US20020197642A1 - Primer-mediated polynucleotide synthesis and manipulation techniques - Google Patents

Primer-mediated polynucleotide synthesis and manipulation techniques Download PDF


Publication number
US20020197642A1 US10/211,341 US21134102A US2002197642A1 US 20020197642 A1 US20020197642 A1 US 20020197642A1 US 21134102 A US21134102 A US 21134102A US 2002197642 A1 US2002197642 A1 US 2002197642A1
United States
Prior art keywords
method according
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Application number
Joseph Sorge
Kerstien Padgett
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Stratagene California
Original Assignee
Stratagene California
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to US59293896A priority Critical
Priority to US08/713,404 priority patent/US6261797B1/en
Priority to US09/795,965 priority patent/US20010031483A1/en
Application filed by Stratagene California filed Critical Stratagene California
Priority to US10/211,341 priority patent/US20020197642A1/en
Publication of US20020197642A1 publication Critical patent/US20020197642A1/en
Application status is Abandoned legal-status Critical




    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/66General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/686Polymerase chain reaction [PCR]


The invention provides improved techniques for conveniently manipulating polynucleotides of interest without the need to rely upon the presence of naturally occurring restriction sites. Additionally, using the methods and primers of the invention, one may synthesize a polynucleotide of interest in a form which is easily and directionally cloned into a DNA sequence of choice without necessarily introducing extraneous nucleotides in the final polynucleotide product. The methods of the invention employ releasable primers that comprise a recognition site for a releasing enzyme joined to a region for annealing to the polynucleotide template of interest. Polynucleotide sequences of interest are synthesized using one or more synthesis primers, wherein at least one of the primers is a releasable primer. After synthesis, the synthesis product is cleaved by a releasing enzyme. In a preferred embodiment of the invention, inhibitory base analogs are incorporated in the synthesis product to protect against the formation of unwanted internal cleavage products. In another embodiment of the invention, at least one of the releasable primers is bound to an immobilizing solid phase support so as to produce immobilized synthesis products that may be conveniently released by a releasing enzyme. Another aspect of the invention is to provide releasable primers and kits for performing the subject methods. Typically, such kits may comprise a releasing enzyme and one or more reagents for performing a polynucleotide synthesis reaction, preferably a cyclic amplification reaction.


  • The present application is a continuation-in-part of U.S. application Ser. No. 08/592,938, filed Jan. 29, 1996, the disclosure of which is expressly incorporated by reference herein.[0001]
  • The invention is in the field of polynucleotide manipulation techniques, particularly amplification and cloning techniques. [0002]
  • A significant problem with many of the currently available molecular biology techniques is their reliance upon naturally occurring convenient restriction sites. Modifications of the polymerase chain reaction (PCR) and other similar amplification techniques have been developed in an attempt to overcome this problem. In the absence of naturally occurring convenient restriction sites, it is possible to introduce restriction sites into the sequence of interest by using primers and PCR. However, this technique results in the presence of extraneous polynucleotides in the amplification products even after restriction digestion. Such extraneous polynucleotides can be problematic. For example, the introduction of unwanted nucleotides often imposes design limitations on the cloned product which may interfere with the structure and function of the desired gene products. [0003]
  • One method of joining DNA without introducing extraneous bases or relying on the presence of restriction sites is splice overlap extension (SOE). Yon et al., 1989, [0004] Nucl. Acids Res. 17:4895. Horton et al., 1989, Gene 77:61-68. This method is based on the hybridization of homologous 3′single-stranded overhangs to prime synthesis of DNA using each complementary strand as template. Although this technique can join fragments without introducing extraneous nucleotides (in other words, seamlessly), it does not permit the easy insertion of a DNA segment into a specific location when seamless junctions at both ends of the segment are required. Nor does this technique function to join fragments with a vector. Ligation with a vector must be subsequently performed by incorporating restriction sites onto the termini of the final SOE fragment. Finally, this technique is particularly awkward when trying to exchange polynucleotides encoding various domains or mutation sites between genetic constructs encoding related proteins,
  • Another commonly used genetic manipulation technique is immobilized amplification, e.g., immobilized PCR. In techniques involving immobilized PCR, i.e., bound PCR, polynucleotide amplification products are immobilized on a solid phase support. Immobilization is typically accomplished through the use of streptavidin (or avidin) and biotinylated polynucleotides, antibody-hapten binding interactions, or through the covalent attachment of nucleic acids to solid supports. A serious limitation, however, of such conventional immobilization techniques is that the amplification products cannot be conveniently unbound from the solid phase support for use in subsequent manipulations, e.g., sequencing of the amplification products. [0005]
  • An additional problem with conventional techniques, particularly the manipulation of amplification reaction products, is that cleavage at certain restriction sites must be avoided in order to obtain desired polynucleotides. Presently, however, this can only be accomplished by cumbersome techniques such as partial digestions and methylase protection. [0006]
  • Accordingly, in view of the foregoing limitations of current recombinant DNA technology, it is of interest to provide improved techniques for conveniently manipulating polynucleotides without having to rely on naturally occurring convenient restriction sites. It is also of interest to provide methods of synthesizing polynucleotides in which some or all of the nucleotides introduced through synthesis primers may be conveniently removed from the final synthesis product. Additionally, it is of interest to provide improved methods of manipulating polynucleotide synthesis products by restriction enzymes which overcome the problems of cleavage at internal sites within the synthesis products. Further, it is of interest to provide an improved method of releasing amplification products that are bound to a solid phase support. The present invention meets these needs. [0007]
  • The present invention relates to improved methods of synthesizing polynucleotides of interest. The invention is based, in part, on the use of enzymes, referred to herein as releasing enzymes, which cleave polynucleotide substrates. In one embodiment of the invention, it is preferred that the site cleaved by the releasing enzyme is different or distal from the enzyme recognition site on the substrate. The methods of the invention employ primers which comprise a recognition site for a releasing enzyme joined to a region for annealing to the polynucleotide template of interest. These primers are referred to as releasable primers. Preferably, the recognition site for the releasing enzyme is joined 5′ to the annealing region. [0008]
  • In one embodiment of the invention, the releasable primers comprise a recognition site for a type IIS restriction endonuclease. The type IIS restriction endonuclease recognizes this site, but then cleaves the DNA in a sequence independent manner several base pairs 3′ to the recognition site. Optionally, releasable primers of the invention comprise additional nucleotides located 5′ and adjacent to the recognition site. [0009]
  • The releasable primers may be used for priming polynucleotide synthesis reactions, including, but not limited to, polymerase chain reactions and other amplification reactions. [0010]
  • The methods of the invention comprise the steps of synthesizing a polynucleotide sequence of interest with at least one releasable primer. The polynucleotide synthesis reaction may be, but is not necessarily, a cyclic amplification reaction. When polynucleotide synthesis occurs in a cyclic amplification reaction, the polymerase chain reaction (PCR) is particularly preferred for use. After synthesis, the synthesis product is cleaved by a releasing enzyme capable of recognizing the recognition site on the releasable primer. Restriction endonuclease inhibitory base analogs may be incorporated in the synthesis product to protect against unwanted cleavage of internal recognition sites by the releasing enzyme, yet still permit cleavage of the desired sites introduced by the releasable primer or primers. [0011]
  • In another embodiment of the invention, i.e., seamless domain replacement, a first synthesis product is produced using a pair of primers and a second synthesis product is produced using a second pair of primers, wherein at least one member of each pair of primers is a releasable primer. Both first and second syntheses products are subsequently cleaved by releasing enzymes. The resultant released first and second synthesis products may then be ligated to one another so as to produce a recombinant DNA construct that does not contain extraneous nucleotides introduced by the synthesis primers. This method may be used to conveniently replace one segment of a genetic construct with a similar (but different) segment of a second genetic construct. [0012]
  • In another embodiment of the invention, at least one releasable primer is bound to a solid phase support. After synthesis of a polynucleotide of interest using the bound primer, an immobilized synthesis product is produced. The immobilized synthesis product may be released by means of a releasing enzyme. Restriction endonuclease inhibitory base analogs may be incorporated in the synthesis product to protect against unwanted cleavage of internal restriction sites by the selected releasing enzyme, yet still permit cleavage of the desired restriction sites introduced by the releasable primer(s). [0013]
  • Another aspect of the invention is to provide releasable primers and kits for performing the subject methods. Typically, such kits comprise a releasing enzyme and one or more reagents for performing polynucleotide synthesis, e.g., a cyclic amplification reaction. Optionally, such kits further comprise nucleotide base analogs capable of inhibiting or substantially inhibiting cleavage by the releasing enzyme. Preferably, such inhibitory nucleotide base analogs are in the form of nucleoside triphosphates. The kits may also optionally comprise a polynucleotide primer comprising a recognition site for a releasing enzyme. [0014]
  • The methods of the invention permit one to efficiently synthesize and manipulate polynucleotides of interest by primer mediated polynucleotide synthesis, e.g., PCR, without introducing extraneous primer-derived nucleotides into the ultimate synthesis products, i.e., seamless polynucleotide synthesis. The invention allows the efficient directional cloning of a desired DNA sequence into any location without the limitation of naturally occurring convenient restriction sites. Additionally, the invention permits DNA synthesis products to be manipulated by restriction enzymes without problems of cleavage at undesired restriction sites.[0015]
  • FIG. 1 is a schematic diagram of an embodiment of the invention in which two sets of releasable primers are used to produce two different synthesis products that are subsequently ligated to one another to produce a plasmid of interest. Part (A) of the figure shows a first polynucleotide synthesis product obtained by PCR. The figure shows the methods of the invention being employed to replace the D region on the plasmid in part (B) with the D′ region on the plasmid of part (A). In part (A), PCR is performed with releasable primers in the presence of [0016] m5IDCTP (5-methyldCTP) thereby forming an amplification product. The amplification product is subsequently exposed to the releasing enzyme Eam1104I to produce a released synthesis product with overhanging, i.e., “sticky”, non-identical non-palindromic ends to provide for directional cloning. The procedure shown in part (B) is essentially the same as in part (A) except different primers (with a different orientation) and a different template are used. In part (C), the two released synthesis products are ligated together in the presence of Eam1104I. The symbol • is used to indicate the Eam1104I recognition sequence CTCTTC.
  • FIG. 2 is a schematic representation of cycles within a PCR reaction. The diagram indicates that PCR is performed in the presence of an inhibitory base analog. The last cycle of PCR is performed in the absence of the inhibitory base analog. “M” represents the inhibitory base analog, i.e., a modified base. The products of the last cycle only have inhibitory base analogs in one strand.[0017]
  • The term “cyclic amplification reaction,” as used herein, refers to a variety of enzyme mediated polynucleotide synthesis reactions that employ pairs of polynucleotide primers to amplify a given polynucleotide and proceed through one or more cycles, each cycle resulting in polynucleotide replication, i.e., synthesis. A cyclic amplification reaction cycle typically comprises the steps of denaturing the double-stranded template, annealing primers to the denatured template, and synthesizing polynucleotides from the primers. The cycle may be repeated several times so as to produce the desired amount of newly synthesized polynucleotide product. Guidance in performing the various steps of cyclic amplification reactions can be obtained from reviewing literature describing the polymerase chain reaction (“PCR”) including, [0018] PCR: A Practical Approach, M. J. McPherson, et al., IRL Press (1991), PCR Protocols: A Guide to Methods and Applications, by Innis, et al., Academic Press (1990), and PCR Technology: Principals and Applications of DNA Amplification, H. A. Erlich, Stockton Press (1989). PCR is also described in numerous U.S. patents, including U.S. Pat. Nos. 4,683,195; 4,683,202; 4,800,159; 4,965,188; 4,889,818; 5,075,216; 5,079,352; 5,104,792, 5,023,171;
  • [0019] 5,091,310; and 5,066,584, which are hereby incorporated by reference. Many variations of amplification techniques are known to the person of ordinary skill in the art of molecular biology. These variations include rapid amplification of cDNA ends (RACE-PCR), PLCR (a combination of polymerase chain reaction and ligase chain reaction), ligase chain reaction (LCR), self-sustained sequence replication (SSR), Q-beta phage amplification (as described in Shah et al., Journal of Medical Micro. 33(6): 1435-41 (1995)), strand displacement amplification, (SDA), splice overlap extension PCR (SOE-PCR), 3SR amplification (as described in Stillman et al., PCR Methods and Applications 3(6): 320-31 (1994), and the like. A person of ordinary skill in the art may use these known methods to design variations of the releasable primer mediated cyclic amplification reaction based methods explicitly described in this application.
  • The term “oligonucleotide,” as used herein with respect to releasable primers, is intended to be construed broadly. Oligonucleotides include not only DNA but various analogs thereof. Such analogs may be, depending upon the specific releasing enzyme selected for use in a given embodiment of the invention, base analogs and/or backbone analogs, e.g., phosphorothioates, phosphonates, and the like. Techniques for the synthesis of oligonucleotides, e.g., through phosphoramidite chemistry, are well known to the person of ordinary skill in the art and are described, among other places, in [0020] Oligonucleotides and Analogues: A Practical Approach, ed. Eckstein, IRL Press, Oxford (1992). Preferably, the oligonucleotides used as releasable primers are DNA molecules.
