US20020183518A1 - Modulators of proteins with phosphotyrosine recognition units - Google Patents

Modulators of proteins with phosphotyrosine recognition units Download PDF

Info

Publication number
US20020183518A1
US20020183518A1 US09/995,550 US99555001A US2002183518A1 US 20020183518 A1 US20020183518 A1 US 20020183518A1 US 99555001 A US99555001 A US 99555001A US 2002183518 A1 US2002183518 A1 US 2002183518A1
Authority
US
United States
Prior art keywords
alkyl
arylc
compound
solvates
prodrugs
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US09/995,550
Inventor
Adnan Mjalli
Xiaodong Cao
Edmund Moran
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ontogen Corp
Original Assignee
Ontogen Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US08/543,630 external-priority patent/US5770620A/en
Priority claimed from US08/766,114 external-priority patent/US5753687A/en
Priority claimed from US08/960,637 external-priority patent/US5965558A/en
Application filed by Ontogen Corp filed Critical Ontogen Corp
Priority to US09/995,550 priority Critical patent/US20020183518A1/en
Publication of US20020183518A1 publication Critical patent/US20020183518A1/en
Abandoned legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D471/00Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00
    • C07D471/02Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00 in which the condensed system contains two hetero rings
    • C07D471/04Ortho-condensed systems

Definitions

  • the present invention relates to novel protein tyrosine phosphatase modulating compounds, to methods for their preparation, to compositions comprising the compounds, to their use for treatment of human and animal disorders, to their use for purification of proteins or glycoproteins, and to their use in diagnosis.
  • the invention relates to modulation of the activity of molecules with phosphotyrosine recognition units, including protein tyrosine phosphatases (PTPases) and proteins with Src-homology-2 domains, in in vitro systems, microorganisms, eukaryoic cells, whole animals and human beings.
  • PTPases protein tyrosine phosphatases
  • PK's/PP's the protein serine/threonine kinases and protein serine/threonine phosphatases—have been shown to play critical roles in the regulation of metabolism. See generally, Cohen, Trends Biochem. Sci., 17:408-413 (1992); Shenolikar, Ann. Rev. Cell Biol., 10:55-86 (1994); Bollen et al., Crit. Rev. Biochem. Mol. Biol., 27:227-81 (1992). As their name suggests, these enzymes phosphorylate and dephoshphorylate serine or threonine residues of substrate proteins. Inhibitors of protein serine/threonine phosphatases and kinases have been described. See, e.g., MacKintosh and MacKintosh, TIBS, 19:444-448 (1994).
  • the protein tyrosine kinases/phosphatases comprise a second, distinct family of PK/PP enzymes of significant interest, and have been implicated in the control of normal and neoplastic cell growth and proliferation.
  • PK/PP Protein tyrosine kinase
  • PTPases Protein tyrosine phosphatases
  • PTPases are generally grouped into two categories: those which have both an extracellular domain and an intracellular catalytic domain, the receptor PTPases (R-PTPases); and those which are entirely intracellular.
  • R-PTPases Much effort has been directed at determining the function of the extracellular domain.
  • Most of the R-PTPases contain extracellular domains which are structurally similar to domains found in known adhesion molecules; these domains include fibronectin type III repeats, immunoglobulin domains, and cadherin extracellular repeats. See generally Brady-Kalnay and Tonks, Curr. Opin. Cell. Biol. 7:650-657 (1995); Streuli, Curr. Opin. Cell. Biol. 8:182-188 (1996). This homology with proteins known to be involved in adhesion suggested a role for these R-PTPases in regulating or mediating adhesion events. For several of the R-PTPases, this has now been demonstrated.
  • Cells form specialized structures at the sites of cell-cell contact (adherens junctions) and cell-extracellular matrix contact (focal adhesion). Multiple signal transduction molecules are recruited to these sites, including several PTK's; and these sites are characterized by increased protein tyrosine phosphorylation. These sites are impermanent, and are created and destroyed as required for cell mobility. As enhanced tyrosine phosphorylation is characteristic of the formation of adherens junctions and focal adhesions, it is likely that protein tyrosine dephosphorylation by PTPases serves to regulate the creation and destruction of the sites.
  • R-PTPases may also act to positively regulate adhesion.
  • Adherens junctions contain, among others, adhesion receptors termed cadherins which mediate cell-cell contact through homophilic binding; the cadherins associate with ⁇ -, ⁇ -, and ⁇ -catenins, intracellular proteins which interact with cortical actin. Association between cadherins and catenins serves to stabilize the adherens junction and to strengthen cell-cell contact. See generally Cowin, Proc. Natl. Acad. Sci. 91:10759-10761 (1994).
  • the R-PTPases PTP ⁇ and PTP ⁇ associate intracellularly with cadherins, and colocalize with cadherins and catenins to adherens junctions [Brady-Kalnay et al., J. Cell. Biol. 130:977-986 (1995); Fuchs et al., J. Biol. Chem. 271:16712-16719 (1996)]; thus PTP ⁇ and PTP ⁇ are likely to enhance cadherin function by limiting catenin phosphorylation.
  • PTP ⁇ and PTP ⁇ mediate cellular aggregation through homophilic binding [Brady-Kalnay et al., J. Cell. Biol. 122:961-972 (1993); Gebbink et al., J. Biol. Chem. 268:16101-16104 (1993); Sap et al., Mol. Cell. Biol. 14:1-9 (1994)].
  • the neuronal PTP ⁇ (which has also been called R-PTP ⁇ ) binds to contactin, a neuronal cell recognition molecule; binding of PTP ⁇ to contactin increases cell adhesion and neurite outgrowth.
  • a secreted splice variant of PTP ⁇ (also known as phosphacan) binds the extracellular matrix protein tenascin [Barnea et al. J. Biol. Chem. 269:14349-14352 (1994)], and the neural cell adhesion molecules N-CAM and Ng-CAM [Maurel et al., Proc. Natl. Acad. Sci. 91:2512-2516 (1994)].
  • PTP ⁇ As the expression of PTP ⁇ is restricted to radial glial cells in the developing central nervous system, which are though to form barriers to neuronal migration during embryogenesis, it is likely that the interaction of PTP ⁇ with contactin, tenascin, N-CAM, and/or Ng-CAM acts to regulate neuronal migration. This has been demonstrated for a related R-PTPase, DLAR, in Drosophila [Krueger et al. Cell 84:611-622 (1996)].
  • SHP1 which has also been called SHPTP1, SHP, HCP, and PTP-1C [see Adachi et al., Cell 85:15 (1996)]
  • SHP1 which has also been called SHPTP1, SHP, HCP, and PTP-1C [see Adachi et al., Cell 85:15 (1996)]
  • SHP1 which contains two amino-terminal phosphotyrosyl binding Src Homology 2 (SH2) domains followed by the catalytic PTPase domain
  • SH2 phosphotyrosyl binding Src Homology 2
  • mice loss of SHP1 function (the motheaten and viable motheaten phenotypes) causes multiple hematopoietic defects resulting in immunodeficiency and severe autoimmunity; culminating in lethality by 2-3 weeks or 2-3 months depending on the severity of SHP1 deficiency.
  • these mice have reduced numbers of hematopoietic cells, suggesting defects in development and maturation, those cells which survive and enter the periphery are characterized by hyper-responsiveness to growth factors and antigen. This observation suggested a role for SHP1 in negative regulation of hematopoietic signaling events.
  • EpoR erythropoietin receptor
  • SHP1 associates via its SH2 domains with tyrosine-phosphorylated EpoR, causing dephosphorylation and inactivation of the EpoR-associated Janus kinase 2 and termination of the cellular response to erythropoietin. Klingmuller et al., Cell 80:729-738 (1995).
  • Mutation of the tyrosine on the EpoR to which SHP1 binds results in enhanced cell proliferation to erythropoietin in vitro [Klingmuller, supra].
  • mutation of the EpoR resulting in loss of association with SHP1 causes autosomal dominant benign erythrocytosis, which is characterized by increased numbers of erythrocytes in the periphery and increased hematocrit. de la Chapelle et al., Proc. Natl. Acad. Sci. 90:4495-4499 (1993).
  • SHP1 also appears to be a negative regulator of the cellular response to colony stimulating factor-1 (CSF-1, a major macrophage mitogenic cytokine), as cells from viable motheaten and motheaten mice, which have reduced or absent SHP1 function, are hyper-responsive to CSF-1 in vitro. Reduced SHP1 expression also results in increased cellular response to interleukin 3 [Yi et al., Mol. Cell. Biol. 13:7577-7586 (1993)].
  • PTPases appear to play a homologous role in the insulin signaling pathway.
  • Treatment of adipocytes with the PTPase inhibitor vanadate results in increased tyrosine phosphorylation and tyrosine kinase activity of the insulin receptor (InsR), and enhances or mimics the cellular effects of insulin including increased glucose transport.
  • InsR insulin receptor
  • PTPases Several PTPases (PTP ⁇ , PTP ⁇ , CD45) in vitro has been demonstrated to result in diminished InsR signaling [see, e.g., Moller, et al., J. Biol. Chem. 271:23126-23131 (1995); Kulas et al., J. Biol. Chem. 271:755-760 (1996)].
  • increased expression of LAR was observed in adipose tissue from obese human subjects [Ahmad, et al., J. Clin. Invest. 95:2806-2812 (1995)].
  • CD45 is abundantly expressed on the cell surface of all nucleated hematopoietic cells, in several alternative splice variants. T and B lymphocytes which lack CD45 expression are incapable of responding normally to antigen, suggesting that CD45 is required for antigen receptor signaling.
  • CD45 genetically engineered mice which lack expression of CD45 exhibit severe defects in T lymphocyte development and maturation, indicating an additional role for CD45 in thymopoiesis.
  • the major substrates for CD45 appear to be members of the Src family of PTK's, particularly Lck and Fyn, whose kinase activity is both positively and negatively regulated by tyrosine phosphorylation.
  • Lck and Fyn isolated from CD45-deficient cells are hyperphosphorylated on negative regulatory tyrosine residues, and their PTK activity is reduced.
  • CD45 can dephosphorylate and activate purified Lck and Fyn in vitro, these data suggest that CD45 maintains the activity of Lck and Fyn in vivo through dephosphorylation of these negative regulatory tyrosines and that this is an important mechanism for maintaining lymphocyte homeostasis.
  • a second PTPase which is now believed to play an important positive role in signal transduction is the intracellular, SH2-domain-containing SHP2 (which has also been called SHPTP-2, SHPTP-3, syp, PTP2c, and PTP-1D [Adachi, et al., supra]). See generally Saltiel, Am. J. Physiol. 270:E375-385 (1996); Draznin, Endocrinology 137:2647-2648.
  • SHP2 associates, via its SH2 domains, with the receptor for platelet-derived growth factor (PDGF-R), the receptor for epidermal growth factor (EGF-R), with the insulin receptor, and with the predominant substrate of the InsR, insulin receptor substrate 1 (IRS1).
  • PDGF-R platelet-derived growth factor
  • EGF-R epidermal growth factor
  • IMS1 insulin receptor substrate 1
  • SHP2 PTPase activity is required for cellular response to EGF and insulin, as competitive expression of inactive forms of SHP2 results in diminished signaling events and reduced cellular responses to EGF and insulin.
  • Milarski and Saltiel J. Biol. Chem. 269:21239-21243 (1994); Xiao et al., J. Biol. Chem. 269:21244-21248 (1994); Yamauchi et al., Proc. Natl. Acad. Sci. 92:664-668 (1995).
  • the relevant substrate(s) for the PTPase domain of SHP2 is not known.
  • PTP-1B overexpression has been correlated with breast and ovarian cancers [Weiner et al., J. Natl. Cancer Inst., 86:372-8 (1994); Weiner et al., Am J. Obstet. Gynecol., 170:1177-883 (1994)], and thus agents which modulate PTP-1B activity would be helpful in elucidating the role of PTP-1B in these conditions and for the development of effective therapeutics against these disease states.
  • CD45 The important role of CD45 in hematopoietic development and T lymphocyte function likewise indicates a therapeutic utility for PTPase inhibitors in conditions that are associated with autoimmune disease, and as a prophylaxis for transplant rejection.
  • the antibiotic suramin which also appears to possess anti-neoplastic indications, has recently been shown to be a potent, irreversible, non-competitive inhibitor of CD45. See Ghosh and Miller, Biochem. Biophys. Res. Comm. 194:36-44 (1993).
  • the PTPase Yop2b is an essential virulence determinant in the pathogenic bacterium Yersinia, responsible for bubonic plague. Bliska et al., Proc. Natl. Acad Sci. USA, 88:1187-91(1991), and thus an antimicrobial indication exists for PTPase inhibitor compounds, as well.
  • PTPases have been implicated in diabetic conditions.
  • PTPase inhibitors vanadium derivatives
  • metal-containing PTPase inhibitors act in a fairly non-specific fashion and act with similar potencies against all PTPase enzymes.
  • certain organic phosphotyrosine mimetics are reportedly capable of competitively inhibiting PTPase molecules when such mimetics are incorporated into polypeptide artificial PTPase substrates of 6-11 amino acid residues.
  • a “natural” (phosphorylated tyrosine) PTPase substrate which may be depicted by the Formula:
  • the invention provides compounds and derivatives thereof useful for modulating, and especially inhibiting, the phosphatase activity of one or more protein tyrosine phosphatase (PTPase) and/or dual specificity phosphatase enzymes.
  • PTPase protein tyrosine phosphatase
  • the present invention relates to compounds having the general structure shown in Formula (A1):
  • R′, R′′, R′′′, X and Y are defined below.
  • the inventions further provides salts, esters, prodrugs, solvates, and the like of the compounds, and compositions comprising these compounds.
  • derivatives means: aryl acrylic acids with structure depicted in Formula (A1) having substitution (with, e.g., hydrogen, hydroxy, halo, amino, carboxy, nitro, cyano, methoxy, etc.) at one or more atoms of the aryl ring.
  • “derivatives” includes compounds of the Formula (A1) having substitution at the alkene carbons with, e.g., an electron withdrawing group (e.g., Cl, F, Br, CF 3 , phenyl) or an electron donating group (e.g., CH 3 , alkoxy).
  • attachment signifies a stable covalent bond, certain preferred points of attachment being apparent to those skilled in the art.
  • halogen or “halo” include fluorine, chlorine, bromine, and iodine.
  • alkyl includes C 1 -C 11 straight chain saturated and C 2 -C 11 unsaturated aliphatic hydrocarbon groups, C 1 -C 11 branched saturated and C 2 -C 11 unsaturated aliphatic hydrocarbon groups, C 3 -C 8 cyclic saturated and C 5 -C 8 unsaturated aliphatic hydrocarbon groups, and C 1 -C 11 straight chain or branched saturated and C 2 -C 11 straight chain or branched unsaturated aliphatic hydrocarbon groups substituted with C 3 -C 8 cyclic saturated and unsaturated aliphatic hydrocarbon groups having the specified number of carbon atoms.
  • this definition shall include but is not limited to methyl (Me), ethyl (Et), propyl (Pr), butyl (Bu), pentyl, hexyl, heptyl, octyl, nonyl, decyl, undecyl, ethenyl, propenyl, butenyl, penentyl, hexenyl, heptenyl, octenyl, nonenyl, decenyl, undecenyl, isopropyl (i-Pr), isobutyl (i-Bu), tert-butyl (t-Bu), sec-butyl (s-Bu), isopentyl, neopentyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, cyclopentenyl, cyclohexeny
  • substituted alkyl represents an alkyl group as defined above wherein the substitutents are independently selected from halo, cyano, nitro, trihalomethyl, carbamoyl, C 0-11 alkyloxy, arylC 0-11 alkyloxy, C 0-11 alkylthio, arylC 0-11 alkylthio, C 0-11 alkylamino, arylC 0-11 alkylamino, di(arylC 0-11 alkyl)amino, C 1-11 alkylcarbonyl, arylC 1-11 alkylcarbonyl, C 1-11 alkylcarboxy, arylC 1-11 alkylcarboxy, C 1-11 alkylcarbonylamino, arylC 1-11 alkylcarbonylamino, tetrahydrofuryl, morpholinyl, piperazinyl, hydroxypyronyl, —C 0-11 alkylCOOR 1
  • alkyloxy (e.g. methoxy, ethoxy, propyloxy, allyloxy, cyclohexyloxy) represents an alkyl group as defined above having the indicated number of carbon atoms attached through an oxygen bridge.
  • alkyloxyalkyl represents an alkyloxy group attached through an alkyl group as defined above having the indicated number of carbon atoms.
  • alkylthio (e.g. methylthio, ethylthio, propylthio, cyclohexenylthio and the like) represents an alkyl group as defined above having the indicated number of carbon atoms attached through a sulfur bridge.
  • alkylthioalkyl represents an alkylthio group attached through an alkyl group as defined above having the indicated number of carbon atoms.
  • alkylamino (e.g. methylamino, diethylamino, butylamino, N-propyl-N-hexylamino, (2-cyclopentyl)propylamino, hexenylamino, pyrrolidinyl, piperidinyl and the like) represents one or two alkyl groups as defined above having the indicated number of carbon atoms attached through an amine bridge.
  • the two alkyl groups maybe taken together with the nitrogen to which they are attached forming a cyclic system containing 3 to 11 carbon atoms with at least one C 1 -C 11 alkyl, arylC 0 -C 11 alkyl substituent.
  • alkylaminoalkyl represents an alkylamino group attached through an alkyl group as defined above having the indicated number of carbon atoms.
  • alkylcarbonyl (e.g. cyclooctylcarbonyl, pentylcarbonyl, 3-hexenylcarbonyl) represents an alkyl group as defined above having the indicated number of carbon atoms attached through a carbonyl group.
  • alkylcarbonylalkyl represents an alkylcarbonyl group attached through an alkyl group as defined above having the indicated number of carbon atoms.
  • alkylcarboxy (e.g. heptylcarboxy, cyclopropylcarboxy, 3-pentenylcarboxy) represents an alkylcarbonyl group as defined above wherein the carbonyl is in turn attached through an oxygen.
  • alkylcarboxyalkyl represents an alkylcarboxy group attached through an alkyl group as defined above having the indicated number of carbon atoms.
  • alkylcarbonylamino (e.g. hexylcarbonylamino, cyclopentylcarbonyl-aminomethyl, methylcarbonylaminophenyl) represents an alkylcarbonyl group as defined above wherein the carbonyl is in turn attached through the nitrogen atom of an amino group.
  • the nitrogen group may itself be substituted with an alkyl or aryl group.
  • alkylcarbonylaminoalkyl represents an alkylcarbonylamino group attached through an alkyl group as defined above having the indicated number of carbon atoms.
  • the nitrogen group may itself be substituted with an alkyl or aryl group.
  • aryl represents an unsubstituted, mono-, di- or trisubstituted monocyclic, polycyclic, biaryl and heterocyclic aromatic groups covalently attached at any ring position capable of forming a stable covalent bond, certain preferred points of attachment being apparent to those skilled in the art (e.g., 3-indolyl, 4-imidazolyl).
  • the aryl substituents are independently selected from the group consisting of halo, nitro, cyano, trihalomethyl, hydroxypyronyl, C 1-11 alkyl, arylC 1-11 alkyl, C 0-11 alkyloxyC 0-11 alkyl, arylC 0-11 alkyloxyC 0-11 alkyl, C 0-11 alkylthioC 0-11 alkyl, arylC 0-11 alkylthioC 0-11 alkyl, C 0-11 alkylaminoC 0-11 alkyl, arylC 0-11 alkylaminoC 0-11 alkyl, di(arylC 1-11 alkyl)aminoC 0-11 alkyl, C 1-11 alkylcarbonylC 0-11 alkyl, arylC 1-11 alkylcarbonylC 0-11 alkyl, C 1-11 alkylcarboxyC 0-11 alkyl, arylC 1-11 alkylcarboxyC
  • aryl includes but is not limited to phenyl, biphenyl, naphthyl, dihydronaphthyl, tetrahydronaphthyl, indenyl, indanyl, azulenyl, anthryl, phenanthryl, fluorenyl, pyrenyl, thienyl, benzothienyl, isobenzothienyl, 2,3-dihydrobenzothienyl, furyl, pyranyl, benzofuranyl, isobenzofuranyl, 2,3-dihydrobenzofuranyl, pyrrolyl, indolyl, isoindolyl, indolizinyl, indazolyl, imidazolyl, benzimidazolyl, pyridyl, pyrazinyl, pyradazinyl, pyrimidinyl, triazinyl, quinolyl, iso
  • arylalkyl e.g. (4-hydroxyphenyl)ethyl, (2-aminonaphthyl)hexenyl, pyridylcyclopentyl
  • arylalkyl represents an aryl group as defined above attached through an alkyl group as defined above having the indicated number of carbon atoms.
  • arylcarbonyl e.g. 2-thiophenylcarbonyl, 3-methoxyanthrylcarbonyl, oxazolylcarbonyl
  • arylcarbonyl represents an aryl group as defined above attached through a carbonyl group.
  • arylalkylcarbonyl e.g. (2,3-dimethoxyphenyl)propylcarbonyl, (2-chloronaphthyl)pentenylcarbonyl, imidazolylcyclopentylcarbonyl
  • arylalkylcarbonyl represents an arylalkyl group as defined above wherein the alkyl group is in turn attached through a carbonyl.
  • signal transduction is a collective term used to define all cellular processes that follow the activation of a given cell or tissue.
  • Examples of signal transduction include but are not in any way limited to cellular events that are induced by polypeptide hormones and growth factors (e.g. insulin, insulin-like growth factors I and II, growth hormone, epidermal growth factor, platelet-derived growth factor), cytokines (e.g. interleukines), extracellular matrix components, and cell-cell interactions.
  • polypeptide hormones and growth factors e.g. insulin, insulin-like growth factors I and II, growth hormone, epidermal growth factor, platelet-derived growth factor
  • cytokines e.g. interleukines
  • extracellular matrix components e.g. interleukines
  • Phosphotyrosine recognition units/tyrosine phosphate recognition units/phosphotyrosine recognition units are defined as areas or domains of proteins or glycoproteins that have affinity for molecules containing phosphorylated tyrosine residues (pTyr).
  • pTyr recognition units include but are not in any way limited to: PTPases, SH2 domains and PTB domains.
  • PTPases are defined as enzymes with the capacity to dephosphorylate pTyr-containing proteins or glycoproteins.
  • PTPases include but are not in any way limited to: intracellular PTPases (e.g. PTP-1B, TC-PTP, PTP-1C, PTP-1D,PTP-D1, PTP-D2), receptor-type PTPases (e.g. PTP ⁇ , PTP ⁇ , PTP ⁇ , PTP ⁇ , CD45, PTP ⁇ , PTP ⁇ ), dual specificity phosphatases (e.g.
  • VH1, VHR, cdc25 VH1, VHR, cdc25
  • PTPases such as LAR, SHP-1, SHP-2, PTP-1H, PTPMEGI, PTP-PEST, PTP ⁇ , PTPS31, IA-2 and HePTP and the like.
  • Modulation of cellular processes is defined as the capacity of compounds of the invention to 1) either increase or decrease ongoing, normal or abnormal, signal transduction, 2) initiate normal signal transduction, and 3) initiate abnormal signal transduction.
  • Modulation of pTyr-mediated signal transduction/modulation of the activity of molecules with pTyr recognition units is defined as the capacity of compounds of the invention to 1) increase or decrease the activity of proteins or glycoproteins with pTyr recognition units (e.g. PTPases, SH2 domains or PTB domains) or to 2) decrease or increase the association of a pTyr-containing molecule with a protein or glycoprotein with pTyr recognition units either via a direct action on the pTyr recognition site or via an indirect mechanism.
  • proteins or glycoproteins with pTyr recognition units e.g. PTPases, SH2 domains or PTB domains
  • Examples of modulation of pTyr-mediated signal transduction/modulation of the activity of molecules with pTyr recognition units are: a) inhibition of PTPase activity leading to either increased or decreased signal transduction of ongoing cellular processes; b) inhibition of PTPase activity leading to initiation of normal or abnormal cellular activity; c) stimulation of PTPase activity leading to either increased or decreased signal transduction of ongoing cellular processes; d) stimulation of PTPase activity leading to initiation of normal or abnormal cellular activity; e) inhibition of binding of SH2 domains or PTB domains to proteins or glycoproteins with pTyr leading to increase or decrease of ongoing cellular processes; f) inhibition of binding of SH2 domains or PTB domains to proteins or glycoproteins with pTyr leading to initiation of normal or abnormal cellular activity.
  • a subject is defined as any mammalian species, including humans.
  • R′ and R′′ are independently selected from the group consisting of hydrogen, halo, cyano, nitro, trihalomethyl, alkyl, arylalkyl,
  • R′′′ is selected from the group consisting of hydrogen, alkyl, substituted alkyl, aryl, arylalkyl
  • Y is selected from hydrogen or
  • a class of preferred PTPase activity-modulating compounds have the general structural Formula depicted in (A2):
  • R′, R′′, R′′′ and X are defined as above in Formula (A1), and wherein the remaining of R 1 , R 2 and R 3 are independently selected from the group consisting of hydrogen, alkyl, substituted alkyl, aryl, arylalkyl.
  • a class of preferred PTPase activity-modulating compounds have the general structural Formula depicted in (A3):
  • R′, R′′, R′′′ and X are defined as above in Formula (A1), and wherein the remaining of R 1 , R 2 and R 3 are independently selected from the group consisting of:hydrogen, alkyl, substituted alkyl, alkylcarbonyl, substituted alkylcarbonyl, aryl, arylalkyl, arylcarbonyl, arylalkylcarbonyl.
  • a class of preferred PTPase activity-modulating compounds have the general structural Formula depicted in (A4):
  • R′, R′′, R′′′ and X are defined as above in Formula (A1), and wherein the remaining of R 1 , R 2 is defined as above in Formula (A2).
  • a class of preferred PTPase activity-modulating compounds have the general structural Formula depicted in (A5):
  • R′, R′′, R′′′ and X are defined as above in Formula (A1), and wherein the remaining of R 1 and R 2 is defined as above in Formula (A2).
  • a class of preferred PTPase activity-modulating compounds have the general structural Formula depicted in (A6):
  • R′, R′′, R′′′ and X are defined as above in Formula (A1), and wherein the remaining of R 1 , R 2 , R 3 and R 4 have the same definition as R 1 , R 2 and R 3 in Formula (A2), with the proviso that when R 3 and R 4 are selected from substituted phenyl or substituted furyl then the phenyl and furyl substituents exclude hydroxy, halo, trifluoromethyl, C 1-6 alkyl, C 1-6 alkyloxy, C 1-6 alkylthio, amino, C 1-6 alkylamino, di(C 1-6 alkyl)amino, phenylC 1-6 alkylamino and di(phenylC 1-6 alkyl)amino.
  • a class of preferred PTPase activity-modulating compounds have the general structural Formula depicted in (A6):
  • R 4 is selected from —COR 5 , —COOR 6 , —CONR 7 R 8 wherein R 5 thru R 8 are selected from hydrogen, alkyl, substituted alkyl, aryl, arylalkyl, or R 7 and R 8 are taken together with the nitrogen to which they are attached forming a cyclic system containing 3 to 8 carbon atoms with at least one alkyl, aryl, arylalkyl substituent, and wherein at least one of R 1 , R 2 , and R 3 substituents has the general structure depicted in Formula (B)
  • R′, R′′, R′′′ and X are defined as above in Formula (A1), and wherein the remaining of R 1 , R 2 and R 3 are defined as above in Formula (A2).
  • a class of preferred PTPase activity-modulating compounds have the general structural Formula depicted in (A6):
  • R 1 , R 2 , R 3 and R 4 are defined as above in (6).
  • a class of preferred PTPase activity-modulating compounds have the general structural Formula depicted in (A7):
  • R 2 is selected from —COR 5 , —COOR 6 , —CONR 7 R 8 wherein R 5 thru R 8 are defined as above in (6) and wherein at least one of R 1 and R 3 substituents has the general structure depicted in Formula (B)
  • R′, R′′, R′′′ and X are defined as above in Formula (A1), and wherein the remaining of R 1 and R 3 are defined as above in Formula (A2).
  • R′, R′′, R′′′ and X are defined as above in Formula (A1), and wherein the remaining of R 1 and R 2 is defined as above in Formula (A2), and wherein m is an integer between 0 and 4 and each R 3 is independently selected from the group consisting of halo, nitro, cyano, trihalomethyl, hydroxypyronyl, alkyl, arylalkyl, C 0-11 alkyloxyC 0-11 alkyl, arylC 0-11 alkyloxyC 0-11 alkyl, C 0-11 alkylthioC 0-11 alkyl, arylC 0-11 alkylthioC 0-11 alkyl, C 0-11 alkylaminoC 0-11 alkyl, arylC 0-11 alkylaminoC 0-11 alkyl, di(arylC 1-11 alkyl)aminoC 0-11 alkyl, C 1-11 alkylcarbonylC 0-11 alkyl, C 1-11
  • R 1 is selected from —COR 5 , —COOR 6 , —CONR 7 R 8 wherein R 5 thru R 8 are defined as above in (6) and wherein R 2 has the general structure depicted in Formula (B)
  • R′, R′′, R′′′ and X are defined as above in Formula (A1), and wherein m is an integer between 0 and 4 and each R 3 is defined as above in (9).
  • m is an integer between 0 and 3 and wherein R 1 , R 2 each R 3 is defined as above in (9).
  • a class of preferred PTPase activity-modulating compounds have the general structural Formula depicted in (A9):
  • R 1 or R 2 is selected from —COR 5 , —COOR 6 , —CONR 7 R 8 wherein R 5 thru R 8 are defined as in (6) and wherein the remainder of R 1 and R 2 is defined as above in (9), and wherein m is an integer between 0 and 3 and each R 3 is defined as above in (9).
  • a class of preferred PTPase activity-modulating compounds have the general structural Formula depicted in (A10):
  • Z 1 and Z 2 are independently selected from the group consisting of OR 3 , SR 4 , NR 5 R 6 and wherein at least one of R 1 , R 2 substituents has the general structure depicted in Formula (B)
  • R′, R′′, R′′′ and X are defined as above in Formula (A1), and wherein the remaining of R 1 , R 2 is defined as above in Formula (A2), and wherein R 3 , R 4 , R 5 , R 6 are independently selected from hydrogen, alkyl, substituted alkyl, alkylcarbonyl, substituted alkylcarbonyl, aryl, arylalkyl, arylcarbonyl, arylalkylcarbonyl.
  • a class of preferred PTPase activity-modulating compounds have the general structural Formula depicted in (A11):
  • R′, R′′, R′′′ and X are defined as above in Formula (A1), and wherein the remaining of R 1 , R 2 and R 3 are defined as above in Formula (A2).
  • compositions of the invention include compositions comprising compounds as defined above in structural formula (A1), (A2), (A3), (A4), (A5), (A6), (A7), (A8), (A9), (A10), (A11) (or pharmaceutically acceptable salts, prodrugs, esters, or solvates of these compounds) in admixture with a pharmaceutically acceptable diluent, adjuvent, or carrier.
  • novel compounds which modulate the activity of PTPase or other molecules with pTyr recognition unit(s) as well as previously known aryl acrylic acid compounds which modulate the activity of PTPase or other molecules with pTyr recognition unit(s).
  • compositions comprising PTPase modulating compounds of the invention suitable for administration to a mammalian host.
  • the compounds of the invention act as inhibitors of PTPases, e.g. protein tyrosine phosphatases involved in the regulation of tyrosine kinase signaling pathways.
  • PTPases e.g. protein tyrosine phosphatases involved in the regulation of tyrosine kinase signaling pathways.
  • Preferred embodiments include modulation of receptor-tyrosine kinase signaling pathways via interaction with regulatory PTPases, e.g. the signaling pathways of the insulin receptor, the IGF-I receptor and other members of the insulin receptor family, the EGF-receptor family, the platelet-derived growth factor family, the nerve growth factor receptor family, the hepatocyte growth factor receptor family, the growth hormone receptor family and members of other receptor-type tyrosine kinase families.
  • regulatory PTPases e.g. the signaling pathways of the insulin receptor, the IGF-I receptor and other members of the insulin receptor family, the EGF-receptor family
  • Further preferred embodiments of the invention is modulation of non-receptor tyrosine kinase signaling through modulation of regulatory PTPases, e.g. modulation of members of the Src kinase family.
  • PTPases e.g. modulation of members of the Src kinase family.
  • One type of preferred embodiments of the invention relates to modulation of the activity of PTPases that negatively regulate signal transduction pathways.
  • Another type of preferred embodiments of the inventions relate to modulation of the activity of PTPases that positively regulate signale transduction pathways.
  • compounds of the inventions act as modulators of the active site of PTPases.
  • the compounds of the invention modulate the activity of PTPases via interaction with structures positioned outside the active sites of the enzymes, preferably SH2 domains.
  • Further preferred embodiments include modulation of signal transduction pathways via binding of the compounds of the invention to SH2 domains or PTB domains of non-PTPase signaling molecules.
  • the compounds of the invention may be used as therapeutics to inhibit PTPases involved in the regulation of the insulin recptor tyrosine kinase signaling pathway in patients with type I diabetes, type II diabetes, impaired glucose tolerance, insuline resistance and obesity.
  • Further preferred embodiments include use of the compounds of the invention for treatment of disorders with general or specific dysfunction of PTPase activity, e.g. proliferative disorders including neoplastic diseases and psoriosis.
  • the compounds of the invention may be used in pharmaceutical preparations for treatment of osteoporosis.
  • Preferred embodiments of the invention further include use of compounds of the invention in pharmaceutical preparations to increase the secretion or action of growth hormone and its analogs or somatomedins including IGf-I and IGF-2 by modulating the activity of PTPases or other signal transduction molecules with affinity for phosphotyrosine involved controlling or inducing the action of these hormones or any regulating molecule.
  • the uses of growth hormone maybe summarized as follows: stimulation of growth hormone release in the elderly; prevention of catabolic side effects of glucocorticoids; treatment of osteoporosis, stimulation of the immune system; treatment of retardation, accelaration of wound healing; accelerating bone fracture repair; treatment of growth retardation; treating renal failure or insufficiency resulting in growth retardation; treatment of physiological short stature including growth hormone deficient children and short stature associated with chronic illness; treatment of obesity and growth retardation associated with obesity; treating growth retardation associated with the Pader-Willi syndrom and Turner's syndrom; accelerating the recovery and reducing hospitalization of burn patients; treatment of intrauterine growth retardation, skeletal dysplasia, hypercortisolism and Cushings syndrome; induction of pulsatile growth hormone release; replacement of growth hormone in stressed patients; treatment of osteochondro-dysplasis, Noonans syndrome, schizophrenia, depressions, Alzheimer's disease, delayed wound healing and psychosocial deprivation; treatment of pulmonary dysfunction and ventilator
  • the compounds of the invention may be used in pharmaceutical preparations for treatment of various disorders of the immune system, either as stimulant or suppressor of normal or perturbed immune functions, including autoimmune reactions. Further embodiments of the invention for treatment of allergic reactions, e.g. asthma, dermal reactions, conjunctivitis.
  • allergic reactions e.g. asthma, dermal reactions, conjunctivitis.
  • compounds of the invention may be used in pharmaceutical preparations for prevention or induction of platelet aggregation.
  • compounds of the invention may be used in pharmaceutical preparations for treatment of infectious disorders.
  • the compounds of the invention may be used for treatment of infectious disorders caused by Yersinia and other bacteria as well as disorders caused by viruses or other microorganisms.
  • Compounds of the invention may additionally be used for treatment or prevention of diseases in animals, including commercially important animals.
  • the invention is further directed to a method for detecting the presence of PTPases in cell or in a subject comprising
  • the invention further relates to analysis and identification of the specific functions of certain PTPases by modulating their activity by using compounds of the invention in cellular assay systems or in whole animals.
  • the invention further provides methods for making compounds (A1), (A2), (A3), (A4), (A5), (A6), (A7), (A8), (A9), (A10), (A11) of the present invention having PTPase-modulatory/inhibitory activity.
  • compounds of the invention are synthesized in a multi-component combinatorial array, which permits rapid synthesis of numerous, structurally related compounds for subsequent evaluation.
  • the acrylic acid moiety of a compound is protected during synthesis by, e.g., esterification with a tert-butyl protecting group.
  • a preferred method of making compounds of the invention comprises use of a protected acrylic acid reagent and removal of the protective group by, e.g., treatment of a precursor ester compound with acid.
  • a method includes further esterifying or salifying the acrylic acid product thereby obtained.
  • a preferred method of making compounds of the invention comprises use of a protected acrylic acid reagent and removal of the protective group by, e.g., treatment of a precursor ester compound with acid.
  • a method includes further esterifying or salifying the acrylic acid product thereby obtained.
  • the compounds of formula (A1), (A2), (A3), (A4), (A5), (A6), (A7), (A8), (A9), (A10), (A11) may be prepared by procedures known to those skilled in the art from known compounds or readily preparable intermediates. General synthetic procedures and examples are as follow:
  • tert-butyl esters were converted to their corresponding carboxylic acids via treatment with a solution of 50% trifluoroacetic acid in dichloromethane for 1 hour at 23° C. The solvent was removed in vacuo and the residue was azeotroped with toluene or acetonitrile to yield the corresponding carboxylic acid.
  • reaction may be carried out neat or in a solvent such as dimethylformamide (DMF), tetrahydrofuran (THF), or toluene, in the presence of a catalyst (e.g. Pd(OAc) 2 , Pd(PPh 3 ) 4 , Pd 2 dba 3 ), a ligand (e.g. Ph 3 P, Ph 3 As, (o-tolyl) 3 P) and a base (e.g. K 2 CO 3 , CsCO 3 , Et 3 N) at temperatures ranging from 23° C. to 130° C., for 1 to 60 hours.
  • a catalyst e.g. Pd(OAc) 2 , Pd(PPh 3 ) 4 , Pd 2 dba 3
  • a ligand e.g. Ph 3 P, Ph 3 As, (o-tolyl) 3 P
  • a base e.g. K 2 CO 3 , CsCO 3 , Et 3 N
  • the reaction mixture was heated at 100° C. for 12 hours, cooled to 23° C. and the solvent was removed in vacuo. Ethyl acetate was added and the organic layer was washed with water and dried over sodium sulfate. The solvent was removed and the residue (mixture of dibromobenzil, mono and bis-tert-butylacrylate benzil) was recrystallized from hot 30% dichloromethane in hexane. The solid which crashed out (mixture of dibromobenzil and mono-tert-butylacrylate benzil) was filtered off and treated with 20% trifluoroacetic acid in dichloromethane.
  • the resin was filtered and thoroughly washed with dichloromethane (500 mL), methanol (500 mL), dimethylformamide (500 mL), dichloromethane (500 mL) and methanol (500 mL) and dried in vacuo (0.1 mmHg) for 24 hours.
  • the coupling was repeated and resin 15 was filtered, washed and dried as above, and used directly in the next step.
  • the resin was filtered hot and washed thoroughly with hot dimethylformamide (500 mL), hot acetic acid (500 mL), methanol (500 mL), dichloromethane (500 mL), dimethylformamide (500 mL), dichloromethane (500 mL) and methanol (500 mL) and dried in vacuo (0.1 mmHg) for 24 hours.
  • the linker was cleaved from the resin with a solution of 20% trifluoroacetic acid in dichloromethane for 20 min at ambient temperature.
  • 1 H NMR for monobromo-monoacid linker 400 MHz, d 6 -DMSO) ⁇ 6.7 (d, 2H), 7.6 (d, 2H), 7.8 (s, 4H), 7.9 (s, 4H).
  • the resin was filtered hot and washed thoroughly with hot dimethylformamide (500 mL), hot acetic acid (500 mL), methanol (500 mL), dichloromethane (500 mL), dimethylformamide (500 mL), dichloromethane (500 mL) and methanol (500 mL) and dried in vacuo (0.1 mmHg) for 24 hours.
  • the linker was cleaved from the resin with a solution of 20% trifluoroacetic acid in dichloromethane for 20 min at ambient temperature.
  • 1 H NMR for diacid linker 400 MHz, d 6 -DMSO) ⁇ 6.7 (d, 2H), 7.6 (d, 2H), 7.9 (s, 8H).
  • the resin was filtered hot and washed thoroughly with hot dimethylformamide (50 mL), water (50 mL), 10% sodium bicarbonate (50 mL), 10% aqueous acetic acid (50 mL), water (50 mL), methanol (50 mL), dichloromethane (50 mL), methanol (50 mL), dichloromethane (50 mL) and dried in vacuo (0.1 mmHg) for 24 hours.
  • the linker was cleaved from the resin with a solution of 20% trifluoroacetic acid in dichloromethane for 20 min at ambient temperature.
  • 1 H NMR for diacid linker 400 MHz, d 6 -DMSO) ⁇ 6.7 (d, 2H), 7.6 (d, 2H), 7.9 (s, 8H).
  • Resin 18 was treated with a 1.0M solution of oxalyl chloride in dichloromethane in the presence of a catalytic amount of dimethylformamide for 1 hour and filtered. The resin was subsequently treated with a dichloromethane solution containing the alcohol (ROH), pyridine and 4-dimethylaminopyridine for 20 hours at 23° C. to yield the monoester resin 19.
  • ROH alcohol
  • pyridine 4-dimethylaminopyridine
  • Resin 18 was treated with a 1.0M solution of oxalyl chloride in dichloromethane in the presence of a catalytic amount of dimethylformamide for 1 hour and filtered. The resin was subsequently treated with a dichloromethane solution containing the aromatic amine (ArN(R,)H), pyridine and 4-dimethylaminopyridine for 20 hours at 23° C. to yield the monoamide resin 20.
  • Resin 18 was treated with a dichloromethane solution containing the amine (R 1 R 2 NH), EDCI and 4-dimethylaminopyridine for 20 hours at 23° C. to yield the monoamide resin 21.
  • reaction may be carried out in a solvent or combination of solvents such as tetrahydrofuran (THF), dichloromethane (CH 2 Cl 2 ), in the presence of a catalyst (e.g. TiCl 3 ), and a base (e.g. pyridine) at temperatures ranging from ⁇ 78° C. to 23° C., for 1 to 60 hours.
  • solvents such as tetrahydrofuran (THF), dichloromethane (CH 2 Cl 2 )
  • a catalyst e.g. TiCl 3
  • a base e.g. pyridine
  • the first step in this reaction may be carried out in a solvent such as tetrahydrofuran (THF), dichloromethane (CH 2 Cl 2 ), in the presence of diisopropyl carbodiimide (DIC) and a base (e.g. 4-dimethylaminopyridine) at temperatures ranging from 0° C. to 23° C., for 1 to 60 hours.
  • the second step in this reaction may be carried out in a solvent such as dichloromethane (CH 2 Cl 2 ), in the presence of an oxidizing reagent (e.g. tetrapropylammonium perruthenate (VII) (TPAP)) and activated 4 ⁇ molecular sieves at temperatures ranging from 0° C. to 23° C., for 1 to 60 hours.
  • a solvent such as tetrahydrofuran (THF), dichloromethane (CH 2 Cl 2 )
  • DIC diisopropyl carbodiimide
  • a base
  • the first step in this reaction may be carried out in a solvent or a combination of solvents such as tetrahydrofuran (THF), dichloromethane (CH 2 Cl 2 ), in the presence of a catalyst (e.g. TiCl 3 ), and a base (e.g. pyridine) at temperatures ranging from ⁇ 78° C. to 23° C., for 1 to 60 hours.
  • the second step in this reaction may be carried out in a solvent such as dichloromethane (CH 2 Cl 2 ), in the presence of an oxidizing reagent (e.g. tetrapropylammonium perruthenate (VII) (TPAP)) and activated 4 ⁇ molecular sieves at temperatures ranging from 0° C. to 23° C., for 1 to 60 hours.
  • a solvent or a combination of solvents such as tetrahydrofuran (THF), dichloromethane (CH 2 Cl 2 )
  • a catalyst e.g. TiC
  • These reactions may be carried out in a solvent or a combination of solvents such as dichloromethane (CH 2 Cl 2 ), chloroform (CHCl 3 ), methanol (MeOH), tetrahydrofuran (THF) or acetonitrile (CH 3 CN), in the presence or absence of a catalyst (e.g. ZnCl 2 , MgBr 2 ) at temperatures ranging from ⁇ 78° C. to 80° C., for 1 to 60 hours.
  • a catalyst e.g. ZnCl 2 , MgBr 2
  • a solution of the carboxylic acid, aldehyde and isocyanide in a given solvent selected from tetrahydrofuran, acetonitrile, ethyl ether or chloroform was stirred between 0° and 25° C. for 1 to 3 days.
  • the solution was diluted with ethyl acetate, washed with saturated sodium bicarbonate and dried over sodium sulfate. The solvent was removed in vacuo and the residue was purified by silica gel chromatography.
  • reaction may be carried out in a solvent or combination of solvents such as tetrahydrofuran (THF), dichloromethane (CH 2 Cl 2 ), in the presence of a catalyst (e.g. TiCl 3 ), and a base (e.g. pyridine) at temperatures ranging from ⁇ 78° C. to 23° C., for 1 to 60 hours.
  • solvents such as tetrahydrofuran (THF), dichloromethane (CH 2 Cl 2 )
  • a catalyst e.g. TiCl 3
  • a base e.g. pyridine
  • This reaction may be carried out on functionalized cross linked polystyrene polymers such as Merrifield resin, Wang resin, Rink resin, TentagelTM resin, in a solvent such as acetic acid (AcOH) at temperatures ranging from 23° C. to 120° C., for 1 to 60 hours.
  • a solvent such as acetic acid (AcOH)
  • AcOH acetic acid
  • the resin was filtered and thoroughly washed with dimethylforamide (500 mL), methanol (500 mL), dichloromethane (500 mL) and methanol (500 mL) and dried in vacuo (0.1 mmHg) for 24 hours.
  • a coupling yield of 80% was established by cleaving 100 mg of the resin with a solution of 20% trifluoroacetic acid in dichloromethane for 20 min at ambient temperature.
  • the first step in this reaction may be carried out on functionalized cross linked polystyrene resins such as Merrifield resin, Wang resin, Rink resin, TentagelTM resin, in a solvent or a combination of solvents such as dichloromethane (CH 2 Cl 2 ), chloroform (CHCl 3 ), methanol (MeOH), tetrahydrofuran (THF) or acetonitrile (CH 3 CN), in the presence or absence of a catalyst (e.g. ZnCl 2 , MgBr 2 ) at temperatures ranging from ⁇ 78° C. to 80° C., for 1 to 60 hours.
  • the second step in this reaction may be carried out in a solvent such as acetic acid (AcOH) at temperatures ranging from 23° C. to 120° C., for 1 to 60 hours.
  • the first step in this reaction reaction may be carried out in a solvent or a combination of solvents such as dichloromethane (CH 2 Cl 2 ), chloroform (CHCl 3 ), methanol (MeOH), tetrahydrofuran (THF), acetonitrile (CH 3 CN), in the presence or absence of a catalyst (e.g. ZnCl 2 , MgBr 2 ) at temperatures ranging from ⁇ 78° C. to 80° C., for 1 to 60 hours.
  • a catalyst e.g. ZnCl 2 , MgBr 2
  • the second step in this reaction may be carried out in a solvent such as acetic acid (AcOH) at temperatures ranging from 23° C. to 120° C., for 1 to 60 hours.
  • the first step in this reaction reaction may be carried out in a solvent or a combination of solvents such as dichloromethane (CH 2 Cl 2 ), chloroform (CHCl 3 ), methanol (MeOH), tetrahydrofaran (THF), acetonitrile (CH 3 CN), in the presence or absence of a catalyst (e.g. ZnCl 2 , MgBr 2 ) at temperatures ranging from ⁇ 78° C. to 80° C., for 1 to 60 hours.
  • a catalyst e.g. ZnCl 2 , MgBr 2
  • the second step in this reaction may be carried out in a solvent such as acetic acid (AcOH) at temperatures ranging from 23° C. to 120° C., for 1 to 60 hours.
  • reaction may be carried out in a solvent such as tetrahydrofuran (THF), dichloromethane (CH 2 Cl 2 ), in the presence of diisopropyl carbodiimide (DIC) and a base (e.g. 4,4-dimethylaminopyridine) at temperatures ranging from 0° C. to 23° C., for 1 to 60 hours.
  • a solvent such as tetrahydrofuran (THF), dichloromethane (CH 2 Cl 2 )
  • DIC diisopropyl carbodiimide
  • a base e.g. 4,4-dimethylaminopyridine
  • the first step in this sequence of reactions may be carried out in a solvent such as tetrahydrofuran (THF), dichloromethane (CH 2 Cl 2 ), in the presence of a base (e.g. 4,4-dimethylaminopyridine, triethylamine, triisopropylamine) and a sulfonyl chloride (e.g. tosyl chloride, mesyl chloride), at temperatures ranging from ⁇ 20° C. to 23° C., for 1 to 60 hours.
  • the second step in this sequence of reactions may be carried out in a solvent such as dichloromethane (CH 2 Cl 2 ), in the presence of an oxidizing reagent (e.g.
  • TPAP tetrapropylammonium perruthenate
  • VI tetrapropylammonium perruthenate
  • TPAP tetrapropylammonium perruthenate
  • the third step in this sequence of reactions may be carried out in a solvent such as acetic acid, toluene, dioxane at temperatures ranging from 0° C. to 120° C., for 1 to 60 hours.
  • a human placental cDNA library was synthesized in a 50 ul reaction containing 1 ug human placental poly(A) + mRNA (Clontech, Palo Alto, Calif.), 4 ul random hexamer primers, 8 ul of 10 mM dNTPs (Pharmacia, Piscataway N.J.), 1 ul (200 U/ul) Moloney murine leukemia virus reverse transcriptase (Gibco-BRL, Canada), 0.5 ul (26 U/ul) RNAsin (Promega, Madison Wis.), and 12 ul 5 ⁇ buffer (Gibco-BRL). The synthesis reaction was incubated at 37° C. for one hour and then heat inactivated at 95° C. for five minutes.
  • a PTP-1B cDNA was amplified, using polymerase chain reaction (PCR), from the cDNAs synthesized as described above. More particularly, based on the published sequence of PTB-1B, two PCR primers were synthesized to amplify a portion of the PTP-1B coding sequence known to encode a 321 amino acid fragment containing the PTP-1B catalytic domain and having PTPase activity. See Hoppe et al., Eur. J. Biochem., 223:1069-77 (1994); Barford, D., et al., J. Molec. Biol., 239.726-730 (1994); Chemoff et al., Proc. Natl. Acad. Sci.
  • PCR polymerase chain reaction
  • the primers had the following respective sequences: PTP-1B-A(5′) (SEQ ID NO: 1) 5′ CGCACTGGATCCTCATGGAGATGGAAAAGG 3′ PTP-1B-B(3′) (SEQ ID NO: 2) 5′ CTCCCTGAATTCCTAATTGTGTGGCTCCAGG 3′
  • the first primer which hybridizes to the non-coding strand, corresponds to the 5′ portion of the PTP-1B coding sequence and encodes a BamH I restriction site upstream of the initiation codon, to facilitate cloning.
  • the second primer which hybridizes to the coding strand, corresponds to the 3′ portion of the PTB-1B fragment of interest, and encodes a stop codon and an EcoR I restriction site downstream from the stop codon.
  • the PCR reaction product (992 bp) was digested with BamH I and EcoR I (New England Biolabs, Beverly Mass.) to yield a 975 bp product encoding the 321 amino acid PTP-1B protein fragment, and having “sticky ends” to facilitate cloning.
  • the 975 bp PTP-1B partial cDNA was purified by agarose gel electrophoresis and ligated into a BamH I/EcoR I-digested pGEX-3X plasmid vector (Pharmacia, Piscataway, N.J.).
  • the pGEX vector is designed to produce a fusion of glutathione-S-transferase (GST) to a protein encoded by another DNA fragment inserted into the vector's cloning site.
  • GST glutathione-S-transferase
  • E. Coli strain DH5 ⁇ (Gibco-BRL) was transformed with plasmid pGEX-3X-PTP-1B following the supplier's transformation protocol and grown at 37° C. with vigorous shaking in Luria-Bertani broth supplemented with 100 ug/ml ampicillin. When the cultures reached an O.D. 600 of 0.7-1, production of the GST/PTP-1B fusion protein was induced with 0.1 mM IPTG (Isopropyl b-D-Thiogalactoside). After 3 additional hours of culturing at 37° C., the bacteria were pelleted by centrifugation.
  • IPTG Isopropyl b-D-Thiogalactoside
  • the bacterial pellet was resuspended in 10 ⁇ (w/v) lysis buffer consisting of 12.5 mM HEPES, 2 mM EDTA, pH 7.0, 15 mM b-mercaptoethanol (bME) and 1 mM PMSF.
  • the lysate was sonicated (on ice) until slight clearing was observed (approx. three min.) and then centrifuged at 10,000 revolutions per minute (RPM) for 10 min.
  • the supernatant was diluted 1:4 with buffer A (25 mM HEPES, pH 7.0, and 15 mM bME).
  • the GST/PTP-1B-containing fractions from the GST-Sepharose 4B purification were pooled, concentrated into a final storage buffer (0.2 M NaCl, 25 mM HEPES, 1 mM EDTA, and 5 mM DTT, pH 7.0) using a 1 ml Hi-Trap Q column (pre-packed, Pharmacia), and stored at ⁇ 80° C. (final concentration of 0.52 mg/ml).
  • the foregoing procedure yielded approximately 5 mg of PTP-1B fusion protein per 500 ml of cultured cells, purified to substantial homogeneity as assessed by SDS-PAGE.
  • the protein concentration of the PTP-1B enzyme preparation was determined using the Bio-Rad Protein Assay kit (Bio-Rad, Hercules Calif.). An aliquot from each sample was taken and diluted to 2 mg protein/ml using activity assay buffer (100 mM Sodium Acetate, pH 6.0, 1 mM EDTA, 0.1% TX-100 (International Biotechnologies, Inc.) and 15 mM bME) to form a PTP-1B stock solution.
  • activity assay buffer 100 mM Sodium Acetate, pH 6.0, 1 mM EDTA, 0.1% TX-100 (International Biotechnologies, Inc.) and 15 mM bME
  • a 100 ul reaction mixture was prepared containing 10 ul of the PTP-1B stock solution, 10 ul of 9 mM p-nitrophenylphosphate ((pNPP), Sigma Chemical Co., St. Louis Mo.), and 80 ul of activity assay buffer (100 mM sodium acetate, pH 6.0, 1 mM EDTA, 0.1% Triton X-100, 15 mM bME). Reactions were mixed gently and incubated at 37° C. for 60 minutes. Enzymatic cleavage of phosphate from pNPP (a tyrosine phosphate analog) is marked by a colorimetric change in this substrate.
  • pNPP 9 mM p-nitrophenylphosphate
  • activity assay buffer 100 mM sodium acetate, pH 6.0, 1 mM EDTA, 0.1% Triton X-100, 15 mM bME.
  • a human cDNA library was synthesized from RNA isolated from the human Jurkat cell line, as described above for PTP-1 B
  • CD45 cDNA was amplified, using polymerase chain reaction (PCR), from the cDNAs synthesized above. Two PCR primers were synthesized to amplify the coding sequence of CD45. The primers had the following respective sequences: CD45 (5′) (SEQ ID NO: 3) 5′ CTACATCCCGGGATGTCCTGCAATTTAGATG 3′ CD45 (3′) (SEQ ID NO: 4) 5′ CATTTATGTCCCGGGCTATGAACCTTGAT 3′
  • the first primer corresponds to the 5′ portion of the CD45 coding sequence and encodes a Sma I restriction site upstream of the initiation codon, to facilitate cloning.
  • the second primer corresponds to the 3′ portion of the CD45 sequence, and encodes a stop codon and a Sma I restriction site downstream from the stop codon.
  • the PCR reaction product (2127 bp) was digested with Sma I (New England Biolabs, Beverly Mass.) to yield a 2110 bp product.
  • the pET24C plasmid vector (Novagen, Inc., Madison Wis.) was digested with the BamH I restriction enzyme, and the “sticky” ends were filled using T4 DNA polymerase according to the manufacturer's instructions (New England Biolabs, Beverly Mass.); the resulting plasmid DNA was ligated to Sma I-digested CD45 PCR product.
  • the pET24C vector is designed to produce high levels of the protein encoded by cDNA inserted into the vector's cloning site (CD45), in bacterial hosts. Complete sequencing of the insert of the resultant plasmid, designated pET24C-CD45, confirmed the identity of the CD45 cDNA, and insertion in the proper orientation and reading frame.
  • E. coil strain DH5 ⁇ (Gibco-BRL) was transformed with pET24C-CD45 following the supplier's transformation protocol, plated onto Luria-Bertani agar plates supplemented with 30 ug/ml kanamycin and grown overnight at 37° C. A single bacterial colony was transferred into 50 mls Luria-Bertani broth supplemented with 30 ug/ml kanamycin and grown overnight with vigorous shaking. This overnight culture was split into two equal parts, and added to 2 L Luria-Bertani broth supplemented with 50 ug/ml kanamycin. When the cultures reached an O.D.
  • the bacterial pellet (approximately 5 grams) was resuspended in 10 ⁇ (w/v) lysis buffer consisting of 12.5 mM HEPES, 2 mM EDTA, pH 7.0, 15 mM bME and 1 mM PMSF. The lysate was sonicated (on ice) until slight clearing was observed (approx. three min.) and then centrifuged at 10,000 revolutions per minute (RPM) for 10 min. The supernatant was filtered through 1 mm Wattman filter paper, and 9.7 grams (i.e., 194 grams/L) of ammonium sulfate were added to the solution on ice to precipitate soluble proteins.
  • 10 ⁇ (w/v) lysis buffer consisting of 12.5 mM HEPES, 2 mM EDTA, pH 7.0, 15 mM bME and 1 mM PMSF.
  • the lysate was sonicated (on ice) until slight clearing was observed (approx. three min
  • the lysate was spun at 10,000 RPM for 30 min. at 4 C; supernatant was removed, and an additional 7.6 grams (i.e., 151 grams/L) of ammonium sulfate were added.
  • the resulting pellet was resuspended in 3 mls of buffer B (33 mM imidazole-HCl pH 8.0, 2 mM EDTA, 10 mM bME, 0.002% PMSF) and stored on ice.
  • the spin supernatant with ammonium sulfate was spun again at 10,000 RPM for 30 mins at 4 C.
  • the resulting pellet from the second centrifugation was resuspended in 2 mls of buffer B.
  • the two pellet solutions were pooled and dialyzed overnight against buffer B.
  • CD45 enzymatic activity of samples was assayed in microtiter plates as follows.
  • a 100 ul reaction mixture was prepared containing 10 ul of the CD45 stock solution, 10 ul of 9.3 mM p-nitrophenylphosphate ((pNPP), Sigma Chemical Co., St. Louis Mo.), and 80 ul of activity assay buffer (100 mM sodium acetate, pH 6.0, 1 mM EDTA, 0.1% Triton X-100, 15 mM bME). Reactions were mixed gently and incubated at 37° C. for 60 minutes. Reactions were stopped by addition of 10 ul of a 0.5 M NaOH/50% EtOH solution. To determine the enzymatic activity, absorbance readings of the reactions were measured at 405 nm using a Molecular Devices Thermomax Plate Reader (Menlo Park Calif.).
  • each 100 ul reaction contained 10 ul PTPase enzyme stock solution (final phosphatase concentration of approximately 20 ng/well), 70 ul activity assay buffer, 10 ul pNPP stock solution (final pNPP concentration of 0.9 mM for PTP-1B assay, 0.93 mM for CD45 assay, 0.5 mM for PTP ⁇ assay, and 8 mM for PTP-1C assay), and 10 ul of the diluted inhibitor compound in DMSO.
  • Assay buffers contained: for CD45 and PTP-1B assays, 100 mM sodium acetate at pH 6.0, 1 mM EDTA, 0.1% Triton X-100, and 15 mM bME; for PTP-1C assays, 100 mM sodium acetate at pH 5.5, 0.1% BSA, and 15 mM bME; for PTP ⁇ assays, 100 mM sodium acetate at pH 5.25, 0.1% BSA, and 15 mM bME. Purified phosphatase was added to the reaction mixtures to begin the reactions; the reactions were incubated at 37° C. for 60 min. (for PTP-1B and CD45 assays) or at 27° C. for 60 min.
  • the concentration of inhibitor compound required to inhibit 50% of the PTPase activity was determined as follows. First, absorbance readings from the negative control reactions were treated as a baseline and subtracted from the absorbance readings of the experimental reactions. Then, for each reaction, a percent inhibition was calculated using the following formula:
  • Inhibitor compounds having an IC50 less than 10 uM (and optimally less than 5 uM) for a particular PTPase were scored as highly effective inhibitors of that PTPase enzyme, and are preferred inhibitors of the present invention. TABLE 6 MWt. MWt.
  • This reaction may be carried out on functionalized cross linked polystyrene polymers such as Merrifield resin, Wang resin, Rink resin, TentagelTM resin, in a solvent such as acetic acid (AcOH) at temperatures ranging from 23° C. to 120° C., for 1 to 60 hours.
  • a solvent such as acetic acid (AcOH)
  • AcOH acetic acid
  • the resin was filtered and thoroughly washed with dimethylforamide (500 mL), methanol (500 mL), dichloromethane (500 mL) and methanol (500 mL) and dried in vacuo (0.1 mmHg) for 24 hours.
  • a coupling yield of 80% was established by cleaving 100 mg of the resin with a solution of 20% trifluoroacetic acid in dichloromethane for 20 min at ambient temperature.
  • the first step in this reaction may be carried out on functionalized cross linked polystyrene resins such as Merrifield resin, Wang resin, Rink resin, TentagelTM resin, in a solvent or a combination of solvents such as dichloromethane (CH 2 Cl 2 ), chloroform (CHCl 3 ), methanol (MeOH), tetrahydrofuran (THF) or acetonitrile (CH 3 CN), in the presence or absence of a catalyst (e.g. ZnCl 2 , MgBr 2 ) at temperatures ranging from ⁇ 78° C. to 80° C., for 1 to 60 hours.
  • the second step in this reaction may be carried out in a solvent such as acetic acid (AcOH) at temperatures ranging from 23° C. to 120° C., for 1 to 60 hours.
  • the first step in this reaction reaction may be carried out in a solvent or a combination of solvents such as dichloromethane (CH 2 Cl 2 ), chloroform (CHCl 3 ), methanol (MeOH), tetrahydrofuran (THF), acetonitrile (CH 3 CN), in the presence or absence of a catalyst (e.g. ZnCl 2 , MgBr 2 ) at temperatures ranging from ⁇ 78° C. to 80° C., for 1 to 60 hours.
  • a catalyst e.g. ZnCl 2 , MgBr 2
  • the second step in this reaction may be carried out in a solvent such as acetic acid (AcOH) at temperatures ranging from 23° C. to 120° C., for 1 to 60 hours.
  • the first step in this reaction reaction may be carried out in a solvent or a combination of solvents such as dichloromethane (CH 2 Cl 2 ), chloroform (CHCl 3 ), methanol (MeOH), tetrahydrofuran (THF), acetonitrile (CH 3 CN), in the presence or absence of a catalyst (e.g. ZnCl 2 , MgBr 2 ) at temperatures ranging from ⁇ 78° C. to 80° C., for 1 to 60 hours.
  • a catalyst e.g. ZnCl 2 , MgBr 2
  • the second step in this reaction may be carried out in a solvent such as acetic acid (AcOH) at temperatures ranging from 23° C. to 120° C., for 1 to 60 hours.
  • reaction may be carried out in a solvent such as tetrahydrofuran (THF), dichloromethane (CH 2 Cl 2 ), in the presence of diisopropyl carbodiimide (DIC) and a base (e.g. 4,4-dimethylaminopyridine) at temperatures ranging from 0° C. to 23° C., for 1 to 60 hours.
  • a solvent such as tetrahydrofuran (THF), dichloromethane (CH 2 Cl 2 )
  • DIC diisopropyl carbodiimide
  • a base e.g. 4,4-dimethylaminopyridine
  • the first step in this sequence of reactions may be carried out in a solvent such as tetrahydrofuran (THF), dichloromethane (CH 2 Cl 2 ), in the presence of a base (e.g. 4,4-dimethylaminopyridine, triethylamine, triisopropylamine) and a sulfonyl chloride (e.g. tosyl chloride, mesyl chloride), at temperatures ranging from ⁇ 20° C. to 23° C., for 1 to 60 hours.
  • the second step in this sequence of reactions may be carried out in a solvent such as dichloromethane (CH 2 Cl 2 ), in the presence of an oxidizing reagent (e.g.
  • TPAP tetrapropylammonium perruthenate
  • VI tetrapropylammonium perruthenate
  • TPAP activated 4A molecular sieves at temperatures ranging from 0° C. to 23° C., for 1 to 60 hours.
  • the third step in this sequence of reactions may be carried out in a solvent such as acetic acid, toluene, dioxane at temperatures ranging from 0° C. to 120° C., for 1 to 60 hours.
  • a human placental cDNA library was synthesized in a 50 ul reaction containing 1 ug human placental poly(A) + mRNA (Clontech, Palo Alto, Calif.), 4 ul random hexamer primers, 8 ul of 10 mM dNTPs (Pharmacia, Piscataway N.J.), 1 ul (200 U/ul) Moloney murine leukemia virus reverse transcriptase (Gibco-BRL, Canada), 0.5 ul (26 U/ul) RNAsin (Promega, Madison Wis.), and 12 ul 5 ⁇ buffer (Gibco-BRL). The synthesis reaction was incubated at 37° C. for one hour and then heat inactivated at 95° C. for five minutes.
  • a PTP-1B cDNA was amplified, using polymerase chain reaction (PCR), from the cDNAs synthesized as described above. More particularly, based on the published sequence of PTB-1B, two PCR primers were synthesized to amplify a portion of the PTP-1B coding sequence known to encode a 321 amino acid fragment containing the PTP-1B catalytic domain and having PTPase activity. See Hoppe et al., Eur. J. Biochem., 223:1069-77 (1994); Barford, D., et al., J. Molec. Biol., 239:726-730 (1994); Chemoff et al., Proc. Natl. Acad. Sci.
  • PCR polymerase chain reaction
  • the primers had the following respective sequences: PTP-1B-A (5′) (SEQ ID NO: 1) 5′ CGCACTGGATCCTCATGGAGATGGAAAAGG 3′ PTP-1B-B (3′) (SEQ ID NO: 2) 5′ CTCCCTGAATTCCTAATTGTGTGGCTCCAGG 3′
  • the first primer which hybridizes to the non-coding strand, corresponds to the 5′ portion of the PTP-1B coding sequence and encodes a BamH I restriction site upstream of the initiation codon, to facilitate cloning.
  • the second primer which hybridizes to the coding strand, corresponds to the 3′ portion of the PTB-1B fragment of interest, and encodes a stop codon and an EcoR I restriction site downstream from the stop codon.
  • the PCR reaction product (992 bp) was digested with BamH I and EcoR I (New England Biolabs, Beverly Mass.) to yield a 975 bp product encoding the 321 amino acid PTP-1B protein fragment, and having “sticky ends” to facilitate cloning.
  • the 975 bp PTP-1B partial cDNA was purified by agarose gel electrophoresis and ligated into a BamH I/EcoR I-digested pGEX-3X plasmid vector (Pharmacia, Piscataway, N.J.).
  • the pGEX vector is designed to produce a fusion of glutathione-S-transferase (GST) to a protein encoded by another DNA fragment inserted into the vector's cloning site.
  • GST glutathione-S-transferase
  • E. coli strain DH5 ⁇ (Gibco-BRL) was transformed with plasmid pGEX-3X-PTP-1B following the supplier's transformation protocol and grown at 37° C. with vigorous shaking in Luria-Bertani broth supplemented with 100 ug/ml ampicillin. When the cultures reached an O.D. 600 of 0.7-1, production of the GST/PTP-1B fusion protein was induced with 0.1 mM IPTG (Isopropyl b-D-Thiogalactoside). After 3 additional hours of culturing at 37° C., the bacteria were pelleted by centrifugation.
  • IPTG Isopropyl b-D-Thiogalactoside
  • the bacterial pellet was resuspended in 10 ⁇ (w/v) lysis buffer consisting of 12.5 mM HEPES, 2 mM EDTA, pH 7.0, 15 mM b-mercaptoethanol (bME) and 1 mM PMSF.
  • the lysate was sonicated (on ice) until slight clearing was observed (approx. three min.) and then centrifuged at 10,000 revolutions per minute (RPM) for 10 min.
  • the supernatant was diluted 1:4 with buffer A (25 mM HEPES, pH 7.0, and 15 mM bME).
  • the GST/PTP-1B-containing fractions from the GST-Sepharose 4B purification were pooled, concentrated into a final storage buffer (0.2 M NaCl, 25 mM HEPES, 1 mM EDTA, and 5 mM DTT, pH 7.0) using a 1 ml Hi-Trap Q column (pre-packed, Pharmacia), and stored at ⁇ 80° C. (final concentration of 0.52 mg/ml).
  • the foregoing procedure yielded approximately 5 mg of PTP-1B fusion protein per 500 ml of cultured cells, purified to substantial homogeneity as assessed by SDS-PAGE.
  • the protein concentration of the PTP-1B enzyme preparation was determined using the Bio-Rad Protein Assay kit (Bio-Rad, Hercules Calif.). An aliquot from each sample was taken and diluted to 2 mg protein/ml using activity assay buffer (100 mM Sodium Acetate, pH 6.0, 1 mM EDTA, 0.1% TX-100 (International Biotechnologies, Inc.) and 15 mM bME) to form a PTP-1B stock solution.
  • activity assay buffer 100 mM Sodium Acetate, pH 6.0, 1 mM EDTA, 0.1% TX-100 (International Biotechnologies, Inc.) and 15 mM bME
  • a 100 ul reaction mixture was prepared containing 10 ul of the PTP-1B stock solution, 10 ul of 9 mM p-nitrophenylphosphate ((pNPP), Sigma Chemical Co., St. Louis Mo.), and 80 ul of activity assay buffer (100 mM sodium acetate, pH 6.0, 1 mM EDTA, 0.1% Triton X-100, 15 mM bME). Reactions were mixed gently and incubated at 37° C. for 60 minutes. Enzymatic cleavage of phosphate from pNPP (a tyrosine phosphate analog) is marked by a colorimetric change in this substrate.
  • pNPP 9 mM p-nitrophenylphosphate
  • activity assay buffer 100 mM sodium acetate, pH 6.0, 1 mM EDTA, 0.1% Triton X-100, 15 mM bME.
  • a human cDNA library was synthesized from RNA isolated from the human Jurkat cell line, as described above for PTP-1B.
  • CD45 cDNA was amplified, using polymerase chain reaction (PCR), from the cDNAs synthesized above. Two PCR primers were synthesized to amplify the coding sequence of CD45. The primers had the following respective sequences: CD45 (5′) (SEQ ID NO: 3) 5′ CTACATCCCGGGATGTCCTGCAATTTAGATG 3′ CD45 (3′) (SEQ ID NO: 4) 5′ CATTTATGTCCCGGGCTATGAACCTTGAT 3′
  • the first primer corresponds to the 5′ portion of the CD45 coding sequence and encodes a Sma I restriction site upstream of the initiation codon, to facilitate cloning.
  • the second primer corresponds to the 3′ portion of the CD45 sequence, and encodes a stop codon and a Sma I restriction site downstream from the stop codon.
  • the PCR reaction product (2127 bp) was digested with Sma I (New England Biolabs, Beverly Mass.) to yield a 2110 bp product.
  • the pET24C plasmid vector (Novagen, Inc., Madison Wis.) was digested with the BamH I restriction enzyme, and the “sticky” ends were filled using T4 DNA polymerase according to the manufacturer's instructions (New England Biolabs, Beverly MA); the resulting plasmid DNA was ligated to Sma I-digested CD45 PCR product.
  • the pET24C vector is designed to produce high levels of the protein encoded by cDNA inserted into the vector's cloning site (CD45), in bacterial hosts. Complete sequencing of the insert of the resultant plasmid, designated pET24C-CD45, confirmed the identity of the CD45 cDNA, and insertion in the proper orientation and reading frame.
  • E. coli strain DH5 ⁇ (Gibco-BRL) was transformed with pET24C-CD45 following the supplier's transformation protocol, plated onto Luria-Bertani agar plates supplemented with 30 ug/ml kanamycin and grown overnight at 37° C. A single bacterial colony was transferred into 50 mls Luria-Bertani broth supplemented with 30 ug/ml kanamycin and grown overnight with vigorous shaking. This overnight culture was split into two equal parts, and added to 2 L Luria-Bertani broth supplemented with 50 ug/ml kanamycin. When the cultures reached an O.D.
  • the bacterial pellet (approximately 5 grams) was resuspended in 10 ⁇ (w/v) lysis buffer consisting of 12.5 mM HEPES, 2 mM EDTA, pH 7.0, 15 mM bME and 1 mM PMSF. The lysate was sonicated (on ice) until slight clearing was observed (approx. three min.) and then centrifuged at 10,000 revolutions per minute (RPM) for 10 min. The supernatant was filtered through 1 mm Wattman filter paper, and 9.7 grams (i.e., 194 grams/L) of ammonium sulfate were added to the solution on ice to precipitate soluble proteins.
  • 10 ⁇ (w/v) lysis buffer consisting of 12.5 mM HEPES, 2 mM EDTA, pH 7.0, 15 mM bME and 1 mM PMSF.
  • the lysate was sonicated (on ice) until slight clearing was observed (approx. three min
  • the lysate was spun at 10,000 RPM for 30 min. at 4 C; supernatant was removed, and an additional 7.6 grams (i.e., 151 grams/L) of ammonium sulfate were added.
  • the resulting pellet was resuspended in 3 mls of buffer B (33 mM imidazole-HCl pH 8.0, 2 mM EDTA, 10 mM bME, 0.002% PMSF) and stored on ice.
  • the spin supernatant with ammonium sulfate was spun again at 10,000 RPM for 30 mins at 4 C.
  • the resulting pellet from the second centrifugation was resuspended in 2 mls of buffer B.
  • the two pellet solutions were pooled and dialyzed overnight against buffer B.
  • CD45-containing fractions from the MonoQ column purification were pooled and stored at 4 C.
  • CD45 enzymatic activity of samples was assayed in microtiter plates as follows.
  • a 100 ul reaction mixture was prepared containing 10 ul of the CD45 stock solution, 10 ul of 9.3 mM p-nitrophenylphosphate ((pNPP), Sigma Chemical Co., St. Louis Mo.), and 80 ul of activity assay buffer (100 mM sodium acetate, pH 6.0, 1 mM EDTA, 0. 1% Triton X-100, 15 mM bME). Reactions were mixed gently and incubated at 37° C. for 60 minutes. Reactions were stopped by addition of 10 ul of a 0.5 M NaOH/50% EtOH solution. To determine the enzymatic activity, absorbance readings of the reactions were measured at 405 nm using a Molecular Devices Thermomax Plate Reader (Menlo Park Calif.).
  • 0.001 mmol of the cinnamic acid derivative (or other PTPase inhibitor compound) was dissolved in 100 ul of DMSO to create a 10 mM stock solution.
  • the 10 mM stock solution was used to add varying concentrations (100 uM, 33 uM, 10 uM, 3 uM, 1 uM, 0.3 uM, 0.1 uM, 0.03 uM, 0.01 uM or 0.003 uM) of the inhibitor compound to a series of otherwise identical PTPase activity assay reactions (100 ul final volume in microtiter wells).
  • each 100 ul reaction contained 10 ul PTPase enzyme stock solution (final phosphatase concentration of approximately 20 ng/well), 70 ul activity assay buffer, 10 ul pNPP stock solution (final pNPP concentration of 0.9 mM for PTP-1B assay, 0.93 mM for CD45 assay, 0.5 mM for PTP ⁇ assay, and 8 mM for PTP-1C assay), and 10 ul of the diluted inhibitor compound in DMSO.
  • Assay buffers contained: for CD45 and PTP-1B assays, 100 mM sodium acetate at pH 6.0, 1 mM EDTA, 0.
  • IC50 concentration of inhibitor compound required to inhibit 50% of the PTPase activity
  • Inhibitor compounds having an IC50 less than 10 uM (and optimally less than 5 uM) for a particular PTPase were scored as highly effective inhibitors of that PTPase enzyme, and are preferred inhibitors of the present invention.
  • the compounds of the present invention have asymmetric centers and may occur as racemates, racemic mixtures, and as individual enantiomers or diastereoisomers, with all isomeric forms being included in the present invention as well as mixtures thereof.
  • salts of the compounds of Formula (A1) thru (A11) where a basic or acidic group is present in the structure are also included within the scope of this invention.
  • an acidic substituent such as —COOH
  • a basic group such as amino or a basic heteroaryl radical, such as pyridyl
  • an acidic salt such as hydrochloride, hydrobromide, acetate, maleate, pamoate, methanesulfonate, p-toluenesulfonate, and the like, can be used as the dosage form.
  • esters can be employed, e.g., methyl, tert-butyl, pivaloyloxymethyl, and the like, and those esters known in the art for modifying solubility or hydrolysis characteristics for use as sustained release or prodrug formulations.
  • terapéuticaally effective amount shall mean that amount of drug or pharmaceutical agent that will elicit the biological or medical response of a tissue, system, animal, or human that is being sought by a researcher, veterinarian, medical doctor or other clinician.
  • a daily dose of about 0.5 mg/Kg to 100 mg/Kg body weight in divided doses is suggested to treat PTPase related diseases. Such dosage has to be individualized by the clinician.
  • the present invention also has the objective of providing suitable topical, oral, and parenteral pharmaceutical formulations for use in the novel methods of treatment of the present invention.
  • the compounds of the present invention may be administered orally as tablets, aqueous or oily suspensions, lozenges, troches, powders, granules, emulsions, capsules, syrups or elixirs.
  • the composition for oral use may contain one or more agents selected from the group of sweetening agents, flavouring agents, colouring agents and preserving agents in order to produce pharmaceutically elegant and palatable preparations.
  • the tablets contain the acting ingredient in admixture with non-toxic pharmaceutically acceptable excipients which are suitable for the manufacture of tablets.
  • excipients may be, for example, (1) inert diluents, such as calcium carbonate, lactose, calcium phosphate or sodium phosphate; (2) granulating and disintegrating agents, such as corn starch or alginic acid; (3) binding agents, such as starch, gelatin or acacia; and (4) lubricating agents, such as magnesium stearate, stearic acid or talc.
  • inert diluents such as calcium carbonate, lactose, calcium phosphate or sodium phosphate
  • granulating and disintegrating agents such as corn starch or alginic acid
  • binding agents such as starch, gelatin or acacia
  • lubricating agents such as magnesium stearate, stearic acid or talc.
  • These tablets may be uncoated or coated by known techniques to delay disintegration and absorption in the gastrointestinal tract and thereby provide a sustained action over a longer period.
  • a time delay material such as gly
  • Formulations for oral use may be in the form of hard gelatin capsules wherein the active ingredient is mixed with an inert solid diluent, for example, calcium carbonate, calcium phosphate or kaolin. They may also be in the form of soft gelatin capsules wherein the active ingredient is mixed with water or an oil medium, such as peanut oil, liquid paraffin or olive oil.
  • an inert solid diluent for example, calcium carbonate, calcium phosphate or kaolin.
  • the active ingredient is mixed with water or an oil medium, such as peanut oil, liquid paraffin or olive oil.
  • Aqueous suspensions normally contain the active materials in admixture with excipients suitable for the manufacture of aqueous suspension.
  • expicients may be:
  • suspending agent such as sodium carboxymethyl cellulose, methyl cellulose, hydroxypropylmethylcellulose, sodium alginate, polyvinylpyrrolidone, gum tragacanth and gum acacia;
  • dispersing or wetting agents which may be (a) naturally occurring phosphatide such as lecithin; (b) a condensation product of an alkylene oxide with a fatty acid, for example, polyoxyethylene stearate; (c) a condensation product of ethylene oxide with a long chain aliphatic alcohol, for example, heptadecaethylenoxycetanol; (d) a condensation product of ethylene oxide with a partial ester derived from a fatty acid and hexitol such as polyoxyethylene sorbitol monooleate, or (e) a condensation product of ethylene oxide with a partial ester derived from fatty acids and hexitol anhydrides, for example polyoxyethylene sorbitan monooleate.
  • phosphatide such as lecithin
  • a condensation product of an alkylene oxide with a fatty acid for example, polyoxyethylene stearate
  • a condensation product of ethylene oxide with a long chain aliphatic alcohol for
  • the pharmaceutical compositions may be in the form of a sterile injectable aqueous or oleagenous suspension.
  • This suspension may be formulated according to known methods using those suitable dispersing or wetting agents and suspending agents which have been mentioned above.
  • the sterile injectable preparation may also a sterile injectable solution or suspension in a non-toxic parenterally-acceptable diluent or solvent, for example, as a solution in 1,3-butanediol.
  • the acceptable vehicles and solvents that may be employed are water, Ringer's solution, and isotonic sodium chloride solution.
  • sterile, fixed oils are conventionally employed as a solvent or suspending medium.
  • any bland fixed oil may be employed including synthetic mono- or diglycerides.
  • fatty acids such as oleic acid find use in the preparation of injectables.
  • Compounds of Formula (A1) thru (A11) may also be administered in the form of suppositories for rectal administration of the drug.
  • These compositions can be prepared by mixing the drug with a suitable non-irritating excipient which is solid at ordinary temperature but liquid at the rectal temperature and will therefore melt in the rectum to release the drug.
  • suitable non-irritating excipient which is solid at ordinary temperature but liquid at the rectal temperature and will therefore melt in the rectum to release the drug.
  • Such materials are cocoa butter and polyethylene glycols.
  • the compounds of the present invention may also be administered in the form of liposome delivery systems, such as small unilamellar vesicles, large unilamellar vesicles, and multilamellar vesicles.
  • Liposomes can be formed from a variety of phospholipids, such as cholesterol, stearylamine, or phosphatidylcholines.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)

