US12037637B2 - Photoselective non-invasive targeted genomic and epigenomic sequencing of spatially-defined cells or subcellular regions - Google Patents
Photoselective non-invasive targeted genomic and epigenomic sequencing of spatially-defined cells or subcellular regions Download PDFInfo
- Publication number
- US12037637B2 US12037637B2 US17/582,102 US202217582102A US12037637B2 US 12037637 B2 US12037637 B2 US 12037637B2 US 202217582102 A US202217582102 A US 202217582102A US 12037637 B2 US12037637 B2 US 12037637B2
- Authority
- US
- United States
- Prior art keywords
- sequencing
- tissue
- dna
- sample
- optionally
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active, expires
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases [RNase]; Deoxyribonucleases [DNase]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N1/00—Sampling; Preparing specimens for investigation
- G01N1/28—Preparing specimens for investigation including physical details of (bio-)chemical methods covered elsewhere, e.g. G01N33/50, C12Q
- G01N1/30—Staining; Impregnating ; Fixation; Dehydration; Multistep processes for preparing samples of tissue, cell or nucleic acid material and the like for analysis
Definitions
- the present disclosure relates to methods aimed towards non-invasive targeted genomic and epigenomic sequencing of spatially-defined cellular or subcellular regions. More particularly, the present disclosure relates to methods of using photoselection for non-invasive targeted genomic and epigenomic sequencing of spatially-defined cellular or subcellular regions using light-activated probes.
- the current disclosure relates, at least in part, to methods for non-invasive targeted genomic and epigenomic sequencing of spatially-defined cellular or subcellular region(s) using light activated probes that provide for photoselective sequencing.
- Specifically contemplated applications for the non-invasive targeted genomic and epigenomic sequencing of spatially-defined cellular or subcellular regions using light activated probes that the instant disclosure provides include, without limitation, targeted ATAC-seq (Assay for Transposase-Accessible Chromatin using sequencing) for profiling of open chromatin regions restricted to a desired population of cells, and selective analysis of protein-DNA interactions by selectively probing the genomic locations of protein complexes with particular spatial features, as visualized by fluorescence microscopy.
- targeted ATAC-seq Assay for Transposase-Accessible Chromatin using sequencing
- selective analysis of protein-DNA interactions by selectively probing the genomic locations of protein complexes with particular spatial features, as visualized by fluorescence microscopy.
- the disclosure provides a method for obtaining targeted genomic and epigenomic sequence data from a tissue or cell sample that includes the steps of: (i) obtaining the tissue or cell sample from a subject; (ii) fixing the tissue or cell sample with a fixing agent; (iii) staining the fixed tissue or cell sample; (iv) preparing a photolabile sequencing library using a DNA fragmenting agent loaded with amplification-blocked adapters; (v) targeting illumination of the fixed tissue or cell sample with near-UV light to unblock the adapters in a region of interest; (vi) purifying DNA from the sample; and (vii) amplifying and sequencing the unblocked adapters on a sequencing platform.
- the method further includes the step of: permeabilizing the fixed tissue or cell sample of step (ii) with a permeabilizing agent.
- the amplification-blocked adapters include an oligonucleotide sequence conjugated to a fluorophore via a photocleavable spacer.
- the photocleavable spacer includes a photolabile molecule that is cleaved during exposure to light in the near-ultraviolet spectral range.
- the photocleavable spacer comprises a 10 atom long molecule which is cleaved upon absorption of near-ultraviolet light to produce an exposed 5′phosphate.
- secondary adapter sequences are selectively ligated to unblocked adapters prior to step (vii) amplifying and sequencing the unblocked adapters on a sequencing platform.
- the permeabilizing agent is selected from among the following: Triton X-100, NP-40, methanol, acetone, Tween 20, saponin, LeucopermTM, and digitonin.
- the permeabilizing agent is Triton X-100 at a concentration between about 0.01% and about 5%.
- contacting of the section of the tissue sample with the permeabilizing agent is performed for a duration of time between about 0.1 minute and about 30 minutes.
- the DNA fragmenting agent is selected from among the following: a transposase; H 2 O 2 ; sonication; and a DNase.
- the DNase is a restriction endonuclease.
- the DNA fragmenting agent includes a Tn5 transposase enzyme.
- the Tn5 transposase enzyme is present in a tagmentation buffer including adapter and mosaic oligonucleotides.
- the Tn5 enzyme in tagmentation buffer including adapter and mosaic oligonucleotides contacts the sectioned tissue sample for about 20 minutes to about 16 hours.
- the Tn5 enzyme in tagmentation buffer including adapter and mosaic oligonucleotides contacts the sectioned tissue sample at between about 25° C. and about 55° C.
- the section of the tissue sample is a fixed section or a cryosection.
- the target DNA molecules are selected from among the following: genomic DNA molecules, mitochondrial DNA (mtDNA) molecules, viral DNA molecules (optionally retroviral DNA molecules or AAV DNA molecules) and bacterial DNA molecules.
- the target DNA molecules are genomic DNA molecules.
- the genomic DNA molecules are enriched for accessible chromatin sequences, as compared to inaccessible chromatin sequences (e.g., genomic DNA sequences associated with nucleosomes and/or other forms of condensed chromatin).
- the permeabilizing agent is about 0.1% to about 0.5% Triton X-100.
- the contacting of the section of the tissue sample with the Triton X-100 is performed for a duration of time between about 10 minutes and about 60 minutes.
- the tissue sample is obtained from a tissue selected from among the following: brain, lung, liver, kidney, pancreas, heart, and gastrointestinal (GI) tract.
- GI gastrointestinal
- the tissue sample is obtained from a tumor.
- the subject is a mammal.
- the subject is a human.
- the sequencing platform is a NGS platform.
- the NGS platform is an Illumina® platform.
- the method is compatible with established Tn5-transposase based library preparations including ATAC-seq, Cut & Tag, or whole-genome sequencing.
- the method further includes the step (x) generating an image of the tissue sample that depicts the location(s) and relative abundance of one or more captured target DNAs within the sample.
- the image is a two-dimensional image.
- the disclosure provides a method for non-invasive targeted genomic and epigenomic sequencing of a spatially-defined cellular or subcellular region using light-activated probes, the method including the steps of: (i) obtaining cells or a tissue sample from a subject; (ii) fixing and permeabilizing the cells or the tissue sample with a fixing agent and a permeabilizing agent; (iii) staining the fixed cells or tissue sample to visualize one or more regions of interest by microscopy; (iv) preparing a photolabile sequencing library using Tn5 transposase enzyme loaded with amplification-blocked adapters, where the adapters include an oligonucleotide sequence conjugated to a fluorophore via a photocleavable spacer; (v) targeting illumination of the fixed cells or tissue sample with near-UV light to unblock the adapters in the one or more regions of interest; (vi) purifying DNA from the sample; and (vii) amplifying and sequencing the unblocked adapters on a sequencing platform.
- the Tn5 transposase enzyme loaded with amplification-blocked adapters is present in a tagmentation buffer.
- the Tn5 enzyme loaded with amplification-blocker adapters in tagmentation buffer contacts the sectioned tissue sample for about 20 minutes to about 16 hours, optionally wherein the Tn5 enzyme loaded with customized amplification-blocker adapters in tagmentation buffer contacts the sectioned tissue sample at between about 25° C. and about 55° C.
- the buffer contacts the sectioned tissue sample for about 20 minutes, about 30 minutes, about 40 minutes, about 50 minutes, about 1 hour, about 2 hours, about 3 hours, about 4 hours, about 5 hours, about 6 hours, about 7 hours, about 8 hours, about 9 hours, about 10 hours, about 11 hours, about 12 hours, about 13 hours, about 14 hours, about 15 hours, or about 16 hours.
- the tissue sample is obtained from a tissue selected from the group consisting of brain, lung, liver, kidney, pancreas, heart, and gastrointestinal (GI) tract.
- GI gastrointestinal
- the tissue sample is obtained from a tumor.
- the subject is a mammal, optionally a human.
- the sequencing platform is an Illumina® platform.
- the disclosure provides a kit for non-invasive targeted genomic and epigenomic sequencing of a spatially-defined cellular or subcellular region using light activated probes that includes: (i) a permeabilizing agent; and (ii) a DNA fragmenting agent loaded with amplification-blocked adapters.
- the permeabilizing agent is Triton X-100 at a concentration between about 0.01% and about 5%.
- the DNA fragmenting agent is selected from the group consisting of a transposase; H 2 O 2 ; sonication; and a DNase, optionally wherein the DNase is a restriction endonuclease.
- the DNA fragmenting agent comprises a Tn5 transposase enzyme, optionally wherein the Tn5 transposase enzyme is present in a tagmentation buffer.
- the amplification-blocked adapters include an oligonucleotide sequence conjugated to a fluorophore via a photocleavable spacer.
- the kit includes secondary adapters for ligation to unblocked adapters.
- the term “about” is understood as within a range of normal tolerance in the art, for example within 2 standard deviations of the mean. “About” can be understood as within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, or 0.01% of the stated value.
- the term “approximately” or “about” refers to a range of values that fall within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value).
- amplicon when used in reference to a nucleic acid, means the product of copying the nucleic acid, wherein the product has a nucleotide sequence that is the same as or complementary to at least a portion of the nucleotide sequence of the nucleic acid.
- An amplicon can be produced by any of a variety of amplification methods that use the nucleic acid, or an amplicon thereof, as a template including, for example, polymerase extension, polymerase chain reaction (PCR), rolling circle amplification (RCA), multiple displacement amplification (MDA), ligation extension, or ligation chain reaction.
- An amplicon can be a nucleic acid molecule having a single copy of a particular nucleotide sequence (e.g., a PCR product) or multiple copies of the nucleotide sequence (e.g., a concatameric product of RCA).
- a first amplicon of a target nucleic acid is typically a complementary copy.
- Subsequent amplicons are copies that are created, after generation of the first amplicon, from the target nucleic acid or from the first amplicon.
- a subsequent amplicon can have a sequence that is substantially complementary to the target nucleic acid or substantially identical to the target nucleic acid.
- the term “array” refers to a population of features or sites that can be differentiated from each other according to relative location. Different molecules that are at different sites of an array can be differentiated from each other according to the locations of the sites in the array.
- An individual site of an array can include one or more molecules of a particular type. For example, a site can include a single target nucleic acid molecule having a particular sequence or a site can include several nucleic acid molecules having the same sequence (and/or complementary sequence, thereof).
- the sites of an array can be different features located on the same substrate. Exemplary features include without limitation, wells in a substrate, beads (or other particles) in or on a substrate, projections from a substrate, ridges on a substrate or channels in a substrate.
- the sites of an array can be separate substrates each bearing a different molecule. Different molecules attached to separate substrates can be identified according to the locations of the substrates on a surface to which the substrates are associated or according to the locations of the substrates in a liquid or gel. Exemplary arrays in which separate substrates are located on a surface include, without limitation, those having beads in wells, beads arranged upon a flat surface (e.g., a slide), optionally beads captured upon a flat surface (e.g., a layer of beads adhered to or otherwise stably associated with a slide (e.g., a layer of beads adsorbed to a slide-attached elastomeric surface)), etc.
- an analyte such as a nucleic acid
- a material such as a gel or solid support
- a covalent bond is characterized by the sharing of pairs of electrons between atoms.
- a non-covalent bond is a chemical bond that does not involve the sharing of pairs of electrons and can include, for example, hydrogen bonds, ionic bonds, van der Waals forces, hydrophilic interactions and hydrophobic interactions.
- barcode sequence is intended to mean a series of nucleotides in a nucleic acid that can be used to identify the nucleic acid, a characteristic of the nucleic acid (e.g., the identity and optionally the location of a bead to which the nucleic acid is attached), or a manipulation that has been carried out on the nucleic acid.
- the barcode sequence can be a naturally occurring sequence or a sequence that does not occur naturally in the organism from which the barcoded nucleic acid was obtained.
- a barcode sequence can be unique to a single nucleic acid species in a population or a barcode sequence can be shared by several different nucleic acid species in a population (e.g., all nucleic acid species attached to a single bead might possess the same barcode sequence, while different beads present a different shared barcode sequence that serves to identify each such different bead).
- each nucleic acid probe in a population can include different barcode sequences from all other nucleic acid probes in the population.
- each nucleic acid probe in a population can include different barcode sequences from some or most other nucleic acid probes in a population.
- each probe in a population can have a barcode that is present for several different probes in the population even though the probes with the common barcode differ from each other at other sequence regions along their length.
- one or more barcode sequences that are used with a biological specimen are not present in the genome, transcriptome or other nucleic acids of the biological specimen.
- barcode sequences can have less than 80%, 70%, 60%, 50% or 40% sequence identity to the nucleic acid sequences in a particular biological specimen.
- beads can include small discrete particles.
- the composition of the beads can vary, depending upon the class of capture probe, the method of synthesis, and other factors. In certain embodiments of the disclosure, the sizes of the beads of the disclosure tend to range from 1 ⁇ m to 100 ⁇ m in diameter (with all subranges within this range expressly contemplated), e.g., depending upon the extent of image resolution desired, nature of the solid support to be used for spatial bead array construction, sequencing processes (e.g., flow cell sequencing) to be employed, as well as other factors.
- biological specimen is intended to mean one or more cell, tissue, organism or portion thereof.
- a biological specimen can be obtained from any of a variety of organisms.
- Exemplary organisms include, but are not limited to, a mammal such as a rodent, mouse, rat, rabbit, guinea pig, ungulate, horse, sheep, pig, goat, cow, cat, dog, primate (i.e. human or non-human primate); a plant such as Arabidopsis thaliana , corn, sorghum, oat, wheat, rice, canola, or soybean; an algae such as Chlamydomonas reinhardtii ; a nematode such as Caenorhabditis elegans;
- an insect such as Drosophila melanogaster , mosquito, fruit fly, honey bee or spider; a fish such as zebrafish; a reptile; an amphibian such as a frog or Xenopus laevis ; a Dictyostelium discoideum; a fungi such as Pneumocystis carinii, Takifugu rubripes , yeast, Saccharomyces cerevisiae or Schizosaccharomyces pombe ; or a Plasmodium falciparum .
- Target nucleic acids can also be derived from a prokaryote such as a bacterium, Escherichia coli , Staphylococci or Mycoplasma pneumoniae ; an archae; a virus such as Hepatitis C virus or human immunodeficiency virus; or a viroid.
- Specimens can be derived from a homogeneous culture or population of the above organisms or alternatively from a collection of several different organisms, for example, in a community or ecosystem.
- cleavage site is intended to mean a location in a nucleic acid molecule that is susceptible to bond breakage.
- the location can be specific to a particular chemical, enzymatic or physical process that results in bond breakage.
- the location can be a nucleotide that is abasic or a nucleotide that has a base that is susceptible to being removed to create an abasic site. Examples of nucleotides that are susceptible to being removed include uracil and 8-oxo-guanine as set forth in further detail herein below.
- the location can also be at or near a recognition sequence for a restriction endonuclease such as a nicking enzyme.
- control or “reference” is meant a standard of comparison. Methods to select and test control samples are within the ability of those in the art. Determination of statistical significance is within the ability of those skilled in the art, e.g., the number of standard deviations from the mean that constitute a positive result.
- the term “cryosection” refers to a piece of tissue, e.g., a biopsy, that has been obtained from a subject, snap frozen, embedded in optimal cutting temperature embedding material, frozen, and cut into thin sections.
- the thin sections can be treated with a permeabilizing agent and/or a DNA fragmenting agent, and then directly applied to an array of beads captured upon a solid support (e.g., a slide), or the thin sections can be fixed (e.g., in methanol or paraformaldehyde), treated with a permeabilizing agent and/or a DNA fragmenting agent, and then applied to a bead-presenting planar surface, e.g., a slide upon which a layer of microbeads has been attached/arrayed.
- nucleic acids As used herein, the term “different”, when used in reference to nucleic acids, means that the nucleic acids have nucleotide sequences that are not the same as each other. Two or more nucleic acids can have nucleotide sequences that are different along their entire length. Alternatively, two or more nucleic acids can have nucleotide sequences that are different along a substantial portion of their length. For example, two or more nucleic acids can have target nucleotide sequence portions that are different for the two or more molecules while also having a universal sequence portion that is the same on the two or more molecules. Two beads can be different from each other by virtue of being attached to different nucleic acids.
- each when used in reference to a collection of items, is intended to identify an individual item in the collection but does not necessarily refer to every item in the collection. Exceptions can occur if explicit disclosure or context clearly dictates otherwise.
- the term “extend,” when used in reference to a nucleic acid, is intended to mean addition of at least one nucleotide or oligonucleotide to the nucleic acid.
- one or more nucleotides can be added to the 3′ end of a nucleic acid, for example, via polymerase catalysis (e.g., DNA polymerase, RNA polymerase or reverse transcriptase). Chemical or enzymatic methods can be used to add one or more nucleotide to the 3′ or 5′ end of a nucleic acid.
- One or more oligonucleotides can be added to the 3′ or 5′ end of a nucleic acid, for example, via chemical or enzymatic (e.g., ligase catalysis) methods.
- a nucleic acid can be extended in a template directed manner, whereby the product of extension is complementary to a template nucleic acid that is hybridized to the nucleic acid that is extended.
- feature means a location in an array for a particular species of molecule.
- a feature can contain only a single molecule or it can contain a population of several molecules of the same species.
- Features of an array are typically discrete. The discrete features can be contiguous or they can have spaces between each other. The size of the features and/or spacing between the features can vary such that arrays can be high density, medium density or lower density. High density arrays are characterized as having sites separated by less than about 15 ⁇ m. Medium density arrays have sites separated by about 15 to 30 ⁇ m, while low density arrays have sites separated by greater than 30 ⁇ m.
- An array useful herein can have, for example, sites that are separated by less than 100 ⁇ m, 50 ⁇ m, 10 ⁇ m, 5 ⁇ m, 1 ⁇ m, or 0.5 ⁇ m.
- An apparatus or method of the present disclosure can be used to detect an array at a resolution sufficient to distinguish sites at the above densities or density ranges.
- isolated refers to material that is free to varying degrees from components which normally accompany it as found in its native state.
- Isolate denotes a degree of separation from original source or surroundings.
- Purify denotes a degree of separation that is higher than isolation.
- NGS next-generation sequencing
- conventional sequencing methods e.g., standard Sanger or Maxam-Gilbert sequencing methods
- These unprecedented speeds are achieved by performing and reading out thousands to millions of sequencing reactions in parallel.
- NGS sequencing platforms include, but are not limited to, the following: Massively Parallel Signature Sequencing (Lynx Therapeutics); 454 pyrosequencing (454 Life Sciences/Roche Diagnostics); solid-phase, reversible dye-terminator sequencing (Solexa/Illumina®); SOLiDTM technology (Applied Biosystems); Ion semiconductor sequencing (Ion TorrentTM); and DNA nanoball sequencing (Complete Genomics).
- nucleic acid and “nucleotide” are intended to be consistent with their use in the art and to include naturally occurring species or functional analogs thereof. Particularly useful functional analogs of nucleic acids are capable of hybridizing to a nucleic acid in a sequence specific fashion or capable of being used as a template for replication of a particular nucleotide sequence.
- Naturally occurring nucleic acids generally have a backbone containing phosphodiester bonds.
- An analog structure can have an alternate backbone linkage including any of a variety of those known in the art.
- Naturally occurring nucleic acids generally have a deoxyribose sugar (e.g., found in deoxyribonucleic acid (DNA)) or a ribose sugar (e.g., found in ribonucleic acid (RNA)).
- a nucleic acid can contain nucleotides having any of a variety of analogs of these sugar moieties that are known in the art.
- a nucleic acid can include native or non-native nucleotides.
- a native deoxyribonucleic acid can have one or more bases selected from the group consisting of adenine, thymine, cytosine or guanine and a ribonucleic acid can have one or more bases selected from the group consisting of uracil, adenine, cytosine or guanine.
- Useful non-native bases that can be included in a nucleic acid or nucleotide are known in the art.
- probe or “target,” when used in reference to a nucleic acid or sequence of a nucleic acid, are intended as semantic identifiers for the nucleic acid or sequence in the context of a method or composition set forth herein and does not necessarily limit the structure or function of the nucleic acid or sequence beyond what is otherwise explicitly indicated.
- probe and target can be similarly applied to other analytes such as proteins, small molecules, cells or the like.
- the term “random” can be used to refer to the spatial arrangement or composition of locations on a surface.
- the first relating to the spacing and relative location of features (also called “sites”) and the second relating to identity or predetermined knowledge of the particular species of molecule that is present at a particular feature.
- features of an array can be randomly spaced such that nearest neighbor features have variable spacing between each other.
- the spacing between features can be ordered, for example, forming a regular pattern such as a rectilinear grid or hexagonal grid.
- features of an array can be random with respect to the identity or predetermined knowledge of the species of analyte (e.g., nucleic acid of a particular sequence) that occupies each feature independent of whether spacing produces a random pattern or ordered pattern.
- An array set forth herein can be ordered in one respect and random in another. For example, in some embodiments set forth herein a surface is contacted with a population of nucleic acids under conditions where the nucleic acids attach at sites that are ordered with respect to their relative locations but ‘randomly located’ with respect to knowledge of the sequence for the nucleic acid species present at any particular site.
- references to “randomly distributing” nucleic acids at locations on a surface is intended to refer to the absence of knowledge or absence of predetermination regarding which nucleic acid will be captured at which location (regardless of whether the locations are arranged in an ordered pattern or not).
- solid support refers to a rigid substrate that is insoluble in aqueous liquid.
- the substrate can be non-porous or porous.
- the substrate can optionally be capable of taking up a liquid (e.g., due to porosity) but will typically be sufficiently rigid that the substrate does not swell substantially when taking up the liquid and does not contract substantially when the liquid is removed by drying.
- a nonporous solid support is generally impermeable to liquids or gases.
- Exemplary solid supports include, but are not limited to, glass and modified or functionalized glass, plastics (including acrylics, polystyrene and copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polyurethanes, TeflonTM, cyclic olefins, polyimides etc.), nylon, ceramics, resins, Zeonor, silica or silica-based materials including silicon and modified silicon, carbon, metals, inorganic glasses, optical fiber bundles, and polymers.
- Particularly useful solid supports for some embodiments are slides and beads capable of assorting/packing upon the surface of a slide (e.g., beads to which a large number of oligonucleotides are attached).
- the term “spatial tag” is intended to mean a nucleic acid having a sequence that is indicative of a location.
- the nucleic acid is a synthetic molecule having a sequence that is not found in one or more biological specimen that will be used with the nucleic acid.
- the nucleic acid molecule can be naturally derived or the sequence of the nucleic acid can be naturally occurring, for example, in a biological specimen that is used with the nucleic acid.
- the location indicated by a spatial tag can be a location in or on a biological specimen, in or on a solid support or a combination thereof.
- a barcode sequence can function as a spatial tag.
- the identification of the tag that serves as a spatial tag is only determined after a population of beads (each possessing a distinct barcode sequence) has been arrayed upon a solid support (optionally randomly arrayed upon a solid support) and sequencing of such a bead-associated barcode sequence has been determined in situ upon the solid support.
- subject includes humans and mammals (e.g., mice, rats, pigs, cats, dogs, and horses).
- subjects are mammals, particularly primates, especially humans.
- subjects are livestock such as cattle, sheep, goats, cows, swine, and the like; poultry such as chickens, ducks, geese, turkeys, and the like; and domesticated animals particularly pets such as dogs and cats.
- subject mammals will be, for example, rodents (e.g., mice, rats, hamsters), rabbits, primates, or swine such as inbred pigs and the like.
- tissue is intended to mean an aggregation of cells, and, optionally, intercellular matter. Typically the cells in a tissue are not free floating in solution and instead are attached to each other to form a multicellular structure. Exemplary tissue types include muscle, nerve, epidermal and connective tissues.
- the term “universal sequence” refers to a series of nucleotides that is common to two or more nucleic acid molecules even if the molecules also have regions of sequence that differ from each other.
- a universal sequence that is present in different members of a collection of molecules can allow capture of multiple different nucleic acids using a population of universal capture nucleic acids that are complementary to the universal sequence.
- a universal sequence present in different members of a collection of molecules can allow the replication or amplification of multiple different nucleic acids using a population of universal primers that are complementary to the universal sequence.
- a universal capture nucleic acid or a universal primer includes a sequence that can hybridize specifically to a universal sequence.
- Target nucleic acid molecules may be modified to attach universal adapters, for example, at one or both ends of the different target sequences.
- Ranges can be expressed herein as from “about” one particular value, and/or to “about” another particular value. When such a range is expressed, another aspect includes from the one particular value and/or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent “about,” it is understood that the particular value forms another aspect. It is further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint. It is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed as “about” that particular value in addition to the value itself.
- data are provided in a number of different formats and that this data represent endpoints and starting points and ranges for any combination of the data points. For example, if a particular data point “10” and a particular data point “15” are disclosed, it is understood that greater than, greater than or equal to, less than, less than or equal to, and equal to 10 and 15 are considered disclosed as well as between 10 and 15. It is also understood that each unit between two particular units are also disclosed. For example, if 10 and 15 are disclosed, then 11, 12, 13, and 14 are also disclosed.
- Ranges provided herein are understood to be shorthand for all of the values within the range.
- a range of 1 to 50 is understood to include any number, combination of numbers, or sub-range from the group consisting 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 as well as all intervening decimal values between the aforementioned integers such as, for example, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, and 1.9.
- a nested sub-range of an exemplary range of 1 to 50 may comprise 1 to 10, 1 to 20, 1 to 30, and 1 to 40 in one direction, or 50 to 40, 50 to 30, 50 to 20, and 50 to 10 in the other direction.
- transitional term “comprising,” which is synonymous with “including,” “containing,” or “characterized by,” is inclusive or open-ended and does not exclude additional, unrecited elements or method steps.
- the transitional phrase “consisting of” excludes any element, step, or ingredient not specified in the claim.
- the transitional phrase “consisting essentially of” limits the scope of a claim to the specified materials or steps “and those that do not materially affect the basic and novel characteristic(s)” of the claimed invention.
- FIG. 1 illustrates a flowchart showing an exemplary method for non-invasive targeted genomic and epigenomic sequencing of spatially-defined cellular or subcellular region using light-activated probes.
- FIGS. 2 A- 2 E depict an image, a graph, a bar graph, two images, and a scatterplot, respectively.
- FIG. 2 A is an image showing photoselective ATAC libraries in HeLa cells, as visualized by a fluorescently-labeled photocleavable tagmentation adapter. Targeted illumination of specific cells cleaves the spacer, removing the fluorophore from the adapter and exposing a 5′phosphate used in subsequent steps of the library prep. This results in a loss of fluorescence.
- FIG. 2 B is a graph showing photoselective sequencing libraries in HeLa cells have hallmark properties of ATAC including a periodic fragment size distribution and high enrichment in transcription start sites.
- FIG. 1 is an image showing photoselective ATAC libraries in HeLa cells, as visualized by a fluorescently-labeled photocleavable tagmentation adapter. Targeted illumination of specific cells cleaves the spacer, removing the fluorophore from the adapter and exposing a 5′phosphat
- FIG. 2 C is a bar graph showing photoselective sequencing background estimated by a species mixing experiment.
- Mouse (M) and human (H) DNA from various numbers of cells were mixed, however only the DNA from one species was unblocked (blocked species indicated as BG).
- the fraction of reads mapping to the genomes of each species is shown, with >90% of reads map to the correct genome, even in the worst case.
- FIG. 2 D show images of a photoselective ATAC library as visualized in the dentate gyrus region of the mouse brain, before and after photoselection.
- FIG. 2 E is a scatterplot showing photoselected granule cell data compared to granule cell data from a published single cell ATAC data set. Scatter plot compares reads in peaks between the two data sets (where peaks were called on the pooled data).
- the present disclosure is based, at least in part, on the discovery of photoselective sequencing, a sequencing methodology that enables non-invasive targeted genomic and epigenomic sequencing of spatially-defined cellular or subcellular regions of tissues or cell populations or cells using light-activated probes.
- the disclosure provides in-situ tagmentation with blocked adapters consisting of an oligonucleotide sequence conjugated to a fluorophore via a photocleavable spacer. Photo-induced cleavage of the spacer removes the fluorophore and uncages a 5′ phosphate group that enables ligation of secondary adapters, which are subsequently used to amplify the selected DNA fragments, optionally after digestion of the sample.
- photoselective sequencing provides diffraction-limited resolution and straightforward compatibility with varied genomic and epigenetic sequencing libraries. Additionally, photoselective sequencing is not limited to spatially localized populations of cells.
- an exemplary embodiment of photoselective sequencing may involve staining fixed tissues or populations of cells or cells to visualize regions of interest by microscopy; preparing a photolabile sequencing library via in situ tagmentation by using Tn5 transposase loaded with customized amplification-blocked adapters (e.g., oligonucleotide sequences conjugated to a fluorophore via a photocleavable spacer); illuminating with near-UV light, in a spatially targeted manner, the stained sample (e.g., fixed tissues, populations of cells, cells, and the like) to unblock the customized amplification-blocked adapters in the regions of interest (e.g., by uncaging a 5′ phosphate group that enables ligation of secondary adapters); purifying the library (with total nucleic acids and/or DNA) from the sample; amplifying the un-blocked fragments (e.g., by ligating secondary adapter oligonucleotides and conducting PCR
- the techniques herein provide for the preparation of DNA sequencing libraries by capturing targeted double-stranded DNA sequences from spatially-defined regions within tissues or cell population with diffraction-limited resolution.
- the techniques herein are compatible with established Tn5-transposase based library preparations.
- Examples of contemplated applications for methods of non-invasive targeted genomic and epigenomic sequencing of spatially-defined cellular or subcellular region using light activated probes include, but are not limited to, targeted ATAC-seq (Assay for Transposase-Accessible Chromatin using sequencing) for profiling of open chromatin regions restricted to a desired population of cells, and selective analysis of protein-DNA interactions by selectively probing the genomic locations of protein complexes with particular spatial features, as visualized by fluorescence microscopy.
- targeted ATAC-seq Assay for Transposase-Accessible Chromatin using sequencing
- a wide range of diagnostic, therapeutic and research applications are therefore contemplated.
- the techniques herein employ in-situ tagmentation of a sample (e.g., a tissue sample, a cell population, cells, or the like) with blocked adapters consisting of an oligonucleotide sequence conjugated to a fluorophore (see e.g., US2020/0115753A1) via a photocleavable spacer. Cleavage of the spacer removes the fluorophore and uncages a 5′ phosphate group, which enables ligation of secondary adapters that are subsequently used to amplify the selected DNA fragments after digestion of the sample.
- a sample e.g., a tissue sample, a cell population, cells, or the like
- blocked adapters consisting of an oligonucleotide sequence conjugated to a fluorophore (see e.g., US2020/0115753A1) via a photocleavable spacer. Cleavage of the spacer removes the fluorophore and uncages
- high-resolution images of relative levels for individual target DNA sequences can be generated using the methods of the disclosure for a large number (e.g., tens, hundreds, thousands, millions, etc.) of DNA sequences, across an individual fixed tissue sample).
- the techniques herein provide spatially resolved capture of DNA for sequencing from cells and tissues with diffraction-limited resolution of approximately 200-500 nm (sub-cellular).
- Art-recognized spatial profiling technologies have the disadvantage of being directed to targeted in situ techniques, which are laborious, offer only a low degree of multiplexing with a high degree of technical difficulty, and provide only very low resolution on spatial capture arrays (e.g., resolutions of approximately 100-200 ⁇ m).
- the disclosure provides a level of image resolution that is a full order of magnitude superior in lateral resolution to such prior approaches, and two orders of magnitude superior in capture area.
- DNA capture and subsequent high-throughput sequencing e.g., Illumina® bead-based sequencing
- the disclosure provides methods that are easily adoptable and allows for whole and partial genomic profiling of complex tissues.
- tissue function is facilitated not only by knowledge of cell types and states but also their spatial organization within the tissue.
- Current technologies to investigate tissue biology fall typically into one of two categories: 1) high throughput transcriptomics and/or (epi)genomics, which capture a comprehensive snapshot of cell states within a tissue but lose the spatial context of those cells, or 2) imaging-based methods that provide spatial information but are typically laborious and require a priori knowledge of which genes/transcripts/proteins to target.
- the techniques herein provide improved technologies/platforms that allow unbiased, high-throughput capture of particularly genomic and/or mitochondrial DNA fragments from intact tissue while preserving their spatial context.
- Recent approaches such as “CHEX-seq” (see e.g., US Patent Publication No. 20200216841A1), have provided for targeted illumination to selectively identify single-stranded DNA with sub-cellular resolution.
- CHEX-seq see e.g., US Patent Publication No. 20200216841A1
- the disclosure provides methods for non-invasively capturing targeted double-stranded DNA sequences from spatially-defined regions of tissue (e.g., fixed tissue preparations) or cell populations to prepare a DNA sequencing library in a high-throughput manner (e.g., read-outs are obtained via next-generation sequencing) and with high (up to 10 ⁇ m, 10-100 ⁇ m, etc.) spatial resolution.
- tissue e.g., fixed tissue preparations
- cell populations e.g., cell populations
- a DNA sequencing library in a high-throughput manner (e.g., read-outs are obtained via next-generation sequencing) and with high (up to 10 ⁇ m, 10-100 ⁇ m, etc.) spatial resolution.
- Two key concepts that distinguish the methods from many prior approaches are: 1) use of targeted illumination to non-invasively capture targeted double-stranded DNA sequences from spatially-defined regions of tissue (e.g., fixed tissue preparations) or cell populations with diffraction-limited resolution and 2) compatibility with established Tn5-transposase based library preparations such as “ATAC-seq” (see e.g., US Patent Publication No. 20180237951A1), Cut & Tag, or whole-genome sequencing.
- tissue e.g., fixed tissue preparations
- Tn5-transposase based library preparations such as “ATAC-seq” (see e.g., US Patent Publication No. 20180237951A1), Cut & Tag, or whole-genome sequencing.
- the tissue section is treated with a permeabilizing agent and/or a DNA fragmenting agent, and is then contacted with Tn5 transposase loaded with customized amplification-blocked adapters consisting of an oligonucleotide sequence conjugated to a fluorophore via a photocleavable spacer.
- the amplification-blocked adapters have the following structure: 5′-Fluorophore-Photocleavable spacer-oligonucleotided sequence-3′.
- the fluorophore is chosen for compatibility with the stains in the sample and may include cyanine fluors (e.g. Cy3, Cy5, Cy7), Alexa Fluors (e.g. Alexa Fluor 488, Alexa Fluor 647), or any other small molecule fluorophore that can be conjugated via the photocleavable spacer.
- the photocleavable spacer is a 10 atom long molecule that is cleaved upon absorption of near-ultraviolet light.
- the oligonucleotide sequences typically used are as follows:
- the two adapters may have the generalized structure:
- N is any of the four nucleotides A, T, C or G.
- the number of N nucleotides may vary as long as compatibility is maintained with the intended sequencing platform.
- Certain aspects of the disclosure feature permeabilizing agents, examples of which tend to compromise and/or remove the protective boundary of lipids often surrounding cellular macromolecules. Disruption of cellular lipid barriers via administration of a permeabilizing agent can provide enhanced physical access to cellular macromolecules, such as DNA, that might otherwise be relatively inaccessible.
- permeabilizing agents include, without limitation: Triton X-100, NP-40, methanol, acetone, Tween 20, saponin, LeucopermTM, and digitonin, among others.
- Some aspects of the disclosure employ DNA fragmenting agents, which typically allow for capture of target DNA molecules and performance of high throughput DNA sequencing upon such captured target DNA molecules (e.g., target DNA of accessible chromatin in situ).
- a hyperactive variant of the Tn5 transposase that mediates the fragmentation of double-stranded DNA and ligates synthetic oligonucleotides at both ends can be employed.
- the Tn5 enzyme randomly cleaves accessible double stranded DNA into fragments and tags the DNA, by end-joining to the 5′-ends synthetic “mosaic ends,” or adapter sequences.
- the mosaic ends, or Tn5 adapter sequences complement bead adapter and Illumina® Handle sequences.
- a hyperactive variant of the Tn5 transposase employed herein in the below Examples was derived from the naturally occurring wild-type Tn5 transposase. Three missense mutations in the 476 residues of the Tn5 protein have typically been introduced: E54K, M56A, L372P, to produce the hyperactive variant.
- the wild type Tn5 transposon also contains two near-identical insertion sequences (IS50L and IS50R) flanking three antibiotic resistance genes (Reznikoff 2008). Each IS50 contains two inverted 19-base pair end sequences. However, because wild-type end sequences exhibited relatively low activity, they were replaced in vitro by synthetic hyperactive mosaic end sequences. A complex of the hyperactive Tn5 transposase with the 19-base pair mosaic end sequences therefore can provoke the mutant Tn5 to induce DNA fragmentation.
- DNA fragmenting agents/enzymes for use in the disclosure include, without limitation: transposases (including non-Tn5 transposases), DFF40, and DNases, including restriction endonucleases.
- transposases including non-Tn5 transposases
- DFF40 including restriction endonucleases
- DNases including restriction endonucleases.
- H 2 O 2 hydrogen peroxide
- the disclosure employs a Tn5 tagmentation reaction, in which a Tn5 enzyme randomly cleaves double stranded DNA into fragments and tags the DNA, by end-joining to the 5′′-ends, synthetic adapter sequences.
- the synthetic adapters, or Tn5 adapter sequences are equivalent to the published Illumina® Nextera Transposase Adapters.
- “tagmentation” refers to sequencing techniques that employ a hyperactive mutant form of Tn5 enzyme as described above. The tagmentation results in the simultaneous fragmentation of the DNA and ligation of the adapter sequences to the 5′ ends of both strands of duplex fragments.
- sequences can be added to the ends of the adapted fragments, for example by PCR, ligation, or any other suitable methodology known to those of skill in the art.
- the sequencing reads can then be used to infer regions of increased accessibility as well as to map regions of transcription factor binding sites and nucleosome positions. The number of reads for a region correlate with the degree of accessibility of the chromatin region.
- Tn5 transposase based tagmentation The number of steps required to transform DNA into adapter sequence-modified templates in solution ready for cluster formation and sequencing can be minimized by the use of Tn5 transposase based tagmentation.
- Exemplary transposition procedures and systems that can be readily adapted for use with the transposases of the present disclosure are described, for example, in WO 10/048605; US Patent Publication No. 2012/0301925; US Patent Publication No. 2013/0143774, each of which is incorporated herein by reference in its entirety.
- a method as set forth herein can employ any of a variety of amplification techniques.
- Exemplary amplification techniques that can be used include, but are not limited to, polymerase chain reaction (PCR), rolling circle amplification (RCA), multiple displacement amplification (MDA), and random prime amplification (RPA).
- PCR polymerase chain reaction
- RCA rolling circle amplification
- MDA multiple displacement amplification
- RPA random prime amplification
- the amplification can be carried out in solution, for example, when features of an array are capable of containing amplicons in a volume having a desired capacity.
- Formats that utilize two species of primers are often referred to as bridge amplification because double stranded amplicons form a bridge-like structure between the two surface-attached primers that flank the template sequence that has been copied.
- Exemplary reagents and conditions that can be used for bridge amplification are described, for example, in U.S. Pat. Nos. 5,641,658; 7,115,400; and 8,895,249; and/or U.S. Patent Publication Nos. 2002/0055100 A1, 2004/0096853 A1, 2004/0002090 A1, 2007/0128624 A1 and 2008/0009420 A1, each of which is incorporated herein by reference.
- Solid-phase PCR amplification can also be carried out with one of the amplification primers and the second primer in solution.
- An exemplary format that uses a combination of a surface-attached primer and soluble primer is the format used in emulsion PCR as described, for example, in Dressman et al., Proc. Natl. Acad. Sci. USA 100:8817-8822 (2003), PCT Publication No. WO 05/010145, or U.S. Patent Publication Nos. 2005/0130173 or 2005/0064460, each of which is incorporated herein by reference.
- Emulsion PCR is illustrative of the format and it will be understood that for purposes of the methods set forth herein the use of an emulsion is optional and indeed for several embodiments an emulsion is not used.
- RCA techniques can be modified for use in a method of the present disclosure.
- Exemplary components that can be used in an RCA reaction and principles by which RCA produces amplicons are described, for example, in Lizardi et al., Nat. Genet. 19:225-232 (1998) and U.S. Patent Publication No. 2007/0099208, each of which is incorporated herein by reference.
- Primers used for RCA can be in solution.
- the primers can be one or more of the universal primers described herein.
- a combination of the above-exemplified amplification techniques can be used.
- RCA and MDA can be used in a combination wherein RCA is used to generate a concatameric amplicon in solution (e.g., using solution-phase primers).
- the amplicon can then be used as a template for MDA using primers (e.g., universal primers).
- nucleic acid detection methods include, but are not limited to, nucleic acid sequencing of a probe, hybridization of nucleic acids to a probe, ligation of nucleic acids that are hybridized to a probe, extension of nucleic acids that are hybridized to a probe, extension of a first nucleic acid that is hybridized to a probe followed by ligation of the extended nucleic acid to a second nucleic acid that is hybridized to the probe, or other methods known in the art such as those set forth in U.S. Pat. No. 8,288,103 or 8,486,625, each of which is incorporated herein by reference.
- the unblocked fragments are amplified and sequenced in bulk via a sequencing platform (e.g., Illumina® platform) which utilizes sequencing techniques, such as the sequencing-by-synthesis (SBS) technique.
- a sequencing platform e.g., Illumina® platform
- SBS sequencing-by-synthesis
- features e.g., feature(s) where nucleic acid probes are attached.
- the nucleotides can include a reversible termination moiety that terminates further primer extension once a nucleotide has been added to the SBS primer.
- a nucleotide analog having a reversible terminator moiety can be added to a primer such that subsequent extension cannot occur until a deblocking agent is delivered to remove the moiety.
- a deblocking reagent can be delivered to the bead or other solid support (before or after detection occurs). Washes can be carried out between the various delivery steps. The cycle can then be repeated n times to extend the primer by n nucleotides, thereby detecting a sequence of length n.
- Pyrosequencing detects the release of inorganic pyrophosphate (PPi) as particular nucleotides are incorporated into a nascent nucleic acid strand (Ronaghi, et al., Analytical Biochemistry 242(1), 84-9 (1996); Ronaghi, Genome Res. 1 1 (1), 3-1 1 (2001); Ronaghi et al. Science 281 (5375), 363 (1998); or U.S. Pat. Nos. 6,210,891, 6,258,568 or 6,274,320, each of which is incorporated herein by reference).
- PPi inorganic pyrophosphate
- released PPi can be detected by being immediately converted to adenosine triphosphate (ATP) by ATP sulfurylase, and the level of ATP generated can be detected via luciferase-produced photons.
- ATP adenosine triphosphate
- the sequencing reaction can be monitored via a luminescence detection system.
- Excitation radiation sources used for fluorescence based detection systems are not necessary for pyrosequencing procedures.
- Useful fluidic systems, detectors and procedures that can be used for application of pyrosequencing to apparatus, compositions or methods of the present disclosure are described, for example, in PCT Patent Publication No. WO2012/058096, US Patent Publication No. 2005/0191698 A1, or U.S. Pat. Nos. 7,595,883 or 7,244,559, each of which is incorporated herein by reference.
- Sequencing-by-ligation reactions are also useful including, for example, those described in Shendure et al. Science 309:1728-1732 (2005); or U.S. Pat. Nos. 5,599,675 or 5,750,341, each of which is incorporated herein by reference.
- Some embodiments can include sequencing-by-hybridization procedures as described, for example, in Bains et al., Journal of Theoretical Biology 135(3), 303-7 (1988); Drmanac et al., Nature Biotechnology 16, 54-58 (1998); Fodor et al., Science 251 (4995), 767-773 (1995); or PCT Publication No. WO 1989/10977, each of which is incorporated herein by reference.
- target nucleic acids or amplicons thereof
- Compositions, apparatus or methods set forth herein or in references cited herein can be readily adapted for sequencing-by-ligation or sequencing-by-hybridization procedures.
- the oligonucleotides are fluorescently labeled and can be detected using fluorescence detectors similar to those described with regard to SBS procedures herein or in references cited herein.
- Some sequencing embodiments can utilize methods involving the real-time monitoring of DNA polymerase activity. For example, nucleotide incorporations can be detected through fluorescence resonance energy transfer (FRET) interactions between a fluorophore-bearing polymerase and ⁇ -phosphate-labeled nucleotides, or with zeromode waveguides (ZMWs).
- FRET fluorescence resonance energy transfer
- ZMWs zeromode waveguides
- sequencing embodiments include detection of a proton released upon incorporation of a nucleotide into an extension product.
- sequencing based on detection of released protons can use an electrical detector and associated techniques that are commercially available from Ion Torrent (Guilford, C T, a Life Technologies and Thermo Fisher subsidiary) or sequencing methods and systems described in U.S. Patent Publication Nos. 2009/0026082 A1; 2009/0127589 A1; 2010/0137143 A1; or U.S. Publication No. 2010/0282617 A1, each of which is incorporated herein by reference.
- a method of the present disclosure can include a step of contacting a biological specimen (i.e., a sectioned tissue sample treated with a permeabilizing agent and/or a DNA fragmenting agent and/or an agent for disrupting nucleosomes/histones or other cellular components that confer genomic/chromatin structure, thereby allowing for increased genomic accessibility while using the approach) light-activated nucleic acid probes attached thereto.
- a biological specimen i.e., a sectioned tissue sample treated with a permeabilizing agent and/or a DNA fragmenting agent and/or an agent for disrupting nucleosomes/histones or other cellular components that confer genomic/chromatin structure, thereby allowing for increased genomic accessibility while using the approach
- light-activated nucleic acid probes attached thereto The identity and location of the light-activated nucleic acid probes may have been decoded prior to contacting the biological specimen with the bead or other solid support.
- a light-activated nucleic acid probe used in a composition or method set forth herein can include a target capture moiety.
- the target capture moiety is a target capture sequence.
- the target capture sequence is generally complementary to a target sequence such that target capture occurs by formation of a probe-target hybrid complex.
- a target capture sequence can be any of a variety of lengths.
- a plurality of different nucleic acid probes can include different target capture sequences that hybridize to different target nucleic acid sequences from a biological specimen. Different target capture sequences can be used to selectively bind to one or more desired target nucleic acids from a biological specimen.
- the different nucleic acid probes can include a target capture sequence that is common to all or a subset of the probes on a solid support.
- the light activated nucleic acid probes can be complementary to a transposon adapter sequence, e.g., where tagmentation is performed. Such probes or amplicons thereof can hybridize to tagmented DNA molecules or amplicons thereof.
- target DNA insert sequences will differ, capture will be mediated by the common sequence regions complementary to transposon adapter sequences.
- a method set forth herein can include a step of hybridizing light-activated nucleic acid probes to target nucleic acids that are from portions of the biological specimen that are proximal to the probes.
- a target nucleic acid will flow or diffuse from a region of the biological specimen to an area of the probe-presenting bead array that is in proximity with that region of the specimen.
- the target nucleic acid will interact with nucleic acid probes that are proximal to the region of the specimen from which the target nucleic acid was released.
- a target-probe hybrid complex can form where the target nucleic acid encounters a complementary target capture sequence on a nucleic acid probe.
- the location of the target-probe hybrid complex will generally correlate with the region of the biological specimen from where the target nucleic acid was derived.
- the plurality of light-activated nucleic acid probes with bind to the target nucleic acids on the biological specimen and a plurality of target-probe hybrids will be formed.
- the sequences of the target nucleic acids and their locations determined by tagmentation will provide spatial information about the nucleic acid content of the biological specimen.
- An embodiment of the present disclosure may include a step of extending light-activated probes to which target nucleic acids are hybridized.
- the extended probes are thus spatially tagged versions of the target nucleic acids from the biological specimen.
- the sequences of the extended probes identify what nucleic acids are in the biological specimen and where in the biological specimen the target nucleic acids are located. It will be understood that other sequence elements that are present in the nucleic acid probes can also be included in the extended probes (see, e.g., description as provided elsewhere herein). Such elements include, for example, primer binding sites, cleavage sites, other tag sequences (e.g., sample identification tags), capture sequences, recognition sites for nucleic acid binding proteins or nucleic acid enzymes, or the like.
- nucleotides can be added to the 3′ end of a nucleic acid, for example, via polymerase catalysis (e.g., DNA polymerase). Chemical or enzymatic methods can be used to add one or more nucleotide to the 3′ or 5′ end of a nucleic acid.
- polymerase catalysis e.g., DNA polymerase
- Chemical or enzymatic methods can be used to add one or more nucleotide to the 3′ or 5′ end of a nucleic acid.
- oligonucleotides can be added to the 3′ or 5′ end of a nucleic acid, for example, via chemical or enzymatic (e.g., ligase catalysis) methods.
- a nucleic acid can be extended in a template directed manner, whereby the product of extension is complementary to a template nucleic acid that is hybridized to the nucleic acid that is extended.
- Exemplary methods for extending nucleic acids are set forth in US Patent Publication No. US 2005/0037393 or U.S. Pat. No. 8,288,103 or 8,486,625, each of which is incorporated herein by reference.
- an extended probe can include at least, 1, 2, 5, 10, 25, 50, 100, 200, 500, 1000 or more nucleotides that are copied from a target nucleic acid.
- the length of the extension product can be controlled, for example, using reversibly terminated nucleotides in the extension reaction and running a limited number of extension cycles. The cycles can be run as exemplified for SBS techniques and the use of labeled nucleotides is not necessary.
- an extended probe produced in a method set forth herein can include no more than 1000, 500, 200, 100, 50, 25, 10, 5, 2 or 1 nucleotides that are copied from a target nucleic acid.
- extended probes can be any length within or outside of the ranges set forth above.
- light activated probes used in a method, composition or apparatus set forth herein need not be nucleic acids.
- Other molecules can be used such as proteins, carbohydrates, small molecules, particles or the like.
- Light activated probes can be a combination of a nucleic acid component (e.g., having a barcode, primer binding site, cleavage site and/or other sequence element set forth herein) and another moiety (e.g., a moiety that captures or modifies a target nucleic acid).
- Exemplary cleavage sites include, but are not limited to, moieties that are susceptible to a chemical, enzymatic or physical process that results in bond breakage.
- the location can be a nucleotide sequence that is recognized by an endonuclease.
- Suitable endonucleases and their recognition sequences are well known in the art and in many cases are even commercially available (e.g., from New England Biolabs, Beverley MA; ThermoFisher, Waltham, MA or Sigma Aldrich, St. Louis MO).
- a particularly useful endonuclease will break a bond in a nucleic acid strand at a site that is 3′-remote to its binding site in the nucleic acid, examples of which include Type II or Type Hs restriction endonucleases.
- an endonuclease will cut only one strand in a duplex nucleic acid (e.g., a nicking enzyme).
- Examples of endonucleases that cleave only one strand include Nt.BstNBI and Nt.Alwl.
- a cleavage site is an abasic site or a nucleotide that has a base that is susceptible to being removed to create an abasic site.
- nucleotides that are susceptible to being removed to form an abasic site include uracil and 8-oxo-guanine.
- Abasic sites can be created by hydrolysis of nucleotide residues using chemical or enzymatic reagents. Once formed, abasic sites may be cleaved (e.g., by treatment with an endonuclease or other single-stranded cleaving enzyme, exposure to heat or alkali), providing a means for site-specific cleavage of a nucleic acid.
- An abasic site may be created at a uracil nucleotide on one strand of a nucleic acid.
- the enzyme uracil DNA glycosylase (UDG) may be used to remove the uracil base, generating an abasic site on the strand.
- the nucleic acid strand that has the abasic site may then be cleaved at the abasic site by treatment with endonuclease (e.g., EndolV endonuclease, AP lyase, FPG glycosylase/AP lyase, EndoVIII glycosylase/AP lyase), heat or alkali.
- endonuclease e.g., EndolV endonuclease, AP lyase, FPG glycosylase/AP lyase, EndoVIII glycosylase/AP lyase
- Abasic sites may also be generated at non-natural/modified deoxyribonucleotides other than uracil and cleaved in an analogous manner by treatment with endonuclease, heat or alkali.
- endonuclease heat or alkali.
- 8-oxo-guanine can be converted to an abasic site by exposure to FPG glycosylase.
- Deoxyinosine can be converted to an abasic site by exposure to AlkA glycosylase.
- the abasic sites thus generated may then be cleaved, typically by treatment with a suitable endonuclease (e.g., EndolV or AP lyase).
- cleavage sites and methods that can be used to cleave nucleic acids are set forth, for example, in U.S. Pat. No. 7,960,120, which is incorporated herein by reference.
- oligonucleotide sequence can vary across a wide range, e.g., billions, or more. It is further expressly contemplated that in addition to the above-described sequence features, oligonucleotides of the disclosure can possess any number of other art-recognized features while remaining within the scope of the disclosure.
- a tissue section is employed.
- the tissue can be derived from a multicellular organism.
- Exemplary multicellular organisms include, but are not limited to a mammal, plant, algae, nematode, insect, fish, reptile, amphibian, fungi or Plasmodium falciparum .
- Exemplary species are set forth previously herein or known in the art.
- the tissue can be freshly excised from an organism or it may have been previously preserved for example by freezing, embedding in a material such as paraffin (e.g., formalin fixed paraffin embedded samples), formalin fixation, infiltration, dehydration or the like.
- a tissue section can be cryosectioned, using techniques and compositions as described herein and as known in the art.
- a tissue can be permeabilized and the cells of the tissue lysed. Any of a variety of art-recognized lysis treatments can be used. Target nucleic acids that are released from a tissue that is permeabilized can be captured by nucleic acid probes, as described herein and as known in the art.
- a tissue can be prepared in any convenient or desired way for its use in a method, composition or apparatus herein. Fresh, frozen, fixed or unfixed tissues can be used. A tissue can be fixed or embedded using methods described herein or known in the art.
- a tissue sample for use herein can be fixed by deep freezing at temperature suitable to maintain or preserve the integrity of the tissue structure, e.g., less than ⁇ 20° C.
- a tissue can be prepared using formalin-fixation and paraffin embedding (FFPE) methods which are known in the art.
- FFPE formalin-fixation and paraffin embedding
- Other fixatives and/or embedding materials can be used as desired.
- a fixed or embedded tissue sample can be sectioned, i.e. thinly sliced, using known methods.
- a tissue sample can be sectioned using a chilled microtome or cryostat, set at a temperature suitable to maintain both the structural integrity of the tissue sample and the chemical properties of the nucleic acids in the sample.
- Exemplary additional fixatives that are expressly contemplated include alcohol fixation (e.g., methanol fixation, ethanol fixation), glutaraldehyde fixation and paraformaldehyde fixation.
- a tissue sample will be treated to remove embedding material (e.g., to remove paraffin or formalin) from the sample prior to release, capture or modification of nucleic acids. This can be achieved by contacting the sample with an appropriate solvent (e.g., xylene and ethanol washes). Treatment can occur prior to contacting the tissue sample with a solid support-captured bead array as set forth herein or the treatment can occur while the tissue sample is on the solid support-captured bead array.
- an appropriate solvent e.g., xylene and ethanol washes
- the thickness of a tissue sample or other biological specimen that is contacted with a bead array in a method, composition or apparatus set forth herein can be any suitable thickness desired.
- the thickness will be at least 0.1 ⁇ m, 0.25 ⁇ m, 0.5 ⁇ m, 0.75 ⁇ m, 1 ⁇ m, 5 ⁇ m, 10 ⁇ m, 50 ⁇ m, 100 ⁇ m or thicker.
- the thickness of a tissue sample that is contacted with bead array will be no more than 100 ⁇ m, 50 ⁇ m, 10 ⁇ m, 5 ⁇ m, 1 ⁇ m, 0.5 ⁇ m, 0.25 ⁇ m, 0.1 ⁇ m or thinner.
- a particularly relevant source for a tissue sample is a human being.
- the sample can be derived from an organ, including for example, an organ of the central nervous system such as brain, brainstem, cerebellum, spinal cord, cranial nerve, or spinal nerve; an organ of the musculoskeletal system such as muscle, bone, tendon or ligament; an organ of the digestive system such as salivary gland, pharynx, esophagus, stomach, small intestine, large intestine, liver, gallbladder or pancreas; an organ of the respiratory system such as larynx, trachea, bronchi, lungs or diaphragm; an organ of the urinary system such as kidney, ureter, bladder or urethra; a reproductive organ such as ovary, fallopian tube, uterus, vagina, placenta, testicle, epididymis, vas deferens, seminal vesicle, prostate, penis or scrotum; an organ of the
- a sample from a human can be considered (or suspected) healthy or diseased when used. In some cases, two samples can be used: a first being considered diseased and a second being considered as healthy (e.g., for use as a healthy control).
- Any of a variety of conditions can be evaluated, including but not limited to, cancer, an autoimmune disease, cystic fibrosis, aneuploidy, pathogenic infection, psychological condition, hepatitis, diabetes, sexually transmitted disease, heart disease, stroke, cardiovascular disease, multiple sclerosis or muscular dystrophy.
- Certain contemplated conditions include genetic conditions or conditions associated with pathogens having identifiable DNA abundance signatures.
- a photolabile sequencing library is purified from the sample including a step of washing with a wash solution such as a buffered salt solution (or other stabilizing solution).
- a wash solution such as a buffered salt solution (or other stabilizing solution).
- buffered salt solutions include saline-sodium citrate (SSC), for example at a NaCl concentration of about 0.2 M to 5 M NaCl, optionally at about 0.5 to 3 M NaCl, optionally at about 1 M NaCl.
- buffered solutions include, e.g., PBS, Tris buffered saline and/or Tris buffer, as well as, more broadly, any aqueous buffer possessing a pH between 4 and 10 and salt between 0-1 osmolarity.
- Wash solutions can contain various additives, such as surfactants (e.g., detergents), enzymes (e.g., proteases and collagenases), cleavage reagents, or the like, to facilitate removal of the specimen.
- the solid support is treated with a solution comprising a proteinase enzyme.
- the solution can include cellulase, hemicellulase or chitinase enzymes (e.g., if desiring to remove a tissue sample from a plant or fungal source).
- the temperature of a wash solution will be at least 30° C., 35° C., 50° C., 60° C. or 90° C. Conditions can be selected for removal of a biological specimen while not denaturing hybrid complexes formed between target nucleic acids and attached light-activated nucleic acid probes.
- Some of the methods and compositions provided herein employ methods of sequencing nucleic acids.
- a number of DNA sequencing techniques are known in the art, including fluorescence-based sequencing methodologies (see e.g., Birren et al, Genome Analysis Analyzing DNA, 1, Cold Spring Harbor, N.Y., which is incorporated herein by reference in its entirety).
- automated sequencing techniques understood in that art are utilized.
- parallel sequencing of partitioned amplicons can be utilized (PCT Publication No. WO2006084132, which is incorporated herein by reference in its entirety).
- DNA sequencing is achieved by parallel oligonucleotide extension (See, e.g., U.S. Pat. Nos.
- NGS Next-generation sequencing methods
- NGS methods can be employed in certain aspects of the disclosure to obtain a high volume of sequence information (such as are particularly required to perform deep sequencing of bead-associated cellular DNAs following capture of such DNAs from treated tissue sections (e.g., treated cryosections)) in a highly efficient and cost effective manner.
- NGS methods share the common feature of massively parallel, high-throughput strategies, with the goal of lower costs in comparison to older sequencing methods (see, e.g., Voelkerding et al, Clinical Chem., 55: 641-658, 2009; MacLean et al, Nature Rev. Microbiol, 7-287-296; which are incorporated herein by reference in their entireties).
- NGS methods can be broadly divided into those that typically use template amplification and those that do not.
- Amplification-utilizing methods include pyrosequencing commercialized by Roche as the 454 technology platforms (e.g., GS 20 and GS FLX), the Solexa platform commercialized by Illumina®, and the Supported Oligonucleotide Ligation and Detection (SOLiDTM) platform commercialized by Applied Biosystems.
- Non-amplification approaches also known as single-molecule sequencing, are exemplified by the HeliScope platform commercialized by Helicos Biosciences, SMRT sequencing commercialized by Pacific Biosciences, and emerging platforms marketed by VisiGen and Oxford Nanopore Technologies Ltd.
- template DNA is fragmented, end-repaired, ligated to adaptors, and clonally amplified in-situ by capturing single template molecules with beads bearing oligonucleotides complementary to the adaptors.
- Each bead bearing a single template type is compartmentalized into a water-in-oil microvesicle, and the template is clonally amplified using a technique referred to as emulsion PCR.
- the emulsion is disrupted after amplification and beads are deposited into individual wells of a picotitre plate functioning as a flow cell during the sequencing reactions. Ordered, iterative introduction of each of the four dNTP reagents occurs in the flow cell in the presence of sequencing enzymes and luminescent reporter such as luciferase.
- luminescent reporter such as luciferase.
- an appropriate dNTP is added to the 3′ end of the sequencing primer, the resulting production of ATP causes a burst of luminescence within the well, which is recorded using a CCD camera. It is possible to achieve read lengths greater than or equal to 400 bases, and 10 6 sequence reads can be achieved, resulting in up to 500 million base pairs (Mb) of sequence.
- sequencing data are produced in the form of shorter-length reads.
- single-stranded fragmented DNA is end-repaired to generate 5′-phosphorylated blunt ends, followed by Klenow-mediated addition of a single A base to the 3′ end of the fragments.
- A-addition facilitates addition of T-overhang adaptor oligonucleotides, which are subsequently used to capture the template-adaptor molecules on the surface of a flow cell that is studded with oligonucleotide anchors.
- the anchor is used as a PCR primer, but because of the length of the template and its proximity to other nearby anchor oligonucleotides, extension by PCR results in the “arching over” of the molecule to hybridize with an adjacent anchor oligonucleotide to form a bridge structure on the surface of the flow cell.
- These loops of DNA are denatured and cleaved. Forward strands are then sequenced with reversible dye terminators.
- sequence of incorporated nucleotides is determined by detection of post-incorporation fluorescence, with each fluorophore and block removed prior to the next cycle of dNTP addition. Sequence read length ranges from 36 nucleotides to over 50 nucleotides, with overall output exceeding 1 billion nucleotide pairs per analytical run.
- Sequencing nucleic acid molecules using SOLiD technology can initially involve fragmentation of the template, ligation to oligonucleotide adaptors, attachment to beads, and clonal amplification by emulsion PCR. Following this, beads bearing template are immobilized on a derivatized surface of a glass flow-cell, and a primer complementary to the adaptor oligonucleotide is annealed.
- interrogation probes have 16 possible combinations of the two bases at the 3′ end of each probe, and one of four fluors at the 5′ end. Fluor color, and thus identity of each probe, corresponds to specified color-space coding schemes. Multiple rounds (usually 7) of probe annealing, ligation, and fluor detection are followed by denaturation, and then a second round of sequencing using a primer that is offset by one base relative to the initial primer. In this manner, the template sequence can be computationally re-constructed, and template bases are interrogated twice, resulting in increased accuracy. Sequence read length averages 35 nucleotides, and overall output exceeds 4 billion bases per sequencing run.
- nanopore sequencing is employed (see, e.g., Astier et al, J. Am. Chem. Soc. 2006 Feb. 8; 128(5): 1705-10, which is incorporated by reference).
- the theory behind nanopore sequencing has to do with what occurs when a nanopore is immersed in a conducting fluid and a potential (voltage) is applied across it. Under these conditions a slight electric current due to conduction of ions through the nanopore can be observed, and the amount of current is exceedingly sensitive to the size of the nanopore.
- the Ion Torrent technology is a method of DNA sequencing based on the detection of hydrogen ions that are released during the polymerization of DNA (see, e.g., Science 327(5970): 1190 (2010); U.S. Patent Publication Nos. 20090026082, 20090127589, 20100301398, 20100197507, 20100188073, and 20100137143, which are incorporated herein by reference in their entireties).
- a microwell contains a template DNA strand to be sequenced. Beneath the layer of microwells is a hypersensitive ISFET ion sensor. All layers are contained within a CMOS semiconductor chip, similar to that used in the electronics industry.
- a hydrogen ion is released, which triggers a hypersensitive ion sensor.
- a hydrogen ion is released, which triggers a hypersensitive ion sensor.
- homopolymer repeats are present in the template sequence, multiple dNTP molecules will be incorporated in a single cycle. This leads to a corresponding number of released hydrogens and a proportionally higher electronic signal.
- This technology differs from other sequencing technologies in that no modified nucleotides or optics are used.
- the per base accuracy of the Ion Torrent sequencer is approximately 99.6% for 50 base reads, with approximately 100 Mb generated per run. The read-length is 100 base pairs.
- the accuracy for homopolymer repeats of 5 repeats in length is approximately 98%.
- the benefits of ion semiconductor sequencing are rapid sequencing speed and low upfront and operating costs.
- targeted double-stranded DNA sequences can first be assigned to an image location, with all associated DNA sequence data also assigned to that position. High resolution images representing the extent of capture of individual or grouped DNAs across the various spatial positions can then be generated using the underlying DNA sequence information. Images (i.e., pixel coloring and/or intensities) can be adjusted and/or normalized using any (or any number of) art-recognized technique(s) deemed appropriate by one of ordinary skill in the art.
- a high-resolution image of the disclosure is an image in which discrete features (e.g., pixels) of the image are spaced at 100 ⁇ m or less.
- the spacing of discrete features within the image is at 50 ⁇ m or less, optionally 40 ⁇ m or less, optionally 30 ⁇ m or less, optionally 20 ⁇ m or less, optionally 15 ⁇ m or less, optionally 10 ⁇ m or less, optionally 9 ⁇ m or less, optionally 8 ⁇ m or less, optionally 7 ⁇ m or less, optionally 6 ⁇ m or less, optionally 5 ⁇ m or less, optionally 4 ⁇ m or less, optionally 3 ⁇ m or less, optionally 2 ⁇ m or less, or optionally 1 ⁇ m or less.
- Images can be obtained using detection devices known in the art. Examples include microscopes configured for light, bright field, dark field, phase contrast, fluorescence, reflection, interference, or confocal imaging.
- a biological specimen can be stained prior to imaging to provide contrast between different regions or cells. In some embodiments, more than one stain can be used to image different aspects of the specimen (e.g., different regions of a tissue, different cells, specific subcellular components or the like). In other embodiments, a biological specimen can be imaged without staining.
- a fluorescence microscope e.g., a confocal fluorescent microscope
- a biological specimen that is fluorescent, for example, by virtue of a fluorescent label.
- Fluorescent specimens can also be imaged using a nucleic acid sequencing device having optics for fluorescent detection such as a Genome Analyzer®, MiSeq®, NextSeq® or HiSeq® platform device commercialized by Illumina, Inc. (San Diego, CA); or a SOLiDTM sequencing platform commercialized by Life Technologies (Carlsbad, CA).
- Other imaging optics that can be used include those that are found in the detection devices described in Bentley et al., Nature 456:53-59 (2008), PCT Publication Nos.
- An image of a biological specimen can be obtained at a desired resolution, for example, to distinguish tissues, cells or subcellular components. Accordingly, the resolution can be sufficient to distinguish components of a biological specimen that are separated by at least 0.5 ⁇ m, 1 ⁇ m, 5 ⁇ m, 10 ⁇ m, 50 ⁇ m, 100 ⁇ m, 500 ⁇ m, 1 mm or more. Alternatively or additionally, the resolution can be set to distinguish components of a biological specimen that are separated by at least 1 mm, 500 ⁇ m, 100 ⁇ m, 50 ⁇ m, 10 ⁇ m, 5 ⁇ m, 1 ⁇ m, 0.5 ⁇ m or less.
- a method set forth herein can include a step of correlating locations in an image of a biological specimen with light-activated nucleic acid probes to which the biological specimen is, was or will be contacted. Accordingly, characteristics of the biological specimen that are identifiable in the image can be correlated with the nucleic acids that are found to be present in their proximity. Any of a variety of morphological characteristics can be used in such a correlation, including for example, cell shape, cell size, tissue shape, staining patterns, presence of particular proteins (e.g., as detected by immunohistochemical stains) or other characteristics that are routinely evaluated in pathology or research applications. Accordingly, the biological state of a tissue or its components as determined by visual observation can be correlated with molecular biological characteristics as determined by spatially resolved nucleic acid analysis.
- a solid support upon which a biological specimen is imaged can include fiducial markers to facilitate determination of the orientation of the specimen or the image thereof in relation to probes that are attached to the solid support.
- exemplary fiducials include, but are not limited to, beads (with or without fluorescent moieties or moieties such as nucleic acids to which labeled probes can be bound), fluorescent molecules attached at known or determinable features, or structures that combine morphological shapes with fluorescent moieties.
- Exemplary fiducials are set forth in US Patent Publication No. 2002/0150909 A1 or U.S. patent application Ser. No. 14/530,299, each of which is incorporated herein by reference.
- One or more fiducials are preferably visible while obtaining an image of a biological specimen.
- the fiducials can be provided in a pattern, for example, along an outer edge of a perimeter of a location where a biological specimen resides.
- one or more fiducials are detected using the same imaging conditions used to visualize a biological specimen.
- separate images can be obtained (e.g., one image of the biological specimen and another image of the fiducials) and the images can be aligned to each other.
- kits containing agents of this disclosure for use in the methods of the present disclosure.
- Kits of the disclosure may include one or more containers comprising an agent (e.g., permeabilizing agent) and/or composition (e.g., Tn5 transposase loaded with customized amplification-blocked adapters) of this disclosure.
- the kits further include instructions for use in accordance with the methods of this disclosure.
- these instructions comprise a description of administration of the agent to diagnose, e.g., a disease and/or malignancy.
- the instructions comprise a description of how to create a tissue cryosection, treat a tissue section with a permeabilizing agent and/or a DNA fragmenting agent, form a spatially-defined (or simply spatially definable, pending performance of a step that defines the spatial resolution of the bead array) bead array, contact a tissue cryosection with a spatially-defined bead array and/or obtain captured, tissue cryosection-derived DNA sequence from the spatially-defined bead array.
- the kit may further comprise a description of selecting an individual suitable for treatment based on identifying whether that subject has a certain pattern of DNA abundance of one or more sequences in a cryosection sample.
- kits of the disclosure are typically written instructions on a label or package insert (e.g., a paper sheet included in the kit), but machine-readable instructions (e.g., instructions carried on a magnetic or optical storage disk) are also acceptable.
- a label or package insert e.g., a paper sheet included in the kit
- machine-readable instructions e.g., instructions carried on a magnetic or optical storage disk
- the label or package insert indicates that the composition is used for staging a cryosection and/or diagnosing a specific DNA abundance pattern in a cryosection. Instructions may be provided for practicing any of the methods described herein.
- kits of this disclosure are in suitable packaging.
- suitable packaging includes, but is not limited to, vials, bottles, jars, flexible packaging (e.g., sealed Mylar or plastic bags), and the like.
- the container may further comprise a pharmaceutically active agent.
- Kits may optionally provide additional components such as buffers and interpretive information.
- the kit comprises a container and a label or package insert(s) on or associated with the container.
- the techniques herein provide photoselective sequencing, a sequencing methodology that enables non-invasive targeted genomic and epigenomic sequencing of spatially-defined cellular or subcellular regions of tissues or cell populations or cells using light-activated probes.
- the disclosure provides in-situ tagmentation with blocked adapters consisting of an oligonucleotide sequence conjugated to a fluorophore via a photocleavable spacer. Photo-induced cleavage of the spacer removes the fluorophore and uncages a 5′ phosphate group that enables ligation of secondary adapters, which are subsequently used to amplify the selected DNA fragments after digestion of the sample.
- photoselective sequencing provides diffraction-limited resolution and straightforward compatibility with varied genomic and epigenetic sequencing libraries. Additionally, photoselective sequencing is not limited to spatially localized populations of cells.
- photoselective sequencing may involve: step 100 obtaining the tissue or cell sample from a subject; step 200 fixing the tissue or cell sample with a fixing agent; step 300 staining the fixed tissue or cell sample; step 400 preparing a photolabile sequencing library using a DNA fragmenting agent loaded with amplification-blocked adapters; step 500 targeting illumination of the fixed tissue or cell sample with near-UV light to unblock the adapters in a region of interest; step 600 purifying DNA from the sample; and step 700 amplifying and sequencing the unblocked adapters on a sequencing platform.
- FIG. 2 A shows an ATAC library prepared for photoselective sequencing in HeLa cells.
- Successful cleavage of the amplification-block in targeted cells removes the fluorophore and unblocks the library, as indicated by a loss of fluorescence.
- Libraries prepared for photoselective sequencing display hallmark properties of the established versions of the corresponding library preparations. For example, sequenced ATAC libraries in HeLa cells (prepared according to the photoselective sequencing protocol described herein) show high enrichment in transcription-start-sites, and a periodic fragment size distribution as expected (see e.g., FIG. 2 B ).
- Photoselective sequencing has a low level of background fragments (e.g., fragments that were not intentionally unblocked), as indicated by a species mixing experiment.
- Tagmented DNA from various numbers of human and mouse cells was mixed, however, only fragments from only one of the two species were unblocked using the photoselective sequencing mechanism.
- the photoselective sequencing library preparation was carried out on the mixed-DNA sample and the number of human and mouse reads were quantified by sequencing an alignment to the respective genomes.
- the results see e.g., FIG. 2 C ) show that, for example, even when the unblocked DNA-fragments from 10 human cells is mixed with blocked DNA from 10,000 mouse cells, the vast majority of reads (>90%) align to the human genome.
- photoselective sequencing recapitulates data derived from single-cell ATAC.
- a photoselective ATAC library was prepared in sections from the hippocampal region of a wild type mouse brain, and the dentate dentate gyrus region was selected by exposure to 405 nm light (see e.g., FIG. 2 D ).
- the sequencing reads from the photoselected libraries were aligned to the mouse genome and compared to granule cell data from a reference single-cell ATAC data set (where granule cells were called computationally) obtained from Sinnamon et al. (Genome Res. 2019 May; 29(5):857-869).
- a feature set was created by pooling the photoselective sequencing reads with the published sequencing reads, and calling peaks on the joint data set. To compare the data two sets, the fraction of reads lying in each peak was compared between the data sets (see e.g., FIG. 2 E ) establishing high correlation between the data produced by the two methods (correlation coefficient ⁇ 0.86).
- Adherent cells are cultured in an appropriate growth medium and split onto an imaging-compatible dish or slide.
- tissue 10 uM sections of a fresh-frozen sample are collected and placed onto a glass-bottom imaging dish or microscope slide. The tissue is lightly melted onto the glass by touching the underlying glass briefly with one finger.
- the sample is stained for cells or subcellular regions of interest using standard protocols. This may include immunofluorescence against proteins that mark subcellular regions or cell types of interest, a DAPI stain to identify cellular regions based on morphology, or FISH targeting cell-specific gene markers, or particular chromosomes.
- immunofluorescence the sample is blocked for 30 minutes at room temperature in 4% bovine serum albumin dissolved in 0.1% PBSTween (1 ⁇ PBS containing 0.1% Tween 20).
- the sample is next stained with a 1:200 dilution of the primary antibody, either at room temperature for 1 hour or overnight at 4° C. Excess primary antibody is removed by washing 3 ⁇ 5 minutes with 0.1% PBSTween.
- the sample is then stained with a fluorescently-labeled secondary antibody for 1 hour at room temperature, then washed 3 ⁇ 5 minutes with 1 ⁇ PBS.
- Tagmentation adapters (Adapter 1 and Adapter 2) are annealed to the mosaic end sequence by mixing 12.25 ⁇ L of 100 uM Adapter 1, 12.25 ⁇ L of 100 ⁇ M Adapter 2, 24 ⁇ L of 100 uM Mosaic End, 0.5 ⁇ L of 1 M Tris, pH 8, and 0.5 ⁇ L of 5 M NaCl in a PCR strip tube. The mixture is heated to 85° C. and cooled to 20° C. over the course of 1-1.5 hours. The annealed oligos are mixed with 50 uL of 100% glycerol and stored at ⁇ 20° C. until loaded into the Tn5 transposase.
- Tn5 is loaded by combining 13.5 ⁇ M Tn5 transposase with annealed oligos and dilution buffer (50% glycerol, 50 mM Tris pH 7.5, 100 mM NaCl, 100 ⁇ M EDTA, 1 mM DTT, 0.1% NP-40) in a 1:2:1 ratio. The mixture is incubated for 30 min at room temperature, then transferred to ⁇ 20° C. for storage up to one week, or used immediately for tagmentation.
- dilution buffer 50% glycerol, 50 mM Tris pH 7.5, 100 mM NaCl, 100 ⁇ M EDTA, 1 mM DTT, 0.1% NP-40
- Loaded Tn5 transposase is either diluted 1/20 (cells) or 2 ⁇ 5 (tissues) in reaction buffer (in 0.3 ⁇ PBS, 10 mM Tris pH 8.5, 5 mM MgCl 2 ). The mixture is incubated at 37° C. for 3 hours in a humidified incubator. The tagmentation reaction is quenched by rinsing the sample once with 50 mM EDTA in 1 ⁇ PBS, then incubating for an additional 30 minutes at 37° C. in fresh 50 mM EDTA in 1 ⁇ PBS.
- the sample is visualized by light microscopy to identify regions of interest that will be targeted for sequencing.
- the tagmented DNA in these regions of interest are unblocked by exposure to a focused beam of near-ultraviolet light (e.g., a 405 nm laser line focused onto the sample plane). This can be accomplished using a laser-scanning confocal microscope, a commercially available targeted illumination device, or a custom setup.
- a focused beam of near-ultraviolet light e.g., a 405 nm laser line focused onto the sample plane.
- a focused beam of near-ultraviolet light e.g., a 405 nm laser line focused onto the sample plane.
- This can be accomplished using a laser-scanning confocal microscope, a commercially available targeted illumination device, or a custom setup.
- the fluorescence of the library is monitored by visualizing the fluorophore at the 5′ ends of the tagmentation adapters (e.g. Alexa Flu
- the sample is digested by incubating the sample overnight at 55° C. with Proteinase K diluted 1:50 in a buffer containing 50 mM Tris pH 8, 50 mM NaCl and 0.4% SDS.
- the digested samples are column purified and eluted in 10 mM Tris pH 8. This recovers a mixture of blocked and unblocked fragments; however, only unblocked fragments will be ligated in subsequent steps.
- Secondary adapters are (P5 ligation adapter, P7 ligation adapter) are hybridized to the tagmented DNA using splints (Adapter 1 splint and Adapter 2 splint) that bridge the tagmentation and secondary adapters.
- splints Adapter 1 splint and Adapter 2 splint
- the photoselected DNA is combined with 1 ⁇ M P5 ligation adapter, 1 ⁇ M P7 ligation adapter, 1 ⁇ M Adapter 1 splint, 1 ⁇ M Adapter 2 splint in 1 ⁇ T4 DNA ligase buffer (NEB).
- the mixture is heated to 68° C. and cooled ⁇ 0.1° C./s until it reaches 22° C.
- T4 DNA ligase (NEB) is then spiked into the reaction (1 ⁇ L ligase/10 ⁇ L total reaction volume), and the ligation reaction is incubated for 30 minutes at 22° C.
- the ligation reaction is cleaned using 1.8 ⁇ AMPureXP beads (Beckman Coulter) according to the manufactures directions and eluted in 10 mM Tris pH 8.
- Cleaned ligation reactions are amplified for sequencing using NEBNext PCR master mix with primers PCR 1 and PCR 2, both at 1.25 ⁇ M.
- the thermocycling conditions are as follows: 5 min at 72° C., 30 s at 90° C., 5 repeats of 10s at 98° C. then 1 min 30s at 72° C., 2 min at 72° C., hold at 4° C. After an initial 5 cycles of PCR, the additional number of cycles needed is determined by performing qPCR on 10 ⁇ L of the previously amplified DNA.
- the qPCR reaction uses the same components as the initial PCR, except with the addition of SYBR green at a final concentration of 1 ⁇ .
- the samples are cleaned using 1.8 ⁇ AMPureXP (Beckman Coulter) according to the manufactures directions and eluted in ultrapure water (Invitrogen).
- the libraries are quantified using a Kapa Quantification Kit (Roche) as per the manufacturer's directions. Libraries are diluted and then sequenced on an Illumina platform as directed by the manufacturer.
- Any remaining adapter sequences are trimmed from the reads using a custom python script. Trimmed reads are aligned to an appropriate genome using Bowtie2. Duplicate reads are removed using Picard, resulting in filtered BAM files that can be used for downstream analysis as desired.
- oligos used in example protocol written as they would be purchased from Integrated DNA Technologies (IDTTM).
- /iSpPC/ is a photocleavable spacer
- /5 Alex546N/ is a 5′ Alexa Fluor 546 modification.
- the N bases in the P7 ligation adapter represent an index sequence that uniquely identifies each sample.
- /3ddC/ is a 3′ dideoxycytidine modification that prevents extension by polymerases.
- /5phos/ is a 5′ phosphate modification and * is a phosphorothiolate (or alternatively a phosphorothioate) bond.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Medicinal Chemistry (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Plant Pathology (AREA)
- Crystallography & Structural Chemistry (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Description
| (SEQ ID NO: 1) | |
| 5′-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-3′ | |
| (SEQ ID NO: 2) | |
| 5′-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-3′ |
| (SEQ ID NO: 3) | |
| 5′-NNNNNNNNNNNNNNNNNNNTGTATAAGAGACAG-3′ |
-
- 1) Mitochondrial lineage tracing. Somatic mutations in mitochondrial DNA have been recently shown to enable lineage inference in hematopoietic cells and solid tumors. Since the instant approach is capable of capturing all forms of cellular DNA, including mitochondrial DNA, it can be applied to study clonal dynamics and their spatial relationship in tissues.
- 2) High-resolution spatial assessment of epigenetic regulation, including, e.g., high-resolution spatial assessment of DNA methylation patterns. The previously described Assay for Transposase-Accessible Chromatin using sequencing (ATAC-seq in e.g., US Patent Publication No. 20180237951A1) has led to numerous new insights into cell state transitions and gene regulation, but has so far not been able to preserve spatial information with high resolution. Using the approach of the disclosure DNA libraries have now been successfully prepared that show a significant enrichment for transcription start sites, which indicates that the instant approach can specifically capture accessible chromatin. The disclosure can therefore be used to study how different cell types with varying epigenetic states are spatially distributed within a tissue.
- 3) Improved identification of regions of monoallelic gene expression and gene dosage in an assayed tissue. A variety of genes are expressed from one allele only (e.g., through imprinting, X chromosome inactivation, or autosomal random monoallelic expression) but many aspects of their regulation, such as tissue-specific skewing towards one allele or the stability of repression of autosomal alleles, are poorly understood. In certain aspects, the disclosure allows for capture specifically of accessible chromatin (i.e. active alleles), which can therefore be used to study the spatial distribution of mono- vs. bi-allelic gene expression.
- 5) High-resolution, spatial evaluation of gene therapy deliverables to tissue, including, e.g., identification of cellular delivery of CRISPR/Cas9 plasmid(s) and/or gels, TALEN plasmid(s) and/or gels, viral vectors (e.g., AAV), expression vectors/plasmids in general, etc.
- 6) Assessment of synthetic DNA arrays for sequence-specific quantities and distributions of DNA upon the synthetic DNA array. It is herein specifically contemplated that DNA from synthetic arrays can be allowed to hybridize to a sequenced puck, using known sequences attached to the DNA (so that target DNA can be captured by reverse-complement sequences included in the bead-attached oligonucleotides. Tagmentation (see e.g., US Patent Publication No. 2020/0115753 A1) as described herein is an approach that allows for addition of such adapter sequences.
-
- Tissue slices are incubated in 1% PFA for 10 minutes at room temperature. The fixation reaction is quenched by the addition of 250 mM Tris pH 8 for 5 minutes. The sample is washed 2×5 min in 1×PBS, then incubated in 0.5% Triton X-100 in 1×PBS for 20 minutes at room temperature, then washed another 3×5 min in 1×PBS
Staining for Regions of Interest:
- Tissue slices are incubated in 1% PFA for 10 minutes at room temperature. The fixation reaction is quenched by the addition of 250 mM Tris pH 8 for 5 minutes. The sample is washed 2×5 min in 1×PBS, then incubated in 0.5% Triton X-100 in 1×PBS for 20 minutes at room temperature, then washed another 3×5 min in 1×PBS
-
- If whole genome sequencing is desired, the sample is treated with 0.1N HCl for 5 min at room temperature to denature histones and allow uninform tagmentation. Protein targeted tagmentation can be achieved by specifically tethering the loaded Tn5 to the protein of interest, typically through the use of a ProteinA-Tn5 transposase fusion which will bind an antibody stain. Proceeding without modifications at this point will result in an ATAC library.
Tagmentation:
- If whole genome sequencing is desired, the sample is treated with 0.1N HCl for 5 min at room temperature to denature histones and allow uninform tagmentation. Protein targeted tagmentation can be achieved by specifically tethering the loaded Tn5 to the protein of interest, typically through the use of a ProteinA-Tn5 transposase fusion which will bind an antibody stain. Proceeding without modifications at this point will result in an ATAC library.
| SEQ | ||
| Oligo | Sequence (5′-3′) | ID NO: |
| |
/5Alex546N// |
1 |
| | ||
| Adapter | ||
| 2 | /5Alex546N// |
2 |
| AGATGTGTATAAGAGACAG | ||
| P5 | AATGATACGGCGACCACCGAGATCTACACCTCT | 4 |
| ligation | CTAT | |
| adapter | ||
| P7 | CAAGCAGAAGACGGCATACGAGATNNNNNNNNC | 5 |
| ligation | | |
| adapter | ||
| Adapter | ||
| 1 | TGCCGACGAATAGAGAGGTGTAG/3ddC/ | 6 |
| | ||
| Adapter | ||
| 2 | CCCACGAGACAGAGTCAGTCG/3ddC/ | 7 |
| splint | ||
| Mosiac | /5phos/C*T*G*T*C*T*C*T*T*A*T*A*C* | 8 |
| end | A*C*A*/3ddC/ | |
| |
AATGATACGGCGACCACCGAGATCTACAC | 9 |
| |
CAAGCAGAAGACGGCATACGAGAT | 10 |
Claims (18)
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US17/582,102 US12037637B2 (en) | 2021-01-25 | 2022-01-24 | Photoselective non-invasive targeted genomic and epigenomic sequencing of spatially-defined cells or subcellular regions |
| US18/763,436 US20250034634A1 (en) | 2021-01-25 | 2024-07-03 | Photoselective non-invasive targeted genomic and epigenomic sequencing of spatially-defined cells or subcellular regions |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202163141342P | 2021-01-25 | 2021-01-25 | |
| US17/582,102 US12037637B2 (en) | 2021-01-25 | 2022-01-24 | Photoselective non-invasive targeted genomic and epigenomic sequencing of spatially-defined cells or subcellular regions |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US18/763,436 Division US20250034634A1 (en) | 2021-01-25 | 2024-07-03 | Photoselective non-invasive targeted genomic and epigenomic sequencing of spatially-defined cells or subcellular regions |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| US20220235396A1 US20220235396A1 (en) | 2022-07-28 |
| US12037637B2 true US12037637B2 (en) | 2024-07-16 |
Family
ID=82494514
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US17/582,102 Active 2042-01-24 US12037637B2 (en) | 2021-01-25 | 2022-01-24 | Photoselective non-invasive targeted genomic and epigenomic sequencing of spatially-defined cells or subcellular regions |
| US18/763,436 Pending US20250034634A1 (en) | 2021-01-25 | 2024-07-03 | Photoselective non-invasive targeted genomic and epigenomic sequencing of spatially-defined cells or subcellular regions |
Family Applications After (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US18/763,436 Pending US20250034634A1 (en) | 2021-01-25 | 2024-07-03 | Photoselective non-invasive targeted genomic and epigenomic sequencing of spatially-defined cells or subcellular regions |
Country Status (1)
| Country | Link |
|---|---|
| US (2) | US12037637B2 (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117740504A (en) * | 2022-09-22 | 2024-03-22 | 深圳华大生命科学研究院 | Sample processing method for space histology analysis |
| CN116287140A (en) * | 2023-01-17 | 2023-06-23 | 华南师范大学 | A nucleic acid amplification method based on light regulation |
| CN120041539A (en) * | 2023-06-28 | 2025-05-27 | 深圳赛陆医疗科技有限公司 | Library construction method combining low-depth whole genome sequencing and targeted sequencing |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011006075A1 (en) * | 2009-07-09 | 2011-01-13 | Somalogic, Inc. | Method for generating aptamers with improved off-rates |
| US20170253876A1 (en) * | 2014-08-04 | 2017-09-07 | The Trustees of the University fo Pennsylvania | Transcriptome In Vivo Analysis (TIVA) and Transcriptome In Situ Analysis (TISA) |
-
2022
- 2022-01-24 US US17/582,102 patent/US12037637B2/en active Active
-
2024
- 2024-07-03 US US18/763,436 patent/US20250034634A1/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011006075A1 (en) * | 2009-07-09 | 2011-01-13 | Somalogic, Inc. | Method for generating aptamers with improved off-rates |
| US20170253876A1 (en) * | 2014-08-04 | 2017-09-07 | The Trustees of the University fo Pennsylvania | Transcriptome In Vivo Analysis (TIVA) and Transcriptome In Situ Analysis (TISA) |
Non-Patent Citations (10)
| Title |
|---|
| Buenrostro, Jason D., et al. "ATAC-seq: a method for assaying chromatin accessibility genome-wide." Current protocols in molecular biology 109.1 (2015): 21-29 (Year: 2015). * |
| Chen, Chuming, et al. "Software for pre-processing Illumina next-generation sequencing short read sequences." Source code for biology and medicine 9.1 (2014): 1-11 (Year: 2014). * |
| Curran S., McKay J.A., McLeod H.L., Murray G.I. Laser capture microscopy. Mol Pathol. 2000;53(2):64-68. doi:10.1136/mp.53.2.64. |
| Fuchs, Ryan T., et al. "Bias in ligation-based small RNA sequencing library construction is determined by adaptor and RNA structure." PloS one 10.5 (2015): e0126049 (Year: 2015). * |
| Genshaft A.S. et al. Spatially-Resolved Live Cell Tagging and Isolation Using Protected Photoactivatable Cell Dyes. bioRxiv 2020.02.28.966598; doi: https://doi.org/10.1101/2020.02.28.966598. |
| Ghrebi, Salem S., Gethin Rh Owen, and Donald M. Brunette. "Triton X-100 pretreatment of LR-white thin sections improves immunofluorescence specificity and intensity." Microscopy Research and Technique 70.7 (2007): 555-562 (Year: 2007). * |
| Jamur, Maria Célia, and Constance Oliver. "Permeabilization of cell membranes." Immunocytochemical methods and protocols (2010): 63-66 (Year: 2010). * |
| Lee J. et al. Single Cell Spatial Chromatin Analysis of Fixed Immunocytochemically Identified Neuronal Cells. bioRxiv 780387; doi: https://doi.org/10.1101/780387. |
| Picelli, Simone, et al. "Tn5 transposase and tagmentation procedures for massively scaled sequencing projects." Genome research 24.12 (2014): 2033-2040 (Year: 2014). * |
| Ruble, Brittani K., Sean B. Yeldell, and Ivan J. Dmochowski. "Caged oligonucleotides for studying biological systems." Journal of inorganic biochemistry 150 (2015): 182-188 (Year: 2015). * |
Also Published As
| Publication number | Publication date |
|---|---|
| US20250034634A1 (en) | 2025-01-30 |
| US20220235396A1 (en) | 2022-07-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11613773B2 (en) | Spatially distinguished, multiplex nucleic acid analysis of biological specimens | |
| US20250327060A1 (en) | High-resolution spatial macromolecule abundance assessment | |
| US20250034634A1 (en) | Photoselective non-invasive targeted genomic and epigenomic sequencing of spatially-defined cells or subcellular regions | |
| US20220389409A1 (en) | High-resolution spatial and quantitative dna assessment | |
| JP2023533418A (en) | Methods for Increasing Yields of Sequencing Libraries | |
| US20220177963A1 (en) | Paired macromolecule abundance and t-cell receptor sequencing with high spatial resolution | |
| CA3140900A1 (en) | Sequencing by emergence | |
| US20240043915A1 (en) | Methods and compositions for in situ macromolecule detection and uses thereof | |
| HK40102430B (en) | Spatially distinguished, multiplex nucleic acid analysis of biological specimens | |
| HK40102430A (en) | Spatially distinguished, multiplex nucleic acid analysis of biological specimens | |
| HK40062809B (en) | Spatially distinguished, multiplex nucleic acid analysis of biological specimens | |
| HK40062809A (en) | Spatially distinguished, multiplex nucleic acid analysis of biological specimens | |
| HK40081866A (en) | Spatially distinguished, multiplex nucleic acid analysis of biological specimens | |
| HK40062808A (en) | Spatially distinguished, multiplex nucleic acid analysis of biological specimens | |
| HK40080403B (en) | Spatially distinguished, multiplex nucleic acid analysis of biological specimens |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| FEPP | Fee payment procedure |
Free format text: ENTITY STATUS SET TO UNDISCOUNTED (ORIGINAL EVENT CODE: BIG.); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY |
|
| FEPP | Fee payment procedure |
Free format text: ENTITY STATUS SET TO SMALL (ORIGINAL EVENT CODE: SMAL); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: DOCKETED NEW CASE - READY FOR EXAMINATION |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: RESPONSE TO NON-FINAL OFFICE ACTION ENTERED AND FORWARDED TO EXAMINER |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: NON FINAL ACTION MAILED |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: RESPONSE TO NON-FINAL OFFICE ACTION ENTERED AND FORWARDED TO EXAMINER |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: NOTICE OF ALLOWANCE MAILED -- APPLICATION RECEIVED IN OFFICE OF PUBLICATIONS |
|
| AS | Assignment |
Owner name: THE BROAD INSTITUTE, INC., MASSACHUSETTS Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:MANGIAMELI, SARAH;CHEN, HAIQI;REEL/FRAME:066670/0126 Effective date: 20210503 Owner name: PRESIDENT AND FELLOWS OF HARVARD COLLEGE, MASSACHUSETTS Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:CHEN, FEI;REEL/FRAME:066671/0267 Effective date: 20211202 Owner name: THE BROAD INSTITUTE, INC., MASSACHUSETTS Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:CHEN, FEI;REEL/FRAME:066671/0267 Effective date: 20211202 |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: PUBLICATIONS -- ISSUE FEE PAYMENT VERIFIED |
|
| STCF | Information on status: patent grant |
Free format text: PATENTED CASE |