Connect public, paid and private patent data with Google Patents Public Datasets

Nucleic acid typing by polymerase extension of oligonucleotides using terminator mixtures

Info

Publication number
US20030044778A1
US20030044778A1 US09258132 US25813299A US2003044778A1 US 20030044778 A1 US20030044778 A1 US 20030044778A1 US 09258132 US09258132 US 09258132 US 25813299 A US25813299 A US 25813299A US 2003044778 A1 US2003044778 A1 US 2003044778A1
Authority
US
Grant status
Application
Patent type
Prior art keywords
primer
nucleic
acid
nucleotide
template
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US09258132
Inventor
Philip Goelet
Michael R. Knapp
Stephen Anderson
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Orchid Cellmark Inc
Original Assignee
Orchid Cellmark Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869Methods for sequencing

Abstract

This invention concerns a reagent composition comprising at least two different terminators of a nucleic acid template-dependent, primer extension reaction. This invention also concerns a method for determining the identity of a nucleotide base at a specific position in a nucleic acid of interest. This invention further concerns a method for determining the presence or absence of a particular nucleotide sequence in a sample of nucleic acids. This invention further concerns a method for identifying different alleles in a sample containing nucleic acids. This invention further concerns a method for determining the genotype of an organism at one or more particular genetic loci.

Description

    BACKGROUND OF THE INVENTION
  • [0001]
    This invention relates to the field of nucleic acid sequence detection. The detection of nucleic acid sequences can be used in two general contexts. First, the detection of nucleic acid sequences can be used to determine the presence or absence of a particular genetic element. Second, the detection of nucleic acid sequences can be used to determine the specific type of a particular genetic element that is present. Variant genetic elements usually exist. Many techniques have been developed (1) to determine the presence of specific nucleic acid sequences, and (2) to compare homologous segments of nucleic acid sequence to determine if the segments are identical or if they differ at one or more nucleotides. Practical applications of these techniques include genetic disease diagnoses, infectious disease diagnoses, forensic techniques, paternity determinations, and genome mapping.
  • [0002]
    In general, the detection of nucleic acids in a sample and the subtypes thereof depends on the technique of specific nucleic acid hybridization in which the oligonucleotide probe is annealed under conditions of high stringency to nucleic acids in the sample, and the successfully annealed probes are subsequently detected (see Spiegelman, S., Scientific American, Vol. 210, p. 48 (1964)).
  • [0003]
    The most definitive method for comparing DNA segments is to determine the complete nucleotide sequence of each segment. Examples of how sequencing has been used to study mutations in human genes are included in the publications of Engelke, et al., Proc. Natl. Acad. Sci. U.S.A., 85:544-548 (1988) and Wong, et al., Nature, 330:384-386 (1987). At the present time, it is not practical to use extensive sequencing to compare more than just a few DNA segments because the effort required to determine, interpret, and compare sequence information is time-consuming.
  • [0004]
    A commonly used screen for DNA polymorphisms arising from DNA sequence variation consists of digesting DNA with restriction endonucleases and analyzing the resulting fragments by means of Southern blots, as described by Botstein, et al., Am. J. Hum. Genet., 32:314-331 (1980) and White, et al., Sci. Am., 258:40-48 (1988). Mutations that affect the recognition sequence of the endonuclease will preclude enzymatic cleavage at that site, thereby altering the cleavage pattern of that DNA. DNAs are compared by looking for differences in restriction fragment lengths. A major problem with this method (known as restriction fragment length polymorphism mapping or RFLP mapping) is its inability to detect mutations that do not affect cleavage with a restriction endonuclease. Thus, many mutations are missed with this method. One study, by Jeffreys, Cell, 18:1-18 (1979), was able to detect only 0.7% of the mutational variants estimated to be present in a 40,000 base pair region of human DNA. Another problem is that the methods used to detect restriction fragment length polymorphisms are very labor intensive, in particular, the techniques involved with Southern blot analysis.
  • [0005]
    A technique for detecting specific mutations in any segment of DNA is described in Wallace, et al., Nucl. Acids Res., 9:879-894 (1981). It involves hybridizing the DNA to be analyzed (target DNA) with a complementary, labeled oligonucleotide probe. Due to the thermal instability of DNA duplexes containing even a single base pair mismatch, differential melting temperature can be used to distinguish target DNAs that are perfectly complementary to the probe from target DNAs that differ by as little as a single nucleotide. In a related technique, described in Landegren, et al., Science, 41:1077-1080 (1988), oligonucleotide probes are constructed in pairs such that their junction corresponds to the site on the DNA being analyzed for mutation. These oligonucleotides are then hybridized to the DNA being analyzed. Base pair mismatch between either oligonucleotide and the target DNA at the junction location prevents the efficient joining of the two oligonucleotide probes by DNA ligase.
  • [0006]
    A. Nucleic Acid Hybridization
  • [0007]
    The base pairing of nucleic acids in a hybridization reaction forms the basis of most nucleic acid analytical and diagnostic techniques. In practice, tests based only on parameters of nucleic acid hybridization function poorly in cases where the sequence complexity of the test sample is high. This is partly due to the small thermodynamic differences in hybrid stability, generated by single nucleotide changes, and the fact that increasing specificity by lengthening the probe has the effect of further diminishing this differential stability. Nucleic acid hybridization is, therefore, generally combined with some other selection or enrichment procedure for analytical and diagnostic purposes.
  • [0008]
    Combining hybridization with size fractionation of hybridized molecules as a selection technique has been one general diagnostic approach. Size selection can be carried out prior to hybridization. The best known prior size selection technique is Southern Blotting (see Southern, E., Methods in Enzymology, 69:152 (1980). In this technique, a DNA sample is subjected to digestion with restriction enzymes which introduce double stranded breaks in the phosphodiester backbone at or near the site of a short sequence of nucleotides which is characteristic for each enzyme. The resulting heterogeneous mixture of DNA fragments is then separated by gel electrophoresis, denatured, and transferred to a solid phase where it is subjected to hybridization analysis in situ using a labeled nucleic acid probe. Fragments which contain sequences complementary to the labeled probe are revealed visually or densitometrically as bands of hybridized label. A variation of this method is Northern Blotting for RNA molecules. Size selection has also been used after hybridization in a number of techniques, in particular by hybrid protection techniques, by subjecting probe/nucleic acid hybrids to enzymatic digestion before size analysis.
  • [0009]
    B. Polymerase Extension of Duplex Primer:Template Complexes
  • [0010]
    Hybrids between primers and DNA targets can be analyzed by polymerase extension of the hybrids. A modification of this methodology is the polymerase chain reaction in which the purification is produced by sequential hybridization reactions of anti-parallel primers, followed by enzymatic amplification with DNA polymerase (see Saiki, et al., Science 239:487-491 (1988)). By selecting for two hybridization reactions, this methodology provides the specificity lacking in techniques that depend only upon a single hybridization reaction.
  • [0011]
    It has long been known that primer-dependent DNA polymerases have, in general, a low error rate for the addition of nucleotides complementary to a template. This feature is essential in biology for the prevention of genetic mistakes which would have detrimental effects on progeny. The specificity inherent in this enzymological reaction has been widely exploited as the basis of the “Sanger” or dideoxy chain termination sequencing methodology which is the ultimate nucleic acid typing experiment. One type of Sanger DNA sequencing method makes use of mixtures of the four deoxynucleoside triphosphates, which are normal DNA precursors, and one of the four possible dideoxynucleoside triphosphates, which have a hydrogen atom instead of a hydroxyl group attached to the 3′ carbon atom of the ribose sugar component of the nucleotide. DNA chain elongation in the 5′ to 3′ direction (“downstream”) requires this hydroxyl group. As such, when a dideoxynucleotide is incorporated into the growing DNA chain, no further elongation can occur. With one dideoxynucleotide in the mixture, DNA polymerases can, from a primer:template combination, produce a population of molecules of varying length, all of which terminate after the addition of one out of the four possible nucleotides. The series of four independent reactions, each with a different dideoxynucleotide, generates a nested set of fragments, all starting at the same 5′ terminus of the priming DNA molecule and terminating at all possible 3′ nucleotide positions.
  • [0012]
    Another utilization of dideoxynucleoside triphosphates and a polymerase in the analysis of DNA involves labeling the 3′ end of a molecule. One prominent manifestation of this technique provides the means for sequencing a DNA molecule from its 3′ end using the Maxam-Gilbert method. In this technique, a molecule with a protruding 3′ end is treated with terminal transferase in the presence of radioactive dideoxy-ATP. One radioactive nucleotide is added, rendering the molecule suitable for sequencing. Both methods of DNA sequencing using labeled dideoxynucleotides require electrophoretic separation of reaction products in order to derive the typing information. Most methods require four separate gel tracks for each typing determination.
  • [0013]
    The following two patents describe other methods of typing nucleic acids which employ primer extension and labeled nucleotides. Mundy (U.S. Pat No. 4,656,127) describes a method whereby a primer is constructed complementary to a region of a target nucleic acid of interest such that its 3′ end is close to a nucleotide in which variation can occur. This hybrid is subject to primer extension in the presence of a DNA polymerase and four deoxynucleoside triphosphates, one of which is an α-thionucleotide. The hybrid is then digested using an exonuclease enzyme which cannot use thio-derivatized DNA as a substrate for its nucleolytic action (for example Exonuclease III of E. coli). If the variant nucleotide in the template is complementary to one of the thionucleotides in the reaction mixture, the resulting extended primer molecule will be of a characteristic size and resistant to the exonuclease; hybrids without thio-derivatized DNA will be digested. After an appropriate enzyme digest to remove underivatized molecules, the thio-derivatized molecule can be detected by gel electrophoresis or other separation technology.
  • [0014]
    Vary and Diamond (U.S. Pat No. 4,851,331) describes a method similar to that of Mundy wherein the last nucleotide of the primer corresponds to the variant nucleotide of interest. Since mismatching of the primer and the template at the 3′ terminal nucleotide of the primer is counterproductive to elongation, significant differences in the amount of incorporation of a tracer nucleotide will result under normal primer extension conditions This method depends on the use of a DNA polymerase, e.g., AMV reverse transcriptase, that does not have an associated 3′ to 5′ exonuclease activity.
  • [0015]
    The methods of Mundy and of Vary and Diamond have drawbacks. The method of Mundy is useful but cumbersome due to the requirements of the second, different enzymological system where the non-derivatized hybrids are digested. The method of Vary is complicated by the fact that it does not generate discrete reaction products. Any “false” priming will generate significant noise in such a system which would be difficult to distinguish from a genuine signal.
  • [0016]
    The present invention circumvents the problems associated with the methods of Mundy and of Vary and Diamond for typing nucleic acid with respect to particular nucleotides. With methods employing primer extension and a DNA polymerase, the current invention will generate a discrete molecular species one base longer than the primer itself. In many methods, particularly those employing the polymerase chain reaction, the type of reaction used to purify the nucleic acid of interest in the first step can also be used in the subsequent detection step. Finally, with terminators which are labeled with different detector moieties (for example different fluorophors having different spectral properties), it will be possible to use only one reagent for all sequence detection experiments. Furthermore, if techniques are used to separate the terminated primers post-reaction, sequence detection experiments at more than one locus can be carried out in the same tube.
  • [0017]
    A recent article by Mullis (Scientific American, April 1990, pp. 56-65) suggests an experiment, which apparently was not performed, to determine the identity of a targeted base pair in a piece of double-stranded DNA. Mullis suggests using four types of dideoxynucleosides triphosphate, with one type of dideoxynucleoside triphosphate being radioactively labeled.
  • [0018]
    The present invention permits analyses of nucleic acid sequences that can be useful in the diagnosis of infectious diseases, the diagnosis of genetic disorders, and in the identification of individuals and their parentage.
  • [0019]
    A number of methods have been developed for these purposes. Although powerful, such methodologies have been cumbersome and expensive, generally involving a combination of techniques such as gel electrophoresis, blotting, hybridization, and autoradiography or non-isotopic revelation. Simpler technologies are needed to allow the more widespread use of nucleic acid analysis. In addition, tests based on nucleic acids are currently among the most expensive of laboratory procedures and for this reason cannot be used on a routine basis. Finally, current techniques are not adapted to automated procedures which would be necessary to allow the analysis of large numbers of samples and would further reduce the cost.
  • [0020]
    The current invention provides a method that can be used to diagnose or characterize nucleic acids in biological samples without recourse to gel electrophoretic size separation of the nucleic acid species. This feature renders this process easily adaptable to automation and thus will permit the analysis of large numbers of samples at relatively low cost. Because nucleic acids are the essential blueprint of life, each organism or individual can be uniquely characterized by identifiable sequences of nucleic acids. It is, therefore, possible to identify the presence of particular organisms or demonstrate the biological origin of certain samples by detecting these specific nucleic acid sequences.
  • SUMMARY OF THE INVENTION
  • [0021]
    The subject invention provides a reagent composition comprising an aqueous carrier and an admixture of at least two different terminators of a nucleic acid template-dependent, primer extension reaction. Each of the terminators is capable of specifically terminating the extension reaction in a manner strictly dependent on the identity of the unpaired nucleotide base in the template immediately adjacent to, and downstream of, the 3′ end of the primer. In addition, at least one of the terminators is labeled with a detectable marker.
  • [0022]
    The subject invention further provides a reagent composition comprising an aqueous carrier and an admixture of four different terminators of a nucleic acid template-dependent, primer extension reaction. Each of the terminators is capable of specifically terminating the extension reaction as above and one, two, three, or four of the terminators is labeled with a detectable marker.
  • [0023]
    The subject invention further provides a reagent as described above wherein the terminators comprise nucleotides, nucleotide analogs, dideoxynucleotides, or arabinoside triphosphates. The subject invention also provides a reagent wherein the terminators comprise one or more of dideoxyadenosine triphosphate (ddATP), dideoxycytosine triphosphate (ddCTP), dideoxyguanosine triphosphate (ddGTP), dideoxythymidine triphosphate (ddTTP), or dideoxyuridine triphosphate (ddUTP).
  • [0024]
    The subject invention also provides a method for determining the identity of a nucleotide base at a specific position in a nucleic acid of interest. First, a sample containing the nucleic acid of interest is treated, if such nucleic acid is double-stranded, so as to obtain unpaired nucleotide bases spanning the specific position. If the nucleic acid of interest is single-stranded, this step is not necessary. Second, the sample containing the nucleic acid of interest is contacted with an oligonucleotide primer under hybridizing conditions. The oligonucleotide primer is capable of hybridizing with a stretch of nucleotide bases present in the nucleic acid of interest, immediately adjacent to the nucleotide base to be identified, so as to form a duplex between the primer and the nucleic acid of interest such that the nucleotide base to be identified is the first unpaired base in the template immediately downstream of the 3′ end of the primer in the duplex of primer and the nucleic acid of interest. Enzymatic extension of the oligonucleotide primer in the resultant duplex by one nucleotide, catalyzed, for example, by a DNA polymerase, thus depends on correct base pairing of the added nucleotide to the nucleotide base to be identified.
  • [0025]
    The duplex of primer and the nucleic acid of interest is then contacted with a reagent containing four labeled terminators, each terminator being labeled with a different detectable marker. The duplex of primer and the nucleic acid of interest is contacted with the reagent under conditions permitting base pairing of a complementary terminator present in the reagent with the nucleotide base to be identified and the occurrence of a template-dependent, primer extension reaction so as to incorporate the terminator at the 3′ end of the primer. The net result is that the oligonucleotide primer has been extended by one terminator. Next, the identity of the detectable marker present at the 3′ end of the extended primer is determined. The identity of the detectable marker indicates which terminator has base paired to the next base in the nucleic acid of interest. Since the terminator is complementary to the next base in the nucleic acid of interest, the identity of the next base in the nucleic acid of interest is thereby determined.
  • [0026]
    The subject invention also provides another method for determining the identity of a nucleotide base at a specific position in a nucleic acid of interest. This additional method uses a reagent containing four terminators, only one of the terminators having a detectable marker.
  • [0027]
    The subject invention also provides a method of typing a sample of nucleic acids which comprises identifying the base or bases present at each of one or more specific positions, each such nucleotide base being identified using one of the methods for determining the identity of a nucleotide base at a specific position in a nucleic acid of interest as outlined above. Each specific position in the nucleic acid of interest is determined using a different primer. The identity of each nucleotide base or bases at each position can be determined individually or the identities of the nucleotide bases at different positions can be determined simultaneously.
  • [0028]
    The subject invention further provides a method for identifying different alleles in a sample containing nucleic acids which comprises identifying the base or bases present at each of one or more specific positions. The identity of each nucleotide base is determined by the method for determining the identity of a nucleotide base at a specific position in a nucleic acid of interest as outlined above.
  • [0029]
    The subject invention also provides a method for determining the genotype of an organism at one or more particular genetic loci which comprises obtaining from the organism a sample containing genomic DNA and identifying the nucleotide base or bases present at each of one or more specific positions in nucleic acids of interest. The identity of each such base is determined by using one of the methods for determining the identity of a nucleotide base at a specific position in a nucleic acid of interest as outlined above. The identities of the nucleotide bases determine the different alleles and, thereby, determine the genotype of the organism at one or more particular genetic loci.
  • BRIEF DESCRIPTION OF THE FIGURES
  • [0030]
    [0030]FIG. 1. Autoradiography of labeled DNA products after fractionation on a polyacrylamide/urea gel. Panel A shows products of the “A” extension reaction on oligonucleotide primer 182 directed by template oligonucleotides 180 or 181. Panel B shows products of the “B” termination reaction on oligonucleotide primer 182 annealed to template oligonucleotides 180 or 181. Panel C shows the same products as in panel B after purification on magnetic beads. Note: oligodeoxynucleotide 182 was used as supplied by Midland Certified Reagents with no further purification. The minor bands above and below the main band are presumably contaminants due to incomplete reactions or side reactions that occurred during the step-wise synthesis of the oligonucleotide. For a definition of the “A” extension reaction and the “B” termination reaction, see “A. GENERAL METHODS” in the Detailed Description of the Invention.
  • [0031]
    [0031]FIG. 2. Detection of Sequence Polymorphisms in PCR Products. Target polymorphic DNA sequence showing amplification primers, detection primers, and molecular clone (plasmid) designations. For each primer, sites of binding to one or the other strand of the target DNA sequence are indicated by underlining, and the direction of DNA synthesis is indicated by an arrow. Numbering for the target sequence is shown in the righthand margin. Polymorphic sites at positions 114 and 190 are indicated by bold lettering and a slash between the two polymorphic possibilities.
  • [0032]
    [0032]FIG. 3. Autoradiogram of gel-analyzed polymorphism test on PCR products. Templates from PCR products of p183, p624, or p814 were analyzed with the detection primers, TGL182 and TGL166, in a template-directed chain extension experiment, as described in the specification. Reaction products were fractionated by size on a polyacrylamide/urea DNA sequencing gel, and incorporation of [35S]-α-thio-dideoxy adenosine monophosphate was assayed by autoradiography.
  • [0033]
    [0033]FIG. 4. Gel electrophoretic analysis of the labelled extension products of primers TGL346 and TGL391. Productive primer-template complexes of TGL346 or TGL391 with the bead-bound oligonucleotide template, TGL382, were subjected to primer extension labelling reactions with the four different [α-thio-35S]dideoxynucleoside triphosphate mixes. Labelled primer DNA was released from the washed beads and electrophoresed on an 8% polyacrylamide/8 M urea DNA sequencing gel (2.5 pmoles of primer/lane), then analyzed by autoradiography. The four lanes shown for the primer TGL346 indicate that labelling occurred predominantly with the ddC mix, indicating that the next unpaired base in the TGL382 template adjacent to the 3′ end of TGL346 was a G (see sequence given in Example 4). The four lanes shown for the primer TGL391 indicate that the labelling occurred predominantly with the ddT mix, indicating that the next unpaired base in the TGL382 template adjacent to the 3′ end of TGL391 was an A.
  • [0034]
    [0034]FIG. 5. Autoradiographic analyses of total radioactivity bound to beads. The bead suspensions, containing the products of the extension reactions described in FIG. 5, were spotted onto filter paper (1 pmole of primer per spot) and exposed to X-ray film to assay total bead-bound radioactivity. As shown, TGL346 predominantly incorporated label from the ddC mix and TGL391 predominantly from the ddT mix.
  • [0035]
    [0035]FIG. 6. PCR-amplified polymorphic locus of mammalian DNA. Shown is a 327 basepair segment of mammalian DNA that was amplified from samples of genomic DNA using the PCR primers TGL240 (biotinylated) and TGL239 (unbiotinylated). Samples of DNA from two homozygous individuals, ESB164 (genotype AA) and EA2014 (genotype BB), were subjected to the analyses described in Example 5. The complete DNA sequence of the A allele at this locus is shown, with the polymorphic sites where the B allele sequence differs from the A allele sequence indicated by the bases underneath the A sequence. The detection primer, TGL308, is shown base-paired with the template strand extending from the biotinylated primer. For the A allele, the first unpaired template base immediately downstream of the 3′ end of TGL308 is a C, and for the B allele this base is an A. Thus, the A allele should result in labelling of TGL308 by the ddG mix only, and the B allele should result in labelling by the ddT mix only.
  • [0036]
    [0036]FIG. 7. Gel electrophoretic analysis of PCR products from two different homozygous individuals. Primers TGL240 and TGL239 were used to amplify genomic DNA (obtained from blood) from two individuals, ESB164 and EA2014. The products of the extension reactions for primer TGL308, annealled to the bead-bound, PCR-generated template as outlined in FIG. 7, were analyzed by electrophoresis on an 8% polyacrylamide/8 M urea DNA sequencing gel as outlined in FIG. 5. Shown for individual ESB164 (genotype AA: labelling expected from the ddG mix) are 250 fmoles of extended primer from the four different ddNTP labelling reactions. Shown for individual EA2014 (genotype BB: labelling expected from the ddT mix) are loadings of 25, 75, and 250 fmoles of extended primer from the four different ddNTP labelling reactions.
  • [0037]
    [0037]FIG. 8. Autoradiographic analyses of total and NaOH-eluted radioactivity from TGL308 primer extension reactions. Primer TGL308 was used to analyze the genotypes of individuals ESB164 and EA2014 as outlined in Example 5 and FIGS. 7 and 8. Total bead-associated radioactivity was determined by directly spotting a suspension of beads containing 75 fmoles of primer onto filter paper followed by autoradiographic detection of the label in the spot. Radioactivity specifically associated with the TGL308 primer was determined by magnetically immobilizing the beads, eluting the primer with NaOH as described in Examples 4 and 5, and spotting on filter paper an amount corresponding to 75 fmoles. Label in these spots was also detected by autoradiography.
  • DETAILED DESCRIPTION OF THE INVENTION
  • [0038]
    The subject invention provides a reagent composition comprising an aqueous carrier and an admixture of at least two different terminators of a nucleic acid template-dependent, primer extension reaction. Each of the terminators is capable of specifically terminating the extension reaction in a manner strictly dependent on the identity of the unpaired nucleotide base in the template immediately adjacent to, and downstream of, the 3′ end of the primer. In addition, at least one of the terminators is labeled with a detectable marker.
  • [0039]
    The subject invention further provides a reagent composition comprising an aqueous carrier and an admixture of four different terminators of a nucleic acid template-dependent, primer extension reaction. Each of the terminators is capable of specifically terminating the extension reaction as above and at least one of the terminators is labeled with a detectable marker.
  • [0040]
    The subject invention further provides a reagent composition comprising an aqueous carrier and an admixture of four different terminators of a nucleic acid template-dependent, primer extension reaction. Each of the terminators is capable of specifically terminating the extension reaction as above and two, three, or four of the terminators are labeled with a different detectable marker.
  • [0041]
    The subject invention further provides a reagent as described above wherein the terminators comprise nucleotides, nucleotide analogs, dideoxynucleotides, or arabinoside triphosphates. The subject invention also provides a reagent wherein the terminators comprise one or more of dideoxyadenosine triphosphate (ddATP), dideoxycytosine triphosphate (ddCTP), dideoxyguanosine triphosphate (ddGTP), dideoxythymidine triphosphate (ddTTP), or dideoxyuridine triphosphate (ddUTP).
  • [0042]
    The subject invention further provides a reagent as described above wherein each of the detectable markers attached to the terminators is an isotopically labeled moiety, a chromophore, a fluorophore, a protein moiety, or a moiety to which an isotopically labeled moiety, a chromophore, a fluorophore, or a protein moiety can be attached. The subject invention also provides a reagent wherein each of the different detectable markers is a different fluorophore.
  • [0043]
    The subject invention also provides a reagent as described above wherein the reagent further comprises pyrophosphatase.
  • [0044]
    The invented reagent consists of two or more chain terminators with one or more of the chain terminators being identifiably tagged. This reagent can be used in a DNA polymerase primer extension reaction to type nucleic acid sequences of interest that are complementary to one or more oligonucleotide primers by chemically or physically separating the polymerase extended primers from the chain terminator reagent and analyzing the terminal additions. Any kind of terminator that inhibits further elongation can be used, for example, a dideoxynucleoside triphosphate. Several approaches can be used for the labeling and detection of terminators: (1) radioactivity and its detection by either autoradiography or scintillation counting, (2) fluorescence or absorption spectroscopy, (3) mass spectrometry, or (4) enzyme activity, using a protein moiety. The identity of each terminator can be determined individually, i.e., one at a time. In addition, methods which permit independent analyses of each of the terminators permit analysis of incorporation of up to four terminators simultaneously.
  • [0045]
    The subject invention also provides a method for determining the identity of a nucleotide base at a specific position in a nucleic acid of interest. First, a sample containing the nucleic acid of interest is treated, if such nucleic acid is double-stranded, so as to obtain unpaired nucleotide bases spanning the specific position. If the nucleic acid of interest is single-stranded, this step is not necessary. Second, the sample containing the nucleic acid of interest is contacted with an oligonucleotide primer under hybridizing conditions. The oligonucleotide primer is capable of hybridizing with a stretch of nucleotide bases present in the nucleic acid of interest, immediately adjacent to the nucleotide base to be identified, so as to form a duplex between the primer and the nucleic acid of interest such that the nucleotide base to be identified is the first unpaired base in the template immediately downstream of the 3′ end of the primer in the duplex of primer and the nucleic acid of interest. Enzymatic extension of the oligonucleotide primer in the resultant duplex by one nucleotide, catalyzed, for example, by a DNA polymerase, thus depends on correct base pairing of the added nucleotide to the nucleotide base to be identified.
  • [0046]
    The duplex of primer and the nucleic acid of interest is then contacted with a reagent containing four labeled terminators, each terminator being labeled with a different detectable marker. The duplex of primer and the nucleic acid of interest is contacted with the reagent under conditions permitting base pairing of a complementary terminator present in the reagent with the nucleotide base to be identified and the occurrence of a template-dependent, primer extension reaction so as to incorporate the terminator at the 3′ end of the primer.
  • [0047]
    The net result is that the oligonucleotide primer has been extended by one terminator. Next, the identity of the detectable marker present at the 3′ end of the extended primer is determined. The identity of the detectable marker indicates which terminator has base paired to the next base in the nucleic acid of interest. Since the terminator is complementary to the next base in the nucleic acid of interest, the identity of the next base in the nucleic acid of interest is thereby determined.
  • [0048]
    The subject invention also provides another method for determining the identity of a nucleotide base at a specific position in a nucleic acid of interest. First, a sample containing the nucleic acid of interest is treated, if such nucleic acid is double-stranded, so as to obtain unpaired nucleotide bases spanning the specific position. If the nucleic acid of interest is single-stranded, this step is not necessary. Second, the sample containing the nucleic acid of interest is contacted with an oligonucleotide primer under hybridizing conditions. The oligonucleotide primer is capable of hybridizing with nucleotide bases in the nucleic acid of interest, immediately adjacent to the nucleotide base to be identified, so as to form a duplex between the primer and the nucleic acid of interest such that the nucleotide base to be identified is the first unpaired base in the template immediately downstream of the 3′ end of the primer in the duplex of primer and the nucleic acid of interest.
  • [0049]
    The duplex of primer and the nucleic acid of interest is then contacted with a reagent containing four terminators, only one of the terminators having a detectable marker. The duplex of primer and the nucleic acid of interest is contacted with the reagent under conditions permitting base pairing of a complementary terminator present in the reagent with the nucleotide base to be identified and the occurrence of a template-dependent, primer extension reaction so as to incorporate the terminator at the 3′ end of the primer. The net result is that the oligonucleotide primer has been extended by one terminator.
  • [0050]
    The original duplex of primer and the nucleic acid of interest is then contacted with three different reagents, with a different one of each of the four terminators being labeled in each of the four parallel reaction steps. Next, the products of the four parallel template-dependent, primer extension reactions are examined to determine which of the products has a detectable marker. The product with a detectable marker indicates which terminator has base paired to the next base in the nucleic acid of interest. Since the terminator is complementary to the next base in the nucleic acid of interest, the identity of the next base in the nucleic acid of interest is thereby determined.
  • [0051]
    Both of the methods for determining the identity of a nucleotide base at a specific position in a nucleic acid of interest label the primer after hybridization between the primer and the template. If the template-dependent enzyme has no exonuclease function, the 3′ end of the primer must be base paired for the labeling by a terminator to occur.
  • [0052]
    The subject invention also provides a method for determining the presence or absence of a particular nucleotide sequence in a sample of nucleic acids. First, the sample of nucleic acids is treated, if such sample of nucleic acids contains double-stranded nucleic acids, so as to obtain single-stranded nucleic acids. If the nucleic acids in the sample are single-stranded, this step is not necessary. Second, the sample of nucleic acids is contacted with an oligonucleotide primer under hybridizing conditions. The oligonucleotide primer is capable of hybridizing with the particular nucleotide sequence, if the particular nucleotide sequence is present, so as to form a duplex between the primer and the particular nucleotide sequence.
  • [0053]
    The duplex of primer and the particular nucleotide sequence, if any, is then contacted with a reagent containing four labeled terminators, each terminator being labeled with a different detectable marker. The duplex of primer and the particular nucleotide sequence, if any, is contacted with the reagent under conditions permitting base pairing of a complementary terminator present in the reagent with the unpaired template nucleotide base downstream of the 3′ end of the primer, the primer being hybridized with the particular nucleotide sequence in the template, and the occurrence of a template-dependent, primer extension reaction so as to incorporate the terminator at the 3′ end of the primer. Next, the absence or presence and identity of a detectable marker at the 3′ end of the primer are determined. The presence or absence of the detectable marker indicates whether the primer has hybridized to the template. If a detectable marker is absent, the primer did not hybridize to the template, and, therefore, the particular nucleotide sequence is not present in the sample of nucleic acids. If a detectable marker is present, the primer did hybridize to the template, and, therefore, the particular nucleotide sequence is present in the sample of nucleic acids.
  • [0054]
    The subject invention also provides another method for determining the presence or absence of a particular nucleotide sequence in a sample of nucleic acids. First, the sample of nucleic acids is treated, if such sample of nucleic acids contains double-stranded nucleic acids, so as to obtain single-stranded nucleic acids. Second, the sample of nucleic acids is contacted with an oligonucleotide primer under hybridizing conditions. The oligonucleotide primer is capable of hybridizing with the particular nucleotide sequence, if the particular nucleotide sequence is present, so as to form a duplex between the primer and the particular nucleotide sequence.
  • [0055]
    The duplex of primer and the particular nucleotide sequence, if any, is then contacted with a reagent containing four terminators, only one of the terminators having a detectable marker. The duplex of primer and the particular nucleotide sequence, if any, is contacted with the reagent under conditions permitting base pairing of a complementary terminator present in the reagent with the unpaired template nucleotide base downstream of the 3′ end of the primer, the primer being hybridized with the particular nucleotide sequence in the template, and the occurrence of a template-dependent, primer extension reaction. The net result is the incorporation of the terminator at the 3′ end of the primer.
  • [0056]
    The original duplex of primer and the particular nucleotide sequence, if any, is then contacted with three different reagents, with a different one of each of the four terminators being labeled in each of the four parallel reaction steps. Next, the products of the four parallel, template-dependent, primer extension reactions are examined to determine which, if any, of the products have detectable markers. The absence or presence and identity of the detectable marker indicates whether the primer has hybridized to the template. If no detectable marker is present in any of the products, the primer did not hybridize to the template, and, therefore, the particular nucleotide sequence was not present in the sample of nucleic acids. If a detectable marker is present in any of the products, the primer did hybridize to the template, and, therefore, the particular nucleotide sequence was present in the sample of nucleic acids.
  • [0057]
    Different versions of the method for determining the identity of a nucleotide base at a specific position in a nucleic acid of interest and the method for determining the presence or absence of a particular nucleotide sequence in a sample of nucleic acids are possible. In the first version, the template is a deoxyribonucleic acid, the primer is an oligodeoxyribonucleotide, oligoribonucleotide, or a copolymer of deoxyribonucleotides and ribonucleotides, and the template-dependent enzyme is a DNA polymerase. This version gives a DNA product. In a second version, the template is a ribonucleic acid, the primer is an oligodeoxyribonucleotide, oligoribonucleotide, or a copolymer of deoxyribonucleotides and ribonucleotides, and the template-dependent enzyme is a reverse transcriptase. This version gives a DNA product. In a third version, the template is a deoxyribonucleic acid, the primer is an oligoribonucleotide, and the enzyme is an RNA polymerase. This version gives an RNA product. In a fourth version, the template is a ribonucleic acid, the primer is an oligoribonucleotide, and the template-dependent enzyme is an RNA replicase. This version gives an RNA product.
  • [0058]
    Preferably, before the primer extension reaction is performed, the template is capped by the addition of a terminator to the 3′ end of the template. The terminator is capable of terminating a template-dependent, primer extension reaction. The template is capped so that no additional labeled terminator will attach at the 3′ end of the template. The extension reaction should occur on the primer, not on the template. A dideoxynucleotide can be used as a terminator for capping the template.
  • [0059]
    Another modification of the method for determining the identity of a nucleotide base at a specific position in a nucleic acid of interest is to separate the primer from the nucleic acid of interest after the extension reaction by using appropriate denaturing conditions. The denaturing conditions can comprise heat, alkali, formamide, urea, glyoxal, enzymes, and combinations thereof. The denaturing conditions can also comprise treatment with 2.0 N NaOH.
  • [0060]
    The nucleic acid of interest can comprise non-natural nucleotide analogs such as deoxyinosine or 7-deaza-2′-deoxyguanosine. These analogues destabilize DNA duplexes and could allow a primer annealing and extension reaction to occur in a double-stranded sample without completely separating the strands.
  • [0061]
    The sample of nucleic acids can be from any source. The sample of nucleic acids can be natural or synthetic (i.e., synthesized enzymatically in vitro). The sample of nucleic acids can comprise deoxyribonucleic acids, ribonucleic acids, or copolymers of deoxyribonucleic acid and ribonucleic acid. The nucleic acid of interest can be a deoxyribonucleic acid, a ribonucleic acid, or a copolymer of deoxyribonucleic acid and ribonucleic acid. The nucleic acid of interest can be synthesized enzymatically in vivo, synthesized enzymatically in vitro, or synthesized non-enzymatically. The sample containing the nucleic acid or acids of interest can comprise genomic DNA from an organism, RNA transcripts thereof, or cDNA prepared from RNA transcripts thereof. The sample containing the nucleic acid or acids of interest can also comprise extragenomic DNA from an organism, RNA transcripts thereof, or cDNA prepared from RNA transcripts thereof. Also, the nucleic acid or acids of interest can be synthesized by the polymerase chain reaction.
  • [0062]
    The sample can be taken from any organism. Some examples of organisms to which the method of the subject invention is applicable include plants, microorganisms, viruses, birds, vertebrates, invertebrates, mammals, human beings, horses, dogs, cows, cats, pigs, or sheep.
  • [0063]
    The nucleic acid of interest can comprise one or more moieties that permit affinity separation of the nucleic acid of interest from the unincorporated reagent and/or the primer. The nucleic acid of interest can comprise biotin which permits affinity separation of the nucleic acid of interest from the unincorporated reagent and/or the primer via binding of the biotin to streptavidin which is attached to a solid support. The sequence of the nucleic acid of interest can comprise a DNA sequence that permits affinity separation of the nucleic acid of interest from the unincorporated reagent and/or the primer via base pairing to a complementary sequence present in a nucleic acid attached to a solid support. The nucleic acid of interest can be labeled with a detectable marker; this detectable marker can be different from any detectable marker present in the reagent or attached to the primer.
  • [0064]
    The oligonucleotide primer can be an oligodeoxyribonucleotide, an oligoribonucleotide, or a copolymer of deoxyribonucleotides and ribonucleotides. The oligonucleotide primer can be either natural or synthetic. The oligonucleotide primer can be synthesized either enzymatically in vivo, enzymatically in vitro, or non-enzymatically in vitro. The oligonucleotide primer can be labeled with a detectable marker; this detectable marker can be different from any detectable marker present in the reagent or attached to the nucleic acid of interest. In addition, the oligonucleotide primer must be capable of hybridizing or annealing with nucleotides present in the nucleic acid of interest, immediately adjacent to, and upstream of, the nucleotide base to be identified. One way to accomplish the desired hybridization is to have the template-dependent primer be substantially complementary or fully complementary to the known base sequence immediately adjacent to the base to be identified.
  • [0065]
    The oligonucleotide primer can comprise one or more moieties that permit affinity separation of the primer from the unincorporated reagent and/or the nucleic acid of interest. The oligonucleotide primer can comprise biotin which permits affinity separation of the primer from the unincorporated reagent and/or nucleic acid of interest via binding of the biotin to streptavidin which is attached to a solid support. The sequence of the oligonucleotide primer can comprise a DNA sequence that permits affinity separation of the primer from the unincorporated reagent and/or the nucleic acid of interest via base pairing to a complementary sequence present in a nucleic acid attached to a solid support.
  • [0066]
    The subject invention also provides a method of typing a sample of nucleic acids which comprises identifying the base or bases present at each of one or more specific positions, each such nucleotide base being identified using one of the methods for determining the identity of a nucleotide base at a specific position in a nucleic acid of interest as outlined above. Each specific position in the nucleic acid of interest is determined using a different primer. The identity of each nucleotide base or bases at each position can be determined individually or the identities of the nucleotide bases at different positions can be determined simultaneously.
  • [0067]
    The subject invention also provides another method of typing a sample of nucleic acids which comprises determining the presence or absence of one or more particular nucleotide sequences, the presence or absence of each such nucleotide sequence being determined using one of the methods for determining the presence or absence of a particular nucleotide sequence in a sample of nucleic acids as outlined above.
  • [0068]
    The subject invention also provides an additional method of typing a sample containing nucleic acids. First, the presence or absence of one or more particular nucleotide sequences is determined; the presence or absence of each such nucleotide sequence is determined using one of the methods for determining the presence or absence of a particular nucleotide sequence in a sample of nucleic acids as outlined above. Second, the nucleotide base or bases present at each of one or more specific positions is identified; each such base is identified using one of the methods for determining the identity of a nucleotide base at a specific position in a nucleic acid of interest as outlined above.
  • [0069]
    The subject invention further provides a method for identifying different alleles in a sample containing nucleic acids which comprises identifying the base or bases present at each of one or more specific positions. The identity of each nucleotide base is determined by the method for determining the identity of a nucleotide base at a specific position in a nucleic acid of interest as outlined above.
  • [0070]
    The subject invention also provides a method for determining the genotype of an organism at one or more particular genetic loci which comprises obtaining from the organism a sample containing genomic DNA and identifying the nucleotide base or bases present at each of one or more specific positions in nucleic acids of interest. The identity of each such base is determined by using one of the methods for determining the identity of a nucleotide base at a specific position in a nucleic acid of interest as outlined above. The identity of the nucleotide bases determine the different alleles and, thereby, determine the genotype of the organism at one or more particular genetic loci.
  • [0071]
    The chain termination reagent in combination with an appropriate oligonucleotide primer, and a DNA polymerase with or without an associated 3′ to 5′ exonuclease function, and an appropriate salt and cofactor mixture, can be used under appropriate hybridization conditions as a kit for diagnosing or typing nucleic acids, if appropriate primer separation techniques are used. To simplify the primer separation and the terminal nucleotide addition analysis this invention makes use of oligonucleotides that are modified in such ways that permit affinity separation as well as polymerase extension. The 5′ termini and internal nucleotides of synthetic oligonucleotides can be modified in a number of different ways to permit different affinity separation approaches, e.g., biotinylation. These affinity reagents can be used with the terminator mixture to facilitate the analysis of extended oligonucleotide(s) in two ways:
  • [0072]
    (1) If a single affinity group is used on the oligonucleotide(s), the oligonucleotide(s) can be separated from the unincorporated terminator reagent. This eliminates the need of physical or size separation.
  • [0073]
    (2) More than one oligonucleotide can be separated from the terminator reagent and analyzed simultaneously if more than one affinity group is used. This permits the analysis of several nucleic acid species or more nucleic acid sequence information per extension reaction.
  • [0074]
    The affinity group(s) need not be on the priming oligonucleotide but could, alternatively, be present on the template. As long as the primer remains hydrogen bonded to the template during the affinity separation step, this will allow efficient separation of the primer from unincorporated terminator reagent. This also has the additional benefit of leaving sites free on the primer for the convenient attachment of additional moieties. For example, the 5′-terminus of the primer could be modified by coupling it to a suitable fluorescent group such as rhodamine, allowing the amount of primer in the primer:template complex to be easily quantified after the affinity separation step. The amounts of 3′-terminating terminators could then be normalized to the total amount of annealed primer.
  • [0075]
    The oligonucleotide primers and template can be any length or sequence, can be DNA or RNA, or any modification thereof. It is necessary, however, that conditions are chosen to optimize stringent hybridization of the primers to the target sequences of interest.
  • [0076]
    The conditions for the occurence of the template-dependent, primer extension reaction can be created, in part, by the presence of a suitable template-dependent enzyme. Some of the suitable template-dependent enzymes are DNA polymerases. The DNA polymerase can be of several types. The DNA polymerase must, however, be primer and template dependent. For example, E. coli DNA polymerase I or the “Klenow fragment” thereof, T4 DNA polymerase, T7 DNA polymerase (“Sequenase”), T. aquaticus DNA polymerase, or a retroviral reverse transcriptase can be used. RNA polymerases such as T3 or T7 RNA polymerase could also be used in some protocols. Depending upon the polymerase, different conditions must be used, and different temperatures ranges may be required for the hybridization and extension reactions.
  • [0077]
    The reagents of the subject invention permit the typing of nucleic acids of interest by facilitating the analysis of the 3′ terminal addition of terminators to a specific primer or primers under specific hybridization and polymerase chain extension conditions. Using only the terminator mixture as the nucleoside triphosphate substrate ensures addition of only one nucleotide residue to the 3′ terminus of the primer in the polymerase reaction. Using all four terminators simultaneously ensures fidelity, i.e., suppression of misreading.
  • [0078]
    By specifically labeling one or more of the terminators, the sequence of the extended primer can be deduced. In principle, more than one reaction product can be analyzed per reaction if more than one terminator is specifically labeled.
  • [0079]
    By specifically tagging the oligonucleotide primer(s), or template(s) with a moiety that does not affect the 3′ extension reaction yet permits affinity separation, the extension product(s) can be separated post-reaction from the unincorporated terminators, other components of the reagents, and/or the template strand. Several oligonucleotides can be analyzed per extension reaction if more than one affinity agent is used.
  • [0080]
    In principle, the combination of four differently labeled terminators and many primers or templates tagged with different groups permits the typing of many different nucleic acid sequences simultaneously.
  • [0081]
    Specificity in this diagnostic reaction is determined by (1) the stringency of oligonucleotide hybridization and (2) the sequence information gained by the single residue extension.
  • A. GENERAL METHODS
  • [0082]
    1. Biotinylation of oligodeoxynucleotides.
  • [0083]
    Oligodeoxynucleotides, terminated at their 5′-ends with a primary amino group, were ordered from Midland Certified Reagents, Midland, Texas. These were biotinylated using biotin-XX-NHS ester (Clontech Laboratories, Inc., Palo Alto, Calif.), a derivative of biotin-N-hydroxysuccinimide. Reagents used were from the Clontech biotinylation kit. Typically, the oligonucleotide (9 nanomoles) was dissolved in 100 μl of 0.1M NaHCO3/Na2CO3 (pH 9), and 25 μl of N,N-dimethylformamide containing 2.5 mg biotin-XX-NHS-ester was added. The mixture was incubated overnight at room temperature. It was then passed over a 6 ml Sephadex G-25 column (“DNA grade”-Pharmacia) equilibrated with H2O. Eluate fractions containing DNA were identified by mixing 4 μl aliquots with an equal volume of ethidium bromide (2 μg/ml) and the DNA-induced fluorescence was monitored with a UV transilluminator. Unreacted ester was detected by UV absorption at 220 nm. The tubes containing DNA were pooled, concentrated in a Centricon-3 microconcentrator (Amicon), and passed over Sephadex again.
  • [0084]
    Inhibition of the binding of [3H]-biotin to magnetic M-280 streptavidin Dynabeads (Dynal) was used to assay quantitatively the extent of biotinylation of the oligonucleotides. Eppendorf tubes and pipet tips were siliconized. A known amount (5-10 pmoles) of biotin-labeled oligonucleotide in 10 μl 0.1M NaCl was added to tubes containing 25 μl of 1:4 suspension of beads in 0.1M NaCl. The tubes were rotated for one hour on a Labquake shaker (Labindustries, Inc.). Increasing amounts of [3H]-biotin (5-35 pmoles) in 20 μl of 0.1M NaCl were added to the tubes and these were rotated again for one hour. Tubes were put on a Dynal MPC-E magnet to remove the beads from suspension, 10 μl aliquots of the supernatant were withdrawn, and the amount of radioactivity in these was measured using a Beckman LS 5000 TD liquid scintillation counter. Counts were compared to those from tubes to which no oligonucleotide had been added. Alternatively, for some primers, biotinylation was monitored by size fractionation of the reaction products using analytical polyacrylamide gel electrophoresis in the presence of 8 M urea.
  • [0085]
    2. Template-dependent Primer Extension/Termination Reactions.
  • [0086]
    Approximately five pmoles of 5′-biotinylated oligodeoxynucleotide template (see above) were mixed with approximately three pmoles of primer in 1× sequencing buffer (from Sequenase Version 2.0 kit, US Biochemical Corp.) (10 μl final volume), the mixture was incubated at 65° C. for 2 min, then allowed to cool to room temperature in order to anneal the primer and template. The solution containing the annealed template-primer was separated into two 5 μl portions, A and B, to which were added the following: Reactions A (for normalizing template concentrations)—0.5 μl of 100 mM dithiothreitol, 1 μl each of 10 μM dATP, dGTP, ddCTP, 0.5 μl of “Mn buffer” (from Sequenase Version 2.0 kit, US Biochemical Corp.), 0.5 μl of [35S]-α-thio-dTTP (10 mCi/ml, 1180 Ci/mmole) (Dupont-NEN), 1 μl of Sequenase (1:8 dilution, US Biochemical Corp.); Reactions B (for template-specific labeling of primer 3′-ends)—same additions as in Reactions A except the nucleotides used were ddCTP, ddGTP, ddTTP, and [35S]-α-thio-ddATP.
  • [0087]
    Reactions were for 5 min at 37° C. Control reactions omitting the primer or the Sequenase were also performed. Aliquots were removed and analyzed by electrophoresis on a 15% polyacrylamide, 8 M urea, DNA sequencing gel (see Maniatis, T., et al., Molecular Cloning, a Laboratory Manual, Cold Spring Harbor Laboratory (1982)). The gel was fixed in 10% methanol, 10% acetic acid, dried down onto Whatman's 3 MM paper, and exposed to Kodak X-Omat AR film. Alternatively, for purposes of analyzing the products by liquid scintillation counting, the biotinylated template or template-primer was bound to an excess of M-280 streptavidin Dynabeads (Dynal) before or after the Sequenase reaction (see above, “1. Biotinylation of oligodeoxynucleotides”, for binding conditions). Beads were washed three times with 0.1 M NaCl to remove unincorporated label, then scintillation fluid was added and the radioactivity measured by liquid scintillation counting.
  • [0088]
    3. Generation of Templates from Polymerase Chain Reaction Products.
  • [0089]
    Polymerase chain reaction (PCR) reactions were carried out where one or the other of the amplification primers flanking the target stretch of DNA were biotinylated as described above. These primers (2 μmol final concentration) and the target DNA (up to 1 μg) were incubated with 2.5 units of Taq polymerase (Perkin Elmer/Cetus), 200 μM each of dATP, dCTP, dGTP, and dTTP, 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2, and 0.01% gelatin (Sigma). Reaction mixtures were overlayed with paraffin oil and incubated for 30 cycles in Perkin Elmer/Cetus thermocycler. Each cycle consisted of 1 min at 94° C., 2 min at 60° C., and 3 min at 72° C. Reaction products were purified by phenol/chloroform extraction and ethanol precipitation, then analyzed by ethidium bromide staining after electrophoresis on a polyacrylamide gel. The yield of duplex PCR product was typically about 10 μg.
  • [0090]
    Approximately 5 μg of this PCR product was incubated with gentle agitation for 60 min with 50 μL of a suspension of prewashed M-280 Dynabeads in 0.1 M NaCl. The beads with the bound DNA (approximately 15 pmoles) were then incubated for 5 min at 25° C. with 0.15 M NaOH. Beads were washed once with 0.15 M NAOH to remove the unbiotinylated DNA strand, then washed three times with H2O. The beads were resuspended in H2O and the strand bound to the beads via the biotin-streptavidin link was used as template for further primer extension reactions.
  • B. EXAMPLES Example 1
  • [0091]
    [0091]
    Primer oligo 182:
    5′GCCTTGGCGTTGTAGAA3′
    Template oligos
    180 (C)/181(T):
    3′TCGGGTCGGAACCGCAACATCTTC/TATAGACTA5′
  • [0092]
    Oligonucleotides 180 and 181 were synthesized with primary amino groups attached to their 5′ termini. These were coupled with biotin as described above. Oligonucleotide 182 was annealed as a primer and extension reactions “A” and “B” (see above) were carried out. The expected template-dependent 3-terminal extensions to oligonucleotide 182 were as follows (“★” preceding a nucleotide signifies a radioactive label):
    Template Reaction A Reaction B
    180 —dG—*dT—dA—*dT—ddC —ddG
    181 —dA—*dT—dA—*dT—ddC —*ddA
  • [0093]
    Thus, in the “A” reactions, both template oligonucleotides will direct a radioactively-labelled five nucleotide extension of the primer; the amount of labeling should be proportional to the amount of productively primed template present in the reactions. In the “B” reactions, both templates will direct a one nucleotide extension of the primer, but only for template 181 should this result in labeling of the primer. The “B” reaction, therefore, is an example of template-directed, sequence-specific labeling of an oligonucleotide via DNA polymerase-catalyzed extension of a productive primer-template complex.
  • [0094]
    The reaction products were fractionated by size on a 15% polyacrylamide/8M urea sequencing gel and visualized by autoradiography. The results (FIG. 1) show that, as expected, the “A” reactions yield labeling and extension of both primers whereas the “B” reaction results in labeling that is strongly biased in favor of template 181. Panel C in FIG. 1 shows a gel analysis of the same reaction products as in Panel B, except the reaction products were first purified as described above using M-280 streptavidin Dynabeads.
  • Example 2
  • [0095]
    The experiment described in Example 1 shows template-directed labeling of oligonucleotide primer 182 in which the labeling is specific with respect to oligonucleotides or other species that migrate similarly on a polyacrylamide gel. In order to assess more generally the template-directed specific labeling of oligonucleotide 182 with respect to all other labeled species, regardless of gel mobility, a direct measurement of incorporated radioactivity was performed. In this experiment, both reactions “A” and “B” were performed, reaction products were purified using Dynabeads, and total radioactivity in the aliquots was measured by liquid scintillation counting. This procedure assesses both misincorporation of label into other species and, in addition, the efficiency of the Dynabead washing procedure with respect to unincorporated nucleotides. As a practical matter, it would be of interest to minimize both sources of non-specific label in order to have a simple, non-gel-based, procedure for assessing specific, template-directed labeling of the primer. The results of directly counting the reaction products after washing on the magnetic beads are as follows (all results expressed as cpm of 35S):
    Reaction Template 180 Template 181
    A, complete 325,782 441,823
    A, no polymerase  5,187  5,416
    A, no primer  4,351  12,386
    B, complete  5,674 176,291
    B, no polymerase  2,988  1,419
    B, no primer  1,889  1,266
  • [0096]
    As can be seen from these results, specific template-directed labeling of primer 182 can also be determined by measuring the total radioactivity of the reaction products after washing with magnetic beads to remove unreacted nucleotides. The background in this experiment due to nonspecific label from all other sources was approximately 3-4% (compare templates 180 and 181 in the “B, complete” reaction). Control experiments (“no polymerase” and “no primer”) showed that the bulk of the background label was probably contributed by unincorporated nucleotides that were not completely removed by the washing step. The “A, complete” reactions showed that, -for both templates, productive template:primer complexes were present.
  • Example 3
  • [0097]
    Two amplification primers, TGL 105 and TGL 106 (FIG. 2), were used to amplify a cloned stretch of bovine DNA containing two DNA sequence polymorphisms: a C or T at position 114 and an A or G at position 190 (FIG. 2). DNAs containing these polymorphisms were molecularly cloned and available on plasmids, as follows: plasmid p183, C114 and A190; plasmid p624, T114 and A190; plasmid p814, C114 and G190. Four PCR reactions with biotinylated primers were performed to amplify and purify specific strands of these plasmids for use as templates:
    Primers Plasmids Detection Primers
    105 biotinylated, p183 and p624 TGL 182
    106 unbiotinylated
    105 unbiotinylated, p183 and p814 TGL 166
    106 biotinylated
  • [0098]
    The duplex PCR products were bound to magnetic microspheres, denatured with NaOH, and the biotinylated strand purified as described above. Templates prepared with biotinylated TGL 105 were subjected to analysis by DNA sequencing with unbiotinylated primer TGL 106 in order to measure the amount of template present. Similarly, template prepared using biotinylated TGL 106 was analyzed by sequencing with unbiotinylated TGL 105.
  • [0099]
    Approximately equal amounts of template (2 pmoles) were annealed for 5 min at 65° C. to the polymorphism detection primers, TGL 182 and TGL 166 (see above and FIG. 2). These primers hydrogen-bond to the templates in a sequence-specific fashion such that their 3′-termini are adjacent to nucleotide positions 114 and 190, respectively (FIG. 2). Template-directed primer extension reactions (reaction “B” conditions) were carried out on these primer:template complexes in the presence of the four ddNTPs, one of which (ddATP) was labeled. The products of these extension reactions were analyzed by electrophoresis on a 15% polyacrylamide/8M urea gel followed by autoradiography (FIG. 3).
  • Example 4
  • [0100]
    [0100]
    Primer oligo TGL391:
    5′TGTTTTGCACAAAAGCA3′
    Primer oligo TGL346:
    5′GTTTTGCACAAAAGCAT3′
    Template oligo TGL382:
    3′CACAAAACGTGTTTTCGTAGGA5′-biotin:
    (streptavidin-bead)
  • [0101]
    Oligonucleotide TGL382 was purchased from the Midland Certified Reagent Company, Midland, Tex. It was biotinylated using Midland Certified Reagent Company's “Biotin dX” reagent (a biotin derivative phosphoramidite) which is suitable for use in automated DNA synthesis in the 5′ terminal nucleotide position. The biotinylated oligonucleotide was then purified by anion exchange HPLC. Streptavidin-conjugated M-280 Dynabeads were washed in TNET buffer (10 mM Tris-HCl, pH 7.5, 100 mM NaCl, 1 mM EDTA, 0.1% Triton X-100) and resuspended in the same buffer at a concentration of 7×108 beads/ml. 10-100 pmoles of biotinylated oligonucleotide TGL382 was incubated with 100 μl of the Dynabead suspension in TNET for 30 minutes at 20° C. in order to allow the biotin moiety to bind to the streptavidin. The beads were then washed (using a magnet to immobilize them) three times with 200 μl of TNET and resuspended in 100 μl of TNET. For annealing, 25 μl of this suspension of the Dynabeads with the attached template oligonucleotide was immobilized with the magnet, the TNET withdrawn, and 25 μl of 40 mM Tris-HCL, pH 7.5, 20 mM MgCl2, 50 mM NaCl, containing 2 μM of oligonucleotide primers 346 or 391, was added. The template and each primer were annealled by incubating them for 5 minutes at 65° C., followed by slow cooling over a period of 20 minutes to room temperature. Beads containing the bound template-primer complexes were washed twice with 200 μl TNET, followed by resuspension in 25 μl of 40 mM Tris-HCl, pH 7.5, 20 mM MgCl2, 50 mM NaCl.
  • [0102]
    The following ddNTP mixes were used:
  • [0103]
    [0103]35S-labelled dideoxynucleoside triphosphate mixes (labelled nucleotide indicated in the form ddN★TP):
    ddG Mix:  5 μM ddG*TP 10 μM ddATP 10 μM ddTTP
    10 μM ddCTP
    ddA Mix: 10 μM ddGTP  5 μM ddA*TP 10 μM ddTTP
    10 μM ddCTP
    ddT Mix: 10 μM ddGTP 10 μM ddATP  5 μM ddT*TP
    10 μM ddCTP
    ddC Mix: 10 μM ddGTP 10 μM ddATP 10 μM ddTTP
     5 μM ddC*TP
  • [0104]
    For each bead-bound, template-primer complex, four extension reactions were carried out, one reaction for each of the four ddNTP mixes. Extension reactions contained the following components: 5.0 μl bead suspension containing the annealled template-primer complex, 0.5 μl of 100 mM dithiothreitol, 0.5 μl of “Mn++ solution” (100 mM MnCl2, 150 mM DL-isocitrate, pH 7.0; purchased from U.S. Biochemicals, Cleveland, Ohio), 1.0 μl of ddG, ddA, ddT, or ddC mix, 2.0 μl of H2O, and 1.0 μl of T7 DNA polymerase (“Sequenase”, version 2.0, US Biochemicals, 1625 units/ml in 50 mM Tris-HCl, pH 7.5, 10 mM 2-mercaptoethanol, 1 mg/ml bovine serum albumin).
  • [0105]
    Reactions were allowed to proceed for 15 minutes at 20° C., then stopped by washing the magnetically immobilized beads three times with 500 μl TNET. Beads were resuspended in final volume of 25 μl TNET prior to the detection assays.
  • [0106]
    Incorporation of labelled dideoxynucleotides by the primer extension reaction was assayed two different ways: gel electrophoresis followed by autoradiography, and direct autoradiographic analysis of labelled DNA.
  • [0107]
    1. Gel electrophoresis followed by autoradiography (35S-labelled material only). Samples of washed, bead-bound DNA were heated at 94° C. for 5 minutes in 10 μl of formamide loading buffer (80% formamide, 10 mM Tris-HCl, pH 8, 1 mM EDTA, 0.02% bromphenol blue) to denature the DNA and release the labelled primer from the primer:template complex. Samples were analyzed by electrophoresis on 8 or 12.5% polyacrylamide/8 M urea sequencing gels (19:1 acrylamide:bis-acrylamide ratio; 100 mM Tris-HCl, 100 mM borate, 2 mM EDTA, pH 8.3, running buffer; 60 watts constant power). After electrophoresis, gels were either dried down onto filter paper or frozen at −80° C. to prevent diffusion, covered with plastic wrap, and exposed to X-ray film to visualize the labelled DNA by autoradiography (FIG. 4).
  • [0108]
    2. Direct autoradiographic analysis of labelled DNA. For the analysis of total radioactivity bound to the beads, 10 μl aliquots of the bead suspensions in TNET were spotted directly onto filter paper or nylon membranes. Filters or membranes were dried under an incandescent lamp, covered with plastic wrap, and exposed to X-ray film (FIG. 5).
  • Example 5
  • [0109]
    [0109]
    TGL240: 5′AGATGATGCTTTTGTGCAAAACAC3′
    TGL239: 5′TCAATACCTGAGTCCCGACACCCTG3′
    TGL308: 5′AGCCTCAGACCGCGTGGTGCCTGGT3′
  • [0110]
    Oligonucleotide TGL240 was synthesized with a primary amino group attached to its 5′ terminus and coupled with biotin as described above. TGL240 (biotinylated) and TGL239 (unbiotinylated) were used to amplify, via the polymerase chain reaction procedure (see “A. General Methods”), a region of DNA comprising a particular genetic locus in samples of mammalian genomic DNA. DNAs from two different individuals, each homozygous for a particular set of linked sequence polymorphisms (the “A” allele and the “B” allele—see FIG. 6), were examined. After the PCR reaction, 2-20 pmoles of duplex PCR DNA was incubated with 100 u1 of streptavidin-conjugated M-280 Dynabeads (7×108 beads/ml) in TNET buffer in order to bind the biotinylated strand to the beads. After binding, the beads were magnetically immobilized and washed three times with 200 μl of TNET, then resuspended in 100 μl of TNET. To remove the non-biotinylated strand, 500 μl of 0.15 N NaOH was added and the suspension incubated for 30 minutes at 20° C. The beads were then magnetically immobilized and washed once with 250 μl of 0.15 N NaOH, three times with 500 μl TNET, and resuspended in 100 μl of TNET.
  • [0111]
    The detection primer, oligonucleotide TGL308 (FIG. 6), was annealled to the bead-bound PCR-generated template as described above in Example 4. Further washes, extension reactions, and detection assays were also carried out as described in Example 4. A gel autoradiographic analysis of the labelled primer extension products for the two homozygous individuals, ESB164 (“AA” genotype) and EA2014 (“BB” genotype), is shown in FIG. 7. Autoradiographic analyses of total bead-bound radioactivity, or primer-associated radioactivity after NaOH elution, are shown for these same individuals using the filter spotting assay (FIG. 8). For the analysis of primer only, 10 μl of 0.4 N NaOH was added to 10 μl of the bead suspension. After incubation for 10 minutes at room temperature, the beads were immobilized magnetically and the supernatant withdrawn and spotted onto nylon blotting membrane.
  • C. PREFERRED EMBODIMENT
  • [0112]
    A particularly advantageous way to practice the present invention involves obtaining from a convenient source, such as blood, epithelium, hair, or other tissue, samples of DNA or RNA, then amplifying in vitro specific regions of the nucleic acid using the polymerase chain reaction, transcription-based amplification (see Kwoh, et al., Proc. Natl. Acad. Sci. 80:1173 (1989)), etc. Amplification is accomplished using specific primers flanking the region of interest, with one or more of the primers being modified by having an attached affinity group (although in any given reaction only one such primer is modified at a time). A preferred modification is attachment of biotin moieties to the 5′-termini of the primers. A sample (typically, 0.5-5 pmoles) of the amplified DNA is then bound to streptavidin-conjugated magnetic microspheres (e.g., Dynal M-280 “Dynabeads”) via the attached biotin moiety on the amplification primer. The DNA is denatured by adjusting the aqueous suspension containing the microspheres to a sufficiently alkaline pH, and the strand bound to the microspheres via the biotin-streptavidin link is separated from the complementary strand by washing under similar alkaline conditions. To accomplish this, the microspheres are centrifuged or immobilized by the application of a magnetic field. The microsphere-bound strand is then used as a template in the remaining manipulations.
  • [0113]
    To the template strand, generated as described above, a specific primer oligonucleotide is bound under high stringency annealing conditions, the sequence of the primer being consistent with unique binding to a site on the template strand immediately adjacent to a known DNA sequence polymorphism. A preferred sequence and mode of binding for the primer ensures that the primer forms a duplex with the template such that the 3′-terminal nucleotide of the primer forms a Watson-Crick basepair with the template nucleotide immediately adjacent to the site of the first nucleotide in the sequence polymorphism, without the duplex overlapping any of the polymorphic sequence to be analyzed. This arrangement causes the nucleotides added via template-directed, DNA polymerase-catalyzed, extension of the primer to be determined unambiguously by the polymorphic nucleotide sequence in the template.
  • [0114]
    The above-described primer:template complex is contacted, under conditions of salt, pH, and temperature compatible with template-directed DNA synthesis, with a suitable DNA polymerase and four different chain-terminating nucleotide analogues known to form specific base pairs with the bases in the template. Most likely, but not necessarily, the bases in the template as well as the chain-terminating analogues are based on the common nucleosides: adenosine, cytosine, guanine or inosine, thymidine or uridine. A preferred set of chain-terminating analogues are the four dideoxynucleoside triphosphates, ddATP, ddCTP, ddGTP, and ddTTP, where each of the four ddNTPs has been modified by attachment of a different fluorescent reporter group. These fluorescent tags would have the property of having spectroscopically distinguishable emission spectra, and in no case would the dideoxynucleoside triphosphate modification render the chain-terminating analogue unsuitable for DNA polymerase-catalyzed incorporation onto primer 3′-termini. The result of DNA polymerase-catalyzed chain extension in such a mixture with such a primer:template complex is the quantitative, specific and unambiguous incorporation of a fluorescent chain-terminating analogue onto the 3′-terminus of the primer, the particular fluorescent nucleotide added being solely dictated by the sequence of the polymorphic nucleotides in the template.
  • [0115]
    The fluorescently-tagged primer:template complex, still attached to the magnetic microspheres, is then separated from the reaction mix containing the unincorporated nucleotides by, for example, washing the magnetically immobilized beads in a suitable buffer. Additionally, it is desirable in some circumstances to then elute the primer from the immobilized template strand with NaOH, transfer the eluted primer to a separate medium or container, and subsequently determine the identity of the incorporated terminator. The identity of the attached fluorescent group is then assessed by illuminating the modified DNA strand with light, preferably provided by a laser, of a suitable wavelength and intensity and spectrophotometrically analyzing the emission spectrum produced. In general, for a two allele (diploid) system at any given site in the DNA sequence, there are ten possible canonical emission spectra produced, corresponding to the sixteen possible homozygotic and heterozygotic pairings. By suitable matching of the measured spectra to this library of canonical spectra it is possible to identify which chain-terminating nucleotide(s) have been added to the 3′-terminus of the primer and thereby identify the nature of the sequence polymorphism in the template. Spectra produced by multiple allele systems or by alleles present in a ratio other than 1:1 can also be deconvolved by suitable mathematical treatments to identify and estimate the relative ratios of each contributing nucleotide.
  • [0116]
    All of the above steps involve chemistries, manipulations, and protocols that have been, or are amenable to being, automated. Thereby, incorporation of the preferred mode of practice of this invention into the operation of a suitably programmed robotic workstation should result in significant cost savings and increases in productivity for virtually any diagnostic procedure that depends on the detection of specific nucleotide sequences or sequence differences in nucleic acids derived from biological samples.

Claims (59)

What we claim is:
1. A reagent composition which comprises an aqueous carrier and an admixture of at least two different terminators of a nucleic acid template-dependent, primer extension reaction, each of the terminators being capable of specifically terminating the extension reaction in a manner strictly dependent on the identity of the unpaired nucleotide base in the template immediately adjacent to, and downstream of, the 3′ end of the primer, and at least one of the terminators being labeled with a detectable marker.
2. A reagent of claim 1, wherein the reagent comprises four different terminators.
3. A reagent of claim 2, wherein two of the terminators are labeled, each with a different detectable marker.
4. A reagent of claim 2, wherein three of the terminators are labeled, each with a different detectable marker.
5. A reagent of claim 2, wherein the four terminators are labeled, each with a different detectable marker.
6. A reagent of any of claims 1-5, wherein the terminator(s) comprise(s) a nucleotide or nucleotide analog.
7. A reagent of claim 6, wherein the terminator(s) comprise(s) dideoxynucleotides.
8. A reagent of claim 6, wherein the terminator(s) comprise(s) arabinoside triphosphates.
9. A reagent of claim 7, wherein the terminator(s) comprise(s) one or more of ddATP, ddCTP, ddGTP or ddTTP.
10. A reagent of any of claims 1-5, wherein each of the different detectable markers is an isotopically labeled moiety, a chromophore, a fluorophore, a protein moiety, or a moiety to which an isotopically labeled moiety, a chromophore, a fluorophore, or a protein moiety can be attached.
11. A reagent of claim 10, wherein each of the different detectable markers is a different fluorophore.
12. A reagent of any of claims 1-5, wherein the reagent further comprises pyrophosphatase.
13. A method of determining the identity of a nucleotide base at a specific position in a nucleic acid of interest which comprises:
(a) treating a sample containing the nucleic acid of interest, if such nucleic acid is double-stranded, so as to obtain unpaired nucleotide bases spanning the specific position, or directly employing step (b) if the nucleic acid of interest is single-stranded;
(b) contacting the sample from step (a), under hybridizing conditions, with an oligonucleotide primer which is capable of hybridizing with a stretch of nucleotide bases present in the nucleic acid of interest, immediately adjacent to the nucleotide base to be identified, so as to form a duplex between the primer and the nucleic acid of interest such that the nucleotide base to be identified is the first unpaired base in the template immediately downstream of the 31 end of the primer in said duplex;
(c) contacting the duplex from step (b) with a reagent of claim 5, under conditions permitting base pairing of a complementary terminator present in the reagent with the nucleotide base to be identified and occurrence of a template-dependent, primer extension reaction so as to incorporate the terminator at the 3′ end of the primer, the net result being that the primer has been extended by one terminator; and
(d) determining the identity of the detectable marker present at the 3′ end of the extended primer from step (c) and thereby determining the identity of the nucleotide base at the specific position in the nucleic acid of interest.
14. A method of determining the identity of a nucleotide base at a specific position in a nucleic acid of interest which comprises:
(a) treating a sample containing the nucleic acid of interest, if such nucleic acid is double-stranded, so as to obtain unpaired nucleotide bases spanning the specific position, or directly employing step (b) if the nucleic acid of interest is single-stranded;
(b) contacting the sample from step (a), under hybridizing conditions, with an oligonucleotide primer which is capable of hybridizing with a stretch of nucleotide bases present in the nucleic acid of interest, immediately adjacent to the nucleotide base to be identified, so as to form a duplex between the primer and the nucleic acid of interest such that the nucleotide base to be identified is the first unpaired base in the template immediately downstream of the 3′ end of the primer in said duplex;
(c) contacting the duplex from step (b) with a reagent of claim 2, wherein only one of the terminators has a detectable marker, under conditions permitting base pairing of a complementary terminator present in the reagent with the nucleotide base to be identified and occurrence of a template-dependent primer extension reaction so as to incorporate the terminator at the 3′ end of the primer, the net result being that the primer has been extended by one terminator;
(d) repeating step (c) three additional times, with a different one of each of the four terminators being labeled in each of the four parallel reaction steps; and,
(e) determining which of the products of the four parallel template-dependent, primer extension reactions has a detectable marker present at the 3′ end of the primer and thereby determining the identity of the nucleotide base at the specific position in the nucleic acid of interest.
15. A method of determining the presence or absence of a particular nucleotide sequence in a sample of nucleic acids which comprises:
(a) treating the sample of nucleic acids, if such sample of nucleic acids contains double-stranded nucleic acids, so as to obtain single-stranded nuclei c acids, or directly employing step (b) if the sample of nucleic acids contains only single-stranded nucleic acids;
(b) contacting the sample from step (a), under hybridizing conditions, with an oligonucleotide primer which is capable of hybridizing with the particular nucleotide sequence, if the particular nucleotide sequence is present, so as to form a duplex between the primer and the particular nucleotide sequence;
(c) contacting the duplex, if any, from step (b) with a reagent of claim 5, under conditions permitting base pairing of a complementary terminator present in the reagent with the unpaired template nucleotide base immediately downstream of the 3′ end of the primer, the primer being hybridized with the particular nucleotide sequence in the template, and occurrence of a template-dependent, primer extension reaction so as to incorporate the terminator at the 3′ end of the primer; and,
(d) determining the absence or presence and identity of a detectable marker at the 3′ end of the primer from step (c) and thereby determining the presence or absence of the particular nucleotide sequence in the sample of nucleic acids.
16. A method of determining the presence or absence of a particular nucleotide sequence in a sample of nucleic acids which comprises:
(a) treating the sample of nucleic acids, if such sample of nucleic acids contains double-stranded nucleic acids, so as to obtain single-stranded nucleic acids, or directly employing step (b) if the sample of nucleic acids contains only single-stranded nucleic acids;
(b) contacting the sample from step (a), under hybridizing conditions, with an oligonucleotide primer which is capable of hybridizing with the particular nucleotide sequence, if the particular nucleotide sequence is present, so as to form a duplex between the primer and the particular nucleotide sequence;
(c) contacting the duplex, if any, from step (b) with a reagent of claim 2, wherein only one of the terminators has a detectable marker, under conditions permitting base pairing of a complementary terminator present in the reagent with the unpaired template nucleotide base immediately downstream of the 3′ end of the primer, the primer being hybridized with the particular nucleotide sequence in the template, and occurrence of a template-dependent, primer extension reaction so as to incorporate the terminator at the 3′ end of the primer;
(d) repeating step (c) three additional times, with a different one of each of the four terminators being labeled in each of the four parallel reaction steps; and,
(e) determining the absence or presence and identity of a detectable marker at the 3′ end of the primer in the products of each of the four parallel template-dependent, primer extension reactions and thereby determining the presence or absence of the particular nucleotide sequence in the sample of nucleic acids.
17. A method of typing a sample containing nucleic acids which comprises identifying the nucleotide base or bases present at each of one or more specific positions, each such nucleotide base being identified using the method of claim 13 or 14, and each such specific position being determined using a different primer.
18. A method of claim 17, wherein the identity of each nucleotide base or bases at each position is determined individually or wherein the identities of the nucleotide bases at different positions are determined simultaneously.
19. A method of typing a sample containing nucleic acids which comprises determining the presence or absence of one or more particular nucleotide sequences, the presence or absence of each such nucleotide sequence being determined by the method of claim 15 or 16.
20. A method of typing a sample containing nucleic acids which comprises:
(a) determining the presence or absence of one or more particular nucleotide sequences, the presence or absence of each such nucleotide sequence being determined by the method of claim 15 or 16; and,
(b) identifying the nucleotide base or bases present at each of one or more specific positions, each such nucleotide base being identified using the method of claim 13 or 14, and each such specific position being determined using a different primer.
21. A method for identifying different alleles in a sample containing nucleic acids which comprises identifying the nucleotide base or bases present at each of one or more specific positions, each such nucleotide base being identified by the method of claim 13 or 14.
22. A method for determining the genotype of an organism at one or more particular genetic loci which comprises:
(a) obtaining from the organism a sample containing genomic DNA; and
(b) identifying the nucleotide base or bases present at each of one or more specific positions in nucleic acids of interest, each such base or bases being identified using the method of claim 13 or 14, and thereby identifying different alleles and thereby, in turn, determining the genotype of the organism at one or more particular genetic loci.
23. A method of claim 13 or 14, wherein the conditions for the occurrence of the template-dependent, primer extension reaction in step (c) are created, in part, by the presence of a suitable template-dependent enzyme.
24. A method of claim 23, wherein the template-dependent enzyme is E. coli DNA polymerase I or the “Klenow fragment” thereof, T4 DNA polymerase, T7 DNA polymerase (“Sequenase”), T. aquaticus DNA polymerase, a retroviral reverse transcriptase, or combinations thereof.
25. A method of claim 13 or 14, wherein the nucleic acid of interest is a deoxyribonucleic acid, a ribonucleic acid, or a copolymer of deoxyribonucleic acid and ribonucleic acid.
26. A method of claim 13 or 14, wherein the primer is an oligodeoxyribonucleotide, an oligoribonucleotide, or a copolymer of deoxyribonucleic acid and ribonucleic acid.
27. A method of claim 13 or 14, wherein the template is a deoxyribonucleic acid, the primer is an oligodeoxyribonucleotide, oligoribonucleotide, or a copolymer of deoxyribonucleotides and ribonucleotides, and the template-dependent enzyme is a DNA polymerase.
28. A method of claim 13 or 14, wherein the template is a ribonucleic acid, the primer is an oligodeoxyribonucleotide, oligoribonucleotide, or a copolymer of deoxyribonucleotides and ribonucleotides, and the template-dependent enzyme is a reverse transcriptase.
29. A method of claim 13 or 14, wherein the template is a deoxyribonucleic acid, the primer is an oligoribonucleotide, and the enzyme is an RNA polymerase.
30. A method of claim 13 or 14, wherein the template is a ribonucleic acid, the primer is an oligoribonucleotide, and the template-dependent enzyme is an RNA replicase.
31. A method of claim 13 or 14, wherein, prior to the primer extension reaction in step (c), the template has been capped at its 3′ end by the addition of a terminator to the 3′ end of the template, said terminator being capable of terminating a template-dependent, primer extension reaction.
32. A method of claim 31, wherein the terminator is a dideoxynucleotide.
33. A method of claim 13 or 14, wherein the nucleic acid of interest has been synthesized enzymatically in vivo, synthesized enzymatically in vitro, or synthesized non-enzymatically.
34. A method of claim 13 or 14, wherein the oligonucleotide primer has been synthesized enzymatically in vivo, synthesized enzymatically in vitro, or synthesized non-enzymatically.
35. A method of claim 13 or 14, wherein the oligonucleotide primer comprises one or more moieties that permit affinity separation of the primer from the unincorporated reagent and/or the nucleic acid of interest.
36. A method of claim 35, wherein the oligonucleotide primer comprises biotin which permits affinity separation of the primer from the unincorporated reagent and/or nucleic acid of interest via binding of the biotin to streptavidin which is attached to a solid support.
37. A method of claim 13 or 14, wherein the sequence of the oligonucleotide primer comprises a DNA sequence that permits affinity separation of the primer from the unincorporated reagent and/or the nucleic acid of interest via base pairing to a complementary sequence present in a nucleic acid attached to a solid support.
38. A method of claim 13 or 14, wherein the nucleic acid of interest comprises one or more moieties that permit affinity separation of the nucleic acid of interest from the unincorporated reagent and/or the primer.
39. A method of claim 38, wherein the nucleic acid of interest comprises biotin which permits affinity separation of the nucleic acid of interest from the unincorporated reagent and/or the primer via binding of the biotin to streptavidin which is attached to a solid support.
40. A method of claim 13 or 14, wherein the sequence of the nucleic acid of interest comprises a DNA sequence that permits affinity separation of the nucleic acid of interest from the unincorporated reagent and/or the primer via base pairing to a complementary sequence present in a nucleic acid attached to a solid support.
41. A method of claim 13 or 14, wherein the oligonucleotide primer is labeled with a detectable marker.
42. A method of claim 41, wherein the oligonucleotide primer is labeled with a detectable marker that is different from any detectable marker present in the reagent or attached to the nucleic acid of interest.
43. A method of claim 13 or 14, wherein the nucleic acid of interest is labeled with a detectable marker.
44. A method of claim 43, wherein the nucleic acid of interest is labeled with a detectable marker that is different from any detectable marker present in the reagent or attached to the primer.
45. A method of claim 13 or 14, wherein the nucleic acid of interest comprises non-natural nucleotide analogs.
46. A method of claim 45, wherein the non-natural nucleotide analogs comprise deoxyinosine or 7-deaza-2′-deoxyguanosine.
47. A method of claim 13 or 14, wherein the nucleic acid of interest has been synthesized by the polymerase chain reaction.
48. A method of claim 13 or 14, wherein the sample comprises genomic DNA from an organism, RNA transcripts thereof, or cDNA prepared from RNA transcripts thereof.
49. A method of claim 13 or 14, wherein the sample comprises extragenomic DNA from an organism, RNA transcripts thereof, or cDNA prepared from RNA transcripts thereof.
50. A method of claim 13 or 14, wherein the primer is substantially complementary to the known base sequence immediately adjacent to the base to be identified.
51. A method of claim 13 or 14, wherein the primer is fully complementary to the known base sequence immediately adjacent to the base to be identified.
52. A method of claim 13 or 14, wherein the primer is separated from the nucleic acid of interest after the primer extension reaction in step (c) by using appropriate denaturing conditions.
53. A method of claim 52, wherein the denaturing conditions comprise heat, alkali, formamide, urea, glyoxal, enzymes, and combinations thereof.
54. A method of claim 53, wherein the denaturing conditions comprise treatment with 0.2 N NaOH.
55. A method of claim 48, wherein the organism is a plant, microorganism, virus, or bird.
56. A method of claim 48, wherein the organism is a vertebrate or invertebrate.
57. A method of claim 48, wherein the organism is a mammal.
58. A method of claim 57, wherein the mammal is a human being.
59. A method of claim 57, wherein the mammal is a horse, dog, cow, cat, pig, or sheep.
US09258132 1991-03-05 1999-02-26 Nucleic acid typing by polymerase extension of oligonucleotides using terminator mixtures Abandoned US20030044778A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US07664837 US5888819A (en) 1991-03-05 1991-03-05 Method for determining nucleotide identity through primer extension
US09258132 US20030044778A1 (en) 1991-03-05 1999-02-26 Nucleic acid typing by polymerase extension of oligonucleotides using terminator mixtures

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
US09258132 US20030044778A1 (en) 1991-03-05 1999-02-26 Nucleic acid typing by polymerase extension of oligonucleotides using terminator mixtures

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US07664837 Continuation US5888819A (en) 1991-03-05 1991-03-05 Method for determining nucleotide identity through primer extension

Publications (1)

Publication Number Publication Date
US20030044778A1 true true US20030044778A1 (en) 2003-03-06

Family

ID=24667654

Family Applications (2)

Application Number Title Priority Date Filing Date
US07664837 Expired - Lifetime US5888819A (en) 1991-03-05 1991-03-05 Method for determining nucleotide identity through primer extension
US09258132 Abandoned US20030044778A1 (en) 1991-03-05 1999-02-26 Nucleic acid typing by polymerase extension of oligonucleotides using terminator mixtures

Family Applications Before (1)

Application Number Title Priority Date Filing Date
US07664837 Expired - Lifetime US5888819A (en) 1991-03-05 1991-03-05 Method for determining nucleotide identity through primer extension

Country Status (1)

Country Link
US (2) US5888819A (en)

Cited By (29)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040023220A1 (en) * 2002-07-23 2004-02-05 Lawrence Greenfield Integrated method for PCR cleanup and oligonucleotide removal
US20050014175A1 (en) * 1999-06-28 2005-01-20 California Institute Of Technology Methods and apparatuses for analyzing polynucleotide sequences
US20050032076A1 (en) * 1998-05-01 2005-02-10 Arizona Board Of Regents Method of determining the nucleotide sequence of oligonucleotides and dna molecules
WO2005029040A2 (en) * 2003-09-18 2005-03-31 Parallele Biosciences, Inc. System and methods for enhancing signal-to-noise ratios of microarray-based measurements
US20050170367A1 (en) * 2003-06-10 2005-08-04 Quake Stephen R. Fluorescently labeled nucleoside triphosphates and analogs thereof for sequencing nucleic acids
US20050239085A1 (en) * 2004-04-23 2005-10-27 Buzby Philip R Methods for nucleic acid sequence determination
US20050260609A1 (en) * 2004-05-24 2005-11-24 Lapidus Stanley N Methods and devices for sequencing nucleic acids
US20060019263A1 (en) * 1999-06-28 2006-01-26 Stephen Quake Methods and apparatuses for analyzing polynucleotide sequences
US20060019276A1 (en) * 2004-05-25 2006-01-26 Timothy Harris Methods and devices for nucleic acid sequence determination
US20060024678A1 (en) * 2004-07-28 2006-02-02 Helicos Biosciences Corporation Use of single-stranded nucleic acid binding proteins in sequencing
US20060046258A1 (en) * 2004-02-27 2006-03-02 Lapidus Stanley N Applications of single molecule sequencing
US20060118754A1 (en) * 2004-12-08 2006-06-08 Lapen Daniel C Stabilizing a polyelectrolyte multilayer
US20060172313A1 (en) * 2005-01-28 2006-08-03 Buzby Philip R Methods and compositions for improving fidelity in a nucleic acid synthesis reaction
US20060172328A1 (en) * 2005-01-05 2006-08-03 Buzby Philip R Methods and compositions for correcting misincorporation in a nucleic acid synthesis reaction
US20060172408A1 (en) * 2003-12-01 2006-08-03 Quake Steven R Device for immobilizing chemical and biochemical species and methods of using same
US20060252077A1 (en) * 2004-12-30 2006-11-09 Helicos Biosciences Corporation Stabilizing a nucleic acid for nucleic acid sequencing
US20060263790A1 (en) * 2005-05-20 2006-11-23 Timothy Harris Methods for improving fidelity in a nucleic acid synthesis reaction
US20070117103A1 (en) * 2005-11-22 2007-05-24 Buzby Philip R Nucleotide analogs
US20070117102A1 (en) * 2005-11-22 2007-05-24 Buzby Philip R Nucleotide analogs
US20070117104A1 (en) * 2005-11-22 2007-05-24 Buzby Philip R Nucleotide analogs
US20070128614A1 (en) * 2005-12-06 2007-06-07 Liu David R Nucleotide analogs
US20070128610A1 (en) * 2005-12-02 2007-06-07 Buzby Philip R Sample preparation method and apparatus for nucleic acid sequencing
US20070211467A1 (en) * 2006-03-08 2007-09-13 Helicos Biosciences Corporation Systems and methods for reducing detected intensity non-uniformity in a laser beam
US20080309926A1 (en) * 2006-03-08 2008-12-18 Aaron Weber Systems and methods for reducing detected intensity non uniformity in a laser beam
US7666593B2 (en) 2005-08-26 2010-02-23 Helicos Biosciences Corporation Single molecule sequencing of captured nucleic acids
US7897345B2 (en) 2003-11-12 2011-03-01 Helicos Biosciences Corporation Short cycle methods for sequencing polynucleotides
US20110171655A1 (en) * 2006-12-20 2011-07-14 The Board Of Trustees Of The Leland Stanford Junior University Ph measurement for sequencing of dna
US7981604B2 (en) 2004-02-19 2011-07-19 California Institute Of Technology Methods and kits for analyzing polynucleotide sequences
US20110183321A1 (en) * 1998-05-01 2011-07-28 Arizona Board Of Regents Method of determining the nucleotide sequence of oligonucleotides and dna molecules

Families Citing this family (181)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5547839A (en) * 1989-06-07 1996-08-20 Affymax Technologies N.V. Sequencing of surface immobilized polymers utilizing microflourescence detection
US6013431A (en) * 1990-02-16 2000-01-11 Molecular Tool, Inc. Method for determining specific nucleotide variations by primer extension in the presence of mixture of labeled nucleotides and terminators
US6004744A (en) * 1991-03-05 1999-12-21 Molecular Tool, Inc. Method for determining nucleotide identity through extension of immobilized primer
US5605798A (en) 1993-01-07 1997-02-25 Sequenom, Inc. DNA diagnostic based on mass spectrometry
US20030129589A1 (en) * 1996-11-06 2003-07-10 Hubert Koster Dna diagnostics based on mass spectrometry
US7001722B1 (en) * 1993-06-22 2006-02-21 Baylor College Of Medicine Parallel primer extension approach to nucleic acid sequence analysis
GB9507238D0 (en) * 1995-04-07 1995-05-31 Isis Innovation Detecting dna sequence variations
US7803529B1 (en) * 1995-04-11 2010-09-28 Sequenom, Inc. Solid phase sequencing of biopolymers
WO1997033000A1 (en) 1996-03-04 1997-09-12 Genetrace Systems, Inc. Methods of screening nucleic acids using mass spectrometry
WO1997035033A1 (en) 1996-03-19 1997-09-25 Molecular Tool, Inc. Method for determining the nucleotide sequence of a polynucleotide
US6208941B1 (en) * 1996-09-16 2001-03-27 University Of Utah Research Foundation Method and apparatus for analysis of chromatographic migration patterns
US5965363A (en) 1996-09-19 1999-10-12 Genetrace Systems Inc. Methods of preparing nucleic acids for mass spectrometric analysis
GB9620209D0 (en) 1996-09-27 1996-11-13 Cemu Bioteknik Ab Method of sequencing DNA
DE69735445D1 (en) 1996-12-10 2006-05-04 Sequenom Inc Cleavable, nonvolatile molecules for mass marker
GB9626815D0 (en) 1996-12-23 1997-02-12 Cemu Bioteknik Ab Method of sequencing DNA
US6982431B2 (en) * 1998-08-31 2006-01-03 Molecular Devices Corporation Sample analysis systems
US6297018B1 (en) 1998-04-17 2001-10-02 Ljl Biosystems, Inc. Methods and apparatus for detecting nucleic acid polymorphisms
US6204024B1 (en) * 1997-09-12 2001-03-20 Akzo Nobel N.V. CCR5 RNA transcription based amplification assay
US7632651B2 (en) * 1997-09-15 2009-12-15 Mds Analytical Technologies (Us) Inc. Molecular modification assays
US20050227294A1 (en) * 1997-09-15 2005-10-13 Molecular Devices Corporation Molecular modification assays involving lipids
US7745142B2 (en) * 1997-09-15 2010-06-29 Molecular Devices Corporation Molecular modification assays
US6090558A (en) * 1997-09-19 2000-07-18 Genetrace Systems, Inc. DNA typing by mass spectrometry with polymorphic DNA repeat markers
US6764822B1 (en) 1997-09-19 2004-07-20 Sequenom, Inc. DNA typing by mass spectrometry with polymorphic DNA repeat markers
US6391551B1 (en) 1998-03-13 2002-05-21 Promega Corporation Detection of nucleic acid hybrids
US6270974B1 (en) 1998-03-13 2001-08-07 Promega Corporation Exogenous nucleic acid detection
US7090975B2 (en) * 1998-03-13 2006-08-15 Promega Corporation Pyrophosphorolysis and incorporation of nucleotide method for nucleic acid detection
US6268146B1 (en) 1998-03-13 2001-07-31 Promega Corporation Analytical methods and materials for nucleic acid detection
US6277578B1 (en) 1998-03-13 2001-08-21 Promega Corporation Deploymerization method for nucleic acid detection of an amplified nucleic acid target
US6235480B1 (en) 1998-03-13 2001-05-22 Promega Corporation Detection of nucleic acid hybrids
US6270973B1 (en) 1998-03-13 2001-08-07 Promega Corporation Multiplex method for nucleic acid detection
US6312902B1 (en) 1998-03-13 2001-11-06 Promega Corporation Nucleic acid detection
US6703211B1 (en) 1998-03-13 2004-03-09 Promega Corporation Cellular detection by providing high energy phosphate donor other than ADP to produce ATP
US6104028A (en) * 1998-05-29 2000-08-15 Genetrace Systems Inc. Volatile matrices for matrix-assisted laser desorption/ionization mass spectrometry
US6180408B1 (en) 1998-08-21 2001-01-30 Washington University Fluorescence polarization in nucleic acid analysis
US6743578B1 (en) * 1998-12-18 2004-06-01 The Regents Of The University Of California Method for the detection of specific nucleic acid sequences by polymerase nucleotide incorporation
US6503718B2 (en) 1999-01-10 2003-01-07 Exact Sciences Corporation Methods for detecting mutations using primer extension for detecting disease
JP2002539849A (en) * 1999-03-26 2002-11-26 アフィメトリックス インコーポレイテッド Universal array
US6573047B1 (en) 1999-04-13 2003-06-03 Dna Sciences, Inc. Detection of nucleotide sequence variation through fluorescence resonance energy transfer label generation
DE60040741D1 (en) 1999-04-20 2008-12-18 Illumina Inc Detection of nucleic acid reactions to beads arrays
US20060275782A1 (en) 1999-04-20 2006-12-07 Illumina, Inc. Detection of nucleic acid reactions on bead arrays
US6533912B2 (en) 1999-07-13 2003-03-18 Molecular Dynamics, Inc. Increased throughput analysis of small compounds using multiple temporally spaced injections
WO2001004357A9 (en) 1999-07-13 2002-07-25 Whitehead Biomedical Inst Generic sbe-fret protocol
US20020045182A1 (en) * 1999-07-16 2002-04-18 Lynx Therapeutics, Inc. Multiplexed differential displacement for nucleic acid determinations
CA2380258C (en) 1999-07-26 2008-07-15 Clinical Micro Sensors, Inc. Sequence determination of nucleic acids using electronic detection
US6280947B1 (en) 1999-08-11 2001-08-28 Exact Sciences Corporation Methods for detecting nucleotide insertion or deletion using primer extension
US6528319B1 (en) 1999-09-02 2003-03-04 Amersham Biosciences Corp Method for anchoring oligonucleotides to a substrate
CN1373812B (en) 1999-09-13 2012-04-11 纽亘技术公司 Methods and compositions for linear isothermal amplification of polynucleotide sequences
US6692918B2 (en) * 1999-09-13 2004-02-17 Nugen Technologies, Inc. Methods and compositions for linear isothermal amplification of polynucleotide sequences
US7211390B2 (en) * 1999-09-16 2007-05-01 454 Life Sciences Corporation Method of sequencing a nucleic acid
US7244559B2 (en) * 1999-09-16 2007-07-17 454 Life Sciences Corporation Method of sequencing a nucleic acid
EP1218546A4 (en) * 1999-09-30 2005-01-05 New England Biolabs Inc Incorporation of modified nucleotides by archaeon dna polymerases and related methods
EP1235932A2 (en) 1999-10-08 2002-09-04 Protogene Laboratories, Inc. Method and apparatus for performing large numbers of reactions using array assembly
US6596483B1 (en) * 1999-11-12 2003-07-22 Motorola, Inc. System and method for detecting molecules using an active pixel sensor
US6642000B1 (en) 1999-11-12 2003-11-04 University Of Chicago PCR amplification on microarrays of gel immobilized oligonucleotides
JP2001245698A (en) * 1999-11-22 2001-09-11 Morisawa Nobukatsu Method for detecting nucleic acid
WO2001037878A2 (en) * 1999-11-29 2001-05-31 Orchid Biosciences, Inc. Methods of identifying optimal drug combinations and compositions thereof
US6458544B1 (en) 1999-12-02 2002-10-01 Dna Sciences, Inc. Methods for determining single nucleotide variations and genotyping
US6762018B1 (en) 1999-12-23 2004-07-13 Tetragen Sa Analysis of nucleotide polymorphisms at a site
US20020132234A1 (en) * 2000-01-24 2002-09-19 Moskowitz David W. Nitric oxide synthase gene diagnostic polymorphisms
US8076063B2 (en) * 2000-02-07 2011-12-13 Illumina, Inc. Multiplexed methylation detection methods
US7955794B2 (en) 2000-09-21 2011-06-07 Illumina, Inc. Multiplex nucleic acid reactions
US20050214825A1 (en) * 2000-02-07 2005-09-29 John Stuelpnagel Multiplex sample analysis on universal arrays
US7285384B2 (en) 2000-02-16 2007-10-23 Illuminia, Inc. Parallel genotyping of multiple patient samples
US20040170992A1 (en) * 2000-03-24 2004-09-02 Moskowitz David W. Diagnostic polymorphisms of tgf-beta1 promoter
WO2001073128A1 (en) * 2000-03-24 2001-10-04 Dzgenes, Llc DIAGNOSTIC POLYMORPHISMS OF TGF-β-RII PROMOTER
WO2001079561A3 (en) * 2000-04-17 2003-05-01 Stephen B Liggett Alpha-2 adrenergic receptor polymorphisms
US20050009016A1 (en) * 2000-05-04 2005-01-13 Moskowitz David W. Tgfbeta-rII promoter polymorphisms
US6355433B1 (en) 2000-06-02 2002-03-12 Dna Sciences, Inc. Determination of nucleotide sequence variations through limited primer extension
WO2001094546A3 (en) * 2000-06-02 2002-03-28 Dna Sciences Inc Primer extension using a mixture of labelled and unlabelled nucleotides
US6824980B2 (en) 2000-06-08 2004-11-30 Xiao Bing Wang Isometric primer extension method and kit for detection and quantification of specific nucleic acid
DE60137722D1 (en) 2000-06-13 2009-04-02 Univ Boston Using mass-matched nucleotide in the analysis of oligonucleotide mixtures and in the high-multiplex nucleic acid sequencing
CA2412721A1 (en) * 2000-06-26 2002-01-03 Nugen Technologies, Inc. Methods and compositions for transcription-based nucleic acid amplification
US7846733B2 (en) * 2000-06-26 2010-12-07 Nugen Technologies, Inc. Methods and compositions for transcription-based nucleic acid amplification
WO2002008468A1 (en) * 2000-07-25 2002-01-31 Dz Genes Llc Diagnostic polymorphisms for the tgf-beta1 promoter
US20050084849A1 (en) * 2000-07-25 2005-04-21 Moskowitz David W. Diagnostic polymorphisms for the ecnos promoter
US20040166491A1 (en) * 2001-08-09 2004-08-26 Henderson Lee A Vhl promoter diagnostic polymorphism
US7211386B2 (en) * 2000-08-10 2007-05-01 University Of Cincinnati Alpha-2A-adrenergic receptor polymorphisms
EP1387894A4 (en) * 2000-08-24 2006-10-11 Aviva Biosciences Corp Methods and compositions for identifying nucleic acid molecules using nucleolytic activities and hybridization
US6900013B1 (en) 2000-08-25 2005-05-31 Aviva Biosciences Corporation Methods and compositions for identifying nucleic acid molecules using nucleolytic activities and hybridization
US6548251B1 (en) 2000-09-05 2003-04-15 Fidelity Systems, Inc. Inhibition of molecular and biological processes using modified oligonucleotides
WO2002022881A1 (en) * 2000-09-11 2002-03-21 Dzgenes, Llc Endothelin-1 promoter polymorphism
US20040191774A1 (en) * 2001-09-11 2004-09-30 Moskowitz David W Endothelin-1 promoter polymorphism
WO2002022870A3 (en) * 2000-09-18 2003-09-04 Eidgenoessische Forschungsanst Method for the characterization and/or identification of genomes
US7229756B1 (en) 2000-10-19 2007-06-12 University Of Cincinnati Alpha-2B-adrenergic receptor polymorphisms
EP1343973B1 (en) 2000-11-16 2017-11-08 California Institute Of Technology Apparatus and methods for conducting assays and high throughput screening
DE60142709D1 (en) 2000-12-13 2010-09-09 Nugen Technologies Inc Methods and compositions for generation a variety of copies of nucleic acid sequences and methods for detection thereof
US20030165865A1 (en) * 2001-01-29 2003-09-04 Hinkel Christopher A. Methods of analysis of nucleic acids
US20020142336A1 (en) * 2001-02-02 2002-10-03 Genome Therapeutics Corporation Methods for determining a nucleotide at a specific location within a nucleic acid molecule
US6720148B1 (en) 2001-02-22 2004-04-13 Caliper Life Sciences, Inc. Methods and systems for identifying nucleotides by primer extension
CA2439074A1 (en) * 2001-03-09 2002-09-19 Nugen Technologies, Inc. Methods and compositions for amplification of rna sequences
DE60220025D1 (en) 2001-03-09 2007-06-21 Nugen Technologies Inc Methods and compositions for amplification of RNA sequences
US6428964B1 (en) 2001-03-15 2002-08-06 Exact Sciences Corporation Method for alteration detection
WO2002083839A3 (en) * 2001-03-30 2003-05-22 Motorola Inc P450 single nucleotide polymorphism biochip analysis
EP1950305A1 (en) 2001-05-09 2008-07-30 Monsanto Technology, LLC Tyr a genes and uses thereof
WO2002097109A3 (en) * 2001-05-25 2003-05-08 Invitrogen Corp Compositions and methods for extension of nucleic acids
US20050255463A1 (en) * 2001-06-14 2005-11-17 Dephillipo John R Kits and methods for assessing leptin-mediated lipid metabolism
US20030082584A1 (en) * 2001-06-29 2003-05-01 Liang Shi Enzymatic ligation-based identification of transcript expression
US20030170695A1 (en) * 2001-06-29 2003-09-11 Liang Shi Enzymatic ligation-based identification of nucleotide sequences
EP1632778A3 (en) 2001-07-09 2006-03-29 Euroscreen S.A. Natural ligand of gpcr chemr23 and uses thereof
US7582420B2 (en) * 2001-07-12 2009-09-01 Illumina, Inc. Multiplex nucleic acid reactions
GB0119719D0 (en) * 2001-08-13 2001-10-03 Solexa Ltd DNA sequence analysis
US6995841B2 (en) * 2001-08-28 2006-02-07 Rice University Pulsed-multiline excitation for color-blind fluorescence detection
US20030077584A1 (en) * 2001-08-28 2003-04-24 Mark Kunkel Methods and compositons for bi-directional polymorphism detection
US7045319B2 (en) * 2001-10-30 2006-05-16 Ribomed Biotechnologies, Inc. Molecular detection systems utilizing reiterative oligonucleotide synthesis
US20040054162A1 (en) * 2001-10-30 2004-03-18 Hanna Michelle M. Molecular detection systems utilizing reiterative oligonucleotide synthesis
WO2003038059A3 (en) * 2001-11-01 2003-11-13 Nina V Fedoroff Enzymatic manipulation of metal particle-bound dna
US7118910B2 (en) 2001-11-30 2006-10-10 Fluidigm Corporation Microfluidic device and methods of using same
EP1456418A4 (en) * 2001-12-20 2006-07-26 Merck & Co Inc Identification of novel polymorphic sites in the human mglur8 gene and uses thereof
WO2003057730A1 (en) 2002-01-07 2003-07-17 Euroscreen S.A. Ligand for g-protein coupled receptor gpr43 and uses thereof
US6803201B2 (en) * 2002-01-24 2004-10-12 Stratagene Compositions and methods for polynucleotide sequence determination
US7776524B2 (en) * 2002-02-15 2010-08-17 Genzyme Corporation Methods for analysis of molecular events
US20030170637A1 (en) * 2002-03-06 2003-09-11 Pirrung Michael C. Method of analyzing mRNA splice variants
US7211382B2 (en) * 2002-04-09 2007-05-01 Orchid Cellmark Inc. Primer extension using modified nucleotides
US20030235827A1 (en) * 2002-06-25 2003-12-25 Orchid Biosciences, Inc. Methods and compositions for monitoring primer extension and polymorphism detection reactions
US20040096870A1 (en) * 2002-06-28 2004-05-20 Sention, Inc. Methods of detecting sequence differences
US20060094010A1 (en) * 2002-06-28 2006-05-04 Giles Robert C Methods and compositions for analyzing comprised sample using single nucleotide polymorphism panels
US20040011650A1 (en) * 2002-07-22 2004-01-22 Frederic Zenhausern Method and apparatus for manipulating polarizable analytes via dielectrophoresis
EP1576174A4 (en) * 2002-08-02 2007-07-25 Orchid Cellmark Inc Methods and compositions for genotyping
JP4657919B2 (en) * 2002-08-19 2011-03-23 プレジデント アンド フェローズ オブ ハーバード カレッジ New molecular function to evolve
US8017323B2 (en) * 2003-03-26 2011-09-13 President And Fellows Of Harvard College Free reactant use in nucleic acid-templated synthesis
US20040259105A1 (en) * 2002-10-03 2004-12-23 Jian-Bing Fan Multiplex nucleic acid analysis using archived or fixed samples
US20040067492A1 (en) * 2002-10-04 2004-04-08 Allan Peng Reverse transcription on microarrays
US7192700B2 (en) * 2002-12-20 2007-03-20 Orchid Cellmark Inc. Methods and compositions for conducting primer extension and polymorphism detection reactions
WO2004059013A1 (en) * 2002-12-23 2004-07-15 Decode Genetics Ehf. Single nucleotide polymorphism detection using nucleotide depletion genotyping
US20040126765A1 (en) * 2002-12-27 2004-07-01 Adams Craig W. Method and compositions for sequencing nucleic acid molecules
US20040175704A1 (en) 2003-03-06 2004-09-09 Stratagene Compositions and methods for polynucleotide sequence detection
EP1861512A4 (en) 2005-03-18 2009-12-09 Fluidigm Corp Thermal reaction device and method for using the same
WO2004089810A3 (en) 2003-04-03 2005-07-07 Fluidigm Corp Microfluidic devices and methods of using same
WO2004092418A3 (en) 2003-04-14 2004-12-02 Nugen Technologies Inc Global amplification using a randomly primed composite primer
US20040248102A1 (en) * 2003-06-03 2004-12-09 Diane Ilsley-Tyree Methods and compositions for performing template dependent nucleic acid primer extension reactions that produce a reduced complexity product
US20050181394A1 (en) * 2003-06-20 2005-08-18 Illumina, Inc. Methods and compositions for whole genome amplification and genotyping
US7670810B2 (en) 2003-06-20 2010-03-02 Illumina, Inc. Methods and compositions for whole genome amplification and genotyping
US20040259100A1 (en) * 2003-06-20 2004-12-23 Illumina, Inc. Methods and compositions for whole genome amplification and genotyping
US20060057766A1 (en) * 2003-07-08 2006-03-16 Quanxi Jia Method for preparation of semiconductive films
US20050059035A1 (en) * 2003-09-09 2005-03-17 Quest Diagnostics Incorporated Methods and compositions for the amplification of mutations in the diagnosis of cystic fibrosis
CN101068934A (en) * 2003-10-29 2007-11-07 里伯米德生物技术公司 Compositions, methods and detection technologies for reiterative oligonucleotide synthesis
US7972783B2 (en) * 2003-11-24 2011-07-05 Branhaven LLC Method and markers for determining the genotype of horned/polled cattle
US20050112591A1 (en) * 2003-11-25 2005-05-26 Applera Corporation Novel method for isolating single stranded product
US20050136414A1 (en) * 2003-12-23 2005-06-23 Kevin Gunderson Methods and compositions for making locus-specific arrays
US8338578B1 (en) 2004-03-05 2012-12-25 Quest Diagnostics Investments Incorporated Cystic fibrosis gene mutations
WO2005111244A3 (en) * 2004-05-10 2006-06-22 Exact Sciences Corp Methods for detecting a mutant nucleic acid
US7307802B2 (en) 2004-06-07 2007-12-11 Fluidigm Corporation Optical lens system and method for microfluidic devices
US7981607B2 (en) * 2004-08-27 2011-07-19 Esoterix Genetic Laboratories LLC Method for detecting recombinant event
US7678824B2 (en) 2004-09-14 2010-03-16 The Regents Of The University Of Colorado, A Body Corporate Methods for treatment with bucindolol based on genetic targeting
WO2006047787A3 (en) 2004-10-27 2006-06-01 Exact Sciences Corp Method for monitoring disease progression or recurrence
US7767394B2 (en) * 2005-02-09 2010-08-03 Pacific Biosciences Of California, Inc. Nucleotide compositions and uses thereof
US20070141598A1 (en) * 2005-02-09 2007-06-21 Pacific Biosciences Of California, Inc. Nucleotide Compositions and Uses Thereof
WO2007044071A3 (en) * 2005-04-21 2008-01-24 Exact Sciences Corp Analysis of heterogeneous nucleic acid samples
US20110045991A1 (en) * 2005-06-23 2011-02-24 Sadanand Gite Methods for the Detection of Colorectal Cancer
CA2613482A1 (en) 2005-07-01 2007-02-15 Arbor Vita Corporation Methods and compositions for diagnosis and treatment of influenza
US7838646B2 (en) * 2005-08-18 2010-11-23 Quest Diagnostics Investments Incorporated Cystic fibrosis transmembrane conductance regulator gene mutations
EP1929046B1 (en) * 2005-09-07 2012-07-11 Nugen Technologies, Inc. Improved nucleic acid amplification procedure
US8933209B2 (en) 2006-04-26 2015-01-13 Abbvie Inc. Dep2 and its uses in major depressive disorder and other related disorders
US20070256148A1 (en) * 2006-04-26 2007-11-01 Katz David A DEP2 and its uses in major depressive disorder and other related disorders
US8055034B2 (en) 2006-09-13 2011-11-08 Fluidigm Corporation Methods and systems for image processing of microfluidic devices
US8050516B2 (en) * 2006-09-13 2011-11-01 Fluidigm Corporation Methods and systems for determining a baseline during image processing
CA2663954A1 (en) * 2006-09-19 2008-04-24 Human Biomolecular Research Institute Curcumin analogs, diagnostic methods and genetic markers for diagnosing and treating alzheimer's disease
US20080242560A1 (en) * 2006-11-21 2008-10-02 Gunderson Kevin L Methods for generating amplified nucleic acid arrays
US8473216B2 (en) * 2006-11-30 2013-06-25 Fluidigm Corporation Method and program for performing baseline correction of amplification curves in a PCR experiment
US7794937B2 (en) * 2006-12-22 2010-09-14 Quest Diagnostics Investments Incorporated Cystic fibrosis transmembrane conductance regulator gene mutations
US8034568B2 (en) * 2008-02-12 2011-10-11 Nugen Technologies, Inc. Isothermal nucleic acid amplification methods and compositions
GB2470672B (en) 2008-03-21 2012-09-12 Nugen Technologies Inc Methods of RNA amplification in the presence of DNA
WO2009140666A3 (en) 2008-05-15 2010-04-01 Ribomed Biotechnologies, Inc. METHODS AND REAGENTS FOR DETECTING CpG METHYLATION WITH A METHYL CpG BINDING PROTEIN (MBP)
US8211644B2 (en) * 2008-07-13 2012-07-03 Ribomed Biotechnologies, Inc. Molecular beacon-based methods for detection of targets using abscription
US8263339B2 (en) 2009-03-15 2012-09-11 Ribomed Biotechnologies, Inc. Abscription based molecular detection
WO2011039731A1 (en) 2009-10-02 2011-04-07 Actelion Pharmaceuticals Ltd Natural peptide and derivatives as modulators of gpcr gpr1 and uses thereof
US8728731B2 (en) 2010-03-22 2014-05-20 Laboratory Corporation Of America Holdings Mutations associated with cystic fibrosis
US8951940B2 (en) 2010-04-01 2015-02-10 Illumina, Inc. Solid-phase clonal amplification and related methods
US9206216B2 (en) 2010-04-21 2015-12-08 Pierce Biotechnology, Inc. Modified nucleotides methods and kits
US8536323B2 (en) 2010-04-21 2013-09-17 Pierce Biotechnology, Inc. Modified nucleotides
US9057726B2 (en) 2010-09-28 2015-06-16 Actelion Pharmaceuticals Ltd. Neuropeptide Q as modulator of GPCR GALR2 and uses thereof
GB201101891D0 (en) 2011-02-03 2011-03-23 X Pol Biotech S L Method for genotyping
EP2505661A1 (en) 2011-03-28 2012-10-03 Universitätsklinikum Hamburg-Eppendorf Methods for detecting the mortality risk
EP2535717A1 (en) 2011-06-13 2012-12-19 Universitätsklinikum Hamburg-Eppendorf Method for determining the mortality risk
WO2013059746A1 (en) 2011-10-19 2013-04-25 Nugen Technologies, Inc. Compositions and methods for directional nucleic acid amplification and sequencing
GB2533882B (en) 2012-01-26 2016-10-12 Nugen Tech Inc Method of enriching and sequencing nucleic acids of interest using massively parallel sequencing
EP2684964A1 (en) 2012-07-09 2014-01-15 OakLabs GmbH Microarray-based methods for identifying single nucleotides at specific positions in nucleic acids
WO2014144092A1 (en) 2013-03-15 2014-09-18 Nugen Technologies, Inc. Sequential sequencing
US9745614B2 (en) 2014-02-28 2017-08-29 Nugen Technologies, Inc. Reduced representation bisulfite sequencing with diversity adaptors
EP2930246A1 (en) 2014-04-07 2015-10-14 QIAGEN GmbH Novel single nucleotide polymorphisms associated with various diseases and disorders
CN107205353A (en) 2014-09-26 2017-09-26 谱赛科美国股份有限公司 Single nucleotide polymorphism (SNP) markers for stevia

Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4683202A (en) * 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4734363A (en) * 1984-11-27 1988-03-29 Molecular Diagnostics, Inc. Large scale production of DNA probes
US4800159A (en) * 1986-02-07 1989-01-24 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences
US4840892A (en) * 1984-05-15 1989-06-20 Smithkline Beckman Corporation Polynucleotide hybridization probes
US4863849A (en) * 1985-07-18 1989-09-05 New York Medical College Automatable process for sequencing nucleotide
US5310893A (en) * 1986-03-31 1994-05-10 Hoffmann-La Roche Inc. Method for HLA DP typing
US5332666A (en) * 1986-07-02 1994-07-26 E. I. Du Pont De Nemours And Company Method, system and reagents for DNA sequencing
US5476769A (en) * 1987-03-11 1995-12-19 Orion-Yahtyma Oy Method for assays of nucleic acid, a reagent combination and a kit therefor
US5846710A (en) * 1990-11-02 1998-12-08 St. Louis University Method for the detection of genetic diseases and gene sequence variations by single nucleotide primer extension

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB8311018D0 (en) * 1983-04-22 1983-05-25 Amersham Int Plc Detecting mutations in dna
US4962020A (en) * 1988-07-12 1990-10-09 President And Fellows Of Harvard College DNA sequencing

Patent Citations (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4840892A (en) * 1984-05-15 1989-06-20 Smithkline Beckman Corporation Polynucleotide hybridization probes
US4734363A (en) * 1984-11-27 1988-03-29 Molecular Diagnostics, Inc. Large scale production of DNA probes
US4683202A (en) * 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4683202B1 (en) * 1985-03-28 1990-11-27 Cetus Corp
US4863849A (en) * 1985-07-18 1989-09-05 New York Medical College Automatable process for sequencing nucleotide
US4800159A (en) * 1986-02-07 1989-01-24 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences
US5310893A (en) * 1986-03-31 1994-05-10 Hoffmann-La Roche Inc. Method for HLA DP typing
US5332666A (en) * 1986-07-02 1994-07-26 E. I. Du Pont De Nemours And Company Method, system and reagents for DNA sequencing
US5476769A (en) * 1987-03-11 1995-12-19 Orion-Yahtyma Oy Method for assays of nucleic acid, a reagent combination and a kit therefor
US5846710A (en) * 1990-11-02 1998-12-08 St. Louis University Method for the detection of genetic diseases and gene sequence variations by single nucleotide primer extension

Cited By (42)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7645596B2 (en) 1998-05-01 2010-01-12 Arizona Board Of Regents Method of determining the nucleotide sequence of oligonucleotides and DNA molecules
US9458500B2 (en) 1998-05-01 2016-10-04 Life Technologies Corporation Method of determining the nucleotide sequence of oligonucleotides and DNA molecules
US20050032076A1 (en) * 1998-05-01 2005-02-10 Arizona Board Of Regents Method of determining the nucleotide sequence of oligonucleotides and dna molecules
US20110183321A1 (en) * 1998-05-01 2011-07-28 Arizona Board Of Regents Method of determining the nucleotide sequence of oligonucleotides and dna molecules
US9096898B2 (en) 1998-05-01 2015-08-04 Life Technologies Corporation Method of determining the nucleotide sequence of oligonucleotides and DNA molecules
US9725764B2 (en) 1998-05-01 2017-08-08 Life Technologies Corporation Method of determining the nucleotide sequence of oligonucleotides and DNA molecules
US9212393B2 (en) 1998-05-01 2015-12-15 Life Technologies Corporation Method of determining the nucleotide sequence of oligonucleotides and DNA molecules
US9540689B2 (en) 1998-05-01 2017-01-10 Life Technologies Corporation Method of determining the nucleotide sequence of oligonucleotides and DNA molecules
US20050014175A1 (en) * 1999-06-28 2005-01-20 California Institute Of Technology Methods and apparatuses for analyzing polynucleotide sequences
US20060019263A1 (en) * 1999-06-28 2006-01-26 Stephen Quake Methods and apparatuses for analyzing polynucleotide sequences
US20050147992A1 (en) * 1999-06-28 2005-07-07 California Institute Of Technology Methods and apparatus for analyzing polynucleotide sequences
US20040023220A1 (en) * 2002-07-23 2004-02-05 Lawrence Greenfield Integrated method for PCR cleanup and oligonucleotide removal
US20060141523A1 (en) * 2002-07-23 2006-06-29 Applera Corporation Integrated method for PCR cleanup and oligonucleotide removal
US20050170367A1 (en) * 2003-06-10 2005-08-04 Quake Stephen R. Fluorescently labeled nucleoside triphosphates and analogs thereof for sequencing nucleic acids
US20050100939A1 (en) * 2003-09-18 2005-05-12 Eugeni Namsaraev System and methods for enhancing signal-to-noise ratios of microarray-based measurements
WO2005029040A3 (en) * 2003-09-18 2007-12-21 Malek Faham System and methods for enhancing signal-to-noise ratios of microarray-based measurements
WO2005029040A2 (en) * 2003-09-18 2005-03-31 Parallele Biosciences, Inc. System and methods for enhancing signal-to-noise ratios of microarray-based measurements
US9012144B2 (en) 2003-11-12 2015-04-21 Fluidigm Corporation Short cycle methods for sequencing polynucleotides
US7897345B2 (en) 2003-11-12 2011-03-01 Helicos Biosciences Corporation Short cycle methods for sequencing polynucleotides
US9657344B2 (en) 2003-11-12 2017-05-23 Fluidigm Corporation Short cycle methods for sequencing polynucleotides
US20060172408A1 (en) * 2003-12-01 2006-08-03 Quake Steven R Device for immobilizing chemical and biochemical species and methods of using same
US7981604B2 (en) 2004-02-19 2011-07-19 California Institute Of Technology Methods and kits for analyzing polynucleotide sequences
US20060046258A1 (en) * 2004-02-27 2006-03-02 Lapidus Stanley N Applications of single molecule sequencing
US20050239085A1 (en) * 2004-04-23 2005-10-27 Buzby Philip R Methods for nucleic acid sequence determination
US20050260609A1 (en) * 2004-05-24 2005-11-24 Lapidus Stanley N Methods and devices for sequencing nucleic acids
US20060019276A1 (en) * 2004-05-25 2006-01-26 Timothy Harris Methods and devices for nucleic acid sequence determination
US20060024678A1 (en) * 2004-07-28 2006-02-02 Helicos Biosciences Corporation Use of single-stranded nucleic acid binding proteins in sequencing
US20060118754A1 (en) * 2004-12-08 2006-06-08 Lapen Daniel C Stabilizing a polyelectrolyte multilayer
US20060252077A1 (en) * 2004-12-30 2006-11-09 Helicos Biosciences Corporation Stabilizing a nucleic acid for nucleic acid sequencing
US20060172328A1 (en) * 2005-01-05 2006-08-03 Buzby Philip R Methods and compositions for correcting misincorporation in a nucleic acid synthesis reaction
US20060172313A1 (en) * 2005-01-28 2006-08-03 Buzby Philip R Methods and compositions for improving fidelity in a nucleic acid synthesis reaction
US20060263790A1 (en) * 2005-05-20 2006-11-23 Timothy Harris Methods for improving fidelity in a nucleic acid synthesis reaction
US7666593B2 (en) 2005-08-26 2010-02-23 Helicos Biosciences Corporation Single molecule sequencing of captured nucleic acids
US9868978B2 (en) 2005-08-26 2018-01-16 Fluidigm Corporation Single molecule sequencing of captured nucleic acids
US20070117104A1 (en) * 2005-11-22 2007-05-24 Buzby Philip R Nucleotide analogs
US20070117103A1 (en) * 2005-11-22 2007-05-24 Buzby Philip R Nucleotide analogs
US20070117102A1 (en) * 2005-11-22 2007-05-24 Buzby Philip R Nucleotide analogs
US20070128610A1 (en) * 2005-12-02 2007-06-07 Buzby Philip R Sample preparation method and apparatus for nucleic acid sequencing
US20070128614A1 (en) * 2005-12-06 2007-06-07 Liu David R Nucleotide analogs
US20080309926A1 (en) * 2006-03-08 2008-12-18 Aaron Weber Systems and methods for reducing detected intensity non uniformity in a laser beam
US20070211467A1 (en) * 2006-03-08 2007-09-13 Helicos Biosciences Corporation Systems and methods for reducing detected intensity non-uniformity in a laser beam
US20110171655A1 (en) * 2006-12-20 2011-07-14 The Board Of Trustees Of The Leland Stanford Junior University Ph measurement for sequencing of dna

Also Published As

Publication number Publication date Type
US5888819A (en) 1999-03-30 grant

Similar Documents

Publication Publication Date Title
Fraga et al. DNA methylation: a profile of methods and applications
Tost et al. Genotyping single nucleotide polymorphisms by mass spectrometry
US6277578B1 (en) Deploymerization method for nucleic acid detection of an amplified nucleic acid target
US6190865B1 (en) Method for characterizing nucleic acid molecules
US6960436B2 (en) Quantitative methylation detection in DNA samples
US5093245A (en) Labeling by simultaneous ligation and restriction
US5455166A (en) Strand displacement amplification
US6221603B1 (en) Rolling circle amplification assay for nucleic acid analysis
US5674686A (en) Allelic ladders for short tandem repeat loci
US5580730A (en) Enzyme digestion method for the detection of amplified DNA
US5834189A (en) Method for evaluation of polymorphic genetic sequences, and the use thereof in identification of HLA types
US7014994B1 (en) Coupled polymerase chain reaction-restriction-endonuclease digestion-ligase detection reaction process
US5547861A (en) Detection of nucleic acid amplification
US6287766B1 (en) DNA polymorphism identity determination using flow cytometry
Guo et al. Enhanced discrimination of single nucleotide polymorphisms by artificial mismatch hybridization
US7285384B2 (en) Parallel genotyping of multiple patient samples
Saiki et al. Genetic analysis of amplified DNA with immobilized sequence-specific oligonucleotide probes
US6818420B2 (en) Methods of using FET labeled oligonucleotides that include a 3′-5′ exonuclease resistant quencher domain and compositions for practicing the same
EP1130113A1 (en) Multiplex ligation dependent amplification assay
US5024934A (en) Detection of minimal numbers of neoplastic cells carrying DNA translocations by DNA sequence amplification
US5849487A (en) Nucleic acid detection by repetitive synthesis and degradation of a nucleotide on a nuclease resistant oligonucleotide
US6268146B1 (en) Analytical methods and materials for nucleic acid detection
US6977161B2 (en) Solid support assay systems and methods utilizing non-standard bases
US6294336B1 (en) Method for analyzing the nucleotide sequence of a polynucleotide by oligonucleotide extension on an array
US6692915B1 (en) Sequencing a polynucleotide on a generic chip

Legal Events

Date Code Title Description
AS Assignment

Owner name: ORCHID BIOSCIENCES, INC., NEW JERSEY

Free format text: CHANGE OF NAME;ASSIGNOR:ORCHID BIOCOMPUTER, INC.;REEL/FRAME:010703/0477

Effective date: 20000216

AS Assignment

Owner name: ORCHID CELLMARK INC., NEW JERSEY

Free format text: CHANGE OF NAME;ASSIGNOR:ORCHID BIOSCIENCES, INC.;REEL/FRAME:016593/0821

Effective date: 20050608