  • The terms “amplification”, “amplification products”, “polynucleotide synthesis”, and “polynucleotide synthesis products” are used herein as a matter of convenience and should not be interpreted to limit the subject invention to PCR or other cyclic amplification reactions. Accordingly, one skilled in the art having the benefit of this disclosure will appreciate that the present invention contemplates synthesis of end products through means other than PCR and related cyclic amplification reactions, e.g., DNA synthesis, DNA replication, cDNA synthesis, and the like. [0021]
  • The present invention is based, in part, on the discovery that enzymes which cleave polynucleotides at a position which is different or distal from their recognition site may be used to clone or modify virtually any polynucleotide sequence independent of naturally occurring restriction sites. Accordingly, in certain embodiments of the invention, releasable primers are used to introduce recognition sites for enzymes which cleave polynucleotides at a site distinct from the recognition site. Particularly preferred are sites recognized by type IIS restriction endonucleases. When these primers are used to amplify a polynucleotide product, and then treated with type IIS restriction endonucleases, the polynucleotide sequences in the synthesis product which comprise the type IIS recognition sequence are completely or partially removed. Thus, using the methods of the invention, one may efficiently synthesize and manipulate polynucleotides of interest by primer mediated polynucleotide synthesis, e.g., PCR, without introducing some or all of the primer-derived nucleotides into the ultimate synthesis products. [0022]
  • The invention also allows directional cloning of a desired DNA sequence into any location. Additionally, the invention permits the treatment of polynucleotide synthesis products, including cyclic amplification reaction products, with releasing enzymes to produce the desired end products without cleaving internal restriction sites. The present invention also allows for the convenient release of polynucleotide synthesis products that are immobilized on solid phase supports. [0023]
  • In one specific embodiment of the invention described merely by way of illustrative example herein, the primers and methods of the invention are used to switch predetermined regions of a polynucleotide construct in a manner independent of any naturally occurring restriction sites. This method referred to herein as “seamless domain replacement,” affords the skilled practitioner unprecedented freedom to design, manipulate, and clone desired polynucleotide products. [0024]
  • Releasable Primers and Their Cognate Releasing Enzymes
  • In accordance with the embodiments of the invention, releasable primers and pairs of releasable primers, are provided. “Releasable primers” comprise a single stranded oligonucleotide and have two separate regions: (1) the “releasing enzyme recognition site” and (2) the “annealing region”. In a preferred embodiment of the invention, the releasing enzyme recognition site is located 5′ to the annealing region. The releasable primer may further comprise additional nucleotides located adjacent, preferably 5′, to the releasing enzyme recognition site. [0025]
  • The “releasing enzyme recognition site” of a releasable primer may consist of the nucleotides which identify the recognition site for a given restriction endonuclease, in other words, a restriction endonuclease recognition site. In fact, the recognition site may be any site that is recognized by a sequence specific DNA binding protein. The recognition site may alternatively be a binding site for an “artificial restriction enzyme” which makes use of organic cleaving molecules such as those described in U.S. Pat. No. 4,942,227 issued Jul. 17, 1990. In certain embodiments of the invention, it is preferred that the “recognition site” is the recognition site for a restriction endonuclease wherein a base in one strand of the recognition site is lacking in the other strand of the recognition site. Such enzymes are defined herein for purposes of the invention as Class A enzymes (see infra). Alternatively, releasing enzyme recognition sites may be sites which are recognized by Class B or Class C enzymes. Class B and Class C enzymes are described more fully below in the next section. [0026]
  • In a preferred embodiment of the invention, the recognition site is recognized by a type IIS restriction endonuclease wherein one strand of the recognition sequence lacks a base that is present on the complementary strand of the recognition sequence. A type IIS restriction endonuclease is a restriction endonuclease that cleaves outside of the recognition site. A review of type IIS (also referred to as class IIS) restriction endonucleases can be found in Szybalski et al., [0027] Gene 100:13-26 (1991). In accordance with particularly preferred embodiments of the invention, the recognition site is for the type IIS restriction endonuclease Eam1104I. This recognition site is particularly preferred because it contains three cytosine residues in one strand which are lacking in the complementary strand of the recognition site.
  • Alternatively, the “releasing enzyme recognition site” of a releasable primer may consist of a protein or polypeptide (or biotin or other hapten) which is recognized by an enzyme capable of cleaving a polynucleotide substrate. In this case, the releasable primer will be a hybrid molecule comprised of protein (or biotin or other hapten) linked to a polynucleotide. The releasing enzyme recognizes the site on the protein portion of the releasable primer, and then cleaves the polynucleotide portion of the releasable primer. The cleavage may be performed by a catalytic protein domain of the releasing enzyme, or may be performed by an organic cleaving moiety linked to the releasing enzyme. In embodiments of the invention in which the hybrid molecules are comprised of biotin or other haptens, the releasing enzyme will recognize the biotin or hapten portion of the hybrid molecule. [0028]
  • The “annealing region” of a releasable primer of the invention comprises a polynucleotide sequence designed to anneal to target polynucleotides and prime synthesis of a desired polynucleotide at a specific location on a polynucleotide template. Polynucleotide synthesis products produced in a synthesis reaction employing a releasable primer may be contacted with a releasing enzyme that cleaves within the recognition site of the releasable primer or outside the recognition site (when the releasing enzyme is a type IIS restriction endonuclease). The precise nucleotide sequence of the annealing region in a specific embodiment of the invention is dependent upon the nucleotide sequence to which the releasable primer is designed to anneal. [0029]
  • Principles for designing amplification primers that anneal to and amplify polynucleotides of interest are well known to the person of ordinary skill in the art and may be readily applied for use in the design of annealing regions of the releasable primers of the invention. The annealing region hybridizes to templates for synthesis in a manner essentially identical to the annealing of primers in conventional PCR. The annealing region should be of sufficient length to permit specific annealing to the targeted sites. Preferably, the annealing region is at least nucleotides in length, more preferably, at least 20 nucleotides in length. While the annealing region may be 30 nucleotides in length or significantly longer, the increased length is usually not necessary to produce the desired synthesis products. Additionally, a releasable primer with a long annealing region, i.e., greater than about 30 nucleotides, may be unnecessarily difficult and expensive to synthesize. [0030]
  • In certain embodiments of the invention, it may be of interest to provide portions of the annealing region that do not necessarily anneal to the target template, thereby providing for the introduction of additional polynucleotide sequences into the synthesis product These additional nucleotides may be used to introduce site-directed mutations or to facilitate additional sequence manipulations. [0031]
  • Releasable primers may further comprise additional nucleotides located 5′ and adjacent to the recognition site. These additional nucleotides are optionally present in releasable primers of the invention. Such additional nucleotides located 5′ to the recognition site may enhance the activity of the selected releasing enzyme. Preferably, the additional 5′ nucleotides are of minimal length to reduce the possibility of hybridization to non-targeted polynucleotide sequences. Nucleotide sequence information of a polynucleotide comprising the target sequence for synthesis may be used in designing the sequence of any additional nucleotides located 5′ to the recognition site so that the releasable primers do not anneal to non-targeted segments of the polynucleotide for synthesis or self-anneal to segments of the primer. In those embodiments of the invention in which the releasing enzyme is Eam1104I, preferably at least two additional nucleotides are present 5′ to the Eam1104I recognition site. Another aspect of the present invention is the discovery that these two or more additional nucleotides significantly improves Eam1104I activity. [0032]
  • “Releasing enzymes” are enzymes which are capable of cleaving polynucleotide substrates at desired sites introduced by the releasable primer or primers of the invention and, when used in accordance with methods of the invention, are either incapable of or may be rendered incapable of undesired cleavage at internal sites. Releasing enzymes useful in the present invention are restriction endonucleases capable of recognizing the releasing enzyme recognition site introduced by a given releasable primer. Releasing enzymes may be naturally occurring restriction enzymes, or may be hybrid molecules comprised of a polynucleotide binding domain attached to a cleaving domain. For example, releasing enzymes may include hybrid enzymes such as those described in U.S. Pat. No. 5,436,150, issued Jul. 25, 1995, wherein the cleavage domain of the Fok I enzyme is linked to the recognition domain of another protein. Additionally, the recognition domain of the releasing enzyme may be linked to a non-protein cleaving agent, for example, an organic DNA cleaving moiety, such those described by Oakley et al. (1994), Bioconjug. Chem. 5:242-247. Further, the releasing enzyme may be an “artificial restriction enzyme” similar to those described in U.S. Pat. No. 4,942,227, issued Jul. 17, 1990. [0033]
  • In preferred embodiments of the invention, the releasing enzyme is a type IIS restriction endonuclease wherein the type IIS endonuclease may also be further characterized as a Class A, B or C enzyme (as defined herein infra.). Type IIS restriction endonucleases of interest recognize a specific nucleotide sequence and catalyze a double-stranded cleavage in a region outside the specific sequence of the restriction endonuclease recognition site. By using type IIS restriction endonucleases as releasing enzymes, all or part of the nucleotides introduced by the releasable primers of the invention may be removed from the polynucleotide product. Preferred type IIS restriction endonucleases for use as releasing enzymes cleave DNA 3′ with respect to the recognition site. The type IIS restriction endonuclease Eam1104I has been found particularly useful in the methods of the invention, and its use is specifically described by way of example herein. Many different type IIS restriction endonucleases and other restriction endonucleases are known to the person of ordinary skill in art, for example, see Szybalski, et al., [0034] Gene 100:13-26 (1991); and Ausubel, et al., Current Protocols in Molecular Biology, John Wiley & Sons (1995). It will be further appreciated by a person of ordinary skill in the art that new restriction endonucleases are continually being discovered and may be readily adapted for use in the subject invention.
  • Releasing enzymes may also include enzymes which cleave polynucleotides but which recognize a site which is other than a polynucleotide sequence, for example, another protein. [0035]
  • Examples of such releasing enzymes are, for example, exonucleases and polymerases having exonuclease activity. [0036]
  • In one embodiment of the invention, a polynucleotide of interest is synthesized in a polynucleotide synthesis reaction employing a primer that is a releasable primer. The polynucleotide synthesis reaction may be, but is not necessarily, a cyclic amplification reaction. In those embodiments of the invention in which synthesis occurs in a cyclic amplification reaction, typically 10-30 amplification cycles are used; however, the number of cycles may be as low as 1. Amplification reaction parameters, e.g., temperature and time, may be determined by reference to conventional cyclic amplification techniques such as the polymerase chain reaction (PCR). In a cyclic amplification reaction employing a pair of primers, at least one of the primers is a releasable primer. In a preferred embodiment of the invention, the first and second primers of a cyclic amplification reaction are both releasable primers. [0037]
  • In accordance with the invention, the polynucleotide synthesis reaction of the invention results in the generation of a polynucleotide synthesis product, i.e., a double-stranded polynucleotide, which incorporates at least one releasable primer. After the desired synthesis product is produced, the synthesis product is contacted with a releasing enzyme. The releasing enzyme cleaves the synthesis product according to the sites introduced by the releasable primer during the synthesis reaction, whereby a released synthesis product is produced. Releasing enzymes that are type IIS restriction endonucleases, and thus cleave outside the releasing enzyme recognition site, may be used to produce released synthesis products that do not contain either all or part of the nucleotide sequences derived from the releasable primer or primers used to generate the polynucleotide synthesis product. Pairs of releasable primers may be used to produce released polynucleotide synthesis products that have non-identical overhanging ends, thereby permitting directional cloning of the released polynucleotide synthesis product in a predetermined orientation. [0038]
  • Preventing Cleavage at Internal Sites
  • Treatment of synthesis products with releasing enzymes may result in the formation of undesired digestion products because of the presence of “internal”, i.e., pre-existing, restriction sites in regions of the synthesis products not derived from the synthesis primers. These internal restriction sites may be identified prior to synthesis or may be cryptic because no prior sequence information exists about the entire polynucleotide being synthesized. [0039]
  • This potential problem with internal restriction sites can be avoided by incorporating inhibitory base analogs into the polynucleotide synthesis products to protect or substantially protect the internal restriction sites from cleavage by the releasing enzyme. In accordance with an aspect of the invention, protection of internal restriction sites is accomplished by selection of a releasing enzyme that is an analog sensitive releasing enzyme with respect to the nucleotide base analog or analogs selected for use. [0040]
  • Analog sensitive releasing enzymes are releasing enzymes that are inhibited or substantially inhibited by a base analog at a nucleotide or nucleotides of the recognition site and/or the cleavage site of the restriction endonuclease. It will be appreciated by those skilled in the art that a given analog sensitive releasing enzyme is not inhibited or substantially inhibited by all nucleotide base analogs. Accordingly, a given releasing enzyme is analog sensitive with respect to a given nucleotide base analog. Conversely, a nucleotide base analog that inhibits or substantially inhibits the releasing enzyme is an inhibitory base analog with respect to that releasing enzyme. An example of an analog sensitive releasing enzyme is Eam1104I, which is inhibited by 5-methylcytosine (5-methyl-dCTP) at the recognition site, i.e., 5-methylcytosine is an inhibitory base analog with respect to Eam1104I. [0041]
  • Synthesis of a polynucleotide of interest with inhibitory base analogs may be accomplished by performing a polymerase mediated polynucleotide synthesis reaction with a nucleoside triphosphate mixture comprising the four basic nucleoside triphosphates (deoxyadenosine triphosphate, deoxyguanosine triphosphate, deoxycytidine triphosphate, and deoxythymidine triphosphate) or functional equivalents thereof, wherein at least one of the four basic nucleoside triphosphates is modified to comprise an inhibitory base analog rather than a conventional, i.e., non-inhibiting, nucleotide. [0042]
  • Examples of inhibitory base analogs include 6-methyladenine, 5-methylcytosine, 5-hydroxymethylcytosine, and the like. Inhibitory base analogs may be in the form of deoxyribonucleotide triphosphates (or functional equivalents thereof), in order to provide for polymerase mediated incorporation. Inhibitory nucleotide analogs may also be alpha-thio-deoxyribonucleotide triphosphate analogs. The present invention contemplates the use of any of a multitude of possible nucleotide base analogs as inhibitory base analogs, including, but not limited to, 2′-deoxyriboinosine, 5-iodo-2′-deoxyribocytosine, 5-mecuri-2′-deoxyriboguanosine. Accordingly, those skilled in the art will appreciate that alternative nucleotide base analogs may be suitably utilized as inhibitory base analogs in the invention, provided that such analogs are capable of being specifically incorporated within and protecting or substantially protecting double stranded DNA from cleavage by the selected releasing enzyme. It will also be readily appreciated by persons skilled in the art that in addition to the use of base analogs, analogs of phosphorylated sugars, e.g., phosphorothioates may be used to inhibit releasing enzyme activity. In a preferred embodiment of the invention, the inhibitory base analog is a methylated base analog, and the releasing enzyme is a methylation sensitive releasing enzyme. [0043]
  • The choice of a particular inhibitory base analog or analogs for use in a given embodiment of the invention is dependent upon the particular releasing enzyme selected for use. Certain releasing enzymes for use in the subject methods are inhibited or substantially inhibited by inhibitory base analogs in the recognition site of the restriction endonuclease. The term “substantially inhibited” is used to indicate that the inhibition of the enzymatic activity need not be complete. In many embodiments of the invention, the level of inhibition may be significantly less than complete inhibition because only partial inhibition is necessary to produce a useful amount of the ultimately desired released synthesis product. Inhibition of releasing enzyme cleavage may be achieved by incorporation of the inhibitory base analog into the recognition site and/or the restriction endonuclease cleavage site (when the recognition site and cleavage site are separate from one another). [0044]
  • The inhibitory effects of several nucleotide base analogs (particularly, naturally occurring methylated bases) on the activity of many restriction endonucleases is well described in the literature of molecular biology (see for example, Ausubel et al., [0045] Protocols in Molecular Biology, John Wiley & Sons (1995)). However, it may be necessary to determine whether or not a given nucleotide base analog is an inhibitory base analog with respect to a given restriction endonuclease. The determination of whether or not a given nucleotide base analog is inhibitory with respect to a given releasing enzyme may be made by techniques well known to a person of ordinary skill in the art. For example, a polynucleotide known to be cleaved by a given releasing enzyme can be synthesized with a nucleotide base analog of interest using conventional enzymatic or chemical polynucleotide synthesis techniques. After synthesis, the polynucleotide is treated, i.e., digested, with a restriction endonuclease for potential use as a releasing enzyme which cleaves at the anticipated cleavage sites. The results of the digestion are then analyzed by gel electrophoresis (or the functional equivalent thereof) in order to determine if the anticipated digestion products are produced.
  • Additionally, the choice of an inhibitory base analog for use in a given embodiment of the invention will in part be determined by the sequence of the restriction endonuclease recognition site and the annealing region. The relationship of such sequences to the nucleotide base analog inhibition sensitivities of the releasing enzyme is an important factor in selecting the nucleotide base analog or analogs for use in a given embodiment of the invention. This relationship is of particular importance for purposes of the present invention because the inhibitory base analogs selected for use should not significantly interfere with the ability of the selected releasing enzyme to cleave at either the recognition site or a cleavage site within the annealing region of the releasable primer or primers. If inhibitory base analogs incorporated into the synthesis products at locations complementary to the releasable primer significantly inhibit cleavage, then the synthesis products will not be converted into the desired released synthesis products by the releasing enzyme. [0046]
  • In accordance with the invention, alternative approaches may be used to avoid potential inhibition of released synthesis product formation. One way is to select a releasing enzyme having a recognition sequence that is asymmetric, wherein one strand of the recognition sequence lacks a base that is present on the complementary strand of the recognition sequence, and modification of that base inhibits the activity of the enzyme. These types of enzymes are referred to herein as Class A enzymes. An example of such a Class A releasing enzyme and inhibitory base analog combination is Eam1104I (having a recognition site 5′-CTCTTC-3′) and 5-methylcytosine (or other cytosine derived inhibitory analogs). Because cytosine does not base pair with the cytosine or thymine of the recognition site of the releasable primer, 5-methylcytosine cannot be incorporated into the complementary strand of the Eam1104I recognition site of the releasable primer. Thus, 5-methylcytosine cannot interfere with the ability of Eam1104I to produce released synthesis products. Therefore, when the releasing enzyme used in the subject methods is the particularly preferred Eam 1104I, 5-methylcytosine may be used as the inhibitory base analog. [0047]
  • The problem of potential inhibition of released synthesis product formation may also be avoided by using a releasing enzyme that cleaves when the recognition site of the enzyme has the selected inhibitory base analog in one strand, but is inhibited when the inhibitory base analog is present in both strands of the recognition site. In this embodiment of the invention, the restriction site may be identical and symmetric on both strands, or may be asymmetric. These enzymes, which are inhibited only when both strands contain the inhibitory base analog, are referred to as Class B enzymes. The desired nucleotide product is synthesized using an appropriate inhibitory base analog and the releasable primer (which does not itself contain an inhibitory base analog). Since the recognition sequence in the releasable primer incorporates inhibitory base analog in only one strand (the synthesized complementary strand), the releasing enzyme will cleave at the primer sequence. [0048]
  • Yet another way to allow for the release of synthesis product formation, while avoiding cleavage at internal sites, is by utilizing a primer which lacks inhibitory base analogs, and incorporating inhibitory base analogs into polynucleotide strands primed by the releasable primer but not incorporating the inhibitory analogs into the strand complementary to the releasable primer. The resultant polynucleotide does not have an inhibitory base analog in either strand of the recognition site introduced by the releasable primer. These polynucleotides may then be treated with a releasing enzyme that is inhibited by inhibitory base analogs incorporated into either one or both strands of a restriction site. These types of releasing enzymes are referred to as Class C enzymes. The releasing enzyme may have a symmetric recognition site or an asymmetric site. [0049]
  • One method of producing polynucleotide synthesis products that have inhibitory base analogs in only one strand of the internal recognition sites is through cyclic amplification reactions (see FIG. 2). Inhibitory base analogs may be present during initial reaction cycles of the cyclic amplification reaction, but omitted from the last synthesis step. A purification reaction to remove unincorporated inhibitory base analogs may be performed prior to this last synthesis step, thereby increasing the yield of the desired hemi-modified polynucleotide synthesis product. [0050]
  • Enzymes that may be used to catalyze polynucleotide synthesis in the synthesis steps of the invention, including cyclic amplification reactions, are well known to the person skilled in the art and include, but are not limited to, Taq DNA polymerase, Pfu DNA polymerase (Stratagene), phage T7 polymerase, phage T4 polymerase, [0051] E. coli DNA polymerase I, Vent™ (New England Biolabs, Beverly Mass.) DNA polymerase, Deep Vent™ DNA polymerase (New England Biolabs, Beverly Mass.), Moloney Murine Leukemia Virus reverse transcriptase, and the like. In those embodiments of the invention in which polynucleotide synthesis is achieved by means of a cyclic amplification reaction, the enzyme used to catalyze the polynucleotide synthesis reaction is preferably a thermostable DNA polymerase.
  • When the DNA sequence for synthesis is relatively long and synthesis is achieved by means of a cyclic amplification reaction, it may be desirable to use a mixture of thermostable DNA polymerases, wherein one of the DNA polymerases has 5′-3′ exonuclease activity and the other DNA polymerase lacks or substantially lacks 5′-3′ exonuclease activity. A description of how to amplify long regions of DNA using these polymerase mixtures can be found, among other places, in U.S. Patent No. 5,436,149, Cheng et al., [0052] Proc. Natl. Aca. Sci. USA 91:5695-9 (1994), and Barnes Proc. Natl. Aca. Sci. USA 91:2216-2220 (1994) and U.S. patent applications Ser. Nos. 08/164,290, and 08/197,791.
  • Seamless Domain Replacement
  • The invention is particularly useful because it may be applied to the convenient switching of polynucleotide sequences in related genetic constructs either with or without the introduction of additional nucleotides. This embodiment of the invention is referred to herein as “seamless domain replacement.” Seamless domain replacement involves the use of seamless synthesis reactions to produce a polynucleotide of interest by synthesizing two different polynucleotide sequences using separate sets of primers, cleaving the synthesis products with a releasing enzyme, and ligating together the two sets of released synthesis products. Either all the primers in the two synthesis reactions are releasable primers or one of the primers in each of the two synthesis reactions is a releasable primer. In a preferred embodiment of the invention, all of the primers used for seamless domain replacement are releasable primers. In a particularly preferred embodiment of the invention, which may be used to prevent the introduction of extraneous nucleotides, the releasing enzyme recognition sites of the releasable primers are sites for type IIS restriction endonucleases. The primers may be selected so as to produce released polynucleotide synthesis products that have non-identical overhanging ends, thereby permitting directional cloning. [0053]
  • An example of an embodiment of seamless domain replacement can be found in FIG. 1. FIG. 1 is a schematic diagram of seamless domain replacement showing a first (A) and a second (B) cyclic amplification reaction using releasable primers. The embodiment of the method of the invention shown in FIG. 1 results in the replacement of polynucleotide sequence D with polynucleotide sequence D′. This replacement method comprises the following steps: a polynucleotide of interest is amplified using first and second releasable primers, thereby producing a first synthesis product. The first synthesis product is then treated, i.e., contacted, with a releasing enzyme to produce a first released synthesis product. The method further comprises the step of performing a second cyclic amplification reaction using third and fourth releasable primers to produce a second synthesis product. The second synthesis product is then treated with a selected releasing enzyme to produce a second released synthesis product. The first and second released synthesis products may then be ligated together to produce the genetic construct of interest. Performing the ligation step in the presence of the releasing enzyme reduces the time and steps required to obtain the desired product. [0054]
  • The method of the invention can be used to directionally clone any synthesis product by designing the releasable primers such that the releasing enzyme or enzymes produce non-identical sticky ends (i.e., overhanging ends as opposed to blunt ends). Thus, to directionally clone the seamless domain replacement shown in FIG. 1, the released synthesis products produced by the first and second releasable primers produce a first released synthesis product having non-identical non-palindromic sticky ends that are ligatable (in a directed orientation) with the sticky ends of the second released synthesis product produced from the third and fourth releasable primers. [0055]
  • Another aspect of the invention is to provide releasable primer sets suitable for carrying out seamless domain replacement methods of the invention. The subject primer sets comprise (1) a first primer pair consisting of first and second releasable primers and (2) a second primer pair consisting of third and fourth releasable primers. The releasing enzyme recognition sites of all members of a set of releasable primers for seamless domain replacement may be identical. The annealing regions of the releasable primers are selected subject to the following constraints: (1) a first released synthesis product, resulting from treatment of the synthesis product by a releasing enzyme, has two non-identical sticky ends, (2) a second released synthesis product, resulting from treatment of the synthesis product by a releasing enzyme, has two non-identical sticky ends that are homologous, i.e., capable of being ligated, to the two non-identical sticky ends of the first released synthesis product. [0056]
  • Use of The Invention To Release Polynucleotides From Solid Supports
  • The present invention is also directed to methods for the convenient release of synthesis products bound or immobilized on a solid support. Performing cyclic amplification reactions so as to produce a bound, i.e., immobilized, synthesis product has numerous applications, particularly in the field of assays for a polynucleotide of interest. Such assays may have diagnostics applications for the detection of microorganisms or indicia of disease. Furthermore, cyclic amplification reactions that produce an immobilized synthesis product, particularly a releasable synthesis product, may readily be adapted for use with automated equipment. [0057]
  • Polynucleotide synthesis products may be produced in a form attached to solid phase supports by employing the subject methods of synthesis, wherein polynucleotide synthesis is primed by at least one releasable primer attached to a solid phase support. The releasable primer may be attached to the solid phase support by any of a variety of means, including covalent and non-covalent bonds. Methods for the attachment of polynucleotides to solid supports are well known to the person of ordinary skill in the art. Descriptions of methods for attachment of nucleic acids to a variety of solid supports can be found, among other places, as follows: nitrocellulose (Ranki et al., [0058] Gene 21:77-85 (1983), cellulose (Goldkorn and Prockop, Nucl. Acids Res. 14:9171-9191 (1986), polystyrene (Ruth et al., Conference of Therapeutic and Diagnostic Applications of Synthetic Nucleic Acids. Cambridge U.K. (1987), teflon-acrylamide (Duncan et al. Anal. Biochem 169:104-108 (1988)), polypropylene (Polsky-Cynkin et al. Clin. Chem 31:1438-1443 (1985)), nylon (Van Ness et al., Nucl. Acids Res. 19:3345-3350 (1991)), agarose (Polsky-Cynkin et al., Clin. Chem. 31:1438-1443 (1985)), sephacryl (Langdale and Malcolm, Gene 36:201-210 (1985)), latex (Wolf et al., Nucl. Acids Res. 15:2911-2926 (1987) and paramagnetic beads (Albretsen et al. Anal. Biochem. 189:40-50 (1990), Lang et al. Nucl. Acids Res. 16:10861-10880 (1988)).
  • As the polynucleotide synthesis reaction proceeds, the synthesis products produced are bound to a solid support. Preferably, the polynucleotide synthesis reaction is a cyclic amplification reaction. The synthesis product may be released by contacting the bound synthesis products with a suitable releasing enzyme, thereby producing released synthesis products from the immobilized synthesis products. Released polynucleotide synthesis products may be readily transferred from the site of synthesis and subjected to further manipulation or analysis. [0059]
  • Kits for Practice of The Invention
  • Another aspect of the invention is to provide kits for performing the methods of the invention. The kits of the invention comprise one or more of the enzymes or other reagents for use in performing the subject methods. Kits may contain reagents in pre-measured amounts to ensure both precision and accuracy when performing the subject methods. Preferably, kits contain written instructions that describe how to perform the methods of the subject invention. At a minimum, the kits of the invention comprise a restriction endonuclease and either a nucleoside triphosphate with a base analog inhibitory for that restriction endonuclease or a thermostable DNA polymerase suitable for use in a cyclic amplification reaction. The restriction endonuclease in the kit may be a type IIS restriction endonuclease. In addition, to these embodiments, the kits of the invention may further comprise one or more of the following components: concentrated reaction buffer, DNA ligase, nucleoside triphosphates, mixtures of nucleoside triphosphates in equimolar amounts, nucleoside triphosphates having inhibitory base analogs, mixtures of nucleoside triphosphates and nucleoside triphosphates having inhibitory base analogs, thermostable DNA polymerases, frozen competent cells, positive/negative control templates, control releasable primers, and the like. An example of a kit of the invention is a kit comprising the restriction endonuclease Eam1104I and 5-methylcytosine triphosphate as the inhibitory base analog. [0060]
  • The invention having been described, the following example is offered by way of illustrating the invention and not by way of limitation. [0061]
  • EXAMPLE Seamless Domain Replacement
  • Experiments were performed to use the methods of the invention to replace a segment of a plasmid with a corresponding segment of a second plasmid. The experiments did not rely on the use of convenient restriction sites in either plasmid. [0062]
  • Two commercially available plasmids were used for the experiments. The plasmid pBluescript® II KS contains an alpha complementing fragment of LacZ. The plasmid pWhitescript5.7 is a derivative of pBluescript® II KS (Stratagene) and contains a single point mutation that introduces an ochre stop codon 22 nucleotides downstream from the lacZ ATG. This mutation prevents expression of a functional α-complementing βGal protein, resulting in bacterial colonies that remain white when plated on media supplemented with XGal and IPTG. Exchanging the region that contains the stop codon with that of the parental pBluescript II vector was expected to restore the original blue phenotype of the lacZ gene. [0063]
  • The vector backbone and each domain of interest was PCR amplified in the presence of [0064] m5dCTP. The primers are given in table I; the underlined segments of the polynucleotide indicate the restriction endonuclease recognition site. TABLE 1 (1F) AGTTACTCTTCACCATGATTACGCCAAGCGC (SEQ ID NO: 1) (1R) AGTTACTCTTCAGTGAGCGCGCGTAATACG (SEQ ID NO: 2) (2F) AGTTACTCTTCACACTGGCCGTCGTTTTACAACG (SEQ ID NO: 3) (2R) AGTTACTCTTCATGGTCATAGCTGTTTCCTGTG (SEQ ID NO: 4)
  • Sense and antisense primers for the plasmid backbone (Primers 2R and 2F) were designed to amplify all but a 190-bp region of the lacZ gene of pWhitescript5.7 that contained the point mutation. The primer pair (1F and 1R) for the 190-bp domain of interest was designed to amplify the fragment from pBluescript II needed to reconstitute the complete lacZ gene. The sense primer was engineered to lie within the lacZ gene, downstream from the translation start site. The PCR products were digested with Eam1104I and subsequently ligated together in the presence of the restriction enzyme, for details see Lin and Schwartz, [0065] BioTechniques 12:28-30 (1992); Russek et al., Cell Mol. Biol. Res. 36:177-182 (1993); Weiner, M. P., BioTechniques 15:502-505 (1993). The negative control reaction received no ligase and did not yield colonies upon transformation.
  • The domain of interest was prepared by PCR amplification of 10 ng pBluescript II SK+DNA template in a 50-μl reaction containing 200 μM of each dNTP/2.5 μ Tag DNA polymerase/2.5 μTaqExtender™ additive/200 nM of each primer 1F and 1R/20 mM Tris C1 pH 8.5/10 mM KC1/10 mM (NH[0066] 4)4SO4/2 mM MgCl2/0.1 mg/ml BSA/0.1% Triton X-100. The reaction was overlaid with mineral oil and amplified once at 94° C. for 3 min/58° C. for 2 min/72° C. for 3 min/with 9 subsequent cycles at 94° C. for 45s/58° C. for 35s/72° C. for 1 min. 5 additional cycles were performed in the presence of m5dCTP by adding a 50 μl solution of 200 μM each dATP, dGTP, dTTP/1 mM m5dCTP/2.5 μ each Tag DNA polymerase and TaqExtender™ additive(Stratagene, La Jolla, Calif.) in the same buffer. The cycling parameters were kept constant except for the denaturation cycle which was increased to 95° C. for 1.5 min. Modification of the denaturation cycle was required because methylated DNA has a higher melting temperature compared to unmethylated DNA.
  • Subsequently, we determined that the length of the denaturation cycle could be reduced to 45 sec. without compromising the product yield. [0067]
  • The vector backbone was prepared in the same fashion as the domain of interest, except for the following modifications. The extension time was changed from 1 min to min to accommodate the slower processivity of the enzyme. [0068]
  • The denaturation time was held constant at 45 sec The resulting PCR products were phenol: chloroform extracted and ethanol precipitated. Approx. 0.3 pmol of vector and 1 pmol of insert were combined and digested with 24 units of Eam1104I in 1X universal buffer (100 mM KoAc, 25 mM tris acetate pH 7-6, 10 mM MgOAc, 0.5 mM β-mercaptoethanol, 10 μg/ml BSA) {fraction (1/10)} of the crude digest was ligated for 30 min at 37° C. in a 20 μl reaction containing 50 mM Tris-HCl/10 mM MgCl/10 mM DTT/20 μg BSA per ml/1 mM ATP/8 or 6 units Eam1104I/6 Weiss units T4 DNA ligase. [0069]
  • Competent XL-1 Blue MRF′/[0070] E. coli cells were transformed with 4 μl of the ligation according to the manufacturer's instructions and plated on ampicillin selection medium supplemented with 100 μM IPTG and 10 μg XGal/ml.
  • The data showed that 2% of the bacterial colonies remained white, whereas 98% exhibited the blue color that was expected of clones carrying the restored lacZ gene (data not shown). The high percentage of blue colonies suggests that the addition of Eam1104I to the ligation reaction provided a selection for the formation of the desired product. The presence of the restriction endonuclease in the ligation mixture not only maintains unmethylated vector in a linear state, but also re-digests unwanted ligation products and thus contributes to the assembly and maintenance of only accurately joined insert: vector pairings, which results in higher cloning efficiency. [0071]
  • Incorporation by Reference
  • All patents, patents applications, and publications cited are incorporated herein by reference. [0072]
  • Equivalents
  • The foregoing written specification is considered to be sufficient to enable one skilled in the art to practice the invention. Indeed, various modifications of the above-described methods for carrying out the invention which are obvious to those skilled in the field of molecular biology or related fields are intended to be within the scope of the following claims. [0073]

Claims (36)

What is claimed is:
1. A method of producing a polynucleotide of interest, said method comprising the steps:
synthesizing the polynucleotide of interest in a polynucleotide synthesis reaction employing a first releasable primer, whereby a polynucleotide synthesis product is produced; and
cleaving the polynucleotide synthesis product with a releasing enzyme specific for the releasable primer, whereby a released synthesis product is produced.
2. A method according to claim 1, wherein said polynucleotide synthesis reaction employs a second primer.
3. A method according to claim 2, wherein the second primer is a releasable primer.
4. A method according to claim 2, wherein said polynucleotide synthesis reaction is a cyclic amplification reaction.
5. A method according to claim 4, wherein the cyclic amplification reaction is a polymerase chain reaction.
6. A method according to claim 1, wherein the releasable primer comprises a recognition site for a type IIS restriction endonuclease.
7. A method according to claim 3, wherein the first and second releasable primers comprise recognition sites for a type IIS restriction endonuclease.
8. A method according to claim 1, wherein the releasable primer is bound to a solid phase support.
9. A method according to claim 1, wherein at least one inhibitory base analog is present in the released synthesis product.
10. The method according to claim 9 wherein the inhibitory base analog is a methylated analog.
11. The method according to claim 10, wherein the inhibitory base analog is 5-methyl-cytosine.
12. The method according to claim 11, wherein the releasing enzyme is Eam1104I.
13. A method according to claim 3, wherein at least one inhibitory base analog is present in the released synthesis product.
14. A method according to claim 13, wherein the inhibitory base analog is a methylated analog.
15. A method according to claim 14, wherein the inhibitory base analog is 5-methyl-cytosine.
16. A method according to claim 15, wherein the releasing enzyme is Eam1104I.
17. A method of constructing a polynucleotide of interest, said method comprising the steps of:
synthesizing a first polynucleotide of interest in a polynucleotide synthesis reaction employing first and second primers, wherein at least one of said first and second primers is a releasable primer, whereby a first polynucleotide synthesis is produced;
cleaving the first polynucleotide synthesis product with a releasing enzyme specific for a recognition site of said first releasable primer, whereby a first released synthesis product is produced;
synthesizing a second polynucleotide of interest in a second polynucleotide synthesis reaction employing third and fourth primers, wherein at least one of said third and fourth primers is a releasable primer, whereby a second polynucleotide synthesis product is produced;
cleaving the second polynucleotide synthesis product with said releasing enzyme specific for the recognition site of said third releasable primer, whereby a second released synthesis product is produced; and
ligating the first released synthesis product to the second released synthesis product.
18. A method according to claim 17, wherein said first polynucleotide synthesis reaction is a cyclic amplification reaction.
19. A method according to claim 18, wherein said second polynucleotide synthesis reaction is a cyclic amplification reaction.
20. A method according to claim 19, wherein the first, second, third, and fourth primers are releasable primers.
21. A method according to claim 20, wherein at least one inhibitory base analog is present in the first polynucleotide synthesis product.
22. A method according to claim 21, wherein at least one inhibitory base analog is present in the second polynucleotide synthesis product.
23. The method according to claim 21 wherein the inhibitory base analog is a methylated analog.
24. The method according to claim 23, wherein the inhibitory base analog is 5-methyl-cytosine.
25. The method according to claim 24, wherein the releasing enzyme is Eam1104I.
26. A releasable oligonucleotide primer, said primer comprising a recognition site for a releasing enzyme and an annealing region, wherein the releasing enzyme cleaves polynucleotide substrates at a site separate from the recognition site.
27. A releasable oligonucleotide primer according to claim 26, wherein said releasing enzyme recognition site is a restriction endonuclease recognition site.
28. A releasable oligonucleotide primer according to claim 27, further comprising nucleotides located 5′ and adjacent to the restriction endonuclease recognition site.
29. A releasable oligonucleotide primer according to claim 28, wherein the restriction endonuclease recognition site is recognized by Eam1104I.
30. A releasable oligonucleotide primer according to claim 27, wherein the primer is bound to a solid phase support.
31. A set of releasable synthesis primers for seamless domain replacement comprising the first, second, third, and fourth releasable primers of the method of claim 20.
32. A kit for seamless polynucleotide synthesis, said kit comprising a releasing enzyme.
33. A kit according to claim 32, said kit further comprising an inhibitory base analog nucleoside triphosphate.
34. A kit according to claim 32, said kit further comprising a thermostable DNA polymerase.
35. A kit according to claim 33, wherein the releasing enzyme is a type IIS restriction endonuclease.
36. A kit according to claim 35, said kit comprising 5-methylcytosine triphosphate and Eam1104I.
US10/211,341 1996-01-29 2002-08-05 Primer-mediated polynucleotide synthesis and manipulation techniques Abandoned US20020197642A1 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
US59293896A true 1996-01-29 1996-01-29
US08/713,404 US6261797B1 (en) 1996-01-29 1996-09-13 Primer-mediated polynucleotide synthesis and manipulation techniques
US09/795,965 US20010031483A1 (en) 1996-01-29 2001-02-28 Primer-mediated polynucleotide synthesis and manipulation techniques
US10/211,341 US20020197642A1 (en) 1996-01-29 2002-08-05 Primer-mediated polynucleotide synthesis and manipulation techniques

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
US10/211,341 US20020197642A1 (en) 1996-01-29 2002-08-05 Primer-mediated polynucleotide synthesis and manipulation techniques

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US09/795,965 Continuation US20010031483A1 (en) 1996-01-29 2001-02-28 Primer-mediated polynucleotide synthesis and manipulation techniques

Publications (1)

Publication Number Publication Date
US20020197642A1 true US20020197642A1 (en) 2002-12-26



Family Applications (3)

Application Number Title Priority Date Filing Date
US08/713,404 Expired - Lifetime US6261797B1 (en) 1996-01-29 1996-09-13 Primer-mediated polynucleotide synthesis and manipulation techniques
US09/795,965 Abandoned US20010031483A1 (en) 1996-01-29 2001-02-28 Primer-mediated polynucleotide synthesis and manipulation techniques
US10/211,341 Abandoned US20020197642A1 (en) 1996-01-29 2002-08-05 Primer-mediated polynucleotide synthesis and manipulation techniques

Family Applications Before (2)

Application Number Title Priority Date Filing Date
US08/713,404 Expired - Lifetime US6261797B1 (en) 1996-01-29 1996-09-13 Primer-mediated polynucleotide synthesis and manipulation techniques
US09/795,965 Abandoned US20010031483A1 (en) 1996-01-29 2001-02-28 Primer-mediated polynucleotide synthesis and manipulation techniques

Country Status (2)

Country Link
US (3) US6261797B1 (en)
WO (1) WO1997028282A1 (en)

Families Citing this family (71)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998038326A1 (en) * 1997-02-28 1998-09-03 Nature Technology Corporation Self-assembling genes, vectors and uses thereof
DE19806431C1 (en) 1998-02-17 1999-10-14 Novartis Ag New process for the identification and characterization of mRNA molecules
GB9826247D0 (en) * 1998-11-30 1999-01-20 Nycomed Pharma As Method
GB9913694D0 (en) * 1999-06-11 1999-08-11 Simper Adrian M DNA manipulation methods and applications for synthetic enzymes
US6964847B1 (en) * 1999-07-14 2005-11-15 Packard Biosciences Company Derivative nucleic acids and uses thereof
AU1075701A (en) * 1999-10-08 2001-04-23 Protogene Laboratories, Inc. Method and apparatus for performing large numbers of reactions using array assembly
US7198924B2 (en) 2000-12-11 2007-04-03 Invitrogen Corporation Methods and compositions for synthesis of nucleic acid molecules using multiple recognition sites
EP1130092A1 (en) * 2000-02-14 2001-09-05 Stefan B. c/o Universität Hamburg Abt. für Allgemeinchirurgie Hosch A method of preparing recombinant nucleic acids
US20030017552A1 (en) * 2000-07-21 2003-01-23 Jarrell Kevin A. Modular vector systems
US6730500B1 (en) * 2000-08-30 2004-05-04 Zymogenetics, Inc. Methods for generating a continuous nucleotide sequence from noncontiguous nucleotide sequences
DE10145553B4 (en) * 2001-09-16 2006-06-08 Gene Architects Ag Nucleic acid for a cloning vector
US6815167B2 (en) * 2002-04-25 2004-11-09 Geneohm Sciences Amplification of DNA to produce single-stranded product of defined sequence and length
US7563600B2 (en) 2002-09-12 2009-07-21 Combimatrix Corporation Microarray synthesis and assembly of gene-length polynucleotides
EP1398375A1 (en) * 2002-09-13 2004-03-17 Cosmix Molecular Biologicals GmbH Recombination process for recombining fragments of variant polynucleotides
WO2005014796A2 (en) 2003-08-08 2005-02-17 Invitrogen Corporation Methods and compositions for seamless cloning of nucleic acid molecules
WO2005054438A2 (en) 2003-12-01 2005-06-16 Invitrogen Corporation Nucleic acid molecules containing recombination sites and methods of using the same
JP2007526772A (en) * 2004-02-27 2007-09-20 プレジデント・アンド・フェロウズ・オブ・ハーバード・カレッジ Polony fluorescent beads for in situ sequencing
EP1812598A1 (en) * 2004-10-18 2007-08-01 Codon Devices, Inc. Methods for assembly of high fidelity synthetic polynucleotides
US20070122817A1 (en) * 2005-02-28 2007-05-31 George Church Methods for assembly of high fidelity synthetic polynucleotides
EP1963501A4 (en) * 2005-12-22 2009-04-22 Pacific Biosciences California Protein engineering strategies to optimize activity of surface attached proteins
EP1963530B1 (en) * 2005-12-22 2011-07-27 Pacific Biosciences of California, Inc. Active surface coupled polymerases
US8921086B2 (en) 2005-12-22 2014-12-30 Pacific Biosciences Of California, Inc. Polymerases for nucleotide analogue incorporation
US20090087840A1 (en) * 2006-05-19 2009-04-02 Codon Devices, Inc. Combined extension and ligation for nucleic acid assembly
CN101495656B (en) * 2006-06-07 2017-02-08 纽约哥伦比亚大学理事会 DNA sequencing by nanopore using modified nucleotides
WO2008027558A2 (en) * 2006-08-31 2008-03-06 Codon Devices, Inc. Iterative nucleic acid assembly using activation of vector-encoded traits
WO2008067035A2 (en) * 2006-10-05 2008-06-05 Nationwide Children's Hospital Unrestricted mutagenesis and cloning methods
WO2008051530A2 (en) * 2006-10-23 2008-05-02 Pacific Biosciences Of California, Inc. Polymerase enzymes and reagents for enhanced nucleic acid sequencing
EP2115144A1 (en) * 2007-02-05 2009-11-11 Philipps-Universität Marburg Method of cloning at least one nucleic acid molecule of interest using type iis restriction endonucleases, and corresponding cloning vectors, kits and system using type iis restriction endonucleases
EP2202313A4 (en) * 2007-08-21 2011-03-23 Univ Hokkaido Nat Univ Corp Method for preparation of recombinant dna
EP3002288A1 (en) 2008-09-03 2016-04-06 Quantumdx Group Limited Design, synthesis and use of synthetic nucleotides comprising ionic reporter groups
US9410196B2 (en) 2008-09-03 2016-08-09 Quantumdx Group Limited Methods and kits for nucleic acid sequencing
ES2574137T3 (en) 2008-09-03 2016-06-15 Quantumdx Group Limited Strategies and methods for detecting nucleic acids by biosensors
WO2011030154A1 (en) * 2009-09-12 2011-03-17 Zoragen Biotechnologies Llp Detection of quantitative genetic differences
WO2011056872A2 (en) 2009-11-03 2011-05-12 Gen9, Inc. Methods and microfluidic devices for the manipulation of droplets in high fidelity polynucleotide assembly
US9216414B2 (en) 2009-11-25 2015-12-22 Gen9, Inc. Microfluidic devices and methods for gene synthesis
WO2011085075A2 (en) 2010-01-07 2011-07-14 Gen9, Inc. Assembly of high fidelity polynucleotides
US9605307B2 (en) * 2010-02-08 2017-03-28 Genia Technologies, Inc. Systems and methods for forming a nanopore in a lipid bilayer
US9678055B2 (en) 2010-02-08 2017-06-13 Genia Technologies, Inc. Methods for forming a nanopore in a lipid bilayer
US20110192723A1 (en) * 2010-02-08 2011-08-11 Genia Technologies, Inc. Systems and methods for manipulating a molecule in a nanopore
US8324914B2 (en) 2010-02-08 2012-12-04 Genia Technologies, Inc. Systems and methods for characterizing a molecule
EP2622103B1 (en) * 2010-09-30 2018-09-12 Raindance Technologies, Inc. Sandwich assays in droplets
CA2814047C (en) 2010-10-08 2017-11-14 President And Fellows Of Harvard College High-throughput immune sequencing
DK2625320T3 (en) 2010-10-08 2019-07-01 Harvard College High-throughput single coverage coding
US10457935B2 (en) 2010-11-12 2019-10-29 Gen9, Inc. Protein arrays and methods of using and making the same
WO2012088341A2 (en) 2010-12-22 2012-06-28 Genia Technologies, Inc. Nanopore-based single dna molecule characterization, identification and isolation using speed bumps
US9581563B2 (en) 2011-01-24 2017-02-28 Genia Technologies, Inc. System for communicating information from an array of sensors
US9110478B2 (en) 2011-01-27 2015-08-18 Genia Technologies, Inc. Temperature regulation of measurement arrays
EP2766498B1 (en) 2011-10-14 2019-06-19 President and Fellows of Harvard College Sequencing by structure assembly
US10202628B2 (en) 2012-02-17 2019-02-12 President And Fellows Of Harvard College Assembly of nucleic acid sequences in emulsions
US8986629B2 (en) 2012-02-27 2015-03-24 Genia Technologies, Inc. Sensor circuit for controlling, detecting, and measuring a molecular complex
US9150853B2 (en) 2012-03-21 2015-10-06 Gen9, Inc. Methods for screening proteins using DNA encoded chemical libraries as templates for enzyme catalysis
WO2013163263A2 (en) 2012-04-24 2013-10-31 Gen9, Inc. Methods for sorting nucleic acids and multiplexed preparative in vitro cloning
US9914967B2 (en) 2012-06-05 2018-03-13 President And Fellows Of Harvard College Spatial sequencing of nucleic acids using DNA origami probes
US9494554B2 (en) 2012-06-15 2016-11-15 Genia Technologies, Inc. Chip set-up and high-accuracy nucleic acid sequencing
US9384320B2 (en) 2012-07-19 2016-07-05 President And Fellows Of Harvard College Methods of storing information using nucleic acids
US9476089B2 (en) 2012-10-18 2016-10-25 President And Fellows Of Harvard College Methods of making oligonucleotide probes
US9605309B2 (en) 2012-11-09 2017-03-28 Genia Technologies, Inc. Nucleic acid sequencing using tags
US9759711B2 (en) 2013-02-05 2017-09-12 Genia Technologies, Inc. Nanopore arrays
WO2014163886A1 (en) 2013-03-12 2014-10-09 President And Fellows Of Harvard College Method of generating a three-dimensional nucleic acid containing matrix
US9551697B2 (en) 2013-10-17 2017-01-24 Genia Technologies, Inc. Non-faradaic, capacitively coupled measurement in a nanopore cell array
US10421995B2 (en) 2013-10-23 2019-09-24 Genia Technologies, Inc. High speed molecular sensing with nanopores
US9567630B2 (en) 2013-10-23 2017-02-14 Genia Technologies, Inc. Methods for forming lipid bilayers on biochips
US9863880B2 (en) 2013-11-17 2018-01-09 Quantum-Si Incorporated Optical system and assay chip for probing, detecting and analyzing molecules
WO2016022998A2 (en) 2014-08-08 2016-02-11 Quantum-Si Incorporated Integrated device for temporal binning of received photons
AU2015300778A1 (en) 2014-08-08 2017-03-16 Quantum-Si Incorporated Optical system and assay chip for probing, detecting, and analyzing molecules
US10174363B2 (en) 2015-05-20 2019-01-08 Quantum-Si Incorporated Methods for nucleic acid sequencing
KR20170041850A (en) 2014-08-08 2017-04-17 퀀텀-에스아이 인코포레이티드 Integrated device with external light source for probing, detecting, and analyzing molecules
US9963687B2 (en) 2014-08-27 2018-05-08 New England Biolabs, Inc. Fusion polymerase and method for using the same
WO2016033315A2 (en) 2014-08-27 2016-03-03 New England Biolabs, Inc. Synthon formation
US9834774B2 (en) 2015-02-11 2017-12-05 Agilent Technologies, Inc. Methods and compositions for rapid seamless DNA assembly
WO2018213803A1 (en) 2017-05-19 2018-11-22 Neon Therapeutics, Inc. Immunogenic neoantigen identification

Citations (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4800159A (en) * 1986-02-07 1989-01-24 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences
US4935357A (en) * 1986-02-05 1990-06-19 New England Biolabs, Inc. Universal restriction endonuclease
US4942227A (en) * 1982-01-11 1990-07-17 California Institute Of Technology Bifunctional molecules having a DNA intercalator or DNA groove binder linked to ethylene diamine tetraacetic acid, their preparation and use to cleave DNA
US4965188A (en) * 1986-08-22 1990-10-23 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences using a thermostable enzyme
US5106727A (en) * 1989-04-27 1992-04-21 Life Technologies, Inc. Amplification of nucleic acid sequences using oligonucleotides of random sequences as primers
US5279952A (en) * 1991-08-09 1994-01-18 Board Of Regents, The University Of Texas System PCR-based strategy of constructing chimeric DNA molecules
US5350672A (en) * 1993-01-22 1994-09-27 Kansas State University Research Foundation Specific DNA primers and method to use same detect Eperythrozoon suis
US5436150A (en) * 1992-04-03 1995-07-25 The Johns Hopkins University Functional domains in flavobacterium okeanokoities (foki) restriction endonuclease
US5508169A (en) * 1990-04-06 1996-04-16 Queen's University At Kingston Indexing linkers
US5512463A (en) * 1991-04-26 1996-04-30 Eli Lilly And Company Enzymatic inverse polymerase chain reaction library mutagenesis
US5514568A (en) * 1991-04-26 1996-05-07 Eli Lilly And Company Enzymatic inverse polymerase chain reaction
US5556772A (en) * 1993-12-08 1996-09-17 Stratagene Polymerase compositions and uses thereof
US5604122A (en) * 1992-03-21 1997-02-18 The University Of Hull Improvements in or relating to DNA cloning techniques and products for use therewith
US5683869A (en) * 1993-09-03 1997-11-04 Duke University Method of nucleic acid sequencing
US5691140A (en) * 1995-05-18 1997-11-25 New England Biolabs, Inc. Bidirectional in vitro transcription vectors utilizing a single RNA polymerase for both directions

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB8827160D0 (en) * 1988-11-21 1988-12-29 Apothekernes Lab Detection & quantitative determination of rna & dna

Patent Citations (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4942227A (en) * 1982-01-11 1990-07-17 California Institute Of Technology Bifunctional molecules having a DNA intercalator or DNA groove binder linked to ethylene diamine tetraacetic acid, their preparation and use to cleave DNA
US4935357A (en) * 1986-02-05 1990-06-19 New England Biolabs, Inc. Universal restriction endonuclease
US4800159A (en) * 1986-02-07 1989-01-24 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences
US4965188A (en) * 1986-08-22 1990-10-23 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences using a thermostable enzyme
US5106727A (en) * 1989-04-27 1992-04-21 Life Technologies, Inc. Amplification of nucleic acid sequences using oligonucleotides of random sequences as primers
US5508169A (en) * 1990-04-06 1996-04-16 Queen's University At Kingston Indexing linkers
US5514568A (en) * 1991-04-26 1996-05-07 Eli Lilly And Company Enzymatic inverse polymerase chain reaction
US5512463A (en) * 1991-04-26 1996-04-30 Eli Lilly And Company Enzymatic inverse polymerase chain reaction library mutagenesis
US5279952A (en) * 1991-08-09 1994-01-18 Board Of Regents, The University Of Texas System PCR-based strategy of constructing chimeric DNA molecules
US5604122A (en) * 1992-03-21 1997-02-18 The University Of Hull Improvements in or relating to DNA cloning techniques and products for use therewith
US5436150A (en) * 1992-04-03 1995-07-25 The Johns Hopkins University Functional domains in flavobacterium okeanokoities (foki) restriction endonuclease
US5350672A (en) * 1993-01-22 1994-09-27 Kansas State University Research Foundation Specific DNA primers and method to use same detect Eperythrozoon suis
US5683869A (en) * 1993-09-03 1997-11-04 Duke University Method of nucleic acid sequencing
US5556772A (en) * 1993-12-08 1996-09-17 Stratagene Polymerase compositions and uses thereof
US5691140A (en) * 1995-05-18 1997-11-25 New England Biolabs, Inc. Bidirectional in vitro transcription vectors utilizing a single RNA polymerase for both directions

Also Published As

Publication number Publication date
US20010031483A1 (en) 2001-10-18
US6261797B1 (en) 2001-07-17
WO1997028282A1 (en) 1997-08-07

Similar Documents

Publication Publication Date Title
Mead et al. A universal method for the direct cloning of PCR amplified nucleic acid
US6261808B1 (en) Amplification of nucleic acid molecules via circular replicons
ES2450047T3 (en) Method of preparing polynucleotide template libraries
US5928905A (en) End-complementary polymerase reaction
DE69133389T2 (en) Direct cloning of pcr amplified nucleic acids
US8034568B2 (en) Isothermal nucleic acid amplification methods and compositions
JP5907990B2 (en) Methods, compositions, systems, devices and kits for nucleic acid amplification
DK2374900T3 (en) Polynucleotides for amplification and analysis of the total genomic and total transcription libraries generated by a DNA polymerization
US6498023B1 (en) Generation of single-strand circular DNA from linear self-annealing segments
US7615625B2 (en) In vitro amplification of nucleic acid molecules via circular replicons
US6794141B2 (en) Nucleic acid amplification
JP2012506704A (en) Transposon end compositions and methods for modifying nucleic acids
US20040209299A1 (en) In vitro DNA immortalization and whole genome amplification using libraries generated from randomly fragmented DNA
EP2807292B1 (en) Compositions and methods for targeted nucleic acid sequence enrichment and high efficiency library generation
US5518900A (en) Method for generating single-stranded DNA molecules
JP3561523B2 (en) How to characterize the nucleic acid molecule
EP1050587A2 (en) Generation and amplification of nucleic acids from ribonucleic acids
US6180338B1 (en) Method, reagent and kit for the detection and amplification of nucleic acid sequences
DE69825240T2 (en) Process for subtractive hybridization and differential analysis
US6218152B1 (en) In vitro amplification of nucleic acid molecules via circular replicons
US20030134276A1 (en) Method for the direct, exponential amplification and sequencing of dna molecules and its application
DE69837208T2 (en) Normalized nucleic acid libraries and manufacturing method thereof
ES2262902T3 (en) A reaction in cascade of amplification of nucleic acid.
US20180201976A1 (en) Methods and transposon nucleic acids for generating a dna library
EP0807186B1 (en) Methods for the isothermal amplification of nucleic acid molecules

Legal Events

Date Code Title Description
AS Assignment



Effective date: 20031209

STCB Information on status: application discontinuation