US11590198B2 - Methods and reagents for efficient and targeted delivery of therapeutic molecules to CXCR4 cells - Google Patents
Methods and reagents for efficient and targeted delivery of therapeutic molecules to CXCR4 cells Download PDFInfo
- Publication number
- US11590198B2 US11590198B2 US17/026,543 US202017026543A US11590198B2 US 11590198 B2 US11590198 B2 US 11590198B2 US 202017026543 A US202017026543 A US 202017026543A US 11590198 B2 US11590198 B2 US 11590198B2
- Authority
- US
- United States
- Prior art keywords
- cxcr4
- cells
- polypeptide
- peptide
- protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
- A61K38/10—Peptides having 12 to 20 amino acids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
- A61K47/66—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid the modifying agent being a pre-targeting system involving a peptide or protein for targeting specific cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
- C07K7/04—Linear peptides containing only normal peptide links
- C07K7/08—Linear peptides containing only normal peptide links having 12 to 20 amino acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/62—DNA sequences coding for fusion proteins
Definitions
- the invention relates to conjugates comprising a targeting moiety and a therapeutic or diagnostic moiety as well as to the uses thereof for therapy.
- Chemokine receptors are expressed on the surface of certain cells, which interact with cytokines called chemokines.
- the CXC chemokine receptor 4 (CXCR4) is a G-protein-coupled receptor that transduces signals of its endogenous ligand, the chemokine CXCL12 (stromal cell-derived factor-1, SDF-I).
- CXCR4/CXCL12 stromal cell-derived factor-1, SDF-I
- intracellular calcium (Ca 2+ ) ions fluxes are triggered. This causes cellular responses, including chemotaxis, allowing cells to travel within the organism.
- CXCR4 is expressed on myeloid cells, T-lymphocytes, B-lymphocytes, epithelial cells, endothelial cells and dendritic cells.
- the expression of this molecule on the surface of tumor cells make it a suitable candidate as ligand for the specific targeting of therapeutic compounds to cells expressing said molecule.
- WO2006029078 describes fusion constructs comprising a protein translocation domain formed by the Tat protein, the CXCR4-receptor binding DV3 peptide domain and a therapeutic agent which is either a cdk2 antagonist peptide or a p53 activating peptide.
- constructs are targeted to cells expressing CXCR4 and, by means of the protein translocation domain, the therapeutic agent is translocated inside the cell.
- these constructs require, in addition to the CXCR4 ligand which acts solely in the docking of the construct to the cell, a translocating domain which delivers the therapeutic agent inside the cell.
- Driessen et al. (Molecular Therapy, 2008, 16:516-524) describes the use of a peptide analog, 4-fluorobenzoyl-RR-(L-3-(2-naphthyl)alanine)-CYEK-(1-citrulline)-PYR-(1-citrulline)-CR (SEQ ID NO: 1), covalently linked to a phospholipid to target a lipid-based gene delivery vehicle to CXCR4+-cells.
- this method shows low efficency and requires increasing expression of CXCR4 on the surface of the target cells by contacting the cells with VEGF prior to the contacting with the conjugates.
- Tamamura et al. (Bioinorganic & Medicinal Chemistry, 2001, 9: 2179-2187) describe conjugates of different analoges of the T140 CXCR4 agonist and 3′-azido-3-deoxythymidine (AZT) and their use for preventing HIV-1-induced cytopathogenicity in MT-4 cells.
- AZT 3′-azido-3-deoxythymidine
- conjugates act by delivering the therapeutic agent to the surface of the cell from where internalization of the said agent requires its binding to specific receptors on the cell surface. Therefore, there is a need in the art for further conjugates suitable for the specific delivery of molecules of interest to CXCR4 cells which overcome the problems of the conjugates described in the prior art and wherein internalization of the therapeutic agent occurs by the use of a CXCR4-targeting molecule which can be internalized by the CXCR4-expressing cells together with the therapeutic agent bound to it.
- the invention relates to a conjugate comprising
- the invention relates to a conjugate, a polynucleotide, a vector or a host cell according to the invention for use in medicine.
- the invention relates to a conjugate, a polynucleotide, a vector or a host cell according to the invention for use in a method for the treatment of cancer wherein said cancer contains cells that express CXCR4.
- the invention relates to a conjugate, a polynucleotide, a vector or a host cell according to the invention for use in a method of treatment of a disease associated with HIV infection.
- FIGS. 1 A- 1 B Internalization of T22, vCCL2, V1 and CXCL12-GFP-H6 fusion proteins in HeLa cells. Green fluorescent protein emission determined by flow cytometry, of untreated HeLa cells and 20 h after being exposed to 0.6 ⁇ M of the CXCR4 ligand-GFP-H6 fusion proteins T22-GFP-H6, V1-GFP-H6, vCCL2-GFP-H6 and CXCL12-GFP-H6 in FIG. 1 A PBS+10% glycerol buffer or FIG. 1 B in Tris 20 mM+NaCl 500 mM buffer. HeLa cells had a prolonged trypsin treatment (see experimental section) to eliminate potential residual fluorescent emission due to eventual cell surface attached GFP fusion proteins.
- FIGS. 2 A, 2 B, 2 C, 2 D Confocal analysis of T22, vCCL2, V1 and CXCL12-GFP-H6 upon internalization in HeLa cells.
- the cell membrane was labelled with CellMask and cell DNA was labelled with Hoechst 33342.
- CXCR4 ligand-GFP-H6 fusion proteins produced a green signal that can be seen as intense dots inside the cells.
- Cultured cells were exposed for 20 h to 0.6 ⁇ M of FIG. 2 A T22-GFP-H6, FIG. 2 B V1-GFP-H6, FIG. 2 C vCCL2-GFP-H6 and FIG. 2 D CXCL12-GFP-H6 proteins dissolved in PBS+10% glycerol buffer.
- FIGS. 3 A- 3 O Characterization of T22-GFP-H6 entrance in HeLa cells.
- FIG. 3 A Green fluorescent protein emission determined by flow cytometry of untreated HeLa cells and 20 h after being exposed to different concentrations of T22-GFP-H6.
- FIG. 3 B Green fluorescent protein emission determined by flow cytometry of HeLa cells 20 h after exposure to 2 ⁇ M T22-GFP-H6, and with different trypsinization treatments previous to cytometry analysis.
- FIG. 3 C Effect of serum on 2 ⁇ M T22-GFP-H6 internalization measured by flow cytometry and analyzed by confocal microscopy in the presence of complete medium ( FIG. 3 E ) or Optipro ( FIG. 3 D ), 20 h after protein addition.
- FIG. 3 E Green fluorescent protein emission determined by flow cytometry of untreated HeLa cells and 20 h after being exposed to different concentrations of T22-GFP-H6.
- FIG. 3 B Green fluorescent protein emission determined by flow cytometry of
- FIGS. 3 F- 3 H are isosurface representation of HeLa cells within a 3D volumetric x-y-z data field after incubation with 2 ⁇ M T22-GFP-H6.
- FIGS. 3 F- 3 H are TEM images of randomly T22-GFP-H6 particles in Tris 20 mM +NaCl 500 mM buffer.
- FIG. 3 I 2 ⁇ M T22-GFP-H6 internalization by confocal microscopy at 30 min ( FIG. 3 J ), 1 h ( FIG. 3 K ), 2 h ( FIG. 3 L ), 3 h ( FIG. 3 M ), 4 h ( FIG. 3 N ), and 24 h ( FIG. 3 O ).
- FIGS. 4 A- 4 D Evaluation of DNA-binding and gene transfer properties of T22-GFP-H6.
- FIG. 4 A Retardation of plasmid DNA migration in agarose gel electrophoresis promoted by increasing amounts of T22-GFP-H6.
- FIG. 4 B , FIG. 4 C and FIG. 4 D Confocal microscopy of a HeLa cell with T22-GFP-H6 protein inside (intense signal dots), which expresses td tomato gene (soft signal), 24 h after exposition to T22-GFP-H6-td tomato gene complex.
- FIG. 5 Inhibition of T22-GFP-H6 internalization by a natural ligand of CXCR4, the protein SDFalpha, at different T22-GFP-H6/SDFalpha ratios (1:0, 1:1, 1:10). Two irrelevant proteins, GFP-H6 and GLA, were used as controls at a 1:10 ratio.
- FIG. 6 Selective biodistribution of the T22-GFP, a fusion protein comprising T22 as a target moiety (which specifically binds to the CXCR4 receptor) and a green fluorescent protein, to primary tumor tissue derived from CXCR4+SW1417 human colorectal cancer cells xenotransplanted in the cecum of immunosuppressed mice. Notice the 8-47 fold accumulation of T22-GFP, as measured by fluorescence quantitation, using a IVIS200 system (Xenogen) at a dose range varying form 20 to 500 ug, at several time points (5, 24 or 48 h), after intravenous single dose administration. No fluorescence is detected in primary tumor tissue in control mice treated with vehicle. Fluorescence in the stomach is due to ingested food, which does not differ between experimental and control animals. Black asterisk: Primary tumor.
- FIG. 7 Selective biodistribution of the T22-GFP to the peritoneal metastases and mesenteric and diaphragmatic lymph nodes derived from CXCR4+SW1417 human colorectal cancer cells xenotransplanted in the cecum of immunosuppressed mice. Notice the 20-40 fold accumulation of T22-GFP in peritoneal metastatic foci, as measured by fluorescence quantitation using a IVIS200 system (Xenogen) at a 500 ug dose at 5 h or 24 h after intravenous single dose administration.
- IVIS200 system Xenogen
- a peptide derived from the sequence of poliphemusin II ([Tyr 5,12 ,Lys 7 ]-polyphemusin II, hereinafter T22 peptide) is able to promote the internalization of functional and soluble fused compounds into target CXCR4+ cells.
- T22 peptide a fusion protein comprising the T22 peptide and a marker protein can be internalized and released in the cytoplasm.
- the experiments provided in the present invention illustrate that other high-affinity CXCR4 ligands (the V1 peptide corresponding to the N-terminal region of vCCL2, the complete vCCL2 or CXCL12/SDF-1), while capable of promoting endocytosis of the ligand, did not lead to endosomal escape of the proteins attached to said peptide.
- the invention relates to a conjugate comprising
- the first component of the conjugates of the invention is a targeting peptide comprising the sequence RRWCYRKCYKGYCYRKCR (SEQ ID NO: 5) (hereinafter the T22 peptide) or a functionally equivalent variant thereof.
- peptide generally refers to a linear chain of around 2 to 40 amino acid residues joined together with peptide bonds.
- amino acid residue refers to any naturally occurring amino acid, any amino acid derivative or any amino acid mimic known in the art.
- the residues of the protein or peptide are sequential, without any non-amino acid interrupting the sequence of amino acid residues.
- the sequence may comprise one or more non-amino acid moieties.
- the sequence of residues of the protein or peptide may be interrupted by one or more non-amino acid moieties.
- the term “functionally equivalent variant”, as used herein, refers to any variant of the T22 which contain insertions, deletions or substitutions of one or more amino acids and which conserve substantially the capacity of T22 for interacting with CXCR4 and for promoting internalization and/or endosomal escape of therapeutic molecules attached to it.
- a suitable assay for determining whether a given peptide can be seen as a functionally equivalent variant thereof is, for instance, the assay described in example 1 of the present invention.
- a putative functionally equivalent variant of T22 variant is fused in frame with a marker polypeptide (e.g. a fluorescent protein) and incubated with a cell expressing CXCR4 (e.g. HeLa cells). If the peptide is a functionally equivalent variant of T22, the marker protein will be internalized and expressed in the cytosol.
- a marker polypeptide e.g. a fluorescent protein
- the targeting peptide is the selected from the group consisting of:
- the targeting peptide is not a peptide selected from the group consisting of the T140 peptide, TN14003 peptide, TC14012 peptide, the TE14011, the TZ14011 or the N-terminally acetylated variant of TZ14011 and the T131 peptide having the sequence RRYCYRKX 1 PYRKCR wherein X 1 is D-Lys (SEQ ID NO:37).
- the tertiary structure of the targeting peptides may depend on the presence of disulfide bridges between the cysteine residues found in the primary structure.
- the T22 peptide contains at least one disulfide bridge between cysteines at positions 4 and 17.
- the T22 peptide contains at least one disulfide bridge between cysteines at positions 8 and 13.
- the T22 peptide contains a first disulfide bridge between cysteines at positions 4 and 17 and a second disulfide bridge between cysteines at positions 8 and 13.
- the T22 peptide may further comprise a methionine residue at the N-terminal position.
- Suitable functional variants of the targeting peptide are those showing a degree of identity with respect to the T22 peptide of about greater than 25% amino acid sequence identity, such as 25% 40%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%.
- the degree of identity between two polypeptides is determined using computer algorithms and methods that are widely known for the persons skilled in the art.
- the identity between two amino acid sequences is preferably determined by using the BLASTP algorithm as described previously [BLAST Manual, Altschul, S., et al., NCBI NLM NIH Bethesda, Md. 20894, Altschul, S., et al., J. Mol. Biol. 1990; 215: 403-410].
- the proteins of the invention may include post-translational modifications, such as glycosylation, acetylation, isoprenylation, myristoylation, proteolytic processing, etc.
- suitable functional variants of the targeting peptide are those wherein one or more positions contain an amino acid which is a conservative substitution of the amino acid present in the T22 protein mentioned above.
- “Conservative amino acid substitutions” result from replacing one amino acid with another having similar structural and/or chemical properties
- the following six groups each contain amino acids that are conservative substitutions for one another: 1) Alanine (A), Serine (S), Threonine (T); 2) Aspartic acid (D), Glutamic acid (E); 3) Asparagine (N), Glutamine (Q); 4) Arginine (R), Lysine (K); 5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V); and 6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W).
- the first component is capable of specifically binding to CXCR4 and promoting internalization of the second component.
- CXCR4 refers to a G protein-coupled, seven-transmembrane chemokine receptor. Like other chemokine receptors, CXCR4 plays an important role in immune and inflammatory responses by mediating the directional migration and activation of leukocytes CXCR4 is expressed or overexpressed in a variety of cancer cell lines and tissues including breast, prostate, lung, ovarian, colon, pancreatic, kidney, and brain, as well as non-Hodgkin's lymphoma and chronic lymphocytic leukemia.
- the only known ligand to CXCR4 is stromal cell-derived factor-1 (SDF-1, or CXCL12). The interaction between CXCR4 and SDF-1 plays an important role in multiple phases of tumorigenesis, including tumor growth, invasion, angiogenesis, and metastasis.
- Binding affinity is measured, for instance, as described by Tamamura et al. by the oil-cushion method (see Hesselgesset et al, 1998, J. Immunol., 160:877-883) comprising contacting the peptide with CXCR4-transfected cell line (e.g. CHO cells) and a labeled CXCR4 ligand (e.g. 125 I-SDF-1 ⁇ ) and measuring the inhibition percentage of the targeting peptide against the binding of the labeled CXCR4 ligand.
- CXCR4-transfected cell line e.g. CHO cells
- a labeled CXCR4 ligand e.g. 125 I-SDF-1 ⁇
- CXCR4 specifically binding to CXCR4 refers to the ability of the conjugates of the invention to bind more frequently, more rapidly, with greater duration and/or with greater affinity to CXCR4 or cell expressing same than it does with alternative receptors or cells without substantially binding to other molecules.
- Binding affinity is measured, for instance, as described by Tamamura et al. by the oil-cushion method (see Hesselgesset et al, 1998, J. Immunol., 160:877-883) comprising contacting the peptide with CXCR4-transfected cell line (e.g. CHO cells) and a labeled CXCR4 ligand (e.g. 125 I-SDF-1 ⁇ ) and measuring the inhibition percentage of the targeting peptide against the binding of the labeled CXCR4 ligand.
- CXCR4-transfected cell line e.g. CHO cells
- a labeled CXCR4 ligand e.g. 125 I-SDF-1 ⁇
- Specific binding can be exhibited, e.g., by a low affinity targeting agent having a Kd of at least about 10 ⁇ 4 M.
- a low affinity targeting agent having a Kd of at least about 10 ⁇ 4 M.
- a ligand having low affinity can be useful for targeting.
- Specific binding also can be exhibited by a high affinity ligands, e.g. a ligand having a Kd of at least about of 10 ⁇ 7 M, at least about 10 ⁇ 8 M, at least about 10 ⁇ 9 M, at least about 10 ⁇ 10 M, or can have a Kd of at least about 10 ⁇ 11 M or 10 ⁇ 12 M or greater. Both low and high affinity-targeting ligands are useful for incorporation in the conjugates of the present invention.
- internalization refers to a process by which a molecule or a construct comprising a molecule binds to a target element on the outer surface of the cell membrane and the resulting complex is internalized by the cell. Internalization may be followed up by dissociation of the resulting complex within the cytoplasm. The target element, along with the molecule or the construct, may then localize to a specific cellular compartment.
- the ability of the conjugate of the invention to be internalized by cells expressing CXCR4 may be conveniently determined by fluorescence methods in the case that the conjugate comprises a fluorescent protein, such as GFP.
- fusion proteins can be obtained by preparing a recombinant nucleic acid wherein the nucleic acids encoding the T22 peptide and the fluorescent protein are fused in frame and expressed in an adequate host cell or organism. The fusion protein is then contacted with a culture of cells expressing CXCR4 or in vivo with a tissue which expresses CXCR4 for an appropriate amount of time, after which fluorescence microscopy may be used to determine whether the construct penetrated the cell. Presence of fluorescence in the cytoplasm may be further investigated by comparing the fluorescence microscopy image resulting from the fluorescent protein to that obtained with a known cytoplasmic stain.
- the conjugate of the invention it is also possible to test the ability of the conjugate of the invention to be internalized by cells expressing CXCR4 by preparing non-covalent complexes between a fusion protein comprising the first component of the conjugate and a polynucleotide encoding a fluorescent protein (e.g. the TdTomato gene, encoding a red fluorescent protein).
- a fluorescent protein e.g. the TdTomato gene, encoding a red fluorescent protein.
- the complex is then contacted with a culture of cells expressing CXCR4 or in vivo with a tissue which expresses CXCR4 for an appropriate amount of time, after which fluorescence microscopy may be used to determine whether the construct penetrated the cell and the gene encoding the fluorescent protein has been expressed. Presence of fluorescence in the nucleus may be further investigated by comparing the fluorescence microscopy image resulting from the fluorescent protein to that obtained with a known nuclear stain (e.g. DAPI).
- the first component is capable of specifically binding to CXCR4 and promoting internalization and endosomal escape of the second component.
- promoting endosomal escape refers to the ability of the targeting peptide to induce the release of the conjugates from the endosomal compartment after internalization by receptor-mediated endocytosis.
- the therapeutic agent (also known herein as second component of the conjugate of the invention) is a compound of therapeutic interest.
- terapéutica is used in a generic sense and includes treating agents, prophylactic agents, and replacement agents.
- the therapeutic agent is not particularly limiting as long as it can be conjugated to the targeting peptide or provided as a complex with the targeting peptide.
- the therapeutic agent may be a polypeptide or a nucleic acid.
- the following alternatives of therapeutic agent are possible:
- the therapeutic agent is a high molecular weight compound.
- “high molecular weight compound” refers to any chemical entity or molecule, such as nucleic acids, peptides, proteins, natural and synthetic polymers, drugs such as antibiotics and the like, having a molecular weight greater than 1 kDa, preferably greater than 5 kDa, more preferably greater than 10 kDa and even more preferably greater than 100 kDa.
- the therapeutic agent is a polypeptide.
- polypeptide refers to a polymer of amino acid residues.
- the term also apply to amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers and non-naturally occurring amino acid polymer.
- the conjugate may be a covalent complex of the therapeutic agent and the targeting peptide.
- the therapeutic agent and the targeting peptide form a fusion protein.
- the conjugate is not polyphemusin-1 or polyphemusin-2.
- the polypeptide which acts as active agent or the fusion protein formed by the said polypeptide and the targeting peptide further comprises a tag which may be used for the detection or for the purification of the conjugate using reagents showing specific affinity towards said tags.
- Adequate detection/purification tags includes hexa-his (metal chelate moiety), hexa-hat GST (glutathione S-tranferase) glutathione affinity, calmodulin-binding peptide (CBP), strep-tag, cellulose binding domain, maltose binding protein, S-peptide tag, chitin binding tag, immuno-reactive epitopes, epitope tags, E2tag, HA epitope tag, Myc epitope, FLAG epitope, AU1 and AU5 epitopes, GIu-GIu epitope, KT3 epitope, IRS epitope, Btag epitope, protein kinase-C epitope, VSV epitope or any other tag as long as the tag does not affect the stability of the conjugate or the targeting capabilities.
- CBP calmodulin-binding peptide
- Suitable polypeptides that can be used as therapeutic agents include any polypeptide which is capable of promoting a decrease in cell proliferation rates.
- the therapeutic agent forming part of the conjugates of the invention is a nucleic acid.
- the therapeutic agent is a polynucleotide
- this is either directly associated to the targeting peptide interactions in those cases wherein the peptide has a net positive charge which allows the formation of electrostatic interactions with the DNA.
- the targeting peptide may comprise an additional protein domain present in said targeting peptide having a net positive charge and thus, capable of forming electrostatic interactions with the DNA.
- Suitable protein domains which are capable of associating with DNA via electrostatic interaction include, without limitation, polylysine, protamine, albumin and cationized albumin.
- nucleic acid and “polynucleotide”, as used herein interchangeably, refer to a polymer composed of nucleotide units (ribonucleotides, deoxyribonucleotides, related naturally occurring structural variants and synthetic non-naturally occurring analogs thereof or combinations thereof) linked via phosphodiester bonds, related naturally occurring structural variants and synthetic non-naturally occurring analogs thereof.
- the nucleic acids include coding regions and the adequate regulatory signals for promoting expression in the target cells in those cases wherein a defective gene function is to be reinstated in the cell or a silencing nucleic acid wherein the expression of a target gene is to be inhibited.
- nucleic acids containing a coding region will be operably linked to appropriate regulatory sequences.
- Such regulatory sequence will at least comprise a promoter sequence.
- promoter refers to a nucleic acid fragment that functions to control the transcription of one or more genes, located upstream with respect to the direction of transcription of the transcription initiation site of the gene, and is structurally identified by the presence of a binding site for DNA-dependent RNA polymerase, transcription initiation sites and any other DNA sequences, including, but not limited to transcription factor binding sites, repressor and activator protein binding sites, and any other sequences of nucleotides known to one of skill in the art to act directly or indirectly to regulate the amount of transcription from the promoter.
- a “constitutive” promoter is a promoter that is active under most physiological and developmental conditions.
- An “inducible” promoter is a promoter that is regulated depending on physiological or developmental conditions.
- CMV cytomegalovirus
- LTRs viral long terminal repeat promoters
- MMLV murine moloney leukaemia virus
- HTLV-I simian virus 40
- SV 40 herpes simplex virus thymidine kinase promoter
- said coding region is selected from the group consisting of a tumor suppressor gene, a suicide gene or a polynucleotide which is capable of activating the immune response towards a tumor.
- Suitable genes or cDNAs are those which encode the cytotoxic, proapoptotic or metastasis-suppressor polypeptides mentioned above in relation to the active agent being a polypeptide.
- a “small molecule” refers to a substantially non-peptidic, non-oligomeric organic compound either prepared in the laboratory or found in nature.
- Small molecules can refer to compounds that are “natural product-like,” however, the term “small molecule” is not limited to “natural product-like” compounds. Rather, a small molecule is typically characterized in that it contains several carbon-carbon bonds, and has a molecular weight of less than 1500 g/mol, less than 1250 g/mol, less than 1000 g/mol, less than 750 g/mol, less than 500 g/mol, or less than 250 g/mol, although this characterization is not intended to be limiting for the purposes of the present invention. In certain other embodiments, natural-product-like small molecules are utilized.
- Suitable small molecules that can be incorporated in the nanotransporters forming part of the conjugates according to the invention include, without limitation, anti-cancer agents, anti-angiogenic agents, pro-apoptotic and antiretroviral agents.
- nanotransporter relates to a multi-component complex with controlled dimensions, e.g., a diameter or radius on the order of about 1 to about 1000 nanometers that contains a compound of interest.
- the nanotransporters according to the invention may include one or more of the active agents (polynucleotide or polypeotides) mentioned above as well as any other cytotoxic agent suitable for decreasing cell proliferation, including small molecules.
- Preferred nanotransporters for use in the present invention include nanoparticles, viruses, virus-like particles (VLP), nanoparticles, protein cages and the like.
- VLP virus-like particles
- the nanotransporters are nanoparticles.
- Nanoparticles suitable for use in the present invention include lipid nanoparticles as well as polymeric nanoparticles.
- Polymeric nanoparticles are formed by a polymeric matrix which is attached to the T22 peptide targeting moiety.
- biocompatible polymers that may be useful in the polymeric nanoparticules according to the present invention include polyethylenes, polycarbonates, polyanhydrides, polyhydroxyacids, polypropylfumerates, polycaprolactones, polyamides, polyacetals, polyethers, polyesters, poly(orthoesters), polycyanoacrylates, polyvinyl alcohols, polyurethanes, polyphosphazenes, polyacrylates, polymethacrylates, polycyanoacrylates, polyureas, polystyrenes, or polyamines, polyglutamate, dextran, polyanhydrides, polyurethanes, polymethacrylates, polyacrylates or polycyanoacrylates.polydioxanone (PDO), polyhydroxyalkanoate, polyhydroxybutyrate, poly(glycerol sebacate), polyglycolide, polylact
- the nanoparticles of the invention may be lipid nanoparticles such as a liposome or a micelle.
- Vesicle-forming lipids refer to lipids that spontaneously form lipid bilayers above their gel-to-liquid crystalline phase transition temperature range. Such lipids typically have certain features that permit spontaneous bilayer formation, such as close to identical cross-section areas of their hydrophobic and hydrophilic portions permitting packing into lamellar phases. Lipids capable of stable incorporation into lipid bilayers, such as cholesterol and its various analogs, can be incorporated into the lipid bilayer during bilayer formation.
- the vesicle-forming lipids are preferably lipids having two hydrocarbon chains, typically acyl chains, and a head group, either polar or nonpolar.
- lipids such as phosphatidylcholine, phosphatidylethanolamine, phosphatidic acid, phosphatidylinositol, and sphingomyelin, where the two-hydrocarbon chains are typically between about 14-22 carbon atoms in length, and either saturated or having varying degrees of unsaturation.
- phospholipids such as phosphatidylcholine, phosphatidylethanolamine, phosphatidic acid, phosphatidylinositol, and sphingomyelin
- the above-described lipids and phospholipids whose acyl chains have varying degrees of saturation can be obtained commercially or prepared according to published methods.
- suitable lipids include phospholipids, sphingolipids, glycolipids, and sterols, such as cholesterol.
- liposome refers to vesicles comprised of one or more concentrically ordered lipid bilayers, which encapsulate an aqueous phase.
- the aqueous phase typically contains the compound to be delivered to a target site.
- the liposome fuses with the plasma membranes of local tumor cells or tumor blood vessel cells, thereby releasing the compound into the cytosol.
- the liposome is endocytosed or otherwise taken in by the tumor cells or of tumor blood vessel cells as the content of a transport vesicle (e.g., an endosome or phagosome).
- the liposome Once in the transport vesicle, the liposome either degrades or fuses with the membrane of the vesicle and releases its contents.
- Suitable methods include, for example, sonication, extrusion, high pressure/homogenization, micro fluidization, detergent dialysis, calcium-induced fusion of small liposome vehicles and ether fusion methods, all of which are well known in the art.
- Polymeric and lipidic nanotransporters can additionally include a coating of an amphiphilic compound that surrounds the polymeric material forming a shell for the particle or a stealth material that can allow the particles to evade recognition by immune system components and increase particle circulation half life.
- the nanotransporter of the invention is a virus.
- any virus known in the art may be used as nanotransporter in the present invention provided that sufficient information is available so as to allow the modification of the external components by T22 peptide or the functionally equivalent variant thereof.
- the nanotransporters of the invention are obtained by directly modifying at least one of the capsid proteins, either by chemical coupling of the T22 peptide or the functionally equivalent variant thereof or by inserting the sequence encoding the T22 peptide or the functionally equivalent variant thereof into the viral gene coding for the capsid protein so that, upon synthesis and assembly into the capsid, the T22 peptide or the functionally equivalent variant thereof is exposed to the outer surface of the capsid.
- suitable virus capsids that can be modified in the above manner include, but are not limited to, capsids from Sindbis virus and other alphaviruses, rhabdoviruses (e.g.
- vesicular stomatitis virus picornaviruses (e.g., human rhino virus, Aichi virus), togaviruses (e.g., rubella virus), orthomyxoviruses (e.g., Thogoto virus, Batken virus, fowl plague virus), polyomaviruses (e.g., polyomavirus BK, polyomavirus JC, avian polyomavirus BFDV), parvoviruses, rotaviruses, bacteriophage Q ⁇ , bacteriophage P1, bacteriophage M13, bacteriophage MS2, bacteriophage G4, bacteriophage P2, bacteriophage P4, bacteriophage 186, bacteriophage ⁇ 6, bacteriophage ⁇ 29, bacteriophage MS2, bacteriophage N4, bacteriophage ⁇ X174, bacteriophage AP205, Norwalk virus, foot and mouth disease virus, a retrovirus
- the targeting peptide is preferably attached to or replacing a part of the envelope glycoproteins.
- surface glycoproteins that may be used for inserting the short fiber protein include glycoproteins from alphaviruses, such as Semliki Forest virus (SFV), Ross River virus (RRV) and Aura virus (AV), which comprise surface glycoproteins such as E1, E2, and E3.
- the E2 glycoproteins derived from the Sindbis virus (SIN) and the hemagglutinin (HA) of influenza virus are non-retroviral glycoproteins that specifically bind particular molecules on cell surfaces (heparin sulfate glycosaminoglycan for E2, sialic acid for HA) which are known to tolerate certain genetic modifications and remain efficiently assembled on the retroviral surface (Morizono et al. J. Virol.
- glycoproteins of Lassa fever virus, Hepatitis B virus, Rabies virus, Borna disease virus, Hantaan virus, or SARS-CoV glycoproteins of Lassa fever virus, Hepatitis B virus, Rabies virus, Borna disease virus, Hantaan virus, or SARS-CoV
- flavivirus-based surface glycoproteins hemagglutinin (HA) from influenza A/fowl plague virus/Rostock/34 (FPV), a class I fusogen, is used (T. Hatziioannou, S. Valsesia-Wittmann, S. J. Russell, F. L. Cosset, J. Virol. 72, 5313 (1998)).
- Suitables viruses for use in the present invention comprise alphaviruses, paramyxoviruses, rhabdoviruses, coronaviruses, picornaviruses, myxoviruses, reoviruses, bunyaviruses, flaviviruses, rubiviruses, filoviruses, arenaviruses, arteriviruses or caliciviruses.
- the nanotransporter used in the present invention is a VLP.
- VLP or viral-like particle relates to a self-assembling macromolecular structure formed by the viral nucleocapsids which acquire a quaternary structure resembling that of the virus from which they originate but which are devoid of the virus genetic material.
- the VLPs for use according to the present invention may be formed from polypeptides derived from any virus known in the art having an ordered and repetitive structure.
- VLPs can be produced and purified from virus-infected cell culture.
- the resulting virus or virus-like particle for vaccine purpose needs to be devoid of virulence.
- physical or chemical methods can be employed to inactivate the viral genome function, such as UV irradiation, formaldehyde treatment.
- the VLP is a recombinant VLP.
- the skilled person will appreciate that almost all commonly known viruses of known sequence may be used for the generation of VLPs provided that the gene encoding the coat protein or proteins can be easily identified by a skilled artisan.
- VLPs by the recombinant expression of the coat protein or proteins in a host are within the common knowledge of a skilled artisan.
- Suitable VLPS can be obtained from the nucleocapsid proteins of a virus selected form the group consisting of RNA-bacteriophages, adenovirus, papaya mosaic virus, influenza virus, norovirus, papillomavirus, hepadnaviridae, respiratory syncytial virus, hepatitis B virus, hepatitis C virus, measles virus; Sindbis virus; rotavirus, foot-and-mouth-disease virus, Newcastle disease virus, Norwalk virus, alphavirus; SARS, paramoxyvirus, transmissible gastroenteritis virus retrovirus, retrotransposon Ty, Polyoma virus; tobacco mosaic virus; Flock House Virus, Cowpea Chlorotic Mottle Virus; a Cowpea Mosaic Virus; and alfalfa mosaic virus.
- the nanotransporter used in the present invention is a protein cage.
- protein cage relates to self-assembling macromolecular structure formed by one or more different proteins which are capable of forming a constrained internal environment. Protein cages can have different core sizes, ranging from 1 to 30 nm (e.g., the internal diameter of the shells). Preferred protein cages suitable for use in the present invention include ferritin protein cages, heat-shock protein cages as described in WO08124483 and the like.
- the conjugates object of the invention comprising the targeting peptide and the therapeutic agent wherein said therapeutic agent has a peptidic nature can contain a bond directly connecting the targeting peptide and the therapeutic agent or, alternatively, can contain an additional amino acid sequence acting as a linker between the targeting peptide and the therapeutic agent.
- the linker peptide preferably comprises at least two amino acids, at least three amino acids, at least five amino acids, at least ten amino acids, at least 15 amino acids, at least 20 amino acids, at least 30 amino acids, at least 40 amino acids, at least 50 amino acids, at least 60 amino acids, at least 70 amino acids, at least 80 amino acids, at least 90 amino acids or approximately 100 amino acids.
- said non-natural intermediate amino acid sequence acts as a hinge region between domains, allowing them to move independently from one another while they maintain the three-dimensional shape of the individual domains.
- a preferred non-natural intermediate amino acid sequence according to the invention would be a hinge region characterized by a structural ductility allowing this movement.
- said non-natural intermediate amino acid sequence is a non-natural flexible linker.
- said flexible linker is a flexible linker peptide with a length of 20 amino acids or less.
- the linker peptide comprises 2 amino acids or more selected from the group consisting of glycine, serine, alanine and threonine.
- said flexible linker is a polyglycine linker.
- spacer or linker peptides include those which have been used for binding proteins without substantially deteriorating the function of the bound proteins or at least without substantially deteriorating the function of one of the bound proteins. More preferably, the spacers or linkers have been used for binding proteins comprising structures with coiled helixes such as:
- the two components of the conjugates of the invention can be connected by a peptide the sequence of which contains a cleavage target for a protease, thus allowing the separation of the targeting peptide from the therapeutic agent.
- Protease cleavage sites suitable for their incorporation into the polypeptides of the invention include enterokinase (cleavage site DDDDK, SEQ ID NO: 23), factor Xa (cleavage site IEDGR, SEQ ID NO: 24), thrombin (cleavage site LVPRGS, SEQ ID NO: 25), TEV protease (cleavage site ENLYFQG, SEQ ID NO: 26), PreScission protease (cleavage site LEVLFQGP, SEQ ID NO: 27), inteins and the like.
- the conjugate is a fusion protein of the targeting peptide and the active (therapeutic or diagnostic) agent
- the fusion protein can be produced in vivo by the recipient subject when a polynucleotide encoding the fusion protein is used.
- the invention relates to a polynucleotide encoding a conjugate according to the invention.
- nucleotide sequence refers to the polymer form of phosphate esters of ribonucleosides (adenosine, guanosine, uridine or cytidine; “RNA molecules”) or deoxyribonucleosides (deoxyadenosine, deoxyguanosine, deoxythymidine or deoxycytidine; “DNA molecules”), or any analogous phosphoester thereof, such as phosphorothioates and thioesters, in single-strand or double-strand form.
- RNA molecules phosphate esters of ribonucleosides
- deoxyribonucleosides deoxyadenosine, deoxyguanosine, deoxythymidine or deoxycytidine
- DNA molecules deoxyadenosine, deoxyguanosine, deoxythymidine or deoxycytidine
- DNA molecules deoxyadenosine, deoxyguanosine, deoxythymidine or deoxy
- nucleic acid sequence and, in particular, DNA or RNA molecule, refers solely to the primary or secondary structure of the molecule and does not limit any particular type of tertiary structure. Thus, this term includes double-chain DNA as it appears in linear or circular DNA molecules, supercoiled DNA plasmids and chromosomes.
- the invention relates to a vector comprising a polynucleotide according to the invention.
- the term “vector” refers to a vehicle whereby a polynucleotide or a DNA molecule may be manipulated or introduced into a cell.
- the vector may be a linear or circular polynucleotide, or it may be a larger-size polynucleotide or any other type of construct, such as DNA or RNA from a viral genome, a virion or any other biological construct that allows for the manipulation of DNA or the introduction thereof into the cell. It is understood that the expressions “recombinant vector” and “recombinant system” may be used interchangeably with the term “vector”.
- vector may be a cloning vector suitable for propagation and to obtain the adequate polynucleotides or gene constructs or expression vectors in different heterologous organisms suitable for the purification of the conjugates.
- suitable vectors in accordance with this invention include expression vectors in prokaryotes, such as pUC18, pUC19, Bluescript and the derivatives thereof, mp18, mp19, pBR322, pMB9, CoIE1, pCR1, RP4, phages and “shuttle” vectors, such as pSA3 and pAT28, expression vectors in yeasts, such as vectors of the 2-micron plasmid type, integration plasmids, YEP vectors, centromere plasmids and similar ones, expression vectors in insect cells, such as the vectors in the pAC series and the pVL series, expression vectors in plants, such as vectors from the pIBI, pEarleyGate, pAVA, pCAMBIA, pGSA, pGWB, pMDC, pMY, pORE series and similar ones, and expression vectors in higher eukaryotic cells based on viral vectors (adenoviruse
- the vector of the invention may be used to transform, transfect or infect cells susceptible to being tranformed, transfected or infected by said vector.
- another aspect of the invention relates to a cell that comprises a polynucleotide, a gene construct or a vector of the invention; to this end, said cell has been transformed, transfected or infected with a construct or vector provided by this invention.
- Transformed, transfected or infected cells may be obtained by conventional methods known to those skilled in the art (Sambrook et al., 2001, cited supra).
- said host cell is an animal cell transfected or infected with an appropriate vector.
- Host cells suitable for the expression of the conjugates of the invention include, without being limited thereto, cells from mammals, plants, insects, fungi and bacteria.
- Bacterial cells include, without being limited thereto, cells from Gram-positive bacteria, such as species from the genera Bacillus, Streptomyces and Staphylococcus , and cells from Gram-negative bacteria, such as cells from the genera Escherichia and Pseudomonas .
- Fungi cells preferably include cells from yeasts such as Saccharomyces, Pichia pastoris and Hansenula polymorpha .
- Insect cells include, without limitation, Drosophila cells and Sf9 cells.
- Plant cells include, amongst others, cells from cultivated plants, such as cereals, medicinal plants, ornamental plants or bulbs.
- Mammalian cells suitable for this invention include epithelial cell lines (porcine, etc.), osteosarcoma cell lines (human, etc.), neuroblastoma cell lines (human, etc.), epithelial carcinomas (human, etc.), glial cells (murine, etc.), hepatic cell lines (from monkeys, etc.), CHO (Chinese Hamster Ovary) cells, COS cells, BHK cells, HeLa, 911, AT1080, A549, 293 or PER.C6 cells, human NTERA-2 ECC cells, D3 cells from the mESC line, human embryonary stem cells, such as HS293 and BGV01, SHEF1, SHEF2 and HS181, NIH3T3, 293T, REH and MCF-7 cells, and hMSC cells.
- the invention relates to a conjugate, a polynucleotide, or a vector according to the invention wherein the therapeutic agent is an antitumor agent.
- antiproliferative agent refers to any chemical or biological agent or compound with antiproliferative, antioncogenic and/or carcinostatic properties which can be used to inhibit tumor growth, proliferation and/or development
- Suitable antitumor agents for use in the present invention include, without limitation:
- cytotoxic polypeptide refers to an agent that is capable of inhibiting cell function.
- the agent may inhibit proliferation or may be toxic to cells.
- Any polypeptide that when internalized by a cell interfere with or detrimentally alter cellular metabolism or in any manner inhibit cell growth or proliferation are included within the ambit of this term, including, but are not limited to, agents whose toxic effects are mediated when transported into the cell and also those whose toxic effects are mediated at the cell surface.
- Useful cytoxic polypeptides include proteinaceous toxins and bacterial toxins.
- Useful type one plant RIPs include, but are not limited to, dianthin 30, dianthin 32, lychnin, saporins 1-9, pokeweed activated protein (PAP), PAP II, PAP-R, PAP-S, PAP-C, mapalmin, dodecandrin, bryodin-L, bryodin, Colicin 1 and 2, luffin-A, luffin-B, luffin-S, 19K-protein synthesis inhibitory protein (PSI), 15K-PSI, 9K-PSI, alpha-kirilowin, beta-kirilowin, gelonin, momordin, momordin-II, momordin-Ic, MAP-30, alpha-momorcharin, beta-momorcharin, trichosanthin, TAP-29
- Useful type two RIPs include, but are not limited to, volkensin, ricin, nigrin-b, CIP-29, abrin, modeccin, ebulitin-[beta], ebultin-[gamma], vircumin, porrectin, as well as the biologically active enzymatic subunits thereof (Stirpe et al., Bio/Technology 10:405-12, 1992; Pastan et al., Annu. Rev. Biochem. 61:331-54; Brinkmann and Pastan, Biochim. et Biophys. Acta 1198:27-45, 1994; and Sandvig and Van Deurs, Physiol. Rev. 76:949-66, 1996).
- bacterial toxins useful as cell toxins include, but are not limited to, shiga toxin and shiga-like toxins (i.e., toxins that have the same activity or structure), as well as the catalytic subunits and biologically functional fragments thereof. These bacterial toxins are also type two RIPs (Sandvig and Van Deurs, Physiol. Rev. 76:949-66, 1996; Armstrong, J. Infect. Dis., 171:1042-5, 1995; Kim et al., Microbiol. Immunol. 41:805-8, 1997, and Skinner et al., Microb. Pathog. 24:117-22, 1998).
- useful bacterial toxins include, but are not limited to, Pseudomonas exotoxin and Diphtheria toxin (Pastan et al., Annu. Rev. Biochem. 61:331-54; and Brinkmann and Pastan, Biochim. et Biophys. Acta 1198:27-45, 1994). Truncated forms and mutants of the toxin enzymatic subunits also can be used as a cell toxin moiety (Pastan et al., Annu. Rev. Biochem. 61:331-54; Brinkmann and Pastan, Biochim. et Biophys. Acta 1198:27-45, 1994; Mesri et al., J.
- Targets include, but are not limited to the more then 34 described Colicin family of RNase toxins which include colicins A, B, D, E1-9, cloacin DF13 and the fungal RNase, [alpha]-sarcin (Ogawa et al. Science 283: 2097-100, 1999; Smarda et al., Folia Microbiol (Praha) 43:563-82, 1998; Wool et al., Trends Biochem. Sci., 17: 266-69, 1992).
- RNase toxins include colicins A, B, D, E1-9, cloacin DF13 and the fungal RNase, [alpha]-sarcin (Ogawa et al. Science 283: 2097-100, 1999; Smarda et al., Folia Microbiol (Praha) 43:563-82, 1998; Wool et al., Trends Biochem. Sci., 17: 266-69, 1992).
- anti-angiogenic polypeptide denotes a polypeptide capable of inhibiting angiogenesis.
- Suitable antiangiogenic polypeptides include, without limitation, angiostatin, endostatin, anti-angiogenic anti-thrombin III, sFRP-4 as described in WO2007115376, an anti-VEGF antibody such as anibizumab, bevacizumab (avastin), Fab IMC 1121 and F200 Fab.
- a tumor suppressor is a gene or gene product that has a normal biological role of restraining unregulated growth of a cell.
- the functional counterpart to a tumor suppressor is an oncogene.
- Genes that promote normal cell growth may be known as “protooncogenes”.
- a mutation that activates such a gene or gene product further converts it to an “oncogene”, which continues the cell growth activity, but in a dysregulated manner.
- tumor suppressor genes and gene products are well known in the literature and may include PTC, BRCA1, BRCA2, p16, APC, RB, WT1, EXT1, p53, NF1, TSC2, NF2, VHL,ST7, ST14, PTEN, APC, CD95 or SPARC.
- pro-apoptotic polypeptides refers to a protein which is capable of inducing cell death in a cell or cell population.
- Suitable pro-apoptotic polypeptides include, without limitation, proapoptotic members of the BCL-2 family of proteins such as BAX, BAK, BOK/MTD, BID, BAD, BIK/NBK, BLK, HRK, BIM/BOD, BNIP3, NIX, NOXA, PUMA, BMF, EGL-I, and viral homologs, caspases sich as caspase-8, the adenovirus E4orf4 gene, p53 pathway genes, proapoptotic ligands such as TNF, FasL, TRAIL and/or their receptors, such as TNFR, Fas, TRAIL-R1 and TRAIL-R2.
- metastasis suppressor refers to a protein that acts to slow or prevent metastases (secondary tumors) from spreading in the body of an organism with cancer.
- Suitable metastasis suppressors include, without limitation, proteins such as BRMS 1, CRSP3, DRG1, KAI1, KISS-1, NM23, a TIMP-family protein and uteroglobin.
- an immunostimulatory polypeptide agent is a polypeptide that stimulates an immune response (including enhancing a pre-existing immune response) in a subject to whom it is administered, whether alone or in combination with another agent, flagellin, muramyl dipeptide), cytokines including interleukins (e.g., IL-2, IL-7, IL-15 (or superagonist/mutant forms of these cytokines), IL-12, IFN-gamma, IFN-alpha, GM-CSF, FLT3-ligand, etc.), immunostimulatory antibodies (e.g., anti-CTLA-4, anti-CD28, anti-CD3, or single chain/antibody fragments of these molecules), and the like.
- interleukins e.g., IL-2, IL-7, IL-15 (or superagonist/mutant forms of these cytokines)
- IL-12 e.g., IFN-gamma, IFN-alpha, GM-CSF, FLT3-lig
- Suitable tumor suppressor genes include a gene or gene product that encodes any of the polypeptides defined above.
- Examples of tumor suppressor genes and gene products are well known in the literature and may include PTC, BRCA1, BRCA2, p16, APC, RB, WT1, EXT1, p53, NF1, TSC2, NF2, VHL,ST7, ST14, PTEN, APC, CD95 or SPARC.
- the nucleic acid is a silencing agent
- said silencing agent is aimed at blocking the expression of genes the over-expression of which leads to cell proliferation and tumor growth.
- Genes that can be inhibited by the conjugates according to the invention carrying silencing agent include, without limitation, HRAS (v-Ha-ras Harvey rat sarcoma viral oncogene homolog), NRAS (neuroblastoma RAS viral (v-ras) oncogene homolog), KRAS (v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog), MYC (v-myc myelocytomatosis viral oncogene homolog, avian), MYCN (v-myc myelocytomatosis viral related oncogene, neuroblastoma derived, avian), MYB (v-myb myeloblastosis viral oncogene homolog, avian), Jun-oncogene, FOS (
- silencing agents suitable for use in the present invention include those directed against cyclin G1, cyclin D1, Bc1-2 (B-cell chronic lymphatic leukemia associated protein 2), Bcl-XL (Bcl-2 related gene xl), HLA-G (Human leukocyte antigen class G), IGF-1 (Insulin-like growth factor-1), EGF (epidermal growth factor), FGF (fibroblast growth factor), VEGF (vascular endothelial growth factor), VEGFR (vascular endothelial growth factor receptor), IGFR (insulin-like growth factor receptor), EGFR (epidermal growth factor receptor), FGFR (fibroblast growth factor receptor), TGF-beta (transforming growth factor beta), Caspase 3, CEACAM6 (Carcinoembryonic antigen-related cell adhesion molecule 6), HPV-E6 (human papiloma virus protein E6), HPV-E7 (human papiloma virus protein E7), H-Ras gene, P100a gene
- therapeutic molecules include, but are not limited to, cell cycle control agents; agents which inhibit cyclin proteins, such as antisense polynucleotides to the cyclin G1 and cyclin D1 genes.
- the silencing agent can be targeted against CXCR4.
- Suitable CXCR4-silencing agents include, without limitation:
- RNA-interference agents Potential target sites in the mRNA for the design of RNA-interference agents are identified based on rational design principles, which include target accessibility and secondary structure prediction. Each of these may affect the reproducibility and degree of knockdown of expression of the mRNA target, and the concentration of siRNA required for therapeutic effect.
- thermodynamic stability of the siRNA duplex e.g., antisense siRNA binding energy, internal stability profiles, and differential stability of siRNA duplex ends
- Empirical rules such as those provided by the Tuschl laboratory (Elbashir et al., Nature 411:494-498, 2001; Elbashir et al., Genes Dev. 15:188-200, 2001) are also used.
- Software and internet interactive services for siRNA design are available at the Ambion and Invitrogen websites.
- Levenkova et al. describe a software system for design and prioritization of siRNA oligos (Levenkova et al., Bioinformatics 20:430-432, 2004).
- the Levenkova system is available on the internet and is downloadable freely for both academic and commercial purposes.
- the siRNA molecules disclosed herein were based on the Ambion, Invitrogen and Levenkova recommendations.
- siRNA oligos specific for a given target is carried out based primarily on uniqueness vs. human sequences (i.e., a single good hit vs human Unigene, and a big difference in hybridization temperature Tm against the second best hit) and on GC content (i.e., sequences with percent GC in the range of 40-60 percent).
- RNA target accessibility and secondary structure prediction can be carried out using, for example, Sfold software (Ding Y and Lawrence, C. E. (2004) Rational design of siRNAs with Sfold software. In: RNA Interference: from Basic Science to Drug Development. K.
- RNA secondary structure determination is also described in Current Protocols in Nucleic Acid Chemistry, Beaucage et al., ed, 2000, at 11.2.1-11.2.10.
- Suitable silencing agents include, without limitation, antisense RNA or DNA, ribozymes and other oligonucleotides that are intended to be used as antisense agents.
- Suitable silencing agents against a gene of interest can be identified using standard techniques to detect expression levels of a gene, such as RT-PCR, Northern blot and the like.
- Antisense oligonucleotides including, antisense oligonucleotides; triplex molecules; dumbbell oligonucleotides; Extracellular Protein Binding Oligonucleotides; and Small Nucleotide Molecules, are oligonucleotides that specifically bind to mRNA that has complementary sequences, thereby preventing translation of the mRNA (see, e.g., U.S. Pat. No. 5,168,053 to Altman et al. U.S. Pat. No. 5,190,931 to Inouye, U.S. Pat. No. 5,135,917 to Burch; U.S. Pat. No. 5,087,617 to Smith and Clusel et al.
- Triplex molecules refer to single DNA strands that target duplex DNA and thereby prevent transcription (see, e.g., U.S. Pat. No. 5,176,996 to Hogan et al. which describes methods for making synthetic oligonucleotides that bind to target sites on duplex DNA).
- the polynucleotide used as active agent comprises the coding region of a suicide gene.
- suicide gene refers to a nucleic acid coding for a product, wherein the product causes cell death by itself or in the presence of other compounds.
- a representative example of a suicide gene is one, which codes for thymidine kinase of herpes simplex virus. Additional examples are thymidine kinase of varicella zoster virus and the bacterial gene cytosine deaminase, which can convert 5-fluorocytosine to the highly cytotoxic compound 5-fluorouracil.
- Suicide genes may produce cytotoxicity by converting a prodrug to a product that is cytotoxic.
- the term “prodrug” means any compound that can be converted to a toxic product for cells.
- a representative example of such a prodrug is gancyclovir which is converted in vivo to a toxic compound by HSV-thymidine kinase.
- the gancyclovir derivative subsequently is toxic to cells.
- Other representative examples of prodrugs include acyclovir, FIAU [1-(2-deoxy-2-fluoro-beta-D-arabinofuranosyl)-5-iodouracil], 6-methoxypurine arabinoside for VZV-TK, and 5-fluorocytosine for cytosine deaminase.
- Suitable polynucleotides capable of activating the immune response towards a tumor include a gene that encodes any immunostimulatory polypeptide agent as defined above.
- an anti-cancer agent is an agent that at least partially inhibits the development or progression of a cancer, including inhibiting in whole or in part symptoms associated with the cancer even if only for the short term.
- DNA damaging agents include topoisomerase inhibitors (e.g., etoposide, ramptothecin, topotecan, teniposide, mitoxantrone), DNA alkylating agents (e.g., cisplatin, mechlorethamine, cyclophosphamide, ifosfamide, melphalan, chorambucil, busulfan, thiotepa, carmustine, lomustine, carboplatin, dacarbazine, procarbazine), DNA strand break inducing agents (e.g., bleomycin, doxorubicin, daunorubicin, idarubicin, mitomycin C), anti-microtubule agents
- topoisomerase inhibitors e.g.,
- anti-cancer agents include without limitation Acivicin; Aclarubicin; Acodazole Hydrochloride; Acronine; Adozelesin; Aldesleukin; Altretamine; Ambomycin; Ametantrone Acetate; Aminoglutethimide; Amsacrine; Anastrozole; Anthramycin; Asparaginase; Asperlin; Azacitidine; Azetepa; Azotomycin; Batimastat; Benzodepa; Bicalutamide; Bisantrene Hydrochloride; Bisnafide Dimesylate; Bizelesin; Bleomycin Sulfate; Bortezomib (VELCADE); Brequinar Sodium; Bropirimine; Busulfan; Cactinomycin; Calusterone; Caracemide; Carbetimer; Carboplatin (a platinum-containing regimen); Carmustine; Carubicin Hydrochloride; Carzelesin; Cedefingol; Chloram
- the anti-cancer agent may be an enzyme inhibitor including without limitation tyrosine kinase inhibitor, a CDK inhibitor, a MAP kinase inhibitor, or an EGFR inhibitor.
- the tyrosine kinase inhibitor may be without limitation Genistein (4′,5,7-trihydroxyisoflavone), Tyrphostin 25 (3,4,5-trihydroxyphenyl), methylene]-propanedinitrile, Herbimycin A, Daidzein (4′,7-dihydroxyisoflavone), AG-126, trans-1-(3′-carboxy-4′-hydroxyphenyl)-2-(2′′,5′′-dihydroxy-phenyl)ethane, or HDBA (2-Hydroxy5-(2,5-Dihydroxybenzylamino)-2-hydroxybenzoic acid.
- the CDK inhibitor may be without limitation p21, p27, p57, p15, p16, p18, or p19.
- the MAP kinase inhibitor may be without limitation KY12420 (C 23 H 24 O 8 ), CNI-1493, PD98059, or 4-(4-Fluorophenyl)-2-(4-methylsulfinyl phenyl)-5-(4-pyridyl) 1H-imidazole.
- the EGFR inhibitor may be without limitation erlotinib (TARCEVA), gefitinib (IRESSA), WHI-P97 (quinazoline derivative), LFM-Al2 (leflunomide metabolite analog), ABX-EGF, lapatinib, canertinib, ZD-6474 (ZACTIMA), AEE788, and AG1458.
- the anti-cancer agent may be a VEGF inhibitor including without limitation bevacizumab (AVASTIN), ranibizumab (LUCENTIS), pegaptanib (MACUGEN), sorafenib, sunitinib (SUTENT), vatalanib, ZD-6474 (ZACTIMA), anecortave (RETAANE), squalamine lactate, and semaphorin.
- AVASTIN bevacizumab
- ranibizumab LCENTIS
- MACUGEN pegaptanib
- sorafenib sunitinib
- SUTENT sunitinib
- ZACTIMA ZACTIMA
- anecortave squalamine lactate
- semaphorin semaphorin
- the anti-cancer agent may be an antibody or an antibody fragment including without limitation an antibody or an antibody fragment including but not limited to bevacizumab (AVASTIN), trastuzumab (HERCEPTIN), alemtuzumab (CAMPATH, indicated for B cell chronic lymphocytic leukemia,), gemtuzumab (MYLOTARG, hP67.6, anti-CD33, indicated for leukemia such as acute myeloid leukemia), rituximab (RITUXAN), tositumomab (BEXXAR, anti-CD20, indicated for B cell malignancy), MDX-210 (bispecific antibody that binds simultaneously to HER-2/neu oncogene protein product and type I Fc receptors for immunoglobulin G (IgG) (Fc gamma RI)), oregovomab (OVAREX, indicated for ovarian cancer), edrecolomab (PANOREX), daclizumab (ZENAPAX),
- DNA cleaving agents suitable for inclusion as the cell toxin in the conjugates used in practicing the methods include, but are not limited to, anthraquinone-oligopyrrol-carboxamide, benzimidazole, leinamycin; dynemycin A; enediyne; as well as biologically active analogs or derivatives thereof (i.e., those having a substantially equivalent biological activity).
- DNA cleaving agents suitable for inclusion as the cell toxin in the conjugates used in practicing the methods include, but are not limited to, anthraquinone-oligopyrrol-carboxamide, benzimidazole, leinamycin; dynemycin A; enediyne; as well as biologically active analogs or derivatives thereof (i.e., those having a substantially equivalent biological activity).
- Known analogs and derivatives are disclosed, for examples in Islam et al., J. Med. Chem. 34 2954-61, 1991; Skibo et al.,
- a protein that acts as an angiogenesis inhibitor is targeted to a tumor.
- agents include, in addition to the anti-angiogenic polypeptides mentioned above, Marimastat; AG3340; COL-3, BMS-275291, Thalidomide, Endostatin, SU5416, SU6668, EMD121974, 2-methoxyoestradiol, carboxiamidotriazole, CM1O1, pentosan polysulphate, angiopoietin 2 (Regeneron), herbimycin A, PNU145156E, 16K prolactin fragment, Linomide, thalidomide, pentoxifylline, genistein, TNP470, endostatin, paclitaxel, accutin, angiostatin, cidofovir, vincristine, bleomycin, AGM-1470, platelet factor 4 or minocycline.
- the invention relates to a conjugate according to the invention for use in medicine.
- the invention relates to a pharmaceutical composition comprising a conjugate according to the invention and a pharmaceutically acceptable carrier.
- the term “pharmaceutically acceptable carrier” means a non-toxic, inert solid, semi-solid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type.
- Remington's Pharmaceutical Sciences. Ed. by Gennaro, Mack Publishing, Easton, Pa., 1995 discloses various carriers used in formulating pharmaceutical compositions and known techniques for the preparation thereof.
- compositions of this invention can be administered to a patient by any means known in the art including oral and parenteral routes.
- inventive compositions may be administered by injection (e.g., intravenous, subcutaneous or intramuscular, intraperitoneal injection), rectally, vaginally, topically (as by powders, creams, ointments, or drops), or by inhalation (as by sprays).
- the conjugates of the invention are particularly useful for the delivery of compound of interest to said tumor cells. If the active compound has cytostatic or cytotoxic activity, then the conjugates are particularly useful for the treatment of cancers which over-express CXCR4.
- the invention relates to a conjugate according to the invention, a polynucleotide according to the invention, a vector according to the invention or a host cell according to the invention for use in a method for the treatment of cancer wherein said cancer contains cells that expresses CXCR4.
- the invention relates to the use of a conjugate according to the invention, a polynucleotide according to the invention, a vector according to the invention or a host cell according to the invention for the manufacture of a medicament for use in a method for the treatment of cancer wherein said cancer contains cells that expresses CXCR4.
- the invention relates to a method for the treatment in a subject of cancer wherein said cancer contains cells that expresses CXCR4 comprising the administration to said subject of a conjugate according to the invention, a polynucleotide according to the invention, a vector according to the invention or a host cell according to the invention.
- Cancer containing cells that expresses CXCR4 include, without limitation, ovarian, bladder, colorectal, lung, head and neck, renal, stomach, uterine, acute lymphoblastic leukemia, and cervical cancers.
- the cancer to be treated using the method according to the present invention is colorectal cancer or pancreatic cancer.
- colonal cancer includes any type of colon, rectal and appendix neoplasia and refers both to early and late adenomas and to carcinomas as well as to the hereditary, familial or sporadic cancer.
- Hereditary CRC includes those syndromes which include the presence of polyps, such as the hamartomatous polyposis syndromes and the most known, familial adenomatous polyposis (FAP) as well as nonpolyposis syndromes such as hereditary nonpolyposis colorectal cancer (HNPCC) or Lynch syndrome I.
- said colorectal cancer is colon cancer, rectal cancer and/or vermiform appendix cancer.
- said colorectal cancer is stage 0, stage I, stage II, stage III and/or stage IV colorectal cancer.
- the stages of CRC referred to herein correspond to the American Joint Committee on Cancer (AJCC) CRC staging, although other staging methods, such as Dukes and Astler-Coller staging, can equally be used.
- AJCC American Joint Committee on Cancer
- pancreatic cancer refers to a malignant neoplasm of the pancreas, including but not limited to, adenocarcinomas, adenosquamous carcinomas, signet ring cell carcinomas, hepatoid carcinomas, colloid carcinomas, undifferentiated carcinomas, undifferentiated carcinomas with osteoclast-like giant cells and islet cell carcinomas.
- a “subject”, as used therein, can be a human or non-human animal.
- Non-human animals include, for example, livestock and pets, such as ovine, bovine, porcine, canine, feline and murine mammals, as well as reptiles, birds and fish.
- livestock and pets such as ovine, bovine, porcine, canine, feline and murine mammals, as well as reptiles, birds and fish.
- the subject is human.
- an enhanced immune response could also be monitored by observing one or more of the following effects: (1) inhibition, to some extent, of tumor growth, including, (i) slowing down (ii) inhibiting angiogenesis and (ii) complete growth arrest; (2) reduction in the number of tumor cells; (3) maintaining tumor size; (4) reduction in tumor size; (5) inhibition, including (i) reduction, (ii) slowing down or (iii) complete prevention, of tumor cell infiltration into peripheral organs; (6) inhibition, including (i) reduction, (ii) slowing down or (iii) complete prevention, of metastasis; (7) enhancement of anti-tumor immune response, which may result in (i) maintaining tumor size, (ii) reducing tumor size, (iii) slowing the growth of a tumor, (iv) reducing, slowing or preventing invasion and/or (8) relief, to some extent, of the severity or number of one or more symptoms associated with the disorder.
- an effective amount is a dosage of the agent sufficient to provide a medically desirable result.
- the effective amount will vary with the particular condition being treated, the age and physical condition of the subject being treated, the severity of the condition, the duration of the treatment, the nature of the concurrent or combination therapy (if any), the specific route of administration and like factors within the knowledge and expertise of the health practitioner. It is preferred generally that a maximum dose be used, that is, the highest safe dose according to sound medical judgment.
- an effective amount may be that amount that reduces the tumor volume or load (as for example determined by imaging the tumor).
- Effective amounts may also be assessed by the presence and/or frequency of cancer cells in the blood or other body fluid or tissue (e.g., a biopsy). If the tumor is impacting the normal functioning of a tissue or organ, then the effective amount may be assessed by measuring the normal functioning of the tissue or organ.
- the conjugates are formulated for selected delivery routes including, but are not limited to, topically, intraarticularly, intracisternally, intraocularly, intraventricularly, intrathecally, intravenously, intramuscularly, intratracheally, intraperitoneally and intradermally.
- the conjugates of the invention are particularly useful for the delivery of compound of interest to said CD4+ cells. If the active compound has anti-retroviral activity or is capable of inducing the death of the cells, the conjugates are particularly useful for the treatment of diseases associated with an HIV infection.
- antiretroviral agent refers to a compound that inhibits the ability of a retrovirus to effectively infect a host. Antiretroviral agents can inhibit a variety of process including the replication of viral genetic materials, or entry of retroviruses into cells. In some embodiments, antiretroviral agents are selected from the group consisting of: protease inhibitor, a reverse transcriptase inhibitor, and a viral fusion inhibitor.
- the active compound is an anti-HIV agent that can be used for the treatment of a disease associated with HIV infection.
- Suitable anti-HIV agents for use as therapeutic agents according to the invention include, without limitation, one or more of the following:
- compositions according to the present invention may further comprise an antiretroviral agent selected from the group consisting of vaccines, gene therapy treatments, cytokines, TAT inhibitors, and immunomodulators in amounts effective for treatment of HIV when used in a combination therapy.
- an antiretroviral agent selected from the group consisting of vaccines, gene therapy treatments, cytokines, TAT inhibitors, and immunomodulators in amounts effective for treatment of HIV when used in a combination therapy.
- the invention relates to a conjugate according to the invention, a polynucleotide according to the invention, a vector according to the invention or a host cell according to the invention wherein the therapeutic agent is selected from the group consisting of
- the invention relates to the use of a conjugate according to the invention, a polynucleotide according to the invention, a vector according to the invention wherein the therapeutic agent is selected from the group consisting of
- the invention relates to a method for the treatment of a disease associated with HIV infection in a subject in need thereof which comprises the administration to said subject of a conjugate according to the invention, a polynucleotide according to the invention, a vector according to the invention wherein the therapeutic agent is selected from the group consisting of
- cytotoxic polypeptide “pro-apoptotic polypeptide”, “silencing agent” and “suicide gene” have been explained in detail above in the context of the antitumoral agents of the invention and are equally applied in the context of the present methods.
- Suitable silencing agents include, without limitation, siRNA constructs for suppression of HIV replication. These siRNA constructs can be specific for various HIV targets (reviewed in Morris (2006) Gene Ther 13:553-558; Rossi (2006) Biotechniques Supp1:25-29; Nekhai (2006) Curr Opin Mol Ther 8:52-61; and Cullen (2005) AIDS Rev 7:22-25).
- the invention also features components to decrease expression of T cell coreceptors (e.g., CCRS and CCR4). Such suppression would be expected to hinder infection of host T-cells as people with CCR5A32 mutation are resistant to HIV infection.
- the invention also features the inclusion of multiple siRNA constructs (e.g., constructs against HIV genes and T-cell receptors used for HIV infection). Here, one siRNA construct can block infection and while a second siRNA construct prevents progression of infection.
- the term “disease associated with HIV infection”, as used herein, includes a state in which the subject has developed AIDS as well as a state in which the subject infected with HIV has not shown any sign or symptom of the disease.
- the compositions of the invention when administered to a subject that has no clinical signs of the infection can have a preventive activity, since they can prevent the onset of the disease.
- the compositions are capable of preventing or slowing the infection and destruction of healthy CD4+ T cells in such a subject.
- Beneficial or desired clinical results include, but are not limited to, an increase in absolute na ⁇ ve CD4+ T-cell count (range 10-3520), an increase in the percentage of CD4+T-cell over total circulating immune cells (range 1-50 percent), and/or an increase in CD4+ T-cell count as a percentage of normal CD4+ T-cell count in an uninfected subject (range 1-161 percent). “Treatment” can also mean prolonging survival of the infected subject as compared to expected survival if the subject did not receive any HIV targeted treatment.
- the present invention further relates to preventing or reducing symptoms associated with HIV infection.
- symptoms associated with the minor symptomatic phase of HIV infection including, for example, shingles, skin rash and nail infections, mouth sores, recurrent nose and throat infection and weight loss.
- further symptoms associated with the major symptomatic phase of HIV infection include, for instance, oral and vaginal thrush (Candida), persistent diarrhea, weight loss, persistent cough and reactivated tuberculosis or recurrent herpes infections, such as cold sores (herpes simplex).
- Methods for the preparation of the conjugates are provided. These methods include chemical conjugation methods and methods that rely on recombinant production of the conjugates.
- the targeting peptide used in the practice of the invention may be attached to the active compound of therapeutic or diagnostic interest by chemical modification.
- the chemical methods rely on derivatization of the active agent (therapeutic or diagnostic) with the desired linking agent, and then reaction with the targeting peptide.
- the chemical methods of derivatization may be carried out using bifunctional cross-linking agents.
- a targeting peptide that is produced by any means, typically by expression of DNA in a bacterial or eukaryotic host or by chemical synthesis is chemically coupled with the active agent. If the targeting peptide or active agent does not contain suitable moieties for effecting chemical linkage it can be derivatized.
- the agent such as Shiga toxin, gelonin or other such agent, can be derivatized such as by reaction with a linking agent, such as N-succinimidyl-3-(2-pyridyidithio)propionate (SPDP).
- the targeted agent such as shiga A chain
- the targeted agent is modified at or near the N-terminus to include a cysteine residue, so that the resulting modified agent can react with the chemokine receptor-binding moiety protein without further derivatization.
- Non-limiting examples of possible chemical groups involved in such the conjugation are: a carboxylic acid group on the targeting peptide, which could be reacted with an amino group on the active agent (for example, the .epsilon.-amino group on a lysine side chain) to form an amide group linking the targeting peptide and the active agent; an amino group on the targeting peptide, which could be reacted with a carboxylic acid group on the active agent (for example, the carboxylic acid group on a glutamate or aspartate side chain) to form an amide group linking the targeting peptide and the active agent; a disulfide group on the targeting peptide, which could be reacted with a thiol group on the active agent (for example, the thiol group on a cysteine side chain) to form a disulfide group linking the targeting peptide and the active agent.
- an amino group on the targeting peptide which could be reacted with an amino group on the active agent (
- the conjugate generally will be purified to separate the conjugate from unconjugated targeting agents or from other contaminants.
- a large number of purification techniques are available for use in providing conjugates of a sufficient degree of purity to render them clinically useful. Purification methods based upon size separation, such as gel filtration, gel permeation or high performance liquid chromatography, will generally be of most use. Other chromatographic techniques, such as Blue-Sepharose separation, may also be used.
- the conjugate is a fusion protein of the targeting peptide and the therapeutic agent, in which case the fusion protein or peptide may be isolated or purified.
- Protein purification techniques are well known to those of skill in the art. These techniques involve, at one level, the homogenization and crude fractionation of the cells, tissue or organ to polypeptide and non-polypeptide fractions. The protein or polypeptide of interest may be further purified using chromatographic and electrophoretic techniques to achieve partial or complete purification (or purification to homogeneity).
- Analytical methods particularly suited to the preparation of a pure peptide are ion-exchange chromatography, gel exclusion chromatography, polyacrylamide gel electrophoresis, affinity chromatography, immunoaffmity chromatography and isoelectric focusing.
- a particularly efficient method of purifying peptides is fast performance liquid chromatography (FPLC) or even high performance liquid chromatography (HPLC).
- a purified protein or peptide is intended to refer to a composition, isolatable from other components, wherein the protein or peptide is purified to any degree relative to its naturally-obtainable state.
- An isolated or purified protein or peptide therefore, also refers to a protein or peptide free from the environment in which it may naturally occur.
- purified will refer to a protein or peptide composition that has been subjected to fractionation to remove various other components, and which composition substantially retains its expressed biological activity.
- substantially purified this designation will refer to a composition in which the protein or peptide forms the major component of the composition, such as constituting about 50 percent, about 60 percent, about 70 percent, about 80 percent, about 90 percent, about 95 percent, or more of the proteins in the composition.
- Partial purification may be accomplished by using fewer purification steps in combination, or by utilizing different forms of the same general purification scheme. For example, it is appreciated that a cation-exchange column chromatography performed utilizing an HPLC apparatus will generally result in a greater “-fold” purification than the same technique utilizing a low pressure chromatography system. Methods exhibiting a lower degree of relative purification may have advantages in total recovery of protein product, or in maintaining the activity of an expressed protein.
- GFP fusion genes were produced by standard recombinant DNA technologies, to encode hybrid proteins containing a His tag at the C terminus and a relevant CXCR4 ligand at the amino terminus.
- the encoded proteins T22-GFP-H6, V1-GFP-H6, vCCL2-GFP-H6 and CXCL12-GFP-H6 were produced in soluble form in Escherichia coli strain Origami B (OmpT-, lon-, trxB-, gor-(Novagen)).
- Proteins were purified from crude cell extracts by 6 ⁇ His tag affinity chromatography using HiTrap Chelating HP 1 ml Ni 2+ columns (GE healthcare) in an AKTA purifier FPLC (GE healthcare). Positive fractions were collected in elution buffer (Tris-HCl 20 mM pH 7.5, 500 mM NaCl, 500 mM Imidazole), dialyzed against PBS+10% glycerol or 20 mM Tris 500 mM NaCl buffers, and quantified by Bradford's procedure. Protein integrity was characterized by mass spectrometry (MALDI-TOF) and N-terminal sequencing.
- MALDI-TOF mass spectrometry
- DNA-protein incubation and DNA mobility assays were performed according to previously published protocols (2) in PBS pH 6+10% glycerol.
- purified proteins were diluted to 0.2 mg/ml final concentration. All the protein samples were negatively stained with 2% Uranyl acetate onto carbon coated grids. The samples were also platinated by depositing evaporated 1 nm platinum layer over the sample containing grids. All the samples were visualized in Hitachi H-7000 transmission electron microscope.
- HeLa (ATCC-CCL-2) cell line was used in all the experiments and monitored in vivo, in absence of fixation.
- Cells were maintained in MEM (GIBCO, Rockville, Md.) supplemented with 10% Fetal Calf Serum (GIBCO) and incubated at 37° C. and 5% CO 2 in a humidified atmosphere.
- GFP fusion proteins at the concentrations indicated, were added to cell culture in the presence of Optipro medium (GIBCO, Invitrogen) 20 h before confocal analysis, except for time-course studies and studies of internalization in the presence of serum (complete media).
- Optipro medium Optipro medium
- cells were grown on Mat-Teck culture dishes (Mat Teck Corp., Ashland, Mass., United States).
- Nuclei were labelled with 20 pg/m1 Hoechst 33342 (Molecular Probes, Eugene, Oreg., United States) and the plasma membrane was labelled with 2.5 ⁇ g/ml CELLMASK Deep Red (Molecular Probes, Invitrogen, Carlsbad, Calif., USA) for 5 min in the dark. Cells were washed in PBS (Sigma-Aldrich Chemie GmbH, Steinheim, Germany). Live cells were recorded with a TCS-SP5 confocal laser scanning microscope (Leica Microsystems, Heidelberg, Germany) using a Plan Apo 63x/1.4 (oil HC ⁇ PL APO lambda blue) objective.
- Hoechst 33342 DNA labels was excited with a blue diode (405 nm) and detected in the 415-460 nm range.
- GFP-proteins were excited with an Ar laser (488 nm) and detected in the 525-545 nm range.
- CELLMASKTM was excited with a HeNe laser (633 nm) and detected in the 650-775 nm range.
- stacks of 10 to 20 sections every 0.5 ⁇ m along the cell thickness were collected. The projections of the series obtained were generated with Leica LAS AF software, and three-dimensional models were generated using Imaris v. 6.1.0 software (Bitplane; Switzerland).
- T22-GFP-H6 protein (1, 2, 3 and 4 retardation units —RU—) and 1 ⁇ g of TdTomato expression vector were mixed into a final volume of 85 ⁇ l of PBS+10% glycerol buffer, and complexes were formed after 1 h at room temperature, after which convenient volumes of Optipro were added.
- the complex was gently added to HeLa cells, followed by incubation for 24 and 48 h at 37° C. in 5% CO 2 atmosphere.
- TdTomato gene expression was monitored by flow cytometry and by confocal microscopy. Cells without treatment, or just incubated with the expression vector or the protein alone, were used as controls.
- T22-GFP-H6 To assess the binding specificity of T22-GFP-H6 to CXCR4, HeLa cells were grown in a 24-well plaque at 70% confluence in a competition assay. Cells were pre-incubated for 30 min with increasing amounts of the natural CXCR4 ligand SDF1alpha in Optipro, to reach 25 nM and 250 nM, or with the irrelevant proteins GFP-H6 and human alpha-galactosidase (both at 250 nM). Then, T22-GFP-H6 was added to the cultures at 25 nM and further incubated. One hour later, cells were treated with 1 mg/mL trypsin for 15 min and intracellular fluorescence determined by flow cytometry. Data were analyzed with WinMDI, Microsoft Excel 2003 and Sigmaplot 10 software.
- the Peptide T22 is Able to Promote the Internalization of Functional and Soluble Fused Proteins into Target CXCR4+ Cells.
- FIGS. 3 C, 3 D, 3 E, 3 F, 3 G, 3 H, 3 I, 3 J, 3 K, 3 L, 3 M, 3 N, and 3 O were submitted to confocal analysis that confirmed the highly efficient internalization of T22-GFP-H6, and the poor penetrability of the rest of tested peptides.
- the peptide T22 is able to promote the internalization of functional and soluble fused proteins into target CXCR4+ cells.
- the Peptide T22 is Able to Promote the Internalization and Expression of Plasmid DNA into Target CXCR4+ Cells.
- T22-GFP-H6 Different biological and physicochemical features of T22-GFP-H6 were determined by alternative procedures ( FIGS. 3 C, 3 D, 3 E, 3 F, 3 G, 3 H, 3 I, 3 J, 3 K, 3 L, 3 M, 3 N, and 3 O ). Among them, it was noteworthy the perinuclear localization of T22-GFP-H6 and the presumed docking of the protein in the nuclear membrane ( FIGS. 3 F, 3 G and 3 H , see the inset). This suggested that apart from the potential of T22 in the delivery of functional proteins (in the model a fully fluorescent GFP shown in Example 1), this peptide could also deliver expressible DNA and eventually promote their entrance into the nuclear compartment.
- T22-GFP-H6 The Internalization of T22-GFP-H6 is Inhibited by a Natural Ligand of CXCR4
- SDFalpha a natural CXCR4 ligand
- T22-GFP-H6 The ability of a natural CXCR4 ligand (SDFalpha) to inhibit the internalization of T22-GFP-H6 was tested by contacting CXCR4+ cells with the T22-GFP-H6 in the presence of the protein SDFalpha, at different T22-GFP-H6/SDFalpha ratios (1:0, 1:1, 1:10). Two irrelevant proteins, GFP-H6 and GLA were used as controls at a 1:10 ratio. The results showed that SDFalpha was capable to inhibit in a dose-dependent manner the internalization of the T22-GFP-H6, whereas no effect was observed with the unrelated proteins ( FIG. 5 ).
- a fusion protein comprising T22 as a target moiety (which specifically binds to the CXCR4 receptor) and a green fluorescent protein was administered to immunosuppressed mice containing a primary tumor resulting from the xenotransplant of CXCR4+ SW1417 human colorectal cancer cells in the cecum of the mice.
- Distribution of T22-GFP was determined at several time points (5, 24 or 48 h) after intravenous single dose administration of a dose range varying form 20 to 500 ug.
- T22-GFP accumulated 8-47 fold with respect to control animals, as measured by fluorescence quantitation, using a IVIS200 system (Xenogen). No fluorescence is detected in primary tumor tissue in control mice treated with vehicle.
- T22-GFP An intravenous single dose of 500 ⁇ g of T22-GFP was administered to mice showing peritoneal metastases and mesenteric and diaphragmatic lymph nodes derived from CXCR4+ SW1417 human colorectal cancer cells xenotransplanted in the cecum of immunosuppressed mice.
- T22-GFP accumulated 20-40 fold in peritoneal metastatic foci, as measured by fluorescence quantitation using a IVIS200 system (Xenogen) at 5 h or 24 h after.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Epidemiology (AREA)
- Gastroenterology & Hepatology (AREA)
- Biotechnology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Toxicology (AREA)
- Immunology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Cell Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Virology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Communicable Diseases (AREA)
- Oncology (AREA)
- Medicinal Preparation (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Peptides Or Proteins (AREA)
Abstract
Description
-
- (i) a targeting peptide comprising the sequence RRWCYRKCYKGYCYRKCR (SEQ ID NO: 5) or a functionally equivalent variant thereof and
- (ii) a therapeutic agent
wherein the targeting peptide is capable of specifically binding to CXCR4 and promoting internalization of the therapeutic agent in a cell expressing CXCR4. In further aspects, the invention relates to a polynucleotide encoding a conjugate according to the invention, a vector comprising said polynucleotide and a host cell comprising said polynucleotide or said vector.
-
- (i) a targeting peptide comprising the sequence RRWCYRKCYKGYCYRKCR (SEQ ID NO: 5) or a functionally equivalent variant thereof and
- (ii) a therapeutic agent
wherein the targeting peptide is capable of specifically binding to CXCR4 and promoting internalization of the therapeutic agent in a CXCR4 expressing cell.
-
- the T140 peptide having the sequence RRX1CYRKX2PYRX3CR (SEQ ID NO: 6) wherein X1 is L-3-(2-naphtyl)alanine, X2 is D-Lys and X3 is L-Citrulline.
- the TN14003 peptide having the sequence RRX1CYX2KX3PYRX4CR (SEQ ID NO: 7) wherein X1 is L-3-(2-naphtyl)alanine, X2 is Cit, X3 is dLys and X4 is L-Citrulline,
- the TC14012 peptide having the sequence RRX1CYEKX2PYRX3CR (SEQ ID NO: 8) wherein X1 is L-3-(2-naphtyl)alanine, X2 is d-Citrulline and X3 is L-Citrulline,
- the TE14011 peptide having the sequence RRX1CYX2KX3PYRX4CR (SEQ ID NO: 9) wherein X1 is L-3-(2-naphtyl)alanine, X2 is L-Citrulline, X3 is dGlu and X4 is L-Citrulline and
- the TZ14011 peptide having the sequence RRX1CYX2KX3PYRX4CR (SEQ ID NO: 9) wherein X1 is L-3-(2-naphtyl)alanine, X2 is L-Citrulline, X3 is D-Lys and X4 is L-Citrulline or the variant thereof wherein the N-terminal Arginine residue is acetylated (known Ac-TZ14011).
-
- The therapeutic agent is a polypeptide which is associated to the targeting peptide by a covalent bond.
- The therapeutic agent is a polypeptide and forms a fusion protein with the targeting peptide.
- The therapeutic agent is a polynucleotide which may be directly attached to the targeting peptide or by an additional protein domain which shows affinity for DNA, particularly by electrostatic interaction. Suitable protein domains which are capable of associating with DNA via electrostatic interaction include, without limitation, polylysine, protamine, albumin and cationized albumin.
- The therapeutic agent is a small organic molecule.
- The therapeutic agent is any of the above (polypeptide, polynucleotide or small organic molecule) which is provided within a nanotransporter which is coupled to the targeting peptide.
-
- the peptide GTKVHMK (SEQ ID NO:18) formed by residues 53-56 and residues 57-59 of tetranectin (Nielsen, B.B. et al., FEBS Lett. 412: 388-396, 1997);
- the connecting
strand 3 from human fibronectin, corresponding to amino acids 1992-2102 (SWISSPROT numbering, entry P02751). - The subsequence PGTSGQQPSVGQQ (SEQ ID NO: 19) corresponding to amino acids number 2037-2049 of fibronectin and within that subsequence fragment GTSGQ (SEQ ID NO: 20) corresponding to amino acids 2038-2042.
- The 10 amino acid residue sequence of the upper hinge region of murine IgG3 (PKPSTPPGSS, SEQ ID NO: 21). In a preferred embodiment, the linker peptide is selected from the group of the peptide of sequence APAETKAEPMT (SEQ ID NO: 22) and of the peptide of sequence GAP.
- The eight amino acid sequence GGSSRSSS (SEQ ID NO:32).
-
- (i) a cytotoxic polypeptide,
- (ii) an antiangiogenic polypeptide,
- (iii) a polypeptide encoded by a tumor suppressor gene,
- (iv) a polypeptide encoded by a polynucleotide which is capable of activating the immune response towards a tumor,
- (v) a tumor suppressor gene,
- (vi) a silencing agent,
- (vii) a suicide gene,
- (viii) a polynucleotide which is capable of activating the immune response towards a tumor,
- (ix) a chemotherapy agent and
- (x) an antiangiogenic molecule.
-
- The antisense oligonucleotides to CXCR4 having the
sequences 5′-CTGATCCCCTCCATGGTAACCGCT-3′ (SEQ ID NO: 10), 5′-TATATACTGATCCCCTCCATGGTA-3′ (SEQ ID NO: 11) and 5-CCTCCATGGTAACCGCTGGTTCT-3′ (SEQ ID NO: 12) and described in U.S. Pat. No. 6,429,308; - The CXCR4-specific siRNAs as described in WO2008008852 comprising sense strands having the
sequences 5′-UAAAAUCUUCCUGCCCACCdTdT-3′ (SEQ ID NO: 13) and 5′-GGAAGCUGUUGGCUGAAAAdTdT-3′ (SEQ ID NO: 14). - The CXCR4-specific interference RNAs targeting the sequences within CXCR4 mRNA described in WO2007143584.
- The CXCR4-specific interference RNAs targeting the sequences within CXCR4 mRNA described in US20050124569.
- The CXCR4-specific ribozyme having the
sequence 3′-UGUUGCA-X-Y-X-UCACUC-5′ wherein X are the catalytic sequences and Y is the sequence of a stem-loop region. Detailed structures of this ribozyme and the DNA-cassetes encoding said sequences are described in U.S. Pat. No. 6,916,653; - The CXCR4-specific shRNA having the
sequence 5′-GATCCAGGATGGTGGTGTTTCAATTCCTTCAAGAGAGGAATTGAAACACCACCA TCCTTTTTGG-3 (SEQ ID NO: 15) as described in US2009210952. - The CXCR4-specific siRNAs targeting the sequences within the CXCR4 mRNA AATAAAATCTTCCTGCCCACC (SEQ ID NO: 16) and AAGGAAGCTGTTGGCTGAAAA (SEQ ID NO: 17) as described in WO2004087068.
- The CXCR4-specific interference RNAs targeting the sequences within CXCR4 mRNA described in US2009235772 and US2005124569.
- The antisense oligonucleotides to CXCR4 having the
-
- 1) Combination drugs: efavirenz, emtricitabine or tenofovir disoproxil fumarate (ATRIPLA (R)BMS, Gilead); lamivudine or zidovudine (COMBIVIR (R)/GSK); abacavir or lamivudine (EPZICOM (R)/GSK); abacavir, lamivudine or zidovudine (TRIZIVIR (R)/GSK); emtricitabine, tenofovir disoproxil fumarate (TRUVADA (R)/Gilead).
- 2) Entry and fusion inhibitors: maraviroc (CELSENTRI (R), SELZENTRY (R)/Pfizer); pentafuside or enfuvirtide (FUZEON (R)/Roche, Trimeris). In some embodiments, the viral entry inhibitor is a fusion inhibitor, a CD4 receptor binding inhibitor, is a CD4 mimic or a gp120 mimic. In some further embodiments, the viral entry inhibitor is a gp41 antagonist, a CD4 monoclonal antibody or a CCRS antagonist, including CCRS antagonist sub-classes such as, for example, zinc finger inhibitors. In yet another embodiment, the viral entry inhibitor is a CXCR4 co-receptor antagonist.
- 3) Integrase inhibitors: raltegravir or MK-0518 (ISENTRESS (R)/Merck).
- 4) Reverse transcriptase inhibitors: Suitable reverse transcriptase inhibitors for use in the compositions according to the present invention is one or more compounds selected from the group consisting of emtricitabine, capravirine, tenofovir, lamivudine, zalcitabine, delavirdine, nevirapine, didanosine, stavudine, abacavir, alovudine, zidovudine, racemic emtricitabine, apricitabine, emivirine, elvucitabine, TMC-278, DPC-083, amdoxovir, (−)-beta-D-2,6-diamino-purine dioxolane, MIV-210 (FLG), DFC (dexelvucitabine), dioxolane thymidine, Calanolide A, etravirine (TMC-125), L697639, atevirdine (U87201E), MIV-150, GSK-695634, GSK-678248, TMC-278, KP1461, KP-1212, lodenosine (FddA), 5-[(3,5-dichlorophenyl)thio]-4-isopropyl-1-(4-pyridylmethyl)imidazole-2-methanol carbamic acid, (−)-I2-D-2,6-diaminopurine dioxolane, AVX-754, BCH-13520, BMS-56190 ((4S)-6-chloro-4-[(1E)-cyclopropylethenyl]-3,-4-dihydro-4-trifluoromethyl-2 (1H)-quinazolinone), TMC-120, and L697639, where the compounds are present in amounts effective for treatment of HIV when used in a combination therapy.
- 5) Protease inhibitors: Suitable protease inhibitors that can be combined with the miRNAs or polynucleotides encoding miRNAs according to the invention is selected from the group consisting of ritonavir, lopinavir, saquinavir, amprenavir, fosamprenavir, nelfmavir, tipranavir, indinavir, atazanavir, TMC-126, darunavir, mozenavir (DMP-450), JE-2147 (AG1776), L-756423, KNI-272, DPC-681, DPC-684, telinavir (SC-52151), BMS 186318, droxinavir (SC-55389a), DMP-323, KNI-227, 1-[(2-hydroxyethoxy)methyl]-6-(phenylthio)-thymine, AG-1859, RO-033-4649, R-944, DMP-850, DMP-851, and brecanavir (GW640385). Preferred protease inhibitors for use in combination with a compound of the present invention include saquinavir, ritonavir, indinavir, nelfhavir, amprenavir, lopinavir, atazanavir, darunavir, brecanavir, fosamprenavir, and tipranavir. Particularly useful such combinations include, for example, AZT+3TC; TDF+3TC; TDF+FTC; ABC+3TC; and Abacavir+3TC.
-
- (i) an antiretroviral agent,
- (ii) a cytotoxic polypeptide,
- (iii) a pro-apoptotic polypeptide
- (iv) a silencing agent and
- (v) a suicide gene,
for use in the treatment of a disease associated with a HIV infection.
-
- (i) an antiretroviral agent,
- (ii) a cytotoxic polypeptide,
- (iii) a pro-apoptotic polypeptide
- (iv) a silencing agent and
- (v) a suicide gene,
for the manufacture of a medicament for use in a method for the treatment.
-
- (i) an antiretroviral agent,
- (ii) a cytotoxic polypeptide,
- (iii) a pro-apoptotic polypeptide
- (iv) a silencing agent and
- (v) a suicide gene,
| TABLE 1 |
| Main physicochemical properties of the peptides used in this study. |
| Peptide | Sequence | mer | Mw (Da) | P | N | Arg | pI | AI | H | SI |
| T22 | MRRWCYRKCYKGYCYRKCR (SEQ ID | 19 | 2623.1 | 8 | 0 | 5 | 9.96 | 0 | -1.516 | 39.06 |
| NO: 28) | (stable) | |||||||||
| V1 | MLGASWHRPDKCCLGYQKRPLP (SEQ | 22 | 2557 | 4 | 1 | 2 | 9.38 | 57.73 | -0.705 | 55.14 |
| ID NO: 29) | (unstable) | |||||||||
| vCCL2 | MLGASWHRPDKCCLGYQKRPLPQVLLSSW | 71 | 8103.6 | 12 | 3 | 4 | 9.9 | 79.58 | -0.361 | 37.48 |
| YPTSQLCSKPGVIFLTKRGRQVCADKSKD | (stable) | |||||||||
| WVKKLMQQLPVTA (SEQ ID NO: 30) | ||||||||||
| CXCL12 | MKPVSLSYRCPCRFFESHVARANVKHLKI | 68 | 7966.4 | 12 | 4 | 5 | 9.81 | 97.5 | -0.328 | 16.24 |
| LNTPNCALQIVARLKNNNRQVCIDPKLKW | (stable) | |||||||||
| IQEYLEKALN (SEQ ID NO: 31) | ||||||||||
| P: Positively charged amino acids; N: Negatively charged amino acids; Arg: Number of arginine residues; pI: Isolelectric point; Al: Aliphatic index; H: Hidrophobicity; SI: Stability index; | ||||||||||
| TABLE 2 |
| Main physicochemical properties of the fusion proteins generated in this study. |
| SF | |||||||||||||||
| Fusion | Mw | S | (FU/μg | ||||||||||||
| Protein | mer | (Da) | (%) | protein) | P | N | pI | AI | H | SI | TAS | HphoAS | HphiAS | NCP | NCT |
| T22-GFP- | 269 | 30691.5 | 100 | 13.76 (PBS) | 36 | 34 | 8.12 | 66.99 | -0.71 | 34.18 | 16039 | 8828 | 7212 | 3 | 0 |
| H6 | 22.8 (Tris) | (stable) | |||||||||||||
| (SEQ ID | |||||||||||||||
| NO: 33) | |||||||||||||||
| V1-GFP- | 272 | 30625.4 | 100 | 12.01 (PBS) | 32 | 35 | 6.62 | 70.92 | -0.653 | 35.85 | 14787 | 8405 | 6382 | -4 | -6 |
| H6 | 12.44 (Tris) | (stable) | |||||||||||||
| (SEQ ID | |||||||||||||||
| NO: 34) | |||||||||||||||
| vCCL2- | 321 | 36172 | 100 | 17.15 (PBS) | 40 | 37 | 8.38 | 73.74 | -0.585 | 34.89 | 24780 | 15428 | 9353 | 2 | 1 |
| GFP-H6 | 11.57 (Tris) | (stable) | |||||||||||||
| (SEQ ID | |||||||||||||||
| NO: 35) | |||||||||||||||
| CXCL12- | 318 | 36034.8 | 5.33 | 27.4 (PBS) | 40 | 38 | 8.11 | 77.52 | -0.58 | 29.85 | 17806 | 10007 | 7799 | 0 | 0 |
| GFP-H6 | 14.32 (Tris) | (stable) | |||||||||||||
| (SEQ ID | |||||||||||||||
| NO: 36) | |||||||||||||||
| S: Solubility; SF: Specific fluorescence; P: Positively charged amino acids; N: Negatively charged amino acids; pI: Isolelectric point; AI: Aliphatic index; H: Hidrophobicity; SI: Stability index; TAS: Total accessibility to solvent; HphoAS: Hydrophobic accessibility to solvent; HphiAS: Hydrophilic accessibility to solvent; NCP: Net charge in PBS (pH = 7.4); NCT: Net charge in Tris (pH = 8) | |||||||||||||||
Claims (11)
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US17/026,543 US11590198B2 (en) | 2011-01-13 | 2020-09-21 | Methods and reagents for efficient and targeted delivery of therapeutic molecules to CXCR4 cells |
Applications Claiming Priority (8)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP11382005 | 2011-01-13 | ||
| EPEP11382005.4 | 2011-01-13 | ||
| EP11382005A EP2476441A1 (en) | 2011-01-13 | 2011-01-13 | Methods and reagents for efficient and targeted delivery of therapeutic molecules to CXCR4 cells |
| PCT/EP2012/050513 WO2012095527A1 (en) | 2011-01-13 | 2012-01-13 | Methods and reagents for efficient and targeted delivery of therapeutic molecules to cxcr4 cells |
| US201313979560A | 2013-11-01 | 2013-11-01 | |
| US15/402,795 US10265371B2 (en) | 2011-01-13 | 2017-01-10 | Methods and reagents for efficient and targeted delivery of therapeutic molecules to CXCR4 cells |
| US16/287,583 US10813975B2 (en) | 2011-01-13 | 2019-02-27 | Methods and reagents for efficient and targeted delivery of therapeutic molecules to CXCR4 cells |
| US17/026,543 US11590198B2 (en) | 2011-01-13 | 2020-09-21 | Methods and reagents for efficient and targeted delivery of therapeutic molecules to CXCR4 cells |
Related Parent Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US16/287,583 Continuation US10813975B2 (en) | 2011-01-13 | 2019-02-27 | Methods and reagents for efficient and targeted delivery of therapeutic molecules to CXCR4 cells |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| US20210008154A1 US20210008154A1 (en) | 2021-01-14 |
| US11590198B2 true US11590198B2 (en) | 2023-02-28 |
Family
ID=43983350
Family Applications (4)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US13/979,560 Active US9580468B2 (en) | 2011-01-13 | 2012-01-13 | Methods and reagents for efficient and targeted delivery of therapeutic molecules to CXCR4 cells |
| US15/402,795 Active US10265371B2 (en) | 2011-01-13 | 2017-01-10 | Methods and reagents for efficient and targeted delivery of therapeutic molecules to CXCR4 cells |
| US16/287,583 Active US10813975B2 (en) | 2011-01-13 | 2019-02-27 | Methods and reagents for efficient and targeted delivery of therapeutic molecules to CXCR4 cells |
| US17/026,543 Active US11590198B2 (en) | 2011-01-13 | 2020-09-21 | Methods and reagents for efficient and targeted delivery of therapeutic molecules to CXCR4 cells |
Family Applications Before (3)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US13/979,560 Active US9580468B2 (en) | 2011-01-13 | 2012-01-13 | Methods and reagents for efficient and targeted delivery of therapeutic molecules to CXCR4 cells |
| US15/402,795 Active US10265371B2 (en) | 2011-01-13 | 2017-01-10 | Methods and reagents for efficient and targeted delivery of therapeutic molecules to CXCR4 cells |
| US16/287,583 Active US10813975B2 (en) | 2011-01-13 | 2019-02-27 | Methods and reagents for efficient and targeted delivery of therapeutic molecules to CXCR4 cells |
Country Status (11)
| Country | Link |
|---|---|
| US (4) | US9580468B2 (en) |
| EP (2) | EP2476441A1 (en) |
| JP (1) | JP2014508515A (en) |
| CN (1) | CN103501818A (en) |
| AU (1) | AU2012206533B2 (en) |
| DK (1) | DK2663336T3 (en) |
| ES (1) | ES2646390T3 (en) |
| IL (1) | IL227442B (en) |
| PL (1) | PL2663336T3 (en) |
| PT (1) | PT2663336T (en) |
| WO (1) | WO2012095527A1 (en) |
Families Citing this family (24)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112851769A (en) | 2014-01-27 | 2021-05-28 | 分子模板公司 | Deimmunized Shiga toxin subunit A effector polypeptides for use in mammals |
| CN103789333B (en) * | 2014-03-05 | 2016-02-24 | 湖北肽洋红生物工程有限公司 | A kind of oral recombination fusion protein TAT-MAP30 and preparation method and application |
| CN106604934A (en) * | 2014-06-11 | 2017-04-26 | 分子模板公司 | Shiga toxin A subunit effector polypeptides resistant to protease cleavage and cell targeting molecules comprising same |
| US9616114B1 (en) | 2014-09-18 | 2017-04-11 | David Gordon Bermudes | Modified bacteria having improved pharmacokinetics and tumor colonization enhancing antitumor activity |
| US10676723B2 (en) | 2015-05-11 | 2020-06-09 | David Gordon Bermudes | Chimeric protein toxins for expression by therapeutic bacteria |
| CN105859841B (en) * | 2016-03-04 | 2019-09-20 | 中山大学 | A dual-target chimeric peptide and its application in the preparation of anti-tumor metastasis drugs |
| CN106086075B (en) * | 2016-06-23 | 2019-08-06 | 福建医科大学 | Construction method of CXCR4RNAi lentiviral vector |
| US11129906B1 (en) | 2016-12-07 | 2021-09-28 | David Gordon Bermudes | Chimeric protein toxins for expression by therapeutic bacteria |
| US11180535B1 (en) | 2016-12-07 | 2021-11-23 | David Gordon Bermudes | Saccharide binding, tumor penetration, and cytotoxic antitumor chimeric peptides from therapeutic bacteria |
| TWI738314B (en) * | 2017-02-21 | 2021-09-01 | 美商庫拉腫瘤技術股份有限公司 | Methods of treating cancer with farnesyltransferase inhibitors |
| CN110997705B (en) * | 2017-05-05 | 2026-04-10 | 巴塞罗那自治大学 | Nanostructured proteins and their applications |
| EP3652196A4 (en) | 2017-07-10 | 2021-08-18 | Brown, Kathlynn, C. | MOLECULAR GUIDANCE SYSTEM PEPTIDES AND THEIR USES |
| JP2020527556A (en) * | 2017-07-10 | 2020-09-10 | エスアールアイ インターナショナルSRI International | Peptide saporin complex for cancer treatment |
| EP3427756A1 (en) * | 2017-07-14 | 2019-01-16 | Universidad Autónoma De Barcelona (UAB) | Therapeutic nanoconjugates and uses thereof |
| CN107325187B (en) * | 2017-07-19 | 2021-11-09 | 黄子为 | Polypeptide with CXCR4 protein agonistic activity and application and pharmaceutical composition thereof |
| US10639379B2 (en) * | 2017-09-05 | 2020-05-05 | Mainline Biosciences Llc | High affinity CXCR4 selective binding conjugate and method for using the same |
| EP3856224A4 (en) * | 2018-09-25 | 2022-07-06 | Emory University | NUCLEIC ACIDS FOR RECOGNITION AND INTEGRATION OF CELLS |
| CN113677705A (en) * | 2019-03-04 | 2021-11-19 | 南通壹宸生物医药科技有限公司 | Novel bispecific binding molecules and drug conjugates thereof |
| BR112021019405A2 (en) * | 2019-04-01 | 2021-11-30 | Cytodyn Inc | Anti-ccr5 agents and treatment methods that block cancer metastasis or enhance DNA-damaging chemotherapy-induced cell death |
| EP3722255A1 (en) * | 2019-04-11 | 2020-10-14 | Universitat Autònoma De Barcelona | Protein nano- or microparticles as artificial inclusion bodies |
| CN113950332A (en) * | 2019-04-11 | 2022-01-18 | 巴塞罗那自治大学 | Protein nanoparticles or microparticles as artificial inclusion bodies |
| EP3842452A1 (en) * | 2019-12-26 | 2021-06-30 | Universitat Autònoma de Barcelona | Scaffold proteins and therapeutic nanoconjugates based on nidogen |
| WO2023133422A1 (en) * | 2022-01-04 | 2023-07-13 | The Broad Institute, Inc. | Compositions and methods for delivering cargo to a target cell |
| CN118252937B (en) * | 2024-04-07 | 2024-10-22 | 中山大学 | Application of CXCR4 receptor antagonists in the prevention of Ebola virus infection |
Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0513613B1 (en) | 1991-05-02 | 1994-11-09 | Seikagaku Kogyo Kabushiki Kaisha | Novel polypeptides with affinity to lipopolysaccharides and their uses |
| US20020102265A1 (en) | 2000-06-30 | 2002-08-01 | Hong Frank D. | Isolation of a cell-specific internalizing peptide that infiltrates tumor tissue for targeted drug delivery |
| US20040132642A1 (en) | 2002-11-12 | 2004-07-08 | Government Of The U.S.A., Represented By The Secretary, Dept. Of Health & Human Services | Methods of inhibiting metastasis or growth of a tumor cell |
| WO2006029078A2 (en) | 2004-09-07 | 2006-03-16 | The Regents Of The University Of California | Targeting transducible molecules to specific cell types |
| US20090099060A1 (en) | 2004-01-15 | 2009-04-16 | Bondarev Igor E | Modulation of line-1 reverse transcriptase |
| WO2009046834A2 (en) | 2007-09-11 | 2009-04-16 | Mondobiotech Laboratories Ag | Use of a peptide as a therapeutic agent |
| US20120064142A1 (en) | 2008-11-30 | 2012-03-15 | University Of The Witwatersrand, Johannesburg | Polymeric pharmaceutical dosage form in sustained release |
| US8394758B2 (en) | 2008-10-29 | 2013-03-12 | Academia Sinica | Tumor-targeting peptides and uses thereof |
Family Cites Families (17)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5190931A (en) | 1983-10-20 | 1993-03-02 | The Research Foundation Of State University Of New York | Regulation of gene expression by employing translational inhibition of MRNA utilizing interfering complementary MRNA |
| US5082927A (en) | 1986-09-24 | 1992-01-21 | The United States Of America As Represented By The Department Of Health And Human Services | Selectively cytotoxic IL-4-PE40 fusion protein |
| US5176996A (en) | 1988-12-20 | 1993-01-05 | Baylor College Of Medicine | Method for making synthetic oligonucleotides which bind specifically to target sites on duplex DNA molecules, by forming a colinear triplex, the synthetic oligonucleotides and methods of use |
| US5087617A (en) | 1989-02-15 | 1992-02-11 | Board Of Regents, The University Of Texas System | Methods and compositions for treatment of cancer using oligonucleotides |
| US5168053A (en) | 1989-03-24 | 1992-12-01 | Yale University | Cleavage of targeted RNA by RNAase P |
| US5135917A (en) | 1990-07-12 | 1992-08-04 | Nova Pharmaceutical Corporation | Interleukin receptor expression inhibiting antisense oligonucleotides |
| US5622958A (en) | 1994-12-01 | 1997-04-22 | Sloan-Kettering Institute For Cancer Research | Enediyne quinone imines and methods of preparation and use thereof |
| AU763325B2 (en) | 1998-01-15 | 2003-07-17 | King's College London | Ribozymal nucleic acids cleaving CCR5 or CXCR4 |
| US6429308B1 (en) | 1998-11-24 | 2002-08-06 | Hisamitsu Pharmaceutical Co., Inc. | HIV infection inhibitors |
| US20050124569A1 (en) | 2001-05-18 | 2005-06-09 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of CXCR4 gene expression using short interfering nucleic acid (siNA) |
| JP2006524242A (en) | 2003-03-27 | 2006-10-26 | エモリー ユニバーシティー | CXCR4 antagonists and methods of their use |
| JP2009519715A (en) | 2005-12-16 | 2009-05-21 | ザ ユーエービー リサーチ ファウンデーション | Compositions and methods for controlled gene expression using viral vectors |
| WO2007115376A1 (en) | 2006-04-11 | 2007-10-18 | The University Of Western Australia | Anti-angiogenic agents and methods of their use |
| TW200808328A (en) | 2006-06-02 | 2008-02-16 | Alcon Mfg Ltd | RNAi-mediated inhibition of stromal cell-derived factor 1-related targets for treatment of neovascularization-related conditions |
| WO2008008852A2 (en) | 2006-07-11 | 2008-01-17 | Emory University | Cxcr4 antagonists including heteroatoms for the treatment of medical disorders |
| WO2008124483A1 (en) | 2007-04-04 | 2008-10-16 | Specigen, Inc. | Protein cage immunotherapeutics |
| US7908940B2 (en) | 2008-03-24 | 2011-03-22 | Shimano Inc. | Bar end electric shifter |
-
2011
- 2011-01-13 EP EP11382005A patent/EP2476441A1/en not_active Withdrawn
-
2012
- 2012-01-13 DK DK12704711.6T patent/DK2663336T3/en active
- 2012-01-13 PL PL12704711T patent/PL2663336T3/en unknown
- 2012-01-13 PT PT127047116T patent/PT2663336T/en unknown
- 2012-01-13 US US13/979,560 patent/US9580468B2/en active Active
- 2012-01-13 EP EP12704711.6A patent/EP2663336B1/en active Active
- 2012-01-13 JP JP2013548853A patent/JP2014508515A/en active Pending
- 2012-01-13 AU AU2012206533A patent/AU2012206533B2/en active Active
- 2012-01-13 CN CN201280011605.XA patent/CN103501818A/en active Pending
- 2012-01-13 ES ES12704711.6T patent/ES2646390T3/en active Active
- 2012-01-13 WO PCT/EP2012/050513 patent/WO2012095527A1/en not_active Ceased
-
2013
- 2013-07-11 IL IL227442A patent/IL227442B/en active IP Right Grant
-
2017
- 2017-01-10 US US15/402,795 patent/US10265371B2/en active Active
-
2019
- 2019-02-27 US US16/287,583 patent/US10813975B2/en active Active
-
2020
- 2020-09-21 US US17/026,543 patent/US11590198B2/en active Active
Patent Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0513613B1 (en) | 1991-05-02 | 1994-11-09 | Seikagaku Kogyo Kabushiki Kaisha | Novel polypeptides with affinity to lipopolysaccharides and their uses |
| US20020102265A1 (en) | 2000-06-30 | 2002-08-01 | Hong Frank D. | Isolation of a cell-specific internalizing peptide that infiltrates tumor tissue for targeted drug delivery |
| US20040132642A1 (en) | 2002-11-12 | 2004-07-08 | Government Of The U.S.A., Represented By The Secretary, Dept. Of Health & Human Services | Methods of inhibiting metastasis or growth of a tumor cell |
| US20090099060A1 (en) | 2004-01-15 | 2009-04-16 | Bondarev Igor E | Modulation of line-1 reverse transcriptase |
| WO2006029078A2 (en) | 2004-09-07 | 2006-03-16 | The Regents Of The University Of California | Targeting transducible molecules to specific cell types |
| WO2009046834A2 (en) | 2007-09-11 | 2009-04-16 | Mondobiotech Laboratories Ag | Use of a peptide as a therapeutic agent |
| US8394758B2 (en) | 2008-10-29 | 2013-03-12 | Academia Sinica | Tumor-targeting peptides and uses thereof |
| US20120064142A1 (en) | 2008-11-30 | 2012-03-15 | University Of The Witwatersrand, Johannesburg | Polymeric pharmaceutical dosage form in sustained release |
Non-Patent Citations (17)
Also Published As
| Publication number | Publication date |
|---|---|
| US9580468B2 (en) | 2017-02-28 |
| EP2663336A1 (en) | 2013-11-20 |
| US20140094404A1 (en) | 2014-04-03 |
| ES2646390T3 (en) | 2017-12-13 |
| AU2012206533A1 (en) | 2013-08-01 |
| EP2476441A1 (en) | 2012-07-18 |
| US20190183968A1 (en) | 2019-06-20 |
| JP2014508515A (en) | 2014-04-10 |
| PL2663336T3 (en) | 2018-01-31 |
| EP2663336B1 (en) | 2017-08-09 |
| PT2663336T (en) | 2017-11-15 |
| IL227442B (en) | 2018-05-31 |
| IL227442A0 (en) | 2013-09-30 |
| AU2012206533B2 (en) | 2017-08-31 |
| CN103501818A (en) | 2014-01-08 |
| US20210008154A1 (en) | 2021-01-14 |
| US20170209590A1 (en) | 2017-07-27 |
| DK2663336T3 (en) | 2017-11-27 |
| US10265371B2 (en) | 2019-04-23 |
| US10813975B2 (en) | 2020-10-27 |
| WO2012095527A1 (en) | 2012-07-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11590198B2 (en) | Methods and reagents for efficient and targeted delivery of therapeutic molecules to CXCR4 cells | |
| JP7390748B2 (en) | conditionally active polypeptide | |
| WO2022165262A1 (en) | Compositions and methods for delivering cargo to a target cell | |
| JP2022095641A (en) | Conditionally active polypeptide and method for producing it | |
| US20250243250A1 (en) | Therapeutic nanoconjugates and uses thereof | |
| TWI377954B (en) | Oil body carriers, uses in target therapy and/or detection of the same, and fusion proteins comprised therein | |
| US20250073350A1 (en) | Compositions and methods for delivering cargo to a target cell | |
| EP3842452A1 (en) | Scaffold proteins and therapeutic nanoconjugates based on nidogen | |
| KR101253261B1 (en) | Recombinant protein for siRNA delivery and composition comprising the same | |
| KR20230112691A (en) | Methods and compositions for treating viral infections | |
| KR20220117091A (en) | An Expression cassette encoding a polypeptide of interest synthesized and secreted from cells in vivo and penetrating into cells, and uses thereof | |
| KR101430232B1 (en) | p19-YSA Recombinant protein for intracellular delivery of siRNA and composition comprising the same | |
| KR102603739B1 (en) | A Composition for Cancer-Specific Delivery of Nucleic Acid Molecules and Use Thereof | |
| Yang et al. | Targeted inhibition of hantavirus replication and intracranial pathogenesis by a chimeric protein-delivered siRNA | |
| Yalcinkaya et al. | Investigation of LL-37-mediated siRNA transfection | |
| Muzakki et al. | The Potential of Chitosan Nanoparticles as a Delivery System for the Expression of Dengue Virus' rE Gene with pEGFP-N1 Vector in HeLa Cells | |
| HK40013352B (en) | Cytoplasmic transduction peptide and intracellular messenger comprising same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| FEPP | Fee payment procedure |
Free format text: ENTITY STATUS SET TO UNDISCOUNTED (ORIGINAL EVENT CODE: BIG.); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY |
|
| AS | Assignment |
Owner name: UNIVERSITAT AUTONOMA DE BARCELONA, SPAIN Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:VILLAVERDE CORRALES, ANTONIO PEDRO;VAZQUEZ GOMEZ, ESTHER;FERRER MIRALLES, NEUS;AND OTHERS;REEL/FRAME:053846/0256 Effective date: 20130729 Owner name: INSTITUT RECERCA HOSPITAL DE LA SANTA CREU I SANT PAU, SRI LANKA Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:MANGUES BAFALLUY, RAMON;REEL/FRAME:053846/0366 Effective date: 20130801 Owner name: CENTRO DE INVESTIGACION BIOMEDICA EN RED EN BIOINGENIERIA BIOMATERIALES Y NANOMEDICINA (CIBER BBN), SPAIN Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:CESPEDES NAVARRO, MARIA VIRTUDES;CASANOVA RIGAT, ISOLDA;REEL/FRAME:053846/0658 Effective date: 20130801 |
|
| FEPP | Fee payment procedure |
Free format text: ENTITY STATUS SET TO SMALL (ORIGINAL EVENT CODE: SMAL); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: APPLICATION DISPATCHED FROM PREEXAM, NOT YET DOCKETED |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: NON FINAL ACTION MAILED |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: RESPONSE TO NON-FINAL OFFICE ACTION ENTERED AND FORWARDED TO EXAMINER |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: NON FINAL ACTION MAILED |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: RESPONSE TO NON-FINAL OFFICE ACTION ENTERED AND FORWARDED TO EXAMINER |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: FINAL REJECTION MAILED |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: RESPONSE AFTER FINAL ACTION FORWARDED TO EXAMINER |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: NOTICE OF ALLOWANCE MAILED -- APPLICATION RECEIVED IN OFFICE OF PUBLICATIONS |
|
| STCF | Information on status: patent grant |
Free format text: PATENTED CASE |