Abstract

Y—X—C(R′)═C(R″)COOR″′  (A1)
The present invention relates to novel protein tyrosine phosphatase modulating compounds having the general structure shown in Formula (A1), to methods for their preparation, to compositions comprising the compounds, to their use for treatment of human and animal disorders, to their use for purification of proteins or glycoproteins, and to their use in diagnosis. The invention relates to modulation of the activity of molecules with phosphotyrosine recognition units, including protein tyrosine phosphatases (PTPases) and proteins with Src-homology-2 domains, in in vitro systems, microorganisms, eukaryoic cells, whole animals and human beings. R′ and R″ are independently selected from the group consisting of hydrogen, halo, cyano, nitro, trihalomethyl, alkyl, arylalkyl. R″′ is selected from the group consisting of hydrogen, alkyl, substituted alkyl, aryl, arylalkyl. X is aryl. Y is selected from hydrogen or
Figure US20020183518A1-20021205-C00001
wherein (*) indicates a potential point of attachment to X.

Description

  • This application is a continuation-in-part-application of application Ser. No. 08/543,630 filed Oct. 19, 1995, now pending, which in turn claims the benefit of the filing date of application No. 60/017,610 filed Jun. 19, 1995.[0001]
  • FIELD OF THE INVENTION
  • The present invention relates to novel protein tyrosine phosphatase modulating compounds, to methods for their preparation, to compositions comprising the compounds, to their use for treatment of human and animal disorders, to their use for purification of proteins or glycoproteins, and to their use in diagnosis. The invention relates to modulation of the activity of molecules with phosphotyrosine recognition units, including protein tyrosine phosphatases (PTPases) and proteins with Src-homology-2 domains, in in vitro systems, microorganisms, eukaryoic cells, whole animals and human beings. [0002]
  • BACKGROUND OF THE INVENTION
  • Reversible phosphorylation of proteins is a prevalent biological mechanism for modulation of enzymatic activity in living organisms. Tonks et al., [0003] J. Biol. Chem., 263(14):6722-30 (1988). Such reversible phosphorylation requires both a protein kinase (PK), to phosphorylate a protein at a particular amino acid residue, and a protein phosphatase (PP), to remove the phosphate moieties. See generally, Hunter, Cell, 80:225-236 (1995). Recently, it has been estimated that humans have as many as 2000 conventional PK genes, and as many as 1000 PP genes. Id.
  • One major class of PK's/PP's—the protein serine/threonine kinases and protein serine/threonine phosphatases—have been shown to play critical roles in the regulation of metabolism. See generally, Cohen, [0004] Trends Biochem. Sci., 17:408-413 (1992); Shenolikar, Ann. Rev. Cell Biol., 10:55-86 (1994); Bollen et al., Crit. Rev. Biochem. Mol. Biol., 27:227-81 (1992). As their name suggests, these enzymes phosphorylate and dephoshphorylate serine or threonine residues of substrate proteins. Inhibitors of protein serine/threonine phosphatases and kinases have been described. See, e.g., MacKintosh and MacKintosh, TIBS, 19:444-448 (1994).
  • The protein tyrosine kinases/phosphatases comprise a second, distinct family of PK/PP enzymes of significant interest, and have been implicated in the control of normal and neoplastic cell growth and proliferation. See Fisher et al., [0005] Science, 253:401-406 (1991). Protein tyrosine kinase (PTK) genes are ancient in evolutionary origin and share a high degree of inter-species conservation. See generally Hunter and Cooper, Ann. Rev. Biochem., 54:897-930 (1985). PTK enzymes exhibit high specificity for tyrosine, and ordinarily do not phosphorylate serine, threonine, or hydroxyproline.
  • More than 75 members of the PTPase family have been identified in eukaryotes, prokaryotes, and even viruses. Tonks and Neel, [0006] Cell 87:365-368. Protein tyrosine phosphatases (PTPases) were originally identified and purified from cell and tissue lysates using a variety of artificial substrates, and therefore their natural functions and substrates were not obvious. However, their roles in cellular processes, including cell-cell contact and cell adhesion, and growth factor and antigen signaling events, have begun to be elucidated.
  • PTPases are generally grouped into two categories: those which have both an extracellular domain and an intracellular catalytic domain, the receptor PTPases (R-PTPases); and those which are entirely intracellular. For R-PTPases much effort has been directed at determining the function of the extracellular domain. Most of the R-PTPases contain extracellular domains which are structurally similar to domains found in known adhesion molecules; these domains include fibronectin type III repeats, immunoglobulin domains, and cadherin extracellular repeats. See generally Brady-Kalnay and Tonks, [0007] Curr. Opin. Cell. Biol. 7:650-657 (1995); Streuli, Curr. Opin. Cell. Biol. 8:182-188 (1996). This homology with proteins known to be involved in adhesion suggested a role for these R-PTPases in regulating or mediating adhesion events. For several of the R-PTPases, this has now been demonstrated.
  • Cells form specialized structures at the sites of cell-cell contact (adherens junctions) and cell-extracellular matrix contact (focal adhesion). Multiple signal transduction molecules are recruited to these sites, including several PTK's; and these sites are characterized by increased protein tyrosine phosphorylation. These sites are impermanent, and are created and destroyed as required for cell mobility. As enhanced tyrosine phosphorylation is characteristic of the formation of adherens junctions and focal adhesions, it is likely that protein tyrosine dephosphorylation by PTPases serves to regulate the creation and destruction of the sites. Supporting this, several studies have shown that treatment with a general PTPase inhibitor (vanadate) resulted in increased focal adhesion formation and increased cell spreading. Volberg et al., [0008] The EMBO J. 11:1733-1742(1992); Bennett et al., J. Cell Sci. 106:891-901 (1993). Importantly, the broadly-expressed LAR R-PTPase has been demonstrated to localize to focal adhesions, apparently via the LAR-interacting protein LIP.1. Serra-Pages et al., The EMBO J 14:2827-2838 (1995). As PTPδ and PTPσ, both R-PTPases, also associate with LIP.1 [Pulido et al., Proc. Natl. Acad. Sci. 92:11686-11690 (1995)], it is likely that these two phosphatases can also localize to focal adhesions. Most significantly, LAR only localized to the portion of the focal adhesion which is proximal to the nucleus, and is thought to be undergoing disassembly. Thus it is likely that these phosphatases act to negatively regulate focal adhesion formation, acting to enhance the destruction of the focal adhesion site.
  • R-PTPases may also act to positively regulate adhesion. Adherens junctions contain, among others, adhesion receptors termed cadherins which mediate cell-cell contact through homophilic binding; the cadherins associate with α-, β-, and γ-catenins, intracellular proteins which interact with cortical actin. Association between cadherins and catenins serves to stabilize the adherens junction and to strengthen cell-cell contact. See generally Cowin, [0009] Proc. Natl. Acad. Sci. 91:10759-10761 (1994). Association of cadherin with β-catenin is decreased by tyrosine phosphorylation of β3-catenin [Kinch et al., J. Cell. Biol. 130:461471 (1995); Behrens et al., J. Cell. Biol. 120:757-766 (1993)]; moreover, treatment with the PTPase inhibitor vanadate inhibits cadherin-dependent adhesion [Matsuyoshi et al., J. Cell. Biol. 118:703-714 (1992)]. Collectively, these data indicate that PTPase activity is critical in maintaining cadherin-mediated cell aggregation. The R-PTPases PTPμ and PTPκ associate intracellularly with cadherins, and colocalize with cadherins and catenins to adherens junctions [Brady-Kalnay et al., J. Cell. Biol. 130:977-986 (1995); Fuchs et al., J. Biol. Chem. 271:16712-16719 (1996)]; thus PTPμ and PTPκ are likely to enhance cadherin function by limiting catenin phosphorylation.
  • In addition to their catalytic function in regulating adhesion events, several R-PTPases have direct roles in mediating adhesion through their extracellular domains. PTPκ and PTPμ mediate cellular aggregation through homophilic binding [Brady-Kalnay et al., [0010] J. Cell. Biol. 122:961-972 (1993); Gebbink et al., J. Biol. Chem. 268:16101-16104 (1993); Sap et al., Mol. Cell. Biol. 14:1-9 (1994)]. The neuronal PTPζ (which has also been called R-PTPβ) binds to contactin, a neuronal cell recognition molecule; binding of PTPζ to contactin increases cell adhesion and neurite outgrowth. Peles et al., Cell 82:251-260 (1995). A secreted splice variant of PTPζ (also known as phosphacan) binds the extracellular matrix protein tenascin [Barnea et al. J. Biol. Chem. 269:14349-14352 (1994)], and the neural cell adhesion molecules N-CAM and Ng-CAM [Maurel et al., Proc. Natl. Acad. Sci. 91:2512-2516 (1994)]. As the expression of PTPζ is restricted to radial glial cells in the developing central nervous system, which are though to form barriers to neuronal migration during embryogenesis, it is likely that the interaction of PTPζ with contactin, tenascin, N-CAM, and/or Ng-CAM acts to regulate neuronal migration. This has been demonstrated for a related R-PTPase, DLAR, in Drosophila [Krueger et al. Cell 84:611-622 (1996)].
  • Because tyrosine phosphorylation by PTK enzymes usually is associated with cell proliferation, cell transformation and cell differentiation, it was assumed that PTPases were also associated with these events. For several of the intracellular PTPases, this function has now been verified. [0011]
  • SHP1 (which has also been called SHPTP1, SHP, HCP, and PTP-1C [see Adachi et al., [0012] Cell 85:15 (1996)]), an intracellular PTPase which contains two amino-terminal phosphotyrosyl binding Src Homology 2 (SH2) domains followed by the catalytic PTPase domain, has been demonstrated to be an important negative regulator of growth factor signaling events. See generally Tonks and Neel, supra; Streuli, supra. In mice, loss of SHP1 function (the motheaten and viable motheaten phenotypes) causes multiple hematopoietic defects resulting in immunodeficiency and severe autoimmunity; culminating in lethality by 2-3 weeks or 2-3 months depending on the severity of SHP1 deficiency. Although these mice have reduced numbers of hematopoietic cells, suggesting defects in development and maturation, those cells which survive and enter the periphery are characterized by hyper-responsiveness to growth factors and antigen. This observation suggested a role for SHP1 in negative regulation of hematopoietic signaling events.
  • This has now been well-established for the erythropoietin receptor (EpoR), a member of the cytokine receptor family (which also includes the receptors for interleukins 2, 3, 4, 5, 6, 7; granulocyte-macrophage colony stimulating factor, and macrophage colony stimulating factor). SHP1 associates via its SH2 domains with tyrosine-phosphorylated EpoR, causing dephosphorylation and inactivation of the EpoR-associated Janus kinase 2 and termination of the cellular response to erythropoietin. Klingmuller et al., [0013] Cell 80:729-738 (1995). Mutation of the tyrosine on the EpoR to which SHP1 binds results in enhanced cell proliferation to erythropoietin in vitro [Klingmuller, supra]. In humans, mutation of the EpoR resulting in loss of association with SHP1 causes autosomal dominant benign erythrocytosis, which is characterized by increased numbers of erythrocytes in the periphery and increased hematocrit. de la Chapelle et al., Proc. Natl. Acad. Sci. 90:4495-4499 (1993).
  • SHP1 also appears to be a negative regulator of the cellular response to colony stimulating factor-1 (CSF-1, a major macrophage mitogenic cytokine), as cells from viable motheaten and motheaten mice, which have reduced or absent SHP1 function, are hyper-responsive to CSF-1 in vitro. Reduced SHP1 expression also results in increased cellular response to interleukin 3 [Yi et al., [0014] Mol. Cell. Biol. 13:7577-7586 (1993)]. Collectively, these observations suggest that SHP1 functions to limit the cellular response to cytokines and growth factors by reversing the tyrosine phosphorylation of key signaling intermediates in these pathways.
  • PTPases appear to play a homologous role in the insulin signaling pathway. Treatment of adipocytes with the PTPase inhibitor vanadate results in increased tyrosine phosphorylation and tyrosine kinase activity of the insulin receptor (InsR), and enhances or mimics the cellular effects of insulin including increased glucose transport. See, e.g., Shisheva and Shechter, [0015] Endocrinology 133: 1562-1568 (1993); Fantus, et al., Biochemistry 28:8864-8871 (1989); Kadota, et al., Biochem. Biophys. Res. Comm. 147:259-266 (1987); Kadota, et al., J. Biol. Chem. 262:8252-8256 (1987). Transiently induced reduction in expression of two PTPases, the intracellular PTPase PTP-1B and the R-PTPase LAR, resulted in similar increases in the cellular response to insulin. Kulas, et al., J. Biol. Chem. 270:2435-2438 (1995); Ahmad et al., J. Biol. Chem. 270:20503-20508 (1995). Conversely, increased cellular expression of several PTPases (PTPα, PTPε, CD45) in vitro has been demonstrated to result in diminished InsR signaling [see, e.g., Moller, et al., J. Biol. Chem. 271:23126-23131 (1995); Kulas et al., J. Biol. Chem. 271:755-760 (1996)]. Finally, increased expression of LAR was observed in adipose tissue from obese human subjects [Ahmad, et al., J. Clin. Invest. 95:2806-2812 (1995)]. These data provide clear evidence that PTPases negatively regulate the insulin signaling pathway.
  • While many of the PTPases function to negatively regulate cellular metabolism and response, it is becoming increasingly evident that PTPases provide important positive signaling mechanisms as well. Perhaps the best example of such a positive regulator is the hematopoietic R-PTPase CD45. See generally Streuli, supra; Okumura and Thomas, supra; Trowbridge, [0016] Annu. Rev. Immunol. 12:85-116 (1994). CD45 is abundantly expressed on the cell surface of all nucleated hematopoietic cells, in several alternative splice variants. T and B lymphocytes which lack CD45 expression are incapable of responding normally to antigen, suggesting that CD45 is required for antigen receptor signaling. Genetically engineered mice which lack expression of CD45 exhibit severe defects in T lymphocyte development and maturation, indicating an additional role for CD45 in thymopoiesis. The major substrates for CD45 appear to be members of the Src family of PTK's, particularly Lck and Fyn, whose kinase activity is both positively and negatively regulated by tyrosine phosphorylation. Lck and Fyn isolated from CD45-deficient cells are hyperphosphorylated on negative regulatory tyrosine residues, and their PTK activity is reduced. As CD45 can dephosphorylate and activate purified Lck and Fyn in vitro, these data suggest that CD45 maintains the activity of Lck and Fyn in vivo through dephosphorylation of these negative regulatory tyrosines and that this is an important mechanism for maintaining lymphocyte homeostasis.
  • A second PTPase which is now believed to play an important positive role in signal transduction is the intracellular, SH2-domain-containing SHP2 (which has also been called SHPTP-2, SHPTP-3, syp, PTP2c, and PTP-1D [Adachi, et al., supra]). See generally Saltiel, [0017] Am. J. Physiol. 270:E375-385 (1996); Draznin, Endocrinology 137:2647-2648. SHP2 associates, via its SH2 domains, with the receptor for platelet-derived growth factor (PDGF-R), the receptor for epidermal growth factor (EGF-R), with the insulin receptor, and with the predominant substrate of the InsR, insulin receptor substrate 1 (IRS1). Bennett, et al., Proc. Natl. Acad. Sci. 91:7335-7339 (1994); Case, et al., J. Biol. Chem. 269:10467-10474 (1994); Kharitonenkov, et al., J. Biol. Chem. 270:29189-29193 (1995); Kuhne, et al., J. Biol. Chem. 268:11479-11481 (1993). SHP2 PTPase activity is required for cellular response to EGF and insulin, as competitive expression of inactive forms of SHP2 results in diminished signaling events and reduced cellular responses to EGF and insulin. Milarski and Saltiel, J. Biol. Chem. 269:21239-21243 (1994); Xiao et al., J. Biol. Chem. 269:21244-21248 (1994); Yamauchi et al., Proc. Natl. Acad. Sci. 92:664-668 (1995). The relevant substrate(s) for the PTPase domain of SHP2 is not known.
  • Due to the fundamental role that PTPases play in normal and neoplastic cellular growth and proliferation, a need exists in the art for agents capable of modulating PTPase activity. On a fundamental level, such agents are useful for elucidating the precise role of protein tyrosine phosphatases and kinases in cellular signalling pathways and cellular growth and proliferation. See generally MacKintosh and MacKintosh, [0018] TIBS, 19:444-448 (1994).
  • More importantly, modulation of PTPase activity has important clinical significance. For example, PTP-1B overexpression has been correlated with breast and ovarian cancers [Weiner et al., [0019] J. Natl. Cancer Inst., 86:372-8 (1994); Weiner et al., Am J. Obstet. Gynecol., 170:1177-883 (1994)], and thus agents which modulate PTP-1B activity would be helpful in elucidating the role of PTP-1B in these conditions and for the development of effective therapeutics against these disease states. The important role of CD45 in hematopoietic development and T lymphocyte function likewise indicates a therapeutic utility for PTPase inhibitors in conditions that are associated with autoimmune disease, and as a prophylaxis for transplant rejection. The antibiotic suramin, which also appears to possess anti-neoplastic indications, has recently been shown to be a potent, irreversible, non-competitive inhibitor of CD45. See Ghosh and Miller, Biochem. Biophys. Res. Comm. 194:36-44 (1993). The negative regulatory effects of several PTPases on signaling through receptors for growth factors and cytokines, which are implicated in normal cell processing as well as disease states such as cancer and atherosclerosis, also indicate a therapeutic potential for PTPase inhibitors in diseases of hematopoietic origin.
  • The PTPase Yop2b is an essential virulence determinant in the pathogenic bacterium Yersinia, responsible for bubonic plague. Bliska et al., [0020] Proc. Natl. Acad Sci. USA, 88:1187-91(1991), and thus an antimicrobial indication exists for PTPase inhibitor compounds, as well.
  • PTPases have been implicated in diabetic conditions. Experiments with one family of PTPase inhibitors, vanadium derivatives, indicate a therapeutic utility for such compounds as oral adjuvants or as alternatives to insulin for the treatment of hyperglycemia. See Posner et al., [0021] J. Biol. Chem., 269:4596-4604 (1994). However, such metal-containing PTPase inhibitors act in a fairly non-specific fashion and act with similar potencies against all PTPase enzymes.
  • In addition to vanadium derivatives, certain organic phosphotyrosine mimetics are reportedly capable of competitively inhibiting PTPase molecules when such mimetics are incorporated into polypeptide artificial PTPase substrates of 6-11 amino acid residues. For example, a “natural” (phosphorylated tyrosine) PTPase substrate, which may be depicted by the Formula: [0022]
    Figure US20020183518A1-20021205-C00002
  • has been mimicked by eleven-mer oligopeptides containing phosphonomethyl phenylalanine (Pmp), as depicted by the schematic Formula: [0023]
    Figure US20020183518A1-20021205-C00003
  • See Chatterjee et al., “Phosphopeptide substrates and phosphonopeptide inhibitors of protein tyrosine phosphatases,” in [0024] Peptides: Chemistry and Biology (Rivier and Smith, Eds.), 1992, Escom Science Publishers: Leiden, Netherlands, pp. 553-55; Burke et al., Biochemistry, 33:6490-94 (1994). More recently, Burke et al., Biochem. Biophys. Res. Comm. 204(1):129-134 (1994) reported that a particular hexameric peptide sequence comprising a Pmp moiety or, more preferably, a phosphonodifluoromethyl phenylalanine (F2Pmp) moiety, as depicted by the schematic Formula:
    Figure US20020183518A1-20021205-C00004
  • competitively inhibited PTP-1B. However, such hexapeptide inhibitors nonetheless possess drawbacks for PTPase modulation in vivo. More particularly, the hexapeptide inhibitors described by Burke et al. are sufficiently large and anionic to potentially inhibit efficient migration across cell membranes, for interaction with the catalytic domains of transmembrane and intracellular PTPase enzymes which lie within a cell membrane. A need exists for small, organic-molecule based PTPase inhibitors having fewer anionic moieties, to facilitate migration across cell membranes. [0025]
  • For all of the foregoing reasons, a need exists in the art for novel compounds effective for modulating, and especially inhibiting, the phosphatase activity of protein tyrosine phosphatase molecules. [0026]
  • SUMMARY OF THE INVENTION
  • The invention provides compounds and derivatives thereof useful for modulating, and especially inhibiting, the phosphatase activity of one or more protein tyrosine phosphatase (PTPase) and/or dual specificity phosphatase enzymes. In one aspect, the present invention relates to compounds having the general structure shown in Formula (A1): [0027]
  • Y—X—C(R′)═C(R″)COOR″′  (A1)
  • wherein R′, R″, R″′, X and Y are defined below. The inventions further provides salts, esters, prodrugs, solvates, and the like of the compounds, and compositions comprising these compounds. [0028]
  • Definitions
  • In the specification and claims, the term “derivatives” means: aryl acrylic acids with structure depicted in Formula (A1) having substitution (with, e.g., hydrogen, hydroxy, halo, amino, carboxy, nitro, cyano, methoxy, etc.) at one or more atoms of the aryl ring. Moreover, “derivatives” includes compounds of the Formula (A1) having substitution at the alkene carbons with, e.g., an electron withdrawing group (e.g., Cl, F, Br, CF[0029] 3, phenyl) or an electron donating group (e.g., CH3, alkoxy).
  • Y—X—C(R′)═C(R″)COOR″′  (A1)
  • As used herein, the term “attached” signifies a stable covalent bond, certain preferred points of attachment being apparent to those skilled in the art. [0030]
  • The terms “halogen” or “halo” include fluorine, chlorine, bromine, and iodine. [0031]
  • The term “alkyl” includes C[0032] 1-C11 straight chain saturated and C2-C11 unsaturated aliphatic hydrocarbon groups, C1-C11 branched saturated and C2-C11 unsaturated aliphatic hydrocarbon groups, C3-C8 cyclic saturated and C5-C8 unsaturated aliphatic hydrocarbon groups, and C1-C11 straight chain or branched saturated and C2-C11 straight chain or branched unsaturated aliphatic hydrocarbon groups substituted with C3-C8 cyclic saturated and unsaturated aliphatic hydrocarbon groups having the specified number of carbon atoms. For example, this definition shall include but is not limited to methyl (Me), ethyl (Et), propyl (Pr), butyl (Bu), pentyl, hexyl, heptyl, octyl, nonyl, decyl, undecyl, ethenyl, propenyl, butenyl, penentyl, hexenyl, heptenyl, octenyl, nonenyl, decenyl, undecenyl, isopropyl (i-Pr), isobutyl (i-Bu), tert-butyl (t-Bu), sec-butyl (s-Bu), isopentyl, neopentyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, cyclopentenyl, cyclohexenyl, cycloheptenyl, cyclooctenyl, methylcyclopropyl, ethylcyclohexenyl, butenylcyclopentyl, and the like.
  • The term “substituted alkyl” represents an alkyl group as defined above wherein the substitutents are independently selected from halo, cyano, nitro, trihalomethyl, carbamoyl, C[0033] 0-11alkyloxy, arylC0-11alkyloxy, C0-11alkylthio, arylC0-11alkylthio, C0-11alkylamino, arylC0-11alkylamino, di(arylC0-11alkyl)amino, C1-11alkylcarbonyl, arylC1-11alkylcarbonyl, C1-11alkylcarboxy, arylC1-11alkylcarboxy, C1-11alkylcarbonylamino, arylC1-11alkylcarbonylamino, tetrahydrofuryl, morpholinyl, piperazinyl, hydroxypyronyl, —C0-11alkylCOOR1, —C0-11alkylCONR2R3 wherein R1, R2 and R3 are independently selected from hydrogen, C1-11alkyl, arylC0-11alkyl, or R2 and R3 are taken together with the nitrogen to which they are attached forming a cyclic system containing 3 to 8 carbon atoms with at least one C1-11alkyl, arylC0-11alkyl substituent.
  • The term “alkyloxy” (e.g. methoxy, ethoxy, propyloxy, allyloxy, cyclohexyloxy) represents an alkyl group as defined above having the indicated number of carbon atoms attached through an oxygen bridge. The term “alkyloxyalkyl” represents an alkyloxy group attached through an alkyl group as defined above having the indicated number of carbon atoms. [0034]
  • The term “alkylthio” (e.g. methylthio, ethylthio, propylthio, cyclohexenylthio and the like) represents an alkyl group as defined above having the indicated number of carbon atoms attached through a sulfur bridge. The term “alkylthioalkyl” represents an alkylthio group attached through an alkyl group as defined above having the indicated number of carbon atoms. [0035]
  • The term “alkylamino” (e.g. methylamino, diethylamino, butylamino, N-propyl-N-hexylamino, (2-cyclopentyl)propylamino, hexenylamino, pyrrolidinyl, piperidinyl and the like) represents one or two alkyl groups as defined above having the indicated number of carbon atoms attached through an amine bridge. The two alkyl groups maybe taken together with the nitrogen to which they are attached forming a cyclic system containing 3 to 11 carbon atoms with at least one C[0036] 1-C11alkyl, arylC0-C11alkyl substituent. The term “alkylaminoalkyl” represents an alkylamino group attached through an alkyl group as defined above having the indicated number of carbon atoms.
  • The term “alkylcarbonyl” (e.g. cyclooctylcarbonyl, pentylcarbonyl, 3-hexenylcarbonyl) represents an alkyl group as defined above having the indicated number of carbon atoms attached through a carbonyl group. The term “alkylcarbonylalkyl” represents an alkylcarbonyl group attached through an alkyl group as defined above having the indicated number of carbon atoms. [0037]
  • The term “alkylcarboxy” (e.g. heptylcarboxy, cyclopropylcarboxy, 3-pentenylcarboxy) represents an alkylcarbonyl group as defined above wherein the carbonyl is in turn attached through an oxygen. The term “alkylcarboxyalkyl” represents an alkylcarboxy group attached through an alkyl group as defined above having the indicated number of carbon atoms. [0038]
  • The term “alkylcarbonylamino” (e.g. hexylcarbonylamino, cyclopentylcarbonyl-aminomethyl, methylcarbonylaminophenyl) represents an alkylcarbonyl group as defined above wherein the carbonyl is in turn attached through the nitrogen atom of an amino group. The nitrogen group may itself be substituted with an alkyl or aryl group. The term “alkylcarbonylaminoalkyl” represents an alkylcarbonylamino group attached through an alkyl group as defined above having the indicated number of carbon atoms. The nitrogen group may itself be substituted with an alkyl or aryl group. [0039]
  • The term “aryl” represents an unsubstituted, mono-, di- or trisubstituted monocyclic, polycyclic, biaryl and heterocyclic aromatic groups covalently attached at any ring position capable of forming a stable covalent bond, certain preferred points of attachment being apparent to those skilled in the art (e.g., 3-indolyl, 4-imidazolyl). The aryl substituents are independently selected from the group consisting of halo, nitro, cyano, trihalomethyl, hydroxypyronyl, C[0040] 1-11alkyl, arylC1-11alkyl, C0-11alkyloxyC0-11alkyl, arylC0-11alkyloxyC0-11alkyl, C0-11alkylthioC0-11alkyl, arylC0-11alkylthioC0-11alkyl, C0-11alkylaminoC0-11alkyl, arylC0-11alkylaminoC0-11alkyl, di(arylC1-11alkyl)aminoC0-11alkyl, C1-11alkylcarbonylC0-11alkyl, arylC1-11alkylcarbonylC0-11alkyl, C1-11alkylcarboxyC0-11alkyl, arylC1-11alkylcarboxyC0-11alkyl, C1-11alkylcarbonylaminoC0-11alkyl, arylC1-11alkylcarbonylaminoC0-11alkyl, —C0-11alkylCOOR4, —C0-11alkylCONR5R6 wherein R4, R5 and R6 are independently selected from hydrogen, C1-C11alkyl, arylC0-C11alkyl, or R5 and R6 are taken together with the nitrogen to which they are attached forming a cyclic system containing 3 to 8 carbon atoms with at least one C1-C11alkyl, arylC0-C11 alkyl substituent.
  • The definition of aryl includes but is not limited to phenyl, biphenyl, naphthyl, dihydronaphthyl, tetrahydronaphthyl, indenyl, indanyl, azulenyl, anthryl, phenanthryl, fluorenyl, pyrenyl, thienyl, benzothienyl, isobenzothienyl, 2,3-dihydrobenzothienyl, furyl, pyranyl, benzofuranyl, isobenzofuranyl, 2,3-dihydrobenzofuranyl, pyrrolyl, indolyl, isoindolyl, indolizinyl, indazolyl, imidazolyl, benzimidazolyl, pyridyl, pyrazinyl, pyradazinyl, pyrimidinyl, triazinyl, quinolyl, isoquinolyl, 4H-quinolizinyl, cinnolinyl, phthalazinyl, quinazolinyl, quinoxalinyl, 1,8-naphthyridinyl, pteridinyl, carbazolyl, acridinyl, phenazinyl, phenothiazinyl, phenoxazinyl, chromanyl, benzodioxolyl, piperonyl, purinyl, pyrazolyl, triazolyl, tetrazolyl, thiazolyl, isothiazolyl, benzthiazolyl, oxazolyl, isoxazolyl, benzoxazolyl, oxadiazolyl, thiadiazolyl. [0041]
  • The term “arylalkyl” (e.g. (4-hydroxyphenyl)ethyl, (2-aminonaphthyl)hexenyl, pyridylcyclopentyl) represents an aryl group as defined above attached through an alkyl group as defined above having the indicated number of carbon atoms. [0042]
  • The term “arylcarbonyl” (e.g. 2-thiophenylcarbonyl, 3-methoxyanthrylcarbonyl, oxazolylcarbonyl) represents an aryl group as defined above attached through a carbonyl group. [0043]
  • The term “arylalkylcarbonyl” (e.g. (2,3-dimethoxyphenyl)propylcarbonyl, (2-chloronaphthyl)pentenylcarbonyl, imidazolylcyclopentylcarbonyl) represents an arylalkyl group as defined above wherein the alkyl group is in turn attached through a carbonyl. [0044]
  • The term “signal transduction” is a collective term used to define all cellular processes that follow the activation of a given cell or tissue. Examples of signal transduction include but are not in any way limited to cellular events that are induced by polypeptide hormones and growth factors (e.g. insulin, insulin-like growth factors I and II, growth hormone, epidermal growth factor, platelet-derived growth factor), cytokines (e.g. interleukines), extracellular matrix components, and cell-cell interactions. [0045]
  • Phosphotyrosine recognition units/tyrosine phosphate recognition units/phosphotyrosine recognition units are defined as areas or domains of proteins or glycoproteins that have affinity for molecules containing phosphorylated tyrosine residues (pTyr). Examples of pTyr recognition units include but are not in any way limited to: PTPases, SH2 domains and PTB domains. [0046]
  • PTPases are defined as enzymes with the capacity to dephosphorylate pTyr-containing proteins or glycoproteins. Examples of PTPases include but are not in any way limited to: intracellular PTPases (e.g. PTP-1B, TC-PTP, PTP-1C, PTP-1D,PTP-D1, PTP-D2), receptor-type PTPases (e.g. PTPα, PTPε, PTPβ, PTPγ, CD45, PTPκ, PTPμ), dual specificity phosphatases (e.g. VH1, VHR, cdc25) and other PTPases such as LAR, SHP-1, SHP-2, PTP-1H, PTPMEGI, PTP-PEST, PTPζ, PTPS31, IA-2 and HePTP and the like. [0047]
  • Modulation of cellular processes is defined as the capacity of compounds of the invention to 1) either increase or decrease ongoing, normal or abnormal, signal transduction, 2) initiate normal signal transduction, and 3) initiate abnormal signal transduction. [0048]
  • Modulation of pTyr-mediated signal transduction/modulation of the activity of molecules with pTyr recognition units is defined as the capacity of compounds of the invention to 1) increase or decrease the activity of proteins or glycoproteins with pTyr recognition units (e.g. PTPases, SH2 domains or PTB domains) or to 2) decrease or increase the association of a pTyr-containing molecule with a protein or glycoprotein with pTyr recognition units either via a direct action on the pTyr recognition site or via an indirect mechanism. Examples of modulation of pTyr-mediated signal transduction/modulation of the activity of molecules with pTyr recognition units, which are not intended in any way limiting to the scope of the invention claimed, are: a) inhibition of PTPase activity leading to either increased or decreased signal transduction of ongoing cellular processes; b) inhibition of PTPase activity leading to initiation of normal or abnormal cellular activity; c) stimulation of PTPase activity leading to either increased or decreased signal transduction of ongoing cellular processes; d) stimulation of PTPase activity leading to initiation of normal or abnormal cellular activity; e) inhibition of binding of SH2 domains or PTB domains to proteins or glycoproteins with pTyr leading to increase or decrease of ongoing cellular processes; f) inhibition of binding of SH2 domains or PTB domains to proteins or glycoproteins with pTyr leading to initiation of normal or abnormal cellular activity. [0049]
  • A subject is defined as any mammalian species, including humans. [0050]
  • DETAILED DESCRIPTION
  • This application relates to compounds having the general structure shown in Formula (A1): [0051]
  • Y—X—C(R′)═C(R″)COOR″′  (A1)
  • wherein [0052]
  • (i) R′ and R″ are independently selected from the group consisting of hydrogen, halo, cyano, nitro, trihalomethyl, alkyl, arylalkyl, [0053]
  • (ii) R″′ is selected from the group consisting of hydrogen, alkyl, substituted alkyl, aryl, arylalkyl [0054]
  • (iii) X is aryl, [0055]
  • (iv) Y is selected from hydrogen or [0056]
    Figure US20020183518A1-20021205-C00005
  • wherein (*) indicates a potential point of attachment to X and all other positions are substituted as described below. [0057]
  • (1) According to the invention, a class of preferred PTPase activity-modulating compounds have the general structural Formula depicted in (A2): [0058]
    Figure US20020183518A1-20021205-C00006
  • wherein at least one of R[0059] 1, R2 and R3 substituents has the general structure depicted in Formula (B)
  • X—C(R′)═C(R″)COOR″′  (B)
  • wherein R′, R″, R″′ and X are defined as above in Formula (A1), and wherein the remaining of R[0060] 1, R2 and R3 are independently selected from the group consisting of hydrogen, alkyl, substituted alkyl, aryl, arylalkyl.
  • (2) According to the invention, a class of preferred PTPase activity-modulating compounds have the general structural Formula depicted in (A3): [0061]
    Figure US20020183518A1-20021205-C00007
  • wherein at least one of R[0062] 1, R2 and R3 substituents has the general structure depicted in Formula (B)
  • X—C(R′)═C(R″)COOR″′  (B)
  • wherein R′, R″, R″′ and X are defined as above in Formula (A1), and wherein the remaining of R[0063] 1, R2 and R3 are independently selected from the group consisting of:hydrogen, alkyl, substituted alkyl, alkylcarbonyl, substituted alkylcarbonyl, aryl, arylalkyl, arylcarbonyl, arylalkylcarbonyl.
  • (3) According to the invention, a class of preferred PTPase activity-modulating compounds have the general structural Formula depicted in (A4): [0064]
    Figure US20020183518A1-20021205-C00008
  • wherein at least one of R[0065] 1, R2 substituents has the general structure depicted in Formula (B)
  • X—C(R′)═C(R″)COOR″′  (B)
  • wherein R′, R″, R″′ and X are defined as above in Formula (A1), and wherein the remaining of R[0066] 1, R2 is defined as above in Formula (A2).
  • (4) According to the invention, a class of preferred PTPase activity-modulating compounds have the general structural Formula depicted in (A5): [0067]
    Figure US20020183518A1-20021205-C00009
  • wherein at least one of R[0068] 1 and R2 substituents has the general structure depicted in Formula (B)
  • X—C(R′)═C(R″)COOR″′  (B)
  • wherein R′, R″, R″′ and X are defined as above in Formula (A1), and wherein the remaining of R[0069] 1 and R2 is defined as above in Formula (A2).
  • (5) According to the invention, a class of preferred PTPase activity-modulating compounds have the general structural Formula depicted in (A6): [0070]
    Figure US20020183518A1-20021205-C00010
  • wherein at least one of R[0071] 1, R2, R3 and R4 substituents has the general structure depicted in Formula (B)
  • X—C(R′)═C(R″)COOR″′  (B)
  • wherein R′, R″, R″′ and X are defined as above in Formula (A1), and wherein the remaining of R[0072] 1, R2, R3 and R4 have the same definition as R1, R2 and R3 in Formula (A2), with the proviso that when R3 and R4 are selected from substituted phenyl or substituted furyl then the phenyl and furyl substituents exclude hydroxy, halo, trifluoromethyl, C1-6alkyl, C1-6alkyloxy, C1-6alkylthio, amino, C1-6alkylamino, di(C1-6alkyl)amino, phenylC1-6alkylamino and di(phenylC1-6alkyl)amino.
  • (6) According to the invention, a class of preferred PTPase activity-modulating compounds have the general structural Formula depicted in (A6): [0073]
    Figure US20020183518A1-20021205-C00011
  • wherein R[0074] 4 is selected from —COR5, —COOR6, —CONR7R8 wherein R5 thru R8 are selected from hydrogen, alkyl, substituted alkyl, aryl, arylalkyl, or R7 and R8 are taken together with the nitrogen to which they are attached forming a cyclic system containing 3 to 8 carbon atoms with at least one alkyl, aryl, arylalkyl substituent, and wherein at least one of R1, R2, and R3 substituents has the general structure depicted in Formula (B)
  • X—C(R′)═C(R″)COOR″′  (B)
  • wherein R′, R″, R″′ and X are defined as above in Formula (A1), and wherein the remaining of R[0075] 1, R2 and R3 are defined as above in Formula (A2).
  • (7) According to the invention, a class of preferred PTPase activity-modulating compounds have the general structural Formula depicted in (A6): [0076]
    Figure US20020183518A1-20021205-C00012
  • wherein R[0077] 1, R2, R3 and R4 are defined as above in (6).
  • (8) According to the invention, a class of preferred PTPase activity-modulating compounds have the general structural Formula depicted in (A7): [0078]
    Figure US20020183518A1-20021205-C00013
  • wherein R[0079] 2 is selected from —COR5, —COOR6, —CONR7R8 wherein R5 thru R8 are defined as above in (6) and wherein at least one of R1 and R3 substituents has the general structure depicted in Formula (B)
  • X—C(R′)═C(R″)COOR″′  (B)
  • wherein R′, R″, R″′ and X are defined as above in Formula (A1), and wherein the remaining of R[0080] 1 and R3 are defined as above in Formula (A2).
  • (9) According to the invention, a class of preferred PTPase activity-modulating compounds have the general structural Formula depicted in (A8): [0081]
    Figure US20020183518A1-20021205-C00014
  • wherein at least one of R[0082] 1 and R2 substituents has the general structure depicted in Formula (B)
  • X—C(R′)═C(R″)COOR″′  (B)
  • wherein R′, R″, R″′ and X are defined as above in Formula (A1), and wherein the remaining of R[0083] 1 and R2 is defined as above in Formula (A2), and wherein m is an integer between 0 and 4 and each R3 is independently selected from the group consisting of halo, nitro, cyano, trihalomethyl, hydroxypyronyl, alkyl, arylalkyl, C0-11alkyloxyC0-11alkyl, arylC0-11alkyloxyC0-11alkyl, C0-11alkylthioC0-11alkyl, arylC0-11alkylthioC0-11alkyl, C0-11alkylaminoC0-11alkyl, arylC0-11alkylaminoC0-11alkyl, di(arylC1-11alkyl)aminoC0-11alkyl, C1-11alkylcarbonylC0-11alkyl, arylC1-11alkylcarbonylC0-11alkyl, C1-11alkylcarboxyC0-11alkyl, arylC1-11alkylcarboxyC0-11alkyl, C1-11alkylcarbonylaminoC0-11alkyl, arylC1-11alkylcarbonylaminoC0-11alkyl, —C0-11alkylCOOR4, —C0-11alkylCONR5R6 wherein R4, R5 and R6 are independently selected from hydrogen, C1-C11alkyl, arylC0-C11alkyl, or R5 and R6 are taken together with the nitrogen to which they are attached forming a cyclic system containing 3 to 8 carbon atoms with at least one C1-C11alkyl, arylC0-C11alkyl substituent.
  • (10) According to the invention, a class of preferred PTPase activity-modulating compounds have the general structural Formula depicted in (A8): [0084]
    Figure US20020183518A1-20021205-C00015
  • wherein R[0085] 1 is selected from —COR5, —COOR6, —CONR7R8 wherein R5 thru R8 are defined as above in (6) and wherein R2 has the general structure depicted in Formula (B)
  • X—C(R′)═C(R″)COOR″′  (B)
  • wherein R′, R″, R″′ and X are defined as above in Formula (A1), and wherein m is an integer between 0 and 4 and each R[0086] 3 is defined as above in (9).
  • (11) According to the invention, a class of preferred PTPase activity-modulating compounds have the general structural Formula depicted in (A9): [0087]
    Figure US20020183518A1-20021205-C00016
  • wherein m is an integer between 0 and 3 and wherein R[0088] 1, R2 each R3 is defined as above in (9).
  • (12) According to the invention, a class of preferred PTPase activity-modulating compounds have the general structural Formula depicted in (A9): [0089]
    Figure US20020183518A1-20021205-C00017
  • wherein either R[0090] 1 or R2 is selected from —COR5, —COOR6, —CONR7R8 wherein R5 thru R8 are defined as in (6) and wherein the remainder of R1 and R2 is defined as above in (9), and wherein m is an integer between 0 and 3 and each R3 is defined as above in (9).
  • (13) According to the invention, a class of preferred PTPase activity-modulating compounds have the general structural Formula depicted in (A10): [0091]
    Figure US20020183518A1-20021205-C00018
  • wherein Z[0092] 1 and Z2 are independently selected from the group consisting of OR3, SR4, NR5R6 and wherein at least one of R1, R2 substituents has the general structure depicted in Formula (B)
  • X—C(R′)═C(R″)COOR″′  (B)
  • wherein R′, R″, R″′ and X are defined as above in Formula (A1), and wherein the remaining of R[0093] 1, R2 is defined as above in Formula (A2), and wherein R3, R4, R5, R6 are independently selected from hydrogen, alkyl, substituted alkyl, alkylcarbonyl, substituted alkylcarbonyl, aryl, arylalkyl, arylcarbonyl, arylalkylcarbonyl.
  • (14) According to the invention, a class of preferred PTPase activity-modulating compounds have the general structural Formula depicted in (A11): [0094]
    Figure US20020183518A1-20021205-C00019
  • wherein at least one of R[0095] 1, R2, and R3 substituents has the general structure depicted in Formula (B)
  • X—C(R′)═C(R″)COOR″′  (B)
  • wherein R′, R″, R″′ and X are defined as above in Formula (A1), and wherein the remaining of R[0096] 1, R2 and R3 are defined as above in Formula (A2).
  • Preferred compositions of the invention include compositions comprising compounds as defined above in structural formula (A1), (A2), (A3), (A4), (A5), (A6), (A7), (A8), (A9), (A10), (A11) (or pharmaceutically acceptable salts, prodrugs, esters, or solvates of these compounds) in admixture with a pharmaceutically acceptable diluent, adjuvent, or carrier. [0097]
  • Provided according to the invention, therefore, are novel compounds which modulate the activity of PTPase or other molecules with pTyr recognition unit(s) as well as previously known aryl acrylic acid compounds which modulate the activity of PTPase or other molecules with pTyr recognition unit(s). [0098]
  • Another aspect of the present invention provides compositions comprising PTPase modulating compounds of the invention suitable for administration to a mammalian host. [0099]
  • In a preferred embodiment the compounds of the invention act as inhibitors of PTPases, e.g. protein tyrosine phosphatases involved in the regulation of tyrosine kinase signaling pathways. Preferred embodiments include modulation of receptor-tyrosine kinase signaling pathways via interaction with regulatory PTPases, e.g. the signaling pathways of the insulin receptor, the IGF-I receptor and other members of the insulin receptor family, the EGF-receptor family, the platelet-derived growth factor family, the nerve growth factor receptor family, the hepatocyte growth factor receptor family, the growth hormone receptor family and members of other receptor-type tyrosine kinase families. Further preferred embodiments of the invention is modulation of non-receptor tyrosine kinase signaling through modulation of regulatory PTPases, e.g. modulation of members of the Src kinase family. One type of preferred embodiments of the invention relates to modulation of the activity of PTPases that negatively regulate signal transduction pathways. Another type of preferred embodiments of the inventions relate to modulation of the activity of PTPases that positively regulate signale transduction pathways. [0100]
  • In a preferred embodiment compounds of the inventions act as modulators of the active site of PTPases. In another preferred embodiment the compounds of the invention modulate the activity of PTPases via interaction with structures positioned outside the active sites of the enzymes, preferably SH2 domains. Further preferred embodiments include modulation of signal transduction pathways via binding of the compounds of the invention to SH2 domains or PTB domains of non-PTPase signaling molecules. [0101]
  • Other preferred embodiments include use of the compounds of the invention for modulation of cell-cell interactions as well as cell-matrix interactions. [0102]
  • As a preferred embodiment, the compounds of the invention may be used as therapeutics to inhibit PTPases involved in the regulation of the insulin recptor tyrosine kinase signaling pathway in patients with type I diabetes, type II diabetes, impaired glucose tolerance, insuline resistance and obesity. Further preferred embodiments include use of the compounds of the invention for treatment of disorders with general or specific dysfunction of PTPase activity, e.g. proliferative disorders including neoplastic diseases and psoriosis. As another embodiment, the compounds of the invention may be used in pharmaceutical preparations for treatment of osteoporosis. [0103]
  • Preferred embodiments of the invention further include use of compounds of the invention in pharmaceutical preparations to increase the secretion or action of growth hormone and its analogs or somatomedins including IGf-I and IGF-2 by modulating the activity of PTPases or other signal transduction molecules with affinity for phosphotyrosine involved controlling or inducing the action of these hormones or any regulating molecule. [0104]
  • To those skilled in the art, it is well known that the current and potential uses of growth hormone in humans are varied and muti-tudinous. Thus, compounds of the invention can be administered for purposes of stimulating the release of growth hormone from the pituitary or increase its action on target tissues thereby leading to similar effects or uses as growth hormone itself. The uses of growth hormone maybe summarized as follows: stimulation of growth hormone release in the elderly; prevention of catabolic side effects of glucocorticoids; treatment of osteoporosis, stimulation of the immune system; treatment of retardation, accelaration of wound healing; accelerating bone fracture repair; treatment of growth retardation; treating renal failure or insufficiency resulting in growth retardation; treatment of physiological short stature including growth hormone deficient children and short stature associated with chronic illness; treatment of obesity and growth retardation associated with obesity; treating growth retardation associated with the Pader-Willi syndrom and Turner's syndrom; accelerating the recovery and reducing hospitalization of burn patients; treatment of intrauterine growth retardation, skeletal dysplasia, hypercortisolism and Cushings syndrome; induction of pulsatile growth hormone release; replacement of growth hormone in stressed patients; treatment of osteochondro-dysplasis, Noonans syndrome, schizophrenia, depressions, Alzheimer's disease, delayed wound healing and psychosocial deprivation; treatment of pulmonary dysfunction and ventilator dependency; attenuation of protein catabolic responses after major surgery; reducing cachexia and protein loss due to chronic illness such as cancer or AIDS; treatment of hyperinsulinemia including nesidio-blastosis; adjuvant treatment for ovulation induction; stimulation of thymic development and prevention of age related decline or thymic function; treatment of immunosuppresed patients; improvement in muscle strength, mobility, maintenance of skin thickness, metabolic homeostasis, renal homeostasis in the frail elderly; stimulation of osteoblasts, bone remodelling and cartilage growth; stimulation of the immune system in companion animals and treatment of disorder of aging in companion animals; growth promotant in livestock and stimulation of wool growth in sheep. [0105]
  • The compounds of the invention may be used in pharmaceutical preparations for treatment of various disorders of the immune system, either as stimulant or suppressor of normal or perturbed immune functions, including autoimmune reactions. Further embodiments of the invention for treatment of allergic reactions, e.g. asthma, dermal reactions, conjunctivitis. [0106]
  • In another embodiment, compounds of the invention may be used in pharmaceutical preparations for prevention or induction of platelet aggregation. [0107]
  • In yet another embodiment, compounds of the invention may be used in pharmaceutical preparations for treatment of infectious disorders. In particular, the compounds of the invention may be used for treatment of infectious disorders caused by Yersinia and other bacteria as well as disorders caused by viruses or other microorganisms. [0108]
  • Compounds of the invention may additionally be used for treatment or prevention of diseases in animals, including commercially important animals. [0109]
  • Also included in the present invention is a process for isolation of PTPases via affinity purification procedures based on the use of immobilized compounds of the invention using procedures well-known to those skilled in the art. [0110]
  • The invention is further directed to a method for detecting the presence of PTPases in cell or in a subject comprising [0111]
  • (a) contacting said cell or an extract thereof with labeled compounds of the invention. [0112]
  • (b) detecting the binding of the compounds of the invention or measuring the quantity bound, thereby detecting the presence or measuring the quantity of certain PTPases. [0113]
  • The invention further relates to analysis and identification of the specific functions of certain PTPases by modulating their activity by using compounds of the invention in cellular assay systems or in whole animals. [0114]
  • The invention further provides methods for making compounds (A1), (A2), (A3), (A4), (A5), (A6), (A7), (A8), (A9), (A10), (A11) of the present invention having PTPase-modulatory/inhibitory activity. In preferred methods, compounds of the invention are synthesized in a multi-component combinatorial array, which permits rapid synthesis of numerous, structurally related compounds for subsequent evaluation. In preferred synthesis protocols, the acrylic acid moiety of a compound is protected during synthesis by, e.g., esterification with a tert-butyl protecting group. Thus, a preferred method of making compounds of the invention comprises use of a protected acrylic acid reagent and removal of the protective group by, e.g., treatment of a precursor ester compound with acid. Optionally, such a method includes further esterifying or salifying the acrylic acid product thereby obtained. [0115]
  • Thus, a preferred method of making compounds of the invention comprises use of a protected acrylic acid reagent and removal of the protective group by, e.g., treatment of a precursor ester compound with acid. Optionally, such a method includes further esterifying or salifying the acrylic acid product thereby obtained. [0116]
  • The compounds of formula (A1), (A2), (A3), (A4), (A5), (A6), (A7), (A8), (A9), (A10), (A11) may be prepared by procedures known to those skilled in the art from known compounds or readily preparable intermediates. General synthetic procedures and examples are as follow: [0117]
  • General Method for the Removal of Tert-butyl Esters [0118]
    Figure US20020183518A1-20021205-C00020
  • Unless otherwise stated, tert-butyl esters were converted to their corresponding carboxylic acids via treatment with a solution of 50% trifluoroacetic acid in dichloromethane for 1 hour at 23° C. The solvent was removed in vacuo and the residue was azeotroped with toluene or acetonitrile to yield the corresponding carboxylic acid. [0119]
  • General Method for the Synthesis of Compounds (A1) and (A5) [0120]
  • Method 1 [0121]
    Figure US20020183518A1-20021205-C00021
  • By allowing a compound of formula (1) wherein LG is a suitable leaving group such as bromo, iodo, or triflate to react with compound of formula (2) wherein Z is hydrogen (Heck reaction: [0122] J. Org. Chem., 1977, 42, 3903), or trialkyltin (Stille reaction: J. Am. Chem. Soc., 1991, 113, 9585), or B(OH)2 (Suzuki reaction: J. Am. Chem. Soc., 1989, 111, 314) and wherein R′, R″, R″′ and X are defined as above for formula (A1).
  • These reactions may be carried out neat or in a solvent such as dimethylformamide (DMF), tetrahydrofuran (THF), or toluene, in the presence of a catalyst (e.g. Pd(OAc)[0123] 2, Pd(PPh3)4, Pd2dba3), a ligand (e.g. Ph3P, Ph3As, (o-tolyl)3P) and a base (e.g. K2CO3, CsCO3, Et3N) at temperatures ranging from 23° C. to 130° C., for 1 to 60 hours.
  • EXAMPLES
  • [0124]
    Figure US20020183518A1-20021205-C00022
  • Prepared according to Patel et al ([0125] J. Org. Chem., 1977, 42, 3903).
  • [0126] 1H NMR of 3 (400 MHz, CDCl3) δ 1.5 (s, 9H), 6.4 (d, 1H), 7.6 (m, 3H), 8.05 (d, 2H).
    Figure US20020183518A1-20021205-C00023
  • Prepared according to Patel et al ([0127] J. Org. Chem., 1977, 42, 3903).
  • [0128] 1H NMR of 4 (400 MHz, CDCl3) δ 1.5 (s, 9H), 6.4 (d, 1 H), 7.55 (d, 1H), 7.6 (d, 2H), 7.8 (d, 2H), 9.95 (s, 1H).
    Figure US20020183518A1-20021205-C00024
  • Prepared according to Patel et al ([0129] J. Org. Chem., 1977, 42, 3903).
  • [0130] 1H NMR of 5 (400 MHz, CDCl3) δ 1.44 (s, 9H), 6.26 (d, 1H), 7.18 (d, 1H), 7.56 (d, 1H), 7.74 (d, 1H).
    Figure US20020183518A1-20021205-C00025
  • Prepared according to Patel et al ([0131] J. Org. Chem. 1977, 42, 3903).
  • [0132] 1H NMR of 6 (400 MHz, CDCl3) δ 1.5 (s, 18H), 6.42 (d, 2H), 7.6 (m, 6H), 7.9 (d, 4H).
    Figure US20020183518A1-20021205-C00026
  • Prepared according to Patel et al ([0133] J. Org. Chem. 1977, 42, 3903).
  • [0134] 1H NMR of 7 (400 MHz, CDCl3) δ 1.5 (s, 18H), 6.2 (d, 2H), 7.1 (d, 2H), 7.35 (d, 2H), 7.5 (s, 2H), 7.7 (d, 2H).
    Figure US20020183518A1-20021205-C00027
  • To 11 g of 4,4′-dibromobenzil (30 mmol, 1.0 equiv), 67 mg of palladium (II) acetate (0.3 mmol, 0.01 equiv), 365 mg of tri-o-tolylphosphine (1.2 mmol, 0.04 equiv) was added 200 mL of dimethylformamide followed by 4.2 mL (30 mmol, 1.0 equiv) of A triethylamine. The mixture was placed in a 100° C. preheated bath and 4.4 mL of tert-butylacrylate (30 mmol, 1.0 equiv) in 30 mL of dimethylforamide was added dropwise over 1 hour. The reaction mixture was heated at 100° C. for 12 hours, cooled to 23° C. and the solvent was removed in vacuo. Ethyl acetate was added and the organic layer was washed with water and dried over sodium sulfate. The solvent was removed and the residue (mixture of dibromobenzil, mono and bis-tert-butylacrylate benzil) was recrystallized from hot 30% dichloromethane in hexane. The solid which crashed out (mixture of dibromobenzil and mono-tert-butylacrylate benzil) was filtered off and treated with 20% trifluoroacetic acid in dichloromethane. After 20 minutes, the mono-tert-butylacrylate benzil 8 was filtered off and washed with 20% trifluoroacetic acid in dichloromethane (1.4 g isolated). The mother liquor (mixture of mono and bis-tert-butylacrylate benzil) was recovered and purified by flash chromatography (ethyl acetate-hexane eluant) to yield 2.4 g of the mono-tert-butylacrylate dione which was treated with 20% trifluoroacetic acid in dichloromethane to give 2.2 g of 8. The combined total yield of 8 was 3.6 g (34%). [0135] 1H NMR of 8 (400 MHz, d6-DMSO) δ 6.7 (d, 1H), 7.6 (d, 1H), 7.8 (s, 4H), 7.9 (s, 4H).
    Figure US20020183518A1-20021205-C00028
  • [0136] 1H NMR of 9 (400 MHz, d6-DMSO) δ 6.7 (d, 2H), 7.6 (d, 2H), 7.9 (s, 8H).
    Figure US20020183518A1-20021205-C00029
  • Prepared according to Patel et al ([0137] J. Org. Chem., 1977, 42, 3903).
  • [0138] 1H NMR of 10 (400 MHz, CDCl3-CD3OD 9:1) δ 1.45 (s, 9H), 6.42 (d, 1H),
  • 6.5 (d, 1H), 7.55 (d, 1H), 7.6 (dd, 4H), 7.68 (d, 1H), 7.92 (dd, 4H). [0139]
    Figure US20020183518A1-20021205-C00030
  • To a solution of 10 (1 equiv) in dichloromethane was added octylamine (1 equiv), EDCI (1.3 equiv) and 4-dimethylaminopyridine (0.5 equiv) at 23° C. The solution was stirred overnight, diluted with ethyl acetate, washed with 1N HCl and saturated sodium bicarbonate and dried over sodium sulfate. The residue was purified by flash chromatography (ethyl acetate-hexane eluant) and the solvent was removed in vacuo to yield compound 11. [0140] 1H NMR of 11 (400 MHz, CDCl3) δ 0.9 (t, 3H), 1.25 (s br, 10H), 1. 5 (s, 9H), 1.55 (s br, 2H), 3.35 (dd, H), 5.6 (t br, 1H), 6.44 9d, 1H), 6.48 (d, 1H), 7.58 (m, 6H), 7.92 (d, 4H).
    Figure US20020183518A1-20021205-C00031
  • Same procedure as compound 11. [0141] 1H NMR of 12 (400 MHz, CDCl3) δ 1.5 (s, 9H), 2.83 (t, 2H), 3.62 (dt, 2H), 5.82 (t br, 1H), 6.4 (m, 2H), 7.18 (m, 5H), 7.6 (m, 6H), 7.9 (m, 4H).
    Figure US20020183518A1-20021205-C00032
    Figure US20020183518A1-20021205-C00033
  • By allowing a compound of formula (1) as defined above to react with polymer bound compound of formula (14) wherein Z, R′ and R″ are defined as above in method 1. [0142]
  • These reactions may be carried out on functionalized cross linked polystyrene polymers such as Merrifield resin, Wang resin, Rink resin, Tentagel™ resin, in a solvent such as dimethylformamide (DMF), tetrahydrofuran (THF), or toluene, in the presence of a catalyst (e.g. Pd(OAc)[0143] 2, Pd(PPh3)4, Pd2dba3), a ligand (e.g. Ph3P, Ph3As, (o-tolyl)3P) and a base (e.g. K2CO3, CsCO3, Et3N) at temperatures ranging from 23° C. to 130° C., for 1 to 60 hours.
  • EXAMPLES
  • [0144]
    Figure US20020183518A1-20021205-C00034
  • For leading references see: a) Mathias ([0145] Synthesis 1979, 561). b) Sarantakis et al (Biochem. Biophys. Res. Commun. 1976, 73, 336). c) Hudson et al (Peptide Chemistry 1985 (Kiso, Y., ed.), 1986, Protein Research Foundation, Osaka.). d) Wang (J. Am. Chem. Soc. 1973, 95, 1328). e) Lu et al (J. Org. Chem. 1981, 46, 3433.) e) Morphy et al (Tetrahedron Letters 1996, 37, 3209). e) Yedidia et al (Can. J Chem. 1980, 58,1144).
  • To 10 g (11.2 mmol, 1 equiv) of Wang resin in 80 mL of dry dichloromethane was added 33.6 mmol (3 equiv) of diisopropylcarbodiimide and the mixture was sonnicated under N[0146] 2 for 2 hours (final bath temperature was 40° C.). Freshly distilled acrylic acid (33.6 mmol, 3 equiv) and 4-dimethylaminopyridine (11.2 mmol, 1 equiv) were added and the mixture was magnetically stirred for 16 hours at ambient temperature. The resin was filtered and thoroughly washed with dichloromethane (500 mL), methanol (500 mL), dimethylformamide (500 mL), dichloromethane (500 mL) and methanol (500 mL) and dried in vacuo (0.1 mmHg) for 24 hours. The coupling was repeated and resin 15 was filtered, washed and dried as above, and used directly in the next step.
    Figure US20020183518A1-20021205-C00035
  • To 8.2 g of acrylate Wang resin 15 was added 10.4 g (28.3 mmol) of 4,4′-dibromobenzil, 437 mg of palladium (II) acetate (1.95 mmol), 1.25 g of tri-o-tolylphosphine (4.11 mmol), 95 mL of dimethylformamide followed by 3.3 mL (23.7 mmol) of triethylamine. The mixture was placed in a 100° C. preheated bath and stirred magnetically at 200 rpm for 2 hours. The resin was filtered hot and washed thoroughly with hot dimethylformamide (500 mL), hot acetic acid (500 mL), methanol (500 mL), dichloromethane (500 mL), dimethylformamide (500 mL), dichloromethane (500 mL) and methanol (500 mL) and dried in vacuo (0.1 mmHg) for 24 hours. The linker was cleaved from the resin with a solution of 20% trifluoroacetic acid in dichloromethane for 20 min at ambient temperature. [0147] 1H NMR for monobromo-monoacid linker (400 MHz, d6-DMSO) δ 6.7 (d, 2H), 7.6 (d, 2H), 7.8 (s, 4H), 7.9 (s, 4H).
    Figure US20020183518A1-20021205-C00036
  • To 10.2 g resin 16 was added 5.41 mL (37 mmol) of tert-butylacrylate, 132 mg of palladium (II) acetate (0.592 mmol), 0.360 g of tri-o-tolylphosphine (1.18 mmol), 31 mL of dimethylformamide followed by 1 mL (7.4 mmol) of triethylamine. The mixture was placed in a 100° C. preheated bath and stirred magnetically at 200 rpm for 18 hours. The resin was filtered hot and washed thoroughly with hot dimethylformamide (500 mL), hot acetic acid (500 mL), methanol (500 mL), dichloromethane (500 mL), dimethylformamide (500 mL), dichloromethane (500 mL) and methanol (500 mL) and dried in vacuo (0.1 mmHg) for 24 hours. The linker was cleaved from the resin with a solution of 20% trifluoroacetic acid in dichloromethane for 20 min at ambient temperature. [0148] 1H NMR for diacid linker (400 MHz, d6-DMSO) δ 6.7 (d, 2H), 7.6 (d, 2H), 7.9 (s, 8H).
    Figure US20020183518A1-20021205-C00037
  • To 1 g of acrylate resin 15 was added 1.02 g (2.8 mmol) of mono-bromo-mono-tert-butylacrylate benzil (8), 0.044 g of palladium (II) acetate (0.19 mmol), 0.130 g of tri-o-tolylphosphine (0.41 mmol), 10 mL of dimethylformamide followed by a solution of 0.76 mL (5.7 mmol) of triethylamine in 10 mL of dimethylformamide. The mixture was placed in a 100° C. preheated bath and stirred magnetically at 200 rpm for 2 hours. The resin was filtered hot and washed thoroughly with hot dimethylformamide (50 mL), water (50 mL), 10% sodium bicarbonate (50 mL), 10% aqueous acetic acid (50 mL), water (50 mL), methanol (50 mL), dichloromethane (50 mL), methanol (50 mL), dichloromethane (50 mL) and dried in vacuo (0.1 mmHg) for 24 hours. The linker was cleaved from the resin with a solution of 20% trifluoroacetic acid in dichloromethane for 20 min at ambient temperature. [0149] 1H NMR for diacid linker (400 MHz, d6-DMSO) δ 6.7 (d, 2H), 7.6 (d, 2H), 7.9 (s, 8H).
    Figure US20020183518A1-20021205-C00038
  • Resin 18 was treated with a 1.0M solution of oxalyl chloride in dichloromethane in the presence of a catalytic amount of dimethylformamide for 1 hour and filtered. The resin was subsequently treated with a dichloromethane solution containing the alcohol (ROH), pyridine and 4-dimethylaminopyridine for 20 hours at 23° C. to yield the monoester resin 19. [0150]
    Figure US20020183518A1-20021205-C00039
  • Resin 18 was treated with a 1.0M solution of oxalyl chloride in dichloromethane in the presence of a catalytic amount of dimethylformamide for 1 hour and filtered. The resin was subsequently treated with a dichloromethane solution containing the aromatic amine (ArN(R,)H), pyridine and 4-dimethylaminopyridine for 20 hours at 23° C. to yield the monoamide resin 20. [0151]
    Figure US20020183518A1-20021205-C00040
  • Resin 18 was treated with a dichloromethane solution containing the amine (R[0152] 1R2NH), EDCI and 4-dimethylaminopyridine for 20 hours at 23° C. to yield the monoamide resin 21.
  • General Methods for the Synthesis of Compounds (A2) and (A10) [0153]
  • Method 1 [0154]
    Figure US20020183518A1-20021205-C00041
  • By allowing an aldehyde (R[0155] 1CHO) wherein R1 is defined as above in formula (A10) to react with itself.
  • These reactions may be carried out in a solvent or combination of solvents such as tetrahydrofuran (THF), dichloromethane (CH[0156] 2Cl2), in the presence of a catalyst (e.g. TiCl3), and a base (e.g. pyridine) at temperatures ranging from −78° C. to 23° C., for 1 to 60 hours.
  • EXAMPLES
  • [0157]
    Figure US20020183518A1-20021205-C00042
  • Prepared according to Araneo et al ([0158] Tetrahedron Lett. 1994, 35, 2213). The reaction was stirred for 4hrs at 23° C. 1H NMR of 22 (400 MHz, CDCl3) δ 1.55 (s, 18H), 4.65 (s, 2H), 6.27 (d, 2H), 7.05 (d, 4H), 7.31 (d, 4H), 7.5 (d, 2H).
    Figure US20020183518A1-20021205-C00043
  • [0159] 1H NMR of 23 (400 MHz, CD3OD) δ 4.65 (s, 2H), 6.4 (d, 2H), 7.15 (d, 4H), 7.4 (d, 4H), 7.6 (d, 2H). MS ESI (neg ion) for [M−H]: 353 (calculated 354).
  • Method 2 [0160]
    Figure US20020183518A1-20021205-C00044
  • By allowing a compound of formula (A10)-1 prepared as above to react with a acid chloride (R[0161] 2CO2H) and by subsequently oxidizing (A10)-2 wherein R1 and R2 are defined as in formula (A2).
  • The first step in this reaction may be carried out in a solvent such as tetrahydrofuran (THF), dichloromethane (CH[0162] 2Cl2), in the presence of diisopropyl carbodiimide (DIC) and a base (e.g. 4-dimethylaminopyridine) at temperatures ranging from 0° C. to 23° C., for 1 to 60 hours. The second step in this reaction may be carried out in a solvent such as dichloromethane (CH2Cl2), in the presence of an oxidizing reagent (e.g. tetrapropylammonium perruthenate (VII) (TPAP)) and activated 4 Å molecular sieves at temperatures ranging from 0° C. to 23° C., for 1 to 60 hours.
  • EXAMPLES
  • [0163]
    Figure US20020183518A1-20021205-C00045
  • To 50 mg of diol 22 (1 equiv) in 1 mL of dichloromethane was added diisopropyl carbodiimide (0.4 equiv) and the reaction was stirred for 1 hour at 23° C. To the solution was added 4-dimethylaminopyridine (0.1 equiv) followed by para-methoxybenzoic acid (0.4 equiv) in 5 mL of tetrahydrofuran and the mixture was stirred for an additional 3 hours at 23° C. The reaction was diluted with ethyl acetate and washed with 1N HCl, saturated sodium bicarbonate and the organic layer was dried over sodium sulfate. The crude mixture was separated using radial chromatography (ethyl acetate-hexane eluent). [0164] 1H NMR of 24 (400 MHz, CDCl3) δ 1.55 (s, 18H), 3.8 (s, 3H), 5.05 (d, 1H), 6.0 (d, 1H), 6.25 (d, 1H), 6.3 (d, 1H), 6.9 (d, 2H), 7.1 (d, 4H), 7.32 (m, 4H), 7.45 (d, 1H), 7.48 (d, 1H), 8.0 (d, 1H).
    Figure US20020183518A1-20021205-C00046
  • [0165] 1H NMR of 25 (400 MHz, CD30D) δ 3.82 (s, 3H), 5.08 (d, 1H), 6.02 (d, 1H),
  • 6.4 (d, 2H), 6.9 (d, 2H), 7.22 (d, 4H), 7.42 (d, 4H), 7.6 (d, 2H), 8.03 (d, 2H). [0166]
  • MS ESI (neg ion) for [M−H][0167] : 487 (calculated 488).
    Figure US20020183518A1-20021205-C00047
  • Hydroxyester 24 (1 equiv) was oxidized to ketoester 26 at 23° C. in CH[0168] 2Cl2, in the presence of catalytic amount of TPAP (0.1 equiv), N-methylmorpholine oxide (2 equiv) and 4 Å activated powdered molecular sieves (500 mg/mol of substrate). 1H NMR of 26 (400 MHz, CDCl3) δ 1.55 (s, 18H), 3.8 (s, 3H), 6.25 (d, 1H), 6.29 (d, 1H), 6.9 (d, 2H), 7.0 (s, 1H), 7.5 (m, 10H), 7.95 (d, 1H), 8.02 (d, 1H).
    Figure US20020183518A1-20021205-C00048
  • [0169] 1H NMR of 27 (400 MHz, CD3OD) δ 3.82 (s, 3H), 6.45 (d, 1H), 6.55 (d, 1H), 6.95 (d, 2H), 7.18 (s, 1H), 7.65 (m, 10H), 8.0 (d, 1H), 8.08 (d, 1H).
  • Method 3 [0170]
    Figure US20020183518A1-20021205-C00049
  • By allowing an acid chloride (R[0171] 1COCl) to react with an aldehyde (R2CHO) wherein R1, R2 are defined as above in formula (A2) and by subsequently oxidizing (A10)-3.
  • The first step in this reaction may be carried out in a solvent or a combination of solvents such as tetrahydrofuran (THF), dichloromethane (CH[0172] 2Cl2), in the presence of a catalyst (e.g. TiCl3), and a base (e.g. pyridine) at temperatures ranging from −78° C. to 23° C., for 1 to 60 hours. The second step in this reaction may be carried out in a solvent such as dichloromethane (CH2Cl2), in the presence of an oxidizing reagent (e.g. tetrapropylammonium perruthenate (VII) (TPAP)) and activated 4 Å molecular sieves at temperatures ranging from 0° C. to 23° C., for 1 to 60 hours.
  • EXAMPLES
  • [0173]
    Figure US20020183518A1-20021205-C00050
  • Prepared according to Araneo et al ([0174] Tetrahedron Lett. 1994, 35, 2213). The reaction was stirred for 4 hrs at 23° C., the crude mixture was separated by flash chromatography (ethyl acetate in hexane eluent) to yield hydroxyester 28. 1H NMR of 28 (400 MHz, CDCl3) δ 1.55 (s, 18H), 1.6 (m, 4H), 2.2-2.4 (m, 4H), 3.6 (s, 3H), 4.9 (d, 1H), 5.85 (d, 1H), 6.25 (d, 1H), 6.3 (d, 1H), 7.07 (m, 4H), 7.3 (m, 4H), 7.45 (m, 2H).
    Figure US20020183518A1-20021205-C00051
  • [0175] 1H NMR of 29 (400 MHz, CD3OD) δ 1.5 (m, 4H), 2.3 (m, 2H), 2.4 (m, 2H), 3.6 (s, 3H), 4.95 (d, 1H), 5.85 (d, 1H), 6.4 (d, 2H), 7.2 (m, 4H), 7.42 (d, 4H), 7.6 (d, 2H). MS ESI (neg ion) for [M−H]: 495 (calculated 496).
    Figure US20020183518A1-20021205-C00052
  • Hydroxyester 28 was oxidized to ketoester 30 as above. [0176] 1H NMR of 30 (400 MHz, CDCl3) δ 1.55 (s, 18H), 1.65 (s br, 4H), 2.3 (m, 2H), 2.5 (m, 2H), 3.6 (s, 3H), 6.3 (d, 1H), 6.35 (d, 1H), 6.78 (s, 1H), 7.4-7.6 (m, 8H), 7.9 (d, 2H).
  • General Method for the Synthesis of Compounds (A3) [0177]
  • Method 1 [0178]
    Figure US20020183518A1-20021205-C00053
  • By allowing a carboxylic acid (R[0179] 1CO2H) to react with an isocyanide (R2NC) and an aldehyde (R3CHO) wherein R1, R2, and R3 are defined as above in formula (A3).
  • These reactions may be carried out in a solvent or a combination of solvents such as dichloromethane (CH[0180] 2Cl2), chloroform (CHCl3), methanol (MeOH), tetrahydrofuran (THF) or acetonitrile (CH3CN), in the presence or absence of a catalyst (e.g. ZnCl2, MgBr2) at temperatures ranging from −78° C. to 80° C., for 1 to 60 hours.
  • EXAMPLES
  • [0181]
    Figure US20020183518A1-20021205-C00054
  • Prepared according to Passerini ([0182] Gazz. Chim. Ital. 1926, 56, 826).
  • A solution of the carboxylic acid, aldehyde and isocyanide in a given solvent selected from tetrahydrofuran, acetonitrile, ethyl ether or chloroform was stirred between 0° and 25° C. for 1 to 3 days. The solution was diluted with ethyl acetate, washed with saturated sodium bicarbonate and dried over sodium sulfate. The solvent was removed in vacuo and the residue was purified by silica gel chromatography. [0183]
    Figure US20020183518A1-20021205-C00055
  • [0184] 1H NMR of 32 (400 MHz, d6-acetone) δ 0.8 (t, 3H), 1.1-1.6 (m, 9H), 1.97 (m, 1H), 3.9 (m, 2H), 4.1 (m, 2H), 5.3 (t, 1H), 6.62 (d, 1H), 7.7 (d, 1H), 7.8 (d, 2H), 8.05 (d, 2H).
  • Method 2 [0185]
    Figure US20020183518A1-20021205-C00056
  • By allowing a carboxylic acid (R[0186] 1CO2H) and an aldehyde (R3CHO) to react with a polymer bound isocyanide (R2NC) wherein R1, R2, and R3 are defined as above in formula (A3).
  • These reactions may be carried out on functionalized cross linked polystyrene polymers such as Merrifield resin, Wang resin, Rink resin, Tentagel™ resin, in a solvent or a combination of solvents such as dichloromethane (CH[0187] 2Cl2), chloroform (CHCl3), methanol (MeOH), tetrahydrofuran (THF), acetonitrile (CH3CN), in the presence or absence of a catalyst (e.g. ZnCl2, MgBr2) at temperatures ranging from −78° C. to 80° C., for 1 to 60 hours. The product maybe released from the polymer by conditions known to those skilled in the art.
  • EXAMPLES
  • [0188]
    Figure US20020183518A1-20021205-C00057
  • Prepared according to Zhang et al ([0189] Tetrahedron Letters 1996, 37, 751).
    Figure US20020183518A1-20021205-C00058
  • A solution of the carboxylic acid 3 in tetrahydrofuran was added to a mixture of the aldehyde and isocyanide resin 33 in tetrahydrofuran or acetonitrile. The mixture was stirred at 25° C. or 60° C. for 1 to 3 days. The resin was filtered and washed with dichloromethane and methanol and dried. Compounds 34 were isolated after treatment of the resin with a solution of 50% trifluoroacetic acid in dichloromethane for 1 hour at 23° C. and removal of the solvent in vacuo. [0190]
    Figure US20020183518A1-20021205-C00059
  • A solution of the carboxylic acid in tetrahydrofuran was added to a mixture of the aldehyde 4 and isocyanide resin 33 in tetrahydrofuran or acetonitrile. The mixture was stirred at 25° C. or 60° C. for 1 to 3 days. The resin was filtered and 4 washed with dichloromethane and methanol and dried. Compounds 35 were isolated after treatment of the resin with a solution of 50% trifluoroacetic acid in dichloromethane for 1 hour at 23° C. and removal of the solvent in vacuo. [0191]
    TABLE 1
    MWt [M − H]
    Compound R2 n (Calculated) (Found)
    36
    Figure US20020183518A1-20021205-C00060
    2 475; 477 474; 476
    37
    Figure US20020183518A1-20021205-C00061
    5 519 518
    38 C6H14CHO 2 405 404
    39 C6H14CHO 5 447 446
    40 C9H20CHO 2 447 446
    41 C9H20CHO 5 4898 488
    Figure US20020183518A1-20021205-C00062
  • [0192]
    TABLE 2
    MWt [M − H]
    Compound R1 n (Calculated) (Found)
    42
    Figure US20020183518A1-20021205-C00063
    2 427 426
    43
    Figure US20020183518A1-20021205-C00064
    5 469 468
    44
    Figure US20020183518A1-20021205-C00065
    2 442 441
    45
    Figure US20020183518A1-20021205-C00066
    2 441 440
    46
    Figure US20020183518A1-20021205-C00067
    5 483 482
    47
    Figure US20020183518A1-20021205-C00068
    2 419 418
    48
    Figure US20020183518A1-20021205-C00069
    5 519 518
    49
    Figure US20020183518A1-20021205-C00070
    2 417 416
    50
    Figure US20020183518A1-20021205-C00071
    5 459 458
  • General Method for the Synthesis of Compounds (A4) [0193]
    Figure US20020183518A1-20021205-C00072
  • By allowing an acid chloride (R[0194] 1COCl) to react with an aldehyde (R2CHO) wherein R1, R2 are defined as above in formula (A4).
  • These reactions may be carried out in a solvent or combination of solvents such as tetrahydrofuran (THF), dichloromethane (CH[0195] 2Cl2), in the presence of a catalyst (e.g. TiCl3), and a base (e.g. pyridine) at temperatures ranging from −78° C. to 23° C., for 1 to 60 hours.
  • EXAMPLE
  • [0196]
    Figure US20020183518A1-20021205-C00073
  • Prepared according to Araneo et al ([0197] Tetrahedron Lett. 1994, 35, 2213). 1H NMR of 51 (400 MHz, CDCl3) δ 1.45 (s, 9H), 1.5 (m, 4H), 2.1-2.3 (m, 4H), 3.6 (s, 3H), 4.6 (s, 1H), 6.25 (d, 1H), 6.97 (d, 2H), 7.25 (d, 2H), 7.5 (d, 1H).
  • General Methods for the Synthesis of Compounds (A6) [0198]
  • Method 1 [0199]
    Figure US20020183518A1-20021205-C00074
  • By allowing a compound of formula (A5) to react with an aldehyde (R[0200] 2CHO), a primary amine (R1NH2) and ammonium acetate wherein R1, R2, R3 and R4 are defined as above in formula (A6).
  • These reactions may be carried out in a solvent such as acetic acid (AcOH) at temperatures ranging from 23° C. to 120° C., for 1 to 60 hours. [0201]
  • EXAMPLES
  • [0202]
    Figure US20020183518A1-20021205-C00075
  • Prepared according to Krieg et al ([0203] Z Naturforsch teil 1967, 22b, 132).
  • To 47 mg of 6 (0.1 mmol, 1.0 equiv), R[0204] 2CHO (0.1 mmol, 1.0 equiv) in 1 mL of acetic acid was added 231 mg of ammonium acetate (3.0 mmol, 30 equiv) in 0.5 mL of acetic acid and the mixture was placed in 100° C. preheated oil bath for 1 hour. The solution was then poured into ether and washed with saturated sodium bicarbonate. The organic layer was dried over sodium sulfate, filtered and concentrated in vacuo to yield the desired imidazoles 52 which were purified by preparative thin layer chromatography with ethyl acetate-hexane or methanol-dichloromethane as eluent.
    Figure US20020183518A1-20021205-C00076
    TABLE 3
    MWt. MWt.
    Entry R2 (Calc.) (Obs.)
    54
    Figure US20020183518A1-20021205-C00077
    480 479
    55 H —* —*
    56
    Figure US20020183518A1-20021205-C00078
    525 526
    57
    Figure US20020183518A1-20021205-C00079
    481 482
    58
    Figure US20020183518A1-20021205-C00080
    —* —*
    59
    Figure US20020183518A1-20021205-C00081
    511 512
    60
    Figure US20020183518A1-20021205-C00082
    —* —*
    61
    Figure US20020183518A1-20021205-C00083
    —* —*
    62
    Figure US20020183518A1-20021205-C00084
    521 522
    63
    Figure US20020183518A1-20021205-C00085
    487 488
    64
    Figure US20020183518A1-20021205-C00086
    533 534
    65
    Figure US20020183518A1-20021205-C00087
    —* —*
    66
    Figure US20020183518A1-20021205-C00088
    —* —*
    67
    Figure US20020183518A1-20021205-C00089
    —* —*
    68
    Figure US20020183518A1-20021205-C00090
    —* —*
    69
    Figure US20020183518A1-20021205-C00091
    482 483
    70
    Figure US20020183518A1-20021205-C00092
    442 441
    71
    Figure US20020183518A1-20021205-C00093
    494 495
    72
    Figure US20020183518A1-20021205-C00094
    526 527
    73
    Figure US20020183518A1-20021205-C00095
    —* —*
    74
    Figure US20020183518A1-20021205-C00096
    489 490
    75 Ph 436 435
    76
    Figure US20020183518A1-20021205-C00097
    —* —*
    77 n-C5H11 —* —*
    78
    Figure US20020183518A1-20021205-C00098
    454 455
    79
    Figure US20020183518A1-20021205-C00099
    —* —*
    80
    Figure US20020183518A1-20021205-C00100
    560 561
    81
    Figure US20020183518A1-20021205-C00101
    536 537
    82
    Figure US20020183518A1-20021205-C00102
    —* —*
    83
    Figure US20020183518A1-20021205-C00103
    —* —*
    84
    Figure US20020183518A1-20021205-C00104
    526 527
    85
    Figure US20020183518A1-20021205-C00105
    480 481
    86
    Figure US20020183518A1-20021205-C00106
    494 495
    87
    Figure US20020183518A1-20021205-C00107
    542 543
    88
    Figure US20020183518A1-20021205-C00108
    561 562
    89
    Figure US20020183518A1-20021205-C00109
    476 477
    90
    Figure US20020183518A1-20021205-C00110
    493 494
  • 54 (400 MHz, CDCl[0205] 3-CD3OD 10:1) δ 6.23 (d, 2H), 7.3-7.48 (m, 10H), 7.88 (d, 2H), 8.02 (d, 2H).
  • 55 (400 MHz, CD[0206] 3OD) δ 6.5 (d, 2H), 7.52 (d, 4H), 7.7 (m, 6H), 9.1 (s,1H).
  • 56 (400 MHz, CD[0207] 3OD) δ 6.3 (s, 2H), 6.52 (d, 2H), 7.4-7.9 (m, 12H).
  • 57 (400 MHz, CD[0208] 3OD) δ 6.52 (d, 2H), 7.50-8.36 (m, 14H).
  • 58 (400 MHz, CDCl[0209] 3-CD3OD 10:1) δ 3.7 (s, 3H), 6.3 (d, 2H), 6.85 (d, 2H), 7.4 (m, 8H), 7.5 (d, 2H), 7.85 (d, 2H).
  • 59 (400 MHz, CD[0210] 3OD) δ 3.98 (s, 3H), 6.52 (d, 2H), 7.50-7.76 (m, 13H).
  • 60 (400 MHz, CDCl[0211] 3-CD3OD 10:1) δ 6.3 (d, 2H), 6.5 (br s, 1H), 6.85 (d, 2H), 7.3-7.6 (m, 12H).
  • 61 di-tert-butyl ester (400 MHz, CDCl[0212] 3-CD3OD 6:1) δ 1.4 (s, 18H), 6.2 (d, 2H), 6.9 (t, 1H), 7.2-7.42 (m, 1H), 7.58 (d, 11H), 7.62 (d, 1H).
  • 62 (400 MHz, CD[0213] 3OD) δ 6.50 (d, 2H), 7.30-8.70 (m, 12H).
  • 63 (400 MHz, CD[0214] 3OD) δ 6.54 (d, 2H), 7.46-8.60 (m, 16H).
  • 64 (400 MHz, CD[0215] 3OD) δ 3.90 (s, 3H), 6.50 (d, 2H), 7.50-8.30 (m, 13H).
  • 65 di-tert-butyl ester (400 MHz, CDCl[0216] 3-CD3OD 6:1) δ 1.4 (s, 18H), 6.2 (d, 2H), 6.65 (t, 1H), 7.3-7.5 (m, 12H).
  • 66 di-tert-butyl ester (400 MHz, CDCl[0217] 3-CD3OD 6:1) δ 1.4 (s, 18H), 6.2 (dd, 2H), 7.1 (q, 1H), 7.3-7.5 (m, 1OH), 7.6 (br d, 1H), 7.7 (dd, 1H).
  • 67 di-tert-butyl ester (400 MHz, CDCl[0218] 3-CD3OD 6:1) δ 1.4 (s, 18H), 6.2 (d, 2H), 7.1 (t, 2H), 7.3-7.5 (m, 10H), 7.75 (m, 1H).
  • 68 (400 MHz, CD[0219] 3OD) δ 1.2 (t, 6H), 3.48 (q, 4H), 6.52 (d, 2H), 7.3-8.02 (m, 15H).
  • 69 (400 MHz, CD[0220] 3OD) δ 3.96 (s, 3H), 6.52 (d, 2H), 7.04-7.70 (m, 13H).
  • 70 (400 MHz, CD[0221] 3OD) δ 6.46 (d, 2H), 7.14 (d, 1H), 7.50-7.80 (m, 12H).
  • 71 (400 MHz, CD[0222] 3OD) δ 4.32 (m, 4H), 6.52 (d, 2H), 7.1-7.7 (m, 13H).
  • 72 (400 MHz, CD[0223] 3OD) δ 3.90-4.02 (3s, 9H), 6.50 (d, 2H), 6.90-7.80 (m, 12H).
  • 73 (400 MHz, CD[0224] 3OD) δ 6.5 (d, 2H), 7.55 (d, 4H), 7.65 (m, 6H), 7.95 (d, 2H), 8.15 (d, 2H).
  • 74 (400 MHz, CD[0225] 3OD) δ 3.95 (s, 3H), 6.56 (d, 2H), 6.9-7.82 (m, 14H).
  • 75 (400 MHz, CDCl[0226] 3-CD3OD 10:1) δ 6.34 (d, 2H), 7.3-7.4 (m, 11H), 7.52 (d, 2H), 8.92 (d,2H).
  • 76 di-tert-butyl ester (400 MHz, CDCl[0227] 3-CD3OD 6:1) δ 1.4 (s, 18H), 6.2 (br d, 2H), 6.9 (m, 1H), 7.05 (m, 1H), 7.3-7.5 (m, 10H).
  • 77 (400 MHz, CDCl[0228] 3-CD3OD 6:1) δ 0.9 (m, 5H), 1.3 (m, 2H), 1.7 (m, 2H), 2.9 (t, 2H), 6.35 (d, 2H), 7.3-7.6 (m, 10H).
  • 78 (400 MHz, CD[0229] 3OD) δ 6.50 (d, 2H), 7.40-7.9 (m, 14H).
  • 79 di-tert-butyl ester (400 MHz, CDCl[0230] 3) δ 1.4 (s, 18H), 6.3 (d, 2H), 7.1 (d, 2H), 7.22 (d, 1H), 7.34 (t, 2H), 7.4-7.7 (m, 14H), 7.9 (d, 2H).
  • 80 (400 MHz, CD[0231] 3OD) δ 6.54 (d, 2H), 7.6-8.0 (m, 19H).
  • 81 (400 MHz, CD[0232] 3OD) δ 6.54 (d, 2H), 7.6-8.90 (m, 19H).
  • 82 (400 MHz, CD[0233] 3OD) δ 6.50 (d, 2H), 7.58-8.0 (m, 14H).
  • 83 (400 MHz, CD[0234] 3OD) δ 3.96 (s, 3H), 6.52 (d, 2H), 7.36-7.90 (m, 13H).
  • 84 (400 MHz, CD[0235] 3OD) δ 6.50 (d, 2H), 7.55-7.70 (m, 10H).
  • 85 (400 MHz, CD[0236] 3OD) δ 6.12 (s, 2H), 6.56 (d, 2H), 7.10-7.60 (m, 13H).
  • 86 (400 MHz, CD[0237] 3OD) δ 2.20 (s, 3H), 2.40 (s, 3H), 3.90 (s, 3H), 6.52 (d, 2H), 7.10-7.70 (m, 12H).
  • 87 (400 MHz, CD[0238] 3OD) δ 5.20 (s, 2H), 6.56 (d, 2H), 7.22-7.98 (m, 19H).
  • 88 (400 MHz, CD[0239] 3OD) δ 1.52 (2s, 12H), 1.74 (s, 4H), 2.42 (s, 3H), 6.52 (d, 2H), 7.40-7.68 (m, 13H).
  • 89 (400 MHz, CD[0240] 3OD) δ 1.12 (t, 2H), 3.0 (m, 4H), 6.56 (d, 2H), 7.52-7.62 (m, 13H).
  • 90 (400 MHz, CD[0241] 3OD) δ 2.14 (s, 3H), 6.54 (d, 2H), 7.58-8.0 (m, 14H).
    Figure US20020183518A1-20021205-C00111
  • Prepared according to Krieg et al ([0242] Z Naturforsch teil 1967, 22b, 132).
  • [0243] 1H NMR of 91 (400 MHz, CD3OD) δ 3.9 (s,3H), 6.2 (d, 2H), 6.95 (d, 2H), 7.2 (d, 2H), 7.4-7.6 (m, 6H), 7.9 (d, 2H).
    Figure US20020183518A1-20021205-C00112
  • Prepared according to Krieg et al ([0244] Z Naturforsch teil 1967, 22b, 132).
    Figure US20020183518A1-20021205-C00113
    TABLE 4
    MWt MWt
    Entry R1 R2 (Calc.) (Obs.)
     94 n-C4H9 H 416 415
     95 n-C4H9
    Figure US20020183518A1-20021205-C00114
    498 497
     96 Ph
    Figure US20020183518A1-20021205-C00115
    518 517
     97 n-C4H9
    Figure US20020183518A1-20021205-C00116
    522 521
     98 Ph
    Figure US20020183518A1-20021205-C00117
    542 541
     99 Ph H 436 435
    100
    Figure US20020183518A1-20021205-C00118
    Figure US20020183518A1-20021205-C00119
    582 581
  • 94(400 MHz, CD[0245] 3OD) δ 0.8 (t, 3H), 1.22 (m, 2H), 1.62 (m, 2H), 4.10 (t, 2H), 6.42 (d, 1H), 6.58 (d, 1H), 7.32-7.80 (m, 10H), 9.18 (s, 1H).
  • 95(400 MHz, CD[0246] 3OD) δ 0.64 (t, 3H), 1.04 (m, 2H), 1.58 (m, 2H), 4.20 (t, 2H), 6.42 (d, 1H), 6.62 (d, 1H), 7.42-8.0 (m, 13H).
  • 94(400 MHz, CD[0247] 3OD) δ 6.42 (2d, 2H), 7.12-7.68 (m, 18H).
  • 97 (400 MHz, CD[0248] 3OD) δ 0.6 (t, 3H), 1.0 (m, 2H), 1.38 (m, 2H), 4.12 (t, 2H), 3.84 (s, 3H), 6.42 (d, 1H), 6.62 (d, 1H), 7.22-7.8 (m, 13H).
  • 98 (400 MHz, CD[0249] 3OD) δ 3.80 (s, 3H), 6.44 (2d, 2H), 6.94-7.68 (m, 19H).
  • 99 (400 MHz, CD[0250] 3OD) δ 6.44 (2d, 2H), 7.20-7.60 (m, 15H), 9.2 (s, 1H).
  • 100 (400 MHz, CD[0251] 3OD) δ 1.22 (s, 9H), 2.40 (s, 3H), 6.36-6.44 (2d, 2H), 7.26-7.60 (m, 18H).
  • Method 2 [0252]
    Figure US20020183518A1-20021205-C00120
  • By allowing a polymer bound compound of formula (A5)-2 to react with an aldehyde (R[0253] 2CHO), a primary amine (R1NH2) and ammonium acetate wherein R1, R2, R3 and R4 are defined as above in formula (A6).
  • These reactions may be carried out on functionalized cross linked polystyrene polymers such as Merrifield resin, Wang resin, Rink resin, Tentagel™ resin, in a solvent such as acetic acid (AcOH) at temperatures ranging from 23° C. to 120° C., for 1 to 60 hours. The product maybe released from the polymer using conditions known to those skilled in the art. [0254]
  • EXAMPLES
  • [0255]
    Figure US20020183518A1-20021205-C00121
  • To resin 17 were added excess NH[0256] 4OAc and R2CHO and acetic acid and the mixture was heated at 100° C. for 15 hours, cooled to 23° C. and washed with methanol and dichloromethane and dried under vacuum. The trifluoroacetate salts of imidazoles 101 were isolated following treatment of the resin with a solution of 20% trifluoroacetic acid in dichloromethane for 20 minutes at 23° C.
    Figure US20020183518A1-20021205-C00122
  • Same procedure as imidazoles 101. [0257]
    TABLE 5
    MWt. MWt.
    Entry R1 R2 (Calc.) (Obs.)
    103 Me
    Figure US20020183518A1-20021205-C00123
    495 496
    104
    Figure US20020183518A1-20021205-C00124
    Figure US20020183518A1-20021205-C00125
    620 621
    105
    Figure US20020183518A1-20021205-C00126
    Figure US20020183518A1-20021205-C00127
    602 603
    106
    Figure US20020183518A1-20021205-C00128
    Figure US20020183518A1-20021205-C00129
    586 587
    107
    Figure US20020183518A1-20021205-C00130
    Figure US20020183518A1-20021205-C00131
    638 639
    108
    Figure US20020183518A1-20021205-C00132
    Figure US20020183518A1-20021205-C00133
    634 635
    109 2-propyl
    Figure US20020183518A1-20021205-C00134
    496 497
    110 2-propyl
    Figure US20020183518A1-20021205-C00135
    523 524
    111 2-propyl
    Figure US20020183518A1-20021205-C00136
    553 554
    112 2-indanyl
    Figure US20020183518A1-20021205-C00137
    627 628
    113
    Figure US20020183518A1-20021205-C00138
    Figure US20020183518A1-20021205-C00139
    626 627
  • [0258]
    Figure US20020183518A1-20021205-C00140
  • Same procedure as imidazoles 101. [0259]
    Figure US20020183518A1-20021205-C00141
  • Same procedure as imidazoles 101. [0260]
    Figure US20020183518A1-20021205-C00142
    TABLE 6
    MWt. MWt.
    Entry R1 R2 (Calc.) (Obs.)
    116
    Figure US20020183518A1-20021205-C00143
    Figure US20020183518A1-20021205-C00144
    559 560
    117
    Figure US20020183518A1-20021205-C00145
    Figure US20020183518A1-20021205-C00146
    562 563
    118
    Figure US20020183518A1-20021205-C00147
    Figure US20020183518A1-20021205-C00148
    633 634
    119
    Figure US20020183518A1-20021205-C00149
    Figure US20020183518A1-20021205-C00150
    642 643
    120
    Figure US20020183518A1-20021205-C00151
    Figure US20020183518A1-20021205-C00152
    592 593
    121
    Figure US20020183518A1-20021205-C00153
    Figure US20020183518A1-20021205-C00154
    579 580
    122 n-propyl
    Figure US20020183518A1-20021205-C00155
    508 509
    123 n-propyl
    Figure US20020183518A1-20021205-C00156
    562, 564 563, 565
    124 n-butyl
    Figure US20020183518A1-20021205-C00157
    528 529
    125 n-heptyl
    Figure US20020183518A1-20021205-C00158
    579 580
    126 n-octyl
    Figure US20020183518A1-20021205-C00159
    566 567
    127 n-octyl
    Figure US20020183518A1-20021205-C00160
    619 620
    128
    Figure US20020183518A1-20021205-C00161
    Figure US20020183518A1-20021205-C00162
    612 613
  • Method 3 [0261]
    Figure US20020183518A1-20021205-C00163
  • By allowing a compound of formula (129) ([0262] J. Org. Chem., 1995, 60, 8231; J. Org. Chem., 1993, 58,4785) to react with an aldehyde (R2CHO), a primary amine (R1NH2) and ammonium acetate wherein R1, R2, R3 and R4 are defined as above in formula (A6).
  • These reactions may be carried out in a solvent such as acetic acid (AcOH) at temperatures ranging from 23° C. to 120° C., for 1 to 60 hours. [0263]
  • EXAMPLES
  • [0264]
    Figure US20020183518A1-20021205-C00164
  • Prepared according to Wasserman et al ([0265] J. Org. Chem., 1995, 60, 8231; J. Org. Chem., 1993, 58, 4785). Benzyl (triphenylphosphoranylidene) acetate (130) was purchased from Aldrich chemical company and used directly. 1H NMR of 131 (400 MHz, CDCl3) δ 1.5 (s, 9H), 4.62 (s, 2H), 6.3 (d, 1H), 6.62 (d, 2H), 7.05 (t, 2H), 7.1 (t, 1H), 7.38-7.8 (m, 20H). TLC: Rf=0.5 (30% ethyl acetate-hexane).
    Figure US20020183518A1-20021205-C00165
  • Prepared according to Wasserman et al ([0266] J. Org. Chem., 1995, 60, 8231; J. Org. Chem., 1993,58,4785). 1H NMR of 132 (400 MHz, CDCl3) δ 1.5 (s, 9H), 5.1 (s, 2H), 5.15 (br s, 2H, 2× H—O), 6.4 (d, 1H), 6.95 (d, 2H), 7.1 (t, 2H), 7.18 (t, 1H), 7.4 (d, 2H), 7.5 (d, 1H), 7.9 (d, 2H). TLC: Rf=0.7 (30% ethyl acetate-hexane).
    Figure US20020183518A1-20021205-C00166
  • [0267] 1H NMR of 133 (400 MHz, CDCl3-CD3OD, 8:1) δ 5 (s, 2H), 6.4 (d 1H), 6.9-7.16 (m, 5H), 7.35 (d, 2H), 7.53 (d, 1H), 7.9 (d, 2H).
    Figure US20020183518A1-20021205-C00167
  • Prepared according to Brackeen et al ([0268] Tetrahedron Letters 1994, 35, 1635). For other approaches to imidazole-4-carboxylates see: a) Nunami et al (J. Org. Chem. 1994, 59, 7635). b) Heindel et al (Tetrahedron Letters 1971, 1439). 1H NMR of 134 (400 MHz, 8:1 CDCl3-CD3OD) δ 5.2 (s, 2H), 6.4 (d, 1H), 7.25 (br s, 5H), 7.5 (d, 2H), 7.6 (d, 1H), 7.7 (d, 2H), 8.3 (s, 1H).
  • Method 4 [0269]
    Figure US20020183518A1-20021205-C00168
  • By allowing a compound of formula (129) to react with a polymer bound aldehyde (R[0270] 1CHO), a primary amine (R2NH2) and ammonium acetate wherein R1, R2, R3 and R4 are defined as above in formula (A6).
  • This reaction may be carried out on functionalized cross linked polystyrene polymers such as Merrifield resin, Wang resin, Rink resin, Tentagel™ resin, in a solvent such as acetic acid (AcOH) at temperatures ranging from 23° C. to 120° C., for 1 to 60 hours. The product maybe released from the polymer using conditions known to those skilled in the art. [0271]
  • EXAMPLES
  • [0272]
    Figure US20020183518A1-20021205-C00169
  • For leading references see: a) Mathias ([0273] Synthesis, 1979, 561). b) Sarantakis et al (Biochem. Biophys. Res. Commun. 1976, 73, 336). c) Hudson et al (Peptide Chemistry 1985 (Kiso, Y., ed.), 1986, Protein Research Foundation, Osaka.). d) Wang (J. Am. Chem. Soc. 1973, 95, 1328). e) Lu et al (J. Org. Chem. 1981, 46, 3433). To 6 mmol (1 equiv) of Wang resin in 130 mL of dry dimethylformamide was added 18 mmol (3 equiv) of diisopropylcarbodiimide and the mixture was sonnicated for 4 hours (final bath temperature was 37° C.). 4-Formylcinnamic acid (18 mmol, 3 equiv) and 4-dimethylaminopyridine (6 mmol, 1 equiv) were added and the mixture was magnetically stirred for 48 hours at ambient temperature. The resin was filtered and thoroughly washed with dimethylforamide (500 mL), methanol (500 mL), dichloromethane (500 mL) and methanol (500 mL) and dried in vacuo (0.1 mmHg) for 24 hours. A coupling yield of 80% was established by cleaving 100 mg of the resin with a solution of 20% trifluoroacetic acid in dichloromethane for 20 min at ambient temperature.
    Figure US20020183518A1-20021205-C00170
  • To 60 mg (0.048 mmol, 1.0 equiv) of 135 was added 40 mg (0.097 mmol, 2.0 equiv) of 132 followed by 37 mg (0.481 mmol, 5.0 equiv) of ammonium acetate and 0.2 mL of acetic acid. The mixture was heated to 100° C. for 15 hours, filtered, washed with dimethylformamide, dichloromethane, methanol and dichloromethane. The crude product was isolated by treatment of the polymer with a solution of 50% trifluoroacetic acid in dichloromethane for 1 hour at 23° C. The solvent was removed and the residue was purified by preparative thin layer chromatography (20% methanol-dichloromethane eluent). [0274] 1H NMR of 136 (400 MHz, CD3OD) δ 5.15 (s, 2H), 6.48 (d, 1H), 6.55 (d, 1H), 7.25 (br s, 4H), 7.5-7.8 (m, 9H), 8.1 (d, 1H). MS (ESI negative ion) [M−H]: 493;
  • Method 5 [0275]
    Figure US20020183518A1-20021205-C00171
  • By allowing a primary amine (R[0276] 1NH2), a carboxylic acid (R2CO2H) and a ketoaldehyde (R4COCHO) to react with a polymer bound isocyanide (R3NC) and by subsequently cyclizing compound 137 with ammonium acetate wherein R1, R2, R3 and R4 are defined as above in formula (A6).
  • The first step in this reaction may be carried out on functionalized cross linked polystyrene resins such as Merrifield resin, Wang resin, Rink resin, Tentagel™ resin, in a solvent or a combination of solvents such as dichloromethane (CH[0277] 2Cl2), chloroform (CHCl3), methanol (MeOH), tetrahydrofuran (THF) or acetonitrile (CH3CN), in the presence or absence of a catalyst (e.g. ZnCl2, MgBr2) at temperatures ranging from −78° C. to 80° C., for 1 to 60 hours. The second step in this reaction may be carried out in a solvent such as acetic acid (AcOH) at temperatures ranging from 23° C. to 120° C., for 1 to 60 hours.
    Figure US20020183518A1-20021205-C00172
  • Prepared according to Gunn et al ([0278] J. Org. Chem. 1977, 42, 754).
    Figure US20020183518A1-20021205-C00173
  • Prepared according to Zhang et al ([0279] Tetrahedron Letters 1996, 37, 751).
    Figure US20020183518A1-20021205-C00174
  • Prepared according to Zhang et al ([0280] Tetrahedron Letters 1996, 37, 751).
  • [0281] 1H NMR of mono tert-butyl ester of 140 (400 MHz, CDCl3) δ 1.1 (m,2H),
  • 1.2 (d,3H), 1.3 (m,2H), 1.5 (s,9H), 1.56 (m,2H), 2.2 (m,2H), 2.9 (m,1H), [0282]
  • 3.1 (m,1H), 3.2 (m,1H), 3.8 (s,3H), 4.6 (m,2H), 6.1 (d,1H), 6.9 (t,4H), [0283]
  • 7.1 (m,5H), 7.4 (d, 2H), 7.6 (d,1H). [0284]
  • Method 6 [0285]
    Figure US20020183518A1-20021205-C00175
  • By allowing a carboxylic acid (R[0286] 1CO2H) to react with an isocyanide (R3NC) and a ketoaldehyde (R2COCHO) and by allowing compound 141 to cyclize in the presence of ammonium acetate, wherein R1, R2, and R3 are defined as above in formula (A6).
  • The first step in this reaction reaction may be carried out in a solvent or a combination of solvents such as dichloromethane (CH[0287] 2Cl2), chloroform (CHCl3), methanol (MeOH), tetrahydrofuran (THF), acetonitrile (CH3CN), in the presence or absence of a catalyst (e.g. ZnCl2, MgBr2) at temperatures ranging from −78° C. to 80° C., for 1 to 60 hours. The second step in this reaction may be carried out in a solvent such as acetic acid (AcOH) at temperatures ranging from 23° C. to 120° C., for 1 to 60 hours.
  • EXAMPLES
  • [0288]
    Figure US20020183518A1-20021205-C00176
  • Prepared according to Bossio et al ([0289] Liebigs Ann. Chem. 1991, 1107).
  • To an ethyl ether mixture of the carboxylic acid and ketoaldehyde at 0° C. was added dropwise an ethyl ether solution of the isocyanide. The mixture was warmed to 25° C. and stirred for 2 hours to 3 days. The solution was diluted with ethyl acetate, washed with saturated sodium bicarbonate and dried over sodium sulfate. The solvent was removed in vacuo and the residue was purified by silica gel chromatography to yield α-Acyloxy-β-ketoamide 142. [0290]
  • A solution of the α-Acyloxy-β-ketoamide 142 (1 equiv) and ammonium acetate (30 equiv) in acetic acid was heated at 100° C. for 2 to 15 hours. The reaction was cooled to 23° C., diluted with ethyl acetate, washed with saturated sodium bicarbonate and dried over sodium sulfate. Solvent was removed in vacuo and the crude mixture was separated by silica gel chromatography to provide imidazole 143. [0291]
    Figure US20020183518A1-20021205-C00177
  • [0292] 1H NMR of 144 (400 MHz, d6-acetone) δ 0.85 (t, 3H), 1.2-1.6 (m, 4H),
  • 3.3 (m, 2H), 6.55 (s, 1H), 6.62 (d, 1H), 7.3 (t, 2H), 7.7 (d, 1H), 7.82 (d, 2H), [0293]
  • 8.1 (d, 2H), 8.25 (dd, 2H). [0294]
    Figure US20020183518A1-20021205-C00178
  • [0295] 1H NMR of 146 (400 MHz, d6-acetone) δ 0.9 (t, 3H), 1.4 (m, 2H), 1.6 (m, 2H), 3.35 (m, 2H), 6.58 (d, 1H), 7.12 (t, 2H), 7.65 (d, 1H), 7.78 (d, 2H), 8.1 (s br, 1H), 8.05 (m, 1H), 8.2 (d, 2H).
  • General Method for the Synthesis of Compounds (A7) [0296]
    Figure US20020183518A1-20021205-C00179
  • By allowing a carboxylic acid (R[0297] 1CO2H) to react with an isocyanide (R3NC) and a ketoaldehyde (R2COCHO) wherein R1, R2, and R3 are defined as above in formula (A7) and by allowing compound 141 to cyclize in the presence of ammonium acetate.
  • The first step in this reaction reaction may be carried out in a solvent or a combination of solvents such as dichloromethane (CH[0298] 2Cl2), chloroform (CHCl3), methanol (MeOH), tetrahydrofaran (THF), acetonitrile (CH3CN), in the presence or absence of a catalyst (e.g. ZnCl2, MgBr2) at temperatures ranging from −78° C. to 80° C., for 1 to 60 hours. The second step in this reaction may be carried out in a solvent such as acetic acid (AcOH) at temperatures ranging from 23° C. to 120° C., for 1 to 60 hours.
  • EXAMPLES
  • [0299]
    Figure US20020183518A1-20021205-C00180
  • Prepared according to Bossio et al ([0300] Liebigs Ann. Chem. 1991, 1107).
  • A solution of the α-Acyloxy-β-ketoamide 141 (1 equiv) and ammonium acetate (2 equiv) in acetic acid was heated at 100° C. for 2 to 15 hours. The reaction was cooled to 23° C., diluted with ethyl acetate, washed with saturated sodium bicarbonate and dried over sodium sulfate. Solvent was removed in vacuo and the crude oxazole 147 was purified by silica gel chromatography. [0301]
    Figure US20020183518A1-20021205-C00181
  • [0302] 1H NMR of 148 (400 MHz, d6-acetone) δ 0.9 (t, 3H), 1.4 (m, 2H), 1.6 (m, 2H), 3.42 (m, 2H), 6.63 (d, 1H), 7.2 (t, 2H), 7.7 (d, 1H), 7.9 (d, 2H), 8.18 (s br, 1H), 8.25 (d, 2H), 8.6 (m, 1H).
  • General Methods for the Synthesis of Compounds (A8) and (A9) [0303]
  • Method 1 [0304]
    Figure US20020183518A1-20021205-C00182
  • By allowing a compound of formula (A5) to react with compound of formula (149) wherein R[0305] 1, R2, R3, R4, R5, and R6 are defined as above in formula (A8).
  • These reactions may be carried out in a solvent or a combination of solvents such as dioxane or acetic acid (AcOH) at temperatures ranging from 23° C. to 120° C., for 1 to 60 hours. [0306]
  • EXAMPLES
  • [0307]
    Figure US20020183518A1-20021205-C00183
  • A solution of 0.1 mmol of diamine 150 and 0.1 mmol of 6 in 1.2 mL of 1,4-dioxane-acetic acid (5:1) was heated at 100° C. Upon completion of the reaction as judged by thin layer chromatography, ethyl acetate was added and the organic layer was washed with water, 0.5M citric acid, 10% sodium bicarbonate and dried over sodium sulfate. The compounds were purified using silica gel chromatography. [0308]
    Figure US20020183518A1-20021205-C00184
    TABLE 7
    Compound R1 R2 R3 R4
    152 H H NO2 H
    153 H Cl Cl H
    154 H H CH3 H
    155 H H CO2H H
    156 H H CO2Me H
    157 H H H H
  • 152 (400 MHz, CD[0309] 3OD) δ 6.5 (d, 2H), 7.3 (s, 1H), 7.4-7.8 (m, 10H), 7.9 (s, 1H), 8.05 (d, 1H). MS ESI (pos ion) for [M+H]+: 468 (calculated 467).
  • 153 (400 MHz, CD[0310] 3OD) δ 6.48 (d, 2H), 7.5 (dd, 8H), 7.6 (d, 2H), 8.24 (s, 2H). MS ESI (pos ion) for [M+H]+: 491, 492 (calculated 490, 491).
  • 154 (400 MHz, CD[0311] 3OD) δ 3.3 (s, 3H), 6.5 (d, 2H), 7.59 (s, 8H), 7.62 (d, 2H), 8.3 (d, 1H), 8.55 (d, 1H), 8.95 (s, 1H). MS ESI (pos ion) for [M+H]+: 437 (calculated 436).
  • 155(400 MHz, d[0312] 6-DMSO) δ 6.56 (d, 2H), 7.5 (m, 6H), 7.65 (d, 4H), 8.2 (d, 1H), 8.3 (d, 1H), 8.6 (s, 1H). MS ESI (neg ion) for [M−H]: 465 (calculated 466).
  • 156(400 MHz, CD[0313] 3OD) δ 6.56 (d, 2H), 7.5 (s br, 8H), 7.65 (d, 2H), 8.2 (d, 1H), 8.3 (d, 1H), 8.7 (s, 1H). MS ESI (neg ion) for [M−H]: 479 (calculated 480).
  • 157(400 MHz, d[0314] 6-DMSO) δ 6.52 (d, 2H), 7.54-8.16 (m, 14H).
  • Method 2 [0315]
    Figure US20020183518A1-20021205-C00185
  • By allowing a compound of formula (A5) to react with compound of formula (158) wherein R[0316] 1, R2, R3, R4, R5 are defined as above in formula (A9).
  • These reactions may be carried out in a solvent or a combination of solvents such as dioxane or acetic acid (AcOH) at temperatures ranging from 23° C. to 120° C., for 1 to 60 hours. [0317]
  • EXAMPLES
  • [0318]
    Figure US20020183518A1-20021205-C00186
  • [0319] 1H NMR of 160 (400 MHz, CD3OD) δ 6.5 (d, 2H), 7.5-7.7 (m, 12H),
  • 7.95 (m, 1H), 8.65 (d, 1H), 9.15 (s, 1H). [0320]
  • MS ESI (pos ion) for [M+H][0321] +: 424 (calculated 423).
  • General Method for the Synthesis of Compounds (A10) [0322]
    Figure US20020183518A1-20021205-C00187
  • By allowing a compound of formula (A10)-1 prepared as above to react with a carboxylic acid (R[0323] 2CO2H) wherein R1 and R2 are defined as above in formula (A10).
  • These reactions may be carried out in a solvent such as tetrahydrofuran (THF), dichloromethane (CH[0324] 2Cl2), in the presence of diisopropyl carbodiimide (DIC) and a base (e.g. 4,4-dimethylaminopyridine) at temperatures ranging from 0° C. to 23° C., for 1 to 60 hours.
  • EXAMPLES
  • [0325]
    Figure US20020183518A1-20021205-C00188
  • To 50 mg of diol 22 in 1 mL of dichloromethane was added diisopropyl carbodiimide (2.2 equiv) and the reaction was stirred for 1 hour at 23° C. To the solution was added 4,4-dimethylaminopyridine (0.2 equiv) followed by para-methoxybenzoic acid (2.2 equiv) in 5 mL of tetrahydrofuran and the mixture was stirred for an additional 3 hours at 23° C. The reaction was diluted with ethyl acetate and washed with 1N HCl, saturated sodium bicarbonate and the organic layer was dried over sodium sulfate. The crude mixture was purified using radial chromatography (ethyl acetate-hexane eluent). [0326] 1H NMR of 161 (400 MHz, CDCl3) δ 1.5 (s, 18H), 3.8 (s, 6H), 6.25 (d, 2H), 6.32 (s, 2H), 6.85 (d, 4H), 7.18 (d, 4H), 7.31 (d, 4H), 7.45 (d, 2H), 7.95 (d, 4H).
    Figure US20020183518A1-20021205-C00189
  • [0327] 1H NMR of 162 (400 MHz, CD3OD) δ 3.8 (s, 6H), 6.4 (m, 4H), 6.95 (d, 4H), 7.38 (d, 4H), 7.5 (d, 4H), 7.6 (d, 2H), 7.95 (d, 4H). MS ESI (neg ion) for [M−H]: 621 (calculated 622).
  • General Method for the Synthesis of Compounds (A11) [0328]
    Figure US20020183518A1-20021205-C00190
  • By allowing a compound of formula (A10)-1 prepared as above to react with a sulfonyl chloride (R[0329] 2SO2Cl), and subsequently by oxidizing intermediate 163 and by allowing intermediate 164 to react with a thioamide (R3C(S)NH2) wherein R1, R2 and R3 are defined as above in formula (A11).
  • The first step in this sequence of reactions may be carried out in a solvent such as tetrahydrofuran (THF), dichloromethane (CH[0330] 2Cl2), in the presence of a base (e.g. 4,4-dimethylaminopyridine, triethylamine, triisopropylamine) and a sulfonyl chloride (e.g. tosyl chloride, mesyl chloride), at temperatures ranging from −20° C. to 23° C., for 1 to 60 hours. The second step in this sequence of reactions may be carried out in a solvent such as dichloromethane (CH2Cl2), in the presence of an oxidizing reagent (e.g. tetrapropylammonium perruthenate (VII) (TPAP)) and activated 4 Å molecular sieves at temperatures ranging from 0° C. to 23° C., for 1 to 60 hours. The third step in this sequence of reactions may be carried out in a solvent such as acetic acid, toluene, dioxane at temperatures ranging from 0° C. to 120° C., for 1 to 60 hours.
  • EXAMPLES
  • [0331]
    Figure US20020183518A1-20021205-C00191
  • To 50 mg of diol 22 in 1 mL of dichloromethane was added Tosyl chloride (42.5 mg), 4,4-dimethylaminopyridine (6 mg), triethylamine (95 μl), and the reaction was stirred for 12 hours at 23° C. The volatiles were removed in vacuo and the crude mixture (containing 165, the bis-tosylated compound and the corresponding epoxide) was separated by flash chromatography (ethyl acetate-hexane eluent) to give a mixture of 165 and the corresponding bis-tosylated compound (27 mg total). [0332]
    Figure US20020183518A1-20021205-C00192
  • The mixture consisting of 165 and the corresponding bis-tosylated compound was oxidized as described above for compound 24. The crude mixture was purified by flash chromatography (ethyl acetate-hexane eluent) to give3.9 mg of 166 and 16 mg of the corresponding bis-tosylate. [0333] 1H NMR of 166 (400 MHz, d6-acetone) δ 1.5 (d, 18H), 2.4 (s, 3H), 6.4 (d, 1H), 6.5 (d, 1H), 6.95 (s, 1H), 7.35 (d, 2H), 7.42 (d, 2H), 7.5 (d, 1H), 7.6 (m, 3H), 7.7 (dd, 4H), 8 (d, 2H).
    Figure US20020183518A1-20021205-C00193
  • To 3.9 mg of 166 was added 3 mg of para-methoxythiobenzamide and 0.5 ml of toluene and the reaction was heated at 65° C. for 12 hours. The solvent was removed in vacuo and the crude mixture was purified by flash chromatography (ethyl 9 acetate-hexane eluent) to give1.8 mg of 167. [0334] 1H NMR of 167 (400 MHz, CDCl3) δ 1.5 (d, 18H), 3.8 (s, 3H), 6.3 (dd, 2H), 6.9 (d, 2H), 7.35 (d, 2H), 7.4 (m, 4H), 7.55 (m, 4H), 7.9 (d, 2H).
    Figure US20020183518A1-20021205-C00194
  • [0335] 1H NMR of 168 (400 MHz, CD3OD) δ 3.8 (s, 3H), 6.45 (dd, 2H), 7.0 (d, 2H), 7.4 (d, 2H), 7.5-7.7 (m, 8H), 7.9 (d, 2H).
  • Biological Protocols [0336]
  • PTP-1B Gene Cloning and Protein Purification [0337]
  • The following procedure was conducted for recombinant production and purification of protein tyrosine phosphatase PTP-1B, for use as a substrate in PTPase inhibition assays. [0338]
  • A. Production of a PTP-1B cDNA [0339]
  • A human placental cDNA library was synthesized in a 50 ul reaction containing 1 ug human placental poly(A)[0340] + mRNA (Clontech, Palo Alto, Calif.), 4 ul random hexamer primers, 8 ul of 10 mM dNTPs (Pharmacia, Piscataway N.J.), 1 ul (200 U/ul) Moloney murine leukemia virus reverse transcriptase (Gibco-BRL, Canada), 0.5 ul (26 U/ul) RNAsin (Promega, Madison Wis.), and 12 ul 5× buffer (Gibco-BRL). The synthesis reaction was incubated at 37° C. for one hour and then heat inactivated at 95° C. for five minutes.
  • A PTP-1B cDNA was amplified, using polymerase chain reaction (PCR), from the cDNAs synthesized as described above. More particularly, based on the published sequence of PTB-1B, two PCR primers were synthesized to amplify a portion of the PTP-1B coding sequence known to encode a 321 amino acid fragment containing the PTP-1B catalytic domain and having PTPase activity. See Hoppe et al., [0341] Eur. J. Biochem., 223:1069-77 (1994); Barford, D., et al., J. Molec. Biol., 239.726-730 (1994); Chemoff et al., Proc. Natl. Acad. Sci. USA, 87:2735-2739 (1990); Charbonneau et al. Proc. Natl. Acad. Sci. USA, 86:5252-5256 (1989). The primers had the following respective sequences:
    PTP-1B-A(5′) (SEQ ID NO: 1)
    5′ CGCACTGGATCCTCATGGAGATGGAAAAGG 3′
    PTP-1B-B(3′) (SEQ ID NO: 2)
    5′ CTCCCTGAATTCCTAATTGTGTGGCTCCAGG 3′
  • The first primer, which hybridizes to the non-coding strand, corresponds to the 5′ portion of the PTP-1B coding sequence and encodes a BamH I restriction site upstream of the initiation codon, to facilitate cloning. The second primer, which hybridizes to the coding strand, corresponds to the 3′ portion of the PTB-1B fragment of interest, and encodes a stop codon and an EcoR I restriction site downstream from the stop codon. [0342]
  • A 100 μl PCR reaction mixture containing approx. 1 ug of the human placental cDNA library, 0.2 mM of each dNTP, 30 uM of each primer, 1× Amplitaq DNA polymerase buffer (Perkin-Elmer, Norwalk Conn.), and 5 units Amplitaq DNA polymerase (Perkin-Elmer) was denatured at 94° C. for 5 minutes and then subjected to 25 cycles of amplification as follows: 1) 94° C. denaturation for 1 minute; 2) 55° C. annealing for 1 minute; and 3) 72° C. primer extension for 1 minute. [0343]
  • The PCR reaction product (992 bp) was digested with BamH I and EcoR I (New England Biolabs, Beverly Mass.) to yield a 975 bp product encoding the 321 amino acid PTP-1B protein fragment, and having “sticky ends” to facilitate cloning. [0344]
  • B. Production of a PTP-1B Expression Vector. [0345]
  • The 975 bp PTP-1B partial cDNA was purified by agarose gel electrophoresis and ligated into a BamH I/EcoR I-digested pGEX-3X plasmid vector (Pharmacia, Piscataway, N.J.). The pGEX vector is designed to produce a fusion of glutathione-S-transferase (GST) to a protein encoded by another DNA fragment inserted into the vector's cloning site. Complete sequencing of the insert of the resultant plasmid, designated pGEX-3X-PTP-1B, confirmed the identity of the PTP-1B cDNA, and insertion in the proper orientation and reading frame. [0346]
  • C. Expression and Purification of GST/PTP1B Fusion Protein. [0347]
  • [0348] E. Coli strain DH5α (Gibco-BRL) was transformed with plasmid pGEX-3X-PTP-1B following the supplier's transformation protocol and grown at 37° C. with vigorous shaking in Luria-Bertani broth supplemented with 100 ug/ml ampicillin. When the cultures reached an O.D.600 of 0.7-1, production of the GST/PTP-1B fusion protein was induced with 0.1 mM IPTG (Isopropyl b-D-Thiogalactoside). After 3 additional hours of culturing at 37° C., the bacteria were pelleted by centrifugation.
  • The bacterial pellet was resuspended in 10× (w/v) lysis buffer consisting of 12.5 mM HEPES, 2 mM EDTA, pH 7.0, 15 mM b-mercaptoethanol (bME) and 1 mM PMSF. The lysate was sonicated (on ice) until slight clearing was observed (approx. three min.) and then centrifuged at 10,000 revolutions per minute (RPM) for 10 min. The supernatant was diluted 1:4 with buffer A (25 mM HEPES, pH 7.0, and 15 mM bME). [0349]
  • Primary purification was achieved using a 5 ml Hi-Trap pre-packed Q column (Pharmacia). After loading the diluted supernatant onto the column, the column was washed with 10 bed volumes of buffer A. The GST/PTP-1B fusion protein was then eluted using a linear gradient of Buffer A and Buffer B (buffer A+1 M NaCl). Eluted fractions containing protein were identified by SDS-PAGE and Coomassie Blue staining (Pharmacia PhastSystem), and fractions containing PTP-1B activity were identified using the PTP-1B activity assay described below. Elution of the fusion protein occurred at about 30% Buffer B. [0350]
  • Fractions containing PTPase activity were pooled, diluted 1:4 with NET buffer (20 mM Tris, pH 8.8, 100 mM NaCl, 1 mM EDTA and 15 mM bME), and loaded onto a 10 ml GST-Sepharose 4B column (Pharmacia). After loading, the column was washed first with 3 bed volumes of NET buffer+1% NP40 (Sigma Chemical Co., St. Louis, Mo.), then with NET buffer until O.D. at 280 nm was basal. The GST/PTP-1B fusion protein was eluted from the column using 10 mM glutathione in 33 mM Tris, pH 8.0. Elution of proteins was monitored at O.D.[0351] 280 and fractions were assayed for activity and run on SDS-PAGE as described above. PTP-1B fusion protein eluted after approx. 4-5 minutes (flow rate 1 ml/min.).
  • The GST/PTP-1B-containing fractions from the GST-Sepharose 4B purification were pooled, concentrated into a final storage buffer (0.2 M NaCl, 25 mM HEPES, 1 mM EDTA, and 5 mM DTT, pH 7.0) using a 1 ml Hi-Trap Q column (pre-packed, Pharmacia), and stored at −80° C. (final concentration of 0.52 mg/ml). The foregoing procedure yielded approximately 5 mg of PTP-1B fusion protein per 500 ml of cultured cells, purified to substantial homogeneity as assessed by SDS-PAGE. [0352]
  • Assay of PTP-1B Activity. [0353]
  • PTP-1B enzymatic activity of samples was assayed in microtiter plates as follows. [0354]
  • The protein concentration of the PTP-1B enzyme preparation was determined using the Bio-Rad Protein Assay kit (Bio-Rad, Hercules Calif.). An aliquot from each sample was taken and diluted to 2 mg protein/ml using activity assay buffer (100 mM Sodium Acetate, pH 6.0, 1 mM EDTA, 0.1% TX-100 (International Biotechnologies, Inc.) and 15 mM bME) to form a PTP-1B stock solution. [0355]
  • A 100 ul reaction mixture was prepared containing 10 ul of the PTP-1B stock solution, 10 ul of 9 mM p-nitrophenylphosphate ((pNPP), Sigma Chemical Co., St. Louis Mo.), and 80 ul of activity assay buffer (100 mM sodium acetate, pH 6.0, 1 mM EDTA, 0.1% Triton X-100, 15 mM bME). Reactions were mixed gently and incubated at 37° C. for 60 minutes. Enzymatic cleavage of phosphate from pNPP (a tyrosine phosphate analog) is marked by a colorimetric change in this substrate. See, e.g., Imbert et al., [0356] Biochem J., 297:163-173 (1994); Ghosh and Miller, Biochem. Biophys. Res. Comm., 194:36-44 (1993); Zanke et al., Eur. J. Immunol., 22:235-39 (1992).
  • Reactions were stopped by addition of 10 ul of a 0.5 M NaOH/50% EtOH solution. To determine the enzymatic activity, absorbance readings of the reactions were measured at 405 nm using a Molecular Devices Thermomax Plate Reader (Menlo Park Calif.). [0357]
  • CD45 Gene Cloning and Protein Purification [0358]
  • The following procedure was conducted for recombinant production and purification of protein tyrosine phosphatase CD45, for use as a substrate in PTPase inhibition assays. [0359]
  • A. Production of aCD45 cDNA, and Production of a CD45 Expression Vector. [0360]
  • A human cDNA library was synthesized from RNA isolated from the human Jurkat cell line, as described above for PTP-1 B [0361]
  • CD45 cDNA was amplified, using polymerase chain reaction (PCR), from the cDNAs synthesized above. Two PCR primers were synthesized to amplify the coding sequence of CD45. The primers had the following respective sequences: [0362]
    CD45 (5′) (SEQ ID NO: 3)
    5′ CTACATCCCGGGATGTCCTGCAATTTAGATG 3′
    CD45 (3′) (SEQ ID NO: 4)
    5′ CATTTATGTCCCGGGCTATGAACCTTGAT 3′
  • The first primer corresponds to the 5′ portion of the CD45 coding sequence and encodes a Sma I restriction site upstream of the initiation codon, to facilitate cloning. The second primer corresponds to the 3′ portion of the CD45 sequence, and encodes a stop codon and a Sma I restriction site downstream from the stop codon. [0363]
  • The PCR reaction product (2127 bp) was digested with Sma I (New England Biolabs, Beverly Mass.) to yield a 2110 bp product. The pET24C plasmid vector (Novagen, Inc., Madison Wis.) was digested with the BamH I restriction enzyme, and the “sticky” ends were filled using T4 DNA polymerase according to the manufacturer's instructions (New England Biolabs, Beverly Mass.); the resulting plasmid DNA was ligated to Sma I-digested CD45 PCR product. The pET24C vector is designed to produce high levels of the protein encoded by cDNA inserted into the vector's cloning site (CD45), in bacterial hosts. Complete sequencing of the insert of the resultant plasmid, designated pET24C-CD45, confirmed the identity of the CD45 cDNA, and insertion in the proper orientation and reading frame. [0364]
  • C. Expression and Purification of CD45 Protein. [0365]
  • [0366] E. coil strain DH5α (Gibco-BRL) was transformed with pET24C-CD45 following the supplier's transformation protocol, plated onto Luria-Bertani agar plates supplemented with 30 ug/ml kanamycin and grown overnight at 37° C. A single bacterial colony was transferred into 50 mls Luria-Bertani broth supplemented with 30 ug/ml kanamycin and grown overnight with vigorous shaking. This overnight culture was split into two equal parts, and added to 2 L Luria-Bertani broth supplemented with 50 ug/ml kanamycin. When the cultures reached an O.D.600 of 1, production of the recombinant CD45 protein was induced with 0.1 mM IPTG (Isopropyl b-D-Thiogalactoside). After 5 additional hours of culturing at 37° C., the bacteria were pelleted by centrifugation.
  • The bacterial pellet (approximately 5 grams) was resuspended in 10× (w/v) lysis buffer consisting of 12.5 mM HEPES, 2 mM EDTA, pH 7.0, 15 mM bME and 1 mM PMSF. The lysate was sonicated (on ice) until slight clearing was observed (approx. three min.) and then centrifuged at 10,000 revolutions per minute (RPM) for 10 min. The supernatant was filtered through 1 mm Wattman filter paper, and 9.7 grams (i.e., 194 grams/L) of ammonium sulfate were added to the solution on ice to precipitate soluble proteins. After a 1 hour incubation on ice, the lysate was spun at 10,000 RPM for 30 min. at 4 C; supernatant was removed, and an additional 7.6 grams (i.e., 151 grams/L) of ammonium sulfate were added. The resulting pellet was resuspended in 3 mls of buffer B (33 mM imidazole-HCl pH 8.0, 2 mM EDTA, 10 mM bME, 0.002% PMSF) and stored on ice. After another 1 hour incubation on ice, the spin supernatant with ammonium sulfate was spun again at 10,000 RPM for 30 mins at 4 C. The resulting pellet from the second centrifugation was resuspended in 2 mls of buffer B. The two pellet solutions were pooled and dialyzed overnight against buffer B. [0367]
  • Secondary purification was achieved using a Mono-Q column. (Pharmacia). After loading the diluted supernatant onto the column, the column was washed with 10 bed volumes of buffer B. The recombinant CD45 protein was then eluted using a linear gradient of Buffer B and Buffer C (buffer B+1 M NaCl). Eluted fractions containing protein were identified by SDS-PAGE and Coomassie Blue staining (Pharmacia PhastSystem), and fractions containing CD45 activity were identified using the CD45 activity assay described below. [0368]
  • The CD45-containing fractions from the MonoQ column purification were pooled and stored at 4 C. [0369]
  • Assay of CD45 Activity. [0370]
  • CD45 enzymatic activity of samples was assayed in microtiter plates as follows. [0371]
  • A 100 ul reaction mixture was prepared containing 10 ul of the CD45 stock solution, 10 ul of 9.3 mM p-nitrophenylphosphate ((pNPP), Sigma Chemical Co., St. Louis Mo.), and 80 ul of activity assay buffer (100 mM sodium acetate, pH 6.0, 1 mM EDTA, 0.1% Triton X-100, 15 mM bME). Reactions were mixed gently and incubated at 37° C. for 60 minutes. Reactions were stopped by addition of 10 ul of a 0.5 M NaOH/50% EtOH solution. To determine the enzymatic activity, absorbance readings of the reactions were measured at 405 nm using a Molecular Devices Thermomax Plate Reader (Menlo Park Calif.). [0372]
  • In vitro PTPase Inhibition Assay [0373]
  • The ability of the compounds of the present invention, such as the cinnamic 4 acid derivative compounds of Example 2, to inhibit the PTPase activity of PTP-1B, CD45, PTP-1C, and PTPα was determined using modifications of the PTP-1B and CD45 activity assays described in Examples 3 and 4. [0374]
  • First, 0.001 mmol of the cinnamic acid derivative (or other PTPase inhibitor compound) was dissolved in 100 ul of DMSO to create a 10 mM stock solution. The 10 mM stock solution was used to add varying concentrations (100 uM, 133 uM, 10 uM, 3 uM, 1 uM, 0.3 uM, 0.1 uM, 0.03 uM, 0.01 uM or 0.003 uM) of the inhibitor compound to a series of otherwise identical PTPase activity assay reactions (100 ul final volume in microtiter wells). Thus, each 100 ul reaction contained 10 ul PTPase enzyme stock solution (final phosphatase concentration of approximately 20 ng/well), 70 ul activity assay buffer, 10 ul pNPP stock solution (final pNPP concentration of 0.9 mM for PTP-1B assay, 0.93 mM for CD45 assay, 0.5 mM for PTPα assay, and 8 mM for PTP-1C assay), and 10 ul of the diluted inhibitor compound in DMSO. Assay buffers contained: for CD45 and PTP-1B assays, 100 mM sodium acetate at pH 6.0, 1 mM EDTA, 0.1% Triton X-100, and 15 mM bME; for PTP-1C assays, 100 mM sodium acetate at pH 5.5, 0.1% BSA, and 15 mM bME; for PTPα assays, 100 mM sodium acetate at pH 5.25, 0.1% BSA, and 15 mM bME. Purified phosphatase was added to the reaction mixtures to begin the reactions; the reactions were incubated at 37° C. for 60 min. (for PTP-1B and CD45 assays) or at 27° C. for 60 min. (for PTP-1C and PTPα assays), stopped, and colorimetrically analyzed as described above. As positive and negative controls, reactions were performed containing 10 ul DMSO with no inhibitor compound or containing the known PTPase inhibitors vanadate (final concentration 0.5 mM; for PTP-1B and CD45 assays) or ammonium molybdate (final concentration 1 mM; for PTP-1C and PTPα assays) substituted for the inhibitor compound of the invention. [0375]
  • The concentration of inhibitor compound required to inhibit 50% of the PTPase activity (IC50) was determined as follows. First, absorbance readings from the negative control reactions were treated as a baseline and subtracted from the absorbance readings of the experimental reactions. Then, for each reaction, a percent inhibition was calculated using the following formula: [0376]
  • 100×[1−(O.D. 405 reaction/O.D. 405 DMSO)]
  • For each inhibitor compound tested, an IC50 concentration was calculated from a best-fit computer analysis of the calculated percent inhibition for the various dilutions of the compound. [0377]
  • Inhibitor compounds having an IC50 less than 10 uM (and optimally less than 5 uM) for a particular PTPase were scored as highly effective inhibitors of that PTPase enzyme, and are preferred inhibitors of the present invention. [0378]
    Figure US20020183518A1-20021205-C00195
    TABLE 6
    MWt. MWt.
    Entry R1 R2 (Calc.) (Obs.)
    116
    Figure US20020183518A1-20021205-C00196
    Figure US20020183518A1-20021205-C00197
    559 560
    117
    Figure US20020183518A1-20021205-C00198
    Figure US20020183518A1-20021205-C00199
    562 563
    118
    Figure US20020183518A1-20021205-C00200
    Figure US20020183518A1-20021205-C00201
    633 634
    119
    Figure US20020183518A1-20021205-C00202
    Figure US20020183518A1-20021205-C00203
    642 643
    120
    Figure US20020183518A1-20021205-C00204
    Figure US20020183518A1-20021205-C00205
    592 593
    121
    Figure US20020183518A1-20021205-C00206
    Figure US20020183518A1-20021205-C00207
    579 580
    122 n-propyl
    Figure US20020183518A1-20021205-C00208
    508 509
    123 n-propyl
    Figure US20020183518A1-20021205-C00209
    562, 564 563, 565
    124 n-butyl
    Figure US20020183518A1-20021205-C00210
    528 529
    125 n-heptyl
    Figure US20020183518A1-20021205-C00211
    579 580
    126 n-octyl
    Figure US20020183518A1-20021205-C00212
    566 567
    127 n-octyl
    Figure US20020183518A1-20021205-C00213
    619 620
    128
    Figure US20020183518A1-20021205-C00214
    Figure US20020183518A1-20021205-C00215
    612 613
  • Method 3 [0379]
    Figure US20020183518A1-20021205-C00216
  • By allowing a compound of formula (129) ([0380] J. Org. Chem., 1995, 60, 8231; J. Org. Chem., 1993, 58, 4785) to react with an aldehyde (R2CHO), a primary amine (R1NH2) and ammonium acetate wherein R1, R2, R3 and R4 are defined as above in formula (A6).
  • These reactions may be carried out in a solvent such as acetic acid (AcOH) at temperatures ranging from 23° C. to 120° C., for 1 to 60 hours. [0381]
  • EXAMPLES
  • [0382]
    Figure US20020183518A1-20021205-C00217
  • Prepared according to Wasserman et al ([0383] J. Org. Chem., 1995, 60, 8231; J. Org. Chem., 1993, 58, 4785). Benzyl (triphenylphosphoranylidene) acetate (130) was purchased from Aldrich chemical company and used directly. 1H NMR of 131 (400 MHz, CDCl3) δ 1.5 (s, 9H), 4.62 (s, 2H), 6.3 (d, 1H), 6.62 (d, 2H), 7.05 (t, 2H), 7.1 (t, 1H), 7.38-7.8 (m, 20H). TLC: Rf=0.5 (30% ethyl acetate-hexane).
    Figure US20020183518A1-20021205-C00218
  • Prepared according to Wasserman et al ([0384] J. Org. Chem., 1995, 60, 8231; J Org. Chem., 1993, 58, 4785). 1H NMR of 132 (400 MHz, CDCl3) δ 1.5 (s, 9H), 5.1 (s, 2H), 5.15 (br s, 21, 2× H—O), 6.4 (d, 1H), 6.95 (d, 2H), 7.1 (t, 2H), 7.18 (t, 1H), 7.4 (d, 2H), 7.5 (d, 1H), 7.9 (d, 2H). TLC: Rf=0.7 (30% ethyl acetate-hexane).
    Figure US20020183518A1-20021205-C00219
  • [0385] 1H NMR of 133 (400 MHz, CDCl3-CD3OD, 8:1) δ 5 (s, 2H), 6.4 (d 1H), 6.9-7.16 (m, 5H), 7.35 (d, 2H), 7.53 (d, 1H), 7.9 (d, 2H).
    Figure US20020183518A1-20021205-C00220
  • Prepared according to Brackeen et al ([0386] Tetrahedron Letters 1994, 35, 1635). For other approaches to imidazole-4-carboxylates see: a) Nunami et al (J. Org. Chem. 1994, 59, 7635). b) Heindel et al (Tetrahedron Letters 1971, 1439). 1H NMR of 134 (400 MHz, 8:1 CDCl3-CD3OD) δ 5.2 (s, 2H), 6.4 (d, 1H), 7.25 (br s, 5H), 7.5 (d, 2H), 7.6 (d, 1 H), 7.7 (d, 2H), 8.3 (s, 1H).
  • Method 4 [0387]
    Figure US20020183518A1-20021205-C00221
  • By allowing a compound of formula (129) to react with a polymer bound aldehyde (R[0388] 1CHO), a primary amine (R2NH2) and ammonium acetate wherein R1, R2, R3 and R4 are defined as above in formula (A6).
  • This reaction may be carried out on functionalized cross linked polystyrene polymers such as Merrifield resin, Wang resin, Rink resin, Tentagel™ resin, in a solvent such as acetic acid (AcOH) at temperatures ranging from 23° C. to 120° C., for 1 to 60 hours. The product maybe released from the polymer using conditions known to those skilled in the art. [0389]
  • EXAMPLES
  • [0390]
    Figure US20020183518A1-20021205-C00222
  • For leading references see: a) Mathias ([0391] Synthesis, 1979, 561). b) Sarantakis et al (Biochem. Biophys. Res. Commun. 1976, 73, 336). c) Hudson et al (Peptide Chemistry 1985 (Kiso, Y., ed.), 1986, Protein Research Foundation, Osaka.). d) Wang (J. Am. Chem. Soc. 1973, 95, 1328). e) Lu et al (J. Org Chem. 1981, 46, 3433). To 6 mmol (1 equiv) of Wang resin in 130 mL of dry dimethylformamide was added 18 mmol (3equiv) of diisopropylcarbodiimide and the mixture was sonnicated for 4 hours (final bath temperature was 37° C.). 4-Formylcinnamic acid (1 8 mmol, 3equiv) and 4-dimethylaminopyridine (6 mmol, 1 equiv) were added and the mixture was magnetically stirred for 48 hours at ambient temperature. The resin was filtered and thoroughly washed with dimethylforamide (500 mL), methanol (500 mL), dichloromethane (500 mL) and methanol (500 mL) and dried in vacuo (0.1 mmHg) for 24 hours. A coupling yield of 80% was established by cleaving 100 mg of the resin with a solution of 20% trifluoroacetic acid in dichloromethane for 20 min at ambient temperature.
    Figure US20020183518A1-20021205-C00223
  • To 60 mg (0.048 mmol, 1.0 equiv) of 135 was added 40 mg (0.097 mmol, 2.0 equiv) of 132 followed by 37 mg (0.481 mmol, 5.0 equiv) of ammonium acetate and 0.2 mL of acetic acid. The mixture was heated to 100° C. for 15 hours, filtered, washed with dimethylformamide, dichloromethane, methanol and dichloromethane. The crude product was isolated by treatment of the polymer with a solution of 50% trifluoroacetic acid in dichloromethane for 1 hour at 23° C. The solvent was removed and the residue was purified by preparative thin layer chromatography (20% methanol-dichloromethane eluent). [0392] 1H NMR of 136 (400 MHz, CD3OD) δ 5.15 (s, 2H), 6.48 (d, 1H), 6.55 (d, 1H), 7.25 (br s, 4H), 7.5-7.8 (m, 9H), 8.1 (d, 1H). MS (ESI negative ion) [M−H]: 493;
  • Method 5 [0393]
    Figure US20020183518A1-20021205-C00224
  • By allowing a primary amine (R[0394] 1NH2), a carboxylic acid (R2CO2H) and a ketoaldehyde (R4COCHO) to react with a polymer bound isocyanide (R3NC) and by subsequently cyclizing compound 137 with ammonium acetate wherein R1, R2, R3 and R4 are defined as above in formula (A6).
  • The first step in this reaction may be carried out on functionalized cross linked polystyrene resins such as Merrifield resin, Wang resin, Rink resin, Tentagel™ resin, in a solvent or a combination of solvents such as dichloromethane (CH[0395] 2Cl2), chloroform (CHCl3), methanol (MeOH), tetrahydrofuran (THF) or acetonitrile (CH3CN), in the presence or absence of a catalyst (e.g. ZnCl2, MgBr2) at temperatures ranging from −78° C. to 80° C., for 1 to 60 hours. The second step in this reaction may be carried out in a solvent such as acetic acid (AcOH) at temperatures ranging from 23° C. to 120° C., for 1 to 60 hours.
    Figure US20020183518A1-20021205-C00225
  • Prepared according to Gunn et al ([0396] J. Org. Chem. 1977, 42, 754).
    Figure US20020183518A1-20021205-C00226
  • Prepared according to Zhang et al ([0397] Tetrahedron Letters 1996, 37, 751).
    Figure US20020183518A1-20021205-C00227
  • Prepared according to Zhang et al ([0398] Tetrahedron Letters 1996, 37, 751).
  • [0399] 1H NMR of mono tert-butyl ester of 140 (400 MHz, CDCl3) δ 1.1 (m,2H), 1.2 (d,3H), 1.3 (m,2H), 1.5 (s,9H), 1.56 (m,2H), 2.2 (m,2H), 2.9 (m,1H), 3.1 (m,1H), 3.2 (m,1H), 3.8 (s,3H), 4.6 (m,2H), 6.1 (d,1H), 6.9 (t,4H), 7.1 (m,5H), 7.4 (d, 2H), 7.6 (d,1H).
  • Method 6 [0400]
    Figure US20020183518A1-20021205-C00228
  • By allowing a carboxylic acid (R[0401] 1CO2H) to react with an isocyanide (R3NC) and a ketoaldehyde (R2COCHO) and by allowing compound 141 to cyclize in the presence of ammonium acetate, wherein R1, R2, and R3 are defined as above in formula (A6).
  • The first step in this reaction reaction may be carried out in a solvent or a combination of solvents such as dichloromethane (CH[0402] 2Cl2), chloroform (CHCl3), methanol (MeOH), tetrahydrofuran (THF), acetonitrile (CH3CN), in the presence or absence of a catalyst (e.g. ZnCl2, MgBr2) at temperatures ranging from −78° C. to 80° C., for 1 to 60 hours. The second step in this reaction may be carried out in a solvent such as acetic acid (AcOH) at temperatures ranging from 23° C. to 120° C., for 1 to 60 hours.
  • EXAMPLES
  • [0403]
    Figure US20020183518A1-20021205-C00229
  • Prepared according to Bossio et al ([0404] Liebigs Ann. Chem. 1991, 1107).
  • To an ethyl ether mixture of the carboxylic acid and ketoaldehyde at 0° C. was added dropwise an ethyl ether solution of the isocyanide. The mixture was warmed to 25° C. and stirred for 2 hours to 3 days. The solution was diluted with ethyl acetate, washed with saturated sodium bicarbonate and dried over sodium sulfate. The solvent was removed in vacuo and the residue was purified by silica gel chromatography to yield α-Acyloxy-β-ketoamide 142. [0405]
  • A solution of the α-Acyloxy-β-ketoamide 142 (1 equiv) and ammonium acetate (30 equiv) in acetic acid was heated at 100° C. for 2 to 15 hours. The reaction was cooled to 23° C., diluted with ethyl acetate, washed with saturated sodium bicarbonate and dried over sodium sulfate. Solvent was removed in vacuo and the crude mixture was sepaprated by silica gel chromatography to provide imidazole 143. [0406]
    Figure US20020183518A1-20021205-C00230
  • [0407] 1H NMR of 144 (400 MHz, d6-acetone) δ 0.85 (t, 3H), 1.2-1.6 (m, 4H), 3.3 (m, 2H), 6.55 (s, 1H), 6.62 (d, 1H), 7.3 (t, 2H), 7.7 (d, 1H), 7.82 (d, 2H), 8.1 (d, 2H), 8.25 (dd, 2H).
    Figure US20020183518A1-20021205-C00231
  • [0408] 1H NMR of 146 (400 MHz, d6-acetone) δ 0.9 (t, 3H), 1.4 (m, 2H), 1.6 (m, 2H), 3.35 (m, 2H), 6.58 (d, 1H), 7.12 (t, 2H), 7.65 (d, 1H), 7.78 (d, 2H), 8.1 (s br, 1H), 8.05 (m, 1H), 8.2 (d, 2H).
  • General Method for the Synthesis of Compounds (A7) [0409]
    Figure US20020183518A1-20021205-C00232
  • By allowing a carboxylic acid (R[0410] 1CO2H) to react with an isocyanide (R3NC) and a ketoaldehyde (R2COCHO) wherein R1, R2, and R3 are defined as above in formula (A7) and by allowing compound 141 to cyclize in the presence of ammonium acetate.
  • The first step in this reaction reaction may be carried out in a solvent or a combination of solvents such as dichloromethane (CH[0411] 2Cl2), chloroform (CHCl3), methanol (MeOH), tetrahydrofuran (THF), acetonitrile (CH3CN), in the presence or absence of a catalyst (e.g. ZnCl2, MgBr2) at temperatures ranging from −78° C. to 80° C., for 1 to 60 hours. The second step in this reaction may be carried out in a solvent such as acetic acid (AcOH) at temperatures ranging from 23° C. to 120° C., for 1 to 60 hours.
  • EXAMPLES
  • [0412]
    Figure US20020183518A1-20021205-C00233
  • Prepared according to Bossio et al ([0413] Liebigs Ann. Chem. 1991, 1107).
  • A solution of the α-Acyloxy-β-ketoamide 141 (1 equiv) and ammonium acetate (2 equiv) in acetic acid was heated at 100° C. for 2 to 15 hours. The reaction was cooled to 23° C., diluted with ethyl acetate, washed with saturated sodium bicarbonate and dried over sodium sulfate. Solvent was removed in vacuo and the crude oxazole 147 was purified by silica gel chromatography. [0414]
    Figure US20020183518A1-20021205-C00234
  • [0415] 1H NMR of 148 (400 MHz, d6-acetone) δ 0.9 (t, 3H), 1.4 (m, 2H), 1.6 (m, 2H), 3.42 (m, 2H), 6.63 (d, 1H), 7.2 (t, 2H), 7.7 (d, 1H), 7.9 (d, 2H), 8.18 (s br, 1H), 8.25 (d, 2H), 8.6 (m, 1H).
  • General Methods for the Synthesis of Compounds (A8) and (A9) [0416]
  • Method 1 [0417]
    Figure US20020183518A1-20021205-C00235
  • By allowing a compound of formula (A5) to react with compound of formula (149) wherein R[0418] 1, R2, R3, R4, R5, and R6 are defined as above in formula (A8).
  • These reactions may be carried out in a solvent or a combination of solvents such as dioxane or acetic acid (AcOH) at temperatures ranging from 23° C. to 120° C., for 1 to 60 hours. [0419]
  • EXAMPLES
  • [0420]
    Figure US20020183518A1-20021205-C00236
  • A solution of 0.1 mmol of diamine 150 and 0.1 mmol of 6 in 1.2 mL of 1,4-dioxane-acetic acid (5:1) was heated at 100° C. Upon completion of the reaction as judged by thin layer chromatography, ethyl acetate was added and the organic layer was washed with water, 0.5M citric acid, 10% sodium bicarbonate and dried over sodium sulfate. The compounds were purified using silica gel chromatography. [0421]
    Figure US20020183518A1-20021205-C00237
    TABLE 7
    Compound R1 R2 R3 R4
    152 H H NO2 H
    153 H Cl Cl H
    154 H H CH3 H
    155 H H CO2H H
    156 H H CO2Me H
    157 H H H H
  • 152 (400 MHz, CD[0422] 3OD) δ 6.5 (d, 2H), 7.3 (s, 1H), 7.4-7.8 (m, 10H), 7.9 (s, 1H), 8.05 (d, 1H). MS ESI (pos ion) for [M+H]+: 468 (calculated 467).
  • 153 (400 MHz, CD[0423] 3OD) δ 6.48 (d, 2H), 7.5 (dd, 8H), 7.6 (d, 2H), 8.24 (s, 2H). MS ESI (pos ion) for [M+H]+: 491, 492 (calculated 490, 491).
  • 154 (400 MHz, CD[0424] 3OD) δ 3.3 (s, 3H), 6.5 (d, 2H), 7.59 (s, 8H), 7.62 (d, 2H), 8.3 (d, 1H), 8.55 (d, 1H), 8.95 (s, 1H). MS ESI (pos ion) for [M+H]+: 437 (calculated 436).
  • 155 (400 MHz, d[0425] 6-DMSO) δ 6:56 (d, 2H), 7.5 (m, 6H), 7.65 (d, 4H), 8.2 (d, 1H), 8.3 (d, 1H), 8.6 (s, 1H). MS ESI (neg ion) for [M−H]: 465 (calculated 466).
  • 156 (400 MHz, CD[0426] 3OD) δ 6.56 (d, 2H), 7.5 (s br, 8H), 7.65 (d, 2H), 8.2 (d, 1H), 8.3 (d, 1H), 8.7 (s, 1H). MS ESI (neg ion) for [M−H]: 479 (calculated 480).
  • 157 (400 MHz, d[0427] 6-DMSO) δ 6.52 (d, 2H), 7.54-8.16 (m, 14H).
  • Method 2 [0428]
    Figure US20020183518A1-20021205-C00238
  • By allowing a compound of formula (A5) to react with compound of formula (158) wherein R[0429] 1, R2, R3, R4, R5 are defined as above in formula (A9).
  • These reactions may be carried out in a solvent or a combination of solvents such as dioxane or acetic acid (AcOH) at temperatures ranging from 23° C. to 120° C., for 1 to 60 hours. [0430]
  • EXAMPLES
  • [0431]
    Figure US20020183518A1-20021205-C00239
  • [0432] 1H NMR of 160 (400 MHz, CD3OD) δ 6.5 (d, 2H), 7.5-7.7 (m, 12H), 7.95 (m, 1H), 8.65 (d, 1H), 9.15 (s, 1H).
  • MS ESI (pos ion) for [M+H][0433] +: 424 (calculated 423).
  • General Method for the Synthesis of Compounds (A10) [0434]
    Figure US20020183518A1-20021205-C00240
  • By allowing a compound of formula (A10)-1 prepared as above to react with a carboxylic acid (R[0435] 2CO2H) wherein R1 and R2 are defined as above in formula (A10).
  • These reactions may be carried out in a solvent such as tetrahydrofuran (THF), dichloromethane (CH[0436] 2Cl2), in the presence of diisopropyl carbodiimide (DIC) and a base (e.g. 4,4-dimethylaminopyridine) at temperatures ranging from 0° C. to 23° C., for 1 to 60 hours.
  • EXAMPLES
  • [0437]
    Figure US20020183518A1-20021205-C00241
  • To 50 mg of diol 22 in 1 mL of dichloromethane was added diisopropyl carbodiimide (2.2 equiv) and the reaction was stirred for 1 hour at 23° C. To the solution was added 4,4-dimethylaminopyridine (0.2 equiv) followed by para-methoxybenzoic acid (2.2 equiv) in 5 mL of tetrahydrofuran and the mixture was stirred for an additional 3 hours at 23° C. The reaction was diluted with ethyl acetate and washed with 1N HCl, saturated sodium bicarbonate and the organic layer was dried over sodium sulfate. The crude mixture was purified using radial chromatography (ethyl acetate-hexane eluent). [0438] 1H NMR of 161 (400 MHz, CDCl3) δ 1.5 (s, 18H), 3.8 (s, 6H), 6.25 (d, 2H), 6.32 (s, 2H), 6.85 (d, 4H), 7.18 (d, 4H), 7.31 (d, 4H), 7.45 (d, 2H), 7.95 (d, 4H).
    Figure US20020183518A1-20021205-C00242
  • [0439] 1H NMR of 162 (400 MHz, CD3OD) δ 3.8 (s, 6H), 6.4 (m, 4H), 6.95 (d, 4H), 7.38 (d, 4H), 7.5 (d, 4H), 7.6 (d, 2H), 7.95 (d, 4H). MS ESI (neg ion) for [M−H]: 621 (calculated 622).
  • General Method for the Synthesis of Compounds (A11) [0440]
    Figure US20020183518A1-20021205-C00243
  • By allowing a compound of formula (A10)-1 prepared as above to react with a sulfonyl chloride (R[0441] 2SO2Cl), and subsequently by oxidizing intermediate 163 and by allowing intermediate 164 to react with a thioamide (R3C(S)NH2) wherein R1, R2 and R3 are defined as above in formula (A11).
  • The first step in this sequence of reactions may be carried out in a solvent such as tetrahydrofuran (THF), dichloromethane (CH[0442] 2Cl2), in the presence of a base (e.g. 4,4-dimethylaminopyridine, triethylamine, triisopropylamine) and a sulfonyl chloride (e.g. tosyl chloride, mesyl chloride), at temperatures ranging from −20° C. to 23° C., for 1 to 60 hours. The second step in this sequence of reactions may be carried out in a solvent such as dichloromethane (CH2Cl2), in the presence of an oxidizing reagent (e.g. tetrapropylammonium perruthenate (VII) (TPAP)) and activated 4A molecular sieves at temperatures ranging from 0° C. to 23° C., for 1 to 60 hours. The third step in this sequence of reactions may be carried out in a solvent such as acetic acid, toluene, dioxane at temperatures ranging from 0° C. to 120° C., for 1 to 60 hours.
  • EXAMPLES
  • [0443]
    Figure US20020183518A1-20021205-C00244
  • To 50 mg of diol 22 in 1 mL of dichloromethane was added Tosyl chloride (42.5 mg), 4,4-dimethylaminopyridine (6 mg), triethylamine (95 μl), and the reaction was stirred for 12 hours at 23° C. The volatiles were removed in vacuo and the crude mixture (containing 165, the bis-tosylated compound and the corresponding epoxide) was separated by flash chromatography (ethyl acetate-hexane eluent) to give a mixture of 165 and the corresponding bis-tosylated compound (27 mg total). [0444]
    Figure US20020183518A1-20021205-C00245
  • The mixture consisting of 165 and the corresponding bis-tosylated compound was oxidized as described above for compound 24. The crude mixture was purified by flash chromatography (ethyl acetate-hexane eluent) to give3.9 mg of 166 and 16 mg of the corresponding bis-tosylate. [0445] 1H NMR of 166 (400 MHz, d6-acetone) δ 1.5 (d, 18H), 2.4 (s, 3H), 6.4 (d, 1H), 6.5 (d, 1H), 6.95 (s, 1H), 7.35 (d, 2H), 7.42 (d, 2H), 7.5 (d, 1H), 7.6 (m, 3H), 7.7 (dd, 4H), 8 (d, 2H).
    Figure US20020183518A1-20021205-C00246
  • To 3.9 mg of 166 was added 3 mg of para-methoxythiobenzamide and 0.5 ml of toluene and the reaction was heated at 65° C. for 12 hours. The solvent was removed in vacuo and the crude mixture was purified by flash chromatography (ethyl acetate-hexane eluent) to give1.8 mg of 167. [0446] 1H NMR of 167 (400 MHz, CDCl3) δ 1.5 (d, 18H), 3.8 (s, 3H), 6.3 (dd, 2H), 6.9 (d, 2H), 7.35 (d, 2H), 7.4 (m, 4H), 7.55 (m, 4H), 7.9 (d, 2H).
    Figure US20020183518A1-20021205-C00247
  • [0447] 1H NMR of 168 (400 MHz, CD3OD) δ 3.8 (s, 3H), 6.45 (dd, 2H), 7.0 (d, 2H), 7.4 (d, 2H), 7.5-7.7 (m, 8H), 7.9 (d, 2H).
  • Biological Protocols [0448]
  • PTP-1B Gene Cloning and Protein Purification [0449]
  • The following procedure was conducted for recombinant production and purification of protein tyrosine phosphatase PTP-1B, for use as a substrate in PTPase inhibition assays. [0450]
  • A. Production of a PTP-1B cDNA [0451]
  • A human placental cDNA library was synthesized in a 50 ul reaction containing 1 ug human placental poly(A)[0452] + mRNA (Clontech, Palo Alto, Calif.), 4 ul random hexamer primers, 8 ul of 10 mM dNTPs (Pharmacia, Piscataway N.J.), 1 ul (200 U/ul) Moloney murine leukemia virus reverse transcriptase (Gibco-BRL, Canada), 0.5 ul (26 U/ul) RNAsin (Promega, Madison Wis.), and 12 ul 5× buffer (Gibco-BRL). The synthesis reaction was incubated at 37° C. for one hour and then heat inactivated at 95° C. for five minutes.
  • A PTP-1B cDNA was amplified, using polymerase chain reaction (PCR), from the cDNAs synthesized as described above. More particularly, based on the published sequence of PTB-1B, two PCR primers were synthesized to amplify a portion of the PTP-1B coding sequence known to encode a 321 amino acid fragment containing the PTP-1B catalytic domain and having PTPase activity. See Hoppe et al., [0453] Eur. J. Biochem., 223:1069-77 (1994); Barford, D., et al., J. Molec. Biol., 239:726-730 (1994); Chemoff et al., Proc. Natl. Acad. Sci. USA, 87:2735-2739 (1990); Charbonneau et al. Proc. Natl. Acad. Sci. USA, 86:5252-5256 (1989). The primers had the following respective sequences:
    PTP-1B-A (5′) (SEQ ID NO: 1)
    5′ CGCACTGGATCCTCATGGAGATGGAAAAGG 3′
    PTP-1B-B (3′) (SEQ ID NO: 2)
    5′ CTCCCTGAATTCCTAATTGTGTGGCTCCAGG 3′
  • The first primer, which hybridizes to the non-coding strand, corresponds to the 5′ portion of the PTP-1B coding sequence and encodes a BamH I restriction site upstream of the initiation codon, to facilitate cloning. The second primer, which hybridizes to the coding strand, corresponds to the 3′ portion of the PTB-1B fragment of interest, and encodes a stop codon and an EcoR I restriction site downstream from the stop codon. [0454]
  • A 100 μl PCR reaction mixture containing approx. 1 ug of the human placental cDNA library, 0.2 mM of each dNTP, 30 uM of each primer, 1× Amplitaq DNA polymerase buffer (Perkin-Elmer, Norwalk Conn.), and 5 units Amplitaq DNA polymerase (Perkin-Elmer) was denatured at 94° C. for 5 minutes and then subjected to 25 cycles of amplification as follows: 1) 94° C. denaturation for 1 minute; 2) 55° C. annealing for 1 minute; and 3) 72° C. primer extension for 1 minute. [0455]
  • The PCR reaction product (992 bp) was digested with BamH I and EcoR I (New England Biolabs, Beverly Mass.) to yield a 975 bp product encoding the 321 amino acid PTP-1B protein fragment, and having “sticky ends” to facilitate cloning. [0456]
  • B. Production of a PTP-1B Expression Vector. [0457]
  • The 975 bp PTP-1B partial cDNA was purified by agarose gel electrophoresis and ligated into a BamH I/EcoR I-digested pGEX-3X plasmid vector (Pharmacia, Piscataway, N.J.). The pGEX vector is designed to produce a fusion of glutathione-S-transferase (GST) to a protein encoded by another DNA fragment inserted into the vector's cloning site. Complete sequencing of the insert of the resultant plasmid, designated pGEX-3X-PTP-1B, confirmed the identity of the PTP-1B cDNA, and insertion in the proper orientation and reading frame. [0458]
  • C. Expression and Purification of GST/PTP-1B Fusion Protein. [0459]
  • [0460] E. coli strain DH5α (Gibco-BRL) was transformed with plasmid pGEX-3X-PTP-1B following the supplier's transformation protocol and grown at 37° C. with vigorous shaking in Luria-Bertani broth supplemented with 100 ug/ml ampicillin. When the cultures reached an O.D.600 of 0.7-1, production of the GST/PTP-1B fusion protein was induced with 0.1 mM IPTG (Isopropyl b-D-Thiogalactoside). After 3 additional hours of culturing at 37° C., the bacteria were pelleted by centrifugation.
  • The bacterial pellet was resuspended in 10× (w/v) lysis buffer consisting of 12.5 mM HEPES, 2 mM EDTA, pH 7.0, 15 mM b-mercaptoethanol (bME) and 1 mM PMSF. The lysate was sonicated (on ice) until slight clearing was observed (approx. three min.) and then centrifuged at 10,000 revolutions per minute (RPM) for 10 min. The supernatant was diluted 1:4 with buffer A (25 mM HEPES, pH 7.0, and 15 mM bME). [0461]
  • Primary purification was achieved using a 5 ml Hi-Trap pre-packed Q column (Pharmacia). After loading the diluted supernatant onto the column, the column was washed with 10 bed volumes of buffer A. The GST/PTP-1B fusion protein was then eluted using a linear gradient of Buffer A and Buffer B (buffer A+1 M NaCl). Eluted fractions containing protein were identified by SDS-PAGE and Coomassie Blue staining (Pharmacia PhastSystem), and fractions containing PTP-1B activity were identified using the PTP-1B activity assay described below. Elution of the fusion protein occurred at about 30% Buffer B. [0462]
  • Fractions containing PTPase activity were pooled, diluted 1:4 with NET buffer (20 mM Tris, pH 8.8, 100 mM NaCl, 1 mM EDTA and 15 mM bME), and loaded onto a 10 ml GST-Sepharose 4B column (Pharmacia). After loading, the column was washed first with 3 bed volumes of NET buffer+1% NP40 (Sigma Chemical Co., St. Louis, Mo.), then with NET buffer until O.D. at 280 nm was basal. The GST/PTP-1B fusion protein was eluted from the column using 10 mM glutathione in 33 mM Tris, pH 8.0. Elution of proteins was monitored at O.D.[0463] 280 and fractions were assayed for activity and run on SDS-PAGE as described above. PTP-1B fusion protein eluted after approx. 4-5 minutes (flow rate 1 ml/min.).
  • The GST/PTP-1B-containing fractions from the GST-Sepharose 4B purification were pooled, concentrated into a final storage buffer (0.2 M NaCl, 25 mM HEPES, 1 mM EDTA, and 5 mM DTT, pH 7.0) using a 1 ml Hi-Trap Q column (pre-packed, Pharmacia), and stored at −80° C. (final concentration of 0.52 mg/ml). The foregoing procedure yielded approximately 5 mg of PTP-1B fusion protein per 500 ml of cultured cells, purified to substantial homogeneity as assessed by SDS-PAGE. [0464]
  • Assay of PTP-1B Activity. [0465]
  • PTP-1B enzymatic activity of samples was assayed in microtiter plates as follows. [0466]
  • The protein concentration of the PTP-1B enzyme preparation was determined using the Bio-Rad Protein Assay kit (Bio-Rad, Hercules Calif.). An aliquot from each sample was taken and diluted to 2 mg protein/ml using activity assay buffer (100 mM Sodium Acetate, pH 6.0, 1 mM EDTA, 0.1% TX-100 (International Biotechnologies, Inc.) and 15 mM bME) to form a PTP-1B stock solution. [0467]
  • A 100 ul reaction mixture was prepared containing 10 ul of the PTP-1B stock solution, 10 ul of 9 mM p-nitrophenylphosphate ((pNPP), Sigma Chemical Co., St. Louis Mo.), and 80 ul of activity assay buffer (100 mM sodium acetate, pH 6.0, 1 mM EDTA, 0.1% Triton X-100, 15 mM bME). Reactions were mixed gently and incubated at 37° C. for 60 minutes. Enzymatic cleavage of phosphate from pNPP (a tyrosine phosphate analog) is marked by a colorimetric change in this substrate. See, e.g., Imbert et al., [0468] Biochem J., 297:163-173 (1994); Ghosh and Miller, Biochem. Biophys. Res. Comm., 194:36-44 (1993); Zanke et al., Eur. J Immunol., 22:235-39 (1992).
  • Reactions were stopped by addition of 10 ul of a 0.5 M NaOH/50% EtOH solution. To determine the enzymatic activity, absorbance readings of the reactions were measured at 405 nm using a Molecular Devices Thermomax Plate Reader (Menlo Park Calif.). [0469]
  • CD45 Gene Cloning and Protein Purification [0470]
  • The following procedure was conducted for recombinant production and purification of protein tyrosine phosphatase CD45, for use as a substrate in PTPase inhibition assays. [0471]
  • A. Production of aCD45 cDNA, and Production of a CD45 Expression Vector. [0472]
  • A human cDNA library was synthesized from RNA isolated from the human Jurkat cell line, as described above for PTP-1B. [0473]
  • CD45 cDNA was amplified, using polymerase chain reaction (PCR), from the cDNAs synthesized above. Two PCR primers were synthesized to amplify the coding sequence of CD45. The primers had the following respective sequences: [0474]
    CD45 (5′) (SEQ ID NO: 3)
    5′ CTACATCCCGGGATGTCCTGCAATTTAGATG 3′
    CD45 (3′) (SEQ ID NO: 4)
    5′ CATTTATGTCCCGGGCTATGAACCTTGAT 3′
  • The first primer corresponds to the 5′ portion of the CD45 coding sequence and encodes a Sma I restriction site upstream of the initiation codon, to facilitate cloning. The second primer corresponds to the 3′ portion of the CD45 sequence, and encodes a stop codon and a Sma I restriction site downstream from the stop codon. [0475]
  • The PCR reaction product (2127 bp) was digested with Sma I (New England Biolabs, Beverly Mass.) to yield a 2110 bp product. The pET24C plasmid vector (Novagen, Inc., Madison Wis.) was digested with the BamH I restriction enzyme, and the “sticky” ends were filled using T4 DNA polymerase according to the manufacturer's instructions (New England Biolabs, Beverly MA); the resulting plasmid DNA was ligated to Sma I-digested CD45 PCR product. The pET24C vector is designed to produce high levels of the protein encoded by cDNA inserted into the vector's cloning site (CD45), in bacterial hosts. Complete sequencing of the insert of the resultant plasmid, designated pET24C-CD45, confirmed the identity of the CD45 cDNA, and insertion in the proper orientation and reading frame. [0476]
  • C. Expression and Purification of CD45 Protein. [0477]
  • [0478] E. coli strain DH5α (Gibco-BRL) was transformed with pET24C-CD45 following the supplier's transformation protocol, plated onto Luria-Bertani agar plates supplemented with 30 ug/ml kanamycin and grown overnight at 37° C. A single bacterial colony was transferred into 50 mls Luria-Bertani broth supplemented with 30 ug/ml kanamycin and grown overnight with vigorous shaking. This overnight culture was split into two equal parts, and added to 2 L Luria-Bertani broth supplemented with 50 ug/ml kanamycin. When the cultures reached an O.D.600 of 1, production of the recombinant CD45 protein was induced with 0.1 mM IPTG (Isopropyl b-D-Thiogalactoside). After 5 additional hours of culturing at 37° C., the bacteria were pelleted by centrifugation.
  • The bacterial pellet (approximately 5 grams) was resuspended in 10× (w/v) lysis buffer consisting of 12.5 mM HEPES, 2 mM EDTA, pH 7.0, 15 mM bME and 1 mM PMSF. The lysate was sonicated (on ice) until slight clearing was observed (approx. three min.) and then centrifuged at 10,000 revolutions per minute (RPM) for 10 min. The supernatant was filtered through 1 mm Wattman filter paper, and 9.7 grams (i.e., 194 grams/L) of ammonium sulfate were added to the solution on ice to precipitate soluble proteins. After a 1 hour incubation on ice, the lysate was spun at 10,000 RPM for 30 min. at 4 C; supernatant was removed, and an additional 7.6 grams (i.e., 151 grams/L) of ammonium sulfate were added. The resulting pellet was resuspended in 3 mls of buffer B (33 mM imidazole-HCl pH 8.0, 2 mM EDTA, 10 mM bME, 0.002% PMSF) and stored on ice. After another 1 hour incubation on ice, the spin supernatant with ammonium sulfate was spun again at 10,000 RPM for 30 mins at 4 C. The resulting pellet from the second centrifugation was resuspended in 2 mls of buffer B. The two pellet solutions were pooled and dialyzed overnight against buffer B. [0479]
  • Secondary purification was achieved using a Mono-Q column. (Pharmacia). After loading the diluted supernatant onto the column, the column was washed with 10 bed volumes of buffer B. The recombinant CD45 protein was then eluted using a linear gradient of Buffer B and Buffer C (buffer B+1 M NaCl). Eluted fractions containing protein were identified by SDS-PAGE and Coomassie Blue staining (Pharmacia PhastSystem), and fractions containing CD45 activity were identified using the CD45 activity assay described below. [0480]
  • The CD45-containing fractions from the MonoQ column purification were pooled and stored at 4 C. [0481]
  • Assay of CD45 Activity. [0482]
  • CD45 enzymatic activity of samples was assayed in microtiter plates as follows. [0483]
  • A 100 ul reaction mixture was prepared containing 10 ul of the CD45 stock solution, 10 ul of 9.3 mM p-nitrophenylphosphate ((pNPP), Sigma Chemical Co., St. Louis Mo.), and 80 ul of activity assay buffer (100 mM sodium acetate, pH 6.0, 1 mM EDTA, 0. 1% Triton X-100, 15 mM bME). Reactions were mixed gently and incubated at 37° C. for 60 minutes. Reactions were stopped by addition of 10 ul of a 0.5 M NaOH/50% EtOH solution. To determine the enzymatic activity, absorbance readings of the reactions were measured at 405 nm using a Molecular Devices Thermomax Plate Reader (Menlo Park Calif.). [0484]
  • In vitro PTPase Inhibition Assay [0485]
  • The ability of the compounds of the present invention, such as the cinnamic acid derivative compounds of Example 2, to inhibit the PTPase activity of PTP-1B, CD45, PTP-1C, and PTPα was determined using modifications of the PTP-1B and CD45 activity assays described in Examples 3 and 4. [0486]
  • First, 0.001 mmol of the cinnamic acid derivative (or other PTPase inhibitor compound) was dissolved in 100 ul of DMSO to create a 10 mM stock solution. The 10 mM stock solution was used to add varying concentrations (100 uM, 33 uM, 10 uM, 3 uM, 1 uM, 0.3 uM, 0.1 uM, 0.03 uM, 0.01 uM or 0.003 uM) of the inhibitor compound to a series of otherwise identical PTPase activity assay reactions (100 ul final volume in microtiter wells). Thus, each 100 ul reaction contained 10 ul PTPase enzyme stock solution (final phosphatase concentration of approximately 20 ng/well), 70 ul activity assay buffer, 10 ul pNPP stock solution (final pNPP concentration of 0.9 mM for PTP-1B assay, 0.93 mM for CD45 assay, 0.5 mM for PTPα assay, and 8 mM for PTP-1C assay), and 10 ul of the diluted inhibitor compound in DMSO. Assay buffers contained: for CD45 and PTP-1B assays, 100 mM sodium acetate at pH 6.0, 1 mM EDTA, 0. 1% Triton X-100, and 15 mM bME; for PTP-1C assays, 100 mM sodium acetate at pH 5.5, 0.1% BSA, and 15 mM bME; for PTPα assays, 100 mM sodium acetate at pH 5.25, 0.1% BSA, and 15 mM bME. Purified phosphatase was added to the reaction mixtures to begin the reactions; the reactions were incubated at 37° C. for 60 min. (for PTP-1B and CD45 assays) or at 27 C for 60 min. (for PTP-1C and PTPα assays), stopped, and calorimetrically analyzed as described above. As positive and negative controls, reactions were performed containing 10 ul DMSO with no inhibitor compound or containing the known PTPase inhibitors vanadate (final concentration 0.5 mM; for PTP-1B and CD45 assays) or ammonium molybdate (final concentration 1 mM; for PTP-1C and PTPα assays) substituted for the inhibitor compound of the invention. [0487]
  • The concentration of inhibitor compound required to inhibit 50% of the PTPase activity (IC50) was determined as follows. First, absorbance readings from the negative control reactions were treated as a baseline and subtracted from the absorbance readings of the experimental reactions. Then, for each reaction, a percent inhibition was calculated using the following formula: [0488]
  • 100×[1−(O.D. 405 reaction/O.D. 405 DMSO)]
  • For each inhibitor compound tested, an IC50 concentration was calculated from a best-fit computer analysis of the calculated percent inhibition for the various dilutions of the compound. [0489]
  • Inhibitor compounds having an IC50 less than 10 uM (and optimally less than 5 uM) for a particular PTPase were scored as highly effective inhibitors of that PTPase enzyme, and are preferred inhibitors of the present invention. [0490]
  • As it will be apparent to those persons skilled in the art, the foregoing biological data is not absolute and will vary according to many factors such as assay conditions and the like. [0491]
    TABLE 8
    % inhibition % inhibition % inhibition
    of PTP1B of PTPα of PTP1C
    Compound at 1 μM at 100 μM at 100 μM
    36 52  0 42
    37 85 63 59
    38 93 71 63
    39 82 47 53
    40 88 82 62
    41 39 20 17
    42 84 92 88
    43 76 82 79
    44 79 87 86
    45 85 85 84
    46 75 73 61
    47 68 48 63
    48 69  3 33
    49 37  0 35
    50 50 37 25
  • [0492]
    TABLE 9
    IC50 values (in μM) against
    PTP1B and CD45 for given compounds
    PTP1B CD45 PTP1B CD45 PTP1B CD45
     9 0.37 3.9 70 0.42 1.9  95 2 6
    13 31 —* 71 0.43 0.53  96 0.4 2.4
    23 0.27 —* 72 0.52 5.5  97 6 10
    25 0.89 —* 73 0.62 2.8  98 6 10
    27 0.5 —* 74 0.64 4.2  99 1.5 7.4
    29 0.8 —* 75 0.68 3.4 100 26 >100
    32 1.8 —* 76 0.68 0.93 133 —*
    54 0.072 0.73 77 0.78 7.5 134 3.4 20
    55 0.1 0.56 78 0.79 1.15 136 0.7 8
    56 0.135 0.94 79 4.8 8.2 140 1.2 20
    57 0.25 1.0 80 10 20 144 3 —*
    58 0.25 0.97 81 26 19 146 5.9 —*
    59 0.25 0.35 82 11.9 12.8 148 9 —*
    60 0.29 1.0 83 1.3 1.5 152 0.85 1.2
    61 0.97 0.955 84 1.2 2.7 153 2.65 1.91
    62 1.5 0.985 85 1.5 1.8 154 3.83 2.45
    63 1.7 2.4 86 1.8 7.1 155 1 1.3
    64 3.0 6.4 87 1.0 1.1 156 1.7 1.3
    65 1.3 1.4 88 2.65 7.8 157 5.5 1.5
    66 1.7 2.5 89 13.7 >100 160 0.98 1.52
    67 1.0 1.25 90 0.86 1.12 162 1.8 —*
    68 0.3 0.865 91 25.9 >100 168 3 —*
    69 0.41 1.9 94 0.7 7
  • [0493]
    TABLE 10
    % inhibition % inhibition
    of PTP1B of CD45
    Compound at 1 μM at 1 μM
    103 44% 14%
    104 24% 14%
    105 61% 18%
    106 45% 21%
    107 25% 51%
    108 30% 62%
    109 —* 14%
    110 —* 22%
    111 —* 18%
    112 —* 16%
    113 —* 61%
  • [0494]
    TABLE 11
    % inhibition %inhibition
    of PTP1B of PTP1B
    Compound at 1 μM Compound at 1 μM
    116 41% 123 85%
    117 67% 124 83%
    118 56% 125 93%
    119 71% 126 59%
    120 67% 127 79%
    121 73% 128 80%
    122 87%
  • The compounds of the present invention have asymmetric centers and may occur as racemates, racemic mixtures, and as individual enantiomers or diastereoisomers, with all isomeric forms being included in the present invention as well as mixtures thereof. [0495]
  • Pharmaceutically acceptable salts of the compounds of Formula (A1) thru (A11) where a basic or acidic group is present in the structure, are also included within the scope of this invention. When an acidic substituent is present, such as —COOH, there can be formed the ammonium, sodium, potassium, calcium salt, and the like, for use as the dosage form. When a basic group is present, such as amino or a basic heteroaryl radical, such as pyridyl, an acidic salt, such as hydrochloride, hydrobromide, acetate, maleate, pamoate, methanesulfonate, p-toluenesulfonate, and the like, can be used as the dosage form. [0496]
  • Also, in the case of the —COOH being present, pharmaceutically acceptable esters can be employed, e.g., methyl, tert-butyl, pivaloyloxymethyl, and the like, and those esters known in the art for modifying solubility or hydrolysis characteristics for use as sustained release or prodrug formulations. [0497]
  • In addition, some of the compounds of the instant invention may form solvates with water or common organic solvents. Such solvates are encompassed within the scope of the invention. [0498]
  • The term “therapeutically effective amount” shall mean that amount of drug or pharmaceutical agent that will elicit the biological or medical response of a tissue, system, animal, or human that is being sought by a researcher, veterinarian, medical doctor or other clinician. Generally, a daily dose of about 0.5 mg/Kg to 100 mg/Kg body weight in divided doses is suggested to treat PTPase related diseases. Such dosage has to be individualized by the clinician. [0499]
  • The present invention also has the objective of providing suitable topical, oral, and parenteral pharmaceutical formulations for use in the novel methods of treatment of the present invention. The compounds of the present invention may be administered orally as tablets, aqueous or oily suspensions, lozenges, troches, powders, granules, emulsions, capsules, syrups or elixirs. The composition for oral use may contain one or more agents selected from the group of sweetening agents, flavouring agents, colouring agents and preserving agents in order to produce pharmaceutically elegant and palatable preparations. The tablets contain the acting ingredient in admixture with non-toxic pharmaceutically acceptable excipients which are suitable for the manufacture of tablets. These excipients may be, for example, (1) inert diluents, such as calcium carbonate, lactose, calcium phosphate or sodium phosphate; (2) granulating and disintegrating agents, such as corn starch or alginic acid; (3) binding agents, such as starch, gelatin or acacia; and (4) lubricating agents, such as magnesium stearate, stearic acid or talc. These tablets may be uncoated or coated by known techniques to delay disintegration and absorption in the gastrointestinal tract and thereby provide a sustained action over a longer period. For example, a time delay material such as glyceryl monostearate or glyceryl distearate may be employed. Coating may also be performed using techniques described in the U.S. Pat. Nos. 4,256,108; 4,160,452; and 4,265,874 to form osmotic therapeutic tablets for control release. [0500]
  • Formulations for oral use may be in the form of hard gelatin capsules wherein the active ingredient is mixed with an inert solid diluent, for example, calcium carbonate, calcium phosphate or kaolin. They may also be in the form of soft gelatin capsules wherein the active ingredient is mixed with water or an oil medium, such as peanut oil, liquid paraffin or olive oil. [0501]
  • Aqueous suspensions normally contain the active materials in admixture with excipients suitable for the manufacture of aqueous suspension. Such expicients may be: [0502]
  • (1) suspending agent such as sodium carboxymethyl cellulose, methyl cellulose, hydroxypropylmethylcellulose, sodium alginate, polyvinylpyrrolidone, gum tragacanth and gum acacia; [0503]
  • (2) dispersing or wetting agents which may be (a) naturally occurring phosphatide such as lecithin; (b) a condensation product of an alkylene oxide with a fatty acid, for example, polyoxyethylene stearate; (c) a condensation product of ethylene oxide with a long chain aliphatic alcohol, for example, heptadecaethylenoxycetanol; (d) a condensation product of ethylene oxide with a partial ester derived from a fatty acid and hexitol such as polyoxyethylene sorbitol monooleate, or (e) a condensation product of ethylene oxide with a partial ester derived from fatty acids and hexitol anhydrides, for example polyoxyethylene sorbitan monooleate. [0504]
  • The pharmaceutical compositions may be in the form of a sterile injectable aqueous or oleagenous suspension. This suspension may be formulated according to known methods using those suitable dispersing or wetting agents and suspending agents which have been mentioned above. The sterile injectable preparation may also a sterile injectable solution or suspension in a non-toxic parenterally-acceptable diluent or solvent, for example, as a solution in 1,3-butanediol. Among the acceptable vehicles and solvents that may be employed are water, Ringer's solution, and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose, any bland fixed oil may be employed including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid find use in the preparation of injectables. [0505]
  • Compounds of Formula (A1) thru (A11) may also be administered in the form of suppositories for rectal administration of the drug. These compositions can be prepared by mixing the drug with a suitable non-irritating excipient which is solid at ordinary temperature but liquid at the rectal temperature and will therefore melt in the rectum to release the drug. Such materials are cocoa butter and polyethylene glycols. [0506]
  • The compounds of the present invention may also be administered in the form of liposome delivery systems, such as small unilamellar vesicles, large unilamellar vesicles, and multilamellar vesicles. Liposomes can be formed from a variety of phospholipids, such as cholesterol, stearylamine, or phosphatidylcholines. [0507]
  • For topical use, creams, ointments, jellies, solutions or suspensions, etc., containing the compounds of Formula (A1) thru (A11) are employed. [0508]
  • References [0509]
  • 1) Tonks et al., J. Biol. Chem., 263(14):6722-30 (1988). [0510]
  • 2) Hunter, [0511] Cell, 80:225-236 (1995).
  • 3) Cohen, [0512] Trends Biochem. Sci., 17:408-413 (1992).
  • 4) Shenolikar, [0513] Ann. Rev. Cell Biol., 10:55-86 (1994).
  • 5) Bollen et al., [0514] Crit. Rev. Biochem. Mol. Biol., 27:227-81 (1992).
  • 6) MacKintosh and MacKintosh, [0515] TIBS, 19:444-448 (1994).
  • 7) Fisher et al., [0516] Science, 253:401-406 (1991).
  • 8) Hunter and Cooper, [0517] Ann. Rev. Biochem., 54:897-930 (1985).
  • 9) Tonks and Neel, [0518] Cell 87:365-368.
  • 10) Brady-Kalnay and Tonks, [0519] Curr. Opin. Cell. Biol. 7:650-657 (1995).
  • 11) Streuli, [0520] Curr. Opin. Cell. Biol. 8:182-188 (1996).
  • 12) Volberg et al., [0521] The EMBO J. 11:1733-1742 (1992).
  • 13) Bennett et al., J. Cell Sci. 106:891-901 (1993). [0522]
  • 14) Serra-Pages et al., [0523] The EMBO J. 14:2827-2838 (1995).
  • 15) Pulido et al., Proc. Natl. Acad. Sci. 92:11686-11690 (1995). [0524]
  • 16) Cowin, [0525] Proc. Natl. Acad. Sci. 91:10759-10761 (1994).
  • 17) Kinch et al., J. Cell. Biol. 130:461-471 (1995). [0526]
  • 18) Behrens et al., [0527] J. Cell. Biol. 120:757-766 (1993).
  • 19) Matsuyoshi et al., [0528] J. Cell. Biol. 118:703-714 (1992).
  • 20) Brady-Kalnay et al., [0529] J. Cell. Biol. 130:977-986 (1995).
  • 21) Fuchs et al., [0530] J. Biol. Chem. 271:16712-16719 (1996).
  • 22) Brady-Kalnay et al., [0531] J. Cell. Biol. 122:961-972 (1993).
  • 23) Gebbink et al., [0532] J. Biol. Chem. 268:16101-16104 (1993).
  • 24) Sap et al., Mol. Cell. Biol. 14:1-9 (1994). [0533]
  • 25) Peles et al., [0534] Cell 82:251-260 (1995).
  • 26) Bamea et al. [0535] J. Biol. Chem. 269:14349-14352 (1994).
  • 27) Maurel et al., Proc. Natl. Acad. Sci. 91:2512-2516 (1994). [0536]
  • 28) Krueger et al. [0537] Cell 84:611-622 (1996).
  • 29) Adachi et al., [0538] Cell 85:15 (1996).
  • 30) Klingmuller et al., [0539] Cell 80:729-738 (1995).
  • 31) de la Chapelle et al., [0540] Proc. Natl. Acad. Sci. 90:4495-4499 (1993).
  • 32) Yi et al., Mol. Cell. Biol. 13:7577-7586 (1993) [0541]
  • 33) Shisheva and Shechter, [0542] Endocrinology 133:1562-1568 (1993).
  • 34) Fantus, et al., [0543] Biochemistry 28:8864-8871 (1989).
  • 35) Kadota, et al., Biochem. Biophys. Res. Comm. 147:259-266 (1987). [0544]
  • 36) Kadota, et al., [0545] J. Biol. Chem. 262:8252-8256 (1987).
  • 37) Kulas, et al., [0546] J. Biol. Chem. 270:2435-2438 (1995).
  • 38) Ahmad et al., [0547] J. Biol. Chem. 270:20503-20508 (1995).
  • 39) Moller, et al., [0548] J. Biol. Chem. 271:23126-23131 (1995).
  • 40) Kulas et al., [0549] J. Biol. Chem. 271:755-760 (1996).
  • 41) Ahmad, et al., J. Clin. Invest. 95:2806-2812 (1995). [0550]
  • 42) Trowbridge, [0551] Annu. Rev. Immunol. 12:85-116 (1994).
  • 43) Saltiel, [0552] Am. J. Physiol. 270:E375-385 (1996).
  • 44) Draznin, [0553] Endocrinology 137:2647-2648.
  • 45) Bennett, et al., Proc. Natl. Acad. Sci. 91:7335-7339 (1994). [0554]
  • 46) Case, et al., [0555] J. Biol. Chem. 269:10467-10474 (1994).
  • 47) Kharitonenkov, et al., [0556] J. Biol. Chem. 270:29189-29193 (1995).
  • 48) Kuhne, et al., [0557] J. Biol. Chem. 268:11479-11481 (1993).
  • 49) Milarski and Saltiel, [0558] J. Biol. Chem. 269:21239-21243 (1994).
  • 50) Xiao et al., [0559] J. Biol. Chem. 269:21244-21248 (1994).
  • 51) Yamauchi et al., Proc. Natl. Acad. Sci. 92:664-668 (1995). [0560]
  • 52) MacKintosh and MacKintosh, [0561] TIBS, 19:444-448 (1994).
  • 53) Weiner et al., J. Natl. Cancer Inst., 86:372-8 (1994). [0562]
  • 54) Weiner et al., Am J. Obstet. Gynecol., 170:1177-883 (1994). [0563]
  • 55) Ghosh and Miller, [0564] Biochem. Biophys. Res. Comm. 194:36-44 (1993).
  • 56) Bliska et al., Proc. Natl. Acad Sci. USA, 88:1187-91 (1991). [0565]
  • 57) Posner et al, [0566] J. Biol. Chem., 269:4596-4604 (1994).
  • 58) Chatterjee et al., “Phosphopeptide substrates and phosphonopeptide inhibitors of protein tyrosine phosphatases,” in [0567] Peptides: Chemistry and Biology (Rivier and Smith, Eds.), 1992, Escom Science Publishers: Leiden, Netherlands, pp. 553-55.
  • 59) Burke et al., [0568] Biochemistry, 33:6490-94 (1994).
  • 60) Burke et al., Biochem. Biophys. Res. Comm. 204(1):129-134 (1994). [0569]
  • 61) Patel et al [0570] J. Org. Chem., 1977, 42, 3903.
  • 62) J. Am. Chem. Soc., 1991, 113, 9585. [0571]
  • 63) J. Am. Chem. Soc., 1989, 111, 314. [0572]
  • 64) Mathias [0573] Synthesis 1979, 561.
  • 65) Sarantakis et al [0574] Biochem. Biophys. Res. Commun. 1976, 73, 336.
  • 66) Hudson et al [0575] Peptide Chemistry 1985 (Kiso, Y., ed.), 1986, Protein Research Foundation, Osaka.
  • 67) Wang [0576] J. Am. Chem. Soc. 1973, 95, 1328.
  • 68) Lu et al [0577] J. Org. Chem. 1981, 46, 3433.
  • 69) Morphy et al [0578] Tetrahedron Letters 1996, 37, 3209.
  • 70) Yedidia et al [0579] Can. J. Chem. 1980, 58, 1144.
  • 71) Araneo et al [0580] Tetrahedron Lett. 1994, 35, 2213.
  • 72) Passerini [0581] Gazz. Chim. Ital. 1926, 56, 826.
  • 73) Zhang et al [0582] Tetrahedron Letters 1996, 37, 751.
  • 74) Krieg et al [0583] Z Naturforsch teil 1967, 22b, 132.
  • 75) Wasserman et al [0584] J. Org. Chem., 1995, 60, 8231.
  • 76) Wasserman et al [0585] J. Org. Chem., 1993, 58, 4785.
  • 77) Brackeen et al [0586] Tetrahedron Letters 1994, 35, 1635.
  • 78) Gunn et al [0587] J. Org. Chem. 1977, 42, 754.
  • 79) Bossio et al [0588] Liebigs Ann. Chem. 1991, 1107.
  • 80) Hoppe et al., Eur. J. Biochem., 223:1069-77 (1994). [0589]
  • 81) Barford, D., et al., [0590] J. Molec. Biol., 239:726-730 (1994).
  • 82) Chemoff et al., Proc. Natl. Acad. Sci. USA, 87:2735-2739 (1990). [0591]
  • 83) Charbonneau et al. Proc. Natl. Acad. Sci. USA, 86:5252-5256 (1989). [0592]
  • 84) Imbert et al., [0593] Biochem J, 297:163-173 (1994).
  • 85) Ghosh and Miller, [0594] Biochem. Biophys. Res. Comm., 194:36-44 (1993).
  • 86) Zanke et al., [0595] Eur. J. Immunol., 22:235-39 (1992).

Claims (266)

What is claimed is:
1. A protein tyrosine phosphatase activity-modulating compound with the structure depicted in Formula (B):
X—C(R′)═C(R″)COOR″′  (b)
wherein
(i) R′ and R″ are independently selected from the group consisting of hydrogen, halo, cyano, nitro, trihalomethyl, C1-11alkyl, optionally substituted arylC1-11alkyl wherein the aryl substituents are independently selected from the group consisting of hydrogen, halo, nitro, cyano, trihalomethyl, hydroxypyronyl, C1-11alkyl, arylC1-11alkyl, C0-11alkyloxyC0-11alkyl, arylC0-11alkyloxyC0-11alkyl, C0-11alkylthioC0-11alkyl, arylC0-11alkylthioC0-11alkyl, C0-11alkylaminoC0-11alkyl, arylC0-11alkylaminoC0-11alkyl, di(arylC1-11alkyl)aminoC0-11alkyl, C1-11alkylcarbonylC0-11alkyl, arylC1-11alkylcarbonylC0-11alkyl, C1-11alkylcarboxyC0-11alkyl, arylC1-11alkylcarboxyC0-11alkyl, C1-11alkylcarbonylaminoC0-11alkyl, arylC1-11alkylcarbonylaminoC0-11alkyl, —C0-11alkylCOOR1, —C0-11alkylCONR2R3 wherein R1, R2 and R3 are independently selected from hydrogen, C1-C11alkyl, arylC0-C11alkyl, or R2 and R3 are taken together with the nitrogen to which they are attached forming a cyclic system containing 3 to 8 carbon atoms with at least one C1-C11alkyl, arylC0-C11alkyl substituent.
(ii) R″′ is selected from the group consisting of
(a) hydrogen,
(b) C1-11alkyl, substituted C1-11alkyl wherein the substituents are independently selected from halo, cyano, nitro, trihalomethyl, carbamoyl, tetrahydrofuryl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, hydroxypyronyl, C0-11alkyloxy, arylC0-11alkyloxy, C0-11alkylthio, arylC0-11alkylthio, C0-11alkylamino, arylC0-11alkylamino, di(arylC0-11alkyl)amino, C1-11alkylcarbonyl, arylC1-11alkylcarbonyl, C1-11alkylcarboxy, arylC1-11alkylcarboxy, C1-11alkylcarbonylamino, aryl C1-11alkylcarbonylamino, —C0-11alkylCOOR4, —C0-11alkylCONR5R6 wherein R4, R5 and R6 are independently selected from hydrogen, C1-C11alkyl, arylC0-C11alkyl, or R5 and R6 are taken together with the nitrogen to which they are attached forming a cyclic system containing 3 to 8 carbon atoms with at least one C1-C11alkyl, arylC0-C11alkyl substituent,
(c) mono-, di- and tri-substituted arylC0-C11alkyl wherein the aryl substituents are defined as above for R′ and R″,
(iii) X is a mono-, di- or trisubstituted aryl wherein the aryl substituents are defined as above for R′ and R″, and aryl is selected from phenyl, biphenyl, naphthyl, dihydronaphthyl, tetrahydronaphthyl, indenyl, indanyl, azulenyl, anthryl, phenanthryl, fluorenyl, pyrenyl, thienyl, benzothienyl, isobenzothienyl, 2,3-dihydrobenzothienyl, furyl, pyranyl, benzofuranyl, isobenzofuranyl, 2,3-dihydrobenzofuranyl, pyrrolyl, indolyl, isoindolyl, indolizinyl, indazolyl, imidazolyl, benzimidazolyl, pyridyl, pyrazinyl, pyradazinyl, pyrimidinyl, triazinyl, quinolyl, isoquinolyl, 4H-quinolizinyl, cinnolinyl, phthalazinyl, quinazolinyl, quinoxalinyl, 1,8-naphthyridinyl, pteridinyl, carbazolyl, acridinyl, phenazinyl, phenothiazinyl, phenoxazinyl, chromanyl, benzodioxolyl, piperonyl, purinyl, hydroxypyronyl, pyrazolyl, triazolyl, tetrazolyl, thiazolyl, isothiazolyl, benzthiazolyl, oxazolyl, isoxazolyl, benzoxazolyl, oxadiazolyl, or thiadiazolyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
2. A compound as defined in claim 1 wherein aryl is selected from phenyl, biphenyl, naphthyl, dihydronaphthyl, tetrahydronaphthyl, indenyl, indanyl, azulenyl, anthryl, phenanthryl, fluorenyl, pyrenyl, or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
3. A compound as defined in claim 1 wherein aryl is selected from thienyl, benzothienyl, isobenzothienyl, 2,3-dihydrobenzothienyl, furyl, pyranyl, benzofuranyl, isobenzofuranyl, 2,3-dihydrobenzofuranyl, pyrrolyl, indolyl, isoindolyl, indolizinyl, indazolyl, imidazolyl, benzimidazolyl, pyridyl, pyrazinyl, pyradazinyl, pyrimidinyl, triazinyl, quinolyl, isoquinolyl, 4H-quinolizinyl, cinnolinyl, phthalazinyl, quinazolinyl, quinoxalinyl, 1,8-naphthyridinyl, pteridinyl, carbazolyl, acridinyl, phenazinyl, phenothiazinyl, phenoxazinyl, chromanyl, benzodioxolyl, piperonyl, purinyl, hydroxypyronyl, pyrazolyl, triazolyl, tetrazolyl, thiazolyl, isothiazolyl, benzthiazolyl, oxazolyl, isoxazolyl, benzoxazolyl, oxadiazolyl, thiadiazolyl, or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
4. A compound as defined in claim 1 wherein aryl is selected from thienyl, benzothienyl, isobenzothienyl, 2,3-dihydrobenzothienyl, phenothiazinyl, thiazolyl, isothiazolyl, benzthiazolyl, thiadiazolyl, or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
5. A compound as defined in claim 1 wherein aryl is selected from furyl, pyranyl, benzofuranyl, isobenzofuranyl, 2,3-dihydrobenzofuranyl, phenoxazinyl, chromanyl, benzodioxolyl, hydroxypyronyl, oxazolyl, isoxazolyl, benzoxazolyl, oxadiazolyl, or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
6. A compound as defined in claim 1 wherein aryl is selected from pyrrolyl, indolyl, isoindolyl, indolizinyl, indazolyl, imidazolyl, benzimidazolyl, pyridyl, pyrazinyl, pyradazinyl, pyrimidinyl, triazinyl, quinolyl, isoquinolyl, 4H-quinolizinyl, cinnolinyl, phthalazinyl, quinazolinyl, quinoxalinyl, 1,8-naphthyridinyl, pteridinyl, carbazolyl, acridinyl, phenazinyl, phenothiazinyl, phenoxazinyl, purinyl, pyrazolyl, triazolyl, tetrazolyl, thiazolyl, isothiazolyl, benzthiazolyl, oxazolyl, isoxazolyl, benzoxazolyl, oxadiazolyl, thiadiazolyl, or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
7. A compound as defined in claim 1 wherein aryl is selected from phenyl, naphthyl, biphenyl, thienyl, benzothienyl, isobenzothienyl, furyl, benzofuranyl, isobenzofuranyl, pyrrolyl, indolyl, isoindolyl, imidazolyl, benzimidazolyl, pyridyl, pyrazinyl, pyradazinyl, pyrimidinyl, quinolyl, isoquinolyl, phthalazinyl, quinazolinyl, quinoxalinyl, hydroxypyronyl, pyrazolyl, triazolyl, tetrazolyl, thiazolyl, isothiazolyl, benzthiazolyl, oxazolyl, isoxazolyl, benzoxazolyl, oxadiazolyl, thiadiazolyl, or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
8. A compound as defined in claim 1 wherein aryl is selected from phenyl, naphthyl, biphenyl, thienyl, benzothienyl, furyl, benzofuranyl, pyrrolyl, indolyl, imidazolyl, benzimidazolyl, pyridyl, quinolyl, thiazolyl, benzthiazolyl, oxazolyl, benzoxazolyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
9. A compound as defined in claim 1 wherein aryl is selected from phenyl, naphthyl, biphenyl, thienyl, furyl, pyridyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
10. A compound as defined in claim 1 wherein aryl is phenyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
11. A compound as defined in claim 1 wherein aryl is naphthyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
12. A compound as defined in claim 1 wherein aryl is biphenyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
13. A compound as defined in claim 1 wherein aryl is thienyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
14. A compound as defined in claim 1 wherein aryl is furyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
15. A compound as defined in claim 1 wherein aryl is pyridyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
16. A compound with the structure depicted in Formula (A2):
Figure US20020183518A1-20021205-C00248
wherein at least one of R1, R2 and R3 substituents has the general structure depicted in Formula (B)
X—C(R′)═C(R″)COOR″′  (B)
wherein
(i) R′ and R″ are independently selected from the group consisting of hydrogen, halo, cyano, nitro, trihalomethyl, C1-11alkyl, optionally substituted arylC1-11alkyl wherein the aryl substituents are independently selected from the group consisting of hydrogen, halo, nitro, cyano, trihalomethyl, hydroxypyronyl, C1-11alkyl, arylC1-11alkyl, C0-11alkyloxyC0-11alkyl, arylC0-11alkyloxyC0-11alkyl, C0-11alkylthioC0-11alkyl, arylC0-11alkylthioC0-11alkyl, C0-11alkylaminoC0-11alkyl, arylC0-11alkylaminoC0-11alkyl, di(arylC1-11alkyl)aminoC0-11alkyl, C1-11alkylcarbonylC0-11alkyl, arylC1-11alkylcarbonylC0-11alkyl, C1-11alkylcarboxyC0-11alkyl, arylC1-11alkylcarboxyC0-11alkyl, C1-11alkylcarbonylaminoC0-11alkyl, arylC1-11alkylcarbonylaminoC0-11alkyl, —C0-11alkylCOOR4, —C0-11alkylCONR5R6 wherein R4, R5 and R6 are independently selected from hydrogen, C1-C11alkyl, arylC0-C11alkyl, or R5 and R6 are taken together with the nitrogen to which they are attached forming a cyclic system containing 3 to 8 carbon atoms with at least one C1-C11alkyl, arylC0-C11alkyl substituent.
(ii) R″′ is selected from the group consisting of
(a) hydrogen,
(b) C1-11alkyl, substituted C1-11alkyl wherein the substituents are independently selected from halo, cyano, nitro, trihalomethyl, carbamoyl, tetrahydrofuryl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, hydroxypyronyl, C0-11alkyloxy, arylC0-11alkyloxy, C0-11alkylthio, arylC0-11alkylthio, C0-11alkylamino, arylC0-11alkylamino, di(arylC0-11alkyl)amino, C1-11alkylcarbonyl, arylC1-11alkylcarbonyl, C1-11alkylcarboxy, arylC1-11alkylcarboxy, C1-11alkylcarbonylamino, aryl C1-11alkylcarbonylamino, —C0-11alkylCOOR7, —C0-11alkylCONR8R9 wherein R7, R8 and R9 are independently selected from hydrogen, C1-C11alkyl, arylC0-C11alkyl, or R8 and R9 are taken together with the nitrogen to which they are attached forming a cyclic system containing 3 to 8 carbon atoms with at least one C1-C11alkyl, arylC0-C11alkyl substituent,
(c) mono-, di- and tri-substituted arylC0-C11alkyl wherein the aryl substituents are defined as above for R′ and R″,
(iii) X is a mono-, di- or trisubstituted aryl wherein the aryl substituents are defined as above for R′ and R″, and aryl is selected from phenyl, biphenyl, naphthyl, dihydronaphthyl, tetrahydronaphthyl, indenyl, indanyl, azulenyl, anthryl, phenanthryl, fluorenyl, pyrenyl, thienyl, benzothienyl, isobenzothienyl, 2,3-dihydrobenzothienyl, furyl, pyranyl, benzofuranyl, isobenzofuranyl, 2,3-dihydrobenzofuranyl, pyrrolyl, indolyl, isoindolyl, indolizinyl, indazolyl, imidazolyl, benzimidazolyl, pyridyl, pyrazinyl, pyradazinyl, pyrimidinyl, triazinyl, quinolyl, isoquinolyl, 4H-quinolizinyl, cinnolinyl, phthalazinyl, quinazolinyl, quinoxalinyl, 1,8-naphthyridinyl, pteridinyl, carbazolyl, acridinyl, phenazinyl, phenothiazinyl, phenoxazinyl, chromanyl, benzodioxolyl, piperonyl, purinyl, hydroxypyronyl, pyrazolyl, triazolyl, tetrazolyl, thiazolyl, isothiazolyl, benzthiazolyl, oxazolyl, isoxazolyl, benzoxazolyl, oxadiazolyl, or thiadiazolyl,
and wherein the remaining of R1, R2 and R3 are independently selected from the group consisting of:
(i) hydrogen;
(ii) C1-11alkyl, substituted C1-11alkyl wherein the alkyl substituents are defined as above,
(iii) arylC0-11alkyl,
(iv) mono-, di- and tri-substituted arylC0-C11alkyl wherein the aryl substituents are defined as above,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
17. A compound as defined in claim 16 wherein aryl is selected from phenyl, naphthyl, biphenyl, thienyl, furyl, pyridyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
18. A compound as defined in claim 16 wherein aryl is phenyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
19. A compound as defined in claim 16 wherein aryl is naphthyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
20. A compound as defined in claim 16 wherein aryl is biphenyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
21. A compound as defined in claim 16 wherein aryl is thienyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
22. A compound as defined in claim 16 wherein aryl is furyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
23. A compound as defined in claim 16 wherein aryl is pyridyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
24. A compound with the structure depicted in Formula (A3):
Figure US20020183518A1-20021205-C00249
wherein at least one of R1, R2 and R3 substituents has the general structure depicted in Formula (B)
X—C(R′)═C(R″)COOR″′  (B)
wherein
(i) R′ and R″ are independently selected from the group consisting of hydrogen, halo, cyano, nitro, trihalomethyl, C1-11alkyl, optionally substituted arylC1-11alkyl wherein the aryl substituents are independently selected from the group consisting of hydrogen, halo, nitro, cyano, trihalomethyl, hydroxypyronyl, C1-11alkyl, arylC1-11alkyl, C0-11alkyloxyC0-11alkyl, arylC0-11alkyloxyC0-11alkyl, C0-11alkylthioC0-11alkyl, arylC0-11alkylthioC0-11alkyl, C0-11alkylaminoC0-11alkyl, arylC0-11alkylaminoC0-11alkyl, di(arylC1-11alkyl)aminoC0-11alkyl, C1-11alkylcarbonylC0-11alkyl, arylC1-11alkylcarbonylC0-11alkyl, C1-11alkylcarboxyC0-11alkyl, arylC1-11alkylcarboxyC0-11alkyl, C1-11alkylcarbonylaminoC0-11alkyl, arylC1-11alkylcarbonylaminoC0-11alkyl, —C0-11alkylCOOR4, —C0-11alkylCONR5R6 wherein R4, R5 and R6 are independently selected from hydrogen, C1-C11alkyl, arylC0-C11alkyl, or R5 and R6 are taken together with the nitrogen to which they are attached forming a cyclic system containing 3 to 8 carbon atoms with at least one C1-C11alkyl, arylC0-C11alkyl substituent.
(ii) R″′ is selected from the group consisting of
(a) hydrogen,
(b) C1-11alkyl, substituted C1-11alkyl wherein the substituents are independently selected from halo, cyano, nitro, trihalomethyl, carbamoyl, tetrahydrofuryl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, hydroxypyronyl, C0-11alkyloxy, arylC0-11alkyloxy, C0-11alkylthio, arylC0-11alkylthio, C0-11alkylamino, arylC0-11alkylamino, di(arylC0-11alkyl)amino, C1-11alkylcarbonyl, arylC1-11alkylcarbonyl, C1-11alkylcarboxy, arylC1-11alkylcarboxy, C1-11alkylcarbonylamino, arylC1-11alkylcarbonylamino, —C0-11alkylCOOR7, —C0-11alkylCONR8R9 wherein R7, R8 and R9 are independently selected from hydrogen, C1-C11alkyl, arylC0-C11alkyl, or R8 and R9 are taken together with the nitrogen to which they are attached forming a cyclic system containing 3 to 8 carbon atoms with at least one C1-C11alkyl, arylC0-C11alkyl substituent,
(c) mono-, di- and tri-substituted arylC0-C11alkyl wherein the aryl substituents are defined as above for R′ and R″,
(iii) X is a mono-, di- or trisubstituted aryl wherein the aryl substituents are defined as above for R′ and R″, and aryl is selected from phenyl, biphenyl, naphthyl, dihydronaphthyl, tetrahydronaphthyl, indenyl, indanyl, azulenyl, anthryl, phenanthryl, fluorenyl, pyrenyl, thienyl, benzothienyl, isobenzothienyl, 2,3-dihydrobenzothienyl, furyl, pyranyl, benzofuranyl, isobenzofuranyl, 2,3-dihydrobenzofuranyl, pyrrolyl, indolyl, isoindolyl, indolizinyl, indazolyl, imidazolyl, benzimidazolyl, pyridyl, pyrazinyl, pyradazinyl, pyrimidinyl, triazinyl, quinolyl, isoquinolyl, 4H-quinolizinyl, cinnolinyl, phthalazinyl, quinazolinyl, quinoxalinyl, 1,8-naphthyridinyl, pteridinyl, carbazolyl, acridinyl, phenazinyl, phenothiazinyl, phenoxazinyl, chromanyl, benzodioxolyl, piperonyl, purinyl, hydroxypyronyl, pyrazolyl, triazolyl, tetrazolyl, thiazolyl, isothiazolyl, benzthiazolyl, oxazolyl, isoxazolyl, benzoxazolyl, oxadiazolyl, or thiadiazolyl,
and wherein the remaining of R1, R2 and R3 are independently selected from the group consisting of:
(i) hydrogen;
(ii) C1-11alkyl, substituted C1-11alkyl, C1-11alkylcarbonyl, substituted C1-11alkylcarbonyl wherein the alkyl substituents are defined as above,
(iii) arylC0-11alkyl, arylC0-11alkylcarbonyl,
(iv) mono-, di- and tri-substituted arylC0-C11alkyl, mono-, di- and tri-substituted arylC0-C11alkylcarbonyl wherein the aryl substituents are defined as above,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
25. A compound as defined in claim 24 wherein aryl is selected from phenyl, naphthyl, biphenyl, thienyl, furyl, pyridyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
26. A compound as defined in claim 24 wherein aryl is phenyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
27. A compound as defined in claim 24 wherein aryl is naphthyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
28. A compound as defined in claim 24 wherein aryl is thienyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
29. A compound as defined in claim 24 wherein aryl is furyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
30. A compound as defined in claim 24 wherein aryl is pyridyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
31. A compound with the structure depicted in Formula (A4):
Figure US20020183518A1-20021205-C00250
wherein at least one of R1, R2 substituents has the general structure depicted in Formula (B)
X—C(R′)═C(R″)COOR″′  (B)
wherein
(i) R′ and R″ are independently selected from the group consisting of hydrogen, halo, cyano, nitro, trihalomethyl, C1-11alkyl, optionally substituted arylC1-11alkyl wherein the aryl substituents are independently selected from the group consisting of hydrogen, halo, nitro, cyano, trihalomethyl, hydroxypyronyl, C1-11alkyl, arylC1-11alkyl, C0-11alkyloxyC0-11alkyl, arylC0-11alkyloxyC0-11alkyl, C0-11alkylthioC0-1alkyl, arylC0-11alkylthioC0-11alkyl, C0-11alkylaminoC0-11alkyl, arylC0-11alkylaminoC0-11alkyl, di(arylC1-11alkyl)aminoC0-11alkyl, C1-11alkylcarbonylC0-11alkyl, arylC1-11alkylcarbonylC0-11alkyl, C1-11alkylcarboxyC0-11alkyl, arylC1-11alkylcarboxyC0-11alkyl, C1-11alkylcarbonylaminoC0-11alkyl, arylC1-11alkylcarbonylaminoC0-11alkyl, —C0-11alkylCOOR3, —C0-11alkylCONR4R5 wherein R3, R4 and R5 are independently selected from hydrogen, C1-C11alkyl, arylC0-C11alkyl, or R4 and R5 are taken together with the nitrogen to which they are attached forming a cyclic system containing 3 to 8 carbon atoms with at least one C1-C11alkyl, arylC0-C11alkyl substituent.
(ii) R″′ is selected from the group consisting of
(a) hydrogen,
(b) C1-11alkyl, substituted C1-11alkyl wherein the substituents are independently selected from halo, cyano, nitro, trihalomethyl, carbamoyl, tetrahydrofuryl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, hydroxypyronyl, C0-11alkyloxy, arylC0-11alkyloxy, C0-11alkylthio, arylC0-11alkylthio, C0-11alkylamino, arylC0-11alkylamino, di(arylC0-11alkyl)amino, C1-11alkylcarbonyl, arylC1-11alkylcarbonyl, C1-11alkylcarboxy, arylC1-11alkylcarboxy, C1-11alkylcarbonylamino, aryl C1-11alkylcarbonylamino, —C0-11alkylCOOR6, —C0-11alkylCONR7R8 wherein R6, R7 and R8 are independently selected from hydrogen, C1-C11alkyl, arylC0-C11alkyl, or R7 and R8 are taken together with the nitrogen to which they are attached forming a cyclic system containing 3 to 8 carbon atoms with at least one C1-C11alkyl, arylC0-C11alkyl substituent,
(c) mono-, di- and tri-substituted arylC0-C11alkyl wherein the aryl substituents are defined as above for R′ and R″,
(iii) X is a mono-, di- or trisubstituted aryl wherein the aryl substituents are defined as above for R′ and R″, and aryl is selected from phenyl, biphenyl, naphthyl, dihydronaphthyl, tetrahydronaphthyl, indenyl, indanyl, azulenyl, anthryl, phenanthryl, fluorenyl, pyrenyl, thienyl, benzothienyl, isobenzothienyl, 2,3-dihydrobenzothienyl, furyl, pyranyl, benzofuranyl, isobenzofuranyl, 2,3-dihydrobenzofuranyl, pyrrolyl, indolyl, isoindolyl, indolizinyl, indazolyl, imidazolyl, benzimidazolyl, pyridyl, pyrazinyl, pyradazinyl, pyrimidinyl, triazinyl, quinolyl, isoquinolyl, 4H-quinolizinyl, cinnolinyl, phthalazinyl, quinazolinyl, quinoxalinyl, 1,8-naphthyridinyl, pteridinyl, carbazolyl, acridinyl, phenazinyl, phenothiazinyl, phenoxazinyl, chromanyl, benzodioxolyl, piperonyl, purinyl, hydroxypyronyl, pyrazolyl, triazolyl, tetrazolyl, thiazolyl, isothiazolyl, benzthiazolyl, oxazolyl, isoxazolyl, benzoxazolyl, oxadiazolyl, or thiadiazolyl,
and wherein the remaining of R1, R2 is selected from the group consisting of:
(i) hydrogen;
(ii) C1-11alkyl, substituted C1-11alkyl wherein the alkyl substituents are defined as above,
(iii) arylC0-11alkyl,
(iv) mono-, di- and tri-substituted arylC0-C11alkyl wherein the aryl substituents are defined as above,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
32. A compound as defined in claim 31 wherein aryl is selected from phenyl, naphthyl, biphenyl, thienyl, furyl, pyridyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
33. A compound as defined in claim 31 wherein aryl is phenyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
34. A compound as defined in claim 31 wherein aryl is naphthyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
35. A compound as defined in claim 31 wherein aryl is biphenyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
36. A compound as defined in claim 31 wherein aryl is thienyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
37. A compound as defined in claim 31 wherein aryl is furyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
38. A compound as defined in claim 31 wherein aryl is pyridyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
39. A compound with the structure depicted in Formula (A5):
Figure US20020183518A1-20021205-C00251
wherein at least one of R1, R2 substituents has the general structure depicted in Formula (B)
X—C(R′)═C(R″)COOR″′  (B)
wherein
(i) R′ and R″ are independently selected from the group consisting of hydrogen, halo, cyano, nitro, trihalomethyl, C1-11alkyl, optionally substituted arylC1-11alkyl wherein the aryl substituents are independently selected from the group consisting of hydrogen, halo, nitro, cyano, trihalomethyl, hydroxypyronyl, C1-11alkyl, arylC1-11alkyl, C0-11alkyloxyC0-11alkyl, arylC0-11alkyloxyC0-11alkyl, C0-11alkylthioC0-11alkyl, arylC0-11alkylthioC0-11alkyl, C0-11alkylaminoC0-11alkyl, arylC0-11alkylaminoC0-11alkyl, di(arylC1-11alkyl)aminoC0-11alkyl, C1-11alkylcarbonylC0-11alkyl, arylC1-11alkylcarbonylC0-11alkyl, C1-11alkylcarboxyC0-11alkyl, arylC1-11alkylcarboxyC0-11alkyl, C1-11alkylcarbonylaminoC0-11alkyl, arylC1-11alkylcarbonylaminoC0-11alkyl, —C0-11alkylCOOR3, —C0-11alkylCONR4R5 wherein R3, R4 and R5 are independently selected from hydrogen, C1-C11alkyl, arylC0-C11alkyl, or R4 and R5 are taken together with the nitrogen to which they are attached forming a cyclic system containing 3 to 8 carbon atoms with at least one C1-C11alkyl, arylC0-C11alkyl substituent.
(ii) R″′ is selected from the group consisting of
(a) hydrogen,
(b) C1-11alkyl, substituted C1-11alkyl wherein the substituents are independently selected from halo, cyano, nitro, trihalomethyl, carbamoyl, tetrahydrofuryl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, hydroxypyronyl, C0-11alkyloxy, arylC0-11alkyloxy, C0-11alkylthio, arylC0-11alkylthio, C0-11alkylamino, arylC0-11alkylamino, di(arylC1-11alkyl)amino, C1-11alkylcarbonyl, arylC1-11alkylcarbonyl, C1-11alkylcarboxy, arylC1-11alkylcarboxy, C1-11alkylcarbonylamino, aryl C1-11alkylcarbonylamino, —C0-11alkylCOOR6, —C0-11alkylCONR7R wherein R6, R7 and R8 are independently selected from hydrogen, C1-C11alkyl, arylC0-C11alkyl, or R7 and R8 are taken together with the nitrogen to which they are attached forming a cyclic system containing 3 to 8 carbon atoms with at least one C1-C11alkyl, arylC0-C11alkyl substituent,
(c) mono-, di- and ti-substituted arylC0-C11alkyl wherein the aryl substituents are defined as above for R′ and R″,
(iii) X is a mono-, di- or trisubstituted aryl wherein the aryl substituents are defined as above for R′ and R″, and aryl is selected from phenyl, biphenyl, naphthyl, dihydronaphthyl, tetrahydronaphthyl, indenyl, indanyl, azulenyl, anthryl, phenanthryl, fluorenyl, pyrenyl, thienyl, benzothienyl, isobenzothienyl, 2,3-dihydrobenzothienyl, furyl, pyranyl, benzofuranyl, isobenzofuranyl, 2,3-dihydrobenzofuranyl, pyrrolyl, indolyl, isoindolyl, indolizinyl, indazolyl, imidazolyl, benzimidazolyl, pyridyl, pyrazinyl, pyradazinyl, pyrimidinyl, triazinyl, quinolyl, isoquinolyl, 4H-quinolizinyl, cinnolinyl, phthalazinyl, quinazolinyl, quinoxalinyl, 1,8-naphthyridinyl, pteridinyl, carbazolyl, acridinyl, phenazinyl, phenothiazinyl, phenoxazinyl, chromanyl, benzodioxolyl, piperonyl, purinyl, hydroxypyronyl, pyrazolyl, triazolyl, tetrazolyl, thiazolyl, isothiazolyl, benzthiazolyl, oxazolyl, isoxazolyl, benzoxazolyl, oxadiazolyl, or thiadiazolyl,
and wherein the remaining of R1, R2 is selected from the group consisting of:
(i) hydrogen;
(ii) C1-11alkyl, substituted C1-11alkyl wherein the alkyl substituents are defined as above,
(iii) arylC0-11alkyl,
(iv) mono-, di- and tri-substituted arylC0-C11alkyl wherein the aryl substituents are defined as above,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
40. A compound as defined in claim 39 wherein aryl is selected from phenyl, naphthyl, biphenyl, thienyl, furyl, pyridyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
41. A compound as defined in claim 39 wherein aryl is phenyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
42. A compound as defined in claim 39 wherein aryl is naphthyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
43. A compound as defined in claim 39 wherein aryl is biphenyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
44. A compound as defined in claim 39 wherein aryl is thienyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
45. A compound as defined in claim 39 wherein aryl is furyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
46. A compound as defined in claim 39 wherein aryl is pyridyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
47. A compound with the structure depicted in Formula (A6):
Figure US20020183518A1-20021205-C00252
wherein at least one of R1, R2, R3 and R4 substituents has the general structure depicted in Formula (B)
X—C(R′)═C(R″)COOR″′  (B)
wherein
(i) R′ and R″ are independently selected from the group consisting of hydrogen, halo, cyano, nitro, trihalomethyl, C1-11alkyl, optionally substituted arylC1-11alkyl wherein the aryl substituents are independently selected from the group consisting of hydrogen, halo, nitro, cyano, trihalomethyl, hydroxypyronyl, C1-11alkyl, arylC1-11alkyl, C0-11alkyloxyC0-11alkyl, arylC0-11alkyloxyC0-11alkyl, C0-11alkylthioC0-11alkyl, arylC0-11alkylthioC0-11alkyl, C0-11alkylaminoC0-11alkyl, arylC0-11alkylaminoC0-11alkyl, di(arylC1-11alkyl)aminoC0-11alkyl, C1-11alkylcarbonylC0-11alkyl, arylC1-11alkylcarbonylC0-11alkyl, C1-11alkylcarboxyC0-11alkyl, arylC1-11alkylcarboxyC0-11alkyl, C1-11alkylcarbonylaminoC0-11alkyl, arylC1-11alkylcarbonylaminoC0-11alkyl, —C0-11alkylCOOR5, —C0-11alkylCONR6R7 wherein R5, R6 and R7 are independently selected from hydrogen, C1-C11alkyl, arylC0-C11alkyl, or R6 and R7 are taken together with the nitrogen to which they are attached forming a cyclic system containing 3 to 8 carbon atoms with at least one C1-C11alkyl, arylC0-C11alkyl substituent.
(ii) R″′ is selected from the group consisting of
(a) hydrogen,
(b) C1-11alkyl, substituted C1-11alkyl wherein the substituents are independently selected from halo, cyano, nitro, trihalomethyl, carbamoyl, tetrahydrofuryl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, hydroxypyronyl, C0-11alkyloxy, arylC0-11alkyloxy, C0-11alkylthio, arylC0-11alkylthio, C0-11alkylamino, arylC0-11alkylamino, di(arylC0-11alkyl)amino, C1-11alkylcarbonyl, arylC1-11alkylcarbonyl, C1-11alkylcarboxy, arylC1-11alkylcarboxy, C1-11alkylcarbonylamino, aryl C1-11alkylcarbonylamino, —C0-11alkylCOOR8, —C0-11alkylCONR9R10 wherein R8, R9 and R10 are independently selected from hydrogen, C1-C11alkyl, arylC0-C11alkyl, or R9 and R10 are taken together with the nitrogen to which they are attached forming a cyclic system containing 3 to 8 carbon atoms with at least one C1-C11alkyl, arylC0-C11alkyl substituent,
(c) mono-, di- and tri-substituted arylC0-C11alkyl wherein the aryl substituents are defined as above for R′ and R″,
(iii) X is a mono-, di- or trisubstituted aryl wherein the aryl substituents are defined as above for R′ and R″, and aryl is selected from phenyl, biphenyl, naphthyl, dihydronaphthyl, tetrahydronaphthyl, indenyl, indanyl, azulenyl, anthryl, phenanthryl, fluorenyl, pyrenyl, thienyl, benzothienyl, isobenzothienyl, 2,3-dihydrobenzothienyl, furyl, pyranyl, benzofuranyl, isobenzofuranyl, 2,3-dihydrobenzofuranyl, pyrrolyl, indolyl, isoindolyl, indolizinyl, indazolyl, imidazolyl, benzimidazolyl, pyridyl, pyrazinyl, pyradazinyl, pyrimidinyl, triazinyl, quinolyl, isoquinolyl, 4H-quinolizinyl, cinnolinyl, phthalazinyl, quinazolinyl, quinoxalinyl, 1,8-naphthyridinyl, pteridinyl, carbazolyl, acridinyl, phenazinyl, phenothiazinyl, phenoxazinyl, chromanyl, benzodioxolyl, piperonyl, purinyl, hydroxypyronyl, pyrazolyl, triazolyl, tetrazolyl, thiazolyl, isothiazolyl, benzthiazolyl, oxazolyl, isoxazolyl, benzoxazolyl, oxadiazolyl, or thiadiazolyl,
and wherein the remaining of R1, R2, R3 and R4 are independently selected from the group consisting of:
(i) hydrogen;
(ii) C1-11alkyl, substituted C1-11alkyl wherein the alkyl substituents are defined as above,
(iii) arylC0-11alkyl,
(iv) mono-, di- and tri-substituted arylC0-C11alkyl wherein the aryl substituents are defined as above, with the proviso that when R3 and R4 are selected from substituted phenyl or substituted furyl then the phenyl and furyl substituents exclude hydroxy, halo, trifluoromethyl, C1-6alkyl, C1-6alkyloxy, C1-6alkylthio, amino, C1-6alkylamino, di(C1-6alkyl)amino, phenylC1-6alkylamino and di(phenylC1-6alkyl)amino,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
48. A compound as defined in claim 47 wherein aryl is selected from phenyl, naphthyl, biphenyl, thienyl, furyl, pyridyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
49. A compound as defined in claim 47 wherein aryl is phenyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
50. A compound as defined in claim 47 wherein aryl is naphthyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
51. A compound as defined in claim 47 wherein aryl is biphenyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
52. A compound as defined in claim 47 wherein aryl is thienyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
53. A compound as defined in claim 47 wherein aryl is furyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
54. A compound as defined in claim 47 wherein aryl is pyridyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
55. A compound with the structure depicted in Formula (A6):
Figure US20020183518A1-20021205-C00253
wherein R4 is selected from —COR5, —COOR6, —CONR7R8 wherein R5 thru R8 are independently selected from hydrogen, C1-C11alkyl, substituted C1-11alkyl where the alkyl substituents are as defined below, optionally substituted arylC0-C11alkyl where the aryl substituents are as defined below, or R7 and R8 are taken together with the nitrogen to which they are attached forming a cyclic system containing 3 to 8 carbon atoms with at least one C1-C11alkyl, arylC0-C11alkyl substituent, and wherein at least one of R1, R2, and R3 substituents has the general structure depicted in Formula (B)
X—C(R′)═C(R″)COOR″′  (B)
wherein
(i) R′ and R″ are independently selected from the group consisting of hydrogen, halo, cyano, nitro, trihalomethyl, C1-11alkyl, optionally substituted arylC1-11alkyl wherein the aryl substituents are independently selected from the group consisting of hydrogen, halo, nitro, cyano, trihalomethyl, hydroxypyronyl, C1-11alkyl, arylC1-11alkyl, C0-11alkyloxyC0-11alkyl, arylC0-11alkyloxyC0-11alkyl, C0-11alkylthioC0-11alkyl, arylC0-11alkylthioC0-11alkyl, C0-11alkylaminoC0-11alkyl, arylC0-11alkylaminoC0-11alkyl, di(arylC1-11alkyl)aminoC0-11alkyl, C1-11alkylcarbonylC0-11alkyl, arylC1-11alkylcarbonylC0-11alkyl, C1-11alkylcarboxyC0-11alkyl, arylC11-1alkylcarboxyC0-11alkyl, C1-11alkylcarbonylaminoC0-11alkyl, arylC1-11alkylcarbonylaminoC0-11alkyl, —C0-11alkylCOOR9, —C0-11alkylCONR10R11 wherein R9, R10 and R11 are independently selected from hydrogen, C1-C11alkyl, arylC0-C11alkyl, or R10 and R11 are taken together with the nitrogen to which they are attached forming a cyclic system containing 3 to 8 carbon atoms with at least one C1-C11alkyl, arylC0-C11alkyl substituent.
(ii) R″′ is selected from the group consisting of
(a) hydrogen,
(b) C1-11alkyl, substituted C1-11alkyl wherein the substituents are independently selected from halo, cyano, nitro, trihalomethyl, carbamoyl, tetrahydrofuryl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, hydroxypyronyl, C0-11alkyloxy, arylC0-11alkyloxy, C0-11alkylthio, arylC0-11alkylthio, C0-11alkylamino, arylC0-11alkylamino, di(arylC0-11alkyl)amino, C1-11alkylcarbonyl, arylC1-11alkylcarbonyl, C1-11alkylcarboxy, arylC1-11alkylcarboxy, C1-11alkylcarbonylamino, aryl C1-11alkylcarbonylamino, —C0-11alkylCOOR12, —C0-11alkylCONR13R14 wherein R12, R13 and R14 are independently selected from hydrogen, C1-C11alkyl, arylC0-C11alkyl, or R13 and R14 are taken together with the nitrogen to which they are attached forming a cyclic system containing 3 to 8 carbon atoms with at least one C1-C11alkyl, arylC0-C11alkyl substituent,
(c) mono-, di- and tri-substituted arylC0-C11alkyl wherein the aryl substituents are defined as above for R′ and R″,
(iii) X is a mono-, di- or trisubstituted aryl wherein the aryl substituents are defined as above for R′ and R″, and aryl is selected from phenyl, biphenyl, naphthyl, dihydronaphthyl, tetrahydronaphthyl, indenyl, indanyl, azulenyl, anthryl, phenanthryl, fluorenyl, pyrenyl, thienyl, benzothienyl, isobenzothienyl, 2,3-dihydrobenzothienyl, furyl, pyranyl, benzofuranyl, isobenzofuranyl, 2,3-dihydrobenzofuranyl, pyrrolyl, indolyl, isoindolyl, indolizinyl, indazolyl, imidazolyl, benzimidazolyl, pyridyl, pyrazinyl, pyradazinyl, pyrimidinyl, triazinyl, quinolyl, isoquinolyl, 4H-quinolizinyl, cinnolinyl, phthalazinyl, quinazolinyl, quinoxalinyl, 1,8-naphthyridinyl, pteridinyl, carbazolyl, acridinyl, phenazinyl, phenothiazinyl, phenoxazinyl, chromanyl, benzodioxolyl, piperonyl, purinyl, hydroxypyronyl, pyrazolyl, triazolyl, tetrazolyl, thiazolyl, isothiazolyl, benzthiazolyl, oxazolyl, isoxazolyl, benzoxazolyl, oxadiazolyl, or thiadiazolyl,
and wherein the remaining of R1, R2 and R3 are independently selected from the group consisting of:
(i) hydrogen;
(ii) C1-11alkyl, substituted C1-11alkyl wherein the alkyl substituents are defined as above,
(iii) arylC0-11alkyl,
(iv) mono-, di- and tri-substituted arylC0-C11alkyl wherein the aryl substituents are defined as above,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
56. A compound as defined in claim 55 wherein aryl is selected from phenyl, naphthyl, biphenyl, thienyl, furyl, pyridyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
57. A compound as defined in claim 55 wherein aryl is phenyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
58. A compound as defined in claim 55 wherein aryl is naphthyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
59. A compound as defined in claim 55 wherein aryl is biphenyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
60. A compound as defined in claim 55 wherein aryl is thienyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
61. A compound as defined in claim 55 wherein aryl is furyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
62. A compound as defined in claim 55 wherein aryl is pyridyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
63. A compound with the structure depicted in Formula (A6):
Figure US20020183518A1-20021205-C00254
wherein R3 is selected from —COR5, —COOR6, —CONR7R8 wherein R5 thru R8 are independently selected from hydrogen, C1-C11alkyl, substituted C1-11alkyl where the alkyl substituents are as defined below, optionally substituted arylC0-C11alkyl where the aryl substituents are as defined below, or R7 and R8 are taken together with the nitrogen to which they are attached forming a cyclic system containing 3 to 8 carbon atoms with at least one C1-C11alkyl, arylC0-C11alkyl substituent, and wherein at least one of R1, R2, and R4 substituents has the general structure depicted in Formula (B)
X—C(R′)═C(R″)COOR″′  (B)
wherein
(i) R′ and R″ are independently selected from the group consisting of hydrogen, halo, cyano, nitro, trihalomethyl, C1-11alkyl, optionally substituted arylC1-11alkyl wherein the aryl substituents are independently selected from the group consisting of hydrogen, halo, nitro, cyano, trihalomethyl, hydroxypyronyl, C1-11alkyl, arylC1-11alkyl, C0-11alkyloxyC0-11alkyl, arylC0-11alkyloxyC0-11alkyl, C0-11alkylthioC0-11alkyl, arylC0-11alkylthioC0-11alkyl, C0-11alkylaminoC0-11alkyl, arylC0-11alkylaminoC0-11alkyl, di(arylC1-11alkyl)aminoC0-11alkyl, C1-11alkylcarbonylC1-11alkyl, arylC1-11alkylcarbonylC0-11alkyl, C1-11alkylcarboxyC0-11alkyl, arylC1-11alkylcarboxyC0-11alkyl, C1-11alkylcarbonylaminoC0-11alkyl, arylC1-11alkylcarbonylaminoC0-11alkyl, —C0-11alkylCOOR9, —C0-11alkylCONR10R11 wherein R9, R10 and R11 are independently selected from hydrogen, C1-C11alkyl, arylC0-C11alkyl, or R10 and R11 are taken together with the nitrogen to which they are attached forming a cyclic system containing 3 to 8 carbon atoms with at least one C1-C11alkyl, arylC0-C11alkyl substituent.
(ii) R″′ is selected from the group consisting of
(a) hydrogen,
(b) C1-11alkyl, substituted C1-11alkyl wherein the substituents are independently selected from halo, cyano, nitro, trihalomethyl, carbamoyl, tetrahydrofuryl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, hydroxypyronyl, C0-11alkyloxy, arylC0-11alkyloxy, C0-11alkylthio, arylC0-11alkylthio, C0-11alkylamino, arylC0-11alkylamino, di(arylC0-11alkyl)amino, C1-11alkylcarbonyl, arylC1-11alkylcarbonyl, C1-11alkylcarboxy, arylC1-11alkylcarboxy, C1-11alkylcarbonylamino, aryl C1-11alkylcarbonylamino, C0-11alkylCOOR12, —C0-11alkylCONR13R14 wherein R12, R13 and R14 are independently selected from hydrogen, C1-C11alkyl, arylC0-C11alkyl, or R13 and R14 are taken together with the nitrogen to which they are attached forming a cyclic system containing 3 to 8 carbon atoms with at least one C1-C11alkyl, arylC0-C11alkyl substituent,
(c) mono-, di- and tri-substituted arylC0-C11alkyl wherein the aryl substituents are defined as above for R′ and R″,
(iii) X is a mono-, di- or trisubstituted aryl wherein the aryl substituents are defined as above for R′ and R″, and aryl is selected from phenyl, biphenyl, naphthyl, dihydronaphthyl, tetrahydronaphthyl, indenyl, indanyl, azulenyl, anthryl, phenanthryl, fluorenyl, pyrenyl, thienyl, benzothienyl, isobenzothienyl, 2,3-dihydrobenzothienyl, furyl, pyranyl, benzofuranyl, isobenzofuranyl, 2,3-dihydrobenzofuranyl, pyrrolyl, indolyl, isoindolyl, indolizinyl, indazolyl, imidazolyl, benzimidazolyl, pyridyl, pyrazinyl, pyradazinyl, pyrimidinyl, triazinyl, quinolyl, isoquinolyl, 4H-quinolizinyl, cinnolinyl, phthalazinyl, quinazolinyl, quinoxalinyl, 1,8-naphthyridinyl, pteridinyl, carbazolyl, acridinyl, phenazinyl, phenothiazinyl, phenoxazinyl, chromanyl, benzodioxolyl, piperonyl, purinyl, hydroxypyronyl, pyrazolyl, triazolyl, tetrazolyl, thiazolyl, isothiazolyl, benzthiazolyl, oxazolyl, isoxazolyl, benzoxazolyl, oxadiazolyl, or thiadiazolyl,
and wherein the remaining of R1, R2 and R4 are independently selected from the group consisting of:
(i) hydrogen;
(ii) C1-11alkyl, substituted C1-11alkyl wherein the alkyl substituents are defined as above,
(iii) arylC0-11alkyl,
(iv) mono-, di- and tri-substituted arylC0-C11alkyl wherein the aryl substituents are defined as above,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
64. A compound as defined in claim 63 wherein aryl is selected from phenyl, naphthyl, biphenyl, thienyl, furyl, pyridyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
65. A compound as defined in claim 63 wherein aryl is phenyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
66. A compound as defined in claim 63 wherein aryl is naphthyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
67. A compound as defined in claim 63 wherein aryl is biphenyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
68. A compound as defined in claim 63 wherein aryl is thienyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
69. A compound as defined in claim 63 wherein aryl is furyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
70. A compound as defined in claim 63 wherein aryl is pyridyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
71. A compound with the structure depicted in Formula (A7):
Figure US20020183518A1-20021205-C00255
wherein R2 is selected from —COR5, —COOR6, —CONR7R8 wherein R5 thru R8 are independently selected from hydrogen, C1-C11alkyl, substituted C1-11alkyl where the alkyl substituents are as defined below, optionally substituted arylC0-C11alkyl where the aryl substituents are as defined below, or R7 and R8 are taken together with the nitrogen to which they are attached forming a cyclic system containing 3 to 8 carbon atoms with at least one C1-C11alkyl, arylC0-C11alkyl substituent, and wherein at least one of R1 and R3 substituents has the general structure depicted in Formula (B)
X—C(R′)═C(R″)COOR″′  (B)
wherein
(i) R′ and R″ are independently selected from the group consisting of hydrogen, halo, cyano, nitro, trihalomethyl, C1-11alkyl, optionally substituted arylC1-11alkyl wherein the aryl substituents are independently selected from the group consisting of hydrogen, halo, nitro, cyano, trihalomethyl, hydroxypyronyl, C1-11alkyl, arylC1-11alkyl, C0-11alkyloxyC0-11alkyl, arylC0-11alkyloxyC0-11alkyl, C0-11alkylthioC0-11alkyl, arylC0-11alkylthioC0-11alkyl, C0-11alkylaminoC0-11alkyl, arylC0-11alkylaminoC0-11alkyl, di(arylC1-11alkyl)aminoC0-11alkyl, C1-11alkylcarbonylC1-11alkyl, arylC1-11alkylcarbonylC0-11alkyl, C1-11alkylcarboxyC0-11alkyl, arylC1-11alkylcarboxyC0-11alkyl, C1-11alkylcarbonylaminoC0-11alkyl, arylC1-11alkylcarbonylaminoC0-11alkyl, —C0-11alkylCOOR9, —C0-11alkylCONR10R11 wherein R9, R10 and R11 are independently selected from hydrogen, C1-C11alkyl, arylC0-C11alkyl, or R10 and R11 are taken together with the nitrogen to which they are attached forming a cyclic system containing 3 to 8 carbon atoms with at least one C1-C11alkyl, arylC0-C11alkyl substituent.
(ii) R″′ is selected from the group consisting of
(a) hydrogen,
(b) C1-11alkyl, substituted C1-11alkyl wherein the substituents are independently selected from halo, cyano, nitro, trihalomethyl, carbamoyl, tetrahydrofuryl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, hydroxypyronyl, C0-11alkyloxy, arylC0-11alkyloxy, C0-11alkylthio, arylC0-11alkylthio, C0-11alkylamino, arylC0-11alkylamino, di(arylC0-11alkyl)amino, C1-11alkylcarbonyl, arylC1-11alkylcarbonyl, C1-11alkylcarboxy, arylC1-11alkylcarboxy, C1-11alkylcarbonylamino, aryl C1-11alkylcarbonylamino, C0-11alkylCOOR12, —C0-11alkylCONR13R14 wherein R12, R13 and R14 are independently selected from hydrogen, C1-C11alkyl, arylC0-C11alkyl, or R13 and R14 are taken together with the nitrogen to which they are attached forming a cyclic system containing 3 to 8 carbon atoms with at least one C1-C11alkyl, arylC0-C11alkyl substituent,
(c) mono-, di- and tri-substituted arylC0-C11alkyl wherein the aryl substituents are defined as above for R′ and R″,
(iii) X is a mono-, di- or trisubstituted aryl wherein the aryl substituents are defined as above for R′ and R″, and aryl is selected from phenyl, biphenyl, naphthyl, dihydronaphthyl, tetrahydronaphthyl, indenyl, indanyl, azulenyl, anthryl, phenanthryl, fluorenyl, pyrenyl, thienyl, benzothienyl, isobenzothienyl, 2,3-dihydrobenzothienyl, furyl, pyranyl, benzofuranyl, isobenzofuranyl, 2,3-dihydrobenzofuranyl, pyrrolyl, indolyl, isoindolyl, indolizinyl, indazolyl, imidazolyl, benzimidazolyl, pyridyl, pyrazinyl, pyradazinyl, pyrimidinyl, triazinyl, quinolyl, isoquinolyl, 4H-quinolizinyl, cinnolinyl, phthalazinyl, quinazolinyl, quinoxalinyl, 1,8-naphthyridinyl, pteridinyl, carbazolyl, acridinyl, phenazinyl, phenothiazinyl, phenoxazinyl, chromanyl, benzodioxolyl, piperonyl, purinyl, hydroxypyronyl, pyrazolyl, triazolyl, tetrazolyl, thiazolyl, isothiazolyl, benzthiazolyl, oxazolyl, isoxazolyl, benzoxazolyl, oxadiazolyl, or thiadiazolyl,
and wherein the remaining of R1 and R3 are independently selected from the group consisting of:
(i) hydrogen;
(ii) C1-11alkyl, substituted C1-11alkyl wherein the alkyl substituents are defined as above,
(iii) arylC0-11alkyl,
(iv) mono-, di- and tri-substituted arylC0-C11alkyl wherein the aryl substituents are defined as above,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
72. A compound as defined in claim 71 wherein aryl is selected from phenyl, naphthyl, biphenyl, thienyl, furyl, pyridyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
73. A compound as defined in claim 71 wherein aryl is phenyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
74. A compound as defined in claim 71 wherein aryl is naphthyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
75. A compound as defined in claim 71 wherein aryl is biphenyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
76. A compound as defined in claim 71 wherein aryl is thienyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
77. A compound as defined in claim 71 wherein aryl is furyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
78. A compound as defined in claim 71 wherein aryl is pyridyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
79. A compound with the structure depicted in Formula (A8):
Figure US20020183518A1-20021205-C00256
wherein at least one of R1 and R2 substituents has the general structure depicted in Formula (B)
X—C(R′)═C(R″)COOR″′  (B)
wherein
(i) R′ and R″ are independently selected from the group consisting of hydrogen, halo, cyano, nitro, trihalomethyl, C1-11alkyl, optionally substituted arylC1-11alkyl wherein the aryl substituents are independently selected from the group consisting of hydrogen, halo, nitro, cyano, trihalomethyl, hydroxypyronyl, C1-11alkyl, arylC1-11alkyl, C0-11alkyloxyC0-11alkyl, arylC0-11alkyloxyC0-11alkyl, C0-11alkylthioC0-11alkyl, arylC0-11alkylthioC0-11alkyl, C0-11alkylaminoC0-11alkyl, arylC0-11alkylaminoC0-11alkyl, di(arylC1-11alkyl)aminoC0-11alkyl, C1-11alkylcarbonylC0-11alkyl, arylC1-11alkylcarbonylC0-11alkyl, C1-11alkylcarboxyC1-11alkyl, arylC1-11alkylcarboxyC0-11alkyl, C1-11alkylcarbonylaminoC0-11alkyl, arylC1-11alkylcarbonylaminoC0-11alkyl, —C0-11alkylCOOR4, —C0-11alkylCONR5R6 wherein R4, R5 and R6 are independently selected from hydrogen, C1-C11alkyl, arylC0-C11alkyl, or R5 and R6 are taken together with the nitrogen to which they are attached forming a cyclic system containing 3 to 8 carbon atoms with at least one C1-C11alkyl, arylC0-C11alkyl substituent.
(ii) R″′ is selected from the group consisting of
(a) hydrogen,
(b) C1-11alkyl, substituted C1-11alkyl wherein the substituents are independently selected from halo, cyano, nitro, trihalomethyl, carbamoyl, tetrahydrofuryl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, hydroxypyronyl, C0-11alkyloxy, arylC0-11alkyloxy, C0-11alkylthio, arylC0-11alkylthio, C0-11alkylamino, arylC0-11alkylamino, di(arylC0-11alkyl)amino, C1-11alkylcarbonyl, arylC1-11alkylcarbonyl, C1-11alkylcarboxy, arylC1-11alkylcarboxy, C1-11alkylcarbonylamino, aryl C1-11alkylcarbonylamino, —C0-11alkylCOOR7, C0-11alkylCONR8R9 wherein R7, R8 and R9 are independently selected from hydrogen, C1-C11alkyl, arylC0-C11alkyl, or R8 and R9 are taken together with the nitrogen to which they are attached forming a cyclic system containing 3 to 8 carbon atoms with at least one C1-C11alkyl, arylC0-C11alkyl substituent,
(c) mono-, di- and tri-substituted arylC0-C11alkyl wherein the aryl substituents are defined as above for R′ and R″,
(iii) X is a mono-, di- or trisubstituted aryl wherein the aryl substituents are defined as above for R′ and R″, and aryl is selected from phenyl, biphenyl, naphthyl, dihydronaphthyl, tetrahydronaphthyl, indenyl, indanyl, azulenyl, anthryl, phenanthryl, fluorenyl, pyrenyl, thienyl, benzothienyl, isobenzothienyl, 2,3-dihydrobenzothienyl, furyl, pyranyl, benzofuranyl, isobenzofuranyl, 2,3-dihydrobenzofuranyl, pyrrolyl, indolyl, isoindolyl, indolizinyl, indazolyl, imidazolyl, benzimidazolyl, pyridyl, pyrazinyl, pyradazinyl, pyrimidinyl, triazinyl, quinolyl, isoquinolyl, 4H-quinolizinyl, cinnolinyl, phthalazinyl, quinazolinyl, quinoxalinyl, 1,8-naphthyridinyl, pteridinyl, carbazolyl, acridinyl, phenazinyl, phenothiazinyl, phenoxazinyl, chromanyl, benzodioxolyl, piperonyl, purinyl, hydroxypyronyl, pyrazolyl, triazolyl, tetrazolyl, thiazolyl, isothiazolyl, benzthiazolyl, oxazolyl, isoxazolyl, benzoxazolyl, oxadiazolyl, or thiadiazolyl,
and wherein the remaining of R1 and R2 is independently selected from the group consisting of:
(i) hydrogen;
(ii) C1-11alkyl, substituted C1-11alkyl wherein the alkyl substituents are defined as above,
(iii) arylC0-11alkyl,
(iv) mono-, di- and tri-substituted arylC0-C11alkyl wherein the aryl substituents are defined as above,
and wherein m is an integer between 0 and 4 and each R3 is independently selected from the group consisting of hydrogen, halo, nitro, cyano, trihalomethyl, hydroxypyronyl, C1-11alkyl, C0-11alkyloxyC0-11alkyl, arylC0-11alkyloxyC0-11alkyl, C0-11alkylthioC0-11alkyl, arylC0-11alkylthioC0-11alkyl, C0-11alkylaminoC0-11alkyl, arylC0-11alkylaminoC0-11alkyl, di(arylC1-11alkyl)aminoC0-11alkyl, C1-11alkylcarbonylC0-11alkyl, C1-11alkylcarboxyC0-11alkyl, C1-11alkylcarbonylaminoC1-11alkyl, arylC1-11alkylcarbonylC0-11alkyl, arylC1-11alkylcarboxyC0-11alkyl, arylC1-11alkylcarbonylaminoC0-11alkyl, —CH═CHCOOR10,
—CH═CHCONR11R12, —C1-11alkylCOOR13, —C0-11alkylCONR14R15 wherein R10 thru R15 are independently selected from hydrogen, C1-C11alkyl, arylC0-C11alkyl, or R11 and R12 are taken together with the nitrogen to which they are attached forming a cyclic system containing 3 to 8 carbon atoms with at least one C1-C11alkyl, arylC0-C11alkyl substituent, or R14 and R15 are taken together with the nitrogen to which they are attached forming a cyclic system containing 3 to 8 carbon atoms with at least one C1-C11alkyl, arylC0-C11alkyl substituent,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
80. A compound as defined in claim 79 wherein aryl is selected from phenyl, naphthyl, biphenyl, thienyl, furyl, pyridyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
81. A compound as defined in claim 79 wherein aryl is phenyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
82. A compound as defined in claim 79 wherein aryl is naphthyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
83. A compound as defined in claim 79 wherein aryl is biphenyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
84. A compound as defined in claim 79 wherein aryl is thienyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
85. A compound as defined in claim 79 wherein aryl is furyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
86. A compound as defined in claim 79 wherein aryl is pyridyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
87. A compound with the structure depicted in Formula (A8):
Figure US20020183518A1-20021205-C00257
wherein R1 is selected from —COR16, —COOR17, —CONR18R19 wherein R16 thru R19 are independently selected from hydrogen, C1-C11alkyl, substituted C1-11alkyl where the alkyl substituents are as defined below, optionally substituted arylC0-C11alkyl where the aryl substituents are as defined below, or R18 and R19 are taken together with the nitrogen to which they are attached forming a cyclic system containing 3 to 8 carbon atoms with at least one C1-C11alkyl, arylC0-C11alkyl substituent, and wherein R2 has the general structure depicted in Formula (B)
X—C(R′)═C(R″)COOR″′  (B)
wherein
(i) R′ and R″ are independently selected from the group consisting of hydrogen, halo, cyano, nitro, trihalomethyl, C1-11alkyl, optionally substituted arylC1-11alkyl wherein the aryl substituents are independently selected from the group consisting of hydrogen, halo, nitro, cyano, trihalomethyl, hydroxypyronyl, C1-11alkyl, arylC1-11alkyl, C0-11alkyloxyC0-11alkyl, arylC0-11alkyloxyC0-11alkyl, C0-11alkylthioC0-11alkyl, arylC1-11alkylthioC0-11alkyl, C0-11alkylaminoC0-11alkyl, arylC0-11alkylaminoC0-11alkyl, di(arylC1-11alkyl)aminoC0-11alkyl, C1-11alkylcarbonylC0-11alkyl, arylC1-11alkylcarbonylC0-11alkyl, C1-11alkylcarboxyC0-11alkyl, arylC1-11alkylcarboxyC0-11alkyl, C1-11alkylcarbonylaminoC0-11alkyl, arylC1-11alkylcarbonylaminoC0-11alkyl, —C0-11alkylCOOR4, —C0-11alkylCONR5R6 wherein R4, R5 and R6 are independently selected from hydrogen, C1-C11alkyl, arylC0-C11alkyl, or R5 and R6 are taken together with the nitrogen to which they are attached forming a cyclic system containing 3 to 8 carbon atoms with at least one C1-C11alkyl, arylC0-C11alkyl substituent.
(ii) R″′ is selected from the group consisting of
(a) hydrogen,
(b) C1-11alkyl, substituted C1-11alkyl wherein the substituents are independently selected from halo, cyano, nitro, trihalomethyl, carbamoyl, tetrahydrofuryl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, hydroxypyronyl, C0-11alkyloxy, arylC0-11alkyloxy, C0-11alkylthio, arylC0-11alkylthio, C0-11alkylamino, arylC0-11alkylamino, di(arylC0-11alkyl)amino, C1-11alkylcarbonyl, arylC1-11alkylcarbonyl, C1-11alkylcarboxy, arylC1-11alkylcarboxy, C1-11alkylcarbonylamino, aryl C1-11alkylcarbonylamino, C0-11alkylCOOR7, —C0-11alkylCONR8R9 wherein R7, R8 and R9 are independently selected from hydrogen, C1-C11alkyl, arylC0-C11alkyl, or R8 and R9 are taken together with the nitrogen to which they are attached forming a cyclic system containing 3 to 8 carbon atoms with at least one C1-C11alkyl, arylC0-C11alkyl substituent,
(c) mono-, di- and tri-substituted arylC0-C11alkyl wherein the aryl substituents are defined as above for R′ and R″,
(iii) X is a mono-, di- or trisubstituted aryl wherein the aryl substituents are defined as above for R′ and R″, and aryl is selected from phenyl, biphenyl, naphthyl, dihydronaphthyl, tetrahydronaphthyl, indenyl, indanyl, azulenyl, anthryl, phenanthryl, fluorenyl, pyrenyl, thienyl, benzothienyl, isobenzothienyl, 2,3-dihydrobenzothienyl, furyl, pyranyl, benzofuranyl, isobenzofuranyl, 2,3-dihydrobenzofuranyl, pyrrolyl, indolyl, isoindolyl, indolizinyl, indazolyl, imidazolyl, benzimidazolyl, pyridyl, pyrazinyl, pyradazinyl, pyrimidinyl, triazinyl, quinolyl, isoquinolyl, 4H-quinolizinyl, cinnolinyl, phthalazinyl, quinazolinyl, quinoxalinyl, 1,8-naphthyridinyl, pteridinyl, carbazolyl, acridinyl, phenazinyl, phenothiazinyl, phenoxazinyl, chromanyl, benzodioxolyl, piperonyl, purinyl, hydroxypyronyl, pyrazolyl, triazolyl, tetrazolyl, thiazolyl, isothiazolyl, benzthiazolyl, oxazolyl, isoxazolyl, benzoxazolyl, oxadiazolyl, or thiadiazolyl,
and wherein R2 is selected from the group consisting of:
(i) hydrogen;
(ii) C1-11alkyl, substituted C1-11alkyl wherein the alkyl substituents are defined as above,
(iii) arylC0-11alkyl,
(iv) mono-, di- and tri-substituted arylC0-C11alkyl wherein the aryl substituents are defined as above,
and wherein m is an integer between 0 and 4 and each R3 is independently selected from the group consisting of hydrogen, halo, nitro, cyano, trihalomethyl, hydroxypyronyl, C1-11alkyl, C0-11alkyloxyC0-11alkyl, arylC0-11alkyloxyC0-11alkyl, C0-11alkylthioC0-11alkyl, arylC0-11alkylthioC0-11alkyl, C0-11alkylaminoC0-11alkyl, arylC0-11alkylaminoC0-11alkyl, di(arylC1-11alkyl)aminoC0-11alkyl, C1-11alkylcarbonylC0-11alkyl, C1-11alkylcarboxyC1-11alkyl, C1-11alkylcarbonylaminoC0-11alkyl, arylC1-11alkylcarbonylC0-11alkyl, arylC1-11alkylcarboxyC0-11alkyl, arylC1-11alkylcarbonylaminoC0-11alkyl, CH═CHCOOR10, CH═CHCONR11R12, C0-11alkylCOOR13, C1-11alkylCONR14R15 wherein R10 thru R15 are independently selected from hydrogen, C1-C11alkyl, arylC0-C11alkyl, or R11 and R12 are taken together with the nitrogen to which they are attached forming a cyclic system containing 3 to 8 carbon atoms with at least one C1-C11alkyl, arylC0-C11alkyl substituent, or R14 and R15 are taken together with the nitrogen to which they are attached forming a cyclic system containing 3 to 8 carbon atoms with at least one C1-C11alkyl, arylC0-C11alkyl substituent,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
88. A compound as defined in claim 87 wherein aryl is selected from phenyl, naphthyl, biphenyl, thienyl, furyl, pyridyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
89. A compound as defined in claim 87 wherein aryl is phenyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
90. A compound as defined in claim 87 wherein aryl is naphthyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
91. A compound as defined in claim 87 wherein aryl is biphenyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
92. A compound as defined in claim 87 wherein aryl is thienyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
93. A compound as defined in claim 87 wherein aryl is furyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
94. A compound as defined in claim 87 wherein aryl is pyridyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
95. A compound with the structure depicted in Formula (A9):
Figure US20020183518A1-20021205-C00258
wherein at least one of R1 and R2 substituents has the general structure depicted in Formula (B)
X—C(R′)═C(R″)COOR″′  (B)
wherein
(i) R′ and R″ are independently selected from the group consisting of hydrogen, halo, cyano, nitro, trihalomethyl, C1-11alkyl, optionally substituted arylC1-11alkyl wherein the aryl substituents are independently selected from the group consisting of hydrogen, halo, nitro, cyano, trihalomethyl, hydroxypyronyl, C1-11alkyl, arylC1-11alkyl, C0-11alkyloxyC0-11alkyl, arylC0-11alkyloxyC0-11alkyl, C0-11alkylthioC0-11alkyl, arylC0-11alkylthioC0-11alkyl, C0-11alkylaminoC0-11alkyl, arylC0-11alkylaminoC0-11alkyl, di(arylC1-11alkyl)aminoC0-11alkyl, C1-11alkylcarbonylC0-11alkyl, arylC1-11alkylcarbonylC0-11alkyl, C0-11alkylcarboxyC0-11alkyl, arylC1-11alkylcarboxyC0-11alkyl, C1-11alkylcarbonylaminoC0-11alkyl, arylC1-11alkylcarbonylaminoC0-11alkyl, —C0-11alkylCOOR4, —C0-11alkylCONR5R6 wherein R4, R5 and R6 are independently selected from hydrogen, C1-C11alkyl, arylC0-C11alkyl, or R5 and R6 are taken together with the nitrogen to which they are attached forming a cyclic system containing 3 to 8 carbon atoms with at least one C1-C11alkyl, arylC0-C11alkyl substituent.
(ii) R″′ is selected from the group consisting of
(a) hydrogen,
(b) C1-11alkyl, substituted C1-11alkyl wherein the substituents are independently selected from halo, cyano, nitro, trihalomethyl, carbamoyl, tetrahydrofuryl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, hydroxypyronyl, C0-11alkyloxy, arylC0-11alkyloxy, C0-11alkylthio, arylC0-11alkylthio, C0-11alkylamino, arylC0-11alkylamino, di(arylC0-11alkyl)amino, C1-11alkylcarbonyl, arylC1-11alkylcarbonyl, C1-11alkylcarboxy, arylC1-11alkylcarboxy, C1-11alkylcarbonylamino, aryl C1-11alkylcarbonylamino, —C0-11alkylCOOR7, —C0-11alkylCONR8R9 wherein R7, R8 and R9 are independently selected from hydrogen, C1-C11alkyl, arylC0-C11alkyl, or R8 and R9 are taken together with the nitrogen to which they are attached forming a cyclic system containing 3 to 8 carbon atoms with at least one C1-C11alkyl, arylC0-C11alkyl substituent,
(c) mono-, di- and tri-substituted arylC0-C11alkyl wherein the aryl substituents are defined as above for R′ and R″,
(iii) X is a mono-, di- or trisubstituted aryl wherein the aryl substituents are defined as above for R′ and R″, and aryl is selected from phenyl, biphenyl, naphthyl, dihydronaphthyl, tetrahydronaphthyl, indenyl, indanyl, azulenyl, anthryl, phenanthryl, fluorenyl, pyrenyl, thienyl, benzothienyl, isobenzothienyl, 2,3-dihydrobenzothienyl, furyl, pyranyl, benzofuranyl, isobenzofuranyl, 2,3-dihydrobenzofuranyl, pyrrolyl, indolyl, isoindolyl, indolizinyl, indazolyl, imidazolyl, benzimidazolyl, pyridyl, pyrazinyl, pyradazinyl, pyrimidinyl, triazinyl, quinolyl, isoquinolyl, 4H-quinolizinyl, cinnolinyl, phthalazinyl, quinazolinyl, quinoxalinyl, 1,8-naphthyridinyl, pteridinyl, carbazolyl, acridinyl, phenazinyl, phenothiazinyl, phenoxazinyl, chromanyl, benzodioxolyl, piperonyl, purinyl, hydroxypyronyl, pyrazolyl, triazolyl, tetrazolyl, thiazolyl, isothiazolyl, benzthiazolyl, oxazolyl, isoxazolyl, benzoxazolyl, oxadiazolyl, or thiadiazolyl,
and wherein the remaining of R1 and R2 is independently selected from the group consisting of:
(i) hydrogen;
(ii) C1-11alkyl, substituted C1-11alkyl wherein the alkyl substituents are defined as above,
(iii) arylC0-11alkyl,
(iv) mono-, di- and tri-substituted arylC0-C11alkyl wherein the aryl substituents are defined as above,
and wherein m is an integer between 0 and 3 and each R3 is independently selected from the group consisting of hydrogen, halo, nitro, cyano, trihalomethyl, hydroxypyronyl, C1-11alkyl, C0-11alkyloxyC1-11alkyl, arylC0-11alkyloxyC0-11alkyl, C0-11alkylthioC0-11alkyl, arylC0-11alkylthioC0-11alkyl, C0-11alkylaminoC0-11alkyl, arylC0-11alkylaminoC0-11alkyl, di(arylC1-11alkyl)aminoC0-11alkyl, C1-11alkylcarbonylC0-11alkyl, C1-11alkylcarboxyC0-11alkyl, C1-11alkylcarbonylaminoC0-11alkyl, arylC1-11alkylcarbonylC0-11alkyl, arylC1-11alkylcarboxyC0-11alkyl, arylC1-11alkylcarbonylaminoC0-11alkyl, —CH═CHCOOR10, —CH═CHCONR11R12, —C0-11alkylCOOR13, C0-11alkylCONR14R15 wherein R10 thru R15 are independently selected from hydrogen, C1-C11alkyl, arylC0-C11alkyl, or R11 and R12 are taken together with the nitrogen to which they are attached forming a cyclic system containing 3 to 8 carbon atoms with at least one C1-C11alkyl, arylC0-C11alkyl substituent, or R14 and R15 are taken together with the nitrogen to which they are attached forming a cyclic system containing 3 to 8 carbon atoms with at least one C1-C11alkyl, arylC0-C11alkyl substituent,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
96. A compound as defined in claim 95 wherein aryl is selected from phenyl, naphthyl, biphenyl, thienyl, furyl, pyridyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
97. A compound as defined in claim 95 wherein aryl is phenyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
98. A compound as defined in claim 95 wherein aryl is naphthyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
99. A compound as defined in claim 95 wherein aryl is biphenyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
100. A compound as defined in claim 95 wherein aryl is thienyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
101. A compound as defined in claim 95 wherein aryl is furyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
102. A compound as defined in claim 95 wherein aryl is pyridyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
103. A compound having the structure depicted in Formula (A9):
Figure US20020183518A1-20021205-C00259
wherein R1 or R2 is selected from —COR16, —COOR17, —CONR15R19 wherein R16 thru R19 are independently selected from hydrogen, C1-C11alkyl, substituted C1-11alkyl where the alkyl substituents are as defined below, optionally substituted arylC0-C11alkyl where the aryl substituents are as defined below, or R18 and R19 are taken together with the nitrogen to which they are attached forming a cyclic system containing 3 to 8 carbon atoms with at least one C1-C11alkyl, arylC0-C11alkyl substituent, and wherein the remainder of R1 or R2 has the general structure depicted in Formula (B)
X—C(R′)═C(R″)COOR″′  (B)
wherein
(i) R′ and R″ are independently selected from the group consisting of hydrogen, halo, cyano, nitro, trihalomethyl, C1-11alkyl, optionally substituted arylC1-11alkyl wherein the aryl substituents are independently selected from the group consisting of hydrogen, halo, nitro, cyano, trihalomethyl, hydroxypyronyl, C1-11alkyl, arylC1-11alkyl, C0-11alkyloxyC0-11alkyl, arylC0-11alkyloxyC0-11alkyl, C0-11alkylthioC0-1alkyl, arylC0-11alkylthioC0-11alkyl, C0-11alkylaminoC0-11alkyl, arylC0-11alkylaminoC0-11alkyl, di(arylC1-11alkyl)aminoC0-11alkyl, C1-11alkylcarbonylC0-11alkyl, arylC1-11alkylcarbonylC0-11alkyl, C1-11alkylcarboxyC0-11alkyl, arylC1-11alkylcarboxyC0-11alkyl, C1-11alkylcarbonylaminoC0-11alkyl, arylC1-11alkylcarbonylaminoC0-11alkyl, —C0-11alkylCOOR4, —C0-11alkylCONR5R6 wherein R4, R5 and R6 are independently selected from hydrogen, C1-C11alkyl, arylC0-C11alkyl, or R5 and R6 are taken together with the nitrogen to which they are attached forming a cyclic system containing 3 to 8 carbon atoms with at least one C1-C11alkyl, arylC0-C11alkyl substituent.
(ii) R″′ is selected from the group consisting of
(a) hydrogen,
(b) C1-11alkyl, substituted C1-11alkyl wherein the substituents are independently selected from halo, cyano, nitro, trihalomethyl, carbamoyl, tetrahydrofuryl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, hydroxypyronyl, C0-11alkyloxy, arylC0-11alkyloxy, C0-11alkylthio, arylC0-11alkylthio, C0-11alkylamino, arylC0-11alkylamino, di(arylC0-11alkyl)amino, C1-11alkylcarbonyl, arylC1-11alkylcarbonyl, C1-11alkylcarboxy, arylC1-11alkylcarboxy, C1-11alkylcarbonylamino, aryl C1-11alkylcarbonylamino, —C0-11alkylCOOR7, —C0-11alkylCONR8R9 wherein R7, R8 and R9 are independently selected from hydrogen, C1-C11alkyl, arylC0-C11alkyl, or R8 and R9 are taken together with the nitrogen to which they are attached forming a cyclic system containing 3 to 8 carbon atoms with at least one C1-C11alkyl, arylC0-C11alkyl substituent,
(c) mono-, di- and tri-substituted arylC0-C11alkyl wherein the aryl substituents are defined as above for R′ and R″,
(iii) X is a mono-, di- or trisubstituted aryl wherein the aryl substituents are defined as above for R′ and R″, and aryl is selected from phenyl, biphenyl, naphthyl, dihydronaphthyl, tetrahydronaphthyl, indenyl, indanyl, azulenyl, anthryl, phenanthryl, fluorenyl, pyrenyl, thienyl, benzothienyl, isobenzothienyl, 2,3-dihydrobenzothienyl, furyl, pyranyl, benzofuranyl, isobenzofuranyl, 2,3-dihydrobenzofuranyl, pyrrolyl, indolyl, isoindolyl, indolizinyl, indazolyl, imidazolyl, benzimidazolyl, pyridyl, pyrazinyl, pyradazinyl, pyrimidinyl, triazinyl, quinolyl, isoquinolyl, 4H-quinolizinyl, cinnolinyl, phthalazinyl, quinazolinyl, quinoxalinyl, 1,8-naphthyridinyl, pteridinyl, carbazolyl, acridinyl, phenazinyl, phenothiazinyl, phenoxazinyl, chromanyl, benzodioxolyl, piperonyl, purinyl, hydroxypyronyl, pyrazolyl, triazolyl, tetrazolyl, thiazolyl, isothiazolyl, benzthiazolyl, oxazolyl, isoxazolyl, benzoxazolyl, oxadiazolyl, or thiadiazolyl,
and wherein R2 is selected from the group consisting of:
(i) hydrogen;
(ii) C1-11alkyl, substituted C1-11alkyl wherein the alkyl substituents are defined as above,
(iii) arylC0-11alkyl,
(iv) mono-, di- and tri-substituted arylC0-C11alkyl wherein the aryl substituents are defined as above,
and wherein m is an integer between 0 and 3 and each R3 is independently selected from the group consisting of hydrogen, halo, nitro, cyano, trihalomethyl, hydroxypyronyl, C1-11alkyl, C0-11alkyloxyC0-11alkyl, arylC0-11alkyloxyC0-11alkyl, C0-11alkylthioC0-11alkyl, arylC0-11alkylthioC0-11alkyl, C0-11alkylaminoC0-11alkyl, arylC0-11alkylaminoC0-11alkyl, di(arylC1-11alkyl)aminoC0-11alkyl, C1-11alkylcarbonylC0-11alkyl, C1-11alkylcarboxyC0-11alkyl, C1-11alkylcarbonylaminoC0-11alkyl, arylC1-11alkylcarbonylC0-11alkyl, arylC1-11alkylcarboxyC0-11alkyl, arylC1-11alkylcarbonylaminoC0-11alkyl, —CH═CHCOOR10,
—CH═CHCONR11R12, —C0-11alkylCOOR13, —C 0-11alkylCONR14R15 wherein R10 thru R15 are independently selected from hydrogen, C1-C11alkyl, arylC0-C11alkyl, or R11 and R12 are taken together with the nitrogen to which they are attached forming a cyclic system containing 3 to 8 carbon atoms with at least one C1-C11alkyl, arylC0-C11alkyl substituent, or R14 and R15 are taken together with the nitrogen to which they are attached forming a cyclic system containing 3 to 8 carbon atoms with at least one C1-C11alkyl, arylC0-C11alkyl substituent,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
104. A compound as defined in claim 103 wherein aryl is selected from phenyl, naphthyl, biphenyl, thienyl, furyl, pyridyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
105. A compound as defined in claim 103 wherein aryl is phenyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
106. A compound as defined in claim 103 wherein aryl is naphthyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
107. A compound as defined in claim 103 wherein aryl is biphenyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
108. A compound as defined in claim 103 wherein aryl is thienyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
109. A compound as defined in claim 103 wherein aryl is furyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
110. A compound as defined in claim 103 wherein aryl is pyridyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
111. A compound with the structure depicted in Formula (A10):
Figure US20020183518A1-20021205-C00260
wherein Z1 and Z2 are independently selected from the group consisting of OR3, SR4, NR5R6, wherein R3, R4, R5, R6 are independently selected from:
(i) hydrogen;
(ii) C1-11alkyl, substituted C1-11alkyl, C1-11alkylcarbonyl, substituted C1-11alkylcarbonyl wherein the alkyl substituents are defined as below,
(iii) arylC0-11alkyl, arylC0-11alkylcarbonyl;
(iv) mono-, di- and tri-substituted arylC0-C11alkyl; mono-, di- and tri-substituted arylC0-C11alkylcarbonyl wherein the aryl substituents are defined as in below,
and wherein at least one of R1 and R2 substituents has the general structure depicted in Formula (B)
X—C(R′)═C(R″)COOR″′  (B)
wherein
(i) R′ and R″ are independently selected from the group consisting of hydrogen, halo, cyano, nitro, trihalomethyl, C1-11alkyl, optionally substituted arylC1-11alkyl wherein the aryl substituents are independently selected from the group consisting of hydrogen, halo, nitro, cyano, trihalomethyl, hydroxypyronyl, C1-11alkyl, arylC1-11alkyl, C0-11alkyloxyC0-11alkyl, arylC0-11alkyloxyC0-11alkyl, C0-11alkylthioC0-11alkyl, arylC0-11alkylthioC0-11alkyl, C0-11alkylaminoC0-11alkyl, arylC0-11alkylaminoC0-11alkyl, di(arylC1-11alkyl)aminoC0-11alkyl, C1-11alkylcarbonylC0-11alkyl, arylC1-11alkylcarbonylC0-11alkyl, C1-11alkylcarboxyC0-11alkyl, arylC1-11alkylcarboxy C0-11alkyl, C1-11alkylcarbonylaminoC0-11alkyl, arylC0-11alkylcarbonylaminoC0-11alkyl, —C0-11alkylCOOR7, —C0-11alkylCONR8R9 wherein R7, R8 and R9 are independently selected from hydrogen, C1-C11alkyl, arylC0-C11alkyl, or R8 and R9 are taken together with the nitrogen to which they are attached forming a cyclic system containing 3 to 8 carbon atoms with at least one C1-C11alkyl, arylC0-C11alkyl substituent.
(ii) R″′ is selected from the group consisting of
(a) hydrogen,
(b) C1-11alkyl, substituted C1-11alkyl wherein the substituents are independently selected from halo, cyano, nitro, trihalomethyl, carbamoyl, tetrahydrofuryl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, hydroxypyronyl, C0-11alkyloxy, arylC0-11alkyloxy, C0-11alkylthio, arylC0-11alkylthio, C0-11alkylamino, arylC0-11alkylamino, di(arylC0-11alkyl)amino, C1-11alkylcarbonyl, arylC1-11alkylcarbonyl, C1-11alkylcarboxy, arylC1-11alkylcarboxy, C1-11alkylcarbonylamino, aryl C1-11alkylcarbonylamino, —C0-11alkylCOOR10, —C0-11alkylCONR11R12 wherein R10, R11 and R12 are independently selected from hydrogen, C1-C11alkyl, arylC0-C11alkyl, or R11 and R12 are taken together with the nitrogen to which they are attached forming a cyclic system containing 3 to 8 carbon atoms with at least one C1-C11alkyl, arylC0-C11alkyl substituent,
(c) mono-, di- and tri-substituted arylC0-C11alkyl wherein the aryl substituents are defined as above for R′ and R″,
(iii) X is a mono-, di- or trisubstituted aryl wherein the aryl substituents are defined as above for R′ and R″, and aryl is selected from phenyl, biphenyl, naphthyl, dihydronaphthyl, tetrahydronaphthyl, indenyl, indanyl, azulenyl, anthryl, phenanthryl, fluorenyl, pyrenyl, thienyl, benzothienyl, isobenzothienyl, 2,3-dihydrobenzothienyl, furyl, pyranyl, benzofuranyl, isobenzofuranyl, 2,3-dihydrobenzofuranyl, pyrrolyl, indolyl, isoindolyl, indolizinyl, indazolyl, imidazolyl, benzimidazolyl, pyridyl, pyrazinyl, pyradazinyl, pyrimidinyl, triazinyl, quinolyl, isoquinolyl, 4H-quinolizinyl, cinnolinyl, phthalazinyl, quinazolinyl, quinoxalinyl, 1,8-naphthyridinyl, pteridinyl, carbazolyl, acridinyl, phenazinyl, phenothiazinyl, phenoxazinyl, chromanyl, benzodioxolyl, piperonyl, purinyl, hydroxypyronyl, pyrazolyl, triazolyl, tetrazolyl, thiazolyl, isothiazolyl, benzthiazolyl, oxazolyl, isoxazolyl, benzoxazolyl, oxadiazolyl, or thiadiazolyl,
and wherein the remaining of R1, and R2 is independently selected from the group consisting of:
(i) hydrogen;
(ii) C1-11alkyl, substituted C1-11alkyl wherein the alkyl substituents are defined as above,
(iii) arylC0-11alkyl,
(iv) mono-, di- and tri-substituted arylC0-C11alkyl wherein the aryl substituents are defined as above,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
112. A compound as defined in claim 111 wherein aryl is selected from phenyl, naphthyl, biphenyl, thienyl, furyl, pyridyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
113. A compound as defined in claim 11 1 wherein aryl is phenyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
114. A compound as defined in claim 111 wherein aryl is naphthyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
115. A compound as defined in claim 111 wherein aryl is biphenyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
116. A compound as defined in claim 111 wherein aryl is thienyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
117. A compound as defined in claim 111 wherein aryl is furyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
118. A compound as defined in claim 111 wherein aryl is pyridyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
119. A compound with the structure depicted in Formula (AI 1):
Figure US20020183518A1-20021205-C00261
wherein at least one of R1, R2 and R3 substituents has the general structure depicted in Formula (B)
X—C(R′)═C(R″)COOR″′  (B)
wherein
(i) R′ and R″ are independently selected from the group consisting of hydrogen, halo, cyano, nitro, trihalomethyl, C1-11alkyl, optionally substituted arylC1-11alkyl wherein the aryl substituents are independently selected from the group consisting of hydrogen, halo, nitro, cyano, trihalomethyl, hydroxypyronyl, C1-11alkyl, arylC1-11alkyl, C0-11alkyloxyC0-11alkyl, arylC0-11alkyloxyC0-11alkyl, C0-11alkylthioC0-11alkyl, arylC0-11alkylthioC0-11alkyl, C0-11alkylaminoC0-11alkyl, arylC1-11alkylaminoC0-11alkyl, di(arylC1-11alkyl)aminoC0-11alkyl, C1-11alkylcarbonylC0-11alkyl, arylC1-11alkylcarbonylC0-11alkyl, C1-11alkylcarboxyC0-11alkyl, arylC1-11alkylcarboxyC0-11alkyl, C1-11alkylcarbonylaminoC0-11alkyl, arylC1-11alkylcarbonylaminoC0-11alkyl, —C0-11alkylCOOR5, C0-11alkylCONR6R7 wherein R5, R6 and R7 are independently selected from hydrogen, C1-C11alkyl, arylC0-C11alkyl, or R6 and R7 are taken together with the nitrogen to which they are attached forming a cyclic system containing 3 to 8 carbon atoms with at least one C1-C11alkyl, arylC0-C11alkyl substituent.
(ii) R″′ is selected from the group consisting of
(a) hydrogen,
(b) C1-11alkyl, substituted C1-11alkyl wherein the substituents are independently selected from halo, cyano, nitro, trihalomethyl, carbamoyl, tetrahydrofuryl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, hydroxypyronyl, C0-11alkyloxy, arylC0-11alkyloxy, C0-11alkylthio, arylC0-11alkylthio, C0-11alkylamino, arylC0-11alkylamino, di(arylC0-11alkyl)amino, C1-11alkylcarbonyl, arylC1-11alkylcarbonyl, C1-11alkylcarboxy, arylC1-11alkylcarboxy, C1-11alkylcarbonylamino, aryl C1-11alkylcarbonylamino, C0-11alkylCOOR8, C0-11alkylCONR9R10 wherein R8, R9 and R10 are independently selected from hydrogen, C1-C11alkyl, arylC0-C11alkyl, or R9 and R10 are taken together with the nitrogen to which they are attached forming a cyclic system containing 3 to 8 carbon atoms with at least one C1-C11alkyl, arylC0-C11alkyl substituent,
(c) mono-, di- and tri-substituted arylC0-C11alkyl wherein the aryl substituents are defined as above for R′ and R″,
(iii) X is a mono-, di- or trisubstituted aryl wherein the aryl substituents are defined as above for R′ and R″, and aryl is selected from phenyl, biphenyl, naphthyl, dihydronaphthyl, tetrahydronaphthyl, indenyl, indanyl, azulenyl, anthryl, phenanthryl, fluorenyl, pyrenyl, thienyl, benzothienyl, isobenzothienyl, 2,3-dihydrobenzothienyl, furyl, pyranyl, benzofuranyl, isobenzofuranyl, 2,3-dihydrobenzofuranyl, pyrrolyl, indolyl, isoindolyl, indolizinyl, indazolyl, imidazolyl, benzimidazolyl, pyridyl, pyrazinyl, pyradazinyl, pyrimidinyl, triazinyl, quinolyl, isoquinolyl, 4H-quinolizinyl, cinnolinyl, phthalazinyl, quinazolinyl, quinoxalinyl, 1,8-naphthyridinyl, pteridinyl, carbazolyl, acridinyl, phenazinyl, phenothiazinyl, phenoxazinyl, chromanyl, benzodioxolyl, piperonyl, purinyl, hydroxypyronyl, pyrazolyl, triazolyl, tetrazolyl, thiazolyl, isothiazolyl, benzthiazolyl, oxazolyl, isoxazolyl, benzoxazolyl, oxadiazolyl, or thiadiazolyl,
and wherein the remaining of R1, R2 and R3 are independently selected from the group consisting of:
(i) hydrogen;
(ii) C1-11alkyl, substituted C1-11alkyl wherein the alkyl substituents are defined as above,
(iii) arylC0-11alkyl,
(iv) mono-, di- and tri-substituted arylC0-C11alkyl wherein the aryl substituents are defined as above,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
120. A compound as defined in claim 119 wherein aryl is selected from phenyl, naphthyl, biphenyl, thienyl, furyl, pyridyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
121. A compound as defined in claim 119 wherein aryl is phenyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
122. A compound as defined in claim 119 wherein aryl is naphthyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
123. A compound as defined in claim 119 wherein aryl is biphenyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
124. A compound as defined in claim 119 wherein aryl is thienyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
125. A compound as defined in claim 119 wherein aryl is furyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
126. A compound as defined in claim 119 wherein aryl is pyridyl,
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
127. A compound as defined in claim 1 with the structure as depicted below
Figure US20020183518A1-20021205-C00262
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
128. A compound as defined in claim 1 with the structure as depicted below
Figure US20020183518A1-20021205-C00263
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
129. A compound as defined in claim 63 with the structure as depicted below
Figure US20020183518A1-20021205-C00264
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
130. A compound as defined in claim 63 with the structure as depicted below
Figure US20020183518A1-20021205-C00265
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
131. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00266
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
132. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00267
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
133. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00268
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
134. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00269
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
135. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00270
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
136. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00271
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
137. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00272
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
138. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00273
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
139. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00274
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
140. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00275
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
141. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00276
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
142. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00277
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
143. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00278
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
144. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00279
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
145. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00280
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
146. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00281
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
147. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00282
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
148. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00283
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
149. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00284
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
150. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00285
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
151. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00286
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
152. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00287
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
153. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00288
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
154. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00289
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
155. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00290
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
156. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00291
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
157. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00292
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
158. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00293
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
159. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00294
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
160. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00295
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
161. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00296
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
162. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00297
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
163. A compound with the structure as depicted below
Figure US20020183518A1-20021205-C00298
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
164. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00299
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
165. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00300
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
166. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00301
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
167. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00302
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
168. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00303
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
169. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00304
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
170. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00305
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
171. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00306
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
172. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00307
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
173. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00308
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
174. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00309
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
175. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00310
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
176. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00311
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
177. A compound with the structure as depicted below
Figure US20020183518A1-20021205-C00312
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
178. A compound as defined in claim 39 with the structure as depicted below
Figure US20020183518A1-20021205-C00313
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
179. A compound as defined in claim 39 with the structure as depicted below
Figure US20020183518A1-20021205-C00314
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
180. A compound as defined in claim 39 with the structure as depicted below
Figure US20020183518A1-20021205-C00315
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
181. A compound as defined in claim 3 9 with the structure as depicted below
Figure US20020183518A1-20021205-C00316
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
182. A compound as defined in claim 39 with the structure as depicted below
Figure US20020183518A1-20021205-C00317
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
183. A compound as defined in claim 39 with the structure as depicted below
Figure US20020183518A1-20021205-C00318
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
184. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00319
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
185. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00320
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
186. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00321
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
187. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00322
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
189. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00323
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
190. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00324
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
191. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00325
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
192. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00326
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
193. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00327
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
194. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00328
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
195. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00329
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
196. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00330
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
197. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00331
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
198. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00332
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
199. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00333
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
200. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00334
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
201. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00335
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
202. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00336
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
203. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00337
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
204. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00338
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
205. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00339
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
206. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00340
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
207. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00341
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
208. A compound as defined in claim 47 with the structure as depicted below
Figure US20020183518A1-20021205-C00342
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
209. A compound as defined in claim 63 with the structure as depicted below
Figure US20020183518A1-20021205-C00343
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
210. A compound as defined in claim 24 with the structure as depicted below
Figure US20020183518A1-20021205-C00344
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
211. A compound as defined in claim 24 with the structure as depicted below
Figure US20020183518A1-20021205-C00345
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
212. A compound as defined in claim 24 with the structure as depicted below
Figure US20020183518A1-20021205-C00346
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
213. A compound as defined in claim 24 with the structure as depicted below
Figure US20020183518A1-20021205-C00347
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
214. A compound as defined in claim 24 with the structure as depicted below
Figure US20020183518A1-20021205-C00348
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
215. A compound as defined in claim 24 with the structure as depicted below
Figure US20020183518A1-20021205-C00349
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
216. A compound as defined in claim 24 with the structure as depicted below
Figure US20020183518A1-20021205-C00350
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
217. A compound as defined in claim 24 with the structure as depicted below
Figure US20020183518A1-20021205-C00351
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
218. A compound as defined in claim 24 with the structure as depicted below
Figure US20020183518A1-20021205-C00352
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
219. A compound as defined in claim 24 with the structure as depicted below
Figure US20020183518A1-20021205-C00353
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
220. A compound as defined in claim 24 with the structure as depicted below
Figure US20020183518A1-20021205-C00354
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
221. A compound as defined in claim 24 with the structure as depicted below
Figure US20020183518A1-20021205-C00355
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
222. A compound as defined in claim 24 with the structure as depicted below
Figure US20020183518A1-20021205-C00356
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
223. A compound as defined in claim 24 with the structure as depicted below
Figure US20020183518A1-20021205-C00357
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
224. A compound as defined in claim 24 with the structure as depicted below
Figure US20020183518A1-20021205-C00358
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
225. A compound as defined in claim 24 with the structure as depicted below
Figure US20020183518A1-20021205-C00359
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
226. A compound as defined in claim 24 with the structure as depicted below
Figure US20020183518A1-20021205-C00360
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
227. A compound as defined in claim 24 with the structure as depicted below
Figure US20020183518A1-20021205-C00361
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
228. A compound as defined in claim 24 with the structure as depicted below
Figure US20020183518A1-20021205-C00362
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
229. A compound as defined in claim 55 with the structure as depicted below
Figure US20020183518A1-20021205-C00363
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
230. A compound as defined in claim 71 with the structure as depicted below
Figure US20020183518A1-20021205-C00364
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
231. A compound as defined in claim 79 with the structure as depicted below
Figure US20020183518A1-20021205-C00365
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
232. A compound as defined in claim 79 with the structure as depicted below
Figure US20020183518A1-20021205-C00366
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
233. A compound as defined in claim 79 with the structure as depicted below
Figure US20020183518A1-20021205-C00367
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
234. A compound as defined in claim 79 with the structure as depicted below
Figure US20020183518A1-20021205-C00368
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
235. A compound as defined in claim 79 with the structure as depicted below
Figure US20020183518A1-20021205-C00369
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
236. A compound as defined in claim 79 with the structure as depicted below
Figure US20020183518A1-20021205-C00370
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
237. A compound as defined in claim 87 with the structure as depicted below
Figure US20020183518A1-20021205-C00371
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
238. A compound as defined in claim 87 with the structure as depicted below
Figure US20020183518A1-20021205-C00372
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
239. A compound as defined in claim 95 with the structure as depicted below
Figure US20020183518A1-20021205-C00373
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
240. A compound as defined in claim 103 with the structure as depicted below
Figure US20020183518A1-20021205-C00374
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
241. A compound as defined in claim 103 with the structure as depicted below
Figure US20020183518A1-20021205-C00375
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
242. A compound as defined in claim 111 with the structure as depicted below
Figure US20020183518A1-20021205-C00376
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
243. A compound as defined in claim 111 with the structure as depicted below
Figure US20020183518A1-20021205-C00377
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
244. A compound as defined in claim 1 I with the structure as depicted below
Figure US20020183518A1-20021205-C00378
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
245. A compound as defined in claim 111 with the structure as depicted below
Figure US20020183518A1-20021205-C00379
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
246. A compound as defined in claim 111 with the structure as depicted below
Figure US20020183518A1-20021205-C00380
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
247. A compound as defined in claim 119 with the structure as depicted below
Figure US20020183518A1-20021205-C00381
or its pharmaceutically acceptable salts, prodrugs, esters, or solvates thereof.
248. A pharmaceutical composition comprising as active component a compound according to any one of the preceding compound claims together with a pharmaceutically acceptable carrier or diluent.
249. A pharmaceutical composition suitable for modulating the activity of PTPases or other molecules with tyrosine phosphate recognition unit(s) comprising an effective amount of a compound according to any one of the preceding compound claims together with a pharmaceutically acceptable carrier or diluent.
250. The pharmaceutical composition according to any one of the claims 248 or 249 suitable for treating or preventing type I diabetes, type II diabetes, impaired glucose tolerance, insuline resistance, obesity, immune dysfunctions including autoimmunity and AIDS, diseases with dysfunctions of the coagulation system, allergic diseases, osteoperosis, proliferative disorders including cancer and psoriosis, diseases with decreased or increased synthesis or effects of growth hormone, diseases with decreased or increased synthesis of hormones or cytokines that regulate the release of/or response to growth hormone, diseases of the brain including Alzheimer's disease and schizophrnia, and infectious diseases.
251. The pharmaceutical composition according to any one of the claims 248, 249 or 250 comprising between 0.5 mg and 1000 mg of a compound according to any one of the preceding compound claims per unit dose.
252. A method of modulating the activity of PTPases or other molecules with phosphotyrosine recognition unit(s) in a subject in need of such treatment comprising administering to said subject an effective amount of a compound or composition according to any one of the preceding compound or composition claims.
253. The use of a compound according to any one of the preceding compound claims for preparing a medicament.
254. The use of a compound according to any one of the preceding compound claims for preparing a medicament for modulating the activity of PTPases or other molecules with phosphotyrosine recognition unit(s).
255. The use of a compound according to any one of the preceding compound claims for preparing a medicament for treating or preventing type I diabetes, type II diabetes, impaired glucose tolerance, insuline resistance, obesity, immune dysfunctions including autoimmunity and AIDS, diseases with dysfunctions of the coagulation system, allergic diseases, osteoperosis, proliferative disorders including cancer and psoriasis, diseases with decreased or increased synthesis or effects of growth hormone, diseases with decreased or increased synthesis of hormones or cytokines that regulate the release of/or response to growth hormone, diseases of the brain including Alzheimer's disease and schizophrnia, and infectious diseases.
256. The use of a compound according to any one of the preceding compound claims for preparing a medicament for treating a subject in need of such treatment.
257. The use of a compound according to any one of the preceding compound claims for preparing a medicament for use as an immunosuppressant.
258. An immobilized compound comprising a suitable solid-phase coupled with a compound according to any one of the preceding compound claim.
259. A method for coupling a compound according to any one of the preceding compound claims to a suitable solid-phase matrix.
260. A method for isolating a protein or a glycoprotein with affinity for a compound according to any one of the preceding compound claims from a biological sample, comprising
(1) contacting an immobilized compound according to claim 258 with said biological sample in order for said immobilized compound to form a complex by binding said protein or glycoprotein
(2) removing unbound material from said biological sample and isolating said complex
(3) extracting said protein or glycoprotein from said complex.
261. A method for isolating a protein-tyrosine phosphatase with affinity for a compound according to any one of the preceding compound claims from a biological sample, comprising
(1) contacting an immobilized compound according to claim 258 with said biological sample in order for said immobilized compound to form a complex by binding said protein-tyrosine phosphatase
(2) removing unbound material from said biological sample and isolating said complex
(3) extracting said protein-tyrosine phosphatase from said complex.
262. A method for isolating a Src-homology 2 domain containing protein or a phosphotyrosine binding domain containg protein with affinity for a compound according to any one of the preceding compound claims from a biological sample, comprising
(1) contacting an immobilized compound according to claim 258 with said biological sample in order for said immobilized compound to form a complex by binding said Src-homology 2 domain containing protein or a phosphotyrosine binding domain containg protein
(2) removing unbound material from said biological sample and isolating said complex
(3) extracting said Src-homology 2 domain containing protein or a phosphotyrosine binding domain containg protein from said complex.
263. A compound according to any one of the preceding compound claims coupled to a fluorescent or radioactive molecule.
264. A method for coupling a fluorescent or radioactive molecule to a compound according to any one of the preceding compound claims comprising
(1) contacting said compound with said fluorescent or radioactive molecule in a reaction mixture to produce a complex
(2) removing uncomplexed material and isolating said complex from said reaction mixture.
265. A method for detecting a protein-tyrosine phosphatase or other molecules with phosphotyrosine recognition unit(s) in a cell or in a subject using a compound according to claim 263 comprising
(1) contacting said cell or an extract thereof or a biological sample from said subject or by injecting said compound into said subject in order for said compound to produce a complex with said protein-tyrosine phosphatase or said other molecules with phosphotyrosine recognition unit(s)
(2) detecting said complex, thereby detecting the presence of said protein-tyrosine phosphatase or said other molecules with phosphotyrosine recognition unit(s).
266. A method for quantifying the amount of protein-tyrosine phosphatase or other molecules with phosphotyrosine recognition unit(s) in a cell or in a subject using a compound according to claim 263 comprising
(1) contacting said cell or an extract thereof or a biological sample from said subject or by injecting said compound into said subject in order for said compound to produce a complex with said protein-tyrosine phosphatase or said other molecules with phosphotyrosine recognition unit(s)
(2) measuring the amount of said complex, thereby detecting the presence of said protein-tyrosine phosphatase or said other molecules with phosphotyrosine recognition unit(s).
267. A method for determining the function of a given protein-tyrosine phosphatase or group of protein-tyrosine phosphatases or said molecules with phosphotyrosine recognition unit(s) in a cell or in a subject using a compound according to claim 263 comprising
(1) contacting said cell or an extract thereof or a biological sample from said subject or by injecting said compound into said subject in order for said compound to produce a complex with said protein-tyrosine phosphatase or said other molecules with phosphotyrosine recognition unit(s)
(2) measuring the biological effects induced by said complex.
US09/995,550 1995-06-19 2001-11-27 Modulators of proteins with phosphotyrosine recognition units Abandoned US20020183518A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US09/995,550 US20020183518A1 (en) 1995-06-19 2001-11-27 Modulators of proteins with phosphotyrosine recognition units

Applications Claiming Priority (7)

Application Number Priority Date Filing Date Title
US1761095P 1995-06-19 1995-06-19
US08/543,630 US5770620A (en) 1995-06-19 1995-10-16 Aryl acrylic acid derivatives useful as protein tyrosine phosphatase inhibitors
US08/766,114 US5753687A (en) 1995-06-19 1996-12-16 Modulators of proteins with phosphotryrosine recognition units
US08/960,637 US5965558A (en) 1995-06-19 1997-10-29 Modulators of proteins with phosphotyrosine recognition units
US09/210,076 US6150532A (en) 1995-06-19 1998-12-11 Modulators of proteins with phosphotyrosine recognition units
US09/645,785 US6388076B1 (en) 1995-06-19 2000-08-24 Protein tyrosine phosphatase-inhibiting compounds
US09/995,550 US20020183518A1 (en) 1995-06-19 2001-11-27 Modulators of proteins with phosphotyrosine recognition units

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US09/645,785 Continuation US6388076B1 (en) 1995-06-19 2000-08-24 Protein tyrosine phosphatase-inhibiting compounds

Publications (1)

Publication Number Publication Date
US20020183518A1 true US20020183518A1 (en) 2002-12-05

Family

ID=46276957

Family Applications (2)

Application Number Title Priority Date Filing Date
US09/645,785 Expired - Fee Related US6388076B1 (en) 1995-06-19 2000-08-24 Protein tyrosine phosphatase-inhibiting compounds
US09/995,550 Abandoned US20020183518A1 (en) 1995-06-19 2001-11-27 Modulators of proteins with phosphotyrosine recognition units

Family Applications Before (1)

Application Number Title Priority Date Filing Date
US09/645,785 Expired - Fee Related US6388076B1 (en) 1995-06-19 2000-08-24 Protein tyrosine phosphatase-inhibiting compounds

Country Status (1)

Country Link
US (2) US6388076B1 (en)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040186151A1 (en) * 2003-02-12 2004-09-23 Mjalli Adnan M.M. Substituted azole derivatives as therapeutic agents
US20040192743A1 (en) * 2003-02-12 2004-09-30 Mjalli Adnan M.M. Substituted azole derivatives as therapeutic agents
US20050096335A1 (en) * 2001-10-19 2005-05-05 Mjalli Adnan M.M. Heteroaryl - fused nitrogen heterocycles as therapeutic agents
EP1555264A1 (en) * 2004-01-15 2005-07-20 Sireen AG Five-membered heterocyclic compounds as inhibitors of SRC family protein kinase.
US20050187277A1 (en) * 2004-02-12 2005-08-25 Mjalli Adnan M. Substituted azole derivatives, compositions, and methods of use
US20080187932A1 (en) * 2006-01-10 2008-08-07 Vita Genomics, Inc. Single Nucleotide Polymorphisms in Protein-Tyrosine Phosphatase Receptor-Type Delta for the Diagnosis of Susceptibility to Infection and Asthma
US20100113331A1 (en) * 2006-01-30 2010-05-06 Transtech Pharma, Inc. Substituted Imidazole Derivatives, Compositions, and Methods of Use as PtPase Inhibitors
EP2671891A2 (en) 2008-06-27 2013-12-11 Amgen Inc. Ang-2 inhibition to treat multiple sclerosis

Families Citing this family (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE10015818A1 (en) * 2000-03-30 2001-10-18 Infineon Technologies Ag Biosensor and method for determining macromolecular biopolymers using a biosensor
CA2451845A1 (en) * 2001-05-31 2002-12-05 The Cleveland Clinic Foundation Ptpase inhibitors and method of using same
US20040010045A1 (en) * 2001-09-07 2004-01-15 Taolin Yi Therapeutic compositions comprised of pentamidine and methods of using same to treat cancer
WO2003070158A2 (en) 2001-09-07 2003-08-28 The Cleveland Clinic Foundation Therapeutic compositions and methods useful in modulating protein tyrosine phosphatases
US20050215629A1 (en) * 2001-09-07 2005-09-29 Taolin Yi PTPase inhibitors and methods of using the same
US20030161893A1 (en) * 2001-09-07 2003-08-28 Taolin Yi PTPase inhibitors and methods of using the same
US20100173864A1 (en) 2004-03-29 2010-07-08 Cheng Jin Q Compositions including triciribine and one or more platinum compounds and methods of use thereof
US20100028339A1 (en) 2004-03-29 2010-02-04 Cheng Jin Q Compositions including triciribine and trastuzumab and methods of use thereof
MXPA06011219A (en) 2004-03-29 2007-05-08 Univ South Florida Effective treatment of tumors and cancer with triciribine and related compounds.
US20100009929A1 (en) 2004-03-29 2010-01-14 Cheng Jin Q Compositions including triciribine and bortezomib and derivatives thereof and methods of use thereof
US20110008327A1 (en) 2004-03-29 2011-01-13 Cheng Jin Q Compositions including triciribine and epidermal growth factor receptor inhibitor compounds or salts thereof and methods of use thereof
US20100009928A1 (en) * 2004-03-29 2010-01-14 Cheng Jin Q Compositions including triciribine and taxanes and methods of use thereof
CN1870631B (en) * 2005-11-11 2010-04-14 华为技术有限公司 Gate control method for media gateway
TW200803835A (en) * 2006-01-11 2008-01-16 Cleveland Clinic Foundation Therapeutic compositions and methods useful in modulating protein tyrosine phosphatases
US20080226596A1 (en) * 2006-06-19 2008-09-18 Taolin Yi Therapeutic compositions and methods useful in treating hepatitis
WO2007149381A2 (en) * 2006-06-19 2007-12-27 The Cleveland Clinic Foundation Compositions comprising a ptp-ase inhibitor and use thereof in treating cancer

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4612321A (en) * 1983-09-09 1986-09-16 Takeda Chemical Industries, Inc. 5-pyridyl-1,3-thiazole derivatives

Family Cites Families (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0151765B1 (en) * 1981-03-24 1987-07-08 Southern Research Institute Novel intermediates in a process for making novel 1,2-dihydropyrido(3,4-b)-pyrazines
US4988813A (en) * 1986-10-20 1991-01-29 The Trustees Of Princeton University Process for the preparation of fused pyridine compounds
US4920131A (en) 1987-11-03 1990-04-24 Rorer Pharmaceutical Corp. Quinoline derivatives and use thereof as antagonists of leukotriene D4
KR0143565B1 (en) 1988-06-13 1998-07-15 사노 가즈오 P-substituted phenyl ester derivatives of pivalic acid, methods for their preparation and compositions comprising them.
CA2018487A1 (en) 1989-06-08 1990-12-08 Frank P. Dininno 2- (substituted-dibenzofuranyl and dibenzothienyl) carbapenem antibacterial agents
JPH0374386A (en) * 1989-08-16 1991-03-28 Terumo Corp Pyrazine derivative and blood platelet agglutination inhibitor or anti-inflammatory agent containing the same
US5025006A (en) 1990-06-26 1991-06-18 Merck & Co., Inc. 2-biphenyl-carbapenem antibacterial agents
US5132422A (en) 1990-10-09 1992-07-21 Merck & Co., Inc. 2-naphthyl-carbapenem intermediates
US5208229A (en) 1990-11-29 1993-05-04 Merck & Co., Inc. 2-(1,2,3-triazolylsubstituted)phenyl carbapenem antibacterial agents
US5208328A (en) 1991-04-16 1993-05-04 Merck & Co., Inc. 2-phenanthridonyl carbapenem intermediates
US5157033A (en) 1991-04-16 1992-10-20 Merck & Co., Inc. 2-phenanthridonyl carbapenems having cationizeable substituents
US5214139A (en) 1991-04-16 1993-05-25 Merck & Co., Inc. 2-phenanthridonyl-carbapenems
JPH07508039A (en) 1992-05-20 1995-09-07 メルク エンド カンパニー インコーポレーテッド Ester derivatives of 4-azasteroids
FR2700167B1 (en) 1993-01-07 1995-02-03 Rhone Poulenc Rorer Sa Pyrrolidine and thiazolidine derivatives, their preparation and the drugs containing them.
CA2167391A1 (en) 1993-07-16 1995-01-26 Robert W. Armstrong Synthesis of combinatorial arrays of organic compounds through the use of multiple component combinatorial array syntheses
US5770620A (en) * 1995-06-19 1998-06-23 Ontogen Corporation Aryl acrylic acid derivatives useful as protein tyrosine phosphatase inhibitors
US5753687A (en) * 1995-06-19 1998-05-19 Ontogen Corporation Modulators of proteins with phosphotryrosine recognition units
US5965558A (en) * 1995-06-19 1999-10-12 Ontogen Corporation Modulators of proteins with phosphotyrosine recognition units

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4612321A (en) * 1983-09-09 1986-09-16 Takeda Chemical Industries, Inc. 5-pyridyl-1,3-thiazole derivatives

Cited By (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050096335A1 (en) * 2001-10-19 2005-05-05 Mjalli Adnan M.M. Heteroaryl - fused nitrogen heterocycles as therapeutic agents
US20040192743A1 (en) * 2003-02-12 2004-09-30 Mjalli Adnan M.M. Substituted azole derivatives as therapeutic agents
US20040186151A1 (en) * 2003-02-12 2004-09-23 Mjalli Adnan M.M. Substituted azole derivatives as therapeutic agents
EP1555264A1 (en) * 2004-01-15 2005-07-20 Sireen AG Five-membered heterocyclic compounds as inhibitors of SRC family protein kinase.
WO2005068458A3 (en) * 2004-01-15 2005-11-24 Sirenade Pharmaceuticals Ag Five-membered heterocyclic compounds as inhibitors of src family protein kinase
US20110092553A1 (en) * 2004-02-12 2011-04-21 Transtech Pharma, Inc. Substituted Azole Derivatives, Compositions, and Methods of Use
US20050187277A1 (en) * 2004-02-12 2005-08-25 Mjalli Adnan M. Substituted azole derivatives, compositions, and methods of use
US20080187932A1 (en) * 2006-01-10 2008-08-07 Vita Genomics, Inc. Single Nucleotide Polymorphisms in Protein-Tyrosine Phosphatase Receptor-Type Delta for the Diagnosis of Susceptibility to Infection and Asthma
US7604945B2 (en) 2006-01-10 2009-10-20 Vita Genomics, Inc. Single nucleotide polymorphisms in protein-tyrosine phosphatase receptor-type delta for the diagnosis of susceptibility to asthma
US20100113331A1 (en) * 2006-01-30 2010-05-06 Transtech Pharma, Inc. Substituted Imidazole Derivatives, Compositions, and Methods of Use as PtPase Inhibitors
US7723369B2 (en) 2006-01-30 2010-05-25 Transtech Pharma, Inc. Substituted imidazole derivatives, compositions, and methods of use as PTPase inhibitors
US8404731B2 (en) 2006-01-30 2013-03-26 Transtech Pharma, Inc. Substituted imidazole derivatives, compositions, and methods of use as PTPase inhibitors
EP2671891A2 (en) 2008-06-27 2013-12-11 Amgen Inc. Ang-2 inhibition to treat multiple sclerosis

Also Published As

Publication number Publication date
US6388076B1 (en) 2002-05-14

Similar Documents

Publication Publication Date Title
US6388076B1 (en) Protein tyrosine phosphatase-inhibiting compounds
US5753687A (en) Modulators of proteins with phosphotryrosine recognition units
US5965558A (en) Modulators of proteins with phosphotyrosine recognition units
AU740425B2 (en) Modulators of proteins with phosphotyrosine recognition units
KR101442663B1 (en) Heterocyclic Compounds as CRTH2 Receptor Antagonists
US5710129A (en) Inhibitors of SH2-mediated processes
EP2346865B1 (en) Indole derivatives as crth2 receptor antagonists
CN100503572C (en) Caspase inhibitors and uses thereof
US20070010457A1 (en) Caspase inhibitors and uses thereof
CN102918034A (en) Polysubstituted aromatic compounds as inhibitors of thrombin
NO323952B1 (en) Substituted indoles for modulating NFκB activity, method of preparation, drug comprising them, their use and a method for the preparation of a drug.
US5420133A (en) Quinazolinones substituted with phenoxyphenylacetic acid derivatives
EA001280B1 (en) Substituted n-[(aminoiminomethyl or aminomethyl)phenyl]propyl amides
JP2002537294A (en) Di- and tripeptide nitrile derivatives as inhibitors of cathepsin L and cathepsin S
KR20140103925A (en) Derivatives of 4-hydroxy-1,2,3,4-tetrahydronaphtalen-1-yl urea and their use in the treatment of, inter alia, diseases of the respiratory tract
US5686478A (en) Endothelin antagonists
JP2002510623A (en) Antidiabetic drugs
AU713863B2 (en) Aryl acrylic acid derivatives useful as protein tyrosine phosphatase inhibitors
US20020049316A1 (en) Protease inhibitors
PL184060B1 (en) Substituted phenyl compounds and method of applying them as endoteline antagonists
JP2003512463A (en) Compounds and their use as cysteine protease inhibitors
CN116396284A (en) Benzo seven-membered nitrogen oxygen heterocyclic indole-2-carboxamide derivative and its preparation method and use
JP2002523486A (en) N-Hydroxyacylamino compounds, methods for their preparation, and pharmaceutical compositions containing them
WO2003082263A1 (en) Sulfamic acids as inhibitors of human cytoplasmic protein tyrosine phosphatases
JPH1087567A (en) Phenol ester derivatives, their production and use

Legal Events

Date Code Title Description
STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION