US11427874B1

US11427874B1 - Methods and systems for detection of prostate cancer by DNA methylation analysis

Info

Publication number: US11427874B1
Application number: US16/995,180
Authority: US
Inventors: Fang Fang; Neng Yang
Original assignee: Epi One Inc
Current assignee: Epi One Inc
Priority date: 2019-08-26
Filing date: 2020-08-17
Publication date: 2022-08-30
Anticipated expiration: 2040-08-17

Abstract

The present disclosure provides methods and systems directed to detection of prostate cancer. A method for processing or analyzing DNA molecules from a biological sample of a subject may comprise processing (a) providing a first set of DNA fragments derived from a first portion of the DNA molecules upon subjecting the first portion to CpG site fragmentation conditions; (b) providing a second set of DNA fragments derived from a second portion of the DNA molecules, the second portion not subjected to fragmentation conditions; (c) for a genomic region, processing the first and the second sets of DNA fragments or derivatives thereof to yield first and second quantitative measures of DNA methylation; and (d) processing the first quantitative measure with the second quantitative measure to yield a third quantitative measure of DNA methylation at the genomic region, thereby generating a methylation profile of the DNA molecules at the genomic region.

Description

CROSS-REFERENCE

This application claims the benefit of U.S. Provisional Patent Application No. 62/891,673, filed Aug. 26, 2019, which is incorporated by reference herein in its entirety. INCORPORATION BY REFERENCE OF SEQUENCE LISTING PROVIDED AS A TEXT FILE

A Sequence Listing is provided herewith as a text file, “55223-701_201_SL.txt” created on Feb. 9, 2022, and having a size of 87,479 bytes. The contents of the text file are hereby incorporated by reference herein in their entirety.

BACKGROUND

Prostate cancer is the second most common form of cancer in men worldwide, accounting for about 15% of the cancers diagnosed in men. Currently, the only available blood molecular screening method for prostate cancer is a prostate-specific antigen (PSA) test, which aims to detect prostate cancer at an early stage when the disease is amenable to curative treatment and reduce the overall disease-specific mortality. However, PSA is not a cancer-specific biomarker, and its level often increases abnormally in prostate-benign patients. Further, only a small minority of men with an elevated PSA level are actually found to have prostate cancer when a biopsy is performed. Therefore, there is scant evidence to establish that PSA screening for prostate cancer can save lives. Currently, biopsy is the only method for prostate cancer diagnosis, but high false negative rates of biopsy can leads significant percentages of men remaining undiagnosed after the first biopsy. Further, marker of prostate cancer such as the tumor stage, Gleason score, and PSA level cannot accurately identify the individuals ultimately failing of a treatment. Thus, there is an urgent need to develop high performance assays with panels of good biomarkers for tissue and blood tests to reduce the need for repeated biopsies for prostate cancer diagnosis and to monitor treated patients for recurrence and metastasis.

SUMMARY

The present disclosure provides methods, systems, and kits for detecting prostate cancers by processing nucleic acids from biological samples (e.g., tissue samples and/or bodily fluid samples) obtained from or derived from a subject. Biological samples obtained from subjects may be analyzed to measure a presence, absence, or relative assessment of the prostate cancer. The analysis may be performed at a set of genomic regions, such as a panel of DNA methylation biomarker regions. The subjects may include subjects with prostate cancer (e.g., prostate cancer patients) and subjects without prostate cancer (e.g., normal or healthy controls).

In an aspect, the present disclosure provides a method for processing or analyzing a plurality of deoxyribonucleic (DNA) molecules from a biological sample of a subject, comprising: (a) providing a first set of DNA fragments derived from a first portion of said plurality of DNA molecules upon subjecting said first portion of said plurality of DNA molecules to fragmentation conditions sufficient to fragment at least a subset of said first portion of said plurality of DNA molecules at one or more CpG sites, wherein at least a subset of said first set of DNA fragments comprises methylated nucleic acid bases; (b) providing a second set of DNA fragments derived from a second portion of said plurality of DNA molecules, wherein said second portion of said plurality of DNA molecules is not subjected to fragmentation conditions; (c) for a genomic region, processing (i) said first set of DNA fragments or derivatives thereof to yield a first quantitative measure of DNA methylation and (ii) said second set of DNA fragments or derivatives thereof to yield a second quantitative measure of DNA methylation; and (d) processing said first quantitative measure with said second quantitative measure to yield a third quantitative measure of DNA methylation at said genomic region, thereby generating a methylation profile of said plurality of DNA molecules at said genomic region.

In some embodiments, said biological sample is obtained or derived from a tissue sample, a blood sample, a plasma sample, a serum sample, an exosome sample, a urine sample, a sweat sample, or a saliva sample.

In some embodiments, the method further comprises performing an assay selected from the group consisting of methylation-sensitive restriction enzyme (MSRE) digestion, polymerase chain reaction (PCR), quantitative PCR (qPCR), nucleic acid sequencing, target capture, mass spectrometry-based target fragmentation assay, flap endonuclease-based assay, CRISPR-based assay, methylation-specific assay comprising bisulfite treatment, methylation-specific PCR, targeted sequencing, targeted bisulfite sequencing, pyrosequencing, mass spectroscopy-based bisulfite sequencing (EpiTYPER), reduced representation bisulfite sequence (RRBS), whole genome sequencing (WGS), and a combination thereof.

In some embodiments, said fragmentation conditions comprise MSRE digestion of said first portion of said plurality of DNA molecules to fragment said at least said subset of said first portion of said plurality of DNA molecules at said one or more CpG sites. In some embodiments, said MSRE is selected from the group consisting of AatII, Acc65I, AccI, Acil, ACII, Afel, Agel, Apal, ApaLI, AscI, AsiSI, Aval, AvaII, Aox I, BaeI, BanI, BbeI, BceAI, BegI, BfuCI, BglI, BisI, BisI, BmgBI, BsaAI, BsaBI, BsaHI, BsaI, BseYI, BsiEI, BsiWI, BslI, BsmAI, BsmBI, BsmFI, BspDI, BsrBI, BsrFI, BssHII, BssKI, BstAPI, BstBI, BstUI, BstZl7I, Cac8I, ClaI, DpnI, DrdI, EaeI, EagI, Eagl-IF, EciI, EcoRI, EcoRI-HF, FauI, Fnu4HI, FseI, FspI, Gla I, Glu I, HaeII, HgaI, HhaI, HincII, HincII, Hinfl, HinPlI, HpaI, HpaII, Hpyl66ii, Hpyl88iii, Hpy99I, HpyCH4IV, KasI, Kro I, Mal I, MluI, MmeI, MspAlI, Mte I, MwoI, NaeI, NacI, NgoNIV, Nhe-HFI, NheI, NlaIV, NotI, NotI-HF, NruI, Nt.BbvCI, Nt.BsmAI, Nt.CviPII, PaeR7I, PleI, PmeI, PmlI, Pcs I, Pkr I, PshAI, PspOMI, PvuI, RsaI, RsrII, SacII, Sall, SalI-HF, Sau3AI, Sau96I, ScrFI, SfiI, SfoI, SgrAI, Smal, SnaBI, TfiI, TscI, TseI, TspMI, and ZraI.

In some embodiments, processing said first set of DNA fragments or derivatives thereof in (c) (i) comprises subjecting said first set of DNA fragments or derivatives thereof to amplification, and wherein processing said second set of DNA fragments or derivatives thereof in (c) (ii) comprises subjecting said second set of DNA fragments or derivatives thereof to said amplification. In some embodiments, said amplification comprises targeted quantitative polymerase chain reaction (qPCR) at said genomic region. In some embodiments, processing said first set of DNA fragments or derivatives thereof in (c) (i) comprises determining a first cycle threshold (Ct) value for said amplification of said first set of DNA fragments or derivatives thereof at said genomic region, and wherein processing said second set of DNA fragments or derivatives thereof in (c) (ii) comprises determining a second cycle threshold (Ct) value for said amplification of said second set of DNA fragments or derivatives thereof at said genomic region. In some embodiments, (c) comprises determining a reference Ct value for said amplification of said first set of DNA fragments or derivatives thereof and said second set of DNA fragments or derivatives thereof at a reference genomic region, and normalizing said first quantitative measure and said second quantitative measure using said reference Ct value. In some embodiments, said normalizing comprises subtracting said reference Ct value from said first quantitative measure and said second quantitative measure. In some embodiments, processing said first quantitative measure with said second quantitative measure in (d) comprises calculating an intensity ratio of said first quantitative measure and said second quantitative measure at said genomic region. In some embodiments, calculating said intensity ratio comprises determining a difference between said first quantitative measure and said second quantitative measure at said genomic region. In some embodiments, calculating said intensity ratio comprises determining an exponentiation of a base value and said determined difference at said genomic region. In some embodiments, said base value is 2. In some embodiments, calculating said intensity ratio comprises determining a reciprocal of said determined exponentiation at said genomic region.

In some embodiments, the method further comprises subjecting said first set of DNA fragments and said second set of DNA fragments, or derivatives thereof, to conditions sufficient to permit said methylated nucleic acid bases to be distinguished from unmethylated nucleic acid bases. In some embodiments, subjecting said first set of DNA fragments and said second set of DNA fragments, or derivatives thereof, to said conditions comprises performing bisulfite treatment on first set of DNA fragments and said second set of DNA fragments, or derivatives thereof.

In some embodiments, the method further comprises processing said methylation profile with one or more reference methylation profiles. In some embodiments, said one or more reference methylation profiles are obtained from reference biological samples of one or more additional subjects. In some embodiments, said one or more additional subjects comprise healthy subjects. In some embodiments, said one or more additional subjects comprise subjects having a disease or disorder. In some embodiments, said disease or disorder is a cancer. In some embodiments, said disease or disorder is a cancer selected from the group consisting of pancreatic cancer, liver cancer, lung cancer, colorectal cancer, leukemia, bladder cancer, bone cancer, brain cancer, breast cancer, cervical cancer, endometrial cancer, esophageal cancer, gastric cancer, head and neck cancer, melanoma, ovarian cancer, and prostate cancer. In some embodiments, said cancer is prostate cancer.

In some embodiments, said genomic region comprises one or more CpG sites. In some embodiments, said genomic region comprises a plurality of CpG sites. In some embodiments, said plurality of CpG sites comprises at least about 10 CpG sites.

In some embodiments, said genomic region comprises one or more genes selected from the group consisting of SCGB3A1, ANKDDIB, C5orf49, C9orf3, and GPR75-ASB3. In some embodiments, said genomic region is selected from Table 1, Table 2, or SEQ ID NO:1-SEQ ID NO:276. In some embodiments, said genomic region comprises at least about 10, at least about 20, at least about 30, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 120, at least about 140, at least about 160, at least about 180, at least about 200, at least about 220, at least about 240, or at least about 260 distinct genomic regions selected from Table 1, Table 2, or SEQ ID NO:1-SEQ ID NO:276. In some embodiments, said genomic region is selected from Table 2.

In some embodiments, the method further comprises electronically outputting a report indicative of said methylation profile. In some embodiments, the method further comprises processing said methylation profile to generate a likelihood of said subject as having or being suspected of having a disease or disorder. In some embodiments, said disease or disorder is a cancer. In some embodiments, said disease or disorder is a cancer selected from the group consisting of pancreatic cancer, liver cancer, lung cancer, colorectal cancer, leukemia, bladder cancer, bone cancer, brain cancer, breast cancer, cervical cancer, endometrial cancer, esophageal cancer, gastric cancer, head and neck cancer, melanoma, ovarian cancer, and prostate cancer. In some embodiments, said cancer is prostate cancer.

In some embodiments, said likelihood is generated with a sensitivity of at least about 80%. In some embodiments, said likelihood is generated with a sensitivity of at least about 90%. In some embodiments, said likelihood is generated with a specificity of at least about 90%. In some embodiments, said likelihood is generated with a specificity of at least about 95%. In some embodiments, said likelihood is generated with an accuracy of at least about 90%. In some embodiments, said likelihood is generated with an accuracy of at least about 95%. In some embodiments, said likelihood is generated with an area under the curve (AUC) of at least about 0.90.

In some embodiments, said first set of DNA fragments and said second set of DNA fragments each comprises a first amount of external DNA molecules, wherein said external DNA molecules do not contain CpG sites.

In another aspect, the present disclosure provides a method for processing or analyzing a plurality of deoxyribonucleic (DNA) molecules from a biological sample of a subject, comprising: (a) providing a first set of DNA fragments derived from a first portion of said plurality of DNA molecules upon subjecting said first portion of said plurality of DNA molecules to fragmentation conditions sufficient to fragment at least a subset of said first portion of said plurality of DNA molecules at one or more CpG sites, wherein at least a subset of said first set of DNA fragments comprises methylated nucleic acid bases; (b) providing a second set of DNA fragments derived from a second portion of said plurality of DNA molecules, wherein said second portion has a substantially equal amount of DNA as said first portion; (c) for a genomic region, processing (i) said first set of DNA fragments or derivatives thereof to yield a first quantitative measure of DNA methylation and (ii) said second set of DNA fragments or derivatives thereof to yield a second quantitative measure of DNA methylation; and (d) processing said first quantitative measure with said second quantitative measure to yield a third quantitative measure of DNA methylation at said genomic region, thereby generating a methylation profile of said plurality of DNA molecules at said genomic region.

In some embodiments, said fragmentation conditions comprise MSRE digestion of said first portion of said plurality of DNA molecules to fragment said at least said subset of said first portion of said plurality of DNA molecules at said one or more CpG sites. In some embodiments, said MSRE is selected from the group consisting of AatII, Acc65I, AccI, Acil, ACII, Afel, Agel, Apal, ApaLI, AscI, AsiSI, Aval, AvaII, Aox I, BaeI, BanI, BbeI, BceAI, BcgI, BfuCI, BglI, BisI, BlsI, BmgBI, BsaAI, BsaBI, BsaHI, BsaI, BseYI, BsiEI, BsiWI, BslI, BsmAI, BsmBI, BsmFI, BspDI, BsrBI, BsrFI, BssHII, BssKI, BstAPI, BstBI, BstUI, BstZl7I, Cac8I, ClaI, DpnI, DrdI, EaeI, EagI, Eagl-IF, EciI, EcoRI, EcoRI-HF, FauI, Fnu4HI, FseI, FspI, Gla I, Glu I, HaeII, HgaI, HhaI, HincII, HincII, Hinfl, HinPlI, HpaI, HpaII, Hpyl66ii, Hpyl88iii, Hpy99I, HpyCH4IV, KasI, Kro I, Mal I, MluI, MmeI, MspAlI, Mte I, MwoI, NaeI, NacI, NgoNIV, Nhe-HFI, NheI, NlaIV, NotI, NotI-HF, NruI, Nt.BbvCI, Nt.BsmAI, Nt.CviPII, PaeR7I, PleI, PmeI, PmlI, Pcs I, Pkr I, PshAI, PspOMI, PvuI, RsaI, RsrII, SacII, Sall, SalI-HF, Sau3AI, Sau96I, ScrFI, SfiI, SfoI, SgrAI, Smal, SnaBI, TfiI, TscI, TseI, TspMI, and ZraI.

In another aspect, the present disclosure provides a method for identifying prostate cancer of a subject, comprising: (a) using a methylation assay to process a plurality of deoxyribonucleic acid (DNA) molecules from a biological sample of the subject to determine quantitative measures of methylation at each of one or more genes, thereby generating a DNA methylation signature of said biological sample of said subject, wherein said one or more genes comprise genes selected from the group consisting of SCGB3A1, ANKDD1B, C5orf49, C9orf3, and GPR75-ASB3; (b) comparing said DNA methylation signature with one or more reference DNA methylation signatures; and (c) based at least in part on the comparing in (b), identifying the prostate cancer of said subject.

In some embodiments, said biological sample is obtained or derived from a tissue sample, a blood sample, or a urine sample.

In some embodiments, said methylation assay comprises one or more assays selected from the group consisting of: methylation-sensitive restriction enzyme (MSRE) digestion, polymerase chain reaction (PCR), quantitative PCR (qPCR), nucleic acid sequencing, target capture, mass spectrometry-based target fragmentation assay, flap endonuclease-based assay, CRISPR-based assay, methylation-specific assay comprising bisulfite treatment, methylation-specific PCR, targeted sequencing, targeted bisulfite sequencing, pyrosequencing, mass spectroscopy-based bisulfite sequencing (EpiTYPER), reduced representation bisulfite sequence (RRBS), whole genome sequencing (WGS), and a combination thereof.

Another aspect of the present disclosure provides a non-transitory computer readable medium comprising machine executable code that, upon execution by one or more computer processors, implements any of the methods above or elsewhere herein.

Another aspect of the present disclosure provides a system comprising one or more computer processors and computer memory coupled thereto. The computer memory comprises machine executable code that, upon execution by the one or more computer processors, implements any of the methods above or elsewhere herein.

Additional aspects and advantages of the present disclosure will become readily apparent to those skilled in this art from the following detailed description, wherein only illustrative embodiments of the present disclosure are shown and described. As will be realized, the present disclosure is capable of other and different embodiments, and its several details are capable of modifications in various obvious respects, all without departing from the disclosure. Accordingly, the drawings and description are to be regarded as illustrative in nature, and not as restrictive.

INCORPORATION BY REFERENCE

All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. To the extent publications and patents or patent applications incorporated by reference contradict the disclosure contained in the specification, the specification is intended to supersede and/or take precedence over any such contradictory material.

BRIEF DESCRIPTION OF THE DRAWINGS

The novel features of the invention are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present invention will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the invention are utilized, and the accompanying drawings (also “Figure” and “FIG.” herein), of which:

FIG. 1 illustrates a flow-chart for a method 100 of prostate cancer identification in a subject, in accordance with disclosed embodiments.

FIGS. 2A and 2B illustrate an example of quantitative polymerase chain reaction (qPCR) amplification plots for a control locus and two restriction loci tested in a healthy (prostate normal) sample (“N1-digested” and “N1-undigested”) and a prostate cancer sample (“T1-digested” and “T1-undigested”), respectively, in accordance with disclosed embodiments.

FIGS. 3A-3E illustrate receiver operating characteristic (ROC) plots with area under the ROC (AUC) values for the top 5 target genes C5orf49 (AUC=0.9428), GPR75-ASB3 (AUC=0.883), ANKDD18 (AUC=0.9098), SCGB3A1 (AUC=0.9238), and C9orf3 (AUC=0.9212), respectively, in accordance with disclosed embodiments.

FIG. 4 illustrates a computer system that is programmed or otherwise configured to implement methods provided herein.

DETAILED DESCRIPTION

While various embodiments of the invention have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions may occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein may be employed.

As used in the specification and claims, the singular form “a,” “an,” and “the” include plural references unless the context clearly dictates otherwise. For example, the term “a nucleic acid” includes a plurality of nucleic acids, including mixtures thereof.

As used herein, the term “nucleic acid” generally refers to a polymeric form of nucleotides of any length, either deoxyribonucleotides (dNTPs) or ribonucleotides (rNTPs), or analogs thereof. Nucleic acids may have any three-dimensional structure, and may perform any function, known or unknown. Non-limiting examples of nucleic acids include DNA, RNA, coding or non-coding regions of a gene or gene fragment, loci (locus) defined from linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, short interfering RNA (siRNA), short-hairpin RNA (shRNA), micro-RNA (miRNA), ribozymes, cDNA, recombinant nucleic acids, branched nucleic acids, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. A nucleic acid may comprise one or more modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure may be made before or after assembly of the nucleic acid. The sequence of nucleotides of a nucleic acid may be interrupted by non-nucleotide components. A nucleic acid may be further modified after polymerization, such as by conjugation or binding with a reporter agent.

As used herein, the term “target nucleic acid” generally refers to a nucleic acid molecule in a starting population of nucleic acid molecules having a nucleotide sequence whose presence, amount, and/or sequence, or changes in one or more of these, are desired to be determined. A target nucleic acid may be any type of nucleic acid, including DNA, RNA, and analogs thereof. As used herein, a “target ribonucleic acid (RNA)” generally refers to a target nucleic acid that is RNA. As used herein, a “target deoxyribonucleic acid (DNA)” generally refers to a target nucleic acid that is DNA.

As used herein, the term “target” generally refers to a genomic region within a marker gene or marker region. As used herein, the term “reference” generally refers to a sample obtained or derived from a subject who is diagnosed with prostate cancer (prostate cancer patient) or who has received a negative clinical indication of prostate cancer (e.g., a healthy or control subject without prostate cancer).

As used herein, the terms “locus” or “region” are generally interchangeable and refer to a specific genomic region on the genome represented by chromosome number, start position, and end position.

As used herein, the term “subject,” generally refers to an entity or a medium that has testable or detectable genetic information. A subject can be a person or individual, such as a patient. A subject can be a vertebrate, such as, for example, a mammal. Non-limiting examples of mammals include murines, simians, humans, farm animals, sport animals, and pets.

As used herein, the term “sample” generally refers to a bodily sample or part(s) of a subject, which is obtained and analyzed to measure or to determine the character of the whole, such as a specimen of tissue, blood, or urine.

As used herein, the term “tumor suppression genes” generally refers to a group of genes directing the production of the protein that regulates cell division. The tumor suppressor protein can play a role in keeping cell division in check. When mutated, a tumor suppressor gene may become unable to control cell division and lead to uncontrolled cell growth, an important mechanism in tumorigenesis.

As used herein, the term “biomarker” generally refers to any substance, structure, or process that can be measured in a subject's body or its products and be used to influence or predict a clinical outcome or disease with or without treatment, select an appropriate treatment (or predict whether treatment would be effective), or monitor a current treatment and potentially change the treatment.

As used herein, the term “methylation” refers to 5-methyl cytosine (5mc) or 5-hydroxymethylcytosine (5hmC), including cytosine residues that are part of the sequence CG, also denoted as CpG dinucleotides (cytosine residues that are part of other sequences are not methylated). Some CG dinucleotides in the human genome are methylated, and others are not. In addition, methylation can be cell-specific and tissue-specific, such that a specific CG dinucleotide can be methylated in a certain cell and at the same time unmethylated in a different cell, or methylated in a certain tissue and at the same time unmethylated in different tissues. DNA methylation can be an important regulator of gene transcription. Aberrant DNA methylation patterns, both hypermethylation and hypomethylation, as compared to normal tissue, may be associated with a large number of human malignancies. In some embodiments, 5hmC residues of a sequence may be subjected to glucosylation prior to subsequent bisulfite treatment and MSRE digestion. For example, the glucosylation may be performed using a glucosyltransferase.

As used herein, the terms “methylation state,” “methylation status,” and “methylation profile” generally refer to the presence of absence of one or more methylated nucleotide bases in the nucleic acid molecule. For example, a nucleic acid molecule (e.g., DNA molecule) containing a methylated cytosine is considered methylated (e.g., the methylation state of the nucleic acid molecule is methylated). A nucleic acid molecule that does not contain any methylated nucleotides is considered unmethylated.

As used herein, the term “bisulfite treatment” generally refers to the treatment of DNA with bisulfite that converts cytosine residues to uracil residues, but leaves 5-methylcytosine residues unaffected. Therefore, DNA that has been treated with bisulfite may retain only methylated cytosines.

As used herein, the term “pyrosequencing” generally refers to a sequencing-by-synthesis method that quantitatively monitors the real-time incorporation of nucleotides through the enzymatic conversion of released pyrophosphate into a proportional light signal. Analysis of DNA methylation patterns by pyrosequencing may combine a simple reaction protocol with reproducible and accurate measures of the degree of methylation at several CpGs in close proximity with high quantitative resolution. After bisulfite treatment and PCR, the degree of each methylation at each CpG position in a sequence may be determined from the ratio of T and C. The process of purification and sequencing can be repeated for the same template to analyze other CpGs in the same amplification product.

As used herein, the terms “amplifying” and “amplification” are used interchangeably and generally refer to generating one or more copies or “amplified product” of a nucleic acid. The term “DNA amplification” generally refers to generating one or more copies of a DNA molecule or “amplified DNA product.” The term “reverse transcription amplification” generally refers to the generation of deoxyribonucleic acid (DNA) from a ribonucleic acid (RNA) template via the action of a reverse transcriptase. Amplification may be performed by polymerase chain reaction (PCR), which is based on using DNA polymerase to synthesize new strands of DNA complementary to the initial template strands.

As used herein, the term “polymerase chain reaction (PCR)” generally refers to a method for increasing the concentration of a segment of a target sequence in a mixture of genomic DNA without cloning or purification. This process for amplifying the target sequence may comprise introducing a large excess of two oligonucleotide primers to the DNA mixture containing the desired target sequence, followed by a precise sequence of thermal cycling in the presence of a DNA polymerase. The two primers may be complementary to their respective strands of the double-stranded target sequence. To perform amplification, the mixture may be denatured and the primers may be annealed to their complementary sequences within the target molecule. Following annealing, the primers may be extended with a polymerase so as to form a new pair of complementary strands. The steps of denaturation, primer annealing, and polymerase extension can be repeated many times (e.g., denaturation, annealing and extension constitute one “cycle”; there can be numerous “cycles”) to obtain a high concentration of an amplified segment of the desired target sequence. The length of the amplified segment of the desired target sequence may be determined by the relative positions of the primers with respect to each other, and therefore, this length is a controllable parameter. By virtue of the repeating aspect of the process, the method is referred to as “polymerase chain reaction” (PCR). Because the desired amplified segments of the target sequence become the predominant sequences (in terms of concentration) in the mixture, they are said to be “PCR amplified” and are “PCR products” or “amplicons.”

As used herein, the term “DNA template” generally refers to the sample DNA that contains the target sequence. At the beginning of the reaction, high temperature is applied to the original double-stranded DNA molecule to separate the strands from each other.

As used herein, the term “primer” generally refers to a short piece of single-stranded DNA that are complementary to the DNA template. The polymerase begins synthesizing new DNA from the end of the primer.

As used herein, the term “Ct value” generally refers to the number of cycles required for the fluorescent signal to cross a given cycle threshold (e.g., at which the signal exceeds a background level). Ct levels may be inversely proportional to the amount of target nucleic acid in a sample (e.g., the lower the Ct level of a given sample, the greater the amount of target nucleic acid in the sample).

As used herein, the term “restriction enzyme” generally refers to an enzyme that cuts DNA at or near specific recognition nucleotide sequences (e.g., restriction sites).

As used herein, the term “methylation-sensitive” restriction enzyme (MSRE) generally refers to a restriction endonuclease that cleaves its recognition sequence only if it is unmethylated (leaving methylated sites remain intact). The DNA cutting intensity of a “methylation-sensitive” restriction enzyme may depend on the methylation level of the specific sequence, where higher methylation levels lead to less digestion.

As used herein, the term “internal control” generally refers to a sequence from a human genome that does not contain the specific sequences required for methylation-sensitive restriction enzymes to cut.

As used herein, the term “external control” generally refers to a sequence from a non-human genome that does not contain a CG site.

As used herein, the term “methylation-specific PCR (MSP)” generally refers to a tool for qualitative DNA methylation analysis. MSP may have advantages such as ease of design and execution, sensitivity in the ability to detect small quantities of methylated DNA, and the ability to rapidly screen a large number of samples without expensive laboratory equipment. This assay may require modification of the genomic DNA by sodium bisulfite and two independent primer sets for PCR amplification, one pair designed to recognize the methylated versions of the bisulfite-modified sequence and the other pair designed to recognize the unmethylated versions of the bisulfite-modified sequence. The amplicons may be visualized using ethidium bromide staining following agarose gel electrophoresis. Amplicons of the expected size produced from either primer pair may be indicative of the presence of DNA in the original sample with the respective methylation status.

As used herein, the term “reduced representation bisulfite sequencing (RRBS)” generally refers to an efficient and high-throughput technique for analyzing the genome-wide methylation profiles on a single nucleotide level. Reduced representation bisulfite sequencing (RRBS) may combine restriction enzymes and bisulfite sequencing to enrich for areas of the genome with a high CpG content. RRBS can reduce the amount of nucleotides required to sequence to 1% of the genome. The fragments that comprise the reduced genome may still include the majority of promoters, as well as regions such as repeated sequences that are difficult to profile using conventional bisulfite sequencing approaches.

As used herein, the term “targeted (bisulfite) sequencing” generally refers to an accurate, efficient, and economical technology for DNA methylation analysis of target regions, which may include a hybridization-based step on platforms containing pre-designed oligonucleotides (oligos) that capture the CpG islands, gene promoters, and other significant methylated regions, or a PCR-based step to amplify multiple bisulfite-converted DNA regions in a single reaction. Specific primers may be designed to capture the region of interest and evaluate site-specific DNA methylation changes.

As used herein, the term “sensitivity” generally refers to the percentage of a set of samples that report a DNA methylation value above a threshold value that distinguishes between neoplastic (e.g., prostate cancer) and non-neoplastic (e.g., healthy or control) samples. In some embodiments, a positive is defined as a histology-confirmed neoplasia that reports a DNA methylation value above a threshold value (e.g., the range associated with disease), and a false negative is defined as a histology-confirmed neoplasia that reports a DNA methylation value below the threshold value (e.g., the range associated with no disease). The value of sensitivity may reflect the probability that a DNA methylation measurement for a given marker obtained from a diseased sample falls in the range of disease-associated measurements. The clinical relevance of the calculated sensitivity value may represent an estimation of the probability that a given marker can detect or predict the presence of a clinical condition when applied to a subject having the clinical condition.

As used herein, the term “specificity” generally refers to the percentage of non-neoplastic samples that report a DNA methylation value below a threshold value that distinguishes between neoplastic and non-neoplastic samples. In some embodiments, a negative is defined as a histology-confirmed non-neoplastic sample that reports a DNA methylation value below the threshold value (e.g., the range associated with no disease) and a false positive is defined as a histology-confirmed non-neoplastic sample that reports a DNA methylation value above the threshold value (e.g., the range associated with disease). The value of specificity may reflect the probability that a DNA methylation measurement for a given marker obtained from a non-neoplastic (e.g., healthy or control) sample falls in the range of non-disease associated measurements. The clinical relevance of the calculated specificity value may represent an estimation of the probability that a given marker can detect or predict the absence of a clinical condition when applied to a subject not having the clinical condition.

As used herein, the term “AUC” or “AUROC” generally refers to an abbreviation for the area under a Receiver Operating Characteristic (ROC) curve. The ROC curve may be a plot of the true positive rate (TPR) against the false positive rate (FPR) for a plurality of different possible thresholds or cut points of a diagnostic test, thereby illustrating the trade-off between sensitivity and specificity depending on the selected cut point (e.g., any increase in sensitivity is accompanied by a decrease in specificity). The area under an ROC curve (AUC) can be a measure for the accuracy of a diagnostic test (e.g., the larger the area, the more accurate the diagnosis), with an optimal value of 1. In comparison, a random test may have an ROC curve lying on the diagonal with an AUC of 0.5 (e.g., representing a random or worthless test).

Prostate cancer is the second most common form of cancer in men worldwide, accounting for about 15% of the cancers diagnosed in men. Currently, the only available blood molecular screening method for prostate cancer is a prostate-specific antigen (PSA) test, which aims to detect prostate cancer at an early stage when the disease is amenable to curative treatment and reduce the overall disease-specific mortality. However, PSA is not a cancer-specific biomarker, and its level often increases abnormally in prostate-benign patients. Further, only a small minority of men with an elevated PSA level are actually found to have prostate cancer when a biopsy is performed. Therefore, there is scant evidence to establish that PSA screening for prostate cancer can save lives. Currently, biopsy is the only method for prostate cancer diagnosis, but high false negative rates of biopsy can leads significant percentages of men remaining undiagnosed after the first biopsy. Further, marker of prostate cancer such as the tumor stage, Gleason score, and PSA level cannot accurately identify the individuals ultimately failing of a treatment. Thus, there is an urgent need to develop high performance assays with panels of good biomarkers to reduce the need for repeated biopsies for prostate cancer diagnosis and to direct treatment strategies for prostate cancer.

Inactivation of tumor suppression genes is an important event contributing to the development of neoplastic malignancies. The alteration of a gene promoter DNA methylation may be often correlated to gene expression level changes. DNA methylation can occur when DNA methyltransferase adds a methyl group to a DNA molecule at a cytosine-phosphate-guanine (CpG) site without changing the sequence of the DNA molecule. DNA methylation may be an early event during tumorigenesis, and global abnormal DNA methylation may be observed in different tumor types. In general, cancer can be characterized by global hypomethylation (resulting in increased oncogene expression and genomic instability) and by gene-specific promoter hypermethylation resulting in suppressed DNA repair and other tumor-suppressive functions. DNA methylation may be stable in fixed samples over time and may be detectable in various bodily fluids and tissue. DNA methylation may also be cell-type specific. Further, various techniques for measuring DNA methylation can be performed. In light of all these characteristics, DNA methylation may be promising targets for the development of powerful diagnostic, prognostic, and predictive biomarkers for cancers.

The present disclosure provides methods, systems, and kits for detecting prostate cancer in a subject by analyzing nucleic acids from biological samples (e.g., tissue samples and/or bodily fluid samples) obtained from or derived from the subject for abnormal methylation profiles (e.g., relative to reference samples or methylation profiles). Biological samples obtained from subjects may be analyzed to measure a presence, absence, or relative assessment of the prostate cancer. The analysis may be performed at a set of genomic regions, such as DNA methylation marker regions. The subjects may include subjects with prostate cancer (e.g., prostate cancer patients) and subjects without prostate cancer (e.g., normal or healthy controls).

Methods and systems of the present disclosure may use methylation-sensitive restriction enzymes (MSRE) to analyze the methylation status of cytosine residues in CpG sequences. The enzymes may be unable to cleave methylated-cytosine residues and therefore leave methylated DNA intact. In some embodiments, sample DNA obtained or derived from a test subject can be digested with at least one methylation-sensitive restriction enzyme. For example, biomarkers of the present disclosure may include genomic loci that contain at least one specific MSRE recognized sequence (recognition site). The sample DNA can be cut (digested) according to its methylation level, where higher methylation results in less digestion by the enzyme. For example, if a DNA sample from a healthy subject is less methylated than another DNA sample from a cancer patient for the CpGs on the recognition sequence, it will be cut more extensively.

In some embodiments, a control locus is designed to be without MSRE cutting sites. In some embodiments, a fixed proportion of control DNA is added into the sample DNA for all test subjects. In some embodiments, at least one pair of qPCR primers is designed for each target genomic region of a biomarker. For each patient, two qPCR reactions are run independently on the same qPCR target: a first qPCR reaction is run on a first portion of the sample DNA that contains MSRE-digested DNA template, and a second qPCR reaction is run on a second portion of the sample DNA that contains undigested DNA templates. The undigested template may be used to represent the fully methylated DNA. After the purification of the MSRE digestion, the same amount of DNA may be used for the digested and undigested templates. The signal intensity of the qPCR reaction may be generated from the cycle threshold (Ct) values. For each locus of a given subject, the Ct difference (delta Ct) between the first qPCR reaction (run on the digested DNA template) and the second qPCR reaction (run on the undigested DNA template) is calculated and used to indicate the DNA methylation level of the subject. Thus, the delta Ct value can represent the subject's DNA methylation level for the target region. For example, the undigested DNA may have low Ct values, while the digested DNA from a normal individual may have high Ct values, thereby resulting in large absolute delta Ct values. Otherwise, the delta Ct values from a prostate cancer patient may be small (e.g., close to 0).

Using methods and systems of the present disclosure, prostate cancer can be accurately detected using a non user-dependent assay with high sensitivity and specificity in prostate tissue samples. The blood-based assay can use a set of biomarkers that accurately distinguish prostate cancer samples from control samples across all stages of prostate cancer. Further, the blood-based assay may offer high specificity, thereby facilitating the non-invasive application of prostate cancer associated biomarkers for treatment monitoring of prostate cancer patients.

The use of methods, systems, and kits of the present disclosure for prostate cancer detection based on analysis of aberrant methylation profiles (e.g., containing abnormal DNA methylation over a panel of predetermined biomarker genomic regions) may comprise the following steps:

1) Extracting DNA molecules from a biological sample (e.g., tissue, blood, urine, or exosome) of a test subject;

2) Preparing two sub-samples of equal or substantially equal size (e.g., amount and/or volume) obtained or derived from the same subject;

3) Digesting the first sub-sample of the DNA mixture with at least one MSRE to produce DNA fragments, and purifying the digested DNA fragments;

4) Performing qPCR amplification of the digested DNA fragments and the undigested DNA molecules for a panel of one or more target genes (e.g., prostate cancer biomarker genes or biomarker regions) and an internal control locus;

5) Normalizing the cycle threshold (Ct) values by subtracting the control Ct from the target Ct measured for the same subject;

6) Calculating the intensity ratio given by: 1/2^{∧(Ct of normalized MSRE digested DNA−Ct of normalized undigested DNA)}to produce an intensity ratio of the test sample; and

7) Comparing the intensity ratio of the test sample to the intensity ratio of reference samples obtained or derived from one or more prostate cancer patients and one or more control (e.g., healthy or normal) subjects.

Processing Biological Samples

In an aspect, the present disclosure provides a method for identifying or monitoring prostate cancer in a subject by processing or analyzing DNA molecules from a biological sample of the subject. The method may comprise providing a first set of DNA fragments derived from a first portion of the DNA molecules upon subjecting the first portion to CpG site fragmentation conditions. For example, DNA molecules of a urine sample may be split into two sub-samples, and the first DNA sub-sample may be MSRE-digested to fragment the DNA molecules at CpG sites. The two sub-samples may be of equal or substantially equal size (e.g., amount or volume). Next, the method may comprise providing a second set of DNA fragments derived from a second portion of the DNA molecules, wherein the second portion is not subjected to fragmentation conditions. For example, after the DNA molecules of a urine sample are split into two sub-samples, the second DNA sub-sample may not be subjected to fragmentation conditions such as MSRE digestion. Next, the method may comprise, for a genomic region, processing (i) the first set of DNA fragments or derivatives thereof to yield a first quantitative measure of DNA methylation and (ii) the second set of DNA fragments or derivatives thereof to yield a second quantitative measure of DNA methylation. Next, the method may comprise processing the first quantitative measure with the second quantitative measure to yield a third quantitative measure of DNA methylation at the genomic region, to generate a methylation profile of the plurality of DNA molecules at the genomic region.

FIG. 1 illustrates a flow-chart for a method 100 of prostate cancer identification in a subject, in accordance with disclosed embodiments. The method 100 may comprise obtaining a biological sample (e.g., tissue, blood, and/or urine sample) from a subject (e.g., a patient) (as in operation 102). Next, DNA molecules may be extracted from the biological sample (as in operation 104). Next, at least a first portion of the extracted DNA molecules may be subjected to CpG site fragmentation conditions, such as digestion with methylation-sensitive restriction enzymes (MSREs), while a second portion of the extracted DNA molecules may not be subjected to such fragmentation conditions (as in operation 106). Next, qPCR amplification of at least one biomarker locus, an internal control locus, may be performed (e.g., using qPCR primers) (as in operation 108). Next, cycle threshold (Ct) values may be obtained for each amplified region of a set of genomic regions (e.g., prostate cancer associated biomarkers) and normalized based on the internal control (as in operation 110). Next, a qPCR signal intensity may be calculated for the biomarker region, where the signal intensity=2{circumflex over ( )}[Ct, biomarker restriction locus−Ct, internal control locus] (as in operation 112). Next, a probability score may be calculated, which reflects the correlation between the biomarker signal intensity in the subject and tumor references and/or the correlation between the biomarker signal intensity in the subject and normal references (as in operation 114).

The biological samples may be obtained (as in operation 102) or derived from a tissue sample, a blood sample, a plasma sample, a serum sample, a saliva sample, a sputum sample, a urine sample, a stool sample, a sweat sample, a Pap smear sample, or an exosome sample from a human subject. The biological samples may be stored in a variety of storage conditions before processing, such as different temperatures (e.g., at room temperature, under refrigeration or freezer conditions, at 4° C., at −18° C., −20° C., or at −80° C.) or different preservatives (e.g., alcohol, formaldehyde, or potassium dichromate).

The biological sample may be obtained from a subject with a disease or disorder, from a subject that is suspected of having the disease or disorder, or from a subject that does not have or is not suspected of having the disease or disorder. The disease or disorder may be an infectious disease, an immune disorder or disease, a cancer, a genetic disease, a degenerative disease, a lifestyle disease, an injury, a rare disease or an age related disease. The infectious disease may be caused by bacteria, viruses, fungi, and/or parasites. The cancer may be a prostate cancer. The sample may be taken before and/or after treatment of a subject with a disease or disorder. Samples may be taken before and/or after a treatment. Samples may be taken during a treatment or a treatment regime. Multiple samples may be taken from a subject to monitor the effects of the treatment over time. The sample may be taken from a subject known or suspected of having a prostate cancer for which a definitive positive or negative diagnosis is not available via clinical tests.

The sample may be taken from a subject suspected of having a disease or a disorder. The sample may be taken from a subject experiencing unexplained symptoms, such as fatigue, nausea, weight loss, aches and pains, weakness, or memory loss. The sample may be taken from a subject having explained symptoms. The sample may be taken from a subject at risk of developing a disease or disorder due to factors such as familial history, age, environmental exposure, lifestyle risk factors, or presence of other known risk factors.

After obtaining a biological sample from the subject, the biological sample obtained from the subject may be assayed to generate methylation data indicative of a presence, absence, or relative assessment of a prostate cancer of a subject. For example, a presence, absence, or relative assessment of nucleic acid molecules of the biological sample at a panel of prostate cancer-associated genomic loci (e.g., quantitative measures of methylation at a plurality of prostate cancer-associated genomic loci) may be indicative of prostate cancer of the subject. The biological samples obtained or derived from the subject may be processed by (i) subjecting the biological sample to conditions that are sufficient to isolate, enrich, or extract a plurality of nucleic acid molecules (e.g., DNA molecules), and (ii) assaying the plurality of nucleic acid molecules to generate a methylation profile of the nucleic acid molecules at the panel of prostate cancer-associated genomic loci.

A plurality of nucleic acid molecules may be extracted from the biological sample (as in operation 104) and subjected to further assaying (e.g., sequencing to generate a plurality of sequencing reads). The nucleic acid molecules may comprise deoxyribonucleic acid (DNA) or ribonucleic acid (RNA). The nucleic acid molecules (e.g., DNA or RNA) may be extracted from the biological sample by a variety of methods, such as a FastDNA Kit protocol from MP Biomedicals or a DNeasy Blood & Tissue Kit from QIAGEN. The extraction method may extract all DNA molecules from a sample. Alternatively, the extraction method may selectively extract a portion of DNA molecules from a sample. Extracted RNA molecules from a sample may be converted to DNA molecules by reverse transcription (RT).

The method may comprise a variety of assays suitable for assessing the presence of DNA methylation (e.g., at one or more CpG sites) at the prostate cancer-specific markers in a biological sample. The DNA molecules may be assayed using an assay including, for example, methylation-sensitive restriction enzyme (MSRE) digestion, polymerase chain reaction (PCR), quantitative PCR (qPCR), digital PCR (dPCR), nucleic acid sequencing, target capture, mass spectrometry-based target fragmentation assay, flap endonuclease-based assay, CRISPR-based assay, methylation-specific assay comprising bisulfite treatment, methylation-specific PCR (MSP), COLD-PCR, targeted sequencing, targeted bisulfite sequencing, pyrosequencing, mass spectroscopy-based bisulfite sequencing (EpiTYPER), reduced representation bisulfite sequence (RRBS), whole genome sequencing (WGS), amplification fragment length polymorphism, amplification fragment length polymorphism (AFLP), enzyme-linked immunosorbent assay (ELISA), luminometric methylation assay (LUMA), methyl-sensitive cut counting (MSCC), high-performance liquid chromatograph (HPLC), microarray, bead array, or a combination thereof. For example, the assay may comprise restriction landmark genomic scanning and/or methylation-sensitive restriction enzyme (MSRE) digestion followed by quantitative PCR. The assay may utilize bisulfite treatment of DNA as a step of methylation analysis. After the bisulfite treatment, subsequent steps can include methylation-specific PCR (MSP), targeted sequencing, pyrosquencing, Epityper, reduced representation sequencing, whole genome sequencing, whole genome bisulfite sequencing (WGBS), or a combination thereof. All these methods are prevented from being used to measure DNA methylation of a single/multiple CpG sites in current invented region on the human genome.

In some embodiments, the methylation-sensitive restriction enzyme (MSRE) is selected from the group consisting of AatII, Acc65I, AccI, Acil, ACII, Afel, Agel, Apal, ApaLI, AscI, AsiSI, Aval, AvaII, Aox I, BaeI, BanI, BbeI, BceAI, BcgI, BfuCI, BglI, BisI, BlsI, BmgBI, BsaAI, BsaBI, BsaHI, BsaI, BseYI, BsiEI, BsiWI, BslI, BsmAI, BsmBI, BsmFI, BspDI, BsrBI, BsrFI, BssHII, BssKI, BstAPI, BstBI, BstUI, BstZl7I, Cac8J, ClaI, DpnI, DrdI, EaeI, EagI, Eagl-IF, EciI, EcoRI, EcoRI-HF, FauI, Fnu4HI, FseI, FspI, Gla I, Glu I, HaeII, HgaI, HhaI, HincII, HincII, Hinfl, HinPlI, HpaI, HpaII, Hpyl66ii, Hpyl88iii, Hpy99I, HpyCH4IV, KasI, Kro I, Mal I, MluI, MmeI, MspAlI, Mte I, MwoI, NaeI, NacI, NgoNIV, Nhe-HFI, NheI, NlaIV, NotI, NotI-HF, NruI, Nt.BbvCI, Nt.BsmAI, Nt.CviPII, PaeR7I, PleI, PmeI, PmlI, Pcs I, Pkr I, PshAI, PspOMI, PvuI, RsaI, RsrII, SacII, Sall, SalI-HF, Sau3AI, Sau96I, ScrFI, SfiI, SfoI, SgrAI, Smal, SnaBI, TfiI, TscI, TseI, TspMI, and ZraI.

The nucleic acid sequencing may be performed by any suitable sequencing methods, such as massively parallel sequencing, paired-end sequencing, high-throughput sequencing, next-generation sequencing (NGS), shotgun sequencing, single-molecule sequencing, nanopore sequencing, semiconductor sequencing, pyrosequencing, sequencing-by-synthesis (SBS), sequencing-by-ligation, and sequencing-by-hybridization, RNA-Seq (Illumina). The sequencing may comprise nucleic acid amplification (e.g., of DNA or RNA molecules). In some embodiments, the nucleic acid amplification is polymerase chain reaction (PCR). A suitable number of rounds of PCR (e.g., PCR, qPCR, reverse-transcriptase PCR, digital PCR, etc.) may be performed to sufficiently amplify an initial amount of nucleic acid (e.g., DNA) to a desired input quantity for subsequent sequencing. In some cases, the PCR may be used for global amplification of nucleic acids. This may comprise using adapter sequences that may be first ligated to different molecules followed by PCR amplification using universal primers. PCR may be performed using any of a number of commercial kits, e.g., provided by Life Technologies, Affymetrix, Promega, Qiagen, etc. In other cases, only certain target nucleic acids within a population of nucleic acids may be amplified (e.g., one or more of the panel of prostate cancer biomarkers or prostate cancer-associated genomic loci). Specific primers, possibly in conjunction with adapter ligation, may be used to selectively amplify certain targets for downstream sequencing. The PCR may comprise targeted amplification of one or more genomic loci, such as genomic loci associated with prostate cancer (e.g., listed in databases such as TCGA or COSMIC). The sequencing may comprise use of simultaneous reverse transcription (RT) and polymerase chain reaction (PCR), such as a OneStep RT-PCR kit protocol by Qiagen, NEB, Thermo Fisher Scientific, or Bio-Rad.

DNA or RNA molecules may be tagged, e.g., with identifiable tags, to allow for multiplexing of a plurality of samples. Any number of DNA or RNA samples may be multiplexed. For example a multiplexed reaction may contain DNA or RNA from at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, or more than 100 initial samples. For example, a plurality of samples may be tagged with sample barcodes such that each DNA molecule may be traced back to the sample (and the subject) from which the DNA molecule originated. Such tags may be attached to DNA or RNA molecules by ligation or by PCR amplification with primers.

After subjecting the nucleic acid molecules to sequencing, suitable bioinformatics processes may be performed on the sequence reads to generate the methylation data indicative of the presence, absence, or relative assessment of the prostate cancer. For example, the sequence reads may be aligned to one or more reference genomes (e.g., a genome of one or more species such as a human genome). The aligned sequence reads may be quantified at a panel of genomic loci to generate the data indicative of a distribution of the presence, absence, or relative assessment of the prostate cancer. For example, quantification of sequences corresponding to a panel of genomic loci associated with prostate cancer may generate the methylation data indicative of the presence, absence, or relative assessment of the prostate cancer.

The prostate cancer may be identified or monitored in the subject by using probes configured to selectively enrich nucleic acid (e.g., DNA or RNA) molecules corresponding to the panel of genomic loci (e.g., prostate cancer-associated genomic loci). The probes may be nucleic acid primers. The probes may have sequence complementarity with nucleic acid sequences (e.g., about 5 nucleotides, about 10 nucleotides, about 15 nucleotides, about 20 nucleotides, about 25 nucleotides, about 30 nucleotides, about 35 nucleotides, about 40 nucleotides, about 45 nucleotides, about 50 nucleotides, about 55 nucleotides, about 60 nucleotides, about 65 nucleotides, about 70 nucleotides, about 75 nucleotides, about 80 nucleotides, about 85 nucleotides, about 90 nucleotides, about 95 nucleotides, about 100 nucleotides, or more than about 100 nucleotides) from one or more of the individual genomic loci (e.g., prostate cancer-associated genomic loci). The one or more genomic loci (e.g., prostate cancer-associated genomic loci) may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 55, about 60, about 65, about 70, about 75, about 80, about 85, about 90, about 95, about 100, or more than about 100 distinct genomic loci (e.g., prostate cancer-associated genomic loci). In some embodiments, the panel of genomic loci comprises one or more prostate cancer-associated genomic loci listed in Table 1.

The biological sample may be processed without any nucleic acid extraction. For example, the processing may comprise assaying the biological sample using probes that are selected for the panel of genomic loci (e.g., prostate cancer-associated genomic loci). The panel of genomic loci (e.g., prostate cancer-associated genomic loci) may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 55, about 60, about 65, about 70, about 75, about 80, about 85, about 90, about 95, about 100, or more than about 100 distinct genomic loci (e.g., prostate cancer-associated genomic loci). In some embodiments, the panel of genomic loci comprises one or more prostate cancer-associated genomic loci listed in Table 1.

The processing may comprise assaying the biological sample using probes that are selective for the one or more genomic loci (e.g., prostate cancer-associated genomic loci) among other genomic loci in the biological sample. The probes may be nucleic acid molecules (e.g., DNA or RNA) having sequence complementarity with nucleic acid sequences (e.g., about 5 nucleotides, about 10 nucleotides, about 15 nucleotides, about 20 nucleotides, about 25 nucleotides, about 30 nucleotides, about 35 nucleotides, about 40 nucleotides, about 45 nucleotides, about 50 nucleotides, about 55 nucleotides, about 60 nucleotides, about 65 nucleotides, about 70 nucleotides, about 75 nucleotides, about 80 nucleotides, about 85 nucleotides, about 90 nucleotides, about 95 nucleotides, about 100 nucleotides, or more than about 100 nucleotides) from one or more of the individual genomic loci (e.g., prostate cancer-associated genomic loci). These nucleic acid molecules may be primers or enrichment sequences. The assaying of the biological sample using probes that are selected for the one or more genomic loci (e.g., prostate cancer-associated genomic loci) may comprise use of array hybridization, polymerase chain reaction (PCR), or nucleic acid sequencing (e.g., DNA sequencing or RNA sequencing).

The assay readouts may be quantified at one or more of the panel of genomic loci (e.g., prostate cancer-associated genomic loci) to generate the methylation data indicative of a presence, absence, or relative assessment of the prostate cancer. For example, quantification of array hybridization or polymerase chain reaction (PCR) corresponding to the panel of prostate cancer-associated genomic loci may generate methylation data at the panel of prostate cancer-associated genomic loci in the biological sample. Assay readouts may comprise quantitative PCR (qPCR) values, digital PCR (dPCR) values, digital droplet PCR (ddPCR) values, fluorescence values, etc.

Cycle threshold (Ct) values may be obtained for each amplified region of a set of genomic regions (e.g., prostate cancer associated biomarkers) and normalized based on the external control locus (as in operation 112). For example, a first cycle threshold (Ct) value may be determined for the amplification of a set of digested DNA fragments or derivatives thereof at one or more genomic regions, and a second cycle threshold (Ct) value may be determined for the amplification of a set of undigested DNA molecules or derivatives thereof at the one or more genomic regions. The undigested template may be used to represent the fully methylated DNA. After the purification of the MSRE digestion, the same amount of DNA may be used for the qPCR analysis of the digested and undigested templates. Reference Ct values may be generated based on the external control locus for (i) the amplification of the set of digested DNA fragments or derivatives thereof at the one or more genomic regions, and for (ii) the amplification of the set of undigested DNA molecules or derivatives thereof at the one or more genomic regions. Then, the first Ct value (for amplification of digested DNA) and the second Ct value (for amplification of undigested DNA) can be normalized using the difference of the internal control gene's Ct values before and after the digestion (delta Ct^c). The normalization may comprise subtracting the delta Ct^cvalue from the difference between the first Ct value (for amplification of digested DNA) and the second Ct value (for amplification of undigested DNA).

For each locus of a given subject, the Ct difference (delta Ct) between the first qPCR reaction (run on the digested DNA template) and the second qPCR reaction (run on the undigested DNA template) is calculated and used to indicate the DNA methylation level of the subject. Thus, the delta Ct value can represent the subject's DNA methylation level for the target region. For example, the undigested DNA may have low Ct values, while the digested DNA from a normal individual may have high Ct values, thereby resulting in large absolute delta Ct values. Otherwise, the delta Ct values from a prostate cancer patient may be small (e.g., close to 0).

Next, the qPCR signal intensity may be calculated for the biomarker region from the cycle threshold (Ct) values (as in operation 114). For example, the signal intensity can be given by 2{circumflex over ( )}[Ct, biomarker restriction locus−Ct, internal control locus]. An intensity ratio may be calculated using the first Ct value (for amplification of digested DNA) and the second Ct value (for amplification of undigested DNA), such as by determining the reciprocal of an exponentiation of (i) a base value (e.g., 2, 10, or e) and (ii) a difference between the first Ct value and the second Ct value.

Next, a likelihood (e.g., a probability score) may be calculated, which reflects the correlation between the biomarker signal intensity in the subject and tumor references and/or the correlation between the biomarker signal intensity in the subject and normal references (as in operation 116). Such a likelihood or probability score may be determined using a classifier, as described herein.

Kits

The present disclosure provides kits for identifying or monitoring a prostate cancer in a subject. A kit may comprise probes for identifying a presence, absence, or relative amount of sequences at the panel of prostate cancer-associated genomic loci in a biological sample of the subject, which may be indicative of a prostate cancer. The probes may be selective for the sequences at the panel of prostate cancer-associated genomic loci in the biological sample. A kit may comprise instructions for using the probes to process the biological sample to generate methylation data at the panel of prostate cancer-associated genomic loci in a biological sample of the subject.

The probes in the kit may be selective for the sequences at the plurality of prostate cancer-associated genomic loci in the biological sample. The probes in the kit may be configured to selectively enrich nucleic acid (e.g., DNA or RNA) molecules corresponding to the panel of prostate cancer-associated genomic loci. The probes in the kit may be nucleic acid primers. The probes in the kit may have sequence complementarity with nucleic acid sequences from one or more of the prostate cancer-associated genomic loci. The one or more genomic loci (e.g., prostate cancer-associated genomic loci) may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 55, about 60, about 65, about 70, about 75, about 80, about 85, about 90, about 95, about 100, or more than about 100 distinct genomic loci (e.g., prostate cancer-associated genomic loci). In some embodiments, the one or more genomic loci comprise one or more prostate cancer-associated genomic loci listed in Table 1.

The instructions in the kit may comprise instructions to assay the biological sample using the probes that are selective for the sequences at the panel of prostate cancer-associated genomic loci in the biological sample. The probes may be nucleic acid molecules (e.g., DNA or RNA) having sequence complementarity with nucleic acid sequences (e.g., about 5 nucleotides, about 10 nucleotides, about 15 nucleotides, about 20 nucleotides, about 25 nucleotides, about 30 nucleotides, about 35 nucleotides, about 40 nucleotides, about 45 nucleotides, about 50 nucleotides, about 55 nucleotides, about 60 nucleotides, about 65 nucleotides, about 70 nucleotides, about 75 nucleotides, about 80 nucleotides, about 85 nucleotides, about 90 nucleotides, about 95 nucleotides, about 100 nucleotides, or more than about 100 nucleotides) from one or more of the individual genomic loci (e.g., prostate cancer-associated genomic loci). These nucleic acid molecules may be primers or enrichment sequences. The instructions to assay the biological sample may comprise introductions to perform array hybridization, polymerase chain reaction (PCR), or nucleic acid sequencing (e.g., DNA sequencing or RNA sequencing) to process the biological sample to generate methylation data indicative of a presence, absence, or relative amount of sequences at the panel of prostate cancer-associated genomic loci in the biological sample, which may be indicative of a prostate cancer.

The instructions in the kit may comprise instructions to measure and interpret assay readouts, which may be quantified at one or more of the panel of prostate cancer-associated genomic loci to generate the methylation data indicative of a presence, absence, or relative amount of sequences at the panel of prostate cancer-associated genomic loci in the biological sample. For example, quantification of array hybridization or polymerase chain reaction (PCR) corresponding to the panel of prostate cancer-associated genomic loci may generate methylation data at the panel of prostate cancer-associated genomic loci in the biological sample. Assay readouts may comprise quantitative PCR (qPCR) values, digital PCR (dPCR) values, digital droplet PCR (ddPCR) values, fluorescence values, etc., or normalized values thereof.

Classifiers

After processing the biological sample from the subject, a classifier may be used to process the methylation data at the panel of prostate cancer-associated genomic loci to classify the biological sample, thereby identifying or assessing a prostate cancer of the subject. The classifier may be configured to identify the prostate cancer with an accuracy of at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or more than 99% for at least about 25, at least about 50, at least about 100, at least about 150, at least about 200, at least about 250, at least about 300, at least about 350, at least about 400, at least about 450, at least about 500, or more than about 500 independent samples.

The classifier may comprise a supervised machine learning algorithm or an unsupervised machine learning algorithm. The classifier may comprise a classification and regression tree (CART) algorithm. The classifier may comprise, for example, a support vector machine (SVM), a linear regression, a logistic regression, a nonlinear regression, a neural network, a Random Forest, a deep learning algorithm, a naïve Bayes classifier.

The classifier may be configured to accept a plurality of input variables and to produce one or more output values based on the plurality of input variables. The plurality of input variables may comprise data indicative of a presence, absence, or relative amount of sequences or methylated residues at each of the plurality of prostate cancer-associated genomic loci. For example, an input variable may comprise a number of sequences or methylated residues corresponding to or aligning to each of the plurality of prostate cancer-associated genomic loci.

The classifier may have one or more possible output values, each comprising one of a fixed number of possible values (e.g., a linear classifier, a logistic regression classifier, etc.) indicating a classification of the biological sample by the classifier. The classifier may comprise a binary classifier, such that each of the one or more output values comprises one of two values (e.g., {0, 1}, {positive, negative}, or {cancerous, non-cancerous}) indicating a classification of the biological sample by the classifier. The classifier may be another type of classifier, such that each of the one or more output values comprises one of more than two values (e.g., {0, 1, 2}, {positive, negative, or indeterminate}, or {cancerous, non-cancerous, or indeterminate}) indicating a classification of the biological sample by the classifier. The output values may comprise descriptive labels, numerical values, or a combination thereof. Some of the output values may comprise descriptive labels. Such descriptive labels may provide an identification or indication of the disease state of the subject, and may comprise, for example, positive, negative, cancerous, non-cancerous, or indeterminate. Such descriptive labels may provide an identification of a treatment for the subject's disease state, and may comprise, for example, a therapeutic intervention, a duration of the therapeutic intervention, and/or a dosage of the therapeutic intervention. Such descriptive labels may provide an identification of secondary clinical tests that may be appropriate to perform on the subject, and may comprise, for example, a biopsy, a blood test, a computed tomography (CT) scan, a magnetic resonance imaging (MRI) scan, an ultrasound scan, a chest X-ray, a positron emission tomography (PET) scan, or a PET-CT scan. Such descriptive labels may provide a prognosis of the disease state of the subject. Some descriptive labels may be mapped to numerical values, for example, by mapping “positive” to 1 and “negative” to 0.

Some of the output values may comprise numerical values, such as binary, integer, or continuous values. Such binary output values may comprise, for example, {0, 1}. Such integer output values may comprise, for example, {0, 1, 2}. Such continuous output values may comprise, for example, a probability value of at least 0 and no more than 1. Such continuous output values may comprise, for example, an un-normalized probability value of at least 0. Such continuous output values may comprise, for example, an un-normalized probability value of at least 0. Such continuous output values may indicate a prognosis of the disease or disorder state of the subject and may comprise, for example, an indication of an expected or average progression-free survival (PFS) or overall survival (OS) of the subject. Such continuous output values may indicate a prediction of the course of treatment to treat the disease or disorder state of the subject and may comprise, for example, an indication of an expected duration of efficacy of the course of treatment. Some numerical values may be mapped to descriptive labels, for example, by mapping 1 to “positive” and 0 to “negative.”

Some of the output values may be assigned based on one or more cutoff values. For example, a binary classification of samples may assign an output value of “positive” or 1 if the sample indicates that the subject has at least a 50% probability of being diseased. For example, a binary classification of samples may assign an output value of “negative” or 0 if the sample indicates that the subject has less than a 50% probability of being diseased. In this case, a single cutoff value of 50% is used to classify samples into one of the two possible binary output values. Examples of single cutoff values may include about 1%, about 2%, about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 98%, and about 99%.

As another example, a classification of samples may assign an output value of “positive” or 1 if the sample indicates that the subject has a probability of being diseased of at least 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, or at least about 99%. The classification of samples may assign an output value of “positive” or 1 if the sample indicates that the subject has a probability of being diseased of more than 50%, more than 55%, more than 60%, more than 65%, more than 70%, more than 75%, more than 80%, more than 85%, more than 90%, more than 95%, more than 98%, or more than 99%. The classification of samples may assign an output value of “negative” or 0 if the sample indicates that the subject has a probability of being diseased of less than 50%, less than 45%, less than 40%, less than 35%, less than 30%, less than 25%, less than 20%, less than 10%, less than 5%, less than 2%, or less than 1%. The classification of samples may assign an output value of “negative” or 0 if the sample indicates that the subject has a probability of being diseased of no more than 50%, no more than 45%, no more than 40%, no more than 35%, no more than 30%, no more than 25%, no more than 20%, no more than 10%, no more than 5%, no more than 2%, or no more than 1%. The classification of samples may assign an output value of “indeterminate” or 2 if the sample has not been classified as “positive,” “negative,” 1, or 0. In this case, a set of two cutoff values is used to classify samples into one of the three possible output values. Examples of sets of cutoff values may include {1%, 99%}, {2%, 98%}, {5%, 95%}, {10%, 90%}, {15%, 85%}, {20%, 80%}, {25%, 75%}, {30%, 70%}, {35%, 65%}, {40%, 60%}, and {45%, 55%}. Similarly, sets of n cutoff values may be used to classify samples into one of n+1 possible output values, where n is any positive integer.

The classifier may be trained with a plurality of independent training samples. Each of the independent training samples may comprise a biological sample from a subject, associated data obtained by processing the biological sample (as described elsewhere herein), and one or more known output values corresponding to the biological sample (e.g., a clinical diagnosis, prognosis, treatment efficacy, or absence of a disease or disorder such as a prostate cancer of the subject). Independent training samples may comprise biological samples and associated data and outputs obtained from a plurality of different subjects. Independent training samples may comprise biological samples and associated data and outputs obtained at a plurality of different time points from the same subject (e.g., before, after, and/or during a course of treatment to treat a disease or disorder of the subject). Independent training samples may be associated with presence of the prostate cancer (e.g., training samples comprising biological samples and associated data and outputs obtained from a plurality of subjects known to have the prostate cancer). Independent training samples may be associated with absence of the prostate cancer (e.g., training samples comprising biological samples and associated data and outputs obtained from a plurality of subjects who are known to not have a previous diagnosis of the prostate cancer, or otherwise who are asymptomatic for the prostate cancer).

The classifier may be trained with at least about 50, at least about 100, at least about 150, at least about 200, at least about 250, at least about 300, at least about 350, at least about 400, at least about 450, or at least about 500 independent training samples. The independent training samples may comprise samples associated with presence of the prostate cancer and/or samples associated with absence of the prostate cancer. The classifier may be trained with no more than 500, no more than 450, no more than 400, no more than 350, no more than 300, no more than 250, no more than 200, no more than 150, no more than 100, or no more than 50 independent training samples associated with presence of the prostate cancer. In some embodiments, the biological sample is independent of samples used to train the classifier.

The classifier may be trained with a first number of independent training samples associated with presence of the prostate cancer and a second number of independent training samples associated with absence of the prostate cancer. The first number of independent training samples associated with presence of the prostate cancer may be no more than the second number of independent training samples associated with absence of the prostate cancer. The first number of independent training samples associated with presence of the prostate cancer may be equal to the second number of independent training samples associated with absence of the prostate cancer. The first number of independent training samples associated with presence of the prostate cancer may be greater than the second number of independent training samples associated with absence of the prostate cancer.

The classifier may be configured to identify the prostate cancer with an accuracy of at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or more than about 99%, for at least about 50, at least about 100, at least about 150, at least about 200, at least about 250, at least about 300, or more than about 300 independent samples. The accuracy of identifying the prostate cancer by the classifier may be calculated as the percentage of independent test samples (e.g., subjects having the prostate cancer, or apparently healthy subjects with negative clinical test results for the prostate cancer) that are correctly identified or classified as having or not having the prostate cancer, respectively.

The classifier may be configured to identify the prostate cancer with a positive predictive value (PPV) of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or more than about 99%. The PPV of identifying the prostate cancer by the classifier may be calculated as the percentage of biological samples identified or classified as having the prostate cancer that correspond to subjects that truly have the prostate cancer. A PPV may also be referred to as a precision.

The classifier may be configured to identify the prostate cancer with a negative predictive value (NPV) of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or more than about 99%. The NPV of identifying the prostate cancer by the classifier may be calculated as the percentage of biological samples identified or classified as not having the prostate cancer that correspond to subjects that truly do not have the prostate cancer.

The classifier may be configured to identify the prostate cancer with a clinical sensitivity of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or more than about 99%. The clinical sensitivity of identifying the prostate cancer by the classifier may be calculated as the percentage of independent test samples associated with presence of the prostate cancer (e.g., subjects known to have the prostate cancer) that are correctly identified or classified as having the prostate cancer. A clinical sensitivity may also be referred to as a recall.

The classifier may be configured to identify the prostate cancer with a clinical specificity of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or more than about 99%. The clinical specificity of identifying the prostate cancer by the classifier may be calculated as the percentage of independent test samples associated with absence of the prostate cancer (e.g., apparently healthy subjects with negative clinical test results for the prostate cancer) that are correctly identified or classified as not having the prostate cancer.

The classifier may be configured to identify the prostate cancer with an Area-Under-Curve (AUC) of at least about 0.50, at least about 0.55, at least about 0.60, at least about 0.65, at least about 0.70, at least about 0.75, at least about 0.80, at least about 0.81, at least about 0.82, at least about 0.83, at least about 0.84, at least about 0.85, at least about 0.86, at least about 0.87, at least about 0.88, at least about 0.89, at least about 0.90, at least about 0.91, at least about 0.92, at least about 0.93, at least about 0.94, at least about 0.95, at least about 0.96, at least about 0.97, at least about 0.98, at least about 0.99, or more than about 0.99. The AUC may be calculated as an integral of the Receiver Operator Characteristic (ROC) curve (e.g., the area under the ROC curve) associated with the classifier in classifying biological samples as having or not having the prostate cancer.

The classifier may be adjusted or tuned to improve the performance, accuracy, PPV, NPV, clinical sensitivity, clinical specificity, or AUC of identifying the prostate cancer. The classifier may be adjusted or tuned by adjusting parameters of the classifier (e.g., a set of cutoff values used to classify a sample as described elsewhere herein, or weights of a neural network). The classifier may be adjusted or tuned continuously during the training process or after the training process has completed.

After the classifier is initially trained, a subset of the inputs may be identified as most influential or most important to be included for making high-quality classifications. For example, a subset of the plurality of prostate cancer-associated genomic loci may be identified as most influential or most important to be included for making high-quality classifications or identifications of prostate cancer. The plurality of prostate cancer-associated genomic loci or a subset thereof may be ranked based on metrics indicative of each genomic locus's influence or importance toward making high-quality classifications or identifications of prostate cancer. Such metrics may be used to reduce, in some cases significantly, the number of input variables (e.g., predictor variables) that may be used to train the classifier to a desired performance level (e.g., based on a desired minimum accuracy, PPV, NPV, clinical sensitivity, clinical specificity, or AUC). For example, if training the training algorithm with a plurality comprising several dozen or hundreds of input variables in the classifier results in an accuracy of classification of more than 99%, then training the training algorithm instead with only a selected subset of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, no more than about 10, no more than about 15, no more than about 20, no more than about 25, no more than about 30, no more than about 35, no more than about 40, no more than about 45, no more than about 50, or no more than about 100 such most influential or most important input variables (e.g., marker genes, marker regions, or other genomic loci) among the plurality results in decreased but still acceptable accuracy of classification (e.g., at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, or at least about 98%). The subset may be selected by rank-ordering the entire plurality of input variables and selecting a predetermined number (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, no more than about 10, no more than about 15, no more than about 20, no more than about 25, no more than about 30, no more than about 35, no more than about 40, no more than about 45, no more than about 50, or no more than about 100) of input variables with the best metrics. In some embodiments, the selected subset of the influential or most important input variables comprises one or more genomic loci listed in Table 2.

Identifying or Monitoring a Prostate Cancer

After using a classifier to process the methylation data at the panel of prostate cancer-associated genomic loci to classify the biological sample, a quantitative measure indicative of the presence, absence, or relative assessment of the prostate cancer may be determined (e.g., likelihood or probability of prostate cancer), and the prostate cancer may be identified or a progression or regression of the prostate cancer may be monitored in the subject based at least in part on the quantitative measure (e.g., likelihood or probability of prostate cancer).

The prostate cancer may be identified in the subject with an accuracy of at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or more than about 99%. The accuracy of identifying the prostate cancer by the classifier may be calculated as the percentage of independent test samples (e.g., subjects having the prostate cancer, or apparently healthy subjects with negative clinical test results for the prostate cancer) that are correctly identified or classified as having or not having the prostate cancer, respectively.

The prostate cancer may be identified in the subject with a positive predictive value (PPV) of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or more than about 99%. The PPV of identifying the prostate cancer by the classifier may be calculated as the percentage of biological samples identified or classified as having the prostate cancer that correspond to subjects that truly have the prostate cancer. A PPV may also be referred to as a precision.

The prostate cancer may be identified in the subject with a negative predictive value (NPV) of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or more than about 99%. The NPV of identifying the prostate cancer by the classifier may be calculated as the percentage of biological samples identified or classified as not having the prostate cancer that correspond to subjects that truly do not have the prostate cancer.

The prostate cancer may be identified in the subject with a clinical sensitivity of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or more than about 99%. The clinical sensitivity of identifying the prostate cancer by the classifier may be calculated as the percentage of independent test samples associated with presence of the prostate cancer (e.g., subjects having the prostate cancer) that are correctly identified or classified as having the prostate cancer. A clinical sensitivity may also be referred to as a recall.

The prostate cancer may be identified in the subject with a clinical specificity of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or more than about 99%. The clinical specificity of identifying the prostate cancer by the classifier may be calculated as the percentage of independent test samples associated with absence of the prostate cancer (e.g., apparently healthy subjects with negative clinical test results for the prostate cancer) that are correctly identified or classified as not having the prostate cancer.

After the prostate cancer is identified in a subject, a stage of the prostate cancer (e.g., stage I, stage II, stage III, or stage IV) may further be identified. The stage of the prostate cancer may be determined based at least in part on the methylation data at a panel of prostate cancer-associated genomic loci (e.g., quantitative measures of mutations at the prostate cancer-associated genomic loci).

Upon identifying the subject as having the prostate cancer, the subject may be provided with a therapeutic intervention (e.g., prescribing an appropriate course of treatment to treat the prostate cancer of the subject). The therapeutic intervention may comprise a surgical tumor resection, an effective dose of chemotherapy, an effective dose of radiotherapy, an effective dose of targeted therapy, an effective dose of immunotherapy. If the subject is currently being treated for the prostate cancer with a course of treatment, the therapeutic intervention may comprise a subsequent different course of treatment (e.g., to increase treatment efficacy due to tumor resistance, tumor recurrence, non-response of the current course of treatment).

The therapeutic intervention may comprise recommending the subject for a secondary clinical test to confirm a diagnosis of the prostate cancer. This secondary clinical test may comprise a biopsy, an imaging test, a blood test, a computed tomography (CT) scan, a magnetic resonance imaging (MRI) scan, an ultrasound scan, a chest X-ray, a positron emission tomography (PET) scan, a PET-CT scan, or any combination thereof.

The subject may be treated upon identifying the subject as having the prostate cancer. Treating the subject may comprise administering an appropriate therapeutic intervention to treat the prostate cancer of the subject. The therapeutic intervention may comprise a surgical tumor resection, an effective dose of chemotherapy, an effective dose of radiotherapy, an effective dose of targeted therapy, an effective dose of immunotherapy, or any combination thereof. If the subject is currently being treated for the prostate cancer with a course of treatment, the administered therapeutic intervention may comprise a subsequent different course of treatment (e.g., to increase treatment efficacy due to tumor resistance, tumor recurrence, non-response of the current course of treatment).

The methylation data at the panel of prostate cancer-associated genomic loci (e.g., quantitative measures of methylation at the prostate cancer-associated genomic loci) may be assessed over a duration of time to monitor a patient (e.g., subject who has prostate cancer or who is being treated for prostate cancer). In such cases, the quantitative measures of methylation at the prostate cancer-associated genomic loci of the patient may change during the course of treatment. For example, the quantitative measures of methylation at the prostate cancer-associated genomic loci of a patient whose prostate cancer is regressing due to an effective treatment (e.g., chemotherapy or surgical resection) may shift toward the methylation profile or distribution of a healthy subject. Conversely, for example, the quantitative measures of methylation at the prostate cancer-associated genomic loci of a patient whose prostate cancer is progressing due to an ineffective treatment (e.g., when the tumor becomes resistant) may shift toward the methylation profile or distribution of a subject with more advanced stage prostate cancer.

The progression or regression of the prostate cancer in the subject may be monitored by monitoring a course of treatment for treating the prostate cancer in the subject. The monitoring may comprise assessing the prostate cancer in the subject at two or more time points. The assessing may be based at least on the methylation data at a panel of prostate cancer-associated genomic loci (e.g., quantitative measures of methylation at the prostate cancer-associated genomic loci) determined at each of the two or more time points.

A difference in methylation data at a panel of prostate cancer-associated genomic loci (e.g., quantitative measures of methylation at the prostate cancer-associated genomic loci) determined between the two or more time points may be indicative of one or more clinical indications, such as (i) a diagnosis of the prostate cancer in the subject, (ii) a prognosis of the prostate cancer in the subject, (iii) a progression of the prostate cancer in the subject, (iv) a regression of the prostate cancer in the subject, (v) an efficacy of the course of treatment for treating the prostate cancer in the subject, and (vi) a resistance of the prostate cancer toward the course of treatment for treating the prostate cancer in the subject.

A difference in methylation data at a panel of prostate cancer-associated genomic loci (e.g., quantitative measures of methylation at the prostate cancer-associated genomic loci) determined between the two or more time points may be indicative of a diagnosis of the prostate cancer in the subject. For example, if the prostate cancer was not detected in the subject at an earlier time point but was detected in the subject at a later time point, then the difference is indicative of a diagnosis of the prostate cancer in the subject. A clinical action or decision may be made based on this indication of diagnosis of the prostate cancer in the subject, e.g., prescribing a new therapeutic intervention for the subject.

A difference in methylation data at a panel of prostate cancer-associated genomic loci (e.g., quantitative measures of methylation at the prostate cancer-associated genomic loci) determined between the two or more time points may be indicative of a prognosis of the prostate cancer in the subject.

A difference in methylation data at a panel of prostate cancer-associated genomic loci (e.g., quantitative measures of methylation at the prostate cancer-associated genomic loci) determined between the two or more time points may be indicative of a progression of the prostate cancer in the subject. For example, if the prostate cancer was detected in the subject both at an earlier time point and at a later time point, and if the difference is a negative difference (e.g., the presence, absence, or relative assessment of methylation at a panel of prostate cancer-associated genomic loci (e.g., quantitative measures of methylation at the prostate cancer-associated genomic loci) increased from the earlier time point to the later time point), then the difference may be indicative of a progression (e.g., increased tumor load, tumor burden, or tumor size) of the prostate cancer in the subject. A clinical action or decision may be made based on this indication of the progression, e.g., prescribing a new therapeutic intervention or switching therapeutic interventions (e.g., ending a current treatment and prescribing a new treatment) for the subject.

A difference in methylation data at a panel of prostate cancer-associated genomic loci (e.g., quantitative measures of methylation at the prostate cancer-associated genomic loci) determined between the two or more time points may be indicative of a regression of the prostate cancer in the subject. For example, if the prostate cancer was detected in the subject both at an earlier time point and at a later time point, and if the difference is a positive difference (e.g., the presence, absence, or relative assessment of methylation at a panel of prostate cancer-associated genomic loci (e.g., quantitative measures of methylation at the prostate cancer-associated genomic loci) decreased from the earlier time point to the later time point), then the difference may be indicative of a regression (e.g., decreased tumor load, tumor burden, or tumor size) of the prostate cancer in the subject. A clinical action or decision may be made based on this indication of the regression, e.g., continuing or ending a current therapeutic intervention for the subject.

A difference in methylation data at a panel of prostate cancer-associated genomic loci (e.g., quantitative measures of methylation at the prostate cancer-associated genomic loci) determined between the two or more time points may be indicative of an efficacy of the course of treatment for treating the prostate cancer in the subject. For example, if the prostate cancer was detected in the subject at an earlier time point but was not detected in the subject at a later time point, then the difference may be indicative of an efficacy of the course of treatment for treating the prostate cancer in the subject. A clinical action or decision may be made based on this indication of the efficacy of the course of treatment for treating the prostate cancer in the subject, e.g., continuing or ending a current therapeutic intervention for the subject.

A difference in methylation data at a panel of prostate cancer-associated genomic loci (e.g., quantitative measures of methylation at the prostate cancer-associated genomic loci) determined between the two or more time points may be indicative of a resistance of the prostate cancer toward the course of treatment for treating the prostate cancer in the subject. For example, if the prostate cancer was detected in the subject both at an earlier time point and at a later time point, and if the difference is a negative or zero difference (e.g., the presence, absence, or relative assessment of methylation at a panel of prostate cancer-associated genomic loci (e.g., quantitative measures of methylation at the prostate cancer-associated genomic loci) increased or remained at a constant level from the earlier time point to the later time point), and if an efficacious treatment was indicated at an earlier time point, then the difference may be indicative of a resistance (e.g., increased or constant tumor load, tumor burden, or tumor size) of the course of treatment for treating the prostate cancer in the subject. A clinical action or decision may be made based on this indication of the resistance of the course of treatment for treating the prostate cancer in the subject, e.g., ending a current therapeutic intervention and/or switching to (e.g., prescribing) a different new therapeutic intervention for the subject.

Outputting a Report of the Prostate Cancer

After the prostate cancer is identified or a progression or regression of the prostate cancer is monitored in the subject, a report may be electronically outputted that identifies or provides an indication of the identification, prognosis, progression, or regression of the prostate cancer in the subject. The subject may not display a benign or prostate cancer (e.g., is asymptomatic of the benign or prostate cancer). The report may be presented on a graphical user interface (GUI) of an electronic device of a user. The user may be the subject, a caretaker, a physician, a nurse, or another health care worker.

The report may include one or more clinical indications such as (i) a diagnosis of the prostate cancer in the subject, (ii) a prognosis of the prostate cancer in the subject, (iii) a progression of the prostate cancer in the subject, (iv) a regression of the prostate cancer in the subject, (v) an efficacy of the course of treatment for treating the prostate cancer in the subject, and (vi) a resistance of the prostate cancer toward the course of treatment for treating the prostate cancer in the subject. The report may include one or more clinical actions or decisions made based on these one or more clinical indications.

For example, a clinical indication of a diagnosis of the prostate cancer in the subject may be accompanied with a clinical action of prescribing a new therapeutic intervention for the subject. As another example, a clinical indication of a progression of the prostate cancer in the subject may be accompanied with a clinical action of prescribing a new therapeutic intervention or switching therapeutic interventions (e.g., ending a current treatment and prescribing a new treatment) for the subject. As another example, a clinical indication of a regression of the prostate cancer in the subject may be accompanied with a clinical action of continuing or ending a current therapeutic intervention for the subject. As another example, a clinical indication of an efficacy of the course of treatment for treating the prostate cancer in the subject may be accompanied with a clinical action of continuing or ending a current therapeutic intervention for the subject. As another example, a clinical indication of a resistance of the course of treatment for treating the prostate cancer in the subject may be accompanied with a clinical action of ending a current therapeutic intervention and/or switching to (e.g., prescribing) a different new therapeutic intervention for the subject.

Computer Systems

The present disclosure provides computer systems that are programmed to implement methods of the disclosure. FIG. 4 shows a computer system 401 that is programmed or otherwise configured to, for example, determine quantitative measures of DNA methylation to generate methylation profiles of DNA molecules at genomic regions; determine cycle threshold (Ct) values for amplification of DNA fragments or derivatives thereof at genomic regions; calculate intensity ratio values of first quantitative measures and second quantitative measures at genomic regions; determine a quantitative measure indicative of a presence, absence, or relative assessment of prostate cancer of a subject; identify or provide an indication of the prostate cancer of the subject; and electronically output a report that identifies or provides an indication of the prostate cancer of the subject.

The computer system 401 can regulate various aspects of analysis, calculation, and generation of the present disclosure, such as, for example, determining quantitative measures of DNA methylation to generate methylation profiles of DNA molecules at genomic regions; determining cycle threshold (Ct) values for amplification of DNA fragments or derivatives thereof at genomic regions; calculating intensity ratio values of first quantitative measures and second quantitative measures at genomic regions; determining a quantitative measure indicative of a presence, absence, or relative assessment of prostate cancer of a subject; identifying or providing an indication of the prostate cancer of the subject; and electronically outputting a report that identifies or provides an indication of the prostate cancer of the subject. The computer system 401 can be an electronic device of a user or a computer system that is remotely located with respect to the electronic device. The electronic device can be a mobile electronic device.

The computer system 401 includes a central processing unit (CPU, also “processor” and “computer processor” herein) 405, which can be a single core or multi core processor, or a plurality of processors for parallel processing. The computer system 401 also includes memory or memory location 410 (e.g., random-access memory, read-only memory, flash memory), electronic storage unit 415 (e.g., hard disk), communication interface 420 (e.g., network adapter) for communicating with one or more other systems, and peripheral devices 425, such as cache, other memory, data storage and/or electronic display adapters. The memory 410, storage unit 415, interface 420, and peripheral devices 425 are in communication with the CPU 405 through a communication bus (solid lines), such as a motherboard. The storage unit 415 can be a data storage unit (or data repository) for storing data. The computer system 401 can be operatively coupled to a computer network (“network”) 430 with the aid of the communication interface 420. The network 430 can be the Internet, an internet and/or extranet, or an intranet and/or extranet that is in communication with the Internet.

The network 430 in some cases is a telecommunication and/or data network. The network 430 can include one or more computer servers, which can enable distributed computing, such as cloud computing. For example, one or more computer servers may enable cloud computing over the network 430 (“the cloud”) to perform various aspects of analysis, calculation, and generation of the present disclosure, such as, for example, determining quantitative measures of DNA methylation to generate methylation profiles of DNA molecules at genomic regions; determining cycle threshold (Ct) values for amplification of DNA fragments or derivatives thereof at genomic regions; calculating intensity ratio values of first quantitative measures and second quantitative measures at genomic regions; determining a quantitative measure indicative of a presence, absence, or relative assessment of prostate cancer of a subject; identifying or providing an indication of the prostate cancer of the subject; and electronically outputting a report that identifies or provides an indication of the prostate cancer of the subject. Such cloud computing may be provided by cloud computing platforms such as, for example, Amazon Web Services (AWS), Microsoft Azure, Google Cloud Platform, and IBM cloud. The network 430, in some cases with the aid of the computer system 401, can implement a peer-to-peer network, which may enable devices coupled to the computer system 401 to behave as a client or a server.

The CPU 405 may comprise one or more computer processors and/or one or more graphics processing units (GPUs). The CPU 405 can execute a sequence of machine-readable instructions, which can be embodied in a program or software. The instructions may be stored in a memory location, such as the memory 410. The instructions can be directed to the CPU 405, which can subsequently program or otherwise configure the CPU 405 to implement methods of the present disclosure. Examples of operations performed by the CPU 405 can include fetch, decode, execute, and writeback.

The CPU 405 can be part of a circuit, such as an integrated circuit. One or more other components of the system 401 can be included in the circuit. In some cases, the circuit is an application specific integrated circuit (ASIC).

The storage unit 415 can store files, such as drivers, libraries and saved programs. The storage unit 415 can store user data, e.g., user preferences and user programs. The computer system 401 in some cases can include one or more additional data storage units that are external to the computer system 401, such as located on a remote server that is in communication with the computer system 401 through an intranet or the Internet.

The computer system 401 can communicate with one or more remote computer systems through the network 430. For instance, the computer system 401 can communicate with a remote computer system of a user. Examples of remote computer systems include personal computers (e.g., portable PC), slate or tablet PC's (e.g., Apple® iPad, Samsung® Galaxy Tab), telephones, Smart phones (e.g., Apple® iPhone, Android-enabled device, Blackberry®), or personal digital assistants. The user can access the computer system 401 via the network 430.

Methods as described herein can be implemented by way of machine (e.g., computer processor) executable code stored on an electronic storage location of the computer system 401, such as, for example, on the memory 410 or electronic storage unit 415. The machine executable or machine readable code can be provided in the form of software. During use, the code can be executed by the processor 405. In some cases, the code can be retrieved from the storage unit 415 and stored on the memory 410 for ready access by the processor 405. In some situations, the electronic storage unit 415 can be precluded, and machine-executable instructions are stored on memory 410.

The code can be pre-compiled and configured for use with a machine having a processer adapted to execute the code, or can be compiled during runtime. The code can be supplied in a programming language that can be selected to enable the code to execute in a pre-compiled or as-compiled fashion.

Aspects of the systems and methods provided herein, such as the computer system 401, can be embodied in programming. Various aspects of the technology may be thought of as “products” or “articles of manufacture” typically in the form of machine (or processor) executable code and/or associated data that is carried on or embodied in a type of machine readable medium. Machine-executable code can be stored on an electronic storage unit, such as memory (e.g., read-only memory, random-access memory, flash memory) or a hard disk. “Storage” type media can include any or all of the tangible memory of the computers, processors or the like, or associated modules thereof, such as various semiconductor memories, tape drives, disk drives and the like, which may provide non-transitory storage at any time for the software programming. All or portions of the software may at times be communicated through the Internet or various other telecommunication networks. Such communications, for example, may enable loading of the software from one computer or processor into another, for example, from a management server or host computer into the computer platform of an application server. Thus, another type of media that may bear the software elements includes optical, electrical and electromagnetic waves, such as used across physical interfaces between local devices, through wired and optical landline networks and over various air-links. The physical elements that carry such waves, such as wired or wireless links, optical links or the like, also may be considered as media bearing the software. As used herein, unless restricted to non-transitory, tangible “storage” media, terms such as computer or machine “readable medium” refer to any medium that participates in providing instructions to a processor for execution.

Hence, a machine readable medium, such as computer-executable code, may take many forms, including but not limited to, a tangible storage medium, a carrier wave medium or physical transmission medium. Non-volatile storage media include, for example, optical or magnetic disks, such as any of the storage devices in any computer(s) or the like, such as may be used to implement the databases, etc. shown in the drawings. Volatile storage media include dynamic memory, such as main memory of such a computer platform. Tangible transmission media include coaxial cables; copper wire and fiber optics, including the wires that comprise a bus within a computer system. Carrier-wave transmission media may take the form of electric or electromagnetic signals, or acoustic or light waves such as those generated during radio frequency (RF) and infrared (IR) data communications. Common forms of computer-readable media therefore include for example: a floppy disk, a flexible disk, hard disk, magnetic tape, any other magnetic medium, a CD-ROM, DVD or DVD-ROM, any other optical medium, punch cards paper tape, any other physical storage medium with patterns of holes, a RAM, a ROM, a PROM and EPROM, a FLASH-EPROM, any other memory chip or cartridge, a carrier wave transporting data or instructions, cables or links transporting such a carrier wave, or any other medium from which a computer may read programming code and/or data. Many of these forms of computer readable media may be involved in carrying one or more sequences of one or more instructions to a processor for execution.

The computer system 401 can include or be in communication with an electronic display 435 that comprises a user interface (UI) 440 for providing, for example, a visual display of data indicative of a presence, absence, or relative assessment of prostate cancer of a subject, a determined presence, absence, or relative assessment of prostate cancer of a subject, an identification of a subject as having prostate cancer, or an electronic report that identifies or provides an indication of the prostate cancer of the subject. Examples of UI's include, without limitation, a graphical user interface (GUI) and web-based user interface.

Methods and systems of the present disclosure can be implemented by way of one or more algorithms. An algorithm can be implemented by way of software upon execution by the central processing unit 405. The algorithm can, for example, determine quantitative measures of DNA methylation to generate methylation profiles of DNA molecules at genomic regions; determine cycle threshold (Ct) values for amplification of DNA fragments or derivatives thereof at genomic regions; calculate intensity ratio values of first quantitative measures and second quantitative measures at genomic regions; determine a quantitative measure indicative of a presence, absence, or relative assessment of prostate cancer of a subject; identify or provide an indication of the prostate cancer of the subject; and electronically output a report that identifies or provides an indication of the prostate cancer of the subject.

EXAMPLES Example 1

A healthy (prostate normal) sample and a prostate cancer sample were each processed using methods of the present disclosure, including quantitative polymerase chain reaction (qPCR) amplification at a control locus and two restriction loci. FIGS. 2A and 2B illustrate an example of quantitative polymerase chain reaction (qPCR) amplification plots for the control locus and two restriction loci tested in the healthy (prostate normal) sample (“N1-digested” and “N1-undigested”) and the prostate cancer sample (“T1-digested” and “T1-undigested”), respectively, in accordance with disclosed embodiments.

FIGS. 3A-3F illustrate receiver operating characteristic (ROC) plots with area under the ROC (AUC) values for the target 5 genes C5orf49 (AUC=0.9428), GPR75-ASB3 (AUC=0.883), ANKDD18 (AUC=0.9098), SCGB3A1 (AUC=0.9238), and C9orf3 (AUC=0.9212), respectively, in accordance with disclosed embodiments.

Table 1 provides a list of marker regions, genomic coordinates, and strands for a set of prostate cancer-specific biomarkers. Marker regions may include marker genes or intergenic regions. Panels of one or more prostate cancer-specific genomic loci can be selected from this list. The genomic coordinates may comprise portions of genes or intergenic regions.

Table 2 provides a list of selected marker regions that are observed to be most influential or most important toward classification of samples for prostate cancer assessment. Table 3 provides performance data (including sensitivity, specificity, positive predictive value (PPV), negative predictive value (NPV), and area under the ROC (AUC)) for this set of selected marker regions that are observed to be most influential or most important toward classification of samples for prostate cancer assessment. Table 4 provides signal ratio values (mean ratio and standard deviation) measured for this set of selected marker regions that are observed to be most influential or most important toward classification of samples for prostate cancer assessment, across the set of normal samples and the set of tumor samples.

TABLE 1

Differentially methylated regions (DMRs) with genomic coordinates

Marker Region Name	Genomic Coordinates	Strand

FOXE3	chr1:47882821-47883001	+
INTchrl_178456064_178456230	chr11:78456064-178456230	NA
SYT15	chr10:46970108-46970295	−;−
EPS8L2	chr11:721572-721764	+
SLC15A3	chr11:60718471-60718618	−
KDM2A	chr11:66885273-66885367	+
INT.chr11_69452031_69452146	chr11:69452031-69452146	NA
INT.chr11_69452505_69452633	chr11:69452505-69452633	NA
BIN2	chr12:51718739-51718869	−
RHOF	chr12:122231231-122231336	−
ZIC2	chr13:100637718-100637764	+
NPAS3	chr14:34269667-34269714	+
INT.chr14_54413694_54413930	chr14:54413694-54413930	NA
AMN	chr14:103394658-103394809	+
SYNGR3	chr16:2042521-2042624	+
FAM18A	chr16:10912373-10912435	−
INT.chr16_88700552_88700661	chr16:88700552-88700661	NA
CYBA	chr16:88717186-88717443	−
ALOX12;LOC100506713	chr17:6898966-6899129	+;−
RAI1	chr17:17603974-17604067	+
STAC2	chr17:37381086-37381291	−
HSF5	chr17:56564955-56565159	−
UTS2R	chr17:80332893-80332988	+
CELF4	chr18:34833673-34833820	−
NFATC1	chr18:77280255-77280394	+;+
INT.chr18_77377808_77378030	chr18:77377808-77378030	NA
GNG7	chr19:2561966-2562267	−
S1PR4	chr19:3178378-3178763	+
S1PR4	chr19:3179843-3180439	+
ICAM5	chr19:10398645-10398816	+;+
INT.chr19_13209661_13209782	chr19:13209661-13209782	NA
LYL1	chr19:13210312-13210610	−
KCNN4	chr19:44278646-44278776	−
DACT3	chr19:47152943-47153124	−
GRIN2D	chr19:48946038-48946234	+
ARHGEF33;LOC375196	chr2:39186942-39187340	−;+
GPR75-ASB3	chr2:54086834-54087146	−
LOXL3;DOK1	chr2:74782170-74782343	−;+;+
SPEG	chr2:220299387-220299671	+
OBSL1;MIR3132	chr2:220416365-220416499	−;−
ADRA1D	chr20:4202298-4202568	−
M1R5095;RBM38	chr20:55965671-55965845	+;+
PR1C285	chr20:62200059-62200211	−
INT.chr21_44819085_44819433	chr21:44819085-44820000	NA
CLDN5	chr22:19511041-19511173	−
SCARF2	chr22:20783492-20784226	−
BCR	chr22:23523796-23524384	+
BAIAP2L2	chr22:38485113-38485188	−
CELSR1	chr22 :46932291-46932543	−
PLXNB2	chr22:50738284-50738549	−
GPR62	chr3:51989765-51989989	+
CTBP1	chr4:1210457-1211157	−
INT.chr4_55015512_55015839	chr4:55015512-55015839	NA
SCGB3A1	chr5:180017902-180018673	−
C5orf49	chr5:7849801-7850443	−
MCI	chr5:54516403-54516681	−
ANKDD1B	chr5:74907331-74907750	+
SH2B2	chr7:101961701-101962105	+
MEST;MESTIT1	chr7:130131962-130132110	+;+;+;+;−
TMEM176B;TMEM176A	chr7:150497959-150498298	−,+
KCNH2	chr7:150655309-150655540	−;−
KBTBD11	chr8:1950518-1950729	+
INT.chr8_38508331_38508694	chr8:38508331-38508694	NA
INT.chr8_48675655_48676143	chr8:48675655-48676143	NA
C9orf3	chr9:97807476-97807681	+
C9orf172	chr9:139740230-139740378	+
CLIC3	chr9:139889657-139889955	−

TABLE 2

Selected top marker regions

Marker Region Name	Genomic Coordinates	Strand

SCGB3A1	chr5: 180017902-180018673	+
ANKDD1B	chr5: 74907443-74907561	+
C5orf49	chr5: 7850160-7850286	−
C9orf3	chr9: 97807476-97807681	+
GPR75-ASB3	chr2: 54086834-54087017	−

TABLE 3

Performance data for the selected top marker regions tested
in a set of 52 normal and 47 tumor patient tissue samples

Locus	Sensitivity	Specificity	PPV	NPV	AUC

SEQ ID NO:127	78.80%	98.20%	97.10%	86.10%	0.909
SEQ ID NO:201	88.10%	94.70%	92.50%	91.50%	0.943
SEQ ID NO:134	73.80%	89.50%	83.80%	83.90%	0.883
SEQ ID NO:43	88.10%	91.20%	88.10%	91.20%	0.924
SEQ ID NO:96	81.00%	86.00%	81.00%	86.00%	0.921

TABLE 4

Signal ratio of the selected top marker regions tested
in a set of 52 normal and 47 patient tissue samples

	Normal	Normal	Cancer	Cancer
	Mean	Standard	Mean	Standard
Locus	Ratio	Deviation	Ratio	Deviation

SEQ ID NO:127	78.2	2.8	5.1	3.6
SEQ ID NO:201	52.0	2.9	3.0	3.1
SEQ ID NO:134	3.0	2	2.5	2.2
SEQ ID NO:43	34.3	3.7	4.1	4.3
SEQ ID NO:96	4.2	1.8	1.8	1.7

TABLE 5

Area under an ROC curve (AUC) with respect to identification
of prostate cancer using combinations of one or more loci

Loci	Sensitivity	Specificity	AUC

{SEQ ID NO:134}	80.9%	82.4%	0.883
{SEQ ID NO:134,	76.2%	87.7%	0.895
SEQ ID NO:127}
{SEQ ID NO:134,	78.6%	98.2%	0.904
SEQ ID NO:127,
SEQ ID NO:43}
{SEQ ID NO:134,	80.9%	98.2%	0.908
SEQ ID NO:127,
SEQ ID NO:43,
SEQ ID NO:96}
{SEQ ID NO:134,	83.3%	98.2%	0.917
SEQ ID NO:127,
SEQ ID NO:43,
SEQ ID NO:96,
SEQ ID NO:201}

TABLE 6

Sequences of the DMRs in Table 1

Marker Region Name	Sequence	SEQ ID NO:

FOXE3	ggcccgctgcccgctgagcccctcctggccttggccGGGCCGGC	277
	AGCCGCTCTCGGCCCGCTCAGCCCTGGGGAG
	GCCTACCTGAGGCAGCCGGGCTTCGCGTCGG
	GGCTGGAGCGCTACCTGTGAGCCTGCGCCGC
	GCGGGCAGGCACCTGTGCGACCTGTGCCCCG
	GACCTGCGGCGC

INTchr1_178456064_178456230	GGAGGCGGAAGCGCGCGAGTAGGAGGTGCG	278
	GAGGTCGGGCTCGCGGGGCTCCGGGCTGCCC
	CTCTGAGTGAGCCGCGCTGCTGAAGCCGGGC
	CCTGCGAGGCGCCCACGGGGCCGGTGCTGGT
	CCCTAGGGCCAGAGAGAAGACTTCTGTGGGG
	TCCGCTGCGCCC

SYT15	GGGGGTGCTCAGACGCTGGGTTCCAACCGCT	279
	GGCCACCTGGGGCGGGCCAAAAAGGTGCCTC
	CCTTAGGGTGACGTGCGGCCGCGGGGCATTC
	AGGTCTCAGGGATCTGCACTGGGTGGGGTGG
	TGAGAAGGCCGGACCCCCCACACCTCCTAAG
	CCGCAACTGACCGCGAAGAGCGGGCCTCAGCG

EPS8L2	CAACTGCGCCCTGGACGACATCGAGTGGTTT	280
	GTGGCCCGGCTGCAGAAGGCAGCCGAGGCTT
	TCAAGCAGCTGAACCAGCGGAAAAAGGGGA
	AGAAGAAGGGCAAGAAGGCGCCAGCAGGTG
	CAggggacagggacggggccggcaggtgcaggggacggggccagc
	aggtgcaggggacagggacggggac

SLC15A3	GGCACCGAAGGAGGTGAGGTTGCTCCGGACG	281
	GAGCTGGCGGCCAGGCCGAGTAGCAGCAGGC
	CCGCGTAGAGGACGGGCGCGCAGTAGGGGCT
	GGGCGAGGAGCGCGGGCAGCCGGCCGAGGG
	GCAGGCAGGTCCCAGCGGCGACGC

KDM2A	CCCGGATCGCGGCTGGGCTGCTCGCATGGCA	282
	CTGCTCGGGTACCTCCGGCCGGGCTCCGTCGA
	CGTTCGGAGCCTGCTGGCCCGTCGGGCAGCT

INT.chr11_69452031_69452146	GGAGTGGGGCATGCCGTGGGAGCCCACGAGG	283
	GCCTCAGCGCGGATCCTCCGCCGGAAAACCG
	GCTCCCGCGAGCCGCCGCCGCAGGTTTCCTA
	GGCCCCGCGAGTCCCGCAGCGA

INT.chr11_69452505_69452633	CCCCTACCTGTTGGGTTTGCGTTTTAACTCCA	284
	GCGCACACCTTGCCGGCAGCCCTCGGAGCTA
	GGGGAGGGGTCTCGTTTCCCCGCAGCCCGCC
	GGACAGACGACTGGGGCACGGGAGGGGCGG
	TGGC

BIN2	aaataaataaataaataaataaataaatGAGGAACAACTAAG	285
	CTGGAGATAGAAACAGGGTAGGGGGCTGGTT
	CTTAGGCAAGAGAATGATCACATTGAAAAAA
	GGCTGAGGAGGATAGTATGGACGCCC

RHOF	GTCCCGGATCAGCCCCCCCTCACCCCGCTGGG	286
	CTCTGGAATTCCCGAGGGGGCGCCCCGGGGT
	GGCGGCCGCCTGTCCGTGCTCGGGACGCTGG
	GGACTGAGGGT

ZIC2	cggcggcggctgcggcggcggcggccgcggtgtccgcggtgcaccg	287

NPAS3	cccggcgccgacggcgcggccgcccgcAAGACTCAGTTCG	288
	GCGCCTC

INT.chr14_54413694_54413930	CGCCGCGGACGCGCCGAGCCCTCTCAGTGTG	289
	GCGCTGCCCGGCGGCGAGGGGGGTGTGGAAC
	GAAGCACGGTCAAGACAGAAAACAAAGTCA
	GCAGGTCACCTGGCAGGTTCTGGGCGAATTA
	TGCAACGAAAGCAGGGGAATGTTTGATGCGT
	CCCACTCCACACCCCCCCAACCTTTTTTTTTTT
	TTTTTAAGCTCCTAGGAAGCCGGTTCCAGTTT
	AAGGGTTGGGTAGGGAT

AMN	GTGCACAGGGTCTCGGCTTCTCGTCCCAGGG	290
	GACTGGGGGCGGGGTGGGCGCGGAGCAGGC
	CCGGACCCCCGCGTGGCGCCGCCTCAGCCCG
	TGTCTCTTGCAGCTCCTGCCGCTGGATGGGGA
	ACTCGTCCTGGCTTCAGGAGCCGGATT

SYNGR3	GGCGAGCCCAGGCGAGGCGCCCCAAGCCTCG	291
	GGCCCACCGACCTTTCCTCCTCCGGGCGAGGC
	CGCCGTGGGCCACCGCGTGGAGCGTCGCCCT
	GACGCGCCG

FAM18A	CGCCCAGGCCCGGGGCTCCAGCTCCGCCCGT	292
	CGCCGCTGAAGGGGTCGGACGCCGGGCGGGC

INT.chr16_88700552_88700661	CATGACGATTTTGCACCCCCGCCAGCAGTGCC	293
	CTCGGCTGGACACACCTGCGTTGTGGGCAGC
	CGGCAGCGCGTGACCCACTGTGCACCTGCGC
	CTTGATGTAGGGGGG

CYBA	CCAGCCCGCGGCCTGAGGGTCCCGCCCCCGT	294
	TCCCCGCACCCTCCTGGCCTGACCCCGGCCCG
	GCCTGGCCCGCCTGGCGCCCCACTTCCCCACC
	CTGTAAGTAGCCCGAGGTCCCGGCTGGGGTC
	TTGGGACACCCCTCCAGGCTGCAGCCTCCACC
	GTCCCTGACGTGCACTCACTCAGGCCGGACG
	CCAGCGCCTGTTCGTTGGCCCACATGGCCCAC
	TCGATCTGCCCCATGGCGACACGAACCCGGC
	TGGGA

ALOX12; LOC100506713	GGGTCCCAGCCCAGAAAAGCGGAGACCTTCC	295
	CCTCCGTTTGGAAGATGGACTCATCCCCTACT
	TCCTCCTGGCTCCCCAGAAGACCTGGAGACCT
	CGGGAAGTGTTCTCATCTATGTTCGCTCCAAC
	CCGGGGGCTCAGGCCCACCTCGATCCCGCCTT
	CCCG

RAI1	GGGGCCTCCGCGAGGCCGGGCCTCGTCCGCC	296
	GAGGCCGCAGTCCGGCCCCTCTCGTCCTCGG
	GGCGCGGCGCGTTCGTTTCATTAATTTATCG

STAC2	GGCCGCGGCCTCGCGTCCCCGAGCCCAACAG	297
	GGCTAGGAGCGGGGAATGCAGGACTGCGGA
	GGGGCAGGGAGAGACGCCCTGAGACGCGGA
	GATAAACACCCGGAGACGCCGGGAGAGACG
	GGGAGAGACGCACACAGAGACACCAAGACA
	CAGACACGCAGGTTGTAGAGACAAATTCAGA
	GACACGAGCGAGGATAGAGGCGC

HSF5	GCCAATGGGTCCCCGGCGCCTTTCCGACGCCC	298
	ATAGCGTGAGGACGTGCGAAAATGCGCCCTC
	CAGCGGCGGTTGCTCCCCGCCGCCCATGTGCC
	CACTGTGGGCGAGGGCACGGGCAGTCCGGAC
	TCACCGTGCGGCTcgggccggggccccgcgggcggcggcg
	gcTGCTGGTGCTGCAGTGGCGCGGTGGCGGCG
	GAGGCC

UTS2R	GCGCGCCTGGCCCGCGCCTACCGCCGCTCGC	299
	AGCGCGCCTCCTTCAAgcgggcccggcggccgggggcg
	cgcgcgcTGCGCCTGGTGCTGGGCAT

CELF4	GGTCCGTCTGGTTCCCTCCCAACCCCCGTccccg	300
	cgccccggccgcccccggTTACCTGTGCGAGTCCTGGT
	CTCCCCCGGGGGACGCTCCCGCCGGCGCTCA
	GTACGGGCGATTGGCGTCTTTGGGCCGCTTCA
	GCTGCACCTTGA

NFATC1	GCAGCCCTCGCGTGGCGTTGCTGCCTCTGCAG	301
	ATGCCTCCGGAGGGACTCGGTGTGTCTCGGT
	GTTGATTTCAGAACAGGGGAGATGCTGACGT
	GTCCCGGTGGCTCTCACAGCACAGTGGAAGG
	CGAGTGGCAGCTCC

INT.chr18_77377808_77378030	CCCGCGCGGACAAGCAGCTTCCCAGAGGCCT	302
	CAGGAAGCCCCGCCCGAGGGTGTCAGCTCCA
	GCTCTGAGCGGGTCCCGCAAACGCCCCAGCG
	TGTTCCCACCGGTGACCCCGACACCCCAACA
	CCCCAACGCCCCGCACCGCCCTCAGCAGCCG
	CGCCTTGGCCAGCGGGTGCCCCGGTGCCTGC
	GGCCTCTGACATAGAAAACGAGGAAGGAGGc
	gggcg

GNG7	CGGGGCGACCCGAGAAACAGGAAACCCTGTT	303
	TCTGAGCTTCGCAGGCTCTTCTGGGAGACCAG
	CGGGTAATCCCCTTCCTCCGACATTTCTCTGA
	GAAGTCTCTCTGCGTTCTGCTTCTCAGAAAGA
	AACCAGGGTCCGGGGCAGGCATTCACGCCCT
	CCACCCACTCAGGGGTTTGCAGTAACACCCTT
	GGGATCTGCAGGTTCACACAGAGCCAGAGCC
	GTGAGTCACCGCAGCCCCGGAGCTGCCGGGG
	TCCCCACCTGCTCAGCCCCAGGAACACACAT
	CTACAGCGGGTTCCTTTT

ICAM5	CGCCTTCTGCTCCCAGCTTGGAGCCCCGCGCC	304
	CACAGCTTTGGCCTCCGGTTCCATCGCTGCCC
	TTGTAGGGATCCTCCTCACTGTGGGCGCTGCG
	TACCTATGCAAGTGCCTAGCTATGAAGTCCCA
	GGCGTAAAGGGGGATGTTCTATGCCGGCTGA
	GCGAGAAAAAGA

LYL1	CCCGGGAGGGGTGGGGCCTGCGGCCAGAGCT	305
	GCGGCTTGGTCGCGCAGCAGCCGCACCAGGA
	AGCCGATGTACTTCATGGCTAGGCGGAGCAC
	CTCGTTCTTGCTCAGCTTCCGGTCGGGCGGGT
	GCGTCGGCAGCAGCTTCCTCAGCTCGGCGAA
	GGCGCCGTTAACGTTCTGCTGCCGCCAGCGCT
	CCCGGCTGTTGGTGAACACGCGCCGGGCCAC
	CTTCTGGGGCTGGTGCCCTGTGGACAAGGAG
	GGCCGGGTTGGTGCCATGGCCCAAAGGGCGG
	CCCCTCCTGCCCTCCCG

KCNN4	CACGGCGGGCCCCGCACGGGCGCCGGGTGCA	306
	GCCCACACACCACCAGCTCCAGCACGATCTG
	CGCCGCCTGCCGCCCGGTCAGCGCCACGCGC
	CAGTCCCGCAGCCCGTTGTCGGTCATGAACA
	GCTGCC

DACT3	GGCTGCGCATCGCCACGGCGTGCAGGGGGCT	307
	GGGCGTCAGAAAgggcccggcgcgggcccgccgcTCCG
	CCGAGGAGCAGGCCTCCGGGCCGGCGGACCC
	CCCTGCCGTCGGGTAGGGCGCTGAGAAGGAC
	CGCGGCACCGCTGCCCGCGCGCCCACCACCT
	CCGGAGCGCTGGGACTGGC

GRIN2D	ggggggcgcgggccTGGCCGACGGCTTCCACCGCTA	308
	CTACGGCCCCATCGAGCCGCAGGGCCTAGGC
	CTCGGCCTGGGCGAAgcgcgcgcggcaccgcggggcgca
	gccgggcgcccgctgtccccgccggccgcTCAGCCCCCGCA
	GAAGCCGCCGCCCTCCTATTTCGCCATCGTAC
	GCGACAAGGAGCCAGCC

ARHGEF33; LOC375196	GTAAGCACAGCTCTTTTGTACTCTGTTTTCCC	309
	CCTAAAGACATCTGATGCCCCCAGTGAAGAA
	AAGCCAACAGCAGCAAAGCCTGATGGAGAGC
	ATGCAGCCCGGGAAGCCCAGTGACTGGGAGC
	TGGAGGGCAGGAAGCACGAGCGGCCCGAGA
	GCCTTCTGGCACCGACGCAGTTCTGCGCGGCC
	GAGCAGGACGTGAAGGCGCTGGCCGGGCCCC
	TGCAGGCCATCCCGGAGATGGACTTCGAGTC
	CTCTCCGGCGGAGCCGCTGGGCAACGTGGAG
	CGCTCCCTGCGCGCCCCGGCCGAGCTCCTGCC
	CGATGCCCGCGGCTTCGTGCCCGCGGCCTAC
	GAAGAGTTCGAGTACGGCGGCGAGATCTTCG
	CGCTGCCCGCGCCCTACGACGAGG

GPR75-ASB3	CACCAGGAAGACAGGTACGCGGAGCCGGGCC	310
	TGGCCCAGCGCAGCCGCGCTCCTCGCTATCCC
	GCCAGCCTCCGGGAGCCGTCTCCGGCATCGT
	GGGGTTGTCCTCCTCCAGGGGCCCGCGGCCTC
	TCACCTGCCGGGTGGCCGCAGCGCCGCCCCT
	CCTCCATCTCGCAGTCCGGACCCCAGCTCCGC
	CTGCCGCTCTGGATGATGCAGGACTAGAGGC
	ATCATCGCCATCGCCACCGCCTCCGCGCATCC
	CGGGAGCCGCGGCAAGACGCGGGCGCAGAG
	GCGCAGTCACGGAGACGCCGAGGGCACCGC

LOXL3; DOK1	TTTGGAAGCCCCAGATCCCAAATCGACTTGC	311
	GCCGCAACCTCCTTCCCCGTCGGGACCCGGG
	CCGCCTGCGCACGCCACTCCCTCTCGAGCACT
	CTCTCTCTCTCCCTAGAGGTGGAGGAAGACCT
	GGGCCGTGCTCTACCCGGCCAGTCCCCACGG
	CGTAGCGCGGCTCGAG

OBSL1; MIR3132	CATCTCATACTTATCTCCCGGGCACAGCTCGG	312
	CCCCCTCCCGCAGCCAGCACACGTGGCCCCC
	CGAGCGGGACACAGTCACCTCCAGCACCGCC
	CGGCGGCCCACCAGAACGGTCTTCTCGCGAG
	GGGGGTGGC

MIR5095; RBM38	CCTTTCTATGGCTGGGGGCCGGATGAGGGAC	313
	CCGGGTCTGCTCTTACTCGCCCCAAGGGTCCC
	TGACACCAGCCCAGAACGGGGTGGAGCTGGA
	AAGAGCCCACACCTGCTTCCTCTGCCCACCTC
	ATCTCCCGCGGGGCCTCTGAGACCGCCCGGG
	ACCCGCTTCTATCGCGG

PRIC285	GCTGCAGCCCCAGGGCCAAGCAGCAGCGGGC	314
	CGGAAGCAGCAGCCACAGCGCCTGCTCTGAG
	CTGGCCCGCCTCTCCAGCCGCACCTCGAACAC
	CGTATTGTCGGGTGCAGGTACAGGGGCCACC
	AGGGCTGTGCTGACCGCCCGGCCCAGC

CLDN5	GGTCCATGCGGGGCTCCCCAGGCTTATCCAA	315
	CGCCTCGCAGGCGTGGCTGGCAGGAGGGGCC
	CGGCCGTGCCCAGCGCCCTCAGACGTAGTTCT
	TCTTGTCGTAGTCGCCGGTGGCCGTGGGCCGC
	CGCGGC

BCR	ACGGCGCGGGCTCGAGCGTGGGGGATGCATC	316
	CAGGCCCCCTTACCGGGGACGCTCCTCGGAG
	AGCAGCTGCGGCGTCGACGGCGACTACGAGG
	ACGCCGAGTTGAACCCCCGCTTCCTGAAGGA
	CAACCTGATCGACGCCAATGGCGGTAGCAGG
	CCCCCTTGGCCGCCCCTGGAGTACCAGCCCTA
	CCAGAGCATCTACGTCGGGGGCATGATGGAA
	GGGGAGGGCAAGGGCCCGCTCCTGCGCAGCC
	AGAGCACCTCTGAGCAGGAGAAGCGCCTTAC
	CTGGCCCCGCAGGTCCTACTCCCCCCGGAGTT
	TTGAGGATTGCGGAGGCGGCTATACCCCGGA
	CTGCAGCTCCAATGAGAACCTCACCTCCAGC
	GAGGAGGACTTCTCCTCTGGCCAGTCCAGCC
	GCGTGTCCCCAAGCCCCACCACCTACCGCAT
	GTTCCGGGACAAAAGCCGCTCTCCCTCGCAG
	AACTCGCAACAGTCCTTCGACAGCAGCAGTC
	CCCCCACGCCGCAGTGCCATAAGCGGCACCG
	GCACTGCCCGGTTGTCGTGTCCGAGGCCACC
	ATCGTGGGCGTCCGCAAGACCGGGCAGA

BAIAP2L2	GTGCGGGGCAGGGAGCGACGGTCTGGCTCTA	317
	GCTGGGACGCGGGCCTCGCGTCGGGCTCGGT
	GCCGTAGGAGCCG

CELSR1	GGTTCGTTCTCAAACAACGCCACCTGGTAGTT	318
	GGGCATCGGAAACTTCAGGCTCCCTCTGCCG
	CTCGTgccccgccgggcccgtcgcgccggccccgcccgggcTT
	CGGGCAAGTTCGGCGGCAGGGGCGGCGATGG
	GGATGGCGACGCGGAGGGCGTCCCCGCGGTG
	GCGGCCTCCAGCGCCAGTCCCACCCGGACGG
	CGCCAGCCGCGCGCCGCAGGGCGCACAGCAG
	ACGCAGGCGGACCGAGCCGCCC

PLXNB2	GGCCTGTGTGGAGCGCCCTGGACTATTCCTCG	319
	CAGGCCGACCCAGGTGGCACAGCCCCTCCCC
	CGGCGCCGGCACCGCCAGACTCCCCGGAGGG
	CGCAGAACGGTTGCCCGGGAGCCAGGGGCAA
	AGCGCGCCCGGGGCCAGGAAGCGCAGGGACT
	AGGCCCGCGCCTCCTCGGCGCCGCCCACTGC
	CCCCCGCGAGCCCAAGCTCCACGGCCACCGC
	CCGCGCCCTCCCGGGGACTCCGGCGCCCCGT
	CCGCCCCTCGGCCTCG

GPR62	GCGCGCTGCTGGTCGTGGTGCTGCGCACGCC	320
	GGGACTGCGCGACGCGCTCTACCTGGCGCAC
	CTGTGCGTCGTGGACCTGCTGGCGGCCGCCTC
	CATCATGCCGCTGGGCCTGCTGGCCGCACCG
	CCGCCCGGGCTGGGCCGCGTGCGCCTGGGCC
	CCGCGCCATGCCGCGCCGCTCGCTTCCTCTCC
	GCCGCTCTGCTGCCGGCCTGCACGCTCGGGGT
	GGCC

INT.chr4_55015512_55015839	ccgcggagcagggggtggggagggggcggggcggcggggctccgg	321
	ggctcgcgcatggcgggctgccagtcgccagccatgggagtcggggga
	gccgggggaggaaggcagctgaggcccgacgagaattcgagcgccga
	cccggtgggccagcactgctgagggacccggcgcaccctctgcagctgc
	tggcccgggtgctaagcccctcactgactggtgcggtggcgccggccgg
	ccgctccaagtgcggggcccgccgagcccacgcccatccggaactcgc
	gctggccggcgagcacggggcacggccccggttcccgcccg

C5orf49	GACTCGCAGATCCCATCCCAGGAAATGCACG	322
	GGCCGGTGTGGCCAGGACAGAACAGAGGGA
	CCACTCTCAGTCCAGCCCTCCCTGCAGGCGGC
	TCGCCAGCTATTCCTTCTGGTCTTCGGTTTGC
	AGGAGGGCAGAGGGTTTCCCGCGCCCTGGAC
	CATCCGGGCGTAGTCCCGGCAGCAAGGCCTT
	CTTTCCTTGCTAGCCTGGGCCTGCCGCAGACA
	GACCCCAGAGGGAGCCGCGCCCAGCCCGCTG
	GGCGGCCCCGGCTTCCCGCGACCCCCTCCAG
	ACCCTGGGCAGAAAGAGCGCCCTGCTGTCCC
	GACAGAGCCACTGTGCTTTTGAGGGATCCTG
	ACACCTAGTGGCTCCCGCTCCCTTCTCCGAAG
	AGCACCGGGTCCTATCTGAGCATTCCCGCGA
	CTCCCAGCCCCTGATCGCAGCTAAGACACCC
	ATTCGCGCACCCGGCTTCTCCCACATCCTCGT
	CCCAGGGGTTCAGCTGACACTGGTAGTCGCC
	TGAGCTGTACTCTTTGGGGCCCAGGCGCCTTG
	GCGGGAGCTCACCCTCCCTGTCTCCCCAGCTG
	ACCCTGCCGCGCCCCCTTCATCTCCGCACGCT
	CCCACCCGGCCCCCTCCACAGGCTGTCCAGCC
	CCGCCCCTCGGAAC

MCI	GGGCCTGGTGTCAGTATTCGCGGGCTCTGGC	323
	AGCAGTCGGGGCCGCTTGGGATCGCGGCTCT
	GAAGGGCTTCATCGCAGCGCTCGGAAATCTC
	CCTCAGGATGGCGTCCACTTCCGCGCAATCCT
	GCCCCGCAGCGCTGACCAACTCCTCCAGGCT
	CCTTTTGGCCTTCGCCTTGAGCAGGAAGGGCT
	CGGCCGCCGCCCCACAATCCCGGGACTGTGT
	GATCATCAGCTTCTACGAAAGACAGGGAAGA
	GCGCCGCCCTGGGGCCTGCCGGACCCTC

ANKDD1B	GGCTGACCTGCCTGCGTCCAGCCCCCGCGCCC	324
	TGGGCCTGCctgggtctggatctgtgtccgagtctgggtctggatct
	gggtccgagtctgggtctggCCCTGCGCTCAGGGCCCGC
	GGAGGAGACTATGGAccccgccgggcgcgcccggggcc
	AAGGGGCCACGGCAGGGGGGCTGCTGCTCCG
	GGCTGCTGCGGCCGCCAAGGGTCTCAGGGAA
	GACCTGTGGGGCGCGGCCGCCCTGCCTTGGA
	GGAGCCTGTCCCGGATCCCGAAGCGGGAGGG
	TCTTGGAGAGGAGGACACAGCAGTTGCCGGA
	CACGAGCTCCGTGAGTCCCGGGACGAGGTCT
	CAGAAAATCAGGCTGCGGGGCGGGCTGGGTC
	GAAGGGACTTGAGAAGGTACCCAGAGCAGCA
	CCTCCGGACGCTGCA

SCGB3A1	GCGCCCCCGCGGGAGGCGCCCAGGAACCGTC	325
	GCGCCCTGCCCGGCTCCCCGACCGCCCCTCCC
	TCCTGCGCCGAGGCCTGCCAGGTGCGAGCCC
	CCGGGACACAGGCGGGTCTGGGGAGGCGGCC
	CCGCCAGGAGACGCTGCAGGGTCACCGGAGT
	GGCCTGAGGGTGGCGGAAGGACCGGTGAACT
	CTGTGCAGGGTCCGGGACAGGCCCCCAAGGG
	AGGGGACACTCGCGCTGCGCCTTGCAGGATG
	AGGAGCCGGTCTCCAGACGGGGGGCAGACGG
	GTGTCCCCAGGCCAGGGGCGGCCTCCATCCC
	GGCACGAGGCTGGAGACAGCCCTGAGAGGG
	GGAGGCCGCGGGCTGCAGGCGCGGGGCCCCG
	GGGTGGCGGAGCCCTCTGGGCGCCGGGCGAG
	GCTGGAAGGACCTGGGATCCACGATCGGCGC
	AGGCAGCGGCGGGGGCGCAGCGGGCGCCGA
	GGCCTCAGGCCCCACCGTGCGCGCCAGGAGC
	CCGGGGCGCTCACCGGAGCTGCAGGACAGGG
	CCACGCAGAGCCCCAGGAGGGCGGCGAGCTT
	CATGGCGCGGGGGCTCGGGGCGCGCGGGGAA
	CCTGCGGCTGCCCGGGCAAGGCCACGAGGCT
	TCTTATACCCGGTCCTCGCCCCTCCAGCGCCG
	GCCTCGCCCGCGCTCCTGAGAAAGCCCTGCC
	CGCTCCGCTCACGGCCGTGCCCTGGCCAACTT
	CCTGCTGCGGCCGGCGGGCCCTGGGAAGCCC
	GTGCCCCCTTCCCTGCCCGGGCCTCG

SH2B2	GGCCTCCCTGCAGGATGTGGCCAGCCCAGGT	326
	CCCCACTCACGCCCTGCCGTCGCCTTGTTGCA
	GAGCCGGGCCCCACGCCCCCTGCCGCGCCCG
	CGTCCCCGGCCTGCTGGAGCGACTCGCCCGG
	CCAGCACTACTTCTCCAGCCTCGCCGCGGCCG
	CCTGCCCGCCTGCCTCGCCCTCCGACGCCGCC
	GGCGCCTCCTCGTCTTCCGCCTCGTCGTCCTC
	TGCCGCGTcggggcccgcccccccgcgccccgTCGAGGG
	CCAGCTCAGCGCGCGGAGCCGCAGCAACAGC
	GCCGAGCGCCTGCTGGAGGCCGTGGCCGCCA
	CCGCCGCCGAGGAgcccccggaggccgcgcccggccgcgc
	gcgcgccgTGGAGAACCAGTACTCCTTCTACTAG
	CCCGCGGC

MEST; MESTIT1	GGCAGCTGCGCCTCGCAAGCGCAGTGCCGCA	327
	GCGCACGCCGGAGTGGCTGTAGCTgcccggcgcgg
	cgccgccctgcgcgggcTGTGGGCTGCGGGCTGCGCC
	CCCGCTGCTGGCCAGCTCTGCACGGCTGCGG
	GCTCTGCGGCGCCC

TMEM176B; TMEM176A	GCACGCACCCCGAGCTGCCTCCGCACAGTTG	328
	GAGGAGCGTAGGAGGGACCCCCACCCAGGG
	ATGACACTCCAGGAAGGGGACTGCAGAGGAA
	GCCAGGTGCGGCCCCGGCTTTTGACCTACCTC
	CGCACCGCAGCGCGGTCCTTCACGGGGCAGG
	GGCGGCGTGAACCCGTCGGGCGTGAGCAGCA
	GTCGGTGGAGCGGGAGGTCGGCGGTGGCGGG
	GATGGGGGTATCCGGAGCGCAGCCGGGGCGC
	AGCTGCTGGCACAGGAGCTCCACAGGCAGCC
	AAGGACTCGGTCCTGTCCCAGAGCCTGCGGA
	CTGTGGAGGGGAGGCCGCAGGAAGAGCCC

KCNH2	GGGCGATGGGAGCTGGCCGGGCGCGCTGCGG	329
	GGCGGAGAGCCGGGACCCACCAGCGCACGCC
	GCTCCTCCGCGGGCCCGAGCCCTGCCACGTG
	GTTGTCCATGGCTGTCACTTCGTCCAGGGCCA
	GCGACTCGCTGCTGGGTGCCGCGGGCGTCAG
	GTCCACGTCCACCACCAcggcccccggggcgcccgcgc
	cgcccgcgccgcccgACCGCACCGACGACTCCCGGGC

KBTBD11	GGCCACGGACAGCTGGAGCGCCGTGAGGCCC	330
	CTGCGCCAGGCGCGCTCGCAGCTGCGGCTGC
	TGGCCCTGGACGGTCACCTCTACGCCGTGGG
	CGGCGAGTGCCTGCTCAGCGTGGAGCGCTAC
	GAcccgcgcgccgaccgctgggcccccgtggcgccgctgccccggg
	gcgccTTCGCCGTGGCGCATGAGGCCACCACCT
	GCCACGGC

INT.chr8_38508331_38508694	GGCCGCCAGCCCCAGAACAAATGGCGGCTTT	331
	CCCGCTGTATTCAGCTAGTCAGCGTTCCCCGG
	TTAAAAGGCGCTGGGGCAGGAACGGCCGGGG
	CCTTCGGGGGCGCGACGCGGCGACGCCCAGC
	CTGGGAAGGGGCGCGGGGCCCGTGTTGGCCG
	CGGTGGGTCCCGGCTCCCTGGAGGCTGAGCC
	CCGGGCGCTCTTTCCTCGCGGCGCTGCCGTGG
	GGTGGCCGGGAGGGCAGAACGAGGGGCTGC
	GGGACGGTGTTCGGAAGAAAATCGTGCGAGT
	TTAAAAACATCCAAAGTGAGCCGAGCTGGGC
	CCCAAGCCTCGGCCTCGCGCACTCGCCAGGC
	CCAGGAGGCGGAGCAGGCGTC

INT.chr8_48675655_48676143	GGGAATTAGCGTTTTAGTCTGTTCTGCTAACA	332
	ATCGGTGTTTCTCAGTGCCAACCAGTCACAGC
	ACGCGCGGCGCCCAGCCCCTGGTTTCTAAAC
	CCCATTCTGTCGTCCCGGGACGAATGTCTTGG
	GATGTCTGGCTGGGTCCAGGGCAAACATCCT
	GCAGTGACAAAATGTGTGAAAGTGAAGTTGA
	GCAACAAGAGGAACAGCATAGCAGCAGATTG
	TAACCCAACAGATAAAGACATTGTCTGAGTC
	AATGCGTACAGACCCATTATTCTCCGTGAGG
	GAAGTGCGCGTCTTCCCTAGCCGCTACTGTCC
	TCTTTCTGCGCCGCCGGGCTGGGCTCAGTCCG
	CAGTGACCCAGTCTCGTGTAGGTGGGACCAG
	CATCTTCACCGGCCGAGGAGACGCCCCTGGA
	CCACCTGCGTGGGCAGGATCCAGGCAGGCGA
	CAGGGCTCAGGGCTGCAGCCAAGTCCCCCAG
	AAACAGTCCCCCTGGGAC

C9orf3	CTGTGCTTGGAGGAAAGGACGACAGGTTTTA	333
	AAGAGGGAGTGTCATCGCCTGCAGCGGGCGG
	ACCCGTGTCCCGGCAGTGCAGCTCCGCAGGC
	GCAGGAGGGATGCGGGCTGGGGACGCCTTGG
	GGCGGCTGCAGGCTGGGGCGCGCCCCTGCAC
	CCGGCGGGCCTCCGCTGCGTCCACTGCGGAC
	AGGGGTCGGTGAGAGGCCC

C9orf172	GGGGCCGCGCCGAGAAGACCCGTTGGGCCGC	334
	GGCCGCAGCTACGAGAACCTGCTGGGGCGCG
	AGGTGCGGGAGCCGCGAGGCGTGTCCCCCGA
	AGGCCGGCGCCCGCCCGTCGTCGTGAACCTG
	TCCACCTCTCCCAGACGCTACGCC

CLIC3	GGGTTCTTGATGAACGCGGAGAACTTGTGGA	335
	AAACGTCGTTGCCGGCGGTGTTGGACTCCCTG
	TAACGAGGCGCCAGGCTGGGGAAGCTGCGGG
	ATGAGGGGGTGGGACTCCATTAGACTGGGGG
	CAGCCCCGTCCCGGCCCCACAGTACCCCCAC
	AGCGCCTTCCTGGGCTCTGTCTTGCGCGCGTC
	CTCCCTGGGCCCCCCTCTTTTCCCCTCCCACC
	CTGCCGGGGCTCTCACTCGGGCGGCCCCAGC
	GTCTCCTCCAGAAAGTCCTCGATCTGCAGCGT
	GTCTGTCTTGGCGTC

While preferred embodiments of the present invention have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. It is not intended that the invention be limited by the specific examples provided within the specification. While the invention has been described with reference to the aforementioned specification, the descriptions and illustrations of the embodiments herein are not meant to be construed in a limiting sense. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the invention. Furthermore, it shall be understood that all aspects of the invention are not limited to the specific depictions, configurations or relative proportions set forth herein which depend upon a variety of conditions and variables. It should be understood that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention. It is therefore contemplated that the invention shall also cover any such alternatives, modifications, variations or equivalents. It is intended that the following claims define the scope of the invention and that methods and structures within the scope of these claims and their equivalents be covered thereby.

Claims

What is claimed is:

1. A method for analyzing a plurality of deoxyribonucleic (DNA) molecules from prostate cells in a biological sample obtained from a test subject, and providing a treatment to said test subject, said method comprising:

(a) providing a first portion of said plurality of DNA molecules, wherein said first portion comprises DNA molecules with methylated and unmethylated cytosines in CpG dinucleotides, and generating fragments by subjecting said first portion to methylation status-dependent fragmentation conditions at one or more CpG sites sufficient to produce fragments of at least a subset of said DNA molecules of said first portion;

(b) providing a second portion of said plurality of DNA molecules, wherein said second portion is not subjected to said fragmentation conditions;

(c) for one or more genomic regions, processing: (i) said first portion of said plurality of DNA molecules subjected to said fragmentation conditions, or derivatives thereof, to yield a first quantitative measure of DNA methylation, and (ii) said second portion of said plurality of DNA molecules not subjected to said fragmentation conditions, or derivatives thereof, to yield a second quantitative measure of DNA methylation, wherein said one or more genomic regions include genomic coordinates chr5:74907443-74907561 of the ANKDD1B locus;

(d) processing said first quantitative measure of DNA methylation with said second quantitative measure of DNA methylation to yield a third quantitative measure of DNA methylation at said one or more genomic regions in said plurality of DNA molecules, thereby generating a methylation profile of said plurality of DNA molecules at said one or more genomic regions;

(e) processing said methylation profile to indicate a likelihood of said test subject having prostate cancer, wherein processing said methylation profile indicates increased methylation in said genomic region that is chr5:74907443-74907561 in said plurality of DNA molecules as compared to methylation in chr5:74907443-74907561 in a sample obtained from a control subject without prostate cancer, wherein processing said methylation profile indicates an increased likelihood of said test subject having prostate cancer; and

(f) administering to said test subject a therapeutic intervention for treatment of prostate cancer, wherein said therapeutic intervention comprises a surgical prostate tumor resection, a chemotherapy, a radiotherapy, a targeted therapy, or an immunotherapy.

2. The method of claim 1, wherein said biological sample is obtained or derived from a tissue sample, a blood sample, a plasma sample, a serum sample, an exosome sample, or a urine sample.

3. The method of claim 1, further comprising performing an assay selected from the group consisting of methylation-sensitive restriction enzyme (MSRE) digestion, polymerase chain reaction (PCR), quantitative PCR (qPCR), nucleic acid sequencing, target capture, mass spectrometry-based target fragmentation assay, flap endonuclease-based assay, CRISPR-based assay, methylation-specific assay comprising bisulfite treatment, methylation-specific PCR, targeted sequencing, targeted bisulfite sequencing, pyrosequencing, mass spectroscopy-based bisulfite sequencing (EpiTYPER), reduced representation bisulfite sequence (RRBS), whole genome sequencing (WGS), and a combination thereof.

4. The method of claim 1, wherein said fragmentation conditions comprise MSRE digestion at said one or more CpG sites.

5. The method of claim 4, wherein said MSRE comprises HpaII.

6. The method of claim 1, wherein:

processing said first portion of said plurality of DNA molecules subjected to said fragmentation conditions, or derivatives thereof, in (c) (i) comprises amplification; and

processing said second portion of said plurality of DNA molecules not subjected to said fragmentation conditions, or derivatives thereof, in (c) (ii) comprises amplification.

7. The method of claim 6, wherein:

said amplification comprises targeted quantitative polymerase chain reaction (qPCR) at said one or more genomic regions;

processing said first portion of said plurality of DNA molecules subjected to said fragmentation conditions, or derivatives thereof, in (c) (i) comprises determining a first cycle threshold (Ct) value for amplification of said one or more genomic regions; and

processing said second portion of said plurality of DNA molecules not subjected to said fragmentation conditions, or derivatives thereof, in (c) (ii) comprises determining a second cycle threshold (Ct) value for amplification of said one or more genomic regions.

8. The method of claim 7, wherein (c) comprises:

determining a reference Ct value for amplification of one or more reference genomic regions in said first portion of said plurality of DNA molecules subjected to said fragmentation conditions, or derivatives thereof, and in said second portion of said plurality of DNA molecules not subjected to said fragmentation conditions, or derivatives thereof; and

normalizing said first quantitative measure of DNA methylation and said second quantitative measure of DNA methylation using said reference Ct value.

9. The method of claim 7, wherein processing said first quantitative measure of DNA methylation with said second quantitative measure of DNA methylation in (d) comprises calculating an intensity ratio of said first quantitative measure of DNA methylation and said second quantitative measure of DNA methylation at said one or more genomic regions.

10. The method of claim 1, further comprising subjecting said first portion of said plurality of DNA molecules and said second portion of said plurality of DNA molecules to conditions sufficient to permit methylated nucleic acid bases to be distinguished from unmethylated nucleic acid bases.

11. The method of claim 10, wherein said conditions sufficient to permit methylated nucleic acid bases to be distinguished from unmethylated nucleic acid bases comprise performing bisulfite treatment.

12. The method of claim 1, wherein each of said one or more genomic regions comprises one or more CpG sites.

13. The method of claim 1, further comprising processing said methylation profile with one or more reference methylation profiles obtained from reference biological samples of one or more additional subjects, wherein said one or more additional subjects comprise subjects having prostate cancer.

14. A method for analyzing a plurality of deoxyribonucleic (DNA) molecules from prostate cells in a biological sample obtained from a test subject, and providing a treatment to said test subject, said method comprising:

(b) providing a second portion of said plurality of DNA molecules, wherein said second portion is not subjected to said fragmentation conditions, wherein said second portion has a substantially equal amount of DNA molecules as said first portion;

(c) for one or more genomic regions, processing: (i) said first portion of said plurality of DNA molecules subjected to said fragmentation conditions, or derivatives thereof, to yield a first quantitative measure of DNA methylation and; (ii) said second portion of said plurality of DNA molecules not subjected to said fragmentation conditions, or derivatives thereof, to yield a second quantitative measure of DNA methylation, wherein said one or more genomic regions include genomic coordinates chr5:74907443-74907561 of the ANKDD1B locus;

(e) processing said methylation profile to indicate a likelihood of said test subject as having prostate cancer, wherein processing said methylation profile indicates increased methylation in said genomic region that is chr5:74907443-74907561 in said plurality of DNA molecules as compared to methylation in chr5:74907443-74907561 in a sample obtained from a control subject without prostate cancer, wherein processing said methylation profile indicates an increased likelihood of said test subject having prostate cancer; and

(f) administering to said test subject a therapeutic intervention for said treatment of prostate cancer, wherein said therapeutic intervention comprises a surgical prostate tumor resection, a chemotherapy, a radiotherapy, a targeted therapy, or an immunotherapy.

15. A method for processing or analyzing a plurality of deoxyribonucleic (DNA) molecules from a biological sample of a subject, comprising:

(a) providing a first portion of said plurality of DNA molecules, wherein said first portion comprises DNA fragments generated upon subjecting at least a subset of said plurality of DNA molecules to fragmentation conditions sufficient to fragment at least a subset of said plurality of DNA molecules at one or more CpG sites, wherein at least a subset of said DNA fragments comprises methylated nucleic acid bases;

(b) providing a second portion of said plurality of DNA molecules, wherein said second portion has a substantially equal amount of DNA as said first portion;

(c) for one or more genomic regions, processing (i) said first portion of said plurality of DNA molecules or derivatives thereof to yield a first quantitative measure of DNA methylation, and (ii) said second portion of said plurality of DNA molecules or derivatives thereof to yield a second quantitative measure of DNA methylation;

(d) processing said first quantitative measure of DNA methylation with said second quantitative measure of DNA methylation to yield a third quantitative measure of DNA methylation at said one or more genomic regions, thereby generating a methylation profile of said plurality of DNA molecules at said one or more genomic regions;

(e) processing said methylation profile to generate a likelihood of said subject having or being suspected of having prostate cancer; and

(f) providing a subject that is suspected as having or being suspected of having prostate cancer based on said likelihood with a therapeutic intervention, wherein said therapeutic intervention comprises a surgical tumor resection, an effective dose of chemotherapy, an effective dose of radiotherapy, an effective dose of targeted therapy, or an effective dose of immunotherapy,

wherein said one or more genomic regions comprise ANKDD1B with genomic coordinate of chr5:74907443-74907561.

16. The method of claim 1, wherein said one or more genomic regions further comprise genomic coordinates chr5:180017902-180018673 of the SCGB3A1 locus.

17. The method of claim 1, wherein said one or more genomic regions further comprise genomic coordinates chr5:7850160-7850286 of the C5orf49 locus.

18. The method of claim 1, wherein said one or more genomic regions further comprise genomic coordinates chr9:97807476-97807681 of the C9orf3 locus.

19. The method of claim 1, wherein said one or more genomic regions further comprise genomic coordinates chr2:54086834-54087017 of the GPR75-ASB3 locus.

20. The method of claim 1, wherein processing said methylation profile in (e) comprises using a classifier.