US20030166862A1 - Purified mammalian CTLA-8 antigens and related reagents - Google Patents

Purified mammalian CTLA-8 antigens and related reagents Download PDF

Info

Publication number
US20030166862A1
US20030166862A1 US10/417,674 US41767403A US2003166862A1 US 20030166862 A1 US20030166862 A1 US 20030166862A1 US 41767403 A US41767403 A US 41767403A US 2003166862 A1 US2003166862 A1 US 2003166862A1
Authority
US
United States
Prior art keywords
protein
ctla
antibody
peptide
val
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US10/417,674
Inventor
Pierre Golstein
Eric Rouvier
Francois Fossiez
Serge Lebecque
Odile Djossou
Jacques Banchereau
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institut National de la Sante et de la Recherche Medicale INSERM
Original Assignee
Institut National de la Sante et de la Recherche Medicale INSERM
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US08/250,846 external-priority patent/US6562333B1/en
Application filed by Institut National de la Sante et de la Recherche Medicale INSERM filed Critical Institut National de la Sante et de la Recherche Medicale INSERM
Priority to US10/417,674 priority Critical patent/US20030166862A1/en
Publication of US20030166862A1 publication Critical patent/US20030166862A1/en
Priority to US11/097,622 priority patent/US20050266445A1/en
Priority to US11/848,672 priority patent/US20090227021A1/en
Priority to US11/930,368 priority patent/US7879980B2/en
Abandoned legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/715Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52Cytokines; Lymphokines; Interferons
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/24Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against cytokines, lymphokines or interferons
    • C07K16/244Interleukins [IL]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10TECHNICAL SUBJECTS COVERED BY FORMER USPC
    • Y10STECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10S435/00Chemistry: molecular biology and microbiology
    • Y10S435/975Kit

Definitions

  • the present invention relates to compositions related to proteins which function in controlling physiology, development, and differentiation of mammalian cells, e.g., cells of a mammalian immune system.
  • mammalian cells e.g., cells of a mammalian immune system.
  • it provides proteins and mimetics which regulate cellular physiology, development, differentiation, or function of various cell types, including hematopoietic cells.
  • the immune system of vertebrates consists of a number of organs and several different cell types.
  • Two major cell types include the myeloid and lymphoid lineages.
  • lymphoid cell lineage are B cells, which were originally characterized as differentiating in fetal liver or adult bone marrow, and T cells, which were originally characterized as differentiating in the thymus. See, e.g., Paul (ed.) (1993) Fundamental Immunology (3d ed.) Raven Press, New York.
  • cytokines In many aspects of the development of an immune response or cellular differentiation, soluble proteins known as cytokines play a critical role in regulating cellular interactions. These cytokines apparently mediate cellular activities in many ways. They have been shown, in many cases, to modulate proliferation, growth, and differentiation of hematopoietic stem cells into the vast number of progenitors composing the lineages responsible for an immune response.
  • the present invention is based, in part, upon the discovery of a cDNA clone encoding a cytokine-like protein.
  • This protein has been designated CTLA-8.
  • CTLA-8 This protein has been designated CTLA-8.
  • the invention embraces isolated genes encoding the proteins of the invention, variants of the encoded protein, e.g., mutations (muteins) of the natural sequence, species and allelic variants, fusion proteins, chemical mimetics, antibodies, and other structural or functional analogs.
  • Various uses of these different nucleic acid or protein compositions are also provided.
  • the present invention embraces isolated genes encoding the proteins of the invention, variants of the encoded protein, e.g., mutations (muteins) of the natural sequence, species and allelic variants, fusion proteins, chemical mimetics, antibodies, and other structural or functional analogs. Various uses of these different nucleic acid or protein compositions are also provided.
  • the present invention provides a nucleic acid with at least 95% identity to one encoding a mammalian CTLA-8 protein or fragment thereof.
  • the encoding nucleic acid can comprise a sequence of SEQ ID NO: 1, 3, 5, 7, or 9.
  • the present invention also provides a substantially pure mammalian CTLA-8 protein or peptide thereof.
  • the protein or peptide can comprise at least one polypeptide segment of SEQ ID NO: 2, 4, 6, 8, or 10; exhibit a post-translational modification pattern distinct from a natural mammalian CTLA-8 protein; or induce a cell to secrete an inflammatory mediator, e.g., IL-6, IL-8, and/or PGE2.
  • a further embodiment is a composition comprising such a protein and a pharmaceutically acceptable carrier.
  • the invention includes an antibody which specifically binds to a primate CTLA-8 protein or peptide thereof; the antibody is raised against a protein sequence of SEQ ID NO: 2, 4, 6, 8 or 10; the antibody is a monoclonal antibody; the antibody blocks the CTLA-8 induced secretion of an inflammatory mediator, e.g., IL-6, IL-8, and/or PGE2; or the antibody is labeled.
  • an inflammatory mediator e.g., IL-6, IL-8, and/or PGE2
  • the invention also embraces a kit comprising a substantially pure nucleic acid at least 95% identical to one encoding a mammalian CTLA-8 protein or peptide; a substantially. pure mammalian CTLA-8 protein or fragment, e.g., as a positive control; or an antibody or receptor which specifically binds a mammalian CTLA-8 protein.
  • the availability of these reagents also provides methods of modulating physiology or development of a cell comprising contacting said cell with an agonist or antagonist of a CTLA-8 protein.
  • the method of modulation encompasses regulating CTLA-8 induced secretion of an inflammatory mediator, e.g., IL-6, IL-8, and/or PGE2, by contacting the cell or tissue with an antibody which specifically binds mammalian CTLA-8 or a substantially pure mammalian CTLA-8 protein.
  • the cell can be a synovial cell, epithelial cell, endothelial cell, fibroblast cell, or a carcinoma cell.
  • the present invention provides DNA sequence encoding various mammalian proteins which exhibit properties characteristic of functionally significant T cell expressed molecules.
  • the cDNA sequence exhibits various features which are characteristic of mRNAs encoding cytokines, growth factors, and oncogenes.
  • a murine gene originally thought to be from a mouse, but now recognized as rat as described herein contains an open reading frame encoding a putative 150 amino acid protein. This protein is 57% homologous to a putative protein encoded by a viral genome, the herpesvirus Saimiri ORF13. The message was isolated using a subtraction hybridization method applied to T cells.
  • CTLA-8 proteins are designated CTLA-8 proteins.
  • the natural proteins should be capable of mediating various physiological responses which would lead to biological or physiological responses in target cells. Initial studies had localized the message encoding this protein to various cell lines of hematopoietic cells. Genes encoding the antigen have been mapped to mouse chromosome 1A and human chromosome 2q31.
  • Murine CTLA-8 was originally cloned by Rouvier, et al. (1993) J. Immunol. 150:5445-5456. Similar sequences for proteins in other mammalian species should also be available.
  • CTLA-8 when cultured with synoviocytes, is able to induce the secretion of IL-6 from these cells. This induction is reversed upon the addition of a neutralizing antibody raised against human CTLA-8-8. Endothelial, epithelial, fibroblast and carcinoma cells also exhibit responses to treatment with CTLA-8. This data suggests that CTLA-8 may be implicated in inflammatory fibrosis, e.g., psoriasis, sclerodermia, lung fibrosis, or cirrhosis. CTLA-8 may also cause proliferation of carcinomas or other cancer cells inasmuch as IL-6 often acts as a growth factor for such cells.
  • Table 1 discloses the nucleotide and amino acid sequences of a murine CTLA-8 protein.
  • the described nucleotide sequences and the related reagents are useful in constructing a DNA clone useful for expressing CTLA-8 protein, or, e.g., isolating a homologous gene from another natural source.
  • the sequences will be useful in isolating other genes, e.g., allelic variants, from mouse, and similar procedures will be applied to isolate genes from other species, e.g., warm blooded animals, such as birds and mammals.
  • Cross hybridization will allow isolation of genes from other species.
  • a number of different approaches should be available to successfully isolate a suitable nucleic acid clone from other sources.
  • Mature polypeptide probably starts at about amino acid 13 (Ala).
  • the purified protein or defined peptides are useful for generating antibodies by standard methods, as described above.
  • Synthetic peptides or purified protein can be presented to an immune system to generate a specific binding composition, e.g., monoclonal or polyclonal antibodies. See, e.g., Coligan (1991) Current Protocols in Immunology Wiley/Greene; and Harlow and Lane (1989) Antibodies: A Laboratory Manual Cold Spring Harbor Press.
  • the specific binding composition could be used for screening of an expression library made from a cell line which expresses a CTLA-8 protein.
  • the screening can be standard staining of surface expressed protein, or by panning. Screening of intracellular expression can also be performed by various staining or immunofluorescence procedures.
  • the binding compositions could be used to affinity purify or sort out cells expressing the protein.
  • This invention contemplates use of isolated DNA or fragments to encode a biologically active corresponding CTLA-8 protein or polypeptide.
  • this invention covers isolated or recombinant DNA which encodes a biologically active protein or polypeptide and which is capable of hybridizing under appropriate conditions with the DNA sequences described herein.
  • Said biologically active protein or polypeptide can be an intact antigen, or fragment, and have an amino acid sequence as disclosed in Table 1.
  • this invention covers the use of isolated or recombinant DNA, or fragments thereof, which encode proteins which are homologous to a CTLA-8 protein or which were isolated using cDNA encoding a CTLA-8 protein as a probe.
  • the isolated DNA can have the respective regulatory sequences in the 5′ and 3′ flanks, e.g., promoters, enhancers, poly-A addition signals, and others.
  • the murine CTLA-8 gene has significant homology, about 60%, to the putative protein encoded by the open reading frame ORF13, of herpesvirus Saimiri (Table 2); to a human CTLA-8 counterpart (Table 3), about 60%; and to a mouse CTLA-8 counterpart (Table 4), about 80%.
  • Table 2 Nucleotide sequence of the related herpesvirus Saimiri open reading frame ORF13 and predicted amino acid sequence of encoded protein, see GenBank/EMBL accession number M60286.
  • the mature polypeptide probably starts at a position about amino acid 19 (Leu) to amino acid 21 (Ala).
  • METSerProGlyArgAlaSerSerValSerLeuMETLeuLeuLeuLeuLeuSerLeuAlaAlaThrValLys 24 AlaAlaAlaIleIleProGlnSerSerAlaCysProAsnThrGluAlaLysAspPheLeuGlnAsnValLys 48 ValAsnLeuLysValPheAsnSerLeuGlyAlaLysValSerSerArgArgProSerAspTyrLeuAsnArg 72 SerThrSerProTrpThrLeuHisArgAsnGluAspProAspArgTyrProSerValIleTrpGluAlaGln 96 CysArgHisGlnArgCysValAsnAlacluGlyLysLeuAspHisMETAsn
  • An “isolated” nucleic acid is a nucleic acid, e.g., an RNA, DNA, or a mixed polymer, which is substantially separated from other components which naturally accompany a native sequence, e.g., ribosomes, polymerases, and flanking genomic sequences from the originating species.
  • the term embraces a nucleic acid sequence which has been removed from its naturally occurring environment, and includes recombinant or cloned DNA isolates and chemically synthesized analogs or analogs biologically synthesized by heterologous systems.
  • a substantially pure molecule includes isolated forms of the molecule.
  • a purified species may be separated from host components from a recombinant expression system.
  • the size of homology of such a nucleic acid will typically be less than large vectors, e.g., less than tens of kB, typically less than several kB, and preferably in the 2-6 kB range.
  • An isolated nucleic acid will generally be a homogeneous composition of molecules, but will, in some embodiments, contain minor heterogeneity. This heterogeneity is typically found at the polymer ends or portions not critical to a desired biological function or activity.
  • a “recombinant” nucleic acid is defined either by its method of production or its structure. In reference to its method of production, e.g., a product made by a process, the process is use of recombinant nucleic acid techniques, e.g., involving human intervention in the nucleotide sequence, typically selection or production. Alternatively, it can be a nucleic acid made by generating a sequence comprising fusion of two fragments which are not naturally contiguous to each other, but is meant to exclude products of nature, e.g., naturally occurring mutants.
  • products made by transforming cells with any unnaturally occurring vector is encompassed, as are nucleic acids comprising sequence derived using any synthetic oligonucleotide process. Such is often done to replace a codon with a redundant codon encoding the same or a conservative amino acid, while typically introducing or removing a sequence recognition site. Alternatively, it is performed to join together nucleic acid segments of desired functions to generate a single genetic entity comprising a desired combination of functions not found in the commonly available natural forms. Restriction enzyme recognition sites are often the target of such artificial manipulations, but other site specific targets, e.g., promoters, DNA replication sites, regulation sequences, control sequences, or other useful features may be incorporated by design.
  • site specific targets e.g., promoters, DNA replication sites, regulation sequences, control sequences, or other useful features may be incorporated by design.
  • a similar concept is intended for a recombinant, e.g., fusion, polypeptide.
  • synthetic nucleic acids which, by genetic code redundancy, encode polypeptides similar to fragments of these antigens, and fusions of sequences from various different species variants.
  • a significant “fragment” in a nucleic acid context is a contiguous segment of at least about 17 nucleotides, generally at least 20 nucleotides, more generally at least 23 nucleotides, ordinarily at least 26 nucleotides, more ordinarily at least 29 nucleotides, often at least 32 nucleotides, more often at least 35 nucleotides, typically at least 38 nucleotides more typically at least 41 nucleotides, usually at least 44 nucleotides, more usually at least 47 nucleotides, preferably at least 50 nucleotides, more preferably at least 53 nucleotides, and in particularly preferred embodiments will be at least 56 or more nucleotides. Said fragments may have termini at any location, but especially at boundaries between structural domains.
  • a DNA which codes for a CTLA-8 protein will be particularly useful to identify genes, mRNA, and cDNA species which code for related or homologous proteins, as well as DNAs which code for homologous proteins from different species. There are likely homologues in other species, including primates. Various CTLA-8 proteins should be homologous and ate encompassed herein. However, even proteins that have a more distant evolutionary relationship to the antigen can readily be isolated under appropriate conditions using these sequences if they are sufficiently homologous. Primate CTLA-8 protein proteins are of particular interest.
  • This invention further covers recombinant DNA molecules and fragments having a DNA sequence identical to or highly homologous to the isolated DNAs set forth herein.
  • the sequences will often be operably linked to DNA segments which control transcription, translation, and DNA replication.
  • recombinant clones derived from the genomic sequences e.g., containing introns, will be useful for transgenic studies, including, e.g., transgenic cells and organisms, and for gene therapy. See, e.g., Goodnow (1992) “Transgenic Animals” in Roitt (ed.) Encyclopedia of Immunology Academic Press, San Diego, pp. 1502-1504; Travis (1992) Science 256:1392-1394; Kuhn, et al.
  • homologous nucleic acid sequences when compared, exhibit significant similarity.
  • the standards for homology in nucleic acids are either measures for homology generally used in the art by sequence comparison or based upon hybridization conditions. The hybridization conditions are described in greater detail below.
  • Substantial homology in the nucleic acid sequence comparison context means either that the segments, or their complementary strands, when compared, are identical when optimally aligned, with appropriate nucleotide insertions or deletions, in at least about 50% of the nucleotides, generally at least 56%, more generally at least 59%, ordinarily at least 62%, more ordinarily at least 65%, often at least 68%, more often at least 71%, typically at least 74%, more typically at least 77%, usually at least 80%, more usually at least about 85%, preferably at least about 90%, more preferably at least about 95 to 98% or more, and in particular embodiments, as high at about 99% or more of the nucleotides.
  • substantial homology exists when the segments will hybridize under selective hybridization conditions, to a strand, or its complement, typically using a sequence derived from Table 1, 2, or 3.
  • selective hybridization will occur when there is at least about 55% homology over a stretch of at least about 14 nucleotides, preferably at least about 65%, more preferably at least about 75%, and most preferably at least about 90%. See, Kanehisa (1984) Nuc. Acids Res. 12:203-213.
  • the length of homology comparison may be over longer stretches, and in certain embodiments will be over a stretch of at least about 17 nucleotides, usually at least about 20 nucleotides, more usually at least about 24 nucleotides, typically at least about 28 nucleotides, more typically at least about 40 nucleotides, preferably at least about 50 nucleotides, and more preferably at least about 75 to 100 or more nucleotides.
  • Stringent conditions in referring to homology in the hybridization context, will be stringent combined conditions of salt, temperature, organic solvents, and other parameters, typically those controlled in hybridization reactions.
  • Stringent temperature conditions will usually include temperatures in excess of about 30° C., more usually in excess of about 37° C., typically in excess of about 45° C., more typically in excess of about 55° C., preferably in excess of about 65° C., and more preferably in excess of about 70° C.
  • Stringent salt conditions will ordinarily be less than about 1000 mM, usually less than about 500 mM, more usually less than about 400 mM, typically less than about 300 mM, preferably less than about 200 mM, and more preferably less than about 150 mM.
  • the combination of parameters is much more important than the measure of any single parameter. See, e.g., Wetmur and Davidson (1968) J. Mol. Biol. 31:349-370.
  • CTLA-8 protein from other mammalian species can be cloned and isolated by cross-species hybridization of closely related species, e.g., human, as disclosed in Table 3. Homology may be relatively low between distantly related species, and thus hybridization of relatively closely related species is advisable. Alternatively, preparation of an antibody preparation which exhibits less species specificity may be useful in expression cloning approaches.
  • the predicted sequence of murine CTLA-8 protein amino acid sequence is shown in Table 1.
  • the homologous herpesvirus predicted ORF13 protein sequence is shown in Table 2, and is assigned SEQ ID NO: 4.
  • a human counterpart is described in Table 3.
  • the peptide sequences allow preparation of peptides to generate antibodies to recognize such segments.
  • murine CTLA-8 protein and “human CTLA-8 protein shall encompass, when used in a protein context, a protein having amino acid sequences shown in Table 1 or Table 3, or a significant fragment of such a protein. It also refers to a mouse derived polypeptide which exhibits similar biological function or interacts with CTLA-8 protein specific binding components.
  • binding components e.g., antibodies
  • Homologous proteins would be found in mammalian species other than rat or humans, e.g., mouse, primates, and in the herpesvirus genome, e.g., ORF13. Non-mammalian species should also possess structurally or functionally related genes and proteins.
  • polypeptide as used herein includes a significant fragment or segment, and encompasses a stretch of amino acid residues of at least about 8 amino acids, generally at least 10 amino acids, more generally at least 12 amino acids, often at least 14 amino acids, more often at least 16 amino acids, typically at least 18 amino acids, more typically at least 20 amino acids, usually at least 22 amino acids, more usually at least 24 amino acids, preferably at least 26 amino acids, more preferably at least 28 amino acids, and, in particularly preferred embodiments, at least about 30 or more amino acids.
  • the specific ends of such a segment will be at any combinations within the protein, preferably encompassing structural domains.
  • binding composition refers to molecules that bind with specificity to CTLA-8 protein, e.g., in a ligand-receptor type fashion, an antibody-antigen interaction, or compounds, e.g., proteins which specifically associate with CTLA-8 protein, e.g., in a natural physiologically relevant protein-protein interaction, either covalent or non-covalent.
  • the molecule may be a polymer, or chemical reagent. No implication as to whether CTLA-8 protein is either the ligand or the receptor of a ligand-receptor interaction is represented, other than the interaction exhibit similar specificity, e.g., specific affinity.
  • a functional analog may be a protein with structural modifications, or may be a wholly unrelated molecule, e.g., which has a molecular shape which interacts with the appropriate binding determinants.
  • the proteins may serve as agonists or antagonists of a receptor, see, e.g., Goodman, et al. (eds.) (1990) Goodman & Gilman's: The Pharmacological Bases of Therapeutics (8th ed.), Pergamon Press.
  • Solubility of a polypeptide or fragment depends upon the environment and the polypeptide. Many parameters affect polypeptide solubility, including temperature, electrolyte environment, size and molecular characteristics of the polypeptide, and nature of the solvent. Typically, the temperature at which the polypeptide is used ranges from about 4° C. to about 65° C. Usually the temperature at use is greater than about 18° C. and more usually greater than about 22° C. For diagnostic purposes, the temperature will usually be about room temperature or warmer, but less than the denaturation temperature of components in the assay. For therapeutic purposes, the temperature will usually be body temperature, typically about 37° C. for humans, though under certain situations the temperature may be raised or lowered in situ or in vitro.
  • the electrolytes will usually approximate in situ physiological conditions, but may be modified to higher or lower ionic strength where advantageous.
  • the actual ions may be modified, e.g., to conform to standard buffers used in physiological or analytical contexts.
  • the size and structure of the polypeptide should generally be in a substantially stable state, and usually not in a denatured state.
  • the polypeptide may be associated with other polypeptides in a quaternary structure, e.g., to confer solubility, or associated with lipids or detergents in a manner which approximates natural lipid bilayer interactions.
  • the solvent will usually be a biologically compatible buffer, of a type used for preservation of biological activities, and will usually approximate a physiological solvent.
  • the solvent will have a neutral pH, typically between about 5 and 10, and preferably about 7.5.
  • a detergent will be added, typically a mild non-denaturing one, e.g., CHS or CHAPS, or a low enough concentration as to avoid significant disruption of structural or physiological properties of the antigen.
  • Solubility is reflected by sedimentation measured in Svedberg units, which are a measure of the sedimentation velocity of a molecule under particular conditions.
  • the determination of the sedimentation velocity was classically performed in an analytical ultracentrifuge, but is typically now performed in a standard ultracentrifuge. See, Freifelder (1982) Physical Biochemistry (2d ed.), W. H. Freeman; and Cantor and Schimmel (1980) Biophysical Chemistry, parts 1-3, W. H. Freeman & Co., San Francisco.
  • a sample containing a putatively soluble polypeptide is spun in a standard full sized ultracentrifuge at about 50K rpm for about 10 minutes, and soluble molecules will remain in the supernatant.
  • a soluble particle or polypeptide will typically be less than about 30 S, more typically less than about 15 S, usually less than about 10 S, more usually less than about 6 S, and, in particular embodiments, preferably less than about 4 S, and more preferably less than about 3 S.
  • DNA which encodes the CTLA-8 protein or fragments thereof can be obtained by chemical synthesis, screening cDNA libraries, or by screening genomic libraries prepared from a wide variety of cell lines or tissue samples.
  • This DNA can be expressed in a wide variety of host cells for the synthesis of a full-length protein or fragments which can in turn, for example, be used to generate polyclonal or monoclonal antibodies; for binding studies; for construction and expression of modified molecules; and for structure/function studies.
  • Each antigen or its fragments can be expressed in host cells that are transformed or transfected with appropriate expression vectors. These molecules can be substantially purified to be free of protein or cellular contaminants, other than those derived from the recombinant host, and therefore are particularly useful in pharmaceutical compositions when combined with a pharmaceutically acceptable carrier and/or diluent.
  • the antigen, or portions thereof, may be expressed as fusions with other proteins.
  • Expression vectors are typically self-replicating DNA or RNA constructs containing the desired antigen gene or its fragments, usually operably linked to suitable genetic control elements that are recognized in a suitable host cell. These control elements are capable of effecting expression within a suitable host. The specific type of control elements necessary to effect expression will depend upon the eventual host cell used.
  • the genetic control elements can include a prokaryotic promoter system or a eukaryotic promoter expression control system, and typically include a transcriptional promoter, an optional operator to control the onset of transcription, transcription enhancers to elevate the level of mRNA expression, a sequence that encodes a suitable ribosome binding site, and sequences that terminate transcription and translation.
  • Expression vectors also usually contain an origin of replication that allows the vector to replicate independently of the host cell. Methods for amplifying vector copy number are also known, see, e.g., Kaufman, et al. (1985) Molec. and Cell. Biol. 5:1750-1759.
  • the vectors of this invention contain DNA which encodes a CTLA-8 protein, or a fragment thereof, typically encoding a biologically active polypeptide.
  • the DNA can be under the control of a viral promoter and can encode a selection marker.
  • This invention further contemplates use of such expression vectors which are capable of expressing eukaryotic cDNA coding for a CTLA-8 protein in a prokaryotic or eukaryotic host, where the vector is compatible with the host and where the eukaryotic cDNA coding for the antigen is inserted into the vector such that growth of the host containing the vector expresses the cDNA in question.
  • expression vectors are designed for stable replication in their host cells or for amplification to greatly increase the total number of copies of the desirable gene per cell. It is not always necessary to require that an expression vector replicate in a host cell, e.g., it is possible to effect transient expression of the antigen or its fragments in various hosts using vectors that do not contain a replication origin that is recognized by the host cell. It is also possible to use vectors that cause integration of a CTLA-8 protein gene or its fragments into the host DNA by recombination, or to integrate a promoter which controls expression of an endogenous gene.
  • Vectors as used herein, comprise plasmids, viruses, bacteriophage, integratable DNA fragments, and other vehicles which enable the integration of DNA fragments into the genome of the host.
  • Expression vectors are specialized vectors which contain genetic control elements that effect expression of operably linked genes. Plasmids are the most commonly used form of vector but all other forms of vectors which serve an equivalent function and which are, or become, known in the art are suitable for use herein. See, e.g., Pouwels, et al.. (1985 and Supplements) Cloning Vectors: A Laboratory Manual , Elsevier, N.Y., and Rodriquez, et al. (1988)(eds.) Vectors: A Survey of Molecular Cloning Vectors and Their Uses , Buttersworth, Boston, Mass.
  • Transformed cells include cells, preferably mammalian, that have been transformed or transfected with vectors containing a CTLA-8 gene, typically constructed using recombinant DNA techniques.
  • Transformed host cells usually express the antigen or its fragments, but for purposes of cloning, amplifying, and manipulating its DNA, do not need to express the protein.
  • This invention further contemplates culturing transformed cells in a nutrient medium, thus permitting the protein to accumulate in the culture. The protein can be recovered, either from the culture or from the culture medium.
  • DNA sequences are operably linked when they are functionally related to each other.
  • DNA for a presequence or secretory leader is operably linked to a polypeptide if it is expressed as a preprotein or participates in directing the polypeptide to the cell membrane or in secretion of the polypeptide.
  • a promoter is operably linked to a coding sequence if it controls the transcription of the polypeptide;
  • a ribosome binding site is operably linked to a coding sequence if it is positioned to permit translation.
  • operably linked means contiguous and in reading frame, however, certain genetic elements such as repressor genes are not contiguously linked but still bind to operator sequences that in turn control expression.
  • Suitable host cells include prokaryotes, lower eukaryotes, and higher eukaryotes.
  • Prokaryotes include both gram negative and gram positive organisms, e.g., E. coli and B. subtilis .
  • Lower eukaryotes include yeasts, e.g., S. cerevisiae and Pichia, and species of the genus Dictyostelium.
  • Higher eukaryotes include established tissue culture cell lines from animal cells, both of non-mammalian origin, e.g., insect cells, and birds, and of mammalian origin, e.g., human, primates, and rodents.
  • Prokaryotic host-vector systems include a wide variety of vectors for many different species. As used herein, E. coli and its vectors will be used generically to include equivalent vectors used in other prokaryotes.
  • a representative vector for amplifying DNA is pBR322 or many of its derivatives.
  • Vectors that can be used to express the CTLA-8 proteins or its fragments include, but are not limited to, such vectors as those containing the lac promoter (pUC-series); trp promoter (pBR322-trp); Ipp promoter (the pIN-series); lambda-pP or pR promoters (pOTS); or hybrid promoters such as ptac (pDR540).
  • Lower eukaryotes e.g., yeasts and Dictyostelium, may be transformed with vectors encoding CTLA-8 proteins.
  • the most common lower eukaryotic host is the baker's yeast, Saccharomyces cerevisiae. It will be used to generically represent lower eukaryotes although a number of other strains and species are also available.
  • Yeast vectors typically consist of a replication origin (unless of the integrating type), a selection gene, a promoter, DNA encoding the desired protein or its fragments, and sequences for translation termination, polyadenylation, and transcription termination.
  • Suitable expression vectors for yeast include such constitutive promoters as 3-phosphoglycerate kinase and various other glycolytic enzyme gene promoters or such inducible promoters as the alcohol dehydrogenase 2 promoter or metallothionine promoter.
  • Suitable vectors include derivatives of the following types: self-replicating low copy number (such as the YRp-series), self-replicating high copy number (such as the YEp-series); integrating types (such as the YIp-series), or mini-chromosomes (such as the YCp-series).
  • Higher eukaryotic tissue culture cells are the preferred host cells for expression of the functionally active CTLA-8 protein.
  • many higher eukaryotic tissue culture cell lines are workable, e.g., insect baculovirus expression systems, whether from an invertebrate or vertebrate source.
  • mammalian cells are preferred, in that the processing, both cotranslationally and posttranslationally. Transformation or transfection and propagation of such cells has become a routine procedure.
  • useful cell lines include HeLa cells, Chinese hamster ovary (CHO) cell lines, baby rat kidney (BRK) cell lines, insect cell lines, bird cell lines, and monkey (COS) cell lines.
  • Expression vectors for such cell lines usually include an origin of replication, a promoter, a translation initiation site, RNA splice sites (if genomic DNA is used), a polyadenylation site, and a transcription termination site. These vectors also usually contain a selection gene or amplification gene. Suitable expression vectors may be plasmids, viruses, or retroviruses carrying promoters derived, e.g., from such sources as from adenovirus, SV40, parvoviruses, vaccinia virus, or cytomegalovirus. Representative examples of suitable expression vectors include pCDNA1; pCD, see Okayama, et al. (1985) Mol. Cell Biol.
  • CTLA-8 protein polypeptide in a system which provides a specific or defined glycosylation pattern.
  • the usual pattern will be that provided naturally by the expression system.
  • the pattern will be modifiable by exposing the polypeptide, e.g., an unglycosylated form, to appropriate glycosylating proteins introduced into a heterologous expression system.
  • the CTLA-8 protein gene may be co-transformed with one or more genes encoding mammalian or other glycosylating enzymes. Using this approach, certain mammalian glycosylation patterns will be achievable or approximated in prokaryote or other cells.
  • the CTLA-8 protein may be engineered to be phosphatidyl inositol (PI) linked to a cell membrane, but can be removed from membranes by treatment with a phosphatidyl inositol cleaving enzyme, e.g., phosphatidyl inositol phospholipase-C.
  • PI phosphatidyl inositol
  • a phosphatidyl inositol cleaving enzyme e.g., phosphatidyl inositol phospholipase-C.
  • CTLA-8 protein has been characterized, fragments or derivatives thereof can be prepared by conventional processes for synthesizing peptides. These include processes such as are described in Stewart and Young (1984) Solid Phase Peptide Synthesis , Pierce Chemical Co., Rockford, Ill.; Bodanszky and Bodanszky (1984) The Practice of Peptide Synthesis , Springer-Verlag, New York; and Bodanszky (1984) The Principles of Peptide Synthesis , Springer-Verlag, New York.
  • an azide process for example, an acid chloride process, an acid anhydride process, a mixed anhydride process, an active ester process (for example, p-nitrophenyl ester, N-hydroxysuccinimide ester, or cyanomethyl ester), a carbodiimidazole process, an oxidative-reductive process, or a dicyclohexylcarbodiimide (DCCD)/additive process can be used.
  • Solid phase and solution phase syntheses are both applicable to the foregoing processes.
  • CTLA-8 protein, fragments, or derivatives are suitably prepared in accordance with the above processes as typically employed in peptide synthesis, generally either by a so-called stepwise process which comprises condensing an amino acid to the terminal amino acid, one by one in sequence, or by coupling peptide fragments to the terminal amino acid. Amino groups that are not being used in the coupling reaction are typically protected to prevent coupling at an incorrect location.
  • the C-terminal amino acid is bound to an insoluble carrier or support through its carboxyl group.
  • the insoluble carrier is not particularly limited as long as it has a binding capability to a reactive carboxyl group.
  • examples of such insoluble carriers include halomethyl resins, such as chloromethyl resin or bromomethyl resin, hydroxymethyl resins, phenol resins, tert-alkyloxycarbonyl-hydrazidated resins, and the like.
  • the prepared protein and fragments thereof can be isolated and purified from the reaction mixture by means of peptide separation, for example, by extraction, precipitation, electrophoresis and various forms of chromatography, and the like.
  • the CTLA-8 proteins of this invention can be obtained in varying degrees of purity depending upon its desired use. Purification can be accomplished by use of the protein purification techniques disclosed herein or by the use of the antibodies herein described in immunoabsorbant affinity chromatography.
  • This immunoabsorbant affinity chromatography is carried out by first linking the antibodies to a solid support and then contacting the linked antibodies with solubilized lysates of appropriate source cells, lysates of other cells expressing the protein, or lysates or supernatants of cells producing the CTLA-8 protein as a result of DNA techniques, see below.
  • This invention also encompasses proteins or peptides having substantial amino acid sequence homology with the amino acid sequence of the CTLA-8 protein.
  • the variants include species or allelic variants.
  • Amino acid sequence homology is determined by optimizing residue matches, if necessary, by introducing gaps as required. This changes when considering conservative substitutions as matches.
  • Conservative substitutions typically include substitutions within the following groups: glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid; asparagine, glutamine; serine, threonine; lysine, arginine; and phenylalanine, tyrosine.
  • homologous amino acid sequences are typically intended to include natural allelic and interspecies variations in each respective protein sequence.
  • Typical homologous proteins or peptides will have from 25-100% homology (if gaps can be introduced), to 50-100% homology (if conservative substitutions are included) with the amino acid sequence of the CTLA-8 protein.
  • Homology measures will be at least about 35%, generally at least 40%, more generally at least 45%, often at least 50%, more often at least 55%, typically at least 60%, more typically at least 65%, usually at least 70%, more usually at least 75%, preferably at least 80%, and more preferably at least 80%, and in particularly preferred embodiments, at least 85% or more. See also Needleham, et al. (1970) J. Mol. Biol. 48:443-453; Sankoff, et al.
  • the isolated DNA encoding a CTLA-8 protein can be readily modified by nucleotide substitutions, nucleotide deletions, nucleotide insertions, and inversions of nucleotide stretches. These modifications result in novel DNA sequences which encode these antigens, their derivatives, or proteins having similar physiological, immunogenic, or antigenic activity. These modified sequences can be used to produce mutant antigens or to enhance expression. Enhanced expression may involve gene amplification, increased transcription, increased translation, and other mechanisms.
  • Such mutant CTLA-8 protein derivatives include predetermined or site-specific mutations of the respective protein or its fragments.
  • “Mutant CTLA-8 protein” encompasses a polypeptide otherwise falling within the homology definition of the murine CTLA-8 or human CTLA-8 protein as set forth above, but having an amino acid sequence which differs from that of CTLA-8 protein as found in nature, whether by way of deletion, substitution, or insertion.
  • “site specific mutant CTLA-8 protein” generally includes proteins having significant homology with a protein having sequences of Table 1, 2, or 3, and as sharing various biological activities, e.g., antigenic or immunogenic, with those sequences, and in preferred embodiments contain most of the disclosed sequences. Similar concepts apply to different CTLA-8 proteins, particularly those found in various warm blooded animals, e.g., mammals and birds. As stated before, it is emphasized that descriptions are generally meant to encompass all CTLA-8 proteins, not limited to the mouse embodiment specifically discussed.
  • CTLA-8 protein mutagenesis can be conducted by making amino acid insertions or deletions. Substitutions, deletions, insertions, or any combinations may be generated to arrive at a final construct. Insertions include amino- or carboxy-terminal fusions. Random mutagenesis can be conducted at a target codon and the expressed mutants can then be screened for the desired activity. Methods for making substitution mutations at predetermined sites in DNA having a known sequence are well known in the art, e.g., by M13 primer mutagenesis or polymerase chain reaction (PCR) techniques. See also Sambrook, et al. (1989) and Ausubel, et al. (1987 and Supplements).
  • PCR polymerase chain reaction
  • the mutations in the DNA normally should not place coding sequences out of reading frames and preferably will not create complementary regions that could hybridize to produce secondary mRNA structure such as loops or hairpins.
  • the present invention also provides recombinant proteins, e.g., heterologous fusion proteins using segments from these proteins.
  • a heterologous fusion protein is a fusion of proteins or segments which are naturally not normally fused in the same manner.
  • the fusion product of an immunoglobulin with a CTLA-8 polypeptide is a continuous protein molecule having sequences fused in a typical peptide linkage, typically made as a single translation product and exhibiting properties derived from each source peptide.
  • a similar concept applies to heterologous nucleic acid sequences.
  • new constructs may be made from combining similar functional domains from other proteins.
  • antigen-binding or other segments may be “swapped” between different new fusion polypeptides or fragments. See, e.g., Cunningham, et al. (1989) Science, 243:1330-1336; and O'Dowd, et al. (1988) J. Biol. Chem. 263:15985-15992.
  • new chimeric polypeptides exhibiting new combinations of specificities will result from the functional linkage of biologically relevant domains and other functional domains.
  • CTLA-8 proteins The blocking of physiological response to CTLA-8 proteins may result from the inhibition of binding of the antigen to its natural binding partner, e.g., through competitive inhibition.
  • in vitro assays of the present invention will often use isolated protein, membranes from cells expressing a recombinant membrane associated CTLA-8 protein, soluble fragments comprising binding segments, or fragments attached to solid phase substrates. These assays will also allow for the diagnostic determination of the effects of either binding segment mutations and modifications, or protein mutations and modifications, e.g., analogs.
  • This invention also contemplates the use of competitive drug screening assays, e.g., where neutralizing antibodies to antigen or binding partner fragments compete with a test compound for binding to the protein.
  • the antibodies can be used to detect the presence of any polypeptide which shares one or more antigenic binding sites of the protein and can also be used to occupy binding sites on the protein that might otherwise interact with a binding partner.
  • neutralizing antibodies against the CTLA-8 protein and soluble fragments of the antigen which contain a high affinity receptor binding site can be used to inhibit antigen function in tissues, e.g., tissues experiencing abnormal physiology.
  • “Derivatives” of the CTLA-8 antigens include amino acid sequence mutants, glycosylation variants, and covalent or aggregate conjugates with other chemical moieties.
  • Covalent derivatives can be prepared by linkage of functionalities to groups which are found in the CTLA-8 amino acid side chains or at the N- or C-termini, by means which are well known in the art. These derivatives can include, without limitation, aliphatic esters or amides of the carboxyl terminus, or of residues containing carboxyl side chains, O-acyl derivatives of hydroxyl group-containing residues, and N-acyl derivatives of the amino terminal amino acid or amino-group containing residues, e.g., lysine or arginine.
  • Acyl groups are selected from the group of alkyl-moieties including C3 to C18 normal alkyl, thereby forming alkanoyl aroyl species. Covalent attachment to carrier proteins may be important when immunogenic moieties are haptens.
  • glycosylation alterations are included, e.g., made by modifying the glycosylation patterns of a polypeptide during its synthesis and processing, or in further processing steps. Particularly preferred means for accomplishing this are by exposing the polypeptide to glycosylating enzymes derived from cells which normally provide such processing, e.g., mammalian glycosylation enzymes. Deglycosylation enzymes are also contemplated. Also embraced are versions of the same primary amino acid sequence which have other minor modifications, including phosphorylated amino acid residues, e.g., phosphotyrosine, phosphoserine, or phosphothreonine.
  • a major group of derivatives are covalent conjugates of the CTLA-8 protein or fragments thereof with other proteins or polypeptides. These derivatives can be synthesized in recombinant culture such as N- or C-terminal fusions or by the use of agents known in the art for their usefulness in cross-linking proteins through reactive side groups. Preferred antigen derivatization sites with cross-linking agents are at free amino groups, carbohydrate moieties, and cysteine residues.
  • Fusion polypeptides between the CTLA-8 proteins and other homologous or heterologous proteins are also provided.
  • Homologous polypeptides may be fusions between different surface markers, resulting in, e.g., a hybrid protein exhibiting receptor binding specificity.
  • heterologous fusions may be constructed which would exhibit a combination of properties or activities of the derivative proteins.
  • Typical examples are fusions of a reporter polypeptide, e.g., luciferase, with a segment or domain of an antigen, e.g., a receptor-binding segment, so that the presence or location of the fused antigen may be easily determined. See, e.g., Dull, et al., U.S. Pat. No.
  • gene fusion partners include bacterial ⁇ -galactosidase, trpE, Protein A, ⁇ -lactamase, alpha amylase, alcohol dehydrogenase, and yeast alpha mating factor. See, e.g., Godowski, et al. (1988) Science 241:812-816.
  • polypeptides may also have amino acid residues which have been chemically modified by phosphorylation, sulfonation, biotinylation, or the addition or removal of other moieties, particularly those which have molecular shapes similar to phosphate groups.
  • the modifications will be useful labeling reagents, or serve as purification targets, e.g., affinity ligands.
  • Fusion proteins will typically be made by either recombinant nucleic acid methods or by synthetic polypeptide methods. Techniques for nucleic acid manipulation and expression are described generally, for example, in Sambrook, et al. (1989) Molecular Cloning: A Laboratory Manual (2d ed.), Vols. 1-3, Cold Spring Harbor Laboratory. Techniques for synthesis of polypeptides are described, for example, in Merrifield (1963) J. Amer. Chem. Soc. 85:2149-2156; Merrifield (1986) Science 232: 341-347; and Atherton, et al. (1989) Solid Phase Peptide Synthesis: A Practical Approach , IRL Press, Oxford.
  • This invention also contemplates the use of derivatives of the CTLA-8 proteins other than variations in amino acid sequence or glycosylation.
  • Such derivatives may involve covalent or aggregative association with chemical moieties. These derivatives generally fall into the three classes: (1) salts, (2) side chain and terminal residue covalent modifications, and (3) adsorption complexes, for example with cell membranes.
  • covalent or aggregative derivatives are useful as immunogens, as reagents in immunoassays, or in purification methods such as for affinity purification of antigens or other binding proteins.
  • a CTLA-8 antigen can be immobilized by covalent bonding to a solid support such as cyanogen bromide-activated Sepharose, by methods which are well known in the art, or adsorbed onto polyolefin surfaces, with or without glutaraldehyde cross-linking, for use in the assay or purification of anti-CTLA-8 protein antibodies or its receptor or other binding partner.
  • the CTLA-8 antigens can also be labeled with a detectable group, for example radioiodinated by the chloramine T procedure, covalently bound to rare earth chelates, or conjugated to another fluorescent moiety for use in diagnostic assays. Purification of CTLA-8 protein may be effected by immobilized antibodies or binding partners.
  • a solubilized CTLA-8 antigen or fragment of this invention can be used as an immunogen for the production of antisera or antibodies specific for the protein or fragments thereof.
  • the purified antigen can be used to screen monoclonal antibodies or binding fragments prepared by immunization with various forms of impure preparations containing the protein.
  • the term “antibodies” also encompasses antigen binding fragments of natural antibodies.
  • the purified CTLA-8 proteins can also be used as a reagent to detect any antibodies generated in response to the presence of elevated levels of the protein or cell fragments containing the antigen, both of which may be diagnostic of an abnormal or specific physiological or disease condition. Additionally, antigen fragments may also serve as immunogens to produce the antibodies of the present invention, as described immediately below.
  • this invention contemplates antibodies raised against amino acid sequences encoded by nucleotide sequences shown in Table 1, 2, or 3, or fragments of proteins containing them.
  • this invention contemplates antibodies having binding affinity to or being raised against specific fragments which are predicted to lie outside of the lipid bilayer.
  • the present invention contemplates the isolation of additional closely related species variants.
  • Southern blot analysis established that similar genetic entities exist in other mammals, e.g., rat and human. It is likely that the CTLA-8 proteins are widespread in species variants, e.g., rodents, lagomorphs, carnivores, artiodactyla, perissodactyla, and primates.
  • the invention also provides means to isolate a group of related antigens displaying both distinctness and similarities in structure, expression, and function. Elucidation of many of the physiological effects of the antigens will be greatly accelerated by the isolation and characterization of distinct species variants.
  • the present invention provides useful probes for identifying additional homologous genetic entities in different species.
  • the isolated genes will allow transformation of cells lacking expression of a corresponding CTLA-8 protein, e.g., either species types or cells which lack corresponding antigens and should exhibit negative background activity. Expression of transformed genes will allow isolation of antigenically pure cell lines, with defined or single specie variants. This approach will allow for more sensitive detection and discrimination of the physiological effects of CTLA-8 proteins. Subcellular fragments, e.g., cytoplasts or membrane fragments, can be isolated and used.
  • Antigen internalization may occur under certain circumstances, and interaction between intracellular components and “extracellular” segments of proteins involved in interactions may occur.
  • the specific segments of interaction of CTLA-8 protein with other intracellular components may be identified by mutagenesis or direct biochemical means, e.g., cross-linking or affinity methods. Structural analysis by crystallographic or other physical methods will also be applicable. Further investigation of the mechanism of biological function will include study of associated components which may be isolatable by affinity methods or by genetic means, e.g., complementation analysis of mutants.
  • CTLA-8 protein Further study of the expression and control of CTLA-8 protein will be pursued.
  • the controlling elements associated with the antigens may exhibit differential developmental, tissue specific, or other expression patterns. Upstream or downstream genetic regions, e.g., control elements, are of interest.
  • the present invention provides important reagents related to antigen-binding partner interaction.
  • antigen-binding partner interaction e.g., mouse and other mammalian species or allelic variants, as well as variants thereof.
  • Antibodies can be raised to the various CTLA-8 proteins, including species or allelic variants, and fragments thereof, both in their naturally occurring forms and in their recombinant forms. Additionally, antibodies can be raised to CTLA-8 proteins in either their active forms or in their inactive forms. Anti-idiotypic antibodies are also contemplated.
  • Antibodies, including binding fragments and single chain versions, against predetermined fragments of the antigens can be raised by immunization of animals with conjugates of the fragments with immunogenic proteins.
  • Monoclonal antibodies are prepared from cells secreting the desired antibody. These antibodies can be screened for binding to normal or defective CTLA-8 proteins, or screened for agonistic or antagonistic activity, e.g., mediated through a binding partner. These monoclonal antibodies will usually bind with at least a K D of about 1 mM, more usually at least about 300 ⁇ M, typically at least about 10 ⁇ m, more typically at least about 30 ⁇ M, preferably at least about 10 ⁇ m, and more preferably at least about 3 ⁇ m or better.
  • the antibodies, including antigen binding fragments, of this invention can have significant diagnostic or therapeutic value. They can be potent antagonists that bind to a binding partner and inhibit antigen binding or inhibit the ability of an antigen to elicit a biological response. They also can be useful as non-neutralizing antibodies and can be coupled to toxins or radionuclides so that when the antibody binds to the antigen, a cell expressing it, e.g., on its surface, is killed. Further, these antibodies can be conjugated to drugs or other therapeutic agents, either directly or indirectly by means of a linker, and may effect drug targeting.
  • the antibodies of this invention can also be useful in diagnostic applications. As capture or non-neutralizing antibodies, they can be screened for ability to bind to the antigens without inhibiting binding by a partner. As neutralizing antibodies, they can be useful in competitive binding assays. They will also be useful in detecting or quantifying CTLA-8 protein or its binding partners. See, e.g., Chan (ed.)(1987) Immunoassay: A Practical Guide Academic Press, Orlando, Fla.; Ngo (ed.)(1988) Nonisotopic Immunoassay Plenum Press, NY; and Price and Newman (eds.)(1991) Principles and Practice of Immunoassay Stockton Press, NY.
  • Antigen fragments may be joined to other materials, particularly polypeptides, as fused or covalently joined polypeptides to be used as immunogens.
  • An antigen and its fragments may be fused or covalently linked to a variety of immunogens, such as keyhole limpet hemocyanin, bovine serum albumin, tetanus toxoid, etc. See Microbiology, Hoeber Medical Division, Harper and Row, 1969; Landsteiner (1962) Specificity of Serological Reactions , Dover Publications, New York, and Williams, et. al. (1967) Methods in Immunology and Immunochemistry , Vol. 1, Academic Press, New York, for descriptions of methods of preparing polyclonal antisera.
  • a typical method involves hyperimmunization of an animal with an antigen. The blood of the animal is then collected shortly after the repeated immunizations and the gamma globulin is isolated.
  • monoclonal antibodies from various mammalian hosts, such as mice, rodents, primates, humans, etc. Description of techniques for preparing such monoclonal antibodies may be found in, e.g., Stites, et al.
  • hybrid cell or “hybridoma” that is capable of reproducing in vitro.
  • the population of hybridomas is then screened to isolate individual clones, each of which secrete a single antibody species to the immunogen.
  • the individual antibody species obtained are the products of immortalized and cloned single B cells from the immune animal generated in response to a specific site recognized on the immunogenic substance.
  • labels and conjugation techniques are known and are reported extensively in both the scientific and patent literature. Suitable labels include radionuclides, enzymes, substrates, cofactors, inhibitors, fluorescent moieties, chemiluminescent moieties, magnetic particles, and the like. Patents, teaching the use of such labels include U.S. Pat. Nos. 3,817,837; 3,850,752; 3,939,350; 3,996,345; 4,277,437; 4,275,149; and 4,366,241. Also, recombinant immunoglobulins may be produced, see Cabilly, U.S. Pat. No. 4,816,567.
  • the antibodies of this invention can also be used for affinity chromatography in isolating the protein.
  • Columns can be prepared where the antibodies are linked to a solid support, e.g., particles, such as agarose, Sephadex, or the like, where a cell lysate may be passed through the column, the column washed, followed by increasing concentrations of a mild denaturant, whereby the purified CTLA-8 protein will be released.
  • the antibodies- may also be used to screen expression libraries for particular expression products. Usually the antibodies used in such a procedure will be labeled with a moiety allowing easy detection of presence of antigen by antibody binding.
  • Antibodies raised against each CTLA-8 protein will also be useful to raise anti-idiotypic antibodies. These will be useful in detecting or diagnosing various immunological conditions related to expression of the respective antigens.
  • the present invention provides reagents which will find use in diagnostic applications as described elsewhere herein, e.g., in the general description for physiological or developmental abnormalities, or below in the description of kits for diagnosis.
  • This invention also provides reagents with significant therapeutic value.
  • the CTLA-8 protein naturally occurring or recombinant
  • fragments thereof, and antibodies thereto, along with compounds identified as having binding affinity to CTLA-8 protein, should be useful in the treatment of conditions associated with abnormal physiology or development, including abnormal proliferation, e.g., cancerous conditions, or degenerative conditions.
  • Abnormal proliferation, regeneration, degeneration, and atrophy may be modulated by appropriate therapeutic treatment using the compositions provided herein.
  • a disease or disorder associated with abnormal expression or abnormal signaling by a CTLA-8 antigen should be a likely target for an agonist or antagonist of the protein.
  • Recombinant antibodies which bind to CTLA-8 can be purified and then administered to a patient. These reagents can be combined for therapeutic use with additional active or inert ingredients, e.g., in conventional pharmaceutically acceptable carriers or diluents, e.g., immunogenic adjuvants, along with physiologically innocuous stabilizers and excipients. These combinations can be sterile filtered and placed into dosage forms as by lyophilization in dosage vials or storage in stabilized aqueous preparations. This invention also contemplates use of antibodies or binding fragments thereof, including forms which are not complement binding.
  • CTLA-8 Screening using CTLA-8 for binding partners or compounds having binding affinity to CTLA-8 antigen can be performed, including isolation of associated components. Subsequent biological assays can then be utilized to determine if the compound has intrinsic biological activity and is therefore an agonist or antagonist in that it blocks an activity of the antigen.
  • This invention further contemplates the therapeutic use of antibodies to CTLA-8 protein as antagonists. This approach should be particularly useful with other CTLA-8 protein species variants.
  • reagents necessary for effective therapy will depend upon many different factors, including means of administration, target site, physiological state of the patient, and other medicants administered. Thus, treatment dosages should be titrated to optimize safety and efficacy. Typically, dosages used in vitro may provide useful guidance in the amounts useful for in situ administration of these reagents. Animal testing of effective doses for treatment of particular disorders will provide further predictive indication of human dosage. Various considerations are described, e.g., in Gilman, et al. (eds.) (1990) Goodman and Gilman's: The Pharmacological Bases of Therapeutics, 8th Ed., Pergamon Press; and Remington's Pharmaceutical Sciences, 17th ed.
  • Pharmaceutically acceptable carriers will include water, saline, buffers, and other compounds described, e.g., in the Merck Index , Merck & Co., Rahway, N.J.
  • Dosage ranges would ordinarily be expected to be in amounts lower than 1 mM concentrations, typically less than about 10 ⁇ m concentrations, usually less than about 100 nM, preferably less than about 10 pM (picomolar), and most preferably less than about 1 fM (femtomolar), with an appropriate carrier.
  • Slow release formulations, or a slow release apparatus will often be utilized for continuous administration.
  • CTLA-8 protein, fragments thereof, and antibodies to it or its fragments, antagonists, and agonists may be administered directly to the host to be treated or, depending on the size of the compounds, it may be desirable to conjugate them to carrier proteins such as ovalbumin or serum albumin prior to their administration.
  • Therapeutic formulations may be administered in any conventional dosage formulation. While it is possible for the active ingredient to be administered alone, it is preferable to present it as a pharmaceutical formulation.
  • Formulations typically comprise at least one active ingredient, as defined above, together with one or more acceptable carriers thereof. Each carrier should be both pharmaceutically and physiologically acceptable in the sense of being compatible with the other ingredients and not injurious to the patient.
  • Formulations include those suitable for oral, rectal, nasal, or parenteral (including subcutaneous, intramuscular, intravenous and intradermal) administration.
  • the formulations may conveniently be presented in unit dosage form and may be prepared by any methods well known in the art of pharmacy. See, e.g., Gilman, et al. (eds.) (1990) Goodman and Gilman's: The Pharmacological Bases of Therapeutics, 8th Ed., Pergamon Press, Parrytown, N.Y.; Remington's Pharmaceutical Sciences, 17th ed. (1990), Mack Publishing Co., Easton, Pa.; Avis, et al.
  • CTLA-8 proteins of this invention are particularly useful in kits and assay methods which are capable of screening compounds for binding activity to the proteins.
  • Several methods of automating assays have been developed in recent years so as to permit screening of tens of thousands of compounds in a short period. See, e.g., Fodor, et al. (1991) Science 251:767-773, which describes means for testing of binding affinity by a plurality of defined polymers synthesized on a solid substrate.
  • suitable assays can be greatly facilitated by the availability of large amounts of purified, soluble CTLA-8 protein as provided by this invention.
  • This invention is particularly useful for screening compounds by using recombinant antigen in any of a variety of drug screening techniques.
  • the advantages of using a recombinant protein in screening for specific ligands include: (a) improved renewable source of the antigen from a specific source; (b) potentially greater number of antigen molecules per cell giving better signal to noise ratio in assays; and (c) species variant specificity (theoretically giving greater biological and disease specificity).
  • the purified protein may be tested in numerous assays, typically in vitro assays, which evaluate biologically relevant responses. See, e.g., Coligan Current Protocols in Immunology ; Hood, et al. Immunology Benjamin/Cummings; Paul (ed.) Fundamental Immunology ; and Methods in Enzymology Academic Press.
  • One method of drug screening utilizes eukaryotic or prokaryotic host cells which are stably transformed with recombinant DNA molecules expressing the CTLA-8 antigens.
  • Cells may be isolated which express an antigen in isolation from other functionally equivalent antigens.
  • Such cells either in viable or fixed form, can be used for standard protein-protein binding assays. See also, Parce, et al. (1989) Science 246:243-247; and Owicki, et al. (1990) Proc. Nat'l Acad. Sci. USA 87:4007-4011, which describe sensitive methods to detect cellular responses.
  • Viable cells could also be used to screen for the effects of drugs on CTLA-8 protein mediated functions, e.g., second messenger levels, i.e., Ca ++ ; cell proliferation; inositol phosphate pool changes; and others.
  • second messenger levels i.e., Ca ++
  • cell proliferation i.e., cell proliferation
  • inositol phosphate pool changes e.g., cell proliferation
  • inositol phosphate pool changes e.g., cell proliferation
  • inositol phosphate pool changes e.g., a separation step
  • Some detection methods allow for elimination of a separation step, e.g., a proximity sensitive detection system.
  • Calcium sensitive dyes will be useful for detecting Ca ++ levels, with a fluorimeter or a fluorescence cell sorting apparatus.
  • Another method utilizes membranes from transformed eukaryotic or prokaryotic host cells as the source of the CTLA-8 protein. These cells are stably transformed with DNA vectors directing the expression of a membrane associated CTLA-8 protein, e.g., an engineered membrane bound form. Essentially, the membranes would be prepared from the cells and used in any receptor/ligand type binding assay such as the competitive assay set forth above.
  • Still another approach is to use solubilized, unpurified or solubilized, purified CTLA-8 protein from transformed eukaryotic or prokaryotic host cells. This allows for a “molecular” binding assay with the advantages of increased specificity, the ability to automate, and high drug test throughput.
  • Another technique for drug screening involves an approach which provides high throughput screening for compounds having suitable binding affinity to CTLA-8 and is described in detail in Geysen, European Patent Application 84/03564, published on Sep. 13, 1984.
  • a solid substrate e.g., plastic pins or some other appropriate surface, see Fodor, et al. (1991).
  • all the pins are reacted with solubilized, unpurified or solubilized, purified CTLA-8 binding composition, and washed.
  • the next step involves detecting bound binding composition.
  • Rational drug design may also be based upon structural studies of the molecular shapes of the CTLA-8 protein and other effectors or analogs. Effectors may be other proteins which mediate other functions in response to antigen binding, or other proteins which normally interact with the antigen.
  • One means for determining which sites interact with specific other proteins is a physical structure determination, e.g., x-ray crystallography or 2 dimensional NMR techniques. These will provide guidance as to which amino acid residues form molecular contact regions.
  • x-ray crystallography or 2 dimensional NMR techniques.
  • Purified CTLA-8 protein can be coated directly onto plates for use in the aforementioned drug screening techniques. However, non-neutralizing antibodies to these ligands can be used as capture antibodies to immobilize the respective ligand on the solid phase.
  • This invention also contemplates use of CTLA-8 proteins, fragments thereof, peptides, and their fusion products in a variety of diagnostic kits and methods for detecting the presence of a binding composition.
  • the kit will have a compartment containing either a defined CTLA-8 peptide or gene segment or a reagent which recognizes one or the other, e.g., antigen fragments or antibodies.
  • a kit for determining the binding affinity of a test compound to a CTLA-8 protein would typically comprise a test compound; a labeled compound, for example an antibody having known binding affinity for the antigen; a source of CTLA-8 protein (naturally occurring or recombinant); and a means for separating bound from free labeled compound, such as a solid phase for immobilizing the antigen.
  • a test compound for example an antibody having known binding affinity for the antigen
  • a source of CTLA-8 protein naturally occurring or recombinant
  • a means for separating bound from free labeled compound such as a solid phase for immobilizing the antigen.
  • a preferred kit for determining the concentration of, for example, a CTLA-8 protein in a sample would typically comprise a labeled compound, e.g., antibody, having known binding affinity for the antigen, a source of antigen (naturally occurring or recombinant) and a means for separating the bound from free labeled compound, for example, a solid phase for immobilizing the CTLA-8 protein. Compartments containing reagents, and instructions, will normally be provided.
  • One method for determining the concentration of CTLA-8 protein in a sample would typically comprise the steps of: (1) preparing membranes from a sample comprised of a membrane bound CTLA-8 protein source; (2) washing the membranes and suspending them in a buffer; (3) solubilizing the antigen by incubating the membranes in a culture medium to which a suitable detergent has been added; (4) adjusting the detergent concentration of the solubilized antigen; (5) contacting and incubating said dilution with radiolabeled antibody to form complexes; (6) recovering the complexes such as by filtration through polyethyleneimine treated filters; and (7) measuring the radioactivity of the recovered complexes.
  • Antibodies, including antigen binding fragments, specific for the CTLA-8 protein or fragments are useful in diagnostic applications to detect the presence of elevated levels of CTLA-8 protein and/or its fragments.
  • diagnostic assays can employ lysates, live cells, fixed cells, immunofluorescence, cell cultures, body fluids, and further can involve the detection of antigens related to the protein in serum, or the like. Diagnostic assays may be homogeneous (without a separation step between free reagent and protein-protein complex) or heterogeneous (with a separation step).
  • RIA radioimmunoassay
  • ELISA enzyme-linked immunosorbent assay
  • EIA enzyme immunoassay
  • EMIT enzyme-multiplied immunoassay technique
  • SFIA substrate-labeled fluorescent immunoassay
  • unlabeled antibodies can be employed by using a second antibody which is labeled and which recognizes the antibody to a CTLA-8 protein or to a particular fragment thereof.
  • Similar assays have also been extensively discussed in the literature. See, e.g., Harlow and Lane (1988) Antibodies: A Laboratory Manual , CSH.
  • Anti-idiotypic antibodies may have similar use to diagnose presence of antibodies against a CTLA-8 protein, as such may be diagnostic of various abnormal states.
  • overproduction of CTLA-8 protein may result in production of various immunological reactions which may be diagnostic of abnormal physiological states, particularly in proliferative cell conditions such as cancer or abnormal differentiation.
  • the reagents for diagnostic assays are supplied in kits, so as to optimize the sensitivity of the assay.
  • the protocol, and the label either labeled or unlabeled antibody, or labeled CTLA-8 protein is provided. This is usually in conjunction with other additives, such as buffers, stabilizers, materials necessary for signal production such as substrates for enzymes, and the like.
  • the kit will also contain instructions for proper use and disposal of the contents after use.
  • the kit has compartments for each useful reagent.
  • the reagents are provided as a dry lyophilized powder, where the reagents may be reconstituted in an aqueous medium providing appropriate concentrations of reagents for performing the assay.
  • any of the aforementioned constituents of the drug screening and the diagnostic assays may be used without modification or may be modified in a variety of ways.
  • labeling may be achieved by covalently or non-covalently joining a moiety which directly or indirectly provides a detectable signal.
  • the antigen, test compound, CTLA-8 protein, or antibodies thereto can be labeled either directly or indirectly.
  • Possibilities for direct labeling include label groups: radiolabels such as 125 I, enzymes (U.S. Pat. No. 3,645,090) such as peroxidase and alkaline phosphatase, and fluorescent labels (U.S. Pat. No. 3,940,475) capable of monitoring the change in fluorescence intensity, wavelength shift, or fluorescence polarization.
  • Possibilities for indirect labeling include biotinylation of one constituent followed by binding to avidin coupled to one of the above label groups.
  • CTLA-8 protein can be immobilized on various matrixes followed by washing. Suitable matrixes include plastic such as an ELISA plate, filters, and beads. Methods of immobilizing the CTLA-8 protein to a matrix include, without limitation, direct adhesion to plastic, use of a capture antibody, chemical coupling, and biotin-avidin. The last step in this approach involves the precipitation of protein-protein complex by any of several methods including those utilizing, e.g., an organic solvent such as polyethylene glycol or a salt such as ammonium sulfate.
  • an organic solvent such as polyethylene glycol or a salt such as ammonium sulfate.
  • Another diagnostic aspect of this invention involves use of oligonucleotide or polynucleotide sequences taken from the sequence of a CTLA-8 protein. These sequences can be used as probes for detecting levels of antigen message in samples from patients suspected of having an abnormal condition, e.g., cancer or developmental problem.
  • the preparation of both RNA and DNA nucleotide sequences, the labeling of the sequences, and the preferred size of the sequences has received ample description and discussion in the literature.
  • an oligonucleotide probe should have at least about 14 nucleotides, usually at least about 18 nucleotides, and the polynucleotide probes may be up to several kilobases.
  • Various labels may be employed, most commonly radionuclides, particularly 32 P. However, other techniques may also be employed, such as using biotin modified nucleotides for introduction into a polynucleotide. The biotin then serves as the site for binding to avidin or antibodies, which may be labeled with a wide variety of labels, such as radionuclides, fluorescers, enzymes, or the like. Alternatively, antibodies may be employed which can recognize specific duplexes, including DNA duplexes, RNA duplexes, DNA-RNA hybrid duplexes, or DNA-protein duplexes.
  • the antibodies in turn may be labeled and the assay carried out where the duplex is bound to a surface, so that upon the formation of duplex on the surface, the presence of antibody bound to the duplex can be detected.
  • probes to the novel anti-sense RNA may be carried out in any conventional techniques such as nucleic acid hybridization, plus and minus screening, recombinational probing, hybrid released translation (HRT), and hybrid arrested translation (HART). This also includes amplification techniques such as polymerase chain reaction (PCR).
  • kits which also test for the qualitative or quantitative presence of other markers are also contemplated. Diagnosis or prognosis may depend on the combination of multiple indications used as markers. Thus, kits may test for combinations of markers. See, e.g., Viallet, et al. (1989) Progress in Growth Factor Res. 1:89-97.
  • Methods for protein purification include such methods as ammonium sulfate precipitation, column chromatography, electrophoresis, centrifugation, crystallization, and others. See, e.g., Ausubel, et al. (1987 and periodic supplements); Deutscher (1990) “Guide to Protein Purification” in Methods in Enzymology , vol. 182, and other volumes in this series; and manufacturer's literature on use of protein purification products, e.g., Pharmacia, Piscataway, N.J., or Bio-Rad, Richmond, Calif.
  • Combination with recombinant techniques allow fusion to appropriate segments, e.g., to a FLAG sequence or an equivalent which can be fused via a protease-removable sequence.
  • appropriate segments e.g., to a FLAG sequence or an equivalent which can be fused via a protease-removable sequence.
  • Various cell lines are screened using an appropriate probe for high level message expression. Appropriate cell lines are selected based upon expression levels of the CTLA-8 message. Applicants used subtractive hybridization methods on activated cytotoxic T cells.
  • Standard PCR techniques are used to amplify a CTLA-8 gene sequence from a genomic or cDNA library, or from mRNA.
  • Appropriate primers are selected from the sequences provided, and a full length clone is isolated. Various combinations of primers, of various lengths and possibly with differences in sequence, may be prepared. The full length clone can be used as a hybridization probe to screen for other homologous genes using stringent or less stringent hybridization conditions.
  • oligonucleotides are used to screen a library.
  • synthetic oligonucleotides in appropriate orientations are used as primers to select correct clones from a library.
  • a human genomic library was obtained from Clontech (Cat. HL1006d) and screened with a cDNA probe composed of a 453 base pair entire coding sequence of a murine CTLA-8. A number of independent lambda clones were found to hybridize strongly with the murine CTLA-8 probe.
  • One clone contained a hybridizing XbaI fragment of approximately 2000 base pairs which corresponded to a fragment previously detected using a similar probe on a human genomic DNA Southern blot. This 2000 base pair fragment was subcloned into Bluescript (Stratagene) and sequenced. This revealed a 240 base pair region (see Table 3) 83.8% homologous to the murine CTLA-8 of Table 1.
  • Electroporated cells were then cultivated for 48 hours in RPMI medium supplemented with 10% Fetal Calf Serum. Cells were then incubated with 35 S-Met and 35 S-Cys in order to label cellular proteins. Comparison of the proteins under reducing conditions on SDS-PAGE showed that cells transfected with human CTLA-8 secreted a polypeptide of 15,000 daltons. Non-reducing SDS-PAGE revealed 2 specific bands around 28,000 daltons and 33,000 daltons. Treatment with endoglycosidase F (Boehringer Mannheim) demonstrated that the higher molecular weight species represents an N-glycosylated form of human CTLA-8.
  • peripheral blood mononuclear cells were purified from 500 ml of human blood on a Ficoll gradient.
  • B cells, CD8+ T cells, monocytes, and NK cells were depleted using 100 ⁇ l of ascitic fluid containing anti-CD19, anti-CD8, anti-CD14, and 25 gg of NKH1 monoclonal antibody (Coulter, Hialeah, Fla.).
  • the PBMC were washed twice in RPMI containing 10% Fetal Calf Serum (FCS).
  • FCS Fetal Calf Serum
  • Paramagnetic beads coated with goat antibodies to mouse IgG (Dynabeads M450, Dynal, Oslo, Norway) were added at a final concentration of 5 beads/cell to be depleted. Unwanted cells were subsequently removed by 3 passages on a magnet. The remaining cells were CD4+ cells at 87% purity which were diluted to 10 7 cells/ml in DMEM F12 (Gibco, Gaithersburg, Md.) containing 10% FCS, 10 ng/ml PMA (Sigma, St.
  • human CTLA-8 and human CTLA-8-FLAG were produced in large amounts with transfected COS-7 cells grown in RPMI medium supplemented with 1% Nutridoma HU (Boeringer Mannheim, Mannheim, Germany) and subsequently purified.
  • the content of human CTLA-8-FLAG in the eluted fractions was determined by dot blot using the anti-FLAG monoclonal antibody M2 (Eastman Kodak, New-Haven, Conn.), whereas the content of human CTLA-8 was assessed by silver staining of non-reducing SDS-PAGE.
  • the CTLA-8 containing fractions were then pooled and dialyzed against PBS, and were either used in biological assays or further purified by anion exchange HPLC on a DEAE column.
  • a third step of gle filtration chromatograph was performed on a SUPERDEX G-75 HRD30 column (Pharmacia Uppsala, Sweden) and yielded practically pure human CTLA-8-8 as analyzed by silver stained SDS-PAGE.
  • Inbred Balb/c mice were immunized intraperitoneally with 1 ml of purified human CTLA-8-FLAG emulsified in Freund's complete adjuvant on day 0, and in Freund's incomplete adjuvant on days 15 and 22. The mice were boosted with 0.5 ml of purified human CTLA-8-8 administered intravenously.
  • Hybridomas were created using the non-secreting myeloma cells line SP2/0-Ag8 and polyethylene glycol 1000 (Sigma, St. Louis, Mo.) as the fusing agent. Hybridoma cells were placed in a 96-well Falcon tissue culture plate (Becton Dickinson, N.J.) and fed with DMEM F12 (Gibco, Gaithersburg, Md.) supplemented with 80 ⁇ g/ml gentamycin, 2 mM glutamine, 10% horse serum (Gibco, Gaithersburg, Md.), 1% ADCM (CRTS, Lyon, France:) 10 ⁇ 5 M azaserine (Sigma, St.
  • Hybridoma supernatants were screened for antibody production against human CTLA-8 by immunocytochemistry (ICC) using acetone fixed human CTLA-8 transfected COS-7 cells and by ELISA using human CTLA-8-FLAG purified from COS-7 supernatants as a coating antigen.
  • Aliquots of positive cell clones were expanded for 6 days and cryopreserved as well as propagated in ascites from pristane (2,6,10,14-teramethylpentadecane, Sigma, St. Louis, Mo.) treated Balb/c mice who had received on intraperitoneal injection of pristane 15 days before. About 10 5 hybridoma cells in 1 ml of PBS were given intraperitoneally, and 10 days later, ascites were collected from each mouse.
  • the antibody fraction was isolated by ammonium sulfate precipitation and anion-exchange chromatography on a zephyr-D silicium column (IBF Sepracor) equilabrated with 20 mM Tris pH 8.0. Proteins were eluted with a NaCl gradient (ranging from 0 to 1 M NaCl). 2 ml fractions were collected and tested by ELISA for the presence of anti-CTLA-8 antibody. The fractions containing specific anti-CTLA-8 activity were pooled, dialyzed, and frozen. Aliquots of the purified monoclonal antibodies were peroxydase labeled.
  • TBS-B-T buffer 20 mM Tris, 150 mM NaCl, 1% BSA (Sigma, St. Louis, Mo.), and 0.05% Tween 20] was added to each well. After 3 hours of incubation at 37° C., the plates were washed once. 100 ⁇ l of peroxydase labeled Ab16 diluted to 5 ⁇ g/ml in TBS-B-T buffer was added to each well, and incubated for 2 hours at 37° C. The wells were then washed three times in washing buffer.
  • Kidney epithelial carcinoma cell lines TUMT and CHA were also cultured in complete RPMI 1640 medium (Gibco BRL, Grand Island, N.Y.), supplemented with 2 mM L-glutamine, 100 U/ml penicillin, 50 ⁇ g/ml gentamycin, 20 mM Hepes buffer and heat-inactivated 10% FCS.
  • Cells (104 cells/well) were incubated in 96-well plates (Falcon) in a final volume of 250 ⁇ l of complete culture medium. Increasing concentrations of human CTLA-8-8 were added at the onset of the culture. Cell-free supernatants were collected after 48 hours, and stored at ⁇ 20° C. until cytokine assays.
  • IL-6 levels were measured by two-site sandwich ELISA as described in Abrams, et al. (1992). Immunol. Rev. 127:5-24. Both cell lines exhibited dose dependent increases in IL-6 secretion with increasing concentrations of CTLA-8. In view of these results, other cell lines will also be screened for responses to other species of CTLA-8 variants.
  • MRC-5 human lung fibroblasts were obtained from the ATCC (Rockville, Md.) and were cultured in complete RPMI 1640 medium (Gibco BRL, Grand Island, N.Y.), supplemented with 2 mM L-glutamine, 100 U/ml penicillin, 50 mg/ml gentamycin, 20 mM Hepes buffer and heat-inactivated 10% FCS.
  • Cells (10 4 cells/well) were incubated in 96-well plates (Falcon) in a final volume of 250 ml of complete culture medium. Increasing concentrations of human CTLA-8-8 was added at the onset of the culture. Cell-free supernatants were collected after 48 hours, and stored at ⁇ 20° C. until cytokine assays.
  • IL-6 levels measured by ELISA. Dose dependent induction of IL-6 was observed.
  • Kidney mesangium cells are also expected to respond similarly.
  • the binding composition is used for screening of an expression library made from a cell line which expresses a CTLA-8 protein.
  • Standard staining techniques are used to detect or sort intracellular or surface expressed antigen, or surface expressing transformed cells are screened by panning. Screening of intracellular expression is performed by various staining or immunofluorescence procedures. See also McMahan, et al. (1991) EMBO J. 10:2821-2832.
  • Second antibody e.g., Vector anti-mouse antibody
  • second antibody e.g., Vector anti-mouse antibody
  • Prepare ELISA solution e.g., Vector Elite ABC horseradish peroxidase solution, and preincubate for 30 min.
  • Use e.g., 1 drop of solution A (avidin) and 1 drop solution B (biotin) per 2.5 ml HBSS/saponin.
  • ABC HRP solution and incubate for 30 min. Wash cells twice with HBSS, second wash for 2 min, which closes cells.
  • DAB Vector diaminobenzoic acid
  • the binding compositions are used to affinity purify or sort out cells expressing the antigen. See, e.g., Sambrook, et al. or Ausubel, et al.
  • Species variants are isolated using cross-species hybridization techniques based upon a full length isolate or fragment from one species as a probe, or appropriate species.
  • SEQ ID NO: 1 is murine CTLA-8 cDNA nucleic acid sequence.
  • SEQ ID NO: 2 is murine CTLA-8 peptide amino acid sequence.
  • SEQ ID NO: 3 is herpesvirus ORF13 nucleic acid sequence.
  • SEQ ID NO: 4 is predicted ORF13 amino acid sequence.
  • SEQ ID NO: 5 is human CTLA-8 cDNA nucleic acid sequence.
  • SEQ ID NO: 6 is predicted human CTLA-8 amino acid sequence.
  • SEQ ID NO: 7 is human CTLA-8 cDNA nucleic acid sequence.
  • SEQ ID NO: 8 is predicted human CTLA-8 amino acid sequence.
  • SEQ ID NO: 9 is mouse CTLA-8 cDNA nucleic acid sequence.
  • SEQ ID NO: 10 is mouse CTLA-8 predicted amino acid sequence.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Immunology (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Cell Biology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

CTLA-8 antigen from a mammal, reagents related thereto including purified proteins, specific antibodies, and nucleic acids encoding said antigen. Methods of using said reagents and diagnostic kits are also provided.

Description

  • The present application is a continuation-in-part of copending U.S. Ser. No. 08/250,846, filed May 27, 1994, which is a continuation-in-part of then copending patent application U.S. Ser. No. 08/177,747, filed Jan. 5, 1994, which is a continuation-in-part of then copending patent application U.S. Ser. No. 08/077,203, filed Jun. 14, 1993, each of which is incorporated herein by reference. Also incorporated by reference is co-pending PCT/US95/00001, filed Jan. 3, 1995.[0001]
  • FIELD OF THE INVENTION
  • The present invention relates to compositions related to proteins which function in controlling physiology, development, and differentiation of mammalian cells, e.g., cells of a mammalian immune system. In particular, it provides proteins and mimetics which regulate cellular physiology, development, differentiation, or function of various cell types, including hematopoietic cells. [0002]
  • BACKGROUND OF THE INVENTION
  • The immune system of vertebrates consists of a number of organs and several different cell types. Two major cell types include the myeloid and lymphoid lineages. Among the lymphoid cell lineage are B cells, which were originally characterized as differentiating in fetal liver or adult bone marrow, and T cells, which were originally characterized as differentiating in the thymus. See, e.g., Paul (ed.) (1993) [0003] Fundamental Immunology (3d ed.) Raven Press, New York.
  • In many aspects of the development of an immune response or cellular differentiation, soluble proteins known as cytokines play a critical role in regulating cellular interactions. These cytokines apparently mediate cellular activities in many ways. They have been shown, in many cases, to modulate proliferation, growth, and differentiation of hematopoietic stem cells into the vast number of progenitors composing the lineages responsible for an immune response. [0004]
  • However, the cellular molecules which are expressed by different developmental stages of cells in these maturation pathways are still incompletely identified. Moreover, the roles and mechanisms of action of signaling molecules which induce, sustain, or modulate the various physiological, developmental, or proliferative states of these cells is poorly understood. Clearly, the immune system and its response to various stresses had relevance to medicine, e.g., infectious diseases, cancer related responses and treatment, allergic and transplantation rejection responses. See, e.g., Thorn, et al. [0005] Harrison's Principles of Internal Medicine McGraw/Hill, New York.
  • Medical science relies, in large degree, to appropriate recruitment or suppression of the immune system in effecting cures for insufficient or improper physiological responses to environmental factors. However, the lack of understanding of how the immune system is regulated or differentiates has blocked the ability to advantageously modulate the normal defensive mechanisms to biological challenges. Medical conditions characterized by abnormal or inappropriate regulation of the development or physiology of relevant cells thus remain unmanageable. The discovery and characterization of specific cytokines will contribute to the development of therapies for a broad range of degenerative or other conditions which affect the immune system, hematopoietic cells, as well as other cell types. The present invention provides solutions to some of these and many other problems. [0006]
  • SUMMARY OF THE INVENTION
  • The present invention is based, in part, upon the discovery of a cDNA clone encoding a cytokine-like protein. This protein has been designated CTLA-8. The invention embraces isolated genes encoding the proteins of the invention, variants of the encoded protein, e.g., mutations (muteins) of the natural sequence, species and allelic variants, fusion proteins, chemical mimetics, antibodies, and other structural or functional analogs. Various uses of these different nucleic acid or protein compositions are also provided. [0007]
  • The present invention embraces isolated genes encoding the proteins of the invention, variants of the encoded protein, e.g., mutations (muteins) of the natural sequence, species and allelic variants, fusion proteins, chemical mimetics, antibodies, and other structural or functional analogs. Various uses of these different nucleic acid or protein compositions are also provided. [0008]
  • The present invention provides a nucleic acid with at least 95% identity to one encoding a mammalian CTLA-8 protein or fragment thereof. The encoding nucleic acid can comprise a sequence of SEQ ID NO: 1, 3, 5, 7, or 9. [0009]
  • The present invention also provides a substantially pure mammalian CTLA-8 protein or peptide thereof. The protein or peptide can comprise at least one polypeptide segment of SEQ ID NO: 2, 4, 6, 8, or 10; exhibit a post-translational modification pattern distinct from a natural mammalian CTLA-8 protein; or induce a cell to secrete an inflammatory mediator, e.g., IL-6, IL-8, and/or PGE2. A further embodiment is a composition comprising such a protein and a pharmaceutically acceptable carrier. [0010]
  • The invention includes an antibody which specifically binds to a primate CTLA-8 protein or peptide thereof; the antibody is raised against a protein sequence of SEQ ID NO: 2, 4, 6, 8 or 10; the antibody is a monoclonal antibody; the antibody blocks the CTLA-8 induced secretion of an inflammatory mediator, e.g., IL-6, IL-8, and/or PGE2; or the antibody is labeled. [0011]
  • The invention also embraces a kit comprising a substantially pure nucleic acid at least 95% identical to one encoding a mammalian CTLA-8 protein or peptide; a substantially. pure mammalian CTLA-8 protein or fragment, e.g., as a positive control; or an antibody or receptor which specifically binds a mammalian CTLA-8 protein. [0012]
  • The availability of these reagents also provides methods of modulating physiology or development of a cell comprising contacting said cell with an agonist or antagonist of a CTLA-8 protein. The method of modulation encompasses regulating CTLA-8 induced secretion of an inflammatory mediator, e.g., IL-6, IL-8, and/or PGE2, by contacting the cell or tissue with an antibody which specifically binds mammalian CTLA-8 or a substantially pure mammalian CTLA-8 protein. Preferably, the cell can be a synovial cell, epithelial cell, endothelial cell, fibroblast cell, or a carcinoma cell. [0013]
  • DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS OUTLINE
  • I. General [0014]
  • II. Nucleic Acids [0015]
  • A. natural isolates; methods [0016]
  • B. synthetic genes [0017]
  • C. methods to isolate [0018]
  • III. Purified CTLA-8 protein [0019]
  • A. physical properties [0020]
  • B. biological properties [0021]
  • IV. Making CTLA-8 protein; Mimetics [0022]
  • A. recombinant methods [0023]
  • B. synthetic methods [0024]
  • C. natural purification [0025]
  • V. Physical Variants [0026]
  • A. sequence variants, fragments [0027]
  • B. post-translational variants [0028]
  • 1. glycosylation [0029]
  • 2. others [0030]
  • VI. Functional Variants [0031]
  • A. analogs; fragments [0032]
  • 1. agonists [0033]
  • 2. antagonists [0034]
  • B. mimetics [0035]
  • 1. protein [0036]
  • 2. chemicals [0037]
  • C. species variants [0038]
  • VII. Antibodies [0039]
  • A. polyclonal [0040]
  • B. monoclonal [0041]
  • C. fragments, binding compositions [0042]
  • VIII. Uses [0043]
  • A. diagnostic [0044]
  • B. therapeutic [0045]
  • IX. Kits [0046]
  • A. nucleic acid reagents [0047]
  • B. protein reagents [0048]
  • C. antibody reagents [0049]
  • I. General [0050]
  • The present invention provides DNA sequence encoding various mammalian proteins which exhibit properties characteristic of functionally significant T cell expressed molecules. The cDNA sequence exhibits various features which are characteristic of mRNAs encoding cytokines, growth factors, and oncogenes. A murine gene originally thought to be from a mouse, but now recognized as rat as described herein contains an open reading frame encoding a putative 150 amino acid protein. This protein is 57% homologous to a putative protein encoded by a viral genome, the herpesvirus Saimiri ORF13. The message was isolated using a subtraction hybridization method applied to T cells. [0051]
  • These proteins are designated CTLA-8 proteins. The natural proteins should be capable of mediating various physiological responses which would lead to biological or physiological responses in target cells. Initial studies had localized the message encoding this protein to various cell lines of hematopoietic cells. Genes encoding the antigen have been mapped to mouse chromosome 1A and human chromosome 2q31. Murine CTLA-8 was originally cloned by Rouvier, et al. (1993) [0052] J. Immunol. 150:5445-5456. Similar sequences for proteins in other mammalian species should also be available.
  • Purified CTLA-8, when cultured with synoviocytes, is able to induce the secretion of IL-6 from these cells. This induction is reversed upon the addition of a neutralizing antibody raised against human CTLA-8-8. Endothelial, epithelial, fibroblast and carcinoma cells also exhibit responses to treatment with CTLA-8. This data suggests that CTLA-8 may be implicated in inflammatory fibrosis, e.g., psoriasis, sclerodermia, lung fibrosis, or cirrhosis. CTLA-8 may also cause proliferation of carcinomas or other cancer cells inasmuch as IL-6 often acts as a growth factor for such cells. [0053]
  • The descriptions below are directed, for exemplary purposes, to a murine or human CTLA-8 protein, but are likewise applicable to related embodiments from other species. [0054]
  • II. Nucleic Acids [0055]
  • Table 1 discloses the nucleotide and amino acid sequences of a murine CTLA-8 protein. The described nucleotide sequences and the related reagents are useful in constructing a DNA clone useful for expressing CTLA-8 protein, or, e.g., isolating a homologous gene from another natural source. Typically, the sequences will be useful in isolating other genes, e.g., allelic variants, from mouse, and similar procedures will be applied to isolate genes from other species, e.g., warm blooded animals, such as birds and mammals. Cross hybridization will allow isolation of genes from other species. A number of different approaches should be available to successfully isolate a suitable nucleic acid clone from other sources. [0056]
    TABLE 1
    Nucleotide sequence encoding a murine CTLA-8 protein and
    predicted amino acid sequence. Also can use complementary nucleic acid
    sequences for many purposes. Submitted to GenBank/EMBL under accession
    number L13839.
    1 GAATTCCATC CATGTGCCTG ATGCTGTTGC TGCTACTGAA CCTGGAGGCT ACAGTGAAGG
    61 CAGCGGTACT CATCCCTCAA AGTTCAGTGT GTCCAAACGC CGAGGCCAAT AACTTTCTCC
    121 AGAACGTGAA GGTCAACCTG AAAGTCATCA ACTCCCTTAG CTCAAAAGCG AGCTCCAGAA
    181 GGCCCTCAGA CTACCTCAAC CGTTCCACTT CACCCTGGAC TCTGAGCCGC AATGACGACC
    241 CTGATAGATA TCCTTCTGTG ATCTGGGAGG CACAGTGCCG CCACCAGCGC TGTGTCAACG
    301 CTGAGGGGAA GTTGGACCAC CACATGAATT CTGTTCTCAT CCAGCAAGAG ATCCTGGTCC
    361 TGAAGAGGGA GCCTGAGAAG TGCCCCTTCA CTTTCCGGGT GGAGAAGATG CTGGTGGGCG
    421 TGGGCTGCAC CTGCGTTTCC TCTATTGTCC GCCATGCGTC CTAAACAGAG ACCTGAGGCT
    481 AGCCCCTAAG AAACCCCTGC GTTTCTCTGC AAACTTCCTT GTCTTITTAA AACAGTTCAC
    541 AGTTGAATCT CAGCAAGTGA TATGGATTTA AAGGCGGGGT TAGAATTGTC TGCCTTCCAC
    601 CCTGAAAAGA AGGCGCAGAG GGGATATAAA TTGCTTCTTG TTTTTCTGTG GGCTTTAAAT
    661 TATTTATGTA TTTACTCTAT CCCGAGATAA CTTTGAGGCA TAAGTTATTT TAATGAATTA
    721 TCTACATTAT TATTATGTTT CTTAATGCAG AAGACAAAAT TCAAGACTAA GAAATTTTAT
    781 TATTTAAAAG GTAAAACCTA TATTTATATG AGCTATTTAT GGGTCTATTT ATTTTTCTTC
    841 AGTGCTAAGA TCATGATTAT CAGATCTACC TAAGGAAGTC CTAAATAATA TTAAATATTA
    901 ATTGAAATTT CAGTTTTACT ATTTGCTTAT TTAAGGTTCC CTCCTCTGAA TGGTGTGAAA
    961 TCAAACCTCG TTTTATGTTT TTAAATTATT GAGGCTTCGA AAAATTGGGC AATTTAGCTT
    1021 CCTACTGTGT GTTTAAAAAC CTTGTAACAA TATCACTATA ATAAATTTTT GGAAGAAAAT
    predicted amino acid sequence (150 amino acids). Mature polypeptide
    probably starts at about amino acid 13 (Ala).
    MCLML LLLLN LEATV KAAVL IPQSS VCPNA EANNF LQNVK VNLKV INSLS
    SKASS RRPSD YLNRS TSPWT LSRNE DPDRY PSVIW EAQCR HQRCV NAEGK
    LDHHM NSVLI QQEIL VLKRE PEKCP FTFRV EKMLV GVGCT CVSSI VRHAS
  • The purified protein or defined peptides are useful for generating antibodies by standard methods, as described above. Synthetic peptides or purified protein can be presented to an immune system to generate a specific binding composition, e.g., monoclonal or polyclonal antibodies. See, e.g., Coligan (1991) [0057] Current Protocols in Immunology Wiley/Greene; and Harlow and Lane (1989) Antibodies: A Laboratory Manual Cold Spring Harbor Press.
  • For example, the specific binding composition could be used for screening of an expression library made from a cell line which expresses a CTLA-8 protein. The screening can be standard staining of surface expressed protein, or by panning. Screening of intracellular expression can also be performed by various staining or immunofluorescence procedures. The binding compositions could be used to affinity purify or sort out cells expressing the protein. [0058]
  • This invention contemplates use of isolated DNA or fragments to encode a biologically active corresponding CTLA-8 protein or polypeptide. In addition, this invention covers isolated or recombinant DNA which encodes a biologically active protein or polypeptide and which is capable of hybridizing under appropriate conditions with the DNA sequences described herein. Said biologically active protein or polypeptide can be an intact antigen, or fragment, and have an amino acid sequence as disclosed in Table 1. Further, this invention covers the use of isolated or recombinant DNA, or fragments thereof, which encode proteins which are homologous to a CTLA-8 protein or which were isolated using cDNA encoding a CTLA-8 protein as a probe. The isolated DNA can have the respective regulatory sequences in the 5′ and 3′ flanks, e.g., promoters, enhancers, poly-A addition signals, and others. In particular, the murine CTLA-8 gene has significant homology, about 60%, to the putative protein encoded by the open reading frame ORF13, of herpesvirus Saimiri (Table 2); to a human CTLA-8 counterpart (Table 3), about 60%; and to a mouse CTLA-8 counterpart (Table 4), about 80%. [0059]
    TABLE 2
    Nucleotide sequence of the related herpesvirus Saimiri open
    reading frame ORF13 and predicted amino acid sequence of
    encoded protein, see GenBank/EMBL accession number M60286.
    herpesvirus
    ACCTTCATGC AAATACATCT TATCTTACCA GATTCTCGCC TCATTTGCAA 50
    ACATGCCTCA TCTTTTGAGA AGAAACGCAA TTCGAACTTC TTCTAATGCT 100
    CCTGAACAGC AGCCTGTGCT GCAGCCTGAG CTTGATGCTA TTGAAGAGCT 150
    AGAATAAGAG CTATTTTTTG ACGATGGGTG CTGCCTTTCT GTTCAAGAAA 200
    TCTGCTTAAT TGTTCTTGGA TTCTTATTGT TTCTGCTAGC TGTAATTGTT 250
    TTTTATAACT ATACAGACAC AGATCAATTT GTGAAGCTGA CACATCTTAT 300
    GAGCCACAAA AATTCTATCA AAGGACCTTT AAGGACCTTT GGTATGTACT 350
    CATAATTTTA TTTTTTTATT TCTAAAACAA TCTTAGTATA TATAATTAAT 400
    ACAAATTTTA GAAAATACTA TAATAAATAT TGAAAGCTGT ATTTACATTG 450
    TAAACTATAT ATAGGCAATG TAAAGTCATT CTAACTTTAG GTTTGCTTTA 500
    CCTGTTACAG AAACTTCACC TGTGTGTCAA GAGCTGCAAA CATGGCTTTA 550
    GACTTAAGAA ATCTTAAACA CCTGACTGCT AACTTCAGTT TTAGAATAAT 600
    GATATGGATT ATGCTATGTT TGGCTCTACC TACTGATAGT AAACCTATTT 650
    CAACAACTGA AGCTCCAATA CTAAACATAA CACAATCTCC AAGTTTGAAC 700
    ATCTCATCAC CTTCTACTTT AGAACCTTCA GAGCCTCTTA AAAACTGTAC 750
    AACATTCTTA GACTTACTTT GGCAGCGGCT GGGCGAGAAC GCTTCTATAA 800
    AGGACTTGAT GTTAACATTA CAACGAGAAG AAGTCCACGG AAGAATGACT 850
    ACACTTCCTT CACCTAGACC AAGCAGTAAA GTTGAAGAAC AACAGTTACA 900
    AAGACCTAGA AACTTACTGC CTACTGCTGT CGGGCCACCT CATGTCAAAT 950
    ATAGACTATA TAATCGCTTA TGGGAAGCTC CTAAAGGAGC TGATGTTAAT 1000
    GGTAAACCTA TACAATTTGA TGACCCTCCT CTTCCTTATA CAGGGGCATA 1050
    TAATGATGAT GGTGTTTTAA TGGTTAATAT TAATGGAAAA CATGTGAGGT 1100
    TTGATAGCTT GTCTTATTGG GAAAGAATTA AAAGATCTGG TACCCCATGG 1150
    TGTATAAAGA CACCAAGTGA AAAAGCAGCA ATATTGAAGC AGCTTTTAAA 1200
    AGCTGAAAAA AAATGTAGGA CTACTTCTAA ACGTATCACT GAGTTAGAAG 1250
    AGCAGATTAA AGAACTAGAA AAAACTAGTA CATCTCCATA GATTACTGTT 1300
    AGAATGTGTT TATCATACTA AAATAAATGC TTTATGTATT GCAATATTAC 1350
    TTGTTTGCTA TGACTTTGGT ATATGAAATG CAAATCTTAA ATAAAAAGTT 1400
    TTTCTCTAGT ATTGGCGTCA CTGTATTTTA CTAGCAAAAA TATATAAATT 1450
    GTTATGTAGC AACAAGTTTG TATCAATATA AAAACTCTAA AGTATATAAA 1500
    CAAACATTCA ATTAGTGTAA ATCATAGCAA GCATATCTTT TCATACGTGT 1550
    CTAGTTAATT TAAAGAATTA ATTATGACAT TTAGAATGAC TTCACTTGTG 1600
    TTACTTCTCC TGCTGAGCAT AGATTGTATA GTAAAGTCAG AAATAACAAG 1650
    CGCACAAACC CCAAGATGCT TAGCTGCTAA CAATAGCTTT CCACGGTCTG 1700
    TGATGGTTAC TTTGAGCATC CGTAACTGGA ATACTAGTTC TAAAAGGGCT 1750
    TCAGACTACT ACAATAGATC TACGTCTCCT TGGACTCTCC ATCGCAATGA 1800
    AGATCAAGAT AGATATCCCT CTGTGATTTC GGAAGCAAAG TGTCGCTACT 1850
    TACGATGTGT TAATGCTGAT GGGAATGTAG ACTACCACAT GAACTCAGTC 1900
    CCTATCCAAC AAGAGATTCT AGTGGTGCGC AAAGGGCATC AACCCTGCCC 1950
    TAATTCATTT AGGCTAGAGA AGATGCTAGT GACTGTAGGC TGCACATGCG 2000
    TTACTCCCAT TGTTCACAAT GTAGACTAAA AGCTATCTAA ATTTTGAAAA 2050
    TTAACATTTC ACTAAAAAAC AAAAACTTGA TTTTTTTCTT TTAAATAAAA 2100
    AAAGTTTAAT ATAAGTTCTG GCTTGTTTGG TTTTTGACTA ATCAATGTAG 2150
    ATCACACTTG TGATCTTAGC TCTCGGGAAG CAATGTAAGA AAATATATTT 2200
    AACTTAAGAG TTTTAGACTT GCTTGAGTTT TATGAGTAAA AAACAAAGAA 2250
    TAAGCACAGC TTCTTGTATC TTCTTTTAAA AACTTTAAGT TATTTATGTA 2300
    TTTAATATAA TCTAATGTTT CTTAAACATG TTGAGTTTGA GGTCCACTAA 2350
    TACAACATTA TAATTTTTTC TGTTATAACA CTTTTGCAAG AAGAACTCAT 2400
    TTTATAGAAA ATGAGCAGTA TTCAAAAAAA ATGTTTGATA TGCTGTAATA 2450
    TTGGAGAGGA AGAACTTTTA CAAGCATGTG ATTGTCCTAG CAGAGTCCAT 2500
    CATACATGCT TACAAAGTCA 2520
    Tm17 Peptide sequence
    MVIDG CKKYM RRTCG DVLDN LRGDC YQVLI EDCIP VLKMY AKEGR EFDYV 50
    INDLT AVPIS TSPEE DSTWD FLRLI LDLSM KVLKQ DGKTF TQGNC VNLTE 100
    ALSLY EEQLG RLYCP VEFSK EIVCV PSYLE LNVFY TVWKK AKP 143
  • [0060]
    TABLE 3
    Nucleotide sequence of human CTLA-8 fragment and predicted
    amino acid sequence of encoded protein.
    AGC/CGC AAT GAG GAC CCT GAG AGA TAT CCC TCT GTG ATC TGG GAG
    GCA AAG TGC CGC CAC TTG CCC TGC ATC AAC GCT GAT GGG AAC GTG
    GAC TAC CAC ATG AAC TCT GTC CCC ATC CAG CAA GAG ATC CTG GTC
    CTG CGC AGG GAG CCT CCA CAC TGC CCC AAC TCC TTC CGG CTG GAG
    AAG ATA CTG GTG TCC GTG GGC TCC ACC TCT GTC ACC CCC ATT GTC
    CAC CAT GTG GCC TAA
    ser/arg asn glu asp pro glu arg tyr pro ser val ile trp glu
    ala lys cys arg his leu gly cys ile asn ala asp gly asn val
    asp tyr his met asn ser val pro ile gln gln glu ile leu val
    leu arg arg glu pro pro his cys pro asn ser phe arg leu glu
    lys ile leu val ser val gly cys thr cys val thr pro ile val
    his his val ala OCH
    this was used to isolate a full length clone from human; it
    corresponds to nucleotides 272-510:
                 GG CACAAACTCA TCCATCCCCA GTTGATTGGA AGAAACAACG 42
    ATG ACT CCT GGG AAG ACC TCA TTG GTG TCA CTG CTA CTG CTG CTG 87
    Met thr pro gly lys thr ser leu val ser leu leu leu leu leu 15
    AGC CTG GAG GCC ATA GTC AAG GCA GGA ATC ACA ATC CCA CGA AAT 132
    ser leu glu ala ile val lys ala gly ile thr ile pro arg asn 30
    CCA GGA TCC CCA AAT TCT GAG GAC AAG AAC TTC CCC CGG ACT GTG 177
    pro gly cys pro asn ser glu asp lys asn phe pro arg thr val 45
    ATG GTC AAC CTG AAC ATC CAT AAC CGG AAT ACC AAT ACC AAT CCC 222
    met val asn leu asn ile his asn arg asn thr asn thr asn pro 60
    aaA AGG TCC TCA GAT TAC TAC AAC CGA TCC ACC TCA CCT TGG AAT 267
    lys arg ser ser asp tyr tyr asn arg ser thr ser pro trp asn 75
    CTC CAC CGC AAT GAG GAC CCT GAG AGA TAT CCC TCT CTG ATC TGG 312
    leu his arg asn glu asp pro glu arg tyr pro ser val ile trp 90
    GAG GCA AAG TGC CGC CAC TTG GGC TGC ATC AAC GCT GAT GGG AAC 357
    glu ala lys cys arg his leu gly cys ile asn ala asp gly asn 105
    GTG GAC TAC CAC ATG AAC TCT GTC CCC ATC CAG CAA GAG ATC CTG 402
    val asp tyr his met asn ser val pro ile gln gln glu ile leu 120
    GTC CTG CGC AGG GAG CCT CCA CAC TGC CCC AAC TCC TTC CGG CTG 447
    val leu arg arg glu pro pro his cys pro asn ser phe arg leu 135
    GAG AAG ATA CTG GTG TCC GTG GGC TGC ACC TGT GTC ACC CCG ATT 492
    glu lys ile leu val ser val gly cys thr cys val thr pro ile 150
    GTC CAC CAT GTG GCC TAA 510
    val his his val ala OCH 156
  • [0061]
    TABLE 4
    Nucleotide sequence of mouse CTLA-8 fragment and predicted amino
    acid sequence of encoded protein.
    gaggctcaagtgcacccagcaccagctgatcaggacgcgcaaacatgagtccagggagagcttcatctg 69
    tgtctctgatgctgttgctgctgctgagcctggcggctacagtgaaggcagcagcgatcatccctcaaa 138
    gctcagcgtgtccaaacactgaggccaaggacttcctccagaatgtgaaggtcaacctcaaagtcttta 207
    actcccTTGGCGCAAAAGTGAGCTCCAGAAGgCCCTCAGACTACCTCAACCGTTCCACGTCACCCTGGA 276
    CTCTCCACCGCAATGAAGACCCTGATAGATATCCCTCTGTGATCTGGGAAGCTCAGTGCCGCCACCAGC 345
    GCTGTGTCAATGCGGAGggaaagctggaccaccacatgaattctgttctcatccagcaagagatcctgg 414
    tcctgaagagggagcctgagagctgccccttcactttcagggtcgagaagatgctggtgggTGTGGGCT 483
    GCACCTGCGTGGCCTCGATTGTCCGCCAGGCAGCCTAAACAGAGACCCGCGGCTGACCCCTAAGAAACC 552
    CCCACGTTTCTCAGCAAACTTACTTGCATTTTTAAAACAGTTCGTGCTATTGATTTTCAGCAAGGAATG 621
    TGGATTCAGAGGCAGATTCAGAATTGTCTGCCCTCCACAATGAAAAGAAGGTGTAAAGGGGTCCCAAAC 690
    TGCTTCgtgtttgtttttctgtggactttaaattatttgtgtatttacaatatcccaagataactttga 759
    aggcgtaacttatttaatgaagtatctacattattattatgtttctttctgaagaagacaaaattcaag 828
    actcagaaattttattatttaaaaggtaagcctatatttatatgagctatttatgaatctatttatttt 897
    tcttcagtatttgaagtattaagaacatgattttCAGATCTACCTACGGAAGTCCTAAGTAAGATTAAA 966
    TATTAATGGAAATTTCAGCTTTACTATTTGGTTGATTTAAGGTTCTCTCCTCTGAATGGGGTGAAAACC 1035
    AAACTTAGTTTTATGTTTAATAACTTTTTAAATTATTGAAGATTCAAAAAATTGGATAATTTAGCTCCC 1104
    TACTCTGTTTTAAAAAAAAAAAAAAAAAAA 1134
    Mouse CTLA-8 predicted amino acid sequence. The mature polypeptide probably
    starts at a position about amino acid 19 (Leu) to amino acid 21 (Ala).
    METSerProGlyArgAlaSerSerValSerLeuMETLeuLeuLeuLeuLeuSerLeuAlaAlaThrValLys 24
    AlaAlaAlaIleIleProGlnSerSerAlaCysProAsnThrGluAlaLysAspPheLeuGlnAsnValLys 48
    ValAsnLeuLysValPheAsnSerLeuGlyAlaLysValSerSerArgArgProSerAspTyrLeuAsnArg 72
    SerThrSerProTrpThrLeuHisArgAsnGluAspProAspArgTyrProSerValIleTrpGluAlaGln 96
    CysArgHisGlnArgCysValAsnAlacluGlyLysLeuAspHisHisMETAsnSerValLeuIleGlnGln 120
    GluIleLeuValLeuLysArgGluProGluSercysProPheThrPheArgValGlubysMETLeuValGly 144
    ValGlyCysThrCysValAlaSerIleValArgGlnAlaAla 158
  • An “isolated” nucleic acid is a nucleic acid, e.g., an RNA, DNA, or a mixed polymer, which is substantially separated from other components which naturally accompany a native sequence, e.g., ribosomes, polymerases, and flanking genomic sequences from the originating species. The term embraces a nucleic acid sequence which has been removed from its naturally occurring environment, and includes recombinant or cloned DNA isolates and chemically synthesized analogs or analogs biologically synthesized by heterologous systems. A substantially pure molecule includes isolated forms of the molecule. Alternatively, a purified species may be separated from host components from a recombinant expression system. The size of homology of such a nucleic acid will typically be less than large vectors, e.g., less than tens of kB, typically less than several kB, and preferably in the 2-6 kB range. [0062]
  • An isolated nucleic acid will generally be a homogeneous composition of molecules, but will, in some embodiments, contain minor heterogeneity. This heterogeneity is typically found at the polymer ends or portions not critical to a desired biological function or activity. [0063]
  • A “recombinant” nucleic acid is defined either by its method of production or its structure. In reference to its method of production, e.g., a product made by a process, the process is use of recombinant nucleic acid techniques, e.g., involving human intervention in the nucleotide sequence, typically selection or production. Alternatively, it can be a nucleic acid made by generating a sequence comprising fusion of two fragments which are not naturally contiguous to each other, but is meant to exclude products of nature, e.g., naturally occurring mutants. Thus, for example, products made by transforming cells with any unnaturally occurring vector is encompassed, as are nucleic acids comprising sequence derived using any synthetic oligonucleotide process. Such is often done to replace a codon with a redundant codon encoding the same or a conservative amino acid, while typically introducing or removing a sequence recognition site. Alternatively, it is performed to join together nucleic acid segments of desired functions to generate a single genetic entity comprising a desired combination of functions not found in the commonly available natural forms. Restriction enzyme recognition sites are often the target of such artificial manipulations, but other site specific targets, e.g., promoters, DNA replication sites, regulation sequences, control sequences, or other useful features may be incorporated by design. A similar concept is intended for a recombinant, e.g., fusion, polypeptide. Specifically included are synthetic nucleic acids which, by genetic code redundancy, encode polypeptides similar to fragments of these antigens, and fusions of sequences from various different species variants. [0064]
  • A significant “fragment” in a nucleic acid context is a contiguous segment of at least about 17 nucleotides, generally at least 20 nucleotides, more generally at least 23 nucleotides, ordinarily at least 26 nucleotides, more ordinarily at least 29 nucleotides, often at least 32 nucleotides, more often at least 35 nucleotides, typically at least 38 nucleotides more typically at least 41 nucleotides, usually at least 44 nucleotides, more usually at least 47 nucleotides, preferably at least 50 nucleotides, more preferably at least 53 nucleotides, and in particularly preferred embodiments will be at least 56 or more nucleotides. Said fragments may have termini at any location, but especially at boundaries between structural domains. [0065]
  • A DNA which codes for a CTLA-8 protein will be particularly useful to identify genes, mRNA, and cDNA species which code for related or homologous proteins, as well as DNAs which code for homologous proteins from different species. There are likely homologues in other species, including primates. Various CTLA-8 proteins should be homologous and ate encompassed herein. However, even proteins that have a more distant evolutionary relationship to the antigen can readily be isolated under appropriate conditions using these sequences if they are sufficiently homologous. Primate CTLA-8 protein proteins are of particular interest. [0066]
  • This invention further covers recombinant DNA molecules and fragments having a DNA sequence identical to or highly homologous to the isolated DNAs set forth herein. In particular, the sequences will often be operably linked to DNA segments which control transcription, translation, and DNA replication. Alternatively, recombinant clones derived from the genomic sequences, e.g., containing introns, will be useful for transgenic studies, including, e.g., transgenic cells and organisms, and for gene therapy. See, e.g., Goodnow (1992) “Transgenic Animals” in Roitt (ed.) [0067] Encyclopedia of Immunology Academic Press, San Diego, pp. 1502-1504; Travis (1992) Science 256:1392-1394; Kuhn, et al. (1991) Science 254:707-710; Capecchi (1989) Science 244:1288; Robertson (1987)(ed.) Teratocarcinomas and Embryonic Stem Cells: A Practical Approach IRL Press, Oxford; Rosenberg (1992) J. Clinical Oncology 10:180-199; and Cournoyer and Caskey (1993) Ann. Rev. Immunol. 11:297-329.
  • Homologous nucleic acid sequences, when compared, exhibit significant similarity. The standards for homology in nucleic acids are either measures for homology generally used in the art by sequence comparison or based upon hybridization conditions. The hybridization conditions are described in greater detail below. [0068]
  • Substantial homology in the nucleic acid sequence comparison context means either that the segments, or their complementary strands, when compared, are identical when optimally aligned, with appropriate nucleotide insertions or deletions, in at least about 50% of the nucleotides, generally at least 56%, more generally at least 59%, ordinarily at least 62%, more ordinarily at least 65%, often at least 68%, more often at least 71%, typically at least 74%, more typically at least 77%, usually at least 80%, more usually at least about 85%, preferably at least about 90%, more preferably at least about 95 to 98% or more, and in particular embodiments, as high at about 99% or more of the nucleotides. Alternatively, substantial homology exists when the segments will hybridize under selective hybridization conditions, to a strand, or its complement, typically using a sequence derived from Table 1, 2, or 3. Typically, selective hybridization will occur when there is at least about 55% homology over a stretch of at least about 14 nucleotides, preferably at least about 65%, more preferably at least about 75%, and most preferably at least about 90%. See, Kanehisa (1984) [0069] Nuc. Acids Res. 12:203-213. The length of homology comparison, as described, may be over longer stretches, and in certain embodiments will be over a stretch of at least about 17 nucleotides, usually at least about 20 nucleotides, more usually at least about 24 nucleotides, typically at least about 28 nucleotides, more typically at least about 40 nucleotides, preferably at least about 50 nucleotides, and more preferably at least about 75 to 100 or more nucleotides.
  • Stringent conditions, in referring to homology in the hybridization context, will be stringent combined conditions of salt, temperature, organic solvents, and other parameters, typically those controlled in hybridization reactions. Stringent temperature conditions will usually include temperatures in excess of about 30° C., more usually in excess of about 37° C., typically in excess of about 45° C., more typically in excess of about 55° C., preferably in excess of about 65° C., and more preferably in excess of about 70° C. Stringent salt conditions will ordinarily be less than about 1000 mM, usually less than about 500 mM, more usually less than about 400 mM, typically less than about 300 mM, preferably less than about 200 mM, and more preferably less than about 150 mM. However, the combination of parameters is much more important than the measure of any single parameter. See, e.g., Wetmur and Davidson (1968) [0070] J. Mol. Biol. 31:349-370.
  • CTLA-8 protein from other mammalian species can be cloned and isolated by cross-species hybridization of closely related species, e.g., human, as disclosed in Table 3. Homology may be relatively low between distantly related species, and thus hybridization of relatively closely related species is advisable. Alternatively, preparation of an antibody preparation which exhibits less species specificity may be useful in expression cloning approaches. [0071]
  • III. Purified CTLA-8 Protein [0072]
  • The predicted sequence of murine CTLA-8 protein amino acid sequence is shown in Table 1. The homologous herpesvirus predicted ORF13 protein sequence is shown in Table 2, and is assigned SEQ ID NO: 4. A human counterpart is described in Table 3. The peptide sequences allow preparation of peptides to generate antibodies to recognize such segments. [0073]
  • As used herein, the terms “murine CTLA-8 protein” and “human CTLA-8 protein shall encompass, when used in a protein context, a protein having amino acid sequences shown in Table 1 or Table 3, or a significant fragment of such a protein. It also refers to a mouse derived polypeptide which exhibits similar biological function or interacts with CTLA-8 protein specific binding components. These binding components, e.g., antibodies, typically bind to a CTLA-8 protein with high affinity, e.g., at least about 100 nM, usually better than about 30 nM, preferably better than about 10 nM, and more preferably at better than about 3 nM. Homologous proteins would be found in mammalian species other than rat or humans, e.g., mouse, primates, and in the herpesvirus genome, e.g., ORF13. Non-mammalian species should also possess structurally or functionally related genes and proteins. [0074]
  • The term “polypeptide” as used herein includes a significant fragment or segment, and encompasses a stretch of amino acid residues of at least about 8 amino acids, generally at least 10 amino acids, more generally at least 12 amino acids, often at least 14 amino acids, more often at least 16 amino acids, typically at least 18 amino acids, more typically at least 20 amino acids, usually at least 22 amino acids, more usually at least 24 amino acids, preferably at least 26 amino acids, more preferably at least 28 amino acids, and, in particularly preferred embodiments, at least about 30 or more amino acids. The specific ends of such a segment will be at any combinations within the protein, preferably encompassing structural domains. [0075]
