Connect public, paid and private patent data with Google Patents Public Datasets

RNA sequence-specific mediators of RNA interference

Info

Publication number
US20020086356A1
US20020086356A1 US09821832 US82183201A US2002086356A1 US 20020086356 A1 US20020086356 A1 US 20020086356A1 US 09821832 US09821832 US 09821832 US 82183201 A US82183201 A US 82183201A US 2002086356 A1 US2002086356 A1 US 2002086356A1
Authority
US
Grant status
Application
Patent type
Prior art keywords
rna
mrna
dsrna
gene
nt
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US09821832
Inventor
Thomas Tuschl
Phillip Zamore
Phillip Sharp
David Bartel
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Max-Planck-Gesellschaft zur Forderung der Wissenschaften
University of Massachusetts (UMass)
Whitehead Institute for Biomedical Research
Massachusetts Institute of Technology
Original Assignee
Whitehead Institute for Biomedical Research
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00Rearing or breeding animals, not otherwise provided for; New breeds of animals
    • A01K67/033Rearing or breeding invertebrates; New breeds of invertebrates
    • A01K67/0333Genetically modified inverterbrates, e.g. transgenic, polyploid
    • A01K67/0335Genetically modified worms
    • A01K67/0336Genetically modified Nematodes, e.g. Caenorhabditis elegans
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07HSUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • C07H21/02Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with ribosyl as saccharide radical
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034Isolating an individual clone by screening libraries
    • C12N15/1079Screening libraries by altering the phenotype or phenotypic trait of the host
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/111General methods applicable to biologically active non-coding nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/66Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving luciferase
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2207/00Modified animals
    • A01K2207/05Animals modified by non-integrating nucleic acids, e.g. antisense, RNAi, morpholino, episomal vector, for non-therapeutic purpose
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00Genetically modified animals
    • A01K2217/07Animals genetically altered by homologous recombination
    • A01K2217/075Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00Animals characterised by species
    • A01K2227/70Invertebrates
    • A01K2227/703Worms, e.g. Caenorhabdities elegans
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00Animals characterised by purpose
    • A01K2267/03Animal model, e.g. for test or diseases
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering N.A.
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3212'-O-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/50Physical structure
    • C12N2310/53Physical structure partially self-complementary or closed
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2330/00Production
    • C12N2330/30Production chemically synthesised

Abstract

The present invention relates to a Drosophila in vitro system which was used to demonstrate that dsRNA is processed to RNA segments 21-23 nucleotides (nt) in length. Furthermore, when these 21-23 nt fragments are purified and added back to Drosophila extracts, they mediate RNA interference in the absence of long dsRNA. Thus, these 21-23 nt fragments are the sequence-specific mediators of RNA degradation. A molecular signal, which may be their specific length, must be present in these 21-23 nt fragments to recruit cellular factors involved in RNAi. This present invention encompasses these 21-23 nt fragments and their use for specifically inactivating gene function. The use of these fragments (or chemically synthesized oligonucleotides of the same or similar nature) enables the targeting of specific mRNAs for degradation in mammalian cells, where the use of long dsRNAs to elicit RNAi is usually not practical, presumably because of the deleterious effects of the interferon response. This specific targeting of a particular gene function is useful in functional genomic and therapeutic applications.

Description

    RELATED APPLICATIONS
  • [0001]
    This application claims the benefit of U.S. Provisional Application No. 60/265,232, filed Jan. 31, 2001 and U.S. Provisional Application No. 60/193,594, filed Mar. 30, 2000, and claims priority under 35 U.S.C. §119 to European Application No. 00 126 325.0 filed Dec. 1, 2000. The entire teachings of the above applications are incorporated herein by reference.
  • GOVERNMENT SUPPORT
  • [0002] Work described herein was funded in part by grants from the National Institutes of Health through a United States Public Health Service MERIT award (Grant No. RO1-GM34277) from the National Institutes of Health. The United States government has certain rights in the invention.
  • BACKGROUND OF THE INVENTION
  • [0003]
    RNA interference or “RNAi” is a term initially coined by Fire and co-workers to describe the observation that double-stranded RNA (dsRNA) can block gene expression when it is introduced into worms (Fire et al. (1998) Nature 391, 806-811). dsRNA directs gene-specific, post-transcriptional silencing in many organisms, including vertebrates, and has provided a new tool for studying gene function. RNAi involves mRNA degradation, but many of the biochemical mechanisms underlying this interference are unknown. The recapitulation of the essential features of RNAi in vitro is needed for a biochemical analysis of the phenomenon.
  • SUMMARY OF THE INVENTION
  • [0004]
    Described herein is gene-specific, dsRNA-mediated interference in a cell-free system derived from syncytial blastoderm Drosophila embryos. The in vitro system complements genetic approaches to dissecting the molecular basis of RNAi. As described herein, the molecular mechanisms underlying RNAi were examined using the Drosophila in vitro system. Results showed that RNAi is ATP-dependent yet uncoupled from mRNA translation. That is, protein synthesis is not required for RNAi in vitro. In the RNAi reaction, both strands (sense and antisense) of the dsRNA are processed to small RNA fragments or segments of from about 21 to about 23 nucleotides (nt) in length (RNAs with mobility in sequencing gels that correspond to markers that are 21-23 nt in length, optionally referred to as 21-23 nt RNA). Processing of the dsRNA to the small RNA fragments does not require the targeted mRNA, which demonstrates that the small RNA species is generated by processing of the dsRNA and not as a product of dsRNA-targeted mRNA degradation. The mRNA is cleaved only within the region of identity with the dsRNA. Cleavage occurs at sites 21-23 nucleotides apart, the same interval observed for the dsRNA itself, suggesting that the 21-23 nucleotide fragments from the dsRNA are guiding mRNA cleavage. That purified 21-23 nt RNAs mediate RNAi confirms that these fragments are guiding mRNA cleavage.
  • [0005]
    Accordingly, the present invention relates to isolated RNA molecules (double-stranded; single-stranded) of from about 21 to about 23 nucleotides which mediate RNAi. That is, the isolated RNAs of the present invention mediate degradation of mRNA of a gene to which the mRNA corresponds (mediate degradation of mRNA that is the transcriptional product of the gene, which is also referred to as a target gene). For convenience, such mRNA is also referred to herein as mRNA to be degraded. As used herein, the terms RNA, RNA molecule(s), RNA segment(s) and RNA fragment(s) are used interchangeably to refer to RNA that mediates RNA interference. These terms include double-stranded RNA, single-stranded RNA, isolated RNA (partially purified RNA, essentially pure RNA, synthetic RNA, recombinantly produced RNA), as well as altered RNA that differs from naturally occurring RNA by the addition, deletion, substitution and/or alteration of one or more nucleotides. Such alterations can include addition of non-nucleotide material, such as to the end(s) of the 21-23 nt RNA or internally (at one or more nucleotides of the RNA). Nucleotides in the RNA molecules of the present invention can also comprise non-standard nucleotides, including non-naturally occurring nucleotides or deoxyribonucleotides. Collectively, all such altered RNAs are referred to as analogs or analogs of naturally-occurring RNA. RNA of 21-23 nucleotides of the present invention need only be sufficiently similar to natural RNA that it has the ability to mediate (mediates) RNAi. As used herein the phrase “mediates RNAi” refers to (indicates) the ability to distinguish which RNAs are to be degraded by the RNAi machinery or process. RNA that mediates RNAi interacts with the RNAi machinery such that it directs the machinery to degrade particular mRNAs. In one embodiment, the present invention relates to RNA molecules of about 21 to about 23 nucleotides that direct cleavage of specific mRNA to which their sequence corresponds. It is not necessary that there be perfect correspondence of the sequences, but the correspondence must be sufficient to enable the RNA to direct RNAi cleavage of the target mRNA. In a particular embodiment, the 21-23 nt RNA molecules of the present invention comprise a 3′ hydroxyl group.
  • [0006]
    The present invention also relates to methods of producing RNA molecules of about 21 to about 23 nucleotides with the ability to mediate RNAi cleavage. In one embodiment, the Drosophila in vitro system is used. In this embodiment, dsRNA is combined with a soluble extract derived from Drosophila embryo, thereby producing a combination. The combination is maintained under conditions in which the dsRNA is processed to RNA molecules of about 21 to about 23 nucleotides. In another embodiment, the Drosophila in vitro system is used to obtain RNA sequences of about 21 to about 23 nucleotides which mediate RNA interference of the mRNA of a particular gene (e.g., oncogene, viral gene). In this embodiment, double-stranded RNA that corresponds to a sequence of the gene to be targeted is combined with a soluble extract derived from Drosophila embryo, thereby producing a combination. The combination is maintained under conditions in which the double-stranded RNA is processed to RNA of about 21 to about 23 nucleotides in length. As shown herein, 21-23 nt RNA mediates RNAi of the mRNA of the targeted gene (the gene whose mRNA is to be degraded). The method of obtaining 21-23 nt RNAs using the Drosophila in vitro system can further comprise isolating the RNA sequence from the combination.
  • [0007]
    The present invention also relates to 21-23 nt RNA produced by the methods of the present invention, as well as to 21-23 nt RNAs, produced by other methods, such as chemical synthesis or recombinant DNA techniques, that have the same or substantially the same sequences as naturally-occurring RNAs that mediate RNAi, such as those produced by the methods of the present invention. All of these are referred to as 21-23 nt RNAs that mediate RNA interference. As used herein, the term isolated RNA includes RNA obtained by any means, including processing or cleavage of dsRNA as described herein; production by chemical synthetic methods; and production by recombinant DNA techniques. The invention further relates to uses of the 21-23 nt RNAs, such as for therapeutic or prophylactic treatment and compositions comprising 21-23 nt RNAs that mediate RNAi, such as pharmaceutical compositions comprising 21-23 nt RNAs and an appropriate carrier (e.g., a buffer or water).
  • [0008]
    The present invention also relates to a method of mediating RNA interference of mRNA of a gene in a cell or organism (e.g., mammal such as a mouse or a human). In one embodiment, RNA of about 21 to about 23 nt which targets the mRNA to be degraded is introduced into the cell or organism. The cell or organism is maintained under conditions under which degradation of the mRNA occurs, thereby mediating RNA interference of the mRNA of the gene in the cell or organism. The cell or organism can be one in which RNAi occurs as the cell or organism is obtained or a cell or organism can be one that has been modified so that RNAi occurs (e.g., by addition of components obtained from a cell or cell extract that mediate RNAi or activation of endogenous components). As used herein, the term “cell or organism in which RNAi occurs” includes both a cell or organism in which RNAi occurs as the cell or organism is obtained, or a cell or organism that has been modified so that RNAi occurs. In another embodiment, the method of mediating RNA interference of a gene in a cell comprises combining double-stranded RNA that corresponds to a sequence of the gene with a soluble extract derived from Drosophila embryo, thereby producing a combination. The combination is maintained under conditions in which the double-stranded RNA is processed to RNAs of about 21 to about 23 nucleotides. 21 to 23 nt RNA is then isolated and introduced into the cell or organism. The cell or organism is maintained under conditions in which degradation of mRNA of the gene occurs, thereby mediating RNA interference of the gene in the cell or organism. As described for the previous embodiment, the cell or organism is one in which RNAi occurs naturally (in the cell or organism as obtained) or has been modified in such a manner that RNAi occurs. 21 to 23 nt RNAs can also be produced by other methods, such as chemical synthetic methods or recombinant DNA techniques.
  • [0009]
    The present invention also relates to biochemical components of a cell, such as a Drosophila cell, that process dsRNA to RNA of about 21 to about 23 nucleotides. In addition, biochemical components of a cell that are involved in targeting of mRNA by RNA of about 21 to about 23 nucleotides are the subject of the present invention. In both embodiments, the biochemical components can be obtained from a cell in which they occur or can be produced by other methods, such as chemical synthesis or recombinant DNA methods. As used herein, the term “isolated” includes materials (e.g., biochemical components, RNA) obtained from a source in which they occur and materials produced by methods such as chemical synthesis or recombinant nucleic acid (DNA, RNA) methods.
  • [0010]
    The present invention also relates to a method for knocking down (partially or completely) the targeted gene, thus providing an alternative to presently available methods of knocking down (or out) a gene or genes. This method of knocking down gene expression can be used therapeutically or for research (e.g., to generate models of disease states, to examine the function of a gene, to assess whether an agent acts on a gene, to validate targets for drug discovery). In those instances in which gene function is eliminated, the resulting cell or organism can also be referred to as a knockout. One embodiment of the method of producing knockdown cells and organisms comprises introducing into a cell or organism in which a gene (referred to as a targeted gene) is to be knocked down, RNA of about 21 to about 23 nt that targets the gene and maintaining the resulting cell or organism under conditions under which RNAi occurs, resulting in degradation of the mRNA of the targeted gene, thereby producing knockdown cells or organisms. Knockdown cells and organisms produced by the present method are also the subject of this invention.
  • [0011]
    The present invention also relates to a method of examining or assessing the function of a gene in a cell or organism. In one embodiment, RNA of about 21 to about 23 nt which targets mRNA of the gene for degradation is introduced into a cell or organism in which RNAi occurs. The cell or organism is referred to as a test cell or organism. The test cell or organism is maintained under conditions under which degradation of mRNA of the gene occurs. The phenotype of the test cell or organism is then observed and compared to that of an appropriate control cell or organism, such as a corresponding cell or organism that is treated in the same manner except that the targeted (specific) gene is not targeted. A 21 to 23 nt RNA that does not target the mRNA for degradation can be introduced into the control cell or organism in place of the RNA introduced into the test cell or organism, although it is not necessary to do so. A difference between the phenotypes of the test and control cells or organisms provides information about the function of the degraded mRNA. In another embodiment, double-stranded RNA that corresponds to a sequence of the gene is combined with a soluble extract that mediates RNAi, such as the soluble extract derived from Drosophila embryo described herein, under conditions in which the double-stranded RNA is processed to generate RNA of about 21 to about 23 nucleotides. The RNA of about 21 to about 23 nucleotides is isolated and then introduced into a cell or organism in which RNAi occurs (test cell or test organism). The test cell or test organism is maintained under conditions under which degradation of the mRNA occurs. The phenotype of the test cell or organism is then observed and compared to that of an appropriate control, such as a corresponding cell or organism that is treated in the same manner as the test cell or organism except that the targeted gene is not targeted. A difference between the phenotypes of the test and control cells or organisms provides information about the function of the targeted gene. The information provided may be sufficient to identify (define) the function of the gene or may be used in conjunction with information obtained from other assays or analyses to do so.
  • [0012]
    Also the subject of the present invention is a method of validating whether an agent acts on a gene. In this method, RNA of from about 21 to about 23 nucleotides that targets the mRNA to be degraded is introduced into a cell or organism in which RNAi occurs. The cell or organism (which contains the introduced RNA) is maintained under conditions under which degradation of mRNA occurs, and the agent is introduced into the cell or organism. Whether the agent has an effect on the cell or organism is determined; if the agent has no effect on the cell or organism, then the agent acts on the gene.
  • [0013]
    The present invention also relates to a method of validating whether a gene product is a target for drug discovery or development. RNA of from about 21 to about 23 nucleotides that targets the mRNA that corresponds to the gene for degradation is introduced into a cell or organism. The cell or organism is maintained under conditions in which degradation of the mRNA occurs, resulting in decreased expression of the gene. Whether decreased expression of the gene has an effect on the cell or organism is determined, wherein if decreased expression of the gene has an effect, then the gene product is a target for drug discovery or development.
  • [0014]
    The present invention also encompasses a method of treating a disease or condition associated with the presence of a protein in an individual comprising administering to the individual RNA of from about 21 to about 23 nucleotides which targets the mRNA of the protein (the mRNA that encodes the protein) for degradation. As a result, the protein is not produced or is not produced to the extent it would be in the absence of the treatment.
  • [0015]
    Also encompassed by the present invention is a gene identified by the sequencing of endogenous 21 to 23 nucleotide RNA molecules that mediate RNA interference.
  • [0016]
    Also encompassed by the present invention is a method of identifying target sites within an mRNA that are particularly suitable for RNAi as well as a method of assessing the ability of 21-23 nt RNAs to mediate RNAi.
  • BRIEF DESCRIPTION OF THE DRAWINGS
  • [0017]
    The file of this patent contains at least one drawing executed in color. Copies of this patent with color drawing(s) will be provided by the Patent and Trademark Office upon request and payment of the necessary fee.
  • [0018]
    [0018]FIG. 1 is a schematic representation of reporter mRNAs and dsRNAs Rr-Luc and Pp-Luc. Lengths and positions of the ssRNA, asRNA, and dsRNAs are shown as black bars relative to the Rr-Luc and Pp-Luc reporter mRNA sequences. Black rectangles indicate the two unrelated luciferase coding sequences, lines correspond to the 5′ and 3′ untranslated regions of the mRNAs.
  • [0019]
    [0019]FIG. 2A is a graph of the ratio of luciferase activities after targeting 50 pM Pp-Luc mRNA with 10 nM ssRNA, asRNA, or dsRNA from the 505 bp segment of the Pp-Luc gene showing gene-specific interference by dsRNA in vitro. The data are the average values of seven trials ±standard deviation. Four independently prepared lysates were used. Luciferase activity was normalized to the buffer control; a ratio equal to one indicates no gene-specific interference.
  • [0020]
    [0020]FIG. 2B is a graph of the ratio of luciferase activities after targeting 50 pM Rr-Luc mRNA with 10 nM ssRNA, asRNA, or dsRNA from the 501 bp segment of the Rr-Luc gene showing gene-specific interference by dsRNA in vitro. The data are the average values of six trials ±standard deviation. A Rr-Luc/Pp-Luc ratio equal to one indicates no gene-specific interference.
  • [0021]
    [0021]FIG. 3A is a schematic representation of the experimental strategy used to show that incubation in the Drosophila embryo lysate potentiates dsRNA for gene-specific interference. The same dsRNAs used in FIG. 2 (or buffer) was serially preincubated using two-fold dilutions in six successive reactions with Drosophila embryo lysate, then tested for its capacity to block mRNA expression. As a control, the same amount of dsRNA (10 nM) or buffer was diluted directly in buffer and incubated with Pp-Luc and Rr-Luc mRNAs and lysate.
  • [0022]
    [0022]FIG. 3B is a graph of potentiation when targeting Pp-Luc mRNA. Black columns indicate the dsRNA or the buffer was serially preincubated; white columns correspond to a direct 32-fold dilution of the dsRNA. Values were normalized to those of the buffer controls.
  • [0023]
    [0023]FIG. 3C is a graph of potentiation when targeting Rr-Luc mRNA. The corresponding buffer control is shown in FIG. 3B.
  • [0024]
    [0024]FIG. 4 is a graph showing effect of competitor dsRNA on gene-specific interference. Increasing concentrations of nanos dsRNA (508 bp) were added to reactions containing 5 nM dsRNA (the same dsRNAs used in FIGS. 2A and 2B) targeting Pp-Luc mRNA (black columns, left axis) or Rr-Luc mRNA (white columns, right axis). Each reaction contained both a target mRNA (Pp-Luc for the black columns, Rr-Luc for the white) and an unrelated control mRNA (Rr-Luc for the black columns, Pp-Luc for the white). Values were normalized to the buffer control (not shown). The reactions were incubated under standard conditions (see Methods).
  • [0025]
    [0025]FIG. 5A is a graph showing the effect of dsRNA on mRNA stability. Circles, Pp-Luc mRNA; squares, Rr-Luc mRNA; filled symbols, buffer incubation; open symbols, incubation with Pp-dsRNA.
  • [0026]
    [0026]FIG. 5B is a graph showing the stability of Rr-Luc mRNA incubated with Rr-dsRNA or Pp-dsRNA. Filled squares, buffer; open squares, Pp-dsRNA (10 nM); open circles, Rr-dsRNA (10 nM).
  • [0027]
    [0027]FIG. 5C is a graph showing the dependence on dsRNA length. The stability of the Pp-Luc mRNA was assessed after incubation in lysate in the presence of buffer or dsRNAs of different lengths. Filled squares, buffer; open circles, 49 bp dsRNA (10 nM); open inverted triangles, 149 bp dsRNA (10 nM); open triangles, 505 bp dsRNA (10 nM); open diamonds, 997 bp dsRNA (10 nM). Reactions were incubated under standard conditions (see Methods).
  • [0028]
    [0028]FIG. 6 is a graph showing that RNAi Requires ATP. Creatine kinase (CK) uses creatine phosphate (CP) to regenerate ATP. Circles, +ATP, +CP, +CK; squares, −ATP, +CP, +CK; triangles, −ATP, −CP, +CK; inverted triangles, −ATP, +CP, −CK.
  • [0029]
    [0029]FIG. 7A is a graph of protein synthesis, as reflected by luciferase activity produced after incubation of Rr-luc mRNA in the in vitro RNAi reaction for 1 hour, in the presence of the protein synthesis inhibitors anisomycin, cycloheximide, or chloramphenicol, relative to a reaction without any inhibitor showing that RNAi does not require mRNA translation.
  • [0030]
    [0030]FIG. 7B is a graph showing translation of 7-methyl-guanosine- and adenosine-capped Pp-luc mRNAs (circles and squares, respectively) in the RNAi reaction in the absence of dsRNA, as measured by luciferase activity produced in a one-hour incubation.
  • [0031]
    [0031]FIG. 7C is a graph showing incubation in an RNAi reaction of uniformly 32P-radiolabeled 7-methyl-guanosine-capped Pp-luc mRNA (circles) and adenosine-capped Pp-luc mRNA (squares), in the presence (open symbols) and absence (filled symbols) of 505 bp Pp-luc dsRNA.
  • [0032]
    [0032]FIG. 8A is a graph of the of the denaturing agarose-gel analysis of Pp-luc mRNA incubated in a standard RNAi reaction with buffer, 505 nt Pp-asRNA, or 505 bp Pp-dsRNA for the times indicated showing that asRNA causes a small amount of RNAi in vitro.
  • [0033]
    [0033]FIG. 8B is a graph of the of the denaturing agarose-gel analysis of Rr-luc mRNA incubated in a standard RNAi reaction with buffer, 505 nt Pp-asRNA, or 505 bp Pp-dsRNA for the times indicated showing that asRNA causes a small amount of RNAi in vitro.
  • [0034]
    [0034]FIG. 9 is a schematic of the positions of the three dsRNAs, ‘A,’ ‘B,’ and ‘C,’ relative to the Rr-luc mRNA.
  • [0035]
    [0035]FIG. 10 indicates the cleavage sites mapped onto the first 267 nt of the Rr-luc mRNA (SEQ ID NO: 1). The blue bar below the sequence indicates the position of dsRNA ‘C,’ and blue circles indicate the position of cleavage sites caused by this dsRNA. The green bar denotes the position of dsRNA ‘B,’ and green circles, the cleavage sites. The magenta bar indicates the position of dsRNA ‘A,’ and magenta circles, the cleavages. An exceptional cleavage within a run of 7 uracils is marked with a red arrowhead.
  • [0036]
    [0036]FIG. 11 is a proposed model for RNAi. RNAi is envisioned to begin with cleavage of the dsRNA to 21-23 nt products by a dsRNA-specific nuclease, perhaps in a multiprotein complex. These short dsRNAs might then be dissociated by an ATP-dependent helicase, possibly a component of the initial complex, to 21-23 nt asRNAs that could then target the mRNA for cleavage. The short asRNAs are imagined to remain associated with the RNAi-specific proteins (circles) that were originally bound by the full-length dsRNA, thus explaining the inefficiency of asRNA to trigger RNAi in vivo and in vitro. Finally, a nuclease (triangles) would cleave the mRNA.
  • [0037]
    [0037]FIG. 12 is a bar graph showing sequence-specific gene silencing by 21-23 nt fragments. Ratio of luciferase activity after targeting of Pp-Luc and Rr-Luc mRNA by 5 nM Pp-Luc or Rr-Luc dsRNA (500 bp) or 21-23 nt fragments isolated from a previous incubation of the respective dsRNA in Drosophila lysate. The amount of isolated 21-23 mers present in the incubation reaction correspond to approximately the same amount of 21-23 mers generated during an incubation reaction with 5 nM 500 bp dsRNA. The data are average values of 3 trials and the standard deviation is given by error bars. Luciferase activity was normalized to the buffer control.
  • [0038]
    [0038]FIG. 13A illustrates the purification of RNA fragments on a Superdex HR 200 10/30 gel filtration column (Pharmacia) using the method described in Example 4. dsRNA was 32P-labeled, and the radioactivity recovered in each column fraction is graphed. The fractions were also analyzed by denaturing gel electrophoresis (inset).
  • [0039]
    [0039]FIG. 13B demonstrates the ability of the Rr-luciferase RNA, after incubation in the Drosophila lysate and fractionation as in FIG. 13A, to mediate sequence-specific interference with the expression of a Rr-luciferase target mRNA. One microliter of each resuspended fraction was tested in a 10 microliter in vitro RNAi reaction (see Example 1). This procedure yields a concentration of RNA in the standard in vitro RNAi reaction that is approximately equal to the concentration of that RNA species in the original reaction prior to loading on the column. Relative luminescence per second has been normalized to the average value of the two buffer controls.
  • [0040]
    [0040]FIG. 13C is the specificity control for FIG. 13B. It demonstrates that the fractionated RNA of FIG. 13B does not efficiently mediate sequence-specific interference with the expression of a Pp-luciferase mRNA. Assays are as in FIG. 13B.
  • [0041]
    [0041]FIGS. 14A and 14B are schematic representations of reporter constructs and siRNA duplexes.
  • [0042]
    [0042]FIG. 14A illustrates the firefly (Pp-luc) and sea pansy (Rr-luc) luciferase reporter gene regions from plasmids pGL2-Control, pGL3-Control, and pRL-TK (Promega). SV40 regulatory elements, the HSV thymidine kinase promoter, and two introns (lines) are indicated. The sequence of GL3 luciferase is 95% identical to GL2, but RL is completely unrelated to both. Luciferase expression from pGL2 is approximately 10-fold lower than from pGL3 in transfected mammalian cells. The region targeted by the siRNA duplexes is indicated as black bar below the coding region of the luciferase genes.
  • [0043]
    [0043]FIG. 14B shows the sense (top) and antisense (bottom) sequences of the siRNA duplexes targeting GL2 (SEQ ID Nos: 10 and 11), GL3 (SEQ ID Nos: 12 and 13), and RL (SEQ ID Nos: 14 and 15) luciferase are shown. The GL2 and GL3 siRNA duplexes differ by only 3 single nucleotide substitutions (boxed in gray). As unspecific control, a duplex with the inverted GL2 sequence, invGL2 (SEQ ID Nos: 16 and 17), was synthesized. The 2 nt 3′ overhang of 2′-deoxythymidine is indicated as TT; uGL2 (SEQ ID Nos: 18 and 19) is similar to GL2 siRNA but contains ribo-uridine 3′ overhangs.
  • [0044]
    FIGS. 15A-15J are graphs showing RNA interference by siRNA duplexes. Ratios of target to control luciferase were normalized to a buffer control (bu, black bars); gray bars indicate ratios of Photinus pyralis (Pp-luc) GL2 or GL3 luciferase to Renilla reniformis (Rr-luc) RL luciferase (left axis), white bars indicate RL to GL2 or GL3 ratios (right axis).
  • [0045]
    [0045]FIGS. 15A, 15C, 15E, 15G, and 15I show results of experiments performed with the combination of pGL2-Control and pRL-TK reporter plasmids,
  • [0046]
    [0046]FIGS. 15B, 15D, 15F, 15H, and 15J with pGL3-Control and pRL-TK reporter plasmids. The cell line used for the interference experiment is indicated at the top of each plot. The ratios of Pp-luc/Rr-luc for the buffer control (bu) varied between 0.5 and 10 for pGL2/pRL, and between 0.03 and 1 for pGL3/pRL, respectively, before normalization and between the various cell lines tested. The plotted data were averaged from three independent experiments ±S.D.
  • [0047]
    FIGS. 16A-16F are graphs showing the effects of 21 nt siRNAs, 50 bp, and 500 bp dsRNAs on luciferase expression in HeLa cells. The exact length of the long dsRNAs is indicated below the bars.
  • [0048]
    [0048]FIGS. 16A, 16C, and 16E describe experiments performed with pGL2-Control and pRL-TK reporter plasmids,
  • [0049]
    [0049]FIGS. 16B, 16D, and 16F with pGL3-Control and pRL-TK reporter plasmids. The data were averaged from two independent experiments ±S.D.
  • [0050]
    [0050]FIGS. 16A, 16B, Absolute Pp-luc expression, plotted in arbitrary luminescence units.
  • [0051]
    [0051]FIG. 16C, 16D, Rr-luc expression, plotted in arbitrary luminescence units.
  • [0052]
    [0052]FIGS. 16E, 16F, Ratios of normalized target to control luciferase. The ratios of luciferase activity for siRNA duplexes were normalized to a buffer control (bu, black bars); the luminescence ratios for 50 or 500 bp dsRNAs were normalized to the respective ratios observed for 50 and 500 bp dsRNA from humanized GFP (hG, black bars). It should be noted, that the overall differences in sequence between the 49 and 484 bp dsRNAs targeting GL2 and GL3 are not sufficient to confer specificity between GL2 and GL3 targets (43 nt uninterrupted identity in 49 bp segment, 239 nt longest uninterrupted identity in 484 bp segment) (Parrish, S., et al., Mol. Cell, 6:1077-1087 (2000)).
  • DETAILED DESCRIPTION OF THE INVENTION
  • [0053]
    Double-stranded (dsRNA) directs the sequence-specific degradation of mRNA through a process known as RNA interference (RNAi). The process is known to occur in a wide variety of organisms, including embryos of mammals and other vertebrates. Using the Drosophila in vitro system described herein, it has been demonstrated that dsRNA is processed to RNA segments 21-23 nucleotides (nt) in length, and furthermore, that when these 21-23 nt fragments are purified and added back to Drosophila extracts, they mediate RNA interference in the absence of longer dsRNA. Thus, these 21-23 nt fragments are sequence-specific mediators of RNA degradation. A molecular signal, which may be the specific length of the fragments, must be present in these 21-23 nt fragments to recruit cellular factors involved in RNAi. This present invention encompasses these 21-23 nt fragments and their use for specifically inactivating gene function. The use of these fragments (or recombinantly produced or chemically synthesized oligonucleotides of the same or similar nature) enables the targeting of specific mRNAs for degradation in mammalian cells. Use of long dsRNAs in mammalian cells to elicit RNAi is usually not practical, presumably because of the deleterious effects of the interferon response. Specific targeting of a particular gene function, which is possible with 21-23 nt fragments of the present invention, is useful in functional genomic and therapeutic applications.
  • [0054]
    In particular, the present invention relates to RNA molecules of about 21 to about 23 nucleotides that mediate RNAi. In one embodiment, the present invention relates to RNA molecules of about 21 to about 23 nucleotides that direct cleavage of specific mRNA to which they correspond. The 21-23 nt RNA molecules of the present invention can also comprise a 3′ hydroxyl group. The 21-23 nt RNA molecules can be single-stranded or double stranded (as two 21-23 nt RNAs); such molecules can be blunt ended or comprise overhanging ends (e.g., 5′, 3′). In specific embodiments, the RNA molecule is double stranded and either blunt ended or comprises overhanging ends (as two 21-23 nt RNAs).
  • [0055]
    In one embodiment, at least one strand of the RNA molecule has a 3′ overhang from about 1 to about 6 nucleotides (e.g., pyrimidine nucleotides, purine nucleotides) in length. In other embodiments, the 3′ overhang is from about 1 to about 5 nucleotides, from about 1 to about 3 nucleotides and from about 2 to about 4 nucleotides in length. In one embodiment the RNA molecule is double stranded, one strand has a 3′ overhang and the other strand can be blunt-ended or have an overhang. In the embodiment in which the RNA molecule is double stranded and both strands comprise an overhang, the length of the overhangs may be the same or different for each strand. In a particular embodiment, the RNA of the present invention comprises 21 nucleotide strands which are paired and which have overhangs of from about 1 to about 3, particularly about 2, nucleotides on both 3′ ends of the RNA. In order to further enhance the stability of the RNA of the present invention, the 3′ overhangs can be stabilized against degradation. In one embodiment, the RNA is stabilized by including purine nucleotides, such as adenosine or guanosine nucleotides. Alternatively, substitution of pyrimidine nucleotides by modified analogues, e.g., substitution of uridine 2 nucleotide 3′ overhangs by 2′-deoxythymidine is tolerated and does not affect the efficiency of RNAi. The absence of a 2′ hydroxyl significantly enhances the nuclease resistance of the overhang in tissue culture medium.
  • [0056]
    The 21-23 nt RNA molecules of the present invention can be obtained using a number of techniques known to those of skill in the art. For example, the RNA can be chemically synthesized or recombinantly produced using methods known in the art. The 21-23 nt RNAs can also be obtained using the Drosophila in vitro system described herein. Use of the Drosophila in vitro system entails combining dsRNA with a soluble extract derived from Drosophila embryo, thereby producing a combination. The combination is maintained under conditions in which the dsRNA is processed to RNA of about 21 to about 23 nucleotides. The Drosophila in vitro system can also be used to obtain RNA of about 21 to about 23 nucleotides in length which mediates RNA interference of the mRNA of a particular gene (e.g., oncogene, viral gene). In this embodiment, double-stranded RNA that corresponds to a sequence of the gene is combined with a soluble extract derived from Drosophila embryo, thereby producing a combination. The combination is maintained under conditions in which the double-stranded RNA is processed to the RNA of about 21 to about 23 nucleotides. As shown herein, 21-23 nt RNA mediates RNAi of the mRNA to be degraded. The present invention also relates to the 21-23 nt RNA molecules produced by the methods described herein.
  • [0057]
    In one embodiment, the methods described herein are used to identify or obtain 21-23 nt RNA molecules that are useful as sequence-specific mediators of RNA degradation and, thus, for inhibiting mRNAs, such as human mRNAs, that encode products associated with or causative of a disease or an undesirable condition. For example, production of an oncoprotein or viral protein can be inhibited in humans in order to prevent the disease or condition from occurring, limit the extent to which it occurs or reverse it. If the sequence of the gene to be targeted in humans is known, 21-23 nt RNAs can be produced and tested for their ability to mediate RNAi in a cell, such as a human or other primate cell. Those 21-23 nt human RNA molecules shown to mediate RNAi can be tested, if desired, in an appropriate animal model to further assess their in vivo effectiveness. Additional copies of 21-23 nt RNAs shown to mediate RNAi can be produced by the methods described herein.
  • [0058]
    The method of obtaining the 21-23 nt RNA sequence using the Drosophila in vitro system can further comprise isolating the RNA sequence from the combination. The 21-23 nt RNA molecules can be isolated using a number of techniques known to those of skill in the art. For example, gel electrophoresis can be used to separate 21-23 nt RNAs from the combination, gel slices comprising the RNA sequences removed and RNAs eluted from the gel slices. Alternatively, non-denaturing methods, such as non-denaturing column chromatography, can be used to isolate the RNA produced. In addition, chromatography (e.g., size exclusion chromatography), glycerol gradient centrifugation, affinity purification with antibody can be used to isolate 21-23 nt RNAs. The RNA-protein complex isolated from the Drosophila in vitro system can also be used directly in the methods described herein (e.g., method of mediating RNAi of mRNA of a gene). Soluble extracts derived from Drosophila embryo that mediate or RNAi are encompassed by the invention. The soluble Drosophila extract can be obtained in a variety of ways. For example, the soluble extract can be obtained from syncytial blastoderm Drosophila embryos as described in Examples 1, 2, and 3. Soluble extracts can be derived from other cells in which RNAi occurs. Alternatively, soluble extracts can be obtained from a cell that does not carry out RNAi. In this instance, the factors needed to mediate RNAi can be introduced into such a cell and the soluble extract is then obtained. The components of the extract can also be chemically synthesized and/or combined using methods known in the art.
  • [0059]
    Any dsRNA can be used in the methods of the present invention, provided that it has sufficient homology to the targeted gene to mediate RNAi. The sequence of the dsRNA for use in the methods of the present invention need not be known. Alternatively, the dsRNA for use in the present invention can correspond to a known sequence, such as that of an entire gene (one or more) or portion thereof. There is no upper limit on the length of the dsRNA that can be used. For example, the dsRNA can range from about 21 base pairs (bp) of the gene to the full length of the gene or more. In one embodiment, the dsRNA used in the methods of the present invention is about 1000 bp in length. In another embodiment, the dsRNA is about 500 bp in length. In yet another embodiment, the dsRNA is about 22 bp in length.
  • [0060]
    The 21 to 23 nt RNAs described herein can be used in a variety of ways. For example, the 21 to 23 nt RNA molecules can be used to mediate RNA interference of mRNA of a gene in a cell or organism. In a specific embodiment, the 21 to 23 nt RNA is introduced into human cells or a human in order to mediate RNA interference in the cells or in cells in the individual, such as to prevent or treat a disease or undesirable condition. In this method, a gene (or genes) that cause or contribute to the disease or undesirable condition is targeted and the corresponding mRNA (the transcriptional product of the targeted gene) is degraded by RNAi. In this embodiment, an RNA of about 21 to about 23 nucleotides that targets the corresponding mRNA (the mRNA of the targeted gene) for degradation is introduced into the cell or organism. The cell or organism is maintained under conditions under which degradation of the corresponding mRNA occurs, thereby mediating RNA interference of the mRNA of the gene in the cell or organism. In a particular embodiment, the method of mediating RNA interference of a gene in a cell comprises combining double-stranded RNA that corresponds to a sequence of the gene with a soluble extract derived from Drosophila embryo, thereby producing a combination. The combination is maintained under conditions in which the double-stranded RNA is processed to RNA of about 21 to about 23 nucleotides. The 21 to 23 nt RNA is then isolated and introduced into the cell or organism. The cell or organism is maintained under conditions in which degradation of mRNA of the gene occurs, thereby mediating RNA interference of the gene in the cell or organism. In the event that the 21-23 nt RNA is introduced into a cell in which RNAi, does not normally occur, the factors needed to mediate RNAi are introduced into such a cell or the expression of the needed factors is induced in such a cell. Alternatively, 21 to 23 nt RNA produced by other methods (e.g., chemical synthesis, recombinant DNA production) to have a composition the same as or sufficiently similar to a 21 to 23 nt RNA known to mediate RNAi can be similarly used to mediate RNAi. Such 21 to 23 nt RNAs can be altered by addition, deletion, substitution or modification of one or more nucleotides and/or can comprise non-nucleotide materials. A further embodiment of this invention is an ex vivo method of treating cells from an individual to degrade a gene(s) that causes or is associated with a disease or undesirable condition, such as leukemia or AIDS. In this embodiment, cells to be treated are obtained from the individual using known methods (e.g., phlebotomy or collection of bone marrow) and 21-23 nt RNAs that mediate degradation of the corresponding mRNA(s) are introduced into the cells, which are then re-introduced into the individual. If necessary, biochemical components needed for RNAi to occur can also be introduced into the cells.
  • [0061]
    The mRNA of any gene can be targeted for degradation using the methods of mediating interference of mRNA described herein. For example, any cellular or viral mRNA, can be targeted, and, as a result, the encoded protein (e.g., an oncoprotein, a viral protein), expression will be diminished. In addition, the mRNA of any protein associated with/causative of a disease or undesirable condition can be targeted for degradation using the methods described herein.
  • [0062]
    The present invention also relates to a method of examining the function of a gene in a cell or organism. In one embodiment, an RNA sequence of about 21 to about 23 nucleotides that targets mRNA of the gene for degradation is introduced into the cell or organism. The cell or organism is maintained under conditions under which degradation of mRNA of the gene occurs. The phenotype of the cell or organism is then observed and compared to an appropriate control, thereby providing information about the function of the gene. In another embodiment, double-stranded RNA that corresponds to a sequence of the gene is combined with a soluble extract derived from Drosophila embryo under conditions in which the double-stranded RNA is processed to generate RNA of about 21 to about 23 nucleotides. The RNA of about 21 to about 23 nucleotides is isolated and then introduced into the cell or organism. The cell or organism is maintained under conditions in which degradation of the mRNA of the gene occurs. The phenotype of the cell or organism is then observed and compared to an appropriate control, thereby identifying the function of the gene.
  • [0063]
    A further aspect of this invention is a method of assessing the ability of 21-23 nt RNAs to mediate RNAi and, particularly, determining which 21-23 nt RNA(s) most efficiently mediate RNAi. In one embodiment of the method, dsRNA corresponding to a sequence of an mRNA to be degraded is combined with detectably labeled (e.g., end-labeled, such as radiolabeled) mRNA and the soluble extract of this invention, thereby producing a combination. The combination is maintained under conditions under which the double-stranded RNA is processed and the mRNA is degraded. The sites of the most effective cleavage are mapped by comparing the migration of the labeled mRNA cleavage products to markers of known length. 21 mers spanning these sites are then designed and tested for their efficiency in mediating RNAi.
  • [0064]
    Alternatively, the extract of the present invention can be used to determine whether there is a particular segment or particular segments of the mRNA corresponding to a gene which are more efficiently targeted by RNAi than other regions and, thus, can be especially useful target sites. In one embodiment, dsRNA corresponding to a sequence of a gene to be degraded, labeled mRNA of the gene is combined with a soluble extract that mediates RNAi, thereby producing a combination. The resulting combination is maintained under conditions under which the dsRNA is degraded and the sites on the mRNA that are most efficiently cleaved are identified, using known methods, such as comparison to known size standards on a sequencing gel.
  • OVERVIEW OF EXAMPLES
  • [0065]
    Biochemical analysis of RNAi has become possible with the development of the in vitro Drosophila embryo lysate that recapitulates dsRNA-dependent silencing of gene expression described in Example 1 (Tuschl et al., Genes Dev., 13:3191-7 (1999)). In the in vitro system, dsRNA, but not sense or asRNA, targets a corresponding mRNA for degradation, yet does not affect the stability of an unrelated control mRNA. Furthermore, pre-incubation of the dsRNA in the lysate potentiates its activity for target mRNA degradation, suggesting that the dsRNA must be converted to an active form by binding proteins in the extract or by covalent modification (Tuschl et al., Genes Dev., 13:3191-7 (1999)).
  • [0066]
    The development of a cell-free system from syncytial blastoderm Drosophila embryos that recapitulates many of the features of RNAi is described herein. The interference observed in this reaction is sequence-specific, is promoted by dsRNA, but not by single-stranded RNA, functions by specific mRNA degradation, requires a minimum length of dsRNA and is most efficient with long dsRNA. Furthermore, preincubation of dsRNA potentiates its activity. These results demonstrate that RNAi is mediated by sequence specific processes in soluble reactions.
  • [0067]
    As described in Example 2, the in vitro system was used to analyze the requirements of RNAi and to determine the fate of the dsRNA and the mRNA. RNAi in vitro requires ATP, but does not require either mRNA translation or recognition of the 7-methyl-guanosine cap of the targeted mRNA. The dsRNA, but not single-stranded RNA, is processed in vitro to a population of 21-23 nt species. Deamination of adenosines within the dsRNA does not appear to be required for formation of the 21-23 nt RNAs. As described herein, the mRNA is cleaved only in the region corresponding to the sequence of the dsRNA and that the mRNA is cleaved at 21-23 nt intervals, strongly indicating that the 21-23 nt fragments from the dsRNA are targeting the cleavage of the mRNA. Furthermore, as described in Examples 3 and 4, when the 21-23 nt fragments are purified and added back to the soluble extract, they mediate RNA.
  • [0068]
    The present invention is illustrated by the following examples, which are not intended to be limiting in any way.
  • Example 1 Targeted mRNA Degradation by Double-Stranded RNA in vitro Materials and Methods
  • [0069]
    RNAs
  • [0070]
    Rr-Luc mRNA consisted of the 926 nt Rr luciferase coding sequence flanked by 25 nt of 5′ untranslated sequence from the pSP64 plasmid polylinker and 25 nt of 3′ untranslated sequence consisting of 19 nt of pSP64 plasmid polylinker sequence followed by a 6 nt Sac I site. Pp-Luc mRNA contained the 1653 nt Pp luciferase coding sequence with a Kpn I site introduced immediately before the Pp luciferase stop codon. The Pp coding sequence was flanked by 5′ untranslated sequences consisting of 21 nt of pSP64 plasmid polylinker followed by the 512 nt of the 5′ untranslated region (UTR) from the Drosophila hunchback mRNA and 3′ untranslated sequences consisting of the 562 nt hunchback 3′ UTR followed by a 6 nt Sac I site. The hunchback 3′ UTR sequences used contained six G-to-U mutations that disrupt function of the Nanos Response Elements in vivo and in vitro. Both reporter mRNAs terminated in a 25 nt poly(A) tail encoded in the transcribed plasmid. For both Rr-Luc and Pp-Luc mRNAs, the transcripts were generated by run-off transcription from plasmid templates cleaved at an Nsi I site that immediately followed the 25 nt encoded poly(A) tail. To ensure that the transcripts ended with a poly(A) tail, the Nsi I-cleaved transcription templates were resected with T4 DNA Polymerase in the presence of dNTPs. The SP6 mMessage mMachine kit (Ambion) was used for in vitro transcription. Using this kit, about 80% of the resulting transcripts are 7-methyl guanosine capped. 32P-radiolabeling was accomplished by including α-32P-UTP in the transcription reaction.
  • [0071]
    For Pp-Luc, ss, as, and dsRNA corresponded to positions 93 to 597 relative to the start of translation, yielding a 505 bp dsRNA. For Rr-Luc, ss, as, and dsRNA corresponded to positions 118 to 618 relative to the start of translation, yielding a 501 bp dsRNA. The Drosophila nanos competitor dsRNA corresponded to positions 122 to 629 relative to the start of translation, yielding a 508 bp dsRNA. ssRNA, asRNA, and dsRNA (diagrammed in FIG. 1) were transcribed in vitro with T7 RNA polymerase from templates generated by the polymerase chain reaction. After gel purification of the T7 RNA transcripts, residual DNA template was removed by treatment with RQ1 DNase (Promega). The RNA was then extracted with phenol and chloroform, and then precipitated and dissolved in water.
  • [0072]
    RNA Annealing and Native Gel Electrophoresis.
  • [0073]
    ssRNA and asRNA (0.5 μM) in 10 mM Tris-HCl (pH 7.5) with 20 mM NaCl were heated to 95° C. for 1 min then cooled and annealed at room temperature for 12 to 16 h. The RNAs were precipitated and resuspended in lysis buffer (below). To monitor annealing, RNAs were electrophoresed in a 2% agarose gel in TBE buffer and stained with ethidium bromide (Sambrook et al., Molecular Cloning. Cold Spring Harbor Laboratory Press, Plainview, N.Y. (1989)).
  • [0074]
    Lysate Preparation
  • [0075]
    Zero- to two-hour old embryos from Oregon R flies were collected on yeasted molasses agar at 25° C. Embryos were dechorionated for 4 to 5 min in 50% (v/v) bleach, washed with water, blotted dry, and transferred to a chilled Potter-Elvehjem tissue grinder (Kontes). Embryos were lysed at 4° C. in one ml of lysis buffer (100 mM potassium acetate, 30 mM HEPES-KOH, pH 7.4, 2 mM magnesium acetate) containing 5 mM dithiothreitol (DTT) and 1 mg/ml Pefabloc SC (Boehringer-Mannheim) per gram of damp embryos. The lysate was centrifuged for 25 min at 14,500 × g at 4° C., and the supernatant flash frozen in aliquots in liquid nitrogen and stored at −80° C.
  • [0076]
    Reaction Conditions
  • [0077]
    Lysate preparation and reaction conditions were derived from those described by Hussain and Leibowitz (Hussain and Leibowitz, Gene 46:13-23 (1986)). Reactions contained 50% (v/v) lysate, mRNAs (10 to 50 pM final concentration), and 10% (v/v) lysis buffer containing the ssRNA, asRNA, or dsRNA (10 nM final concentration). Each reaction also contained 10 mM creatine phosphate, 10 μg/ml creatine phosphokinase, 100 μM GTP, 100 μM UTP, 100 μM CTP, 500 μM ATP, 5 μM DTT, 0.1 U/mL RNasin (Promega), and 100 μM of each amino acid. The final concentration of potassium acetate was adjusted to 100 mM. For standard conditions, the reactions were assembled on ice and then pre-incubated at 25° C. for 10 min before adding mRNA. After adding mRNAs, the incubation was continued for an additional 60 min. The 10 min preincubation step was omitted for the experiments in FIGS. 3A-3C and 5A-5C. Reactions were quenched with four volumes of 1.25× Passive Lysis Buffer (Promega). Pp and Rr luciferase activity was detected in a Monolight 2010 Luminometer (Analytical Luminescence Laboratory) using the Dual-Luciferase Reporter Assay System (Promega).
  • [0078]
    RNA Stability
  • [0079]
    Reactions with 32P-radiolabeled mRNA were quenched by the addition of 40 volumes of 2× PK buffer (200 mM Tris-HCl, pH 7.5, 25 mM EDTA, 300 mM NaCl, 2% w/v sodium dodecyl sulfate). Proteinase K (E.M. Merck; dissolved in water) was added to a final concentration of 465 μg/ml. The reactions were then incubated for 15 min at 65° C., extracted with phenol/chloroform/isoamyl alcohol (25:24:1), and precipitated with an equal volume of isopropanol. Reactions were analyzed by electrophoresis in a formaldehyde/agarose (0.8% w/v) gel (Sambrook et al., Molecular Cloning. Cold Spring Harbor Laboratory Press, Plainview, N.Y. (1989)). Radioactivity was detected by exposing the agarose gel [dried under vacuum onto Nytran Plus membrane (Amersham)] to an image plate (Fujix) and quantified using a Fujix Bas 2000 and Image Gauge 3.0 (Fujix) software.
  • [0080]
    Commercial Lysates
  • [0081]
    Untreated rabbit reticulocyte lysate (Ambion) and wheat germ extract (Ambion) reactions were assembled according to the manufacturer's directions. dsRNA was incubated in the lysate at 27° C. (wheat germ) or 30° C. (reticulocyte lysate) for 10 min prior to the addition of mRNAs.
  • [0082]
    Results and Discussion
  • [0083]
    To evaluate if dsRNA could specifically block gene expression in vitro, reporter mRNAs derived from two different luciferase genes that are unrelated both in sequence and in luciferin substrate specificity were used: Renilla reniformis (sea pansy) luciferase (Rr-Luc) and Photuris pennsylvanica (firefly) luciferase (Pp-Luc). dsRNA generated from one gene was used to target that luciferase mRNA whereas the other luciferase mRNA was an internal control co-translated in the same reaction. dsRNAs of approximately 500 bp were prepared by transcription of polymerase-chain reaction products from the Rr-Luc and Pp-Luc genes. Each dsRNA began ˜100 bp downstream of the start of translation (FIG. 1). Sense (ss) and anti-sense (as) RNA were transcribed in vitro and annealed to each other to produce the dsRNA. Native gel electrophoresis of the individual Rr 501 and Pp 505 nt as RNA and ssRNA used to form the Rr and Pp dsRNAs was preformed. The ssRNA, asRNA, and dsRNAs were each tested for their ability to block specifically expression of their cognate mRNA but not the expression of the unrelated internal control mRNA.
  • [0084]
    The ssRNA, asRNA, or dsRNA was incubated for 10 min in a reaction containing Drosophila embryo lysate, then both Pp-Luc and Rr-Luc mRNAs were added and the incubation continued for an additional 60 min. The Drosophila embryo lysate efficiently translates exogenously transcribed mRNA under the conditions used. The amounts of Pp-Luc and Rr-Luc enzyme activities were measured and were used to calculate ratios of either Pp-Luc/Rr-Luc (FIG. 2A) or Rr-Luc/Pp-Luc (FIG. 2B). To facilitate comparison of different experiments, the ratios from each experiment were normalized to the ratio observed for a control in which buffer was added to the reaction in place of ssRNA, asRNA, or dsRNA.
  • [0085]
    [0085]FIG. 2A shows that a 10 nM concentration of the 505 bp dsRNA identical to a portion of the sequence of the Pp-Luc gene specifically inhibited expression of the Pp-Luc mRNA but did not affect expression of the Rr-Luc internal control. Neither ssRNA nor asRNA affected expression of Pp-Luc or the Rr-Luc internal control. Thus, Pp-Luc expression was specifically inhibited by its cognate dsRNA. Conversely, a 10 nM concentration of the 501 bp dsRNA directed against the Rr-Luc mRNA specifically inhibited Rr-Luc expression but not that of the Pp-Luc internal control (FIG. 2B). Again, comparable levels of ssRNA or asRNA had little or no effect on expression of either reporter mRNA. On average, dsRNA reduced specific luciferase expression by 70% in these experiments, in which luciferase activity was measured after 1 h incubation. In other experiments in which the translational capacity of the reaction was replenished by the addition of fresh lysate and reaction components, a further reduction in targeted luciferase activity relative to the internal control was observed.
  • [0086]
    The ability of dsRNA but not asRNA to inhibit gene expression in these lysates is not merely a consequence of the greater stability of the dsRNA (half-life about 2 h) relative to the single-stranded RNAs (half-life ˜10 min). ssRNA and asRNA transcribed with a 7-methyl guanosine cap were as stable in the lysate as uncapped dsRNA, but do not inhibit gene expression. In contrast, dsRNA formed from the capped ssRNA and asRNA specifically blocks expression of the targeted mRNA.
  • [0087]
    Effective RNAi in Drosophila requires the injection of about 0.2 fmol of dsRNA into a syncytial blastoderm embryo (Kennerdell and Carthew, Cell 95:1017-1026 (1998); Carthew, www1.pitt.edu/˜carthew/manual/RNAi_Protocol.html (1999)). Since the average volume of a Drosophila embryo is approximately 7.3 nl, this corresponds to an intracellular concentration of about 25 nM (Mazur et al., Cryobiology 25:543-544 (1988)). Gene expression in the Drosophila lysate was inhibited by a comparable concentration of dsRNA (10 nM), but lowering the dsRNA concentration ten-fold decreased the amount of specific interference. Ten nanomolar dsRNA corresponds to a 200-fold excess of dsRNA over target mRNA added to the lysate. To test if this excess of dsRNA might reflect a time- and/or concentration-dependent step in which the input dsRNA was converted to a form active for gene-specific interference, the effect of preincubation of the dsRNA on its ability to inhibit expression of its cognate mRNA was examined. Because the translational capacity of the lysates is significantly reduced after 30 min of incubation at 25° C. (unpublished observations), it was desired to ensure that all factors necessary for RNAi remained active throughout the pre-incubation period. Therefore, every 30 min, a reaction containing dsRNA and lysate was mixed with a fresh reaction containing unincubated lysate (FIG. 3A). After six successive serial transfers spanning 3 hours of preincubation, the dsRNA, now diluted 64-fold relative to its original concentration, was incubated with lysate and 50 pM of target mRNA for 60 min. Finally, the Pp-Luc and Rr-Luc enzyme levels were measured. For comparison, the input amount of dsRNA (10 nM) was diluted 32-fold in buffer, and its capacity to generate gene-specific dsRNA interference in the absence of any preincubation step was assessed.
  • [0088]
    The preincubation of the dsRNA in lysate significantly potentiated its capacity to inhibit specific gene expression. Whereas the dsRNA diluted 32-fold showed no effect, the preincubated dsRNA was, within experimental error, as potent as undiluted dsRNA, despite having undergone a 64-fold dilution. Potentiation of the dsRNA by preincubation was observed for dsRNAs targeting both the Pp-Luc mRNA (FIG. 3B) and the Rr-Luc mRNA (FIG. 3C). Taking into account the 64-fold dilution, the activation conferred by preincubation allowed a 156 pM concentration of dsRNA to inhibit 50 pM target mRNA. Further, dilution of the “activated” dsRNA may be effective but has not been tested. We note that although both dsRNAs tested were activated by the preincubation procedure, each fully retained its specificity to interfere with expression only of the mRNA to which it is homologous. Further study of the reactions may provide a route to identifying the mechanism of dsRNA potentiation.
  • [0089]
    One possible explanation for the observation that preincubation of the dsRNA enhances its capacity to inhibit gene expression in these lysates is that specific factors either modify and/or associate with the dsRNA. Accordingly, the addition of increasing amounts of dsRNA to the reaction might titrate such factors and decrease the amount of gene-specific interference caused by a second dsRNA of unrelated sequence. For both Pp-Luc mRNA and Rr-Luc mRNA, addition of increasing concentrations of the unrelated Drosophila nanos dsRNA to the reaction decreased the amount of gene-specific interference caused by dsRNA targeting the reporter mRNA (FIG. 4). None of the tested concentrations of nanos dsRNA affected the levels of translation of the untargeted mRNA, demonstrating that the nanos dsRNA specifically titrated factors involved in gene-specific interference and not components of the translational machinery. The limiting factor(s) was titrated by addition of approximately 1000 nM dsRNA, a 200-fold excess over the 5 nM of dsRNA used to produce specific interference.
  • [0090]
    Interference in vitro might reflect either a specific inhibition of mRNA translation or the targeted destruction of the specific mRNA. To distinguish these two possibilities, the fates of the Pp-Luc and Rr-Luc mRNAs were examined directly using 32P-radiolabeled substrates. Stability of 10 nM Pp-Luc mRNA or Rr-Luc mRNA incubated in lysate with either buffer or 505 bp Pp-dsRNA (10 nM). Samples were deproteinized after the indicated times and the 32P-radiolabeled mRNAs were then resolved by denaturing gel electrophoresis. In the absence of dsRNA, both the Pp-Luc and Rr-Luc mRNAs were stable in the lysates, with ˜75% of the input mRNA remaining after 3 h of incubation. (About 25% of the input mRNA is rapidly degraded in the reaction and likely represents uncapped mRNA generated by the in vitro transcription process.) In the presence of dsRNA (10 nM, 505 bp) targeting the Pp-Luc mRNA, less than 15% of the Pp-Luc mRNA remained after 3 h (FIG. 5A). As expected, the Rr-Luc mRNA remained stable in the presence of the dsRNA targeting Pp-Luc mRNA. Conversely, dsRNA (10 nM, 501 bp) targeting the Rr-Luc mRNA caused the destruction of the Rr-Luc mRNA but had no effect on the stability of Pp-Luc mRNA (FIG. 5B). Thus, the dsRNA specifically caused accelerated decay of the mRNA to which it is homologous with no effect on the stability of the unrelated control mRNA. This finding indicates that in vivo, at least in Drosophila, the effect of dsRNA is to directly destabilize the target mRNA, not to change the subcellular localization of the mRNA, for example, by causing it to be specifically retained in the nucleus, resulting in non-specific degradation.
  • [0091]
    These results are consistent with the observation that RNAi leads to reduced cytoplasmic mRNA levels in vivo, as measured by in situ hybridization (Montgomery et al., Proc. Natl. Acad. Sci. USA 95:15502-15507 (1998)) and Northern blotting (Ngo et al., Proc. Natl. Acad. Sci. USA 95:14687-14692 (1998)). Northern blot analyses in trypanosomes and hydra suggest that dsRNA typically decreases mRNA levels by less than 90% (Ngo et al., Proc. Natl. Acad. Sci. USA 95:14687-14692 (1998); Lohmann et al., Dev. Biol. 214:211-214 (1999)). The data presented here show that in vitro mRNA levels are reduced 65 to 85% after three hours incubation, an effect comparable with observations in vivo. They also agree with the finding that RNAi in C. elegans is post-transcriptional (Montgomery et al., Proc. Natl. Acad. Sci. USA 95:15502-15507 (1998)). The simplest explanation for the specific effects on protein synthesis is that it reflects the accelerated rate of RNA decay. However, the results do not exclude independent but specific effects on translation as well as stability.
  • [0092]
    In vivo, RNAi appears to require a minimum length of dsRNA (Ngo et al., Proc. Natl. Acad. Sci., USA, 95:14687-14692 (1998)). The ability of RNA duplexes of lengths 49 bp, 149 bp, 505 bp, and 997 bp (diagrammed in FIG. 1) to target the degradation of the Pp-Luc mRNA in vitro was assessed. In good agreement with in vivo observations, the 49 bp dsRNA was ineffective in vitro, while the 149 bp dsRNA enhanced mRNA decay only slightly, and both the 505 and 997 bp dsRNAs caused robust mRNA degradation (FIG. 5C). 50bp dsRNA targeting other portions of the mRNA cause detectable mRNA degradation, though not as robust as that seen for 500bp dsRNA. Thus, although some short dsRNA do not mediate RNAi, others of approximately the same length, but different composition, will be able to do so.
  • [0093]
    Whether the gene-specific interference observed in Drosophila lysates was a general property of cell-free translation systems was examined. The effects of dsRNAs on expression of Pp-Luc and Rr-Luc mRNA were examined in commercially available wheat germ extracts and rabbit reticulocyte lysates. There was no effect of addition of 10 nM of either ssRNA, asRNA, or dsRNA on the expression of either mRNA reporter in wheat germ extracts. In contrast, the addition of 10 nM of dsRNA to the rabbit reticulocyte lysate caused a profound and rapid, non-specific decrease in mRNA stability. For example, addition of Rr-Luc dsRNA caused degradation of both Rr-Luc and Pp-Luc mRNAs within 15 min. The same non-specific effect was observed upon addition of Pp-Luc dsRNA. The non-specific destruction of mRNA induced by the addition of dsRNA to the rabbit reticulocyte lysate presumably reflects the previously observed activation of RNase L by dsRNA (Clemens and Williams, Cell 13:565-572 (1978); Williams et al., Nucleic Acids Res. 6:1335-1350 (1979); Zhou et al., Cell 72:753-765 (1993); Matthews, Interactions between Viruses and the Cellular Machinery for Protein Synthesis. In Translational Control (eds. J. Hershey, M. Mathews and N. Sonenberg), pp. 505-548. Cold Spring Harbor Laboratory Press, Plainview, N.Y. (1996)). Mouse cell lines lacking dsRNA-induced anti-viral pathways have recently been described (Zhou et al., Virology 258:435-440 (1999)) and may be useful in the search for mammalian RNAi. Although RNAi is known to exist in some mammalian cells (Wianny and Zernicka-Goetz Nat. Cell Biol. 2: 70-75 (2000)), in many mammalian cell types its presence is likely obscured by the rapid induction by dsRNA of non-specific anti-viral responses.
  • [0094]
    dsRNA-targeted destruction of specific mRNA is characteristic of RNAi, which has been observed in vivo in many organisms, including Drosophila. The system described above recapitulates in a reaction in vitro many aspects of RNAi. The targeted mRNA is specifically degraded whereas unrelated control mRNAs present in the same solution are not affected. The process is most efficient with dsRNAs greater than 150 bp in length. The dsRNA-specific degradation reaction in vitro is probably general to many, if not all, mRNAs since it was observed using two unrelated genes.
  • [0095]
    The magnitude of the effects on mRNA stability in vitro described herein are comparable with those reported in vivo (Ngo et al., Proc. Natl. Acad. Sci., USA, 95:14687-14692 (1998); Lohmann et al., Dev. Biol., 214:211-214 (1999). However, the reaction in vitro requires an excess of dsRNA relative to mRNA. In contrast, a few molecules of dsRNA per cell can inhibit gene expression in vivo (Fire et al., Nature, 391: 806-811 (1998); Kennerdell and Carthew, Cell, 95:1017-1026 (1998)). The difference between the stoichiometry of dsRNA to target mRNA in vivo and in vitro should not be surprising in that most in vitro reactions are less efficient than their corresponding in vivo processes. Interestringly, incubation of the dsRNA in the lysate greatly potentiated its activity for RNAi, indicating that it is either modified or becomes associated with other factors or both. Perhaps a small number of molecules is effective in inhibiting the targeted mRNA in vivo because the injected dsRNA has been activated by a process similar to that reported here for RNAi in Drosophila lysates.
  • Example 2 Double-Stranded RNA Directs the ATP-Dependent Cleavage of mRNA at 21 to 23 Nucleotide Intervals
  • [0096]
    Methods and Material
  • [0097]
    In vitro RNAi
  • [0098]
    In vitro RNAi reactions and lysate preparation were as described in Example 1 (Tuschl et al., Genes Dev., 13:3191-7 (1999)) except that the reaction contained 0.03 g/ml creatine kinase, 25 μM creatine phosphate (Fluka), and 1 mM ATP. Creatine phosphate was freshly dissolved at 500 mM in water for each experiment. GTP was omitted from the reactions, except in FIGS. 2 and 3.
  • [0099]
    RNA Synthesis.
  • [0100]
    Pp-luc and Rr-luc mRNAs and Pp- and Rr-dsRNAs (including dsRNA ‘B’ in FIG. 6) were synthesized by in vitro transcription as described previously (Tuschl et al., Genes Dev., 13:3191-7 (1999)). To generate transcription templates for dsRNA ‘C’ the 5′ sense RNA primer was gcgtaatacgactcactataGAACAAAGGAAACGGATGAT (SEQ ID NO: 2) and the 3′ sense RNA primer was GAAGAAGTTATTCTCCAAAA (SEQ ID NO: 3); the 5′ asRNA primer was gcgtaatacgactcactataGAAGAAGTTATTCTCCAAAA (SEQ ID NO: 4) and the 3′ asRNA primer was GAACAAAGGAAACGGATGAT (SEQ ID NO: 5). For dsRNA ‘A’ the 5′ sense RNA primer was gcgtaatacgactcactataGTAGCGCGGTGTATTATACC (SEQ ID NO: 6) and the 3′ sense RNA primer was GTACAACGTCAGGTTTACCA (SEQ ID NO: 7); the 5′ asRNA primer was gcgtaatacgactcactataGTACAACGTCAGGTTTACCA (SEQ ID NO: 8) and the 3′ asRNA primer was GTAGCGCGGTGTATTATACC (SEQ ID NO: 9) (lowercase, T7 promoter sequence).
  • [0101]
    mRNAs were 5′-end-labeled using guanylyl transferase (Gibco/BRL), S-adenosyl methionine (Sigma), and α-32P-GTP (3000 Ci/mmol; New England Nuclear) according to the manufacturer's directions. Radiolabeled RNAs were purified by poly(A) selection using the Poly(A) Tract III kit (Promega). Nonradioactive 7-methyl-guanosine- and adenosine-capped RNAs were synthesized in in vitro transcription reactions with a 5-fold excess of 7-methyl-G(5′)ppp(5′)G or A(5′)ppp(5′)G relative to GTP. Cap analogs were purchased from New England Biolabs.
  • [0102]
    ATP Depletion and Protein Synthesis Inhibition
  • [0103]
    ATP was depleted by incubating the lysate for 10 minutes at 25° C. with 2 mM glucose and 0.1 U/ml hexokinase (Sigma). Protein synthesis inhibitors were purchased from Sigma and dissolved in absolute ethanol as 250-fold concentrated stocks. The final concentrations of inhibitors in the reaction were: anisomycin, 53 mg/ml; cycloheximide, 100 mg/ml; chloramphenicol, 100 mg/ml. Relative protein synthesis was determined by measuring the activity of Rr luciferase protein produced by translation of the Rr-luc mRNA in the RNAi reaction after 1 hour as described previously (Tuschl et al., Genes Dev., 13:3191-7 (1999)).
  • [0104]
    Analysis of dsRNA Processing
  • [0105]
    Internally α-32P-ATP-labeled dsRNAs (505 bp Pp-luc or 501 Rr-luc) or 7-methyl-guanosine-capped Rr-luc antisense RNA (501 nt) were incubated at 5 nM final concentration in the presence or absence of unlabeled mRNAs in Drosophila lysate for 2 hours in standard conditions. Reactions were stopped by the addition of 2× proteinase K buffer and deproteinized as described previously (Tuschl et al., Genes Dev., 13:3191-3197 (1999)). Products were analyzed by electrophoresis in 15% or 18% polyacrylamide sequencing gels. Length standards were generated by complete RNase Ti digestion of α-32P-ATP-labeled 501 nt Rr-luc sense RNA and asRNA.
  • [0106]
    For analysis of mRNA cleavage, 5′-32P-radiolabeled mRNA (described above) was incubated with dsRNA as described previously (Tuschl et al., Genes Dev., 13:3191-3197 (1999)) and analyzed by electrophoresis in 5% (FIG. 5B) and 6% (FIG. 6C) polyacrylamide sequencing gels. Length standards included commercially available RNA size standards (FMC Bioproducts) radiolabeled with guanylyl transferase as described above and partial base hydrolysis and RNase Ti ladders generated from the 5′-radiolabeled mRNA.
  • [0107]
    Deamination Assay
  • [0108]
    Internally α-32P-ATP-labeled dsRNAs (5 nM) were incubated in Drosophila lysate for 2 hours at standard conditions. After deproteinization, samples were run on 12% sequencing gels to separate full-length dsRNAs from the 21-23 nt products. RNAs were eluted from the gel slices in 0.3 M NaCl overnight, ethanol-precipitated, collected by centrifugation, and redissolved in 20 μl water. The RNA was hydrolyzed into nucleoside 5 -phosphates with nuclease P1 (10 μl reaction containing 8 μl RNA in water, 30 mM KOAc pH 5.3, 10 mM ZnSO4, 10 μg or 3 units nuclease P1, 3 hours, 50° C). Samples (1 ml) were co-spotted with non-radioactive 5 -mononucleotides [0.05 O.D. units (A260) of pA, pC, pG, pI, and pU] on cellulose HPTLC plates (EM Merck) and separated in the first dimension in isobutyric acid/25% ammonia/water (66/1/33, v/v/v) and in the second dimension in 0.1M sodium phosphate, pH 6.8/ammonium sulfate/1-propanol (100/60/2, v/w/v; Silberklang et al., 1979). Migration of the non-radioactive internal standards was determined by UV-shadowing.
  • [0109]
    Results and Discussion
  • [0110]
    RNAi Requires ATP
  • [0111]
    As described in Example 1, Drosophila embryo lysates faithfully recapitulate RNAi (Tuschl et al., Genes Dev., 13:3191-7 (1999)). Previously, dsRNA-mediated gene silencing was monitored by measuring the synthesis of luciferase protein from the targeted mRNA. Thus, these RNAi reactions contained an ATP-regenerating system, needed for the efficient translation of the mRNA. To test if ATP was, in fact, required for RNAi, the lysates were depleted for ATP by treatment with hexokinase and glucose, which converts ATP to ADP, and RNAi was monitored directly by following the fate of 32P-radiolabeled Renilla reniformis luciferase (Rr-luc) mRNA (FIG. 6). Treatment with hexokinase and glucose reduced the endogenous ATP level in the lysate from 250 μM to below 10 μM. ATP regeneration required both exogenous creatine phosphate and creatine kinase, which acts to transfer a high-energy phosphate from creatine phosphate to ADP. When ATP-depleted extracts were supplemented with either creatine phosphate or creatine kinase separately, no RNAi was observed. Therefore, RNAi requires ATP in vitro. When ATP, creatine phosphate, and creatine kinase were all added together to reactions containing the ATP-depleted lysate, dsRNA-dependent degradation of the Rr-luc mRNA was restored (FIG. 6). The addition of exogenous ATP was not required for efficient RNAi in the depleted lysate, provided that both creatine phosphate and creatine kinase were present, demonstrating that the endogenous concentration (250 mM) of adenosine nucleotide is sufficient to support RNAi. RNAi with a Photinus pyralis luciferase (Pp-luc) mRNA was also ATP-dependent.
  • [0112]
    The stability of the Rr-luc mRNA in the absence of Rr-dsRNA was reduced in ATP-depleted lysates relative to that observed when the energy regenerating system was included, but decay of the mRNA under these conditions did not display the rapid decay kinetics characteristic of RNAi in vitro, nor did it generate the stable mRNA cleavage products characteristic of dsRNA-directed RNAi. These experiments do not establish if the ATP requirement for RNAi is direct, implicating ATP in one or more steps in the RNAi mechanism, or indirect, reflecting a role for ATP in maintaining high concentrations of another nucleoside triphosphate in the lysate.
  • [0113]
    Translation Is Not Required for RNAi In Vitro
  • [0114]
    The requirement for ATP suggested that RNAi might be coupled to mRNA translation, a highly energy-dependent process. To test this possibility, various inhibitors of protein synthesis were added to the reaction by preparing a denaturing agarose-gel analysis of 5′-32P-radiolabeled Pp-luc mRNA after incubation for indicated times in a standard RNAi reaction with and without protein synthesis inhibitors. The eukaryotic translation inhibitors anisomycin, an inhibitor of initial peptide bond formation, cycloheximide, an inhibitor of peptide chain elongation, and puromycin, a tRNA mimic which causes premature termination of translation (Cundliffe, Antibiotic Inhibitors of Ribosome Function. In The Molecular Basis of Antibiotic Action, E. Gale, E. Cundliffe, P. Reynolds, M. Richmond and M. Warning, eds. (New York: Wiley), pp. 402-547. (1981)) were tested. Each of these inhibitors reduced protein synthesis in the Drosophila lysate by more than 1,900-fold (FIG. 7A). In contrast, chloramphenicol, an inhibitor of Drosophila mitochondrial protein synthesis (Page and Orr-Weaver, Dev. Biol., 183:195-207 (1997)), had no effect on translation in the lysates (FIG. 7A). Despite the presence of anisomycin, cycloheximide, or chloramphenicol, RNAi proceeded at normal efficiency. Puromycin also did not perturb efficient RNAi. Thus, protein synthesis is not required for RNAi in vitro.
  • [0115]
    Translational initiation is an ATP-dependent process that involves recognition of the 7-methyl guanosine cap of the mRNA (Kozak, Gene, 234:187-208 (1999); Merrick and Hershey, The Pathway and Mechanism of Eukaryotic Protein Synthesis. In Translational Control, J. Hershey, M. Mathews and N. Sonenberg, eds. (Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory Press), pp. 31-69 (1996)). The Drosophila lysate used to support RNAi in vitro also recapitulates the cap-dependence of translation; Pp-luc mRNA with a 7-methyl-guanosine cap was translated greater than ten-fold more efficiently than was the same mRNA with an A(5′)ppp(5′)G cap (FIG. 7B). Both RNAs were equally stable in the Drosophila lysate, showing that this difference in efficiency cannot be merely explained by more rapid decay of the mRNA with an adenosine cap (see also Gebauer et al., EMBO J., 18:6146-54 (1999)). Although the translational machinery can discriminate between Pp-luc mRNAs with 7-methyl-guanosine and adenosine caps, the two mRNAs were equally susceptible to RNAi in the presence of Pp-dsRNA (FIG. 7C). These results suggest that steps in cap recognition are not involved in RNAi.
  • [0116]
    dsRNA Is Processed to 21-23 nt Species
  • [0117]
    RNAs 25 nt in length are generated from both the sense and anti-sense strands of genes undergoing post-transcriptional gene silencing in plants (Hamilton and Baulcombe, Science, 286:950-2 (1999)). Denaturing acrylamide-gel analysis of the products formed in a two-hour incubation of uniformly 32P-radiolabeled dsRNAs and capped asRNA in lysate under standard RNAi conditions, in the presence or absence of target mRNAs. It was found that dsRNA is also processed to small RNA fragments. When incubated in lysate, approximately 15% of the input radioactivity of both the 501 bp Rr-dsRNA and the 505 bp Pp-dsRNA appeared in 21 to 23 nt RNA fragments. Because the dsRNAs are more than 500 bp in length, the 15% yield of fragments implies that multiple 21-23 nt RNAs are produced from each full-length dsRNA molecule. No other stable products were detected. The small RNA species were produced from dsRNAs in which both strands were uniformly 32P-radiolabeled. Formation of the 21-23 nt RNAs from the dsRNA did not require the presence of the corresponding mRNA, demonstrating that the small RNA species is generated by processing of the dsRNA, rather than as a product of dsRNA-targeted mRNA degradation. It was noted that 22 nucleotides corresponds to two turns of an A-form RNA-RNA helix.
  • [0118]
    When dsRNAs radiolabeled within either the sense or the anti-sense strand were incubated with lysate in a standard RNAi reaction, 21-23 nt RNAs were generated with comparable efficiency. These data support the idea that the 21-23 nt RNAs are generated by symmetric processing of the dsRNA. A variety of data support the idea that the 21-23 nt RNA is efficiently generated only from dsRNA and is not the consequence of an interaction between single-stranded RNA and the dsRNA. First, a 32P-radiolabeled 505 nt Pp-luc sense RNA or asRNA was not efficiently converted to the 21-23 nt product when it was incubated with 5 nM nonradioactive 505 bp Pp-dsRNA. Second, in the absence of mRNA, a 501 nt 7-methyl-guanosine-capped Rr-asRNA produced only a barely detectable amount of 21-23 nt RNA (capped single-stranded RNAs are as stable in the lysate as dsRNA, Tuschl et al., Genes Dev., 13:3191-7(1999)), probably due to a small amount of dsRNA contaminating the anti-sense preparation. However, when Rr-luc mRNA was included in the reaction with the 32P-radiolabeled, capped Rr-asRNA, a small amount of 21-23 nt product was generated, corresponding to 4% of the amount of 21-23 nt RNA produced from an equimolar amount of Rr-dsRNA. This result is unlikely to reflect the presence of contaminating dsRNA in the Rr-asRNA preparation, since significantly more product was generated from the asRNA in the presence of the Rr-luc mRNA than in the absence. Instead, the data suggest that asRNA can interact with the complementary mRNA sequences to form dsRNA in the reaction and that the resulting dsRNA is subsequently processed to the small RNA species. Rr-asRNA can support a low level of bona fide RNAi in vitro (see below), consistent with this explanation.
  • [0119]
    It was next asked if production of the 21-23 nt RNAs from dsRNA required ATP. When the 505 bp Pp-dsRNA was incubated in a lysate depleted for ATP by treatment with hexokinase and glucose, 21-23 nt RNA was produced, albeit 6 times slower than when ATP was regenerated in the depleted lysate by the inclusion of creatine kinase and creatine phosphate. Therefore, ATP may not be required for production of the 21-23 nt RNA species, but may instead simply enhance its formation. Alternatively, ATP may be required for processing of the dsRNA, but at a concentration less than that remaining after hexokinase treatment. The molecular basis for the slower mobility of the small RNA fragments generated in the ATP-depleted lysate is not understood.
  • [0120]
    Wagner and Sun (Wagner and Sun, Nature, 391:744-745 (1998)) and Sharp (Sharp, Genes Dev., 13:139-41 (1999)) have speculated that the requirement for dsRNA in gene silencing by RNAi reflects the involvement of a dsRNA-specific adenosine deaminase in the process. dsRNA adenosine deaminases unwind dsRNA by converting adenosine to inosine, which does not base-pair with uracil. dsRNA adenosine deaminases function in the post-transcriptional editing of mRNA (for review see Bass, Trends Biochem. Sci., 22:157-62 (1997)). To test for the involvement of dsRNA adenosine deaminase in RNAi, the degree of conversion of adenosine to inosine in the 501 bp Rr-luc and 505 bp Pp-luc dsRNAs after incubation with Drosophila embryo lysate in a standard in vitro RNAi reaction was examined. Adenosine deamination in full-length dsRNA and the 21-23 nt RNA species was assessed by two-dimensional thin-layer chromatography. Inorganic phosphate (Pi,) was produced by the degradation of mononucleotides by phosphatases that contaminate commercially available nuclease P1 (Auxilien et al., J. Mol. Biol., 262:437-458 (1996)). The degree of adenosine deamination in the 21-23 nt species was also determined. The full-length dsRNA radiolabeled with [32P]-adenosine was incubated in the lysate, and both the full-length dsRNA and the 21-23 nt RNA products were purified from a denaturing acrylarnide gel, cleaved to mononucleotides with nuclease P1, and analyzed by two-dimensional thin-layer chromatography.
  • [0121]
    A significant fraction of the adenosines in the full-length dsRNA were converted to inosine after 2 hours (3.1% and 5.6% conversion for Pp-luc and Rr-luc dsRNAs, respectively). In contrast, only 0.4% (Pp-dsRNA) or 0.7% (Rr-dsRNA) of the adenosines in the 21-23 nt species were deaminated. These data imply that fewer than 1 in 27 molecules of the 21-23 nt RNA species contain an inosine. Therefore, it is unlikely that dsRNA-dependent adenosine deamination within the 21-23 nt species is required for its production. asRNA Generates a Small Amount of RNAi in vitro When mRNA was 32P-radiolabeled within the 5′-7-methyl-guanosine cap, stable 5′ decay products accumulated during the RNAi reaction. Such stable 5′ decay products were observed for both the Pp-luc and Rr-luc mRNAs when they were incubated with their cognate dsRNAs. Previously, it was reported that efficient RNAi does not occur when asRNA is used in place of dsRNA (Tuschl et al., Genes Dev., 13:3191-7 (1999)). Nevertheless, mRNA was measurably less stable when incubated with asRNA than with buffer (FIGS. 8A and 8B). This was particularly evident for the Rr-luc mRNA: approximately 90% of the RNA remained intact after a 3-hour incubation in lysate, but only 50% when asRNA was added. Less than 5% remained when dsRNA was added. Interestingly, the decrease in mRNA stability caused by asRNA was accompanied by the formation of a small amount of the stable 5′-decay products characteristic of the RNAi reaction with dsRNA. This finding parallels the observation that a small amount of 21-23 nt product formed from the asRNA when it was incubated with the mRNA (see above) and lends strength to the idea that asRNA can enter the RNAi pathway, albeit inefficiently.
  • [0122]
    mRNA Cleavage Sites Are Determined by the Sequence of the dsRNA
  • [0123]
    The sites of mRNA cleavage were examined using three different dsRNAs, ‘A,’ ‘B,’ and ‘C,’ displaced along the Rr-luc sequence by approximately 100 nts. Denaturing acrylamide-gel analysis of the stable, 5′-cleavage products produced after incubation of the Rr-luc mRNA for the indicated times with each of the three dsRNAs, ‘A,’ ‘B,’ and ‘C,’ or with buffer (Ø) was performed. The positions of these relative to the Rr-luc mRNA sequence are shown in FIG. 9. Each of the three dsRNAs was incubated in a standard RNAi reaction with Rr-luc mRNA 32P-radiolabeled within the 5′-cap. In the absence of dsRNA, no stable 5′-cleavage products were detected for the mRNA, even after 3 hours of incubation in lysate. In contrast, after a 20-minute incubation, each of the three dsRNAs produced a ladder of bands corresponding to a set of mRNA cleavage products characteristic for that particular dsRNA. For each dsRNA, the stable, 5′ mRNA cleavage products were restricted to the region of the Rr-luc mRNA that corresponded to the dsRNA (FIGS. 9 and 10). For dsRNA ‘A,’ the lengths of the 5′ cleavage products ranged from 236 to just under ˜750 nt; dsRNA ‘A’ spans nucleotides 233 to 729 of the Rr-luc mRNA. Incubation of the mRNA with dsRNA ‘B’ produced mRNA 5′-cleavage products ranging in length from 150 to ˜600 nt; dsRNA ‘B’ spans nucleotides 143 to 644 of the mRNA. Finally, dsRNA ‘C’ produced mRNA cleavage products from 66 to ˜500 nt in length. This dsRNA spans nucleotides 50 to 569 of the Rr-luc mRNA. Therefore, the dsRNA not only provides specificity for the RNAi reaction, selecting which mRNA from the total cellular mRNA pool will be degraded, but also determines the precise positions of cleavage along the mRNA sequence.
  • [0124]
    The mRNA Is Cleaved at 21-23 Nucleotide Intervals
  • [0125]
    To gain further insight into the mechanism of RNAi, the positions of several mRNA cleavage sites for each of the three dsRNAs were mapped (FIG. 10). High resolution denaturing acrylamide-gel analysis of a subset of the 5′-cleavage products described above was performed. Remarkably, most of the cleavages occurred at 21-23 nt intervals (FIG. 10). This spacing is especially striking in light of our observation that the dsRNA is processed to a 21-23 nt RNA species and the finding of Hamilton and Baulcombe that a 25 nt RNA correlates with post-transcriptional gene silencing in plants (Hamilton and Baulcombe, Science, 286:950-2 (1999)). Of the 16 cleavage sites we mapped (2 for dsRNA ‘A,’ 5 for dsRNA ‘B,’ and 9 for dsRNA ‘C’), all but two reflect the 21-23 nt interval. One of the two exceptional cleavages was a weak cleavage site produced by dsRNA ‘C’ (indicated by an open blue circle in FIG. 10). This cleavage occurred 32 nt 5′ to the next cleavage site. The other exception is particularly intriguing. After four cleavages spaced 21-23 nt apart, dsRNA ‘C’ caused cleavage of the mRNA just nine nt 3′ to the previous cleavage site (red arrowhead in FIG. 10). This cleavage occurred in a run of seven uracil residues and appears to “reset” the ruler for cleavage; the next cleavage site was 21-23 nt 3′ to the exceptional site. The three subsequent cleavage sites that we mapped were also spaced 21-23 nt apart. Curiously, of the sixteen cleavage sites caused by the three different dsRNAs, fourteen occur at uracil residues. The significance of this finding is not understood, but it suggests that mRNA cleavage is determined by a process which measures 21-23 nt intervals and which has a sequence preference for cleavage at uracil. Results show that the 21-23 nt RNA species produced by incubation of 500 bp dsRNA in the lysate caused sequence-specific interference in vitro when isolated from an acrylamide gel and added to a new RNAi reaction in place of the full-length dsRNA.
  • [0126]
    A Model for dsRNA-Directed mRNA Cleavage
  • [0127]
    Without wishing to be bound by theory, the biochemical data described herein, together with recent genetic experiments in C. elegans and Neurospora (Cogoni and Macino, Nature, 399:166-9 (1999); Grishok et al., Science, 287: 2494-7 (2000); Ketting et al., Cell, 99:133-41 (1999); Tabara et al., Cell, 99:123-32 (1999)), suggest a model for how dsRNA targets mRNA for destruction (FIG. 11). In this model, the dsRNA is first cleaved to 21-23 nt long fragments in a process likely to involve genes such as the C. elegans loci rde-1 and rde-4. The resulting fragments, probably as short asRNAs bound by RNAi-specific proteins, would then pair with the mRNA and recruit a nuclease that cleaves the mRNA. Alternatively, strand exchange could occur in a protein-RNA complex that transiently holds a 21-23 nt dsRNA fragment close to the mRNA. Separation of the two strands of the dsRNA following fragmentation might be assisted by an ATP-dependent RNA helicase, explaining the observed ATP enhancement of 21-23 nt RNA production.
  • [0128]
    It is likely that each small RNA fragment produces one, or at most two, cleavages in the mRNA, perhaps at the 5′ or 3′ ends of the 21-23 nt fragment. The small RNAs may be amplified by an RNA-directed RNA polymerase such as that encoded by the ego-1 gene in C. elegans (Smardon et al., Current Biology, 10:169-178 (2000)) or the qde-1 gene in Neurospora (Cogoni and Macino, Nature, 399:166-9 (1999)), producing long-lasting post-transcriptional gene silencing in the absence of the dsRNA that initiated the RNAi effect. Heritable RNAi in C. elegans requires the rde-1 and rde-4 genes to initiate, but not to persist in subsequent generations. The rde-2, rde-3, and mut-7 genes in C. elegans are required in the tissue where RNAi occurs, but are not required for initiation of heritable RNAi (Grishok et al., Science, in press 2000). These ‘effector’ genes (Grishok et al., Science, in press 2000) are likely to encode proteins functioning in the actual selection of mRNA targets and in their subsequent cleavage. ATP may be required at any of a number of steps during RNAi, including complex formation on the dsRNA, strand dissociation during or after dsRNA cleavage, pairing of the 21-23 nt RNAs with the target mRNA, mRNA cleavage, and recycling of the targeting complex. Testing these ideas with the in vitro RNAi system will be an important challenge for the future. Some genes involved in RNAi are also important for transposon silencing and co-suppresion. Co-suppression is a broad biological phenomenon spanning plants, insects and perhaps humans. The most likely mechanism in Drosophila melanogaster is transcriptional silencing (Pal-Bhanra et al, Cell 99: 35-36. Thus, 21-23 nt fragments are likely to be involved in transcriptional control, as well as in post-transcriptional cotrol.
  • Example 3 Isolated 21-23 mers caused Sequence-Specific Interference when Added to a New RNAi Reaction
  • [0129]
    Isolation of 21-23 nt Fragments from Incubation Reaction of 500 bp dsRNA in Lysate.
  • [0130]
    Double-stranded RNA (500 bp from) was incubated at 10 nM concentration in Drosophila embryo lysate for 3 h at 25° C. under standard conditions as described herein. After deproteinization of the sample, the 21-23 nt reaction products were separated from unprocessed dsRNA by denaturing polyacrylamide (15%) gel electrophoresis. For detection of the non-radiolabeled 21-23 nt fragments, an incubation reaction with radiolabeled dsRNA was loaded in a separate lane of the same gel. Gel slices containing the non-radioactive 21-23 nt fragments were cut out and the 21-23 nt fragments were eluted from the gel slices at 4° C. overnight in 0.4 ml 0.3 M NaCl. The RNA was recovered from the supernatant by ethanol precipitation and centrifugation. The RNA pellet was dissolved in 10 μl of lysis buffer. As control, gel slices slightly above and below the 21-23 nt band were also cut out and subjected to the same elution and precipitation procedures. Also, a non-incubated dsRNA loaded on the 15% gel and a gel slice corresponding to 21-23 nt fragments was cut out and eluted. All pellets from the control experiments were dissolved in 10 μl lysis buffer. The losses of RNA during recovery from gel slices by elution are approx. 50%.
  • [0131]
    Incubation of Purified 21-23 nt Fragments in a Translation-Based RNAi Assay
  • [0132]
    1 μl of the eluted 21-23 mer or control RNA solution was used for a standard 10 μl RNAi incubation reaction (see above). The 21-23 mers were preincubated in the lysate containing reaction mixture for 10 or 30 min before the addition of the target and control mRNA. During pre-incubation, proteins involved in RNA interference may re-associate with the 21-23 mers due to a specific signal present on these RNAs. The incubation was continued for another hour to allow translation of the target and control mRNAs. The reaction was quenched by the addition of passive lysis buffer (Promega), and luciferase activity was measured. The RNA interference is the expressed as the ratio of target to control luciferase activity normalized by an RNA-free buffer control. Specific suppression of the target gene was observed with either 10 or 30 minutes preincubation. The suppression was reproducible and reduced the relative ratio of target to control by 2-3 fold. None of the RNA fragments isolated as controls showed specific interference. For comparison, incubation of 5 nM 500 bp dsRNA (10 min pre-incubation) affects the relative ratio of control to target gene approx. 30-fold.
  • [0133]
    Stability of Isolated 21-23 nt Fragments in a New Lysate Incubation Reaction.
  • [0134]
    Consistent with the observation of RNAi mediated by purified 21-23 nt RNA fragment, it was found that 35% of the input 21-23 nt RNA persists for more than 3 h in such an incubation reaction. This suggests that cellular factors associate with the deproteinized 21-23 nt fragments and reconstitute a functional mRNA-degrading particle. Signals connected with these 21-23 nt fragments, or their possible double stranded nature or specific lengths are likely responsible for this observation. The 21-23 nt fragments have a terminal 3′ hydroxyl group, as evidenced by altered mobility on a sequencing gel following periodate treatment and beta-elimination.
  • Example 4 21-23-mers Purified by Non-Denaturing Methods Caused Sequence-Specific Interference when Added to a New RNAi Reaction.
  • [0135]
    Fifty nanomolar double-stranded RNA (501 bp Rr-luc dsRNA, as described in example 1) was incubated in a 1 ml in vitro reaction with lysate at 25° C. (see example 1). The reaction was then stopped by the addition of an equal volume of 2× PK buffer (see example 1) and proteinase K was added to a final concentration of 1.8 μg/μl. The reaction was incubated for an additional 1 h at 25° C., phenol extracted, and then the RNAs were precipitated with 3 volumes of ethanol. The ethanol precipitate was collected by centrifugation, and the pellet was resuspended in 100 μl of lysis buffer and applied to a Superdex HR 200 10/30 gel filtration column (Pharmacia) run in lysis buffer at 0.75 ml/min. 200 μl fractions were collected from the column. Twenty μl of 3 M sodium acetate and 20 μg glycogen was added to each fraction, and the RNA was recovered by precipitation with 3 volumes of ethanol. The precipitates were resuspended in 30 μl of lysis buffer. Column profiles following the fractionation of 32P-labeled input RNA are shown in FIG. 13A.
  • [0136]
    One microliter of each resuspended fraction was tested in a 10 μl standard in vitro RNAi reaction (see example 1). This procedure yields a concentration of RNA in the in vitro RNAi reaction that is approximately equal to the concentration of that RNA species in the original reaction prior to loading on the column. The fractions were preincubated in the lysate containing reaction mixture for 30 min before the addition of 10 nM Rr-luc mRNA target and 10 nM Pp-luc control mRNA. During pre-incubation, proteins involved in RNA interference may re-associate with the 21-23-mers due to a specific signal present on these RNAs. The incubation was continued for another three hours to allow translation of the target and control mRNAs. The reaction was quenched by the addition of passive lysis buffer (Promega), and luciferase activity was measured. The suppression of Rr-luc mRNA target expression by the purified 21-23 nt fragments was reproducible and reduced the relative ratio of target to control by >30-fold, an amount comparable to a 50 nM 500 bp dsRNA control. Suppression of target mRNA expression was specific: little or no effect on the expression of the Pp-luc mRNA control was observed.
  • [0137]
    The data show that the both the fractions containing uncleaved dsRNA (fractions 3-5) or long, partially cleaved dsRNA (fractions 7-13) and the fractions containing the fully processed 21-23 nt siRNAs (fractions 41-50) mediate effective RNA interference in vitro (FIG. 13B). Suppression of target mRNA expression was specific: little or no effect on the expression of the Pp-luc mRNA control was observed (FIG. 13C). These data, together with those in the earlier examples, demonstrate that the 21-23 nt siRNAs are (1) true intermediates in the RNAi pathway and (2) effective mediators of RNA interference in vitro.
  • Example 5 21-Nucleotide siRNA Duplexes Mediate RNA Interference in Human Tissue Cultures
  • [0138]
    Methods
  • [0139]
    RNA Preparation
  • [0140]
    21 nt RNAs were chemically synthesized using Expedite RNA phosphoramidites and thymidine phosphoramidite (Proligo, Germany). Synthetic oligonucleotides were deprotected and gel-purified (Elbashir, S. M., Lendeckel, W. & Tuschl, T., Genes & Dev. 15, 188-200 (2001)), followed by Sep-Pak C18 cartridge (Waters, Milford, Mass., USA) purification (Tuschl, t., et al., Biochemistry, 32:11658-11668 (1993)). The siRNA sequences targeting GL2 (Acc. X65324) and GL3 luciferase (Acc. U47296) corresponded to the coding regions 153-173 relative to the first nucleotide of the start codon, siRNAs targeting RL (Acc. AF025846) corresponded to region 119-129 after the start codon. Longer RNAs were transcribed with T7 RNA polymerase from PCR products, followed by gel and Sep-Pak purification. The 49 and 484 bp GL2 or GL3 dsRNAs corresponded to position 113-161 and 113-596, respectively, relative to the start of translation; the 50 and 501 bp RL dsRNAs corresponded to position 118-167 and 118-618, respectively. PCR templates for dsRNA synthesis targeting humanized GFP (hG) were amplified from pAD3 (Kehlenbach, R. H., et al., J. Cell Biol., 141:863-874 (1998)), whereby 50 and 501 bp hG dsRNA corresponded to position 118-167 and 118-618, respectively, to the start codon.
  • [0141]
    For annealing of siRNAs, 20 μM single strands were incubated in annealing buffer (100 mM potassium acetate, 30 mM HEPES-KOH at pH 7.4, 2 mM magnesium acetate) for 1 min at 90° C. followed by 1 h at 37° C. The 37° C. incubation step was extended overnight for the 50 and 500 bp dsRNAs, and these annealing reactions were performed at 8.4 μM and 0.84 μM strand concentrations, respectively.
  • [0142]
    Cell Culture
  • [0143]
    S2 cells were propagated in Schneider's Drosophila medium (Life Technologies) supplemented with 10% FBS, 100 units/ml penicillin, and 100 μg/ml streptomycin at 25° C. 293, NIH/3T3, HeLa S3, COS-7 cells were grown at 37° C. in Dulbecco's modified Eagle's medium supplemented with 10% FBS, 100 units/ml penicillin, and 100 μg/ml streptomycin. Cells were regularly passaged to maintain exponential growth. 24 h before transfection at approx. 80% confluency, mammalian cells were trypsinized and diluted 1:5 with fresh medium without antibiotics (1-3×105 cells/ml) and transferred to 24-well plates (500 μl/well). S2 cells were not trypsinized before splitting. Transfection was carried out with Lipofectamine 2000 reagent (Life Technologies) as described by the manufacturer for adherent cell lines. Per well, 1.0 μg pGL2-Control (Promega) or pGL3-Control (Promega), 0.1 μg pRL-TK (Promega), and 0.28 μg siRNA duplex or dsRNA, formulated into liposomes, were applied; the final volume was 600 μl per well. Cells were incubated 20 h after transfection and appeared healthy thereafter. Luciferase expression was subsequently monitored with the Dual luciferase assay (Promega). Transfection efficiencies were determined by fluorescence microscopy for mammalian cell lines after co-transfection of 1.1 μg hGFP-encoding pAD322 and 0.28 μg invGL2 siRNA, and were 70-90%. Reporter plasmids were amplified in XL-1 Blue (Strategene) and purified using the Qiagen EndoFree Maxi Plasmid Kit.
  • [0144]
    Results
  • [0145]
    RNA interference (RNAi) is the process of sequence-specific, post-transcriptional gene silencing in animals and plants, initiated by double-stranded RNA (dsRNA) homologous in sequence to the silenced gene (Fire, A., Trends Genet., 15:358-363 (1999); Sharp, P.A. & Zamore, P. D., Science, 287:2431-2433 (2000); Sijen, T. & Kooter, J. M., Bioessays, 22:520-531 (2000); Bass, B. L., Cell, 101:235-238 (2000); Hammond, S. M., et al., Nat. Rev. Genet., 2:110-119 (2001)). The mediators of sequence-specific mRNA degradation are 21 and 22 nt small interfering RNAs (siRNAs) generated by RNase III cleavage from longer dsRNAs6-10 (Hamilton, A. J. &Baulcombe, D. C, Science, 286:950-952 (1999); Hammond, S. M., et al., Nature, 404:293-296 (2000); Zamore, P. D., et al., Cell, 101:25-33 (2000); Bernstein, E., et al, Naature, 409:363-366 (2001); Elbashir, S. M., et al., Genes & Dev., 15:188-200 (2001)). As shown herein, 21 nt siRNA duplexes are able to specifically suppress reporter gene expression in multiple mammalian tissue cultures, including human embryonic kidney (293) and HeLa cells. In contrast to 50 or 500 bp dsRNAs, siRNAs do not activate the interferon response. These results indicate that siRNA duplexes are a general tool for sequence-specific inactivation of gene function in mammalian cells.
  • [0146]
    Base-paired 21 and 22 nt siRNAs with overhanging 3′ ends mediate efficient sequence-specific mRNA degradation in lysates prepared from D. melanogaster embryos (Elbashir, S. M., et al., Genes & Dev., 15:188-200 (2001)). To test whether siRNAs are also capable of mediating RNAi in tissue culture, 21 nt siRNA duplexes with symmetric 2 nt 3′ overhangs directed against reporter genes coding for sea pansy (Renilla reniformis) and two sequence variants of firefly (Photinus pyralis, GL2 and GL3) luciferases (FIGS. 14A, 14B) were constructed. The siRNA duplexes were co-transfected with the reporter plasmid combinations pGL2/pRL or pGL3/pRL, into D. melanogaster Schneider S2 cells or mammalian cells using cationic liposomes. Luciferase activities were determined 20 h after transfection. In all cell lines tested, specific reduction of the expression of the reporter genes in the presence of cognate siRNA duplexes was observed (FIGS. 15A-15J). Remarkably, the absolute luciferase expression levels were unaffected by non-cognate siRNAs, indicating the absence of harmful side effects by 21 nt RNA duplexes (e.g. FIGS. 16A-16D, for HeLa cells). In D. melanogaster S2 cells (FIGS. 15A, 15B), the specific inhibition of luciferases was complete, and similar to results previously obtained for longer dsRNAs (Hammond, S. M., et al., Nature, 404:293-296 (2000); Caplen, N. J., et al., sGene, 252:95-105 (2000); Clemens, M & Williams, B., Cell, 13:565-572 (1978); Ui-Tei, K., et al., FEBS Letters, 479:79-82 (2000)). In mammalian cells, where the reporter genes were 50- to 100-fold stronger expressed, the specific suppression was less complete (FIGS. 15C-15J). GL2 expression was reduced 3- to 12-fold, GL3 expression 9- to 25-fold, and RL expression 1- to 3-fold, in response to the cognate siRNAs. For 293 cells, targeting of RL luciferase by RL siRNAs was ineffective, although GL2 and GL3 targets responded specifically (FIGS. 15I, 15J). It is likely that the lack of reduction of RL expression in 293 cells is due to its 5- to 20-fold higher expression compared to any other mammalian cell line tested and/or to limited accessibility of the target sequence due to RNA secondary structure or associated proteins. Nevertheless, specific targeting of GL2 and GL3 luciferase by the cognate siRNA duplexes indicated that RNAi is also functioning in 293 cells.
  • [0147]
    The 2 nt 3′ overhang in all siRNA duplexes, except for uGL2, was composed of (2′-deoxy) thymidine. Substitution of uridine by thymidine in the 3′ overhang was well tolerated in the D. melanogaster in vitro system, and the sequence of the overhang was uncritical for target recognition (Elbashir, S. M., et al., Genes & Dev., 15:188-200 (2001)). The thymidine overhang was chosen, because it is supposed to enhance nuclease resistance of siRNAs in the tissue culture medium and within transfected cells. Indeed, the thymidine-modified GL2 siRNA was slightly more potent than the unmodified uGL2 siRNA in all cell lines tested (FIGS. 15A, 15C, 15E, 15G, 15I). It is conceivable that further modifications of the 3′ overhanging nucleotides will provide additional benefits to the delivery and stability of siRNA duplexes.
  • [0148]
    In co-transfection experiments, 25 nM siRNA duplexes with respect to the final volume of tissue culture medium were used (FIGS. 15A-15J, 16A-16F). Increasing the siRNA concentration to 100 nM did not enhance the specific silencing effects, but started to affect transfection efficiencies due to competition for liposome encapsulation between plasmid DNA and siRNA. Decreasing the siRNA concentration to 1.5 nM did not reduce the specific silencing effect, even though the siRNAs were now only 2- to 20-fold more concentrated than the DNA plasmids. This indicates that siRNAs are extraordinarily powerful reagents for mediating gene silencing, and that siRNAs are effective at concentrations that are several orders of magnitude below the concentrations applied in conventional antisense or ribozyme gene targeting experiments.
  • [0149]
    In order to monitor the effect of longer dsRNAs on mammalian cells, 50 and 500 bp dsRNAs cognate to the reporter genes were prepared. As non-specific control, dsRNAs from humanized GFP (hG) (Kehlenbach, R. H., et al., J. Cell Biol., 141:863874 (1998)) was used. When dsRNAs were co-transfected, in identical amounts (not concentrations) to the siRNA duplexes, the reporter gene expression was strongly and unspecifically reduced. This effect is illustrated for HeLa cells as a representative example (FIGS. 16A-16D). The absolute luciferase activities were decreased unspecifically 10- to 20-fold by 50 bp dsRNA, and 20- to 200-fold by 500 bp dsRNA co-transfection, respectively. Similar unspecific effects were observed for COS-7 and NIH/3T3 cells. For 293 cells, a 10- to 20-fold unspecific reduction was observed only for 500 bp dsRNAs. Unspecific reduction in reporter gene expression by dsRNA >30 bp was expected as part of the interferon response (Matthews, M., Interactions between viruses and the cellular machinery for protein synthesis in Translational Control (eds., Hershey, J., Matthews, M. & Sonenberg, N.) 505-548 (Cold Spring Harbor Laboratory Press, Plainview, N.Y.; 1996); Kumar, M. & Carmichael, G. G., Microbiol. Mol. Biol. Rev., 62:1415-1434 (1998); Stark, G. R., et al., Annu. Rev. Biochem., 67:227-264 (1998)). Surprisingly, despite the strong unspecific decrease in reporter gene expression, additional sequence-specific, dsRNA-mediated silencing were reproducibly detected. The specific silencing effects, however, were only apparent when the relative reporter gene activities were normalized to the hG dsRNA controls (FIGS. 16E, 16F). A 2- to 10-fold specific reduction in response to cognate dsRNA was observed, also in the other three mammalian cell lines tested. Specific silencing effects with dsRNAs (356-1662 bp) were previously reported in CHO-K1 cells, but the amounts of dsRNA required to detect a 2- to 4-fold specific reduction were about 20-fold higher than in our experiments (Ui-Tei, K., et al., FEBS Letters, 479:79-82 (2000)). Also, CHO-K1 cells appear to be deficient in the interferon response. In another report, 293, NIH/3T3, and BHK-21 cells were tested for RNAi using luciferase/lacZ reporter combinations and 829 bp specific lacZ or 717 bp unspecific GFP dsRNA (Caplen, N. J., et al., Gene, 252:95105 (2000)). The failure of detecting RNAi in this case is likely due to the less sensitive luciferase/lacZ reporter assay and the length differences of target and control dsRNA. Taken together, the results described herein indicate that RNAi is active in mammalian cells, but that the silencing effect is difficult to detect if the interferon system is activated by dsRNA >30 bp.
  • [0150]
    The mechanism of the 21 nt siRNA-mediated interference process in mammalian cells remains to be uncovered, and silencing may occur post-transcriptional and/or transcriptional. In D. melanogaster lysate, siRNA duplexes mediate post-transcriptional gene silencing by reconstitution of a siRNA-protein complexes (siRNPs), which are guiding mRNA recognition and targeted cleavage (Hammond, S. M., et al., Nature, 404:293-296 (2000); Zamore, P. D., et al., Cell, 101:25-33 (2000); Elbashir, S. M., et al., Genes & Dev., 15:188-200 (2001)). In plants, dsRNA-mediated post-transcriptional silencing has also been linked to RNA-directed DNA methylation, which may also be directed by 21 nt siRNAs (Wassenegger, M., Plant Mol. Biol, 43:203-220 (2000); Finnegan, E. J., et al., Curr. Biol, 11:R99-R102 (2000)). Methylation of promoter regions can lead to transcriptional silencing (Metter, M. F., et al., EMBO J., 19:5194-5201 (2000)), but methylation in coding sequences must not (Wang, M. -B., RNA, 7:16-28 (2001)). DNA methylation and transcriptional silencing in mammals are well-documented processes (Kass, S. U., et al., Trends Genet., 13:444-449 (1997); Razin, A., EMBO J, 17:4905-4908 (1998)), yet they have not been linked to post-transcriptional silencing. Methylation in mammals is predominantly directed towards CpG residues. Because there is no CpG in the RL siRNA, but RL siRNA mediates specific silencing in mammalian tissue culture, it is unlikely that DNA methylation is critical for our observed silencing process. In summary, described herein, is siRNA-mediated gene silencing in mammalian cells. The use of 21 nt siRNAs holds great promise for inactivation of gene function in human tissue culture and the development of gene-specific therapeutics.
  • [0151]
    While this invention has been particularly shown and described with reference to preferred embodiments thereof, it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the scope of the invention encompassed by the appended claims

Claims (50)

What is claimed is:
1. Isolated RNA of from about 21 to about 23 nucleotides that mediates RNA interference of an mRNA to which it corresponds.
2. Isolated RNA of claim 1 that comprises a terminal 3′ hydroxyl group.
3. Isolated RNA of claim 1 which is chemically synthesized RNA or an analog of a naturally occurring RNA.
4. An analog of isolated RNA of claim 1, wherein the analog differs from the RNA of claim 1 by the addition, deletion, substitution or alteration of one or more nucleotides.
5. Isolated RNA of from about 21 to about 23 nucleotides that inactivates a corresponding gene by transcriptional silencing.
6. A soluble extract that mediates RNA interference.
7. The soluble extract of claim 6, wherein the extract is derived from Drosophila embryos.
8. The soluble extract of claim 7 wherein the extract is derived from syncytial blastoderm Drosophila embryos.
9. A method of producing RNA of from about 21 to about 23 nucleotides in length comprising:
(a) combining double-stranded RNA with a soluble extract that mediates RNA interference, thereby producing a combination; and
(b) maintaining the combination of a) under conditions in which the double-stranded RNA is processed to RNA of from about 21 to about 23 nucleotides in length.
10. The method of claim 9, wherein the soluble extract is derived from syncytial blastoderm Drosophila embryos.
11. The method of claim 9 further comprising isolating the RNA of from about 21 to about 23 nucleotides from the combination.
12. RNA of about 21 to about 23 nucleotides produced by the method of claim 9.
13. A method of producing RNA of from about 21 to about 23 nucleotides in length that mediates RNA interference of mRNA of a gene to be degraded, comprising:
(a) combining double-stranded RNA that corresponds to a sequence of the gene to be degraded with a soluble extract that mediates RNA interference, thereby producing a combination; and
(b) maintaining the combination of (a) under conditions under which the double-stranded RNA is processed to RNA of from about 21 to about 23 nucleotides that mediates RNA interference of the mRNA of the gene to be degraded, thereby producing RNA of from about 21 to about 23 nucleotides that mediates RNA interference of the mRNA.
14. The method of claim 13, wherein the soluble extract is derived from syncytial blastoderm Drosophila embryos.
15. The method of claim 13 further comprising isolating RNA of from about 21 to about 23 nucleotides from the combination.
16. Isolated RNA of from about 21 to about 23 nucleotides produced by the method of claim 15.
17. A method of mediating RNA interference of mRNA of a gene in a cell or organism comprising:
(a) introducing RNA of from about 21 to about 23 nucleotides which targets the mRNA of the gene for degradation into the cell or organism;
(b) maintaining the cell or organism produced in (a) under conditions under which degradation of the mRNA occurs, thereby mediating RNA interference of the mRNA of the gene in the cell or organism.
18. The method of claim 17 wherein the RNA of (a) is a chemically synthesized mRNA or an analog of naturally occurring RNA.
19. The method of claim 17, wherein the gene encodes a cellular mRNA or a viral mRNA.
20. A method of mediating RNA interference of mRNA of a gene in a cell or organism in which RNA interference occurs, comprising:
(a) combining double-stranded RNA that corresponds to a sequence of the gene with a soluble extract that mediates RNA interference, thereby producing a combination;
(b) maintaining the combination produced in (a) under conditions under which the double-stranded RNA is processed to RNA of from about 21 to about 23 nucleotides, thereby producing RNA of from about 21 to about 23 nucleotides;
(c) isolating RNA of from about 21 to about 23 nucleotides produced in (b);
(d) introducing RNA isolated in (c) into the cell or organism; and
(e) maintaining the cell or organism produced in (d) under conditions under which degradation of mRNA of the gene occurs, thereby mediating RNA interference of the mRNA of the gene in the cell or organism.
21. The method of claim 20, wherein the soluble extract is derived from syncytial blastoderm Drosophila embryos.
22. The method of claim 20, wherein the RNA is isolated using gel electrophoresis.
23. A method of mediating RNA interference of mRNA of a gene in a cell or organism in which RNA interference occurs, comprising: (a) introducing into the cell or organism RNA of from about 21 to about 23 nucleotides that mediates RNA interference of mRNA of the gene, thereby producing a cell or organism that contains the RNA and (b) maintaining the cell or organism that contains the RNA under conditions under which RNA interference occurs, thereby mediating RNA interference of mRNA of the gene in the cell or organism.
24. The method of claim 23, wherein the RNA of from about 21 to about 23 nucleotides is chemically synthesized RNA or an analog of RNA that mediates RNA interference.
25. The method of claim 23, wherein the gene encodes a cellular mRNA or a viral mRNA.
26. A knockdown cell or organism generated by the method of claim 23.
27. The knockdown cell or organism of claim 26, wherein the cell or organism mimics a disease.
28. A method of examining the function of a gene in a cell or organism comprising:
(a) introducing RNA of from about 21 to about 23 nucleotides that targets mRNA of the gene for degradation into the cell or organism, thereby producing a test cell or test organism;
(b) maintaining the test cell or test organism under conditions under which degradation of mRNA of the gene occurs, thereby producing a test cell or test organism in which mRNA of the gene is degraded; and
(c) observing the phenotype of the test cell or test organism produced in (b) and, optionally, comparing the phenotype observed to that of an appropriate control cell or control organism, thereby providing information about the function of the gene.
29. The method of claim 28 wherein the RNA introduced in (a) is chemically synthesized or an analog of RNA that mediates RNA interference.
30. A method of examining the function of a gene in a cell or organism comprising
(a) combining double-stranded RNA that corresponds to a sequence of the gene with a soluble extract that mediates RNA interference, thereby producing a combination;
(b) maintaining the combination produced in (a) under conditions under which the double-stranded RNA is processed to RNA of about 21 to about 23 nucleotides, whereby RNA of about 21 to about 23 nucleotides is produced;
(c) isolating RNA of about 21 to about 23 nucleotides produced in (b);
(d) introducing the RNA isolated in (c) into the cell or organism, thereby producing a test cell or test organism;
(e) maintaining the test cell or test organism under conditions under which degradation of mRNA of the gene occurs, thereby producing a test cell or test organism in which mRNA of the gene is degraded; and
(f) observing the phenotype of the test cell or test organism produced in (e) and, optionally, comparing the phenotype observed to that of an appropriate control, thereby providing information about the function of the gene.
31. The method of claim 30, wherein the RNA comprises a terminal 3′ hydroxyl group.
32. The method of claim 30, wherein the soluble extract is derived from syncytial blastoderm Drosophila embryos.
33. The method of claim 30, wherein the RNA is isolated using gel electrophoresis.
34. A composition comprising biochemical components of a Drosophila cell that process dsRNA to RNA of about 21 to about 23 nucleotides and a suitable carrier.
35. A composition comprising biochemical components of a cell that target mRNA of a gene to be degraded by RNA of about 21 to about 23 nucleotides.
36. A method of treating a disease or condition associated with the presence of a protein in an individual comprising administering to the individual RNA of from about 21 to about 23 nucleotides that targets the mRNA of the protein for degradation.
37. The method of claim 36 wherein RNA of from about 21 to about 23 nucleotides is chemically synthesized or an analog of RNA that mediates RNA interference.
38. A method of assessing whether an agent acts on a gene product comprising:
(a) introducing RNA of from about 21 to about 23 nucleotides which targets the mRNA of the gene for degradation into a cell or organism;
(b) maintaining the cell or organism of (a) under conditions in which degradation of the mRNA occurs,
(c) introducing the agent into the cell or organism of (b); and
(d) determining whether the agent has an effect on the cell or organism, wherein if the agent has no effect on the cell or organism then the agent acts on the gene product or on a biological pathway that involves the gene product.
39. The method of claim 38, wherein the RNA of from about 21 to about 23 nucleotides is chemically synthesized or an analog of RNA that mediates RNA interference.
40. A method of assessing whether a gene product is a suitable target for drug discovery comprising:
(a) introducing RNA of from about 21 to about 23 nucleotides which targets the mRNA of the gene for degradation into a cell or organism;
(b) maintaining the cell or organism of (a) under conditions in which degradation of the mRNA occurs resulting in decreased expression of the gene; and
(c) determining the effect of the decreased expression of the gene on the cell or organism, wherein if decreased expression has an effect, then the gene product is a target for drug discovery.
41. The method of claim 40, wherein the RNA of from about 21 to about 23 nucleotides is synthetic RNA or an analog of RNA that mediates RNA interference.
42. A gene identified by the sequencing of endogenous 21 to 23 nucleotide RNA molecules that mediate RNA interference.
43. A pharmaceutical composition comprising RNA of from about 21 to about 23 nucleotides that mediates RNA interference and an appropriate carrier.
44. A method of producing knockdown cells, comprising introducing into cells in which a gene is to be knocked down RNA of about 21 to about 23 nt that targets the mRNA corresponding to the gene and maintaining the resulting cells under conditions under which RNAi occurs, resulting in degradation of the mRNA of the gene, thereby producing knockdown cells.
45. The method of claim 44, wherein the RNA of about 21 to about 23 nucleotides is synthetic RNA or an analog of RNA that mediates RNA interference.
46. A method of identifying target sites within mRNA that are efficiently cleaved by the RNAi process, comprising combining dsRNA corresponding to a sequence of a gene to be degraded, labeled mRNA corresponding to the gene and a soluble extract that mediates RNA interference, thereby producing a combination; maintaining the combination under conditions under which the dsRNA is degraded and identifying sites in the mRNA that are efficiently cleaved.
47. A method of identifying 21-23 nt RNAs that efficiently mediate RNAi, wherein said 21-23 nt RNAs span the target sites identified within the mRNA by the method of claim 46.
48. RNA of claim 16, isolated using gel electrophoresis.
49. RNA of claim 16, isolated using non-denaturing methods.
50. RNA of claim 16, isolated using non-denaturing column chromatography.
US09821832 2000-03-30 2001-03-30 RNA sequence-specific mediators of RNA interference Abandoned US20020086356A1 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
US19359400 true 2000-03-30 2000-03-30
EP00126325 2000-12-01
EP00126325.0 2000-12-01
US26523201 true 2001-01-31 2001-01-31
US09821832 US20020086356A1 (en) 2000-03-30 2001-03-30 RNA sequence-specific mediators of RNA interference

Applications Claiming Priority (18)

Application Number Priority Date Filing Date Title
US09821832 US20020086356A1 (en) 2000-03-30 2001-03-30 RNA sequence-specific mediators of RNA interference
US10255568 US20030108923A1 (en) 2000-03-30 2002-09-26 RNA sequence-specific mediators of RNA interference
US11474738 US20070003960A1 (en) 2000-03-30 2006-06-26 RNA sequence-specific mediators of RNA interference
US11474932 US20070003963A1 (en) 2000-03-30 2006-06-26 RNA sequence-specific mediators of RNA interference
US11474919 US20070003961A1 (en) 2000-03-30 2006-06-26 RNA sequence-specific mediators of RNA interference
US11474930 US20070003962A1 (en) 2000-03-30 2006-06-26 RNA sequence-specific mediators of RNA interference
US11880355 US20090186843A1 (en) 2000-03-30 2007-07-19 RNA sequence-specific mediators of RNA interference
US11880464 US20080132461A1 (en) 2000-03-30 2007-07-19 RNA sequence-specific mediators of RNA interference
US12897754 US8420391B2 (en) 2000-03-30 2010-10-04 RNA sequence-specific mediators of RNA interference
US12897740 US8552171B2 (en) 2000-03-30 2010-10-04 RNA sequence-specific mediators of RNA interference
US12897744 US8394628B2 (en) 2000-03-30 2010-10-04 RNA sequence-specific mediators of RNA interference
US12897759 US8790922B2 (en) 2000-03-30 2010-10-04 RNA sequence-specific mediators of RNA interference
US12897749 US8632997B2 (en) 2000-03-30 2010-10-04 RNA sequence-specific mediators of RNA interference
US12897756 US8742092B2 (en) 2000-03-30 2010-10-04 RNA sequence-specific mediators of RNA interference
US13008636 US9012621B2 (en) 2000-03-30 2011-01-18 RNA sequence-specific mediators of RNA interference
US13043917 US9012138B2 (en) 2000-03-30 2011-03-09 RNA sequence-specific mediators of RNA interference
US13830751 US9193753B2 (en) 2000-03-30 2013-03-14 RNA sequence-specific mediators of RNA interference
US14885288 US20160032288A1 (en) 2000-03-30 2015-10-16 Rna sequence-specific mediators of rna interference

Related Child Applications (10)

Application Number Title Priority Date Filing Date
US10255568 Continuation US20030108923A1 (en) 2000-03-30 2002-09-26 RNA sequence-specific mediators of RNA interference
US11474738 Division US20070003960A1 (en) 2000-03-30 2006-06-26 RNA sequence-specific mediators of RNA interference
US11474919 Division US20070003961A1 (en) 2000-03-30 2006-06-26 RNA sequence-specific mediators of RNA interference
US11474930 Division US20070003962A1 (en) 2000-03-30 2006-06-26 RNA sequence-specific mediators of RNA interference
US11474932 Continuation US20070003963A1 (en) 2000-03-30 2006-06-26 RNA sequence-specific mediators of RNA interference
US11474932 Division US20070003963A1 (en) 2000-03-30 2006-06-26 RNA sequence-specific mediators of RNA interference
US11880355 Continuation US20090186843A1 (en) 2000-03-30 2007-07-19 RNA sequence-specific mediators of RNA interference
US11880464 Division US20080132461A1 (en) 2000-03-30 2007-07-19 RNA sequence-specific mediators of RNA interference
US11880464 Continuation US20080132461A1 (en) 2000-03-30 2007-07-19 RNA sequence-specific mediators of RNA interference
US12897740 Continuation US8552171B2 (en) 2000-03-30 2010-10-04 RNA sequence-specific mediators of RNA interference

Publications (1)

Publication Number Publication Date
US20020086356A1 true true US20020086356A1 (en) 2002-07-04

Family

ID=38068195

Family Applications (18)

Application Number Title Priority Date Filing Date
US09821832 Abandoned US20020086356A1 (en) 2000-03-30 2001-03-30 RNA sequence-specific mediators of RNA interference
US10255568 Abandoned US20030108923A1 (en) 2000-03-30 2002-09-26 RNA sequence-specific mediators of RNA interference
US11474738 Abandoned US20070003960A1 (en) 2000-03-30 2006-06-26 RNA sequence-specific mediators of RNA interference
US11474932 Abandoned US20070003963A1 (en) 2000-03-30 2006-06-26 RNA sequence-specific mediators of RNA interference
US11474919 Abandoned US20070003961A1 (en) 2000-03-30 2006-06-26 RNA sequence-specific mediators of RNA interference
US11474930 Abandoned US20070003962A1 (en) 2000-03-30 2006-06-26 RNA sequence-specific mediators of RNA interference
US11880355 Abandoned US20090186843A1 (en) 2000-03-30 2007-07-19 RNA sequence-specific mediators of RNA interference
US11880464 Abandoned US20080132461A1 (en) 2000-03-30 2007-07-19 RNA sequence-specific mediators of RNA interference
US12897759 Active US8790922B2 (en) 2000-03-30 2010-10-04 RNA sequence-specific mediators of RNA interference
US12897744 Active US8394628B2 (en) 2000-03-30 2010-10-04 RNA sequence-specific mediators of RNA interference
US12897754 Active US8420391B2 (en) 2000-03-30 2010-10-04 RNA sequence-specific mediators of RNA interference
US12897749 Active US8632997B2 (en) 2000-03-30 2010-10-04 RNA sequence-specific mediators of RNA interference
US12897740 Active US8552171B2 (en) 2000-03-30 2010-10-04 RNA sequence-specific mediators of RNA interference
US12897756 Active US8742092B2 (en) 2000-03-30 2010-10-04 RNA sequence-specific mediators of RNA interference
US13008636 Active US9012621B2 (en) 2000-03-30 2011-01-18 RNA sequence-specific mediators of RNA interference
US13043917 Active 2022-07-31 US9012138B2 (en) 2000-03-30 2011-03-09 RNA sequence-specific mediators of RNA interference
US13830751 Active US9193753B2 (en) 2000-03-30 2013-03-14 RNA sequence-specific mediators of RNA interference
US14885288 Pending US20160032288A1 (en) 2000-03-30 2015-10-16 Rna sequence-specific mediators of rna interference

Family Applications After (17)

Application Number Title Priority Date Filing Date
US10255568 Abandoned US20030108923A1 (en) 2000-03-30 2002-09-26 RNA sequence-specific mediators of RNA interference
US11474738 Abandoned US20070003960A1 (en) 2000-03-30 2006-06-26 RNA sequence-specific mediators of RNA interference
US11474932 Abandoned US20070003963A1 (en) 2000-03-30 2006-06-26 RNA sequence-specific mediators of RNA interference
US11474919 Abandoned US20070003961A1 (en) 2000-03-30 2006-06-26 RNA sequence-specific mediators of RNA interference
US11474930 Abandoned US20070003962A1 (en) 2000-03-30 2006-06-26 RNA sequence-specific mediators of RNA interference
US11880355 Abandoned US20090186843A1 (en) 2000-03-30 2007-07-19 RNA sequence-specific mediators of RNA interference
US11880464 Abandoned US20080132461A1 (en) 2000-03-30 2007-07-19 RNA sequence-specific mediators of RNA interference
US12897759 Active US8790922B2 (en) 2000-03-30 2010-10-04 RNA sequence-specific mediators of RNA interference
US12897744 Active US8394628B2 (en) 2000-03-30 2010-10-04 RNA sequence-specific mediators of RNA interference
US12897754 Active US8420391B2 (en) 2000-03-30 2010-10-04 RNA sequence-specific mediators of RNA interference
US12897749 Active US8632997B2 (en) 2000-03-30 2010-10-04 RNA sequence-specific mediators of RNA interference
US12897740 Active US8552171B2 (en) 2000-03-30 2010-10-04 RNA sequence-specific mediators of RNA interference
US12897756 Active US8742092B2 (en) 2000-03-30 2010-10-04 RNA sequence-specific mediators of RNA interference
US13008636 Active US9012621B2 (en) 2000-03-30 2011-01-18 RNA sequence-specific mediators of RNA interference
US13043917 Active 2022-07-31 US9012138B2 (en) 2000-03-30 2011-03-09 RNA sequence-specific mediators of RNA interference
US13830751 Active US9193753B2 (en) 2000-03-30 2013-03-14 RNA sequence-specific mediators of RNA interference
US14885288 Pending US20160032288A1 (en) 2000-03-30 2015-10-16 Rna sequence-specific mediators of rna interference

Country Status (9)

Country Link
US (18) US20020086356A1 (en)
JP (4) JP5500750B2 (en)
KR (3) KR101215789B1 (en)
CA (1) CA2404890C (en)
DE (1) DE60140676D1 (en)
DK (1) DK1309726T3 (en)
EP (3) EP2028278B1 (en)
ES (1) ES2336887T3 (en)
WO (1) WO2001075164A3 (en)

Cited By (401)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020114784A1 (en) * 1999-01-28 2002-08-22 Medical College Of Georgia Research Institute, Inc. Composition and method for in vivo and in vitro attenuation of gene expression using double stranded RNA
US20020162126A1 (en) * 2000-03-16 2002-10-31 David Beach Methods and compositions for RNA interference
US20030056235A1 (en) * 1997-12-23 2003-03-20 The Carnegie Institution Of Washington Genetic inhibition by double-stranded RNA
US20030084471A1 (en) * 2000-03-16 2003-05-01 David Beach Methods and compositions for RNA interference
US20030105051A1 (en) * 2001-05-29 2003-06-05 Mcswiggen James Nucleic acid treatment of diseases or conditions related to levels of HER2
US20030139363A1 (en) * 2001-07-23 2003-07-24 Kay Mark A. Methods and compositions for RNAi mediated inhibition of viral gene expression in mammals
US20030166282A1 (en) * 2002-02-01 2003-09-04 David Brown High potency siRNAS for reducing the expression of target genes
US20030175772A1 (en) * 2001-12-27 2003-09-18 Jiwu Wang Compositions for DNA mediated gene silencing
US20030182672A1 (en) * 2000-03-17 2003-09-25 Graham Michael Wayne Genetic silencing
WO2003078630A1 (en) 2002-03-20 2003-09-25 Biostratum Ab INHIBITION OF THE β3 SUBUNIT OF L-TYPE CA2+ CHANNELS
US20030191077A1 (en) * 2001-04-05 2003-10-09 Kathy Fosnaugh Method and reagent for the treatment of asthma and allergic conditions
US20030190654A1 (en) * 2002-01-22 2003-10-09 Ribopharma Double-stranded RNA (dsRNA) and method of use for inhibiting expression of a fusion gene
US20030198627A1 (en) * 2001-09-01 2003-10-23 Gert-Jan Arts siRNA knockout assay method and constructs
US20030206887A1 (en) * 1992-05-14 2003-11-06 David Morrissey RNA interference mediated inhibition of hepatitis B virus (HBV) using short interfering nucleic acid (siNA)
US20030224432A1 (en) * 2002-05-03 2003-12-04 Jason Myers Methods and compositions for use in preparing siRNAs
US20030228597A1 (en) * 1998-04-13 2003-12-11 Cowsert Lex M. Identification of genetic targets for modulation by oligonucleotides and generation of oligonucleotides for gene modulation
US20040002153A1 (en) * 1999-07-21 2004-01-01 Monia Brett P. Modulation of PTEN expression via oligomeric compounds
US20040001811A1 (en) * 2001-01-09 2004-01-01 Ribopharma Ag Compositions and methods for inhibiting expression of anti-apoptotic genes
US20040019001A1 (en) * 2002-02-20 2004-01-29 Mcswiggen James A. RNA interference mediated inhibition of protein typrosine phosphatase-1B (PTP-1B) gene expression using short interfering RNA
US20040018176A1 (en) * 2002-07-24 2004-01-29 The Trustees Of The University Of Pennsylvania Compositions and methods for siRNA inhibition of angiogenesis
WO2004013355A1 (en) * 2002-08-05 2004-02-12 University Of Iowa Research Foundation Sirna-mediated gene silencing with viral vectors
WO2004013280A2 (en) * 2002-08-05 2004-02-12 University Of Iowa Research Foundation ALLELE-SPECIFIC siRNA-MEDIATED GENE SILENCING
US20040033602A1 (en) * 2002-06-12 2004-02-19 Ambion, Inc. Methods and compositions relating to polypeptides with RNase III domains that mediate RNA interference
US20040038278A1 (en) * 2002-08-12 2004-02-26 George Tzertzinis Methods and compositions relating to gene silencing
US20040038921A1 (en) * 2001-10-26 2004-02-26 Ribopharma Ag Composition and method for inhibiting expression of a target gene
US20040053875A1 (en) * 1999-01-30 2004-03-18 Ribopharma Ag Method and medicament for inhibiting the expression of a given gene
US20040054155A1 (en) * 2002-02-01 2004-03-18 Sequitur, Inc. Oligonucleotide compositions with enhanced efficiency
US20040053411A1 (en) * 2002-05-03 2004-03-18 Duke University Method of regulating gene expression
US20040053869A1 (en) * 2000-08-19 2004-03-18 Peter Andrews Stem cell differentiation
US20040077082A1 (en) * 2002-10-18 2004-04-22 Koehn Richard K. RNA-based inhibitory oligonucleotides
US20040086911A1 (en) * 2002-06-24 2004-05-06 Baylor College Of Medicine Inhibition of gene expression in vertebrates using double-stranded RNA (RNAi)
US20040096843A1 (en) * 2002-02-14 2004-05-20 Rossi John J. Methods for producing interfering RNA molecules in mammalian cells and therapeutic uses for such molecules
US20040110698A1 (en) * 2002-12-10 2004-06-10 Kimron Veterinary Institute Oligonucleotides and methods using same for treating cox-ll associated diseases
US20040121348A1 (en) * 2001-10-26 2004-06-24 Ribopharma Ag Compositions and methods for treating pancreatic cancer
US20040138163A1 (en) * 2002-05-29 2004-07-15 Mcswiggen James RNA interference mediated inhibition of vascular edothelial growth factor and vascular edothelial growth factor receptor gene expression using short interfering nucleic acid (siNA)
US20040152117A1 (en) * 2001-01-31 2004-08-05 Tony Giordano Use of post-transcriptional gene silencing for identifying nucleic acid sequences that modulate the function of a cell
US20040171118A1 (en) * 2003-02-13 2004-09-02 City Of Hope Methods for directing DNA methylation in mammalian cells using homologous short double stranded RNAs
US20040175703A1 (en) * 1999-11-24 2004-09-09 Ribopharma Ag Compositions and methods for inhibiting expression of a target gene
US20040176282A1 (en) * 2003-01-09 2004-09-09 Brian Dalby Cellular delivery and activation of polypeptide-nucleic acid complexes
US20040180439A1 (en) * 1998-03-20 2004-09-16 Benitec Australia Limited Synthetic genes and genetic constructs
US20040192626A1 (en) * 2002-02-20 2004-09-30 Mcswiggen James RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US20040191905A1 (en) * 2002-11-22 2004-09-30 University Of Massachusetts Modulation of HIV replication by RNA interference
US20040198682A1 (en) * 2001-11-30 2004-10-07 Mcswiggen James RNA interference mediated inhibition of placental growth factor gene expression using short interfering nucleic acid (siNA)
US20040198690A1 (en) * 1999-04-21 2004-10-07 Wyeth Methods and compositions for inhibiting the function of polynucleotide sequences
US20040203145A1 (en) * 2002-08-07 2004-10-14 University Of Massachusetts Compositions for RNA interference and methods of use thereof
WO2004087862A2 (en) 2003-04-01 2004-10-14 Yissum Research Development Company Of The Hebrew University Of Jerusalem Tak1-mediated inhibition of osteogenesis
US20040219515A1 (en) * 2002-11-26 2004-11-04 Rosetta Genomics Bioinformatically detectable group of novel hiv regulatory genes and uses thereof
US20040229266A1 (en) * 2000-12-01 2004-11-18 Max-Planck-Gesellschaft Zur Forderung Der Wissenschaften E.V. RNA interference mediating small RNA molecules
WO2004099403A1 (en) 2003-05-12 2004-11-18 The University Of Queensland A method of increasing the total or soluble carbohydrate content or sweetness of an endogenous carbohydrate by catalysing the conversion of an endogenous sugar to an alien sugar.
US20040242521A1 (en) * 1999-10-25 2004-12-02 Board Of Regents, The University Of Texas System Thio-siRNA aptamers
US20040241854A1 (en) * 2002-08-05 2004-12-02 Davidson Beverly L. siRNA-mediated gene silencing
US20040242518A1 (en) * 2002-09-28 2004-12-02 Massachusetts Institute Of Technology Influenza therapeutic
WO2004106515A1 (en) 2003-05-28 2004-12-09 Scimedia Ltd. Anti-bambi antibody and diagnostic or remedy for colon cancer and liver cancer containing the same
US20040248094A1 (en) * 2002-06-12 2004-12-09 Ford Lance P. Methods and compositions relating to labeled RNA molecules that reduce gene expression
US20040248174A1 (en) * 2003-04-18 2004-12-09 Thetrustees Of The University Of Pennsylvania Compositions and methods for siRNA inhibition of angiopoietin 1and 2 and their receptor Tie2
US20050004064A1 (en) * 2001-11-21 2005-01-06 Mitsubishi Chemical Corporation Method of inhibiting gene expression
US20050020525A1 (en) * 2002-02-20 2005-01-27 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US20050026290A1 (en) * 2003-08-01 2005-02-03 Ciardi Joseph Anthony Inhibiting gene expression with dsRNA
US20050032733A1 (en) * 2001-05-18 2005-02-10 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (SiNA)
US20050037988A1 (en) * 2003-06-02 2005-02-17 University Of Massachusetts Methods and compositions for controlling efficacy of RNA silencing
US20050042646A1 (en) * 2002-08-05 2005-02-24 Davidson Beverly L. RNA interference suppresion of neurodegenerative diseases and methods of use thereof
US20050048529A1 (en) * 2002-02-20 2005-03-03 Sirna Therapeutics, Inc. RNA interference mediated inhibition of intercellular adhesion molecule (ICAM) gene expression using short interfering nucleic acid (siNA)
US20050054596A1 (en) * 2001-11-30 2005-03-10 Mcswiggen James RNA interference mediated inhibition of vascular endothelial growth factor and vascular endothelial growth factor receptor gene expression using short interfering nucleic acid (siNA)
US20050058982A1 (en) * 2002-07-26 2005-03-17 Chiron Corporation Modified small interfering RNA molecules and methods of use
US20050059044A1 (en) * 2003-06-03 2005-03-17 Graham Michael Wayne Double-stranded nucleic acid
US20050075492A1 (en) * 2003-08-07 2005-04-07 Whitehead Institute For Biomedical Research Methods and products for expression of micro RNAs
US20050074757A1 (en) * 2001-10-12 2005-04-07 Ribopharma Ag Compositions and methods for inhibiting expression of a mutant gene
US20050075304A1 (en) * 2001-11-30 2005-04-07 Mcswiggen James RNA interference mediated inhibition of vascular endothelial growth factor and vascular endothelial growth factor receptor gene expression using short interfering nucleic acid (siNA)
US20050079610A1 (en) * 2001-05-18 2005-04-14 Sirna Therapeutics, Inc. RNA interference mediated inhibition of Fos gene expression using short interfering nucleic acid (siNA)
US20050096284A1 (en) * 2002-02-20 2005-05-05 Sirna Therapeutics, Inc. RNA interference mediated treatment of polyglutamine (polyQ) repeat expansion diseases using short interfering nucleic acid (siNA)
WO2005042708A2 (en) 2003-10-27 2005-05-12 Rosetta Inpharmatics Llc METHOD OF DESIGNING siRNAS FOR GENE SILENCING
US20050102709A1 (en) * 1999-10-27 2005-05-12 Plant Bioscience Limited RNA molecules and vectors for gene silencing
US20050120415A1 (en) * 2003-10-09 2005-06-02 E.I. Du Pont De Nemours And Company Gene silencing
US20050119212A1 (en) * 2001-05-18 2005-06-02 Sirna Therapeutics, Inc. RNA interference mediated inhibition of FAS and FASL gene expression using short interfering nucleic acid (siNA)
US20050124569A1 (en) * 2001-05-18 2005-06-09 Sirna Therapeutics, Inc. RNA interference mediated inhibition of CXCR4 gene expression using short interfering nucleic acid (siNA)
US20050124566A1 (en) * 2001-05-18 2005-06-09 Sirna Therapeutics, Inc. RNA interference mediated inhibition of myostatin gene expression using short interfering nucleic acid (siNA)
US20050137155A1 (en) * 2001-05-18 2005-06-23 Sirna Therapeutics, Inc. RNA interference mediated treatment of Parkinson disease using short interfering nucleic acid (siNA)
US20050136436A1 (en) * 2001-05-18 2005-06-23 Sirna Therapeutics, Inc. RNA interference mediated inhibition of G72 and D-amino acid oxidase (DAAO) gene expression using short interfering nucleic acid (siNA)
US20050143333A1 (en) * 2001-05-18 2005-06-30 Sirna Therapeutics, Inc. RNA interference mediated inhibition of interleukin and interleukin receptor gene expression using short interfering nucleic acid (SINA)
US20050147993A1 (en) * 2003-10-24 2005-07-07 Shaharyar Khan Methods and compositions for delivering polynucleotides
WO2005062937A2 (en) * 2003-12-22 2005-07-14 University Of Massachusetts Methods and compositions for enhancing the efficacy and specificity of single and double blunt-ended sirna
US20050153914A1 (en) * 2001-05-18 2005-07-14 Sirna Therapeutics, Inc. RNA interference mediated inhibition of MDR P-glycoprotein gene expression using short interfering nucleic acid (siNA)
US20050158735A1 (en) * 2001-05-18 2005-07-21 Sirna Therapeutics, Inc. RNA interference mediated inhibition of proliferating cell nuclear antigen (PCNA) gene expression using short interfering nucleic acid (siNA)
US20050159378A1 (en) * 2001-05-18 2005-07-21 Sirna Therapeutics, Inc. RNA interference mediated inhibition of Myc and/or Myb gene expression using short interfering nucleic acid (siNA)
US20050159380A1 (en) * 2001-05-18 2005-07-21 Sirna Therapeutics, Inc. RNA interference mediated inhibition of angiopoietin gene expression using short interfering nucleic acid (siNA)
US20050159379A1 (en) * 2001-05-18 2005-07-21 Sirna Therapeutics, Inc RNA interference mediated inhibition of gastric inhibitory polypeptide (GIP) and gastric inhibitory polypeptide receptor (GIPR) gene expression using short interfering nucleic acid (siNA)
US20050159382A1 (en) * 2001-05-18 2005-07-21 Sirna Therapeutics, Inc. RNA interference mediated inhibition of polycomb group protein EZH2 gene expression using short interfering nucleic acid (siNA)
US20050159381A1 (en) * 2001-05-18 2005-07-21 Sirna Therapeutics, Inc. RNA interference mediated inhibition of chromosome translocation gene expression using short interfering nucleic acid (siNA)
US20050164235A1 (en) * 2003-04-17 2005-07-28 Muthiah Manoharan Modified iRNA agents
US20050164967A1 (en) * 2001-05-18 2005-07-28 Sirna Therapeutics, Inc. RNA interference mediated inhibition of platelet-derived endothelial cell growth factor (ECGF1) gene expression using short interfering nucleic acid (siNA)
US20050164968A1 (en) * 2001-05-18 2005-07-28 Sirna Therapeutics, Inc. RNA interference mediated inhibition of ADAM33 gene expression using short interfering nucleic acid (siNA)
US20050164224A1 (en) * 2001-05-18 2005-07-28 Sirna Therapeutics, Inc. RNA interference mediated inhibition of cyclin D1 gene expression using short interfering nucleic acid (siNA)
US20050171040A1 (en) * 2001-05-18 2005-08-04 Sirna Therapeutics, Inc. RNA interference mediated inhibition of cholesteryl ester transfer protein (CEPT) gene expression using short interfering nucleic acid (siNA)
US20050176025A1 (en) * 2001-05-18 2005-08-11 Sirna Therapeutics, Inc. RNA interference mediated inhibition of B-cell CLL/Lymphoma-2 (BCL-2) gene expression using short interfering nucleic acid (siNA)
US20050176663A1 (en) * 2001-05-18 2005-08-11 Sima Therapeutics, Inc. RNA interference mediated inhibition of protein tyrosine phosphatase type IVA (PRL3) gene expression using short interfering nucleic acid (siNA)
US20050176666A1 (en) * 2001-05-18 2005-08-11 Sirna Therapeutics, Inc. RNA interference mediated inhibition of GPRA and AAA1 gene expression using short interfering nucleic acid (siNA)
US20050176018A1 (en) * 1998-04-20 2005-08-11 Sirna Therapeutics, Inc. Chemically modified double stranded nucleic acid molecules
US20050181385A1 (en) * 2003-09-22 2005-08-18 Linsley Peter S. Synthetic lethal screen using RNA interference
US20050182007A1 (en) * 2001-05-18 2005-08-18 Sirna Therapeutics, Inc. RNA interference mediated inhibition of interleukin and interleukin receptor gene expression using short interfering nucleic acid (SINA)
US20050181382A1 (en) * 2003-06-02 2005-08-18 University Of Massachusetts Methods and compositions for enhancing the efficacy and specificity of RNAi
US20050187174A1 (en) * 2001-05-18 2005-08-25 Sirna Therapeutics, Inc. RNA interference mediated inhibition of intercellular adhesion molecule (ICAM) gene expression using short interfering nucleic acid (siNA)
US20050188438A1 (en) * 2004-02-24 2005-08-25 Basf Plant Science Gmbh Compositions and methods using rna interference for control of nematodes
US20050186586A1 (en) * 2003-06-02 2005-08-25 University Of Massachusetts Methods and compositions for enhancing the efficacy and specificity of RNAi
US20050191618A1 (en) * 2001-05-18 2005-09-01 Sirna Therapeutics, Inc. RNA interference mediated inhibition of human immunodeficiency virus (HIV) gene expression using short interfering nucleic acid (siNA)
US20050196767A1 (en) * 2001-05-18 2005-09-08 Sirna Therapeutics, Inc. RNA interference mediated inhibition of GRB2 associated binding protein (GAB2) gene expression using short interfering nucleic acis (siNA)
US20050196781A1 (en) * 2001-05-18 2005-09-08 Sirna Therapeutics, Inc. RNA interference mediated inhibition of STAT3 gene expression using short interfering nucleic acid (siNA)
US20050203040A1 (en) * 2001-05-18 2005-09-15 Sirna Therapeutics, Inc. RNA interference mediated inhibition of vascular cell adhesion molecule (VCAM) gene expression using short interfering nucleic acid (siNA)
US20050209180A1 (en) * 2001-05-18 2005-09-22 Sirna Therapeutics, Inc. RNA interference mediated inhibition of hepatitis C virus (HCV) expression using short interfering nucleic acid (siNA)
US20050209182A1 (en) * 2002-02-20 2005-09-22 Sirna Therapeutics, Inc. Nucleic acid mediated inhibition of enterococcus infection and cytolysin toxin activity
US20050222399A1 (en) * 2003-05-07 2005-10-06 Rosetta Genomics Bioinformatically detectable group of novel regulatory oligonucleotides associated with alzheimer's disease and uses thereof
US20050222061A1 (en) * 2002-04-18 2005-10-06 Schulte Ralf W Means and methods for the specific inhibition of genes in cells and tissue of the cns and/or eye
US20050222066A1 (en) * 2001-05-18 2005-10-06 Sirna Therapeutics, Inc. RNA interference mediated inhibition of vascular endothelial growth factor and vascular endothelial growth factor receptor gene expression using short interfering nucleic acid (siNA)
US20050221326A1 (en) * 2002-06-12 2005-10-06 Avi Orr-Urtreger Oligonucleotides antibodies and kits including same for treating prostate cancer and determining predisposition thereto
US20050233998A1 (en) * 2001-05-18 2005-10-20 Sirna Therapeutics, Inc. RNA interference mediated inhibition of vascular endothelial growth factor and vascular endothelial growth factor receptor gene expression using short interfering nucleic acid (siNA)
US20050233344A1 (en) * 2001-05-18 2005-10-20 Sirna Therapeutics, Inc. RNA interference mediated inhibition of platelet derived growth factor (PDGF) and platelet derived growth factor receptor (PDGFR) gene expression using short interfering nucleic acid (siNA)
US20050239739A1 (en) * 2001-05-18 2005-10-27 Sirna Therapeutics, Inc. Conjugates and compositions for cellular delivery
US20050246794A1 (en) * 2002-11-14 2005-11-03 Dharmacon Inc. Functional and hyperfunctional siRNA
US20050251877A1 (en) * 1999-08-13 2005-11-10 Commonwealth Scientific And Industrial Research Organization (Csiro) Methods and means for obtaining modified phenotypes
US20050255086A1 (en) * 2002-08-05 2005-11-17 Davidson Beverly L Nucleic acid silencing of Huntington's Disease gene
US20050256069A1 (en) * 2003-04-17 2005-11-17 Muthiah Manoharan IRNA agents with biocleavable tethers
US20050261219A1 (en) * 2001-05-18 2005-11-24 Sirna Therapeutics, Inc. RNA interference mediated inhibition of interleukin and interleukin receptor gene expression using short interfering nucleic acid (siNA)
US20050267058A1 (en) * 2001-05-18 2005-12-01 Sirna Therapeutics, Inc. RNA interference mediated inhibition of placental growth factor gene expression using short interfering nucleic acid (sINA)
US20050267300A1 (en) * 2004-04-05 2005-12-01 Muthiah Manoharan Processes and reagents for oligonucleotide synthesis and purification
US20050273868A1 (en) * 2004-02-17 2005-12-08 University Of Massachusetts Methods and compositions for enhancing RISC activity in vitro and in vivo
US20050277610A1 (en) * 2004-03-15 2005-12-15 City Of Hope Methods and compositions for the specific inhibition of gene expression by double-stranded RNA
US20050282188A1 (en) * 2001-05-18 2005-12-22 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using short interfering nucleic acid (siNA)
US20050287128A1 (en) * 2001-05-18 2005-12-29 Sirna Therapeutics, Inc. RNA interference mediated inhibition of TGF-beta and TGF-beta receptor gene expression using short interfering nucleic acid (siNA)
US20050288244A1 (en) * 2004-04-30 2005-12-29 Alnylam Pharmaceuticals, Inc. Oligonucleotides comprising a C5-modified pyrimidine
US20050288242A1 (en) * 2001-05-18 2005-12-29 Sirna Therapeutics, Inc. RNA interference mediated inhibition of RAS gene expression using short interfering nucleic acid (siNA)
US20060009402A1 (en) * 2001-07-12 2006-01-12 Zamore Phillip D In vivo production of small interfering rnas that mediate gene silencing
US20060014715A1 (en) * 1998-03-20 2006-01-19 Benitec Australia Limited Control of gene expression
US20060037101A1 (en) * 2004-08-13 2006-02-16 Basf Plant Science Gmbh Compositions and methods using rna interference for control of nematodes
US20060063181A1 (en) * 2004-08-13 2006-03-23 Green Pamela J Method for identification and quantification of short or small RNA molecules
US20060069050A1 (en) * 2004-02-17 2006-03-30 University Of Massachusetts Methods and compositions for mediating gene silencing
US20060073500A1 (en) * 2004-08-31 2006-04-06 Eppendorf Ag Methods and compositions for RNA amplification and detection using an RNA-dependent RNA-polymerase
US20060073127A1 (en) * 2004-07-09 2006-04-06 Umass Medical School Therapeutic alteration of transplantable tissues through in situ or ex vivo exposure to RNA interference molecules
US20060084620A1 (en) * 2004-07-09 2006-04-20 Mccray Paul B RNA interference in respiratory epitheial cells
US20060084621A1 (en) * 2001-01-09 2006-04-20 Hans-Peter Vornlocher Compositions and methods for inhibiting expression of anti-apoptotic genes
US20060122141A1 (en) * 2002-01-17 2006-06-08 The University Of British Columbia Treatment of cancer by inhibition of IGFBP's and clusterin
US20060128650A1 (en) * 2002-11-04 2006-06-15 University Of Massachusetts Allele-specific RNA interference
US20060130176A1 (en) * 2004-10-12 2006-06-15 The Rockefeller University MicroRNAs
US7064337B2 (en) 2002-11-19 2006-06-20 The Regents Of The University Of California Radiation detection system for portable gamma-ray spectroscopy
US20060135456A1 (en) * 2000-03-16 2006-06-22 Hannon Gregory J Methods and compositions for RNA interference
US20060134787A1 (en) * 2004-12-22 2006-06-22 University Of Massachusetts Methods and compositions for enhancing the efficacy and specificity of single and double blunt-ended siRNA
US20060142225A1 (en) * 2001-05-18 2006-06-29 Sirna Therapeutics, Inc. RNA interference mediated inhibition of cyclin dependent kinase-2 (CDK2) gene expression using short interfering nucleic acid (siNA)
US20060142228A1 (en) * 2004-12-23 2006-06-29 Ambion, Inc. Methods and compositions concerning siRNA's as mediators of RNA interference
US20060142557A1 (en) * 1994-03-29 2006-06-29 Sirna Therapeutics, Inc. 2'-deoxy-2'alkylnucleotide containing nucleic acid
US20060160110A1 (en) * 2004-12-02 2006-07-20 Takayuki Mizutani Methods of designing small interfering RNAs, antisense polynucleotides, and other hybridizing polynucleotides
US20060166919A1 (en) * 2004-12-23 2006-07-27 Alcon, Inc. RNAi inhibition of CTGF for treatment of ocular disorders
US20060172965A1 (en) * 2005-02-01 2006-08-03 Alcon, Inc. RNAi-mediated inhibition of ocular targets
US20060172961A1 (en) * 2004-12-23 2006-08-03 Alcon, Inc. RNAi inhibition of serum amyloid a for treatment of glaucoma
US20060173026A1 (en) * 2005-02-02 2006-08-03 Bradbury Barton J 8-N-substituted-2H-isothiazolo[5,4-b]quinolizine-3,4-diones and related compounds as antiinfective agents
US20060172925A1 (en) * 1998-10-26 2006-08-03 Board Of Regents, The University Of Texas System Thio-siRNA aptamers
WO2006091233A2 (en) * 2004-07-23 2006-08-31 Boston Medical Center Corporation Cellular delivery of reagents that inhibit gene expression utilizing the anthrax toxin protective antigen (pa)
US20060211647A1 (en) * 2003-10-24 2006-09-21 Gencia Corporation Nonviral vectors for delivering polynucleotides
US20060211642A1 (en) * 2001-05-18 2006-09-21 Sirna Therapeutics, Inc. RNA inteference mediated inhibition of hepatitis C virus (HVC) gene expression using short interfering nucleic acid (siNA)
US20060216747A1 (en) * 2001-05-18 2006-09-28 Sirna Therapeutics, Inc. RNA interference mediated inhibition of checkpoint kinase-1 (CHK-1) gene expression using short interfering nucleic acid (siNA)
US20060217331A1 (en) * 2001-05-18 2006-09-28 Sirna Therapeutics, Inc. Chemically modified double stranded nucleic acid molecules that mediate RNA interference
US20060223773A1 (en) * 2005-03-11 2006-10-05 Alcon, Inc. RNAi-mediated inhibition of Frizzled Related Protein-1 for treatment of glaucoma
US20060223990A1 (en) * 1992-05-11 2006-10-05 Sirna Therapeutics, Inc. Synthesis, deprotection, analysis & purification of RNA & ribozymes
US20060241075A1 (en) * 2001-05-18 2006-10-26 Sirna Therapeutics, Inc. RNA interference mediated inhibition of desmoglein gene expression using short interfering nucleic acid (siNA)
US20060270623A1 (en) * 2001-05-18 2006-11-30 Sirna Therapeutics, Inc. RNA interference mediated treatment of polyglutamine (polyQ) repeat expansion diseases using short interfering nucleic acid (siNA)
US20060276635A1 (en) * 2002-09-05 2006-12-07 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US20060287260A1 (en) * 2004-06-30 2006-12-21 Alnylam Pharmaceuticals, Inc. Oligonucleotides comprising a non-phosphate backbone linkage
US20060294604A1 (en) * 2003-02-17 2006-12-28 Fridman Jordan S Model for studying the role of genes in tumor resistance to chemotherapy
US20070003963A1 (en) * 2000-03-30 2007-01-04 Whitehead Institute For Biomedical Research RNA sequence-specific mediators of RNA interference
US20070003575A1 (en) * 2004-05-26 2007-01-04 Itzhak Bentwich Viral and viral associated MiRNAs and uses thereof
US20070014795A1 (en) * 2004-12-30 2007-01-18 Dhodapkar Madhav V Compositions and methods for enhanced dendritic cell maturation and function
US20070042380A1 (en) * 2003-08-13 2007-02-22 Rosetta Genomics Bioinformatically detectable group of novel regulatory oligonucleotides and uses thereof
WO2007026958A1 (en) 2005-09-01 2007-03-08 Suntory Limited Tryptophan transporter gene and use thereof
US20070083943A1 (en) * 2003-10-31 2007-04-12 Hannah L C Materials and methods for improved sweet corn
US20070093437A1 (en) * 2001-05-18 2007-04-26 Sirna Therapeutics, Inc. Rna interference mediated inhibition of xiap gene expression using short interfering nucleic acid (sina)
US20070105803A1 (en) * 2005-08-18 2007-05-10 Muthiah Manoharan Methods and compositions for treating neurological disease
US20070104688A1 (en) * 2003-02-13 2007-05-10 City Of Hope Small interfering RNA mediated transcriptional gene silencing in mammalian cells
US20070111227A1 (en) * 2005-07-28 2007-05-17 Green Pamela J Small regulatory RNAs and methods of use
US20070134697A1 (en) * 2002-11-14 2007-06-14 Dharmacon, Inc. siRNA targeting TIE-2
WO2007066595A1 (en) 2005-12-05 2007-06-14 Suntory Limited Process for production of ceramide using transformed yeast
US20070141601A1 (en) * 2004-05-12 2007-06-21 Dharmacon, Inc. siRNA targeting cAMP-specific phosphodiesterase 4D
US20070149468A1 (en) * 2003-05-16 2007-06-28 Jackson Aimee L Methods and compositions for rna interference
US20070160980A1 (en) * 2001-05-18 2007-07-12 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using short interfering nucleic acid (siNA)
US20070161004A1 (en) * 2004-05-28 2007-07-12 David Brown Methods and compositions involving microRNA
WO2007081720A2 (en) 2006-01-05 2007-07-19 The Ohio State University Research Foundation Microrna-based methods and compositions for the diagnosis, prognosis and treatment of lung cancer
WO2007081740A2 (en) 2006-01-05 2007-07-19 The Ohio State University Research Foundation Micrornarna-based methods and compositions for the diagnosis and treatment of solid cancers
WO2007084631A2 (en) 2006-01-20 2007-07-26 Cell Signaling Technology, Inc. Translocation and mutant ros kinase in human non-small cell lung carcinoma
US7250496B2 (en) 2002-11-14 2007-07-31 Rosetta Genomics Ltd. Bioinformatically detectable group of novel regulatory genes and uses thereof
US20070178068A1 (en) * 2005-12-22 2007-08-02 Reich Samuel J Compositions and methods for regulating complement system
US20070196334A1 (en) * 2003-06-25 2007-08-23 Shaharyar Khan Modified vectors for organelle transfection
WO2007097113A1 (en) 2006-02-24 2007-08-30 Suntory Limited Gene encoding protein responsible for flocculation property of yeast and use thereof
WO2007097097A1 (en) 2006-02-24 2007-08-30 Suntory Limited Ammonia transporter gene and use thereof
US20070203333A1 (en) * 2001-11-30 2007-08-30 Mcswiggen James RNA interference mediated inhibition of vascular endothelial growth factor and vascular endothelial growth factor receptor gene expression using short interfering nucleic acid (siNA)
WO2007099694A1 (en) 2006-02-24 2007-09-07 Suntory Limited Gene encoding protein responsible for flocculation property of yeast and use thereof
WO2007103808A2 (en) 2006-03-02 2007-09-13 The Ohio State University Microrna expression profile associated with pancreatic cancer
US20070219148A1 (en) * 2003-07-02 2007-09-20 Commissariat A L'energie Atomique Small Interfering RNA Specific to Sub-Units $g(a),$g(a)' and $g(b) of the Kinase Protein ck2,and the Applications of the Same
US20070219151A1 (en) * 1999-04-21 2007-09-20 Wyeth Methods and compositions for inhibiting the function of polynucleotide sequences
WO2007117038A1 (en) 2006-04-07 2007-10-18 Japanese Foundation For Cancer Research Prophylactic/therapeutic agent for cancer
US20070244311A1 (en) * 2002-11-14 2007-10-18 Dharmacon, Inc. siRNA targeting coatomer protein complex, subunit beta 2 (CPOB2)
US20070265220A1 (en) * 2004-03-15 2007-11-15 City Of Hope Methods and compositions for the specific inhibition of gene expression by double-stranded RNA
US20070270579A1 (en) * 2001-05-18 2007-11-22 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using short interfering nucleic acid (siNA)
US20070270360A1 (en) * 2003-04-15 2007-11-22 Sirna Therapeutics, Inc. Rna Interference Mediated Inhibition of Severe Acute Respiratory Syndrome (Sars) Gene Expression Using Short Interfering Nucleic Acid
US20070275376A1 (en) * 2003-08-28 2007-11-29 Joerg Heyer Tumor-Specific Expression of Reporter Genes
US20070275919A1 (en) * 2003-11-04 2007-11-29 Sergei Gryaznov Rna Amidates and Thioamidates for Rnai
US20080021205A1 (en) * 2003-12-11 2008-01-24 Helen Blau Methods and Compositions for Use in Preparing Hairpin Rnas
US20080039414A1 (en) * 2002-02-20 2008-02-14 Sima Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US20080070854A1 (en) * 2003-06-12 2008-03-20 Nucleonics, Inc. Conserved Hbv and Hcv Sequences Useful for Gene Silencing
WO2008032876A1 (en) 2006-09-15 2008-03-20 Tokai University Preventive or remedy for er-negative and her2-negative breast cancer and method of screening the same
US20080108801A1 (en) * 2003-04-17 2008-05-08 Muthiah Manoharan Lipophilic Conjugated iRNA Agents
WO2008063933A2 (en) 2006-11-10 2008-05-29 Massachusetts Institute Of Technology Pak modulators
US20080132462A1 (en) * 2002-03-01 2008-06-05 Frackelton A Raymond SHC proteins as therapeutic targets in proliferative diseases
US20080152654A1 (en) * 2006-06-12 2008-06-26 Exegenics, Inc., D/B/A Opko Health, Inc. COMPOSITIONS AND METHODS FOR siRNA INHIBITION OF ANGIOGENESIS
US20080161256A1 (en) * 2001-05-18 2008-07-03 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using short interfering nucleic acid (siNA)
US20080171715A1 (en) * 2004-11-12 2008-07-17 David Brown Methods and compositions involving mirna and mirna inhibitor molecules
US20080176812A1 (en) * 2002-08-05 2008-07-24 Davidson Beverly L Allele-specific silencing of disease genes
US20080177051A1 (en) * 2002-11-14 2008-07-24 Dharmacon, Inc. siRNA targeting cyclin-dependent kinase inhibitor 1B (p27, Kip1) (CDKN1B)
US20080188430A1 (en) * 2001-05-18 2008-08-07 Sirna Therapeutics, Inc. RNA interference mediated inhibition of hypoxia inducible factor 1 (HIF1) gene expression using short interfering nucleic acid (siNA)
US20080213377A1 (en) * 2006-12-08 2008-09-04 Bhatia Sangeeta N Delivery of Nanoparticles and/or Agents to Cells
US20080222750A1 (en) * 2003-10-24 2008-09-11 Gencia Corporation Nonviral vectors for delivering polynucleotides to plants
US20080227967A1 (en) * 2002-11-14 2008-09-18 Dharmacon, Inc. siRNA targeting ribonucleotide reductase M2 polypeptide (RRM2 or RNR-R2)
US20080242622A1 (en) * 2007-03-19 2008-10-02 Cold Spring Harbor Laboratory Identification of genetic alterations that modulate drug sensitivity in cancer treatments
WO2008120604A1 (en) 2007-03-30 2008-10-09 Suntory Holdings Limited Sphingolipid having endoplasmic reticulum localization signal attached thereto, and method for production of ceramide in transformed cell using δ4-desaturase
US20080262408A1 (en) * 2005-03-11 2008-10-23 Martin Krauss Multi-Constituent Packaging with Applicator
US20080268457A1 (en) * 2002-11-14 2008-10-30 Dharmacon, Inc. siRNA targeting forkhead box P3 (FOXP3)
US20080274996A1 (en) * 2002-08-21 2008-11-06 The University Of British Columbia RNAi Probes Targeting Cancer-Related Proteins
US20080274989A1 (en) * 2002-08-05 2008-11-06 University Of Iowa Research Foundation Rna Interference Suppression of Neurodegenerative Diseases and Methods of Use Thereof
US20080299590A1 (en) * 2005-11-11 2008-12-04 Roger Williams Hospital SHC protein-related methods and compositions
US20080313773A1 (en) * 2007-05-14 2008-12-18 The Rockefeller University Production of artificial micrornas using synthetic microrna precursors
US20080319180A1 (en) * 2002-11-14 2008-12-25 Dharmacon, Inc. siRNA targeting protein kinase N-3 (PKN-3)
US20090004207A1 (en) * 2007-06-08 2009-01-01 Timothy Tun Hla Methods and Compositions for Inhibiting Pathological Angiogenesis in the Eye
US20090005332A1 (en) * 2004-12-30 2009-01-01 Hauser Todd M Compositions and Methods for Modulating Gene Expression Using Self-Protected Oligonucleotides
US20090010941A1 (en) * 2007-04-09 2009-01-08 University Of Massachusetts Methods for treating HIV
US20090029872A1 (en) * 2005-01-03 2009-01-29 Cold Spring Harbor Laboratory Orthotopic and genetically tractable non-human animal model for liver cancer and the uses thereof
US20090061487A1 (en) * 2006-09-08 2009-03-05 Samuel Jotham Reich Sirna and methods of manufacture
US20090082298A1 (en) * 2005-05-31 2009-03-26 Cold Spring Harbor Laboratory Methods for producing microRNAs
US7517864B2 (en) 2001-05-18 2009-04-14 Sirna Therapeutics, Inc. RNA interference mediated inhibition of vascular endothelial growth factor and vascular endothelial growth factor receptor gene expression using short interfering nucleic acid (siNA)
WO2009049129A1 (en) 2007-10-11 2009-04-16 The Ohio State University Research Foundation Methods and compositions for the diagnosis and treatment of esphageal adenocarcinomas
US7521534B1 (en) 2003-03-03 2009-04-21 The University Board Of Regents Of Texas System IKK gamma gene products and methods for making and using same
US7521431B2 (en) 2002-11-01 2009-04-21 The Trustees Of The University Of Pennsylvania Compositions and methods for siRNA inhibition of HIF-1 alpha
EP2050763A2 (en) 2005-03-10 2009-04-22 Genentech, Inc. Methods and compositions for modulating vascular integrity
US20090104260A1 (en) * 2003-01-16 2009-04-23 The Trustees Of The University Of Pennsylvania Compositions and methods for sirna inhibition of icam-1
US20090118214A1 (en) * 2007-11-07 2009-05-07 Beeologics, Llc Compositions for conferring tolerance to viral disease in social insects, and the use thereof
US20090118489A1 (en) * 2002-11-14 2009-05-07 Dharmacon, Inc. siRNA targeting nucleoporin 62kDa (Nup62)
US20090118206A1 (en) * 2003-09-12 2009-05-07 University Of Massachusetts Rna interference for the treatment of gain-of-function disorders
US20090123468A1 (en) * 2003-10-24 2009-05-14 Gencia Corporation Transducible polypeptides for modifying metabolism
US20090137512A1 (en) * 2002-02-20 2009-05-28 Sirna Therapeutics, Inc. RNA Interference Mediated Inhibition of Cyclin D1 Gene Expression Using Short Interfering Nucleic Acid (siNA)
US20090137500A1 (en) * 2002-02-20 2009-05-28 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US20090163435A1 (en) * 2006-09-19 2009-06-25 Bader Andreas G miR-200 REGULATED GENES AND PATHWAYS AS TARGETS FOR THERAPEUTIC INTERVENTION
US20090177267A1 (en) * 2007-11-15 2009-07-09 David Paul Biggs Medical devices and methods for local delivery of angiotensin II type 2 receptor antagonists
US20090176725A1 (en) * 2005-08-17 2009-07-09 Sirna Therapeutics Inc. Chemically modified short interfering nucleic acid molecules that mediate rna interference
US20090175871A1 (en) * 2005-11-25 2009-07-09 Institut National De La Sante Et De La Recherche Medicale (Inserm) Method for demonstrating presence or absence of markers associated with the presence and/or the chemosensitivity of tumors
US20090186839A1 (en) * 2003-02-17 2009-07-23 Cold Spring Harbor Laboratory Model for studying the role of genes in chemoresistance
US20090186348A1 (en) * 2007-09-14 2009-07-23 Asuragen, Inc. Micrornas differentially expressed in cervical cancer and uses thereof
US20090203055A1 (en) * 2005-04-18 2009-08-13 Massachusetts Institute Of Technology Compositions and methods for RNA interference with sialidase expression and uses thereof
US7579451B2 (en) 2004-07-21 2009-08-25 Alnylam Pharmaceuticals, Inc. Oligonucleotides comprising a modified or non-natural nucleobase
US20090217404A1 (en) * 2002-09-27 2009-08-27 Lowe Scott W Cell-based RNA interference and related methods and compositions
US20090221674A1 (en) * 2005-12-08 2009-09-03 Ganymed Pharmaceuticals Ag Compositions and methods for therapy and diagnosis of cancer
US20090227780A1 (en) * 2002-11-14 2009-09-10 Dharmacon, Inc. siRNA targeting connexin 43
US20090233297A1 (en) * 2008-03-06 2009-09-17 Elizabeth Mambo Microrna markers for recurrence of colorectal cancer
US20090239814A1 (en) * 2007-12-04 2009-09-24 Alnylam Pharmaceuticals, Inc. Carbohydrate Conjugates as Delivery Agents for Oligonucleotides
US20090247614A1 (en) * 2007-12-04 2009-10-01 Alnylam Pharmaceuticals, Inc. Folate Conjugates
EP2108701A1 (en) 2008-04-10 2009-10-14 Ganymed Pharmaceuticals AG Methods involving MS4A12 and agents targeting MS4A12 for therapy, diagnosis and testing
US20090258928A1 (en) * 2008-04-08 2009-10-15 Asuragen, Inc. Methods and compositions for diagnosing and modulating human papillomavirus (hpv)
US20090270479A1 (en) * 2005-07-12 2009-10-29 Antonio Giordano Genetic and Epigenetic Alterations In the Diagnosis and Treatment of Cancer
US20090281167A1 (en) * 2008-05-08 2009-11-12 Jikui Shen Compositions and methods related to mirna modulation of neovascularization or angiogenesis
US7626014B2 (en) 2004-04-27 2009-12-01 Alnylam Pharmaceuticals Single-stranded and double-stranded oligonucleotides comprising a 2-arylpropyl moiety
US20090299045A1 (en) * 2001-05-18 2009-12-03 Sirna Therapeutics, Inc. RNA Interference Mediated Inhibition Of Interleukin and Interleukin Gene Expression Using Short Interfering Nucleic Acid (siNA)
US20090304798A1 (en) * 2001-11-02 2009-12-10 Insert Therapeutics, Inc. Methods and compositions for therapeutic use of RNA interference
US20090306356A1 (en) * 2002-11-14 2009-12-10 Dharmacon,Inc. siRNA Targeting TNFalpha
US7632932B2 (en) 2004-08-04 2009-12-15 Alnylam Pharmaceuticals, Inc. Oligonucleotides comprising a ligand tethered to a modified or non-natural nucleobase
US20090317802A1 (en) * 2005-12-09 2009-12-24 Bhatia Sangeeta N Compositions and Methods to Monitor RNA Delivery to Cells
US20100022001A1 (en) * 2004-12-14 2010-01-28 Applied Biosystems, Llc Cationic Liposomes And Method of Use
US7655785B1 (en) 2002-11-14 2010-02-02 Rosetta Genomics Ltd. Bioinformatically detectable group of novel regulatory oligonucleotides and uses thereof
US20100068200A1 (en) * 2008-09-12 2010-03-18 The University Of Connecticut Methods and Compositions for Inhibiting Atherosclerosis and Vascular Inflammation
US20100075423A1 (en) * 2002-06-12 2010-03-25 Life Technologies Corporation Methods and compositions relating to polypeptides with rnase iii domains that mediate rna interference
US20100076056A1 (en) * 2003-04-17 2010-03-25 Alnylam Pharmaceuticals, Inc. MODIFIED iRNA AGENTS
US7687616B1 (en) 2004-05-14 2010-03-30 Rosetta Genomics Ltd Small molecules modulating activity of micro RNA oligonucleotides and micro RNA targets and uses thereof
US7696334B1 (en) 2002-12-05 2010-04-13 Rosetta Genomics, Ltd. Bioinformatically detectable human herpesvirus 5 regulatory gene
US7696342B1 (en) 2002-11-26 2010-04-13 Rosetta Genomics, Ltd. Bioinformatically detectable group of novel viral regulatory genes and uses thereof
US7709616B2 (en) 2004-05-14 2010-05-04 Rosetta Genomics Inc. Micrornas and uses thereof
US20100113307A1 (en) * 2002-11-14 2010-05-06 Dharmacon, Inc. siRNA targeting vascular endothelial growth factor (VEGF)
WO2010050584A1 (en) 2008-10-31 2010-05-06 独立行政法人科学技術振興機構 Method for selectively controlling function of helper t cell
US7723314B1 (en) * 2005-10-28 2010-05-25 Transderm, Inc. Methods and compositions for treating pachyonychia congenita
US20100144845A1 (en) * 2006-08-04 2010-06-10 Massachusetts Institute Of Technology Oligonucleotide systems for targeted intracellular delivery
US20100151470A1 (en) * 2007-05-01 2010-06-17 University Of Massachusetts Methods and compositions for locating snp heterozygosity for allele specific diagnosis and therapy
US20100151007A1 (en) * 2008-12-04 2010-06-17 Opko Ophthalmics, Llc Compositions and methods for selective inhibition of vegf
US7745418B2 (en) 2001-10-12 2010-06-29 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting viral replication
US20100167377A1 (en) * 1997-12-22 2010-07-01 Whitt Michael A Recombinant viruses comprising the membrane-proximal domain of VSV G protein
WO2010074540A2 (en) 2008-12-26 2010-07-01 주식회사 삼양사 Pharmaceutical composition containing an anionic drug, and a production method therefor
US7767802B2 (en) 2001-01-09 2010-08-03 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of anti-apoptotic genes
US20100196886A1 (en) * 2007-03-15 2010-08-05 University Of Cleveland Screening, diagnosing, treating and prognosis of pathophysiologic status by rna regulation
US20100197772A1 (en) * 2007-07-18 2010-08-05 Andrea Califano Tissue-Specific MicroRNAs and Compositions and Uses Thereof
WO2010093928A2 (en) 2009-02-12 2010-08-19 Cell Signaling Technology, Inc. Mutant ros expression in human cancer
US7781575B2 (en) 2002-11-14 2010-08-24 Dharmacon, Inc. siRNA targeting tumor protein 53 (p53)
EP2221063A1 (en) 2009-02-20 2010-08-25 Ganymed Pharmaceuticals AG Methods and compositions for diagnosis and treatment of cancer
EP2221375A1 (en) 2009-02-20 2010-08-25 Ganymed Pharmaceuticals AG Methods and compositions for diagnosis and treatment of cancer
WO2010094499A1 (en) 2009-02-20 2010-08-26 Ganymed Pharmaceuticals Ag Methods and compositions for diagnosis and treatment of cancer
US20100227912A1 (en) * 2002-02-20 2010-09-09 Mcswiggen James RNA INTERFERENCE MEDIATED INHIBITION OF MYOSTATIN GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
WO2010100404A2 (en) 2009-03-02 2010-09-10 Mina Therapeutics Limited Rna molecules and therapeutic uses thereof
EP2249159A1 (en) 2009-04-29 2010-11-10 Ganymed Pharmaceuticals AG Identification of tumor-associated markers for diagnosis and therapy
US7858769B2 (en) 2004-02-10 2010-12-28 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using multifunctional short interfering nucleic acid (multifunctional siNA)
EP2267117A2 (en) 2002-06-27 2010-12-29 Verva Pharmaceuticals Pty Ltd Differentiation modulating agents and uses therefor
US20110002881A1 (en) * 2007-12-10 2011-01-06 Mater Medical Research Institute Treatment and prophylaxis
EP2292739A1 (en) 2006-03-24 2011-03-09 Institut National De La Recherche Agronomique Method for preparing differentiated avian cells and genes involved in the maintenance of pluripotency
EP2295604A2 (en) 2004-02-09 2011-03-16 Thomas Jefferson University Diagnosis and treatment of cancers with microRNA located in or near cancer-associated chromosomal features
WO2011035065A1 (en) 2009-09-17 2011-03-24 Nektar Therapeutics Monoconjugated chitosans as delivery agents for small interfering nucleic acids
US20110104147A1 (en) * 2007-10-23 2011-05-05 Ugur Sahin Identification of Tumor-Associated Markers for Diagnosis and Therapy
US20110110483A1 (en) * 2009-11-06 2011-05-12 Searete Llc, A Limited Liability Corporation Of The State Of Delaware Methods and systems for migrating fuel assemblies in a nuclear fission reactor
US20110123520A1 (en) * 2008-04-11 2011-05-26 Alnylam Pharmaceuticals, Inc. Site-specific delivery of nucleic acids by combining targeting ligands with endosomolytic components
US20110124108A1 (en) * 2009-05-15 2011-05-26 Boehringer Ingelheim International Gmbh Epigenetic engineering
US7951935B2 (en) 2002-11-14 2011-05-31 Dharmacon, Inc. siRNA targeting v-myc myelocytomatosis viral oncogene homolog (MYC)
WO2011065389A1 (en) 2009-11-27 2011-06-03 独立行政法人科学技術振興機構 Method for screening of therapeutic agent for hyperlipemia
US20110142915A1 (en) * 2009-12-04 2011-06-16 Opko Ophthalmics, Llc Compositions and methods for inhibition of vegf
WO2011081415A2 (en) 2009-12-31 2011-07-07 주식회사 삼양사 Sirna for inhibiting c-met expression and an anti-cancer composition comprising the same
US20110172291A1 (en) * 2003-09-12 2011-07-14 University Of Massachusetts Rna interference for the treatment of gain-of-function disorders
US20110213013A1 (en) * 2008-08-19 2011-09-01 Nektar Therapeutics Complexes of Small-Interfering Nucleic Acids
EP2369011A1 (en) 2006-03-20 2011-09-28 The Ohio State University Research Foundation Microrna fingerprints during human megakaryocytopoiesis
EP2369017A1 (en) 2006-07-13 2011-09-28 The Ohio State University Research Foundation Micro-RNA-based methods and compositions for the diagnosis and treatment of colon related diseases
EP2371835A1 (en) 2003-07-03 2011-10-05 The Trustees Of The University Of Pennsylvania Inhibition of syk kinase expression
US8071562B2 (en) 2007-12-01 2011-12-06 Mirna Therapeutics, Inc. MiR-124 regulated genes and pathways as targets for therapeutic intervention
WO2012006552A1 (en) 2010-07-09 2012-01-12 Exelixis, Inc. Combinations of kinase inhibitors for the treatment of cancer
WO2012019132A2 (en) 2010-08-06 2012-02-09 Cell Signaling Technology, Inc. Anaplastic lymphoma kinase in kidney cancer
US20120035240A1 (en) * 2003-06-12 2012-02-09 Alnylam Pharmaceuticals, Inc. Conserved hbv and hcv sequences useful for gene silencing
US8133733B2 (en) 2003-10-24 2012-03-13 Gencia Corporation Nonviral vectors for delivering polynucleotides to target tissues
EP2433955A2 (en) 2005-09-12 2012-03-28 Ganymed Pharmaceuticals AG Identification of tumor-associated antigens for diagnosis and therapy
US20120077750A1 (en) * 2006-03-16 2012-03-29 Jukka Westermarck Use of a growth-stimulating protein
WO2012046065A2 (en) 2010-10-06 2012-04-12 Omnicyte Limited Culture method
WO2012046085A2 (en) 2010-10-08 2012-04-12 Mina Therapeutics Limited Methods of inducing insulin production
US8158677B2 (en) 2007-06-01 2012-04-17 The Trustees Of Princeton University Treatment of viral infections by modulation of host cell metabolic pathways
US8163896B1 (en) 2002-11-14 2012-04-24 Rosetta Genomics Ltd. Bioinformatically detectable group of novel regulatory genes and uses thereof
EP2447360A1 (en) 2006-04-14 2012-05-02 Cell Signaling Technology, Inc. Gene defects and mutant ALK kinase in human solid tumors
WO2012057363A1 (en) 2010-10-27 2012-05-03 学校法人自治医科大学 Adeno-associated virus virions for transferring genes into neural cells
US20120129910A1 (en) * 2003-03-05 2012-05-24 Senesco Technologies Inc. Inhibition of Apoptosis-Specific eIF-5A(elF-5A1") with Antisense Oligonucleotides and siRNA as Anti-Inflammatory Therapeutics
US8193334B2 (en) 2007-04-04 2012-06-05 The Brigham And Women's Hospital Polymer-encapsulated reverse micelles
WO2012072096A1 (en) 2010-12-03 2012-06-07 Biontech Ag Method for cellular rna expression
US8198427B1 (en) * 2002-11-14 2012-06-12 Dharmacon, Inc. SiRNA targeting catenin, beta-1 (CTNNB1)
EP2474623A1 (en) 2006-10-12 2012-07-11 GANYMED Pharmaceuticals AG Compositions and methods for therapy and diagnosis of cancer and cancer metastasis
US8227434B1 (en) 2003-11-04 2012-07-24 H. Lee Moffitt Cancer Center & Research Institute, Inc. Materials and methods for treating oncological disorders
WO2012109495A1 (en) 2011-02-09 2012-08-16 Metabolic Solutions Development Company, Llc Cellular targets of thiazolidinediones
US8277812B2 (en) 2008-10-12 2012-10-02 Massachusetts Institute Of Technology Immunonanotherapeutics that provide IgG humoral response without T-cell antigen
WO2012162373A1 (en) 2011-05-23 2012-11-29 Cell Signaling Technology, Inc. Ros kinase in lung cancer
US8323698B2 (en) 2006-05-15 2012-12-04 Massachusetts Institute Of Technology Polymers for functional particles
WO2012164058A1 (en) 2011-06-01 2012-12-06 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods for adjusting expression of mitochondrial genome by microrna
US8343497B2 (en) 2008-10-12 2013-01-01 The Brigham And Women's Hospital, Inc. Targeting of antigen presenting cells with immunonanotherapeutics
US8343498B2 (en) 2008-10-12 2013-01-01 Massachusetts Institute Of Technology Adjuvant incorporation in immunonanotherapeutics
WO2013056217A1 (en) 2011-10-14 2013-04-18 The Ohio State University Methods and materials related to ovarian cancer
EP2586455A1 (en) 2006-01-05 2013-05-01 The Ohio State University Research Foundation MicroRNA expressions abnormalities in pancreatic endocrine and acinar tumors
WO2013060894A1 (en) 2011-10-27 2013-05-02 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods for the treatment and diagnosis of atherosclerosis
US8476243B2 (en) 2006-12-29 2013-07-02 Transderm, Inc. Methods and compositions for treating keratin hyperproliferative disorders
US8524681B2 (en) 2007-09-19 2013-09-03 Applied Biosystems, Llc siRNA sequence-independent modification formats for reducing off-target phenotypic effects in RNAi, and stabilized forms thereof
US8530436B2 (en) 2007-01-29 2013-09-10 Transderm, Inc. Methods and compositions for transdermal delivery of nucleotides
EP2644205A1 (en) 2007-04-12 2013-10-02 The Brigham and Women's Hospital, Inc. Targeting ABCB5 for cancer therapy
EP2650383A1 (en) 2007-08-03 2013-10-16 The Ohio State University Research Foundation Ultraconserved regions encoding ncRNAs
WO2013153139A1 (en) 2012-04-11 2013-10-17 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods for the treatment and diagnosis of acute leukemia
WO2013153082A1 (en) 2012-04-10 2013-10-17 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods for the treatment of nonalcoholic steatohepatitis
US8591905B2 (en) 2008-10-12 2013-11-26 The Brigham And Women's Hospital, Inc. Nicotine immunonanotherapeutics
WO2014018375A1 (en) 2012-07-23 2014-01-30 Xenon Pharmaceuticals Inc. Cyp8b1 and uses thereof in therapeutic and diagnostic methods
US8709483B2 (en) 2006-03-31 2014-04-29 Massachusetts Institute Of Technology System for targeted delivery of therapeutic agents
WO2014071963A1 (en) 2012-11-09 2014-05-15 Biontech Ag Method for cellular rna expression
WO2014072061A1 (en) 2012-11-09 2014-05-15 Biontech Ag Method for cellular rna expression
US8796436B2 (en) 2003-04-17 2014-08-05 Alnylam Pharmaceuticals, Inc. Modified iRNA agents
US8815821B2 (en) 2002-02-01 2014-08-26 Life Technologies Corporation Double-stranded oligonucleotides
US8822426B2 (en) 2009-05-05 2014-09-02 Beeologics Inc. Prevention and treatment of nosema disease in bees
EP2775001A1 (en) 2007-09-06 2014-09-10 The Ohio State University Research Foundation MicroRNA signatures in human ovarian cancer
EP2796554A2 (en) 2005-09-12 2014-10-29 The Ohio State University Research Foundation Compositions for use in treating BCL2-associated cancers
EP2806025A1 (en) 2002-09-05 2014-11-26 California Institute of Technology Use of zinc finger nucleases to stimulate gene targeting
EP2808398A1 (en) 2007-07-31 2014-12-03 The Ohio State University Research Foundation Methods for reverting methylation by targeting DNMT3A and DNMT3B
US20140371299A1 (en) * 2004-06-07 2014-12-18 Senesco Technologies, Inc. Use of Apoptosis-Specific elF-5A siRNA to Down Regulate Expression of Proinflammatory Cytokines to Treat Sepsis
US8962584B2 (en) 2009-10-14 2015-02-24 Yissum Research Development Company Of The Hebrew University Of Jerusalem, Ltd. Compositions for controlling Varroa mites in bees
US9051570B2 (en) 2007-05-22 2015-06-09 Arcturus Therapeutics, Inc. UNA oligomers for therapeutics
US9056076B2 (en) 2005-10-08 2015-06-16 Potentia Pharmaceuticals, Inc. Method of treating age-related macular degeneration comprising administering a compstatin analog
WO2015086828A1 (en) 2013-12-12 2015-06-18 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods for the prevention and treatment of diabetic cardiomyopathy using mir-424/322
US9066978B2 (en) 2010-05-26 2015-06-30 Selecta Biosciences, Inc. Dose selection of adjuvanted synthetic nanocarriers
US9074213B2 (en) 2001-01-09 2015-07-07 Alnylam Pharmacuticals, Inc. Compositions and methods for inhibiting expression of a target gene
US9181551B2 (en) 2002-02-20 2015-11-10 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US9200276B2 (en) 2009-06-01 2015-12-01 Halo-Bio Rnai Therapeutics, Inc. Polynucleotides for multivalent RNA interference, compositions and methods of use thereof
US9217129B2 (en) 2007-02-09 2015-12-22 Massachusetts Institute Of Technology Oscillating cell culture bioreactor
US9228186B2 (en) 2002-11-14 2016-01-05 Thermo Fisher Scientific Inc. Methods and compositions for selecting siRNA of improved functionality
EP2980220A1 (en) 2005-09-20 2016-02-03 BASF Plant Science GmbH Improved methods controlling gene expression
US9260471B2 (en) 2010-10-29 2016-02-16 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using short interfering nucleic acids (siNA)
US9267937B2 (en) 2005-12-15 2016-02-23 Massachusetts Institute Of Technology System for screening particles
US9321842B2 (en) 2011-05-13 2016-04-26 Ganymed Pharmaceuticals Ag Antibodies for treatment of cancer
WO2016062323A1 (en) 2014-10-20 2016-04-28 Biontech Ag Methods and compositions for diagnosis and treatment of cancer
US9333179B2 (en) 2007-04-04 2016-05-10 Massachusetts Institute Of Technology Amphiphilic compound assisted nanoparticles for targeted delivery
EP3028708A1 (en) 2007-08-22 2016-06-08 The Ohio State University Research Foundation Methods and compositions for inducing deregulation of epha7 and erk phosphorylation in human acute leukemias
US9381477B2 (en) 2006-06-23 2016-07-05 Massachusetts Institute Of Technology Microfluidic synthesis of organic nanoparticles
US9388243B2 (en) 2013-05-29 2016-07-12 Samsung Electronics Co., Ltd. Method of target membrane protein depletion
US20160264966A1 (en) * 2013-10-02 2016-09-15 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of the lect2 gene
EP3072963A1 (en) 2007-10-18 2016-09-28 Cell Signaling Technology, Inc. Translocation and mutant ros kinase in human non-small cell lung carcinoma
US9474717B2 (en) 2007-10-12 2016-10-25 Massachusetts Institute Of Technology Vaccine nanotechnology
US9487584B2 (en) 2009-11-11 2016-11-08 Ganymed Pharmaceuticals Ag Antibodies specific for claudin 6 (CLDN6)
US9492400B2 (en) 2004-11-04 2016-11-15 Massachusetts Institute Of Technology Coated controlled release polymer particles as efficient oral delivery vehicles for biopharmaceuticals
US9611478B2 (en) 2011-02-03 2017-04-04 Mirna Therapeutics, Inc. Synthetic mimics of miR-124
US9642872B2 (en) 2010-09-30 2017-05-09 University Of Zurich Treatment of B-cell lymphoma with microRNA
US9644241B2 (en) 2011-09-13 2017-05-09 Interpace Diagnostics, Llc Methods and compositions involving miR-135B for distinguishing pancreatic cancer from benign pancreatic disease
US9657294B2 (en) 2002-02-20 2017-05-23 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US9719092B2 (en) 2002-11-14 2017-08-01 Thermo Fisher Scientific Inc. RNAi targeting CNTD2
US9718886B2 (en) 2010-07-06 2017-08-01 Ganymed Pharmaceuticals Ag Cancer therapy using CLDN6 target-directed antibodies in vivo
US9719094B2 (en) 2002-11-14 2017-08-01 Thermo Fisher Scientific Inc. RNAi targeting SEC61G
US9771586B2 (en) 2002-11-14 2017-09-26 Thermo Fisher Scientific Inc. RNAi targeting ZNF205
WO2017182524A1 (en) 2016-04-22 2017-10-26 Biontech Rna Pharmaceuticals Gmbh Methods for providing single-stranded rna
US9839649B2 (en) 2002-11-14 2017-12-12 Thermo Fisher Scientific Inc. Methods and compositions for selecting siRNA of improved functionality
US9856475B2 (en) 2014-03-25 2018-01-02 Arcturus Therapeutics, Inc. Formulations for treating amyloidosis
US9879266B2 (en) 2002-11-14 2018-01-30 Thermo Fisher Scientific Inc. Methods and compositions for selecting siRNA of improved functionality

Families Citing this family (317)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9096636B2 (en) 1996-06-06 2015-08-04 Isis Pharmaceuticals, Inc. Chimeric oligomeric compounds and their use in gene modulation
US7812149B2 (en) 1996-06-06 2010-10-12 Isis Pharmaceuticals, Inc. 2′-Fluoro substituted oligomeric compounds and compositions for use in gene modulations
US5898031A (en) 1996-06-06 1999-04-27 Isis Pharmaceuticals, Inc. Oligoribonucleotides for cleaving RNA
US6987025B1 (en) 1999-02-11 2006-01-17 The Arizona Board Of Regents On Behalf Of The University Of Arizona Dwf4 polynucleotides, polypeptides and uses thereof
US7691991B2 (en) 2000-04-17 2010-04-06 Ceres, Inc. Sequence-determined DNA fragments encoding cytochrome P450 proteins
US7385046B2 (en) 2001-01-03 2008-06-10 Ceres, Inc. Sequence-determined DNA fragments encoding ethylene responsive element binding proteins
US7601494B2 (en) 1999-03-17 2009-10-13 The University Of North Carolina At Chapel Hill Method of screening candidate compounds for susceptibility to biliary excretion
DK2028278T3 (en) 2000-03-30 2014-06-23 Univ Massachusetts RNA sequence-specific mediators of RNA interference
US20020165192A1 (en) 2000-09-19 2002-11-07 Kerr William G. Control of NK cell function and survival by modulation of ship activity
EP1666595A1 (en) 2000-10-26 2006-06-07 Beth Israel Deaconess Medical Center, Inc. GAB2 (P97) gene and methods of use thereof
DE10230996A1 (en) * 2001-10-26 2003-07-17 Ribopharma Ag Method for inhibiting viral replication, useful particularly for treating hepatitis C infection, by altering the 3'-untranslated region of the virus
DE10160151A1 (en) * 2001-01-09 2003-06-26 Ribopharma Ag Inhibiting expression of target gene, useful e.g. for inhibiting oncogenes, by administering double-stranded RNA complementary to the target and having an overhang
CN1604783A (en) * 2001-10-26 2005-04-06 里伯药品公司 Drug for treating a fibrotic disease through rna interfence
WO2003035870A1 (en) * 2001-10-26 2003-05-01 Ribopharma Ag Drug for treating a carcinoma of the pancreas
JP2005506087A (en) * 2001-10-26 2005-03-03 リボファーマ アーゲー Use of double-stranded ribonucleic acid for treating an infection with positive stranded rna virus
US20040010130A1 (en) * 2001-02-22 2004-01-15 Motoya Katsuki Recombinant gene containing inverted repeat sequence and utilization thereof
JP2005517427A (en) 2002-02-20 2005-06-16 サーナ・セラピューティクス・インコーポレイテッドSirna Therapeutics,Inc. Inhibition RNA interference mediated short interfering nucleic acid (siNA) C hepatitis virus (HCV) gene expression using
WO2004111237A1 (en) * 2003-04-16 2004-12-23 Sirna Therapeutics, Inc. RNA INTERFERENCE MEDIATED INHIBITION OF PLATELET-DERIVED ENDOTHELIAL CELL GROWTH FACTOR (ECGF1) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
US20030175950A1 (en) * 2001-05-29 2003-09-18 Mcswiggen James A. RNA interference mediated inhibition of HIV gene expression using short interfering RNA
WO2003001877A3 (en) * 2001-06-26 2003-09-12 Daniel P Bednarik Methods for the diagnosis and treatment of cardiac tissue rejection
DK2280070T3 (en) * 2001-07-23 2015-08-24 Univ Leland Stanford Junior A method and compositions for use for the RNAi-mediated inhibition of gene expression in mammalian
DE60207601D1 (en) * 2001-11-05 2005-12-29 Janssen Pharmaceutica Nv Method for the in vitro synthesis of short dobbelsträngigen rnas
FR2832154B1 (en) 2001-11-09 2007-03-16 Centre Nat Rech Scient Oligonucleotide inhibitors and their use for specifically repress a gene
CA2468107A1 (en) * 2001-11-19 2003-05-30 Proteologics, Inc. Methods for identifying and validating potential drug targets
US7871619B2 (en) 2001-11-30 2011-01-18 Chemocentryx, Inc. Compositions and methods for detecting and treating diseases and conditions related to chemokine receptors
EP1432724A4 (en) 2002-02-20 2006-02-01 Sirna Therapeutics Inc Rna interference mediated inhibition of map kinase genes
US20030190635A1 (en) * 2002-02-20 2003-10-09 Mcswiggen James A. RNA interference mediated treatment of Alzheimer's disease using short interfering RNA
US7129267B2 (en) 2002-03-11 2006-10-31 Janssen Pharmaceutica N.V. Methods for SHP1 mediated neuroprotection
CA2479530A1 (en) * 2002-03-20 2003-10-02 Massachusetts Institute Of Technology Hiv therapeutic
US7357928B2 (en) 2002-04-08 2008-04-15 University Of Louisville Research Foundation, Inc. Method for the diagnosis and prognosis of malignant diseases
US7541150B2 (en) 2002-04-08 2009-06-02 University Of Louisville Research Foundation, Inc Method for the diagnosis and prognosis of malignant diseases
US20040180438A1 (en) 2002-04-26 2004-09-16 Pachuk Catherine J. Methods and compositions for silencing genes without inducing toxicity
US20040009946A1 (en) 2002-05-23 2004-01-15 Ceptyr, Inc. Modulation of PTP1B expression and signal transduction by RNA interference
WO2003099298A1 (en) * 2002-05-24 2003-12-04 Max-Planck Gesellschaft zur Förderung der Wissenschaften e.V. Rna interference mediating small rna molecules
WO2004001045A1 (en) * 2002-06-20 2003-12-31 Dsm Ip Assets B.V. Inhibition of nuclear receptors
EP2823809B1 (en) 2002-06-28 2016-11-02 Protiva Biotherapeutics Inc. Method and apparatus for producing liposomes
DE10229872A1 (en) * 2002-07-03 2004-01-29 Curevac Gmbh Immunostimulation by chemically modified RNA
CA2922031A1 (en) 2002-07-19 2004-01-29 Beth Israel Deaconess Medical Center, Inc. Methods of diagnosing and treating pre-eclampsia or eclampsia
US7435419B2 (en) 2002-07-19 2008-10-14 Beth Israel Deaconess Medical Center Methods of diagnosing and treating pre-eclampsia or eclampsia
US7399851B2 (en) 2002-07-25 2008-07-15 Dana Farber Cancer Institute, Inc. Composition and method for imaging cells
DK1527176T4 (en) * 2002-08-05 2017-07-03 Silence Therapeutics Gmbh Further new forms of interfering RNA molecules
KR20120029002A (en) * 2002-08-05 2012-03-23 사일런스 테라퓨틱스 아게 Further novel forms of interfeing rna molecules
ES2389024T3 (en) * 2002-08-05 2012-10-22 Silence Therapeutics Aktiengesellschaft Interfering RNA molecules blunting
EP1546173A4 (en) * 2002-08-06 2006-05-31 Intradigm Corp Methods of down regulating target gene expression in vivo by introduction of interfering rna
US20040029275A1 (en) * 2002-08-10 2004-02-12 David Brown Methods and compositions for reducing target gene expression using cocktails of siRNAs or constructs expressing siRNAs
EP1536827B1 (en) 2002-08-14 2009-01-07 Silence Therapeutics Aktiengesellschaft Use of protein kinase n beta
EP1393742A1 (en) 2002-08-14 2004-03-03 atugen AG Use of protein kinase N beta
US7655772B2 (en) 2002-09-06 2010-02-02 University Of South Florida Materials and methods for treatment of allergic diseases
US20080260744A1 (en) 2002-09-09 2008-10-23 Omeros Corporation G protein coupled receptors and uses thereof
US20040053289A1 (en) * 2002-09-09 2004-03-18 The Regents Of The University Of California Short interfering nucleic acid hybrids and methods thereof
CN1694959B (en) 2002-09-13 2013-09-18 雷普利瑟公司 Non-sequence complementary antiviral oligonucleotides
KR20050084607A (en) * 2002-09-28 2005-08-26 매사추세츠 인스티튜트 오브 테크놀로지 Influenza therapeutic
US9453251B2 (en) 2002-10-08 2016-09-27 Pfenex Inc. Expression of mammalian proteins in Pseudomonas fluorescens
WO2004032877A3 (en) 2002-10-10 2005-10-06 Wei Liu Compositions, organisms and methodologies employing a novel human kinase
EP1551868B1 (en) 2002-10-18 2009-01-07 Silence Therapeutics AG Factor involved in metastasis and uses thereof
EP1554385A2 (en) 2002-10-24 2005-07-20 Roger Ford Calcineurin-like human phoshphoesterase
WO2004039953A3 (en) * 2002-10-28 2005-02-10 Xeotron Corp Array oligomer synthesis and use.
EP1560839A4 (en) 2002-11-05 2008-04-23 Isis Pharmaceuticals Inc Chimeric oligomeric compounds and their use in gene modulation
US9150605B2 (en) 2002-11-05 2015-10-06 Isis Pharmaceuticals, Inc. Compositions comprising alternating 2′-modified nucleosides for use in gene modulation
EP2957568B1 (en) 2002-11-05 2016-12-21 Ionis Pharmaceuticals, Inc. Compositions comprising alternating 2'-modified nucleosides for use in gene modulation
EP1562971B1 (en) 2002-11-05 2014-02-12 Isis Pharmaceuticals, Inc. Polycyclic sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation
US9150606B2 (en) 2002-11-05 2015-10-06 Isis Pharmaceuticals, Inc. Compositions comprising alternating 2'-modified nucleosides for use in gene modulation
CN1498964A (en) * 2002-11-07 2004-05-26 本元正阳基因技术股份有限公司 Serial recombined gland related virus inducible path of RNAi, and utilized in gene therapy
CA2505416A1 (en) 2002-11-21 2004-06-10 Wyeth Methods for diagnosing rcc and other solid tumors
JP4526228B2 (en) * 2002-11-22 2010-08-18 隆 森田 Novel therapies and therapeutic agents according to the RNAi
EP2112229A3 (en) 2002-11-25 2009-12-02 Sequenom, Inc. Methods for identifying risk of breast cancer and treatments thereof
WO2004050831A3 (en) 2002-11-27 2006-09-14 Huimin Chen Compositions, organisms and methodologies employing a novel human kinase
JP4912873B2 (en) * 2003-04-09 2012-04-11 アルナイラム ファーマシューティカルズ, インコーポレイテッドAlnylam Pharmaceuticals, Inc. iRNA complex
EP1625138A4 (en) 2003-04-17 2010-06-23 Alnylam Pharmaceuticals Inc Protected monomers
CA2518475C (en) 2003-03-07 2014-12-23 Alnylam Pharmaceuticals, Inc. Irna agents comprising asymmetrical modifications
US20080249039A1 (en) * 2004-01-30 2008-10-09 Santaris Pharma A/S Modified Short Interfering Rna (Modified Sirna)
GB0306715D0 (en) * 2003-03-24 2003-04-30 Novartis Ag Organic compounds
CA2521464C (en) 2003-04-09 2013-02-05 Alnylam Pharmaceuticals, Inc. Irna conjugates
WO2004101756A3 (en) 2003-05-09 2005-06-09 Laura Corral Ovr110 antibody compositions and methods of use
KR20060013426A (en) 2003-05-30 2006-02-09 니뽄 신야쿠 가부시키가이샤 Oligo double-stranded rna inhibiting the expression of bcl-2 and medicinal composition containing the same
WO2005002507A3 (en) 2003-06-03 2006-04-13 Isis Pharmaceuticals Inc Modulation of survivin expression
US7671188B2 (en) 2003-06-06 2010-03-02 Arborgen Llc Cellulose synthase from pine and methods of use
ES2559828T3 (en) * 2003-07-16 2016-02-16 Protiva Biotherapeutics Inc. RNA interference lipid encapsulated
US7825235B2 (en) * 2003-08-18 2010-11-02 Isis Pharmaceuticals, Inc. Modulation of diacylglycerol acyltransferase 2 expression
EP1660657A1 (en) 2003-08-28 2006-05-31 Novartis AG Interfering rna duplex having blunt-ends and 3'-modifications
US20050282168A1 (en) * 2003-09-29 2005-12-22 Wyeth Cell surface molecules as markers and therapeutic agents against kidney cancers
DE10351149A1 (en) * 2003-11-03 2005-06-30 Beiersdorf Ag Oligoribonucleotides for the treatment of unwanted pigmentation of the skin and hair by RNA interference
US20050266561A1 (en) * 2003-11-21 2005-12-01 Revivicor, Inc. Use of interfering RNA in the production of transgenic animals
WO2005068630A8 (en) * 2003-12-16 2005-10-06 Nat Inst Of Advanced Ind Scien Double-stranded rna for interference
JP2007523636A (en) 2003-12-30 2007-08-23 アーバージェン リミテッド ライアビリティ カンパニー Cell cycle genes and associated methods used were
EP1742661A2 (en) * 2004-01-07 2007-01-17 Neopharm, Inc. Lipid compositions and use thereof
EP1706511A4 (en) 2004-01-23 2010-04-07 New England Biolabs Inc Compositions and methods for generating short double-stranded rna using mutated rnase iii
US20050197310A1 (en) * 2004-01-30 2005-09-08 Orna Mor Oligoribonucleotides and methods of use thereof for treatment of fibrotic conditions and other diseases
EP1747284A4 (en) 2004-02-06 2009-03-11 Wyeth Corp Diagnosis and therapeutics for cancer
US20060019914A1 (en) 2004-02-11 2006-01-26 University Of Tennessee Research Foundation Inhibition of tumor growth and invasion by anti-matrix metalloproteinase DNAzymes
WO2005079299A3 (en) * 2004-02-12 2006-05-04 New England Biolabs Inc HIGHLY POTENT hsiRNA MIXTURES AND METHODS FOR GENE SILENCING
EP1723162A4 (en) 2004-02-13 2010-05-05 Univ Rockefeller Anti-microrna oligonucleotide molecules
US20050182005A1 (en) * 2004-02-13 2005-08-18 Tuschl Thomas H. Anti-microRNA oligonucleotide molecules
US20050272650A1 (en) 2004-02-17 2005-12-08 Mohapatra Shyam S Materials and methods for treatment of inflammatory and cell proliferation disorders
EP1737493B1 (en) 2004-02-25 2011-06-29 Dana-Farber Cancer Institute, Inc. Inhibitors of insulin-like growth factor receptor -1 for inhibiting tumor cell growth
JP5184077B2 (en) 2004-03-26 2013-04-17 キュリス,インコーポレイテッド rna interference modulators and their use hedgehog signaling
US7416842B2 (en) * 2004-04-05 2008-08-26 The Rockefeller University DNA virus microRNA
US8088902B2 (en) 2004-04-05 2012-01-03 The Rockefeller University DNA virus microRNA and methods for inhibiting same
US7365058B2 (en) 2004-04-13 2008-04-29 The Rockefeller University MicroRNA and methods for inhibiting same
WO2005105157A3 (en) 2004-04-23 2006-04-27 Univ Columbia INHIBITION OF HAIRLESS PROTEIN mRNA
CN102102106B (en) 2004-04-23 2013-05-29 塞雷斯公司 Methods for modifying plant characteristics
DE102004025881A1 (en) 2004-05-19 2006-01-05 Beiersdorf Ag Oligoribonucleotides to influence hair growth
US8394947B2 (en) 2004-06-03 2013-03-12 Isis Pharmaceuticals, Inc. Positionally modified siRNA constructs
US7968762B2 (en) 2004-07-13 2011-06-28 Van Andel Research Institute Immune-compromised transgenic mice expressing human hepatocyte growth factor (hHGF)
JP2008506703A (en) 2004-07-14 2008-03-06 ユニバーシティ オブ ユタ リサーチ ファウンデーションUniversity Of Utha Researchfoundation Netrin-related compounds and applications
CN101501055B (en) 2005-06-23 2016-05-11 贝勒医学院 Negative immunomodulatory and immunosuppressive therapy applications Factors
EP1781338A4 (en) 2004-07-19 2010-02-10 Baylor College Medicine Modulation of cytokine signaling regulators and applications for immunotherapy
EP1782321A4 (en) 2004-07-23 2009-11-04 Univ North Carolina Methods and materials for determining pain sensitivity and predicting and treating related disorders
KR20130019457A (en) 2004-07-26 2013-02-26 다우 글로벌 테크놀로지스 엘엘씨 Process for improved protein expression by strain engineering
CA2576193A1 (en) 2004-08-03 2006-02-16 Biogen Idec Ma Inc. Taj in neuronal function
WO2006020768A3 (en) 2004-08-10 2007-07-05 Alnylam Pharmaceuticals Inc Chemically modified oligonucleotides
CN101123994B (en) 2004-08-16 2012-11-14 夸克医药公司 Therapeutic uses of inhibitors of rtp801
US7893197B2 (en) 2004-08-25 2011-02-22 Janssen Pharmaceutica N.V. Relaxin-3 chimeric polypeptides and their preparation and use
US7884086B2 (en) 2004-09-08 2011-02-08 Isis Pharmaceuticals, Inc. Conjugates for use in hepatocyte free uptake assays
US20060057590A1 (en) * 2004-09-14 2006-03-16 Azeddine Si-Ammour RNA probes
US7595433B2 (en) 2004-09-14 2009-09-29 Ceres, Inc. Modulations of amino acid and sugar content in plants
US20060059585A1 (en) 2004-09-14 2006-03-16 Boris Jankowski Modulating plant sugar levels
FI20041204A0 (en) 2004-09-16 2004-09-16 Riikka Lund Methods to exploit new target genes associated with immune-mediated diseases
US7799906B1 (en) 2004-09-22 2010-09-21 Arborgen, Llc Compositions and methods for modulating lignin of a plant
US20060067937A1 (en) 2004-09-24 2006-03-30 Karumanchi S A Methods of diagnosing and treating complications of pregnancy
JP4991547B2 (en) 2004-09-28 2012-08-01 クアーク・ファーマスーティカルス、インコーポレイテッドQuark Pharmaceuticals,Inc. Oligoribonucleotides and methods of use thereof for the treatment of alopecia, acute renal failure and other diseases
US7335760B2 (en) 2004-12-22 2008-02-26 Ceres, Inc. Nucleic acid sequences encoding zinc finger proteins
EP2371954A1 (en) * 2004-10-27 2011-10-05 Schering Corporation Compositions and methods for short interfering nucleic acid inhibition of NAv1.8
US7517870B2 (en) 2004-12-03 2009-04-14 Fondazione Telethon Use of compounds that interfere with the hedgehog signaling pathway for the manufacture of a medicament for preventing, inhibiting, and/or reversing ocular diseases related with ocular neovascularization
WO2006062971A3 (en) 2004-12-08 2006-11-30 Steven Craig Bobzin Modulating plant carbon levels
WO2006065552B1 (en) 2004-12-16 2007-08-02 Steven Craig Bobzin Modulating plant nitrogen levels
CN101287497B (en) 2004-12-27 2013-03-06 赛伦斯治疗公司 Lipid complexes coated with peg and their use
EP1841793B1 (en) 2005-01-07 2010-03-31 Diadexus, Inc. Ovr110 antibody compositions and methods of use
US7718625B2 (en) 2005-01-27 2010-05-18 University Of South Florida Polynucleotides targeted against the extended 5′-UTR region of argininosuccinate synthase and uses thereof
KR20130100207A (en) 2005-02-14 2013-09-09 유니버시티 오브 아이오와 리써치 파운데이션 Methods and reagents for treatment and diagnosis of age-related macular degeneration
WO2006130201A1 (en) 2005-03-14 2006-12-07 Board Of Regents, The University Of Texas System Antigene oligomers inhibit transcription
GB0505081D0 (en) * 2005-03-14 2005-04-20 Genomica Sau Downregulation of interleukin-12 expression by means of rnai technology
EP2535355A3 (en) 2005-03-23 2013-02-20 Genmab A/S Antibodies against CD38 for treatment of multiple myeloma
US7985852B2 (en) 2005-04-15 2011-07-26 National University Corporation Tottori University hTERT gene expression regulatory gene
JP5173793B2 (en) 2005-04-29 2013-04-03 ザ ロックフェラー ユニバーシティ Micro rna and methods of inhibiting it
US20090042186A1 (en) * 2005-05-06 2009-02-12 Alexander Mankin Mapping new sites for antibiotic action in the ribosome
KR100694804B1 (en) 2005-05-18 2007-03-14 아주대학교산학협력단 A composition for the prophylactic or treatment of endometrial cancer and a method for preventing or treating endometrial cancer using the composition
DK1888749T3 (en) 2005-06-01 2015-01-05 Polyplus Transfection Oligonucleotides for RNA interference as well as biological applications thereof
WO2006131925A3 (en) * 2005-06-10 2007-08-02 Elena Feinstein Oligoribonucleotides and methods of use thereof for treatment of fibrotic conditions and other diseases
WO2006135862A3 (en) 2005-06-10 2007-03-15 Children S Hospital And Res Ct Immunomodulation by altering sphingosine 1-phosphate lyase (spl) activity
US20110088126A1 (en) 2005-06-17 2011-04-14 Arborgen, Llc Cell signaling genes and related methods
US8067573B2 (en) 2005-07-07 2011-11-29 Yissum Research Development Company Of The Hebrew University Of Jerusalem Nucleic acid agents for downregulating H19 and methods of using same
WO2007011702A3 (en) 2005-07-15 2009-04-16 Univ North Carolina Use of egfr inhibitors to prevent or treat obesity
JP5066095B2 (en) 2005-11-17 2012-11-07 ボード・オブ・リージエンツ,ザ・ユニバーシテイ・オブ・テキサス・システム Regulation of gene expression by oligomers targeted to chromosome dna
EP1954834B1 (en) 2005-11-29 2012-08-08 Cambridge Enterprise Limited Markers for breast cancer
US20120135493A1 (en) 2005-12-13 2012-05-31 The Trustees Of The University Of Pennsylvania Methods for Phototransfecting Nucleic Acids Into Live Cells
US9157066B2 (en) 2005-12-13 2015-10-13 The Trustees Of The University Of Pennsylvania Transcriptome transfer produces cellular phenotype conversion
KR101317100B1 (en) 2005-12-30 2013-10-15 에보니크 룀 게엠베하 Peptides useful as cell-penetrating peptides
JPWO2007080902A1 (en) 2006-01-11 2009-06-11 協和発酵キリン株式会社 Inhibiting composition expression of a target gene in the eye and of the disease in the eye therapeutics
US20090060921A1 (en) * 2006-01-17 2009-03-05 Biolex Therapeutics, Inc. Glycan-optimized anti-cd20 antibodies
ES2395842T3 (en) 2006-01-17 2013-02-15 Synthon Biopharmaceuticals B.V. Compositions and methods for the humanization and optimization N-glycan in plants
US7825099B2 (en) 2006-01-20 2010-11-02 Quark Pharmaceuticals, Inc. Treatment or prevention of oto-pathologies by inhibition of pro-apoptotic genes
US7910566B2 (en) 2006-03-09 2011-03-22 Quark Pharmaceuticals Inc. Prevention and treatment of acute renal failure and other kidney diseases by inhibition of p53 by siRNA
NL2000439C2 (en) 2006-01-20 2009-03-16 Quark Biotech Therapeutic uses of inhibitors of RTP801.
US8222482B2 (en) 2006-01-26 2012-07-17 Ceres, Inc. Modulating plant oil levels
CA2640423C (en) 2006-01-27 2016-03-15 Biogen Idec Ma Inc. Nogo receptor antagonists
JP2009524419A (en) * 2006-01-27 2009-07-02 サンタリス ファーマ アー/エスSantaris Pharma A/S Lna modified phosphorothioate thiolated oligonucleotide
WO2007095113A3 (en) 2006-02-10 2008-12-11 Massachusetts Inst Technology Cpg15 and cpg15-2 compounds and inhibitors as insulin receptor and insulin-like growth factor receptor agonists and antagonists
JP2009529917A (en) 2006-03-22 2009-08-27 ヴァイラル ロジック システムズ テクノロジー コーポレーション Their use for the treatment of identification methods and immunological diseases of the target polypeptide
CA2644347C (en) * 2006-03-23 2017-05-30 Santaris Pharma A/S Small internally segmented interfering rna
CA2648718A1 (en) 2006-04-07 2007-10-18 The Research Foundation Of State University Of New York Transcobalamin receptor polypeptides, nucleic acids, and modulators thereof, and related methods of use in modulating cell growth and treating cancer and cobalamin deficiency
US9044461B2 (en) 2006-04-07 2015-06-02 The Research Foundation Of State University Of New York Transcobalamin receptor polypeptides, nucleic acids, and modulators thereof, and related methods of use in modulating cell growth and treating cancer and cobalamin deficiency
JP2009533458A (en) 2006-04-14 2009-09-17 マサチューセッツ インスティテュート オブ テクノロジー Identification and modulation of the molecular pathways that mediate plasticity of the nervous system
EP2051585A4 (en) 2006-04-28 2010-06-02 Univ South Florida Materials and methods for reducing inflammation by inhibition of the atrial natriuretic peptide receptor
GB0608838D0 (en) 2006-05-04 2006-06-14 Novartis Ag Organic compounds
CA2654165A1 (en) 2006-06-05 2007-12-13 Cancer Care Ontario Assessment of risk for colorectal cancer
WO2007141796A3 (en) 2006-06-09 2010-12-16 Quark Pharmaceuticals, Inc. Therapeutic uses of inhibitors of rtp801l
DK2447275T3 (en) 2006-07-13 2015-06-29 Univ Iowa Res Found Methods and reagents for the treatment of age-related macular degeneration
EP2546337A1 (en) 2006-07-21 2013-01-16 Silence Therapeutics AG Means for inhibiting the expression of protein kinase 3
JP2010510964A (en) * 2006-09-19 2010-04-08 アシュラジェン インコーポレイテッド As targets for therapeutic intervention, miR-15, miR-26, miR-31, miR-145, miR-147, miR-188, miR-215, miR-216, miR-331, mmu-miR-292- genes and pathways regulated by 3p
JP2010507387A (en) 2006-10-25 2010-03-11 クアーク・ファーマスーティカルス、インコーポレイテッドQuark Pharmaceuticals,Inc. New siRNA and methods of use thereof
EP2061901A2 (en) 2006-10-31 2009-05-27 Noxxon Pharma AG Methods for detection of a single- or double-stranded nucleic acid molecule
US9279127B2 (en) 2006-11-01 2016-03-08 The Medical Research Fund At The Tel-Aviv Sourasky Medical Center Adipocyte-specific constructs and methods for inhibiting platelet-type 12 lipoxygenase expression
EP2104513B1 (en) 2006-11-27 2015-05-20 diaDexus, Inc. Ovr110 antibody compositions and methods of use
EP2431053A1 (en) 2006-11-27 2012-03-21 Patrys Limited Novel glycosylated peptide target in neoplastic cells
US20090131354A1 (en) * 2007-05-22 2009-05-21 Bader Andreas G miR-126 REGULATED GENES AND PATHWAYS AS TARGETS FOR THERAPEUTIC INTERVENTION
CA2671299A1 (en) * 2006-12-08 2008-06-19 Asuragen, Inc. Functions and targets of let-7 micro rnas
CA2671270A1 (en) * 2006-12-29 2008-07-17 Asuragen, Inc. Mir-16 regulated genes and pathways as targets for therapeutic intervention
EP2104735A2 (en) * 2006-12-08 2009-09-30 Asuragen, INC. Mir-21 regulated genes and pathways as targets for therapeutic intervention
WO2008091680A3 (en) 2007-01-25 2008-12-18 Gen Hospital Corp Methods for controlling stem cell differentiation
CA2676143A1 (en) 2007-01-26 2008-07-31 University Of Louisville Research Foundation, Inc. Modification of exosomal components for use as a vaccine
EP2137205A2 (en) 2007-02-26 2009-12-30 Quark Pharmaceuticals, Inc. Inhibitors of rtp801 and their use in disease treatment
US20100292301A1 (en) * 2007-02-28 2010-11-18 Elena Feinstein Novel sirna structures
US20110189663A1 (en) 2007-03-05 2011-08-04 Cancer Care Ontario Assessment of risk for colorectal cancer
CA2680600A1 (en) 2007-03-12 2008-09-18 Antigen Express, Inc. Li-rnai involved li suppression in cancer immunotherapy
US7812002B2 (en) 2007-03-21 2010-10-12 Quark Pharmaceuticals, Inc. Oligoribonucleotide inhibitors of NRF2 and methods of use thereof for treatment of cancer
US8367052B2 (en) 2007-03-26 2013-02-05 General Regeneratives Holdings Inc. Methods for promoting protection and regeneration of bone marrow using CXCL9 and anti-CXCL9 antibodies
WO2008126517A1 (en) * 2007-03-30 2008-10-23 National University Corporation Okayama University Novel slc17-type transporter protein in mammal and use thereof
EP2142651B1 (en) 2007-04-27 2013-05-22 Pfenex Inc. Method for rapidly screening microbial hosts to identify certain strains with improved yield and/or quality in the expression of heterologous proteins
US9580719B2 (en) 2007-04-27 2017-02-28 Pfenex, Inc. Method for rapidly screening microbial hosts to identify certain strains with improved yield and/or quality in the expression of heterologous proteins
US20080268051A1 (en) 2007-04-30 2008-10-30 Allergan, Inc. High viscosity macromolecular compositions for treating ocular conditions
ES2474176T3 (en) 2007-06-27 2014-07-08 Quark Pharmaceuticals, Inc. Compositions and methods for inhibiting gene expression pro-apoptticos
EP2184353A4 (en) 2007-07-03 2010-09-08 Kyorin Seiyaku Kk Treatment of influenza
JP2010532989A (en) 2007-07-10 2010-10-21 ニューリム ファーマシューティカルズ (1991) リミテッド cd44 splice variants in neurodegenerative diseases
WO2009054873A4 (en) 2007-08-02 2010-02-11 Novimmune S.A. Anti-rantes antibodies and methods of use thereof
CA2697055A1 (en) * 2007-08-21 2009-02-26 Scott And White Memorial Hospital And Scott, Sherwood And Brindley Found Ation Methods and compositions for post-transcriptional gene silencing
WO2009033027A3 (en) 2007-09-05 2009-04-23 Medtronic Inc Suppression of scn9a gene expression and/or function for the treatment of pain
CA2701845A1 (en) * 2007-10-03 2009-04-09 Quark Pharmaceuticals, Inc. Novel sirna structures
US8324369B2 (en) 2007-11-30 2012-12-04 Baylor College Of Medicine Dendritic cell vaccine compositions and uses of same
US8614311B2 (en) 2007-12-12 2013-12-24 Quark Pharmaceuticals, Inc. RTP801L siRNA compounds and methods of use thereof
WO2009074990A3 (en) * 2007-12-12 2009-12-10 Quark Pharmaceuticals, Inc. Rtp801l sirna compounds and methods of use thereof
WO2009086156A3 (en) * 2007-12-21 2010-05-06 Asuragen, Inc. Mir-10 regulated genes and pathways as targets for therapeutic intervention
EP2242854A4 (en) * 2008-01-15 2012-08-15 Quark Pharmaceuticals Inc Sirna compounds and methods of use thereof
JP5721441B2 (en) 2008-01-31 2015-05-20 キュアバック ゲーエムベーハーCurevac Gmbh Expression as immunostimulant / adjuvant (I) (NuGlXmGnNv) nucleic acid molecules and derivatives thereof represented by a
US20090263803A1 (en) * 2008-02-08 2009-10-22 Sylvie Beaudenon Mirnas differentially expressed in lymph nodes from cancer patients
CN102016036B (en) * 2008-02-11 2015-04-08 阿克赛医药公司 Modified RNAi polynucleotides and uses thereof
EP2268316A4 (en) * 2008-03-20 2011-05-25 Quark Pharmaceuticals Inc NOVEL siRNA COMPOUNDS FOR INHIBITING RTP801
US20090253780A1 (en) * 2008-03-26 2009-10-08 Fumitaka Takeshita COMPOSITIONS AND METHODS RELATED TO miR-16 AND THERAPY OF PROSTATE CANCER
DK2279254T3 (en) 2008-04-15 2017-09-18 Protiva Biotherapeutics Inc Novel lipid formulations for nukleinsyreindgivelse
EP2285385A4 (en) * 2008-04-15 2013-01-16 Quark Pharmaceuticals Inc siRNA COMPOUNDS FOR INHIBITING NRF2
EP2116602A1 (en) 2008-05-07 2009-11-11 Institut Gustave Roussy Combination products for treating cancer
US8222221B2 (en) 2008-06-04 2012-07-17 The Board Of Regents Of The University Of Texas System Modulation of gene expression through endogenous small RNA targeting of gene promoters
US8431692B2 (en) * 2008-06-06 2013-04-30 Quark Pharmaceuticals, Inc. Compositions and methods for treatment of ear disorders
JP5637849B2 (en) 2008-07-01 2014-12-10 第一三共株式会社 Double-stranded polynucleotide
WO2010008582A3 (en) 2008-07-18 2010-12-29 Rxi Pharmaceuticals Corporation Phagocytic cell delivery of rnai
ES2561812T3 (en) 2008-08-01 2016-03-01 Kyowa Hakko Kirin Co., Ltd. Composition for inhibiting expression of a target gene
WO2011011027A1 (en) 2009-07-20 2011-01-27 Bristol-Myers Squibb Company Combination of anti-ctla4 antibody with diverse therapeutic regimens for the synergistic treatment of proliferative diseases
WO2010042281A9 (en) * 2008-08-25 2011-10-06 Excaliard Pharmaceuticals, Inc. Antisense oligonucleotides directed against connective tissue growth factor and uses thereof
WO2011028218A1 (en) 2009-09-02 2011-03-10 Alnylam Pharmaceuticals, Inc. Process for triphosphate oligonucleotide synthesis
JP2012502991A (en) 2008-09-22 2012-02-02 アールエックスアイ ファーマシューティカルズ コーポレーション rna interference in the skin applied
WO2010037408A1 (en) 2008-09-30 2010-04-08 Curevac Gmbh Composition comprising a complexed (m)rna and a naked mrna for providing or enhancing an immunostimulatory response in a mammal and uses thereof
WO2010054221A3 (en) 2008-11-06 2010-09-16 The Johns Hopkins University Treatment of chronic inflammatory respiratory disorders
JP5774486B2 (en) 2008-11-10 2015-09-09 テクミラ ファーマシューティカルズ コーポレイションTekmira Pharmaceuticals Corporation The novel lipids and compositions for delivering therapeutic agents
WO2010056737A3 (en) * 2008-11-11 2010-09-16 Mirna Therapeutics, Inc. Methods and compositions involving mirnas in cancer stem cells
WO2010059226A3 (en) 2008-11-19 2010-07-15 Rxi Pharmaceuticals Corporation Inhibition of map4k4 through rnai
KR20110097915A (en) 2008-12-03 2011-08-31 마리나 바이오테크, 인크. Usirna complexes
EP2376535B9 (en) 2008-12-09 2017-09-13 F.Hoffmann-La Roche Ag Anti-pd-l1 antibodies and their use to enhance t-cell function
EP2370175A2 (en) 2008-12-16 2011-10-05 Bristol-Myers Squibb Company Methods of inhibiting quiescent tumor proliferation
WO2010080452A3 (en) 2008-12-18 2010-09-02 Quark Pharmaceuticals, Inc. siRNA COMPOUNDS AND METHODS OF USE THEREOF
WO2010078536A1 (en) 2009-01-05 2010-07-08 Rxi Pharmaceuticals Corporation Inhibition of pcsk9 through rnai
US9745574B2 (en) 2009-02-04 2017-08-29 Rxi Pharmaceuticals Corporation RNA duplexes with single stranded phosphorothioate nucleotide regions for additional functionality
KR20110135938A (en) 2009-02-13 2011-12-20 인디애나 유니버시티 리서치 앤드 테크놀로지 코퍼레이션 Compounds and methods for inhibiting mmp2 and mmp9
EP2403863B1 (en) 2009-03-02 2013-08-28 Alnylam Pharmaceuticals Inc. Nucleic acid chemical modifications
JP5830460B2 (en) 2009-03-23 2015-12-09 クォーク ファーマシューティカルズ インコーポレーティッドQuark Pharmaceuticals,Inc. Compounds for treating cancer and fibrotic diseases, compositions, and methods
US8815586B2 (en) 2009-04-24 2014-08-26 The Board Of Regents Of The University Of Texas System Modulation of gene expression using oligomers that target gene regions downstream of 3′ untranslated regions
WO2011019423A3 (en) 2009-05-20 2011-05-05 Schering Corporation Modulation of pilr receptors to treat microbial infections
EP2258858A1 (en) 2009-06-05 2010-12-08 Universitätsklinikum Freiburg Transgenic LSD1 animal model for cancer
CN102625696B (en) 2009-06-10 2015-06-03 阿尔尼拉姆医药品有限公司 Improved lipid formulation
US8268550B2 (en) 2009-06-26 2012-09-18 Massachusetts Institute Of Technology Compositions and methods for identification of PARP function, inhibitors, and activators
US8435961B2 (en) 2009-06-26 2013-05-07 Massachusetts Institute Of Technology Methods and compositions for increasing the activity of inhibitory RNA
US20110097329A1 (en) 2009-06-26 2011-04-28 Massachusetts Institute Of Technology Compositions and methods for treating cancer and modulating stress granule formation
WO2011000107A1 (en) 2009-07-01 2011-01-06 Protiva Biotherapeutics, Inc. Novel lipid formulations for delivery of therapeutic agents to solid tumors
US20110053829A1 (en) 2009-09-03 2011-03-03 Curevac Gmbh Disulfide-linked polyethyleneglycol/peptide conjugates for the transfection of nucleic acids
US20120263709A1 (en) 2009-09-10 2012-10-18 Schering Corporation Use of il-33 antagonists to treat fibrotic diseases
CN102666856B (en) 2009-11-08 2016-04-06 夸克制药公司 RhoA medicament directed to the target gene double-stranded RNA in the manufacture of treatment of neuropathic pain in
WO2011062997A3 (en) 2009-11-17 2011-07-14 Musc Foundation For Research Development Human monoclonal antibodies to human nucleolin
EP2504435A1 (en) 2009-11-26 2012-10-03 Quark Pharmaceuticals, Inc. Sirna compounds comprising terminal substitutions
EP2509628B1 (en) 2009-12-07 2017-10-25 The Johns Hopkins University Sr-bi as a predictor of human female infertility and responsiveness to treatment
CA2783372A1 (en) 2009-12-07 2011-06-16 Muthiah Manoharan Compositions for nucleic acid delivery
EP2510098B1 (en) 2009-12-09 2015-02-11 Quark Pharmaceuticals, Inc. Methods and compositions for treating diseases, disorders or injury of the cns
KR101718534B1 (en) 2009-12-09 2017-03-22 닛토덴코 가부시키가이샤 MODULATION OF hsp47 EXPRESSION
EP2513308B1 (en) 2009-12-17 2017-01-18 Merck Sharp & Dohme Corp. Modulation of pilr to treat immune disorders
EP2512449A4 (en) 2009-12-18 2014-05-21 Univ British Columbia Methods and compositions for delivery of nucleic acids
CN105125572A (en) 2009-12-18 2015-12-09 箭头研究公司 Organic compositions to treat hsf1-related diseases
WO2011084193A1 (en) 2010-01-07 2011-07-14 Quark Pharmaceuticals, Inc. Oligonucleotide compounds comprising non-nucleotide overhangs
WO2011100131A3 (en) 2010-01-28 2012-01-19 Alnylam Pharmacuticals, Inc. Monomers and oligonucleotides comprising cycloaddition adduct(s)
WO2011094580A3 (en) 2010-01-28 2012-06-28 Alnylam Pharmaceuticals, Inc. Chelated copper for use in the preparation of conjugated oligonucleotides
US20120296403A1 (en) 2010-02-10 2012-11-22 Novartis Ag Methods and compounds for muscle growth
RU2615143C2 (en) 2010-03-24 2017-04-04 Адвирна Self-delivered rnai compounds of reduced size
CN103200945B (en) 2010-03-24 2016-07-06 雷克西制药公司 rna interference in ocular symptoms
WO2011119887A1 (en) 2010-03-24 2011-09-29 Rxi Pharmaceuticals Corporation Rna interference in dermal and fibrotic indications
US9102938B2 (en) 2010-04-01 2015-08-11 Alnylam Pharmaceuticals, Inc. 2′ and 5′ modified monomers and oligonucleotides
EP2561366A1 (en) 2010-04-19 2013-02-27 Institut National de la Santé et de la Recherche Medicale Cxcl5 as a marker of hormone escape in prostate cancer
US9725479B2 (en) 2010-04-22 2017-08-08 Ionis Pharmaceuticals, Inc. 5′-end derivatives
WO2011133868A3 (en) 2010-04-22 2012-01-12 Alnylam Pharmaceuticals, Inc. Conformationally restricted dinucleotide monomers and oligonucleotides
WO2011133876A3 (en) 2010-04-22 2013-05-16 Alnylam Pharmaceuticals, Inc. Oligonucleotides comprising acyclic and abasic nucleosides and analogs
EP2561077B1 (en) 2010-04-23 2016-04-13 Arrowhead Research Corporation ORGANIC COMPOSITIONS TO TREAT BETA-ENaC-RELATED DISEASES
EP2561078A4 (en) 2010-04-23 2014-10-15 Cold Spring Harbor Lab NOVEL STRUCTURALLY DESIGNED shRNAs
KR101794376B1 (en) * 2010-04-28 2017-11-06 킴벌리-클라크 월드와이드, 인크. MEDICAL DEVICES FOR DELIVERY OF siRNA
CN102971037B (en) 2010-04-28 2016-05-25 金伯利-克拉克环球有限公司 Rheumatoid arthritis drug delivery device for
CA2796965A1 (en) 2010-04-28 2012-04-12 Kimberly-Clark Worldwide, Inc. Method for increasing permeability of an epithelial barrier
RU2570280C2 (en) 2010-04-28 2015-12-10 Кимберли-Кларк Ворлдвайд, Инк. Composite matrix of microneedles, containing nanostructures on surface
KR20130107203A (en) 2010-05-04 2013-10-01 더 브리검 앤드 우먼즈 하스피털, 인크. Detection and treatment of fibrosis
US20130236968A1 (en) 2010-06-21 2013-09-12 Alnylam Pharmaceuticals, Inc. Multifunctional copolymers for nucleic acid delivery
WO2012000104A1 (en) 2010-06-30 2012-01-05 Protiva Biotherapeutics, Inc. Non-liposomal systems for nucleic acid delivery
WO2012016184A3 (en) 2010-07-30 2012-04-19 Alnylam Pharmaceuticals, Inc. Methods and compositions for delivery of active agents
WO2012016188A3 (en) 2010-07-30 2012-04-12 Alnylam Pharmaceuticals, Inc. Methods and compositions for delivery of active agents
EP2955230A1 (en) 2010-07-30 2015-12-16 CureVac AG Complexation of nucleic acids with disulfide-crosslinked cationic components for transfection and immunostimulation
US20120052079A1 (en) * 2010-08-10 2012-03-01 Dana-Farber Cancer Institute, Inc. Compositions, Kits, and Methods for Predicting Anti-Cancer Response to Anthracyclines
JP6106085B2 (en) 2010-08-24 2017-03-29 サーナ・セラピューティクス・インコーポレイテッドSirna Therapeutics,Inc. Single strand RNAi agent comprising an internal non-nucleic acid spacer
WO2012051491A1 (en) 2010-10-14 2012-04-19 The United States Of America, As Represented By The Secretary National Institutes Of Health Compositions and methods for controlling neurotropic viral pathogenesis by micro-rna targeting
WO2012071436A1 (en) 2010-11-24 2012-05-31 Genentech, Inc. Method of treating autoimmune inflammatory disorders using il-23r loss-of-function mutants
CN103298939A (en) 2010-12-06 2013-09-11 夸克医药公司 Double stranded oligonucleotide compounds comprising positional modifications
WO2012090150A3 (en) 2010-12-27 2012-11-01 Compugen Ltd New cell-penetrating peptides and uses thereof
DK2663548T3 (en) 2011-01-11 2017-07-24 Alnylam Pharmaceuticals Inc Pegylated lipids and their use for drug delivery
JP5952197B2 (en) 2011-01-19 2016-07-13 協和発酵キリン株式会社 Inhibiting composition expression of the target gene
CA2828002A1 (en) 2011-03-03 2012-09-07 Quark Pharmaceuticals, Inc. Compositions and methods for treating lung disease and injury
US9796979B2 (en) 2011-03-03 2017-10-24 Quark Pharmaceuticals Inc. Oligonucleotide modulators of the toll-like receptor pathway
EP2681315B1 (en) 2011-03-03 2017-05-03 Quark Pharmaceuticals, Inc. Oligonucleotide modulators of the toll-like receptor pathway
CA2867139A1 (en) 2011-04-11 2012-10-18 Targeted Growth, Inc. Identification and the use of krp mutants in plants
ES2572915T3 (en) 2011-06-02 2016-06-03 The University Of Louisville Research Foundation, Inc. Conjugated nanoparticles to a nucleolin agent
DK2717921T3 (en) 2011-06-08 2016-07-04 Nitto Denko Corp Retinoid liposomes to improve the modulation of Hsp47 expression
CN104245938A (en) 2011-06-10 2014-12-24 淡马锡生命科学研究院有限公司 Genetic manipulation and expression systems for pucciniomycotina and us tilaginom ycotina subphyla
WO2013003697A1 (en) 2011-06-30 2013-01-03 Trustees Of Boston University Method for controlling tumor growth, angiogenesis and metastasis using immunoglobulin containing and proline rich receptor-1 (igpr-1)
US9120858B2 (en) 2011-07-22 2015-09-01 The Research Foundation Of State University Of New York Antibodies to the B12-transcobalamin receptor
EP2751272A2 (en) 2011-09-02 2014-07-09 Novartis AG Organic compositions to treat hsf1-related diseases
US9701623B2 (en) 2011-09-27 2017-07-11 Alnylam Pharmaceuticals, Inc. Di-aliphatic substituted pegylated lipids
CN104039382B (en) 2011-10-27 2018-01-12 金伯利-克拉克环球有限公司 High viscosity transdermal delivery of biologically active agent
KR20140091683A (en) 2011-11-03 2014-07-22 쿠아크 파마수티칼스 인코퍼레이티드 Methods and compositions for neuroprotection
US20140323549A1 (en) 2011-11-08 2014-10-30 Quark Pharmaceuticals, Inc. Methods and compositions for treating diseases, disorders or injury of the nervous system
CA2860676A1 (en) 2012-01-09 2013-07-18 Novartis Ag Organic compositions to treat beta-catenin-related diseases
US20150126438A1 (en) 2012-01-24 2015-05-07 Beth Israel Deaconess Medical Center, Inc. Novel ChREBP Isoforms and Methods Using the Same
CA2863964A1 (en) 2012-02-07 2013-08-15 Global Bio Therapeutics Usa, Inc. Compartmentalized method of nucleic acid delivery and compositions and uses thereof
WO2013158032A1 (en) 2012-04-19 2013-10-24 Temasek Life Sciences Laboratory Limited Methods for increasing cotton fiber length
US9133515B2 (en) 2012-05-16 2015-09-15 Silence Therapeutics Gmbh Use of VEGFR1 as a biomarker
CN104471062A (en) 2012-07-16 2015-03-25 协和发酵麒麟株式会社 Rnai pharmaceutical composition capable of suppressing expression of kras gene
WO2015015496A1 (en) 2013-07-31 2015-02-05 Qbi Enterprises Ltd. Sphingolipid-polyalkylamine-oligonucleotide compounds
US20160208247A1 (en) 2013-07-31 2016-07-21 Qbi Enterprises Ltd. Methods of use of sphingolipid polyalkylamine oligonucleotide compounds
KR20160108494A (en) 2014-01-17 2016-09-19 교와 핫꼬 기린 가부시키가이샤 Nucleic acids for suppressing the expression of β2GPI
JP6264329B2 (en) 2014-06-18 2018-01-24 トヨタ自動車株式会社 The vehicle drive control apparatus
WO2016038550A1 (en) 2014-09-11 2016-03-17 Novartis Ag Inhibition of prmt5 to treat mtap-deficiency-related diseases
US20170304459A1 (en) 2014-10-10 2017-10-26 Alnylam Pharmaceuticals, Inc. Methods and compositions for inhalation delivery of conjugated oligonucleotide
WO2016077624A1 (en) 2014-11-12 2016-05-19 Nmc, Inc. Transgenic plants with engineered redox sensitive modulation of photosynthetic antenna complex pigments and methods for making the same
WO2016089883A1 (en) 2014-12-01 2016-06-09 Novartis Ag Compositions and methods for diagnosis and treatment of prostate cancer
WO2016193945A3 (en) 2015-06-05 2017-01-12 Novartis Ag Methods and compositions for diagnosing, treating, and monitoring treatment of shank3 deficiency associated disorders
WO2017160754A1 (en) 2016-03-15 2017-09-21 Mersana Therapeutics,Inc. Napi2b-targeted antibody-drug conjugates and methods of use thereof
US20170283818A1 (en) 2016-04-05 2017-10-05 Corn Products Development, Inc. Compositions and methods for producing starch with novel functionality

Citations (71)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4469863A (en) * 1980-11-12 1984-09-04 Ts O Paul O P Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof
US5208149A (en) * 1983-10-20 1993-05-04 The Research Foundation Of State University Of New York Nucleic acid constructs containing stable stem and loop structures
US5457189A (en) * 1989-12-04 1995-10-10 Isis Pharmaceuticals Antisense oligonucleotide inhibition of papillomavirus
US5514577A (en) * 1990-02-26 1996-05-07 Isis Pharmaceuticals, Inc. Oligonucleotide therapies for modulating the effects of herpes viruses
US5576208A (en) * 1991-06-14 1996-11-19 Isis Pharmaceuticals Inc. Antisense oligonucleotide inhibition of the RAS gene
US5578716A (en) * 1993-12-01 1996-11-26 Mcgill University DNA methyltransferase antisense oligonucleotides
US5580859A (en) * 1989-03-21 1996-12-03 Vical Incorporated Delivery of exogenous DNA sequences in a mammal
US5594122A (en) * 1993-06-23 1997-01-14 Genesys Pharma Inc. Antisense oligonucleotides targeted against human immunodeficiency virus
US5624808A (en) * 1995-03-28 1997-04-29 Becton Dickinson And Company Method for identifying cells committed to apoptosis by determining cellular phosphotyrosine content
US5624803A (en) * 1993-10-14 1997-04-29 The Regents Of The University Of California In vivo oligonucleotide generator, and methods of testing the binding affinity of triplex forming oligonucleotides derived therefrom
US5770580A (en) * 1992-04-13 1998-06-23 Baylor College Of Medicine Somatic gene therapy to cells associated with fluid spaces
US5795715A (en) * 1991-12-18 1998-08-18 Cis Bio International Process for preparing double-stranded RNA, and its applications
US5801154A (en) * 1993-10-18 1998-09-01 Isis Pharmaceuticals, Inc. Antisense oligonucleotide modulation of multidrug resistance-associated protein
US5814500A (en) * 1996-10-31 1998-09-29 The Johns Hopkins University School Of Medicine Delivery construct for antisense nucleic acids and methods of use
US5898031A (en) * 1996-06-06 1999-04-27 Isis Pharmaceuticals, Inc. Oligoribonucleotides for cleaving RNA
US5908779A (en) * 1993-12-01 1999-06-01 University Of Connecticut Targeted RNA degradation using nuclear antisense RNA
US5972704A (en) * 1992-05-14 1999-10-26 Ribozyme Pharmaceuticals, Inc. HIV nef targeted ribozymes
US5998203A (en) * 1996-04-16 1999-12-07 Ribozyme Pharmaceuticals, Inc. Enzymatic nucleic acids containing 5'-and/or 3'-cap structures
US6001990A (en) * 1994-05-10 1999-12-14 The General Hospital Corporation Antisense inhibition of hepatitis C virus
US6057153A (en) * 1995-01-13 2000-05-02 Yale University Stabilized external guide sequences
US6218142B1 (en) * 1997-03-05 2001-04-17 Michael Wassenegger Nucleic acid molecules encoding polypeptides having the enzymatic activity of an RNA-directed RNA polymerase (RDRP)
US6225290B1 (en) * 1996-09-19 2001-05-01 The Regents Of The University Of California Systemic gene therapy by intestinal cell transformation
US20020114784A1 (en) * 1999-01-28 2002-08-22 Medical College Of Georgia Research Institute, Inc. Composition and method for in vivo and in vitro attenuation of gene expression using double stranded RNA
US20020132257A1 (en) * 2001-01-31 2002-09-19 Tony Giordano Use of post-transcriptional gene silencing for identifying nucleic acid sequences that modulate the function of a cell
US20020137210A1 (en) * 1999-12-09 2002-09-26 Churikov Nikolai Andreevich Method for modifying genetic characteristics of an organism
US20020160393A1 (en) * 2000-12-28 2002-10-31 Symonds Geoffrey P. Double-stranded RNA-mediated gene suppression
US20020162126A1 (en) * 2000-03-16 2002-10-31 David Beach Methods and compositions for RNA interference
US6476205B1 (en) * 1989-10-24 2002-11-05 Isis Pharmaceuticals, Inc. 2′ Modified oligonucleotides
US6475726B1 (en) * 1998-01-09 2002-11-05 Cubist Pharmaceuticals, Inc. Method for identifying validated target and assay combinations for drug development
US6506559B1 (en) * 1997-12-23 2003-01-14 Carnegie Institute Of Washington Genetic inhibition by double-stranded RNA
US6531647B1 (en) * 1997-09-22 2003-03-11 Plant Bioscience Limited Gene silencing methods
US20030064945A1 (en) * 1997-01-31 2003-04-03 Saghir Akhtar Enzymatic nucleic acid treatment of diseases or conditions related to levels of epidermal growth factor receptors
US20030068301A1 (en) * 1992-05-14 2003-04-10 Kenneth Draper Method and reagent for inhibiting hepatitis B virus replication
US20030084471A1 (en) * 2000-03-16 2003-05-01 David Beach Methods and compositions for RNA interference
US6573099B2 (en) * 1998-03-20 2003-06-03 Benitec Australia, Ltd. Genetic constructs for delaying or repressing the expression of a target gene
US6573009B1 (en) * 1998-08-05 2003-06-03 Sony Corporation Electrolyte containing a crosslinked compound having ether linkages and a high-molecular compound
US20030108923A1 (en) * 2000-03-30 2003-06-12 Whitehead Institute For Biomedical Research RNA sequence-specific mediators of RNA interference
US20030140362A1 (en) * 2001-06-08 2003-07-24 Dennis Macejak In vivo models for screening inhibitors of hepatitis B virus
US20030148985A1 (en) * 2001-12-05 2003-08-07 David Morrissey Methods and reagents for the inhibition of hepatitis B virus replication
US20030153521A1 (en) * 2001-05-29 2003-08-14 Mcswiggen James Nucleic acid treatment of diseases or conditions related to levels of Ras
US20030171311A1 (en) * 1998-04-27 2003-09-11 Lawrence Blatt Enzymatic nucleic acid treatment of diseases or conditions related to hepatitis C virus infection
US20030180756A1 (en) * 2002-03-21 2003-09-25 Yang Shi Compositions and methods for suppressing eukaryotic gene expression
US20030190654A1 (en) * 2002-01-22 2003-10-09 Ribopharma Double-stranded RNA (dsRNA) and method of use for inhibiting expression of a fusion gene
US6635805B1 (en) * 1997-02-14 2003-10-21 Plant Bioscience Limited Methods and DNA constructs for gene silencing in transgenic plants
US20030206887A1 (en) * 1992-05-14 2003-11-06 David Morrissey RNA interference mediated inhibition of hepatitis B virus (HBV) using short interfering nucleic acid (siNA)
US20040002153A1 (en) * 1999-07-21 2004-01-01 Monia Brett P. Modulation of PTEN expression via oligomeric compounds
US20040001811A1 (en) * 2001-01-09 2004-01-01 Ribopharma Ag Compositions and methods for inhibiting expression of anti-apoptotic genes
US20040005593A1 (en) * 2002-03-06 2004-01-08 Rigel Pharmaceuticals, Inc. Novel method for delivery and intracellular synthesis of siRNA molecules
US20040006035A1 (en) * 2001-05-29 2004-01-08 Dennis Macejak Nucleic acid mediated disruption of HIV fusogenic peptide interactions
US20040019001A1 (en) * 2002-02-20 2004-01-29 Mcswiggen James A. RNA interference mediated inhibition of protein typrosine phosphatase-1B (PTP-1B) gene expression using short interfering RNA
US20040038921A1 (en) * 2001-10-26 2004-02-26 Ribopharma Ag Composition and method for inhibiting expression of a target gene
US20040053876A1 (en) * 2002-03-26 2004-03-18 The Regents Of The University Of Michigan siRNAs and uses therof
US20040053875A1 (en) * 1999-01-30 2004-03-18 Ribopharma Ag Method and medicament for inhibiting the expression of a given gene
US20040054156A1 (en) * 1992-05-14 2004-03-18 Kenneth Draper Method and reagent for inhibiting hepatitis B viral replication
US20040096843A1 (en) * 2002-02-14 2004-05-20 Rossi John J. Methods for producing interfering RNA molecules in mammalian cells and therapeutic uses for such molecules
US20040121348A1 (en) * 2001-10-26 2004-06-24 Ribopharma Ag Compositions and methods for treating pancreatic cancer
US20040137471A1 (en) * 2002-09-18 2004-07-15 Timothy Vickers Efficient reduction of target RNA's by single-and double-stranded oligomeric compounds
US20040175703A1 (en) * 1999-11-24 2004-09-09 Ribopharma Ag Compositions and methods for inhibiting expression of a target gene
US20040192626A1 (en) * 2002-02-20 2004-09-30 Mcswiggen James RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US20040191905A1 (en) * 2002-11-22 2004-09-30 University Of Massachusetts Modulation of HIV replication by RNA interference
US20040203145A1 (en) * 2002-08-07 2004-10-14 University Of Massachusetts Compositions for RNA interference and methods of use thereof
US20040214330A1 (en) * 1999-04-07 2004-10-28 Waterhouse Peter Michael Methods and means for obtaining modified phenotypes
US20040224328A1 (en) * 2003-01-15 2004-11-11 Hans Prydz siRNA screening method
US20040229266A1 (en) * 2000-12-01 2004-11-18 Max-Planck-Gesellschaft Zur Forderung Der Wissenschaften E.V. RNA interference mediating small RNA molecules
US20040231016A1 (en) * 2003-02-19 2004-11-18 Commonwealth Scientific And Industrial Research Organization Efficient gene silencing in plants using short dsRNA sequences
US20040241854A1 (en) * 2002-08-05 2004-12-02 Davidson Beverly L. siRNA-mediated gene silencing
US20040248296A1 (en) * 2002-03-20 2004-12-09 Beresford Paul J. HIV therapeutic
US20040248835A1 (en) * 2001-10-26 2004-12-09 Anja Krebs Use of a double-stranded ribonucleic acid for treating an infection with a positivestrand rna-virus
US6939712B1 (en) * 1998-12-29 2005-09-06 Impedagen, Llc Muting gene activity using a transgenic nucleic acid
US20060084621A1 (en) * 2001-01-09 2006-04-20 Hans-Peter Vornlocher Compositions and methods for inhibiting expression of anti-apoptotic genes
US7232806B2 (en) * 2001-09-28 2007-06-19 Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften E.V. MicroRNA molecules

Family Cites Families (67)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPH0468869B2 (en) 1983-04-25 1992-11-04 Nippon Electric Co
GB8704365D0 (en) 1987-02-25 1987-04-01 Exxon Chemical Patents Inc Zeolite l preparation
US5712257A (en) 1987-08-12 1998-01-27 Hem Research, Inc. Topically active compositions of mismatched dsRNAs
CA1327001C (en) 1987-08-12 1994-02-15 Hem Research, Inc. Topically active compositions of double-stranded rnas
EP0604409B1 (en) 1990-01-11 2004-07-14 Isis Pharmaceuticals, Inc. Oligonucleotide analogs for detecting and modulating rna activity and gene expression
US5670633A (en) * 1990-01-11 1997-09-23 Isis Pharmaceuticals, Inc. Sugar modified oligonucleotides that detect and modulate gene expression
DE69123979T2 (en) * 1990-10-12 1997-04-30 Max Planck Gesellschaft modified ribozyme
FR2675803B1 (en) 1991-04-25 1996-09-06 Genset Sa Oligonucleotides farms, antisense and sense and their applications.
CA2131311C (en) 1992-03-05 2004-06-29 Phillip Dan Cook Covalently cross-linked oligonucleotides
DE69737296D1 (en) 1996-12-12 2007-03-15 Yissum Res Dev Co Synthetic antisense oligodeoxynucleotides and pharmaceutical compositions containing them
CA2139319A1 (en) 1992-07-02 1994-01-20 Sudhir Agrawal Self-stabilized oligonucleotides as therapeutic agents
US5652355A (en) 1992-07-23 1997-07-29 Worcester Foundation For Experimental Biology Hybrid oligonucleotide phosphorothioates
WO1994015645A1 (en) 1992-12-31 1994-07-21 Texas Biotechnology Corporation Antisense molecules directed against genes of the raf oncogene family
US6056704A (en) 1993-03-03 2000-05-02 Ide; Masatake Foot-pressure massage stand
EP0616026A1 (en) 1993-03-19 1994-09-21 THE PROCTER & GAMBLE COMPANY Concentrated cleaning compositions
FR2710074B1 (en) 1993-09-15 1995-12-08 Rhone Poulenc Rorer Sa Grb3-3 gene, its variants and their uses.
WO1995013834A1 (en) 1993-11-16 1995-05-26 Genta, Incorporated Chimeric oligonucleoside compounds
US5674683A (en) 1995-03-21 1997-10-07 Research Corporation Technologies, Inc. Stem-loop and circular oligonucleotides and method of using
US5976567A (en) 1995-06-07 1999-11-02 Inex Pharmaceuticals Corp. Lipid-nucleic acid particles prepared via a hydrophobic lipid-nucleic acid complex intermediate and use for gene transfer
EP0851919A1 (en) 1995-09-20 1998-07-08 University of Massachusetts Worcester Antisense oligonucleotide chemotherapy for benign hyperplasia or cancer of the prostate
CN1214688A (en) 1996-02-14 1999-04-21 伊希斯药物有限公司 Sugar-modified gapped oligonucleotides
KR20000005561A (en) 1996-04-17 2000-01-25 아로넥스 파마슈티칼즈, 인코포레이티드 Antisense inhibitor of vegf/vpf expression
DE19618797C2 (en) 1996-05-10 2000-03-23 Bertling Wolf Vehicle for the transport of molecular substance
DE19631919C2 (en) 1996-08-07 1998-07-16 Deutsches Krebsforsch Anti-sense RNA with secondary structure
WO1998014562A1 (en) 1996-10-04 1998-04-09 Derek Nigel John Hart Enzyme having s-adenosyl-l-homocysteine hydrolase (ahcy) type activity
GB9710475D0 (en) 1997-05-21 1997-07-16 Zeneca Ltd Gene silencing
EP2341058A3 (en) 1997-09-12 2011-11-23 Exiqon A/S Oligonucleotide Analogues
WO1999014346A3 (en) 1997-09-19 1999-05-27 Sequitur Inc SENSE mRNA THERAPY
JP4187413B2 (en) 1998-03-20 2008-11-26 コモンウェルス サイエンティフィック アンドインダストリアル リサーチ オーガナイゼーション Control of gene expression
EP3214177A3 (en) 1998-04-08 2017-11-22 Commonwealth Scientific and Industrial Research Organisation Methods and means for obtaining modified phenotypes
JP2003525017A (en) 1998-04-20 2003-08-26 リボザイム・ファーマシューティカルズ・インコーポレーテッド Nucleic acid molecules with novel chemical composition that can modulate gene expression
KR20010071315A (en) 1998-05-26 2001-07-28 한스 루돌프 하우스, 헨리테 브룬너, 베아트리체 귄터 DSRNA-mediated regulation of gene expression in plants
GB9827152D0 (en) 1998-07-03 1999-02-03 Devgen Nv Characterisation of gene function using double stranded rna inhibition
WO2000031271A1 (en) 1998-11-24 2000-06-02 Hisamitsu Pharmaceutical Co., Inc. Hiv infection inhibitors
WO2000032619A1 (en) 1998-11-30 2000-06-08 Ribogene, Inc. Methods and compositions for identification of inhibitors of ribosome assembly
WO2000063364A3 (en) 1999-04-21 2001-01-11 American Home Prod Methods and compositions for inhibiting the function of polynucleotide sequences
US6367949B1 (en) * 1999-08-04 2002-04-09 911 Emergency Products, Inc. Par 36 LED utility lamp
GB9925459D0 (en) * 1999-10-27 1999-12-29 Plant Bioscience Ltd Gene silencing
GB9927444D0 (en) 1999-11-19 2000-01-19 Cancer Res Campaign Tech Inhibiting gene expression
WO2001068826A3 (en) 2000-03-14 2002-05-23 Fonne Pfister Raymonde Protoporphyrinogen oxidase ('protox') genes
DK2028278T3 (en) 2000-03-30 2014-06-23 Univ Massachusetts RNA sequence-specific mediators of RNA interference
US20100305186A1 (en) 2000-05-30 2010-12-02 Johnson & Johnson Research Pty Limited Methods for mediating gene suppression
CA2430886A1 (en) 2000-12-08 2002-08-08 Invitrogen Corporation Compositions and methods for rapidly generating recombinant nucleic acid molecules
DE10163098B4 (en) 2001-10-12 2005-06-02 Alnylam Europe Ag Method of inhibiting the replication of viruses
DE10160151A1 (en) 2001-01-09 2003-06-26 Ribopharma Ag Inhibiting expression of target gene, useful e.g. for inhibiting oncogenes, by administering double-stranded RNA complementary to the target and having an overhang
WO2003035869A1 (en) 2001-10-26 2003-05-01 Ribopharma Ag Use of a double-stranded ribonucleic acid for specifically inhibiting the expression of a given target gene
EP1263250B1 (en) 2001-06-01 2004-03-24 Mobilkom Austria Aktiengesellschaft & Co KG Method to determine the location of a mobile station in a mobile radio system
US6586684B2 (en) * 2001-06-29 2003-07-01 Intel Corporation Circuit housing clamp and method of manufacture therefor
US6900289B2 (en) * 2001-08-22 2005-05-31 The University Of Hawaii Physalia fluorescent proteins
EP1572902B1 (en) 2002-02-01 2014-06-11 Life Technologies Corporation HIGH POTENCY siRNAS FOR REDUCING THE EXPRESSION OF TARGET GENES
WO2003099298A1 (en) 2002-05-24 2003-12-04 Max-Planck Gesellschaft zur Förderung der Wissenschaften e.V. Rna interference mediating small rna molecules
WO2003103600A3 (en) 2002-06-05 2004-10-07 Invitrogen Corp Methods and compositions for synthesis of nucleic acid molecules using multiple recognition sites
GB2406169B (en) 2002-06-12 2006-11-01 Ambion Inc Methods and compositions relating to labeled rna molecules that reduce gene expression
CA2489174C (en) 2002-07-10 2013-02-05 Thomas Tuschl Rna-interference by single-stranded rna molecules
DK1527176T4 (en) 2002-08-05 2017-07-03 Silence Therapeutics Gmbh Further new forms of interfering RNA molecules
US20050020521A1 (en) 2002-09-25 2005-01-27 University Of Massachusetts In vivo gene silencing by chemically modified and stable siRNA
US20040266706A1 (en) 2002-11-05 2004-12-30 Muthiah Manoharan Cross-linked oligomeric compounds and their use in gene modulation
EP2957568B1 (en) 2002-11-05 2016-12-21 Ionis Pharmaceuticals, Inc. Compositions comprising alternating 2'-modified nucleosides for use in gene modulation
JP4262471B2 (en) * 2002-11-12 2009-05-13 富士通株式会社 Biometric data acquisition device
US8090542B2 (en) 2002-11-14 2012-01-03 Dharmacon Inc. Functional and hyperfunctional siRNA
WO2004046324A3 (en) 2002-11-15 2005-08-04 Tariq M Rana Allele-targeted rna interference
WO2004063375A1 (en) 2003-01-15 2004-07-29 Hans Prydz OPTIMIZING siRNA BY RNAi ANTISENSE
EP2333063A1 (en) 2003-01-17 2011-06-15 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. Inducible small interfering RNA (sirna) expression constructs for targeted gene silencing
WO2004065600A3 (en) 2003-01-17 2005-02-17 Sayda Elbashir Rna interference by palindromic or modified rna molecules
KR20050115231A (en) 2003-02-10 2005-12-07 내셔날 인스티튜트 오브 어드밴스드 인더스트리얼 사이언스 앤드 테크놀로지 Regulation of mammalian cells
US7459547B2 (en) 2003-06-02 2008-12-02 University Of Massachusetts Methods and compositions for controlling efficacy of RNA silencing
US7507809B2 (en) 2005-01-07 2009-03-24 Alnylam Pharmaceuticals, Inc. RNAi modulation of RSV and therapeutic uses thereof

Patent Citations (95)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4469863A (en) * 1980-11-12 1984-09-04 Ts O Paul O P Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof
US5208149A (en) * 1983-10-20 1993-05-04 The Research Foundation Of State University Of New York Nucleic acid constructs containing stable stem and loop structures
US5580859A (en) * 1989-03-21 1996-12-03 Vical Incorporated Delivery of exogenous DNA sequences in a mammal
US6476205B1 (en) * 1989-10-24 2002-11-05 Isis Pharmaceuticals, Inc. 2′ Modified oligonucleotides
US5457189A (en) * 1989-12-04 1995-10-10 Isis Pharmaceuticals Antisense oligonucleotide inhibition of papillomavirus
US5514577A (en) * 1990-02-26 1996-05-07 Isis Pharmaceuticals, Inc. Oligonucleotide therapies for modulating the effects of herpes viruses
US5576208A (en) * 1991-06-14 1996-11-19 Isis Pharmaceuticals Inc. Antisense oligonucleotide inhibition of the RAS gene
US5795715A (en) * 1991-12-18 1998-08-18 Cis Bio International Process for preparing double-stranded RNA, and its applications
US5770580A (en) * 1992-04-13 1998-06-23 Baylor College Of Medicine Somatic gene therapy to cells associated with fluid spaces
US5972704A (en) * 1992-05-14 1999-10-26 Ribozyme Pharmaceuticals, Inc. HIV nef targeted ribozymes
US20030068301A1 (en) * 1992-05-14 2003-04-10 Kenneth Draper Method and reagent for inhibiting hepatitis B virus replication
US20030206887A1 (en) * 1992-05-14 2003-11-06 David Morrissey RNA interference mediated inhibition of hepatitis B virus (HBV) using short interfering nucleic acid (siNA)
US20040054156A1 (en) * 1992-05-14 2004-03-18 Kenneth Draper Method and reagent for inhibiting hepatitis B viral replication
US5594122A (en) * 1993-06-23 1997-01-14 Genesys Pharma Inc. Antisense oligonucleotides targeted against human immunodeficiency virus
US5624803A (en) * 1993-10-14 1997-04-29 The Regents Of The University Of California In vivo oligonucleotide generator, and methods of testing the binding affinity of triplex forming oligonucleotides derived therefrom
US5801154A (en) * 1993-10-18 1998-09-01 Isis Pharmaceuticals, Inc. Antisense oligonucleotide modulation of multidrug resistance-associated protein
US5908779A (en) * 1993-12-01 1999-06-01 University Of Connecticut Targeted RNA degradation using nuclear antisense RNA
US5578716A (en) * 1993-12-01 1996-11-26 Mcgill University DNA methyltransferase antisense oligonucleotides
US6001990A (en) * 1994-05-10 1999-12-14 The General Hospital Corporation Antisense inhibition of hepatitis C virus
US6057153A (en) * 1995-01-13 2000-05-02 Yale University Stabilized external guide sequences
US5624808A (en) * 1995-03-28 1997-04-29 Becton Dickinson And Company Method for identifying cells committed to apoptosis by determining cellular phosphotyrosine content
US5998203A (en) * 1996-04-16 1999-12-07 Ribozyme Pharmaceuticals, Inc. Enzymatic nucleic acids containing 5'-and/or 3'-cap structures
US6107094A (en) * 1996-06-06 2000-08-22 Isis Pharmaceuticals, Inc. Oligoribonucleotides and ribonucleases for cleaving RNA
US5898031A (en) * 1996-06-06 1999-04-27 Isis Pharmaceuticals, Inc. Oligoribonucleotides for cleaving RNA
US6225290B1 (en) * 1996-09-19 2001-05-01 The Regents Of The University Of California Systemic gene therapy by intestinal cell transformation
US5814500A (en) * 1996-10-31 1998-09-29 The Johns Hopkins University School Of Medicine Delivery construct for antisense nucleic acids and methods of use
US20030064945A1 (en) * 1997-01-31 2003-04-03 Saghir Akhtar Enzymatic nucleic acid treatment of diseases or conditions related to levels of epidermal growth factor receptors
US6635805B1 (en) * 1997-02-14 2003-10-21 Plant Bioscience Limited Methods and DNA constructs for gene silencing in transgenic plants
US6218142B1 (en) * 1997-03-05 2001-04-17 Michael Wassenegger Nucleic acid molecules encoding polypeptides having the enzymatic activity of an RNA-directed RNA polymerase (RDRP)
US6531647B1 (en) * 1997-09-22 2003-03-11 Plant Bioscience Limited Gene silencing methods
US20030056235A1 (en) * 1997-12-23 2003-03-20 The Carnegie Institution Of Washington Genetic inhibition by double-stranded RNA
US6506559B1 (en) * 1997-12-23 2003-01-14 Carnegie Institute Of Washington Genetic inhibition by double-stranded RNA
US20030051263A1 (en) * 1997-12-23 2003-03-13 The Carnegie Institution Of Washington Genetic inhibition by double-stranded RNA
US20030055020A1 (en) * 1997-12-23 2003-03-20 The Carnegie Institution Of Washington Genetic inhibition by double-stranded RNA
US6475726B1 (en) * 1998-01-09 2002-11-05 Cubist Pharmaceuticals, Inc. Method for identifying validated target and assay combinations for drug development
US6573099B2 (en) * 1998-03-20 2003-06-03 Benitec Australia, Ltd. Genetic constructs for delaying or repressing the expression of a target gene
US20030171311A1 (en) * 1998-04-27 2003-09-11 Lawrence Blatt Enzymatic nucleic acid treatment of diseases or conditions related to hepatitis C virus infection
US6573009B1 (en) * 1998-08-05 2003-06-03 Sony Corporation Electrolyte containing a crosslinked compound having ether linkages and a high-molecular compound
US6939712B1 (en) * 1998-12-29 2005-09-06 Impedagen, Llc Muting gene activity using a transgenic nucleic acid
US20050282764A1 (en) * 1998-12-29 2005-12-22 Bahramian Mohammad B Method of identifying nucleic acid compositions for muting expression of a gene
US20020114784A1 (en) * 1999-01-28 2002-08-22 Medical College Of Georgia Research Institute, Inc. Composition and method for in vivo and in vitro attenuation of gene expression using double stranded RNA
US20050100907A1 (en) * 1999-01-30 2005-05-12 Ribopharma, Ag Method and medicament for inhibiting the expression of a given gene
US20040072779A1 (en) * 1999-01-30 2004-04-15 Ribopharma Ag Method and medicament for inhibiting the expression of a given gene
US20040102408A1 (en) * 1999-01-30 2004-05-27 Ribopharma Ag Method and medicament for inhibiting the expression of a given gene
US20040053875A1 (en) * 1999-01-30 2004-03-18 Ribopharma Ag Method and medicament for inhibiting the expression of a given gene
US20040214330A1 (en) * 1999-04-07 2004-10-28 Waterhouse Peter Michael Methods and means for obtaining modified phenotypes
US20040002153A1 (en) * 1999-07-21 2004-01-01 Monia Brett P. Modulation of PTEN expression via oligomeric compounds
US20040175703A1 (en) * 1999-11-24 2004-09-09 Ribopharma Ag Compositions and methods for inhibiting expression of a target gene
US20020137210A1 (en) * 1999-12-09 2002-09-26 Churikov Nikolai Andreevich Method for modifying genetic characteristics of an organism
US20030084471A1 (en) * 2000-03-16 2003-05-01 David Beach Methods and compositions for RNA interference
US20020162126A1 (en) * 2000-03-16 2002-10-31 David Beach Methods and compositions for RNA interference
US20040086884A1 (en) * 2000-03-16 2004-05-06 Genetica, Inc. Methods and compositions for RNA interference
US20040018999A1 (en) * 2000-03-16 2004-01-29 David Beach Methods and compositions for RNA interference
US20070003961A1 (en) * 2000-03-30 2007-01-04 Whitehead Institute For Biomedical Research RNA sequence-specific mediators of RNA interference
US20070003963A1 (en) * 2000-03-30 2007-01-04 Whitehead Institute For Biomedical Research RNA sequence-specific mediators of RNA interference
US20080132461A1 (en) * 2000-03-30 2008-06-05 Whitehead Institute For Biomedical Research RNA sequence-specific mediators of RNA interference
US20070003962A1 (en) * 2000-03-30 2007-01-04 Whitehead Institute For Biomedical Research RNA sequence-specific mediators of RNA interference
US20070003960A1 (en) * 2000-03-30 2007-01-04 Whitehead Institute For Biomedical Research RNA sequence-specific mediators of RNA interference
US20030108923A1 (en) * 2000-03-30 2003-06-12 Whitehead Institute For Biomedical Research RNA sequence-specific mediators of RNA interference
US20040229266A1 (en) * 2000-12-01 2004-11-18 Max-Planck-Gesellschaft Zur Forderung Der Wissenschaften E.V. RNA interference mediating small RNA molecules
US20070093445A1 (en) * 2000-12-01 2007-04-26 Max-Planck-Gesellschaft Zur Forderung Der Wissenschaften E. V. RNA interference mediating small RNA molecules
US20050234006A1 (en) * 2000-12-01 2005-10-20 Max-Planck-Gesellschaft Zur Forderung Der Wissenschaften E.V. RNA interference mediating small RNA molecules
US20050234007A1 (en) * 2000-12-01 2005-10-20 Max-Planck-Gesellschaft Zur Forderung Der Wissenschaften E.V. RNA interference mediating small RNA molecules
US20040259247A1 (en) * 2000-12-01 2004-12-23 Thomas Tuschl Rna interference mediating small rna molecules
US20050026278A1 (en) * 2000-12-01 2005-02-03 Max-Planck-Gesellschaft Zur Forderung Der Wissenschaften E.V. RNA interference mediating small RNA molecules
US7078196B2 (en) * 2000-12-01 2006-07-18 Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften, E.V. RNA interference mediating small RNA molecules
US7056704B2 (en) * 2000-12-01 2006-06-06 Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften E.V. RNA interference mediating small RNA molecules
US20040259248A1 (en) * 2000-12-01 2004-12-23 Max-Planck-Gesellschaft Zur Forderung Der Wissenschaften E.V. RNA interference mediating small RNA molecules
US20020160393A1 (en) * 2000-12-28 2002-10-31 Symonds Geoffrey P. Double-stranded RNA-mediated gene suppression
US20060084621A1 (en) * 2001-01-09 2006-04-20 Hans-Peter Vornlocher Compositions and methods for inhibiting expression of anti-apoptotic genes
US20040001811A1 (en) * 2001-01-09 2004-01-01 Ribopharma Ag Compositions and methods for inhibiting expression of anti-apoptotic genes
US20020132257A1 (en) * 2001-01-31 2002-09-19 Tony Giordano Use of post-transcriptional gene silencing for identifying nucleic acid sequences that modulate the function of a cell
US20030153521A1 (en) * 2001-05-29 2003-08-14 Mcswiggen James Nucleic acid treatment of diseases or conditions related to levels of Ras
US20040006035A1 (en) * 2001-05-29 2004-01-08 Dennis Macejak Nucleic acid mediated disruption of HIV fusogenic peptide interactions
US20030140362A1 (en) * 2001-06-08 2003-07-24 Dennis Macejak In vivo models for screening inhibitors of hepatitis B virus
US7232806B2 (en) * 2001-09-28 2007-06-19 Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften E.V. MicroRNA molecules
US20040038921A1 (en) * 2001-10-26 2004-02-26 Ribopharma Ag Composition and method for inhibiting expression of a target gene
US20040126791A1 (en) * 2001-10-26 2004-07-01 Ribopharma Ag Compositions and methods for treating trail-resistant cancer cells
US20040248835A1 (en) * 2001-10-26 2004-12-09 Anja Krebs Use of a double-stranded ribonucleic acid for treating an infection with a positivestrand rna-virus
US20040121348A1 (en) * 2001-10-26 2004-06-24 Ribopharma Ag Compositions and methods for treating pancreatic cancer
US20030148985A1 (en) * 2001-12-05 2003-08-07 David Morrissey Methods and reagents for the inhibition of hepatitis B virus replication
US20030190654A1 (en) * 2002-01-22 2003-10-09 Ribopharma Double-stranded RNA (dsRNA) and method of use for inhibiting expression of a fusion gene
US20040096843A1 (en) * 2002-02-14 2004-05-20 Rossi John J. Methods for producing interfering RNA molecules in mammalian cells and therapeutic uses for such molecules
US20040019001A1 (en) * 2002-02-20 2004-01-29 Mcswiggen James A. RNA interference mediated inhibition of protein typrosine phosphatase-1B (PTP-1B) gene expression using short interfering RNA
US20040192626A1 (en) * 2002-02-20 2004-09-30 Mcswiggen James RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US20040005593A1 (en) * 2002-03-06 2004-01-08 Rigel Pharmaceuticals, Inc. Novel method for delivery and intracellular synthesis of siRNA molecules
US20040248296A1 (en) * 2002-03-20 2004-12-09 Beresford Paul J. HIV therapeutic
US20030180756A1 (en) * 2002-03-21 2003-09-25 Yang Shi Compositions and methods for suppressing eukaryotic gene expression
US20040053876A1 (en) * 2002-03-26 2004-03-18 The Regents Of The University Of Michigan siRNAs and uses therof
US20040241854A1 (en) * 2002-08-05 2004-12-02 Davidson Beverly L. siRNA-mediated gene silencing
US20040203145A1 (en) * 2002-08-07 2004-10-14 University Of Massachusetts Compositions for RNA interference and methods of use thereof
US20040137471A1 (en) * 2002-09-18 2004-07-15 Timothy Vickers Efficient reduction of target RNA's by single-and double-stranded oligomeric compounds
US20040191905A1 (en) * 2002-11-22 2004-09-30 University Of Massachusetts Modulation of HIV replication by RNA interference
US20040224328A1 (en) * 2003-01-15 2004-11-11 Hans Prydz siRNA screening method
US20040231016A1 (en) * 2003-02-19 2004-11-18 Commonwealth Scientific And Industrial Research Organization Efficient gene silencing in plants using short dsRNA sequences

Cited By (1079)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060223990A1 (en) * 1992-05-11 2006-10-05 Sirna Therapeutics, Inc. Synthesis, deprotection, analysis & purification of RNA & ribozymes
US20030206887A1 (en) * 1992-05-14 2003-11-06 David Morrissey RNA interference mediated inhibition of hepatitis B virus (HBV) using short interfering nucleic acid (siNA)
US20060142557A1 (en) * 1994-03-29 2006-06-29 Sirna Therapeutics, Inc. 2'-deoxy-2'alkylnucleotide containing nucleic acid
US20100167377A1 (en) * 1997-12-22 2010-07-01 Whitt Michael A Recombinant viruses comprising the membrane-proximal domain of VSV G protein
US7994295B2 (en) 1997-12-22 2011-08-09 The University Of Tennessee Research Corporation Recombinant viruses comprising the membrane-proximal domain of VSV G protein
US8283329B2 (en) 1997-12-23 2012-10-09 The Carnegie Institution Of Washington Genetic inhibition of double-stranded RNA
US20030056235A1 (en) * 1997-12-23 2003-03-20 The Carnegie Institution Of Washington Genetic inhibition by double-stranded RNA
US7538095B2 (en) 1997-12-23 2009-05-26 The Carnegie Institution Of Washington Genetic inhibition by double-stranded RNA
US9102939B2 (en) 1997-12-23 2015-08-11 The Carnegie Institution Of Washington Genetic inhibition by double-stranded RNA
US20080050342A1 (en) * 1997-12-23 2008-02-28 Carnegie Institution Of Washington Genetic inhibition by double-stranded RNA
US8580754B2 (en) 1997-12-23 2013-11-12 Carnegie Institution Of Washington Genetic inhibition by double-stranded RNA
US8168774B2 (en) 1998-03-20 2012-05-01 Commonwealth Scientific And Industrial Research Organisation Control of gene expression
US20060014715A1 (en) * 1998-03-20 2006-01-19 Benitec Australia Limited Control of gene expression
US9029527B2 (en) 1998-03-20 2015-05-12 Commonwealth Scientific And Industrial Research Organisation Synthetic genes and genetic constructs
US20040266005A1 (en) * 1998-03-20 2004-12-30 Benitec Australia Limited Synthetic genes and genetic constructs
US8067383B2 (en) 1998-03-20 2011-11-29 Commonwealth Scientific And Industrial Research Organisation Synthetic genes and genetic constructs comprising same I
US20040180439A1 (en) * 1998-03-20 2004-09-16 Benitec Australia Limited Synthetic genes and genetic constructs
US8048670B2 (en) 1998-03-20 2011-11-01 Commonwealth Scientific And Industrial Research Organisation Synthetic genes and genetic constructs
US7754697B2 (en) 1998-03-20 2010-07-13 Commonwealth Scientific And Industrial Research Organisation Control of gene expression
US8053419B2 (en) 1998-03-20 2011-11-08 Commonwealth Scientific And Industrial Research Organisation Synthetic genes and genetic constructs
US8431547B2 (en) 1998-03-20 2013-04-30 Commonwealth Scientific And Industrial Research Organisation Synthetic genes and genetic constructs
US20030228597A1 (en) * 1998-04-13 2003-12-11 Cowsert Lex M. Identification of genetic targets for modulation by oligonucleotides and generation of oligonucleotides for gene modulation
US20050176018A1 (en) * 1998-04-20 2005-08-11 Sirna Therapeutics, Inc. Chemically modified double stranded nucleic acid molecules
US20060172925A1 (en) * 1998-10-26 2006-08-03 Board Of Regents, The University Of Texas System Thio-siRNA aptamers
US20090156520A1 (en) * 1999-01-28 2009-06-18 Med. College Of Georgia Research Institute, Inc. Composition and method for in vivo and in vitro attenuation of gene expression using double stranded RNA
US20020114784A1 (en) * 1999-01-28 2002-08-22 Medical College Of Georgia Research Institute, Inc. Composition and method for in vivo and in vitro attenuation of gene expression using double stranded RNA
US20040147475A1 (en) * 1999-01-28 2004-07-29 Medical College Of Georgia Research Institute, Inc. Composition and method for in vivo and in vitro attenuation of gene expression using double stranded RNA
US20090215880A1 (en) * 1999-01-28 2009-08-27 Med. College Of Georgia Research Institute, Inc. Composition and Method for IN VIVO and IN VITRO Attenuation of Gene Expression Using Double Stranded RNA
US7888325B2 (en) 1999-01-28 2011-02-15 Medical College Of Georgia Research Institute, Inc. Composition and method for in vivo and in vitro attenuation of gene expression using double stranded RNA
US8148345B2 (en) 1999-01-28 2012-04-03 Georgia Health Sciences University Research Institute, Inc. Composition and method for in vivo and in vitro attenuation of gene expression using double stranded RNA
US20080166800A1 (en) * 1999-01-30 2008-07-10 Roland Kreutzer Method and medicament for inhibiting the expression of a given gene
US20040072779A1 (en) * 1999-01-30 2004-04-15 Ribopharma Ag Method and medicament for inhibiting the expression of a given gene
US8119608B2 (en) 1999-01-30 2012-02-21 Alnylam Pharmaceuticals, Inc. Method and medicament for inhibiting the expression of a given gene
US8114981B2 (en) 1999-01-30 2012-02-14 Alnylam Pharmaceuticals, Inc. Method and medicament for inhibiting the expression of a given gene
US9133454B2 (en) 1999-01-30 2015-09-15 Alnylam Pharmaceuticals, Inc. Method and medicament for inhibiting the expression of a given gene
US20040102408A1 (en) * 1999-01-30 2004-05-27 Ribopharma Ag Method and medicament for inhibiting the expression of a given gene
US8729037B2 (en) 1999-01-30 2014-05-20 Alnylam Pharmaceuticals, Inc. Method and medicament for inhibiting the expression of a given gene
US20050100907A1 (en) * 1999-01-30 2005-05-12 Ribopharma, Ag Method and medicament for inhibiting the expression of a given gene
US20040053875A1 (en) * 1999-01-30 2004-03-18 Ribopharma Ag Method and medicament for inhibiting the expression of a given gene
US8183362B2 (en) 1999-01-30 2012-05-22 Alnylam Pharmaceuticals, Inc. Method and medicament for inhibiting the expression of a given gene
US8101584B2 (en) 1999-01-30 2012-01-24 Alnylam Pharmaceuticals, Inc. Method and medicament for inhibiting the expression of a given gene
US8168776B2 (en) 1999-01-30 2012-05-01 Alnylam Pharmaceuticals, Inc. Method for making a 21 nucleotide double stranded RNA chemically linked at one end
US20080261303A1 (en) * 1999-01-30 2008-10-23 Roland Kreutzer Method and medicament for inhibiting the expression of a given gene
US8101742B2 (en) 1999-01-30 2012-01-24 Alnylam Pharmaceuticals, Inc. Method and medicament for inhibiting the expression of a given gene
US8114851B2 (en) 1999-01-30 2012-02-14 Alnylam Pharmaceuticals, Inc. Method and medicament for inhibiting the expression of a given gene
US20080171861A1 (en) * 1999-01-30 2008-07-17 Roland Kreutzer Method and medicament for inhibiting the expression of a given gene
US8202980B2 (en) 1999-01-30 2012-06-19 Alnylam Pharmaceuticals, Inc. Method and medicament for inhibiting the expression of a given gene
US20080182981A1 (en) * 1999-01-30 2008-07-31 Roland Kreutzer Method and medicament for inhibiting the expression of a given gene
US20080081792A1 (en) * 1999-04-21 2008-04-03 Wyeth Methods and compositions for inhibiting the function of polynucleotide sequences
US20040198690A1 (en) * 1999-04-21 2004-10-07 Wyeth Methods and compositions for inhibiting the function of polynucleotide sequences
US20070219151A1 (en) * 1999-04-21 2007-09-20 Wyeth Methods and compositions for inhibiting the function of polynucleotide sequences
US20040002153A1 (en) * 1999-07-21 2004-01-01 Monia Brett P. Modulation of PTEN expression via oligomeric compounds
US9708621B2 (en) 1999-08-13 2017-07-18 Commonwealth Scientific And Industrial Research Organisation Methods and means for obtaining modified phenotypes
US20050251877A1 (en) * 1999-08-13 2005-11-10 Commonwealth Scientific And Industrial Research Organization (Csiro) Methods and means for obtaining modified phenotypes
US8183217B2 (en) 1999-08-13 2012-05-22 Commonwealth Scientific And Industrial Research Organisation Methods and means for obtaining modified phenotypes
US8334374B2 (en) 1999-08-13 2012-12-18 Commonwealth Scientific And Industrial Research Organisation Methods and means for obtaining modified phenotypes
US20040242521A1 (en) * 1999-10-25 2004-12-02 Board Of Regents, The University Of Texas System Thio-siRNA aptamers
US20060168669A1 (en) * 1999-10-27 2006-07-27 Baulcombe David C Gene silencing
US8097710B2 (en) 1999-10-27 2012-01-17 Plant Bioscience Limited Gene silencing
US20050102709A1 (en) * 1999-10-27 2005-05-12 Plant Bioscience Limited RNA molecules and vectors for gene silencing
US8299235B2 (en) 1999-10-27 2012-10-30 Plant Bioscience Limited RNA molecules and vectors for gene silencing
US20090288182A1 (en) * 1999-10-27 2009-11-19 David Charles Baulcombe Gene silencing
US8759102B2 (en) 1999-10-27 2014-06-24 Plant Bioscience Limited Short RNA producing gene silencing in cells
US8349607B2 (en) 1999-10-27 2013-01-08 Plant Bioscience Limited Gene silencing
US7704688B2 (en) 1999-10-27 2010-04-27 Plant Bioscience Limited Methods of detecting silencing mammalian cells
US8263569B2 (en) 1999-10-27 2012-09-11 Plant Biosciences Limited Gene silencing
US20090286254A1 (en) * 1999-10-27 2009-11-19 David Charles Baulcombe Gene silencing
US20080312176A1 (en) * 1999-10-27 2008-12-18 David Charles Baulcombe Gene silencing
US8258285B2 (en) 1999-10-27 2012-09-04 Plant Bioscience Limited RNA molecules and vectors for gene silencing
US8779236B2 (en) 1999-10-27 2014-07-15 Plant Bioscience Limited Gene silencing
US20050102710A1 (en) * 1999-10-27 2005-05-12 Plant Bioscience Limited Cells and animals produced by gene silencing
US7829693B2 (en) 1999-11-24 2010-11-09 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of a target gene
US20040175703A1 (en) * 1999-11-24 2004-09-09 Ribopharma Ag Compositions and methods for inhibiting expression of a target gene
US20070026394A1 (en) * 2000-02-11 2007-02-01 Lawrence Blatt Modulation of gene expression associated with inflammation proliferation and neurite outgrowth using nucleic acid based technologies
US20050261212A1 (en) * 2000-02-11 2005-11-24 Mcswiggen James A RNA interference mediated inhibition of NOGO and NOGO receptor gene expression using short interfering RNA
US20080213861A1 (en) * 2000-03-16 2008-09-04 Hannon Gregory J Methods and compositions for RNA interference
US8153776B2 (en) 2000-03-16 2012-04-10 Cold Spring Harbor Laboratory Methods and compositions for RNA interference
US20040018999A1 (en) * 2000-03-16 2004-01-29 David Beach Methods and compositions for RNA interference
US8383599B2 (en) 2000-03-16 2013-02-26 Cold Spring Harbor Laboratory Methods and compositions for RNA interference
US20060135456A1 (en) * 2000-03-16 2006-06-22 Hannon Gregory J Methods and compositions for RNA interference
US20030084471A1 (en) * 2000-03-16 2003-05-01 David Beach Methods and compositions for RNA interference
US20090193531A1 (en) * 2000-03-16 2009-07-30 Cold Spring Harbor Laboratory Methods and compositions for RNA Interference
US20020162126A1 (en) * 2000-03-16 2002-10-31 David Beach Methods and compositions for RNA interference
US7732417B2 (en) 2000-03-16 2010-06-08 Cold Spring Harbor Laboratory Methods and compositions for RNA interference using recombinant Dicer and Argonaut
US8202846B2 (en) 2000-03-16 2012-06-19 Cold Spring Harbor Laboratory Methods and compositions for RNA interference
US20040086884A1 (en) * 2000-03-16 2004-05-06 Genetica, Inc. Methods and compositions for RNA interference
US20030182672A1 (en) * 2000-03-17 2003-09-25 Graham Michael Wayne Genetic silencing
US9012621B2 (en) 2000-03-30 2015-04-21 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. RNA sequence-specific mediators of RNA interference
US20090186843A1 (en) * 2000-03-30 2009-07-23 Whitehead Institute For Biomedical Research RNA sequence-specific mediators of RNA interference
US20070003960A1 (en) * 2000-03-30 2007-01-04 Whitehead Institute For Biomedical Research RNA sequence-specific mediators of RNA interference
US20070003963A1 (en) * 2000-03-30 2007-01-04 Whitehead Institute For Biomedical Research RNA sequence-specific mediators of RNA interference
US20070003962A1 (en) * 2000-03-30 2007-01-04 Whitehead Institute For Biomedical Research RNA sequence-specific mediators of RNA interference
US20070003961A1 (en) * 2000-03-30 2007-01-04 Whitehead Institute For Biomedical Research RNA sequence-specific mediators of RNA interference
US8790922B2 (en) 2000-03-30 2014-07-29 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. RNA sequence-specific mediators of RNA interference
US20080132461A1 (en) * 2000-03-30 2008-06-05 Whitehead Institute For Biomedical Research RNA sequence-specific mediators of RNA interference
US9193753B2 (en) 2000-03-30 2015-11-24 University Of Massachusetts RNA sequence-specific mediators of RNA interference
US8394628B2 (en) 2000-03-30 2013-03-12 University Of Massachusetts RNA sequence-specific mediators of RNA interference
US8420391B2 (en) 2000-03-30 2013-04-16 University Of Massachusetts RNA sequence-specific mediators of RNA interference
US9012138B2 (en) 2000-03-30 2015-04-21 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. RNA sequence-specific mediators of RNA interference
US8552171B2 (en) 2000-03-30 2013-10-08 University Of Massachusetts RNA sequence-specific mediators of RNA interference
US8632997B2 (en) 2000-03-30 2014-01-21 University Of Massachusetts RNA sequence-specific mediators of RNA interference
US8742092B2 (en) 2000-03-30 2014-06-03 University Of Massachusetts RNA sequence-specific mediators of RNA interference
US20040053869A1 (en) * 2000-08-19 2004-03-18 Peter Andrews Stem cell differentiation
US8796016B2 (en) 2000-12-01 2014-08-05 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. RNA interference mediating small RNA molecules
US7078196B2 (en) 2000-12-01 2006-07-18 Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften, E.V. RNA interference mediating small RNA molecules
US20070093445A1 (en) * 2000-12-01 2007-04-26 Max-Planck-Gesellschaft Zur Forderung Der Wissenschaften E. V. RNA interference mediating small RNA molecules
US20110112283A1 (en) * 2000-12-01 2011-05-12 Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften E.V. Rna interference mediating small rna molecules
US20040259247A1 (en) * 2000-12-01 2004-12-23 Thomas Tuschl Rna interference mediating small rna molecules
US20110054159A1 (en) * 2000-12-01 2011-03-03 Maxplanck-Gesellschaft Zur Foerderung Der Wissenschaften E.V. Rna interference mediating small rna molecules
US20040229266A1 (en) * 2000-12-01 2004-11-18 Max-Planck-Gesellschaft Zur Forderung Der Wissenschaften E.V. RNA interference mediating small RNA molecules
US20040259248A1 (en) * 2000-12-01 2004-12-23 Max-Planck-Gesellschaft Zur Forderung Der Wissenschaften E.V. RNA interference mediating small RNA molecules
US8933044B2 (en) 2000-12-01 2015-01-13 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. RNA interference mediating small RNA molecules
US8993745B2 (en) 2000-12-01 2015-03-31 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. RNA interference mediating small RNA molecules
US20090155174A1 (en) * 2000-12-01 2009-06-18 Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften E.V. RNA Interference Mediating Small RNA Molecules
US7056704B2 (en) 2000-12-01 2006-06-06 Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften E.V. RNA interference mediating small RNA molecules
US8765930B2 (en) 2000-12-01 2014-07-01 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. RNA interference mediating small RNA molecules
US8329463B2 (en) 2000-12-01 2012-12-11 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. RNA interference mediating small RNA molecules
US8445237B2 (en) 2000-12-01 2013-05-21 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. RNA interference mediating small RNA molecules
US20100010207A1 (en) * 2000-12-01 2010-01-14 Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften E.V. Rna interference mediating small rna molecules
US20050234006A1 (en) * 2000-12-01 2005-10-20 Max-Planck-Gesellschaft Zur Forderung Der Wissenschaften E.V. RNA interference mediating small RNA molecules
US20110020234A1 (en) * 2000-12-01 2011-01-27 Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften E.V. Rna interference mediating small rna molecules
US20050026278A1 (en) * 2000-12-01 2005-02-03 Max-Planck-Gesellschaft Zur Forderung Der Wissenschaften E.V. RNA interference mediating small RNA molecules
US20080269147A1 (en) * 2000-12-01 2008-10-30 Max-Planck-Gesellschaft Zur Forderung Der Wissenschaften E.V. RNA interference mediating small RNA molecules
US8895721B2 (en) 2000-12-01 2014-11-25 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. RNA interference mediating small RNA molecules
US8853384B2 (en) 2000-12-01 2014-10-07 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. RNA interference mediating small RNA molecules
US8778902B2 (en) 2000-12-01 2014-07-15 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. RNA interference mediating small RNA molecules
US8372968B2 (en) 2000-12-01 2013-02-12 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. RNA interference mediating small RNA molecules
US8362231B2 (en) 2000-12-01 2013-01-29 Max-Planck-Gesellschaft zur Föderung der Wissenschaften E.V. RNA interference mediating small RNA molecules
US20050234007A1 (en) * 2000-12-01 2005-10-20 Max-Planck-Gesellschaft Zur Forderung Der Wissenschaften E.V. RNA interference mediating small RNA molecules
US8895718B2 (en) 2000-12-01 2014-11-25 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. RNA interference mediating small RNA molecules
US20060084621A1 (en) * 2001-01-09 2006-04-20 Hans-Peter Vornlocher Compositions and methods for inhibiting expression of anti-apoptotic genes
US9074213B2 (en) 2001-01-09 2015-07-07 Alnylam Pharmacuticals, Inc. Compositions and methods for inhibiting expression of a target gene
US9587240B2 (en) 2001-01-09 2017-03-07 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of a target gene
US20090053808A1 (en) * 2001-01-09 2009-02-26 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting the expression of anti-apoptopic genes
US7473525B2 (en) 2001-01-09 2009-01-06 Alnylam Europe Ag Compositions and methods for inhibiting expression of anti-apoptotic genes
US7423142B2 (en) 2001-01-09 2008-09-09 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of anti-apoptotic genes
US7868160B2 (en) 2001-01-09 2011-01-11 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of anti-apoptotic genes
US20040001811A1 (en) * 2001-01-09 2004-01-01 Ribopharma Ag Compositions and methods for inhibiting expression of anti-apoptotic genes
US7767802B2 (en) 2001-01-09 2010-08-03 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of anti-apoptotic genes
US9051566B2 (en) 2001-01-31 2015-06-09 Alnylam Pharmaceuticals, Inc. Post-transcriptional gene silencing using expressed double stranded RNA
US20040152117A1 (en) * 2001-01-31 2004-08-05 Tony Giordano Use of post-transcriptional gene silencing for identifying nucleic acid sequences that modulate the function of a cell
US20030191077A1 (en) * 2001-04-05 2003-10-09 Kathy Fosnaugh Method and reagent for the treatment of asthma and allergic conditions
US20060154271A1 (en) * 2001-04-05 2006-07-13 Sirna Therapeutics, Inc. Enzymatic nucleic acid treatment of diseases or conditions related to levels of IKK-gamma and PKR
US20050124569A1 (en) * 2001-05-18 2005-06-09 Sirna Therapeutics, Inc. RNA interference mediated inhibition of CXCR4 gene expression using short interfering nucleic acid (siNA)
US20090299045A1 (en) * 2001-05-18 2009-12-03 Sirna Therapeutics, Inc. RNA Interference Mediated Inhibition Of Interleukin and Interleukin Gene Expression Using Short Interfering Nucleic Acid (siNA)
US20050203040A1 (en) * 2001-05-18 2005-09-15 Sirna Therapeutics, Inc. RNA interference mediated inhibition of vascular cell adhesion molecule (VCAM) gene expression using short interfering nucleic acid (siNA)
US20050282188A1 (en) * 2001-05-18 2005-12-22 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using short interfering nucleic acid (siNA)
US20050287128A1 (en) * 2001-05-18 2005-12-29 Sirna Therapeutics, Inc. RNA interference mediated inhibition of TGF-beta and TGF-beta receptor gene expression using short interfering nucleic acid (siNA)
US20050079610A1 (en) * 2001-05-18 2005-04-14 Sirna Therapeutics, Inc. RNA interference mediated inhibition of Fos gene expression using short interfering nucleic acid (siNA)
US20050288242A1 (en) * 2001-05-18 2005-12-29 Sirna Therapeutics, Inc. RNA interference mediated inhibition of RAS gene expression using short interfering nucleic acid (siNA)
US20050196781A1 (en) * 2001-05-18 2005-09-08 Sirna Therapeutics, Inc. RNA interference mediated inhibition of STAT3 gene expression using short interfering nucleic acid (siNA)
US20050196767A1 (en) * 2001-05-18 2005-09-08 Sirna Therapeutics, Inc. RNA interference mediated inhibition of GRB2 associated binding protein (GAB2) gene expression using short interfering nucleic acis (siNA)
US20050032733A1 (en) * 2001-05-18 2005-02-10 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (SiNA)
US20050267058A1 (en) * 2001-05-18 2005-12-01 Sirna Therapeutics, Inc. RNA interference mediated inhibition of placental growth factor gene expression using short interfering nucleic acid (sINA)
US20050137155A1 (en) * 2001-05-18 2005-06-23 Sirna Therapeutics, Inc. RNA interference mediated treatment of Parkinson disease using short interfering nucleic acid (siNA)
US20050191618A1 (en) * 2001-05-18 2005-09-01 Sirna Therapeutics, Inc. RNA interference mediated inhibition of human immunodeficiency virus (HIV) gene expression using short interfering nucleic acid (siNA)
US20070093437A1 (en) * 2001-05-18 2007-04-26 Sirna Therapeutics, Inc. Rna interference mediated inhibition of xiap gene expression using short interfering nucleic acid (sina)
US20050187174A1 (en) * 2001-05-18 2005-08-25 Sirna Therapeutics, Inc. RNA interference mediated inhibition of intercellular adhesion molecule (ICAM) gene expression using short interfering nucleic acid (siNA)
US20050261219A1 (en) * 2001-05-18 2005-11-24 Sirna Therapeutics, Inc. RNA interference mediated inhibition of interleukin and interleukin receptor gene expression using short interfering nucleic acid (siNA)
US20050209180A1 (en) * 2001-05-18 2005-09-22 Sirna Therapeutics, Inc. RNA interference mediated inhibition of hepatitis C virus (HCV) expression using short interfering nucleic acid (siNA)
US20070270579A1 (en) * 2001-05-18 2007-11-22 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using short interfering nucleic acid (siNA)
US7858625B2 (en) 2001-05-18 2010-12-28 Sirna Therapeutics, Inc. Conjugates and compositions for cellular delivery
US20080188430A1 (en) * 2001-05-18 2008-08-07 Sirna Therapeutics, Inc. RNA interference mediated inhibition of hypoxia inducible factor 1 (HIF1) gene expression using short interfering nucleic acid (siNA)
US20050182007A1 (en) * 2001-05-18 2005-08-18 Sirna Therapeutics, Inc. RNA interference mediated inhibition of interleukin and interleukin receptor gene expression using short interfering nucleic acid (SINA)
US20050124566A1 (en) * 2001-05-18 2005-06-09 Sirna Therapeutics, Inc. RNA interference mediated inhibition of myostatin gene expression using short interfering nucleic acid (siNA)
US20050136436A1 (en) * 2001-05-18 2005-06-23 Sirna Therapeutics, Inc. RNA interference mediated inhibition of G72 and D-amino acid oxidase (DAAO) gene expression using short interfering nucleic acid (siNA)
US20050176666A1 (en) * 2001-05-18 2005-08-11 Sirna Therapeutics, Inc. RNA interference mediated inhibition of GPRA and AAA1 gene expression using short interfering nucleic acid (siNA)
US20050176663A1 (en) * 2001-05-18 2005-08-11 Sima Therapeutics, Inc. RNA interference mediated inhibition of protein tyrosine phosphatase type IVA (PRL3) gene expression using short interfering nucleic acid (siNA)
US20060241075A1 (en) * 2001-05-18 2006-10-26 Sirna Therapeutics, Inc. RNA interference mediated inhibition of desmoglein gene expression using short interfering nucleic acid (siNA)
US20050164224A1 (en) * 2001-05-18 2005-07-28 Sirna Therapeutics, Inc. RNA interference mediated inhibition of cyclin D1 gene expression using short interfering nucleic acid (siNA)
US20060142225A1 (en) * 2001-05-18 2006-06-29 Sirna Therapeutics, Inc. RNA interference mediated inhibition of cyclin dependent kinase-2 (CDK2) gene expression using short interfering nucleic acid (siNA)
US20050164968A1 (en) * 2001-05-18 2005-07-28 Sirna Therapeutics, Inc. RNA interference mediated inhibition of ADAM33 gene expression using short interfering nucleic acid (siNA)
US20050164967A1 (en) * 2001-05-18 2005-07-28 Sirna Therapeutics, Inc. RNA interference mediated inhibition of platelet-derived endothelial cell growth factor (ECGF1) gene expression using short interfering nucleic acid (siNA)
US20080161256A1 (en) * 2001-05-18 2008-07-03 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using short interfering nucleic acid (siNA)
US20050222066A1 (en) * 2001-05-18 2005-10-06 Sirna Therapeutics, Inc. RNA interference mediated inhibition of vascular endothelial growth factor and vascular endothelial growth factor receptor gene expression using short interfering nucleic acid (siNA)
US20050159381A1 (en) * 2001-05-18 2005-07-21 Sirna Therapeutics, Inc. RNA interference mediated inhibition of chromosome translocation gene expression using short interfering nucleic acid (siNA)
US20050159382A1 (en) * 2001-05-18 2005-07-21 Sirna Therapeutics, Inc. RNA interference mediated inhibition of polycomb group protein EZH2 gene expression using short interfering nucleic acid (siNA)
US20050159379A1 (en) * 2001-05-18 2005-07-21 Sirna Therapeutics, Inc RNA interference mediated inhibition of gastric inhibitory polypeptide (GIP) and gastric inhibitory polypeptide receptor (GIPR) gene expression using short interfering nucleic acid (siNA)
US20050119212A1 (en) * 2001-05-18 2005-06-02 Sirna Therapeutics, Inc. RNA interference mediated inhibition of FAS and FASL gene expression using short interfering nucleic acid (siNA)
US20050159380A1 (en) * 2001-05-18 2005-07-21 Sirna Therapeutics, Inc. RNA interference mediated inhibition of angiopoietin gene expression using short interfering nucleic acid (siNA)
US20050239739A1 (en) * 2001-05-18 2005-10-27 Sirna Therapeutics, Inc. Conjugates and compositions for cellular delivery
US20050176025A1 (en) * 2001-05-18 2005-08-11 Sirna Therapeutics, Inc. RNA interference mediated inhibition of B-cell CLL/Lymphoma-2 (BCL-2) gene expression using short interfering nucleic acid (siNA)
US20050159378A1 (en) * 2001-05-18 2005-07-21 Sirna Therapeutics, Inc. RNA interference mediated inhibition of Myc and/or Myb gene expression using short interfering nucleic acid (siNA)
US20050158735A1 (en) * 2001-05-18 2005-07-21 Sirna Therapeutics, Inc. RNA interference mediated inhibition of proliferating cell nuclear antigen (PCNA) gene expression using short interfering nucleic acid (siNA)
US20050153914A1 (en) * 2001-05-18 2005-07-14 Sirna Therapeutics, Inc. RNA interference mediated inhibition of MDR P-glycoprotein gene expression using short interfering nucleic acid (siNA)
US20050233344A1 (en) * 2001-05-18 2005-10-20 Sirna Therapeutics, Inc. RNA interference mediated inhibition of platelet derived growth factor (PDGF) and platelet derived growth factor receptor (PDGFR) gene expression using short interfering nucleic acid (siNA)
US20060211642A1 (en) * 2001-05-18 2006-09-21 Sirna Therapeutics, Inc. RNA inteference mediated inhibition of hepatitis C virus (HVC) gene expression using short interfering nucleic acid (siNA)
US20050143333A1 (en) * 2001-05-18 2005-06-30 Sirna Therapeutics, Inc. RNA interference mediated inhibition of interleukin and interleukin receptor gene expression using short interfering nucleic acid (SINA)
US7517864B2 (en) 2001-05-18 2009-04-14 Sirna Therapeutics, Inc. RNA interference mediated inhibition of vascular endothelial growth factor and vascular endothelial growth factor receptor gene expression using short interfering nucleic acid (siNA)
US20060217331A1 (en) * 2001-05-18 2006-09-28 Sirna Therapeutics, Inc. Chemically modified double stranded nucleic acid molecules that mediate RNA interference
US20050233998A1 (en) * 2001-05-18 2005-10-20 Sirna Therapeutics, Inc. RNA interference mediated inhibition of vascular endothelial growth factor and vascular endothelial growth factor receptor gene expression using short interfering nucleic acid (siNA)
US20070160980A1 (en) * 2001-05-18 2007-07-12 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using short interfering nucleic acid (siNA)
US20050171040A1 (en) * 2001-05-18 2005-08-04 Sirna Therapeutics, Inc. RNA interference mediated inhibition of cholesteryl ester transfer protein (CEPT) gene expression using short interfering nucleic acid (siNA)
US20060270623A1 (en) * 2001-05-18 2006-11-30 Sirna Therapeutics, Inc. RNA interference mediated treatment of polyglutamine (polyQ) repeat expansion diseases using short interfering nucleic acid (siNA)
US20060216747A1 (en) * 2001-05-18 2006-09-28 Sirna Therapeutics, Inc. RNA interference mediated inhibition of checkpoint kinase-1 (CHK-1) gene expression using short interfering nucleic acid (siNA)
US20030105051A1 (en) * 2001-05-29 2003-06-05 Mcswiggen James Nucleic acid treatment of diseases or conditions related to levels of HER2
US7691995B2 (en) 2001-07-12 2010-04-06 University Of Massachusetts In vivo production of small interfering RNAS that mediate gene silencing
US8530438B2 (en) 2001-07-12 2013-09-10 University Of Massachusetts Vivo production of small interfering RNAs that mediate gene silencing
US9850487B2 (en) 2001-07-12 2017-12-26 University Of Massachusetts In vivo production of small interfering RNAs that mediate gene silencing
US7893036B2 (en) 2001-07-12 2011-02-22 University Of Massachusetts In vivo production of small interfering RNAs that mediate gene silencing
US20110207224A1 (en) * 2001-07-12 2011-08-25 University Of Massachusetts In vivo production of small interfering rnas that mediate gene silencing
US20060009402A1 (en) * 2001-07-12 2006-01-12 Zamore Phillip D In vivo production of small interfering rnas that mediate gene silencing
US20080200420A1 (en) * 2001-07-12 2008-08-21 Zamore Phillip D In vivo production of small interfering RNAs that mediate gene silencing
US9175287B2 (en) 2001-07-12 2015-11-03 University Of Massachusetts In vivo production of small interfering RNAs that mediate gene silencing
US8232260B2 (en) 2001-07-12 2012-07-31 University Of Massachusetts In vivo production of small interfering RNAs that mediate gene silencing
US8557785B2 (en) 2001-07-12 2013-10-15 University Of Massachusetts In vivo production of small interfering RNAS that mediate gene silencing
US20100234448A1 (en) * 2001-07-12 2010-09-16 University Of Massachusetts In vivo production of small interfering rnas that mediate gene silencing
US20030139363A1 (en) * 2001-07-23 2003-07-24 Kay Mark A. Methods and compositions for RNAi mediated inhibition of viral gene expression in mammals
US20090264505A1 (en) * 2001-07-23 2009-10-22 Kay Mark A Methods and compositions for rnai mediated inhibition of gene expression in mammals
US9018179B2 (en) 2001-07-23 2015-04-28 The Board Of Trustees Of The Leland Stanford Junior University Methods and compositions for RNAi mediated inhibition of gene expression in mammals
US20100099740A1 (en) * 2001-07-23 2010-04-22 Kay Mark A Methods and compositions for rnai mediated inhibition of gene expression in mammals
US20030198627A1 (en) * 2001-09-01 2003-10-23 Gert-Jan Arts siRNA knockout assay method and constructs
US7745418B2 (en) 2001-10-12 2010-06-29 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting viral replication
US7348314B2 (en) 2001-10-12 2008-03-25 Alnylam Europe Ag Compositions and methods for inhibiting viral replication
US8273868B2 (en) * 2001-10-12 2012-09-25 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting viral replication
US20130064879A1 (en) * 2001-10-12 2013-03-14 Matthias John Compositions and Methods for Inhibiting Viral Replication
US20050074757A1 (en) * 2001-10-12 2005-04-07 Ribopharma Ag Compositions and methods for inhibiting expression of a mutant gene
US20100316699A1 (en) * 2001-10-12 2010-12-16 Matthias John Compositions and Methods for Inhibiting Viral Replication
US7763590B2 (en) * 2001-10-12 2010-07-27 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of a mutant gene
US20040121348A1 (en) * 2001-10-26 2004-06-24