US20030027312A1 - Isolated DNA sequence capable of serving as regulatory element in a chimeric gene which can be used for the transformation of plants - Google Patents

Isolated DNA sequence capable of serving as regulatory element in a chimeric gene which can be used for the transformation of plants Download PDF

Info

Publication number
US20030027312A1
US20030027312A1 US10/023,839 US2383901A US2003027312A1 US 20030027312 A1 US20030027312 A1 US 20030027312A1 US 2383901 A US2383901 A US 2383901A US 2003027312 A1 US2003027312 A1 US 2003027312A1
Authority
US
United States
Prior art keywords
gene
ala
leu
plant
val
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US10/023,839
Inventor
Richard Derose
Nicole Chaubet
Claude Gigot
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Individual
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=9481325&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=US20030027312(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Application filed by Individual filed Critical Individual
Priority to US10/023,839 priority Critical patent/US20030027312A1/en
Publication of US20030027312A1 publication Critical patent/US20030027312A1/en
Priority to US11/797,078 priority patent/US7982092B2/en
Abandoned legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/1085Transferases (2.) transferring alkyl or aryl groups other than methyl groups (2.5)
    • C12N9/10923-Phosphoshikimate 1-carboxyvinyltransferase (2.5.1.19), i.e. 5-enolpyruvylshikimate-3-phosphate synthase
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8222Developmentally regulated expression systems, tissue, organ specific, temporal or spatial regulation
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8222Developmentally regulated expression systems, tissue, organ specific, temporal or spatial regulation
    • C12N15/8223Vegetative tissue-specific promoters
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8222Developmentally regulated expression systems, tissue, organ specific, temporal or spatial regulation
    • C12N15/8223Vegetative tissue-specific promoters
    • C12N15/8229Meristem-specific, e.g. nodal, apical
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8222Developmentally regulated expression systems, tissue, organ specific, temporal or spatial regulation
    • C12N15/823Reproductive tissue-specific promoters
    • C12N15/8231Male-specific, e.g. anther, tapetum, pollen
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8222Developmentally regulated expression systems, tissue, organ specific, temporal or spatial regulation
    • C12N15/823Reproductive tissue-specific promoters
    • C12N15/8233Female-specific, e.g. pistil, ovule
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8274Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for herbicide resistance
    • C12N15/8275Glyphosate
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00Genetically modified animals
    • A01K2217/05Animals comprising random inserted nucleic acids (transgenic)

Definitions

  • the present invention relates to the use of a regulatory element isolated from transcribed plant genes, of new chimeric genes containing then and to their use for the transformation of plants.
  • phenotypic characters associated with the expression of one or more gene elements can be integrated into the genome of plants and thus confer on those transgenic plants advantageous agronomic properties.
  • the resistances to pathogenic agents for crops the resistance to phytotoxic plant-protection products, the production of substances of dietary or pharmacological interest.
  • an appropriate expression should be ensured.
  • This appropriate expression may be situated both at the qualitative and quantitative levels. At the qualitative level, for example the spatial level: preferential expression in a specific tissue, or temporal level: inducible expression; at the quantitative level, by the accumulated quantity of the product of expression of the gene introduced.
  • This appropriate expression depends, for a large part, an the presence of regulatory gene elements associated with the transgenes, in particular as regards the quantitative and qualitative elements.
  • regulatory gene elements associated with the transgenes
  • the use of single or combined homologous or heterologous promoter elements has been widely described in the scientific literature.
  • the use of a regulatory element downstream of the transgene was used for the sole purpose of putting a boundary which makes it possible to stop the process of transcription of the transgene, without presupposition as to their role as regards the quality or the quantity of the expression of the transgene.
  • the present invention relates to the use of an intron 1 isolated from plant genes as a regulatory element, of now chimeric genes containing them and to their use for the transformation of plants. It relates to an isolated DNA sequence capable of serving as a regulatory element in a chimeric gene which can be used for the transformation of plants and allowing the expression of the product of translation of the chimeric gene in particular in the regions of the plant undergoing rapid growth, which comprises, in the direction of transcription of the chimeric gene, at least one intron such as the first intron (intron 1) of the noncoding 5′ region of a plant histone gene. It relates more particularly to the simultaneous use of the intron 1 as a regulatory element and of promoters isolated from the same plant gene.
  • This appropriate expression obtained by the use of the present invention, may relate to characters such as; the resistance to pathogenic agents for crops, the resistance to phytotoxic plant-protection products, the production of substances of dietary or pharmacological interest. in particular, it makes it possible to confer on the transgenic plants an enhanced tolerance to herbicides by a qualitative and quantitative preferential expression of the product of expression of the chimeric genes in the regions of the plant undergoing rapid growth.
  • This specific appropriate expression of the gene for herbicide resistance is obtained by the simultaneous use of the promoter regulatory elements and of at least one intron 1 of the histone gene of the “H3.3- like” type as regulatory element.
  • the present invention also relates to the plant cells transformed with the aid of these genes and the transformed plants regenerated from these cells as well as the plants derived from crossings using these transformed plants.
  • the systemic products are characterized in that they are transported in the plant after application and, for some of them, accumulate in the parts undergoing rapid growth, especially the caulinary and root apices, causing, in the case of herbicides, deterioration, up to the destruction, of the sensitive plants.
  • the primary mode of action is known and results from inactivation of characterized enzymes involved in the biosynthesis pathways of compounds required for proper development of the target plants.
  • the target enzymes of those products may be located in various subcellular compartments and observation of the mode of action of known products most often shows a location in the plastid compartment.
  • Tolerance of plants sensitive to a product belonging to this group of herbicides, and whose primary target is known, may be obtained by stable introduction, into their genome, of a gene encoding the target enzyme, of any phylogenetic origin, mutated or otherwise with respect to the characteristics of inhibition, by the herbicide, of the product of expression of this gene.
  • Another approach comprises introducing, in a stable manner, into the genome of sensitive plants a gene of any phylogenetic origin encoding an enzyme capable of metabolizing the herbicide into a compound which is inactive and nontoxic for the development of the plant. In the latter came, it is not necessary to have characterized the target of the herbicide.
  • glyphosate, sulfosate or fosametine which are broad-spectrum systemic herbicides of the phosphonomethylglycine family. They act essentially as competitive inhibitors, in relation to PEP (phosphoenolpyruvate), of 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS, EC 2.5.1.19). After their application to the plant, they are transported into the plant where they accumulate in the parts undergoing rapid growth, especially the caulinary and root apices, causing the deterioration, up to the destruction, of the sensitive plants.
  • PEP phosphoenolpyruvate
  • EPSPS 5-enolpyruvylshikimate-3-phosphate synthase
  • EPSPS the principal target of these products, is an enzyme of the pathway of biosynthesis of aromatic amino acids which is located in the plastid compartment. This enzyme is encoded by one or more nuclear genes and is synthesized in the form of a cytoplasmic precursor and then imported into the plastids where it accumulates in its mature form.
  • plant is understood to mean any differentiated multicellular organism capable of photosynthesis and “plant cell” any cell derived from a plant and capable of constituting undifferentiated tissues such as calli, or differentiated tissues such as embryos or plant portions or plants or seeds.
  • Plant cell any cell derived from a plant and capable of constituting undifferentiated tissues such as calli, or differentiated tissues such as embryos or plant portions or plants or seeds.
  • Intron 1 of Arabidopsis as a regulatory element is understood to mean an isolated DNA sequence of variable length, situated upstream of the coding part or corresponding to the structural part of a transcribed gene.
  • Gene for tolerance to a herbicide is understood to mean any gene, of any phylogenetic origin, encoding either the target enzyme for the herbicide, optionally having one or more mutations with respect to the characteristics of inhibition by the herbicide, or an enzyme capable of metabolizing the herbicide into a compound which is inactive and nontoxic for the plant.
  • Zones of the plants undergoing rapid growth are understood to mean the regions which are the seat of substantial cell multiplications, in particular the apical regions.
  • the present invention relates to the production of transformed plants having an enhanced tolerance to herbicides accumulating in the zones of the treated plants undergoing rapid growth, by regeneration of cells transformed with the aid of new chimeric genes comprising a gene for tolerance to these products.
  • the subject of the invention is also the production of transformed plants having an enhanced tolerance to herbicides of the phosphonomethylglycine family by regeneration of cells transformed with the aid of new chimeric genes comprising a gene for tolerance to these herbicides.
  • the invention also relates to these new chimeric genes, as well as to transformed plants which are more tolerant because of a better tolerance in the parts of these plants undergoing rapid growth, as well as to the plants derived from crossings using these transformed plants. Its subject is also new intron 1 of a plant histone and its use as regulatory zone for the construction of the above chimeric genes.
  • the subject of the invention is a chimeric gene for conferring on plants especially an enhanced tolerance to a herbicide having EPSPS as target, comprising, in the direction of transcription, a promoter element, a signal peptide sequence, a sequence encoding an enzyme for tolerance to the products of the phosphonomethylglycine family and a regulatory element, characterized in that the regulatory element comprises a fragment of an intron 1 of a plant histone gene in any orientation relative to its initial orientation in the gene from which it is derived, allowing the preferential expression and the accumulation of the protein for tolerance to the herbicide in the zones for accumulation of the said herbicide.
  • the histone gene comes from a monocotyledonous plant such an for example wheat, maize or rice, or preferably from a dicotyledonous plant such as for example lucerne, sunflower, soya bean, rapeseed or preferably Arabidopsis thaliana .
  • a histone gene of the “H3.3-like” type is used.
  • the signal peptide sequence comprises, in the direction of transcription, at least one signal peptide sequence of a plant gene encoding a signal peptide directing transport of a polypeptide to a plastid, a portion of the sequence of the mature N-terminal part of a plant gene produced when the first signal peptide is cleaved by proteolytic enzymes, and then a second signal peptide of a plant gene encoding a signal peptide directing transport of the polypeptide to a sub-compartment of the plastid.
  • the signal peptide sequence is preferably derived from a gene for the small subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase (RuBisco) according to European patent application PCT 508 909.
  • the role of this characteristic sequence is to allow the release, into the plastid compartment, of a mature polypeptide with a maximum efficiency, preferably in a native form.
  • the coding sequence which can be used in the chimeric gene according to the invention comes from a herbicide tolerance gene of any phylogenetic origin. This sequence may be especially that of the mutated EPSPS having a degree of tolerance to glyphosate.
  • the promoter element according to European patent application PCT 507 698 may be of any origin, in a single or duplicated or combined form of a gene naturally expressed in plants, that is to say, for example of bacterial origin such as that of the nopaline synthase gene, or of viral origin such as that of the 35S transcript of the cauliflower mosaic virus, or preferably of plant origin such as that of the small subunit of the ribulose-1,5-bisphosphate carboxylase/oxygenase or preferably such as that of a plant histone gene and preferably from Arabidopsis thaliana .
  • a histone gene of the “H4” type is preferably used.
  • the chimeric gene according to the invention may comprise, in addition to the above essential parts, an untranslated intermediate zone (linker) between the promoter zone and the coding zone as well as between the coding zone and intron 1 and which may be of any phylogenetic origin.
  • an untranslated intermediate zone linker
  • c) 50 nanograms (ng) of DNA are mixed with 300 ng of each of the oligonucleotides and subjected to 35 amplification cycles with a Perkin-Elmer 9400 apparatus under the standard medium conditions for amplification recommended by the supplier.
  • the resulting 204 bp fragment constitutes the EPSPS fragment from Arabidopsis thaliana.
  • the pellet after precipitation with isopropanol, the pellet is taken up in water and after dissolution, adjusted to 2.5 M LiCl. After incubation for 12 h at 0° C., the pellet from the 15 min centrifugation at 30,000 g at 4° C. is resolubilized. The LiCl precipitation stage is then repeated. The resolubilized pellet constitutes the RNA fraction of the total nucleic acids.
  • RNA-poly A+ fraction of the RNA fraction is obtained by chromatography on an oligo-dT cellulose column as described in “Current Protocols in Molecular Biology”.
  • the DNA was fixed onto the filters by a 1600 kJ UV treatment (Stratalinker from Stratagene).
  • the filters were prehybridized in: 6 ⁇ SSC/0.1% SDS/0.25[lacuna] skimmed milk for 2 h at 65° C.
  • the EPSPS probe from Arabidopsis thaliana was labelled with 32 P-dCTP by random priming according to the instructions of the supplier (Kit Ready to Go from Pharmacia). The specific activity obtained is of the order of 10 3 cpm per ⁇ g of fragment. After denaturation for 5 min at 100° C., the probe is added to the prehybridization medium and the hybridization is continued for 14 hours at 55° C.
  • the filters are fluorographed for 48 h at ⁇ 80° C. with a Kodak XAR5 film and intensifying screens Hyperscreen RPN from Amersham.
  • the alignment of the positive spots on the filter with the plates from which they are derived make it possible to collect, from the plate, the zones corresponding to the phages exhibiting a positive hybridization response with the EPSPS probe from Arabidopsis thaliana . This step of plating, transfer, hybridization and recovery is repeated until all the spots of the plate of phages successively purified prove 100% positive in hybridization.
  • phages are added to 20 ml of 600hfl bacteria at OD 2 (600 nm/ml) and incubated for 15 minutes at 37° C.
  • This suspension is then diluted in 200 ml of growth medium for the bacteria in a 1l Erlenmeyer flask and shaken in a rotary shaker at 250 rpm. Lysis is observed by clarification of the medium, corresponding to lysis of the turbid bacteria and occurs after about 4 h of shaking.
  • This supernatant is then treated as described in “Current Protocols in Molecular Biology”.
  • the DNA obtained corresponds to the EPSPS clones from the BMS maize cell suspension.
  • Two ⁇ l of the above ligation mixture are used for the transformation of one aliquot of electrocompetent E. coli DH10B; the transformation occurs by electroporation using the following conditions: the mixture of competent bacteria and ligation medium is introduced into an electroporation cuvette 0.2 cm thick (Biorad) previously cooled to 0° C.
  • the physical electroporation conditions using an electroporator of Biorad trade mark are 2500 volts, 25 ⁇ Farad and 200 ⁇ . Under these conditions, the mean condenser discharge time is of the order of 4.2 milliseconds.
  • the bacteria are then taken up in 1 ml of SOC medium (ref.
  • the DNA fragments are transferred onto a Hybond N membrane from Amersham according to the Southern procedure described in “Current Protocols in Molecular Biology”.
  • the filter is hybridized with the EPSPS probe from Arabidopsis thaliana according to the conditions described in paragraph 3 above.
  • the plasmid alone having a 1.7 kbp insert and hybridizing with the EPSPS probe from Arabidopsis thaliana was prepared on a larger scale and the DNA resulting from the lysis of the bacteria purified on a CsCl gradient as described in “Current Protocols in Molecular Biology”.
  • the purified DNA was partially sequenced with a Pharmacia kit, following the supplier's instructions and using, as primers, the direct and reverse M13 universal primers ordered from the same supplier.
  • the partial sequence produced covers about 0.5 kbp.
  • the derived amino acid sequence in the region of the mature protein exhibits 100% identity with the corresponding amino sequence of the mature maize EPSPS described in American patent U.S. Pat. No. 4,971,908.
  • the complete sequence of this clone was obtained on both strands by using the Pharmacia kit procedure and by synthesizing oligonucleotides which are complementary and of opposite direction every 250 bp approximately.
  • the complete sequence of this 1713 bp clone obtained is presented by SEQ ID No. 1.
  • the clone pRPA-ML-711 was cut with the restriction enzyme AseI and the resulting ends of this cut made blunt by treating with the Klenow fragment of DNA polymerase I according to the procedure described in CPMB. A cut with the restriction enzyme SacII was then performed. The DNA resulting from these operations was separated by electrophoresis on a 1% LGTA/TBE agarose gel (ref. CPMD)
  • the gel fragment containing the insert “AseI-blunt ends/SacII” of 0.4 kbp was excised from the gel and purified according to the procedure described in paragraph 5 above.
  • the DNA of the clone pRPA-ML-711 was cut with the restriction enzyme HindIII situated in the polylinker of the cloning vector pUC19 and the ends resulting from this cut were made blunt by treating with the Klenow fragment of DNA polymerase I. A cut with the restriction enzyme SacII was then performed.
  • the DNA resulting from these manipulations was separated by electrophoresis on a 0.7% LGTA/TBE agarose gel (ref. CPMB).
  • the plasmid DNA content of the various clones was analysed according to the procedure described for pRPA-ML-711.
  • One of the plasmid clones retained contains an EcoRI-HindIII insert of about 1.45 kbp.
  • the sequence of the terminal ends of this clones shows that the 5′ end of the insert corresponds exactly to the corresponding end of pRPA-ML-711 and that the 3′ terminal end has the following sequence:
  • sequence underlined corresponds to the codon for the COOH-terminal amino acid asparagine, the next codon corresponding to the stop codon for translation.
  • the nucleotides downstream correspond to sequence components of the polylinker of pUC19. This clone, comprising the sequence of pRPAML-711 up to the site for termination of translation of the mature maize EPSPS and followed by sequences of the polylinker of pUC19 up to the HindIII site, was called pRPA-ML-712.
  • This clone has a methionine codon ATG included in an NcoI site upstream of the N-terminal alanine codon of the mature EPSPSynthase. Furthermore, the alanine and glycine codons of the N-terminal and were conserved, but modified on the third variable base: initial GCGGGT gives modified GCCGGC.
  • the clone pRPA-ML-713 was cut with the restriction enzyme HindIII and the ends of this cut made blunt by treating with the Klenow fragment of DNA polymerase I. A cut with the restriction enzyme SacI was then performed. The DNA resulting from these manipulations was separated by electrophoresis on a 0.8% LGTA/TBE agarose gel (ref. CPMB) The gel fragment containing the insert “HindIII-blunt ends/SacI” of 1.3 kbp was excised from the gel and purified according to the procedure described in paragraph 5 above.
  • This insert was ligated in the presence of DNA from the plasmid pUC19 digested with the restriction enzyme XbaI and the ends of this cut made blunt by treating with the Klenow fragment of DNA polymerase I. A cut with the restriction enzyme SacI was then performed. Two ⁇ l of the ligation mixture served to transform E. coli DH10B as described above in paragraph 5. After analysis of the plasmid DNA content of various clones according to the procedure described above in paragraph 5, one of the clones having an insert of about 1.3 kbp was conserved for subsequent analyses.
  • sequence of the terminal ends of the clone retained shows that the DNA sequence is the following: sequence of the polylinker of pUC19 of the EcoRI to SacI sites, followed by the sequence of the oligonucleotides used during the cloning, from which the 4 bp GATCC of oligonucleotide 1 described above have been deleted, followed by the rest of the sequence present in pRPA-ML-712 up to the HindIII site and sequence of the polylinker of pUC19 from XbaI to HindIII.
  • mutagenesis steps were carried out with the U.S.E. mutagenesis kit from Pharmacia, following the instructions of the supplier.
  • the principle of this mutagenesis system is as follows: the plasmid DNA is heat-denatured and recombined in the presence of a molar excess, on the one hand, of the mutagenesis oligonucleotide and, on the other hand, of an oligonuclootide which makes it possible to eliminate a unique restriction enzyme site present in the polylinker.
  • the synthesis of the complementary strand is performed by the action of T4 DNA polymerase in the presence of T4 DNA ligase and protein of gene 32 in an appropriate buffer provided.
  • the synthesis product is incubated in the presence of the restriction enzyme, whose site is supposed to have disappeared by mutagenesis.
  • the E. coli strain exhibiting, in particular, the mutS mutation is used as host for the transformation of this DNA.
  • the total plasmid DNA is prepared and incubated in the presence of the restriction enzyme used above.
  • the E. coli DH10B strain is used as host for the transformation.
  • the plasmid DNA of the isolated clones is prepared and the presence of the mutation introduced is checked by sequencing.
  • the sequence of pRPA-ML-715 is arbitrarily numbered by placing the first base of the N-terminal alanine codon GCC in position 1. This sequence has an NcoI site in position 1217.
  • the site-modifying oligonucleotide has the sequence;
  • sequence read after mutagenesis corresponds to that of the oligonucleotide used.
  • the NcoI site was indeed eliminated and translation into amino acids in this region conserves the initial sequence present in pRPA-ML-715.
  • This clone was called pRPA-ML-716.
  • oligonucleotides were used: a) Thr 102 ⁇ Ile mutation. 5′-GAATGCTGGAATCGCAATGCGGCCATTGACAGC-3′ b) Pro 106 ⁇ Ser mutation. 5′-GAATGCTGGAACTGCAATGCGGTCCTTGACAGC-3′ c) Gly 101 ⁇ Ala and Thr 102 ⁇ Ile mutations. 5′-CTTGGGGAATGCTGCCATCGCAATGCGGCCATTG-3′ d) Thr 102 ⁇ Ile and Pro 106 ⁇ Ser mutations. 5′-GGGGAATGCTGGAATCGCAATGCGGTCCTTGACAGC-3′
  • the sequence read after mutagenesis on the three mutated fragments is identical to the sequence of the parental DNA pRPA-ML-716 with the exception of the mutagenesis region which corresponds to that of the mutagenesis oligonucleotides used.
  • These clones were called: pRPA-ML-717 for the Thr 102 ⁇ Ile mutation, pRPA-ML-718 for the Pro 106 ⁇ Ser mutation, pRPA-ML-719 for the Gly 101 ⁇ Ala and Thr 102 ⁇ Ile mutations and pRPA-ML-720 for the Thr 102 ⁇ Ile and Pro 106 ⁇ Ser mutations.
  • the 1340 bp sequence of pRPA-ML-720 is represented as SEQ ID No. 4 and SEQ ID No. 5.
  • a DNA fragment of 414 base pairs is purified from digestion of the cosmid clone c22 with the restriction enzyme DdeI followed by treatment with a Klenow fragment of DNA polymerase from E. coli , according to the manufacturer's instructions for creating a blunt-ended DNA fragment and then cut with MseI.
  • the purified DNA fragment is ligated to a synthetic oligonucleotide adapter having the following sequence: Adaptor 1: 5′ TAATTTGTTGAACAGATCCC 3′ TAAACAACTTGTCTAGGG
  • a DNA fragment of 494 base pairs is purified from the digestion of the cosmid clone c22 with the restriction enzymes AluI and CfoI.
  • the purified DNA fragment is listed to a synthetic oligonucleotide adaptor having the following sequence: Adaptor 2: 5′ CAGATCCCGGGATCTGCG 3′ GCGTCTAGGGCCCTAGACGC
  • the ligation product is cloned into pGEM7Zf (+) (Stratagene catalogue No. P2251) which was digested with SmaI. This clone, called “intron No. 2”, is checked by sequencing (SEQ ID No. 7).
  • This plasmid is a derivative of pBI 101.1 (Clonetech catalogue No. 6017-1) which contains the histone promoter from Arabidopsis H4A748 regulating the synthesis of the E. coli ⁇ -glucoronidase gene and of the nopaline synthase (“NOS”) polyadenylation site.
  • NOS nopaline synthase
  • This plasmid contains the above intron No. 1 placed between the H4A748 promoter and the GUS coding region of pRA-1. This plamid is obtained by digestion of cosmid clone c22 with BamHI and SmaI. The intron No. 1 of 418 base pairs is directly ligated into pRA-1 which was digested with BamHI and SmaI.
  • This plasmid contains the above intron No. 2 placed between the H4A748 promoter and the GUS coding region of pRA-1. This plasmid is obtained by digestion of cosmid clone c22 with BamHI and SmaI. The intron No. 2 of 494 base pairs is directly ligated into pRA-1 which was digested with BamHI and SmaI.
  • This plasmid contains only intron No. 1 before the above GUS coding sequence placed between the H4A748 promoter and the GUS coding region of pCG-1.
  • This plasmid is obtained by digestion of pCG-1 with BamHI and HindIII followed by treatment with a Klenow fragment of DNA polymerase from E. coli , according to the manufacturer's instructions for creating a blunt-ended DNA fragment.
  • This vector is then religated to give a chimeric gene having the structure:
  • This plasmid contains only the above intron No. 2 in front of the GUS coding sequence of pCG-13.
  • This plasmid is obtained by partial digestion of pCG-13 with BamHI and SphI, followed by treatment with a fragment of T4 phage DNA polymerase, according to the manufacturer's instructions in order to create a blunt-ended DNA fragment.
  • This vector is then religated and checked by enzymatic digestion in order to give a chimeric gene having the structure:
  • pRPA-ML-720 Addition of a “nos” polyadenylation signal to pRPA-ML-720 with creation of a cloning cassette containing the maize double mutant EPSPS gene (Thr 102 ⁇ Ile and Pro 106 ⁇ ser).
  • pRPA-ML-720 is digested with HindIII and treated with the Klenow fragment of DNA polymerase from E. coli in order to produce a blunt end. A second digestion is carried out with NcoI and the EPSPS fragment is purified.
  • the EPSPS gene is then ligated with purified pRPA-RD-12 (a cloning cassette containing the nopaline synthase polyadenylation signal) to give pRPA-RD-124.
  • pRPA-RD-12 a cloning cassette containing the nopaline synthase polyadenylation signal
  • the “intron No. 1+ ⁇ -glucoronidase gene from E. coli ” portion of pCG-1 is replaced by a chimeric gene of 2 kilobases containing an optimized signal peptide, a double mutant EPSPS gene (Ile 102 +Ser 106 ) and a nopaline synthase polyadenylation site (“NOS”) isolated from pRPA-RD-125.
  • NOS nopaline synthase polyadenylation site isolated from pRPA-RD-125.
  • the digestion of pCG-1 is performed with EcoRI and BamHI, followed by treatment with a Klenow fragment of DNA polymerase from E. coli , according to the manufacturer's instructions in order to create a blunt-ended DNA fragment.
  • the 2-kilobase DNA fragment containing an optimized signal peptide of a double mutant EPSPS gene (Ile 102 +Ser 106 ) and a nopaline synthase polyadenylation site (“NOS”) is obtained from pRPA-RD-125 by digestion with NcoI and NotI, followed by treatment with DNA polymerase from E. coli , according to the manufacturer's instructions in order to create a blunt-ended DNA fragment. This blunt-ended fragment is then ligated into pCG-1 prepared above.
  • a chimeric gene is thus obtained having the structure:
  • the “ ⁇ -glucoronidase gene from E. coli portion of pCG-1 is replaced by a chimeric gene of 2 kilobases containing an optimized signal peptide, a double mutant EPSPS gene (Ile 102 +Ser 106 ) and a nopaline synthase polyadenylation site (“NOS”) isolated from pRPA-RD-125.
  • NOS nopaline synthase polyadenylation site isolated from pRPA-RD-125.
  • the digestion of pCG-1 is performed with EcoRI, followed by treatment with a Klenow fragment of DNA polymerase from E. coli , according to the manufacturer's instructions in order to create a blunt-ended DNA fragment, then cut with SmaI.
  • the 2-kilobase DNA fragment containing an optimized signal peptide, a double mutant EPSPS gene (Ile 102 +Ser 106 ”) and a nopaline synthase polyadenylation site (“NOS”) is obtained from pRPA-RD-125 by digestion with NcoI and NotI, followed by a treatment with DNA polymerase from E. coli , according to the manufacturer's instructions in order to create a blunt-ended DNA fragment. This blunt-ended fragment is then ligated into pCG-1 prepared above.
  • a chimeric gene is thus obtained having the structure:
  • the “ ⁇ -glucoronidase gene from E. coli ” portion of pCG-13 is replaced by a chimeric gene of 2 kilobases containing an optimized signal peptide, a double mutant EPSPS gene (Ile 102 +Ser 106 ) and a nopaline synthase polyadenylation site (“NOS”) isolated from pRPA-RD-125.
  • NOS nopaline synthase polyadenylation site isolated from pRPA-RD-125.
  • the digestion of pCG-13 is performed with EcoRI, followed by treatment with a Klenow fragment of DNA polymerase from E. coli , according to the manufacturer's instructions in order to create a blunt-ended DNA fragment, then cut with SmaI.
  • the 2-kilobase DNA fragment containing an optimized signal peptide, a double mutant EPSPS gene (Ile 102 +Ser 106 ) and a nopaline synthase polyadenylation site (“NOS”) is obtained from pRPA-RD-123 by digestion with NcoI and NotI, followed by a treatment with DNA polymerase from E. coli , according to the manufacturer's instructions in order to create a blunt-ended DNA fragment. This blunt-ended fragment is then ligated into pCG-13 prepared above.
  • a chimeric gene is thus obtained having the structure:
  • the vector is introduced into the nononcogenic strain of Agrobacterium tumefaciens LBA 4404 available from a catalogue (Clontech #6027-1) by triparental crossing using the “helper” plasmid pRK 2013 in Escherichia coil HB101 according to the procedure described by Bevan M. (1984) Nucl. Acids Res., 12, 8711-8721.
  • the GUS activity measured by fluorometry on extracts of floral and leaf buds of the rosette shows that the activity of the H4A74B promoter is increased under the influence of intron Nos. 1 and 2.
  • the GUS activity of pCG-1 and pCG-13 are at least six times greater in the floral buds, twenty times greater in the leaves of the rosette and twenty-six times greater in the roots.
  • the vector is introduced into the nononcogenic strain of Agrobacterium tumefaciens LBA 4404 available from a catalogue (Clontech #6027-1) by triparental crossing using the “helper” plasmid pRK 2013 in Escherichia coli HB101 according to the procedure described by Bevan M. (1984) Nucl. Acids Res., 12, 8711-8721.
  • the transformation technique using foliar explants of tobacco is based on the procedure described by Horsh R. et al. (1985) Science, 227, 1229-1231.
  • the regeneration of the PBD6 tobacco (origin SEITA-France) from foliar explants is carried out on a Murashige and Skoog (MS) basal medium comprising 30 g/l of sucrose as well as 200 ⁇ g/ml of kanamycin in three successive steps: the first comprises the induction of shoots on an MS medium supplemented with 30 g of sucrose containing 0.05 mg of naphthylacetic acid (NAA) and 2 mg/l of benzylaminopurine (BAP) for 15 days.
  • MS Murashige and Skoog
  • the shoots formed during this step are then developed by culturing on an MS medium supplemented with 30 g/l of sucrose but not containing any hormone, for 10 days.
  • the developed shoots are then removed and they are cultured on an MS rooting medium diluted one half, with half the content of salts, vitamins and sugars and not containing any hormone. After about 15 days, the rooted shoots are planted in the soil.
  • results correspond to the observation of phytotoxicity values noted 3 weeks after treatment. Under these conditions, it is observed that the plants transformed with the constructs have on average an acceptable tolerance (pRPA-RD-196) or even a good tolerance (pRPA-RD-197 and pRPA-RD-196) whereas the untransformed control plants are completely destroyed.
  • the transformed plants according to the invention may be used as parents for producing lines and hybrids having the phenotypic character corresponding to the expression of the chimeric gene introduced.

Abstract

An isolated DNA sequence capable of serving as regulatory element in a chimeric gene which can be used for the transformation of plants is disclosed. A chimeric gene for the transformation of plants is also disclosed. The gene comprises at least, in the direction of transcription, a promoter sequence, a transgene and a regulatory element, characterized in that the regulatory element consists of at least one intron 1 in the noncoding 5′ region of a plant histone gene allowing the expression of the protein in the zones undergoing rapid growth. The production of transgenic plants is also disclosed.

Description

  • The present invention relates to the use of a regulatory element isolated from transcribed plant genes, of new chimeric genes containing then and to their use for the transformation of plants. [0001]
  • Numerous phenotypic characters associated with the expression of one or more gene elements can be integrated into the genome of plants and thus confer on those transgenic plants advantageous agronomic properties. In a nonexhaustive manner, there may be mentioned: the resistances to pathogenic agents for crops, the resistance to phytotoxic plant-protection products, the production of substances of dietary or pharmacological interest. In addition to the isolation and characterization of the gene elements encoding these various characters, an appropriate expression should be ensured. This appropriate expression may be situated both at the qualitative and quantitative levels. At the qualitative level, for example the spatial level: preferential expression in a specific tissue, or temporal level: inducible expression; at the quantitative level, by the accumulated quantity of the product of expression of the gene introduced. This appropriate expression depends, for a large part, an the presence of regulatory gene elements associated with the transgenes, in particular as regards the quantitative and qualitative elements. Among the key elements ensuring this appropriate regulation, the use of single or combined homologous or heterologous promoter elements has been widely described in the scientific literature. The use of a regulatory element downstream of the transgene was used for the sole purpose of putting a boundary which makes it possible to stop the process of transcription of the transgene, without presupposition as to their role as regards the quality or the quantity of the expression of the transgene. [0002]
  • The present invention relates to the use of an intron 1 isolated from plant genes as a regulatory element, of now chimeric genes containing them and to their use for the transformation of plants. It relates to an isolated DNA sequence capable of serving as a regulatory element in a chimeric gene which can be used for the transformation of plants and allowing the expression of the product of translation of the chimeric gene in particular in the regions of the plant undergoing rapid growth, which comprises, in the direction of transcription of the chimeric gene, at least one intron such as the first intron (intron 1) of the noncoding 5′ region of a plant histone gene. It relates more particularly to the simultaneous use of the intron 1 as a regulatory element and of promoters isolated from the same plant gene. it allows the appropriate expression, both quantitative and qualitative, of the transgenes under the control of these elements for gene regulation. This appropriate expression, obtained by the use of the present invention, may relate to characters such as; the resistance to pathogenic agents for crops, the resistance to phytotoxic plant-protection products, the production of substances of dietary or pharmacological interest. in particular, it makes it possible to confer on the transgenic plants an enhanced tolerance to herbicides by a qualitative and quantitative preferential expression of the product of expression of the chimeric genes in the regions of the plant undergoing rapid growth. This specific appropriate expression of the gene for herbicide resistance is obtained by the simultaneous use of the promoter regulatory elements and of at least one intron 1 of the histone gene of the “H3.3- like” type as regulatory element. Such a pattern of expression can be obtained for all the characters which are of interest, as described above, with the regulatory elements used to confer an enhanced herbicide tolerance. The present invention also relates to the plant cells transformed with the aid of these genes and the transformed plants regenerated from these cells as well as the plants derived from crossings using these transformed plants. [0003]
  • Among the plant-protection products used for the protection of crops, the systemic products are characterized in that they are transported in the plant after application and, for some of them, accumulate in the parts undergoing rapid growth, especially the caulinary and root apices, causing, in the case of herbicides, deterioration, up to the destruction, of the sensitive plants. For some of the herbicides exhibiting this type of behaviour, the primary mode of action is known and results from inactivation of characterized enzymes involved in the biosynthesis pathways of compounds required for proper development of the target plants. The target enzymes of those products may be located in various subcellular compartments and observation of the mode of action of known products most often shows a location in the plastid compartment. [0004]
  • Tolerance of plants sensitive to a product belonging to this group of herbicides, and whose primary target is known, may be obtained by stable introduction, into their genome, of a gene encoding the target enzyme, of any phylogenetic origin, mutated or otherwise with respect to the characteristics of inhibition, by the herbicide, of the product of expression of this gene. Another approach comprises introducing, in a stable manner, into the genome of sensitive plants a gene of any phylogenetic origin encoding an enzyme capable of metabolizing the herbicide into a compound which is inactive and nontoxic for the development of the plant. In the latter came, it is not necessary to have characterized the target of the herbicide. [0005]
  • Given the mode of distribution and accumulation of products of this type in the treated plants, it is advantageous to be able to express the product of translation of these genes so as to allow their preferential expression and their accumulation in the regions of the plant undergoing rapid growth where these products accumulate. Furthermore, and in the case where the target of these products is located in a cellular compartment other than the cytoplasm, it is advantageous to be able to express the product of translation of these genes in the form of a precursor containing a polypeptide sequence allowing directing of the protein conferring the tolerance into the appropriate compartment, and in particular in the plastid compartment. [0006]
  • By way of example illustrating this approach, there may be mentioned glyphosate, sulfosate or fosametine which are broad-spectrum systemic herbicides of the phosphonomethylglycine family. They act essentially as competitive inhibitors, in relation to PEP (phosphoenolpyruvate), of 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS, EC 2.5.1.19). After their application to the plant, they are transported into the plant where they accumulate in the parts undergoing rapid growth, especially the caulinary and root apices, causing the deterioration, up to the destruction, of the sensitive plants. [0007]
  • EPSPS, the principal target of these products, is an enzyme of the pathway of biosynthesis of aromatic amino acids which is located in the plastid compartment. This enzyme is encoded by one or more nuclear genes and is synthesized in the form of a cytoplasmic precursor and then imported into the plastids where it accumulates in its mature form. [0008]
  • The tolerance of plants to glyphosate and to products of the family is obtained by the stable introduction, into their genome, of an EPSPS gene of plant or bacterial origin, mutated or otherwise with respect to the characteristics of inhibition, by glyphosate, of the product of this gene. Given the mode of action of glyphosate, it is advantageous to be able to express the product of translation of this gene so as to allow its high accumulation in the plastids and, furthermore, in the regions of the plant undergoing rapid growth where the products accumulate. [0009]
  • It is known, for example, from American patent 4,535,060 to confer on a plant a tolerance to a herbicide of the above type, in particular N-phosphonomethylglycine or glyphosate, by introduction, into the genome of the plants, of a gene encoding an EPSPS carrying at least one mutation making this enzyme more resistant to its competitive inhibitor (glyphosate), after location of the enzyme in the plastid compartment. These techniques require, however, to be improved for greater reliability in the use of these plants during a treatment with these products under agronomic conditions. [0010]
  • In the present description, “plant” is understood to mean any differentiated multicellular organism capable of photosynthesis and “plant cell” any cell derived from a plant and capable of constituting undifferentiated tissues such as calli, or differentiated tissues such as embryos or plant portions or plants or seeds. “Intron 1 of Arabidopsis as a regulatory element” is understood to mean an isolated DNA sequence of variable length, situated upstream of the coding part or corresponding to the structural part of a transcribed gene. Gene for tolerance to a herbicide is understood to mean any gene, of any phylogenetic origin, encoding either the target enzyme for the herbicide, optionally having one or more mutations with respect to the characteristics of inhibition by the herbicide, or an enzyme capable of metabolizing the herbicide into a compound which is inactive and nontoxic for the plant. Zones of the plants undergoing rapid growth are understood to mean the regions which are the seat of substantial cell multiplications, in particular the apical regions. [0011]
  • The present invention relates to the production of transformed plants having an enhanced tolerance to herbicides accumulating in the zones of the treated plants undergoing rapid growth, by regeneration of cells transformed with the aid of new chimeric genes comprising a gene for tolerance to these products. The subject of the invention is also the production of transformed plants having an enhanced tolerance to herbicides of the phosphonomethylglycine family by regeneration of cells transformed with the aid of new chimeric genes comprising a gene for tolerance to these herbicides. The invention also relates to these new chimeric genes, as well as to transformed plants which are more tolerant because of a better tolerance in the parts of these plants undergoing rapid growth, as well as to the plants derived from crossings using these transformed plants. Its subject is also new intron 1 of a plant histone and its use as regulatory zone for the construction of the above chimeric genes. [0012]
  • More particularly, the subject of the invention is a chimeric gene for conferring on plants especially an enhanced tolerance to a herbicide having EPSPS as target, comprising, in the direction of transcription, a promoter element, a signal peptide sequence, a sequence encoding an enzyme for tolerance to the products of the phosphonomethylglycine family and a regulatory element, characterized in that the regulatory element comprises a fragment of an intron 1 of a plant histone gene in any orientation relative to its initial orientation in the gene from which it is derived, allowing the preferential expression and the accumulation of the protein for tolerance to the herbicide in the zones for accumulation of the said herbicide. [0013]
  • The histone gene, from which intron 1 according to the invention is derived, comes from a monocotyledonous plant such an for example wheat, maize or rice, or preferably from a dicotyledonous plant such as for example lucerne, sunflower, soya bean, rapeseed or preferably [0014] Arabidopsis thaliana. Preferably, a histone gene of the “H3.3-like” type is used.
  • The signal peptide sequence comprises, in the direction of transcription, at least one signal peptide sequence of a plant gene encoding a signal peptide directing transport of a polypeptide to a plastid, a portion of the sequence of the mature N-terminal part of a plant gene produced when the first signal peptide is cleaved by proteolytic enzymes, and then a second signal peptide of a plant gene encoding a signal peptide directing transport of the polypeptide to a sub-compartment of the plastid. The signal peptide sequence is preferably derived from a gene for the small subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase (RuBisco) according to European patent application PCT 508 909. The role of this characteristic sequence is to allow the release, into the plastid compartment, of a mature polypeptide with a maximum efficiency, preferably in a native form. [0015]
  • The coding sequence which can be used in the chimeric gene according to the invention comes from a herbicide tolerance gene of any phylogenetic origin. This sequence may be especially that of the mutated EPSPS having a degree of tolerance to glyphosate. [0016]
  • The promoter element according to European patent application PCT 507 698 may be of any origin, in a single or duplicated or combined form of a gene naturally expressed in plants, that is to say, for example of bacterial origin such as that of the nopaline synthase gene, or of viral origin such as that of the 35S transcript of the cauliflower mosaic virus, or preferably of plant origin such as that of the small subunit of the ribulose-1,5-bisphosphate carboxylase/oxygenase or preferably such as that of a plant histone gene and preferably from [0017] Arabidopsis thaliana. A histone gene of the “H4” type is preferably used.
  • The chimeric gene according to the invention may comprise, in addition to the above essential parts, an untranslated intermediate zone (linker) between the promoter zone and the coding zone as well as between the coding zone and intron 1 and which may be of any phylogenetic origin. [0018]
  • The following examples show by way of illustration, but with no limitation being implied, several aspects of the invention: isolation of the introns according to the invention and their use for the genetic transformation of plants as well as the improved qualities of expression of the heterologous genes of plants transformed with the aid of these introns. References to “Current Protocols in Molecular Biology” are to Volumes 1 and 2, Ausubel F. M. et al., published by Greene Publishing associates and Wiley Interscience (1989) (CPMB).[0019]
  • EXAMPLE 1
  • 1. Production of an EPSPS fragment from [0020] Arabidopsis thaliana
  • a) two 20-mer oligonucleotides of respective sequences: [0021]
    5′-GCTCTGCTCATGTCTGCTCC-3′
    5′-GCCCGCCCTTGACAAAGAAA-3′
  • were synthesized from the sequence of an EPSPS gene from [0022] Arabidopsis thaliana (Klee H. J. et al., (1987) Mol. Gen. Genet., 210, 437-442). These two oligonucleotides correspond to positions 1523 to 1543 and 1737 to 1717, respectively, of the published sequence and in convergent orientation.
  • b) The total DNA from [0023] Arabidopsis thaliana (var. columbia) was obtained from Clontech (catalogue reference: 6970-1)
  • c) 50 nanograms (ng) of DNA are mixed with 300 ng of each of the oligonucleotides and subjected to 35 amplification cycles with a Perkin-Elmer 9400 apparatus under the standard medium conditions for amplification recommended by the supplier. The resulting 204 bp fragment constitutes the EPSPS fragment from [0024] Arabidopsis thaliana.
  • 2. Construction of a library of a cDNA from a BMS maize cell line. [0025]
  • a) 5 g of filtered cells are ground in liquid nitrogen and the total nucleic acids extracted according to the method described by Shure et al. with the following modifications: [0026]
  • the pH of the lysis buffer is adjusted to pH=9.0 [0027]
  • after precipitation with isopropanol, the pellet is taken up in water and after dissolution, adjusted to 2.5 M LiCl. After incubation for 12 h at 0° C., the pellet from the 15 min centrifugation at 30,000 g at 4° C. is resolubilized. The LiCl precipitation stage is then repeated. The resolubilized pellet constitutes the RNA fraction of the total nucleic acids. [0028]
  • b) the RNA-poly A+ fraction of the RNA fraction is obtained by chromatography on an oligo-dT cellulose column as described in “Current Protocols in Molecular Biology”. [0029]
  • c) Synthesis of double-stranded cDNA with an EcoRI synthetic end; it is carried out by following the procedure of the supplier of the various reagents necessary for this synthesis in the form of a kit: the “copy kit” from the company Invitrogen. [0030]
  • Two single-stranded and partially complementary oligonucleotides of respective sequences: [0031]
    5′-AATTCCCGGG-3′
    5′-CCCGGG-3′
  • (the latter being phosphorylated) are ligated to double-stranded cDNAs with blunt ends. [0032]
  • This ligation of the adaptors results in the creation of SmaI sites attached to the double-stranded cDNAs and of EcoRI sites in cohesive form at each and of the double-stranded cDNAs. [0033]
  • d) Creation of the library: [0034]
  • The cDNAs having at their ends the cohesive artificial EcoRI sites are ligated to the λgt10 bacteriophage cDNA cut with EcoRI and dephosphorylated according to the procedure of the supplier New England Biolabs. [0035]
  • An aliquot from the ligation reaction was encapsidated in vitro with encapsidation extracts: Gigapack Gold according to the supplier's instructions, this library was titrated using the bactertium [0036] E. coli C600 hfl. The library thus obtained is amplified and stored according to the instructions of the same supplier and constitutes the cDNA library from BMS maize cell suspension.
  • 3. screening of the cDNA library from BMS maize cell suspension with the EPSPS probe from [0037] Arabidopsis thaliana:
  • The procedure followed is that of “Current Protocols in Molecular Biology”. Briefly, about 10[0038] 6 recombinant phages are plated on an LB plate at a mean density of 100 phages/cm2. The lysis plaques are replicated in duplicate on a Hybond N membrane from Amersham.
  • The DNA was fixed onto the filters by a 1600 kJ UV treatment (Stratalinker from Stratagene). The filters were prehybridized in: 6×SSC/0.1% SDS/0.25[lacuna] skimmed milk for 2 h at 65° C. The EPSPS probe from [0039] Arabidopsis thaliana was labelled with 32P-dCTP by random priming according to the instructions of the supplier (Kit Ready to Go from Pharmacia). The specific activity obtained is of the order of 103 cpm per μg of fragment. After denaturation for 5 min at 100° C., the probe is added to the prehybridization medium and the hybridization is continued for 14 hours at 55° C. The filters are fluorographed for 48 h at −80° C. with a Kodak XAR5 film and intensifying screens Hyperscreen RPN from Amersham. The alignment of the positive spots on the filter with the plates from which they are derived make it possible to collect, from the plate, the zones corresponding to the phages exhibiting a positive hybridization response with the EPSPS probe from Arabidopsis thaliana. This step of plating, transfer, hybridization and recovery is repeated until all the spots of the plate of phages successively purified prove 100% positive in hybridization. A lysis plaque per independent phage in then collected in the diluent λ medium (Tris-Cl pH=7.5; 10 mM MgSO4; 0.1 M NaCl; 0.1% gelatine), these phages in solution constituting the positive EPSPS clones from the BMS maize cell suspension.
  • 4. Preparation and analysis of the DNA of the EPSPS clones from the BMS maize cell suspension. [0040]
  • About 5×10[0041] 3 phages are added to 20 ml of 600hfl bacteria at OD 2 (600 nm/ml) and incubated for 15 minutes at 37° C. This suspension is then diluted in 200 ml of growth medium for the bacteria in a 1l Erlenmeyer flask and shaken in a rotary shaker at 250 rpm. Lysis is observed by clarification of the medium, corresponding to lysis of the turbid bacteria and occurs after about 4 h of shaking. This supernatant is then treated as described in “Current Protocols in Molecular Biology”. The DNA obtained corresponds to the EPSPS clones from the BMS maize cell suspension.
  • One to two μg of this DNA are cut with EcoRI and separated on a 0.8% LGTA/TBE agarose gel (ref. CPMB). A final verification consists in ensuring that the purified DNA indeed exhibits a hybridization signal with the EPSPS probe from [0042] Arabidopsis thaliana. After electrophoresis, the DNA fragments are transferred onto Hybond N membrane from Amersham according to the Southern procedure described in “Current Protocols in Molecular Biology”. The filter is hybridized with the EPSPS probe from Arabidopsis thaliana according to the conditions described in paragraph 3 above. The clone exhibiting a hybridization signal with the EPSPS probe from Arabidopsis thaliana and containing the longest EcoRI fragment has a gel-estimated size of about 1.7 kbp.
  • 5. Production of the pRPA-ML-711clone: [0043]
  • Ten μg of DNA from the phage clone containing the 1.7 kbp insert are digested with EcoRI and separated on a 0.8% LGTA/TBE agarose gel (ref. CPMB). The gel fragment containing the 1.7 kbp insert is excised from the gel by BET staining and the fragment is treated with β-agarase according to the procedure of the supplier New England Biolabs. The DNA purified from the 1.7 kbp fragment is ligated at 12° C. for 14 h with DNA from the plasmid pUC 19 (New England Biolabs) cut with EcoRI according to the ligation procedure described in “Current Protocols in Molecular Biology”. Two μl of the above ligation mixture are used for the transformation of one aliquot of electrocompetent [0044] E. coli DH10B; the transformation occurs by electroporation using the following conditions: the mixture of competent bacteria and ligation medium is introduced into an electroporation cuvette 0.2 cm thick (Biorad) previously cooled to 0° C. The physical electroporation conditions using an electroporator of Biorad trade mark are 2500 volts, 25 μFarad and 200 Ω. Under these conditions, the mean condenser discharge time is of the order of 4.2 milliseconds. The bacteria are then taken up in 1 ml of SOC medium (ref. CPMB) and shaken for 1 hour at 200 rpm on a rotary shaker in 15 ml Corning tubes. After plating on LB/agar medium supplemented with 100 μg/ml of carbenicillin, the mini-preparations of the bacteria clones having grown overnight at 37° C. are carried out according to the procedure described in “Current Protocols in Molecular Biology”. After digestion of the DNA with EcoRI and separation by electrophoresis on a 0.8% LGTA/TBE agarose gel (ref. CPMB), the clones having a 1.7 kbp insert are conserved. A final verification consists in ensuring that the purified DNA indeed exhibits a hybridization signal with the EPSPS probe from Arabidopsis thaliana. After electrophoresis, the DNA fragments are transferred onto a Hybond N membrane from Amersham according to the Southern procedure described in “Current Protocols in Molecular Biology”. The filter is hybridized with the EPSPS probe from Arabidopsis thaliana according to the conditions described in paragraph 3 above. The plasmid alone having a 1.7 kbp insert and hybridizing with the EPSPS probe from Arabidopsis thaliana was prepared on a larger scale and the DNA resulting from the lysis of the bacteria purified on a CsCl gradient as described in “Current Protocols in Molecular Biology”. The purified DNA was partially sequenced with a Pharmacia kit, following the supplier's instructions and using, as primers, the direct and reverse M13 universal primers ordered from the same supplier. The partial sequence produced covers about 0.5 kbp. The derived amino acid sequence in the region of the mature protein (about 50 amino acid residues) exhibits 100% identity with the corresponding amino sequence of the mature maize EPSPS described in American patent U.S. Pat. No. 4,971,908. This clone, corresponding to a 1.7 kbp EcoRI fragment of the DNA for the EPSP from the BMS maize cell suspension, was called pRPA-ML-711. The complete sequence of this clone was obtained on both strands by using the Pharmacia kit procedure and by synthesizing oligonucleotides which are complementary and of opposite direction every 250 bp approximately. The complete sequence of this 1713 bp clone obtained is presented by SEQ ID No. 1.
  • 6. Production of the clone pRPA-ML-715: [0045]
  • Analysis of the sequence of the clone pRPA-ML-711 and in particular comparison of the derived amino acid sequence with that from maize shows a sequence extension of 92 bp upstream of the GCG codon encoding the NH[0046] 2-terminal alanine of the mature part of the maize EPSPS (American patent U.S. Pat. No. 4,971,908). Likewise, a 288 bp extension downstream of the AAT codon encoding the COOH-terminal asparagine of the mature part of the maize EPSPS (American patent U.S. Pat. No. 4,971,908) is observed. These two parts might correspond, for the NH2-terminal extension, to a portion of the sequence of a signal peptide before plastid location and, for the COOH-terminal extension, to the untranslated 3′ region of the cDNA.
  • In order to obtain a cDNA encoding the mature part of the cDNA for the maize EPSPS, as described in U.S. Pat. No. 4,971,908, the following operations were carried out: [0047]
  • a) Elimination of the untranslated 3′ region: construction of pRPA-ML-712: [0048]
  • The clone pRPA-ML-711 was cut with the restriction enzyme AseI and the resulting ends of this cut made blunt by treating with the Klenow fragment of DNA polymerase I according to the procedure described in CPMB. A cut with the restriction enzyme SacII was then performed. The DNA resulting from these operations was separated by electrophoresis on a 1% LGTA/TBE agarose gel (ref. CPMD) [0049]
  • The gel fragment containing the insert “AseI-blunt ends/SacII” of 0.4 kbp was excised from the gel and purified according to the procedure described in paragraph 5 above. The DNA of the clone pRPA-ML-711 was cut with the restriction enzyme HindIII situated in the polylinker of the cloning vector pUC19 and the ends resulting from this cut were made blunt by treating with the Klenow fragment of DNA polymerase I. A cut with the restriction enzyme SacII was then performed. The DNA resulting from these manipulations was separated by electrophoresis on a 0.7% LGTA/TBE agarose gel (ref. CPMB). [0050]
  • The gel fragment containing the insert HindIII-blunt ends/SacII of about 3.7 kbp was excised from the gel and purified according to the procedure described in paragraph 5 above. [0051]
  • The two inserts were ligated, and 2 μl of the ligation mixture served to transform [0052] E. coli DH10B as described above in paragraph 5.
  • The plasmid DNA content of the various clones was analysed according to the procedure described for pRPA-ML-711. One of the plasmid clones retained contains an EcoRI-HindIII insert of about 1.45 kbp. The sequence of the terminal ends of this clones shows that the 5′ end of the insert corresponds exactly to the corresponding end of pRPA-ML-711 and that the 3′ terminal end has the following sequence: [0053]
  • “5′. . . AATTAAGCTCTAGAGTCGACCTGCAGGCATGCAAGCTT-3′”. [0054]
  • The sequence underlined corresponds to the codon for the COOH-terminal amino acid asparagine, the next codon corresponding to the stop codon for translation. The nucleotides downstream correspond to sequence components of the polylinker of pUC19. This clone, comprising the sequence of pRPAML-711 up to the site for termination of translation of the mature maize EPSPS and followed by sequences of the polylinker of pUC19 up to the HindIII site, was called pRPA-ML-712. [0055]
  • b) Modification of the 5′ end of pRPA-ML-712: construction of pRPA-ML-715 [0056]
  • The clone pRPA-NL-712 was cut with the restriction enzymes PstI and HindIII. The DNA resulting from these manipulations was separated by electrophoresis on a 0.8% LGTA/TBE agarose gel (ref. CPMB). The gel fragment containing the PstI/EcoRI insert of 1.3 kbp was excised from the gel and purified according to the procedure described in paragraph 5 above. This insert was ligated in the presence of an equimolar quantity of each of the two partially complementary oligonucleotides of sequence: [0057]
    Oligo 1:
    5′-GAGCCGAGCTCCATGGCCGGCGCCGAGGAGATCGTGCTGCA-3′
    Oligo 2:
    5′-GCACGATCTCCTCGGCGCCGGCCATGGAGCTCGGCTC-3′
  • as well as in the presence of DNA from the plasmid pUC19 digested with the restriction enzymes BamHI and HindIII. [0058]
  • Two μl of the ligation mixture served to transform [0059] E. coli DH10B as described above in paragraph 5. After analysis of the plasmid DNA content of various clones according to the procedure described above in paragraph 5, one of the clones having an insert of about 1.3 kbp was conserved for subsequent analyses. The sequence of the terminal 5′ end of the clone retained shows that the DNA sequence in this region is the following: sequence of the polylinker of pUC19 of the EcoRI to BamHI sites, followed by the sequence of the oligonucleotides used during the cloning, followed by the rest of the sequence present in pRPAML-712. This clone was called pRPA-ML-713. This clone has a methionine codon ATG included in an NcoI site upstream of the N-terminal alanine codon of the mature EPSPSynthase. Furthermore, the alanine and glycine codons of the N-terminal and were conserved, but modified on the third variable base: initial GCGGGT gives modified GCCGGC.
  • The clone pRPA-ML-713 was cut with the restriction enzyme HindIII and the ends of this cut made blunt by treating with the Klenow fragment of DNA polymerase I. A cut with the restriction enzyme SacI was then performed. The DNA resulting from these manipulations was separated by electrophoresis on a 0.8% LGTA/TBE agarose gel (ref. CPMB) The gel fragment containing the insert “HindIII-blunt ends/SacI” of 1.3 kbp was excised from the gel and purified according to the procedure described in paragraph 5 above. This insert was ligated in the presence of DNA from the plasmid pUC19 digested with the restriction enzyme XbaI and the ends of this cut made blunt by treating with the Klenow fragment of DNA polymerase I. A cut with the restriction enzyme SacI was then performed. Two μl of the ligation mixture served to transform [0060] E. coli DH10B as described above in paragraph 5. After analysis of the plasmid DNA content of various clones according to the procedure described above in paragraph 5, one of the clones having an insert of about 1.3 kbp was conserved for subsequent analyses. The sequence of the terminal ends of the clone retained shows that the DNA sequence is the following: sequence of the polylinker of pUC19 of the EcoRI to SacI sites, followed by the sequence of the oligonucleotides used during the cloning, from which the 4 bp GATCC of oligonucleotide 1 described above have been deleted, followed by the rest of the sequence present in pRPA-ML-712 up to the HindIII site and sequence of the polylinker of pUC19 from XbaI to HindIII. This clone was called pRPA-NL-715.
  • 7) Production of a cDNA encoding a mature [0061]
  • All the mutagenesis steps were carried out with the U.S.E. mutagenesis kit from Pharmacia, following the instructions of the supplier. The principle of this mutagenesis system is as follows: the plasmid DNA is heat-denatured and recombined in the presence of a molar excess, on the one hand, of the mutagenesis oligonucleotide and, on the other hand, of an oligonuclootide which makes it possible to eliminate a unique restriction enzyme site present in the polylinker. After the reassociation step, the synthesis of the complementary strand is performed by the action of T4 DNA polymerase in the presence of T4 DNA ligase and protein of gene 32 in an appropriate buffer provided. The synthesis product is incubated in the presence of the restriction enzyme, whose site is supposed to have disappeared by mutagenesis. The [0062] E. coli strain exhibiting, in particular, the mutS mutation is used as host for the transformation of this DNA. After growth in liquid medium, the total plasmid DNA is prepared and incubated in the presence of the restriction enzyme used above. After these treatments, the E. coli DH10B strain is used as host for the transformation. The plasmid DNA of the isolated clones is prepared and the presence of the mutation introduced is checked by sequencing.
  • A) Site or sequence modifications with no effect a priori on the resistance character of maize EPSPS to the products which are competitive inhibitors of the activity of EPSP synthase: elimination of an internal NcoI site from pRPA-ML-715. [0063]
  • The sequence of pRPA-ML-715 is arbitrarily numbered by placing the first base of the N-terminal alanine codon GCC in position 1. This sequence has an NcoI site in position 1217. The site-modifying oligonucleotide has the sequence; [0064]
  • 5′-CCACAGGATGGCGATGGCCTTCTCC-3′. [0065]
  • After sequencing according to the references given above, the sequence read after mutagenesis corresponds to that of the oligonucleotide used. The NcoI site was indeed eliminated and translation into amino acids in this region conserves the initial sequence present in pRPA-ML-715. [0066]
  • This clone was called pRPA-ML-716. [0067]
  • The 1340 bp sequence of this clone is represented as SEQ ID No. 2 and SEQ ID No. 3. [0068]
  • B) Sequence modifications allowing an increase in the resistance character of maize EPSPS to products which are competitive inhibitors of the activity of EPSP synthase. [0069]
  • The following oligonucleotides were used: [0070]
    a) Thr 102 → Ile mutation.
    5′-GAATGCTGGAATCGCAATGCGGCCATTGACAGC-3′
    b) Pro 106 → Ser mutation.
    5′-GAATGCTGGAACTGCAATGCGGTCCTTGACAGC-3′
    c) Gly 101 → Ala and Thr 102 → Ile mutations.
    5′-CTTGGGGAATGCTGCCATCGCAATGCGGCCATTG-3′
    d) Thr 102 → Ile and Pro 106 → Ser mutations.
    5′-GGGGAATGCTGGAATCGCAATGCGGTCCTTGACAGC-3′
  • After sequencing, the sequence read after mutagenesis on the three mutated fragments is identical to the sequence of the parental DNA pRPA-ML-716 with the exception of the mutagenesis region which corresponds to that of the mutagenesis oligonucleotides used. These clones were called: pRPA-ML-717 for the Thr 102→Ile mutation, pRPA-ML-718 for the Pro 106→Ser mutation, pRPA-ML-719 for the Gly 101→Ala and Thr 102→Ile mutations and pRPA-ML-720 for the Thr 102→Ile and Pro 106→Ser mutations. [0071]
  • The 1340 bp sequence of pRPA-ML-720 is represented as SEQ ID No. 4 and SEQ ID No. 5. [0072]
  • The NcoI-HindIII insert of 1395 bp will be called in the rest of the descriptions “the double mutant of maize EPSPS”. [0073]
  • EXAMPLE 2 Construction of chimeric genes
  • The construction of chimeric genes according to the invention is carried out using the following elements: [0074]
  • 1). The genomic clone (cosmid clone c22) from [0075] Arabidopsis thaliana, containing two genes of the “H3.3-like” type was isolated as described in Chaubet et al. (J. Mol. Biol. 1992, 225 569-574).
  • 2). Intron No. 1: [0076]
  • A DNA fragment of 414 base pairs is purified from digestion of the cosmid clone c22 with the restriction enzyme DdeI followed by treatment with a Klenow fragment of DNA polymerase from [0077] E. coli, according to the manufacturer's instructions for creating a blunt-ended DNA fragment and then cut with MseI. The purified DNA fragment is ligated to a synthetic oligonucleotide adapter having the following sequence:
    Adaptor 1: 5′ TAATTTGTTGAACAGATCCC 3′
         TAAACAACTTGTCTAGGG
  • The ligation product is cloned into pGEM7Zf (+) (Stratagene catalogue No. P2251) which was digested with SmaI. This clone, called “intron No. 1”, is checked by sequencing (SEQ ID No. 6). [0078]
  • 3). Intron No. 2: [0079]
  • A DNA fragment of 494 base pairs is purified from the digestion of the cosmid clone c22 with the restriction enzymes AluI and CfoI. The purified DNA fragment is listed to a synthetic oligonucleotide adaptor having the following sequence: [0080]
    Adaptor 2: 5′   CAGATCCCGGGATCTGCG 3′
       GCGTCTAGGGCCCTAGACGC
  • The ligation product is cloned into pGEM7Zf (+) (Stratagene catalogue No. P2251) which was digested with SmaI. This clone, called “intron No. 2”, is checked by sequencing (SEQ ID No. 7). [0081]
  • 4). pRA-1 [0082]
  • The construction of this plasmid is described in French patent 9,308,029. This plasmid is a derivative of pBI 101.1 (Clonetech catalogue No. 6017-1) which contains the histone promoter from Arabidopsis H4A748 regulating the synthesis of the [0083] E. coli β-glucoronidase gene and of the nopaline synthase (“NOS”) polyadenylation site. Thus, a chimeric gene is obtained having the structure:
  • “H4A748 promoter-GUS gene-NOS”[0084]
  • 5). pCG-1 [0085]
  • This plasmid contains the above intron No. 1 placed between the H4A748 promoter and the GUS coding region of pRA-1. This plamid is obtained by digestion of cosmid clone c22 with BamHI and SmaI. The intron No. 1 of 418 base pairs is directly ligated into pRA-1 which was digested with BamHI and SmaI. [0086]
  • Thus, a chimeric gene in obtained having the structure: [0087]
  • “H4A748 promoter-intron NO. 1-GUS gene-NOS”[0088]
  • 6). pCG-13 [0089]
  • This plasmid contains the above intron No. 2 placed between the H4A748 promoter and the GUS coding region of pRA-1. This plasmid is obtained by digestion of cosmid clone c22 with BamHI and SmaI. The intron No. 2 of 494 base pairs is directly ligated into pRA-1 which was digested with BamHI and SmaI. [0090]
  • Thus, a chimeric gene is obtained having the structure: [0091]
  • “H4A748 promoter-intron No. 2-GUS gene-NOS”[0092]
  • 7). pCG-15 [0093]
  • This plasmid contains only intron No. 1 before the above GUS coding sequence placed between the H4A748 promoter and the GUS coding region of pCG-1. This plasmid is obtained by digestion of pCG-1 with BamHI and HindIII followed by treatment with a Klenow fragment of DNA polymerase from [0094] E. coli, according to the manufacturer's instructions for creating a blunt-ended DNA fragment.
  • This vector is then religated to give a chimeric gene having the structure: [0095]
  • “intron No. 1-GUS-NOS”[0096]
  • 8). pCG-18 [0097]
  • This plasmid contains only the above intron No. 2 in front of the GUS coding sequence of pCG-13. This plasmid is obtained by partial digestion of pCG-13 with BamHI and SphI, followed by treatment with a fragment of T4 phage DNA polymerase, according to the manufacturer's instructions in order to create a blunt-ended DNA fragment. [0098]
  • This vector is then religated and checked by enzymatic digestion in order to give a chimeric gene having the structure: [0099]
  • “intron No. 2-GUS-NOS”[0100]
  • 9). pRPA-RD-124 [0101]
  • Addition of a “nos” polyadenylation signal to pRPA-ML-720 with creation of a cloning cassette containing the maize double mutant EPSPS gene (Thr 102→Ile and Pro 106→ser). pRPA-ML-720 is digested with HindIII and treated with the Klenow fragment of DNA polymerase from [0102] E. coli in order to produce a blunt end. A second digestion is carried out with NcoI and the EPSPS fragment is purified. The EPSPS gene is then ligated with purified pRPA-RD-12 (a cloning cassette containing the nopaline synthase polyadenylation signal) to give pRPA-RD-124. To obtain the purifed useful vector pRPA-RD-12, it was necessary for the latter to be previously digested with SalI, treated with Klenow DNA polymerase, and then digested a second time with NcoI.
  • 10). pRPA-RD-125 [0103]
  • Addition of an optimized signal peptide (OSP) from pRPA-RD-124 with creation of a cloning cassette containing the EPSPS gene targeted on the plasmids. pRPA-RD-7 (European Patent Application EP 652 286) is digested with SphI, treated with T4 DNA polymerase and then digested with SpeI and the OSP fragment is purified. This OSP fragment is cloned into pRPA-RD-124 which was previously digested with NcoI, treated with Klenow DNA polymerase in order to remove the 3′ protruding part, and then digested with SpeI. This clone is then sequenced in order to ensure the correct translational fusion between the OSP and the EPSPS gene. pRPA-RD-125 is then obtained. [0104]
  • 11). pRPA-RD-196 [0105]
  • In this plasmid, the “intron No. 1+β-glucoronidase gene from [0106] E. coli” portion of pCG-1 is replaced by a chimeric gene of 2 kilobases containing an optimized signal peptide, a double mutant EPSPS gene (Ile102+Ser106) and a nopaline synthase polyadenylation site (“NOS”) isolated from pRPA-RD-125. To obtain pRPA-RD-196, the digestion of pCG-1 is performed with EcoRI and BamHI, followed by treatment with a Klenow fragment of DNA polymerase from E. coli, according to the manufacturer's instructions in order to create a blunt-ended DNA fragment. The 2-kilobase DNA fragment containing an optimized signal peptide of a double mutant EPSPS gene (Ile102+Ser106) and a nopaline synthase polyadenylation site (“NOS”) is obtained from pRPA-RD-125 by digestion with NcoI and NotI, followed by treatment with DNA polymerase from E. coli, according to the manufacturer's instructions in order to create a blunt-ended DNA fragment. This blunt-ended fragment is then ligated into pCG-1 prepared above.
  • A chimeric gene is thus obtained having the structure: [0107]
  • “H4A748 promoter-OSP-maize EPSPS gene-NOS”[0108]
  • 12). pRPA-RD-197 [0109]
  • In this plasmid, the “β-glucoronidase gene from [0110] E. coli portion of pCG-1 is replaced by a chimeric gene of 2 kilobases containing an optimized signal peptide, a double mutant EPSPS gene (Ile102+Ser106) and a nopaline synthase polyadenylation site (“NOS”) isolated from pRPA-RD-125. To obtain pRPA-RD-197, the digestion of pCG-1 is performed with EcoRI, followed by treatment with a Klenow fragment of DNA polymerase from E. coli, according to the manufacturer's instructions in order to create a blunt-ended DNA fragment, then cut with SmaI. The 2-kilobase DNA fragment containing an optimized signal peptide, a double mutant EPSPS gene (Ile102+Ser106”) and a nopaline synthase polyadenylation site (“NOS”) is obtained from pRPA-RD-125 by digestion with NcoI and NotI, followed by a treatment with DNA polymerase from E. coli, according to the manufacturer's instructions in order to create a blunt-ended DNA fragment. This blunt-ended fragment is then ligated into pCG-1 prepared above.
  • A chimeric gene is thus obtained having the structure: [0111]
  • “H4A74B promoter-intron No. 1-maize EPSPS gene-NOS”[0112]
  • 13). pRPA-RD-198 [0113]
  • In this plasmid, the “β-glucoronidase gene from [0114] E. coli” portion of pCG-13 is replaced by a chimeric gene of 2 kilobases containing an optimized signal peptide, a double mutant EPSPS gene (Ile102+Ser106) and a nopaline synthase polyadenylation site (“NOS”) isolated from pRPA-RD-125. To obtain pRPA-RD-198, the digestion of pCG-13 is performed with EcoRI, followed by treatment with a Klenow fragment of DNA polymerase from E. coli, according to the manufacturer's instructions in order to create a blunt-ended DNA fragment, then cut with SmaI. The 2-kilobase DNA fragment containing an optimized signal peptide, a double mutant EPSPS gene (Ile102+Ser106) and a nopaline synthase polyadenylation site (“NOS”) is obtained from pRPA-RD-123 by digestion with NcoI and NotI, followed by a treatment with DNA polymerase from E. coli, according to the manufacturer's instructions in order to create a blunt-ended DNA fragment. This blunt-ended fragment is then ligated into pCG-13 prepared above.
  • A chimeric gene is thus obtained having the structure: [0115]
  • H4A74B promoter-intron No. 2-OSP-maize EPSPS gene-“NOS”[0116]
  • EXAMPLE 3 Expression of the activity of a reporter gene
  • 1) Transformation and regeneration [0117]
  • The vector is introduced into the nononcogenic strain of [0118] Agrobacterium tumefaciens LBA 4404 available from a catalogue (Clontech #6027-1) by triparental crossing using the “helper” plasmid pRK 2013 in Escherichia coil HB101 according to the procedure described by Bevan M. (1984) Nucl. Acids Res., 12, 8711-8721.
  • The transformation technique using root explants of [0119] Arabidopsis thaliana L.-ecotype C24 was carried out according to the procedure described by Valvekens D. et al. (1988) Proc. Natl. Acad. Sci USA, 85, 5536-5540. Briefly, 3 steps are necessary: induction of the formation of calli on Gamborg B5 medium supplemented with 2,4-D and kinetin; formation of buds on Gamborg B5 medium supplemented with 2iP and IAA; rooting and formation of seeds on hormone-free M5.
  • 2) Measurement of the GUS activity in plants [0120]
  • a—histochemical observations [0121]
  • Visualization of the GUS activity by histochemical spots (Jefferson R. A. et al. (1987) EMBO J. 6, 3901-3907) on 10-day transgenic plants shows an increase in the intensity of the histochemical pattern which is tissue-specific for the plasmids containing the intron sequences (pCG-1 and pCG-13) compared with those without these introns (pRA-1). In particular, the pattern of spots for pCG-1 and pCG-13 is identical, showing an increase in intensity of the spots for the vascular and meristematic tissues, leaves and roots compared with that of the construct pRA-1. The constructs containing only the sequences of intron No. 1 (pCG-15 and pCG-18) show an extremely clear histochemical spot only in the apical meristem region. [0122]
  • b—fluoromeatric measurements [0123]
  • The GUS activity measured by fluorometry on extracts of floral and leaf buds of the rosette (Jefferson R. A. et al. (1987) EMBO J., 6, 3901-3907) from 12 plants, shows that the activity of the H4A74B promoter is increased under the influence of intron Nos. 1 and 2.Compared with the construct pRA-1, the GUS activity of pCG-1 and pCG-13 are at least six times greater in the floral buds, twenty times greater in the leaves of the rosette and twenty-six times greater in the roots. [0124]
  • These measurements clearly show that introns Nos. 1 and 2 of [0125] Arabidopsis histone genes of the “H3.3-like” type used as a regulatory element induces an increase in the activity of expression of the chimeric gene.
  • EXAMPLE 4 Tolerance of transgenic plants to a herbicide
  • 1) Transformation and regeneration [0126]
  • The vector is introduced into the nononcogenic strain of [0127] Agrobacterium tumefaciens LBA 4404 available from a catalogue (Clontech #6027-1) by triparental crossing using the “helper” plasmid pRK 2013 in Escherichia coli HB101 according to the procedure described by Bevan M. (1984) Nucl. Acids Res., 12, 8711-8721.
  • The transformation technique using foliar explants of tobacco is based on the procedure described by Horsh R. et al. (1985) Science, 227, 1229-1231. The regeneration of the PBD6 tobacco (origin SEITA-France) from foliar explants is carried out on a Murashige and Skoog (MS) basal medium comprising 30 g/l of sucrose as well as 200 μg/ml of kanamycin in three successive steps: the first comprises the induction of shoots on an MS medium supplemented with 30 g of sucrose containing 0.05 mg of naphthylacetic acid (NAA) and 2 mg/l of benzylaminopurine (BAP) for 15 days. The shoots formed during this step are then developed by culturing on an MS medium supplemented with 30 g/l of sucrose but not containing any hormone, for 10 days. The developed shoots are then removed and they are cultured on an MS rooting medium diluted one half, with half the content of salts, vitamins and sugars and not containing any hormone. After about 15 days, the rooted shoots are planted in the soil. [0128]
  • 2) Measurement of the tolerance to glyphosate: [0129]
  • Twenty transformed plants were regenerated and transferred to a greenhouse for each of the constructs pRPA-RD-196, pRPA-RD-197 and pRPA-RD-198. These plants were treated in a greenhouse at the 5-leaf stage with an aqueous suspension of herbicide, sold under the trademark RoundUp, corresponding to 0.8 kg of active substance glyphosate per hectare. [0130]
  • The results correspond to the observation of phytotoxicity values noted 3 weeks after treatment. Under these conditions, it is observed that the plants transformed with the constructs have on average an acceptable tolerance (pRPA-RD-196) or even a good tolerance (pRPA-RD-197 and pRPA-RD-196) whereas the untransformed control plants are completely destroyed. [0131]
  • These results show clearly the improvement offered by the use of a chimeric gene according to the invention for the same gene encoding tolerance to glyphlosate. [0132]
  • The transformed plants according to the invention may be used as parents for producing lines and hybrids having the phenotypic character corresponding to the expression of the chimeric gene introduced. [0133]
  • 1 22 1 1713 DNA Zea mays 1 aatcaatttc acacaggaaa cagctatgac catgattacg aattcgggcc cgggcgcgtg 60 atccggcggc ggcagcggcg gcggcggtgc aggcgggtgc cgaggagatc gtgctgcagc 120 ccatcaagga gatctggggc agcgtcaagc tgccggggtc caagtcgctt tccaaccgga 180 tcctcctact cgccgccctg tccgagggga caacagtggt tgataacctg ctgaacagtg 240 aggatgtcca ctacatgctc ggggccttga ggactcttgg tctctctgtc gaagcggaca 300 aaggtcccaa aagagctgta cttgttggct ctggtggaaa gttcccagtt gaggatgcta 360 aagaggaagt gcagctcttc ttggggaatg ctggaactgc aatgcggcca ttgacagcag 420 ctgttactgc tgctggtgga aatgcaactt acgtgcttga tggagtacca agaatgaggg 480 agagacccat tggcgacttg gttgtcggat tgaagcagct tggtgcagat gttgattgtt 540 tccttggcac tgactgccca cgtgttcgtg tcaatggaat cggagggcta cctggtggca 600 aggtcaagct gtctggctcc atcagcagtc agtacttgag tgccttgctg atggctgctc 660 ctttggctct tggggatgtg gagattgaaa tcattgataa attaatctcc attccgtacg 720 tcgaaatgac attgagattg atggaccgtt ttggtgtgaa agcagagcat tctgatagct 780 gggacagatt ctacattaag ggaggtcaaa aatacaagtc ccctaaaaat gcctatgttg 840 aaggtgatgc ctcaagcgca agctatttct tggctggtgc tgcaattact ggagggactg 900 tgactgtgga aggttgtggc accaccagtt tgcagggtga tgtgaagttt gctgaggtac 960 tggagatgat gggagcgaag gttacatgga ccgagactag cgtaactgtt actcccccac 1020 cgcgggagcc atttgggagg aaacacctca aggcgattga tgtcaacatc aacaagatgc 1080 ctgatgtcgc catgactctt gctgtggttg ccctctttgc cgatggcccg acagccatca 1140 gagacgtggc ttcctggaga gtaaaggaga ccgagaggat ggttgcgatc cggacggagc 1200 taaccaagct gggagcatct gttgaggaag ggccggacta ctgcatcatc acgccgccgg 1260 agaagctgaa cgtgacggcg atcgacacgt acgacgacca caggatggcc atggccttct 1320 cccttgccgc ctgtgccgag gtccccgtca ccatccggga ccctgggtgc acccggaaga 1380 ccttccccga ctacttcgat gtgctgagca ctttcgtcaa gaattaataa agcgtgcgat 1440 actaccacgc agcttgattg aagtgatagg cttgtgctga ggaaatacat ttcttttgtt 1500 ctgtttttct ctttcacggg attaagtttt gagtctgtaa cgttagttgt ttgtagcaag 1560 tttctatttc ggatcttaag tttgtgcact gtaagccaaa tttcatttca agagtggttc 1620 gttggaataa taagaataat aaattacgtt tcagtgaaaa aaaaaaaaaa aaaaaaaaaa 1680 aaaaaaaaaa aaaaaaaaaa aacccgggaa ttc 1713 2 1340 DNA Zea mays CDS (6)..(1337) 2 ccatg gcc ggc gcc gag gag atc gtg ctg cag ccc atc aag gag atc tcc 50 Ala Gly Ala Glu Glu Ile Val Leu Gln Pro Ile Lys Glu Ile Ser 1 5 10 15 ggc acc gtc aag ctg ccg ggg tcc aag tcg ctt tcc aac cgg atc ctc 98 Gly Thr Val Lys Leu Pro Gly Ser Lys Ser Leu Ser Asn Arg Ile Leu 20 25 30 cta ctc gcc gcc ctg tcc gag ggg aca aca gtg gtt gat aac ctg ctg 146 Leu Leu Ala Ala Leu Ser Glu Gly Thr Thr Val Val Asp Asn Leu Leu 35 40 45 aac agt gag gat gtc cac tac atg ctc ggg gcc ttg agg act ctt ggt 194 Asn Ser Glu Asp Val His Tyr Met Leu Gly Ala Leu Arg Thr Leu Gly 50 55 60 ctc tct gtc gaa gcg gac aaa gct gcc aaa aga gct gta gtt gtt ggc 242 Leu Ser Val Glu Ala Asp Lys Ala Ala Lys Arg Ala Val Val Val Gly 65 70 75 tgt ggt gga aag ttc cca gtt gag gat gct aaa gag gaa gtg cag ctc 290 Cys Gly Gly Lys Phe Pro Val Glu Asp Ala Lys Glu Glu Val Gln Leu 80 85 90 95 ttc ttg ggg aat gct gga act gca atg cgg cca ttg aca gca gct gtt 338 Phe Leu Gly Asn Ala Gly Thr Ala Met Arg Pro Leu Thr Ala Ala Val 100 105 110 act gct gct ggt gga aat gca act tac gtg ctt gat gga gta cca aga 386 Thr Ala Ala Gly Gly Asn Ala Thr Tyr Val Leu Asp Gly Val Pro Arg 115 120 125 atg agg gag aga ccc att ggc gac ttg gtt gtc gga ttg aag cag ctt 434 Met Arg Glu Arg Pro Ile Gly Asp Leu Val Val Gly Leu Lys Gln Leu 130 135 140 ggt gca gat gtt gat tgt ttc ctt ggc act gac tgc cca cct gtt cgt 482 Gly Ala Asp Val Asp Cys Phe Leu Gly Thr Asp Cys Pro Pro Val Arg 145 150 155 gtc aat gga atc gga ggg cta cct ggt ggc aag gtc aag ctg tct ggc 530 Val Asn Gly Ile Gly Gly Leu Pro Gly Gly Lys Val Lys Leu Ser Gly 160 165 170 175 tcc atc agc agt cag tac ttg agt gcc ttg ctg atg gct gct cct ttg 578 Ser Ile Ser Ser Gln Tyr Leu Ser Ala Leu Leu Met Ala Ala Pro Leu 180 185 190 gct ctt ggg gat gtg gag att gaa atc att gat aaa tta atc tcc att 626 Ala Leu Gly Asp Val Glu Ile Glu Ile Ile Asp Lys Leu Ile Ser Ile 195 200 205 ccg tac gtc gaa atg aca ttg aga ttg atg gag cgt ttt ggt gtg aaa 674 Pro Tyr Val Glu Met Thr Leu Arg Leu Met Glu Arg Phe Gly Val Lys 210 215 220 gca gag cat tct gat agc tgg gac aga ttc tac att aag gga ggt caa 722 Ala Glu His Ser Asp Ser Trp Asp Arg Phe Tyr Ile Lys Gly Gly Gln 225 230 235 aaa tac aag tcc cct aaa aat gcc tat gtt gaa ggt gat gcc tca agc 770 Lys Tyr Lys Ser Pro Lys Asn Ala Tyr Val Glu Gly Asp Ala Ser Ser 240 245 250 255 gca agc tat ttc ttg gct ggt gct gca att act gga ggg act gtg act 818 Ala Ser Tyr Phe Leu Ala Gly Ala Ala Ile Thr Gly Gly Thr Val Thr 260 265 270 gtg gaa ggt tgt ggc acc acc agt ttg cag ggt gat gtg aag ttt gct 866 Val Glu Gly Cys Gly Thr Thr Ser Leu Gln Gly Asp Val Lys Phe Ala 275 280 285 gag gta ctg gag atg atg gga gcg aag gtt aca tgg acc gag act agc 914 Glu Val Leu Glu Met Met Gly Ala Lys Val Thr Trp Thr Glu Thr Ser 290 295 300 gta act gtt act ggc cca ccg cgg gag cca ttt ggg agg aaa cac ctc 962 Val Thr Val Thr Gly Pro Pro Arg Glu Pro Phe Gly Arg Lys His Leu 305 310 315 aag gcg att gat gtc aac atg aac aag atg cct gat gtc gcc atg act 1010 Lys Ala Ile Asp Val Asn Met Asn Lys Met Pro Asp Val Ala Met Thr 320 325 330 335 ctt gct gtg gtt gcc ctc ttt gcc gat ggc ccg aca gcc atc aga gac 1058 Leu Ala Val Val Ala Leu Phe Ala Asp Gly Pro Thr Ala Ile Arg Asp 340 345 350 gtg gct tcc tgg aga gta aag gag acc gag agg atg gtt gcg atc cgg 1106 Val Ala Ser Trp Arg Val Lys Glu Thr Glu Arg Met Val Ala Ile Arg 355 360 365 acg gag cta acc aag ctg gga gca tct gtt gag gaa ggg ccg gac tac 1154 Thr Glu Leu Thr Lys Leu Gly Ala Ser Val Glu Glu Gly Pro Asp Tyr 370 375 380 tgc atc atc acg ccg ccg gag aag ctg aac gtg acg gcg atc gac acg 1202 Cys Ile Ile Thr Pro Pro Glu Lys Leu Asn Val Thr Ala Ile Asp Thr 385 390 395 tac gac gac cac agg atg gcc atg gcc ttc tcc ctt gcc gcc tgt gcc 1250 Tyr Asp Asp His Arg Met Ala Met Ala Phe Ser Leu Ala Ala Cys Ala 400 405 410 415 gag gtc ccc gtc acc atc cgg gac cct ggg tgc acc cgg aag acc ttc 1298 Glu Val Pro Val Thr Ile Arg Asp Pro Gly Cys Thr Arg Lys Thr Phe 420 425 430 ccc gac tac ttc gat gtg ctg agc act ttc gtc aag aat taa 1340 Pro Asp Tyr Phe Asp Val Leu Ser Thr Phe Val Lys Asn 435 440 3 444 PRT Zea mays 3 Ala Gly Ala Glu Glu Ile Val Leu Gln Pro Ile Lys Glu Ile Ser Gly 1 5 10 15 Thr Val Lys Leu Pro Gly Ser Lys Ser Leu Ser Asn Arg Ile Leu Leu 20 25 30 Leu Ala Ala Leu Ser Glu Gly Thr Thr Val Val Asp Asn Leu Leu Asn 35 40 45 Ser Glu Asp Val His Tyr Met Leu Gly Ala Leu Arg Thr Leu Gly Leu 50 55 60 Ser Val Glu Ala Asp Lys Ala Ala Lys Arg Ala Val Val Val Gly Cys 65 70 75 80 Gly Gly Lys Phe Pro Val Glu Asp Ala Lys Glu Glu Val Gln Leu Phe 85 90 95 Leu Gly Asn Ala Gly Thr Ala Met Arg Pro Leu Thr Ala Ala Val Thr 100 105 110 Ala Ala Gly Gly Asn Ala Thr Tyr Val Leu Asp Gly Val Pro Arg Met 115 120 125 Arg Glu Arg Pro Ile Gly Asp Leu Val Val Gly Leu Lys Gln Leu Gly 130 135 140 Ala Asp Val Asp Cys Phe Leu Gly Thr Asp Cys Pro Pro Val Arg Val 145 150 155 160 Asn Gly Ile Gly Gly Leu Pro Gly Gly Lys Val Lys Leu Ser Gly Ser 165 170 175 Ile Ser Ser Gln Tyr Leu Ser Ala Leu Leu Met Ala Ala Pro Leu Ala 180 185 190 Leu Gly Asp Val Glu Ile Glu Ile Ile Asp Lys Leu Ile Ser Ile Pro 195 200 205 Tyr Val Glu Met Thr Leu Arg Leu Met Glu Arg Phe Gly Val Lys Ala 210 215 220 Glu His Ser Asp Ser Trp Asp Arg Phe Tyr Ile Lys Gly Gly Gln Lys 225 230 235 240 Tyr Lys Ser Pro Lys Asn Ala Tyr Val Glu Gly Asp Ala Ser Ser Ala 245 250 255 Ser Tyr Phe Leu Ala Gly Ala Ala Ile Thr Gly Gly Thr Val Thr Val 260 265 270 Glu Gly Cys Gly Thr Thr Ser Leu Gln Gly Asp Val Lys Phe Ala Glu 275 280 285 Val Leu Glu Met Met Gly Ala Lys Val Thr Trp Thr Glu Thr Ser Val 290 295 300 Thr Val Thr Gly Pro Pro Arg Glu Pro Phe Gly Arg Lys His Leu Lys 305 310 315 320 Ala Ile Asp Val Asn Met Asn Lys Met Pro Asp Val Ala Met Thr Leu 325 330 335 Ala Val Val Ala Leu Phe Ala Asp Gly Pro Thr Ala Ile Arg Asp Val 340 345 350 Ala Ser Trp Arg Val Lys Glu Thr Glu Arg Met Val Ala Ile Arg Thr 355 360 365 Glu Leu Thr Lys Leu Gly Ala Ser Val Glu Glu Gly Pro Asp Tyr Cys 370 375 380 Ile Ile Thr Pro Pro Glu Lys Leu Asn Val Thr Ala Ile Asp Thr Tyr 385 390 395 400 Asp Asp His Arg Met Ala Met Ala Phe Ser Leu Ala Ala Cys Ala Glu 405 410 415 Val Pro Val Thr Ile Arg Asp Pro Gly Cys Thr Arg Lys Thr Phe Pro 420 425 430 Asp Tyr Phe Asp Val Leu Ser Thr Phe Val Lys Asn 435 440 4 1340 DNA Zea mays CDS (6)..(1337) 4 ccatg gcc ggc gcc gag gag atc gtg ctg cag ccc atc aag gag atc tcc 50 Ala Gly Ala Glu Glu Ile Val Leu Gln Pro Ile Lys Glu Ile Ser 1 5 10 15 ggc acc gtc aag ctg ccg ggg tcc aag tcg ctt tcc aac cgg atc ctc 98 Gly Thr Val Lys Leu Pro Gly Ser Lys Ser Leu Ser Asn Arg Ile Leu 20 25 30 cta ctc gcc gcc ctg tcc gag ggg aca aca gtg gtt gat aac ctg ctg 146 Leu Leu Ala Ala Leu Ser Glu Gly Thr Thr Val Val Asp Asn Leu Leu 35 40 45 aac agt gag gat gtc cac tac atg ctc ggg gcc ttg agg act ctt ggt 194 Asn Ser Glu Asp Val His Tyr Met Leu Gly Ala Leu Arg Thr Leu Gly 50 55 60 ctc tct gtc gaa gcg gac aaa gct gcc aaa aga gct gta gtt gtt ggc 242 Leu Ser Val Glu Ala Asp Lys Ala Ala Lys Arg Ala Val Val Val Gly 65 70 75 tgt ggt gga aag ttc cca gtt gag gat gct aaa gag gaa gtg cag ctc 290 Cys Gly Gly Lys Phe Pro Val Glu Asp Ala Lys Glu Glu Val Gln Leu 80 85 90 95 ttc ttg ggg aat gct gga atc gca atg cgg tcc ttg aca gca gct gtt 338 Phe Leu Gly Asn Ala Gly Ile Ala Met Arg Ser Leu Thr Ala Ala Val 100 105 110 act gct gct ggt gga aat gca act tac gtg ctt gat gga gta cca aga 386 Thr Ala Ala Gly Gly Asn Ala Thr Tyr Val Leu Asp Gly Val Pro Arg 115 120 125 atg agg gag aga ccc att ggc gac ttg gtt gtc gga ttg aag cag ctt 434 Met Arg Glu Arg Pro Ile Gly Asp Leu Val Val Gly Leu Lys Gln Leu 130 135 140 ggt gca gat gtt gat tgt ttc ctt ggc act gac tgc cca cct gtt cgt 482 Gly Ala Asp Val Asp Cys Phe Leu Gly Thr Asp Cys Pro Pro Val Arg 145 150 155 gtc aat gga atc gga ggg cta cct ggt ggc aag gtc aag ctg tct ggc 530 Val Asn Gly Ile Gly Gly Leu Pro Gly Gly Lys Val Lys Leu Ser Gly 160 165 170 175 tcc atc agc agt cag tac ttg agt gcc ttg ctg atg gct gct cct ttg 578 Ser Ile Ser Ser Gln Tyr Leu Ser Ala Leu Leu Met Ala Ala Pro Leu 180 185 190 gct ctt ggg gat gtg gag att gaa atc att gat aaa tta atc tcc att 626 Ala Leu Gly Asp Val Glu Ile Glu Ile Ile Asp Lys Leu Ile Ser Ile 195 200 205 ccg tac gtc gaa atg aca ttg aga ttg atg gag cgt ttt ggt gtg aaa 674 Pro Tyr Val Glu Met Thr Leu Arg Leu Met Glu Arg Phe Gly Val Lys 210 215 220 gca gag cat tct gat agc tgg gac aga ttc tac att aag gga ggt caa 722 Ala Glu His Ser Asp Ser Trp Asp Arg Phe Tyr Ile Lys Gly Gly Gln 225 230 235 aaa tac aag tcc cct aaa aat gcc tat gtt gaa ggt gat gcc tca agc 770 Lys Tyr Lys Ser Pro Lys Asn Ala Tyr Val Glu Gly Asp Ala Ser Ser 240 245 250 255 gca agc tat ttc ttg gct ggt gct gca att act gga ggg act gtg act 818 Ala Ser Tyr Phe Leu Ala Gly Ala Ala Ile Thr Gly Gly Thr Val Thr 260 265 270 gtg gaa ggt tgt ggc acc acc agt ttg cag ggt gat gtg aag ttt gct 866 Val Glu Gly Cys Gly Thr Thr Ser Leu Gln Gly Asp Val Lys Phe Ala 275 280 285 gag gta ctg gag atg atg gga gcg aag gtt aca tgg acc gag act agc 914 Glu Val Leu Glu Met Met Gly Ala Lys Val Thr Trp Thr Glu Thr Ser 290 295 300 gta act gtt act ggc cca ccg cgg gag cca ttt ggg agg aaa cac ctc 962 Val Thr Val Thr Gly Pro Pro Arg Glu Pro Phe Gly Arg Lys His Leu 305 310 315 aag gcg att gat gtc aac atg aac aag atg cct gat gtc gcc atg act 1010 Lys Ala Ile Asp Val Asn Met Asn Lys Met Pro Asp Val Ala Met Thr 320 325 330 335 ctt gct gtg gtt gcc ctc ttt gcc gat ggc ccg aca gcc atc aga gac 1058 Leu Ala Val Val Ala Leu Phe Ala Asp Gly Pro Thr Ala Ile Arg Asp 340 345 350 gtg gct tcc tgg aga gta aag gag acc gag agg atg gtt gcg atc cgg 1106 Val Ala Ser Trp Arg Val Lys Glu Thr Glu Arg Met Val Ala Ile Arg 355 360 365 acg gag cta acc aag ctg gga gca tct gtt gag gaa ggg ccg gac tac 1154 Thr Glu Leu Thr Lys Leu Gly Ala Ser Val Glu Glu Gly Pro Asp Tyr 370 375 380 tgc atc atc acg ccg ccg gag aag ctg aac gtg acg gcg atc gac acg 1202 Cys Ile Ile Thr Pro Pro Glu Lys Leu Asn Val Thr Ala Ile Asp Thr 385 390 395 tac gac gac cac agg atg gcg atg gcc ttc tcc ctt gcc gcc tgt gcc 1250 Tyr Asp Asp His Arg Met Ala Met Ala Phe Ser Leu Ala Ala Cys Ala 400 405 410 415 gag gtc ccc gtc acc atc cgg gac cct ggg tgc acc cgg aag acc ttc 1298 Glu Val Pro Val Thr Ile Arg Asp Pro Gly Cys Thr Arg Lys Thr Phe 420 425 430 ccc gac tac ttc gat gtg ctg agc act ttc gtc aag aat taa 1340 Pro Asp Tyr Phe Asp Val Leu Ser Thr Phe Val Lys Asn 435 440 5 444 PRT Zea mays 5 Ala Gly Ala Glu Glu Ile Val Leu Gln Pro Ile Lys Glu Ile Ser Gly 1 5 10 15 Thr Val Lys Leu Pro Gly Ser Lys Ser Leu Ser Asn Arg Ile Leu Leu 20 25 30 Leu Ala Ala Leu Ser Glu Gly Thr Thr Val Val Asp Asn Leu Leu Asn 35 40 45 Ser Glu Asp Val His Tyr Met Leu Gly Ala Leu Arg Thr Leu Gly Leu 50 55 60 Ser Val Glu Ala Asp Lys Ala Ala Lys Arg Ala Val Val Val Gly Cys 65 70 75 80 Gly Gly Lys Phe Pro Val Glu Asp Ala Lys Glu Glu Val Gln Leu Phe 85 90 95 Leu Gly Asn Ala Gly Ile Ala Met Arg Ser Leu Thr Ala Ala Val Thr 100 105 110 Ala Ala Gly Gly Asn Ala Thr Tyr Val Leu Asp Gly Val Pro Arg Met 115 120 125 Arg Glu Arg Pro Ile Gly Asp Leu Val Val Gly Leu Lys Gln Leu Gly 130 135 140 Ala Asp Val Asp Cys Phe Leu Gly Thr Asp Cys Pro Pro Val Arg Val 145 150 155 160 Asn Gly Ile Gly Gly Leu Pro Gly Gly Lys Val Lys Leu Ser Gly Ser 165 170 175 Ile Ser Ser Gln Tyr Leu Ser Ala Leu Leu Met Ala Ala Pro Leu Ala 180 185 190 Leu Gly Asp Val Glu Ile Glu Ile Ile Asp Lys Leu Ile Ser Ile Pro 195 200 205 Tyr Val Glu Met Thr Leu Arg Leu Met Glu Arg Phe Gly Val Lys Ala 210 215 220 Glu His Ser Asp Ser Trp Asp Arg Phe Tyr Ile Lys Gly Gly Gln Lys 225 230 235 240 Tyr Lys Ser Pro Lys Asn Ala Tyr Val Glu Gly Asp Ala Ser Ser Ala 245 250 255 Ser Tyr Phe Leu Ala Gly Ala Ala Ile Thr Gly Gly Thr Val Thr Val 260 265 270 Glu Gly Cys Gly Thr Thr Ser Leu Gln Gly Asp Val Lys Phe Ala Glu 275 280 285 Val Leu Glu Met Met Gly Ala Lys Val Thr Trp Thr Glu Thr Ser Val 290 295 300 Thr Val Thr Gly Pro Pro Arg Glu Pro Phe Gly Arg Lys His Leu Lys 305 310 315 320 Ala Ile Asp Val Asn Met Asn Lys Met Pro Asp Val Ala Met Thr Leu 325 330 335 Ala Val Val Ala Leu Phe Ala Asp Gly Pro Thr Ala Ile Arg Asp Val 340 345 350 Ala Ser Trp Arg Val Lys Glu Thr Glu Arg Met Val Ala Ile Arg Thr 355 360 365 Glu Leu Thr Lys Leu Gly Ala Ser Val Glu Glu Gly Pro Asp Tyr Cys 370 375 380 Ile Ile Thr Pro Pro Glu Lys Leu Asn Val Thr Ala Ile Asp Thr Tyr 385 390 395 400 Asp Asp His Arg Met Ala Met Ala Phe Ser Leu Ala Ala Cys Ala Glu 405 410 415 Val Pro Val Thr Ile Arg Asp Pro Gly Cys Thr Arg Lys Thr Phe Pro 420 425 430 Asp Tyr Phe Asp Val Leu Ser Thr Phe Val Lys Asn 435 440 6 418 DNA Zea mays 6 tgaggtacga ttcttcgatc ctctttgatt ttcctggaaa tattttttcg gtgatcgtga 60 aactactgga atcgctcgat aggtggtacg aaattaggcg agattagttt ctattcttgg 120 ccattatctt gtttcttcgc cgaatgatct tccgtataaa gattttaggt tagagatgaa 180 tcgtatagct agatttcatc accagatagt ttctttgtct agaatctctg aaattctcga 240 tagttttcac atgtgtaaat agattgttct tattcggcga ttgttgatta gggttttgat 300 tttcttgatt atgcgattgc aattagggat tttctttggt tttgtgttga tcttacgata 360 cattcctgca attgaatacg tatggatcta aatcttgtta atttgttgaa cagatccc 418 7 494 DNA Zea mays 7 ctcaggcgaa gaacaggtat gatttgtttg taattagatc aggggtttag gtctttccat 60 tactttttaa tgttttttct gttactgtct ccgcgatctg attttacgac aatagagttt 120 cgggttttgt cccattccag tttgaaaata aacgtccgtc ttttaagttt gctggatcga 180 taaacctgtg aagattgagt ctagtcgatt tattggatga tccattcttc atcgtttttt 240 tcttgcttcg aagttctgta taaccagatt tgtctgtgtg cgattgtcat tacctagccg 300 tgtatcgaga actagggttt tcgagtcaat tttgcccctt ttggttatat ctggttcgat 360 aacgattcat ctggattagg gttttaagtg gtgacgttta gtattccaat ttcttcaaaa 420 tttagttatg gataatgaaa atcccgaatt gactgttcaa tttcttgtta aatgcgcaga 480 tcccgggatc tgcg 494 8 20 DNA Zea mays 8 gctctgctca tgtctgctcc 20 9 20 DNA Zea mays 9 gcccgccctt gacaaagaaa 20 10 10 DNA Zea mays 10 aattcccggg 10 11 38 DNA Zea mays 11 aattaagctc tagagtcgac ctgcaggcat gcaagctt 38 12 41 DNA Zea mays 12 gagccgagct ccatggccgg cgccgaggag atcgtgctgc a 41 13 37 DNA Zea mays 13 gcacgatctc ctcggcgccg gccatggagc tcggctc 37 14 25 DNA Zea mays 14 ccacaggatg gcgatggcct tctcc 25 15 33 DNA Zea mays 15 gaatgctgga atcgcaatgc ggccattgac agc 33 16 33 DNA Zea mays 16 gaatgctgga actgcaatgc ggtccttgac agc 33 17 34 DNA Zea mays 17 cttggggaat gctgccatcg caatgcggcc attg 34 18 36 DNA Zea mays 18 ggggaatgct ggaatcgcaa tgcggtcctt gacagc 36 19 20 DNA Zea mays 19 taatttgttg aacagatccc 20 20 18 DNA Zea mays 20 taaacaactt gtctaggg 18 21 18 DNA Zea mays 21 cagatcccgg gatctgcg 18 22 20 DNA Zea mays 22 gcgtctaggg ccctagacgc 20

Claims (24)

1. An isolated DNA sequence capable of serving as a regulatory element in a chimeric gene which can be used for the transformation of plants and allowing the expression of the product of translation of the chimeric gene in particular in the regions of the plant undergoing rapid growth, characterized in that it comprises at least one intron such as the first intron (intron 1) of the noncoding 5′ region of a plant histone gene.
2. DNA sequence according to claim 1, characterized in that histone intron comes from a plant histone gene of the “H3.3-like” type.
3. DNA sequence according to either of claims 1 and 2, characterized in that histone intron 1 comes from a dicotyledonous plant.
4. DNA sequence according to claim 3, characterized in that histone intron 1 comes from Arabidopsis thaliana.
5. DNA sequence according to either of claims 1 and 2, characterized in that histone intron 1 comes from a monocotyledonous plant.
6. DNA sequence according to claim 5, characterized in that histone intron 1 comes from Zea mays.
7. DNA sequence according to any one of claims 1 to 6, characterized in that intron 1 is oriented, in the direction of transcription of the chimeric gene, in a direct or reversed manner relative to its initial orientation in the direction of transcription of the gene from which it is derived.
8. DNA sequence according to any one of claims 1 to 7, characterized in that the regulatory element comprises two introns 1, identical or different, which are combined.
9. Chimeric gene for the transformation of plants comprising at least, in the direction of transcription, one regulatory element comprising a promoter sequence, a sequence of a herbicide tolerance gene and a regulatory element, characterized in that the regulatory element comprises, in addition, an intron 1 according to any one of claims 1 to 8.
10. Chimeric gene according to claim 9, characterized in that the promoter sequence comes from a promoter of a plant histone gene.
11. Chimeric gene according to either of claims 9 and 10, characterized in that the promoter zone comes from the same plant histone gene as intron 1.
12. Chimeric gene according to any one of claims 9 to 11, characterized in that the promoter sequence comprises a promoter for a duplicated plant histone.
13. Chimeric gene according to any one of claims 9 to 12, characterized in that the promoter sequence contains at least one promoter of a plant histone gene combined with a different promoter derived from a gene which can be naturally expressed in plants.
14. Chimeric gene according to one of claims 9 to 13, characterized in that the coding gene makes it possible to confer on plants an enhanced tolerance to a herbicide.
15. Chimeric gene according to claim 14, characterized in that the herbicide tolerance gene is fused with a DNA sequence encoding a signal peptide allowing the accumulation of the product of translation of the herbicide tolerance gene in a subcellular compartment.
16. Chimeric gene according to claim 15, characterized in that the signal peptide zone allows the accumulation of the product of translation of the herbicide tolerance gene in the plastid compartment.
17. Chimeric gene according to claim 16, characterized in that the signal peptide sequence comprises, in the direction of transcription, at least one signal peptide sequence of a plant gene encoding a signal peptide directing transport of a polypeptide to a plastid, optionally a portion of the sequence of the mature N-terminal part of a plant gene produced when the first signal peptide is cleaved by proteolytic enzymes, and then optionally a second signal peptide of a plant gene encoding a signal peptide directing transport of the polypeptide to a sub-compartment of the plastid.
18. Chimeric gene according to any one of claims 9 to 17, characterized in that the herbicide tolerance gene encodes an enzyme which is active towards herbicides whose target is EPSPS.
19. Chimeric gene according to claim 18, characterized in that the herbicide tolerance gene encodes an enzyme which is active towards glyphosate.
20. Vector for the transformation of plants, characterized in that it comprises a chimeric gene according to any one of claims 9 to 19.
21. Strain of Agrobacterium sp., characterized in that it contains a vector according to claim 20.
22. Transformed plant cells, characterized in that it contains a chimeric gene according to any one of claims 9 to 19.
23. Transformed plant or plant portion obtained from a cell according to claim 22.
24. Process for the construction of a chimeric gene according to any one of claims 9 to 23, which comprises isolating an intron 1 from a plant histons gene as defined in any one of claims 1 to 8, a promoter sequence, a signal peptide, and at least one transgene, and assembling them, in that order in the direction of transcription of the transgene.
US10/023,839 1995-07-19 2001-12-21 Isolated DNA sequence capable of serving as regulatory element in a chimeric gene which can be used for the transformation of plants Abandoned US20030027312A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US10/023,839 US20030027312A1 (en) 1995-07-19 2001-12-21 Isolated DNA sequence capable of serving as regulatory element in a chimeric gene which can be used for the transformation of plants
US11/797,078 US7982092B2 (en) 1995-07-19 2007-04-30 Chimeric gene comprising intron from histone H3.3 gene

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
FR95/08980 1995-07-19
FR9508980A FR2736929B1 (en) 1995-07-19 1995-07-19 ISOLATED DNA SEQUENCE THAT MAY SERVE AS A REGULATION ZONE IN A CHIMERIC GENE FOR USE IN PLANT TRANSFORMATION
US09/000,062 US6338961B1 (en) 1995-07-19 1996-07-17 Isolated DNA sequence capable of serving as regulatory element in a chimeric gene which can be used for the transformation of plants
US10/023,839 US20030027312A1 (en) 1995-07-19 2001-12-21 Isolated DNA sequence capable of serving as regulatory element in a chimeric gene which can be used for the transformation of plants

Related Parent Applications (3)

Application Number Title Priority Date Filing Date
PCT/FR1996/001109 Continuation WO1997004114A2 (en) 1995-07-19 1996-07-17 Isolated dna sequence for use as a regulator region in a chimeric gene useful for transforming plants
US09/000,062 Continuation US6338961B1 (en) 1995-07-19 1996-07-17 Isolated DNA sequence capable of serving as regulatory element in a chimeric gene which can be used for the transformation of plants
US09000062 Continuation 1996-07-17

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US11/797,078 Division US7982092B2 (en) 1995-07-19 2007-04-30 Chimeric gene comprising intron from histone H3.3 gene

Publications (1)

Publication Number Publication Date
US20030027312A1 true US20030027312A1 (en) 2003-02-06

Family

ID=9481325

Family Applications (3)

Application Number Title Priority Date Filing Date
US09/000,062 Expired - Lifetime US6338961B1 (en) 1995-07-19 1996-07-17 Isolated DNA sequence capable of serving as regulatory element in a chimeric gene which can be used for the transformation of plants
US10/023,839 Abandoned US20030027312A1 (en) 1995-07-19 2001-12-21 Isolated DNA sequence capable of serving as regulatory element in a chimeric gene which can be used for the transformation of plants
US11/797,078 Expired - Fee Related US7982092B2 (en) 1995-07-19 2007-04-30 Chimeric gene comprising intron from histone H3.3 gene

Family Applications Before (1)

Application Number Title Priority Date Filing Date
US09/000,062 Expired - Lifetime US6338961B1 (en) 1995-07-19 1996-07-17 Isolated DNA sequence capable of serving as regulatory element in a chimeric gene which can be used for the transformation of plants

Family Applications After (1)

Application Number Title Priority Date Filing Date
US11/797,078 Expired - Fee Related US7982092B2 (en) 1995-07-19 2007-04-30 Chimeric gene comprising intron from histone H3.3 gene

Country Status (16)

Country Link
US (3) US6338961B1 (en)
EP (1) EP0850311B1 (en)
JP (1) JP3961566B2 (en)
KR (1) KR100454307B1 (en)
AR (1) AR002862A1 (en)
AT (1) ATE234360T1 (en)
AU (1) AU718521B2 (en)
BR (1) BR9609774A (en)
CA (1) CA2223881C (en)
DE (1) DE69626653T2 (en)
ES (1) ES2188769T3 (en)
FR (1) FR2736929B1 (en)
IL (1) IL122992A (en)
MX (1) MX9800556A (en)
WO (1) WO1997004114A2 (en)
ZA (1) ZA966077B (en)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011076877A1 (en) 2009-12-23 2011-06-30 Bayer Cropscience Ag Plants tolerant to hppd inhibitor herbicides
WO2011076892A1 (en) 2009-12-23 2011-06-30 Bayer Cropscience Ag Plants tolerant to hppd inhibitor herbicides
WO2011076889A1 (en) 2009-12-23 2011-06-30 Bayer Cropscience Ag Plants tolerant to hppd inhibitor herbicides
WO2011076882A1 (en) 2009-12-23 2011-06-30 Bayer Cropscience Ag Plants tolerant to hppd inhibitor herbicides
WO2011076885A1 (en) 2009-12-23 2011-06-30 Bayer Cropscience Ag Plants tolerant to hppd inhibitor herbicides
CN102471776A (en) * 2009-07-01 2012-05-23 拜尔生物科学公司 Methods and means for obtaining plants with enhanced glyphosate tolerance
WO2014178932A1 (en) * 2013-05-02 2014-11-06 Syngenta Participations Ag Glyphosate resistant class i epsps genes
WO2017205287A1 (en) * 2016-05-24 2017-11-30 Monsanto Technology Llc Plant regulatory elements and uses thereof

Families Citing this family (433)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2736929B1 (en) * 1995-07-19 1997-08-22 Rhone Poulenc Agrochimie ISOLATED DNA SEQUENCE THAT MAY SERVE AS A REGULATION ZONE IN A CHIMERIC GENE FOR USE IN PLANT TRANSFORMATION
FR2736926B1 (en) * 1995-07-19 1997-08-22 Rhone Poulenc Agrochimie 5-ENOL PYRUVYLSHIKIMATE-3-PHOSPHATE SYNTHASE MUTEE, CODING GENE FOR THIS PROTEIN AND PROCESSED PLANTS CONTAINING THIS GENE
CA2888685C (en) 1997-04-03 2017-05-09 T. Michael Spencer Glyphosate resistant maize lines
DE69835209T2 (en) * 1997-06-12 2006-11-23 Dow Agrosciences Llc, Indianapolis REGULATORY SEQUENCES FOR TRANSGENIC PLANTS
CN1191364C (en) 1997-10-07 2005-03-02 巴西农业研究公司 Process for obtaining transgenic leguminous plants (leguminosae) containing exogeneous DNA
WO2000012732A2 (en) * 1998-08-28 2000-03-09 Pioneer Hi-Bred International, Inc. Organelle targeting sequences
JP4911850B2 (en) * 1999-11-23 2012-04-04 ダウ・アグロサイエンス・エル・エル・シー Promoters and introns derived from maize actin depolymerization factor
US7169970B2 (en) * 2000-09-29 2007-01-30 Syngenta Limited Herbicide resistant plants
FR2815969B1 (en) 2000-10-30 2004-12-10 Aventis Cropscience Sa TOLERANT PLANTS WITH HERBICIDES BY METABOLIC BYPASS
FR2848570B1 (en) 2002-12-12 2005-04-01 Bayer Cropscience Sa EXPRESSION CASSETTE ENCODING A 5-ENOL PYRUVYLSHIKIMATE-3-PHOSPHATE SYNTHASE (EPSPS) AND HERBICIDE TOLERANT PLANTS CONTAINING THE SAME
WO2004074443A2 (en) * 2003-02-18 2004-09-02 Monsanto Technology Llc Glyphosate resistant class i 5-enolpyruvylshikimate-3-phosphate synthase (epsps)
US8334430B2 (en) 2005-10-13 2012-12-18 Monsanto Technology Llc Methods for producing hybrid seed
NZ704098A (en) * 2006-01-12 2015-02-27 Incima Ipco B V Epsps mutants
NZ571115A (en) 2006-03-02 2011-11-25 Athenix Corp Method and compositions for improved enzyme activity in transgenic plant
US8158850B2 (en) * 2007-12-19 2012-04-17 Monsanto Technology Llc Method to enhance yield and purity of hybrid crops
BRPI0822484B1 (en) * 2008-03-03 2021-08-31 Ms Technologies, Llc IMMUNORREACTIVE ANTIBODY WITH AN EPSPS POLYPEPTIDE (5-ENOLPYRUVYL-3-PHOSPHOSHICHEMIC ACID SYNTASE) MUTANT, HYBRIDOMAS CELL LINEAGE AND METHOD FOR DETECTING THE PRESENCE OF AN EPSPS POLYPEPTIDE (5-ENOLPHYRUVYL 3-PHOSPHYCHEMICAL ACID) WITH A MUTANT 5-ENOLPHYLOPHYSRUVIL ACID
US7947877B2 (en) * 2008-05-14 2011-05-24 Monosanto Technology LLC Plants and seeds of spring canola variety SCV328921
US7935870B2 (en) * 2008-05-14 2011-05-03 Monsanto Technology Llc Plants and seeds of spring canola variety SCV354718
US7964774B2 (en) * 2008-05-14 2011-06-21 Monsanto Technology Llc Plants and seeds of spring canola variety SCV384196
US8829282B2 (en) * 2008-05-14 2014-09-09 Monsanto Technology, Llc Plants and seeds of spring canola variety SCV425044
WO2010132214A1 (en) 2009-05-15 2010-11-18 University Of Tennessee Research Foundation Environmental stress-inducible promoter and its application in crops
MX2011013224A (en) 2009-06-09 2012-06-01 Pioneer Hi Bred Int Early endosperm promoter and methods of use.
US8071848B2 (en) * 2009-06-17 2011-12-06 Monsanto Technology Llc Plants and seeds of spring canola variety SCV218328
CA2775146A1 (en) 2009-10-26 2011-05-12 Pioneer Hi-Bred International, Inc. Somatic ovule specific promoter and methods of use
US8148611B2 (en) * 2010-02-26 2012-04-03 Monsanto Technology Llc Plants and seeds of spring canola variety SCV453784
US8143488B2 (en) * 2010-02-26 2012-03-27 Monsanto Technoloy LLC Plants and seeds of spring canola variety SCV470336
US8138394B2 (en) * 2010-02-26 2012-03-20 Monsanto Technology Llc Plants and seeds of spring canola variety SCV431158
US8581048B2 (en) * 2010-03-09 2013-11-12 Monsanto Technology, Llc Plants and seeds of spring canola variety SCV119103
US8153865B2 (en) * 2010-03-11 2012-04-10 Monsanto Technology Llc Plants and seeds of spring canola variety SCV152154
US9187762B2 (en) 2010-08-13 2015-11-17 Pioneer Hi-Bred International, Inc. Compositions and methods comprising sequences having hydroxyphenylpyruvate dioxygenase (HPPD) activity
CA2821509A1 (en) 2010-12-22 2012-06-28 Pioneer Hi-Bred International, Inc. Viral promoter, truncations thereof, and methods of use
US8895716B2 (en) 2010-12-22 2014-11-25 Pioneer Hi-Bred International, Inc. Viral promoter, truncations thereof, and methods of use
WO2012112411A1 (en) 2011-02-15 2012-08-23 Pioneer Hi-Bred International, Inc. Root-preferred promoter and methods of use
US8513487B2 (en) 2011-04-07 2013-08-20 Zenon LISIECZKO Plants and seeds of spring canola variety ND-662c
US8513494B2 (en) 2011-04-08 2013-08-20 Chunren Wu Plants and seeds of spring canola variety SCV695971
US8507761B2 (en) 2011-05-05 2013-08-13 Teresa Huskowska Plants and seeds of spring canola variety SCV372145
US8513495B2 (en) 2011-05-10 2013-08-20 Dale Burns Plants and seeds of spring canola variety SCV291489
AP2013007316A0 (en) 2011-07-01 2013-12-31 Monsanto Technology Llc Methods and compositions for selective regulation of protein expression
US8785729B2 (en) 2011-08-09 2014-07-22 Nunhems, B.V. Lettuce variety redglace
US8754293B2 (en) 2011-09-09 2014-06-17 Nunhems B.V. Lettuce variety intred
WO2013096818A1 (en) 2011-12-21 2013-06-27 The Curators Of The University Of Missouri Soybean variety s05-11268
WO2013096810A1 (en) 2011-12-21 2013-06-27 The Curators Of The University Of Missouri Soybean variety s05-11482
US9380756B2 (en) 2012-01-04 2016-07-05 Nunhems B.V. Lettuce variety multigreen 50
WO2013103365A1 (en) 2012-01-06 2013-07-11 Pioneer Hi-Bred International, Inc. Pollen preferred promoters and methods of use
EP2800816A1 (en) 2012-01-06 2014-11-12 Pioneer Hi-Bred International Inc. Ovule specific promoter and methods of use
US8835720B2 (en) 2012-04-26 2014-09-16 Monsanto Technology Llc Plants and seeds of spring canola variety SCV967592
US8859857B2 (en) 2012-04-26 2014-10-14 Monsanto Technology Llc Plants and seeds of spring canola variety SCV259778
US8802935B2 (en) 2012-04-26 2014-08-12 Monsanto Technology Llc Plants and seeds of spring canola variety SCV942568
US8878009B2 (en) 2012-04-26 2014-11-04 Monsanto Technology, LLP Plants and seeds of spring canola variety SCV318181
AU2012208997B1 (en) 2012-07-30 2013-09-19 Dlf Usa Inc. An alfalfa variety named magnum salt
US20140109259A1 (en) 2012-10-11 2014-04-17 Pioneer Hi Bred International Inc Guard Cell Promoters and Uses Thereof
US9273322B2 (en) 2013-03-12 2016-03-01 Pioneer Hi Bred International Inc Root-preferred promoter and methods of use
US9243258B2 (en) 2013-03-12 2016-01-26 Pioneer Hi Bred International Inc Root-preferred promoter and methods of use
AU2014241045B2 (en) 2013-03-13 2017-08-31 Pioneer Hi-Bred International, Inc. Glyphosate application for weed control in brassica
CA2902002C (en) 2013-03-14 2023-08-01 Pioneer Hi-Bred International, Inc. Compositions and methods to control insect pests
RU2015143825A (en) 2013-03-15 2017-04-26 Пайонир Хай-Бред Интернэшнл, Инк. PHI-4 POLYPEPTIDES AND WAYS OF THEIR APPLICATION
CA2918909A1 (en) 2013-07-25 2015-01-29 Pioneer Hi-Bred International, Inc. Method for producing hybrid brassica seed
EA030896B1 (en) 2013-08-16 2018-10-31 Пайонир Хай-Бред Интернэшнл, Инк. Insecticidal proteins and methods for their use
CA2923629A1 (en) 2013-09-11 2015-03-19 Pioneer Hi-Bred International, Inc. Plant regulatory elements and methods of use thereof
BR122021005579B1 (en) 2013-09-13 2022-11-29 Pioneer Hi-Bred International, Inc DNA CONSTRUCTION, METHOD FOR OBTAINING A TRANSGENIC PLANT, FUSION PROTEIN, METHOD FOR CONTROLLING AN INSECT PEST POPULATION, METHOD FOR INHIBITING THE GROWTH OR KILLING AN INSECT PEST
EP3705489A1 (en) 2014-02-07 2020-09-09 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
CN106232620B (en) 2014-02-07 2022-05-13 先锋国际良种公司 Insecticidal proteins and methods of use thereof
US9686931B2 (en) 2014-07-07 2017-06-27 Alforex Seeds LLC Hybrid alfalfa variety named HybriForce-3400
WO2016022516A1 (en) 2014-08-08 2016-02-11 Pioneer Hi-Bred International, Inc. Ubiquitin promoters and introns and methods of use
WO2016044092A1 (en) 2014-09-17 2016-03-24 Pioneer Hi Bred International Inc Compositions and methods to control insect pests
WO2016054071A1 (en) 2014-09-29 2016-04-07 Alforex Seeds LLC Low lignin non-transgenic alfalfa varieties and methods for producing the same
EP3207143B1 (en) 2014-10-16 2023-11-22 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
WO2016099916A1 (en) 2014-12-19 2016-06-23 E. I. Du Pont De Nemours And Company Polylactic acid compositions with accelerated degradation rate and increased heat stability
CA2985198A1 (en) 2015-05-19 2016-11-24 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
EP3310803A1 (en) 2015-06-16 2018-04-25 Pioneer Hi-Bred International, Inc. Compositions and methods to control insect pests
MX2018001523A (en) 2015-08-06 2018-03-15 Pioneer Hi Bred Int Plant derived insecticidal proteins and methods for their use.
CA3004056C (en) 2015-12-22 2024-01-23 Pioneer Hi-Bred International, Inc. Tissue-preferred promoters and methods of use
WO2017192560A1 (en) 2016-05-04 2017-11-09 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
EP3472323A1 (en) 2016-06-16 2019-04-24 Pioneer Hi-Bred International, Inc. Compositions and methods to control insect pests
EP4083215A1 (en) 2016-06-24 2022-11-02 Pioneer Hi-Bred International, Inc. Plant regulatory elements and methods of use thereof
EP3478052B1 (en) 2016-07-01 2021-08-25 Pioneer Hi-Bred International, Inc. Insecticidal proteins from plants and methods for their use
WO2018013333A1 (en) 2016-07-12 2018-01-18 Pioneer Hi-Bred International, Inc. Compositions and methods to control insect pests
BR112019008800A2 (en) 2016-11-01 2019-07-16 Pioneer Hi Bred Int insecticidal polypeptide, insecticidal composition, recombinant polynucleotide, dna construct, plant cell or transgenic plant, method for inhibiting growth or exterminating an agricultural insect pest population, method for inhibiting growth or exterminating an insect pest, method for controlling lepidoptera and / or coleoptera insect infestation in a transgenic plant and provide insect resistance management and use of at least one insecticide polypeptide
US9961858B1 (en) 2017-02-28 2018-05-08 M.S. Technologies, Llc Soybean cultivar 54062650
US9867357B1 (en) 2017-02-28 2018-01-16 M.S. Technologies, Llc Soybean cultivar 56171900
US10058049B1 (en) 2017-02-28 2018-08-28 M.S. Technologies Llc Soybean cultivar 59104161
US9999189B1 (en) 2017-02-28 2018-06-19 M.S. Technologies, Llc Soybean cultivar 54113122
US9961861B1 (en) 2017-02-28 2018-05-08 M.S. Technologies, Llc Soybean cultivar 54190212
US9961860B1 (en) 2017-02-28 2018-05-08 M.S. Technologies, Llc Soybean cultivar 52030201
US9961859B1 (en) 2017-02-28 2018-05-08 M.S. Technologies, Llc Soybean cultivar 57111348
US9999190B1 (en) 2017-02-28 2018-06-19 M.S. Technologies, Llc Soybean cultivar 54172927
CN111373046A (en) 2017-09-25 2020-07-03 先锋国际良种公司 Tissue-preferred promoters and methods of use
US10485208B1 (en) 2018-05-21 2019-11-26 M.S. Technologies, L.L.C. Soybean cultivar 69311428
US10494639B1 (en) 2018-05-21 2019-12-03 M.S. Technologies, L.L.C. Soybean cultivar 63301112
US10499594B1 (en) 2018-05-21 2019-12-10 M.S. Technologies, L.L.C. Soybean cultivar 79162140
US10485209B1 (en) 2018-05-21 2019-11-26 M.S. Technologies, L.L.C. Soybean cultivar 72151329
US10501747B1 (en) 2018-05-21 2019-12-10 M.S. Technologies, L.L.C. Soybean cultivar 77130123
US11702668B2 (en) 2018-05-22 2023-07-18 Pioneer Hi-Bred International, Inc. Plant regulatory elements and methods of use thereof
WO2020005933A1 (en) 2018-06-28 2020-01-02 Pioneer Hi-Bred International, Inc. Methods for selecting transformed plants
US10485212B1 (en) 2018-08-01 2019-11-26 M.S. Technologies, L.L.C. Soybean cultivar 65110742
US10555478B1 (en) 2018-08-01 2020-02-11 M.S. Technologies, L.L.C. Soybean cultivar 75242840
US10499582B1 (en) 2018-08-01 2019-12-10 M.S. Technologies, L.L.C. Soybean cultivar 60312840
US10492399B1 (en) 2018-08-01 2019-12-03 M.S. Technologies, L.L.C. Soybean cultivar 75001212
US10455794B1 (en) 2018-08-01 2019-10-29 M.S. Technologies, L.L.C. Soybean cultivar 51284052
US10455795B1 (en) 2018-08-01 2019-10-29 M.S. Technologies, L.L.C. Soybean cultivar 79150907
US10455796B1 (en) 2018-08-01 2019-10-29 M.S. Technologies, L.L.C. Soybean cultivar 76420724
US10485211B1 (en) 2018-08-01 2019-11-26 M.S. Technologies, L.L.C. Soybean cultivar 74142136
US10485210B1 (en) 2018-08-01 2019-11-26 M.S. Technologies, L.L.C. Soybean cultivar 64432136
US10455793B1 (en) 2018-08-01 2019-10-29 M.S. Technologies, L.L.C. Soybean cultivar 69090024
US10492403B1 (en) 2018-08-01 2019-12-03 M.S. Technologies, L.L.C. Soybean cultivar 70311819
US10492401B1 (en) 2018-08-01 2019-12-03 M.S. Technologies, L.L.C. Soybean cultivar 64002217
US10555479B1 (en) 2018-08-01 2020-02-11 M.S. Technologies, L.L.C. Soybean cultivar 71342318
US10448604B1 (en) 2018-08-01 2019-10-22 M.S. Technologies, L.L.C. Soybean cultivar 60111110
US10492404B1 (en) 2018-08-01 2019-12-03 M.S. Technologies, L.L.C. Soybean cultivar 61332840
US10492402B1 (en) 2018-08-01 2019-12-03 M.S. Technologies, L.L.C. Soybean cultivar 63452016
US10492400B1 (en) 2018-08-01 2019-12-03 M.S. Technologies, L.L.C. Soybean cultivar 76011212
US10492433B1 (en) 2018-08-01 2019-12-03 M.S. Technologies, L.L.C. Soybean cultivar 78492244
US10492441B1 (en) 2018-08-02 2019-12-03 M.S. Technologies, L.L.C. Soybean cultivar 75162223
US10542692B1 (en) 2018-08-02 2020-01-28 M.S. Technologies, L.L.C. Soybean cultivar 70262703
US10349606B1 (en) 2018-08-02 2019-07-16 M.S. Technologies, Llc Soybean cultivar 70404329
US10531620B1 (en) 2018-08-02 2020-01-14 M.S. Technologies, L.L.C. Soybean cultivar 70140849
US10512229B1 (en) 2018-08-02 2019-12-24 M.S. Technologies, L.L.C. Soybean cultivar 74340613
US10524445B1 (en) 2018-08-02 2020-01-07 M.S. Technologies, L.L.C. Soybean cultivar 75052534
US10537084B1 (en) 2018-08-02 2020-01-21 M.S. Technologies, L.L.C. Soybean cultivar 71201428
US10499595B1 (en) 2018-08-02 2019-12-10 M.S. Technologies, L.L.C. Soybean cultivar 77242824
US10542691B1 (en) 2018-08-02 2020-01-28 M.S. Technologies, L.L.C. Soybean cultivar 73040436
US10506783B1 (en) 2018-08-02 2019-12-17 M.S. Technologies, L.L.C. Soybean cultivar 70391206
US10440925B1 (en) 2018-08-02 2019-10-15 M.S. Technologies, L.L.C. Soybean cultivar 61414428
US10448605B1 (en) 2018-08-02 2019-10-22 M.S. Technologies, L.L.C. Soybean cultivar 63332027
US10440924B1 (en) 2018-08-02 2019-10-15 M.S. Technologies, L.L.C. Soybean cultivar 60431428
US10537076B1 (en) 2018-08-02 2020-01-21 M.S. Technologies, L.L.C. Soybean cultivar 70120311
US10492439B1 (en) 2018-08-02 2019-12-03 M.S. Technologies, L.L.C. Soybean cultivar 78281713
US10440926B1 (en) 2018-08-02 2019-10-15 M.S. Technologies, L.L.C. Soybean cultivar 75251428
US10492438B1 (en) 2018-08-02 2019-12-03 M.S. Technologies, L.L.C. Soybean cultivar 72191315
US10349605B1 (en) 2018-08-02 2019-07-16 M.S. Technologies, Llc Soybean cultivar 78320329
US10499596B1 (en) 2018-08-02 2019-12-10 M.S. Technologies, L.L.C. Soybean cultivar 76034331
US10542690B1 (en) 2018-08-02 2020-01-28 M.S. Technologies, L.L.C. Soybean cultivar 71052129
US10492436B1 (en) 2018-08-02 2019-12-03 M.S. Technologies, L.L.C. Soybean cultivar 70422534
US10499583B1 (en) 2018-08-02 2019-12-10 M.S. Technologies, L.L.C. Soybean cultivar 73390208
US10499597B1 (en) 2018-08-02 2019-12-10 M.S. Technologies, L.L.C. Soybean cultivar 74211709
US10492437B1 (en) 2018-08-02 2019-12-03 M.S. Technologies, L.L.C. Soybean cultivar 73081781
US10398120B1 (en) 2018-08-02 2019-09-03 M.S. Technologies, L.L.C. Soybean cultivar 70271905
US10548271B1 (en) 2018-08-02 2020-02-04 M.S. Technologies, L.L.C. Soybean cultivar 65180532
US10398121B1 (en) 2018-08-02 2019-09-03 M.S. Technologies, Llc Soybean cultivar 76132184
US10492440B1 (en) 2018-08-02 2019-12-03 M.S. Technologies, L.L.C. Soybean cultivar 76172605
US10537085B1 (en) 2018-08-02 2020-01-21 M.S. Technologies, L.L.C. Soybean cultivar 73330613
US10631484B2 (en) 2018-08-03 2020-04-28 M.S. Technologies, L.L.C. Soybean cultivar 60310209
US10542694B1 (en) 2018-08-03 2020-01-28 M.S. Technologies, L.L.C. Soybean cultivar 77290232
US10537078B1 (en) 2018-08-03 2020-01-21 M.S. Technologies, L.L.C. Soybean cultivar 78221232
US10492443B1 (en) 2018-08-03 2019-12-03 M.S. Technologies, L.L.C. Soybean cultivar 70552824
US10517245B1 (en) 2018-08-03 2019-12-31 M.S. Technologies, L.L.C. Soybean cultivar 67371612
US10542693B1 (en) 2018-08-03 2020-01-28 M.S. Technologies, L.L.C. Soybean cultivar 74312619
US10517246B1 (en) 2018-08-03 2019-12-31 M.S. Technologies, L.L.C. Soybean cultivar 61242247
US10660286B2 (en) 2018-08-03 2020-05-26 M.S. Technologies, L.L.C. Soybean cultivar 66472542
US10660291B2 (en) 2018-08-03 2020-05-26 M.S. Technologies, L.L.C. Soybean cultivar 76071630
US10492442B1 (en) 2018-08-03 2019-12-03 M.S. Technologies, L.L.C. Soybean cultivar 64490328
US10631483B2 (en) 2018-08-03 2020-04-28 M.S. Technologies, L.L.C. Soybean cultivar 63030535
US10492444B1 (en) 2018-08-03 2019-12-03 M.S. Technologies, L.L.C. Soybean cultivar 73412247
US10537077B1 (en) 2018-08-03 2020-01-21 M.S. Technologies, L.L.C. Soybean cultivar 76391606
US10609881B2 (en) 2018-08-03 2020-04-07 M.S. Technologies, L.L.C. Soybean cultivar 74092327
US10517247B1 (en) 2018-08-03 2019-12-31 M.S. Technologies, L.L.C. Soybean cultivar 71270402
US10531621B1 (en) 2018-08-03 2020-01-14 M.S. Technologies, L.L.C. Soybean cultivar 61364961
US10477819B1 (en) 2018-08-06 2019-11-19 M.S. Technologies, L.L.C. Soybean cultivar 75162339
KR20210084482A (en) 2018-10-31 2021-07-07 파이어니어 하이 부렛드 인터내쇼날 인코포레이팃드 Compositions and methods for Ocrobacterium-mediated plant transformation
EP3938521A1 (en) 2019-03-11 2022-01-19 Pioneer Hi-Bred International, Inc. Methods for clonal plant production
JP2022527766A (en) 2019-03-27 2022-06-06 パイオニア ハイ-ブレッド インターナショナル, インコーポレイテッド Transformation of extraplant fragments
EP3947696A1 (en) 2019-03-28 2022-02-09 Pioneer Hi-Bred International, Inc. Modified agrobacterium strains and use thereof for plant transformation
US10631511B1 (en) 2019-04-04 2020-04-28 M.S. Technologies, L.L.C. Soybean cultivar 83190332
US10667483B1 (en) 2019-04-22 2020-06-02 M.S. Technolgies, L.L.C. Soybean cultivar 88092742
US10595486B1 (en) 2019-06-13 2020-03-24 M.S. Technologies, L.L.C. Soybean cultivar 80330329
US10897866B1 (en) 2019-08-19 2021-01-26 M.S. Technologies, L.L.C. Soybean cultivar 81442208
US10952395B2 (en) 2019-08-19 2021-03-23 M.S. Technologies, L.L.C. Soybean cultivar 81371335
US10973197B2 (en) 2019-08-19 2021-04-13 M.S. Technologies, L.L.C. Soybean cultivar 87161800
US10945401B1 (en) 2019-08-19 2021-03-16 M.S. Technologies, L.L.C. Soybean cultivar 83372609
US10980206B2 (en) 2019-08-19 2021-04-20 M.S. Technologies, L.L.C. Soybean cultivar 86052115
US10952394B2 (en) 2019-08-19 2021-03-23 M.S. Technologies, L.L.C. Soybean cultivar 88390016
US10993402B2 (en) 2019-08-19 2021-05-04 M.S. Technologies, L.L.C. Soybean cultivar 87390112
US10932431B1 (en) 2019-08-19 2021-03-02 M.S. Technologies, L.L.C. Soybean cultivar 86072910
US10980204B2 (en) 2019-08-19 2021-04-20 M.S. Technologies, L.L.C. Soybean cultivar 85010111
US10980205B2 (en) 2019-08-19 2021-04-20 M.S. Technologies, L.L.C. Soybean cultivar 81140111
US10897867B1 (en) 2019-08-19 2021-01-26 M.S. Technologies, L.L.C. Soybean cultivar 84450325
US10980207B2 (en) 2019-08-19 2021-04-20 M.S. Technologies, L.L.C. Soybean cultivar 87242903
US10945400B1 (en) 2019-08-19 2021-03-16 M.S. Technologies, L.L.C. Soybean cultivar 86220335
US10939651B1 (en) 2019-08-19 2021-03-09 M.S. Technologies, L.L.C. Soybean cultivar 83011212
US10993403B2 (en) 2019-08-19 2021-05-04 M.S. Technologies, L.L.C. Soybean cultivar 88042312
US11044870B2 (en) 2019-08-19 2021-06-29 M.S. Technologies, L.L.C. Soybean cultivar 87011338
US10945399B1 (en) 2019-08-19 2021-03-16 M.S. Technologies, L.L.C. Soybean cultivar 89442841
US10918064B1 (en) 2019-08-19 2021-02-16 M.S. Technologies, L.L.C. Soybean cultivar 84322401
US10966396B2 (en) 2019-08-19 2021-04-06 M.S. Technologies, L.L.C. Soybean cultivar 89192414
US10952399B2 (en) 2019-08-20 2021-03-23 M.S. Technologies, L.L.C. Soybean cultivar 80230701
US10945403B1 (en) 2019-08-20 2021-03-16 M.S. Technologies, L.L.C. Soybean cultivar 85202128
US10945405B1 (en) 2019-08-20 2021-03-16 M.S. Technologies, L.L.C. Soybean cultivar 81090603
US11219179B2 (en) 2019-08-20 2022-01-11 M.S. Technologies, L.L.C. Soybean cultivar 87272833
US11337394B2 (en) 2019-08-20 2022-05-24 M.S. Technologies, L.L.C. Soybean cultivar 86092833
US10952398B2 (en) 2019-08-20 2021-03-23 M.S. Technologies, L.L.C. Soybean cultivar 84380724
US11172632B2 (en) 2019-08-20 2021-11-16 M.S. Technologies, L.L.C. Soybean cultivar 85031644
US11212998B2 (en) 2019-08-20 2022-01-04 M.S. Technologies, L.L.C. Soybean cultivar 88282833
US10945404B1 (en) 2019-08-20 2021-03-16 M.S. Technologies, L.L.C. Soybean cultivar 83221630
US11044872B2 (en) 2019-08-20 2021-06-29 M.S. Technologies, L.L.C. Soybean cultivar 84344663
US11044873B2 (en) 2019-08-20 2021-06-29 M.S. Technologies, L.L.C. Soybean cultivar 88482541
US10952397B2 (en) 2019-08-20 2021-03-23 M.S. Technologies, L.L.C. Soybean cultivar 86160724
US11044875B2 (en) 2019-08-20 2021-06-29 M.S. Technologies, L.L.C. Soybean cultivar 81322943
US10945402B1 (en) 2019-08-20 2021-03-16 M.S. Technologies, L.L.C. Soybean cultivar 88020223
US11044871B2 (en) 2019-08-20 2021-06-29 M.S. Technologies, L.L.C. Soybean cultivar 84340383
US11044874B2 (en) 2019-08-20 2021-06-29 M.S. Technologies, L.L.C. Soybean cultivar 83292541
US10932432B1 (en) 2019-08-20 2021-03-02 M.S. Technologies, L.L.C. Soybean cultivar 87222215
US10952396B2 (en) 2019-08-20 2021-03-23 M.S. Technologies, L.L.C. Soybean cultivar 88362310
US11071273B2 (en) 2019-08-27 2021-07-27 M.S. Technologies, L.L.C. Soybean cultivar 86172030
US10993405B2 (en) 2019-08-27 2021-05-04 M.S. Technologies, L.L.C. Soybean cultivar 85281832
US10897871B1 (en) 2019-08-27 2021-01-26 M.S. Technologies, L.L.C. Soybean cultivar 86240211
US11006604B2 (en) 2019-08-27 2021-05-18 M.S. Technologies, L.L.C. Soybean cultivar 82431018
US11044877B2 (en) 2019-08-27 2021-06-29 M.S. Technologies, L.L.C. Soybean cultivar 85262507
US11006605B2 (en) 2019-08-27 2021-05-18 M.S. Technologies, L.L.C. Soybean cultivar 84410120
US10999999B2 (en) 2019-08-28 2021-05-11 M.S. Technologies, L.L.C. Soybean cultivar 83392343
US10986797B2 (en) 2019-08-28 2021-04-27 M.S. Technologies, L.L.C. Soybean cultivar 86440139
US11071274B2 (en) 2019-08-28 2021-07-27 M.S. Technologies, L.L.C. Soybean cultivar 83050118
US10986799B2 (en) 2019-08-28 2021-04-27 M.S. Technologies, L.L.C. Soybean cultivar 81440919
US10966397B2 (en) 2019-08-28 2021-04-06 M.S. Technologies, L.L.C. Soybean cultivar 82151940
US11076554B2 (en) 2019-08-28 2021-08-03 M.S. Technologies, L.L.C. Soybean cultivar 87272107
US11019791B2 (en) 2019-08-28 2021-06-01 M.S. Technologies, L.L.C. Soybean cultivar 89242215
US11096364B2 (en) 2019-08-28 2021-08-24 M.S. Technologies, L.L.C. Soybean cultivar 81111940
US11006606B2 (en) 2019-08-28 2021-05-18 M.S. Technologies, L.L.C. Soybean cultivar 81201100
US10952401B1 (en) 2019-08-28 2021-03-23 M.S. Technologies, L.L.C. Soybean cultivar 83292238
US10966399B2 (en) 2019-08-28 2021-04-06 M.S. Technologies, L.L.C. Soybean cultivar 80532336
US10959391B2 (en) 2019-08-28 2021-03-30 M.S. Technologies, L.L.C. Soybean cultivar 80412336
US10966398B2 (en) 2019-08-28 2021-04-06 M.S. Technologies, L.L.C. Soybean cultivar 86240546
US10986798B2 (en) 2019-08-28 2021-04-27 M.S. Technologies, L.L.C. Soybean cultivar 82230919
US11006607B2 (en) 2019-08-29 2021-05-18 M.S. Technologies, L.L.C. Soybean cultivar 80462534
US11076556B2 (en) 2019-08-29 2021-08-03 M.S. Technologies, L.L.C. Soybean cultivar 83422133
US10925245B1 (en) 2019-08-29 2021-02-23 M.S. Technologies, L.L.C. Soybean cultivar 89021021
US11134635B2 (en) 2019-08-29 2021-10-05 M.S. Technologies, L.L.C. Soybean cultivar 82371519
US11071275B2 (en) 2019-08-29 2021-07-27 M.S. Technologies, L.L.C. Soybean cultivar 88060022
US11140845B2 (en) 2019-08-29 2021-10-12 M.S. Technologies, L.L.C. Soybean cultivar 88041740
US11013198B2 (en) 2019-08-29 2021-05-25 M.S. Technologies, L.L.C. Soybean cultivar 84042612
US10912276B1 (en) 2019-08-29 2021-02-09 M.S. Technologies, L.L.C. Soybean cultivar 85161716
US10939653B1 (en) 2019-08-29 2021-03-09 M.S. Technologies, L.L.C. Soybean cultivar 88432102
US10980209B2 (en) 2019-08-29 2021-04-20 M.S. Technologies, L.L.C. Soybean cultivar 87230016
US10980210B2 (en) 2019-08-29 2021-04-20 M.S. Technologies, L.L.C. Soybean cultivar 80202604
US11000001B2 (en) 2019-08-29 2021-05-11 M.S. Technologies, L.L.C. Soybean cultivar 83271604
US10952404B1 (en) 2019-08-29 2021-03-23 M.S. Technologies, L.L.C. Soybean cultivar 87092440
US11076557B2 (en) 2019-08-29 2021-08-03 M.S. Technologies, L.L.C. Soybean cultivar 83381828
US10952403B1 (en) 2019-08-29 2021-03-23 M.S. Technologies, L.L.C. Soybean cultivar 80462430
US10905082B1 (en) 2019-08-29 2021-02-02 M.S. Technologies, L.L.C. Soybean cultivar 82212235
US11044878B2 (en) 2019-08-29 2021-06-29 M.S. Technologies, L.L.C. Soybean cultivar 88031336
US11140847B2 (en) 2019-08-29 2021-10-12 M.S. Technologies, L.L.C. Soybean cultivar 80372223
US11076555B2 (en) 2019-08-29 2021-08-03 M.S. Technologies, L.L.C. Soybean cultivar 84490022
US10952402B1 (en) 2019-08-29 2021-03-23 M.S. Technologies, L.L.C. Soybean cultivar 81171312
US11134636B2 (en) 2019-08-29 2021-10-05 M.S. Technologies, L.L.C. Soybean cultivar 83222640
US11044879B2 (en) 2019-08-29 2021-06-29 M.S. Technologies, L.L.C. Soybean cultivar 82352802
US11026391B2 (en) 2019-08-29 2021-06-08 M.S. Technologies, L.L.C. Soybean cultivar 82152612
US11140846B2 (en) 2019-08-29 2021-10-12 M.S. Technologies, L.L.C. Soybean cultivar 88070907
US10939654B1 (en) 2019-08-29 2021-03-09 M.S. Technologies, L.L.C. Soybean cultivar 81111423
US10952405B1 (en) 2019-08-29 2021-03-23 M.S. Technologies, L.L.C. Soybean cultivar 88103440
US11109557B1 (en) 2020-02-13 2021-09-07 M.S. Technologies, L.L.C. Soybean cultivar 98110162
US11116168B2 (en) 2020-02-13 2021-09-14 M.S. Technologies, L.L.C. Soybean cultivar 95420460
US11140855B2 (en) 2020-02-13 2021-10-12 M.S. Technologies, L.L.C. Soybean cultivar 90420357
US11202427B2 (en) 2020-02-13 2021-12-21 M.S. Technologies, L.L.C. Soybean cultivar 94110636
US11147230B2 (en) 2020-02-13 2021-10-19 M.S. Technologies, L.L.C. Soybean cultivar 91420287
US11076562B1 (en) 2020-02-13 2021-08-03 M.S. Technologies, L.L.C. Soybean cultivar 95130401
US11076563B1 (en) 2020-02-13 2021-08-03 M.S. Technologies, L.L.C. Soybean cultivar 94040702
US11051481B1 (en) 2020-02-13 2021-07-06 M.S. Technologies, L.L.C. Soybean cultivar 93020437
US11051480B1 (en) 2020-02-13 2021-07-06 M.S. Technologies, L.L.C. Soybean cultivar 93230440
US11191238B2 (en) 2020-02-13 2021-12-07 M.S. Technologies, L.L.C. Soybean cultivar 99240189
US11051479B1 (en) 2020-02-13 2021-07-06 M.S. Technologies, L.L.C. Soybean cultivar 94140580
US11134640B2 (en) 2020-02-13 2021-10-05 M.S. Technologies, L.L.C. Soybean cultivar 94220034
US11147229B2 (en) 2020-02-13 2021-10-19 M.S. Technologies, L.L.C. Soybean cultivar 98240355
US11147231B2 (en) 2020-02-21 2021-10-19 M.S. Technologies, L.L.C. Soybean cultivar 97040540
US11109558B1 (en) 2020-02-21 2021-09-07 M.S. Technologies, L.L.C. Soybean cultivar 91220032
US11140856B2 (en) 2020-02-21 2021-10-12 M.S. Technologies, L.L.C. Soybean cultivar 93440976
US11172639B1 (en) 2020-06-02 2021-11-16 M.S. Technologies, L.L.C. Soybean cultivar 99310382
US11122764B1 (en) 2020-06-02 2021-09-21 M.S. Technologies, L.L.C. Soybean cultivar 91210322
US11140857B1 (en) 2020-06-02 2021-10-12 M.S. Technologies, L.L.C. Soybean cultivar 93320341
US11166430B1 (en) 2020-06-02 2021-11-09 M.S. Technologies, L.L.C. Soybean cultivar 99120525
US11202430B1 (en) 2020-06-02 2021-12-21 M.S. Technologies, L.L.C. Soybean cultivar 93120753
US11213001B2 (en) 2020-06-02 2022-01-04 M.S. Technologies, L.L.C. Soybean cultivar 98320614
US11102951B1 (en) 2020-06-02 2021-08-31 M.S. Technologies, L.L.C. Soybean cultivar 96130264
US11172637B1 (en) 2020-06-02 2021-11-16 M.S. Technologies, L.L.C. Soybean cultivar 96350326
US11172640B1 (en) 2020-06-02 2021-11-16 M.S. Technologies, L.L.C. Soybean cultivar 91230357
US11116169B1 (en) 2020-06-02 2021-09-14 M.S. Technologies, L.L.C. Soybean cultivar 92050703
US11122766B1 (en) 2020-06-02 2021-09-21 M.S. Technologies, L.L.C. Soybean cultivar 96140088
US11122765B1 (en) 2020-06-02 2021-09-21 M.S. Technologies, L.L.C. Soybean cultivar 98220804
US11202429B1 (en) 2020-06-02 2021-12-21 M.S. Technologies, L.L.C. Soybean cultivar 91410746
US11172638B1 (en) 2020-06-02 2021-11-16 M.S. Technologies, L.L.C. Soybean cultivar 97320638
US11172642B1 (en) 2020-07-14 2021-11-16 M.S. Technologies, L.L.C. Soybean cultivar 99150287
US11172641B1 (en) 2020-07-14 2021-11-16 M.S. Technologies, L.L.C. Soybean cultivar 90140287
US11134642B1 (en) 2020-07-14 2021-10-05 M.S. Technologies, L.L.C. Soybean cultivar 98272614
US11202432B1 (en) 2020-07-14 2021-12-21 M.S. Technologies, L.L.C. Soybean cultivar 91410530
US11191241B1 (en) 2020-07-14 2021-12-07 M.S. Technologies, L.L.C. Soybean cultivar 92220615
US11172643B1 (en) 2020-07-14 2021-11-16 M.S. Technologies, L.L.C. Soybean cultivar 94440162
US11116170B1 (en) 2020-07-14 2021-09-14 M.S. Technologies, L.L.C. Soybean cultivar 91250440
CN115867564A (en) 2020-07-14 2023-03-28 先锋国际良种公司 Insecticidal proteins and methods of use thereof
US11197452B1 (en) 2020-07-14 2021-12-14 M.S. Technologies, L.L.C. Soybean cultivar 92140814
US11202433B1 (en) 2020-07-14 2021-12-21 M.S. Technologies, L.L.C. Soybean cultivar 92010858
US11140858B1 (en) 2020-07-14 2021-10-12 M.S. Technologies, L.L.C. Soybean cultivar 91040342
US11191242B1 (en) 2020-07-14 2021-12-07 M.S. Technologies, L.L.C. Soybean cultivar 95450804
US11191240B1 (en) 2020-07-14 2021-12-07 M.S. Technologies, L.L.C. Soybean cultivar 91210615
US11252909B2 (en) 2020-07-17 2022-02-22 M.S. Technologies, L.L.C. Soybean cultivar 94120737
US11224183B1 (en) 2020-07-17 2022-01-18 M.S. Technologies, L.L.C. Soybean cultivar 95040275
US11252913B2 (en) 2020-07-17 2022-02-22 M.S. Technologies, L.L.C. Soybean cultivar 97240377
US11252914B2 (en) 2020-07-17 2022-02-22 M.S. Technologies, L.L.C. Soybean cultivar 95111047
US11202434B1 (en) 2020-07-17 2021-12-21 M.S. Technologies, L.L.C. Soybean cultivar 93140657
US11252911B2 (en) 2020-07-17 2022-02-22 M.S. Technologies, L.L.C. Soybean cultivar 91110447
US11259490B2 (en) 2020-07-17 2022-03-01 M.S. Technologies, L.L.C. Soybean cultivar 99250287
US11202435B1 (en) 2020-07-17 2021-12-21 M.S. Technologies, L.L.C. Soybean cultivar 92040765
US11252910B2 (en) 2020-07-17 2022-02-22 M.S. Technologies, L.L.C. Soybean cultivar 99350737
US11252912B2 (en) 2020-07-17 2022-02-22 M.S. Technologies, L.L.C. Soybean cultivar 90220377
US11219184B1 (en) 2020-07-17 2022-01-11 M.S. Technologies, L.L.C. Soybean cultivar 95250357
US11252908B2 (en) 2020-07-17 2022-02-22 M.S. Technologies, L.L.C. Soybean cultivar 98310437
US11178838B1 (en) 2020-07-29 2021-11-23 M.S. Technologies, L.L.C. Soybean cultivar 99262713
US11224184B1 (en) 2020-07-29 2022-01-18 M.S. Technologies, L.L.C. Soybean cultivar 93330609
US11266103B2 (en) 2020-07-29 2022-03-08 M.S. Technologies, L.L.C. Soybean cultivar 99150754
US11134643B1 (en) 2020-07-29 2021-10-05 M.S. Technologies, L.L.C. Soybean cultivar 93410922
US11337395B2 (en) 2020-07-29 2022-05-24 M.S. Technologies, L.L.C. Soybean cultivar 99090148
US11140860B1 (en) 2020-07-29 2021-10-12 M.S. Technologies, L.L.C. Soybean cultivar 96220972
US11259491B2 (en) 2020-07-29 2022-03-01 M.S. Technologies, L.L.C. Soybean cultivar 80540918
US11252915B1 (en) 2020-07-29 2022-02-22 M.S. Technologies, L.L.C. Soybean cultivar 99040204
US11330782B2 (en) 2020-07-29 2022-05-17 M.S. Technologies, L.L.C. Soybean cultivar 93070018
US11337397B2 (en) 2020-07-29 2022-05-24 M.S. Technologies, L.L.C. Soybean cultivar 90442929
US11219187B1 (en) 2020-07-29 2022-01-11 M.S. Technologies, L.L.C. Soybean cultivar 94240013
US11266101B2 (en) 2020-07-29 2022-03-08 M.S. Technologies, L.L.C. Soybean cultivar 96310052
US11219185B1 (en) 2020-07-29 2022-01-11 M.S. Technologies, L.L.C. Soybean cultivar 97250069
US11219186B1 (en) 2020-07-29 2022-01-11 M.S. Technologies, L.L.C. Soybean cultivar 91120809
US11178837B1 (en) 2020-07-29 2021-11-23 M.S. Technologies, L.L.C. Soybean cultivar 92230102
US11266104B2 (en) 2020-07-29 2022-03-08 M.S. Technologies, L.L.C. Soybean cultivar 99030547
US11337396B2 (en) 2020-07-29 2022-05-24 M.S. Technologies, L.L.C. Soybean cultivar 92312145
US11266102B2 (en) 2020-07-29 2022-03-08 M.S. Technologies, L.L.C. Soybean cultivar 92220922
US11197453B1 (en) 2020-07-29 2021-12-14 M.S. Technologies, L.L.C. Soybean cultivar 95130716
US11229179B1 (en) 2020-07-29 2022-01-25 M.S. Technologies, L.L.C. Soybean cultivar 91410830
US11140859B1 (en) 2020-07-29 2021-10-12 M.S. Technologies, L.L.C. Soybean cultivar 90120947
US11363791B2 (en) 2020-09-25 2022-06-21 M.S. Technologies, L.L.C. Soybean cultivar 96060511
US11432513B2 (en) 2020-09-25 2022-09-06 M.S. Technologies, L.L.C. Soybean cultivar 99350040
US11412693B2 (en) 2020-09-25 2022-08-16 M.S. Technologies, L.L.C. Soybean cultivar 95240447
US11363790B2 (en) 2020-09-25 2022-06-21 M.S. Technologies, L.L.C Soybean cultivar 91320747
US11369075B2 (en) 2020-09-25 2022-06-28 M.S. Technologies, L.L.C. Soybean cultivar 90392435
US11363789B2 (en) 2020-09-25 2022-06-21 M.S. Technologies, L.L.C. Soybean cultivar 90440910
AU2021355365A1 (en) 2020-09-30 2023-04-06 Corteva Agriscience Llc Rapid transformation of monocot leaf explants
US11540481B2 (en) 2020-12-29 2023-01-03 M.S. Technologies, L.L.C. Soybean cultivar 97282440
US11477962B2 (en) 2020-12-29 2022-10-25 M.S. Technologies, L.L.C. Soybean cultivar 94110617
US11445691B2 (en) 2020-12-29 2022-09-20 M.S. Technologies, L.L.C. Soybean cultivar 92170645
US11457602B2 (en) 2020-12-29 2022-10-04 M.S. Technologies, L.L.C. Soybean cultivar 97442034
US11930766B2 (en) 2021-09-07 2024-03-19 M.S. Technologies, L.L.C. Soybean cultivar 03220758
US11818998B2 (en) 2021-09-07 2023-11-21 M.S. Technologies, L.L.C. Soybean cultivar 05370116
US11696559B2 (en) 2021-09-07 2023-07-11 M.S. Technologies, L.L.C. Soybean cultivar 08230349
US11737417B2 (en) 2021-09-07 2023-08-29 M.S. Technologies, L.L.C. Soybean cultivar 09020706
US11716948B2 (en) 2021-09-07 2023-08-08 M.S. Technologies, L.L.C. Soybean cultivar 04010758
US11825797B2 (en) 2021-09-07 2023-11-28 M.S. Technologies, L.L.C. Soybean cultivar 03020534
US11678638B2 (en) 2021-09-07 2023-06-20 M.S. Technologies, L.L.C. Soybean cultivar 02050116
US11737418B2 (en) 2021-09-07 2023-08-29 M.S. Technologies, L.L.C. Soybean cultivar 00120926
US11678637B2 (en) 2021-09-07 2023-06-20 M.S. Technologies, L.L.C. Soybean cultivar 03220116
US11653616B2 (en) 2021-09-07 2023-05-23 M.S. Technologies, L.L.C. Soybean cultivar 03310138
US11712016B2 (en) 2021-09-07 2023-08-01 M.S. Technologies, L.L.C. Soybean cultivar 05101723
US11825800B2 (en) 2021-09-08 2023-11-28 M.S. Technologies, L.L.C. Soybean cultivar 05020705
US11825798B2 (en) 2021-09-08 2023-11-28 M.S. Technologies, L.L.C. Soybean cultivar 07030530
US11700828B2 (en) 2021-09-08 2023-07-18 M.S. Technologies, L.L.C. Soybean cultivar 00320209
US11832575B2 (en) 2021-09-08 2023-12-05 M.S. Technologies, L.L.C. Soybean cultivar 09230307
US11716950B2 (en) 2021-09-08 2023-08-08 M.S. Technologies, L.L.C. Soybean cultivar 02020322
US11707043B2 (en) 2021-09-08 2023-07-25 M.S. Technologies, L.L.C. Soybean cultivar 02330315
US11771039B2 (en) 2021-09-08 2023-10-03 M.S. Technologies, L.L.C. Soybean cultivar 06210302
US11696560B2 (en) 2021-09-08 2023-07-11 M.S. Technologies, L.L.C. Soybean cultivar 01440925
US11825799B2 (en) 2021-09-08 2023-11-28 M.S. Technologies, L.L.C. Soybean cultivar 01120432
US11647728B2 (en) 2021-09-08 2023-05-16 M.S. Technologies, L.L.C. Soybean cultivar 04420302
US11653617B2 (en) 2021-09-08 2023-05-23 M.S. Technologies, L.L.C. Soybean cultivar 08330707
US11716949B2 (en) 2021-09-08 2023-08-08 M.S. Technologies, L.L.C. Soybean cultivar 04130507
US11622528B2 (en) 2021-09-08 2023-04-11 M.S. Technologies, L.L.C. Soybean cultivar 01230324
US11766017B2 (en) 2021-09-08 2023-09-26 M.S. Technologies, L.L.C. Soybean cultivar 01430308
US11839191B2 (en) 2021-09-08 2023-12-12 M.S. Technologies, L.L.C. Soybean cultivar 01230720
US11716951B2 (en) 2021-09-08 2023-08-08 M.S. Technologies, L.L.C. Soybean cultivar 04130322
US11690345B2 (en) 2021-09-08 2023-07-04 M.S. Technologies, L.L.C. Soybean cultivar 09150308
US11895974B2 (en) 2021-09-08 2024-02-13 M.S. Technologies, L.L.C. Soybean cultivar 08140308
US11716952B2 (en) 2021-09-08 2023-08-08 M.S. Technologies, L.L.C. Soybean cultivar 04233715
US11785909B2 (en) 2021-09-10 2023-10-17 M.S. Technologies, L.L.C. Soybean cultivar 08080157
US11716953B2 (en) 2021-09-10 2023-08-08 M.S. Technologies, L.L.C. Soybean cultivar 02440012
US11716955B2 (en) 2021-09-10 2023-08-08 M.S. Technologies, L.L.C. Soybean cultivar 08080534
US11856915B2 (en) 2021-09-10 2024-01-02 M.S. Technologies, L.L.C. Soybean cultivar 00350156
US11696562B2 (en) 2021-09-10 2023-07-11 M.S. Technologies, L.L.C. Soybean cultivar 06320913
US11778971B2 (en) 2021-09-10 2023-10-10 M.S. Technologies, L.L.C. Soybean cultivar 08150118
US11696561B2 (en) 2021-09-10 2023-07-11 M.S. Technologies, L.L.C. Soybean cultivar 03420817
US11690346B2 (en) 2021-09-10 2023-07-04 M.S. Technologies, L.L.C. Soybean cultivar 08210041
US11766018B2 (en) 2021-09-10 2023-09-26 M.S. Technologies, L.L.C. Soybean cultivar 08110534
US11744214B2 (en) 2021-09-10 2023-09-05 M.S. Technologies, L.L.C. Soybean cultivar 04040454
US11712017B2 (en) 2021-09-10 2023-08-01 M.S. Technologies, L.L.C. Soybean cultivar 02270817
US11716954B2 (en) 2021-09-10 2023-08-08 M.S. Technologies, L.L.C. Soybean cultivar 04110156
US11744213B2 (en) 2021-09-10 2023-09-05 M.S. Technologies, L.L.C. Soybean cultivar 05150332
US11771042B2 (en) 2021-09-15 2023-10-03 M.S. Technologies, L.L.C. Soybean cultivar 01310539
US11825801B2 (en) 2021-09-15 2023-11-28 M.S. Technologies, L.L.C. Soybean cultivar 03120254
US11930767B2 (en) 2021-09-15 2024-03-19 M.S. Technologies, L.L.C. Soybean cultivar 04150316
US11766020B2 (en) 2021-09-15 2023-09-26 M.S. Technologies, L.L.C. Soybean cultivar 01450536
US11785910B2 (en) 2021-09-15 2023-10-17 M.S. Technologies, L.L.C. Soybean cultivar 00150230
US11758868B2 (en) 2021-09-15 2023-09-19 M.S. Technologies, L.L.C. Soybean cultivar 03130400
US11766019B2 (en) 2021-09-15 2023-09-26 M.S. Technologies, L.L.C. Soybean cultivar 08220628
US11832576B2 (en) 2021-09-15 2023-12-05 M.S. Technologies, L.L.C. Soybean cultivar 08050515
US11771041B2 (en) 2021-09-15 2023-10-03 M.S. Technologies, L.L.C. Soybean cultivar 00230222
US11771040B2 (en) 2021-09-15 2023-10-03 M.S. Technologies, L.L.C. Soybean cultivar 07110300
US11856916B2 (en) 2021-09-15 2024-01-02 M.S. Technologies, L.L.C. Soybean cultivar 06380605
US11766021B2 (en) 2021-09-15 2023-09-26 M.S. Technologies, L.L.C. Soybean cultivar 03420109
US11856917B2 (en) 2021-09-15 2024-01-02 M.S. Technologies, L.L.C. Soybean cultivar 02220303
US11758867B2 (en) 2021-09-15 2023-09-19 M.S. Technologies, L.L.C. Soybean cultivar 01020340
US11895975B2 (en) 2021-09-15 2024-02-13 M.S. Technologies, L.L.C. Soybean cultivar 09001515
US11778972B2 (en) 2021-09-15 2023-10-10 M.S. Technologies, L.L.C. Soybean cultivar 05120629
US11812716B2 (en) 2021-09-22 2023-11-14 M.S. Technologies, L.L.C. Soybean cultivar 04110707
US11825802B2 (en) 2021-09-22 2023-11-28 M.S. Technologies, L.L.C. Soybean cultivar 05220177
US11812715B2 (en) 2021-09-22 2023-11-14 M.S. Technologies, L.L.C. Soybean cultivar 05150847
US11818999B2 (en) 2021-09-22 2023-11-21 M.S. Technologies, L.L.C. Soybean cultivar 04420349
US11812713B2 (en) 2021-09-22 2023-11-14 M.S. Technologies, L.L.C. Soybean cultivar 09080611
US11812712B2 (en) 2021-09-22 2023-11-14 M.S. Technologies, L.L.C. Soybean cultivar 02120535
US11819001B2 (en) 2021-09-22 2023-11-21 M.S. Technologies, L.L.C. Soybean cultivar 02180205
US11771043B2 (en) 2021-09-22 2023-10-03 M.S. Technologies, L.L.C. Soybean cultivar 06110608
US11825803B2 (en) 2021-09-22 2023-11-28 M.S. Technologies, L.L.C. Soybean cultivar 08140870
US11832577B2 (en) 2021-09-22 2023-12-05 M.S. Technologies, L.L.C. Soybean cultivar 08070926
US11819002B2 (en) 2021-09-22 2023-11-21 M.S. Technologies, L.L.C. Soybean cultivar 06140706
US11819000B2 (en) 2021-09-22 2023-11-21 M.S. Technologies, L.L.C. Soybean cultivar 05030038
US11778974B2 (en) 2021-09-22 2023-10-10 M.S. Technologies, L.L.C. Soybean cultivar 07050021
US11716956B2 (en) 2021-09-22 2023-08-08 M.S. Technologies, L.L.C. Soybean cultivar 07090548
US11812717B2 (en) 2021-09-22 2023-11-14 M.S. Technologies, L.L.C. Soybean cultivar 06360802
US11778973B2 (en) 2021-09-22 2023-10-10 M.S. Technologies, L.L.C. Soybean cultivar 00150108
US11812714B2 (en) 2021-09-22 2023-11-14 M.S. Technologies, L.L.C. Soybean cultivar 03330181
US11925163B2 (en) 2021-10-06 2024-03-12 M.S. Technologies, L.L.C. Soybean cultivar 07160900
US11925165B2 (en) 2021-10-06 2024-03-12 M.S. Technologies, L.L.C. Soybean cultivar 03050606
US11832579B2 (en) 2021-10-06 2023-12-05 M.S. Technologies, L.L.C. Soybean cultivar 04120519
US11839194B2 (en) 2021-10-06 2023-12-12 M.S. Technologies, L.L.C. Soybean cultivar 04020201
US11930771B2 (en) 2021-10-06 2024-03-19 M.S. Technologies, L.L.C. Soybean cultivar 02130624
US11925162B2 (en) 2021-10-06 2024-03-12 M.S. Technologies, L.L.C. Soybean cultivar 01030624
US11832580B2 (en) 2021-10-06 2023-12-05 M.S. Technologies, L.L.C. Soybean cultivar 06150159
US11925164B2 (en) 2021-10-06 2024-03-12 M.S. Technologies, L.L.C. Soybean cultivar 07370900
US11930772B2 (en) 2021-10-06 2024-03-19 M.S. Technologies, L.L.C. Soybean cultivar 04220959
US11758870B2 (en) 2021-10-06 2023-09-19 M.S. Technologies, L.L.C. Soybean cultivar 09020446
US11903359B2 (en) 2021-10-06 2024-02-20 M.S. Technologies, L.L.C. Soybean cultivar 05010818
US11930773B2 (en) 2021-10-07 2024-03-19 M.S. Technologies, L.L.C. Soybean cultivar 81150353
US11895977B2 (en) 2021-10-07 2024-02-13 M.S. Technologies, L.L.C. Soybean cultivar 03220926
US11930774B2 (en) 2021-10-07 2024-03-19 M.S. Technologies. L.L.C. Soybean cultivar 03040515
US11930775B2 (en) 2021-10-07 2024-03-19 M.S. Technologies, L.L.C. Soybean cultivar 09160202
US11882809B2 (en) 2021-10-07 2024-01-30 M.S. Technologies, L.L.C. Soybean cultivar 04110611
US11917975B2 (en) 2021-10-07 2024-03-05 M.S. Technologies, L.L.C. Soybean cultivar 05410624
US11895976B2 (en) 2021-10-07 2024-02-13 M.S. Technologies, L.L.C. Soybean cultivar 04370122
US11895978B2 (en) 2021-11-01 2024-02-13 M.S. Technologies, L.L.C. Soybean cultivar 03140402
US11950562B2 (en) 2021-11-01 2024-04-09 M.S. Technologies, L.L.C. Soybean cultivar 04230926
US11895979B2 (en) 2021-11-01 2024-02-13 M.S. Technologies, L.L.C. Soybean cultivar 04420512
US11930776B2 (en) 2021-11-09 2024-03-19 M.S. Technologies, L.L.C. Soybean cultivar 07081321

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4535060A (en) * 1983-01-05 1985-08-13 Calgene, Inc. Inhibition resistant 5-enolpyruvyl-3-phosphoshikimate synthetase, production and use
US4971908A (en) * 1987-05-26 1990-11-20 Monsanto Company Glyphosate-tolerant 5-enolpyruvyl-3-phosphoshikimate synthase
US5491288A (en) * 1991-03-05 1996-02-13 Rhone Poulenc Agrochimie Chimeric gene comprising the arabidopsis histone H4 promoter for the transformation of plants
US5510471A (en) * 1991-03-05 1996-04-23 Rhone-Poulenc Agrochimie Chimeric gene for the transformation of plants
US5635618A (en) * 1993-11-10 1997-06-03 Rhone-Poulenc Agrochimie Promoter elements of chimeric genes of α-tubulin

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7705215B1 (en) * 1990-04-17 2010-04-27 Dekalb Genetics Corporation Methods and compositions for the production of stably transformed, fertile monocot plants and cells thereof
FR2736929B1 (en) * 1995-07-19 1997-08-22 Rhone Poulenc Agrochimie ISOLATED DNA SEQUENCE THAT MAY SERVE AS A REGULATION ZONE IN A CHIMERIC GENE FOR USE IN PLANT TRANSFORMATION

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4535060A (en) * 1983-01-05 1985-08-13 Calgene, Inc. Inhibition resistant 5-enolpyruvyl-3-phosphoshikimate synthetase, production and use
US4971908A (en) * 1987-05-26 1990-11-20 Monsanto Company Glyphosate-tolerant 5-enolpyruvyl-3-phosphoshikimate synthase
US5491288A (en) * 1991-03-05 1996-02-13 Rhone Poulenc Agrochimie Chimeric gene comprising the arabidopsis histone H4 promoter for the transformation of plants
US5510471A (en) * 1991-03-05 1996-04-23 Rhone-Poulenc Agrochimie Chimeric gene for the transformation of plants
US5635618A (en) * 1993-11-10 1997-06-03 Rhone-Poulenc Agrochimie Promoter elements of chimeric genes of α-tubulin

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102471776A (en) * 2009-07-01 2012-05-23 拜尔生物科学公司 Methods and means for obtaining plants with enhanced glyphosate tolerance
WO2011076877A1 (en) 2009-12-23 2011-06-30 Bayer Cropscience Ag Plants tolerant to hppd inhibitor herbicides
WO2011076892A1 (en) 2009-12-23 2011-06-30 Bayer Cropscience Ag Plants tolerant to hppd inhibitor herbicides
WO2011076889A1 (en) 2009-12-23 2011-06-30 Bayer Cropscience Ag Plants tolerant to hppd inhibitor herbicides
WO2011076882A1 (en) 2009-12-23 2011-06-30 Bayer Cropscience Ag Plants tolerant to hppd inhibitor herbicides
WO2011076885A1 (en) 2009-12-23 2011-06-30 Bayer Cropscience Ag Plants tolerant to hppd inhibitor herbicides
WO2014178932A1 (en) * 2013-05-02 2014-11-06 Syngenta Participations Ag Glyphosate resistant class i epsps genes
US9758792B2 (en) 2013-05-02 2017-09-12 Syngenta Participations Ag Glyphosate resistant class 1 EPSPS genes
WO2017205287A1 (en) * 2016-05-24 2017-11-30 Monsanto Technology Llc Plant regulatory elements and uses thereof
KR20190008933A (en) 2016-05-24 2019-01-25 몬산토 테크놀로지 엘엘씨 Plant regulatory elements and their uses
US10351866B2 (en) 2016-05-24 2019-07-16 Monsanto Technology Llc Plant regulatory elements and uses thereof

Also Published As

Publication number Publication date
BR9609774A (en) 1999-01-26
KR19990029091A (en) 1999-04-15
CA2223881C (en) 2012-06-05
US7982092B2 (en) 2011-07-19
DE69626653T2 (en) 2003-12-24
WO1997004114A3 (en) 1997-03-20
US20090328247A1 (en) 2009-12-31
MX9800556A (en) 1998-04-30
EP0850311B1 (en) 2003-03-12
AR002862A1 (en) 1998-04-29
CA2223881A1 (en) 1997-02-06
IL122992A (en) 2006-08-01
JP3961566B2 (en) 2007-08-22
DE69626653D1 (en) 2003-04-17
AU6618496A (en) 1997-02-18
IL122992A0 (en) 1998-08-16
EP0850311A2 (en) 1998-07-01
ES2188769T3 (en) 2003-07-01
AU718521B2 (en) 2000-04-13
ATE234360T1 (en) 2003-03-15
KR100454307B1 (en) 2004-12-17
JPH11509414A (en) 1999-08-24
FR2736929B1 (en) 1997-08-22
FR2736929A1 (en) 1997-01-24
WO1997004114A2 (en) 1997-02-06
ZA966077B (en) 1997-08-13
US6338961B1 (en) 2002-01-15

Similar Documents

Publication Publication Date Title
US6338961B1 (en) Isolated DNA sequence capable of serving as regulatory element in a chimeric gene which can be used for the transformation of plants
US6566587B1 (en) Mutated 5-enolpyruvylshikimate-3-phosphate synthase, gene coding for said protein and transformed plants containing said gene
US6313282B1 (en) Isolated DNA sequence which can serve as terminator region in a chimeric gene capable of being used for the transformation of plants
AU680899B2 (en) Isolated DNA sequence which can serve as terminator region in a chimeric gene capable of being used for the transformation of plants
AU629539B2 (en) Chimeric gene for herbicidal resistance
AU734878B2 (en) Chimeric gene containing several herbicide tolerance genes, plant cell and plant which are tolerant to several herbicides
US6750378B2 (en) Maize H3C4 promoter combined with the first intron of rice actin, chimeric gene comprising it and transformed plant
AU716115B1 (en) Method for shortening internode of inflorescence by introducing gene for petunia transcription factor PetSPL2
US20040045053A1 (en) Pollen specific promoter
AU2002313983B2 (en) Mutated 5-enol pyruvylshikimate-3-phosphate synthase, gene coding for said protein and transformed plants containing said gene
AU757208B2 (en) Mutated 5-enol pyruvylshikimate-3-phosphate synthase, gene coding for said protein and transformed plants containing said gene

Legal Events

Date Code Title Description
STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION