may provide novel means of tumor diagnosis.
  • [0020]
    5-methylcytosine is the most frequent covalent base modification in the DNA of eukaryotic cells. It plays a role, for example, in the regulation of the transcription, in genetic imprinting, and in tumorigenesis. Therefore, the identification of 5-methylcytosine as a component of genetic information is of considerable interest. However, 5-methylcytosine positions cannot be identified by sequencing since 5-methylcytosine has the same base pairing behavior as cytosine. Moreover, the epigenetic information carried by 5-methylcytosine is completely lost during PCR amplification.
  • [0021]
    A relatively new and currently the most frequently used method for analyzing DNA for 5-methylcytosine is based upon the specific reaction of bisulfite with cytosine which, upon subsequent alkaline hydrolysis, is converted to uracil which corresponds to thymidine in its base pairing behavior. However, 5-methylcytosine remains unmodified under these conditions. Consequently, the original DNA is converted in such a manner that methylcytosine, which originally could not be distinguished from cytosine by its hybridization behavior, can now be detected as the only remaining cytosine using “normal” molecular biological techniques, for example, by amplification and hybridization or sequencing. All of these techniques are based on base pairing which can now be fully exploited. In terms of sensitivity, the prior art is defined by a method which encloses the DNA to be analyzed in an agarose matrix, thus preventing the diffusion and renaturation of the DNA (bisulfite only reacts with single-stranded DNA), and which replaces all precipitation and purification steps with fast dialysis (Olek A, Oswald J, Walter J. A modified and improved method for bisulphite based cytosine methylation analysis. Nucleic Acids Res. Dec. 15, 1996;24(24):5064-6). Using this method, it is possible to analyze individual cells, which illustrates the potential of the method. However, currently only individual regions of a length of up to approximately 3000 base pairs are analyzed, a global analysis of cells for thousands of possible methylation events is not possible. However, this method cannot reliably analyze very small fragments from small sample quantities either. These are lost through the matrix in spite of the diffusion protection.
  • [0022]
    An overview of the further known methods of detecting 5-methylcytosine may be gathered from the following review article: Rein, T., DePamphilis, M. L., Zorbas, H., Nucleic Acids Res. 1998, 26, 2255.
  • [0023]
    To date, barring few exceptions (e.g., Zeschnigk M, Lich C, Buiting K, Doerfler W, Horsthemke B. A single-tube PCR test for the diagnosis of Angelman and Prader-Willi syndrome based on allelic methylation differences at the SNRPN locus. Eur J Hum Genet. March-April 1997;5(2):94-8) the bisulfite technique is only used in research. Always, however, short, specific fragments of a known gene are amplified subsequent to a bisulfite treatment and either completely sequenced (Olek A, Walter J. The pre-implantation ontogeny of the H19 methylation imprint. Nat Genet. November 1997;17(3):275-6) or individual cytosine positions are detected by a primer extension reaction (Gonzalgo M L, Jones P A. Rapid quantitation of methylation differences at specific sites using methylation-sensitive single nucleotide primer extension (Ms-SNuPE). Nucleic Acids Res. Jun. 15, 1997;25(12):2529-31, WO 95/00669) or by enzymatic digestion (Xiong Z, Laird P W. COBRA: a sensitive and quantitative DNA methylation assay. Nucleic Acids Res. Jun. 15, 1997;25(12):2532-4). In addition, detection by hybridization has also been described (Olek et al., WO 99/28498).
  • [0024]
    Further publications dealing with the use of the bisulfite technique for methylation detection in individual genes are: Grigg G, Clark S. Sequencing 5-methylcytosine residues in genomic DNA. Bioessays. June 1994;16(6):431-6, 431; Zeschnigk M, Schmitz B, Dittrich B, Buiting K, Horsthemke B, Doerfler W. Imprinted segments in the human genome: different DNA methylation patterns in the Prader-Willi/Angelman syndrome region as determined by the genomic sequencing method. Hum Mol Genet. March 1997;6(3):387-95; Feil R, Charlton J, Bird A P, Walter J, Reik W. Methylation analysis on individual chromosomes: improved protocol for bisulphite genomic sequencing. Nucleic Acids Res. Feb. 25, 1994;22(4):695-6; Martin V, Ribieras S, Song-Wang X, Rio M C, Dante R. Genomic sequencing indicates a correlation between DNA hypomethylation in the 5′ region of the pS2 gene and its expression in human breast cancer cell lines. Gene. May 19, 1995;157(1-2):261-4; WO 97/46705, WO 95/15373 and WO 97/45560.
  • [0025]
    An overview of the Prior Art in oligomer array manufacturing can be gathered from a special edition of Nature Genetics (Nature Genetics Supplement, Volume 21, January 1999), published in January 1999, and from the literature cited therein.
  • [0026]
    Fluorescently labeled probes are often used for the scanning of immobilized DNA arrays. The simple attachment of Cy3 and Cy5 dyes to the 5′-OH of the specific probe are particularly suitable for fluorescence labels. The detection of the fluorescence of the hybridized probes may be carried out, for example via a confocal microscope. Cy3 and Cy5 dyes, besides many others, are commercially available.
  • [0027]
    Matrix Assisted Laser Desorption Ionization Mass Spectrometry (MALDI-TOF) is a very efficient development for the analysis of biomolecules (Karas M, Hillenkamp F. Laser desorption ionization of proteins with molecular masses exceeding 10,000 daltons. Anal Chem. Oct. 15, 1988;60(20):2299-301). An analyte is embedded in a light-absorbing matrix. The matrix is evaporated by a short laser pulse thus transporting the analyte molecule into the vapor phase in an unfragmented manner. The analyte is ionized by collisions with matrix molecules. An applied voltage accelerates the ions into a field-free flight tube. Due to their different masses, the ions are accelerated at different rates. Smaller ions reach the detector sooner than bigger ones.
  • [0028]
    MALDI-TOF spectrometry is excellently suited to the analysis of peptides and proteins. The analysis of nucleic acids is somewhat more difficult (Gut I G, Beck S. DNA and Matrix Assisted Laser Desorption Ionization Mass Spectrometry. Current Innovations and Future Trends. 1995, 1; 148-57). The sensitivity to nucleic acids is approximately 100 times worse than to peptides and decreases disproportionally with increasing fragment size. For nucleic acids having a multiply negatively charged backbone, the ionization process via the matrix is considerably less efficient. In MALDI-TOF spectrometry, the selection of the matrix plays an eminently important role. For the desorption of peptides, several very efficient matrixes have been found which produce a very fine crystallization. There are now several responsive matrixes for DNA, however, the difference in sensitivity has not been reduced. The difference in sensitivity can be reduced by chemically modifying the DNA in such a manner that it becomes more similar to a peptide. Phosphorothioate nucleic acids in which the usual phosphates of the backbone are substituted with thiophosphates can be converted into a chargeneutral DNA using simple alkylation chemistry (Gut IG, Beck S. A procedure for selective DNA alkylation and detection by mass spectrometry. Nucleic Acids Res. Apr. 25, 1995;23(8):1367-73). The coupling of a charge tag to this modified DNA results in an increase in sensitivity to the same level as that found for peptides. A further advantage of charge tagging is the increased stability of the analysis against impurities which make the detection of unmodified substrates considerably more difficult.
  • [0029]
    Genomic DNA is obtained from DNA of cell, tissue or other test samples using standard methods. This standard methodology is found in references such as Fritsch and Maniatis eds., Molecular Cloning: A Laboratory Manual, 1989.
  • DESCRIPTION
  • [0030]
    The object of the present invention is to provide the chemically modified DNA of genes associated with DNA repair, as well as oligonucleotides and/or PNA-oligomers for detecting cytosine methylations, as well as a method which is particularly suitable for the diagnosis and/or therapy of genetic and epigenetic parameters of genes associated with DNA repair. The present invention is based on the discovery that genetic and epigenetic parameters and, in particular, the cytosine methylation pattern of genes associated with DNA repair are particularly suitable for the diagnosis and/or therapy of diseases associated with DNA repair.
  • [0031]
    This objective is achieved according to the-present invention using a nucleic acid containing a sequence of at least 18 bases in length of the chemically pretreated DNA of genes associated with DNA repair according to one of Seq. ID No.1 through Seq. ID No.144 and sequences complementary thereto and/or a sequence of a chemically pretreated DNA of genes according to table 1 and sequences complementary thereto. In the table, after the listed gene designations, the respective data bank numbers (accession numbers) are specified which define the appertaining gene sequences as unique. GenBank was used as the underlying data bank, which is located at the National Institute of Health, internet address www.ncbi.nlm.nih.gov.
  • [0032]
    The chemically modified nucleic acid could heretofore not be connected with the ascertainment of genetic and epigenetic parameters.
  • [0033]
    The object of the present invention is further achieved by an oligonucleotide or oligomer for detecting the cytosine methylation state in chemically pretreated DNA, containing at least one base sequence having a length of at least 13 nucleotides which hybridizes to a chemically pretreated DNA of genes associated with DNA repair according to Seq. ID No.1 through Seq. ID No.144 and sequences complementary thereto and/or a sequence of a chemically pretreated DNA of genes according to table 1 and sequences complementary thereto. The oligomer probes according to the present invention constitute important and effective tools which, for the first time, make it possible to ascertain the genetic and epigenetic parameters of genes associated with DNA repair. The base sequence of the oligomers preferably contain at least one CpG dinucleotide. The probes may also exist in the form of a PNA (peptide nucleic acid) which has particularly preferred pairing properties. Particularly preferred are oligonucleotides according to the present invention in which the cytosine of the CpG dinucleotide is the 5th-9th nucleotide from the 5′-end of the 13-mer; in the case of PNA-oligomers, it is preferred for the cytosine of the CpG dinucleotide to be the 4th-6th nucleotide from the 5′-end of the 9-mer.
  • [0034]
    The oligomers according to the present invention are normally used in so called “sets” which contain at least one oligomer for each of the CpG dinucleotides of the sequences of Seq. ID No.1 through Seq. ID No.144 and sequences complementary thereto and/or a sequence of a chemically pretreated DNA of genes according to table 1 and sequences complementary thereto. Preferred is a set which contains at least one oligomer for each of the CpG dinucleotides from one of Seq. ID No.1 through Seq. ID No.144 and sequences complementary thereto and/or a sequence of a chemically pretreated DNA of genes according to table 1 and sequences complementary thereto.
  • [0035]
    Moreover, the present invention makes available a set of at least two oligonucleotides which can be used as so-called “primer oligonucleotides” for amplifying DNA sequences of one of Seq. ID No.1 through Seq. ID No.144 and sequences complementary thereto and/or a sequence of a chemically pretreated DNA of genes according to table 1 and sequences complementary thereto and fragments thereof.
  • [0036]
    In the case of the sets of oligonucleotides according to the present invention, it is preferred that at least one oligonucleotide is bound to a solid phase.
  • [0037]
    The present invention moreover relates to a set of at least 10 n (oligonucleotides and/or PNA-oligomers) used for detecting the cytosine methylation state in chemically pretreated genomic DNA (Seq. ID No.1 through Seq. ID No.144 and sequences complementary thereto and/or a sequence of a chemically pretreated DNA of genes according to table 1 and sequences complementary thereto). These probes enable diagnosis and/or therapy of genetic and epigenetic parameters of genes associated with DNA repair. The set of oligomers may also be used for detecting single nucleotide polymorphisms (SNPs) in the chemically pretreated DNA of genes associated with DNA repair according to one of Seq. ID No.1 through Seq. ID No.144 and sequences complementary thereto and/or a sequence of a chemically pretreated DNA of genes according to table 1 and sequences complementary thereto.
  • [0038]
    According to the present invention, it is preferred that an arrangement of different oligonucleotides and/or PNA-oligomers (a so-called “array”) made available by the present invention is present in a manner that it is likewise bound to a solid phase. This array of different oligonucleotide- and/or PNA-oligomer sequences can be characterized in that it is arranged on the solid phase in the form of a rectangular or hexagonal lattice. The solid phase surface is preferably composed of silicon, glass, polystyrene, aluminium, steel, iron, copper, nickel, silver, or gold. However, nitrocellulose as well as plastics such as nylon which can exist in the form of pellets or also as resin matrices are possible as well.
  • [0039]
    Therefore, a further subject matter of the present invention is a method for manufacturing an array fixed to a carrier material for analysis in connection with diseases associated with DNA repair in which method at least one oligomer according to the present invention is coupled to a solid phase. Methods for manufacturing such arrays are known, for example, from U.S. Pat. No. 5,744,305 by means of solid-phase chemistry and photolabile protecting groups.
  • [0040]
    A further subject matter of the present invention relates to a DNA chip for the analysis of diseases associated with DNA repair which contains at least one nucleic acid according to the present invention. DNA chips are known, for example, for U.S. Pat. No. 5,837,832.
  • [0041]
    Moreover, a subject matter of the present invention is a kit which may be composed, for example, of a bisulfite-containing reagent, a set of primer oligonucleotides containing at least two oligonucleotides whose sequences in each case correspond or are complementary to an 18 base long segment of the base sequences specified in the appendix (Seq. ID No.1 through Seq. ID No.144 and sequences complementary thereto and/or a sequence of a chemically pretreated DNA of genes according to table 1 and sequences complementary thereto), oligonucleotides and/or PNA-oligomers as well as instructions for carrying out and evaluating the described method. However, a kit along the lines of the present invention can also contain only part of the aforementioned components.
  • [0042]
    The present invention also makes available a method for ascertaining genetic and/or epigenetic parameters of genes associated with the cycle cell by analyzing cytosine methylations and single nucleotide polymorphisms, including the following steps:
  • [0043]
    In the first step of the method, a genomic DNA sample is chemically treated in such a manner that cytosine bases which are unmethylated at the 5′-position are converted to uracil, thymine, or another base which is dissimilar to cytosine in terms of hybridization behavior. This will be understood as ‘chemical pretreatment’ hereinafter.
  • [0044]
    The genomic DNA to be analyzed is preferably obtained form usual sources of DNA such as cells or cell components, for example, cell lines, biopsies, blood, sputum, stool, urine, cerebral-spinal fluid, tissue embedded in paraffin such as tissue from eyes, intestine, kidney, brain, heart, prostate, lung, breast or liver, histologic object slides, or combinations thereof.
  • [0045]
    The above described treatment of genomic DNA is preferably carried out with bisulfite (hydrogen sulfite, disulfite) and subsequent alkaline hydrolysis which results in a conversion of non-methylated cytosine nucleobases to uracil or to another base which is dissimilar to cytosine in terms of base pairing behavior.
  • [0046]
    Fragments of the chemically pretreated DNA are amplified, using sets of primer oligonucleotides according to the present invention, and a, preferably heat-stable polymerase. Because of statistical and practical considerations, preferably more than ten different fragments having a length of 100-2000 base pairs are amplified. The amplification of several DNA segments can be carried out simultaneously in one and the same reaction vessel. Usually, the amplification is carried out by means of a polymerase chain reaction (PCR).
  • [0047]
    In a preferred embodiment of the method, the set of primer oligonucleotides includes at least two olignonucleotides whose sequences are each reverse complementary or identical to an at least 18 base-pair long segment of the base sequences specified in the appendix (Seq. ID No.1 through Seq. ID No.144 and sequences complementary thereto and/or a sequence of a chemically pretreated DNA of genes according to table 1 and sequences complementary thereto). The primer oligonucleotides are preferably characterized in that they do not contain any CpG dinucleotides.
  • [0048]
    According to the present invention, it is preferred that at least one primer oligonucleotide is bonded to a solid phase during amplification. The different oligonucleotide and/or PNA-oligomer sequences can be arranged on a plane solid phase in the form of a rectangular or hexagonal lattice, the solid phase surface preferably being composed of silicon, glass, polystyrene, aluminium, steel, iron, copper, nickel, silver, or gold, it being possible for other materials such as nitrocellulose or plastics to be used as well.
  • [0049]
    The fragments obtained by means of the amplification can carry a directly or indirectly detectable label. Preferred are labels in the form of fluorescence labels, radionuclides, or detachable molecule fragments having a typical mass which can be detected in a mass spectrometer, it being preferred that the fragments that are produced have a single positive or negative net charge for better detectability in the mass spectrometer. The detection may be carried out and visualized by means of matrix assisted laser desorption/ionization mass spectrometry (MALDI) or using electron spray mass spectrometry (ESI).
  • [0050]
    The amplificates obtained in the second step of the method are subsequently hybridized to an array or a set of oligonucleotides and/or PNA probes. In this context, the hybridization takes place in the manner described in the following. The set of probes used during the hybridization is preferably composed of at least 10 oligonucleotides or PNA-oligomers. In the process, the amplificates serve as probes which hybridize to oligonucleotides previously bonded to a solid phase. The non-hybridized fragments are subsequently removed. Said oligonucleotides contain at least one base sequence having a length of 13 nucleotides which is reverse complementary or identical to a segment of the base sequences specified in the appendix, the segment containing at least one CpG dinucleotide. The cytosine of the CpG dinucleotide is the 5th to 9th nucleotide from the 5′-end of the 9-mer. One oligonucleotide exists for each CpG dinucleotide. Said PNA-oligomers contain at least one base sequence having a length of 9 nucleotides which is reverse complementary or identical to a segment of the base sequences specified in the appendix, the segment containing at least one CpG dinucleotide. The cytosine of the CpG dinucleotide is the 4th to 6th nucleotide seen from the 5′-end of the 9-mer. One oligonucleotide exists for each CpG dinucleotide.
  • [0051]
    In the fourth step of the method, the non-hybridized amplificates are removed. In the final step of the method, the hybridized amplificates are detected. In this context, it is preferred that labels attached to the amplificates are identifiable at each position of the solid phase at which an oligonucleotide sequence is located.
  • [0052]
    According to the present invention, it is preferred that the labels of the amplificates are fluorescence labels, radionuclides, or detachable molecule fragments having a typical mass which can be detected in a mass spectrometer. The mass spectrometer is preferred for the detection of the amplificates, fragments of the amplificates or of probes which are complementary to the amplificates, it being possible for the detection to be carried out and visualized by means of matrix assisted laser desorption/ionization mass spectrometry (MALDI) or using electron spray mass spectrometry (ESI).
  • [0053]
    The produced fragments may have a single positive or negative net charge for better detectability in the mass spectrometer. The aforementioned method is preferably used for ascertaining genetic and/or epigenetic parameters of genes associated with DNA repair.
  • [0054]
    The oligomers according to the present invention or arrays thereof as well as a kit according to the present invention are intended to be used for the diagnosis and/or therapy of diseases associated with DNA repair by analyzing methylation patterns of genes associated with DNA repair. According to the present invention, the method is preferably used for the diagnosis and/or therapy of important genetic and/or epigenetic parameters within genes associated with DNA repair.
  • [0055]
    The method according to the present invention is used, for example, for the diagnosis and/or therapy of diseases.
  • [0056]
    The nucleic acids according to the present invention of Seq. ID No.1 through Seq. ID No.144 and sequences complementary thereto and/or a sequence of a chemically pretreated DNA of genes according to table 1 and sequences complementary thereto can be used for the diagnosis and/or therapy of genetic and/or epigenetic parameters of genes associated with DNA repair.
  • [0057]
    The present invention moreover relates to a method for manufacturing a diagnostic agent and/or therapeutic agent for the diagnosis and/or therapy of diseases associated with DNA repair by analyzing methylation patterns of genes associated with DNA repair, the diagnostic agent and/or therapeutic agent being characterized in that at least one nucleic acid according to the present invention is used for manufacturing it, possibly together with suitable additives and auxiliary agents.
  • [0058]
    A further subject matter of the present invention-relates to a diagnostic agent and/or therapeutic agent for diseases associated with DNA repair by analyzing methylation patterns of genes associated with DNA repair, the diagnostic agent and/or therapeutic agent containing at least one nucleic acid according to the present invention, possibly together with suitable additives and auxiliary agents.
  • [0059]
    The present invention moreover relates to the diagnosis and/or prognosis of events which are disadvantageous to patients or individuals in which important genetic and/or epigenetic parameters within genes associated with DNA repair said parameters obtained by means of the present invention may be compared to another set of genetic and/or epigenetic parameters, the differences serving as the basis for a diagnosis and/or prognosis of events which are disadvantageous to patients or individuals.
  • [0060]
    In the context of the present invention the term “hybridization” is to be understood as a bond of an oligonucleotide to a completely complementary sequence along the lines of the Watson-Crick base pairings in the sample DNA, forming a duplex structure. To be understood by “stringent hybridization conditions” are those conditions in which a hybridization is carried out at 60° C. in 2.5×SSC buffer, followed by several washing steps at 37° C. in a low buffer concentration, and remains stable.
  • [0061]
    The term “functional variants” denotes all DNA sequences which are complementary to a DNA sequence, and which hybridize to the reference sequence under stringent conditions and have an activity similar to the corresponding polypeptide according to the present invention.
  • [0062]
    In the context of the present invention, “genetic parameters” are mutations and polymorphisms of genes associated with DNA repair and sequences further required for their regulation. To be designated as mutations are, in particular, insertions, deletions, point mutations, inversions and polymorphisms and, particularly preferred, SNPs (single nucleotide polymorphisms).
  • [0063]
    In the context of the present invention, “epigenetic parameters” are, in particular, cytosine methylations and further chemical modifications of DNA bases of genes associated with DNA repair and sequences further required for their regulation. Further epigenetic parameters include, for example, the acetylation of histones which, however, cannot be directly analyzed using the described method but which, in turn, correlates with the DNA methylation.
  • [0064]
    In the following, the present invention will be explained in greater detail on the basis of the sequences and examples with reference to the accompanying figure without being limited thereto.
  • [0065]
    [0065]FIG. 1
  • [0066]
    [0066]FIG. 1 shows the hybridisation of fluorescent labelled amplificates to a surface bound oligonucleotide. Sample I being from healthy tissue and sample II being from olgodendrogliome cerebrum (tumor) tissue. Fluorescence at a spot shows hybridisation of the amplificate to the oligonucleotide. Hybridisation to a CG oligonucleotide denotes methylation at the cytosine position being analysed, hybridisation to a TG oligonucleotide denotes no methylation at the cytosine position being analysed.
  • SEQ. ID NOS.1 to 144
  • [0067]
    Sequences having odd sequence numbers (e.g., Seq. ID No. 1, 3, 5, . . . ) exhibit in each case sequences of the chemically pretreated genomic DNAs of different genes associated with DNA repair.Sequences having even sequence numbers (e.g., Seq. ID No. 2, 4, 6, . . . ) exhibit in each case the sequences of the chemically pretreated genomic DNAs of genes associated with DNA repair which are complementary to the preceeding sequences (e.g., the complementary sequence to Seq. ID No.1 is Seq. ID No.2, the complementary sequence to Seq. ID No.3 is Seq. ID No.4, etc.)
  • Seq. ID Nos. 145 to 148
  • [0068]
    Seq. ID Nos. 145 to 148 show the sequences of oligonucleotides used in Example 1.
  • [0069]
    The following example relates to a fragment of a gene associated with DNA repair, in this case, Uracil-DNA glycosylase (UNG) in which a specific CG-position is analyzed for its methylation status.
  • EXAMPLE 1 Methylation Analysis in the Gene Uracil-DNA Glycosylase (UNG) Associated with DNA Repair
  • [0070]
    The following example relates to a fragment of the gene UNG in which a specific CG-position is to be analyzed for methylation.
  • [0071]
    In the first step, a genomic sequence is treated using bisulfite (hydrogen sulfite, disulfite) in such a manner that all cytosines which are not methylated at the 5-position of the base are modified in such a manner that a different base is substituted with regard to the base pairing behavior while the cytosines methylated at the 5-position remain unchanged.
  • [0072]
    If bisulfite solution is used for the reaction, then an addition takes place at the non-methylated cytosine bases. Moreover, a denaturating reagent or solvent as well as a radical interceptor must be present. A subsequent alkaline hydrolysis then gives rise to the conversion of non-methylated cytosine nucleobases to uracil. The chemically converted DNA (sequence ID 73) is then used for the detection of methylated cytosines. In the second method step, the treated DNA sample is diluted with water or an aqueous solution. Preferably, the DNA is subsequently desulfonated (10-30 min, 90-100° C.) at an alkaline pH value. In the third step of the method, the DNA sample is amplified in a polymerase chain reaction, preferably using a heat-resistant DNA polymerase. In the present case, cytosines of the gene UNG are analyzed. To this end, a defined fragment having a length of 476 bp is amplified with the specific primer oligonucleotides GTTATAGTTATAGTTAGGGT (Sequence ID No. 145) and TCTCCCCTCTAATTAAACAA (Sequence ID No. 146). This amplificate serves as a sample which hybridizes to an oligonucleotide previously bonded to a solid phase, forming a duplex structure, for example AGGAAGGCGGTGGGTTT (Sequence ID No. 147), the cytosine to be detected being located at position 252 of the amplificate. The detection of the hybridization product is based on Cy3 and Cy5 fluorescently labeled primer oligonucleotides which have been used for the amplification. A hybridization reaction of the amplified DNA with the oligonucleotide takes place only if a methylated cytosine was present at this location in the bisulfite-treated DNA. Thus, the methylation status of the specific cytosine to be analyzed is inferred from the hybridization product.
  • [0073]
    In order to verify the methylation status of the position, a sample of the amplificate is further hybridized to another oligonucleotide previously bonded to a solid phase. Said olignonucleotide is identical to the oligonucleotide previously used to analyze the methylation status of the sample, with the exception of the position in question. At the position to be analysed said oligonucleotide comprises a thymine base as opposed to a cytosine base i.e AGGAAGGTGGTGGGTTT (Sequence ID No. 148). Therefore, the hybridisation reaction only takes place if an unmethylated cytosine was present at the position to be analysed. The procedure was carried out on cell samples from 2 patients, sample I being from normal healthy tissue and sample II being from a olgodendrogliome cerebrum tumor sample.
  • [0074]
    From the results (FIG. 1) it can be seen that Sample I was methylated and sample II was unmethylated.
    Figure US20040076956A1-20040422-P00900
  • EXAMPLE 2 Diagnosis of Diseases Associated with DNA Repair
  • [0075]
    In order to relate the methylation patterns to one of the diseases associated with DNA repair, it is initially required to analyze the DNA methylation patterns of a group of diseased and of a group of healthy patients. These analyses are carried out, for example, analogously to Example 1. The results obtained in this manner are stored in a database and the CpG dinucleotides which are methylated differently between the two groups are identified. This can be carried out by determining individual CpG methylation rates as can be done, for example, in a relatively imprecise manner, by sequencing or else, in a very precise manner, by a methylation-sensitive “primer extension reaction”. It is also possible for the entire methylation status to be analyzed simultaneously, and for the patterns to be compared, for example, by clustering analyses which can be carried out, for example, by a computer.
  • [0076]
    Subsequently, it is possible to allocate the examined patients to a specific therapy group and to treat these patients selectively with an individualized therapy.
  • [0077]
    Example 2 can be carried, out, for example, for the following diseases: Ataxia telangiectasia, Ageing, Bloom's Syndrome, Immunodeficiency, Cockayne syndrome, Nijmegen breakage syndrome, Trichothiodystrophy, Fanconi Anaemia, Werner Syndrome, solid tumors and cancer
    TABLE I
    Listing of particularly preferred genes of the present
    invention associated with DNA repair
    Database Entry (Genbank, internet
    Gene address www.ncbi.nlm.nih.gov)
    PMS2L1 D38435
    PMS2L12 AF053356
    PMS2L2 D38436
    PMS2L3 D38437
    PMS2L4 D38438 and D38500
    PMS2L5 D38439
    PMS2L6 D38440
    MGMT NM_002412
    MSH2 NM_000251
    NUDT1 NM_002452
    TDG NM_003211
    INPPL1 NM_001567
    RFC4 NM_002916
    DDIT1L
    FANCB
    XRCC8
  • [0078]
    [0078]
  • 0
    SEQUENCE LISTING
    The patent application contains a lengthy “Sequence Listing” section. A copy of the “Sequence Listing” is available in electronic form from the USPTO
    web site (http://seqdata.uspto.gov/sequence.html?DocID=20040076956). An electronic copy of the “Sequence Listing” will also be available from the
    USPTO upon request and payment of the fee set forth in 37 CFR 1.19(b)(3).

Claims (32)

  1. 1. A nucleic acid comprising a sequence at least 18 bases in length of a segment of the chemically pretreated DNA of genes associated with DNA repair according to one of the sequences taken from the group of Seq. ID No.1 to Seq. ID No.144 and sequences complementary thereto.
  2. 2. A nucleic acid comprising a sequence at least 18 base pairs in length of a segment of the chemically pretreated DNA of genes associated with DNA repair according to a sequence according to one of the genes PMS2L1 (D38435), PMS2L12 (AF053356), PMS2L2 (D38436), PMS2L3 (D38437), PMS2L4 (D38438 and D38500), PMS2L5 (D38439), PMS2L6 (D38440), MGMT (NM002412), MSH2 (NM000251), NUDTI (NM002452), TDG (NM003211), INPPL1 (NM001567), RFC4 (NM002916), DDIT1L, FANCB, XRCC8 and sequences complementary thereto:
  3. 3. An oligomer, in particular an oligonucleotide or peptide nucleic acid (PNA)-oligomer, said oligomer comprising in each case at least one base sequence having a length of at least 9 nucleotides which hybridizes to or is identical to a chemically pretreated DNA of genes associated with DNA repair according to one of the Seq ID Nos 1 to 144 according to claim 1 or to a chemically pretreated DNA of genes according to claim 2 and sequences complementary thereto.
  4. 4. The oligomer as recited in claim 3; wherein the base sequence includes at least one CpG dinucleotide.
  5. 5. The oligomer as recited in claim 3; characterized in that the cytosine of the CpG dinucleotide is located approximately in the middle third of the oligomer.
  6. 6. A set of oligomers, comprising at least two oligomers according to any of claims 3 to 5.
  7. 7. A set of oligomers as recited in claim 6, comprising oligomers for detecting the methylation state of all CpG dinucleotides within one of the sequences according to Seq. ID Nos. 1 through 144 according to claim 1 or a chemically pretreated DNA of genes according to claim 2, and sequences complementary thereto
  8. 8. A set of at least two oligonucleotides as recited in claim 3, which can be used as primer oligonucleotides for the amplification of DNA sequences of one of Seq. ID No. 1 through Seq. ID No. 144 and sequences complementary thereto and/or sequences of a chemically pretreated DNA of genes according to claim 2, and sequences complementary thereto and segments thereof.
  9. 9. A set of oligonucleotides as recited in claim 8, characterized in that at least one oligonucleotide is bound to a solid phase.
  10. 10. Use of a set of oligomer probes comprising at least ten of the oligomers according to any of claims 6 through 9 for detecting the cytosine methylation state and/or single nucleotide polymorphisms (SNPS) in a chemically pretreated genomic DNA according to claim 1 or a chemically pretreated DNA of genes according to claim 2.
  11. 11. A method for manufacturing an arrangement of different oligomers (array) fixed to a carrier material for analyzing diseases associated with the methylation state of the CpG dinucleotides of one of the Seq. ID No. 1 through Seq. ID No. 144 and sequences complementary thereto and/or chemically pretreated DNA of genes according to claim 2, wherein at least one oligomer according to any of the claims 3 through 5 is coupled to a solid phase.
  12. 12. An arrangement of different oligomers (array) obtainable according to claim 11.
  13. 13. An array of different oligonucleotide- and/or PNA-oligomer sequences as recited in claim 12, characterized in that these are arranged on a plane solid phase in the form of a rectangular or hexagonal lattice.
  14. 14. The array as recited in any of the claims 12 or 13, characterized in that the solid phase surface is composed of silicon, glass, polystyrene, aluminium, steel, iron, copper, nickel, silver, or gold.
  15. 15. A DNA- and/or PNA-array for analyzing diseases associated with the methylation state of genes, comprising at least one nucleic acid according to one of the preceeding claims.
  16. 16. A method for ascertaining genetic and/or epigenetic parameters for the diagnosis and/or therapy of existing diseases or the predisposition to specific diseases by analyzing cytosine methylations, characterized in that the following steps are carried out:
    a) in a genomic DNA sample, cytosine bases which are unmethylated at the 5-position are converted, by chemical treatment, to uracil or another base which is dissimilar to cytosine in terms of hybridization behavior;
    b) fragments of the chemically pretreated genomic DNA are amplified using sets of primer oligonucleotides according to claim 8 or 9 and a polymerase, the amplificates carrying a detectable label;
    c) Amplificates are hybridized to a set of oligonucleotides and/or PNA probes according to the claims 6 and 7, or else to an array according to one of the claims 12 through 15;
    d) the hybridized amplificates are subsequently detected.
  17. 17. The method as recited in claim 16, characterized in that the chemical treatment is carried out by means of a solution of a bisulfite, hydrogen sulfite or disulfite.
  18. 18. The method as recited in one of the claims 16 or 17, characterized in that more than ten different fragments having a length of 100-2000 base pairs are amplified.
  19. 19. The method as recited in one of the claims 16 through 18, characterized in that the amplification of several DNA segments is carried out in one reaction vessel.
  20. 20. The method as recited in one of the claims 16 through 19, characterized in that the polymerase is a heat-resistant DNA polymerase.
  21. 21. The method as recited in claim 20, characterized in that the amplification is carried out by means of the polymerase chain reaction (PCR).
  22. 22. The method as recited in one of the claims 16 through 21, characterized in that the labels of the amplificates are fluorescence labels.
  23. 23. The method as recited in one of the claims 16 through 21, characterized in that the labels of the amplificates are radionuclides.
  24. 24. The method as recited in one of the claims 16 through 21, characterized in that the labels of the amplificates are detachable molecule fragments having a typical mass which are detected in a mass spectrometer.
  25. 25. The method as recited in one of the claims 16 through 21, characterized in that the amplificates or fragments of the amplificates are detected in the mass spectrometer.
  26. 26. The method as recited in one of the claims 24 and/or 25, characterized in that the produced fragments have a single positive or negative net charge for better detectability in the mass spectrometer.
  27. 27. The method as recited in one of the claims 24 through 26, characterized in that detection is carried out and visualized by means of matrix assisted laser desorption/ionization mass spectrometry (MALDI) or using electron spray mass spectrometry (ESI).
  28. 28. The method as recited in one of the claims 16 through 27, characterized in that the genomic DNA is obtained from cells or cellular components-which contain DNA, sources of DNA comprising, for example, cell lines, biopsies, blood, sputum, stool, urine, cerebral-spinal fluid, tissue embedded in paraffin such as tissue from eyes, intestine, kidney, brain, heart, prostate, lung, breast or liver, histologic object slides, and all possible combinations thereof.
  29. 29. A kit comprising a bisulfite (=disulfite, hydrogen sulfite) reagent as well as oligonucleotides and/or PNA-oligomers according to one of the claims 3 through 5.
  30. 30. The use of a nucleic acid according to claims 1 or 2, of an oligonucleotide or PNA-oligomer according to one of the claims 3 through 5, of a kit according to claim 29, of an array according to one of the claims 12 through 15, of a set of oligonucleotides according to one of claims 6 through 9 for the diagnosis of Ataxia telangiectasia, Ageing, Bloom's Syndrome, Immunodeficiency, Cockayne syndrome, Nijmegen breakage syndrome, Trichothiodystrophy, Fanconi Anaemia, Werner Syndrome, solid tumors and cancer.
  31. 31. The use of a nucleic acid according to claims 1 or 2, of an oligonucleotide or PNA-oligomer according to one of claims 3 through 5, of a kit according to claim 29, of an array according to one of the claims 12 through 15, of a set of oligonucleotides according to one of claims 6 through 9 for the therapy of Ataxia telangiectasia, Ageing, Bloom's Syndrome, Immunodeficiency, Cockayne syndrome, Nijmegen breakage syndrome, Trichothiodystrophy, Fanconi Anaemia, Werner Syndrome, solid tumors and cancer.
  32. 32. A kit, comprising a bisulfite (=disulfite, hydrogen sulfite) reagent as well as oligonucleotides and/or PNA-oligomers according to one of claims 3 through 5.
US10240589 2000-04-06 2001-04-06 Diagnosis of diseases associated with dna repair Abandoned US20040076956A1 (en)

Priority Applications (9)

Application Number Priority Date Filing Date Title
DE2000119058 DE10019058A1 (en) 2000-04-06 2000-04-06 Designing primers and probes for analyzing diseases associated with cytosine methylation state e.g. arthritis, cancer, aging, arteriosclerosis comprising fragments of chemically modified genes associated with cell cycle
DE10019058.8 2000-04-06
DE10019173 2000-04-07
DE10019173.8 2000-04-07
DE2000132529 DE10032529A1 (en) 2000-06-30 2000-06-30 Diagnosis of important genetic parameters within the major histocompatibility complex (MHC)
DE10032529.7 2000-06-30
DE10043826 2000-09-01
DE10043826.1 2000-09-01
PCT/EP2001/003972 WO2001081622A3 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with dna repair

Publications (1)

Publication Number Publication Date
US20040076956A1 true true US20040076956A1 (en) 2004-04-22

Family

ID=27437807

Family Applications (7)

Application Number Title Priority Date Filing Date
US10240485 Abandoned US20030148327A1 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with metastasis
US10240452 Abandoned US20030162194A1 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with apoptosis
US10240454 Abandoned US20040067491A1 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with metabolism
US10240589 Abandoned US20040076956A1 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with dna repair
US10240708 Abandoned US20050282157A1 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with dna replication
US10240453 Abandoned US20030148326A1 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with dna transcription
US10239676 Expired - Fee Related US7195870B2 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with gene regulation

Family Applications Before (3)

Application Number Title Priority Date Filing Date
US10240485 Abandoned US20030148327A1 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with metastasis
US10240452 Abandoned US20030162194A1 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with apoptosis
US10240454 Abandoned US20040067491A1 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with metabolism

Family Applications After (3)

Application Number Title Priority Date Filing Date
US10240708 Abandoned US20050282157A1 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with dna replication
US10240453 Abandoned US20030148326A1 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with dna transcription
US10239676 Expired - Fee Related US7195870B2 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with gene regulation

Country Status (5)

Country Link
US (7) US20030148327A1 (en)
EP (9) EP1268861A2 (en)
JP (3) JP2003531589A (en)
DE (2) DE60126593D1 (en)
WO (8) WO2001076451A3 (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090321626A1 (en) * 2006-05-26 2009-12-31 Akos Vertes Laser desorption ionization and peptide sequencing on laser induced silicon microcolumn arrays
US20100323917A1 (en) * 2009-04-07 2010-12-23 Akos Vertes Tailored nanopost arrays (napa) for laser desorption ionization in mass spectrometry
US9000361B2 (en) 2009-01-17 2015-04-07 The George Washington University Nanophotonic production, modulation and switching of ions by silicon microcolumn arrays
WO2015167959A1 (en) * 2014-04-28 2015-11-05 Sigma-Aldrich Co. Llc Epigenetic modification of mammalian genomes using targeted endonucleases

Families Citing this family (62)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6780982B2 (en) 1996-07-12 2004-08-24 Third Wave Technologies, Inc. Charge tags and the separation of nucleic acid molecules
US6818404B2 (en) 1997-10-23 2004-11-16 Exact Sciences Corporation Methods for detecting hypermethylated nucleic acid in heterogeneous biological samples
US8076063B2 (en) 2000-02-07 2011-12-13 Illumina, Inc. Multiplexed methylation detection methods
US7955794B2 (en) 2000-09-21 2011-06-07 Illumina, Inc. Multiplex nucleic acid reactions
US20030148327A1 (en) * 2000-04-06 2003-08-07 Alexander Olek Diagnosis of diseases associated with metastasis
WO2001093902A3 (en) * 2000-06-07 2002-04-18 Biosynexus Inc Immunostimulatory rna/dna hybrid molecules
US20040023230A1 (en) * 2000-06-30 2004-02-05 Alexander Olek Method and nucleic acids for pharmacogenomic methylation analysis
EP1337662A4 (en) * 2000-11-13 2004-09-08 Human Genetic Signatures Pty Detection of methylated dna molecules
DE10128508A1 (en) 2001-06-14 2003-02-06 Epigenomics Ag Methods and nucleic acids for the differentiation of prostate tumors
US7582420B2 (en) 2001-07-12 2009-09-01 Illumina, Inc. Multiplex nucleic acid reactions
WO2003031932A3 (en) 2001-10-05 2006-10-19 Univ Case Western Reserve Methods and compositions for detecting colon cancers
JP2003144172A (en) * 2001-11-16 2003-05-20 Nisshinbo Ind Inc Oligonucleotide-immobilized board for detecting methylation
US20110151438A9 (en) * 2001-11-19 2011-06-23 Affymetrix, Inc. Methods of Analysis of Methylation
DE10161625A1 (en) * 2001-12-14 2003-07-10 Epigenomics Ag Methods and nucleic acids for the analysis of a lung cell-cell division disruption
EP1497462A4 (en) * 2002-03-07 2007-11-07 Univ Johns Hopkins Med Genomic screen for epigenetically silenced genes associated with cancer
EP1344832A1 (en) * 2002-03-15 2003-09-17 Epigenomics AG Methods and nucleic acids for the analysis of methylation within the gene melastatin
WO2003083107A1 (en) * 2002-03-25 2003-10-09 The Board Of Trustees Of The University Of Arkansas Cpg retrieval of dna from formalin-fixed pathology specimen for promoter methylation analysis
JP2005532067A (en) * 2002-07-03 2005-10-27 コーリー ファーマシューティカル グループ,インコーポレイテッド The nucleic acid compositions for stimulating immune responses
US7807803B2 (en) 2002-07-03 2010-10-05 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US20040053880A1 (en) 2002-07-03 2004-03-18 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
EP1554407B1 (en) * 2002-10-01 2009-07-29 Epigenomics AG Method for the treatment of breast cell proliferative disorders
DE60331852D1 (en) * 2002-12-02 2010-05-06 Illumina Cambridge Ltd Determining the methylation of nucleic acid sequences
DE10304219B3 (en) * 2003-01-30 2004-08-19 Epigenomics Ag A method for detection of cytosine methylation patterns with high sensitivity
WO2004070062A3 (en) * 2003-02-04 2004-11-18 Eugene Brown Compositions and methods for diagnosing and treating cancers
US8168777B2 (en) 2004-04-29 2012-05-01 Human Genetic Signatures Pty. Ltd. Bisulphite reagent treatment of nucleic acid
US20050009059A1 (en) * 2003-05-07 2005-01-13 Affymetrix, Inc. Analysis of methylation status using oligonucleotide arrays
DE602004028478D1 (en) 2003-06-17 2010-09-16 Human Genetic Signatures Pty A process for genomamplifikation
US7485420B2 (en) * 2003-08-14 2009-02-03 Case Western Reserve University Methods and compositions for detecting colon cancers
US8415100B2 (en) 2003-08-14 2013-04-09 Case Western Reserve University Methods and compositions for detecting gastrointestinal and other cancers
DE10338308B4 (en) 2003-08-15 2006-10-19 Epigenomics Ag A method for detection of cytosine methylations in DNA
DE602004018801D1 (en) 2003-09-04 2009-02-12 Human Genetic Signatures Pty Nucleic acid detection test
EP1689885B1 (en) * 2003-10-20 2012-10-17 St Vincent's Hospital Sydney Limited Assessment of predisposition to cancer by quantitative determination of methylation in normal cells of healthy persons.
WO2005054517A3 (en) * 2003-12-01 2006-02-16 Susan Cottrell Methods and nucleic acids for the analysis of gene expression associated with the development of prostate cell proliferative disorders
EP1561821B1 (en) 2003-12-11 2011-02-16 Epigenomics AG Prognostic markers for prediction of treatment response and/or survival of breast cell proliferative disorder patients
US20050196792A1 (en) * 2004-02-13 2005-09-08 Affymetrix, Inc. Analysis of methylation status using nucleic acid arrays
DK1794173T3 (en) 2004-09-10 2010-10-25 Human Genetic Signatures Pty Amplification blocker comprising intercalating nucleic acids (INA) containing intercalating pseudonucleotides (IPN)
KR20060026595A (en) 2004-09-21 2006-03-24 (주)지노믹트리 Method for detecting methylaion of promoter using restriction enzyme and dna chip
KR100617649B1 (en) * 2004-09-24 2006-09-04 (주)지노믹트리 Composition For Cancer diagnosis Containing Methylated Promoters of Colon Cancer Specific Expression-decreased Genes and Use Thereof
ES2399054T3 (en) 2004-12-03 2013-03-25 Human Genetic Signatures Pty Ltd Methods for simplifying microbial nucleic acids by chemical modification of cytosine
US20060134650A1 (en) * 2004-12-21 2006-06-22 Illumina, Inc. Methylation-sensitive restriction enzyme endonuclease method of whole genome methylation analysis
WO2006088978A1 (en) 2005-02-16 2006-08-24 Epigenomics, Inc. Method for determining the methylation pattern of a polynucleic acid
WO2006113770A1 (en) 2005-04-15 2006-10-26 Epigenomics Ag A method for providing dna fragments derived from a remote sample
WO2006111586B1 (en) * 2005-04-20 2007-01-11 Proyecto Biomedicina Cima Sl Method for the in vitro determination of the degree of methylation of the line-1 promoter
WO2006125267A1 (en) 2005-05-26 2006-11-30 Human Genetic Signatures Pty Ltd Isothermal strand displacement amplification using primers containing a non-regular base
US20060292585A1 (en) * 2005-06-24 2006-12-28 Affymetrix, Inc. Analysis of methylation using nucleic acid arrays
WO2007030882A1 (en) 2005-09-14 2007-03-22 Human Genetic Signatures Pty Ltd Assay for a health state
US7465544B2 (en) * 2006-01-11 2008-12-16 Wisconsin Alumni Research Foundation Synthetic cofactor analogs of S-adenosylmethionine as ligatable probes of biological methylation and methods for their use
US7695913B2 (en) 2006-01-11 2010-04-13 Genomic Health, Inc. Gene expression markers for colorectal cancer prognosis
DE602007014278D1 (en) * 2006-02-28 2011-06-16 Charite Universitaetsmedizin Detection and quality control of regulatory T cells by means of DNA-methylation analysis of the FoxP3 gene
US7901882B2 (en) * 2006-03-31 2011-03-08 Affymetrix, Inc. Analysis of methylation using nucleic acid arrays
EP2471951A1 (en) * 2006-05-02 2012-07-04 University of Southhampton Predicting cognitive development by gene methylation analysis
WO2008096146A1 (en) 2007-02-07 2008-08-14 Solexa Limited Preparation of templates for methylation analysis
EP2644711A3 (en) * 2007-10-23 2013-12-11 Clinical Genomics Pty Ltd A method of diagnosing neoplasms - II
EP2215250B1 (en) 2007-11-27 2013-02-27 Human Genetic Signatures Pty Ltd Enzymes for amplification and copying bisulphite modified nucleic acids
EP2660337B1 (en) 2008-07-15 2016-09-14 Epigenomics AG Method of prediciting the prognosis of a breast cancer therapy based on gene methylation analysis
EP2340314B8 (en) 2008-10-22 2015-02-18 Illumina, Inc. Preservation of information related to genomic dna methylation
EP2470673B1 (en) 2009-08-28 2014-07-30 Cellular Dynamics International, Inc. Identifying genetic variation in affected tissues
US20140221229A1 (en) * 2011-04-28 2014-08-07 New York University Genomic signatures of metastasis in prostate cancer
KR20140064918A (en) 2011-09-07 2014-05-28 휴먼 제네틱 시그너처스 피티와이 엘티디 Molecular detection assay
EP2821487B1 (en) * 2012-02-29 2016-10-26 Sysmex Corporation Method for determining presence or absence of cancer cell derived from hepatocellular carcinoma, and determination marker and kit
KR101302173B1 (en) 2012-12-07 2013-08-30 이화여자대학교 산학협력단 Composition for diagnosing alzheimer's disease using methylation status of hmox1 gene and method for diagnosing alzheimer's disease using the same
US20140274757A1 (en) 2013-03-14 2014-09-18 Marie K. Kirby Differential Methylation Level of CpG Loci That Are Determinative of a Biochemical Reoccurrence of Prostate Cancer

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5744305A (en) * 1989-06-07 1998-04-28 Affymetrix, Inc. Arrays of materials attached to a substrate
US6017704A (en) * 1996-06-03 2000-01-25 The Johns Hopkins University School Of Medicine Method of detection of methylated nucleic acid using agents which modify unmethylated cytosine and distinguishing modified methylated and non-methylated nucleic acids
US6214556B1 (en) * 1997-11-27 2001-04-10 Epigenomics Ag Method for producing complex DNA methylation fingerprints
US6331393B1 (en) * 1999-05-14 2001-12-18 University Of Southern California Process for high-throughput DNA methylation analysis
US20030036081A1 (en) * 2001-07-02 2003-02-20 Epigenomics Ag Distributed system for epigenetic based prediction of complex phenotypes
US20030113750A1 (en) * 2001-06-14 2003-06-19 Juergen Distler Method and nucleic acids for the differentiation of prostate tumors

Family Cites Families (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5474796A (en) * 1991-09-04 1995-12-12 Protogene Laboratories, Inc. Method and apparatus for conducting an array of chemical reactions on a support surface
EP0969103A3 (en) 1993-06-22 2004-01-02 Baylor College Of Medicine Parallel primer extension approach to nucleic acid sequence analysis
US5837832A (en) 1993-06-25 1998-11-17 Affymetrix, Inc. Arrays of nucleic acid probes on biological chips
DE69433180D1 (en) * 1993-10-26 2003-10-30 Affymetrix Inc Fields of nukleinsaeuresonden on biological chips
JPH09506253A (en) 1993-11-30 1997-06-24 マクギル・ユニヴァーシティ Inhibition of Dna methyl transferase
US5858661A (en) * 1995-05-16 1999-01-12 Ramot-University Authority For Applied Research And Industrial Development Ataxia-telangiectasia gene and its genomic organization
US5871917A (en) 1996-05-31 1999-02-16 North Shore University Hospital Research Corp. Identification of differentially methylated and mutated nucleic acids
US6251594B1 (en) * 1997-06-09 2001-06-26 Usc/Norris Comprehensive Cancer Ctr. Cancer diagnostic method based upon DNA methylation differences
DE19750172C1 (en) * 1997-11-12 1998-10-01 Deutsches Krebsforsch DNA with promoter activity
EP1036202B1 (en) * 1997-12-05 2002-05-02 Max-Planck-Gesellschaft Zur Förderung Der Wissenschaften E.V. Method for identifying nucleic acids by means of matrix-assisted laser desorption/ionisation mass spectrometry
US6255293B1 (en) * 1998-07-24 2001-07-03 Yeda Research And Development Co., Ltd. Prevention of metastasis with 5-aza-2′-deoxycytidine
DE19905082C1 (en) * 1999-01-29 2000-05-18 Epigenomics Gmbh Identification of methylation patterns of cytosine in genome DNA comprises chemical treatment to produce different base pairing behavior between cytosine and 5-methylcytosine
US6783933B1 (en) * 1999-09-15 2004-08-31 The Johns Hopkins University School Of Medicine CACNA1G polynucleotide, polypeptide and methods of use therefor
US7332275B2 (en) * 1999-10-13 2008-02-19 Sequenom, Inc. Methods for detecting methylated nucleotides
US20040029123A1 (en) * 2000-03-15 2004-02-12 Alexander Olek Diagnosis of diseases associated with the cell cycle
US20030148327A1 (en) 2000-04-06 2003-08-07 Alexander Olek Diagnosis of diseases associated with metastasis
US20040023230A1 (en) 2000-06-30 2004-02-05 Alexander Olek Method and nucleic acids for pharmacogenomic methylation analysis
DE10037769A1 (en) 2000-08-03 2002-02-21 Epigenomics Gmbh Diagnosis of diseases associated with CD24
US6812339B1 (en) * 2000-09-08 2004-11-02 Applera Corporation Polymorphisms in known genes associated with human disease, methods of detection and uses thereof
DE10054972A1 (en) 2000-11-06 2002-06-06 Epigenomics Ag Diagnosis of diseases associated with humos
DE10054974A1 (en) 2000-11-06 2002-06-06 Epigenomics Ag Diagnosis of diseases associated with Cdk4

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5744305A (en) * 1989-06-07 1998-04-28 Affymetrix, Inc. Arrays of materials attached to a substrate
US6017704A (en) * 1996-06-03 2000-01-25 The Johns Hopkins University School Of Medicine Method of detection of methylated nucleic acid using agents which modify unmethylated cytosine and distinguishing modified methylated and non-methylated nucleic acids
US6214556B1 (en) * 1997-11-27 2001-04-10 Epigenomics Ag Method for producing complex DNA methylation fingerprints
US6331393B1 (en) * 1999-05-14 2001-12-18 University Of Southern California Process for high-throughput DNA methylation analysis
US20030113750A1 (en) * 2001-06-14 2003-06-19 Juergen Distler Method and nucleic acids for the differentiation of prostate tumors
US20030036081A1 (en) * 2001-07-02 2003-02-20 Epigenomics Ag Distributed system for epigenetic based prediction of complex phenotypes

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090321626A1 (en) * 2006-05-26 2009-12-31 Akos Vertes Laser desorption ionization and peptide sequencing on laser induced silicon microcolumn arrays
US8084734B2 (en) 2006-05-26 2011-12-27 The George Washington University Laser desorption ionization and peptide sequencing on laser induced silicon microcolumn arrays
US9000361B2 (en) 2009-01-17 2015-04-07 The George Washington University Nanophotonic production, modulation and switching of ions by silicon microcolumn arrays
US20100323917A1 (en) * 2009-04-07 2010-12-23 Akos Vertes Tailored nanopost arrays (napa) for laser desorption ionization in mass spectrometry
US9490113B2 (en) 2009-04-07 2016-11-08 The George Washington University Tailored nanopost arrays (NAPA) for laser desorption ionization in mass spectrometry
WO2015167959A1 (en) * 2014-04-28 2015-11-05 Sigma-Aldrich Co. Llc Epigenetic modification of mammalian genomes using targeted endonucleases

Also Published As

Publication number Publication date Type
EP1274865A2 (en) 2003-01-15 application
WO2001081622A2 (en) 2001-11-01 application
WO2001077377A8 (en) 2002-02-28 application
WO2001077378A3 (en) 2002-10-17 application
US20040067491A1 (en) 2004-04-08 application
WO2001081622A8 (en) 2002-05-16 application
EP1278893A2 (en) 2003-01-29 application
JP2003531589A (en) 2003-10-28 application
WO2001077377A2 (en) 2001-10-18 application
WO2001077376A2 (en) 2001-10-18 application
WO2001077164A8 (en) 2002-03-21 application
WO2001077164A2 (en) 2001-10-18 application
WO2001077375A2 (en) 2001-10-18 application
EP1274865B1 (en) 2007-02-14 grant
DE60126593D1 (en) 2007-03-29 grant
US20030162194A1 (en) 2003-08-28 application
EP1274866A2 (en) 2003-01-15 application
EP1370685A2 (en) 2003-12-17 application
US20050282157A1 (en) 2005-12-22 application
WO2001081622A3 (en) 2003-09-04 application
EP2014776A3 (en) 2009-04-01 application
US7195870B2 (en) 2007-03-27 grant
WO2001076451A3 (en) 2003-09-04 application
EP1360319A2 (en) 2003-11-12 application
EP1272670A2 (en) 2003-01-08 application
EP1268857A2 (en) 2003-01-02 application
US20030148326A1 (en) 2003-08-07 application
WO2001076451A9 (en) 2002-08-08 application
DE60126593T2 (en) 2007-10-31 grant
EP2014776A2 (en) 2009-01-14 application
WO2001092565A3 (en) 2002-09-06 application
JP2003534780A (en) 2003-11-25 application
WO2001077375A8 (en) 2002-10-24 application
WO2001076451A2 (en) 2001-10-18 application
US20030148327A1 (en) 2003-08-07 application
WO2001092565A2 (en) 2001-12-06 application
WO2001077376A3 (en) 2002-08-08 application
WO2001077164A3 (en) 2002-06-20 application
US20030082609A1 (en) 2003-05-01 application
WO2001077376A8 (en) 2002-03-21 application
JP2004508807A (en) 2004-03-25 application
WO2001092565A8 (en) 2002-05-30 application
WO2001077375A3 (en) 2002-06-27 application
WO2001077378A2 (en) 2001-10-18 application
EP1268861A2 (en) 2003-01-02 application
WO2001077377A3 (en) 2002-07-11 application

Similar Documents

Publication Publication Date Title
Kamiya et al. The cell cycle control gene ZAC/PLAGL1 is imprinted—a strong candidate gene for transient neonatal diabetes
Kobayashi et al. Reduced expression of the REIC/Dkk-3 gene by promoter-hypermethylation in human tumor cells
Abdollahi et al. LOT1 (PLAGL1/ZAC1), the candidate tumor suppressor gene at chromosome 6q24–25, is epigenetically regulated in cancer
MacGrogan et al. Structure and methylation-associated silencing of a gene within a homozygously deleted region of human chromosome band 8p22
Hesson et al. Frequent epigenetic inactivation of RASSF1A and BLU genes located within the critical 3p21. 3 region in gliomas
Kaneda et al. Identification of silencing of nine genes in human gastric cancers
Sato et al. The H-cadherin (CDH13) gene is inactivated in human lung cancer
Dammann et al. Hypermethylation of the cpG island of Ras association domain family 1A (RASSF1A), a putative tumor suppressor gene from the 3p21. 3 locus, occurs in a large percentage of human breast cancers
Renault et al. Base transitions are the most frequent genetic changes at p53 in gastric cancer
Sun et al. An infrequent point mutation of the p53 gene in human nasopharyngeal carcinoma
Simoneau et al. Evidence for two tumor suppressor loci associated with proximal chromosome 9p to q and distal chromosome 9q in bladder cancer and the initial screening for GAS1 and PTC mutations
US6251594B1 (en) Cancer diagnostic method based upon DNA methylation differences
US20040241651A1 (en) Detection of single nucleotide polymorphisms (snp's) and cytosine-methylations
Hogg et al. Frequent 3p allele loss and epigenetic inactivation of the RASSF1A tumour suppressor gene from region 3p21. 3 in head and neck squamous cell carcinoma
US20030148290A1 (en) Quantitative methylation detection in DNA samples
WO2000026401A1 (en) METHYLATED CpG ISLAND AMPLIFICATION (MCA)
US20030143606A1 (en) Diagnosis of diseases associated with the immune system by determining cytosine methylation
US20040234960A1 (en) Method for determining the degree of methylation of defined cytosines in genomic dna in the sequence context 5'-cpg-3'
Akama et al. Restriction landmark genomic scanning (RLGS-M)-based genome-wide scanning of mouse liver tumors for alterations in DNA methylation status
US20030129620A1 (en) Method for detecting cytosine methylation in dna samples
US20030119025A1 (en) Ligase/polymerase method for detecting cytosine methylation in dna samples
US20050064401A1 (en) Diagnosis of illnesses or predisposition to certain illnesses
US20030082600A1 (en) Highly sensitive method for the detection of cytosine methylation patters
US20050069879A1 (en) Method for high sensitivity detection of cytosine-methylation
WO2005007830A2 (en) Methods and compositions for diagnosis, staging and prognosis of prostate cancer

Legal Events

Date Code Title Description
AS Assignment

Owner name: EPIGENOMICS AG, GERMANY

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:OLEK, ALEXANDER;PIEPENBROCK, CHRISTIAN;BERLIN, KURT;REEL/FRAME:013829/0878

Effective date: 20021001