  • The term “binding composition” refers to molecules that bind with specificity to CTLA-8 protein, e.g., in a ligand-receptor type fashion, an antibody-antigen interaction, or compounds, e.g., proteins which specifically associate with CTLA-8 protein, e.g., in a natural physiologically relevant protein-protein interaction, either covalent or non-covalent. The molecule may be a polymer, or chemical reagent. No implication as to whether CTLA-8 protein is either the ligand or the receptor of a ligand-receptor interaction is represented, other than the interaction exhibit similar specificity, e.g., specific affinity. A functional analog may be a protein with structural modifications, or may be a wholly unrelated molecule, e.g., which has a molecular shape which interacts with the appropriate binding determinants. The proteins may serve as agonists or antagonists of a receptor, see, e.g., Goodman, et al. (eds.) (1990) [0076] Goodman & Gilman's: The Pharmacological Bases of Therapeutics (8th ed.), Pergamon Press.
  • Solubility of a polypeptide or fragment depends upon the environment and the polypeptide. Many parameters affect polypeptide solubility, including temperature, electrolyte environment, size and molecular characteristics of the polypeptide, and nature of the solvent. Typically, the temperature at which the polypeptide is used ranges from about 4° C. to about 65° C. Usually the temperature at use is greater than about 18° C. and more usually greater than about 22° C. For diagnostic purposes, the temperature will usually be about room temperature or warmer, but less than the denaturation temperature of components in the assay. For therapeutic purposes, the temperature will usually be body temperature, typically about 37° C. for humans, though under certain situations the temperature may be raised or lowered in situ or in vitro. [0077]
  • The electrolytes will usually approximate in situ physiological conditions, but may be modified to higher or lower ionic strength where advantageous. The actual ions may be modified, e.g., to conform to standard buffers used in physiological or analytical contexts. [0078]
  • The size and structure of the polypeptide should generally be in a substantially stable state, and usually not in a denatured state. The polypeptide may be associated with other polypeptides in a quaternary structure, e.g., to confer solubility, or associated with lipids or detergents in a manner which approximates natural lipid bilayer interactions. [0079]
  • The solvent will usually be a biologically compatible buffer, of a type used for preservation of biological activities, and will usually approximate a physiological solvent. Usually the solvent will have a neutral pH, typically between about 5 and 10, and preferably about 7.5. On some occasions, a detergent will be added, typically a mild non-denaturing one, e.g., CHS or CHAPS, or a low enough concentration as to avoid significant disruption of structural or physiological properties of the antigen. [0080]
  • Solubility is reflected by sedimentation measured in Svedberg units, which are a measure of the sedimentation velocity of a molecule under particular conditions. The determination of the sedimentation velocity was classically performed in an analytical ultracentrifuge, but is typically now performed in a standard ultracentrifuge. See, Freifelder (1982) [0081] Physical Biochemistry (2d ed.), W. H. Freeman; and Cantor and Schimmel (1980) Biophysical Chemistry, parts 1-3, W. H. Freeman & Co., San Francisco. As a crude determination, a sample containing a putatively soluble polypeptide is spun in a standard full sized ultracentrifuge at about 50K rpm for about 10 minutes, and soluble molecules will remain in the supernatant. A soluble particle or polypeptide will typically be less than about 30 S, more typically less than about 15 S, usually less than about 10 S, more usually less than about 6 S, and, in particular embodiments, preferably less than about 4 S, and more preferably less than about 3 S.
  • IV. Making CTLA-8 Protein; Mimetics [0082]
  • DNA which encodes the CTLA-8 protein or fragments thereof can be obtained by chemical synthesis, screening cDNA libraries, or by screening genomic libraries prepared from a wide variety of cell lines or tissue samples. [0083]
  • This DNA can be expressed in a wide variety of host cells for the synthesis of a full-length protein or fragments which can in turn, for example, be used to generate polyclonal or monoclonal antibodies; for binding studies; for construction and expression of modified molecules; and for structure/function studies. Each antigen or its fragments can be expressed in host cells that are transformed or transfected with appropriate expression vectors. These molecules can be substantially purified to be free of protein or cellular contaminants, other than those derived from the recombinant host, and therefore are particularly useful in pharmaceutical compositions when combined with a pharmaceutically acceptable carrier and/or diluent. The antigen, or portions thereof, may be expressed as fusions with other proteins. [0084]
  • Expression vectors are typically self-replicating DNA or RNA constructs containing the desired antigen gene or its fragments, usually operably linked to suitable genetic control elements that are recognized in a suitable host cell. These control elements are capable of effecting expression within a suitable host. The specific type of control elements necessary to effect expression will depend upon the eventual host cell used. Generally, the genetic control elements can include a prokaryotic promoter system or a eukaryotic promoter expression control system, and typically include a transcriptional promoter, an optional operator to control the onset of transcription, transcription enhancers to elevate the level of mRNA expression, a sequence that encodes a suitable ribosome binding site, and sequences that terminate transcription and translation. Expression vectors also usually contain an origin of replication that allows the vector to replicate independently of the host cell. Methods for amplifying vector copy number are also known, see, e.g., Kaufman, et al. (1985) [0085] Molec. and Cell. Biol. 5:1750-1759.
  • The vectors of this invention contain DNA which encodes a CTLA-8 protein, or a fragment thereof, typically encoding a biologically active polypeptide. The DNA can be under the control of a viral promoter and can encode a selection marker. This invention further contemplates use of such expression vectors which are capable of expressing eukaryotic cDNA coding for a CTLA-8 protein in a prokaryotic or eukaryotic host, where the vector is compatible with the host and where the eukaryotic cDNA coding for the antigen is inserted into the vector such that growth of the host containing the vector expresses the cDNA in question. Usually, expression vectors are designed for stable replication in their host cells or for amplification to greatly increase the total number of copies of the desirable gene per cell. It is not always necessary to require that an expression vector replicate in a host cell, e.g., it is possible to effect transient expression of the antigen or its fragments in various hosts using vectors that do not contain a replication origin that is recognized by the host cell. It is also possible to use vectors that cause integration of a CTLA-8 protein gene or its fragments into the host DNA by recombination, or to integrate a promoter which controls expression of an endogenous gene. [0086]
  • Vectors, as used herein, comprise plasmids, viruses, bacteriophage, integratable DNA fragments, and other vehicles which enable the integration of DNA fragments into the genome of the host. Expression vectors are specialized vectors which contain genetic control elements that effect expression of operably linked genes. Plasmids are the most commonly used form of vector but all other forms of vectors which serve an equivalent function and which are, or become, known in the art are suitable for use herein. See, e.g., Pouwels, et al.. (1985 and Supplements) [0087] Cloning Vectors: A Laboratory Manual, Elsevier, N.Y., and Rodriquez, et al. (1988)(eds.) Vectors: A Survey of Molecular Cloning Vectors and Their Uses, Buttersworth, Boston, Mass.
  • Transformed cells include cells, preferably mammalian, that have been transformed or transfected with vectors containing a CTLA-8 gene, typically constructed using recombinant DNA techniques. Transformed host cells usually express the antigen or its fragments, but for purposes of cloning, amplifying, and manipulating its DNA, do not need to express the protein. This invention further contemplates culturing transformed cells in a nutrient medium, thus permitting the protein to accumulate in the culture. The protein can be recovered, either from the culture or from the culture medium. [0088]
  • For purposes of this invention, DNA sequences are operably linked when they are functionally related to each other. For example, DNA for a presequence or secretory leader is operably linked to a polypeptide if it is expressed as a preprotein or participates in directing the polypeptide to the cell membrane or in secretion of the polypeptide. A promoter is operably linked to a coding sequence if it controls the transcription of the polypeptide; a ribosome binding site is operably linked to a coding sequence if it is positioned to permit translation. Usually, operably linked means contiguous and in reading frame, however, certain genetic elements such as repressor genes are not contiguously linked but still bind to operator sequences that in turn control expression. [0089]
  • Suitable host cells include prokaryotes, lower eukaryotes, and higher eukaryotes. Prokaryotes include both gram negative and gram positive organisms, e.g., [0090] E. coli and B. subtilis. Lower eukaryotes include yeasts, e.g., S. cerevisiae and Pichia, and species of the genus Dictyostelium. Higher eukaryotes include established tissue culture cell lines from animal cells, both of non-mammalian origin, e.g., insect cells, and birds, and of mammalian origin, e.g., human, primates, and rodents.
  • Prokaryotic host-vector systems include a wide variety of vectors for many different species. As used herein, [0091] E. coli and its vectors will be used generically to include equivalent vectors used in other prokaryotes. A representative vector for amplifying DNA is pBR322 or many of its derivatives. Vectors that can be used to express the CTLA-8 proteins or its fragments include, but are not limited to, such vectors as those containing the lac promoter (pUC-series); trp promoter (pBR322-trp); Ipp promoter (the pIN-series); lambda-pP or pR promoters (pOTS); or hybrid promoters such as ptac (pDR540). See Brosius, et al. (1988) “Expression Vectors Employing Lambda-, trp-, lac-, and Ipp-derived Promoters”, in Rodriguez and Denhardt (eds.) Vectors: A Survey of Molecular Cloning Vectors and Their Uses, Buttersworth, Boston, Chapter 10, pp. 205-236.
  • Lower eukaryotes, e.g., yeasts and Dictyostelium, may be transformed with vectors encoding CTLA-8 proteins. For purposes of this invention, the most common lower eukaryotic host is the baker's yeast, [0092] Saccharomyces cerevisiae. It will be used to generically represent lower eukaryotes although a number of other strains and species are also available. Yeast vectors typically consist of a replication origin (unless of the integrating type), a selection gene, a promoter, DNA encoding the desired protein or its fragments, and sequences for translation termination, polyadenylation, and transcription termination. Suitable expression vectors for yeast include such constitutive promoters as 3-phosphoglycerate kinase and various other glycolytic enzyme gene promoters or such inducible promoters as the alcohol dehydrogenase 2 promoter or metallothionine promoter. Suitable vectors include derivatives of the following types: self-replicating low copy number (such as the YRp-series), self-replicating high copy number (such as the YEp-series); integrating types (such as the YIp-series), or mini-chromosomes (such as the YCp-series).
  • Higher eukaryotic tissue culture cells are the preferred host cells for expression of the functionally active CTLA-8 protein. In principle, many higher eukaryotic tissue culture cell lines are workable, e.g., insect baculovirus expression systems, whether from an invertebrate or vertebrate source. However, mammalian cells are preferred, in that the processing, both cotranslationally and posttranslationally. Transformation or transfection and propagation of such cells has become a routine procedure. Examples of useful cell lines include HeLa cells, Chinese hamster ovary (CHO) cell lines, baby rat kidney (BRK) cell lines, insect cell lines, bird cell lines, and monkey (COS) cell lines. Expression vectors for such cell lines usually include an origin of replication, a promoter, a translation initiation site, RNA splice sites (if genomic DNA is used), a polyadenylation site, and a transcription termination site. These vectors also usually contain a selection gene or amplification gene. Suitable expression vectors may be plasmids, viruses, or retroviruses carrying promoters derived, e.g., from such sources as from adenovirus, SV40, parvoviruses, vaccinia virus, or cytomegalovirus. Representative examples of suitable expression vectors include pCDNA1; pCD, see Okayama, et al. (1985) [0093] Mol. Cell Biol. 5:1136-1142; pMC1neo Poly-A, see Thomas, et al. (1987) Cell 51:503-512; and a baculovirus vector such as pAC 373 or pAC 610, see O'Reilly, et al. (1992) Baculovirus Expression Vectors: A Laboratory Manual Freeman and Co., CRC Press, Boca Raton, Fla.
  • It will often be desired to express a CTLA-8 protein polypeptide in a system which provides a specific or defined glycosylation pattern. In this case, the usual pattern will be that provided naturally by the expression system. However, the pattern will be modifiable by exposing the polypeptide, e.g., an unglycosylated form, to appropriate glycosylating proteins introduced into a heterologous expression system. For example, the CTLA-8 protein gene may be co-transformed with one or more genes encoding mammalian or other glycosylating enzymes. Using this approach, certain mammalian glycosylation patterns will be achievable or approximated in prokaryote or other cells. [0094]
  • The CTLA-8 protein, or a fragment thereof, may be engineered to be phosphatidyl inositol (PI) linked to a cell membrane, but can be removed from membranes by treatment with a phosphatidyl inositol cleaving enzyme, e.g., phosphatidyl inositol phospholipase-C. This releases the antigen in a biologically active form, and allows purification by standard procedures of protein chemistry. See, e.g., Low (1989) [0095] Biochim. Biophys. Acta 988:427-454; Tse, et al. (1985) Science 230:1003-1008; and Brunner, et al. (1991) J. Cell Biol. 114:1275-1283.
  • Now that the CTLA-8 protein has been characterized, fragments or derivatives thereof can be prepared by conventional processes for synthesizing peptides. These include processes such as are described in Stewart and Young (1984) [0096] Solid Phase Peptide Synthesis, Pierce Chemical Co., Rockford, Ill.; Bodanszky and Bodanszky (1984) The Practice of Peptide Synthesis, Springer-Verlag, New York; and Bodanszky (1984) The Principles of Peptide Synthesis, Springer-Verlag, New York. For example, an azide process, an acid chloride process, an acid anhydride process, a mixed anhydride process, an active ester process (for example, p-nitrophenyl ester, N-hydroxysuccinimide ester, or cyanomethyl ester), a carbodiimidazole process, an oxidative-reductive process, or a dicyclohexylcarbodiimide (DCCD)/additive process can be used. Solid phase and solution phase syntheses are both applicable to the foregoing processes.
  • The CTLA-8 protein, fragments, or derivatives are suitably prepared in accordance with the above processes as typically employed in peptide synthesis, generally either by a so-called stepwise process which comprises condensing an amino acid to the terminal amino acid, one by one in sequence, or by coupling peptide fragments to the terminal amino acid. Amino groups that are not being used in the coupling reaction are typically protected to prevent coupling at an incorrect location. [0097]
  • If a solid phase synthesis is adopted, the C-terminal amino acid is bound to an insoluble carrier or support through its carboxyl group. The insoluble carrier is not particularly limited as long as it has a binding capability to a reactive carboxyl group. Examples of such insoluble carriers include halomethyl resins, such as chloromethyl resin or bromomethyl resin, hydroxymethyl resins, phenol resins, tert-alkyloxycarbonyl-hydrazidated resins, and the like. [0098]
  • An amino group-protected amino acid is bound in sequence through condensation of its activated carboxyl group and the reactive amino group of the previously formed peptide or chain, to synthesize the peptide step by step. After synthesizing the complete sequence, the peptide is split off from the insoluble carrier to produce the peptide. This solid-phase approach is generally described by Merrifield, et al. (1963) in [0099] J. Am. Chem. Soc. 85:2149-2156.
  • The prepared protein and fragments thereof can be isolated and purified from the reaction mixture by means of peptide separation, for example, by extraction, precipitation, electrophoresis and various forms of chromatography, and the like. The CTLA-8 proteins of this invention can be obtained in varying degrees of purity depending upon its desired use. Purification can be accomplished by use of the protein purification techniques disclosed herein or by the use of the antibodies herein described in immunoabsorbant affinity chromatography. This immunoabsorbant affinity chromatography is carried out by first linking the antibodies to a solid support and then contacting the linked antibodies with solubilized lysates of appropriate source cells, lysates of other cells expressing the protein, or lysates or supernatants of cells producing the CTLA-8 protein as a result of DNA techniques, see below. [0100]
  • V. Physical Variants [0101]
  • This invention also encompasses proteins or peptides having substantial amino acid sequence homology with the amino acid sequence of the CTLA-8 protein. The variants include species or allelic variants. [0102]
  • Amino acid sequence homology, or sequence identity, is determined by optimizing residue matches, if necessary, by introducing gaps as required. This changes when considering conservative substitutions as matches. Conservative substitutions typically include substitutions within the following groups: glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid; asparagine, glutamine; serine, threonine; lysine, arginine; and phenylalanine, tyrosine. Homologous amino acid sequences are typically intended to include natural allelic and interspecies variations in each respective protein sequence. Typical homologous proteins or peptides will have from 25-100% homology (if gaps can be introduced), to 50-100% homology (if conservative substitutions are included) with the amino acid sequence of the CTLA-8 protein. Homology measures will be at least about 35%, generally at least 40%, more generally at least 45%, often at least 50%, more often at least 55%, typically at least 60%, more typically at least 65%, usually at least 70%, more usually at least 75%, preferably at least 80%, and more preferably at least 80%, and in particularly preferred embodiments, at least 85% or more. See also Needleham, et al. (1970) [0103] J. Mol. Biol. 48:443-453; Sankoff, et al. (1983) Chapter One in Time Warps, String Edits, and Macromolecules: The Theory and Practice of Sequence Comparison Addison-Wesley, Reading, Mass.; and software packages from IntelliGenetics, Mountain View, Calif.; and the University of Wisconsin Genetics Computer Group, Madison, Wis.
  • The isolated DNA encoding a CTLA-8 protein can be readily modified by nucleotide substitutions, nucleotide deletions, nucleotide insertions, and inversions of nucleotide stretches. These modifications result in novel DNA sequences which encode these antigens, their derivatives, or proteins having similar physiological, immunogenic, or antigenic activity. These modified sequences can be used to produce mutant antigens or to enhance expression. Enhanced expression may involve gene amplification, increased transcription, increased translation, and other mechanisms. Such mutant CTLA-8 protein derivatives include predetermined or site-specific mutations of the respective protein or its fragments. “Mutant CTLA-8 protein” encompasses a polypeptide otherwise falling within the homology definition of the murine CTLA-8 or human CTLA-8 protein as set forth above, but having an amino acid sequence which differs from that of CTLA-8 protein as found in nature, whether by way of deletion, substitution, or insertion. In particular, “site specific mutant CTLA-8 protein” generally includes proteins having significant homology with a protein having sequences of Table 1, 2, or 3, and as sharing various biological activities, e.g., antigenic or immunogenic, with those sequences, and in preferred embodiments contain most of the disclosed sequences. Similar concepts apply to different CTLA-8 proteins, particularly those found in various warm blooded animals, e.g., mammals and birds. As stated before, it is emphasized that descriptions are generally meant to encompass all CTLA-8 proteins, not limited to the mouse embodiment specifically discussed. [0104]
  • Although site specific mutation sites are predetermined, mutants need not be site specific. CTLA-8 protein mutagenesis can be conducted by making amino acid insertions or deletions. Substitutions, deletions, insertions, or any combinations may be generated to arrive at a final construct. Insertions include amino- or carboxy-terminal fusions. Random mutagenesis can be conducted at a target codon and the expressed mutants can then be screened for the desired activity. Methods for making substitution mutations at predetermined sites in DNA having a known sequence are well known in the art, e.g., by M13 primer mutagenesis or polymerase chain reaction (PCR) techniques. See also Sambrook, et al. (1989) and Ausubel, et al. (1987 and Supplements). [0105]
  • The mutations in the DNA normally should not place coding sequences out of reading frames and preferably will not create complementary regions that could hybridize to produce secondary mRNA structure such as loops or hairpins. [0106]
  • The present invention also provides recombinant proteins, e.g., heterologous fusion proteins using segments from these proteins. A heterologous fusion protein is a fusion of proteins or segments which are naturally not normally fused in the same manner. Thus, the fusion product of an immunoglobulin with a CTLA-8 polypeptide is a continuous protein molecule having sequences fused in a typical peptide linkage, typically made as a single translation product and exhibiting properties derived from each source peptide. A similar concept applies to heterologous nucleic acid sequences. [0107]
  • In addition, new constructs may be made from combining similar functional domains from other proteins. For example, antigen-binding or other segments may be “swapped” between different new fusion polypeptides or fragments. See, e.g., Cunningham, et al. (1989) [0108] Science, 243:1330-1336; and O'Dowd, et al. (1988) J. Biol. Chem. 263:15985-15992. Thus, new chimeric polypeptides exhibiting new combinations of specificities will result from the functional linkage of biologically relevant domains and other functional domains.
  • The phosphoramidite method described by Beaucage and Carruthers (1981) [0109] Tetra. Letts. 22:1859-1862, will produce suitable synthetic DNA fragments. A double stranded fragment will often be obtained either by synthesizing the complementary strand and annealing the strand together under appropriate conditions or by adding the complementary strand using DNA polymerase with an appropriate primer sequence, e.g., PCR techniques.
  • VI. Functional Variants [0110]
  • The blocking of physiological response to CTLA-8 proteins may result from the inhibition of binding of the antigen to its natural binding partner, e.g., through competitive inhibition. Thus, in vitro assays of the present invention will often use isolated protein, membranes from cells expressing a recombinant membrane associated CTLA-8 protein, soluble fragments comprising binding segments, or fragments attached to solid phase substrates. These assays will also allow for the diagnostic determination of the effects of either binding segment mutations and modifications, or protein mutations and modifications, e.g., analogs. [0111]
  • This invention also contemplates the use of competitive drug screening assays, e.g., where neutralizing antibodies to antigen or binding partner fragments compete with a test compound for binding to the protein. In this manner, the antibodies can be used to detect the presence of any polypeptide which shares one or more antigenic binding sites of the protein and can also be used to occupy binding sites on the protein that might otherwise interact with a binding partner. [0112]
  • Additionally, neutralizing antibodies against the CTLA-8 protein and soluble fragments of the antigen which contain a high affinity receptor binding site, can be used to inhibit antigen function in tissues, e.g., tissues experiencing abnormal physiology. [0113]
  • “Derivatives” of the CTLA-8 antigens include amino acid sequence mutants, glycosylation variants, and covalent or aggregate conjugates with other chemical moieties. Covalent derivatives can be prepared by linkage of functionalities to groups which are found in the CTLA-8 amino acid side chains or at the N- or C-termini, by means which are well known in the art. These derivatives can include, without limitation, aliphatic esters or amides of the carboxyl terminus, or of residues containing carboxyl side chains, O-acyl derivatives of hydroxyl group-containing residues, and N-acyl derivatives of the amino terminal amino acid or amino-group containing residues, e.g., lysine or arginine. Acyl groups are selected from the group of alkyl-moieties including C3 to C18 normal alkyl, thereby forming alkanoyl aroyl species. Covalent attachment to carrier proteins may be important when immunogenic moieties are haptens. [0114]
  • In particular, glycosylation alterations are included, e.g., made by modifying the glycosylation patterns of a polypeptide during its synthesis and processing, or in further processing steps. Particularly preferred means for accomplishing this are by exposing the polypeptide to glycosylating enzymes derived from cells which normally provide such processing, e.g., mammalian glycosylation enzymes. Deglycosylation enzymes are also contemplated. Also embraced are versions of the same primary amino acid sequence which have other minor modifications, including phosphorylated amino acid residues, e.g., phosphotyrosine, phosphoserine, or phosphothreonine. [0115]
  • A major group of derivatives are covalent conjugates of the CTLA-8 protein or fragments thereof with other proteins or polypeptides. These derivatives can be synthesized in recombinant culture such as N- or C-terminal fusions or by the use of agents known in the art for their usefulness in cross-linking proteins through reactive side groups. Preferred antigen derivatization sites with cross-linking agents are at free amino groups, carbohydrate moieties, and cysteine residues. [0116]
  • Fusion polypeptides between the CTLA-8 proteins and other homologous or heterologous proteins are also provided. Homologous polypeptides may be fusions between different surface markers, resulting in, e.g., a hybrid protein exhibiting receptor binding specificity. Likewise, heterologous fusions may be constructed which would exhibit a combination of properties or activities of the derivative proteins. Typical examples are fusions of a reporter polypeptide, e.g., luciferase, with a segment or domain of an antigen, e.g., a receptor-binding segment, so that the presence or location of the fused antigen may be easily determined. See, e.g., Dull, et al., U.S. Pat. No. 4,859,609. Other gene fusion partners include bacterial β-galactosidase, trpE, Protein A, β-lactamase, alpha amylase, alcohol dehydrogenase, and yeast alpha mating factor. See, e.g., Godowski, et al. (1988) [0117] Science 241:812-816.
  • The phosphoramidite method described by Beaucage and Carruthers (1981) [0118] Tetra. Letts. 22:1859-1862, will produce suitable synthetic DNA fragments. A double stranded fragment will often be obtained either by synthesizing the complementary strand and annealing the strand together under appropriate conditions or by adding the complementary strand using DNA polymerase with an appropriate primer sequence.
  • Such polypeptides may also have amino acid residues which have been chemically modified by phosphorylation, sulfonation, biotinylation, or the addition or removal of other moieties, particularly those which have molecular shapes similar to phosphate groups. In some embodiments, the modifications will be useful labeling reagents, or serve as purification targets, e.g., affinity ligands. [0119]
  • Fusion proteins will typically be made by either recombinant nucleic acid methods or by synthetic polypeptide methods. Techniques for nucleic acid manipulation and expression are described generally, for example, in Sambrook, et al. (1989) [0120] Molecular Cloning: A Laboratory Manual (2d ed.), Vols. 1-3, Cold Spring Harbor Laboratory. Techniques for synthesis of polypeptides are described, for example, in Merrifield (1963) J. Amer. Chem. Soc. 85:2149-2156; Merrifield (1986) Science 232: 341-347; and Atherton, et al. (1989) Solid Phase Peptide Synthesis: A Practical Approach, IRL Press, Oxford.
  • This invention also contemplates the use of derivatives of the CTLA-8 proteins other than variations in amino acid sequence or glycosylation. Such derivatives may involve covalent or aggregative association with chemical moieties. These derivatives generally fall into the three classes: (1) salts, (2) side chain and terminal residue covalent modifications, and (3) adsorption complexes, for example with cell membranes. Such covalent or aggregative derivatives are useful as immunogens, as reagents in immunoassays, or in purification methods such as for affinity purification of antigens or other binding proteins. For example, a CTLA-8 antigen can be immobilized by covalent bonding to a solid support such as cyanogen bromide-activated Sepharose, by methods which are well known in the art, or adsorbed onto polyolefin surfaces, with or without glutaraldehyde cross-linking, for use in the assay or purification of anti-CTLA-8 protein antibodies or its receptor or other binding partner. The CTLA-8 antigens can also be labeled with a detectable group, for example radioiodinated by the chloramine T procedure, covalently bound to rare earth chelates, or conjugated to another fluorescent moiety for use in diagnostic assays. Purification of CTLA-8 protein may be effected by immobilized antibodies or binding partners. [0121]
  • A solubilized CTLA-8 antigen or fragment of this invention can be used as an immunogen for the production of antisera or antibodies specific for the protein or fragments thereof. The purified antigen can be used to screen monoclonal antibodies or binding fragments prepared by immunization with various forms of impure preparations containing the protein. In particular, the term “antibodies” also encompasses antigen binding fragments of natural antibodies. The purified CTLA-8 proteins can also be used as a reagent to detect any antibodies generated in response to the presence of elevated levels of the protein or cell fragments containing the antigen, both of which may be diagnostic of an abnormal or specific physiological or disease condition. Additionally, antigen fragments may also serve as immunogens to produce the antibodies of the present invention, as described immediately below. For example, this invention contemplates antibodies raised against amino acid sequences encoded by nucleotide sequences shown in Table 1, 2, or 3, or fragments of proteins containing them. In particular, this invention contemplates antibodies having binding affinity to or being raised against specific fragments which are predicted to lie outside of the lipid bilayer. [0122]
  • The present invention contemplates the isolation of additional closely related species variants. Southern blot analysis established that similar genetic entities exist in other mammals, e.g., rat and human. It is likely that the CTLA-8 proteins are widespread in species variants, e.g., rodents, lagomorphs, carnivores, artiodactyla, perissodactyla, and primates. [0123]
  • The invention also provides means to isolate a group of related antigens displaying both distinctness and similarities in structure, expression, and function. Elucidation of many of the physiological effects of the antigens will be greatly accelerated by the isolation and characterization of distinct species variants. In particular, the present invention provides useful probes for identifying additional homologous genetic entities in different species. [0124]
  • The isolated genes will allow transformation of cells lacking expression of a corresponding CTLA-8 protein, e.g., either species types or cells which lack corresponding antigens and should exhibit negative background activity. Expression of transformed genes will allow isolation of antigenically pure cell lines, with defined or single specie variants. This approach will allow for more sensitive detection and discrimination of the physiological effects of CTLA-8 proteins. Subcellular fragments, e.g., cytoplasts or membrane fragments, can be isolated and used. [0125]
  • Dissection of the critical structural elements which effect the various physiological or differentiation functions provided by the proteins is possible using standard techniques of modern molecular biology, particularly in comparing members of the related class. See, e.g., the homolog-scanning mutagenesis technique described in Cunningham, et al. (1989) [0126] Science 243:1339-1336; and approaches used in O'Dowd, et al. (1988) J. Biol. Chem. 263:15985-15992; and Lechleiter, et al. (1990) EMBO J. 9:4381-4390.
  • In particular, functional domains or segments can be substituted between species variants to determine what structural features are important in both binding partner affinity and specificity, as well as signal transduction. An array of different variants will be used to screen for molecules exhibiting combined properties of interaction with different species variants of binding partners. [0127]
  • Antigen internalization may occur under certain circumstances, and interaction between intracellular components and “extracellular” segments of proteins involved in interactions may occur. The specific segments of interaction of CTLA-8 protein with other intracellular components may be identified by mutagenesis or direct biochemical means, e.g., cross-linking or affinity methods. Structural analysis by crystallographic or other physical methods will also be applicable. Further investigation of the mechanism of biological function will include study of associated components which may be isolatable by affinity methods or by genetic means, e.g., complementation analysis of mutants. [0128]
  • Further study of the expression and control of CTLA-8 protein will be pursued. The controlling elements associated with the antigens may exhibit differential developmental, tissue specific, or other expression patterns. Upstream or downstream genetic regions, e.g., control elements, are of interest. [0129]
  • Structural studies of the antigen will lead to design of new variants, particularly analogs exhibiting agonist or antagonist properties on binding partners. This can be combined with previously described screening methods to isolate variants exhibiting desired spectra of activities. [0130]
  • Expression in other cell types will often result in glycosylation differences in a particular antigen. Various species variants may exhibit distinct functions based upon structural differences other than amino acid sequence. Differential modifications may be responsible for differential function, and elucidation of the effects are now made possible. [0131]
  • Thus, the present invention provides important reagents related to antigen-binding partner interaction. Although the foregoing description has focused primarily upon the murine CTLA-8 and human CTLA-8 protein, those of skill in the art will immediately recognize that the invention encompasses other antigens, e.g., mouse and other mammalian species or allelic variants, as well as variants thereof. [0132]
  • VII. Antibodies [0133]
  • Antibodies can be raised to the various CTLA-8 proteins, including species or allelic variants, and fragments thereof, both in their naturally occurring forms and in their recombinant forms. Additionally, antibodies can be raised to CTLA-8 proteins in either their active forms or in their inactive forms. Anti-idiotypic antibodies are also contemplated. [0134]
  • Antibodies, including binding fragments and single chain versions, against predetermined fragments of the antigens can be raised by immunization of animals with conjugates of the fragments with immunogenic proteins. Monoclonal antibodies are prepared from cells secreting the desired antibody. These antibodies can be screened for binding to normal or defective CTLA-8 proteins, or screened for agonistic or antagonistic activity, e.g., mediated through a binding partner. These monoclonal antibodies will usually bind with at least a K[0135] D of about 1 mM, more usually at least about 300 μM, typically at least about 10 μm, more typically at least about 30 μM, preferably at least about 10 μm, and more preferably at least about 3 μm or better.
  • The antibodies, including antigen binding fragments, of this invention can have significant diagnostic or therapeutic value. They can be potent antagonists that bind to a binding partner and inhibit antigen binding or inhibit the ability of an antigen to elicit a biological response. They also can be useful as non-neutralizing antibodies and can be coupled to toxins or radionuclides so that when the antibody binds to the antigen, a cell expressing it, e.g., on its surface, is killed. Further, these antibodies can be conjugated to drugs or other therapeutic agents, either directly or indirectly by means of a linker, and may effect drug targeting. [0136]
  • The antibodies of this invention can also be useful in diagnostic applications. As capture or non-neutralizing antibodies, they can be screened for ability to bind to the antigens without inhibiting binding by a partner. As neutralizing antibodies, they can be useful in competitive binding assays. They will also be useful in detecting or quantifying CTLA-8 protein or its binding partners. See, e.g., Chan (ed.)(1987) [0137] Immunoassay: A Practical Guide Academic Press, Orlando, Fla.; Ngo (ed.)(1988) Nonisotopic Immunoassay Plenum Press, NY; and Price and Newman (eds.)(1991) Principles and Practice of Immunoassay Stockton Press, NY.
  • Antigen fragments may be joined to other materials, particularly polypeptides, as fused or covalently joined polypeptides to be used as immunogens. An antigen and its fragments may be fused or covalently linked to a variety of immunogens, such as keyhole limpet hemocyanin, bovine serum albumin, tetanus toxoid, etc. See [0138] Microbiology, Hoeber Medical Division, Harper and Row, 1969; Landsteiner (1962) Specificity of Serological Reactions, Dover Publications, New York, and Williams, et. al. (1967) Methods in Immunology and Immunochemistry, Vol. 1, Academic Press, New York, for descriptions of methods of preparing polyclonal antisera. A typical method involves hyperimmunization of an animal with an antigen. The blood of the animal is then collected shortly after the repeated immunizations and the gamma globulin is isolated.
  • In some instances, it is desirable to prepare monoclonal antibodies from various mammalian hosts, such as mice, rodents, primates, humans, etc. Description of techniques for preparing such monoclonal antibodies may be found in, e.g., Stites, et al. (eds.) [0139] Basic and Clinical Immunology (4th ed.), Lange Medical Publications, Los Altos, Calif., and references cited therein; Harlow and Lane (1988) Antibodies: A Laboratory Manual, CSH Press; Goding (1986) Monoclonal Antibodies: Principles and Practice (2d ed.) Academic Press, New York; and particularly in Kohler and Milstein (1975) in Nature 256: 495-497, which discusses one method of generating monoclonal antibodies. Summarized briefly, this method involves injecting an animal with an immunogen. The animal is then sacrificed and cells taken from its spleen, which are then fused with myeloma cells. The result is a hybrid cell or “hybridoma” that is capable of reproducing in vitro. The population of hybridomas is then screened to isolate individual clones, each of which secrete a single antibody species to the immunogen. In this manner, the individual antibody species obtained are the products of immortalized and cloned single B cells from the immune animal generated in response to a specific site recognized on the immunogenic substance.
  • Other suitable techniques involve in vitro exposure of lymphocytes to the antigenic polypeptides or alternatively to selection of libraries of antibodies in phage or similar vectors. See, Huse, et al. (1989) “Generation of a Large Combinatorial Library of the Immunoglobulin Repertoire in Phage Lambda,” [0140] Science 246:1275-1281; and Ward, et al. (1989) Nature 341:544-546. The polypeptides and antibodies of the present invention may be used with or without modification, including chimeric or humanized antibodies. Frequently, the polypeptides and antibodies will be labeled by joining, either covalently or non-covalently, a substance which provides for a detectable signal. A wide variety of labels and conjugation techniques are known and are reported extensively in both the scientific and patent literature. Suitable labels include radionuclides, enzymes, substrates, cofactors, inhibitors, fluorescent moieties, chemiluminescent moieties, magnetic particles, and the like. Patents, teaching the use of such labels include U.S. Pat. Nos. 3,817,837; 3,850,752; 3,939,350; 3,996,345; 4,277,437; 4,275,149; and 4,366,241. Also, recombinant immunoglobulins may be produced, see Cabilly, U.S. Pat. No. 4,816,567.
  • The antibodies of this invention can also be used for affinity chromatography in isolating the protein. Columns can be prepared where the antibodies are linked to a solid support, e.g., particles, such as agarose, Sephadex, or the like, where a cell lysate may be passed through the column, the column washed, followed by increasing concentrations of a mild denaturant, whereby the purified CTLA-8 protein will be released. [0141]
  • The antibodies-may also be used to screen expression libraries for particular expression products. Usually the antibodies used in such a procedure will be labeled with a moiety allowing easy detection of presence of antigen by antibody binding. [0142]
  • Antibodies raised against each CTLA-8 protein will also be useful to raise anti-idiotypic antibodies. These will be useful in detecting or diagnosing various immunological conditions related to expression of the respective antigens. [0143]
  • VIII. Uses [0144]
  • The present invention provides reagents which will find use in diagnostic applications as described elsewhere herein, e.g., in the general description for physiological or developmental abnormalities, or below in the description of kits for diagnosis. [0145]
  • This invention also provides reagents with significant therapeutic value. The CTLA-8 protein (naturally occurring or recombinant), fragments thereof, and antibodies thereto, along with compounds identified as having binding affinity to CTLA-8 protein, should be useful in the treatment of conditions associated with abnormal physiology or development, including abnormal proliferation, e.g., cancerous conditions, or degenerative conditions. Abnormal proliferation, regeneration, degeneration, and atrophy may be modulated by appropriate therapeutic treatment using the compositions provided herein. For example, a disease or disorder associated with abnormal expression or abnormal signaling by a CTLA-8 antigen should be a likely target for an agonist or antagonist of the protein. [0146]
  • Other abnormal developmental conditions are known in the cell types shown to possess CTLA-8 antigen mRNA by Northern blot analysis. See Berkow (ed.) [0147] The Merck Manual of Diagnosis and Therapy, Merck & Co., Rahway, N.J.; and Thorn, et al. Harrison's Principles of Internal Medicine, McGraw-Hill, N.Y. These. problems may be susceptible to prevention or treatment using compositions provided herein.
  • Recombinant antibodies which bind to CTLA-8 can be purified and then administered to a patient. These reagents can be combined for therapeutic use with additional active or inert ingredients, e.g., in conventional pharmaceutically acceptable carriers or diluents, e.g., immunogenic adjuvants, along with physiologically innocuous stabilizers and excipients. These combinations can be sterile filtered and placed into dosage forms as by lyophilization in dosage vials or storage in stabilized aqueous preparations. This invention also contemplates use of antibodies or binding fragments thereof, including forms which are not complement binding. [0148]
  • Screening using CTLA-8 for binding partners or compounds having binding affinity to CTLA-8 antigen can be performed, including isolation of associated components. Subsequent biological assays can then be utilized to determine if the compound has intrinsic biological activity and is therefore an agonist or antagonist in that it blocks an activity of the antigen. This invention further contemplates the therapeutic use of antibodies to CTLA-8 protein as antagonists. This approach should be particularly useful with other CTLA-8 protein species variants. [0149]
  • The quantities of reagents necessary for effective therapy will depend upon many different factors, including means of administration, target site, physiological state of the patient, and other medicants administered. Thus, treatment dosages should be titrated to optimize safety and efficacy. Typically, dosages used in vitro may provide useful guidance in the amounts useful for in situ administration of these reagents. Animal testing of effective doses for treatment of particular disorders will provide further predictive indication of human dosage. Various considerations are described, e.g., in Gilman, et al. (eds.) (1990) [0150] Goodman and Gilman's: The Pharmacological Bases of Therapeutics, 8th Ed., Pergamon Press; and Remington's Pharmaceutical Sciences, 17th ed. (1990), Mack Publishing Co., Easton, Pa. Methods for administration are discussed therein and below, e.g., for oral, intravenous, intraperitoneal, or intramuscular administration, transdermal diffusion, and others. See also Langer (1990) Science 249:1527-1533. Pharmaceutically acceptable carriers will include water, saline, buffers, and other compounds described, e.g., in the Merck Index, Merck & Co., Rahway, N.J. Dosage ranges would ordinarily be expected to be in amounts lower than 1 mM concentrations, typically less than about 10 μm concentrations, usually less than about 100 nM, preferably less than about 10 pM (picomolar), and most preferably less than about 1 fM (femtomolar), with an appropriate carrier. Slow release formulations, or a slow release apparatus will often be utilized for continuous administration.
  • CTLA-8 protein, fragments thereof, and antibodies to it or its fragments, antagonists, and agonists, may be administered directly to the host to be treated or, depending on the size of the compounds, it may be desirable to conjugate them to carrier proteins such as ovalbumin or serum albumin prior to their administration. Therapeutic formulations may be administered in any conventional dosage formulation. While it is possible for the active ingredient to be administered alone, it is preferable to present it as a pharmaceutical formulation. Formulations typically comprise at least one active ingredient, as defined above, together with one or more acceptable carriers thereof. Each carrier should be both pharmaceutically and physiologically acceptable in the sense of being compatible with the other ingredients and not injurious to the patient. Formulations include those suitable for oral, rectal, nasal, or parenteral (including subcutaneous, intramuscular, intravenous and intradermal) administration. The formulations may conveniently be presented in unit dosage form and may be prepared by any methods well known in the art of pharmacy. See, e.g., Gilman, et al. (eds.) (1990) [0151] Goodman and Gilman's: The Pharmacological Bases of Therapeutics, 8th Ed., Pergamon Press, Parrytown, N.Y.; Remington's Pharmaceutical Sciences, 17th ed. (1990), Mack Publishing Co., Easton, Pa.; Avis, et al. (eds.)(1993) Pharmaceutical Dosage Forms: Parenteral Medications 2d ed., Dekker, N.Y.; Lieberman, et al. (eds.)(1990) Pharmaceutical Dosage Forms: Tablets 2d ed., Dekker, N.Y.; and Lieberman, et al. (eds.)(1990) Pharmaceutical Dosage Forms: Disperse Systems Dekker, N.Y. The therapy of this invention may be combined with or used in association with other chemotherapeutic or chemopreventive agents.
  • Both the naturally occurring and the recombinant forms of the CTLA-8 proteins of this invention are particularly useful in kits and assay methods which are capable of screening compounds for binding activity to the proteins. Several methods of automating assays have been developed in recent years so as to permit screening of tens of thousands of compounds in a short period. See, e.g., Fodor, et al. (1991) [0152] Science 251:767-773, which describes means for testing of binding affinity by a plurality of defined polymers synthesized on a solid substrate. The development of suitable assays can be greatly facilitated by the availability of large amounts of purified, soluble CTLA-8 protein as provided by this invention.
  • This invention is particularly useful for screening compounds by using recombinant antigen in any of a variety of drug screening techniques. The advantages of using a recombinant protein in screening for specific ligands include: (a) improved renewable source of the antigen from a specific source; (b) potentially greater number of antigen molecules per cell giving better signal to noise ratio in assays; and (c) species variant specificity (theoretically giving greater biological and disease specificity). The purified protein may be tested in numerous assays, typically in vitro assays, which evaluate biologically relevant responses. See, e.g., Coligan [0153] Current Protocols in Immunology; Hood, et al. Immunology Benjamin/Cummings; Paul (ed.) Fundamental Immunology; and Methods in Enzymology Academic Press.
  • One method of drug screening utilizes eukaryotic or prokaryotic host cells which are stably transformed with recombinant DNA molecules expressing the CTLA-8 antigens. Cells may be isolated which express an antigen in isolation from other functionally equivalent antigens. Such cells, either in viable or fixed form, can be used for standard protein-protein binding assays. See also, Parce, et al. (1989) [0154] Science 246:243-247; and Owicki, et al. (1990) Proc. Nat'l Acad. Sci. USA 87:4007-4011, which describe sensitive methods to detect cellular responses. Competitive assays are particularly useful, where the cells (source of CTLA-8 protein) are contacted and incubated with a labeled binding partner or antibody having known binding affinity to the ligand, such as 125I-antibody, and a test sample whose binding affinity to the binding composition is being measured. The bound and free labeled binding compositions are then separated to assess the degree of antigen binding. The amount of test compound bound is inversely proportional to the amount of labeled receptor binding to the known source. Any one of numerous techniques can be used to separate bound from free antigen to assess the degree of binding. This separation step could typically involve a procedure such as adhesion to filters followed by washing, adhesion to plastic followed by washing, or centrifugation of the cell membranes. Viable cells could also be used to screen for the effects of drugs on CTLA-8 protein mediated functions, e.g., second messenger levels, i.e., Ca++; cell proliferation; inositol phosphate pool changes; and others. Some detection methods allow for elimination of a separation step, e.g., a proximity sensitive detection system. Calcium sensitive dyes will be useful for detecting Ca++ levels, with a fluorimeter or a fluorescence cell sorting apparatus.
  • Another method utilizes membranes from transformed eukaryotic or prokaryotic host cells as the source of the CTLA-8 protein. These cells are stably transformed with DNA vectors directing the expression of a membrane associated CTLA-8 protein, e.g., an engineered membrane bound form. Essentially, the membranes would be prepared from the cells and used in any receptor/ligand type binding assay such as the competitive assay set forth above. [0155]
  • Still another approach is to use solubilized, unpurified or solubilized, purified CTLA-8 protein from transformed eukaryotic or prokaryotic host cells. This allows for a “molecular” binding assay with the advantages of increased specificity, the ability to automate, and high drug test throughput. [0156]
  • Another technique for drug screening involves an approach which provides high throughput screening for compounds having suitable binding affinity to CTLA-8 and is described in detail in Geysen, European Patent Application 84/03564, published on Sep. 13, 1984. First, large numbers of different small peptide test compounds are synthesized on a solid substrate, e.g., plastic pins or some other appropriate surface, see Fodor, et al. (1991). Then all the pins are reacted with solubilized, unpurified or solubilized, purified CTLA-8 binding composition, and washed. The next step involves detecting bound binding composition. [0157]
  • Rational drug design may also be based upon structural studies of the molecular shapes of the CTLA-8 protein and other effectors or analogs. Effectors may be other proteins which mediate other functions in response to antigen binding, or other proteins which normally interact with the antigen. One means for determining which sites interact with specific other proteins is a physical structure determination, e.g., x-ray crystallography or 2 dimensional NMR techniques. These will provide guidance as to which amino acid residues form molecular contact regions. For a detailed description of protein structural determination, see, e.g., Blundell and Johnson (1976) [0158] Protein Crystallography, Academic Press, New York.
  • Purified CTLA-8 protein can be coated directly onto plates for use in the aforementioned drug screening techniques. However, non-neutralizing antibodies to these ligands can be used as capture antibodies to immobilize the respective ligand on the solid phase. [0159]
  • IX. Kits [0160]
  • This invention also contemplates use of CTLA-8 proteins, fragments thereof, peptides, and their fusion products in a variety of diagnostic kits and methods for detecting the presence of a binding composition. Typically the kit will have a compartment containing either a defined CTLA-8 peptide or gene segment or a reagent which recognizes one or the other, e.g., antigen fragments or antibodies. [0161]
  • A kit for determining the binding affinity of a test compound to a CTLA-8 protein would typically comprise a test compound; a labeled compound, for example an antibody having known binding affinity for the antigen; a source of CTLA-8 protein (naturally occurring or recombinant); and a means for separating bound from free labeled compound, such as a solid phase for immobilizing the antigen. Once compounds are screened, those having suitable binding affinity to the antigen can be evaluated in suitable biological assays, as are well known in the art, to determine whether they exhibit similar biological activities to the natural antigen. The availability of recombinant CTLA-8 protein polypeptides also provide well defined standards for calibrating such assays. [0162]
  • A preferred kit for determining the concentration of, for example, a CTLA-8 protein in a sample would typically comprise a labeled compound, e.g., antibody, having known binding affinity for the antigen, a source of antigen (naturally occurring or recombinant) and a means for separating the bound from free labeled compound, for example, a solid phase for immobilizing the CTLA-8 protein. Compartments containing reagents, and instructions, will normally be provided. [0163]
  • One method for determining the concentration of CTLA-8 protein in a sample would typically comprise the steps of: (1) preparing membranes from a sample comprised of a membrane bound CTLA-8 protein source; (2) washing the membranes and suspending them in a buffer; (3) solubilizing the antigen by incubating the membranes in a culture medium to which a suitable detergent has been added; (4) adjusting the detergent concentration of the solubilized antigen; (5) contacting and incubating said dilution with radiolabeled antibody to form complexes; (6) recovering the complexes such as by filtration through polyethyleneimine treated filters; and (7) measuring the radioactivity of the recovered complexes. [0164]
  • Antibodies, including antigen binding fragments, specific for the CTLA-8 protein or fragments are useful in diagnostic applications to detect the presence of elevated levels of CTLA-8 protein and/or its fragments. Such diagnostic assays can employ lysates, live cells, fixed cells, immunofluorescence, cell cultures, body fluids, and further can involve the detection of antigens related to the protein in serum, or the like. Diagnostic assays may be homogeneous (without a separation step between free reagent and protein-protein complex) or heterogeneous (with a separation step). Various commercial assays exist, such as radioimmunoassay (RIA), enzyme-linked immunosorbent assay (ELISA), enzyme immunoassay (EIA), enzyme-multiplied immunoassay technique (EMIT), substrate-labeled fluorescent immunoassay (SLFIA), and the like. For example, unlabeled antibodies can be employed by using a second antibody which is labeled and which recognizes the antibody to a CTLA-8 protein or to a particular fragment thereof. Similar assays have also been extensively discussed in the literature. See, e.g., Harlow and Lane (1988) [0165] Antibodies: A Laboratory Manual, CSH.
  • Anti-idiotypic antibodies may have similar use to diagnose presence of antibodies against a CTLA-8 protein, as such may be diagnostic of various abnormal states. For example, overproduction of CTLA-8 protein may result in production of various immunological reactions which may be diagnostic of abnormal physiological states, particularly in proliferative cell conditions such as cancer or abnormal differentiation. [0166]
  • Frequently, the reagents for diagnostic assays are supplied in kits, so as to optimize the sensitivity of the assay. For the subject invention, depending upon the nature of the assay, the protocol, and the label, either labeled or unlabeled antibody, or labeled CTLA-8 protein is provided. This is usually in conjunction with other additives, such as buffers, stabilizers, materials necessary for signal production such as substrates for enzymes, and the like. Preferably, the kit will also contain instructions for proper use and disposal of the contents after use. Typically the kit has compartments for each useful reagent. Desirably, the reagents are provided as a dry lyophilized powder, where the reagents may be reconstituted in an aqueous medium providing appropriate concentrations of reagents for performing the assay. [0167]
  • Any of the aforementioned constituents of the drug screening and the diagnostic assays may be used without modification or may be modified in a variety of ways. For example, labeling may be achieved by covalently or non-covalently joining a moiety which directly or indirectly provides a detectable signal. In any of these assays, the antigen, test compound, CTLA-8 protein, or antibodies thereto can be labeled either directly or indirectly. Possibilities for direct labeling include label groups: radiolabels such as [0168] 125I, enzymes (U.S. Pat. No. 3,645,090) such as peroxidase and alkaline phosphatase, and fluorescent labels (U.S. Pat. No. 3,940,475) capable of monitoring the change in fluorescence intensity, wavelength shift, or fluorescence polarization. Possibilities for indirect labeling include biotinylation of one constituent followed by binding to avidin coupled to one of the above label groups.
  • There are also numerous methods of separating the bound from the free antigen, or alternatively the bound from the free test compound. The CTLA-8 protein can be immobilized on various matrixes followed by washing. Suitable matrixes include plastic such as an ELISA plate, filters, and beads. Methods of immobilizing the CTLA-8 protein to a matrix include, without limitation, direct adhesion to plastic, use of a capture antibody, chemical coupling, and biotin-avidin. The last step in this approach involves the precipitation of protein-protein complex by any of several methods including those utilizing, e.g., an organic solvent such as polyethylene glycol or a salt such as ammonium sulfate. Other suitable separation techniques include, without limitation, the fluorescein antibody magnetizable particle method described in Rattle, et al. (1984) [0169] Clin. Chem. 30:1457-1461, and the double antibody magnetic particle separation as described in U.S. Pat. No. 4,659,678.
  • The methods for linking proteins or their fragments to the various labels have been extensively reported in the literature and do not require detailed discussion here. Many of the techniques involve the use of activated carboxyl groups either through the use of carbodiimide or active esters to form peptide bonds, the formation of thioethers by reaction of a mercapto group with an activated halogen such as chloroacetyl, or an activated olefin such as maleimide, for linkage, or the like. Fusion proteins will also find use in these applications. [0170]
  • Another diagnostic aspect of this invention involves use of oligonucleotide or polynucleotide sequences taken from the sequence of a CTLA-8 protein. These sequences can be used as probes for detecting levels of antigen message in samples from patients suspected of having an abnormal condition, e.g., cancer or developmental problem. The preparation of both RNA and DNA nucleotide sequences, the labeling of the sequences, and the preferred size of the sequences has received ample description and discussion in the literature. Normally an oligonucleotide probe should have at least about 14 nucleotides, usually at least about 18 nucleotides, and the polynucleotide probes may be up to several kilobases. Various labels may be employed, most commonly radionuclides, particularly [0171] 32P. However, other techniques may also be employed, such as using biotin modified nucleotides for introduction into a polynucleotide. The biotin then serves as the site for binding to avidin or antibodies, which may be labeled with a wide variety of labels, such as radionuclides, fluorescers, enzymes, or the like. Alternatively, antibodies may be employed which can recognize specific duplexes, including DNA duplexes, RNA duplexes, DNA-RNA hybrid duplexes, or DNA-protein duplexes. The antibodies in turn may be labeled and the assay carried out where the duplex is bound to a surface, so that upon the formation of duplex on the surface, the presence of antibody bound to the duplex can be detected. The use of probes to the novel anti-sense RNA may be carried out in any conventional techniques such as nucleic acid hybridization, plus and minus screening, recombinational probing, hybrid released translation (HRT), and hybrid arrested translation (HART). This also includes amplification techniques such as polymerase chain reaction (PCR).
  • Diagnostic kits which also test for the qualitative or quantitative presence of other markers are also contemplated. Diagnosis or prognosis may depend on the combination of multiple indications used as markers. Thus, kits may test for combinations of markers. See, e.g., Viallet, et al. (1989) [0172] Progress in Growth Factor Res. 1:89-97.
  • The broad scope of this invention is best understood with reference to the following examples, which are not intended to limit the invention to specific embodiments. [0173]
  • EXAMPLES
  • I. General Methods [0174]
  • Some of the standard methods are described or referenced, e.g., in Maniatis, et al. (1982) [0175] Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor Press; Sambrook, et al. (1989) Molecular Cloning: A Laboratory Manual, (2d ed.), vols. 1-3, CSH Press, NY; Ausubel, et al., Biology, Greene Publishing Associates, Brooklyn, N.Y.; or Ausubel, et al. (1987 and Supplements) Current Protocols in Molecular Biology, Greene/Wiley, New York; Innis, et al. (eds.)(1990) PCR Protocols: A Guide to Methods and Applications Academic Press, N.Y. Methods for protein purification include such methods as ammonium sulfate precipitation, column chromatography, electrophoresis, centrifugation, crystallization, and others. See, e.g., Ausubel, et al. (1987 and periodic supplements); Deutscher (1990) “Guide to Protein Purification” in Methods in Enzymology, vol. 182, and other volumes in this series; and manufacturer's literature on use of protein purification products, e.g., Pharmacia, Piscataway, N.J., or Bio-Rad, Richmond, Calif. Combination with recombinant techniques allow fusion to appropriate segments, e.g., to a FLAG sequence or an equivalent which can be fused via a protease-removable sequence. See, e.g., Hochuli (1989) Chemische Industrie 12:69-70; Hochuli (1990) “Purification of Recombinant Proteins with Metal Chelate Absorbent” in Setlow (ed.) Genetic Engineering, Principle and Methods 12:87-98, Plenum Press, N.Y.; and Crowe, et al. (1992) QIAexpress: The High Level Expression & Protein Purification System QUIAGEN, Inc., Chatsworth, Calif.
  • FACS analyses are described in Melamed, et al. (1990) [0176] Flow Cytometry and Sorting Wiley-Liss, Inc., New York, N.Y.; Shapiro (1988) Practical Flow Cytometry Liss, New York, N.Y.; and Robinson, et al. (1993) Handbook of Flow Cytometry Methods Wiley-Liss, New York, N.Y.
  • II. Isolation of a DNA Clone Encoding CTLA-8 Protein. [0177]
  • Isolation of murine CTLA-8 is described in Rouvier, et al. (1993) [0178] J. Immunol. 150:5445-5456.
  • Source of the CTLA-8 Message [0179]
  • Various cell lines are screened using an appropriate probe for high level message expression. Appropriate cell lines are selected based upon expression levels of the CTLA-8 message. Applicants used subtractive hybridization methods on activated cytotoxic T cells. [0180]
  • Isolation of a CTLA-8 Encoding Clone [0181]
  • Standard PCR techniques are used to amplify a CTLA-8 gene sequence from a genomic or cDNA library, or from mRNA. Appropriate primers are selected from the sequences provided, and a full length clone is isolated. Various combinations of primers, of various lengths and possibly with differences in sequence, may be prepared. The full length clone can be used as a hybridization probe to screen for other homologous genes using stringent or less stringent hybridization conditions. [0182]
  • In another method, oligonucleotides are used to screen a library. In combination with polymerase chain reaction (PCR) techniques, synthetic oligonucleotides in appropriate orientations are used as primers to select correct clones from a library. [0183]
  • III. Isolation of a Human CTLA-8. [0184]
  • A human genomic library was obtained from Clontech (Cat. HL1006d) and screened with a cDNA probe composed of a 453 base pair entire coding sequence of a murine CTLA-8. A number of independent lambda clones were found to hybridize strongly with the murine CTLA-8 probe. One clone contained a hybridizing XbaI fragment of approximately 2000 base pairs which corresponded to a fragment previously detected using a similar probe on a human genomic DNA Southern blot. This 2000 base pair fragment was subcloned into Bluescript (Stratagene) and sequenced. This revealed a 240 base pair region (see Table 3) 83.8% homologous to the murine CTLA-8 of Table 1. Translation of this region yielded an amino acid sequence 70.8% homologous to the 79 carboxy-terminal amino acids of the murine CTLA-8 putative protein. The exon was used as a probe to screen a library of cDNA made with a primer corresponding to the last 21 nucleotides of the coding region. Three independent cDNA clones were obtained containing the complete coding region of the human CTLA-8. The 468 base pair open reading frame encodes a 155 amino acid polypeptide with a theoretical molecular weight of 17,100 daltons. See Table 3. This human CTLA-8 is 66.4% homologous to the ORF-13 of the virus, and 58.3% homologous to murine CTLA-8 encoded protein. Moreover, the 6 cysteines are conserved between the three genes, as well as the putative glycosylation and phosphorylation sites. [0185]
  • Analysis of the human CTLA-8 amino acid sequence exhibits a hydrophobic stretch of 19 residues, from 7 to about 25, at the amino terminus, similar to a signal peptide. It is highly likely that the human CTLA-8 is a secreted protein of a molecular weight resembling a cytokine. [0186]
  • IV. Biochemical Characterization of CTLA-8 Proteins. [0187]
  • Two forms of human CTLA-8 were expressed in heterologous cells; the native form, and a recombinant form displaying the FLAG peptide at the carboxy terminus. See, e.g., Crowe et al. (1992) [0188] QIAexpress: The High Level Expression and Protein Purification System QIAGEN, Inc. Chatsworth, Calif.; and Hopp et al. (1988) Bio/Technology 6:1204-1210. These two forms of the human CTLA-8 protein were introduced into the expression vectors pME18S or pEE12, and subsequently transfected into COS-7 or NSO cells, respectively, by electroporation. Electroporated cells were then cultivated for 48 hours in RPMI medium supplemented with 10% Fetal Calf Serum. Cells were then incubated with 35S-Met and 35S-Cys in order to label cellular proteins. Comparison of the proteins under reducing conditions on SDS-PAGE showed that cells transfected with human CTLA-8 secreted a polypeptide of 15,000 daltons. Non-reducing SDS-PAGE revealed 2 specific bands around 28,000 daltons and 33,000 daltons. Treatment with endoglycosidase F (Boehringer Mannheim) demonstrated that the higher molecular weight species represents an N-glycosylated form of human CTLA-8.
  • In order to determine if the natural form of human CTLA-8 produced by activated CD4+ T cells was also secreted as a dimer similar to transfected COS-7 and NSO cells, peripheral blood mononuclear cells (PBMC) were purified from 500 ml of human blood on a Ficoll gradient. B cells, CD8+ T cells, monocytes, and NK cells were depleted using 100 μl of ascitic fluid containing anti-CD19, anti-CD8, anti-CD14, and 25 gg of NKH1 monoclonal antibody (Coulter, Hialeah, Fla.). After 30 minutes of incubation at 40° C., the PBMC were washed twice in RPMI containing 10% Fetal Calf Serum (FCS). Paramagnetic beads coated with goat antibodies to mouse IgG (Dynabeads M450, Dynal, Oslo, Norway) were added at a final concentration of 5 beads/cell to be depleted. Unwanted cells were subsequently removed by 3 passages on a magnet. The remaining cells were CD4+ cells at 87% purity which were diluted to 10[0189] 7 cells/ml in DMEM F12 (Gibco, Gaithersburg, Md.) containing 10% FCS, 10 ng/ml PMA (Sigma, St. Louis, Mo.) and 500 ng/ml ionomycin (Sigma, St. Louis, Mo.). After incubation for 4 hours at 37° C. in 5% CO2, the medium was changed to methionine and cysteine free DMEM (ICN Biomedicals, Costa Mesa, Calif.), supplemented with 1% dialyzed FCS, 10 ng/ml PMA and 500 ng/ml ionomycin, and incubated for 1 hour at 37° C. in 5% CO2. 100 μCi/ml of 35S-methionine and 35S-cysteine (Amersham) was added, and metabolic labeling was carried out for 18 hours at 37° C. in 5% CO2. Following preclearing of the supernatants with anti-IFN-γ Mab B27 and 0.5 ml of Protein-G Sepharose (Sigma St. Louis, Mo.), the supernatants were immunoprecipated using monoclonal antibodies to human CTLA-8. Immunoprecipated proteins were analyzed on SDS-PAGE. CD4+ T cells and transfected NSO cells reveal two bands at 28,000 and 33,000 daltons corresponding respectively to non N-glycosylated and N-glycosylated forms of human CTLA-8 dimers. Therefore, human CTLA-8 derived from transfected NSO cells and CTLA-8. isolated from activated T cells display the same biological characteristics.
  • V. Large Scale Production of Human CTLA-8 [0190]
  • For biological assays, human CTLA-8 and human CTLA-8-FLAG were produced in large amounts with transfected COS-7 cells grown in RPMI medium supplemented with 1% Nutridoma HU (Boeringer Mannheim, Mannheim, Germany) and subsequently purified. [0191]
  • In order to produce larger quantities of native human CTLA-8 or human CTLA-8-FLAG, stable transformants of NSO cells were prepared according to the methodology developed by Celltech (Slough, Berkshire, UK; International Patent Applications WO86/05807, WO87/04462, WO89/01036, and WO89/10404). Both CTLA-8 and CTLA-8-FLAG were subcloned into pEE12 and subsequently transfected into NSO cells by electroporation. Transfected NSO cells were seeded in selective glutamine-free DMEM supplemented with 10% Fetal Calf Serum as described in Celltech's protocol. Supernatants from the best producing lines were used in biological assays and purification of human CTLA-8 and human CTLA-8-FLAG. [0192]
  • Purification of Human CTLA-8 Protein [0193]
  • Typically, 1 liter of supernatant containing human CTLA-8 or CTLA-8-FLAG was passed on a 60 ml column of Zn[0194] ++ ions grafted to a Chelating Sepharose Fast Flow matrix (Pharmacia, Upsalla, Sweden). After washing with 10 volumes of binding buffer (His-Bind Buffer kit, Novagen, Madison, Wis.), the proteins retained by the metal ions were eluted with a gradient of 20-100 mM Imidazole. The content of human CTLA-8-FLAG in the eluted fractions was determined by dot blot using the anti-FLAG monoclonal antibody M2 (Eastman Kodak, New-Haven, Conn.), whereas the content of human CTLA-8 was assessed by silver staining of non-reducing SDS-PAGE. The CTLA-8 containing fractions were then pooled and dialyzed against PBS, and were either used in biological assays or further purified by anion exchange HPLC on a DEAE column. A third step of gle filtration chromatograph was performed on a SUPERDEX G-75 HRD30 column (Pharmacia Uppsala, Sweden) and yielded practically pure human CTLA-8-8 as analyzed by silver stained SDS-PAGE.
  • Preparation of Antibodies Specific for CTLA-8 [0195]
  • Inbred Balb/c mice were immunized intraperitoneally with 1 ml of purified human CTLA-8-FLAG emulsified in Freund's complete adjuvant on day 0, and in Freund's incomplete adjuvant on days 15 and 22. The mice were boosted with 0.5 ml of purified human CTLA-8-8 administered intravenously. [0196]
  • Hybridomas were created using the non-secreting myeloma cells line SP2/0-Ag8 and polyethylene glycol 1000 (Sigma, St. Louis, Mo.) as the fusing agent. Hybridoma cells were placed in a 96-well Falcon tissue culture plate (Becton Dickinson, N.J.) and fed with DMEM F12 (Gibco, Gaithersburg, Md.) supplemented with 80 μg/ml gentamycin, 2 mM glutamine, 10% horse serum (Gibco, Gaithersburg, Md.), 1% ADCM (CRTS, Lyon, France:) 10[0197] −5 M azaserine (Sigma, St. Louis, Mo.) and 5×10−5 M hypoxanthine. Hybridoma supernatants were screened for antibody production against human CTLA-8 by immunocytochemistry (ICC) using acetone fixed human CTLA-8 transfected COS-7 cells and by ELISA using human CTLA-8-FLAG purified from COS-7 supernatants as a coating antigen. Aliquots of positive cell clones were expanded for 6 days and cryopreserved as well as propagated in ascites from pristane (2,6,10,14-teramethylpentadecane, Sigma, St. Louis, Mo.) treated Balb/c mice who had received on intraperitoneal injection of pristane 15 days before. About 105 hybridoma cells in 1 ml of PBS were given intraperitoneally, and 10 days later, ascites were collected from each mouse.
  • After centrifugation of the ascites, the antibody fraction was isolated by ammonium sulfate precipitation and anion-exchange chromatography on a zephyr-D silicium column (IBF Sepracor) equilabrated with 20 mM Tris pH 8.0. Proteins were eluted with a NaCl gradient (ranging from 0 to 1 M NaCl). 2 ml fractions were collected and tested by ELISA for the presence of anti-CTLA-8 antibody. The fractions containing specific anti-CTLA-8 activity were pooled, dialyzed, and frozen. Aliquots of the purified monoclonal antibodies were peroxydase labeled. [0198]
  • Quantification of Human CTLA-8 [0199]
  • Among the antibodies specific for CTLA-8, Ab25, and peroxydase labeled Ab16 were selected to quantitate levels of human CTLA-8 using a sandwich assay. Purified Ab25 was diluted at 2 μg/ml in coating buffer (carbonate buffer, pH 9.6. 15 mM Na[0200] 2CO3, 35 mM NaHCO3). This diluted solution was coated onto the wells of a 96-well ELISA plate (Immunoplate Maxisorp F96 certified, NUNC, Denmark) overnight at room temperature. The plates were then washed manually one with a washing buffer consisting of Phosphate Buffered Saline and 0.05% Tween 20 (Technicon Diagnositics, USA). 110 μl of purified human CTLA-8 diluted in TBS-B-T buffer [20 mM Tris, 150 mM NaCl, 1% BSA (Sigma, St. Louis, Mo.), and 0.05% Tween 20] was added to each well. After 3 hours of incubation at 37° C., the plates were washed once. 100 μl of peroxydase labeled Ab16 diluted to 5 μg/ml in TBS-B-T buffer was added to each well, and incubated for 2 hours at 37° C. The wells were then washed three times in washing buffer. 100 μl of peroxydase substrate, 2.2′ Azino-bis(3 ethylbenzthiazoine-6-sulfonic acid) (ABTS), diluted to 1 mg/ml in citrate/phosphate buffer, was added to each well, and the colorimetric reaction was read at 405 nm. The lowest concentration of human CTLA-8 detected was 0.015 ng/ml.
  • V. Induction of IL-6 Secretion by Treatment of Various Cell Types with CTLA-8 [0201]
  • Synoviocytes from normal and rheumatoid arthritic patients (10[0202] 4 cells/well) were incubated with increasing concentrations of human CTLA-8-8. After 48 hours, concentrations of IL-6 were measured by standard ELISA techniques. Secretion of IL-6 was increased in both types of cells in a dose dependent manner.
  • Kidney epithelial carcinoma cell lines TUMT and CHA were also cultured in complete RPMI 1640 medium (Gibco BRL, Grand Island, N.Y.), supplemented with 2 mM L-glutamine, 100 U/ml penicillin, 50 μg/ml gentamycin, 20 mM Hepes buffer and heat-inactivated 10% FCS. Cells (104 cells/well) were incubated in 96-well plates (Falcon) in a final volume of 250 μl of complete culture medium. Increasing concentrations of human CTLA-8-8 were added at the onset of the culture. Cell-free supernatants were collected after 48 hours, and stored at −20° C. until cytokine assays. IL-6 levels were measured by two-site sandwich ELISA as described in Abrams, et al. (1992). [0203] Immunol. Rev. 127:5-24. Both cell lines exhibited dose dependent increases in IL-6 secretion with increasing concentrations of CTLA-8. In view of these results, other cell lines will also be screened for responses to other species of CTLA-8 variants.
  • MRC-5 human lung fibroblasts were obtained from the ATCC (Rockville, Md.) and were cultured in complete RPMI 1640 medium (Gibco BRL, Grand Island, N.Y.), supplemented with 2 mM L-glutamine, 100 U/ml penicillin, 50 mg/ml gentamycin, 20 mM Hepes buffer and heat-inactivated 10% FCS. Cells (10[0204] 4 cells/well) were incubated in 96-well plates (Falcon) in a final volume of 250 ml of complete culture medium. Increasing concentrations of human CTLA-8-8 was added at the onset of the culture. Cell-free supernatants were collected after 48 hours, and stored at −20° C. until cytokine assays. IL-6 levels, measured by ELISA. Dose dependent induction of IL-6 was observed.
  • Similar results were obtained using adult and child dermal fibroblasts, human brain epithelial cells, and human bronchus epithelial cells. Kidney mesangium cells are also expected to respond similarly. [0205]
  • VI. Isolating CTLA-8 Homologues [0206]
  • The binding composition is used for screening of an expression library made from a cell line which expresses a CTLA-8 protein. Standard staining techniques are used to detect or sort intracellular or surface expressed antigen, or surface expressing transformed cells are screened by panning. Screening of intracellular expression is performed by various staining or immunofluorescence procedures. See also McMahan, et al. (1991) [0207] EMBO J. 10:2821-2832.
  • For example, on day 0, precoat 2-chamber permanox slides with 1 ml per chamber of fibronectin, 10 ng/ml in PBS, for 30 min at room temperature. Rinse once with PBS. Then plate COS cells at 2-3×10[0208] 5 cells per chamber in 1.5 ml of growth media. Incubate overnight at 37° C.
  • On day 1 for each sample, prepare 0.5 ml of a solution of 66 μg/ml DEAE-dextran, 66 μM chloroquine, and 4 μg DNA in serum free DME. For each set, a positive control is prepared, e.g., of huIL-10-FLAG cDNA at 1 and 1/200 dilution, and a negative mock. Rinse cells with serum free DME. Add the DNA solution and incubate 5 hr at 37° C. Remove the medium and add 0.5 ml 10% DMSO in DME for 2.5 min. Remove and wash once with DME. Add 1.5 ml growth medium and incubate overnight. [0209]
  • On day 2, change the medium. On days 3 or 4, the cells are fixed and stained. Rinse the cells twice with Hank's Buffered Saline Solution (HBSS) and fix in 4% paraformaldehyde (PFA)/glucose for 5 min. Wash 3× with HBSS. The slides may be stored at −80° C. after all liquid is removed. For each chamber, 0.5 ml incubations are performed as follows. Add HBSS/saponin (0.1%) with 32 μl/ml of 1 M NaN[0210] 3 for 20 min. Cells are then washed with HBSS/saponin 1×. Soluble antibody is added to cells and incubate for 30 min. Wash cells twice with HBSS/saponin. Add second antibody, e.g., Vector anti-mouse antibody, at 1/200 dilution, and incubate for 30 min. Prepare ELISA solution, e.g., Vector Elite ABC horseradish peroxidase solution, and preincubate for 30 min. Use, e.g., 1 drop of solution A (avidin) and 1 drop solution B (biotin) per 2.5 ml HBSS/saponin. Wash cells twice with HBSS/saponin. Add ABC HRP solution and incubate for 30 min. Wash cells twice with HBSS, second wash for 2 min, which closes cells. Then add Vector diaminobenzoic acid (DAB) for 5 to 10 min. Use 2 drops of buffer plus 4 drops DAB plus 2 drops of H2O2 per 5 ml of glass distilled water. Carefully remove chamber and rinse slide in water. Air dry for a few minutes, then add 1 drop of Crystal Mount and a cover slip. Bake for 5 min at 85-90° C.
  • Alternatively, the binding compositions are used to affinity purify or sort out cells expressing the antigen. See, e.g., Sambrook, et al. or Ausubel, et al. [0211]
  • Similar methods are applicable to isolate either species or allelic variants. Species variants are isolated using cross-species hybridization techniques based upon a full length isolate or fragment from one species as a probe, or appropriate species. [0212]
  • All references cited herein are incorporated herein by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference. [0213]
  • Many modifications and variations of this invention can be made without departing from its spirit and scope, as will be apparent to those skilled in the art. The specific embodiments described herein are offered by way of example only, and the invention is to be limited only by the terms of the appended claims, along with the full scope of equivalents to which such claims are entitled. [0214]
  • SEQUENCE SUBMISSION
  • SEQ ID NO: 1 is murine CTLA-8 cDNA nucleic acid sequence. [0215]
  • SEQ ID NO: 2 is murine CTLA-8 peptide amino acid sequence. [0216]
  • SEQ ID NO: 3 is herpesvirus ORF13 nucleic acid sequence. [0217]
  • SEQ ID NO: 4 is predicted ORF13 amino acid sequence. [0218]
  • SEQ ID NO: 5 is human CTLA-8 cDNA nucleic acid sequence. [0219]
  • SEQ ID NO: 6 is predicted human CTLA-8 amino acid sequence. [0220]
  • SEQ ID NO: 7 is human CTLA-8 cDNA nucleic acid sequence. [0221]
  • SEQ ID NO: 8 is predicted human CTLA-8 amino acid sequence. [0222]
  • SEQ ID NO: 9 is mouse CTLA-8 cDNA nucleic acid sequence. [0223]
  • SEQ ID NO: 10 is mouse CTLA-8 predicted amino acid sequence. [0224]
  • 1 10 1080 base pairs nucleic acid single linear cDNA CDS 12..464 /product= “mouse/rat CTLA-8” 1 GAATTCCATC C ATG TGC CTG ATG CTG TTG CTG CTA CTG AAC CTG GAG GCT 50 Met Cys Leu Met Leu Leu Leu Leu Leu Asn Leu Glu Ala 1 5 10 ACA GTG AAG GCA GCG GTA CTC ATC CCT CAA AGT TCA GTG TGT CCA AAC 98 Thr Val Lys Ala Ala Val Leu Ile Pro Gln Ser Ser Val Cys Pro Asn 15 20 25 GCC GAG GCC AAT AAC TTT CTC CAG AAC GTG AAG GTC AAC CTG AAA GTC 146 Ala Glu Ala Asn Asn Phe Leu Gln Asn Val Lys Val Asn Leu Lys Val 30 35 40 45 ATC AAC TCC CTT AGC TCA AAA GCG AGC TCC AGA AGG CCC TCA GAC TAC 194 Ile Asn Ser Leu Ser Ser Lys Ala Ser Ser Arg Arg Pro Ser Asp Tyr 50 55 60 CTC AAC CGT TCC ACT TCA CCC TGG ACT CTG AGC CGC AAT GAG GAC CCT 242 Leu Asn Arg Ser Thr Ser Pro Trp Thr Leu Ser Arg Asn Glu Asp Pro 65 70 75 GAT AGA TAT CCT TCT GTG ATC TGG GAG GCA CAG TGC CGC CAC CAG CGC 290 Asp Arg Tyr Pro Ser Val Ile Trp Glu Ala Gln Cys Arg His Gln Arg 80 85 90 TGT GTC AAC GCT GAG GGG AAG TTG GAC CAC CAC ATG AAT TCT GTT CTC 338 Cys Val Asn Ala Glu Gly Lys Leu Asp His His Met Asn Ser Val Leu 95 100 105 ATC CAG CAA GAG ATC CTG GTC CTG AAG AGG GAG CCT GAG AAG TGC CCC 386 Ile Gln Gln Glu Ile Leu Val Leu Lys Arg Glu Pro Glu Lys Cys Pro 110 115 120 125 TTC ACT TTC CGG GTG GAG AAG ATG CTG GTG GGC GTG GGC TGC ACC TGC 434 Phe Thr Phe Arg Val Glu Lys Met Leu Val Gly Val Gly Cys Thr Cys 130 135 140 GTT TCC TCT ATT GTC CGC CAT GCG TCC TAAACAGAGA CCTGAGGCTA 481 Val Ser Ser Ile Val Arg His Ala Ser 145 150 GCCCCTAAGA AACCCCTGCG TTTCTCTGCA AACTTCCTTG TCTTTTTAAA ACAGTTCACACA 541 GTTGAATCTC AGCAAGTGAT ATGGATTTAA AGGCGGGGTT AGAATTGTCT GCCTTCCACACC 601 CTGAAAAGAA GGCGCAGAGG GGATATAAAT TGCTTCTTGT TTTTCTGTGG GCTTTAAATATT 661 ATTTATGTAT TTACTCTATC CCGAGATAAC TTTGAGGCAT AAGTTATTTT AATGAATTATAT 721 CTACATTATT ATTATGTTTC TTAATGCAGA AGACAAAATT CAAGACTAAG AAATTTTATATT 781 ATTTAAAAGG TAAAACCTAT ATTTATATGA GCTATTTATG GGTCTATTTA TTTTTCTTTCAC 841 GTGCTAAGAT CATGATTATC AGATCTACCT AAGGAAGTCC TAAATAATAT TAAATATTATAA 901 TTGAAATTTC AGTTTTACTA TTTGCTTATT TAAGGTTCCC TCCTCTGAAT GGTGTGAAAAAT 961 CAAACCTCGT TTTATGTTTT TAAATTATTG AGGCTTCGAA AAATTGGGCA ATTTAGCTCTTC 1021 CTACTGTGTG TTTAAAAACC TTGTAACAAT ATCACTATAA TAAATTTTTG GAAGAAAAAAAT 1080 150 amino acids amino acid linear protein 2 Met Cys Leu Met Leu Leu Leu Leu Leu Asn Leu Glu Ala Thr Val Lys 1 5 10 15 Ala Ala Val Leu Ile Pro Gln Ser Ser Val Cys Pro Asn Ala Glu Ala 20 25 30 Asn Asn Phe Leu Gln Asn Val Lys Val Asn Leu Lys Val Ile Asn Ser 35 40 45 Leu Ser Ser Lys Ala Ser Ser Arg Arg Pro Ser Asp Tyr Leu Asn Arg 50 55 60 Ser Thr Ser Pro Trp Thr Leu Ser Arg Asn Glu Asp Pro Asp Arg Tyr 65 70 75 80 Pro Ser Val Ile Trp Glu Ala Gln Cys Arg His Gln Arg Cys Val Asn 85 90 95 Ala Glu Gly Lys Leu Asp His His Met Asn Ser Val Leu Ile Gln Gln 100 105 110 Glu Ile Leu Val Leu Lys Arg Glu Pro Glu Lys Cys Pro Phe Thr Phe 115 120 125 Arg Val Glu Lys Met Leu Val Gly Val Gly Cys Thr Cys Val Ser Ser 130 135 140 Ile Val Arg His Ala Ser 145 150 2520 base pairs nucleic acid single linear DNA (genomic) CDS 1574..2029 /product= “Saimiriine herpesvirus 2 immediate-early protein” /note= “open reading frame 2 (ORF2)” 3 AGCTTCATGC AAATACATCT TATCTTACCA GATTCTCGCC TCATTTGCAA ACATGCCTCA 60 TCTTTTGAGA AGAAACGCAA TTCGAACTTC TTCTAATGCT CCTGAAGAGC AGCCTGTGCT 120 GCAGCCTGAG CTTGATGCTA TTGAAGAGCT AGAATAAGAG CTATTTTTTG ACGATGGGTG 180 CTGCCTTTCT GTTCAAGAAA TCTGCTTAAT TGTTCTTGGA TTCTTATTGT TTCTGCTAGC 240 TGTAATTGTT TTTTATAACT ATACAGACAC AGATCAATTT GTGAAGCTGA CACATCTTAT 300 GAGCCACAAA AATTCTATCA AAGGACCTTT TGATCTTTAA GGTATGTACT CATAATTTTA 360 TTTTTTTATT TCTAAAACAA TCTTAGTATA TATAATTAAT ACAAATTTTA GAAAATACTA 420 TAATAAATAT TGAAAGCTGT ATTTACATTG TAAACTATAT ATAGGCAATG TAAAGTCATT 480 CTAACTTTAG GTTTGCTTTA CCTGTTACAG AAACTTCACC TGTGTGTCAA GAGCTGCAAA 540 CATGGCTTTA GACTTAAGAA ATCTTAAACA CCTGACTGCT AACTTCAGTT TTAGAATAAT 600 GATATGGATT ATGCTATGTT TGGCTCTACC TACTGATAGT AAACCTATTT CAACAACTGA 660 AGCTCCAATA CTAAACATAA CACAATCTCC AAGTTTGAAC ATCTCATCAC CTTCTACTTT 720 AGAACCTTCA GAGCCTCTTA AAAACTGTAC AACATTCTTA GACTTACTTT GGCAGCGGCT 780 GGGCGAGAAC GCTTCTATAA AGGACTTGAT GTTAACATTA CAACGAGAAG AAGTCCACGG 840 AAGAATGACT ACACTTCCTT CACCTAGACC AAGCAGTAAA GTTGAAGAAC AACAGTTACA 900 AAGACCTAGA AACTTACTGC CTACTGCTGT CGGGCCACCT CATGTCAAAT ATAGACTATA 960 TAATCGCTTA TGGGAAGCTC CTAAAGGAGC TGATGTTAAT GGTAAACCTA TACAATTTGA 1020 TGACCCTCCT CTTCCTTATA CAGGGGCATA TAATGATGAT GGTGTTTTAA TGGTTAATAT 1080 TAATGGAAAA CATGTGAGGT TTGATAGCTT GTCTTATTGG GAAAGAATTA AAAGATCTGG 1140 TACCCCATGG TGTATAAAGA CACCAAGTGA AAAAGCAGCA ATATTGAAGC AGCTTTTAAA 1200 AGCTGAAAAA AAATGTAGGA CTACTTCTAA ACGTATCACT GAGTTAGAAG AGCAGATTAA 1260 AGAACTAGAA AAAACTAGTA CATCTCCATA GATTACTGTT AGAATGTGTT TATCATACTA 1320 AAATAAATGC TTTATGTATT GCAATATTAC TTGTTTGCTA TGACTTTGGT ATATGAAATA 1380 CAAATCTTAA ATAAAAAGTT TTTGTCTAGT ATTGGCGTCA CTGTATTTTA CTAGCAAAAA 1440 TATATAAATT GTTATGTAGC AAGAAGTTTG TATCAATATA AAAACTCTAA AGTATATAAA 1500 CAAACATTCA ATTAGTGTAA ATCATAGCAA GCATATCTTT TCATACGTGT CTAGTTAATT 1560 TAAAGAATTA ATT ATG ACA TTT AGA ATG ACT TCA CTT GTG TTA CTT CTG 1609 Met Thr Phe Arg Met Thr Ser Leu Val Leu Leu Leu 1 5 10 CTG CTG AGC ATA GAT TGT ATA GTA AAG TCA GAA ATA ACA AGC GCA CAA 1657 Leu Leu Ser Ile Asp Cys Ile Val Lys Ser Glu Ile Thr Ser Ala Gln 15 20 25 ACC CCA AGA TGC TTA GCT GCT AAC AAT AGC TTT CCA CGG TCT GTG ATG 1705 Thr Pro Arg Cys Leu Ala Ala Asn Asn Ser Phe Pro Arg Ser Val Met 30 35 40 GTT ACT TTG AGC ATC CGT AAC TGG AAT ACT AGT TCT AAA AGG GCT TCA 1753 Val Thr Leu Ser Ile Arg Asn Trp Asn Thr Ser Ser Lys Arg Ala Ser 45 50 55 60 GAC TAC TAC AAT AGA TCT ACG TCT CCT TGG ACT CTC CAT CGC AAT GAA 1801 Asp Tyr Tyr Asn Arg Ser Thr Ser Pro Trp Thr Leu His Arg Asn Glu 65 70 75 GAT CAA GAT AGA TAT CCC TCT GTG ATT TGG GAA GCA AAG TGT CGC TAC 1849 Asp Gln Asp Arg Tyr Pro Ser Val Ile Trp Glu Ala Lys Cys Arg Tyr 80 85 90 TTA GGA TGT GTT AAT GCT GAT GGG AAT GTA GAC TAC CAC ATG AAC TCA 1897 Leu Gly Cys Val Asn Ala Asp Gly Asn Val Asp Tyr His Met Asn Ser 95 100 105 GTC CCT ATC CAA CAA GAG ATT CTA GTG GTG CGC AAA GGG CAT CAA CCC 1945 Val Pro Ile Gln Gln Glu Ile Leu Val Val Arg Lys Gly His Gln Pro 110 115 120 TGC CCT AAT TCA TTT AGG CTA GAG AAG ATG CTA GTG ACT GTA GGC TGC 1993 Cys Pro Asn Ser Phe Arg Leu Glu Lys Met Leu Val Thr Val Gly Cys 125 130 135 140 ACA TGC GTT ACT CCC ATT GTT CAC AAT GTA GAC TAAAAGCTAT CTAAATTT 2046 Thr Cys Val Thr Pro Ile Val His Asn Val Asp 145 150 AAAATTAACA TTTCACTAAA AAACAAAAAC TTGATTTTTT TCTTTTAAAT AAAAAAAGTT 2106 TAATATAAGT TCTGGCTTGT TTGGTTTTTG ACTAATCAAT GTAGATCACA CTTGTGATCT 2166 TAGCTCTCGG GAAGCAATGT AAGAAAATAT ATTTAACTTA AGAGTTTTAG ACTTGCTTGA 2226 GTTTTATGAG TAAAAAACAA AGAATAAGCA CAGCTTCTTG TATCTTCTTT TAAAAACTTT 2286 AAGTTATTTA TGTATTTAAT ATAATCTAAT GTTTCTTAAA CATGTTGAGT TTGAGGTCCA 2346 CTAATACAAC ATTATAATTT TTTCTGTTAT AACACTTTTG CAAGAAGAAC TCATTTTATA 2406 GAAAATGAGC AGTATTCAAA AAAAATGTTT GATATGCTGT AATATTGGAG AGGAAGAACT 2466 TTTACAAGCA TGTGATTGTC CTAGCAGAGT CCATCATACA TGCTTACAAA GTCA 2520 151 amino acids amino acid linear protein 4 Met Thr Phe Arg Met Thr Ser Leu Val Leu Leu Leu Leu Leu Ser Ile 1 5 10 15 Asp Cys Ile Val Lys Ser Glu Ile Thr Ser Ala Gln Thr Pro Arg Cys 20 25 30 Leu Ala Ala Asn Asn Ser Phe Pro Arg Ser Val Met Val Thr Leu Ser 35 40 45 Ile Arg Asn Trp Asn Thr Ser Ser Lys Arg Ala Ser Asp Tyr Tyr Asn 50 55 60 Arg Ser Thr Ser Pro Trp Thr Leu His Arg Asn Glu Asp Gln Asp Arg 65 70 75 80 Tyr Pro Ser Val Ile Trp Glu Ala Lys Cys Arg Tyr Leu Gly Cys Val 85 90 95 Asn Ala Asp Gly Asn Val Asp Tyr His Met Asn Ser Val Pro Ile Gln 100 105 110 Gln Glu Ile Leu Val Val Arg Lys Gly His Gln Pro Cys Pro Asn Ser 115 120 125 Phe Arg Leu Glu Lys Met Leu Val Thr Val Gly Cys Thr Cys Val Thr 130 135 140 Pro Ile Val His Asn Val Asp 145 150 237 base pairs nucleic acid single linear cDNA CDS 1..237 /product= “human CTLA-8 fragment” 5 MGC AAT GAG GAC CCT GAG AGA TAT CCC TCT GTG ATC TGG GAG GCA AAG 48 Xaa Asn Glu Asp Pro Glu Arg Tyr Pro Ser Val Ile Trp Glu Ala Lys 1 5 10 15 TGC CGC CAC TTG GGC TGC ATC AAC GCT GAT GGG AAC GTG GAC TAC CAC 96 Cys Arg His Leu Gly Cys Ile Asn Ala Asp Gly Asn Val Asp Tyr His 20 25 30 ATG AAC TCT GTC CCC ATC CAG CAA GAG ATC CTG GTC CTG CGC AGG GAG 144 Met Asn Ser Val Pro Ile Gln Gln Glu Ile Leu Val Leu Arg Arg Glu 35 40 45 CCT CCA CAC TGC CCC AAC TCC TTC CGG CTG GAG AAG ATA CTG GTG TCC 192 Pro Pro His Cys Pro Asn Ser Phe Arg Leu Glu Lys Ile Leu Val Ser 50 55 60 GTG GGC TGC ACC TGT GTC ACC CCG ATT GTC CAC CAT GTG GCC 234 Val Gly Cys Thr Cys Val Thr Pro Ile Val His His Val Ala 65 70 75 TAA 237 78 amino acids amino acid linear protein Modified-site 1 /product= “OTHER” /note= “Xaa = Ser or Arg” 6 Xaa Asn Glu Asp Pro Glu Arg Tyr Pro Ser Val Ile Trp Glu Ala Lys 1 5 10 15 Cys Arg His Leu Gly Cys Ile Asn Ala Asp Gly Asn Val Asp Tyr His 20 25 30 Met Asn Ser Val Pro Ile Gln Gln Glu Ile Leu Val Leu Arg Arg Glu 35 40 45 Pro Pro His Cys Pro Asn Ser Phe Arg Leu Glu Lys Ile Leu Val Ser 50 55 60 Val Gly Cys Thr Cys Val Thr Pro Ile Val His His Val Ala 65 70 75 510 base pairs nucleic acid single linear cDNA - 1..510 /note= “full length human CTLA-8 clone” CDS 43..510 /product= “human CTLA-8” 7 GGCACAAACT CATCCATCCC CAGTTGATTG GAAGAAACAA CG ATG ACT CCT GGG 54 Met Thr Pro Gly 1 AAG ACC TCA TTG GTG TCA CTG CTA CTG CTG CTG AGC CTG GAG GCC ATA 102 Lys Thr Ser Leu Val Ser Leu Leu Leu Leu Leu Ser Leu Glu Ala Ile 5 10 15 20 GTG AAG GCA GGA ATC ACA ATC CCA CGA AAT CCA GGA TGC CCA AAT TCT 150 Val Lys Ala Gly Ile Thr Ile Pro Arg Asn Pro Gly Cys Pro Asn Ser 25 30 35 GAG GAC AAG AAC TTC CCC CGG ACT GTG ATG GTC AAC CTG AAC ATC CAT 198 Glu Asp Lys Asn Phe Pro Arg Thr Val Met Val Asn Leu Asn Ile His 40 45 50 AAC CGG AAT ACC AAT ACC AAT CCC AAA AGG TCC TCA GAT TAC TAC AAC 246 Asn Arg Asn Thr Asn Thr Asn Pro Lys Arg Ser Ser Asp Tyr Tyr Asn 55 60 65 CGA TCC ACC TCA CCT TGG AAT CTC CAC CGC AAT GAG GAC CCT GAG AGA 294 Arg Ser Thr Ser Pro Trp Asn Leu His Arg Asn Glu Asp Pro Glu Arg 70 75 80 TAT CCC TCT GTG ATC TGG GAG GCA AAG TGC CGC CAC TTG GGC TGC ATC 342 Tyr Pro Ser Val Ile Trp Glu Ala Lys Cys Arg His Leu Gly Cys Ile 85 90 95 100 AAC GCT GAT GGG AAC GTG GAC TAC CAC ATG AAC TCT GTC CCC ATC CAG 390 Asn Ala Asp Gly Asn Val Asp Tyr His Met Asn Ser Val Pro Ile Gln 105 110 115 CAA GAG ATC CTG GTC CTG CGC AGG GAG CCT CCA CAC TGC CCC AAC TCC 438 Gln Glu Ile Leu Val Leu Arg Arg Glu Pro Pro His Cys Pro Asn Ser 120 125 130 TTC CGG CTG GAG AAG ATA CTG GTG TCC GTG GGC TGC ACC TGT GTC ACC 486 Phe Arg Leu Glu Lys Ile Leu Val Ser Val Gly Cys Thr Cys Val Thr 135 140 145 CCG ATT GTC CAC CAT GTG GCC TAA 510 Pro Ile Val His His Val Ala 150 155 155 amino acids amino acid linear protein 8 Met Thr Pro Gly Lys Thr Ser Leu Val Ser Leu Leu Leu Leu Leu Ser 1 5 10 15 Leu Glu Ala Ile Val Lys Ala Gly Ile Thr Ile Pro Arg Asn Pro Gly 20 25 30 Cys Pro Asn Ser Glu Asp Lys Asn Phe Pro Arg Thr Val Met Val Asn 35 40 45 Leu Asn Ile His Asn Arg Asn Thr Asn Thr Asn Pro Lys Arg Ser Ser 50 55 60 Asp Tyr Tyr Asn Arg Ser Thr Ser Pro Trp Asn Leu His Arg Asn Glu 65 70 75 80 Asp Pro Glu Arg Tyr Pro Ser Val Ile Trp Glu Ala Lys Cys Arg His 85 90 95 Leu Gly Cys Ile Asn Ala Asp Gly Asn Val Asp Tyr His Met Asn Ser 100 105 110 Val Pro Ile Gln Gln Glu Ile Leu Val Leu Arg Arg Glu Pro Pro His 115 120 125 Cys Pro Asn Ser Phe Arg Leu Glu Lys Ile Leu Val Ser Val Gly Cys 130 135 140 Thr Cys Val Thr Pro Ile Val His His Val Ala 145 150 155 1134 base pairs nucleic acid single linear cDNA - 1..1134 /note= “mouse CTLA-8 fragment” CDS 45..521 /product= “mouse CTLA-8” 9 GAGGCTCAAG TGCACCCAGC ACCAGCTGAT CAGGACGCGC AAAC ATG AGT CCA GGG 56 Met Ser Pro Gly 1 AGA GCT TCA TCT GTG TCT CTG ATG CTG TTG CTG CTG CTG AGC CTG GCG 104 Arg Ala Ser Ser Val Ser Leu Met Leu Leu Leu Leu Leu Ser Leu Ala 5 10 15 20 GCT ACA GTG AAG GCA GCA GCG ATC ATC CCT CAA AGC TCA GCG TGT CCA 152 Ala Thr Val Lys Ala Ala Ala Ile Ile Pro Gln Ser Ser Ala Cys Pro 25 30 35 AAC ACT GAG GCC AAG GAC TTC CTC CAG AAT GTG AAG GTC AAC CTC AAA 200 Asn Thr Glu Ala Lys Asp Phe Leu Gln Asn Val Lys Val Asn Leu Lys 40 45 50 GTC TTT AAC TCC CTT GGC GCA AAA GTG AGC TCC AGA AGG CCC TCA GAC 248 Val Phe Asn Ser Leu Gly Ala Lys Val Ser Ser Arg Arg Pro Ser Asp 55 60 65 TAC CTC AAC CGT TCC ACG TCA CCC TGG ACT CTC CAC CGC AAT GAA GAC 296 Tyr Leu Asn Arg Ser Thr Ser Pro Trp Thr Leu His Arg Asn Glu Asp 70 75 80 CCT GAT AGA TAT CCC TCT GTG ATC TGG GAA GCT CAG TGC CGC CAC CAG 344 Pro Asp Arg Tyr Pro Ser Val Ile Trp Glu Ala Gln Cys Arg His Gln 85 90 95 100 CGC TGT GTC AAT GCG GAG GGA AAG CTG GAC CAC CAC ATG AAT TCT GTT 392 Arg Cys Val Asn Ala Glu Gly Lys Leu Asp His His Met Asn Ser Val 105 110 115 CTC ATC CAG CAA GAG ATC CTG GTC CTG AAG AGG GAG CCT GAG AGC TGC 440 Leu Ile Gln Gln Glu Ile Leu Val Leu Lys Arg Glu Pro Glu Ser Cys 120 125 130 CCC TTC ACT TTC AGG GTC GAG AAG ATG CTG GTG GGT GTG GGC TGC ACC 488 Pro Phe Thr Phe Arg Val Glu Lys Met Leu Val Gly Val Gly Cys Thr 135 140 145 TGC GTG GCC TCG ATT GTC CGC CAG GCA GCC TAAACAGAGA CCCGCGGCTG 538 Cys Val Ala Ser Ile Val Arg Gln Ala Ala 150 155 ACCCCTAAGA AACCCCCACG TTTCTCAGCA AACTTACTTG CATTTTTAAA ACAGTTCGTC 598 CTATTGATTT TCAGCAAGGA ATGTGGATTC AGAGGCAGAT TCAGAATTGT CTGCCCTCCA 658 CAATGAAAAG AAGGTGTAAA GGGGTCCCAA ACTGCTTCGT GTTTGTTTTT CTGTGGACTT 718 TAAATTATTT GTGTATTTAC AATATCCCAA GATAACTTTG AAGGCGTAAC TTATTTAATG 778 AAGTATCTAC ATTATTATTA TGTTTCTTTC TGAAGAAGAC AAAATTCAAG ACTCAGAAAT 838 TTTATTATTT AAAAGGTAAG CCTATATTTA TATGAGCTAT TTATGAATCT ATTTATTTTT 898 CTTCAGTATT TGAAGTATTA AGAACATGAT TTTCAGATCT ACCTAGGGAA GTCCTAAGTA 958 AGATTAAATA TTAATGGAAA TTTCAGCTTT ACTATTTGGT TGATTTAAGG TTCTCTCCTC 1018 TGAATGGGGT GAAAACCAAA CTTAGTTTTA TGTTTAATAA CTTTTTAAAT TATTGAAGT 1078 TCAAAAAATT GGATAATTTA GCTCCCTACT CTGTTTTAAA AAAAAAAAAA AAAAAA 1134 158 amino acids amino acid linear protein 10 Met Ser Pro Gly Arg Ala Ser Ser Val Ser Leu Met Leu Leu Leu Leu 1 5 10 15 Leu Ser Leu Ala Ala Thr Val Lys Ala Ala Ala Ile Ile Pro Gln Ser 20 25 30 Ser Ala Cys Pro Asn Thr Glu Ala Lys Asp Phe Leu Gln Asn Val Lys 35 40 45 Val Asn Leu Lys Val Phe Asn Ser Leu Gly Ala Lys Val Ser Ser Arg 50 55 60 Arg Pro Ser Asp Tyr Leu Asn Arg Ser Thr Ser Pro Trp Thr Leu His 65 70 75 80 Arg Asn Glu Asp Pro Asp Arg Tyr Pro Ser Val Ile Trp Glu Ala Gln 85 90 95 Cys Arg His Gln Arg Cys Val Asn Ala Glu Gly Lys Leu Asp His His 100 105 110 Met Asn Ser Val Leu Ile Gln Gln Glu Ile Leu Val Leu Lys Arg Glu 115 120 125 Pro Glu Ser Cys Pro Phe Thr Phe Arg Val Glu Lys Met Leu Val Gly 130 135 140 Val Gly Cys Thr Cys Val Ala Ser Ile Val Arg Gln Ala Ala 145 150 155

Claims (22)

What is claimed is:
1. A nucleic acid at least 95% identical to one encoding a mammalian CTLA protein or fragment thereof.
2. The nucleic acid of claim 1, wherein said encoding nucleic acid comprises a sequence of SEQ ID NO: 1, 3, 5, 7, or 9.
3. A substantially pure primate CTLA-8 protein or peptide thereof.
4. The protein or peptide of claim 3, wherein said protein or peptide comprises a sequence of SEQ ID NO: 2, 4, 6, 8, or 10.
5. The protein or peptide of claim 4, wherein said protein or peptide induces a cell to secrete an inflammatory mediator.
6. The protein or peptide of claim 5, wherein said inflammatory mediator is IL-6; IL-8; and/or PGE2.
7. A composition comprising a protein of claim 3, and a pharmaceutically acceptable carrier.
8. An antibody which specifically binds a mammalian CTLA-8 protein or peptide thereof.
9. The antibody of claim 8, wherein said antibody is raised against a peptide sequence of SEQ ID NO: 2, 4, 6, 8, or 10.
10. The antibody of claim 9, wherein said antibody is a monoclonal antibody.
11. The antibody of claim 10, wherein said antibody blocks a CTLA-8 induced secretion of an inflammatory mediator.
12. The antibody of claim 10, wherein said inflammatory mediator is IL-6; IL-8; and/or PGE2.
13. An antibody of claim 10, wherein said antibody is labeled.
14. A kit comprising:
a) a nucleic acid at least 95% identical to one encoding a mammalian CTLA-8 protein or peptide;
b) a substantially pure mammalian CTLA-8 protein or fragment; or
c) an antibody or receptor which specifically binds a mammalian CTLA-8 protein.
15. The kit of claim 14, wherein said encoding nucleic acid comprises a sequence of SEQ ID NO: 1, 3, 5, 7, or 9.
16. The kit of claim 14, wherein said protein or fragment is selected from the group consisting of:
a) a protein or peptide from a mammal, including a rat or human;
b) a protein or peptide comprising at least one polypeptide segment of SEQ ID NO: 2, 4, 6, 8, or 10; and
c) a protein or peptide which exhibits a post-translational modification pattern distinct from a natural mammalian CTLA-8 protein.
17. The kit of claim 14 comprising an antibody or receptor, wherein:
a) said CTLA-8 protein from a mammal, including a mouse or human;
b) said antibody is raised against a peptide sequence of SEQ ID NO: 2, 4, 6, 8, or 10;
c) said antibody is a monoclonal antibody; or
d) said antibody is labeled.
18. A method of modulating physiology or development of a cell comprising contacting said cell with an agonist or antagonist of a mammalian CTLA-8 protein.
19. A method of claim 18, wherein said antagonist is an antibody against a mammalian CTLA-8 protein.
20. A method of modulating CTLA-8 induced secretion of an inflammatory mediator from a cell in a tissue comprising the step of contacting said tissue with:
a) an antibody which specifically binds to a mammalian CTLA-8; or
b) a substantially pure CTLA-8 protein or peptide thereof.
21. The method of claim 20, wherein said inflammatory mediator is selected from the group consisting of: IL-6; IL-8; and/or PGE2.
22. The method of claim 20, wherein said cell is selected from the group consisting of:
a) a synovial cell;
b) an endothelial cell;
c) an epithelial cell;
d) a fibroblast cell; or
e) a carcinoma cell.
US10/417,674 1993-06-14 2003-04-16 Purified mammalian CTLA-8 antigens and related reagents Abandoned US20030166862A1 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
US10/417,674 US20030166862A1 (en) 1993-06-14 2003-04-16 Purified mammalian CTLA-8 antigens and related reagents
US11/097,622 US20050266445A1 (en) 1993-06-14 2005-03-31 Purified mammalian CTLA-8 antigens and related reagents
US11/848,672 US20090227021A1 (en) 1995-05-02 2007-08-31 Purified mammalian ctla-8 antigens and related reagents
US11/930,368 US7879980B2 (en) 1993-06-14 2007-10-31 Monoclonal antibodies to human CTLA-8 (IL-17A)

Applications Claiming Priority (8)

Application Number Priority Date Filing Date Title
US7720393A 1993-06-14 1993-06-14
US17774794A 1994-01-05 1994-01-05
US08/250,846 US6562333B1 (en) 1993-06-14 1994-05-27 Purified mammalian CTLA-8 antigens and related reagents
PCT/US1995/000001 WO1995018826A2 (en) 1994-01-05 1995-01-03 Purified primate ctla-8 antigens and related reagents
WOPCT/US95/00001 1995-01-03
US08/432,994 US6274711B1 (en) 1993-06-14 1995-05-02 Purified mammalian CTLA-8 antigens and related reagents
US09/929,612 US6706870B2 (en) 1993-06-14 2001-08-13 Nucleic acids encoding CTLA-8; and related reagents
US10/417,674 US20030166862A1 (en) 1993-06-14 2003-04-16 Purified mammalian CTLA-8 antigens and related reagents

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US09/929,612 Division US6706870B2 (en) 1993-06-14 2001-08-13 Nucleic acids encoding CTLA-8; and related reagents

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US11/097,622 Division US20050266445A1 (en) 1993-06-14 2005-03-31 Purified mammalian CTLA-8 antigens and related reagents

Publications (1)

Publication Number Publication Date
US20030166862A1 true US20030166862A1 (en) 2003-09-04

Family

ID=27373049

Family Applications (5)

Application Number Title Priority Date Filing Date
US08/432,994 Expired - Lifetime US6274711B1 (en) 1993-06-14 1995-05-02 Purified mammalian CTLA-8 antigens and related reagents
US09/929,612 Expired - Fee Related US6706870B2 (en) 1993-06-14 2001-08-13 Nucleic acids encoding CTLA-8; and related reagents
US10/417,674 Abandoned US20030166862A1 (en) 1993-06-14 2003-04-16 Purified mammalian CTLA-8 antigens and related reagents
US11/097,622 Abandoned US20050266445A1 (en) 1993-06-14 2005-03-31 Purified mammalian CTLA-8 antigens and related reagents
US11/930,368 Expired - Fee Related US7879980B2 (en) 1993-06-14 2007-10-31 Monoclonal antibodies to human CTLA-8 (IL-17A)

Family Applications Before (2)

Application Number Title Priority Date Filing Date
US08/432,994 Expired - Lifetime US6274711B1 (en) 1993-06-14 1995-05-02 Purified mammalian CTLA-8 antigens and related reagents
US09/929,612 Expired - Fee Related US6706870B2 (en) 1993-06-14 2001-08-13 Nucleic acids encoding CTLA-8; and related reagents

Family Applications After (2)

Application Number Title Priority Date Filing Date
US11/097,622 Abandoned US20050266445A1 (en) 1993-06-14 2005-03-31 Purified mammalian CTLA-8 antigens and related reagents
US11/930,368 Expired - Fee Related US7879980B2 (en) 1993-06-14 2007-10-31 Monoclonal antibodies to human CTLA-8 (IL-17A)

Country Status (1)

Country Link
US (5) US6274711B1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090175881A1 (en) * 2006-08-11 2009-07-09 Presta Leonard G Antibodies to il-17a
US11453717B2 (en) 2016-04-29 2022-09-27 Joint Stock Company “Biocad” Trispecific antibodies against IL-17A, IL-17F and other pro-inflammatory molecule

Families Citing this family (29)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6274711B1 (en) * 1993-06-14 2001-08-14 Inserm, Institut National De La Sante Et De La Recherche Medicale Purified mammalian CTLA-8 antigens and related reagents
MX9707021A (en) * 1995-03-23 1997-11-29 Immunex Corp Il-17 receptor.
US6902735B1 (en) * 1995-07-19 2005-06-07 Genetics Institute, Llc Antibodies to human IL-17F and other CTLA-8-related proteins
US20050147609A1 (en) * 1998-05-15 2005-07-07 Genentech, Inc. Use of anti-IL-17 antibody for the treatment of cartilage damaged by osteoarthritis
DE60035057T2 (en) * 1999-10-04 2008-01-31 Novartis Vaccines and Diagnostics, Inc., Emeryville CD40 antagonist for the treatment of psoriasis
US20070160576A1 (en) * 2001-06-05 2007-07-12 Genentech, Inc. IL-17A/F heterologous polypeptides and therapeutic uses thereof
WO2005010044A2 (en) 2003-07-08 2005-02-03 Genentech, Inc. Il-17 a/f heterologous polypeptides and therapeutic uses thereof
MXPA05002219A (en) * 2002-08-28 2005-07-05 Immunex Corp Compositions and methods for treating cardiovascular disease.
EP1576137A4 (en) * 2002-10-29 2010-06-30 Genentech Inc COMPOSITIONS AND METHODS FOR TREATING DISEASES RELATED TO THE IMMUNE SYSTEM
SI1983000T1 (en) * 2003-11-21 2015-12-31 Ucb Biopharma Sprl Method for the treatment of multiple sclerosis by inhibiting IL-17 activity
GB0417487D0 (en) * 2004-08-05 2004-09-08 Novartis Ag Organic compound
GB0425569D0 (en) * 2004-11-19 2004-12-22 Celltech R&D Ltd Biological products
CN101326195B9 (en) * 2005-12-13 2022-11-11 伊莱利利公司 anti-IL-17 antibodies
US7910703B2 (en) 2006-03-10 2011-03-22 Zymogenetics, Inc. Antagonists to IL-17A, IL-17F, and IL-23P19 and methods of use
WO2007106769A2 (en) 2006-03-10 2007-09-20 Zymogenetics, Inc. Antibodies that bind both il-17a and il-17f and methods of using the same
US7790163B2 (en) 2006-03-10 2010-09-07 Zymogenetics, Inc. Antibodies that bind both IL-17A and IL-17F and methods of using the same
CN101472611A (en) * 2006-06-19 2009-07-01 惠氏公司 Methods of modulating IL-22 and IL-17
TW200815469A (en) * 2006-06-23 2008-04-01 Astrazeneca Ab Compounds
US20100304461A1 (en) * 2007-06-12 2010-12-02 Brandis John W Portable, Temperature and Chemically Inducible Expression Vector for High Cell Density Expression of Heterologous Genes in Escherichia Coli
CA2721713C (en) * 2008-05-05 2019-07-09 Novimmune Sa Anti-il-17a/il-17f cross-reactive antibodies and methods of use thereof
KR101318549B1 (en) * 2008-09-29 2013-10-16 로슈 글리카트 아게 Antibodies against human il17 and uses thereof
EP2427203B1 (en) * 2009-05-05 2018-10-17 Novimmune S.A. Anti-il-17f antibodies and use thereof
ME02734B (en) 2011-01-14 2017-10-20 Ucb Biopharma Sprl ANTIBODY MODULES FOR BINDING TO IL-17A AND IL-17F
UA117218C2 (en) 2011-05-05 2018-07-10 Мерк Патент Гмбх POLYPEPTIDE AGAINST IL-17A, IL-17F AND / OR IL17-A / F
CA2868404A1 (en) 2012-04-05 2013-10-10 F. Hoffmann-La Roche Ag Bispecific antibodies against human tweak and human il17 and uses thereof
EP2864355B1 (en) * 2012-06-25 2016-10-12 Orega Biotech Il-17 antagonist antibodies
WO2014161570A1 (en) 2013-04-03 2014-10-09 Roche Glycart Ag Antibodies against human il17 and uses thereof
JP7186094B2 (en) 2016-05-06 2022-12-08 イグジキュア オペレーティング カンパニー Liposomal Spherical Nucleic Acid (SNA) Constructs Presenting Antisense Oligonucleotides (ASOs) for Specific Knockdown of Interleukin 17 Receptor mRNA
US11696954B2 (en) 2017-04-28 2023-07-11 Exicure Operating Company Synthesis of spherical nucleic acids using lipophilic moieties

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5869286A (en) * 1995-03-23 1999-02-09 Immunex Corporation Receptor that binds IL-17
US6043344A (en) * 1995-07-19 2000-03-28 Genetics Institute, Inc. Human CTLA-8 and uses of CTLA-8-related proteins

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5091513A (en) * 1987-05-21 1992-02-25 Creative Biomolecules, Inc. Biosynthetic antibody binding sites
HU217099B (en) 1991-03-29 1999-11-29 Elf Sanofi Sa. Process for producing a protein having cytokine-type activity, recombinant dna coding for this protein, transformed cells, and micro-organisms
US6274711B1 (en) * 1993-06-14 2001-08-14 Inserm, Institut National De La Sante Et De La Recherche Medicale Purified mammalian CTLA-8 antigens and related reagents
US6562333B1 (en) 1993-06-14 2003-05-13 Schering Corporation Purified mammalian CTLA-8 antigens and related reagents
AU727480B2 (en) 1995-07-19 2000-12-14 Genetics Institute, Llc Human CTLA-8 and uses of CTLA-8-related proteins
US5733730A (en) * 1995-08-25 1998-03-31 The Rockefeller University Telomere repeat binding factor and diagnostic and therapeutic use thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5869286A (en) * 1995-03-23 1999-02-09 Immunex Corporation Receptor that binds IL-17
US6043344A (en) * 1995-07-19 2000-03-28 Genetics Institute, Inc. Human CTLA-8 and uses of CTLA-8-related proteins

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090175881A1 (en) * 2006-08-11 2009-07-09 Presta Leonard G Antibodies to il-17a
US7846443B2 (en) 2006-08-11 2010-12-07 Schering Corporation Antibodies to IL-17A
US20110038878A1 (en) * 2006-08-11 2011-02-17 Schering Corporation Antibodies to il-17a
US20110052596A1 (en) * 2006-08-11 2011-03-03 Schering Corporation Antibodies to il-17a
US8193319B2 (en) 2006-08-11 2012-06-05 Schering Corporation Antibodies to IL-17A
US8753843B2 (en) 2006-08-11 2014-06-17 Merck Sharp & Dohme Corp. Antibodies to IL-17A
US11453717B2 (en) 2016-04-29 2022-09-27 Joint Stock Company “Biocad” Trispecific antibodies against IL-17A, IL-17F and other pro-inflammatory molecule

Also Published As

Publication number Publication date
US6274711B1 (en) 2001-08-14
US6706870B2 (en) 2004-03-16
US20090275735A1 (en) 2009-11-05
US20030040603A1 (en) 2003-02-27
US7879980B2 (en) 2011-02-01
US20050266445A1 (en) 2005-12-01

Similar Documents

Publication Publication Date Title
US7879980B2 (en) Monoclonal antibodies to human CTLA-8 (IL-17A)
EP0733069B1 (en) Purified primate ctla-8 antigens and related reagents
AU722499B2 (en) Human B-cell antigens, related reagents
US6512103B1 (en) Mammalian chemokine reagents
EP1895006B1 (en) Interleukin-17 related mammalian cytokines. Polynucleotides encoding them. Uses
EP0699236B1 (en) Purified mammalian flt3 ligands and agonists and antagonists thereof
US5811284A (en) Nucleic acids encoding kp43 protein and antigenic fragments thereof
US7534867B1 (en) Purified mammalian Flt3 ligands; agonists; antagonists
WO1997029192A1 (en) Mammalian dendritic cell chemokine reagents
US6245329B1 (en) Method of inducing calcium flux in cells using mammalian thymokine protein
US5965401A (en) Purified mammalian NK antigens and related reagents
JP4482235B2 (en) Antibodies against mammalian Langerhans cell antigens and their use
US20040203080A1 (en) 7 transmembrane receptor family member BLRx
US6124436A (en) Purified mammalian monocyte antigens and related reagents
US20090227021A1 (en) Purified mammalian ctla-8 antigens and related reagents
US6812004B1 (en) Mammalian dendritic cell chemokine reagents
WO1997020046A1 (en) Dnam, an nk antigen and adhesion molecule of the immunoglobulin superfamily
CA2163105A1 (en) Purified mammalian flt3 ligands and agonists and antagonists thereof
WO1997029125A1 (en) Mammalian dendritic cell chemokine reagents
HK1110096B (en) Interleukin-17 related mammalian cytokines. polynucleotides encoding them. uses

Legal Events

Date Code Title Description
STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION