US11421284B2 - Methods for predicting drug responsiveness in cancer patients - Google Patents

Methods for predicting drug responsiveness in cancer patients Download PDF

Info

Publication number
US11421284B2
US11421284B2 US16/927,725 US202016927725A US11421284B2 US 11421284 B2 US11421284 B2 US 11421284B2 US 202016927725 A US202016927725 A US 202016927725A US 11421284 B2 US11421284 B2 US 11421284B2
Authority
US
United States
Prior art keywords
seq
cancer
irofulven
patient
biomarkers
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
US16/927,725
Other versions
US20200340067A1 (en
Inventor
Steen Knudsen
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Allarity Therapeutics Europe ApS
Original Assignee
Allarity Therapeutics Europe ApS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Allarity Therapeutics Europe ApS filed Critical Allarity Therapeutics Europe ApS
Priority to US16/927,725 priority Critical patent/US11421284B2/en
Publication of US20200340067A1 publication Critical patent/US20200340067A1/en
Assigned to Oncology Venture ApS reassignment Oncology Venture ApS ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: KNUDSEN, STEEN
Assigned to ONCOLOGY VENTURE PRODUCT DEVELOPMENT APS reassignment ONCOLOGY VENTURE PRODUCT DEVELOPMENT APS CHANGE OF NAME (SEE DOCUMENT FOR DETAILS). Assignors: Oncology Venture ApS
Assigned to Allarity Therapeutics Europe ApS reassignment Allarity Therapeutics Europe ApS CHANGE OF NAME (SEE DOCUMENT FOR DETAILS). Assignors: ONCOLOGY VENTURE PRODUCT DEVELOPMENT APS
Application granted granted Critical
Publication of US11421284B2 publication Critical patent/US11421284B2/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2300/00—Mixtures or combinations of active ingredients, wherein at least one active ingredient is fully defined in groups A61K31/00 - A61K41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/12—Ketones
    • A61K31/122—Ketones having the oxygen directly attached to a ring, e.g. quinones, vitamin K1, anthralin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0012—Galenical forms characterised by the site of application
    • A61K9/0019—Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Definitions

  • the invention features methods to detect the expression levels of genes encoding biomarkers in cancer patients and to predict the responsiveness of cancer patients to irofulven.
  • DNA microarrays have been used to measure gene expression in samples from patients and to facilitate diagnosis of disease. Gene expression can reveal the presence of cancer in a patient in addition to the type, stage, and origin of the cancer. Gene expression may even have a role in predicting the efficacy of cancer therapies.
  • NCI National Cancer Institute
  • the NCI has tested cancer therapeutics for their effect in limiting the growth of 60 human cancer cell lines. The NCI has also measured gene expression in those 60 cancer cell lines using DNA microarrays.
  • Various studies have explored the relationship between gene expression and therapeutic effect using the NCI datasets.
  • the invention features methods for detecting expression of a biomarker (e.g., one, two, three, four, five, ten, twenty, or all of the biomarkers shown in Tables 1-4, such as ATP1B1 (SEQ ID NO: 201)) in a patient having cancer, such as a patient having cancer (e.g., a human) that is resistant to one or more cancer therapies other than irofulven (e.g., a patient with prostate cancer, ovarian cancer, or hepatocellular carcinoma (HCC) that is resistant to one or more cancer therapies other than irofulven), and for determining responsiveness of a cancer patient (e.g., a patient with prostate cancer, ovarian cancer, or HCC) to treatment with irofulven.
  • a biomarker e.g., one, two, three, four, five, ten, twenty, or all of the biomarkers shown in Tables 1-4, such as ATP1B1 (SEQ ID NO: 201)
  • the invention also features methods of treating cancer in a patient in need thereof (e.g., a patient with prostate cancer, ovarian cancer, or HCC or a treatment resistant form thereof) that include administering irofulven to the patient, in which the patient is or has been determined to be responsive to irofulven according to the diagnostic methods described herein.
  • a patient in need thereof e.g., a patient with prostate cancer, ovarian cancer, or HCC or a treatment resistant form thereof
  • irofulven to the patient, in which the patient is or has been determined to be responsive to irofulven according to the diagnostic methods described herein.
  • Exemplary types of cancer that can be diagnosed or treated with the methods include, e.g., prostate cancer, ovarian cancer (e.g., ovarian adenocarcinoma or embryonal carcinoma), liver cancer (e.g., HCC or hepatoma), myeloma (e.g., multiple myeloma), colorectal cancer (e.g., colon cancer and rectal cancer), leukemia (e.g., acute myeloid leukemia, acute lymphoid leukemia, chronic myeloid leukemia, chronic lymphocytic leukemia, acute myeloblastic leukemia, acute promyelocytic leukemia, acute myelomonocytic leukemia, acute monocytic leukemia, acute erythroleukemia, and chronic leukemia), myelodysplastic syndrome, lymphoma (e.g., diffuse large B-cell lymphoma, cutaneous T-cell lymphoma, peripheral T-cell lymphom
  • a first aspect of the invention features a method for detecting expression of a biomarker (e.g., one, two, three, four, five, ten, twenty, or all of the biomarkers shown in Tables 1 and/or 2, such as ATP1B1 (SEQ ID NO: 201)) in a patient having cancer (e.g., prostate cancer, ovarian cancer, or HCC), such as a patient having cancer that is resistant to one or more cancer therapies other than irofulven (e.g., a patient with prostate cancer, ovarian cancer, or HCC that is resistant to one or more cancer therapies other than irofulven).
  • a biomarker e.g., one, two, three, four, five, ten, twenty, or all of the biomarkers shown in Tables 1 and/or 2, such as ATP1B1 (SEQ ID NO: 201)
  • cancer e.g., prostate cancer, ovarian cancer, or HCC
  • cancer e.g., prostate cancer, ovarian
  • the method includes (a) contacting a sample (e.g., a tumor sample) from the patient including one or more nucleic acid molecules with a device (e.g., a microarray) including: i) one or more single-stranded nucleic acid molecules capable of specifically hybridizing with the nucleotides of one or more biomarkers of sensitivity selected from the biomarkers of Tables 1 and 3 (e.g., ATP1B1 (SEQ ID NO: 201)); and/or ii) one or more single-stranded nucleic acid molecules capable of specifically hybridizing with the nucleotides of one or more biomarkers of resistance selected from the biomarkers of Tables 2 and 4 (e.g., IGLC1 (SEQ ID NO: 301, 302, 303, or 318)); and (b) detecting a level of expression of one or more of the biomarker(s) of sensitivity and/or one or more of the biomarkers of resistance by performing microarray analysis or quantitative reverse transcriptas
  • Expression of the biomarker(s) may be detected by determining the level of a messenger RNA (mRNA) transcribed from a nucleic acid molecule corresponding to a gene of the biomarker (s; e.g., a mRNA expressed from the ATP1B1 gene (SEQ ID NO: 201)) or a complementary DNA (cDNA) thereof.
  • mRNA messenger RNA
  • s e.g., a mRNA expressed from the ATP1B1 gene (SEQ ID NO: 201)
  • cDNA complementary DNA
  • a second aspect of the invention features a method of determining responsiveness of a patient having cancer (e.g., one of the cancers noted above, such as prostate cancer, ovarian cancer, or HCC) to irofulven.
  • the patient may have a cancer that is resistant to one or more cancer therapies other than irofulven, such as prostate cancer, ovarian cancer, or HCC that is resistant to one or more cancer therapies other than irofulven.
  • the method includes a) contacting a sample (e.g., a tumor sample) from the patient including one or more nucleic acid molecules with a device (e.g., a microarray or a device for performing a qRT-PCR reaction) including: i) one or more single-stranded nucleic acid molecules capable of specifically hybridizing with the nucleotides of one or more biomarkers of sensitivity selected from the biomarkers of Tables 1 and 3 (e.g., ATP1B1 (SEQ ID NO: 201)); and/or ii) one or more single-stranded nucleic acid molecules capable of specifically hybridizing with the nucleotides of one or more biomarkers of resistance selected from the biomarkers of Tables 2 and 4 (e.g., IGLC1 (SEQ ID NO: 301, 302, 303, or 318)); and b) measuring hybridization, or an amplification product resulting from hybridization, between the one or more nucleic acid molecules from the patient and the single-
  • the patient is determined to be responsive to irofulven if: i) the level of expression of the biomarkers of sensitivity is substantially similar to the level of expression of the biomarkers of sensitivity (e.g., ATP1B1 (SEQ ID NO: 201)) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive to irofulven; and/or ii) the level of expression of the biomarkers of resistance (e.g., IGLC1 (SEQ ID NO: 301, 302, 303, or 318)) is substantially dissimilar to the level of expression of the biomarkers of resistance in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be resistant to irofulven.
  • the level of expression of the biomarkers of sensitivity e.g., ATP1B1 (SEQ ID NO: 201)
  • a cell e.g.,
  • the method of the second aspect can further include administering irofulven to the patient if: i) the level of expression of the biomarkers of sensitivity (e.g., ATP1B1 (SEQ ID NO: 201)) is substantially similar to the level of expression of the biomarkers of sensitivity in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive to irofulven; and/or ii) the level of expression of the biomarkers of resistance (e.g., IGLC1 (SEQ ID NO: 301, 302, 303, OR 318)) is substantially dissimilar to the level of expression of the biomarkers of resistance in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be resistant to irofulven.
  • the level of expression of the biomarkers of sensitivity e.g., ATP1B1 (SEQ ID NO: 201)
  • the method can further include administering one or more cancer therapies other than irofulven to the patient if: i) the level of expression of the biomarkers of sensitivity (e.g., ATP1B1 (SEQ ID NO: 201)) is substantially dissimilar to the level of expression of the biomarkers of sensitivity in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive to irofulven; and/or ii) the level of expression of the biomarkers of resistance is substantially similar to the level of expression of the biomarkers of resistance (e.g., IGLC1 (SEQ ID NO: 301, 302, 303, OR 318)) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be resistant to irofulven.
  • the level of expression of the biomarkers of sensitivity e.g., ATP1B1 (SEQ ID NO: 201)
  • the one or more of the cancer therapies includes surgery, radiation, or a therapeutic agent, such as a docetaxel, cabazitaxel, mitoxantrone, estramustine, prednisone, carboplatin, bevacizumab, paclitaxel, gemcitabine, doxorubicin, topotecan, etoposide, tamoxifen, letrozole, sorafenib, fluorouracil, capecitabine, oxaliplatin, interferon-alpha, 5-fluorouracil (5-FU), a histone deacetylase (HDAC) inhibitor, ipilimumab, bortezomib, carfilzomib, thalidomide, lenalidomide, pomalidomide, dexamethasone, cyclophosphamide, vincristine, melphalan, tegafur, irinotecan, cetuximab,
  • the invention also features a method of treating cancer in a patient in need thereof (e.g., one of the cancers noted above, such as prostate cancer, ovarian cancer, or HCC) that includes administering irofulven to the patient, in which the patient has been determined to be responsive to irofulven according to the method of the first or second aspect of the invention.
  • the patient may have a cancer that is resistant to one or more cancer therapies other than irofulven (e.g., a patient with prostate cancer, ovarian cancer, or HCC that is resistant to one or more cancer therapies other than irofulven).
  • a third aspect of the invention features a method of treating a patient having cancer (e.g., one of the cancers noted above, such as prostate cancer, ovarian cancer, or HCC).
  • the patient may have a cancer that is resistant to one or more cancer therapies other than irofulven (e.g., a patient with prostate cancer, ovarian cancer, or HCC that is resistant to one or more cancer therapies other than irofulven).
  • the method includes a) contacting a sample (e.g., a tumor sample) from the patient including one or more nucleic acid molecules with a device (e.g., a microarray or a device for performing a qRT-PCR reaction) including: i) one or more single-stranded nucleic acid molecules capable of specifically hybridizing with the nucleotides of one or more biomarkers of sensitivity selected from the biomarkers of Tables 1 and 3 (e.g., ATP1B1 (SEQ ID NO: 201)); and/or ii) one or more single-stranded nucleic acid molecules capable of specifically hybridizing with the nucleotides of one or more biomarkers of resistance selected from the biomarkers of Tables 2 and 4 (e.g., IGLC1 (SEQ ID NO: 301, 302, 303, OR 318)); and b) measuring hybridization, or an amplification product resulting from hybridization, between the one or more nucleic acid molecules from the patient and the single-
  • the method of the third aspect of the invention may further include administering one or more additional therapies (e.g., surgery, radiation, or a therapeutic agent) to the patient prior to, concurrently with, or after administration of irofulven.
  • the therapeutic agent may be selected from the group consisting of docetaxel, cabazitaxel, mitoxantrone, estramustine, prednisone, carboplatin, bevacizumab, paclitaxel, gemcitabine, doxorubicin, topotecan, etoposide, tamoxifen, letrozole, sorafenib, fluorouracil, capecitabine, oxaliplatin, interferon-alpha, 5-fluorouracil (5-FU), a histone deacetylase (HDAC) inhibitor, ipilimumab, bortezomib, carfilzomib, thalidomide, lenalidomide, pomalidomide
  • the therapeutic agent can be administered parenterally (e.g. intravenously, intramuscularly, transdermally, intradermally, intra-arterially, intracranially, subcutaneously, intraorbitally, intraventricularly, intraspinally, intraperitoneally, or intranasally), enterally, or topically.
  • parenterally e.g. intravenously, intramuscularly, transdermally, intradermally, intra-arterially, intracranially, subcutaneously, intraorbitally, intraventricularly, intraspinally, intraperitoneally, or intranasally
  • enterally e.g. intravenously, intramuscularly, transdermally, intradermally, intra-arterially, intracranially, subcutaneously, intraorbitally, intraventricularly, intraspinally, intraperitoneally, or intranasally.
  • irofulven may be administered parenterally (e.g. intravenously, intramuscularly, transdermally, intradermally, intra-arterially, intracranially, subcutaneously, intraorbitally, intraventricularly, intraspinally, intraperitoneally, or intranasally), enterally, or topically.
  • parenterally e.g. intravenously, intramuscularly, transdermally, intradermally, intra-arterially, intracranially, subcutaneously, intraorbitally, intraventricularly, intraspinally, intraperitoneally, or intranasally
  • enterally or topically.
  • irofulven is administered by intravenous injection.
  • Irofulven may be administered to the patient two or more times, such as one or more times daily, weekly, every two weeks, every three weeks, or monthly (e.g., one or more times per week for two weeks or more).
  • a second dose of irofulven may be administered to the patient two weeks, three weeks, four weeks, or five weeks after administration of a prior dose of irofulven.
  • irofulven is administered in a 3 week treatment regimen in which the irofulven is administered on day 1 an day 8.
  • the treatment regimen may be repeated two to twenty times or more, as needed.
  • irofulven may be administered to the patient at a dose of about 0.05 mg/kg to 5 mg/kg, such as at a dose of about 0.1 mg/kg to 1 mg/kg.
  • irofulven may be administered at a dose of about 0.15 mg/kg, 0.20 mg/kg, 0.25 mg/kg, 0.30 mg/kg, 0.35 mg/kg, 0.40 mg/kg, 0.45 mg/kg, 0.55 mg/kg, 0.60 mg/kg, 0.65 mg/kg, 0.70 mg/kg, 0.75 mg/kg, 0.80 mg/kg, 0.85 mg/kg, 0.90 mg/kg, or 0.95 mg/kg.
  • Irofulven may be administered to the patient in a treatment regimen at least once per week for at least two weeks and/or on day 1 and day 8 of a 3 week treatment regimen, in which the treatment regimen occurs one or more times (e.g., the treatment regimen is repeated two to twenty times).
  • irofulven is administered to the patient at a dose of about 0.1 mg/kg to 1 mg/kg, such as a dose of about 0.2 mg/kg to about 0.6 mg/kg (e.g., a dose of about 0.45 mg/kg).
  • This dosage of irofulven can be administered in a 3 week treatment regimen, in which irofulven is administered on day 1 and day 8.
  • the contacting step (a) and the measuring step (b) may occur prior to, concurrent with, or after administration of irofulven to the patient. Additionally, the contacting step (a) and the measuring step (b) may occur two or more times, e.g., during treatment with irofulven. For example, the contacting step (a) and the measuring step (b) may occur two or more times to assess the continued sensitivity of the patient to irofulven.
  • the device can include at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more single-stranded nucleic acid molecules capable of specifically hybridizing with the nucleotides of one or more biomarkers of sensitivity selected from the biomarkers of Tables 1 and 3 (e.g., ATP1B1 (SEQ ID NO: 201)); and/or at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more single-stranded nucleic acid molecules capable of specifically hybridizing with the nucleotides of one or more biomarkers of resistance selected from the biomarkers of Tables 2 and 4 (e.g., IGLC1 (SEQ ID NO: 301, 302, 303, OR 318)).
  • one or more of the single-stranded nucleic acid molecules of the device have a length
  • the method may include converting the level of expression of one or more of the biomarkers of sensitivity (e.g., one, two, three, four, five, ten, twenty, or all of the biomarkers shown in Tables 1 and 3, such as ATP1B1 (SEQ ID NO: 201)) and/or one or more of the biomarkers of resistance (e.g., one, two, three, four, five, ten, twenty, or all of the biomarkers shown in Tables 2 and 4, such as IGLC1 (SEQ ID NO: 301, 302, 303, OR 318)) into a mean score, in which the mean score indicates the responsiveness of the patient to irofulven.
  • the biomarkers of sensitivity e.g., one, two, three, four, five, ten, twenty, or all of the biomarkers shown in Tables 1 and 3, such as ATP1B1 (SEQ ID NO: 201)
  • one or more of the biomarkers of resistance e.g., one, two, three,
  • the method can further include subtracting the mean score for one or more of the biomarkers of resistance (e.g., one, two, three, four, five, ten, twenty, or all of the biomarkers shown in Tables 2 and 4, such as IGLC1 (SEQ ID NO: 301, 302, 303, OR 318)) from the mean score for one or more of the biomarkers of sensitivity (e.g., one, two, three, four, five, ten, twenty, or all of the biomarkers shown in Tables 1 and 3, such as ATP1B1 (SEQ ID NO: 201)) to obtain a difference score, in which the difference score indicates the responsiveness of the patient to irofulven.
  • the biomarkers of resistance e.g., one, two, three, four, five, ten, twenty, or all of the biomarkers shown in Tables 2 and 4, such as IGLC1 (SEQ ID NO: 301, 302, 303, OR 318)
  • the mean score and/or the difference score above a cutoff value indicates that the patient is responsive to irofulven, such as if the cutoff value is about 0.1, about 0.15, about 0.2, about 0.25, about 0.3, about 0.35, about 0.4, about 0.45, about 0.5, or greater.
  • the biomarker of sensitivity may be selected from one or more of ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), ID1 (SEQ ID NO: 217), and GJA1 (SEQ ID NO: 218).
  • ATP1B1 SEQ ID NO: 201 or 219
  • UCHL1 SEQ ID NO: 202
  • the biomarker of resistance may be selected from one or more of IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), CD53 (SEQ ID NO: 310), MZB1 (SEQ ID NO: 313), RASSF5 (SEQ ID NO: 314 or 386), FAM46C (SEQ ID NO: 315), RCSD1 (SEQ ID NO: 316), IGJ (SEQ ID NO: 317), LPXN (SEQ ID NO: 319), ITGB7 (SEQ ID NO: 320), and GTSF1 (SEQ ID NO: 321).
  • IGLC1 SEQ ID NO: 301, 302, 303, or 3108
  • LAPTM5 SEQ ID
  • the biomarkers of sensitivity may include ATP1B1 (SEQ ID NO: 201 or 219) and UCHL1 (SEQ ID NO: 202).
  • the biomarkers of sensitivity may include ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), and PTGR1 (SEQ ID NO: 203 or 210).
  • the biomarkers of sensitivity may include ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), and NME7 (SEQ ID NO: 204).
  • the biomarkers of sensitivity may include ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), and PLS3 (SEQ ID NO: 205).
  • the biomarkers of sensitivity may include ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), and S100A10 (SEQ ID NO: 206).
  • the biomarkers of sensitivity may include ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), and CD24 (SEQ ID NO: 207 or 209 or 220).
  • ATP1B1 SEQ ID NO: 201 or 219
  • UCHL1 SEQ ID NO: 202
  • PTGR1 SEQ ID NO: 203 or 210
  • NME7 SEQ ID NO: 204
  • PLS3 SEQ ID NO: 205
  • S100A10 SEQ ID NO: 206
  • CD24 SEQ ID NO: 207 or 209 or 220.
  • the biomarkers of sensitivity may include ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), and NQO1 (SEQ ID NO: 208 or 216).
  • ATP1B1 SEQ ID NO: 201 or 219
  • UCHL1 SEQ ID NO: 202
  • PTGR1 SEQ ID NO: 203 or 210
  • NME7 SEQ ID NO: 204
  • PLS3 SEQ ID NO: 205
  • S100A10 SEQ ID NO: 206
  • CD24 SEQ ID NO: 207, 209, or 220
  • NQO1 SEQ ID NO: 208 or 216
  • the biomarkers of sensitivity may include ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), and MYOF (SEQ ID NO: 211).
  • ATP1B1 SEQ ID NO: 201 or 219
  • UCHL1 SEQ ID NO: 202
  • PTGR1 SEQ ID NO: 203 or 210
  • NME7 SEQ ID NO: 204
  • PLS3 SEQ ID NO: 205
  • S100A10 SEQ ID NO: 206
  • CD24 SEQ ID NO: 207, 209, or 220
  • NQO1 SEQ ID NO: 208 or
  • the biomarkers of sensitivity may include ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), and LAPTM4B (SEQ ID NO: 212).
  • ATP1B1 SEQ ID NO: 201 or 219
  • UCHL1 SEQ ID NO: 202
  • PTGR1 SEQ ID NO: 203 or 210
  • NME7 SEQ ID NO: 204
  • PLS3 SEQ ID NO: 205
  • S100A10 SEQ ID NO: 206
  • CD24 SEQ ID NO: 207, 209, or 220
  • the biomarkers of sensitivity may include ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), and CALD1 (SEQ ID NO: 213).
  • the biomarkers of sensitivity may include ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), and PDGFC (SEQ ID NO: 214).
  • ATP1B1 SEQ ID NO: 201 or 219
  • UCHL1 SEQ ID NO: 202
  • PTGR1 SEQ ID NO: 203 or 210
  • NME7 SEQ ID NO: 204
  • PLS3 SEQ ID NO: 205
  • S100A10
  • the biomarkers of sensitivity may include ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), and BASP1 (SEQ ID NO: 215).
  • ATP1B1 SEQ ID NO: 201 or 219
  • UCHL1 SEQ ID NO: 202
  • PTGR1 SEQ ID NO: 203 or 210
  • NME7 SEQ ID NO: 204
  • PLS3 S
  • the biomarkers of sensitivity may include ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), and ID1 (SEQ ID NO: 217).
  • ATP1B1 SEQ ID NO: 201 or 219
  • UCHL1 SEQ ID NO: 202
  • PTGR1 SEQ ID NO: 203 or 210
  • NME7 SEQ
  • the biomarkers of sensitivity may include ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), ID1 (SEQ ID NO: 217), and GJA1 (SEQ ID NO: 218).
  • ATP1B1 SEQ ID NO: 201 or 219
  • UCHL1 SEQ ID NO: 202
  • PTGR1 SEQ ID NO:
  • the biomarkers of resistance may include IGLC1 (SEQ ID NO: 301, 302, 303, or 318) and LAPTM5 (SEQ ID NO: 304 or 338).
  • the biomarkers of resistance may include IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), and ARHGDIB (SEQ ID NO: 305 or 311).
  • the biomarkers of resistance may include IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), and SLC43A3 (SEQ ID NO: 307).
  • the biomarkers of resistance may include IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), and LCP1 (SEQ ID NO: 308).
  • the biomarkers of resistance may include IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), and HCLS1 (SEQ ID NO: 309).
  • the biomarkers of resistance may include IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), and CD53 (SEQ ID NO: 310).
  • the IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), CD53 (SEQ ID NO: 310), and MZB1 (SEQ ID NO: 313).
  • the biomarkers of resistance may include IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), CD53 (SEQ ID NO: 310), MZB1 (SEQ ID NO: 313), and RASSF5 (SEQ ID NO: 314 or 386).
  • IGLC1 SEQ ID NO: 301, 302, 303, or 3108
  • LAPTM5 SEQ ID NO: 304 or 338
  • ARHGDIB SEQ ID NO: 305 or 311
  • SLC43A3 SEQ ID NO: 307
  • LCP1 SEQ ID NO: 308
  • HCLS1 SEQ ID NO: 309
  • CD53 SEQ ID NO: 310
  • MZB1
  • the biomarkers of resistance may include IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), CD53 (SEQ ID NO: 310), MZB1 (SEQ ID NO: 313), RASSF5 (SEQ ID NO: 314 or 386), and FAM46C (SEQ ID NO: 315).
  • IGLC1 SEQ ID NO: 301, 302, 303, or 318
  • LAPTM5 SEQ ID NO: 304 or 338
  • ARHGDIB SEQ ID NO: 305 or 311
  • SLC43A3 SEQ ID NO: 307
  • LCP1 SEQ ID NO: 308
  • HCLS1 SEQ ID NO: 309
  • CD53
  • the biomarkers of resistance may include IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), CD53 (SEQ ID NO: 310), MZB1 (SEQ ID NO: 313), RASSF5 (SEQ ID NO: 314 or 386), FAM46C (SEQ ID NO: 315), and RCSD1 (SEQ ID NO: 316).
  • the biomarkers of resistance may include IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), CD53 (SEQ ID NO: 310), MZB1 (SEQ ID NO: 313), RASSF5 (SEQ ID NO: 314 or 386), FAM46C (SEQ ID NO: 315), RCSD1 (SEQ ID NO: 316), and IGJ (SEQ ID NO: 317).
  • the biomarkers of resistance may include IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), CD53 (SEQ ID NO: 310), MZB1 (SEQ ID NO: 313), RASSF5 (SEQ ID NO: 314 or 386), FAM46C (SEQ ID NO: 315), RCSD1 (SEQ ID NO: 316), IGJ (SEQ ID NO: 317), and LPXN (SEQ ID NO: 319).
  • the biomarkers of resistance may include IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), CD53 (SEQ ID NO: 310), MZB1 (SEQ ID NO: 313), RASSF5 (SEQ ID NO: 314 or 386), FAM46C (SEQ ID NO: 315), RCSD1 (SEQ ID NO: 316), IGJ (SEQ ID NO: 317), LPXN (SEQ ID NO: 319), and ITGB7 (SEQ ID NO: 320).
  • IGLC1 SEQ ID NO: 301, 302, 303, or 3108
  • LAPTM5 SEQ ID NO: 304 or 338
  • ARHGDIB SEQ ID
  • the biomarkers of resistance may include IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), CD53 (SEQ ID NO: 310), MZB1 (SEQ ID NO: 313), RASSF5 (SEQ ID NO: 314 or 386), FAM46C (SEQ ID NO: 315), RCSD1 (SEQ ID NO: 316), IGJ (SEQ ID NO: 317), LPXN (SEQ ID NO: 319), ITGB7 (SEQ ID NO: 320), and GTSF1 (SEQ ID NO: 321).
  • the device can be a microarray, such as a deoxyribonucleic acid (DNA)-based platform.
  • the device can be for performing a qRT-PCR reaction (e.g., the device is used with a system for detecting the amplification product, for example, by fluorescence or by another method).
  • the methods may also utilize both a microarray and a qRT-PCR.
  • the expression level of the biomarkers of sensitivity e.g., one, two, three, four, five, ten, twenty, or all of the biomarkers shown in Tables 1 and 3, such as ATP1B1 (SEQ ID NO: 201)
  • the biomarkers of resistance e.g., one, two, three, four, five, ten, twenty, or all of the biomarkers shown in Tables 2 and 4, such as IGLC1 (SEQ ID NO: 301, 302, 303, OR 318)
  • IGLC1 SEQ ID NO: 301, 302, 303, OR 318
  • the level of expression of one or more of the biomarkers of sensitivity and/or one or more of the biomarkers of resistance is determined by detecting the level of mRNA transcribed from one or more genes encoding one or more of the biomarkers of Tables 1-4.
  • the cancer is selected from a solid tumor cancer and a hematological cancer.
  • the cancer is prostate cancer, ovarian cancer, HCC, multiple myeloma, breast cancer, acute myelogenous leukemia (AML), acute lympho-blastic leukemia (ALL), chronic lymphocytic leukemia (CLL), myelodysplastic syndrome (MDS), chronic myelogenous leukemia-chronic phase (CMLCP), diffuse large B-cell lymphoma (DLBCL), cutaneous T-cell lymphoma (CTCL), peripheral T-cell lymphoma (PTCL), Hodgkin's lymphoma, cervical cancer, renal cell carcinoma (RCC), esophageal cancer, melanoma, glioma, pancreatic cancer, gastrointestinal stromal tumors (GIST), sarcoma, estrogen receptor-positive (ERpos) breast cancer, non-small cell lung carcinoma (NSCLC), colon cancer, bladder cancer, or
  • AML acute myelogenous
  • the cancer is prostate cancer, such as prostate cancer that is resistant to one or more cancer therapies other than irofulven.
  • the cancer may also be ovarian cancer, such as ovarian cancer that is resistant to one or more cancer therapies other than irofulven.
  • the cancer may be HCC, such as HCC that is resistant to one or more cancer therapies other than irofulven.
  • the patient may exhibit cancer relapse (e.g., relapse of prostate cancer, ovarian cancer, or HCC), such as relapse after treatment with a therapeutic agent other than irofulven.
  • cancer relapse e.g., relapse of prostate cancer, ovarian cancer, or HCC
  • the patient may exhibit cancer relapse prior to treatment with irofulven.
  • the patient may have not been administered a treatment for cancer.
  • biomarker is meant a nucleic acid molecule (e.g., a mRNA or its complement, for example, a cDNA) or a protein encoded by the nucleic acid molecule present in, or from, a cell or tissue.
  • the expression of the biomarker correlates to the responsiveness (e.g., sensitivity or resistance) of the cell or tissue (and thus, the patient in which the cell or tissue resides or the patient from which the cell or tissue was obtained) to a cancer treatment (e.g., irofulven).
  • a biomarker of sensitivity is a nucleic acid molecule (e.g., a mRNA or its complement) expressed from any one of the genes shown in Tables 1 and 3, or the protein encoded by the nucleic acid molecule
  • a biomarker of resistance is a nucleic acid molecule (e.g., a mRNA or its complement) expressed from any one of the genes shown in Tables 2 and 4, or the protein encoded by the nucleic acid molecule.
  • cancer refers to or describe the physiological condition in mammals (e.g., humans) that is typically characterized by unregulated cell proliferation.
  • examples of cancer include, but are not limited to, prostate cancer, ovarian cancer (e.g., ovarian adenocarcinoma or embryonal carcinoma), liver cancer (e.g., hepatocellular carcinoma (HCC) or hepatoma), myeloma (e.g., multiple myeloma), colorectal cancer (e.g., colon cancer and rectal cancer), leukemia (e.g., acute myeloid leukemia, acute lymphoid leukemia, chronic myeloid leukemia, chronic lymphocytic leukemia, acute myeloblastic leukemia, acute promyelocytic leukemia, acute myelomonocytic leukemia, acute monocytic leukemia, acute erythroleukemia, and chronic leukemia), myelodysplastic syndrome, lymph
  • cancer includes solid tumors (e.g., prostate cancer, ovarian cancer, or hepatocellular carcinoma (HCC)) and hematological cancers (e.g., cancer of the blood, such as lymphoma (e.g., cutaneous T-cell lymphoma (CTCL))).
  • solid tumors e.g., prostate cancer, ovarian cancer, or hepatocellular carcinoma (HCC)
  • HCC hepatocellular carcinoma
  • hematological cancers e.g., cancer of the blood, such as lymphoma (e.g., cutaneous T-cell lymphoma (CTCL))).
  • lymphoma e.g., cutaneous T-cell lymphoma (CTCL)
  • expression level and “level of expression,” as used herein, refer to the amount of a gene product in a cell, tissue, biological sample, organism, or patient, e.g., amounts of DNA, RNA (e.g. messenger RNA (mRNA)), or proteins corresponding to a given gene.
  • RNA e.g. messenger RNA (mRNA)
  • proteins corresponding to a given gene e.g., proteins corresponding to a given gene.
  • Gene indicates a coding or noncoding gene whose activity can be determined by measuring the produced RNA. Examples include protein coding genes, microRNAs, small nuclear RNAs and other RNAs with catalytic, regulatory or coding properties.
  • inhibit growth means causing a reduction in cell growth (e.g., cancer cell growth, such as the NCI60 cancer cell lines) in vivo or in vitro by, e.g., 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 99% or more, as evident by a reduction in the proliferation of cells exposed to a treatment (e.g., irofulven), relative to the proliferation of cells in the absence of the treatment.
  • a treatment e.g., irofulven
  • Growth inhibition may be the result of a treatment (e.g., irofulven) that induces apoptosis in a cell, induces necrosis in a cell, slows cell cycle progression, disrupts cellular metabolism, induces cell lysis, or induces some other mechanism that reduces the proliferation of cells.
  • a treatment e.g., irofulven
  • Irofulven refers to an antitumor agent that is a cytotoxic semi-synthetic derivative of illudin S, a sesquiterpene toxin found in the Jack ‘o’ Lantern mushroom.
  • Irofulven or 6-hydroxymethylacylfulvene is an alkylating agent that initiates the apoptotic degradation of DNA leading to cell death.
  • Irofulven ((6R)-6′-hydroxy-3′-(hydroxymethyl)-2′,4′,6′-trimethylspiro[cyclopropane-1,5′-inden]-7′(6′H)-one) has the structural molecular formula shown below:
  • “Microarray” as used herein means a device employed by any method that quantifies one or more subject oligonucleotides, e.g., RNA, DNA, cDNA, or analogues thereof, at a time.
  • DNA microarrays including those made by Affymetrix (e.g., an Affymetrix HG-U133A or HG-U133_Plus_2 array), use several probes for determining the expression of a single gene.
  • the DNA microarray may contain oligonucleotide probes that may be, e.g., full-length cDNAs complementary to an RNA or cDNA fragments that hybridize to part of an RNA.
  • the DNA microarray may also contain modified versions of DNA or RNA, such as locked nucleic acids or LNA.
  • Exemplary RNAs include mRNA, miRNA, and miRNA precursors.
  • percent (%) sequence identity refers to the percentage of nucleic acid residues of a candidate sequence, e.g., a probe or primer of the invention, that are identical to the nucleic acid residues of a reference sequence, e.g., a biomarker sequence of the invention, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity (e.g., gaps can be introduced in one or both of the candidate and reference sequences for optimal alignment and non-homologous sequences can be disregarded for comparison purposes).
  • Alignment for purposes of determining percent sequence identity can be achieved in various ways that are within the skill in the art, for instance, using computer software, such as BLAST, BLAST-2, BLAST-P, BLAST-N, BLAST-X, WU-BLAST-2, ALIGN, ALIGN-2, CLUSTAL, Megalign (DNASTAR).
  • computer software such as BLAST, BLAST-2, BLAST-P, BLAST-N, BLAST-X, WU-BLAST-2, ALIGN, ALIGN-2, CLUSTAL, Megalign (DNASTAR).
  • those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve optimal alignment over the length of the sequences being compared.
  • NCI60 as used herein means a panel of 60 cancer cell lines from lung, colon, breast, ovarian, leukemia, renal, melanoma, prostate and brain cancers including the following cancer cell lines: NSCLC_NCIH23, NSCLC_NCIH522, NSCLC_A549ATCC, NSCLC_EKVX, NSCLC_NCIH226, NSCLC_NCIH332M, NSCLC_H460, NSCLC_HOP62, NSCLC_HOP92, COLON_HT29, COLON_HCC-2998, COLON_HCT116, COLON_SW620, COLON_COLO205, COLON_HCT15, COLON_KM12, BREAST_MCF7, BREAST_MCF7ADRr, BREAST_MDAMB231, BREAST_HS578T, BREAST_MDAMB435, BREAST_MDN, BREAST_BT549, BREAST_T47
  • patient refers to any animal (e.g., a mammal, such as a human).
  • a patient to be treated or tested for responsiveness to a treatment e.g., irofulven
  • a treatment e.g., irofulven
  • a cancer such as those described herein, e.g., prostate cancer, ovarian cancer, or hepatocellular carcinoma (HCC).
  • Diagnosis may be performed by any method or techniques known in the art, such as x-ray, MRI, or biopsy, and confirmed by a physician.
  • the patient may be determined to be either responsive or non-responsive to a cancer treatment, such as irofulven, according to the methods described herein.
  • Resistant or “resistance” as used herein means that a cell (e.g., a cancer cell), a tissue (e.g., a tumor), or a patient having cancer (e.g., a human having cancer) is able to withstand treatment with an anti-cancer agent (e.g., irofulven).
  • an anti-cancer agent e.g., irofulven
  • the treatment does not inhibit the growth of a cancer cell in vitro by about 70%, 80%, 90%, 95%, 99% or 100% relative to the growth of a cancer cell not exposed to the treatment.
  • Resistance to treatment may be determined by a cell proliferation assay, e.g., a cell-based assay, which measures the growth of treated cells as a function of the absorbance of the cells of an incident light beam, such as the NCI60 assays described herein. In this assay, greater absorbance indicates greater cell growth, and thus, resistance to the treatment.
  • a cell proliferation assay e.g., a cell-based assay, which measures the growth of treated cells as a function of the absorbance of the cells of an incident light beam, such as the NCI60 assays described herein. In this assay, greater absorbance indicates greater cell growth, and thus, resistance to the treatment.
  • a cancer patient may also have resistance to a cancer therapy other than irofulven, such as surgery, radiation, or a therapeutic agent (e.g., docetaxel, cabazitaxel, mitoxantrone, estramustine, prednisone, carboplatin, bevacizumab, paclitaxel, gemcitabine, doxorubicin, topotecan, etoposide, tamoxifen, letrozole, sorafenib, fluorouracil, capecitabine, oxaliplatin, interferon-alpha, or 5-fluorouracil (5-FU)).
  • a therapeutic agent e.g., docetaxel, cabazitaxel, mitoxantrone, estramustine, prednisone, carboplatin, bevacizumab, paclitaxel, gemcitabine, doxorubicin, topotecan, etoposide, tamoxif
  • responsive refers to the likelihood that a cancer treatment (e.g., irofulven) has (e.g., induces) a desired effect, or, alternatively, refer to the strength of a desired effect caused or induced by the treatment in a cell (e.g., a cancer cell), a tissue (e.g., a tumor), or a patient having cancer (e.g., a human having cancer).
  • a cancer treatment e.g., irofulven
  • induces a desired effect
  • the desired effect can include inhibition of the growth of a cancer cell in vitro by more than 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% relative to the growth of a cancer cell not exposed to the treatment.
  • the desired effect can also include reduction in tumor mass by, e.g., about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%.
  • Responsiveness to treatment may be determined by a cell proliferation assay, e.g., a cell-based assay, which measures the growth of treated cells as a function of the absorbance of the cells of an incident light beam, such as the NCI60 assays described herein. In this assay, lesser absorbance indicates lesser cell growth, and thus, sensitivity to the treatment. A greater reduction in growth indicates more sensitivity to the treatment.
  • responsiveness is a measure of the sensitivity or resistance of a patient to a treatment for cancer (e.g., irofulven).
  • sample refers to any specimen (such as cells, tissue (e.g., a tissue sample obtained by biopsy), blood, serum, plasma, urine, cerebrospinal fluid, or pancreatic fluid) taken from a subject.
  • tissue e.g., a tissue sample obtained by biopsy
  • blood serum, plasma, urine, cerebrospinal fluid, or pancreatic fluid
  • pancreatic fluid a specimen taken from a subject.
  • the sample is taken from a portion of the body affected by a cancer (e.g., a biopsy of the cancer tissue, such as prostate, ovarian, or lung cancer tissue).
  • Biopsy may involve fine needle aspiration biopsy, core needle biopsy (e.g., stereotactic core needle biopsy, vacuum-assisted core biopsy, or magnetic resonance imaging (MRI) guided biopsy), or surgical biopsy (e.g., incisional biopsy or excisional biopsy).
  • core needle biopsy e.g., stereotactic core needle biopsy, vacuum-assisted core biopsy, or magnetic resonance imaging (MRI) guided biopsy
  • the sample may undergo additional purification and processing, for example, to remove cell debris and other unwanted molecules. Additional processing may further involve amplification, e.g., using PCR (RT-PCR).
  • PCR PCR
  • the standard methods of sample purification, such as removal of unwanted molecules, are known in the art.
  • “Sensitive” and “sensitivity” as used herein refer to a cell (e.g., a cancer cell), a tissue (e.g., a tumor), or a patient having cancer (e.g., a human having cancer) that is responsive to treatment, such as an anti-cancer agent (e.g., irofulven) or radiation treatment.
  • the treatment inhibits the growth of a cancer cell in vitro by about 70%, 80%, 90%, 95%, 99% or 100% relative to the growth of a cancer cell not exposed to the treatment.
  • Sensitivity to treatment may be determined by a cell proliferation assay, e.g., a cell-based assay, which measures the growth of treated cells as a function of the absorbance of the cells of an incident light beam, such as the NCI60 assays described herein. In this assay, lesser absorbance indicates lesser cell growth, and thus, sensitivity to the treatment.
  • a cell proliferation assay e.g., a cell-based assay, which measures the growth of treated cells as a function of the absorbance of the cells of an incident light beam, such as the NCI60 assays described herein.
  • Treatment refers to administering or exposing a patient having cancer (e.g., a human), a cell, or a tumor to an anti-cancer agent (e.g., a drug, a protein, an antibody, a nucleic acid, a chemotherapeutic agent, or a radioactive agent), or to some other form of medical intervention used to treat or prevent a disease, disorder, or condition (e.g., surgery, cryotherapy, radiation therapy, or combinations thereof).
  • a medical treatment can include irofulven.
  • the cancer to be treated is a solid tumor or a hematological cancer.
  • cancer examples include, e.g., prostate cancer, ovarian cancer (e.g., ovarian adenocarcinoma or embryonal carcinoma), liver cancer (e.g., hepatocellular carcinoma (HCC) or hepatoma), myeloma (e.g., multiple myeloma), colorectal cancer (e.g., colon cancer and rectal cancer), leukemia (e.g., acute myeloid leukemia, acute lymphoid leukemia, chronic myeloid leukemia, chronic lymphocytic leukemia, acute myeloblastic leukemia, acute promyelocytic leukemia, acute myelomonocytic leukemia, acute monocytic leukemia, acute erythroleukemia, and chronic leukemia), myelodysplastic syndrome, lymphoma (e.g., diffuse large B-cell lymphoma, cutaneous T-cell lymphoma, peripheral T-cell lymphoma, Hod
  • Radiation therapy includes the administration of a radioactive agent to a patient or exposure of a patient to radiation.
  • the radiation may be generated from sources such as particle accelerators and related medical devices or agents that emit, e.g., X-radiation, gamma radiation, or electron (Beta radiation) beams.
  • a treatment may be or further include surgery, e.g., to remove a tumor from a subject or living organism.
  • FIG. 1 is a graph grouping predicted sensitivity to irofulven by cancer type.
  • Each gray circle represents the predicted irofulven sensitivity of one patient calculated as the difference between the mean of the expression levels of the biomarkers of sensitivity and the mean of the expression levels of the biomarkers of resistance for the patient.
  • Patients are grouped according to cancer type.
  • the median predicted sensitivity (black bar) for a cancer type is related to the relative response rate for that cancer type.
  • the predictions are used for relative comparisons to compare cancer types and cannot be used for absolute predictions of response rate for a given cancer type.
  • the predictions are normalized to a scale of 0 to 100 for all 3,522 patients.
  • the expression levels of the biomarkers shown in Tables 1-4 may be detected in a patient having cancer and are useful for predicting the responsiveness of the patient to irofulven.
  • These patients may already be determined to be resistance to a therapy other than irofulven, such as docetaxel, cabazitaxel, mitoxantrone, estramustine, prednisone, carboplatin, bevacizumab, paclitaxel, gemcitabine, doxorubicin, topotecan, etoposide, tamoxifen, letrozole, sorafenib, fluorouracil, capecitabine, oxaliplatin, interferon-alpha, 5-fluorouracil (5-FU), a histone deacetylase (HDAC) inhibitor, ipilimumab, bortezomib, carfilzomib, thalidomide, lenalidomide, pomalidomide
  • a device such as a microarray, with one or more single-stranded oligonucleotide probes that have substantial identity (e.g., at least 85%, 90%, 95%, 99%, or 100% sequence identity) to a sequence that is complementary or identical to the nucleic acid sequence of one or more biomarkers shown in Tables 1-4 can be used according to the methods described herein to assess the responsiveness of a cancer patient to treatment with irofulven.
  • substantial identity e.g., at least 85%, 90%, 95%, 99%, or 100% sequence identity
  • the probes can be used to detect one or more (e.g., two, three, four, five, ten, twenty, or all) of the biomarkers of sensitivity listed in Tables 1 and 3, such as ATP1B1 (SEQ ID NO: 201 or 219), in a sample (e.g., a tumor sample) from a patient having cancer (e.g., prostate cancer, ovarian cancer, or hepatocellular carcinoma (HCC)).
  • a sample e.g., a tumor sample
  • cancer e.g., prostate cancer, ovarian cancer, or hepatocellular carcinoma (HCC)
  • the probes can be used to detect one or more (e.g., two, three, four, five, ten, twenty, or all) of the biomarkers of resistance listed in Tables 2 and 4, such as IGLC1 (SEQ ID NO: 301, 302, 303, or 318), in a sample (e.g., a tumor sample) from a patient having cancer (e.g., prostate cancer, ovarian cancer, or hepatocellular carcinoma (HCC)).
  • IGLC1 SEQ ID NO: 301, 302, 303, or 318
  • a sample e.g., a tumor sample
  • cancer e.g., prostate cancer, ovarian cancer, or hepatocellular carcinoma (HCC)
  • the invention features individual biomarkers (e.g., ATP1B1 (SEQ ID NO: 201 or 219) or IGLC1 (SEQ ID NO: 301, 302, 303, or 318)) and sets of biomarkers shown in Tables 1-4 that can be used to determine the responsiveness of a cancer patient to irofulven at various stages of disease progression (e.g., patients diagnosed with cancer or patients after cancer recurrence) and at different times during the treatment process (e.g., prior to administration of any cancer treatment, after administration of one or more cancer treatments other than irofulven, prior to administration of irofulven, or during administration of irofulven).
  • biomarkers e.g., ATP1B1 (SEQ ID NO: 201 or 219) or IGLC1 (SEQ ID NO: 301, 302, 303, or 318)
  • sets of biomarkers shown in Tables 1-4 that can be used to determine the responsiveness of a cancer patient to iroful
  • the methods can be used to determine the irofulven responsiveness of a patient with cancer that is resistant to one or more cancer therapies other than irofulven, such as docetaxel, cabazitaxel, mitoxantrone, estramustine, prednisone, carboplatin, bevacizumab, paclitaxel, gemcitabine, doxorubicin, topotecan, etoposide, tamoxifen, letrozole, sorafenib, fluorouracil, capecitabine, oxaliplatin, interferon-alpha, 5-fluorouracil (5-FU), a histone deacetylase (HDAC) inhibitor, ipilimumab, bortezomib, carfilzomib, thalidomide, lenalidomide, pomalidomide, dexamethasone, cyclophosphamide, vincristine, melphalan,
  • the invention provides methods for determining whether a patient may be responsive to irofulven by, e.g., detecting the expression level (e.g., mRNA or protein produced therefrom) of one or more of the biomarkers shown in Tables 1-4 (e.g., ATP1B1 (SEQ ID NO: 201 or 219)) in a biological sample (e.g., a tumor biopsy) obtained from the subject using a device (e.g., a microarray or a protein array).
  • a biological sample e.g., a tumor biopsy
  • a device e.g., a microarray or a protein array
  • the expression level of one or more of the biomarkers of sensitivity may then be compared to the expression level of the biomarkers in a cell or tissue known to be sensitive or resistant to irofulven to determine the patient's responsiveness to irofulven.
  • the patient may be responsive to irofulven if the expression level of the one or more of the biomarkers of sensitivity (e.g., one or more of ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), ID1 (SEQ ID NO: 217), and GJA1 (SEQ ID NO: 218)) is substantially similar to the expression level of the bio
  • the patient may also be responsive to irofulven if the level of expression of one or more of the biomarkers of resistance (e.g., one or more of IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), CD53 (SEQ ID NO: 310), MZB1 (SEQ ID NO: 313), RASSF5 (SEQ ID NO: 314 or 386), FAM46C (SEQ ID NO: 315), RCSD1 (SEQ ID NO: 316), IGJ (SEQ ID NO: 317), LPXN (SEQ ID NO: 319), ITGB7 (SEQ ID NO: 320), and GTSF1 (SEQ ID NO: 321)) is substantially dissimilar
  • the invention also features methods of treating a patient having cancer, such as a patient having a cancer that is resistant to one or more cancer therapies other than irofulven, by detecting the expression levels of one or more of the biomarkers shown in Tables 1-4 (e.g., ATP1B1 (SEQ ID NO: 201)) in a sample (e.g., a tumor sample) from the patient, and then administering irofulven based on the expression levels of the biomarkers.
  • a patient having cancer may be administered irofulven if the expression level of one or more biomarkers of sensitivity is substantially similar to the expression level of the biomarkers of sensitivity in a cell or tissue known to be sensitive to irofulven.
  • a patient having cancer may be administered irofulven if the expression level of one or more biomarkers of resistance is substantially dissimilar to the expression level of the biomarkers of resistance in a cell or tissue known to be resistant to irofulven.
  • the methods can be used to treat cancer patients predicted to be responsive to irofulven, such as patients having, e.g., prostate cancer, ovarian cancer, hepatocellular carcinoma (HCC), cervical cancer, renal cell carcinoma (RCC), esophageal cancer, melanoma, glioma, pancreatic cancer, gastrointestinal stromal tumors (GIST), sarcoma, estrogen receptor-positive (ERpos) breast cancer, non-small cell lung carcinoma (NSCLC), colon cancer, bladder cancer, squamous cell carcinoma of the head and neck (SCCHN), acute myelogenous leukemia (AML), acute lympho-blastic leukemia (ALL), chronic lymphocytic leukemia (CLL), myelodys
  • a patient having cancer may not be administered irofulven if the expression level of one or more biomarkers of sensitivity is substantially dissimilar to the expression level of the biomarkers of sensitivity in a cell or tissue known to be sensitive to irofulven.
  • a patient having cancer may not be administered irofulven if the expression level of one or more biomarkers of resistance is substantially similar to the expression level of the biomarkers of resistance in a cell or tissue known to be resistant to irofulven.
  • Methods are described herein for identifying biomarkers of drug responsiveness, detecting biomarker gene expression in cancer patients, determining the responsiveness of a cancer patient to irofulven, and treating cancer patients with irofulven. Also described are devices and kits for use in these methods.
  • the invention features methods for identifying biomarkers (e.g., one or more of the biomarkers of Tables 1-4) for determining the responsiveness of a cancer patient to a cancer treatment, such as irofulven.
  • biomarkers e.g., one or more of the biomarkers of Tables 1-4
  • Such methods can involve, for example, an algorithm based on growth inhibition values (GI50) of cell lines (e.g., NCI60 cell lines) subjected to treatment with irofulven, followed by measurement of gene expression (e.g., using a microarray (e.g., an Affymetrix HG-U133A or HG-U133_Plus_2 array)).
  • GI50 growth inhibition values
  • a microarray e.g., an Affymetrix HG-U133A or HG-U133_Plus_2 array
  • the human tumor cell lines of the cancer screening panel may be grown in RPMI 1640 medium containing 5% fetal bovine serum and 2 mM L-glutamine. Cells may be inoculated into 96 well microtiter plates in 100 ⁇ L at plating densities ranging from 5,000 to 40,000 cells/well depending on the doubling time of individual cell lines. After cell inoculation, the microtiter plates may be incubated at 37° C., 5% CO2, 95% air and 100% relative humidity for 24 hours prior to addition of experimental compounds.
  • TCA time of compound addition
  • Experimental compounds may be solubilized in dimethyl sulfoxide at 400-fold the desired final maximum test concentration and stored frozen prior to use.
  • an aliquot of frozen concentrate may be thawed and diluted to twice the desired final maximum test concentration with complete medium containing 50 ⁇ g/ml Gentamicin.
  • a total of four additional 10-fold or 1 ⁇ 2 log serial dilutions are made to provide a total of five concentrations plus control. Aliquots of 100 ⁇ l of these different compound dilutions are added to the appropriate microtiter wells already containing 100 ⁇ l of medium, resulting in the required final compound concentrations.
  • the plates may be incubated for an additional 48 h at 37° C., 5% CO2, 95% air, and 100% relative humidity.
  • the assay may be terminated by the addition of cold TCA.
  • Cells may be fixed in situ by the gentle addition of 50 ⁇ l of cold 50% (w/v) TCA (final concentration, 10% TCA) and incubated for 60 minutes at 4° C. The supernatant may be discarded, and the plates may be washed five times with tap water and air-dried.
  • SRB Sulforhodamine B
  • 1% acetic acid 1% acetic acid
  • SRB Sulforhodamine B
  • unbound dye may be removed by washing five times with 1% acetic acid and the plates may be air-dried.
  • Bound stain may be subsequently solubilized with 10 mM trizma base, and the absorbance may be read on an automated plate reader at a wavelength of 515 nm.
  • the methodology may be the same, except that the assay may be terminated by fixing settled cells at the bottom of the wells by gently adding 50 ⁇ l of 80% TCA (final concentration, 16% TCA).
  • Three dose response parameters may be calculated for each experimental agent (e.g., irofulven).
  • the LC50 concentration of compound resulting in a 50% reduction in the measured protein at the end of the compound treatment as compared to that at the beginning
  • the gene expression measurements of NCI60 cancer cell lines can be obtained from a publically available database (e.g., the National Cancer Institute and the Massachusetts Institute of Technology). Each dataset can be normalized so that sample expression measured by different chips can be compared.
  • GI50 Growth inhibition data
  • the correlation between the logit-transformed expression level of each gene in each cell line and the logarithm of GI50 can be calculated, e.g., using the Pearson correlation coefficient or the Spearman Rank-Order correlation coefficient.
  • any other measure of patient sensitivity to a given treatment e.g., irofulven
  • the most accurate determination of correlation coefficient can be, e.g., the median of the correlation coefficients calculated for all probes measuring expression of the same gene.
  • the median correlation coefficient of gene expression measured on a probe to growth inhibition or patient sensitivity to irofulven can be calculated for all genes of interest.
  • Genes that have a median correlation above e.g., 0.20, 0.21 0.22. 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, or higher (e.g., 0.2 or higher), can be used as biomarkers of sensitivity for assessing responsiveness of a cancer patient (e.g., a patient having cancer that is resistant to one or more cancer therapies other than irofulven) to irofulven.
  • a cancer patient e.g., a patient having cancer that is resistant to one or more cancer therapies other than irofulven
  • genes that have a median correlation below e.g., ⁇ 0.20, ⁇ 0.21, ⁇ 0.22, ⁇ 0.23, ⁇ 0.24, ⁇ 0.25, ⁇ 0.26, ⁇ 0.27, ⁇ 0.28, ⁇ 0.29, ⁇ 0.30, ⁇ 0.31, ⁇ 0.32, ⁇ 0.33, ⁇ 0.34, ⁇ 0.35, ⁇ 0.36, ⁇ 0.37, ⁇ 0.38, ⁇ 0.39, ⁇ 0.40, or lower (e.g., ⁇ 0.2 or lower), can be used as biomarkers of resistance for assessing responsiveness of a cancer patient (e.g., a patient having cancer that is resistant to one or more cancer therapies other than irofulven) to irofulven.
  • a cancer patient e.g., a patient having cancer that is resistant to one or more cancer therapies other than irofulven
  • the correlation coefficient of a biomarker of sensitivity will exceed 0.2, while the correlation coefficient of a biomarker of resistance will be less than ⁇ 0.2.
  • the result is a list of biomarker genes that correlate to sensitivity or resistance to irofulven, as shown in Tables 1 and 3 and Tables 2 and 4, respectively.
  • the methods, devices, and kits of the invention can be used for diagnosing, prognosing, monitoring, treating, and/or reducing cancer in a subject suffering from, diagnosed with, or susceptible to cancer.
  • cancers that can be diagnosed, prognosed, monitored, treated, or reduced using the methods include hematological and solid tumors.
  • cancers include, e.g., prostate cancer, ovarian cancer (e.g., ovarian adenocarcinoma or embryonal carcinoma), liver cancer (e.g., hepatocellular carcinoma (HCC) or hepatoma), myeloma (e.g., multiple myeloma), colorectal cancer (e.g., colon cancer and rectal cancer), leukemia (e.g., acute myeloid leukemia, acute lymphoid leukemia, chronic myeloid leukemia, chronic lymphocytic leukemia, acute myeloblastic leukemia, acute promyelocytic leukemia, acute myelomonocytic leukemia, acute monocytic leukemia, acute erythroleukemia, and chronic leukemia), myelodysplastic syndrome, lymphoma (e.g., diffuse large B-cell lymphoma, cutaneous T-cell lymphoma, peripheral T-cell lymphoma, lympho
  • the methods are useful for diagnosing, prognosing, monitoring, treating, or preventing, e.g., prostate cancer, ovarian cancer, hepatocellular carcinoma (HCC), cervical cancer, renal cell carcinoma (RCC), esophageal cancer, melanoma, glioma, pancreatic cancer, gastrointestinal stromal tumors (GIST), sarcoma, estrogen receptor-positive (ERpos) breast cancer, non-small cell lung carcinoma (NSCLC), colon cancer, bladder cancer, squamous cell carcinoma of the head and neck (SCCHN), acute myelogenous leukemia (AML), acute lympho-blastic leukemia (ALL), chronic lymphocytic leukemia (CLL), myelodysplastic syndrome (MDS), chronic myelogenous leukemia-chronic phase (CMLCP), diffuse large B-cell lymphoma (DLBCL), cutaneous T-cell lymphoma (CTCL), peripheral T-cell lymphoma (PTCL), and Hodg
  • the cancer can be prostate cancer, such as Stage I, II (e.g., IIA or IIB), III, or IV prostate cancer.
  • the cancer may be prostate cancer that is resistant to one or more cancer therapies, such as docetaxel, cabazitaxel, mitoxantrone, estramustine, prednisone, and/or surgery.
  • the cancer is an ovarian cancer.
  • the ovarian cancer can be, for example, a Stage I (e.g., Stage IA, IB, or IC), Stage II (e.g., Stage IIA or IIB), Stage III (e.g., Stage IIIA1, IIIA2, IIIB, or IIIC), or Stage IV (e.g., Stage IVA or IVB) ovarian cancer.
  • the cancer can be ovarian cancer that is resistant to one or more cancer therapies, such as docetaxel, carboplatin, bevacizumab, paclitaxel, gemcitabine, doxorubicin, topotecan, etoposide, tamoxifen, and/or letrozole.
  • cancer therapies such as docetaxel, carboplatin, bevacizumab, paclitaxel, gemcitabine, doxorubicin, topotecan, etoposide, tamoxifen, and/or letrozole.
  • the cancer can be HCC, such as Stage I, Stage II, Stage III (e.g., Stage IIIA, IIIB, or IIIC), or Stage IV (e.g., Stage IVA or IVB) HCC.
  • the cancer can be HCC that is resistant to one or more cancer therapies, such as sorafenib, doxorubicin, cisplatin, gemcitabine, capecitabine, oxaliplatin, interferon-alpha, and/or 5-fluorouracil (5-FU).
  • cancer therapies such as sorafenib, doxorubicin, cisplatin, gemcitabine, capecitabine, oxaliplatin, interferon-alpha, and/or 5-fluorouracil (5-FU).
  • a cancer patient can be assessed for sensitivity or resistance to irofulven by detecting gene expression of a biomarker (e.g., one or more of the biomarkers of Tables 1-4) in a biological sample obtained from the cancer patient (e.g., a patient having cancer that is resistant to one or more cancer therapies other than irofulven).
  • the biological sample can include, for example, cells, tissue (e.g., a tissue sample obtained by biopsy), blood, serum, plasma, urine, sputum, cerebrospinal fluid, lymph tissue or fluid, or pancreatic fluid.
  • the biological sample can be fresh frozen or formalin-fixed paraffin embedded (FFPE) tissue obtained from the subject, such as a tumor sample (e.g., a biopsy) from the tissue of interest (e.g., prostate, ovarian, lung, lymph nodes, thymus, spleen, bone marrow, breast, colorectal, pancreatic, cervical, bladder, gastrointestinal, head, or neck tissue).
  • FFPE formalin-fixed paraffin embedded
  • RNA may be extracted using, e.g., Trizol Reagent from Invitrogen following manufacturer's instructions, and detected directly or converted to cDNA for detection.
  • RNA may be amplified using, e.g., MessageAmp kit from Ambion following manufacturer's instructions. Amplified RNA may be quantified using, e.g., HG-U133A or HG-U133_Plus2 GeneChip from Affymetrix Inc. or a compatible apparatus, e.g., the GCS3000Dx GeneChip® System from Affymetrix Inc., using the manufacturer's instructions.
  • the resulting biomarker expression measurements may be further analyzed as described herein.
  • the procedures described can be implemented using, e.g., R software available from R-Project and supplemented with packages available from Bioconductor.
  • One or more of the biomarkers shown in Tables 1-4 may be measured in a biological sample (e.g., a tumor sample) obtained from the cancer patient (e.g., a patient with any of the cancer types described herein, such as a patient having cancer that is resistant to one or more cancer therapies other than irofulven) using, e.g., polymerase chain reaction (PCR), reverse transcriptase PCR (RT-PCR), quantitative real-time PCR (qRT-PCR), an array (e.g., a microarray), a genechip, pyrosequencing, nanopore sequencing, sequencing by synthesis, sequencing by expansion, single molecule real time technology, sequencing by ligation, microfluidics, infrared fluorescence, next generation sequencing (e.g., RNA-Seq techniques), Northern blots, Western blots, Southern blots, NanoString nCounter technologies (e.g., RNA-Seq techniques), Northern blots, Western blo
  • the device may include at least one single-stranded nucleic acid (e.g., a probe) having at least 85% sequence identity (e.g., 85%, 90%, 95%, 97%, 98%, 99%, or 100% sequence identity) to a nucleic acid sequence that is complementary or identical to at least 5 (e.g., at least 10, at least 15, at least 20, or more) consecutive nucleotides of one or more biomarkers shown in Tables 1-4 (e.g., ATP1B1 (SEQ ID NO: 201 or 219) or IGLC1 (SEQ ID NO: 301, 302, 303, or 318)), in which the at least one single-stranded nucleic acid is sufficient for the detection of the expression level of the one or more biomarkers.
  • a probe having at least 85% sequence identity (e.g., 85%, 90%, 95%, 97%, 98%, 99%, or 100% sequence identity) to a nucleic acid sequence that is complementary or identical to at least 5 (e.g
  • the device may be used to detect the expression level of a given biomarker by specific hybridization between the single-stranded nucleic acid and the biomarker (e.g., an mRNA, genomic DNA, or non-coding RNA), a nucleic acid encoding the biomarker (e.g., an mRNA), or a complementary nucleic acid thereof.
  • the device may be or include a microarray.
  • the device may also include or be used with reagents and materials for next generation sequence (e.g., sequencing by synthesis).
  • the device may also include or be used with NanoString reagents and at least one nCounter cartridge.
  • the device may be or include a protein array, which contains one or more protein binding moieties (e.g., proteins, antibodies, nucleic acids, aptamers, affibodies, lipids, phospholipids, small molecules, labeled variants of any of the above, and any other moieties useful for protein detection as well known in the art) capable of detectably binding to the polypeptide product(s) of one or more biomarkers shown in Tables 1-4.
  • the device may also be a cartridge for measuring an amplification product resulting from hybridization between one or more nucleic acid molecules from the patient and at least one single-stranded nucleic acid single-stranded nucleic acid molecules of the device, such as a device for performing qRT-PCR.
  • the expression levels of the biomarkers may be determined using high-throughput expression profiling platforms, such as microarrays.
  • a microarray for use in the methods for assessing the responsiveness of a cancer patient (e.g., a patient having cancer that is resistant to one or more cancer therapies other than irofulven) to irofulven contains or is produced by generating oligonucleotide probes (e.g., DNA, cDNA, or RNA probes) capable of hybridizing to one or more biomarkers of interest (e.g., one or more of the biomarkers of Tables 1-4) or the complement sequences thereof.
  • oligonucleotide probes e.g., DNA, cDNA, or RNA probes
  • Each probe can have, e.g., at least 10, 15, 20, 25, 30, or more contiguous nucleic acid residues (e.g., at least 15) that are complementary or identical to a nucleic acid sequence of a selected biomarker.
  • the probe nucleic sequence can also have at least 85% (e.g., 90%, 95%, 99%, or 100%) sequence identity to the nucleic acid sequence of the gene coding the biomarker (e.g., ATP1B1 (SEQ ID NO: 201 or 219)) or the complement sequence thereof.
  • the probe sequences can be complementary to all or a portion of the nucleic acid sequence of the biomarker(s).
  • microarrays of the invention for determining irofulven responsiveness can include probes for one or more (e.g., at least 5, 10, 15, or 20 or more (e.g., all)) biomarkers of sensitivity shown in Tables 1 and 3, such as ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), ID1 (SEQ ID NO:
  • Microarrays for determining irofulven responsiveness can also include probes for one or more (e.g., at least 5, 10, 15, or 20 or more (e.g., all)) biomarkers of resistance listed in Tables 2 and 4, such as IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), CD53 (SEQ ID NO: 310), MZB1 (SEQ ID NO: 313), RASSF5 (SEQ ID NO: 314 or 386), FAM46C (SEQ ID NO: 315), RCSD1 (SEQ ID NO: 316), IGJ (SEQ ID NO: 317), LPXN (SEQ ID NO: 319), ITGB7 (SEQ ID
  • Microarrays for determining irofulven responsiveness can also include probes for one or more (e.g., at least 5, 10, 15, or 20 or more (e.g., all)) biomarkers of sensitivity and biomarkers of resistance shown in Tables 1-4, such as ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), ID1 (SEQ
  • a microarray probe may be single-stranded or double-stranded.
  • the probe may be labeled (e.g., detectably labeled with a fluorescent molecule, dye molecule, small molecule, epitope tag, barcode sequence, polypeptide, or any other detectable molecule).
  • Probes can be detectably labeled and immobilized on a solid support to form the microarray.
  • probes can be either prefabricated and spotted to the surface or directly synthesized on to the surface (in situ) of the microarray.
  • the microarray can also be configured such that the sequence and position of each member (e.g., probe) of the array is known.
  • a selection of biomarkers whose expression correlates with an increased likelihood of responsiveness to irofulven can be arrayed on a solid support.
  • Hybridization of a labeled probe with a particular target nucleic acid indicates that the sample from which the mRNA was derived expresses that biomarker (e.g., the biomarker of sensitivity or resistance to irofulven).
  • biomarkers may be used to determine patient responsiveness to irofulven using the methods described herein.
  • Tissue or cell samples from a cancer patient e.g., a patient having cancer that is resistant to one or more cancer therapies other than irofulven
  • PCR polymerase chain reaction
  • qPCR quantitative real-time PCR
  • q-LAMP quantitative loop-mediated isothermal amplification
  • an mRNA corresponding to a biomarker of Tables 1-4 can be detected in a biological sample by (a) producing cDNA from the sample by reverse transcription using at least one primer; (b) amplifying the cDNA so produced using a target polynucleotide as sense and antisense primers to amplify target cDNAs therein; and (c) detecting the presence of the amplified target cDNA using polynucleotide probes.
  • the primers and probes including the target sequences shown in Tables 1-4 may be used to detect expression of one or more of the indicated biomarkers using PCR.
  • the methods can include one or more steps that allow determination of the levels of target mRNA in a biological sample (e.g., by simultaneously examining the levels of a comparative control mRNA sequence or “housekeeping” gene, such as an actin family member or GAPDH).
  • the primers for these PCR-based assays may be labeled for detection according to methods known in the art.
  • RNA-Seq next generation sequencing platforms
  • This methodology may include fragmentation of RNA to an average length of, e.g., 200 nucleotides, conversion to cDNA by random priming, and synthesis of double-stranded cDNA (e.g., using the PROTOSCRIPT® First Strand cDNA Synthesis Kit from New England Biosciences).
  • the cDNA may then be converted into a molecular library for sequencing by addition of sequence adapters for each library (e.g., from ILLUMINA®/Solexa), and the resulting 50 to 100 nucleotide reads are mapped onto the genome.
  • Exemplary sequencing platforms suitable for use according to the methods include, e.g., pyrosequencing, ILLUMINA® sequencing by synthesis, SOLID® sequencing, ION TORRENT® sequencing, and SMRT® sequencing.
  • the invention features diagnostic methods for the detection and screening of cancer patients (e.g., a patient having cancer that is resistant to one or more cancer therapies other than irofulven) that may be responsive to irofulven using one or more of the biomarkers shown in Tables 1-4 (e.g., ATP1B1 (SEQ ID NO: 201 or 219) or IGLC1 (SEQ ID NO: 301, 302, 303, or 318)).
  • the methods of the invention may be used for predicting a patient's responsiveness to irofulven, and optionally, treating the cancer patient throughout the progression of cancer and/or in cases of recurrence (e.g., after a first line treatment, a second line treatment, and/or a third line treatment).
  • the invention provides individual biomarkers (e.g., ATP1B1 (SEQ ID NO: 201)) and sets of biomarkers (e.g., two or more of the biomarkers listed in Tables 1-4), the expression levels of which, as detected in a biological sample (e.g., a tumor sample, such as a biopsy) obtained from a cancer patient (e.g., a human with cancer), are indicative of responsiveness to irofulven.
  • a biological sample e.g., a tumor sample, such as a biopsy
  • a cancer patient e.g., a human with cancer
  • the biomarkers were identified using methods similar to those previously described in, e.g., Chen et al. ( Mol. Cancer Ther. 11:34-33, 2012), Wang et al. ( J. Nat. Cancer Inst.
  • GI50 growth inhibition values
  • a cell line e.g., NCI60 cells
  • RT-PCR reverse transcriptase polymerase chain reaction
  • qPCR quantitative real-time PCR
  • genes with, e.g., a Pearson correlation coefficient greater than about 0.2 or below about ⁇ 0.2 can be classified as biomarkers of sensitivity or resistance, respectively.
  • a correlation coefficient of about 0.2 or greater is a statistically significant cut-off known in the art for establishing whether the expression level of A GENE, e.g., the genes shown in Tables 1-4, correlate with the likelihood of cancer treatment sensitivity, such as sensitivity to irofulven.
  • a correlation coefficient of about 0.2 or greater or about ⁇ 0.2 or lower can be used to estimate the statistical significance of the expression level of the genes of Tables 1-4 for predicting patient responsiveness to treatment with irofulven according to the methods described herein.
  • One or more biomarkers of sensitivity and/or resistance, identified as described herein, can be used to predict responsiveness to irofulven by measuring the expression level of the biomarkers in a biological sample obtained from the cancer patient.
  • a single biomarker e.g., any of the biomarkers of Tables 1-4, such as ATP1B1 (SEQ ID NO: 201)
  • ATP1B1 SEQ ID NO: 201
  • the expression level of the biomarker(s) in the sample may be compared to the expression level of the biomarker(s) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive to treatment with irofulven.
  • a cell e.g., a cancer cell
  • tissue e.g., a tumor tissue
  • the cancer patient is predicted to be responsive to treatment with irofulven.
  • the expression level of the biomarker(s) in the sample from the cancer patient is substantially dissimilar to the expression level of the biomarker(s) in the cell or tissue known to be sensitive to irofulven, then the cancer patient is predicted to be non-responsive to treatment with irofulven.
  • the expression level of the biomarker (e.g., ATP1B1 (SEQ ID NO: 201)) in a sample from the cancer patient may also be compared to the expression level of the biomarker in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be resistant to treatment with irofulven. If the expression level of the biomarker in the sample from the cancer patient is substantially similar to the expression level of the biomarker in the cell or tissue known to be resistant to irofulven, then the cancer patient is predicted to be non-responsive to treatment with irofulven.
  • a cell e.g., a cancer cell
  • tissue e.g., a tumor tissue
  • the expression level of the biomarker in the sample from the cancer patient is substantially dissimilar to the expression level of the biomarker in the cell or tissue known to be sensitive to irofulven, then the cancer patient is predicted to be responsive to treatment with irofulven.
  • the responsiveness of a cancer patient (e.g., a patient having cancer that is resistant to one or more cancer therapies other than irofulven) to irofulven can also be predicted by comparing the expression level of a biomarker (e.g., ATP1B1 (SEQ ID NO: 201)) to the expression level of the biomarker in one or more cells or tissues (e.g., from a cancer patient population) known to be sensitive to treatment with irofulven and one or more cells or tissues (e.g., from a cancer patient population) known to be resistant to treatment with irofulven.
  • a biomarker e.g., ATP1B1 (SEQ ID NO: 201)
  • the patient may be responsive to treatment with irofulven if the expression level of the biomarker is more similar to the expression level of the biomarker in a cell or tissue known to be sensitive to treatment with irofulven than to a cell or tissue known to be resistant to treatment with irofulven.
  • the patient may be non-responsive to treatment with irofulven if the expression level of the biomarker is more similar to the expression level of the biomarker in a cell or tissue known to be resistant to treatment with irofulven than to a cell or tissue known to be sensitive to treatment with irofulven.
  • biomarkers of sensitivity e.g., one or more of ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), ID1 (SEQ ID NO: 217), and GJA1 (SEQ ID NO: 218)) and one or more biomarkers of resistance (e.g., one or more of IGLC1 (SEQ ID NO: 201 or 219)
  • the predicted responsiveness of a cancer patient may be determined from, e.g., the difference score, which may be defined as the difference between the mean of the expression level of the one or more biomarkers of sensitivity of Tables 1 and 3 and the mean of the expression level of the one or more biomarkers of resistance of Tables 2 and 4.
  • the difference score of the cancer patient can then be compared to the difference score based on the expression level of the biomarkers in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven.
  • a cell e.g., a cancer cell
  • tissue e.g., a tumor tissue
  • the patient may be responsive to treatment with irofulven if the difference score is substantially similar to the expression level of the biomarkers in a cell or tissue known to be sensitive to treatment with irofulven.
  • the patient may be non-responsive to treatment with irofulven if the difference score is substantially similar to the expression level of the biomarkers in a cell or tissue known to be resistant to treatment with irofulven.
  • the patient may be responsive to treatment with irofulven if the difference score is substantially similar to the expression level of the biomarkers in a cell or tissue known to be sensitive to treatment with irofulven than a cell or tissue known to be resistant to treatment with irofulven.
  • the patient may be non-responsive to treatment with irofulven if the difference score is substantially similar to the expression level of the biomarkers in a cell or tissue known to be resistant to treatment with irofulven than a cell or tissue known to be sensitive to treatment with irofulven.
  • One or more biomarkers of sensitivity and/or resistance, identified as described herein, can be used to predict responsiveness to irofulven by measuring the expression level of the biomarkers in a biological sample obtained from the cancer patient.
  • a single biomarker e.g., any of the biomarkers of Tables 1-4, such as ATP1B1 (SEQ ID NO: 201)
  • ATP1B1 SEQ ID NO: 201
  • the expression level of the biomarker(s) in the sample may be compared to the expression level of the biomarker(s) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive to treatment with irofulven.
  • a cell e.g., a cancer cell
  • tissue e.g., a tumor tissue
  • the cancer patient is predicted to be responsive to treatment with irofulven.
  • the expression level of the biomarker(s) in the sample from the cancer patient is substantially dissimilar to the expression level of the biomarker(s) in the cell or tissue known to be sensitive to irofulven, then the cancer patient is predicted to be non-responsive to treatment with irofulven.
  • the expression level of the biomarker (e.g., ATP1B1 (SEQ ID NO: 201)) in a sample from the cancer patient may also be compared to the expression level of the biomarker in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be resistant to treatment with irofulven. If the expression level of the biomarker in the sample from the cancer patient corresponds to the expression level of the biomarker in the cell or tissue known to be resistant to irofulven, then the cancer patient is predicted to be non-responsive to treatment with irofulven.
  • a cell e.g., a cancer cell
  • tissue e.g., a tumor tissue
  • the expression level of the biomarker in the sample from the cancer patient is substantially dissimilar to the expression level of the biomarker in the cell or tissue known to be resistant to irofulven, then the cancer patient is predicted to be responsive to treatment with irofulven.
  • the responsiveness of a cancer patient (e.g., a patient having cancer that is resistant to one or more cancer therapies other than irofulven) to irofulven can also be predicted by comparing the expression level of a biomarker (e.g., ATP1B1 (SEQ ID NO: 201)) to the expression level of the biomarker in one or more cells or tissues (e.g., from a cancer patient population) known to be sensitive to treatment with irofulven and one or more cells or tissues (e.g., from a cancer patient population) known to be resistant to treatment with irofulven.
  • a biomarker e.g., ATP1B1 (SEQ ID NO: 201)
  • the patient may be responsive to treatment with irofulven if the expression level of the biomarker(s) corresponds to the expression level of the biomarker(s) in a cell or tissue known to be sensitive to treatment with irofulven relative to the expression level of the biomarkers in a cell or tissue known to be resistant to treatment with irofulven.
  • the patient may be non-responsive to treatment with irofulven if the expression level of the biomarker(s) corresponds to the expression level of the biomarker(s) in a cell or tissue known to be resistant to treatment with irofulven relative to the expression level of the biomarkers in a cell or tissue known to be resistant to treatment with irofulven.
  • biomarkers of sensitivity e.g., one or more of ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), ID1 (SEQ ID NO: 217), and GJA1 (SEQ ID NO: 218)) and one or more biomarkers of resistance (e.g., one or more of IGLC1 (SEQ ID NO: 201 or 219)
  • the predicted responsiveness of a cancer patient may be determined from, e.g., the difference score, which may be defined as the difference between the mean of the expression level of the one or more biomarkers of sensitivity of Tables 1 and 3 and the mean of the expression level of the one or more biomarkers of resistance of Tables 2 and 4.
  • the difference score of the cancer patient can then be compared to the difference score based on the expression level of the biomarkers in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven.
  • a cell e.g., a cancer cell
  • tissue e.g., a tumor tissue
  • the patient may be responsive to treatment with irofulven if the difference score corresponds to the expression level of the biomarkers in a cell or tissue known to be sensitive to treatment with irofulven.
  • the patient may be non-responsive to treatment with irofulven if the difference score corresponds to the expression level of the biomarkers in a cell or tissue known to be resistant to treatment with irofulven.
  • the patient may be responsive to treatment with irofulven if the difference score corresponds to the expression level of the biomarkers in a cell or tissue known to be sensitive to treatment with irofulven relative to the expression level of the biomarkers in a cell or tissue known to be resistant to treatment with irofulven.
  • the patient may be non-responsive to treatment with irofulven if the difference score corresponds to the expression level of the biomarkers in a cell or tissue known to be resistant to treatment with irofulven relative to the expression level of the biomarkers in a cell or tissue known to be sensitive to treatment with irofulven.
  • the cell or tissue known to be either sensitive or resistant to irofulven is of the same cancer type as the cancer patient with an unknown responsiveness to irofulven.
  • the cancer patient and the cell or tissue known to be either sensitive or resistant to irofulven may both have a cancer type selected from a solid tumor or a hematological cancer, e.g., prostate cancer, ovarian cancer (e.g., ovarian adenocarcinoma or embryonal carcinoma), liver cancer (e.g., hepatocellular carcinoma (HCC) or hepatoma), myeloma (e.g., multiple myeloma), colorectal cancer (e.g., colon cancer and rectal cancer), leukemia (e.g., acute myeloid leukemia, acute lymphoid leukemia, chronic myeloid leukemia, chronic lymphocytic leukemia, acute myeloblastic leukemia, acute promyelocytic leukemia
  • the cancer of the patient and the cell or tissue with known resistance or sensitivity to irofulven is, e.g., prostate cancer, ovarian cancer, hepatocellular carcinoma (HCC), multiple myeloma, breast cancer, acute myelogenous leukemia (AML), acute lympho-blastic leukemia (ALL), chronic lymphocytic leukemia (CLL), myelodysplastic syndrome (MDS), chronic myelogenous leukemia-chronic phase (CMLCP), diffuse large B-cell lymphoma (DLBCL), cutaneous T-cell lymphoma (CTCL), peripheral T-cell lymphoma (PTCL), Hodgkin's lymphoma, cervical cancer, renal cell carcinoma (RCC), esophageal cancer, melanoma, glioma, pancreatic cancer, gastrointestinal stromal tumors (GIST), sarcoma, estrogen receptor-positive (ERpos) breast cancer, non-small cell lung carcinoma (NSCLC), colon
  • Machine learning techniques such as Neural Networks, Support Vector Machines, K Nearest Neighbor, and Nearest Centroids may also be employed to develop models that discriminate patients sensitive to treatment with irofulven from those resistant to treatment with irofulven using biomarker expression as model variables which assign each patient a classification as sensitive or resistant to treatment with irofulven.
  • Machine learning techniques used to classify patients using various measurements are described in U.S. Pat. No. 5,822,715; U.S. Patent Application Publication Nos. 2003/0073083, 2005/0227266, 2005/0208512, 2005/0123945, 2003/0129629, and 2002/0006613; and in Vapnik V N.
  • the expression levels of one or more biomarkers of Tables 1-4 can be used to determine cancer patient responsiveness to treatment with irofulven. Once determined to be responsive, the patient can be treated with irofulven.
  • the biomarker ATP1B1 (SEQ ID NO: 201 or 219) may be used to assess a cancer patient's (e.g, a patient having cancer that is resistant to one or more cancer therapies other than irofulven) responsiveness to irofulven.
  • the expression level of the biomarker ATP1B1 (SEQ ID NO: 201 or 219) may be assessed using nucleic acid amplification methods (e.g., PCR) or a device (e.g., a microarray).
  • the expression level of ATP1B1 (SEQ ID NO: 201 or 219) in the patient sample may then be compared, e.g., to the expression level of ATP1B1 (SEQ ID NO: 201 or 219) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven and used to determine the cancer patient's responsiveness to irofulven.
  • a cell e.g., a cancer cell
  • tissue e.g., a tumor tissue
  • the biomarker ATP1B1 may be used alone to predict cancer patient responsiveness to treatment with irofulven or in combination with one or more additional biomarkers (e.g., one, two, three, four, five, ten, or all of the biomarkers shown in Tables 1-4), such as UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), ID1 (SEQ ID NO: 214), BASP1 (SEQ
  • the expression level of the biomarker(s) may be determined using, e.g., a microarray, PCR, or other techniques described herein, for example, using a nucleic acid probe sequence based on the target sequences shown in Tables 1-4.
  • the expression level of the biomarker UCHL1 may be assessed using nucleic acid amplification methods (e.g., PCR) or a device (e.g., a microarray). As is described above, the expression level of UCHL1 (SEQ ID NO: 202) in the patient sample may then be compared, e.g., to the expression level of UCHL1 (SEQ ID NO: 202) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven and used to determine the cancer patient's responsiveness to irofulven.
  • a cell e.g., a cancer cell
  • tissue e.g., a tumor tissue
  • the biomarker UCHL1 may be used alone to predict cancer patient responsiveness to treatment with irofulven or in combination with one or more additional biomarkers (e.g., one, two, three, four, five, ten, or all of the biomarkers shown in Tables 1-4), such as ATP1B1 (SEQ ID NO: 201 or 219), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), ID1 (SEQ ID NO: 214), BASP1
  • the expression level of the biomarker(s) may be determined using, e.g., a microarray, PCR, or other techniques described herein, for example, using a nucleic acid probe sequence based on the target sequences shown in Tables 1-4.
  • the biomarker PTGR1 (SEQ ID NO: 203 or 210) may be used to assess a cancer patient's (e.g, a patient having cancer that is resistant to one or more cancer therapies other than irofulven) responsiveness to irofulven.
  • the expression level of the biomarker PTGR1 may be assessed using nucleic acid amplification methods (e.g., PCR) or a device (e.g., a microarray).
  • the expression level of PTGR1 (SEQ ID NO: 203 or 210) in the patient sample may then be compared, e.g., to the expression level of PTGR1 (SEQ ID NO: 203 or 210) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven and used to determine the cancer patient's responsiveness to irofulven.
  • a cell e.g., a cancer cell
  • tissue e.g., a tumor tissue
  • the biomarker PTGR1 (SEQ ID NO: 203 or 210) may be used alone to predict cancer patient responsiveness to treatment with irofulven or in combination with one or more additional biomarkers (e.g., one, two, three, four, five, ten, or all of the biomarkers shown in Tables 1-4), such as ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), ID1 (SEQ ID
  • the expression level of the biomarker(s) may be determined using, e.g., a microarray, PCR, or other techniques described herein, for example, using a nucleic acid probe sequence based on the target sequences shown in Tables 1-4.
  • the biomarker NME7 may be used to assess a cancer patient's (e.g, a patient having cancer that is resistant to one or more cancer therapies other than irofulven) responsiveness to irofulven.
  • the expression level of the biomarker NME7 (SEQ ID NO: 204) may be assessed using nucleic acid amplification methods (e.g., PCR) or a device (e.g., a microarray).
  • the expression level of NME7 (SEQ ID NO: 204) in the patient sample may then be compared, e.g., to the expression level of NME7 (SEQ ID NO: 204) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven and used to determine the cancer patient's responsiveness to irofulven.
  • a cell e.g., a cancer cell
  • tissue e.g., a tumor tissue
  • the biomarker NME7 may be used alone to predict cancer patient responsiveness to treatment with irofulven or in combination with one or more additional biomarkers (e.g., one, two, three, four, five, ten, or all of the biomarkers shown in Tables 1-4), such as ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), ID1 (SEQ ID NO: 214), BASP1
  • the expression level of the biomarker(s) may be determined using, e.g., a microarray, PCR, or other techniques described herein, for example, using a nucleic acid probe sequence based on the target sequences shown in Tables 1-4.
  • the biomarker PLS3 may be used to assess a cancer patient's (e.g, a patient having cancer that is resistant to one or more cancer therapies other than irofulven) responsiveness to irofulven.
  • the expression level of the biomarker PLS3 (SEQ ID NO: 205) may be assessed using nucleic acid amplification methods (e.g., PCR) or a device (e.g., a microarray).
  • the expression level of PLS3 (SEQ ID NO: 205) in the patient sample may then be compared, e.g., to the expression level of PLS3 (SEQ ID NO: 205) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven and used to determine the cancer patient's responsiveness to irofulven.
  • a cell e.g., a cancer cell
  • tissue e.g., a tumor tissue
  • the biomarker PLS3 may be used alone to predict cancer patient responsiveness to treatment with irofulven or in combination with one or more additional biomarkers (e.g., one, two, three, four, five, ten, or all of the biomarkers shown in Tables 1-4), such as ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), ID1 (SEQ ID NO: 214), BASP1
  • the expression level of the biomarker(s) may be determined using, e.g., a microarray, PCR, or other techniques described herein, for example, using a nucleic acid probe sequence based on the target sequences shown in Tables 1-4.
  • the biomarker S100A10 may be used to assess a cancer patient's (e.g, a patient having cancer that is resistant to one or more cancer therapies other than irofulven) responsiveness to irofulven.
  • the expression level of the biomarker S100A10 may be assessed using nucleic acid amplification methods (e.g., PCR) or a device (e.g., a microarray).
  • the expression level of S100A10 (SEQ ID NO: 206) in the patient sample may then be compared, e.g., to the expression level of S100A10 (SEQ ID NO: 206) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven and used to determine the cancer patient's responsiveness to irofulven.
  • a cell e.g., a cancer cell
  • tissue e.g., a tumor tissue
  • the biomarker S100A10 may be used alone to predict cancer patient responsiveness to treatment with irofulven or in combination with one or more additional biomarkers (e.g., one, two, three, four, five, ten, or all of the biomarkers shown in Tables 1-4), such as ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), ID1 (SEQ ID NO: 214), BASP1
  • the expression level of the biomarker(s) may be determined using, e.g., a microarray, PCR, or other techniques described herein, for example, using a nucleic acid probe sequence based on the target sequences shown in Tables 1-4.
  • the biomarker CD24 (SEQ ID NO: 207, 209, or 220) may be used to assess a cancer patient's (e.g, a patient having cancer that is resistant to one or more cancer therapies other than irofulven) responsiveness to irofulven.
  • the expression level of the biomarker CD24 (SEQ ID NO: 207, 209, or 220) may be assessed using nucleic acid amplification methods (e.g., PCR) or a device (e.g., a microarray).
  • the expression level of CD24 (SEQ ID NO: 207, 209, or 220) in the patient sample may then be compared, e.g., to the expression level of CD24 (SEQ ID NO: 207, 209, or 220) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven and used to determine the cancer patient's responsiveness to irofulven.
  • a cell e.g., a cancer cell
  • tissue e.g., a tumor tissue
  • the biomarker CD24 (SEQ ID NO: 207, 209, or 220) may be used alone to predict cancer patient responsiveness to treatment with irofulven or in combination with one or more additional biomarkers (e.g., one, two, three, four, five, ten, or all of the biomarkers shown in Tables 1-4), such as ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), ID1 (SEQ
  • the expression level of the biomarker(s) may be determined using, e.g., a microarray, PCR, or other techniques described herein, for example, using a nucleic acid probe sequence based on the target sequences shown in Tables 1-4.
  • the biomarker NQO1 (SEQ ID NO: 208 or 216) may be used to assess a cancer patient's (e.g, a patient having cancer that is resistant to one or more cancer therapies other than irofulven) responsiveness to irofulven.
  • the expression level of the biomarker NQO1 may be assessed using nucleic acid amplification methods (e.g., PCR) or a device (e.g., a microarray).
  • the expression level of NQO1 (SEQ ID NO: 208 or 216) in the patient sample may then be compared, e.g., to the expression level of NQO1 (SEQ ID NO: 208 or 216) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven and used to determine the cancer patient's responsiveness to irofulven.
  • a cell e.g., a cancer cell
  • tissue e.g., a tumor tissue
  • the biomarker NQO1 may be used alone to predict cancer patient responsiveness to treatment with irofulven or in combination with one or more additional biomarkers (e.g., one, two, three, four, five, ten, or all of the biomarkers shown in Tables 1-4), such as ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), ID1 (SEQ ID NO: 217), GJA1 (SEQ ID NO: 218), IG
  • the expression level of the biomarker(s) may be determined using, e.g., a microarray, PCR, or other techniques described herein, for example, using a nucleic acid probe sequence based on the target sequences shown in Tables 1-4.
  • the expression levels of one or more biomarkers of Tables 1-4 can be used to determine cancer patient responsiveness to treatment with irofulven. Once determined to be responsive, the patient can be treated with irofulven.
  • the biomarker MYOF (SEQ ID NO: 211) may be used to assess a cancer patient's (e.g, a patient having cancer that is resistant to one or more cancer therapies other than irofulven) responsiveness to irofulven.
  • the expression level of the biomarker MYOF (SEQ ID NO: 211) may be assessed using nucleic acid amplification methods (e.g., PCR) or a device (e.g., a microarray).
  • the expression level of MYOF (SEQ ID NO: 211) in the patient sample may then be compared, e.g., to the expression level of MYOF (SEQ ID NO: 211) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven and used to determine the cancer patient's responsiveness to irofulven.
  • a cell e.g., a cancer cell
  • tissue e.g., a tumor tissue
  • the biomarker MYOF may be used alone to predict cancer patient responsiveness to treatment with irofulven or in combination with one or more additional biomarkers (e.g., one, two, three, four, five, ten, or all of the biomarkers shown in Tables 1-4), such as ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), ID1 (SEQ ID NO: 214), BASP1
  • the expression level of the biomarker(s) may be determined using, e.g., a microarray, PCR, or other techniques described herein, for example, using a nucleic acid probe sequence based on the target sequences shown in Tables 1-4.
  • the biomarker LAPTM4B (SEQ ID NO: 212) may be used to assess a cancer patient's (e.g, a patient having cancer that is resistant to one or more cancer therapies other than irofulven) responsiveness to irofulven.
  • the expression level of the biomarker LAPTM4B (SEQ ID NO: 212) may be assessed using nucleic acid amplification methods (e.g., PCR) or a device (e.g., a microarray).
  • the expression level of LAPTM4B (SEQ ID NO: 212) in the patient sample may then be compared, e.g., to the expression level of LAPTM4B (SEQ ID NO: 212) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven and used to determine the cancer patient's responsiveness to irofulven.
  • a cell e.g., a cancer cell
  • tissue e.g., a tumor tissue
  • the biomarker LAPTM4B (SEQ ID NO: 212) may be used alone to predict cancer patient responsiveness to treatment with irofulven or in combination with one or more additional biomarkers (e.g., one, two, three, four, five, ten, or all of the biomarkers shown in Tables 1-4), such as ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), ID1 (SEQ ID
  • the expression level of the biomarker(s) may be determined using, e.g., a microarray, PCR, or other techniques described herein, for example, using a nucleic acid probe sequence based on the target sequences shown in Tables 1-4.
  • the biomarker CALD1 may be used to assess a cancer patient's (e.g, a patient having cancer that is resistant to one or more cancer therapies other than irofulven) responsiveness to irofulven.
  • the expression level of the biomarker CALD1 may be assessed using nucleic acid amplification methods (e.g., PCR) or a device (e.g., a microarray).
  • the expression level of CALD1 (SEQ ID NO: 213) in the patient sample may then be compared, e.g., to the expression level of CALD1 (SEQ ID NO: 213) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven and used to determine the cancer patient's responsiveness to irofulven.
  • a cell e.g., a cancer cell
  • tissue e.g., a tumor tissue
  • the biomarker CALD1 may be used alone to predict cancer patient responsiveness to treatment with irofulven or in combination with one or more additional biomarkers (e.g., one, two, three, four, five, ten, or all of the biomarkers shown in Tables 1-4), such as ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), ID1 (SEQ ID NO: 214), BASP1
  • the expression level of the biomarker(s) may be determined using, e.g., a microarray, PCR, or other techniques described herein, for example, using a nucleic acid probe sequence based on the target sequences shown in Tables 1-4.
  • the biomarker PDGFC may be used to assess a cancer patient's (e.g, a patient having cancer that is resistant to one or more cancer therapies other than irofulven) responsiveness to irofulven.
  • the expression level of the biomarker PDGFC may be assessed using nucleic acid amplification methods (e.g., PCR) or a device (e.g., a microarray).
  • the expression level of PDGFC (SEQ ID NO: 214) in the patient sample may then be compared, e.g., to the expression level of PDGFC (SEQ ID NO: 214) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven and used to determine the cancer patient's responsiveness to irofulven.
  • a cell e.g., a cancer cell
  • tissue e.g., a tumor tissue
  • the biomarker PDGFC may be used alone to predict cancer patient responsiveness to treatment with irofulven or in combination with one or more additional biomarkers (e.g., one, two, three, four, five, ten, or all of the biomarkers shown in Tables 1-4), such as ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), BASP1 (SEQ ID NO: 215), ID1 (SEQ ID NO: 212), CALD1
  • the expression level of the biomarker(s) may be determined using, e.g., a microarray, PCR, or other techniques described herein, for example, using a nucleic acid probe sequence based on the target sequences shown in Tables 1-4.
  • the biomarker BASP1 (SEQ ID NO: 215) may be used to assess a cancer patient's (e.g, a patient having cancer that is resistant to one or more cancer therapies other than irofulven) responsiveness to irofulven.
  • the expression level of the biomarker BASP1 (SEQ ID NO: 215) may be assessed using nucleic acid amplification methods (e.g., PCR) or a device (e.g., a microarray).
  • the expression level of BASP1 (SEQ ID NO: 215) in the patient sample may then be compared, e.g., to the expression level of BASP1 (SEQ ID NO: 215) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven and used to determine the cancer patient's responsiveness to irofulven.
  • a cell e.g., a cancer cell
  • tissue e.g., a tumor tissue
  • the biomarker BASP1 (SEQ ID NO: 215) may be used alone to predict cancer patient responsiveness to treatment with irofulven or in combination with one or more additional biomarkers (e.g., one, two, three, four, five, ten, or all of the biomarkers shown in Tables 1-4), such as ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), ID1 (SEQ ID
  • the expression level of the biomarker(s) may be determined using, e.g., a microarray, PCR, or other techniques described herein, for example, using a nucleic acid probe sequence based on the target sequences shown in Tables 1-4.
  • the biomarker ID1 may be used to assess a cancer patient's (e.g, a patient having cancer that is resistant to one or more cancer therapies other than irofulven) responsiveness to irofulven.
  • the expression level of the biomarker ID1 (SEQ ID NO: 217) may be assessed using nucleic acid amplification methods (e.g., PCR) or a device (e.g., a microarray).
  • the expression level of ID1 (SEQ ID NO: 217) in the patient sample may then be compared, e.g., to the expression level of ID1 (SEQ ID NO: 217) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven and used to determine the cancer patient's responsiveness to irofulven.
  • a cell e.g., a cancer cell
  • tissue e.g., a tumor tissue
  • the biomarker ID1 may be used alone to predict cancer patient responsiveness to treatment with irofulven or in combination with one or more additional biomarkers (e.g., one, two, three, four, five, ten, or all of the biomarkers shown in Tables 1-4), such as ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 214), BASP1
  • the expression level of the biomarker(s) may be determined using, e.g., a microarray, PCR, or other techniques described herein, for example, using a nucleic acid probe sequence based on the target sequences shown in Tables 1-4.
  • the biomarker GJA1 may be used to assess a cancer patient's (e.g, a patient having cancer that is resistant to one or more cancer therapies other than irofulven) responsiveness to irofulven.
  • the expression level of the biomarker GJA1 may be assessed using nucleic acid amplification methods (e.g., PCR) or a device (e.g., a microarray).
  • the expression level of GJA1 (SEQ ID NO: 218) in the patient sample may then be compared, e.g., to the expression level of GJA1 (SEQ ID NO: 218) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven and used to determine the cancer patient's responsiveness to irofulven.
  • a cell e.g., a cancer cell
  • tissue e.g., a tumor tissue
  • the biomarker GJA1 may be used alone to predict cancer patient responsiveness to treatment with irofulven or in combination with one or more additional biomarkers (e.g., one, two, three, four, five, ten, or all of the biomarkers shown in Tables 1-4), such as ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 214), BASP
  • the expression level of the biomarker(s) may be determined using, e.g., a microarray, PCR, or other techniques described herein, for example, using a nucleic acid probe sequence based on the target sequences shown in Tables 1-4.
  • the biomarker IGLC1 (SEQ ID NO: 301, 302, 303, or 318) may be used to assess a cancer patient's (e.g, a patient having cancer that is resistant to one or more cancer therapies other than irofulven) responsiveness to irofulven.
  • the expression level of the biomarker IGLC1 (SEQ ID NO: 301, 302, 303, or 318) may be assessed using nucleic acid amplification methods (e.g., PCR) or a device (e.g., a microarray).
  • the expression level of IGLC1 (SEQ ID NO: 301, 302, 303, or 318) in the patient sample may then be compared, e.g., to the expression level of IGLC1 (SEQ ID NO: 301, 302, 303, or 318) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven and used to determine the cancer patient's responsiveness to irofulven.
  • a cell e.g., a cancer cell
  • tissue e.g., a tumor tissue
  • the biomarker IGLC1 (SEQ ID NO: 301, 302, 303, or 318) may be used alone to predict cancer patient responsiveness to treatment with irofulven or in combination with one or more additional biomarkers (e.g., one, two, three, four, five, ten, or all of the biomarkers shown in Tables 1-4), such as ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO
  • the expression level of the biomarker(s) may be determined using, e.g., a microarray, PCR, or other techniques described herein, for example, using a nucleic acid probe sequence based on the target sequences shown in Tables 1-4.
  • the biomarker LAPTM5 (SEQ ID NO: 304 or 338) may be used to assess a cancer patient's (e.g, a patient having cancer that is resistant to one or more cancer therapies other than irofulven) responsiveness to irofulven.
  • the expression level of the biomarker LAPTM5 (SEQ ID NO: 304 or 338) may be assessed using nucleic acid amplification methods (e.g., PCR) or a device (e.g., a microarray).
  • the expression level of LAPTM5 (SEQ ID NO: 304 or 338) in the patient sample may then be compared, e.g., to the expression level of LAPTM5 (SEQ ID NO: 304 or 338) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven and used to determine the cancer patient's responsiveness to irofulven.
  • a cell e.g., a cancer cell
  • tissue e.g., a tumor tissue
  • the biomarker LAPTM5 may be used alone to predict cancer patient responsiveness to treatment with irofulven or in combination with one or more additional biomarkers (e.g., one, two, three, four, five, ten, or all of the biomarkers shown in Tables 1-4), such as ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1
  • additional biomarkers e.g
  • the expression level of the biomarker(s) may be determined using, e.g., a microarray, PCR, or other techniques described herein, for example, using a nucleic acid probe sequence based on the target sequences shown in Tables 1-4.
  • the biomarker ARHGDIB (SEQ ID NO: 305 or 311) may be used to assess a cancer patient's (e.g, a patient having cancer that is resistant to one or more cancer therapies other than irofulven) responsiveness to irofulven.
  • the expression level of the biomarker ARHGDIB (SEQ ID NO: 305 or 311) may be assessed using nucleic acid amplification methods (e.g., PCR) or a device (e.g., a microarray).
  • the expression level of ARHGDIB (SEQ ID NO: 305 or 311) in the patient sample may then be compared, e.g., to the expression level of ARHGDIB (SEQ ID NO: 305 or 311) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven and used to determine the cancer patient's responsiveness to irofulven.
  • a cell e.g., a cancer cell
  • tissue e.g., a tumor tissue
  • the biomarker ARHGDIB (SEQ ID NO: 305 or 311) may be used alone to predict cancer patient responsiveness to treatment with irofulven or in combination with one or more additional biomarkers (e.g., one, two, three, four, five, ten, or all of the biomarkers shown in Tables 1-4), such as ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), B
  • the expression level of the biomarker(s) may be determined using, e.g., a microarray, PCR, or other techniques described herein, for example, using a nucleic acid probe sequence based on the target sequences shown in Tables 1-4.
  • the biomarker SLC43A3 may be used to assess a cancer patient's (e.g, a patient having cancer that is resistant to one or more cancer therapies other than irofulven) responsiveness to irofulven.
  • the expression level of the biomarker SLC43A3 (SEQ ID NO: 307) may be assessed using nucleic acid amplification methods (e.g., PCR) or a device (e.g., a microarray).
  • the expression level of SLC43A3 (SEQ ID NO: 307) in the patient sample may then be compared, e.g., to the expression level of SLC43A3 (SEQ ID NO: 307) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven and used to determine the cancer patient's responsiveness to irofulven.
  • a cell e.g., a cancer cell
  • tissue e.g., a tumor tissue
  • the biomarker SLC43A3 may be used alone to predict cancer patient responsiveness to treatment with irofulven or in combination with one or more additional biomarkers (e.g., one, two, three, four, five, ten, or all of the biomarkers shown in Tables 1-4), such as ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 214),
  • the expression level of the biomarker(s) may be determined using, e.g., a microarray, PCR, or other techniques described herein, for example, using a nucleic acid probe sequence based on the target sequences shown in Tables 1-4.
  • the biomarker LCP1 may be used to assess a cancer patient's (e.g, a patient having cancer that is resistant to one or more cancer therapies other than irofulven) responsiveness to irofulven.
  • the expression level of the biomarker LCP1 may be assessed using nucleic acid amplification methods (e.g., PCR) or a device (e.g., a microarray).
  • the expression level of LCP1 (SEQ ID NO: 308) in the patient sample may then be compared, e.g., to the expression level of LCP1 (SEQ ID NO: 308) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven and used to determine the cancer patient's responsiveness to irofulven.
  • a cell e.g., a cancer cell
  • tissue e.g., a tumor tissue
  • the biomarker LCP1 may be used alone to predict cancer patient responsiveness to treatment with irofulven or in combination with one or more additional biomarkers (e.g., one, two, three, four, five, ten, or all of the biomarkers shown in Tables 1-4), such as ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 214), BASP
  • the expression level of the biomarker(s) may be determined using, e.g., a microarray, PCR, or other techniques described herein, for example, using a nucleic acid probe sequence based on the target sequences shown in Tables 1-4.
  • the biomarker HCLS1 may be used to assess a cancer patient's (e.g, a patient having cancer that is resistant to one or more cancer therapies other than irofulven) responsiveness to irofulven.
  • the expression level of the biomarker HCLS1 (SEQ ID NO: 309) may be assessed using nucleic acid amplification methods (e.g., PCR) or a device (e.g., a microarray).
  • the expression level of HCLS1 (SEQ ID NO: 309) in the patient sample may then be compared, e.g., to the expression level of HCLS1 (SEQ ID NO: 309) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven and used to determine the cancer patient's responsiveness to irofulven.
  • a cell e.g., a cancer cell
  • tissue e.g., a tumor tissue
  • the biomarker HCLS1 may be used alone to predict cancer patient responsiveness to treatment with irofulven or in combination with one or more additional biomarkers (e.g., one, two, three, four, five, ten, or all of the biomarkers shown in Tables 1-4), such as ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 214), B
  • the expression level of the biomarker(s) may be determined using, e.g., a microarray, PCR, or other techniques described herein, for example, using a nucleic acid probe sequence based on the target sequences shown in Tables 1-4.
  • the biomarker CD53 (SEQ ID NO: 310) may be used to assess a cancer patient's (e.g, a patient having cancer that is resistant to one or more cancer therapies other than irofulven) responsiveness to irofulven.
  • the expression level of the biomarker CD53 (SEQ ID NO: 310) may be assessed using nucleic acid amplification methods (e.g., PCR) or a device (e.g., a microarray).
  • the expression level of CD53 (SEQ ID NO: 310) in the patient sample may then be compared, e.g., to the expression level of CD53 (SEQ ID NO: 310) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven and used to determine the cancer patient's responsiveness to irofulven.
  • a cell e.g., a cancer cell
  • tissue e.g., a tumor tissue
  • the biomarker CD53 may be used alone to predict cancer patient responsiveness to treatment with irofulven or in combination with one or more additional biomarkers (e.g., one, two, three, four, five, ten, or all of the biomarkers shown in Tables 1-4), such as ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 214), BASP1
  • the expression level of the biomarker(s) may be determined using, e.g., a microarray, PCR, or other techniques described herein, for example, using a nucleic acid probe sequence based on the target sequences shown in Tables 1-4.
  • the biomarker MZB1 may be used to assess a cancer patient's (e.g, a patient having cancer that is resistant to one or more cancer therapies other than irofulven) responsiveness to irofulven.
  • the expression level of the biomarker MZB1 may be assessed using nucleic acid amplification methods (e.g., PCR) or a device (e.g., a microarray).
  • the expression level of MZB1 (SEQ ID NO: 313) in the patient sample may then be compared, e.g., to the expression level of MZB1 (SEQ ID NO: 313) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven and used to determine the cancer patient's responsiveness to irofulven.
  • a cell e.g., a cancer cell
  • tissue e.g., a tumor tissue
  • the biomarker MZB1 may be used alone to predict cancer patient responsiveness to treatment with irofulven or in combination with one or more additional biomarkers (e.g., one, two, three, four, five, ten, or all of the biomarkers shown in Tables 1-4), such as ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 214), B
  • the expression level of the biomarker(s) may be determined using, e.g., a microarray, PCR, or other techniques described herein, for example, using a nucleic acid probe sequence based on the target sequences shown in Tables 1-4.
  • the biomarker RASSF5 (SEQ ID NO: 314 or 386) may be used to assess a cancer patient's (e.g, a patient having cancer that is resistant to one or more cancer therapies other than irofulven) responsiveness to irofulven.
  • the expression level of the biomarker RASSF5 may be assessed using nucleic acid amplification methods (e.g., PCR) or a device (e.g., a microarray).
  • the expression level of RASSF5 (SEQ ID NO: 314 or 386) in the patient sample may then be compared, e.g., to the expression level of RASSF5 (SEQ ID NO: 314 or 386) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven and used to determine the cancer patient's responsiveness to irofulven.
  • a cell e.g., a cancer cell
  • tissue e.g., a tumor tissue
  • the biomarker RASSF5 may be used alone to predict cancer patient responsiveness to treatment with irofulven or in combination with one or more additional biomarkers (e.g., one, two, three, four, five, ten, or all of the biomarkers shown in Tables 1-4), such as ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1
  • ATP1B1 SEQ ID
  • the expression level of the biomarker(s) may be determined using, e.g., a microarray, PCR, or other techniques described herein, for example, using a nucleic acid probe sequence based on the target sequences shown in Tables 1-4.
  • the biomarker FAM46C (SEQ ID NO: 315) may be used to assess a cancer patient's (e.g, a patient having cancer that is resistant to one or more cancer therapies other than irofulven) responsiveness to irofulven.
  • the expression level of the biomarker FAM46C (SEQ ID NO: 315) may be assessed using nucleic acid amplification methods (e.g., PCR) or a device (e.g., a microarray).
  • the expression level of FAM46C (SEQ ID NO: 315) in the patient sample may then be compared, e.g., to the expression level of FAM46C (SEQ ID NO: 315) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven and used to determine the cancer patient's responsiveness to irofulven.
  • a cell e.g., a cancer cell
  • tissue e.g., a tumor tissue
  • the biomarker FAM46C (SEQ ID NO: 315) may be used alone to predict cancer patient responsiveness to treatment with irofulven or in combination with one or more additional biomarkers (e.g., one, two, three, four, five, ten, or all of the biomarkers shown in Tables 1-4), such as ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (S
  • the expression level of the biomarker(s) may be determined using, e.g., a microarray, PCR, or other techniques described herein, for example, using a nucleic acid probe sequence based on the target sequences shown in Tables 1-4.
  • the biomarker RCSD1 (SEQ ID NO: 316) may be used to assess a cancer patient's (e.g, a patient having cancer that is resistant to one or more cancer therapies other than irofulven) responsiveness to irofulven.
  • the expression level of the biomarker RCSD1 may be assessed using nucleic acid amplification methods (e.g., PCR) or a device (e.g., a microarray).
  • the expression level of RCSD1 (SEQ ID NO: 316) in the patient sample may then be compared, e.g., to the expression level of RCSD1 (SEQ ID NO: 316) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven and used to determine the cancer patient's responsiveness to irofulven.
  • a cell e.g., a cancer cell
  • tissue e.g., a tumor tissue
  • the biomarker RCSD1 (SEQ ID NO: 316) may be used alone to predict cancer patient responsiveness to treatment with irofulven or in combination with one or more additional biomarkers (e.g., one, two, three, four, five, ten, or all of the biomarkers shown in Tables 1-4), such as ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (
  • the expression level of the biomarker(s) may be determined using, e.g., a microarray, PCR, or other techniques described herein, for example, using a nucleic acid probe sequence based on the target sequences shown in Tables 1-4.
  • the biomarker IGJ (SEQ ID NO: 317) may be used to assess a cancer patient's (e.g, a patient having cancer that is resistant to one or more cancer therapies other than irofulven) responsiveness to irofulven.
  • the expression level of the biomarker IGJ (SEQ ID NO: 317) may be assessed using nucleic acid amplification methods (e.g., PCR) or a device (e.g., a microarray).
  • the expression level of IGJ (SEQ ID NO: 317) in the patient sample may then be compared, e.g., to the expression level of IGJ (SEQ ID NO: 317) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven and used to determine the cancer patient's responsiveness to irofulven.
  • a cell e.g., a cancer cell
  • tissue e.g., a tumor tissue
  • the biomarker IGJ may be used alone to predict cancer patient responsiveness to treatment with irofulven or in combination with one or more additional biomarkers (e.g., one, two, three, four, five, ten, or all of the biomarkers shown in Tables 1-4), such as ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 214), BASP
  • the expression level of the biomarker(s) may be determined using, e.g., a microarray, PCR, or other techniques described herein, for example, using a nucleic acid probe sequence based on the target sequences shown in Tables 1-4.
  • the biomarker LPXN may be used to assess a cancer patient's (e.g, a patient having cancer that is resistant to one or more cancer therapies other than irofulven) responsiveness to irofulven.
  • the expression level of the biomarker LPXN (SEQ ID NO: 319) may be assessed using nucleic acid amplification methods (e.g., PCR) or a device (e.g., a microarray).
  • the expression level of LPXN (SEQ ID NO: 319) in the patient sample may then be compared, e.g., to the expression level of LPXN (SEQ ID NO: 319) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven and used to determine the cancer patient's responsiveness to irofulven.
  • a cell e.g., a cancer cell
  • tissue e.g., a tumor tissue
  • the biomarker LPXN may be used alone to predict cancer patient responsiveness to treatment with irofulven or in combination with one or more additional biomarkers (e.g., one, two, three, four, five, ten, or all of the biomarkers shown in Tables 1-4), such as ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 214), B
  • the expression level of the biomarker(s) may be determined using, e.g., a microarray, PCR, or other techniques described herein, for example, using a nucleic acid probe sequence based on the target sequences shown in Tables 1-4.
  • the biomarker ITGB7 (SEQ ID NO: 320) may be used to assess a cancer patient's (e.g, a patient having cancer that is resistant to one or more cancer therapies other than irofulven) responsiveness to irofulven.
  • the expression level of the biomarker ITGB7 (SEQ ID NO: 320) may be assessed using nucleic acid amplification methods (e.g., PCR) or a device (e.g., a microarray).
  • the expression level of ITGB7 (SEQ ID NO: 320) in the patient sample may then be compared, e.g., to the expression level of ITGB7 (SEQ ID NO: 320) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven and used to determine the cancer patient's responsiveness to irofulven.
  • a cell e.g., a cancer cell
  • tissue e.g., a tumor tissue
  • the biomarker ITGB7 (SEQ ID NO: 320) may be used alone to predict cancer patient responsiveness to treatment with irofulven or in combination with one or more additional biomarkers (e.g., one, two, three, four, five, ten, or all of the biomarkers shown in Tables 1-4), such as ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (S
  • the expression level of the biomarker(s) may be determined using, e.g., a microarray, PCR, or other techniques described herein, for example, using a nucleic acid probe sequence based on the target sequences shown in Tables 1-4.
  • the biomarker GTSF1 may be used to assess a cancer patient's (e.g, a patient having cancer that is resistant to one or more cancer therapies other than irofulven) responsiveness to irofulven.
  • the expression level of the biomarker GTSF1 (SEQ ID NO: 321) may be assessed using nucleic acid amplification methods (e.g., PCR) or a device (e.g., a microarray).
  • the expression level of GTSF1 (SEQ ID NO: 321) in the patient sample may then be compared, e.g., to the expression level of GTSF1 (SEQ ID NO: 321) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven and used to determine the cancer patient's responsiveness to irofulven.
  • a cell e.g., a cancer cell
  • tissue e.g., a tumor tissue
  • the biomarker GTSF1 (SEQ ID NO: 321) may be used alone to predict cancer patient responsiveness to treatment with irofulven or in combination with one or more additional biomarkers (e.g., one, two, three, four, five, ten, or all of the biomarkers shown in Tables 1-4), such as ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ
  • the expression level of the biomarker(s) may be determined using, e.g., a microarray, PCR, or other techniques described herein, for example, using a nucleic acid probe sequence based on the target sequences shown in Tables 1-4.
  • the diagnostic methods of the invention permit the assessment of whether a patient is likely to be responsive to treatment with irofulven, and can thus be used to direct the patient's treatment (e.g., as a first line therapy and/or as a second or third line therapy).
  • a patient to be treated or tested for responsiveness to irofulven according to the methods may include, e.g., a patient that has been diagnosed with cancer, a patient that has not received a cancer treatment (e.g., irofulven, an anti-cancer agent other than irofulven, or radiation), a patient that has received a cancer treatment (e.g., an anti-cancer agent other than irofulven or radiation), or a patient during treatment with irofulven.
  • a cancer treatment e.g., irofulven, an anti-cancer agent other than irofulven, or radiation
  • a cancer treatment e.g., an anti-cancer agent other than irofulven or radiation
  • the patient may have a solid tumor or a hematological cancer, such as a cancer type selected from prostate cancer, ovarian cancer (e.g., ovarian adenocarcinoma or embryonal carcinoma), liver cancer (e.g., hepatocellular carcinoma (HCC) or hepatoma), myeloma (e.g., multiple myeloma), colorectal cancer (e.g., colon cancer and rectal cancer), leukemia (e.g., acute myeloid leukemia, acute lymphoid leukemia, chronic myeloid leukemia, chronic lymphocytic leukemia, acute myeloblastic leukemia, acute promyelocytic leukemia, acute myelomonocytic leukemia, acute monocytic leukemia, acute erythroleukemia, and chronic leukemia), myelodysplastic syndrome, lymphoma (e.g., diffuse large B-cell lymphoma, cutaneous T-
  • the cancer of the patient is, e.g., prostate cancer, ovarian cancer, hepatocellular carcinoma (HCC), multiple myeloma, breast cancer, acute myelogenous leukemia (AML), acute lympho-blastic leukemia (ALL), chronic lymphocytic leukemia (CLL), myelodysplastic syndrome (MDS), chronic myelogenous leukemia-chronic phase (CMLCP), diffuse large B-cell lymphoma (DLBCL), cutaneous T-cell lymphoma (CTCL), peripheral T-cell lymphoma (PTCL), Hodgkin's lymphoma, cervical cancer, renal cell carcinoma (RCC), esophageal cancer, melanoma, glioma, pancreatic cancer, gastrointestinal stromal tumors (GIST), sarcoma, estrogen receptor-positive (ERpos) breast cancer, non-small cell lung carcinoma (NSCLC), colon cancer, bladder cancer, or squamous cell carcinoma of the head and neck
  • the patient may have a cancer (e.g., prostate cancer, ovarian cancer, or hepatocellular carcinoma (HCC)) that is resistant to one or more cancer therapies other than irofulven (e.g., docetaxel, cabazitaxel, mitoxantrone, estramustine, prednisone, carboplatin, bevacizumab, paclitaxel, gemcitabine, doxorubicin, topotecan, etoposide, tamoxifen, letrozole, sorafenib, fluorouracil, capecitabine, oxaliplatin, interferon-alpha, 5-fluorouracil (5-FU), a histone deacetylase (HDAC) inhibitor, ipilimumab, bortezomib, carfilzomib, thalidomide, lenalidomide, pomalidomide, dexamethasone, cyclophosp
  • a patient found to be responsive to irofulven according to the methods of the invention may be preferentially selected for treatment with irofulven.
  • a patient can be identified as responsive to irofulven by determining the expression level of one or more biomarkers (e.g., one or more of the biomarkers shown in Tables 1-4, such as ATP1B1 (SEQ ID NO: 201)) in a biological sample (e.g., a tumor sample) obtained from the patient, and subsequently administered irofulven.
  • biomarkers e.g., one or more of the biomarkers shown in Tables 1-4, such as ATP1B1 (SEQ ID NO: 201)
  • a patient can be identified as less likely to be responsive to irofulven by determining the expression level of one or more biomarkers (e.g., one or more of the biomarkers shown in Tables 1-4, such as ATP1B1 (SEQ ID NO: 201)) in a biological sample obtained from the patient. If the patient exhibits expression levels of one or more biomarkers indicative of non-responsiveness to irofulven, the patient may be treated with or offered a treatment with an agent other than irofulven.
  • biomarkers e.g., one or more of the biomarkers shown in Tables 1-4, such as ATP1B1 (SEQ ID NO: 201)
  • the patient may be treated with, e.g., radiation and/or administration of a therapeutic agent, such as docetaxel, cabazitaxel, mitoxantrone, estramustine, prednisone, carboplatin, bevacizumab, paclitaxel, gemcitabine, doxorubicin, topotecan, etoposide, tamoxifen, letrozole, sorafenib, fluorouracil, capecitabine, oxaliplatin, interferon-alpha, 5-fluorouracil (5-FU), a histone deacetylase (HDAC) inhibitor, ipilimumab, bortezomib, carfilzomib, thalidomide, lenalidomide, pomalidomide, dexamethasone, cyclophosphamide, vincristine, melphalan, tegafur, irinotecan, cetuxim
  • irofulven may be administered to the patient, for example, parenterally, enterally, or topically.
  • Enteral routes of irofulven administration include oral, buccal, sublabial, sublingual, or by inhalation.
  • Parenteral routes of irofulven administration include intravenous, transdermal, intradermal, intramuscular, intra-arterial, intracranial, subcutaneous, intraorbital, intraventricular, intraspinal, intraperitoneal, or intranasal.
  • the preferred route for administration of irofulven may be intravenous, such as intravenous infusion.
  • Irofulven can be administered at, e.g., a dose of about 0.05 mg/kg to 5 mg/kg, about 0.06 mg/kg to 4 mg/kg, about 0.1 mg/kg to 3 mg/kg, about 0.2 mg/kg to 2 mg/kg, about 0.3 mg/kg to 1 mg/kg, about 0.4 mg/kg to 1 mg/kg, about 0.2 mg/kg to 4 mg/kg, about 0.35 mg/kg to 4.5 mg/kg, about 0.25 mg/kg to 3.5 mg/kg, about 0.15 mg/kg to 2.5 mg/kg, about 0.45 mg/kg to about 1 mg/kg, about 0.45 mg/kg to about 2 mg/kg, or about 0.45 mg/kg to about 4 mg/kg.
  • Irofulven may be administered at a frequency of, e.g., at least once hourly, once daily, twice daily, once weekly, once every two weeks, once every three weeks, once every four weeks, once monthly, once every two months, once every three months, once every six months, or once every year.
  • irofulven may be administered at a treatment regimen of, e.g., about 0.05 mg/kg to 5 mg/kg, about 0.06 mg/kg to 4 mg/kg, about 0.1 mg/kg to 3 mg/kg, about 0.2 mg/kg to 2 mg/kg, about 0.3 mg/kg to 1 mg/kg, about 0.4 mg/kg to 1 mg/kg, about 0.2 mg/kg to 4 mg/kg, about 0.35 mg/kg to 4.5 mg/kg, about 0.25 mg/kg to 3.5 mg/kg, about 0.15 mg/kg to 2.5 mg/kg, about 0.45 mg/kg to about 1 mg/kg, about 0.45 mg/kg to about 2 mg/kg, or about 0.45 mg/kg to about 4 mg/kg on day 1 and day 8 every 3 weeks.
  • a treatment regimen of, e.g., about 0.05 mg/kg to 5 mg/kg, about 0.06 mg/kg to 4 mg/kg, about 0.1 mg/kg to 3 mg/kg, about 0.2 mg/kg to 2 mg/kg
  • irofulven may be administered at a treatment regimen of about 0.45 mg/kg on day 1 and day 8 every 3 weeks.
  • the treatment regimen may be repeated one to five times, one to ten times, one to fifteen times, one to twenty times, or more.
  • the administration of irofulven can be repeated at such a frequency for a certain period of time, followed by a period without treatment.
  • Such repeated administrations can occur over a course of therapy lasting a specified length of time (e.g., at least 1 week, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, 6 months, 8 months, 10 months, 12 months, 18 months, 24 months, 36 months, 48 months, or 60 months).
  • Irofulven can be administered in a pharmaceutical composition that includes one or more pharmaceutically acceptable carriers, excipients, or diluents.
  • suitable carriers, excipients, or diluents of irofulven include, e.g., saline, sterile water, polyalkylene glycols, oils of vegetable origin, hydrogenated napthalenes, suitable buffer, 1,3-butanediol, Ringer's solution and/or sodium chloride solution.
  • exemplary formulations for parenteral administration can include solutions prepared in water suitably mixed with a surfactant, e.g., hydroxypropylcellulose.
  • Dispersions can also be prepared in glycerol, liquid polyethylene glycols, DMSO and mixtures thereof with or without alcohol, and in oils. Under ordinary conditions of storage and use, these preparations may contain a preservative to prevent the growth of microorganisms.
  • Other exemplary carriers, excipients, or diluents are described in the Handbook of Pharmaceutical Excipients, 6th Edition, Rowe et al., Eds., Pharmaceutical Press (2009), hereby incorporated by reference in its entirety.
  • Kits of the invention can be used for determining the responsiveness of a cancer patient (e.g., a patient having a solid tumor cancer, such as prostate cancer, ovarian cancer, or hepatocellular carcinoma (HCC), or a hematological cancer, such as lymphoma (e.g., cutaneous T-cell lymphoma (CTCL)) to irofulven.
  • Kits of the invention can include reagents and/or materials for, e.g., collecting and/or purifying nucleic acids from biological samples (such as those obtained from a patient to be treated with a target drug(s) of the invention), reagents for amplifying such nucleic acids to produce an amplified sample, and/or at least one device of the invention.
  • Reagents for amplifying nucleic acids may include, e.g., PCR reagents, including but not limited to DNA polymerase, RNA polymerase, PCR buffer, magnesium chloride solutions, nucleic acid primers (e.g., primers designed to target particular biomarkers of responsiveness to a target drug(s) of interest), and/or any other PCR reagents as are well known in the art.
  • PCR reagents including but not limited to DNA polymerase, RNA polymerase, PCR buffer, magnesium chloride solutions, nucleic acid primers (e.g., primers designed to target particular biomarkers of responsiveness to a target drug(s) of interest), and/or any other PCR reagents as are well known in the art.
  • kits useful in the method may include includes one or more of the following: a kit for RNA extraction from tumors (e.g., Trizol for mRNA, mirVana miRNA isolation kit from Ambion Inc), a kit for RNA labeling (e.g., MessageAmp from Ambion Inc., FlashTag from Genisphere Inc), a microarray for measuring biomarker expression (e.g., HG-U133A, HG-U133_Plus2 or miRNA-1.0 from Affymetrix Inc), a microarray hybridization station and scanner (e.g., GeneChip System 3000Dx from Affymetrix Inc), and/or software for analyzing the expression of biomarker genes or RNAs (e.g., miRNAs) as described in herein (e.g., implemented in R from R-Project or S-Plus from Insightful Corp.).
  • a kit for RNA extraction from tumors e.g., Trizol for mRNA, mirVana miRNA isolation kit from Ambion Inc
  • a kit of the invention can include one or more probes capable of detecting one or more biomarkers of Tables 1-4 (e.g., the kit may include probes for the biomarkers of Tables 1-4).
  • probes can, for example, include nucleic acids capable of hybridizing to the biomarker based on nucleic acid sequence complementarity.
  • a probe has at least 85% sequence identity (e.g., 85%, 90%, 95%, 97%, 98%, 99%, or 100% sequence identity) to a nucleic acid sequence that is complementary or identical to at least 5 (e.g., at least 15) consecutive nucleotides of one or more biomarkers.
  • the probes can be attached a solid surface, such as a microarray.
  • the kit may include NanoString capture probes, NanoString reporter probes, and/or one or more nCounter cartridges.
  • the kit may include reagents for next generation sequencing, including but not limited to poly(T) oligonucleotides, dye terminators, sequencing adapters, adapter ligation reagents, reverse transcriptase, primers (e.g., random primers), DNA-cleaving enzymes, polymerases, and/or any combination thereof.
  • the kit may also be one that includes a protein array and/or reagents for detection of the polypeptide product(s) of one or more biomarkers of Tables 1-4.
  • DNA chip measurements of the 60 cancer cell lines of the NCI60 data set were performed using Affymetrix HG-U133A arrays and logit normalized. For each array, the logit transformation was performed followed by a Z-transformation to mean zero and SD 1, and correlated to growth inhibition (log(GI50)). Growth inhibition data of irofulven against the same cell lines were downloaded from the National Cancer Institute. Each gene's expression in each cell line was correlated to the growth of those cell lines (log(GI50)) in the presence of irofulven. The Pearson correlation coefficient was then determined to identify genes positively and negatively correlated to sensitivity to irofulven. Tables 1 and 2 show the top positively correlated genes (the biomarkers of sensitivity) and negatively correlated genes (the biomarkers of resistance) using the Affymetrix HG-U133A arrays.
  • Affymetrix IDs refer to the array type HG-U133A.
  • Affymetrix Probe Gene Affymetrix ID Correlation Affymetrix Probe Sequence SEQ ID NO: S100A10 200872_at 0.571 AGAGTTGTCCAAAGGGTCGCTTAAG 1 ATP1B1 201242_s_at 0.554 TGATCACAAGCACAAATCTTTCCCA 2 CTBP2 201220_x_at 0.549 ACACCCTGCTCTACAATGTTGCATC 3 ASPH 209135_at 0.539 AAAGCTGTGCTGTCGGTGATACAGA 4 LAPTM4B 214039_s_at 0.525 GTTACAAAGTCAGCAACTCTCCTGT 5 CTBP2 210835_s_at 0.524 TGCACGCATAGGATTGAAGACAGTA 6 MYOF 201798_s_at 0.519 CC
  • Affymetrix IDs refer to the array type HG-U133A.
  • Affymetrix Probe Gene Affymetrix ID Correlation Affymetrix Probe Sequence SEQ ID NO: IGJ 212592_at ⁇ 0.609 GCTCACCTGAAAGAGGTATGCTCTC 101 MZB1 221286_s_at ⁇ 0.608 AAAGAAGCTGGGGCTTGCTCTGACG 102 CD8B 207979_s_at ⁇ 0.59 GTAACATTGGGTCCTGGGTCTTTCA 103 ITGB7 205718_at ⁇ 0.588 GAGGATGACGCCAGAGGCACGGTCG 104 CD28 206545_at ⁇ 0.582 GATCAAACTCAGCAGTACTTGGGTG 105 CD53 203416_at ⁇ 0.573 AAAGGGCAAGATCTCATTTCAATTT 106 IQGAP2 203474_at ⁇
  • DNA chip measurements of the 60 cancer cell lines of the NCI60 data set were also performed using HG-U133_Plus_2 arrays and logit normalized. For each array, the logit transformation was performed followed by a Z-transformation to mean zero and SD 1, and correlated to growth inhibition (log(GI50)). Growth inhibition data of irofulven against the same cell lines were downloaded from the National Cancer Institute. Each gene's expression in each cell line was correlated to the growth of those cell lines (log(GI50)) in the presence of irofulven. The Pearson correlation coefficient was then determined to identify genes positively and negatively correlated to sensitivity to irofulven.
  • Tables 3 and 4 show the top positively correlated genes (the biomarkers of sensitivity) and negatively correlated genes (the biomarkers of resistance) using the Affymetrix HG-U133_Plus_2 arrays.
  • the Affymetrix HG-U133_Plus_2 array includes additional genes (e.g., PTGR1 and NME7) that are not included in the Affymetrix HG-U133A array, which were top ranking biomarkers of sensitivity and biomarkers of resistance, as shown in Tables 3 and 4.
  • Affymetrix IDs refer to the array type HG-U133_Plus_2.
  • Affymetrix Probe Gene Affymetrix ID Correlation Affymetrix Probe Sequence SEQ ID NO: ATP1B1 201242_s_at 0.33 GGACCTACACTTAATCTATATGCTT 201 UCHL1 201387_s_at 0.3 AGCCCATGATGCCGTGGCACAGGAA 202 PTGR1 231897_at 0.3 AGGATTTGAAAACATGCCAGCTGCA 203 NME7 227556_at 0.29 GACACAGCTTTAGAACATACCGGAG 204 PLS3 201215_at 0.27 TGTACTCTTGCTTTGTCAAGCTGTT 205 S100A10 200872_at 0.27 GGACCTGGACCAGTGTAGAGATGGC 206 CD24 209771_x_at 0.27 GAACCTGGTCCTA
  • Affymetrix IDs refer to the array type HG-U133_Plus_2.
  • Affymetrix Probe Gene Affymetrix ID Correlation Affymetrix Probe Sequence SEQ ID NO: IGLC1 214677_x_at ⁇ 0.31 AAGTCCCACAGAAGCTACAGCTGCC 301 IGLC1 209138_x_at ⁇ 0.29 AAGACAGTGGCCCCTACAGAATGTT 302 CYAT1 215121_x_at ⁇ 0.28 GAGCCGTGACAGTGGCCTGGAAGGC 303 IGLC1 IGLV1-44 LAPTM5 201721_s_at ⁇ 0.26 AAAACAGTCCCTTCAAACACACAAT 304 ARHGDIB 201288_at ⁇ 0.25 GTCTCCATCTCAGTACACAATCATT 305 IGLV1-44 215379_x_at ⁇ 0.25 CTCCTC
  • An mRNA-based predictor of responsiveness to irofulven developed according to the methods of the invention was applied to 3,522 patients having a variety of cancers. Each patient had a pre-treatment measurement of gene expression with an Affymetrix array. The predicted irofulven sensitivity of each patient was calculated as the difference between the mean of the expression levels of the biomarkers of sensitivity and the mean of the expression levels of the biomarkers of resistance for the patient. When the patients were grouped by cancer types, and cancer types predicted to be more responsive to irofulven were identified ( FIG. 1 ).
  • solid tumor cancers were predicted to be more responsive to irofulven treatment than hematological cancers.
  • HCC hepatocellular carcinoma
  • breast cancer cervical cancer
  • RRCC renal cell carcinoma
  • esophageal cancer melanoma
  • glioma pancreatic cancer
  • GIST gastrointestinal stromal tumors
  • sarcoma estrogen receptor-positive (ERpos) breast cancer
  • NSCLC non-small cell lung carcinoma
  • CCL cutaneous T-cell lymphoma
  • AML acute myelogenous leukemia
  • ALL acute lympho-blastic leukemia
  • CLL chronic lymphocytic leukemia
  • MDS myelodysplastic syndrome
  • CMLCP chronic myelogenous leukemia-chronic phase
  • DLBCL diffuse large B-cell lymphoma
  • PTCL peripheral T-cell lymphoma
  • Hodgkin's lymphoma patients were predicted to be the most responsive to irofulven.
  • the median of the boxplots shown in FIG. 1 is a cutoff that may be used to separate patients predicted to be responsive to irofulven treatment from patients predicted to be non-responsive to irofulven treatment for a given cancer type. Values above the median indicate patients predicted to be responsive to irofulven, while values below the median indicate patients predicted to be non-responsive to irofulven. For a test sample from an individual patient, it is useful to compare the test sample to the reference population for the same cancer type. If the test sample is above the median for the reference population of the same cancer type, then the patient is predicted to be responsive to irofulven treatment.
  • test sample is below the median for the reference population of the same cancer type, then the patient is predicted to be non-responsive to irofulven treatment.
  • This method for predicting patient responsiveness can also be used when the reference cancer population consists of only two patients: a patient responsive to irofulven treatment and a patient non-responsive to irofulven treatment.
  • the diagnostic methods of the present invention can be used to predict the responsiveness of a prostate cancer patient to treatment with irofulven.
  • the prostate cancer patient may be one that has not previously received any cancer treatment or one that has received a cancer treatment other than irofulven.
  • the patient may be one diagnosed with prostate cancer or one with recurrence of prostate cancer.
  • the patient may also have prostate cancer that is resistant to treatment, such as treatment with docetaxel, cabazitaxel, mitoxantrone, estramustine, prednisone, and/or surgery.
  • a biological sample (e.g., a prostate tissue sample) may be obtained from the patient through methods well known in the art.
  • the sample may be frozen and/or prepared, e.g., by formalin fixation and paraffin embedding.
  • mRNA can be isolated from the sample and a gene expression profile can be determined, e.g., using a microarray platform, such as the Affymetrix HG-U133A or HG-U133_Plus_2 array, for one or more of the biomarkers shown in Tables 1-4.
  • One or more of the biomarkers shown in Tables 1-4 can also be measured, e.g., by sequencing or PCR-based techniques, such as those described herein.
  • the expression level of one or more biomarkers of sensitivity to irofulven can be determined in the sample from the patient, such as one or more of ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), ID1 (SEQ ID NO: 217), and GJA1 (SEQ ID NO: 218).
  • ATP1B1 SEQ ID NO: 201
  • the biomarker is ATP1B1 (SEQ ID NO: 201).
  • the expression level of one or more biomarkers of resistance to irofulven can also be determined in the sample from the patient, such as one or more of IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), CD53 (SEQ ID NO: 310), MZB1 (SEQ ID NO: 313), RASSF5 (SEQ ID NO: 314 or 386), FAM46C (SEQ ID NO: 315), RCSD1 (SEQ ID NO: 316), IGJ (SEQ ID NO: 317), LPXN (SEQ ID NO: 319), ITGB7 (SEQ ID NO: 320), and
  • the prostate cancer patient may be responsive to irofulven if the expression level of one or more of the biomarkers of sensitivity is substantially similar to the expression level of the biomarkers of sensitivity in a cell or tissue known to be sensitive to irofulven.
  • the prostate cancer patient may also be responsive to irofulven if the expression level of one or more of the biomarkers of resistance is substantially dissimilar to the expression level of the biomarkers of resistance in a cell or tissue known to be resistant to irofulven.
  • the patient can be administered irofulven, such as irofulven administered intravenously at a dose of about 0.05 mg/kg to 5 mg/kg (e.g., about 0.1 mg/kg to 1 mg/kg, such as about 0.45 mg/kg).
  • irofulven administered intravenously at a dose of about 0.05 mg/kg to 5 mg/kg (e.g., about 0.1 mg/kg to 1 mg/kg, such as about 0.45 mg/kg).
  • the patient can be administered one or more therapies other than irofulven, such as radiation or a therapeutic agent (e.g., docetaxel, cabazitaxel, mitoxantrone, estramustine, prednisone, and/or another therapeutic agent described herein).
  • a therapeutic agent e.g., docetaxel, cabazitaxel, mitoxantrone, estramustine, prednisone, and/or another therapeutic agent described herein.
  • the diagnostic methods of the present invention can be used to predict the responsiveness of an ovarian cancer patient to treatment with irofulven.
  • the ovarian cancer patient may be one that has not previously received any cancer treatment or one that has received a cancer treatment other than irofulven.
  • the patient may be one diagnosed with ovarian cancer or one with recurrence of ovarian cancer.
  • the patient may also have ovarian cancer that is resistant to treatment, such as treatment with docetaxel, carboplatin, bevacizumab, paclitaxel, gemcitabine, doxorubicin, topotecan, etoposide, tamoxifen, and/or letrozole.
  • a biological sample (e.g., an ovarian tissue sample) may be obtained from the patient through methods well known in the art.
  • the sample may be frozen and/or prepared, e.g., by formalin fixation and paraffin embedding.
  • mRNA can be isolated from the sample and a gene expression profile can be determined, e.g., using a microarray platform, such as the Affymetrix HG-U133A or HG-U133_Plus_2 array, for one or more of the biomarkers shown in Tables 1-4.
  • One or more of the biomarkers shown in Tables 1-4 can also be measured, e.g., by sequencing or PCR-based techniques, such as those described herein.
  • the expression level of one or more biomarkers of sensitivity to irofulven can be determined in the sample from the patient, such as one or more of ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), ID1 (SEQ ID NO: 217), and GJA1 (SEQ ID NO: 218).
  • ATP1B1 SEQ ID NO: 201
  • the biomarker is ATP1B1 (SEQ ID NO: 201).
  • the expression level of one or more biomarkers of resistance to irofulven can also be determined in the sample from the patient, such as one or more of IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), CD53 (SEQ ID NO: 310), MZB1 (SEQ ID NO: 313), RASSF5 (SEQ ID NO: 314 or 386), FAM46C (SEQ ID NO: 315), RCSD1 (SEQ ID NO: 316), IGJ (SEQ ID NO: 317), LPXN (SEQ ID NO: 319), ITGB7 (SEQ ID NO: 320), and
  • the ovarian cancer patient may be responsive to irofulven if the expression level of one or more of the biomarkers of sensitivity is substantially similar to the expression level of the biomarkers of sensitivity in a cell or tissue known to be sensitive to irofulven.
  • the ovarian cancer patient may also be responsive to irofulven if the expression level of one or more of the biomarkers of resistance is substantially dissimilar to the expression level of the biomarkers of resistance in a cell or tissue known to be resistant to irofulven.
  • the patient can be administered irofulven, such as irofulven administered intravenously at a dose of about 0.05 mg/kg to 5 mg/kg (e.g., about 0.1 mg/kg to 1 mg/kg, such as about 0.45 mg/kg).
  • irofulven administered intravenously at a dose of about 0.05 mg/kg to 5 mg/kg (e.g., about 0.1 mg/kg to 1 mg/kg, such as about 0.45 mg/kg).
  • the patient can be administered one or more therapies other than irofulven, such as radiation or a therapeutic agent (e.g., docetaxel, carboplatin, bevacizumab, paclitaxel, gemcitabine, doxorubicin, topotecan, etoposide, tamoxifen, letrozole, and/or another therapeutic agent described herein).
  • a therapeutic agent e.g., docetaxel, carboplatin, bevacizumab, paclitaxel, gemcitabine, doxorubicin, topotecan, etoposide, tamoxifen, letrozole, and/or another therapeutic agent described herein.
  • HCC Hepatocellular Carcinoma
  • the diagnostic methods of the present invention can be used to predict the responsiveness of a hepatocellular carcinoma (HCC) patient to treatment with irofulven.
  • the HCC patient may be one that has not previously received any cancer treatment or one that has received a cancer treatment other than irofulven.
  • the patient may be one diagnosed with HCC or one with recurrence of HCC.
  • the patient may also have HCC that is resistant to treatment, such as treatment with sorafenib, doxorubicin, cisplatin, fluorouracil, gemcitabine, capecitabine, oxaliplatin, interferon-alpha, and/or 5-fluorouracil (5-FU).
  • a biological sample (e.g., a liver tissue sample) may be obtained from the patient through methods well known in the art.
  • the sample may be frozen and/or prepared, e.g., by formalin fixation and paraffin embedding.
  • mRNA can be isolated from the sample and a gene expression profile can be determined, e.g., using a microarray platform, such as the Affymetrix HG-U133A or HG-U133_Plus_2 array, for one or more of the biomarkers shown in Tables 1-4.
  • One or more of the biomarkers shown in Tables 1-4 can also be measured, e.g., by sequencing or PCR-based techniques, such as those described herein.
  • the expression level of one or more biomarkers of sensitivity to irofulven can be determined in the sample from the patient, such as one or more of ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), ID1 (SEQ ID NO: 217), and GJA1 (SEQ ID NO: 218).
  • ATP1B1 SEQ ID NO: 201
  • the biomarker is ATP1B1 (SEQ ID NO: 201).
  • the expression level of one or more biomarkers of resistance to irofulven can also be determined in the sample from the patient, such as one or more of IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), CD53 (SEQ ID NO: 310), MZB1 (SEQ ID NO: 313), RASSF5 (SEQ ID NO: 314 or 386), FAM46C (SEQ ID NO: 315), RCSD1 (SEQ ID NO: 316), IGJ (SEQ ID NO: 317), LPXN (SEQ ID NO: 319), ITGB7 (SEQ ID NO: 320), and
  • the HCC patient may be responsive to irofulven if the expression level of one or more of the biomarkers of sensitivity is substantially similar to the expression level of the biomarkers of sensitivity in a cell or tissue known to be sensitive to irofulven.
  • the HCC patient may also be responsive to irofulven if the expression level of one or more of the biomarkers of resistance is substantially dissimilar to the expression level of the biomarkers of resistance in a cell or tissue known to be resistant to irofulven.
  • the patient can be administered irofulven, such as irofulven administered intravenously at a dose of about 0.05 mg/kg to 5 mg/kg (e.g., about 0.1 mg/kg to 1 mg/kg, such as about 0.45 mg/kg).
  • irofulven administered intravenously at a dose of about 0.05 mg/kg to 5 mg/kg (e.g., about 0.1 mg/kg to 1 mg/kg, such as about 0.45 mg/kg).
  • the patient can be administered one or more therapies other than irofulven, such as radiation or a therapeutic agent (e.g., docetaxel, carboplatin, bevacizumab, paclitaxel, gemcitabine, doxorubicin, topotecan, etoposide, tamoxifen, letrozole, and/or another therapeutic agent described herein).
  • a therapeutic agent e.g., docetaxel, carboplatin, bevacizumab, paclitaxel, gemcitabine, doxorubicin, topotecan, etoposide, tamoxifen, letrozole, and/or another therapeutic agent described herein.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Organic Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Pathology (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Genetics & Genomics (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Hospice & Palliative Care (AREA)
  • Biophysics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Dermatology (AREA)
  • Physics & Mathematics (AREA)
  • Oncology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The present invention features methods, devices, and kits for detecting expression in a patient having cancer or determining responsive of a patient having cancer to a treatment, such as irofulven. The invention further includes methods of treating a patient having cancer by administering, e.g., irofulven.

Description

FIELD OF THE INVENTION
The invention features methods to detect the expression levels of genes encoding biomarkers in cancer patients and to predict the responsiveness of cancer patients to irofulven.
BACKGROUND
DNA microarrays have been used to measure gene expression in samples from patients and to facilitate diagnosis of disease. Gene expression can reveal the presence of cancer in a patient in addition to the type, stage, and origin of the cancer. Gene expression may even have a role in predicting the efficacy of cancer therapies. In recent decades, the National Cancer Institute (NCI) has tested cancer therapeutics for their effect in limiting the growth of 60 human cancer cell lines. The NCI has also measured gene expression in those 60 cancer cell lines using DNA microarrays. Various studies have explored the relationship between gene expression and therapeutic effect using the NCI datasets.
During cancer treatment, critical time is often lost due to a trial and error approach to finding an effective therapy. In addition, cancer cells often develop resistance to a previously effective therapy. In such situations, patient outcome would be greatly improved by early detection of such resistance.
Thus, there exists a need in the art for methods and devices that can predict the responsiveness of cancer patients to a medical treatment.
SUMMARY OF THE INVENTION
The invention features methods for detecting expression of a biomarker (e.g., one, two, three, four, five, ten, twenty, or all of the biomarkers shown in Tables 1-4, such as ATP1B1 (SEQ ID NO: 201)) in a patient having cancer, such as a patient having cancer (e.g., a human) that is resistant to one or more cancer therapies other than irofulven (e.g., a patient with prostate cancer, ovarian cancer, or hepatocellular carcinoma (HCC) that is resistant to one or more cancer therapies other than irofulven), and for determining responsiveness of a cancer patient (e.g., a patient with prostate cancer, ovarian cancer, or HCC) to treatment with irofulven. The invention also features methods of treating cancer in a patient in need thereof (e.g., a patient with prostate cancer, ovarian cancer, or HCC or a treatment resistant form thereof) that include administering irofulven to the patient, in which the patient is or has been determined to be responsive to irofulven according to the diagnostic methods described herein.
Exemplary types of cancer that can be diagnosed or treated with the methods include, e.g., prostate cancer, ovarian cancer (e.g., ovarian adenocarcinoma or embryonal carcinoma), liver cancer (e.g., HCC or hepatoma), myeloma (e.g., multiple myeloma), colorectal cancer (e.g., colon cancer and rectal cancer), leukemia (e.g., acute myeloid leukemia, acute lymphoid leukemia, chronic myeloid leukemia, chronic lymphocytic leukemia, acute myeloblastic leukemia, acute promyelocytic leukemia, acute myelomonocytic leukemia, acute monocytic leukemia, acute erythroleukemia, and chronic leukemia), myelodysplastic syndrome, lymphoma (e.g., diffuse large B-cell lymphoma, cutaneous T-cell lymphoma, peripheral T-cell lymphoma, Hodgkin's lymphoma, non-Hodgkin's lymphoma, Waldenstrom's macroglobulinemia, and lymphocytic lymphoma), cervical cancer, esophageal cancer, melanoma, glioma (e.g., oligodendroglioma), pancreatic cancer (e.g., adenosquamous carcinoma, signet ring cell carcinoma, hepatoid carcinoma, colloid carcinoma, islet cell carcinoma, and pancreatic neuroendocrine carcinoma), gastrointestinal stromal tumor, sarcoma (e.g., fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, leiomyosarcoma, Ewing's sarcoma, and rhabdomyosarcoma), breast cancer (e.g., medullary carcinoma), ER-positive cancer, bladder cancer, head and neck cancer (e.g., squamous cell carcinoma of the head and neck), lung cancer (e.g., non-small cell lung carcinoma, large cell carcinoma, bronchogenic carcinoma, and papillary adenocarcinoma), metastatic cancer, oral cavity cancer, uterine cancer, testicular cancer (e.g., seminoma and embryonal carcinoma), skin cancer (e.g., squamous cell carcinoma, and basal cell carcinoma), thyroid cancer (e.g., papillary carcinoma and medullary carcinoma), brain cancer (e.g., astrocytoma and craniopharyngioma), stomach cancer, intra-epithelial cancer, bone cancer, biliary tract cancer, eye cancer, larynx cancer, kidney cancer (e.g., renal cell carcinoma and Wilms tumor), gastric cancer, blastoma (e.g., nephroblastoma, medulloblastoma, hemangioblastoma, neuroblastoma, and retinoblastoma), polycythemia vera, chordoma, synovioma, mesothelioma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, cystadenocarcinoma, bile duct carcinoma, choriocarcinoma, epithelial carcinoma, ependymoma, pinealoma, acoustic neuroma, schwannoma, meningioma, pituitary adenoma, nerve sheath tumor, cancer of the small intestine, cancer of the endocrine system, cancer of the penis, cancer of the urethra, cutaneous or intraocular melanoma, a gynecologic tumor, solid tumors of childhood, or neoplasms of the central nervous system. For example, the cancer may be a solid tumor or a hematological cancer.
A first aspect of the invention features a method for detecting expression of a biomarker (e.g., one, two, three, four, five, ten, twenty, or all of the biomarkers shown in Tables 1 and/or 2, such as ATP1B1 (SEQ ID NO: 201)) in a patient having cancer (e.g., prostate cancer, ovarian cancer, or HCC), such as a patient having cancer that is resistant to one or more cancer therapies other than irofulven (e.g., a patient with prostate cancer, ovarian cancer, or HCC that is resistant to one or more cancer therapies other than irofulven). The method includes (a) contacting a sample (e.g., a tumor sample) from the patient including one or more nucleic acid molecules with a device (e.g., a microarray) including: i) one or more single-stranded nucleic acid molecules capable of specifically hybridizing with the nucleotides of one or more biomarkers of sensitivity selected from the biomarkers of Tables 1 and 3 (e.g., ATP1B1 (SEQ ID NO: 201)); and/or ii) one or more single-stranded nucleic acid molecules capable of specifically hybridizing with the nucleotides of one or more biomarkers of resistance selected from the biomarkers of Tables 2 and 4 (e.g., IGLC1 (SEQ ID NO: 301, 302, 303, or 318)); and (b) detecting a level of expression of one or more of the biomarker(s) of sensitivity and/or one or more of the biomarkers of resistance by performing microarray analysis or quantitative reverse transcriptase polymerase chain reaction (qRT-PCR). Expression of the biomarker(s) may be detected by determining the level of a messenger RNA (mRNA) transcribed from a nucleic acid molecule corresponding to a gene of the biomarker (s; e.g., a mRNA expressed from the ATP1B1 gene (SEQ ID NO: 201)) or a complementary DNA (cDNA) thereof.
A second aspect of the invention features a method of determining responsiveness of a patient having cancer (e.g., one of the cancers noted above, such as prostate cancer, ovarian cancer, or HCC) to irofulven. In particular, the patient may have a cancer that is resistant to one or more cancer therapies other than irofulven, such as prostate cancer, ovarian cancer, or HCC that is resistant to one or more cancer therapies other than irofulven. The method includes a) contacting a sample (e.g., a tumor sample) from the patient including one or more nucleic acid molecules with a device (e.g., a microarray or a device for performing a qRT-PCR reaction) including: i) one or more single-stranded nucleic acid molecules capable of specifically hybridizing with the nucleotides of one or more biomarkers of sensitivity selected from the biomarkers of Tables 1 and 3 (e.g., ATP1B1 (SEQ ID NO: 201)); and/or ii) one or more single-stranded nucleic acid molecules capable of specifically hybridizing with the nucleotides of one or more biomarkers of resistance selected from the biomarkers of Tables 2 and 4 (e.g., IGLC1 (SEQ ID NO: 301, 302, 303, or 318)); and b) measuring hybridization, or an amplification product resulting from hybridization, between the one or more nucleic acid molecules from the patient and the single-stranded nucleic acid molecules of the device to detect a level of expression of one or more of the biomarkers of sensitivity and/or one or more of the biomarkers of resistance. The patient is determined to be responsive to irofulven if: i) the level of expression of the biomarkers of sensitivity is substantially similar to the level of expression of the biomarkers of sensitivity (e.g., ATP1B1 (SEQ ID NO: 201)) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive to irofulven; and/or ii) the level of expression of the biomarkers of resistance (e.g., IGLC1 (SEQ ID NO: 301, 302, 303, or 318)) is substantially dissimilar to the level of expression of the biomarkers of resistance in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be resistant to irofulven.
The method of the second aspect can further include administering irofulven to the patient if: i) the level of expression of the biomarkers of sensitivity (e.g., ATP1B1 (SEQ ID NO: 201)) is substantially similar to the level of expression of the biomarkers of sensitivity in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive to irofulven; and/or ii) the level of expression of the biomarkers of resistance (e.g., IGLC1 (SEQ ID NO: 301, 302, 303, OR 318)) is substantially dissimilar to the level of expression of the biomarkers of resistance in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be resistant to irofulven. The method can further include administering one or more cancer therapies other than irofulven to the patient if: i) the level of expression of the biomarkers of sensitivity (e.g., ATP1B1 (SEQ ID NO: 201)) is substantially dissimilar to the level of expression of the biomarkers of sensitivity in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive to irofulven; and/or ii) the level of expression of the biomarkers of resistance is substantially similar to the level of expression of the biomarkers of resistance (e.g., IGLC1 (SEQ ID NO: 301, 302, 303, OR 318)) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be resistant to irofulven. In particular, the one or more of the cancer therapies includes surgery, radiation, or a therapeutic agent, such as a docetaxel, cabazitaxel, mitoxantrone, estramustine, prednisone, carboplatin, bevacizumab, paclitaxel, gemcitabine, doxorubicin, topotecan, etoposide, tamoxifen, letrozole, sorafenib, fluorouracil, capecitabine, oxaliplatin, interferon-alpha, 5-fluorouracil (5-FU), a histone deacetylase (HDAC) inhibitor, ipilimumab, bortezomib, carfilzomib, thalidomide, lenalidomide, pomalidomide, dexamethasone, cyclophosphamide, vincristine, melphalan, tegafur, irinotecan, cetuximab, leucovorin, SN-38, everolimus, temsirolimus, bleomycin, lomustine, depsipeptide, erlotinib, cisplatin, busulfan, epirubicin, arsenic trioxide, bendamustine, fulvestrant, teniposide, adriamycin, decitabine, estramustine, azaguanine, aclarubicin, mitomycin, paclitaxel, taxotere, APO010, ara-c, methylprednisolone, methotrexate, methyl-gag, belinostat, idarubicin, IL4-PR38, valproic acid, all-trans retinoic acid (ATRA), cytoxan, suberoylanilide hydroxamic acid, leukeran, fludarabine, vinblastine, dacarbazine, hydroxyurea, tegafur, daunorubicin, mechlorethamine, streptozocin, carmustine, mercaptopurine, dactinomycin, tretinoin, ifosfamide, floxuridine, thioguanine, PSC 833, herceptin, celecoxib, iressa, anastrozole, and rituximab.
The invention also features a method of treating cancer in a patient in need thereof (e.g., one of the cancers noted above, such as prostate cancer, ovarian cancer, or HCC) that includes administering irofulven to the patient, in which the patient has been determined to be responsive to irofulven according to the method of the first or second aspect of the invention. In particular, the patient may have a cancer that is resistant to one or more cancer therapies other than irofulven (e.g., a patient with prostate cancer, ovarian cancer, or HCC that is resistant to one or more cancer therapies other than irofulven).
A third aspect of the invention features a method of treating a patient having cancer (e.g., one of the cancers noted above, such as prostate cancer, ovarian cancer, or HCC). In particular, the patient may have a cancer that is resistant to one or more cancer therapies other than irofulven (e.g., a patient with prostate cancer, ovarian cancer, or HCC that is resistant to one or more cancer therapies other than irofulven). The method includes a) contacting a sample (e.g., a tumor sample) from the patient including one or more nucleic acid molecules with a device (e.g., a microarray or a device for performing a qRT-PCR reaction) including: i) one or more single-stranded nucleic acid molecules capable of specifically hybridizing with the nucleotides of one or more biomarkers of sensitivity selected from the biomarkers of Tables 1 and 3 (e.g., ATP1B1 (SEQ ID NO: 201)); and/or ii) one or more single-stranded nucleic acid molecules capable of specifically hybridizing with the nucleotides of one or more biomarkers of resistance selected from the biomarkers of Tables 2 and 4 (e.g., IGLC1 (SEQ ID NO: 301, 302, 303, OR 318)); and b) measuring hybridization, or an amplification product resulting from hybridization, between the one or more nucleic acid molecules from the patient and the single-stranded nucleic acid molecules of the device to detect a level of expression of one or more of the biomarkers of sensitivity and/or one or more of the biomarkers of resistance; and c) administering irofulven to the patient if: i) the level of expression of the biomarkers of sensitivity is substantially similar to the level of expression of the biomarkers of sensitivity in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive to irofulven; and/or ii) the level of expression of the biomarkers of resistance is substantially dissimilar to the level of expression of the biomarkers of resistance in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be resistant to irofulven.
The method of the third aspect of the invention may further include administering one or more additional therapies (e.g., surgery, radiation, or a therapeutic agent) to the patient prior to, concurrently with, or after administration of irofulven. In particular, the therapeutic agent may be selected from the group consisting of docetaxel, cabazitaxel, mitoxantrone, estramustine, prednisone, carboplatin, bevacizumab, paclitaxel, gemcitabine, doxorubicin, topotecan, etoposide, tamoxifen, letrozole, sorafenib, fluorouracil, capecitabine, oxaliplatin, interferon-alpha, 5-fluorouracil (5-FU), a histone deacetylase (HDAC) inhibitor, ipilimumab, bortezomib, carfilzomib, thalidomide, lenalidomide, pomalidomide, dexamethasone, cyclophosphamide, vincristine, melphalan, tegafur, irinotecan, cetuximab, leucovorin, SN-38, everolimus, temsirolimus, bleomycin, lomustine, depsipeptide, erlotinib, cisplatin, busulfan, epirubicin, arsenic trioxide, bendamustine, fulvestrant, teniposide, adriamycin, decitabine, estramustine, azaguanine, aclarubicin, mitomycin, paclitaxel, taxotere, APO010, ara-c, methylprednisolone, methotrexate, methyl-gag, belinostat, idarubicin, IL4-PR38, valproic acid, all-trans retinoic acid (ATRA), cytoxan, suberoylanilide hydroxamic acid, leukeran, fludarabine, vinblastine, dacarbazine, hydroxyurea, tegafur, daunorubicin, mechlorethamine, streptozocin, carmustine, mercaptopurine, dactinomycin, tretinoin, ifosfamide, floxuridine, thioguanine, PSC 833, herceptin, celecoxib, iressa, anastrozole, and rituximab. The therapeutic agent can be administered parenterally (e.g. intravenously, intramuscularly, transdermally, intradermally, intra-arterially, intracranially, subcutaneously, intraorbitally, intraventricularly, intraspinally, intraperitoneally, or intranasally), enterally, or topically.
In the second or third aspect of the invention, irofulven may be administered parenterally (e.g. intravenously, intramuscularly, transdermally, intradermally, intra-arterially, intracranially, subcutaneously, intraorbitally, intraventricularly, intraspinally, intraperitoneally, or intranasally), enterally, or topically. Preferably, irofulven is administered by intravenous injection. Irofulven may be administered to the patient two or more times, such as one or more times daily, weekly, every two weeks, every three weeks, or monthly (e.g., one or more times per week for two weeks or more). Additionally, a second dose of irofulven may be administered to the patient two weeks, three weeks, four weeks, or five weeks after administration of a prior dose of irofulven. In particular, irofulven is administered in a 3 week treatment regimen in which the irofulven is administered on day 1 an day 8. The treatment regimen may be repeated two to twenty times or more, as needed.
In particular, irofulven may be administered to the patient at a dose of about 0.05 mg/kg to 5 mg/kg, such as at a dose of about 0.1 mg/kg to 1 mg/kg. For example, irofulven may be administered at a dose of about 0.15 mg/kg, 0.20 mg/kg, 0.25 mg/kg, 0.30 mg/kg, 0.35 mg/kg, 0.40 mg/kg, 0.45 mg/kg, 0.55 mg/kg, 0.60 mg/kg, 0.65 mg/kg, 0.70 mg/kg, 0.75 mg/kg, 0.80 mg/kg, 0.85 mg/kg, 0.90 mg/kg, or 0.95 mg/kg. Irofulven may be administered to the patient in a treatment regimen at least once per week for at least two weeks and/or on day 1 and day 8 of a 3 week treatment regimen, in which the treatment regimen occurs one or more times (e.g., the treatment regimen is repeated two to twenty times). In particular, irofulven is administered to the patient at a dose of about 0.1 mg/kg to 1 mg/kg, such as a dose of about 0.2 mg/kg to about 0.6 mg/kg (e.g., a dose of about 0.45 mg/kg). This dosage of irofulven can be administered in a 3 week treatment regimen, in which irofulven is administered on day 1 and day 8.
In the second or third aspect of the invention, the contacting step (a) and the measuring step (b) may occur prior to, concurrent with, or after administration of irofulven to the patient. Additionally, the contacting step (a) and the measuring step (b) may occur two or more times, e.g., during treatment with irofulven. For example, the contacting step (a) and the measuring step (b) may occur two or more times to assess the continued sensitivity of the patient to irofulven.
In any of the above aspects of the invention, the device can include at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more single-stranded nucleic acid molecules capable of specifically hybridizing with the nucleotides of one or more biomarkers of sensitivity selected from the biomarkers of Tables 1 and 3 (e.g., ATP1B1 (SEQ ID NO: 201)); and/or at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more single-stranded nucleic acid molecules capable of specifically hybridizing with the nucleotides of one or more biomarkers of resistance selected from the biomarkers of Tables 2 and 4 (e.g., IGLC1 (SEQ ID NO: 301, 302, 303, OR 318)). In particular, one or more of the single-stranded nucleic acid molecules of the device have a length in the range of 10 to 100 nucleotides in length (e.g., a length in the range of 20 to 60 nucleotides).
In any of the above aspects of the invention, the method may include converting the level of expression of one or more of the biomarkers of sensitivity (e.g., one, two, three, four, five, ten, twenty, or all of the biomarkers shown in Tables 1 and 3, such as ATP1B1 (SEQ ID NO: 201)) and/or one or more of the biomarkers of resistance (e.g., one, two, three, four, five, ten, twenty, or all of the biomarkers shown in Tables 2 and 4, such as IGLC1 (SEQ ID NO: 301, 302, 303, OR 318)) into a mean score, in which the mean score indicates the responsiveness of the patient to irofulven. The method can further include subtracting the mean score for one or more of the biomarkers of resistance (e.g., one, two, three, four, five, ten, twenty, or all of the biomarkers shown in Tables 2 and 4, such as IGLC1 (SEQ ID NO: 301, 302, 303, OR 318)) from the mean score for one or more of the biomarkers of sensitivity (e.g., one, two, three, four, five, ten, twenty, or all of the biomarkers shown in Tables 1 and 3, such as ATP1B1 (SEQ ID NO: 201)) to obtain a difference score, in which the difference score indicates the responsiveness of the patient to irofulven. In particular, the mean score and/or the difference score above a cutoff value indicates that the patient is responsive to irofulven, such as if the cutoff value is about 0.1, about 0.15, about 0.2, about 0.25, about 0.3, about 0.35, about 0.4, about 0.45, about 0.5, or greater.
In any of the above aspects of the invention, the biomarker of sensitivity may be selected from one or more of ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), ID1 (SEQ ID NO: 217), and GJA1 (SEQ ID NO: 218). The biomarker of resistance may be selected from one or more of IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), CD53 (SEQ ID NO: 310), MZB1 (SEQ ID NO: 313), RASSF5 (SEQ ID NO: 314 or 386), FAM46C (SEQ ID NO: 315), RCSD1 (SEQ ID NO: 316), IGJ (SEQ ID NO: 317), LPXN (SEQ ID NO: 319), ITGB7 (SEQ ID NO: 320), and GTSF1 (SEQ ID NO: 321).
For example, the biomarkers of sensitivity may include ATP1B1 (SEQ ID NO: 201 or 219) and UCHL1 (SEQ ID NO: 202). The biomarkers of sensitivity may include ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), and PTGR1 (SEQ ID NO: 203 or 210). The biomarkers of sensitivity may include ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), and NME7 (SEQ ID NO: 204). The biomarkers of sensitivity may include ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), and PLS3 (SEQ ID NO: 205). The biomarkers of sensitivity may include ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), and S100A10 (SEQ ID NO: 206). The biomarkers of sensitivity may include ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), and CD24 (SEQ ID NO: 207 or 209 or 220). The biomarkers of sensitivity may include ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), and NQO1 (SEQ ID NO: 208 or 216). The biomarkers of sensitivity may include ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), and MYOF (SEQ ID NO: 211). The biomarkers of sensitivity may include ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), and LAPTM4B (SEQ ID NO: 212). The biomarkers of sensitivity may include ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), and CALD1 (SEQ ID NO: 213). The biomarkers of sensitivity may include ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), and PDGFC (SEQ ID NO: 214). The biomarkers of sensitivity may include ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), and BASP1 (SEQ ID NO: 215). The biomarkers of sensitivity may include ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), and ID1 (SEQ ID NO: 217). The biomarkers of sensitivity may include ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), ID1 (SEQ ID NO: 217), and GJA1 (SEQ ID NO: 218).
For example, the biomarkers of resistance may include IGLC1 (SEQ ID NO: 301, 302, 303, or 318) and LAPTM5 (SEQ ID NO: 304 or 338). The biomarkers of resistance may include IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), and ARHGDIB (SEQ ID NO: 305 or 311). The biomarkers of resistance may include IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), and SLC43A3 (SEQ ID NO: 307). The biomarkers of resistance may include IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), and LCP1 (SEQ ID NO: 308). The biomarkers of resistance may include IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), and HCLS1 (SEQ ID NO: 309). The biomarkers of resistance may include IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), and CD53 (SEQ ID NO: 310). The IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), CD53 (SEQ ID NO: 310), and MZB1 (SEQ ID NO: 313). The biomarkers of resistance may include IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), CD53 (SEQ ID NO: 310), MZB1 (SEQ ID NO: 313), and RASSF5 (SEQ ID NO: 314 or 386). The biomarkers of resistance may include IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), CD53 (SEQ ID NO: 310), MZB1 (SEQ ID NO: 313), RASSF5 (SEQ ID NO: 314 or 386), and FAM46C (SEQ ID NO: 315). The biomarkers of resistance may include IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), CD53 (SEQ ID NO: 310), MZB1 (SEQ ID NO: 313), RASSF5 (SEQ ID NO: 314 or 386), FAM46C (SEQ ID NO: 315), and RCSD1 (SEQ ID NO: 316). The biomarkers of resistance may include IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), CD53 (SEQ ID NO: 310), MZB1 (SEQ ID NO: 313), RASSF5 (SEQ ID NO: 314 or 386), FAM46C (SEQ ID NO: 315), RCSD1 (SEQ ID NO: 316), and IGJ (SEQ ID NO: 317). The biomarkers of resistance may include IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), CD53 (SEQ ID NO: 310), MZB1 (SEQ ID NO: 313), RASSF5 (SEQ ID NO: 314 or 386), FAM46C (SEQ ID NO: 315), RCSD1 (SEQ ID NO: 316), IGJ (SEQ ID NO: 317), and LPXN (SEQ ID NO: 319). The biomarkers of resistance may include IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), CD53 (SEQ ID NO: 310), MZB1 (SEQ ID NO: 313), RASSF5 (SEQ ID NO: 314 or 386), FAM46C (SEQ ID NO: 315), RCSD1 (SEQ ID NO: 316), IGJ (SEQ ID NO: 317), LPXN (SEQ ID NO: 319), and ITGB7 (SEQ ID NO: 320). The biomarkers of resistance may include IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), CD53 (SEQ ID NO: 310), MZB1 (SEQ ID NO: 313), RASSF5 (SEQ ID NO: 314 or 386), FAM46C (SEQ ID NO: 315), RCSD1 (SEQ ID NO: 316), IGJ (SEQ ID NO: 317), LPXN (SEQ ID NO: 319), ITGB7 (SEQ ID NO: 320), and GTSF1 (SEQ ID NO: 321).
In any of the above aspects of the invention, the device can be a microarray, such as a deoxyribonucleic acid (DNA)-based platform. Alternatively, the device can be for performing a qRT-PCR reaction (e.g., the device is used with a system for detecting the amplification product, for example, by fluorescence or by another method). The methods may also utilize both a microarray and a qRT-PCR. Thus, the expression level of the biomarkers of sensitivity (e.g., one, two, three, four, five, ten, twenty, or all of the biomarkers shown in Tables 1 and 3, such as ATP1B1 (SEQ ID NO: 201)) and/or the biomarkers of resistance (e.g., one, two, three, four, five, ten, twenty, or all of the biomarkers shown in Tables 2 and 4, such as IGLC1 (SEQ ID NO: 301, 302, 303, OR 318)) can be measured using qRT-PCR. In particular, the level of expression of one or more of the biomarkers of sensitivity and/or one or more of the biomarkers of resistance is determined by detecting the level of mRNA transcribed from one or more genes encoding one or more of the biomarkers of Tables 1-4.
In any of the above aspects of the invention, the cancer is selected from a solid tumor cancer and a hematological cancer. For example, the cancer is prostate cancer, ovarian cancer, HCC, multiple myeloma, breast cancer, acute myelogenous leukemia (AML), acute lympho-blastic leukemia (ALL), chronic lymphocytic leukemia (CLL), myelodysplastic syndrome (MDS), chronic myelogenous leukemia-chronic phase (CMLCP), diffuse large B-cell lymphoma (DLBCL), cutaneous T-cell lymphoma (CTCL), peripheral T-cell lymphoma (PTCL), Hodgkin's lymphoma, cervical cancer, renal cell carcinoma (RCC), esophageal cancer, melanoma, glioma, pancreatic cancer, gastrointestinal stromal tumors (GIST), sarcoma, estrogen receptor-positive (ERpos) breast cancer, non-small cell lung carcinoma (NSCLC), colon cancer, bladder cancer, or squamous cell carcinoma of the head and neck (SCCHN). In particular, the cancer is prostate cancer, such as prostate cancer that is resistant to one or more cancer therapies other than irofulven. The cancer may also be ovarian cancer, such as ovarian cancer that is resistant to one or more cancer therapies other than irofulven. Alternatively, the cancer may be HCC, such as HCC that is resistant to one or more cancer therapies other than irofulven.
In any of the above aspects of the invention, the patient may exhibit cancer relapse (e.g., relapse of prostate cancer, ovarian cancer, or HCC), such as relapse after treatment with a therapeutic agent other than irofulven. In particular, the patient may exhibit cancer relapse prior to treatment with irofulven. Alternatively, the patient may have not been administered a treatment for cancer.
Definitions
As used herein, “a” or “an” means “at least one” or “one or more” unless otherwise indicated. In addition, the singular forms “a”, “an”, and “the” include plural referents unless the context clearly dictates otherwise.
As used herein, “about” refers to an amount ±10% of the recited value.
By “biomarker” is meant a nucleic acid molecule (e.g., a mRNA or its complement, for example, a cDNA) or a protein encoded by the nucleic acid molecule present in, or from, a cell or tissue. The expression of the biomarker correlates to the responsiveness (e.g., sensitivity or resistance) of the cell or tissue (and thus, the patient in which the cell or tissue resides or the patient from which the cell or tissue was obtained) to a cancer treatment (e.g., irofulven). In particular, a biomarker of sensitivity is a nucleic acid molecule (e.g., a mRNA or its complement) expressed from any one of the genes shown in Tables 1 and 3, or the protein encoded by the nucleic acid molecule, and a biomarker of resistance is a nucleic acid molecule (e.g., a mRNA or its complement) expressed from any one of the genes shown in Tables 2 and 4, or the protein encoded by the nucleic acid molecule.
The terms “cancer” and “cancerous” refer to or describe the physiological condition in mammals (e.g., humans) that is typically characterized by unregulated cell proliferation. Examples of cancer include, but are not limited to, prostate cancer, ovarian cancer (e.g., ovarian adenocarcinoma or embryonal carcinoma), liver cancer (e.g., hepatocellular carcinoma (HCC) or hepatoma), myeloma (e.g., multiple myeloma), colorectal cancer (e.g., colon cancer and rectal cancer), leukemia (e.g., acute myeloid leukemia, acute lymphoid leukemia, chronic myeloid leukemia, chronic lymphocytic leukemia, acute myeloblastic leukemia, acute promyelocytic leukemia, acute myelomonocytic leukemia, acute monocytic leukemia, acute erythroleukemia, and chronic leukemia), myelodysplastic syndrome, lymphoma (e.g., diffuse large B-cell lymphoma, cutaneous T-cell lymphoma, peripheral T-cell lymphoma, Hodgkin's lymphoma, non-Hodgkin's lymphoma, Waldenstrom's macroglobulinemia, and lymphocytic lymphoma), cervical cancer, esophageal cancer, melanoma, glioma (e.g., oligodendroglioma), pancreatic cancer (e.g., adenosquamous carcinoma, signet ring cell carcinoma, hepatoid carcinoma, colloid carcinoma, islet cell carcinoma, and pancreatic neuroendocrine carcinoma), gastrointestinal stromal tumor, sarcoma (e.g., fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, leiomyosarcoma, Ewing's sarcoma, and rhabdomyosarcoma), breast cancer (e.g., medullary carcinoma), ER-positive cancer, bladder cancer, head and neck cancer (e.g., squamous cell carcinoma of the head and neck), lung cancer (e.g., non-small cell lung carcinoma, large cell carcinoma, bronchogenic carcinoma, and papillary adenocarcinoma), metastatic cancer, oral cavity cancer, uterine cancer, testicular cancer (e.g., seminoma and embryonal carcinoma), skin cancer (e.g., squamous cell carcinoma and basal cell carcinoma), thyroid cancer (e.g., papillary carcinoma and medullary carcinoma), brain cancer (e.g., astrocytoma and craniopharyngioma), stomach cancer, intra-epithelial cancer, bone cancer, biliary tract cancer, eye cancer, larynx cancer, kidney cancer (e.g., renal cell carcinoma and Wilms tumor), gastric cancer, blastoma (e.g., nephroblastoma, medulloblastoma, hemangioblastoma, neuroblastoma, and retinoblastoma), polycythemia vera, chordoma, synovioma, mesothelioma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, cystadenocarcinoma, bile duct carcinoma, choriocarcinoma, epithelial carcinoma, ependymoma, pinealoma, acoustic neuroma, schwannoma, meningioma, pituitary adenoma, nerve sheath tumor, cancer of the small intestine, cancer of the endocrine system, cancer of the penis, cancer of the urethra, cutaneous or intraocular melanoma, a gynecologic tumor, solid tumors of childhood, and neoplasms of the central nervous system. The term cancer includes solid tumors (e.g., prostate cancer, ovarian cancer, or hepatocellular carcinoma (HCC)) and hematological cancers (e.g., cancer of the blood, such as lymphoma (e.g., cutaneous T-cell lymphoma (CTCL))).
The terms “expression level” and “level of expression,” as used herein, refer to the amount of a gene product in a cell, tissue, biological sample, organism, or patient, e.g., amounts of DNA, RNA (e.g. messenger RNA (mRNA)), or proteins corresponding to a given gene.
“Gene” as used herein indicates a coding or noncoding gene whose activity can be determined by measuring the produced RNA. Examples include protein coding genes, microRNAs, small nuclear RNAs and other RNAs with catalytic, regulatory or coding properties.
To “inhibit growth” as used herein means causing a reduction in cell growth (e.g., cancer cell growth, such as the NCI60 cancer cell lines) in vivo or in vitro by, e.g., 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 99% or more, as evident by a reduction in the proliferation of cells exposed to a treatment (e.g., irofulven), relative to the proliferation of cells in the absence of the treatment. Growth inhibition may be the result of a treatment (e.g., irofulven) that induces apoptosis in a cell, induces necrosis in a cell, slows cell cycle progression, disrupts cellular metabolism, induces cell lysis, or induces some other mechanism that reduces the proliferation of cells.
The term “irofulven” as used herein refers to an antitumor agent that is a cytotoxic semi-synthetic derivative of illudin S, a sesquiterpene toxin found in the Jack ‘o’ Lantern mushroom. Irofulven or 6-hydroxymethylacylfulvene is an alkylating agent that initiates the apoptotic degradation of DNA leading to cell death. Irofulven ((6R)-6′-hydroxy-3′-(hydroxymethyl)-2′,4′,6′-trimethylspiro[cyclopropane-1,5′-inden]-7′(6′H)-one) has the structural molecular formula shown below:
Figure US11421284-20220823-C00001

Irofulven is also described in MacDonald et al. (Cancer Res. 57 (2): 279-283, 1997), hereby incorporated by reference.
“Microarray” as used herein means a device employed by any method that quantifies one or more subject oligonucleotides, e.g., RNA, DNA, cDNA, or analogues thereof, at a time. For example, many DNA microarrays, including those made by Affymetrix (e.g., an Affymetrix HG-U133A or HG-U133_Plus_2 array), use several probes for determining the expression of a single gene. The DNA microarray may contain oligonucleotide probes that may be, e.g., full-length cDNAs complementary to an RNA or cDNA fragments that hybridize to part of an RNA. The DNA microarray may also contain modified versions of DNA or RNA, such as locked nucleic acids or LNA. Exemplary RNAs include mRNA, miRNA, and miRNA precursors.
As used herein, the term “percent (%) sequence identity” refers to the percentage of nucleic acid residues of a candidate sequence, e.g., a probe or primer of the invention, that are identical to the nucleic acid residues of a reference sequence, e.g., a biomarker sequence of the invention, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity (e.g., gaps can be introduced in one or both of the candidate and reference sequences for optimal alignment and non-homologous sequences can be disregarded for comparison purposes). Alignment for purposes of determining percent sequence identity can be achieved in various ways that are within the skill in the art, for instance, using computer software, such as BLAST, BLAST-2, BLAST-P, BLAST-N, BLAST-X, WU-BLAST-2, ALIGN, ALIGN-2, CLUSTAL, Megalign (DNASTAR). In addition, those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve optimal alignment over the length of the sequences being compared.
“NCI60” as used herein means a panel of 60 cancer cell lines from lung, colon, breast, ovarian, leukemia, renal, melanoma, prostate and brain cancers including the following cancer cell lines: NSCLC_NCIH23, NSCLC_NCIH522, NSCLC_A549ATCC, NSCLC_EKVX, NSCLC_NCIH226, NSCLC_NCIH332M, NSCLC_H460, NSCLC_HOP62, NSCLC_HOP92, COLON_HT29, COLON_HCC-2998, COLON_HCT116, COLON_SW620, COLON_COLO205, COLON_HCT15, COLON_KM12, BREAST_MCF7, BREAST_MCF7ADRr, BREAST_MDAMB231, BREAST_HS578T, BREAST_MDAMB435, BREAST_MDN, BREAST_BT549, BREAST_T47D, OVAR_OVCAR3, OVAR_OVCAR4, OVAR_OVCAR5, OVAR_OVCAR8, OVAR_IGROV1, OVAR_SKOV3, LEUK_CCRFCEM, LEUK_K562, LEUK_MOLT4, LEUK_HL60, LEUK_RPMI8266, LEUK_SR, RENAL_UO31, RENAL_SN12C, RENAL_A498, RENAL_CAKI1, RENAL_RXF393, RENAL_7860, RENAL_ACHN, RENAL_TK10, MELAN_LOXIMVI, MELAN_MALME3M, MELAN_SKMEL2, MELAN_SKMEL5, MELAN_SKMEL28, MELAN_M14, MELAN_UACC62, MELAN_UACC257, PROSTATE_PC3, PROSTATE_DUI45, CNS_SNB19, CNS_SNB75, CNS_U251, CNS_SF268, CNS_SF295, and CNS_SF539.
The terms “patient” and “subject,” as used interchangeably herein, refer to any animal (e.g., a mammal, such as a human). A patient to be treated or tested for responsiveness to a treatment (e.g., irofulven) according to the methods described herein may be one who has been diagnosed with a cancer, such as those described herein, e.g., prostate cancer, ovarian cancer, or hepatocellular carcinoma (HCC). Diagnosis may be performed by any method or techniques known in the art, such as x-ray, MRI, or biopsy, and confirmed by a physician. To minimize exposure of a patient to drug treatments that may not be therapeutic, the patient may be determined to be either responsive or non-responsive to a cancer treatment, such as irofulven, according to the methods described herein.
“Resistant” or “resistance” as used herein means that a cell (e.g., a cancer cell), a tissue (e.g., a tumor), or a patient having cancer (e.g., a human having cancer) is able to withstand treatment with an anti-cancer agent (e.g., irofulven). In particular, the treatment does not inhibit the growth of a cancer cell in vitro by about 70%, 80%, 90%, 95%, 99% or 100% relative to the growth of a cancer cell not exposed to the treatment. Resistance to treatment may be determined by a cell proliferation assay, e.g., a cell-based assay, which measures the growth of treated cells as a function of the absorbance of the cells of an incident light beam, such as the NCI60 assays described herein. In this assay, greater absorbance indicates greater cell growth, and thus, resistance to the treatment.
A cancer patient (e.g., a patient with prostate cancer, ovarian cancer, or a hepatocellular carcinoma) may also have resistance to a cancer therapy other than irofulven, such as surgery, radiation, or a therapeutic agent (e.g., docetaxel, cabazitaxel, mitoxantrone, estramustine, prednisone, carboplatin, bevacizumab, paclitaxel, gemcitabine, doxorubicin, topotecan, etoposide, tamoxifen, letrozole, sorafenib, fluorouracil, capecitabine, oxaliplatin, interferon-alpha, or 5-fluorouracil (5-FU)).
The terms “responsive” and “responsiveness,” as used herein, refer to the likelihood that a cancer treatment (e.g., irofulven) has (e.g., induces) a desired effect, or, alternatively, refer to the strength of a desired effect caused or induced by the treatment in a cell (e.g., a cancer cell), a tissue (e.g., a tumor), or a patient having cancer (e.g., a human having cancer). For example, the desired effect can include inhibition of the growth of a cancer cell in vitro by more than 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% relative to the growth of a cancer cell not exposed to the treatment. The desired effect can also include reduction in tumor mass by, e.g., about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%. Responsiveness to treatment may be determined by a cell proliferation assay, e.g., a cell-based assay, which measures the growth of treated cells as a function of the absorbance of the cells of an incident light beam, such as the NCI60 assays described herein. In this assay, lesser absorbance indicates lesser cell growth, and thus, sensitivity to the treatment. A greater reduction in growth indicates more sensitivity to the treatment. In particular, “responsiveness” is a measure of the sensitivity or resistance of a patient to a treatment for cancer (e.g., irofulven).
The term “sample,” as used herein, refers to any specimen (such as cells, tissue (e.g., a tissue sample obtained by biopsy), blood, serum, plasma, urine, cerebrospinal fluid, or pancreatic fluid) taken from a subject. Preferably, the sample is taken from a portion of the body affected by a cancer (e.g., a biopsy of the cancer tissue, such as prostate, ovarian, or lung cancer tissue). Biopsy may involve fine needle aspiration biopsy, core needle biopsy (e.g., stereotactic core needle biopsy, vacuum-assisted core biopsy, or magnetic resonance imaging (MRI) guided biopsy), or surgical biopsy (e.g., incisional biopsy or excisional biopsy). The sample may undergo additional purification and processing, for example, to remove cell debris and other unwanted molecules. Additional processing may further involve amplification, e.g., using PCR (RT-PCR). The standard methods of sample purification, such as removal of unwanted molecules, are known in the art.
“Sensitive” and “sensitivity” as used herein refer to a cell (e.g., a cancer cell), a tissue (e.g., a tumor), or a patient having cancer (e.g., a human having cancer) that is responsive to treatment, such as an anti-cancer agent (e.g., irofulven) or radiation treatment. In particular, the treatment inhibits the growth of a cancer cell in vitro by about 70%, 80%, 90%, 95%, 99% or 100% relative to the growth of a cancer cell not exposed to the treatment. Sensitivity to treatment may be determined by a cell proliferation assay, e.g., a cell-based assay, which measures the growth of treated cells as a function of the absorbance of the cells of an incident light beam, such as the NCI60 assays described herein. In this assay, lesser absorbance indicates lesser cell growth, and thus, sensitivity to the treatment.
“Treatment,” “medical treatment,” to “treat,” and “therapy,” as used interchangeably herein, refer to administering or exposing a patient having cancer (e.g., a human), a cell, or a tumor to an anti-cancer agent (e.g., a drug, a protein, an antibody, a nucleic acid, a chemotherapeutic agent, or a radioactive agent), or to some other form of medical intervention used to treat or prevent a disease, disorder, or condition (e.g., surgery, cryotherapy, radiation therapy, or combinations thereof). In particular, a medical treatment can include irofulven. For example, the cancer to be treated is a solid tumor or a hematological cancer. Examples of cancer include, e.g., prostate cancer, ovarian cancer (e.g., ovarian adenocarcinoma or embryonal carcinoma), liver cancer (e.g., hepatocellular carcinoma (HCC) or hepatoma), myeloma (e.g., multiple myeloma), colorectal cancer (e.g., colon cancer and rectal cancer), leukemia (e.g., acute myeloid leukemia, acute lymphoid leukemia, chronic myeloid leukemia, chronic lymphocytic leukemia, acute myeloblastic leukemia, acute promyelocytic leukemia, acute myelomonocytic leukemia, acute monocytic leukemia, acute erythroleukemia, and chronic leukemia), myelodysplastic syndrome, lymphoma (e.g., diffuse large B-cell lymphoma, cutaneous T-cell lymphoma, peripheral T-cell lymphoma, Hodgkin's lymphoma, non-Hodgkin's lymphoma, Waldenstrom's macroglobulinemia, and lymphocytic lymphoma), cervical cancer, esophageal cancer, melanoma, glioma (e.g., oligodendroglioma), pancreatic cancer (e.g., adenosquamous carcinoma, signet ring cell carcinoma, hepatoid carcinoma, colloid carcinoma, islet cell carcinoma, and pancreatic neuroendocrine carcinoma), gastrointestinal stromal tumor, sarcoma (e.g., fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, leiomyosarcoma, Ewing's sarcoma, and rhabdomyosarcoma), breast cancer (e.g., medullary carcinoma), ER-positive cancer, bladder cancer, head and neck cancer (e.g., squamous cell carcinoma of the head and neck), lung cancer (e.g., non-small cell lung carcinoma, large cell carcinoma, bronchogenic carcinoma, and papillary adenocarcinoma), metastatic cancer, oral cavity cancer, uterine cancer, testicular cancer (e.g., seminoma and embryonal carcinoma), skin cancer (e.g., squamous cell carcinoma and basal cell carcinoma), thyroid cancer (e.g., papillary carcinoma and medullary carcinoma), brain cancer (e.g., astrocytoma and craniopharyngioma), stomach cancer, intra-epithelial cancer, bone cancer, biliary tract cancer, eye cancer, larynx cancer, kidney cancer (e.g., renal cell carcinoma and Wilms tumor), gastric cancer, blastoma (e.g., nephroblastoma, medulloblastoma, hemangioblastoma, neuroblastoma, and retinoblastoma), polycythemia vera, chordoma, synovioma, mesothelioma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, cystadenocarcinoma, bile duct carcinoma, choriocarcinoma, epithelial carcinoma, ependymoma, pinealoma, acoustic neuroma, schwannoma, meningioma, pituitary adenoma, nerve sheath tumor, cancer of the small intestine, cancer of the endocrine system, cancer of the penis, cancer of the urethra, cutaneous or intraocular melanoma, a gynecologic tumor, solid tumors of childhood, and neoplasms of the central nervous system. Radiation therapy includes the administration of a radioactive agent to a patient or exposure of a patient to radiation. The radiation may be generated from sources such as particle accelerators and related medical devices or agents that emit, e.g., X-radiation, gamma radiation, or electron (Beta radiation) beams. A treatment may be or further include surgery, e.g., to remove a tumor from a subject or living organism.
Other features and advantages of the invention will be apparent from the following Detailed Description, the drawings, and the claims.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 is a graph grouping predicted sensitivity to irofulven by cancer type. Each gray circle represents the predicted irofulven sensitivity of one patient calculated as the difference between the mean of the expression levels of the biomarkers of sensitivity and the mean of the expression levels of the biomarkers of resistance for the patient. Patients are grouped according to cancer type. The median predicted sensitivity (black bar) for a cancer type is related to the relative response rate for that cancer type. The predictions are used for relative comparisons to compare cancer types and cannot be used for absolute predictions of response rate for a given cancer type. The predictions are normalized to a scale of 0 to 100 for all 3,522 patients.
DETAILED DESCRIPTION OF THE INVENTION
I have discovered that the expression levels of the biomarkers shown in Tables 1-4 may be detected in a patient having cancer and are useful for predicting the responsiveness of the patient to irofulven. These patients may already be determined to be resistance to a therapy other than irofulven, such as docetaxel, cabazitaxel, mitoxantrone, estramustine, prednisone, carboplatin, bevacizumab, paclitaxel, gemcitabine, doxorubicin, topotecan, etoposide, tamoxifen, letrozole, sorafenib, fluorouracil, capecitabine, oxaliplatin, interferon-alpha, 5-fluorouracil (5-FU), a histone deacetylase (HDAC) inhibitor, ipilimumab, bortezomib, carfilzomib, thalidomide, lenalidomide, pomalidomide, dexamethasone, cyclophosphamide, vincristine, melphalan, tegafur, irinotecan, cetuximab, leucovorin, SN-38, everolimus, temsirolimus, bleomycin, lomustine, depsipeptide, erlotinib, cisplatin, busulfan, epirubicin, arsenic trioxide, bendamustine, fulvestrant, teniposide, adriamycin, decitabine, estramustine, azaguanine, aclarubicin, mitomycin, paclitaxel, taxotere, APO010, ara-c, methylprednisolone, methotrexate, methyl-gag, belinostat, idarubicin, IL4-PR38, valproic acid, all-trans retinoic acid (ATRA), cytoxan, suberoylanilide hydroxamic acid, leukeran, fludarabine, vinblastine, dacarbazine, hydroxyurea, tegafur, daunorubicin, mechlorethamine, streptozocin, carmustine, mercaptopurine, dactinomycin, tretinoin, ifosfamide, floxuridine, thioguanine, PSC 833, herceptin, celecoxib, iressa, anastrozole, or rituximab.
A device, such as a microarray, with one or more single-stranded oligonucleotide probes that have substantial identity (e.g., at least 85%, 90%, 95%, 99%, or 100% sequence identity) to a sequence that is complementary or identical to the nucleic acid sequence of one or more biomarkers shown in Tables 1-4 can be used according to the methods described herein to assess the responsiveness of a cancer patient to treatment with irofulven. For example, the probes can be used to detect one or more (e.g., two, three, four, five, ten, twenty, or all) of the biomarkers of sensitivity listed in Tables 1 and 3, such as ATP1B1 (SEQ ID NO: 201 or 219), in a sample (e.g., a tumor sample) from a patient having cancer (e.g., prostate cancer, ovarian cancer, or hepatocellular carcinoma (HCC)). Additionally, the probes can be used to detect one or more (e.g., two, three, four, five, ten, twenty, or all) of the biomarkers of resistance listed in Tables 2 and 4, such as IGLC1 (SEQ ID NO: 301, 302, 303, or 318), in a sample (e.g., a tumor sample) from a patient having cancer (e.g., prostate cancer, ovarian cancer, or hepatocellular carcinoma (HCC)).
Accordingly, the invention features individual biomarkers (e.g., ATP1B1 (SEQ ID NO: 201 or 219) or IGLC1 (SEQ ID NO: 301, 302, 303, or 318)) and sets of biomarkers shown in Tables 1-4 that can be used to determine the responsiveness of a cancer patient to irofulven at various stages of disease progression (e.g., patients diagnosed with cancer or patients after cancer recurrence) and at different times during the treatment process (e.g., prior to administration of any cancer treatment, after administration of one or more cancer treatments other than irofulven, prior to administration of irofulven, or during administration of irofulven). Additionally, the methods can be used to determine the irofulven responsiveness of a patient with cancer that is resistant to one or more cancer therapies other than irofulven, such as docetaxel, cabazitaxel, mitoxantrone, estramustine, prednisone, carboplatin, bevacizumab, paclitaxel, gemcitabine, doxorubicin, topotecan, etoposide, tamoxifen, letrozole, sorafenib, fluorouracil, capecitabine, oxaliplatin, interferon-alpha, 5-fluorouracil (5-FU), a histone deacetylase (HDAC) inhibitor, ipilimumab, bortezomib, carfilzomib, thalidomide, lenalidomide, pomalidomide, dexamethasone, cyclophosphamide, vincristine, melphalan, tegafur, irinotecan, cetuximab, leucovorin, SN-38, everolimus, temsirolimus, bleomycin, lomustine, depsipeptide, erlotinib, cisplatin, busulfan, epirubicin, arsenic trioxide, bendamustine, fulvestrant, teniposide, adriamycin, decitabine, estramustine, azaguanine, aclarubicin, mitomycin, paclitaxel, taxotere, APO010, ara-c, methylprednisolone, methotrexate, methyl-gag, belinostat, idarubicin, IL4-PR38, valproic acid, all-trans retinoic acid (ATRA), cytoxan, suberoylanilide hydroxamic acid, leukeran, fludarabine, vinblastine, dacarbazine, hydroxyurea, tegafur, daunorubicin, mechlorethamine, streptozocin, carmustine, mercaptopurine, dactinomycin, tretinoin, ifosfamide, floxuridine, thioguanine, PSC 833, herceptin, celecoxib, iressa, anastrozole, or rituximab.
In particular, the invention provides methods for determining whether a patient may be responsive to irofulven by, e.g., detecting the expression level (e.g., mRNA or protein produced therefrom) of one or more of the biomarkers shown in Tables 1-4 (e.g., ATP1B1 (SEQ ID NO: 201 or 219)) in a biological sample (e.g., a tumor biopsy) obtained from the subject using a device (e.g., a microarray or a protein array). The expression level of one or more of the biomarkers of sensitivity may then be compared to the expression level of the biomarkers in a cell or tissue known to be sensitive or resistant to irofulven to determine the patient's responsiveness to irofulven. The patient may be responsive to irofulven if the expression level of the one or more of the biomarkers of sensitivity (e.g., one or more of ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), ID1 (SEQ ID NO: 217), and GJA1 (SEQ ID NO: 218)) is substantially similar to the expression level of the biomarkers of sensitivity in a cell or tissue known to be sensitive to irofulven (e.g., from a patient sensitive to irofulven). The patient may also be responsive to irofulven if the level of expression of one or more of the biomarkers of resistance (e.g., one or more of IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), CD53 (SEQ ID NO: 310), MZB1 (SEQ ID NO: 313), RASSF5 (SEQ ID NO: 314 or 386), FAM46C (SEQ ID NO: 315), RCSD1 (SEQ ID NO: 316), IGJ (SEQ ID NO: 317), LPXN (SEQ ID NO: 319), ITGB7 (SEQ ID NO: 320), and GTSF1 (SEQ ID NO: 321)) is substantially dissimilar to the expression level of the biomarkers of resistance in a cell or tissue known to be resistant to irofulven (e.g., from a patient resistant to irofulven).
The invention also features methods of treating a patient having cancer, such as a patient having a cancer that is resistant to one or more cancer therapies other than irofulven, by detecting the expression levels of one or more of the biomarkers shown in Tables 1-4 (e.g., ATP1B1 (SEQ ID NO: 201)) in a sample (e.g., a tumor sample) from the patient, and then administering irofulven based on the expression levels of the biomarkers. In particular, a patient having cancer may be administered irofulven if the expression level of one or more biomarkers of sensitivity is substantially similar to the expression level of the biomarkers of sensitivity in a cell or tissue known to be sensitive to irofulven. Additionally, a patient having cancer may be administered irofulven if the expression level of one or more biomarkers of resistance is substantially dissimilar to the expression level of the biomarkers of resistance in a cell or tissue known to be resistant to irofulven. Thus, the methods can be used to treat cancer patients predicted to be responsive to irofulven, such as patients having, e.g., prostate cancer, ovarian cancer, hepatocellular carcinoma (HCC), cervical cancer, renal cell carcinoma (RCC), esophageal cancer, melanoma, glioma, pancreatic cancer, gastrointestinal stromal tumors (GIST), sarcoma, estrogen receptor-positive (ERpos) breast cancer, non-small cell lung carcinoma (NSCLC), colon cancer, bladder cancer, squamous cell carcinoma of the head and neck (SCCHN), acute myelogenous leukemia (AML), acute lympho-blastic leukemia (ALL), chronic lymphocytic leukemia (CLL), myelodysplastic syndrome (MDS), chronic myelogenous leukemia-chronic phase (CMLCP), diffuse large B-cell lymphoma (DLBCL), cutaneous T-cell lymphoma (CTCL), peripheral T-cell lymphoma (PTCL), and Hodgkin's lymphoma. Alternatively, a patient having cancer may not be administered irofulven if the expression level of one or more biomarkers of sensitivity is substantially dissimilar to the expression level of the biomarkers of sensitivity in a cell or tissue known to be sensitive to irofulven. Likewise, a patient having cancer may not be administered irofulven if the expression level of one or more biomarkers of resistance is substantially similar to the expression level of the biomarkers of resistance in a cell or tissue known to be resistant to irofulven.
Methods are described herein for identifying biomarkers of drug responsiveness, detecting biomarker gene expression in cancer patients, determining the responsiveness of a cancer patient to irofulven, and treating cancer patients with irofulven. Also described are devices and kits for use in these methods.
Methods for Identifying Biomarkers of Drug Responsiveness
The invention features methods for identifying biomarkers (e.g., one or more of the biomarkers of Tables 1-4) for determining the responsiveness of a cancer patient to a cancer treatment, such as irofulven. Such methods can involve, for example, an algorithm based on growth inhibition values (GI50) of cell lines (e.g., NCI60 cell lines) subjected to treatment with irofulven, followed by measurement of gene expression (e.g., using a microarray (e.g., an Affymetrix HG-U133A or HG-U133_Plus_2 array)).
Methodology of the In Vitro Cancer Growth Inhibition Screen
The human tumor cell lines of the cancer screening panel may be grown in RPMI 1640 medium containing 5% fetal bovine serum and 2 mM L-glutamine. Cells may be inoculated into 96 well microtiter plates in 100 μL at plating densities ranging from 5,000 to 40,000 cells/well depending on the doubling time of individual cell lines. After cell inoculation, the microtiter plates may be incubated at 37° C., 5% CO2, 95% air and 100% relative humidity for 24 hours prior to addition of experimental compounds.
After 24 hours, two plates of each cell line may be fixed in situ with TCA, to represent a measurement of the cell population for each cell line at the time of compound addition (Tz). Experimental compounds may be solubilized in dimethyl sulfoxide at 400-fold the desired final maximum test concentration and stored frozen prior to use. At the time of compound (e.g., irofulven) addition, an aliquot of frozen concentrate may be thawed and diluted to twice the desired final maximum test concentration with complete medium containing 50 μg/ml Gentamicin. A total of four additional 10-fold or ½ log serial dilutions are made to provide a total of five concentrations plus control. Aliquots of 100 μl of these different compound dilutions are added to the appropriate microtiter wells already containing 100 μl of medium, resulting in the required final compound concentrations.
Following compound (e.g., irofulven) addition, the plates may be incubated for an additional 48 h at 37° C., 5% CO2, 95% air, and 100% relative humidity. For adherent cells, the assay may be terminated by the addition of cold TCA. Cells may be fixed in situ by the gentle addition of 50 μl of cold 50% (w/v) TCA (final concentration, 10% TCA) and incubated for 60 minutes at 4° C. The supernatant may be discarded, and the plates may be washed five times with tap water and air-dried. Sulforhodamine B (SRB) solution (100 μl) at 0.4% (w/v) in 1% acetic acid may be added to each well, and the plates may be incubated for 10 minutes at room temperature. After staining, unbound dye may be removed by washing five times with 1% acetic acid and the plates may be air-dried. Bound stain may be subsequently solubilized with 10 mM trizma base, and the absorbance may be read on an automated plate reader at a wavelength of 515 nm. For suspension cells, the methodology may be the same, except that the assay may be terminated by fixing settled cells at the bottom of the wells by gently adding 50 μl of 80% TCA (final concentration, 16% TCA). Using the seven absorbance measurements [time zero, (Tz), control growth, (C), and test growth in the presence of compound (e.g., irofulven) at the five concentration levels (Ti)], the percentage growth may be calculated at each of the compound concentrations levels. Percentage growth inhibition may be calculated as:
[(Ti−Tz)/(C−Tz)]×100 for concentrations for whichTi>/=Tz
[(Ti−Tz)/Tz]×100 for concentrations for whichTi<Tz
Three dose response parameters may be calculated for each experimental agent (e.g., irofulven). Growth inhibition of 50% (GI50) is calculated from [(Ti−Tz)/(C−Tz)]×100=50, which is the agent (e.g., irofulven) concentration resulting in a 50% reduction in the net protein increase (as measured by SRB staining) in control cells during the compound incubation. The compound concentration resulting in total growth inhibition (TGI) is calculated from Ti=Tz. The LC50 (concentration of compound resulting in a 50% reduction in the measured protein at the end of the compound treatment as compared to that at the beginning) indicating a net loss of cells following treatment is calculated from [(Ti−Tz)/Tz]×100=−50. Values are calculated for each of these three parameters if the level of activity is reached; however, if the effect is not reached or is exceeded, the value for that parameter is expressed as greater or less than the maximum or minimum concentration tested.
Gene Expression and Growth Inhibition Analysis
The gene expression measurements of NCI60 cancer cell lines can be obtained from a publically available database (e.g., the National Cancer Institute and the Massachusetts Institute of Technology). Each dataset can be normalized so that sample expression measured by different chips can be compared. The preferred method of normalization is the logit transformation, which may be performed for each gene y on each chip, as follows:
logit(y)=log [(y−background)/(saturation−y)],
where background is calculated as the minimum intensity measured on the chip minus 0.1% of the signal intensity range: min−0.001*(max−min), and saturation is calculated as the maximum intensity measured on the chip plus 0.1% of the signal intensity range: max+0.001*(max−min). The resulting logit transformed data may then be z-transformed to mean zero and standard deviation 1.
Next, gene expression can be correlated to cancer cell growth inhibition. Growth inhibition data (GI50) of the NCI60 cell lines in the presence of a cancer treatment, such as irofulven, can be obtained from the NCI. The correlation between the logit-transformed expression level of each gene in each cell line and the logarithm of GI50 (the concentration of a given compound that results in a 50% inhibition of growth) can be calculated, e.g., using the Pearson correlation coefficient or the Spearman Rank-Order correlation coefficient. Instead of using GI50s, any other measure of patient sensitivity to a given treatment (e.g., irofulven) may be correlated to gene expression levels of the patient. Since a plurality of measurements may be available for a single gene, the most accurate determination of correlation coefficient can be, e.g., the median of the correlation coefficients calculated for all probes measuring expression of the same gene.
For example, the median correlation coefficient of gene expression measured on a probe to growth inhibition or patient sensitivity to irofulven can be calculated for all genes of interest. Genes that have a median correlation above, e.g., 0.20, 0.21 0.22. 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, or higher (e.g., 0.2 or higher), can be used as biomarkers of sensitivity for assessing responsiveness of a cancer patient (e.g., a patient having cancer that is resistant to one or more cancer therapies other than irofulven) to irofulven. Likewise, genes that have a median correlation below, e.g., −0.20, −0.21, −0.22, −0.23, −0.24, −0.25, −0.26, −0.27, −0.28, −0.29, −0.30, −0.31, −0.32, −0.33, −0.34, −0.35, −0.36, −0.37, −0.38, −0.39, −0.40, or lower (e.g., −0.2 or lower), can be used as biomarkers of resistance for assessing responsiveness of a cancer patient (e.g., a patient having cancer that is resistant to one or more cancer therapies other than irofulven) to irofulven. Preferably, the correlation coefficient of a biomarker of sensitivity will exceed 0.2, while the correlation coefficient of a biomarker of resistance will be less than −0.2. The result is a list of biomarker genes that correlate to sensitivity or resistance to irofulven, as shown in Tables 1 and 3 and Tables 2 and 4, respectively.
Cancer Types
The methods, devices, and kits of the invention can be used for diagnosing, prognosing, monitoring, treating, and/or reducing cancer in a subject suffering from, diagnosed with, or susceptible to cancer. Non-limiting examples of cancers that can be diagnosed, prognosed, monitored, treated, or reduced using the methods include hematological and solid tumors. In particular, cancers include, e.g., prostate cancer, ovarian cancer (e.g., ovarian adenocarcinoma or embryonal carcinoma), liver cancer (e.g., hepatocellular carcinoma (HCC) or hepatoma), myeloma (e.g., multiple myeloma), colorectal cancer (e.g., colon cancer and rectal cancer), leukemia (e.g., acute myeloid leukemia, acute lymphoid leukemia, chronic myeloid leukemia, chronic lymphocytic leukemia, acute myeloblastic leukemia, acute promyelocytic leukemia, acute myelomonocytic leukemia, acute monocytic leukemia, acute erythroleukemia, and chronic leukemia), myelodysplastic syndrome, lymphoma (e.g., diffuse large B-cell lymphoma, cutaneous T-cell lymphoma, peripheral T-cell lymphoma, Hodgkin's lymphoma, non-Hodgkin's lymphoma, Waldenstrom's macroglobulinemia, and lymphocytic lymphoma), cervical cancer, esophageal cancer, melanoma, glioma (e.g., oligodendroglioma), pancreatic cancer (e.g., adenosquamous carcinoma, signet ring cell carcinoma, hepatoid carcinoma, colloid carcinoma, islet cell carcinoma, and pancreatic neuroendocrine carcinoma), gastrointestinal stromal tumor, sarcoma (e.g., fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, leiomyosarcoma, Ewing's sarcoma, and rhabdomyosarcoma), breast cancer (e.g., medullary carcinoma), ER-positive cancer, bladder cancer, head and neck cancer (e.g., squamous cell carcinoma of the head and neck), lung cancer (e.g., non-small cell lung carcinoma, large cell carcinoma, bronchogenic carcinoma, and papillary adenocarcinoma), metastatic cancer, oral cavity cancer, uterine cancer, testicular cancer (e.g., seminoma and embryonal carcinoma), skin cancer (e.g., squamous cell carcinoma and basal cell carcinoma), thyroid cancer (e.g., papillary carcinoma and medullary carcinoma), brain cancer (e.g., astrocytoma and craniopharyngioma), stomach cancer, intra-epithelial cancer, bone cancer, biliary tract cancer, eye cancer, larynx cancer, kidney cancer (e.g., renal cell carcinoma and Wilms tumor), gastric cancer, blastoma (e.g., nephroblastoma, medulloblastoma, hemangioblastoma, neuroblastoma, and retinoblastoma), polycythemia vera, chordoma, synovioma, mesothelioma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, cystadenocarcinoma, bile duct carcinoma, choriocarcinoma, epithelial carcinoma, ependymoma, pinealoma, acoustic neuroma, schwannoma, meningioma, pituitary adenoma, nerve sheath tumor, cancer of the small intestine, cancer of the endocrine system, cancer of the penis, cancer of the urethra, cutaneous or intraocular melanoma, a gynecologic tumor, solid tumors of childhood, and neoplasms of the central nervous system.
In particular, the methods are useful for diagnosing, prognosing, monitoring, treating, or preventing, e.g., prostate cancer, ovarian cancer, hepatocellular carcinoma (HCC), cervical cancer, renal cell carcinoma (RCC), esophageal cancer, melanoma, glioma, pancreatic cancer, gastrointestinal stromal tumors (GIST), sarcoma, estrogen receptor-positive (ERpos) breast cancer, non-small cell lung carcinoma (NSCLC), colon cancer, bladder cancer, squamous cell carcinoma of the head and neck (SCCHN), acute myelogenous leukemia (AML), acute lympho-blastic leukemia (ALL), chronic lymphocytic leukemia (CLL), myelodysplastic syndrome (MDS), chronic myelogenous leukemia-chronic phase (CMLCP), diffuse large B-cell lymphoma (DLBCL), cutaneous T-cell lymphoma (CTCL), peripheral T-cell lymphoma (PTCL), and Hodgkin's lymphoma.
For example, the cancer can be prostate cancer, such as Stage I, II (e.g., IIA or IIB), III, or IV prostate cancer. In particular, the cancer may be prostate cancer that is resistant to one or more cancer therapies, such as docetaxel, cabazitaxel, mitoxantrone, estramustine, prednisone, and/or surgery. Alternatively, the cancer is an ovarian cancer. The ovarian cancer can be, for example, a Stage I (e.g., Stage IA, IB, or IC), Stage II (e.g., Stage IIA or IIB), Stage III (e.g., Stage IIIA1, IIIA2, IIIB, or IIIC), or Stage IV (e.g., Stage IVA or IVB) ovarian cancer. In particular, the cancer can be ovarian cancer that is resistant to one or more cancer therapies, such as docetaxel, carboplatin, bevacizumab, paclitaxel, gemcitabine, doxorubicin, topotecan, etoposide, tamoxifen, and/or letrozole. Additionally, the cancer can be HCC, such as Stage I, Stage II, Stage III (e.g., Stage IIIA, IIIB, or IIIC), or Stage IV (e.g., Stage IVA or IVB) HCC. In particular, the cancer can be HCC that is resistant to one or more cancer therapies, such as sorafenib, doxorubicin, cisplatin, gemcitabine, capecitabine, oxaliplatin, interferon-alpha, and/or 5-fluorouracil (5-FU).
Methods for Detecting Biomarker Gene Expression in Cancer Patients
A cancer patient can be assessed for sensitivity or resistance to irofulven by detecting gene expression of a biomarker (e.g., one or more of the biomarkers of Tables 1-4) in a biological sample obtained from the cancer patient (e.g., a patient having cancer that is resistant to one or more cancer therapies other than irofulven). The biological sample can include, for example, cells, tissue (e.g., a tissue sample obtained by biopsy), blood, serum, plasma, urine, sputum, cerebrospinal fluid, lymph tissue or fluid, or pancreatic fluid. For example, the biological sample can be fresh frozen or formalin-fixed paraffin embedded (FFPE) tissue obtained from the subject, such as a tumor sample (e.g., a biopsy) from the tissue of interest (e.g., prostate, ovarian, lung, lymph nodes, thymus, spleen, bone marrow, breast, colorectal, pancreatic, cervical, bladder, gastrointestinal, head, or neck tissue).
RNA Extraction and Biomarker Expression Measurement
Cell samples or tissue samples may be snap frozen in liquid nitrogen until processing. RNA may be extracted using, e.g., Trizol Reagent from Invitrogen following manufacturer's instructions, and detected directly or converted to cDNA for detection. RNA may be amplified using, e.g., MessageAmp kit from Ambion following manufacturer's instructions. Amplified RNA may be quantified using, e.g., HG-U133A or HG-U133_Plus2 GeneChip from Affymetrix Inc. or a compatible apparatus, e.g., the GCS3000Dx GeneChip® System from Affymetrix Inc., using the manufacturer's instructions. The resulting biomarker expression measurements may be further analyzed as described herein. The procedures described can be implemented using, e.g., R software available from R-Project and supplemented with packages available from Bioconductor.
One or more of the biomarkers shown in Tables 1-4 (e.g., ATP1B1 (SEQ ID NO: 201)) may be measured in a biological sample (e.g., a tumor sample) obtained from the cancer patient (e.g., a patient with any of the cancer types described herein, such as a patient having cancer that is resistant to one or more cancer therapies other than irofulven) using, e.g., polymerase chain reaction (PCR), reverse transcriptase PCR (RT-PCR), quantitative real-time PCR (qRT-PCR), an array (e.g., a microarray), a genechip, pyrosequencing, nanopore sequencing, sequencing by synthesis, sequencing by expansion, single molecule real time technology, sequencing by ligation, microfluidics, infrared fluorescence, next generation sequencing (e.g., RNA-Seq techniques), Northern blots, Western blots, Southern blots, NanoString nCounter technologies (e.g., those described in U.S. Patent Application Nos. US 2011/0201515, US 2011/0229888, and US 2013/0017971, each of which is incorporated by reference in its entirety), proteomic techniques (e.g., mass spectrometry or protein arrays), and combinations thereof.
Devices
Devices of the invention can be used for detecting the level of expression of one or more biomarkers shown in Tables 1-4. The device may include at least one single-stranded nucleic acid (e.g., a probe) having at least 85% sequence identity (e.g., 85%, 90%, 95%, 97%, 98%, 99%, or 100% sequence identity) to a nucleic acid sequence that is complementary or identical to at least 5 (e.g., at least 10, at least 15, at least 20, or more) consecutive nucleotides of one or more biomarkers shown in Tables 1-4 (e.g., ATP1B1 (SEQ ID NO: 201 or 219) or IGLC1 (SEQ ID NO: 301, 302, 303, or 318)), in which the at least one single-stranded nucleic acid is sufficient for the detection of the expression level of the one or more biomarkers. The device may be used to detect the expression level of a given biomarker by specific hybridization between the single-stranded nucleic acid and the biomarker (e.g., an mRNA, genomic DNA, or non-coding RNA), a nucleic acid encoding the biomarker (e.g., an mRNA), or a complementary nucleic acid thereof. The device may be or include a microarray. The device may also include or be used with reagents and materials for next generation sequence (e.g., sequencing by synthesis). The device may also include or be used with NanoString reagents and at least one nCounter cartridge. The device may be or include a protein array, which contains one or more protein binding moieties (e.g., proteins, antibodies, nucleic acids, aptamers, affibodies, lipids, phospholipids, small molecules, labeled variants of any of the above, and any other moieties useful for protein detection as well known in the art) capable of detectably binding to the polypeptide product(s) of one or more biomarkers shown in Tables 1-4. The device may also be a cartridge for measuring an amplification product resulting from hybridization between one or more nucleic acid molecules from the patient and at least one single-stranded nucleic acid single-stranded nucleic acid molecules of the device, such as a device for performing qRT-PCR.
Microarrays
The expression levels of the biomarkers (e.g., the biomarkers listed in Tables 1-4 (e.g., ATP1B1 (SEQ ID NO: 201)) may be determined using high-throughput expression profiling platforms, such as microarrays. In particular, a microarray for use in the methods for assessing the responsiveness of a cancer patient (e.g., a patient having cancer that is resistant to one or more cancer therapies other than irofulven) to irofulven contains or is produced by generating oligonucleotide probes (e.g., DNA, cDNA, or RNA probes) capable of hybridizing to one or more biomarkers of interest (e.g., one or more of the biomarkers of Tables 1-4) or the complement sequences thereof. Each probe can have, e.g., at least 10, 15, 20, 25, 30, or more contiguous nucleic acid residues (e.g., at least 15) that are complementary or identical to a nucleic acid sequence of a selected biomarker. The probe nucleic sequence can also have at least 85% (e.g., 90%, 95%, 99%, or 100%) sequence identity to the nucleic acid sequence of the gene coding the biomarker (e.g., ATP1B1 (SEQ ID NO: 201 or 219)) or the complement sequence thereof. In particular, the probe sequences can be complementary to all or a portion of the nucleic acid sequence of the biomarker(s).
For example, microarrays of the invention for determining irofulven responsiveness can include probes for one or more (e.g., at least 5, 10, 15, or 20 or more (e.g., all)) biomarkers of sensitivity shown in Tables 1 and 3, such as ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), ID1 (SEQ ID NO: 217), and/or GJA1 (SEQ ID NO: 218). Microarrays for determining irofulven responsiveness can also include probes for one or more (e.g., at least 5, 10, 15, or 20 or more (e.g., all)) biomarkers of resistance listed in Tables 2 and 4, such as IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), CD53 (SEQ ID NO: 310), MZB1 (SEQ ID NO: 313), RASSF5 (SEQ ID NO: 314 or 386), FAM46C (SEQ ID NO: 315), RCSD1 (SEQ ID NO: 316), IGJ (SEQ ID NO: 317), LPXN (SEQ ID NO: 319), ITGB7 (SEQ ID NO: 320), and/or GTSF1 (SEQ ID NO: 321). Microarrays for determining irofulven responsiveness can also include probes for one or more (e.g., at least 5, 10, 15, or 20 or more (e.g., all)) biomarkers of sensitivity and biomarkers of resistance shown in Tables 1-4, such as ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), ID1 (SEQ ID NO: 217), GJA1 (SEQ ID NO: 218), IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), CD53 (SEQ ID NO: 310), MZB1 (SEQ ID NO: 313), RASSF5 (SEQ ID NO: 314 or 386), FAM46C (SEQ ID NO: 315), RCSD1 (SEQ ID NO: 316), IGJ (SEQ ID NO: 317), LPXN (SEQ ID NO: 319), ITGB7 (SEQ ID NO: 320), and/or GTSF1 (SEQ ID NO: 321).
A microarray probe may be single-stranded or double-stranded. The probe may be labeled (e.g., detectably labeled with a fluorescent molecule, dye molecule, small molecule, epitope tag, barcode sequence, polypeptide, or any other detectable molecule). Probes can be detectably labeled and immobilized on a solid support to form the microarray. For example, probes can be either prefabricated and spotted to the surface or directly synthesized on to the surface (in situ) of the microarray. The microarray can also be configured such that the sequence and position of each member (e.g., probe) of the array is known. For example, a selection of biomarkers whose expression correlates with an increased likelihood of responsiveness to irofulven can be arrayed on a solid support. Hybridization of a labeled probe with a particular target nucleic acid (e.g., an mRNA corresponding to one or more biomarkers of Tables 1-4) indicates that the sample from which the mRNA was derived expresses that biomarker (e.g., the biomarker of sensitivity or resistance to irofulven).
PCR-Based Techniques
As few as one to thirty (e.g., 5 to 30 or 10 to 30, or at least the first 15 of the biomarkers listed in Tables 1-2) biomarkers may be used to determine patient responsiveness to irofulven using the methods described herein. Tissue or cell samples from a cancer patient (e.g., a patient having cancer that is resistant to one or more cancer therapies other than irofulven) can be conveniently assayed for gene expression levels using polymerase chain reaction (PCR) analysis, such as quantitative real-time PCR (qPCR), or quantitative loop-mediated isothermal amplification (q-LAMP). For example, an mRNA corresponding to a biomarker of Tables 1-4 can be detected in a biological sample by (a) producing cDNA from the sample by reverse transcription using at least one primer; (b) amplifying the cDNA so produced using a target polynucleotide as sense and antisense primers to amplify target cDNAs therein; and (c) detecting the presence of the amplified target cDNA using polynucleotide probes. The primers and probes including the target sequences shown in Tables 1-4, such as ATP1B1 (SEQ ID NO: 201 or 219) and/or IGLC1 (SEQ ID NO: 301, 302, 303, or 318), may be used to detect expression of one or more of the indicated biomarkers using PCR. The methods can include one or more steps that allow determination of the levels of target mRNA in a biological sample (e.g., by simultaneously examining the levels of a comparative control mRNA sequence or “housekeeping” gene, such as an actin family member or GAPDH). The primers for these PCR-based assays may be labeled for detection according to methods known in the art.
Sequencing
The expression levels of the biomarkers shown in Tables 1-4, such as ATP1B1 (SEQ ID NO: 201 or 219) and/or IGLC1 (SEQ ID NO: 301, 302, 303, or 318), may be determined using sequencing technologies, such as next generation sequencing platforms (e.g., RNA-Seq), as described in Mortazavi et al., Nat. Methods 5: 621-628, 2008, hereby incorporated by reference. RNA-Seq is a robust technology for monitoring expression by direct sequencing of the RNA molecules in a sample. This methodology may include fragmentation of RNA to an average length of, e.g., 200 nucleotides, conversion to cDNA by random priming, and synthesis of double-stranded cDNA (e.g., using the PROTOSCRIPT® First Strand cDNA Synthesis Kit from New England Biosciences). The cDNA may then be converted into a molecular library for sequencing by addition of sequence adapters for each library (e.g., from ILLUMINA®/Solexa), and the resulting 50 to 100 nucleotide reads are mapped onto the genome. Exemplary sequencing platforms suitable for use according to the methods include, e.g., pyrosequencing, ILLUMINA® sequencing by synthesis, SOLID® sequencing, ION TORRENT® sequencing, and SMRT® sequencing.
Methods of Determining the Responsiveness of a Patient to Irofulven
The invention features diagnostic methods for the detection and screening of cancer patients (e.g., a patient having cancer that is resistant to one or more cancer therapies other than irofulven) that may be responsive to irofulven using one or more of the biomarkers shown in Tables 1-4 (e.g., ATP1B1 (SEQ ID NO: 201 or 219) or IGLC1 (SEQ ID NO: 301, 302, 303, or 318)). The methods of the invention may be used for predicting a patient's responsiveness to irofulven, and optionally, treating the cancer patient throughout the progression of cancer and/or in cases of recurrence (e.g., after a first line treatment, a second line treatment, and/or a third line treatment).
The invention provides individual biomarkers (e.g., ATP1B1 (SEQ ID NO: 201)) and sets of biomarkers (e.g., two or more of the biomarkers listed in Tables 1-4), the expression levels of which, as detected in a biological sample (e.g., a tumor sample, such as a biopsy) obtained from a cancer patient (e.g., a human with cancer), are indicative of responsiveness to irofulven. The biomarkers were identified using methods similar to those previously described in, e.g., Chen et al. (Mol. Cancer Ther. 11:34-33, 2012), Wang et al. (J. Nat. Cancer Inst. 105: 1284-1291, 2013), and Knudsen et al. (PLoS One, 9: e87415, 2014), each of which are incorporated by reference herein in their entirety. In particular, an algorithm based on growth inhibition values (GI50) of a cell line (e.g., NCI60 cells) is subjected to treatment with irofulven and gene expression is determined (e.g., by microarray analysis, reverse transcriptase polymerase chain reaction (RT-PCR), quantitative real-time PCR (qPCR), or next generation sequencing). After normalization, genes with, e.g., a Pearson correlation coefficient greater than about 0.2 or below about −0.2 can be classified as biomarkers of sensitivity or resistance, respectively. In particular, a correlation coefficient of about 0.2 or greater is a statistically significant cut-off known in the art for establishing whether the expression level of A GENE, e.g., the genes shown in Tables 1-4, correlate with the likelihood of cancer treatment sensitivity, such as sensitivity to irofulven. Thus, a correlation coefficient of about 0.2 or greater or about −0.2 or lower can be used to estimate the statistical significance of the expression level of the genes of Tables 1-4 for predicting patient responsiveness to treatment with irofulven according to the methods described herein.
Comparison of Biomarker Expression Levels
One or more biomarkers of sensitivity and/or resistance, identified as described herein, can be used to predict responsiveness to irofulven by measuring the expression level of the biomarkers in a biological sample obtained from the cancer patient. A single biomarker (e.g., any of the biomarkers of Tables 1-4, such as ATP1B1 (SEQ ID NO: 201)) may be used to determine the responsiveness of a cancer patient (e.g., a patient having cancer that is resistant to one or more cancer therapies other than irofulven) to irofulven. After determining the expression level of the biomarker(s) in a sample (e.g., a tumor sample) from the cancer patient, the expression level of the biomarker(s) in the sample may be compared to the expression level of the biomarker(s) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive to treatment with irofulven. If the expression level of the biomarker(s) in the sample from the cancer patient is substantially similar (e.g., identical to or has the same trend of expression level) to the expression level of the biomarker(s) in the cell or tissue known to be sensitive to irofulven, then the cancer patient is predicted to be responsive to treatment with irofulven. Alternatively, if the expression level of the biomarker(s) in the sample from the cancer patient is substantially dissimilar to the expression level of the biomarker(s) in the cell or tissue known to be sensitive to irofulven, then the cancer patient is predicted to be non-responsive to treatment with irofulven.
The expression level of the biomarker (e.g., ATP1B1 (SEQ ID NO: 201)) in a sample from the cancer patient may also be compared to the expression level of the biomarker in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be resistant to treatment with irofulven. If the expression level of the biomarker in the sample from the cancer patient is substantially similar to the expression level of the biomarker in the cell or tissue known to be resistant to irofulven, then the cancer patient is predicted to be non-responsive to treatment with irofulven. Alternatively, if the expression level of the biomarker in the sample from the cancer patient is substantially dissimilar to the expression level of the biomarker in the cell or tissue known to be sensitive to irofulven, then the cancer patient is predicted to be responsive to treatment with irofulven.
The responsiveness of a cancer patient (e.g., a patient having cancer that is resistant to one or more cancer therapies other than irofulven) to irofulven can also be predicted by comparing the expression level of a biomarker (e.g., ATP1B1 (SEQ ID NO: 201)) to the expression level of the biomarker in one or more cells or tissues (e.g., from a cancer patient population) known to be sensitive to treatment with irofulven and one or more cells or tissues (e.g., from a cancer patient population) known to be resistant to treatment with irofulven. In particular, the patient may be responsive to treatment with irofulven if the expression level of the biomarker is more similar to the expression level of the biomarker in a cell or tissue known to be sensitive to treatment with irofulven than to a cell or tissue known to be resistant to treatment with irofulven. Alternatively, the patient may be non-responsive to treatment with irofulven if the expression level of the biomarker is more similar to the expression level of the biomarker in a cell or tissue known to be resistant to treatment with irofulven than to a cell or tissue known to be sensitive to treatment with irofulven.
Additionally, one or more biomarkers of sensitivity (e.g., one or more of ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), ID1 (SEQ ID NO: 217), and GJA1 (SEQ ID NO: 218)) and one or more biomarkers of resistance (e.g., one or more of IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), CD53 (SEQ ID NO: 310), MZB1 (SEQ ID NO: 313), RASSF5 (SEQ ID NO: 314 or 386), FAM46C (SEQ ID NO: 315), RCSD1 (SEQ ID NO: 316), IGJ (SEQ ID NO: 317), LPXN (SEQ ID NO: 319), ITGB7 (SEQ ID NO: 320), and GTSF1 (SEQ ID NO: 321)) may be used in combination to determine the responsiveness of a cancer patient (e.g., a patient having cancer that is resistant to one or more cancer therapies other than irofulven) to treatment with irofulven. For example, the predicted responsiveness of a cancer patient may be determined from, e.g., the difference score, which may be defined as the difference between the mean of the expression level of the one or more biomarkers of sensitivity of Tables 1 and 3 and the mean of the expression level of the one or more biomarkers of resistance of Tables 2 and 4.
The difference score of the cancer patient can then be compared to the difference score based on the expression level of the biomarkers in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven. In particular, the patient may be responsive to treatment with irofulven if the difference score is substantially similar to the expression level of the biomarkers in a cell or tissue known to be sensitive to treatment with irofulven. Alternatively, the patient may be non-responsive to treatment with irofulven if the difference score is substantially similar to the expression level of the biomarkers in a cell or tissue known to be resistant to treatment with irofulven. Additionally, the patient may be responsive to treatment with irofulven if the difference score is substantially similar to the expression level of the biomarkers in a cell or tissue known to be sensitive to treatment with irofulven than a cell or tissue known to be resistant to treatment with irofulven. Alternatively, the patient may be non-responsive to treatment with irofulven if the difference score is substantially similar to the expression level of the biomarkers in a cell or tissue known to be resistant to treatment with irofulven than a cell or tissue known to be sensitive to treatment with irofulven.
One or more biomarkers of sensitivity and/or resistance, identified as described herein, can be used to predict responsiveness to irofulven by measuring the expression level of the biomarkers in a biological sample obtained from the cancer patient. A single biomarker (e.g., any of the biomarkers of Tables 1-4, such as ATP1B1 (SEQ ID NO: 201)) may be used to determine the responsiveness of a cancer patient (e.g., a patient having cancer that is resistant to one or more cancer therapies other than irofulven) to irofulven. After determining the expression level of the biomarker(s) in a sample (e.g., a tumor sample) from the cancer patient, the expression level of the biomarker(s) in the sample may be compared to the expression level of the biomarker(s) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive to treatment with irofulven. If the expression level of the biomarker(s) in the sample from the cancer patient corresponds to (e.g., is identical to or has the same trend of expression level as) the expression level of the biomarker(s) in the cell or tissue known to be sensitive to irofulven, then the cancer patient is predicted to be responsive to treatment with irofulven. Alternatively, if the expression level of the biomarker(s) in the sample from the cancer patient is substantially dissimilar to the expression level of the biomarker(s) in the cell or tissue known to be sensitive to irofulven, then the cancer patient is predicted to be non-responsive to treatment with irofulven.
The expression level of the biomarker (e.g., ATP1B1 (SEQ ID NO: 201)) in a sample from the cancer patient may also be compared to the expression level of the biomarker in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be resistant to treatment with irofulven. If the expression level of the biomarker in the sample from the cancer patient corresponds to the expression level of the biomarker in the cell or tissue known to be resistant to irofulven, then the cancer patient is predicted to be non-responsive to treatment with irofulven. Alternatively, if the expression level of the biomarker in the sample from the cancer patient is substantially dissimilar to the expression level of the biomarker in the cell or tissue known to be resistant to irofulven, then the cancer patient is predicted to be responsive to treatment with irofulven.
The responsiveness of a cancer patient (e.g., a patient having cancer that is resistant to one or more cancer therapies other than irofulven) to irofulven can also be predicted by comparing the expression level of a biomarker (e.g., ATP1B1 (SEQ ID NO: 201)) to the expression level of the biomarker in one or more cells or tissues (e.g., from a cancer patient population) known to be sensitive to treatment with irofulven and one or more cells or tissues (e.g., from a cancer patient population) known to be resistant to treatment with irofulven. In particular, the patient may be responsive to treatment with irofulven if the expression level of the biomarker(s) corresponds to the expression level of the biomarker(s) in a cell or tissue known to be sensitive to treatment with irofulven relative to the expression level of the biomarkers in a cell or tissue known to be resistant to treatment with irofulven. Alternatively, the patient may be non-responsive to treatment with irofulven if the expression level of the biomarker(s) corresponds to the expression level of the biomarker(s) in a cell or tissue known to be resistant to treatment with irofulven relative to the expression level of the biomarkers in a cell or tissue known to be resistant to treatment with irofulven.
Additionally, one or more biomarkers of sensitivity (e.g., one or more of ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), ID1 (SEQ ID NO: 217), and GJA1 (SEQ ID NO: 218)) and one or more biomarkers of resistance (e.g., one or more of IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), CD53 (SEQ ID NO: 310), MZB1 (SEQ ID NO: 313), RASSF5 (SEQ ID NO: 314 or 386), FAM46C (SEQ ID NO: 315), RCSD1 (SEQ ID NO: 316), IGJ (SEQ ID NO: 317), LPXN (SEQ ID NO: 319), ITGB7 (SEQ ID NO: 320), and GTSF1 (SEQ ID NO: 321)) may be used in combination to determine the responsiveness of a cancer patient (e.g., a patient having cancer that is resistant to one or more cancer therapies other than irofulven) to treatment with irofulven. For example, the predicted responsiveness of a cancer patient may be determined from, e.g., the difference score, which may be defined as the difference between the mean of the expression level of the one or more biomarkers of sensitivity of Tables 1 and 3 and the mean of the expression level of the one or more biomarkers of resistance of Tables 2 and 4.
The difference score of the cancer patient can then be compared to the difference score based on the expression level of the biomarkers in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven. In particular, the patient may be responsive to treatment with irofulven if the difference score corresponds to the expression level of the biomarkers in a cell or tissue known to be sensitive to treatment with irofulven. Alternatively, the patient may be non-responsive to treatment with irofulven if the difference score corresponds to the expression level of the biomarkers in a cell or tissue known to be resistant to treatment with irofulven. Additionally, the patient may be responsive to treatment with irofulven if the difference score corresponds to the expression level of the biomarkers in a cell or tissue known to be sensitive to treatment with irofulven relative to the expression level of the biomarkers in a cell or tissue known to be resistant to treatment with irofulven. Alternatively, the patient may be non-responsive to treatment with irofulven if the difference score corresponds to the expression level of the biomarkers in a cell or tissue known to be resistant to treatment with irofulven relative to the expression level of the biomarkers in a cell or tissue known to be sensitive to treatment with irofulven.
Preferably, the cell or tissue known to be either sensitive or resistant to irofulven is of the same cancer type as the cancer patient with an unknown responsiveness to irofulven. For example, the cancer patient and the cell or tissue known to be either sensitive or resistant to irofulven may both have a cancer type selected from a solid tumor or a hematological cancer, e.g., prostate cancer, ovarian cancer (e.g., ovarian adenocarcinoma or embryonal carcinoma), liver cancer (e.g., hepatocellular carcinoma (HCC) or hepatoma), myeloma (e.g., multiple myeloma), colorectal cancer (e.g., colon cancer and rectal cancer), leukemia (e.g., acute myeloid leukemia, acute lymphoid leukemia, chronic myeloid leukemia, chronic lymphocytic leukemia, acute myeloblastic leukemia, acute promyelocytic leukemia, acute myelomonocytic leukemia, acute monocytic leukemia, acute erythroleukemia, and chronic leukemia), myelodysplastic syndrome, lymphoma (e.g., diffuse large B-cell lymphoma, cutaneous T-cell lymphoma, peripheral T-cell lymphoma, Hodgkin's lymphoma, non-Hodgkin's lymphoma, Waldenstrom's macroglobulinemia, and lymphocytic lymphoma), cervical cancer, esophageal cancer, melanoma, glioma (e.g., oligodendroglioma), pancreatic cancer (e.g., adenosquamous carcinoma, signet ring cell carcinoma, hepatoid carcinoma, colloid carcinoma, islet cell carcinoma, and pancreatic neuroendocrine carcinoma), gastrointestinal stromal tumor, sarcoma (e.g., fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, leiomyosarcoma, Ewing's sarcoma, and rhabdomyosarcoma), breast cancer (e.g., medullary carcinoma), ER-positive cancer, bladder cancer, head and neck cancer (e.g., squamous cell carcinoma of the head and neck), lung cancer (e.g., non-small cell lung carcinoma, large cell carcinoma, bronchogenic carcinoma, and papillary adenocarcinoma), metastatic cancer, oral cavity cancer, uterine cancer, testicular cancer (e.g., seminoma and embryonal carcinoma), skin cancer (e.g., squamous cell carcinoma and basal cell carcinoma), thyroid cancer (e.g., papillary carcinoma and medullary carcinoma), brain cancer (e.g., astrocytoma and craniopharyngioma), stomach cancer, intra-epithelial cancer, bone cancer, biliary tract cancer, eye cancer, larynx cancer, kidney cancer (e.g., renal cell carcinoma and Wilms tumor), gastric cancer, blastoma (e.g., nephroblastoma, medulloblastoma, hemangioblastoma, neuroblastoma, and retinoblastoma), polycythemia vera, chordoma, synovioma, mesothelioma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, cystadenocarcinoma, bile duct carcinoma, choriocarcinoma, epithelial carcinoma, ependymoma, pinealoma, acoustic neuroma, schwannoma, meningioma, pituitary adenoma, nerve sheath tumor, cancer of the small intestine, cancer of the endocrine system, cancer of the penis, cancer of the urethra, cutaneous or intraocular melanoma, a gynecologic tumor, solid tumors of childhood, and neoplasms of the central nervous system. In particular, the cancer of the patient and the cell or tissue with known resistance or sensitivity to irofulven is, e.g., prostate cancer, ovarian cancer, hepatocellular carcinoma (HCC), multiple myeloma, breast cancer, acute myelogenous leukemia (AML), acute lympho-blastic leukemia (ALL), chronic lymphocytic leukemia (CLL), myelodysplastic syndrome (MDS), chronic myelogenous leukemia-chronic phase (CMLCP), diffuse large B-cell lymphoma (DLBCL), cutaneous T-cell lymphoma (CTCL), peripheral T-cell lymphoma (PTCL), Hodgkin's lymphoma, cervical cancer, renal cell carcinoma (RCC), esophageal cancer, melanoma, glioma, pancreatic cancer, gastrointestinal stromal tumors (GIST), sarcoma, estrogen receptor-positive (ERpos) breast cancer, non-small cell lung carcinoma (NSCLC), colon cancer, bladder cancer, or squamous cell carcinoma of the head and neck (SCCHN).
Machine learning techniques such as Neural Networks, Support Vector Machines, K Nearest Neighbor, and Nearest Centroids may also be employed to develop models that discriminate patients sensitive to treatment with irofulven from those resistant to treatment with irofulven using biomarker expression as model variables which assign each patient a classification as sensitive or resistant to treatment with irofulven. Machine learning techniques used to classify patients using various measurements are described in U.S. Pat. No. 5,822,715; U.S. Patent Application Publication Nos. 2003/0073083, 2005/0227266, 2005/0208512, 2005/0123945, 2003/0129629, and 2002/0006613; and in Vapnik V N. Statistical Learning Theory, John Wiley & Sons, New York, 1998; Hastie et al., 2001, The Elements of Statistical Learning: Data Mining, Inference, and Prediction, Springer, N.Y.; Agresti, 1996, An Introduction to Categorical Data Analysis, John Wiley & Sons, New York; V. Tresp et al., “Neural Network Modeling of Physiological Processes,” in Hanson S. J. et al. (Eds.), Computational Learning Theory and Natural Learning Systems 2, MIT Press, 1994, each of which are hereby incorporated by reference in their entirety.
Biomarkers of Sensitivity and Resistance
The expression levels of one or more biomarkers of Tables 1-4 can be used to determine cancer patient responsiveness to treatment with irofulven. Once determined to be responsive, the patient can be treated with irofulven. In particular, the biomarker ATP1B1 (SEQ ID NO: 201 or 219) may be used to assess a cancer patient's (e.g, a patient having cancer that is resistant to one or more cancer therapies other than irofulven) responsiveness to irofulven. The expression level of the biomarker ATP1B1 (SEQ ID NO: 201 or 219) may be assessed using nucleic acid amplification methods (e.g., PCR) or a device (e.g., a microarray). As is described above, the expression level of ATP1B1 (SEQ ID NO: 201 or 219) in the patient sample may then be compared, e.g., to the expression level of ATP1B1 (SEQ ID NO: 201 or 219) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven and used to determine the cancer patient's responsiveness to irofulven. The biomarker ATP1B1 (SEQ ID NO: 201 or 219) may be used alone to predict cancer patient responsiveness to treatment with irofulven or in combination with one or more additional biomarkers (e.g., one, two, three, four, five, ten, or all of the biomarkers shown in Tables 1-4), such as UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), ID1 (SEQ ID NO: 217), GJA1 (SEQ ID NO: 218), IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), CD53 (SEQ ID NO: 310), MZB1 (SEQ ID NO: 313), RASSF5 (SEQ ID NO: 314 or 386), FAM46C (SEQ ID NO: 315), RCSD1 (SEQ ID NO: 316), IGJ (SEQ ID NO: 317), LPXN (SEQ ID NO: 319), ITGB7 (SEQ ID NO: 320), and/or GTSF1 (SEQ ID NO: 321). The expression level of the biomarker(s) may be determined using, e.g., a microarray, PCR, or other techniques described herein, for example, using a nucleic acid probe sequence based on the target sequences shown in Tables 1-4.
The expression level of the biomarker UCHL1 (SEQ ID NO: 202) may be assessed using nucleic acid amplification methods (e.g., PCR) or a device (e.g., a microarray). As is described above, the expression level of UCHL1 (SEQ ID NO: 202) in the patient sample may then be compared, e.g., to the expression level of UCHL1 (SEQ ID NO: 202) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven and used to determine the cancer patient's responsiveness to irofulven. The biomarker UCHL1 (SEQ ID NO: 202) may be used alone to predict cancer patient responsiveness to treatment with irofulven or in combination with one or more additional biomarkers (e.g., one, two, three, four, five, ten, or all of the biomarkers shown in Tables 1-4), such as ATP1B1 (SEQ ID NO: 201 or 219), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), ID1 (SEQ ID NO: 217), GJA1 (SEQ ID NO: 218), IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), CD53 (SEQ ID NO: 310), MZB1 (SEQ ID NO: 313), RASSF5 (SEQ ID NO: 314 or 386), FAM46C (SEQ ID NO: 315), RCSD1 (SEQ ID NO: 316), IGJ (SEQ ID NO: 317), LPXN (SEQ ID NO: 319), ITGB7 (SEQ ID NO: 320), and/or GTSF1 (SEQ ID NO: 321). The expression level of the biomarker(s) may be determined using, e.g., a microarray, PCR, or other techniques described herein, for example, using a nucleic acid probe sequence based on the target sequences shown in Tables 1-4.
The biomarker PTGR1 (SEQ ID NO: 203 or 210) may be used to assess a cancer patient's (e.g, a patient having cancer that is resistant to one or more cancer therapies other than irofulven) responsiveness to irofulven. The expression level of the biomarker PTGR1 (SEQ ID NO: 203 or 210) may be assessed using nucleic acid amplification methods (e.g., PCR) or a device (e.g., a microarray). As is described above, the expression level of PTGR1 (SEQ ID NO: 203 or 210) in the patient sample may then be compared, e.g., to the expression level of PTGR1 (SEQ ID NO: 203 or 210) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven and used to determine the cancer patient's responsiveness to irofulven. The biomarker PTGR1 (SEQ ID NO: 203 or 210) may be used alone to predict cancer patient responsiveness to treatment with irofulven or in combination with one or more additional biomarkers (e.g., one, two, three, four, five, ten, or all of the biomarkers shown in Tables 1-4), such as ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), ID1 (SEQ ID NO: 217), GJA1 (SEQ ID NO: 218), IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), CD53 (SEQ ID NO: 310), MZB1 (SEQ ID NO: 313), RASSF5 (SEQ ID NO: 314 or 386), FAM46C (SEQ ID NO: 315), RCSD1 (SEQ ID NO: 316), IGJ (SEQ ID NO: 317), LPXN (SEQ ID NO: 319), ITGB7 (SEQ ID NO: 320), and/or GTSF1 (SEQ ID NO: 321). The expression level of the biomarker(s) may be determined using, e.g., a microarray, PCR, or other techniques described herein, for example, using a nucleic acid probe sequence based on the target sequences shown in Tables 1-4.
The biomarker NME7 (SEQ ID NO: 204) may be used to assess a cancer patient's (e.g, a patient having cancer that is resistant to one or more cancer therapies other than irofulven) responsiveness to irofulven. The expression level of the biomarker NME7 (SEQ ID NO: 204) may be assessed using nucleic acid amplification methods (e.g., PCR) or a device (e.g., a microarray). As is described above, the expression level of NME7 (SEQ ID NO: 204) in the patient sample may then be compared, e.g., to the expression level of NME7 (SEQ ID NO: 204) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven and used to determine the cancer patient's responsiveness to irofulven. The biomarker NME7 (SEQ ID NO: 204) may be used alone to predict cancer patient responsiveness to treatment with irofulven or in combination with one or more additional biomarkers (e.g., one, two, three, four, five, ten, or all of the biomarkers shown in Tables 1-4), such as ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), ID1 (SEQ ID NO: 217), GJA1 (SEQ ID NO: 218), IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), CD53 (SEQ ID NO: 310), MZB1 (SEQ ID NO: 313), RASSF5 (SEQ ID NO: 314 or 386), FAM46C (SEQ ID NO: 315), RCSD1 (SEQ ID NO: 316), IGJ (SEQ ID NO: 317), LPXN (SEQ ID NO: 319), ITGB7 (SEQ ID NO: 320), and/or GTSF1 (SEQ ID NO: 321). The expression level of the biomarker(s) may be determined using, e.g., a microarray, PCR, or other techniques described herein, for example, using a nucleic acid probe sequence based on the target sequences shown in Tables 1-4.
The biomarker PLS3 (SEQ ID NO: 205) may be used to assess a cancer patient's (e.g, a patient having cancer that is resistant to one or more cancer therapies other than irofulven) responsiveness to irofulven. The expression level of the biomarker PLS3 (SEQ ID NO: 205) may be assessed using nucleic acid amplification methods (e.g., PCR) or a device (e.g., a microarray). As is described above, the expression level of PLS3 (SEQ ID NO: 205) in the patient sample may then be compared, e.g., to the expression level of PLS3 (SEQ ID NO: 205) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven and used to determine the cancer patient's responsiveness to irofulven. The biomarker PLS3 (SEQ ID NO: 205) may be used alone to predict cancer patient responsiveness to treatment with irofulven or in combination with one or more additional biomarkers (e.g., one, two, three, four, five, ten, or all of the biomarkers shown in Tables 1-4), such as ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), ID1 (SEQ ID NO: 217), GJA1 (SEQ ID NO: 218), IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), CD53 (SEQ ID NO: 310), MZB1 (SEQ ID NO: 313), RASSF5 (SEQ ID NO: 314 or 386), FAM46C (SEQ ID NO: 315), RCSD1 (SEQ ID NO: 316), IGJ (SEQ ID NO: 317), LPXN (SEQ ID NO: 319), ITGB7 (SEQ ID NO: 320), and/or GTSF1 (SEQ ID NO: 321). The expression level of the biomarker(s) may be determined using, e.g., a microarray, PCR, or other techniques described herein, for example, using a nucleic acid probe sequence based on the target sequences shown in Tables 1-4.
The biomarker S100A10 (SEQ ID NO: 206) may be used to assess a cancer patient's (e.g, a patient having cancer that is resistant to one or more cancer therapies other than irofulven) responsiveness to irofulven. The expression level of the biomarker S100A10 (SEQ ID NO: 206) may be assessed using nucleic acid amplification methods (e.g., PCR) or a device (e.g., a microarray). As is described above, the expression level of S100A10 (SEQ ID NO: 206) in the patient sample may then be compared, e.g., to the expression level of S100A10 (SEQ ID NO: 206) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven and used to determine the cancer patient's responsiveness to irofulven. The biomarker S100A10 (SEQ ID NO: 206) may be used alone to predict cancer patient responsiveness to treatment with irofulven or in combination with one or more additional biomarkers (e.g., one, two, three, four, five, ten, or all of the biomarkers shown in Tables 1-4), such as ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), ID1 (SEQ ID NO: 217), GJA1 (SEQ ID NO: 218), IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), CD53 (SEQ ID NO: 310), MZB1 (SEQ ID NO: 313), RASSF5 (SEQ ID NO: 314 or 386), FAM46C (SEQ ID NO: 315), RCSD1 (SEQ ID NO: 316), IGJ (SEQ ID NO: 317), LPXN (SEQ ID NO: 319), ITGB7 (SEQ ID NO: 320), and/or GTSF1 (SEQ ID NO: 321). The expression level of the biomarker(s) may be determined using, e.g., a microarray, PCR, or other techniques described herein, for example, using a nucleic acid probe sequence based on the target sequences shown in Tables 1-4.
The biomarker CD24 (SEQ ID NO: 207, 209, or 220) may be used to assess a cancer patient's (e.g, a patient having cancer that is resistant to one or more cancer therapies other than irofulven) responsiveness to irofulven. The expression level of the biomarker CD24 (SEQ ID NO: 207, 209, or 220) may be assessed using nucleic acid amplification methods (e.g., PCR) or a device (e.g., a microarray). As is described above, the expression level of CD24 (SEQ ID NO: 207, 209, or 220) in the patient sample may then be compared, e.g., to the expression level of CD24 (SEQ ID NO: 207, 209, or 220) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven and used to determine the cancer patient's responsiveness to irofulven. The biomarker CD24 (SEQ ID NO: 207, 209, or 220) may be used alone to predict cancer patient responsiveness to treatment with irofulven or in combination with one or more additional biomarkers (e.g., one, two, three, four, five, ten, or all of the biomarkers shown in Tables 1-4), such as ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), ID1 (SEQ ID NO: 217), GJA1 (SEQ ID NO: 218), IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), CD53 (SEQ ID NO: 310), MZB1 (SEQ ID NO: 313), RASSF5 (SEQ ID NO: 314 or 386), FAM46C (SEQ ID NO: 315), RCSD1 (SEQ ID NO: 316), IGJ (SEQ ID NO: 317), LPXN (SEQ ID NO: 319), ITGB7 (SEQ ID NO: 320), and/or GTSF1 (SEQ ID NO: 321). The expression level of the biomarker(s) may be determined using, e.g., a microarray, PCR, or other techniques described herein, for example, using a nucleic acid probe sequence based on the target sequences shown in Tables 1-4.
The biomarker NQO1 (SEQ ID NO: 208 or 216) may be used to assess a cancer patient's (e.g, a patient having cancer that is resistant to one or more cancer therapies other than irofulven) responsiveness to irofulven. The expression level of the biomarker NQO1 (SEQ ID NO: 208 or 216) may be assessed using nucleic acid amplification methods (e.g., PCR) or a device (e.g., a microarray). As is described above, the expression level of NQO1 (SEQ ID NO: 208 or 216) in the patient sample may then be compared, e.g., to the expression level of NQO1 (SEQ ID NO: 208 or 216) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven and used to determine the cancer patient's responsiveness to irofulven. The biomarker NQO1 (SEQ ID NO: 208 or 216) may be used alone to predict cancer patient responsiveness to treatment with irofulven or in combination with one or more additional biomarkers (e.g., one, two, three, four, five, ten, or all of the biomarkers shown in Tables 1-4), such as ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), ID1 (SEQ ID NO: 217), GJA1 (SEQ ID NO: 218), IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), CD53 (SEQ ID NO: 310), MZB1 (SEQ ID NO: 313), RASSF5 (SEQ ID NO: 314 or 386), FAM46C (SEQ ID NO: 315), RCSD1 (SEQ ID NO: 316), IGJ (SEQ ID NO: 317), LPXN (SEQ ID NO: 319), ITGB7 (SEQ ID NO: 320), and/or GTSF1 (SEQ ID NO: 321). The expression level of the biomarker(s) may be determined using, e.g., a microarray, PCR, or other techniques described herein, for example, using a nucleic acid probe sequence based on the target sequences shown in Tables 1-4.
The expression levels of one or more biomarkers of Tables 1-4 can be used to determine cancer patient responsiveness to treatment with irofulven. Once determined to be responsive, the patient can be treated with irofulven. In particular, the biomarker MYOF (SEQ ID NO: 211) may be used to assess a cancer patient's (e.g, a patient having cancer that is resistant to one or more cancer therapies other than irofulven) responsiveness to irofulven. The expression level of the biomarker MYOF (SEQ ID NO: 211) may be assessed using nucleic acid amplification methods (e.g., PCR) or a device (e.g., a microarray). As is described above, the expression level of MYOF (SEQ ID NO: 211) in the patient sample may then be compared, e.g., to the expression level of MYOF (SEQ ID NO: 211) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven and used to determine the cancer patient's responsiveness to irofulven. The biomarker MYOF (SEQ ID NO: 211) may be used alone to predict cancer patient responsiveness to treatment with irofulven or in combination with one or more additional biomarkers (e.g., one, two, three, four, five, ten, or all of the biomarkers shown in Tables 1-4), such as ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), ID1 (SEQ ID NO: 217), GJA1 (SEQ ID NO: 218), IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), CD53 (SEQ ID NO: 310), MZB1 (SEQ ID NO: 313), RASSF5 (SEQ ID NO: 314 or 386), FAM46C (SEQ ID NO: 315), RCSD1 (SEQ ID NO: 316), IGJ (SEQ ID NO: 317), LPXN (SEQ ID NO: 319), ITGB7 (SEQ ID NO: 320), and/or GTSF1 (SEQ ID NO: 321). The expression level of the biomarker(s) may be determined using, e.g., a microarray, PCR, or other techniques described herein, for example, using a nucleic acid probe sequence based on the target sequences shown in Tables 1-4.
The biomarker LAPTM4B (SEQ ID NO: 212) may be used to assess a cancer patient's (e.g, a patient having cancer that is resistant to one or more cancer therapies other than irofulven) responsiveness to irofulven. The expression level of the biomarker LAPTM4B (SEQ ID NO: 212) may be assessed using nucleic acid amplification methods (e.g., PCR) or a device (e.g., a microarray). As is described above, the expression level of LAPTM4B (SEQ ID NO: 212) in the patient sample may then be compared, e.g., to the expression level of LAPTM4B (SEQ ID NO: 212) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven and used to determine the cancer patient's responsiveness to irofulven. The biomarker LAPTM4B (SEQ ID NO: 212) may be used alone to predict cancer patient responsiveness to treatment with irofulven or in combination with one or more additional biomarkers (e.g., one, two, three, four, five, ten, or all of the biomarkers shown in Tables 1-4), such as ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), ID1 (SEQ ID NO: 217), GJA1 (SEQ ID NO: 218), IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), CD53 (SEQ ID NO: 310), MZB1 (SEQ ID NO: 313), RASSF5 (SEQ ID NO: 314 or 386), FAM46C (SEQ ID NO: 315), RCSD1 (SEQ ID NO: 316), IGJ (SEQ ID NO: 317), LPXN (SEQ ID NO: 319), ITGB7 (SEQ ID NO: 320), and/or GTSF1 (SEQ ID NO: 321). The expression level of the biomarker(s) may be determined using, e.g., a microarray, PCR, or other techniques described herein, for example, using a nucleic acid probe sequence based on the target sequences shown in Tables 1-4.
The biomarker CALD1 (SEQ ID NO: 213) may be used to assess a cancer patient's (e.g, a patient having cancer that is resistant to one or more cancer therapies other than irofulven) responsiveness to irofulven. The expression level of the biomarker CALD1 (SEQ ID NO: 213) may be assessed using nucleic acid amplification methods (e.g., PCR) or a device (e.g., a microarray). As is described above, the expression level of CALD1 (SEQ ID NO: 213) in the patient sample may then be compared, e.g., to the expression level of CALD1 (SEQ ID NO: 213) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven and used to determine the cancer patient's responsiveness to irofulven. The biomarker CALD1 (SEQ ID NO: 213) may be used alone to predict cancer patient responsiveness to treatment with irofulven or in combination with one or more additional biomarkers (e.g., one, two, three, four, five, ten, or all of the biomarkers shown in Tables 1-4), such as ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), ID1 (SEQ ID NO: 217), GJA1 (SEQ ID NO: 218), IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), CD53 (SEQ ID NO: 310), MZB1 (SEQ ID NO: 313), RASSF5 (SEQ ID NO: 314 or 386), FAM46C (SEQ ID NO: 315), RCSD1 (SEQ ID NO: 316), IGJ (SEQ ID NO: 317), LPXN (SEQ ID NO: 319), ITGB7 (SEQ ID NO: 320), and/or GTSF1 (SEQ ID NO: 321). The expression level of the biomarker(s) may be determined using, e.g., a microarray, PCR, or other techniques described herein, for example, using a nucleic acid probe sequence based on the target sequences shown in Tables 1-4.
The biomarker PDGFC (SEQ ID NO: 214) may be used to assess a cancer patient's (e.g, a patient having cancer that is resistant to one or more cancer therapies other than irofulven) responsiveness to irofulven. The expression level of the biomarker PDGFC (SEQ ID NO: 214) may be assessed using nucleic acid amplification methods (e.g., PCR) or a device (e.g., a microarray). As is described above, the expression level of PDGFC (SEQ ID NO: 214) in the patient sample may then be compared, e.g., to the expression level of PDGFC (SEQ ID NO: 214) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven and used to determine the cancer patient's responsiveness to irofulven. The biomarker PDGFC (SEQ ID NO: 214) may be used alone to predict cancer patient responsiveness to treatment with irofulven or in combination with one or more additional biomarkers (e.g., one, two, three, four, five, ten, or all of the biomarkers shown in Tables 1-4), such as ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), BASP1 (SEQ ID NO: 215), ID1 (SEQ ID NO: 217), GJA1 (SEQ ID NO: 218), IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), CD53 (SEQ ID NO: 310), MZB1 (SEQ ID NO: 313), RASSF5 (SEQ ID NO: 314 or 386), FAM46C (SEQ ID NO: 315), RCSD1 (SEQ ID NO: 316), IGJ (SEQ ID NO: 317), LPXN (SEQ ID NO: 319), ITGB7 (SEQ ID NO: 320), and/or GTSF1 (SEQ ID NO: 321). The expression level of the biomarker(s) may be determined using, e.g., a microarray, PCR, or other techniques described herein, for example, using a nucleic acid probe sequence based on the target sequences shown in Tables 1-4.
The biomarker BASP1 (SEQ ID NO: 215) may be used to assess a cancer patient's (e.g, a patient having cancer that is resistant to one or more cancer therapies other than irofulven) responsiveness to irofulven. The expression level of the biomarker BASP1 (SEQ ID NO: 215) may be assessed using nucleic acid amplification methods (e.g., PCR) or a device (e.g., a microarray). As is described above, the expression level of BASP1 (SEQ ID NO: 215) in the patient sample may then be compared, e.g., to the expression level of BASP1 (SEQ ID NO: 215) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven and used to determine the cancer patient's responsiveness to irofulven. The biomarker BASP1 (SEQ ID NO: 215) may be used alone to predict cancer patient responsiveness to treatment with irofulven or in combination with one or more additional biomarkers (e.g., one, two, three, four, five, ten, or all of the biomarkers shown in Tables 1-4), such as ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), ID1 (SEQ ID NO: 217), GJA1 (SEQ ID NO: 218), IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), CD53 (SEQ ID NO: 310), MZB1 (SEQ ID NO: 313), RASSF5 (SEQ ID NO: 314 or 386), FAM46C (SEQ ID NO: 315), RCSD1 (SEQ ID NO: 316), IGJ (SEQ ID NO: 317), LPXN (SEQ ID NO: 319), ITGB7 (SEQ ID NO: 320), and/or GTSF1 (SEQ ID NO: 321). The expression level of the biomarker(s) may be determined using, e.g., a microarray, PCR, or other techniques described herein, for example, using a nucleic acid probe sequence based on the target sequences shown in Tables 1-4.
The biomarker ID1 (SEQ ID NO: 217) may be used to assess a cancer patient's (e.g, a patient having cancer that is resistant to one or more cancer therapies other than irofulven) responsiveness to irofulven. The expression level of the biomarker ID1 (SEQ ID NO: 217) may be assessed using nucleic acid amplification methods (e.g., PCR) or a device (e.g., a microarray). As is described above, the expression level of ID1 (SEQ ID NO: 217) in the patient sample may then be compared, e.g., to the expression level of ID1 (SEQ ID NO: 217) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven and used to determine the cancer patient's responsiveness to irofulven. The biomarker ID1 (SEQ ID NO: 217) may be used alone to predict cancer patient responsiveness to treatment with irofulven or in combination with one or more additional biomarkers (e.g., one, two, three, four, five, ten, or all of the biomarkers shown in Tables 1-4), such as ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), GJA1 (SEQ ID NO: 218), IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), CD53 (SEQ ID NO: 310), MZB1 (SEQ ID NO: 313), RASSF5 (SEQ ID NO: 314 or 386), FAM46C (SEQ ID NO: 315), RCSD1 (SEQ ID NO: 316), IGJ (SEQ ID NO: 317), LPXN (SEQ ID NO: 319), ITGB7 (SEQ ID NO: 320), and/or GTSF1 (SEQ ID NO: 321). The expression level of the biomarker(s) may be determined using, e.g., a microarray, PCR, or other techniques described herein, for example, using a nucleic acid probe sequence based on the target sequences shown in Tables 1-4.
The biomarker GJA1 (SEQ ID NO: 218) may be used to assess a cancer patient's (e.g, a patient having cancer that is resistant to one or more cancer therapies other than irofulven) responsiveness to irofulven. The expression level of the biomarker GJA1 (SEQ ID NO: 218) may be assessed using nucleic acid amplification methods (e.g., PCR) or a device (e.g., a microarray). As is described above, the expression level of GJA1 (SEQ ID NO: 218) in the patient sample may then be compared, e.g., to the expression level of GJA1 (SEQ ID NO: 218) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven and used to determine the cancer patient's responsiveness to irofulven. The biomarker GJA1 (SEQ ID NO: 218) may be used alone to predict cancer patient responsiveness to treatment with irofulven or in combination with one or more additional biomarkers (e.g., one, two, three, four, five, ten, or all of the biomarkers shown in Tables 1-4), such as ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), ID1 (SEQ ID NO: 217), IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), CD53 (SEQ ID NO: 310), MZB1 (SEQ ID NO: 313), RASSF5 (SEQ ID NO: 314 or 386), FAM46C (SEQ ID NO: 315), RCSD1 (SEQ ID NO: 316), IGJ (SEQ ID NO: 317), LPXN (SEQ ID NO: 319), ITGB7 (SEQ ID NO: 320), and/or GTSF1 (SEQ ID NO: 321). The expression level of the biomarker(s) may be determined using, e.g., a microarray, PCR, or other techniques described herein, for example, using a nucleic acid probe sequence based on the target sequences shown in Tables 1-4.
The biomarker IGLC1 (SEQ ID NO: 301, 302, 303, or 318) may be used to assess a cancer patient's (e.g, a patient having cancer that is resistant to one or more cancer therapies other than irofulven) responsiveness to irofulven. The expression level of the biomarker IGLC1 (SEQ ID NO: 301, 302, 303, or 318) may be assessed using nucleic acid amplification methods (e.g., PCR) or a device (e.g., a microarray). As is described above, the expression level of IGLC1 (SEQ ID NO: 301, 302, 303, or 318) in the patient sample may then be compared, e.g., to the expression level of IGLC1 (SEQ ID NO: 301, 302, 303, or 318) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven and used to determine the cancer patient's responsiveness to irofulven. The biomarker IGLC1 (SEQ ID NO: 301, 302, 303, or 318) may be used alone to predict cancer patient responsiveness to treatment with irofulven or in combination with one or more additional biomarkers (e.g., one, two, three, four, five, ten, or all of the biomarkers shown in Tables 1-4), such as ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), ID1 (SEQ ID NO: 217), GJA1 (SEQ ID NO: 218), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), CD53 (SEQ ID NO: 310), MZB1 (SEQ ID NO: 313), RASSF5 (SEQ ID NO: 314 or 386), FAM46C (SEQ ID NO: 315), RCSD1 (SEQ ID NO: 316), IGJ (SEQ ID NO: 317), LPXN (SEQ ID NO: 319), ITGB7 (SEQ ID NO: 320), and/or GTSF1 (SEQ ID NO: 321). The expression level of the biomarker(s) may be determined using, e.g., a microarray, PCR, or other techniques described herein, for example, using a nucleic acid probe sequence based on the target sequences shown in Tables 1-4.
The biomarker LAPTM5 (SEQ ID NO: 304 or 338) may be used to assess a cancer patient's (e.g, a patient having cancer that is resistant to one or more cancer therapies other than irofulven) responsiveness to irofulven. The expression level of the biomarker LAPTM5 (SEQ ID NO: 304 or 338) may be assessed using nucleic acid amplification methods (e.g., PCR) or a device (e.g., a microarray). As is described above, the expression level of LAPTM5 (SEQ ID NO: 304 or 338) in the patient sample may then be compared, e.g., to the expression level of LAPTM5 (SEQ ID NO: 304 or 338) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven and used to determine the cancer patient's responsiveness to irofulven. The biomarker LAPTM5 (SEQ ID NO: 304 or 338) may be used alone to predict cancer patient responsiveness to treatment with irofulven or in combination with one or more additional biomarkers (e.g., one, two, three, four, five, ten, or all of the biomarkers shown in Tables 1-4), such as ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), ID1 (SEQ ID NO: 217), GJA1 (SEQ ID NO: 218), IGLC1 (SEQ ID NO: 301, 302, 303, or 318), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), CD53 (SEQ ID NO: 310), MZB1 (SEQ ID NO: 313), RASSF5 (SEQ ID NO: 314 or 386), FAM46C (SEQ ID NO: 315), RCSD1 (SEQ ID NO: 316), IGJ (SEQ ID NO: 317), LPXN (SEQ ID NO: 319), ITGB7 (SEQ ID NO: 320), and/or GTSF1 (SEQ ID NO: 321). The expression level of the biomarker(s) may be determined using, e.g., a microarray, PCR, or other techniques described herein, for example, using a nucleic acid probe sequence based on the target sequences shown in Tables 1-4.
The biomarker ARHGDIB (SEQ ID NO: 305 or 311) may be used to assess a cancer patient's (e.g, a patient having cancer that is resistant to one or more cancer therapies other than irofulven) responsiveness to irofulven. The expression level of the biomarker ARHGDIB (SEQ ID NO: 305 or 311) may be assessed using nucleic acid amplification methods (e.g., PCR) or a device (e.g., a microarray). As is described above, the expression level of ARHGDIB (SEQ ID NO: 305 or 311) in the patient sample may then be compared, e.g., to the expression level of ARHGDIB (SEQ ID NO: 305 or 311) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven and used to determine the cancer patient's responsiveness to irofulven. The biomarker ARHGDIB (SEQ ID NO: 305 or 311) may be used alone to predict cancer patient responsiveness to treatment with irofulven or in combination with one or more additional biomarkers (e.g., one, two, three, four, five, ten, or all of the biomarkers shown in Tables 1-4), such as ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), ID1 (SEQ ID NO: 217), GJA1 (SEQ ID NO: 218), IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), CD53 (SEQ ID NO: 310), MZB1 (SEQ ID NO: 313), RASSF5 (SEQ ID NO: 314 or 386), FAM46C (SEQ ID NO: 315), RCSD1 (SEQ ID NO: 316), IGJ (SEQ ID NO: 317), LPXN (SEQ ID NO: 319), ITGB7 (SEQ ID NO: 320), and/or GTSF1 (SEQ ID NO: 321). The expression level of the biomarker(s) may be determined using, e.g., a microarray, PCR, or other techniques described herein, for example, using a nucleic acid probe sequence based on the target sequences shown in Tables 1-4.
The biomarker SLC43A3 (SEQ ID NO: 307) may be used to assess a cancer patient's (e.g, a patient having cancer that is resistant to one or more cancer therapies other than irofulven) responsiveness to irofulven. The expression level of the biomarker SLC43A3 (SEQ ID NO: 307) may be assessed using nucleic acid amplification methods (e.g., PCR) or a device (e.g., a microarray). As is described above, the expression level of SLC43A3 (SEQ ID NO: 307) in the patient sample may then be compared, e.g., to the expression level of SLC43A3 (SEQ ID NO: 307) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven and used to determine the cancer patient's responsiveness to irofulven. The biomarker SLC43A3 (SEQ ID NO: 307) may be used alone to predict cancer patient responsiveness to treatment with irofulven or in combination with one or more additional biomarkers (e.g., one, two, three, four, five, ten, or all of the biomarkers shown in Tables 1-4), such as ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), ID1 (SEQ ID NO: 217), GJA1 (SEQ ID NO: 218), IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), CD53 (SEQ ID NO: 310), MZB1 (SEQ ID NO: 313), RASSF5 (SEQ ID NO: 314 or 386), FAM46C (SEQ ID NO: 315), RCSD1 (SEQ ID NO: 316), IGJ (SEQ ID NO: 317), LPXN (SEQ ID NO: 319), ITGB7 (SEQ ID NO: 320), and/or GTSF1 (SEQ ID NO: 321). The expression level of the biomarker(s) may be determined using, e.g., a microarray, PCR, or other techniques described herein, for example, using a nucleic acid probe sequence based on the target sequences shown in Tables 1-4.
The biomarker LCP1 (SEQ ID NO: 308) may be used to assess a cancer patient's (e.g, a patient having cancer that is resistant to one or more cancer therapies other than irofulven) responsiveness to irofulven. The expression level of the biomarker LCP1 (SEQ ID NO: 308) may be assessed using nucleic acid amplification methods (e.g., PCR) or a device (e.g., a microarray). As is described above, the expression level of LCP1 (SEQ ID NO: 308) in the patient sample may then be compared, e.g., to the expression level of LCP1 (SEQ ID NO: 308) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven and used to determine the cancer patient's responsiveness to irofulven. The biomarker LCP1 (SEQ ID NO: 308) may be used alone to predict cancer patient responsiveness to treatment with irofulven or in combination with one or more additional biomarkers (e.g., one, two, three, four, five, ten, or all of the biomarkers shown in Tables 1-4), such as ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), ID1 (SEQ ID NO: 217), GJA1 (SEQ ID NO: 218), IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), HCLS1 (SEQ ID NO: 309), CD53 (SEQ ID NO: 310), MZB1 (SEQ ID NO: 313), RASSF5 (SEQ ID NO: 314 or 386), FAM46C (SEQ ID NO: 315), RCSD1 (SEQ ID NO: 316), IGJ (SEQ ID NO: 317), LPXN (SEQ ID NO: 319), ITGB7 (SEQ ID NO: 320), and/or GTSF1 (SEQ ID NO: 321). The expression level of the biomarker(s) may be determined using, e.g., a microarray, PCR, or other techniques described herein, for example, using a nucleic acid probe sequence based on the target sequences shown in Tables 1-4.
The biomarker HCLS1 (SEQ ID NO: 309) may be used to assess a cancer patient's (e.g, a patient having cancer that is resistant to one or more cancer therapies other than irofulven) responsiveness to irofulven. The expression level of the biomarker HCLS1 (SEQ ID NO: 309) may be assessed using nucleic acid amplification methods (e.g., PCR) or a device (e.g., a microarray). As is described above, the expression level of HCLS1 (SEQ ID NO: 309) in the patient sample may then be compared, e.g., to the expression level of HCLS1 (SEQ ID NO: 309) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven and used to determine the cancer patient's responsiveness to irofulven. The biomarker HCLS1 (SEQ ID NO: 309) may be used alone to predict cancer patient responsiveness to treatment with irofulven or in combination with one or more additional biomarkers (e.g., one, two, three, four, five, ten, or all of the biomarkers shown in Tables 1-4), such as ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), ID1 (SEQ ID NO: 217), GJA1 (SEQ ID NO: 218), IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), CD53 (SEQ ID NO: 310), MZB1 (SEQ ID NO: 313), RASSF5 (SEQ ID NO: 314 or 386), FAM46C (SEQ ID NO: 315), RCSD1 (SEQ ID NO: 316), IGJ (SEQ ID NO: 317), LPXN (SEQ ID NO: 319), ITGB7 (SEQ ID NO: 320), and/or GTSF1 (SEQ ID NO: 321). The expression level of the biomarker(s) may be determined using, e.g., a microarray, PCR, or other techniques described herein, for example, using a nucleic acid probe sequence based on the target sequences shown in Tables 1-4.
The biomarker CD53 (SEQ ID NO: 310) may be used to assess a cancer patient's (e.g, a patient having cancer that is resistant to one or more cancer therapies other than irofulven) responsiveness to irofulven. The expression level of the biomarker CD53 (SEQ ID NO: 310) may be assessed using nucleic acid amplification methods (e.g., PCR) or a device (e.g., a microarray). As is described above, the expression level of CD53 (SEQ ID NO: 310) in the patient sample may then be compared, e.g., to the expression level of CD53 (SEQ ID NO: 310) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven and used to determine the cancer patient's responsiveness to irofulven. The biomarker CD53 (SEQ ID NO: 310) may be used alone to predict cancer patient responsiveness to treatment with irofulven or in combination with one or more additional biomarkers (e.g., one, two, three, four, five, ten, or all of the biomarkers shown in Tables 1-4), such as ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), ID1 (SEQ ID NO: 217), GJA1 (SEQ ID NO: 218), IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), MZB1 (SEQ ID NO: 313), RASSF5 (SEQ ID NO: 314 or 386), FAM46C (SEQ ID NO: 315), RCSD1 (SEQ ID NO: 316), IGJ (SEQ ID NO: 317), LPXN (SEQ ID NO: 319), ITGB7 (SEQ ID NO: 320), and/or GTSF1 (SEQ ID NO: 321). The expression level of the biomarker(s) may be determined using, e.g., a microarray, PCR, or other techniques described herein, for example, using a nucleic acid probe sequence based on the target sequences shown in Tables 1-4.
The biomarker MZB1 (SEQ ID NO: 313) may be used to assess a cancer patient's (e.g, a patient having cancer that is resistant to one or more cancer therapies other than irofulven) responsiveness to irofulven. The expression level of the biomarker MZB1 (SEQ ID NO: 313) may be assessed using nucleic acid amplification methods (e.g., PCR) or a device (e.g., a microarray). As is described above, the expression level of MZB1 (SEQ ID NO: 313) in the patient sample may then be compared, e.g., to the expression level of MZB1 (SEQ ID NO: 313) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven and used to determine the cancer patient's responsiveness to irofulven. The biomarker MZB1 (SEQ ID NO: 313) may be used alone to predict cancer patient responsiveness to treatment with irofulven or in combination with one or more additional biomarkers (e.g., one, two, three, four, five, ten, or all of the biomarkers shown in Tables 1-4), such as ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), ID1 (SEQ ID NO: 217), GJA1 (SEQ ID NO: 218), IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), CD53 (SEQ ID NO: 310), RASSF5 (SEQ ID NO: 314 or 386), FAM46C (SEQ ID NO: 315), RCSD1 (SEQ ID NO: 316), IGJ (SEQ ID NO: 317), LPXN (SEQ ID NO: 319), ITGB7 (SEQ ID NO: 320), and/or GTSF1 (SEQ ID NO: 321). The expression level of the biomarker(s) may be determined using, e.g., a microarray, PCR, or other techniques described herein, for example, using a nucleic acid probe sequence based on the target sequences shown in Tables 1-4.
The biomarker RASSF5 (SEQ ID NO: 314 or 386) may be used to assess a cancer patient's (e.g, a patient having cancer that is resistant to one or more cancer therapies other than irofulven) responsiveness to irofulven. The expression level of the biomarker RASSF5 (SEQ ID NO: 314 or 386) may be assessed using nucleic acid amplification methods (e.g., PCR) or a device (e.g., a microarray). As is described above, the expression level of RASSF5 (SEQ ID NO: 314 or 386) in the patient sample may then be compared, e.g., to the expression level of RASSF5 (SEQ ID NO: 314 or 386) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven and used to determine the cancer patient's responsiveness to irofulven. The biomarker RASSF5 (SEQ ID NO: 314 or 386) may be used alone to predict cancer patient responsiveness to treatment with irofulven or in combination with one or more additional biomarkers (e.g., one, two, three, four, five, ten, or all of the biomarkers shown in Tables 1-4), such as ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), ID1 (SEQ ID NO: 217), GJA1 (SEQ ID NO: 218), IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), CD53 (SEQ ID NO: 310), MZB1 (SEQ ID NO: 313), FAM46C (SEQ ID NO: 315), RCSD1 (SEQ ID NO: 316), IGJ (SEQ ID NO: 317), LPXN (SEQ ID NO: 319), ITGB7 (SEQ ID NO: 320), and/or GTSF1 (SEQ ID NO: 321). The expression level of the biomarker(s) may be determined using, e.g., a microarray, PCR, or other techniques described herein, for example, using a nucleic acid probe sequence based on the target sequences shown in Tables 1-4.
The biomarker FAM46C (SEQ ID NO: 315) may be used to assess a cancer patient's (e.g, a patient having cancer that is resistant to one or more cancer therapies other than irofulven) responsiveness to irofulven. The expression level of the biomarker FAM46C (SEQ ID NO: 315) may be assessed using nucleic acid amplification methods (e.g., PCR) or a device (e.g., a microarray). As is described above, the expression level of FAM46C (SEQ ID NO: 315) in the patient sample may then be compared, e.g., to the expression level of FAM46C (SEQ ID NO: 315) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven and used to determine the cancer patient's responsiveness to irofulven. The biomarker FAM46C (SEQ ID NO: 315) may be used alone to predict cancer patient responsiveness to treatment with irofulven or in combination with one or more additional biomarkers (e.g., one, two, three, four, five, ten, or all of the biomarkers shown in Tables 1-4), such as ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), ID1 (SEQ ID NO: 217), GJA1 (SEQ ID NO: 218), IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), CD53 (SEQ ID NO: 310), MZB1 (SEQ ID NO: 313), RASSF5 (SEQ ID NO: 314 or 386), FRCSD1 (SEQ ID NO: 316), IGJ (SEQ ID NO: 317), LPXN (SEQ ID NO: 319), ITGB7 (SEQ ID NO: 320), and/or GTSF1 (SEQ ID NO: 321). The expression level of the biomarker(s) may be determined using, e.g., a microarray, PCR, or other techniques described herein, for example, using a nucleic acid probe sequence based on the target sequences shown in Tables 1-4.
The biomarker RCSD1 (SEQ ID NO: 316) may be used to assess a cancer patient's (e.g, a patient having cancer that is resistant to one or more cancer therapies other than irofulven) responsiveness to irofulven. The expression level of the biomarker RCSD1 (SEQ ID NO: 316) may be assessed using nucleic acid amplification methods (e.g., PCR) or a device (e.g., a microarray). As is described above, the expression level of RCSD1 (SEQ ID NO: 316) in the patient sample may then be compared, e.g., to the expression level of RCSD1 (SEQ ID NO: 316) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven and used to determine the cancer patient's responsiveness to irofulven. The biomarker RCSD1 (SEQ ID NO: 316) may be used alone to predict cancer patient responsiveness to treatment with irofulven or in combination with one or more additional biomarkers (e.g., one, two, three, four, five, ten, or all of the biomarkers shown in Tables 1-4), such as ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), ID1 (SEQ ID NO: 217), GJA1 (SEQ ID NO: 218), IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), CD53 (SEQ ID NO: 310), MZB1 (SEQ ID NO: 313), RASSF5 (SEQ ID NO: 314 or 386), FAM46C (SEQ ID NO: 315), IGJ (SEQ ID NO: 317), LPXN (SEQ ID NO: 319), ITGB7 (SEQ ID NO: 320), and/or GTSF1 (SEQ ID NO: 321). The expression level of the biomarker(s) may be determined using, e.g., a microarray, PCR, or other techniques described herein, for example, using a nucleic acid probe sequence based on the target sequences shown in Tables 1-4.
The biomarker IGJ (SEQ ID NO: 317) may be used to assess a cancer patient's (e.g, a patient having cancer that is resistant to one or more cancer therapies other than irofulven) responsiveness to irofulven. The expression level of the biomarker IGJ (SEQ ID NO: 317) may be assessed using nucleic acid amplification methods (e.g., PCR) or a device (e.g., a microarray). As is described above, the expression level of IGJ (SEQ ID NO: 317) in the patient sample may then be compared, e.g., to the expression level of IGJ (SEQ ID NO: 317) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven and used to determine the cancer patient's responsiveness to irofulven. The biomarker IGJ (SEQ ID NO: 317) may be used alone to predict cancer patient responsiveness to treatment with irofulven or in combination with one or more additional biomarkers (e.g., one, two, three, four, five, ten, or all of the biomarkers shown in Tables 1-4), such as ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), ID1 (SEQ ID NO: 217), GJA1 (SEQ ID NO: 218), IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), CD53 (SEQ ID NO: 310), MZB1 (SEQ ID NO: 313), RASSF5 (SEQ ID NO: 314 or 386), FAM46C (SEQ ID NO: 315), RCSD1 (SEQ ID NO: 316), LPXN (SEQ ID NO: 319), ITGB7 (SEQ ID NO: 320), and/or GTSF1 (SEQ ID NO: 321). The expression level of the biomarker(s) may be determined using, e.g., a microarray, PCR, or other techniques described herein, for example, using a nucleic acid probe sequence based on the target sequences shown in Tables 1-4.
The biomarker LPXN (SEQ ID NO: 319) may be used to assess a cancer patient's (e.g, a patient having cancer that is resistant to one or more cancer therapies other than irofulven) responsiveness to irofulven. The expression level of the biomarker LPXN (SEQ ID NO: 319) may be assessed using nucleic acid amplification methods (e.g., PCR) or a device (e.g., a microarray). As is described above, the expression level of LPXN (SEQ ID NO: 319) in the patient sample may then be compared, e.g., to the expression level of LPXN (SEQ ID NO: 319) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven and used to determine the cancer patient's responsiveness to irofulven. The biomarker LPXN (SEQ ID NO: 319) may be used alone to predict cancer patient responsiveness to treatment with irofulven or in combination with one or more additional biomarkers (e.g., one, two, three, four, five, ten, or all of the biomarkers shown in Tables 1-4), such as ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), ID1 (SEQ ID NO: 217), GJA1 (SEQ ID NO: 218), IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), CD53 (SEQ ID NO: 310), MZB1 (SEQ ID NO: 313), RASSF5 (SEQ ID NO: 314 or 386), FAM46C (SEQ ID NO: 315), RCSD1 (SEQ ID NO: 316), IGJ (SEQ ID NO: 317), ITGB7 (SEQ ID NO: 320), and/or GTSF1 (SEQ ID NO: 321). The expression level of the biomarker(s) may be determined using, e.g., a microarray, PCR, or other techniques described herein, for example, using a nucleic acid probe sequence based on the target sequences shown in Tables 1-4.
The biomarker ITGB7 (SEQ ID NO: 320) may be used to assess a cancer patient's (e.g, a patient having cancer that is resistant to one or more cancer therapies other than irofulven) responsiveness to irofulven. The expression level of the biomarker ITGB7 (SEQ ID NO: 320) may be assessed using nucleic acid amplification methods (e.g., PCR) or a device (e.g., a microarray). As is described above, the expression level of ITGB7 (SEQ ID NO: 320) in the patient sample may then be compared, e.g., to the expression level of ITGB7 (SEQ ID NO: 320) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven and used to determine the cancer patient's responsiveness to irofulven. The biomarker ITGB7 (SEQ ID NO: 320) may be used alone to predict cancer patient responsiveness to treatment with irofulven or in combination with one or more additional biomarkers (e.g., one, two, three, four, five, ten, or all of the biomarkers shown in Tables 1-4), such as ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), ID1 (SEQ ID NO: 217), GJA1 (SEQ ID NO: 218), IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), CD53 (SEQ ID NO: 310), MZB1 (SEQ ID NO: 313), RASSF5 (SEQ ID NO: 314 or 386), FAM46C (SEQ ID NO: 315), RCSD1 (SEQ ID NO: 316), IGJ (SEQ ID NO: 317), LPXN (SEQ ID NO: 319), and/or GTSF1 (SEQ ID NO: 321). The expression level of the biomarker(s) may be determined using, e.g., a microarray, PCR, or other techniques described herein, for example, using a nucleic acid probe sequence based on the target sequences shown in Tables 1-4.
The biomarker GTSF1 (SEQ ID NO: 321) may be used to assess a cancer patient's (e.g, a patient having cancer that is resistant to one or more cancer therapies other than irofulven) responsiveness to irofulven. The expression level of the biomarker GTSF1 (SEQ ID NO: 321) may be assessed using nucleic acid amplification methods (e.g., PCR) or a device (e.g., a microarray). As is described above, the expression level of GTSF1 (SEQ ID NO: 321) in the patient sample may then be compared, e.g., to the expression level of GTSF1 (SEQ ID NO: 321) in a cell (e.g., a cancer cell) or tissue (e.g., a tumor tissue) known to be sensitive or resistant to treatment with irofulven and used to determine the cancer patient's responsiveness to irofulven. The biomarker GTSF1 (SEQ ID NO: 321) may be used alone to predict cancer patient responsiveness to treatment with irofulven or in combination with one or more additional biomarkers (e.g., one, two, three, four, five, ten, or all of the biomarkers shown in Tables 1-4), such as ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), ID1 (SEQ ID NO: 217), GJA1 (SEQ ID NO: 218), IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), CD53 (SEQ ID NO: 310), MZB1 (SEQ ID NO: 313), RASSF5 (SEQ ID NO: 314 or 386), FAM46C (SEQ ID NO: 315), RCSD1 (SEQ ID NO: 316), IGJ (SEQ ID NO: 317), LPXN (SEQ ID NO: 319), and/or ITGB7 (SEQ ID NO: 320). The expression level of the biomarker(s) may be determined using, e.g., a microarray, PCR, or other techniques described herein, for example, using a nucleic acid probe sequence based on the target sequences shown in Tables 1-4.
Methods of Treatment
The diagnostic methods of the invention permit the assessment of whether a patient is likely to be responsive to treatment with irofulven, and can thus be used to direct the patient's treatment (e.g., as a first line therapy and/or as a second or third line therapy). A patient to be treated or tested for responsiveness to irofulven according to the methods may include, e.g., a patient that has been diagnosed with cancer, a patient that has not received a cancer treatment (e.g., irofulven, an anti-cancer agent other than irofulven, or radiation), a patient that has received a cancer treatment (e.g., an anti-cancer agent other than irofulven or radiation), or a patient during treatment with irofulven.
For example, the patient may have a solid tumor or a hematological cancer, such as a cancer type selected from prostate cancer, ovarian cancer (e.g., ovarian adenocarcinoma or embryonal carcinoma), liver cancer (e.g., hepatocellular carcinoma (HCC) or hepatoma), myeloma (e.g., multiple myeloma), colorectal cancer (e.g., colon cancer and rectal cancer), leukemia (e.g., acute myeloid leukemia, acute lymphoid leukemia, chronic myeloid leukemia, chronic lymphocytic leukemia, acute myeloblastic leukemia, acute promyelocytic leukemia, acute myelomonocytic leukemia, acute monocytic leukemia, acute erythroleukemia, and chronic leukemia), myelodysplastic syndrome, lymphoma (e.g., diffuse large B-cell lymphoma, cutaneous T-cell lymphoma, peripheral T-cell lymphoma, Hodgkin's lymphoma, non-Hodgkin's lymphoma, Waldenstrom's macroglobulinemia, and lymphocytic lymphoma), cervical cancer, esophageal cancer, melanoma, glioma (e.g., oligodendroglioma), pancreatic cancer (e.g., adenosquamous carcinoma, signet ring cell carcinoma, hepatoid carcinoma, colloid carcinoma, islet cell carcinoma, and pancreatic neuroendocrine carcinoma), gastrointestinal stromal tumor, sarcoma (e.g., fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, leiomyosarcoma, Ewing's sarcoma, and rhabdomyosarcoma), breast cancer (e.g., medullary carcinoma), ER-positive cancer, bladder cancer, head and neck cancer (e.g., squamous cell carcinoma of the head and neck), lung cancer (e.g., non-small cell lung carcinoma, large cell carcinoma, bronchogenic carcinoma, and papillary adenocarcinoma), metastatic cancer, oral cavity cancer, uterine cancer, testicular cancer (e.g., seminoma and embryonal carcinoma), skin cancer (e.g., squamous cell carcinoma and basal cell carcinoma), thyroid cancer (e.g., papillary carcinoma and medullary carcinoma), brain cancer (e.g., astrocytoma and craniopharyngioma), stomach cancer, intra-epithelial cancer, bone cancer, biliary tract cancer, eye cancer, larynx cancer, kidney cancer (e.g., renal cell carcinoma and Wilms tumor), gastric cancer, blastoma (e.g., nephroblastoma, medulloblastoma, hemangioblastoma, neuroblastoma, and retinoblastoma), polycythemia vera, chordoma, synovioma, mesothelioma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, cystadenocarcinoma, bile duct carcinoma, choriocarcinoma, epithelial carcinoma, ependymoma, pinealoma, acoustic neuroma, schwannoma, meningioma, pituitary adenoma, nerve sheath tumor, cancer of the small intestine, cancer of the endocrine system, cancer of the penis, cancer of the urethra, cutaneous or intraocular melanoma, a gynecologic tumor, solid tumors of childhood, and neoplasms of the central nervous system. In particular, the cancer of the patient is, e.g., prostate cancer, ovarian cancer, hepatocellular carcinoma (HCC), multiple myeloma, breast cancer, acute myelogenous leukemia (AML), acute lympho-blastic leukemia (ALL), chronic lymphocytic leukemia (CLL), myelodysplastic syndrome (MDS), chronic myelogenous leukemia-chronic phase (CMLCP), diffuse large B-cell lymphoma (DLBCL), cutaneous T-cell lymphoma (CTCL), peripheral T-cell lymphoma (PTCL), Hodgkin's lymphoma, cervical cancer, renal cell carcinoma (RCC), esophageal cancer, melanoma, glioma, pancreatic cancer, gastrointestinal stromal tumors (GIST), sarcoma, estrogen receptor-positive (ERpos) breast cancer, non-small cell lung carcinoma (NSCLC), colon cancer, bladder cancer, or squamous cell carcinoma of the head and neck (SCCHN).
The patient may have a cancer (e.g., prostate cancer, ovarian cancer, or hepatocellular carcinoma (HCC)) that is resistant to one or more cancer therapies other than irofulven (e.g., docetaxel, cabazitaxel, mitoxantrone, estramustine, prednisone, carboplatin, bevacizumab, paclitaxel, gemcitabine, doxorubicin, topotecan, etoposide, tamoxifen, letrozole, sorafenib, fluorouracil, capecitabine, oxaliplatin, interferon-alpha, 5-fluorouracil (5-FU), a histone deacetylase (HDAC) inhibitor, ipilimumab, bortezomib, carfilzomib, thalidomide, lenalidomide, pomalidomide, dexamethasone, cyclophosphamide, vincristine, melphalan, tegafur, irinotecan, cetuximab, leucovorin, SN-38, everolimus, temsirolimus, bleomycin, lomustine, depsipeptide, erlotinib, cisplatin, busulfan, epirubicin, arsenic trioxide, bendamustine, fulvestrant, teniposide, adriamycin, decitabine, estramustine, azaguanine, aclarubicin, mitomycin, paclitaxel, taxotere, APO010, ara-c, methylprednisolone, methotrexate, methyl-gag, belinostat, idarubicin, IL4-PR38, valproic acid, all-trans retinoic acid (ATRA), cytoxan, suberoylanilide hydroxamic acid, leukeran, fludarabine, vinblastine, dacarbazine, hydroxyurea, tegafur, daunorubicin, mechlorethamine, streptozocin, carmustine, mercaptopurine, dactinomycin, tretinoin, ifosfamide, floxuridine, thioguanine, PSC 833, herceptin, celecoxib, iressa, anastrozole, and rituximab), surgery, or radiation. The patient may also have experienced a recurrence following a treatment with a cancer therapy other than irofulven, surgery, or radiation.
A patient found to be responsive to irofulven according to the methods of the invention may be preferentially selected for treatment with irofulven. For example, a patient can be identified as responsive to irofulven by determining the expression level of one or more biomarkers (e.g., one or more of the biomarkers shown in Tables 1-4, such as ATP1B1 (SEQ ID NO: 201)) in a biological sample (e.g., a tumor sample) obtained from the patient, and subsequently administered irofulven. Alternatively, a patient can be identified as less likely to be responsive to irofulven by determining the expression level of one or more biomarkers (e.g., one or more of the biomarkers shown in Tables 1-4, such as ATP1B1 (SEQ ID NO: 201)) in a biological sample obtained from the patient. If the patient exhibits expression levels of one or more biomarkers indicative of non-responsiveness to irofulven, the patient may be treated with or offered a treatment with an agent other than irofulven. In particular, the patient may be treated with, e.g., radiation and/or administration of a therapeutic agent, such as docetaxel, cabazitaxel, mitoxantrone, estramustine, prednisone, carboplatin, bevacizumab, paclitaxel, gemcitabine, doxorubicin, topotecan, etoposide, tamoxifen, letrozole, sorafenib, fluorouracil, capecitabine, oxaliplatin, interferon-alpha, 5-fluorouracil (5-FU), a histone deacetylase (HDAC) inhibitor, ipilimumab, bortezomib, carfilzomib, thalidomide, lenalidomide, pomalidomide, dexamethasone, cyclophosphamide, vincristine, melphalan, tegafur, irinotecan, cetuximab, leucovorin, SN-38, everolimus, temsirolimus, bleomycin, lomustine, depsipeptide, erlotinib, cisplatin, busulfan, epirubicin, arsenic trioxide, bendamustine, fulvestrant, teniposide, adriamycin, decitabine, estramustine, azaguanine, aclarubicin, mitomycin, paclitaxel, taxotere, APO010, ara-c, methylprednisolone, methotrexate, methyl-gag, belinostat, idarubicin, IL4-PR38, valproic acid, all-trans retinoic acid (ATRA), cytoxan, suberoylanilide hydroxamic acid, leukeran, fludarabine, vinblastine, dacarbazine, hydroxyurea, tegafur, daunorubicin, mechlorethamine, streptozocin, carmustine, mercaptopurine, dactinomycin, tretinoin, ifosfamide, floxuridine, thioguanine, PSC 833, herceptin, celecoxib, iressa, anastrozole, or rituximab.
Administration of Irofulven
Once a patient has been determined to be responsive to irofulven, according to the methods described herein, irofulven may be administered to the patient, for example, parenterally, enterally, or topically. Enteral routes of irofulven administration include oral, buccal, sublabial, sublingual, or by inhalation. Parenteral routes of irofulven administration include intravenous, transdermal, intradermal, intramuscular, intra-arterial, intracranial, subcutaneous, intraorbital, intraventricular, intraspinal, intraperitoneal, or intranasal. The preferred route for administration of irofulven may be intravenous, such as intravenous infusion.
Irofulven can be administered at, e.g., a dose of about 0.05 mg/kg to 5 mg/kg, about 0.06 mg/kg to 4 mg/kg, about 0.1 mg/kg to 3 mg/kg, about 0.2 mg/kg to 2 mg/kg, about 0.3 mg/kg to 1 mg/kg, about 0.4 mg/kg to 1 mg/kg, about 0.2 mg/kg to 4 mg/kg, about 0.35 mg/kg to 4.5 mg/kg, about 0.25 mg/kg to 3.5 mg/kg, about 0.15 mg/kg to 2.5 mg/kg, about 0.45 mg/kg to about 1 mg/kg, about 0.45 mg/kg to about 2 mg/kg, or about 0.45 mg/kg to about 4 mg/kg. Irofulven may be administered at a frequency of, e.g., at least once hourly, once daily, twice daily, once weekly, once every two weeks, once every three weeks, once every four weeks, once monthly, once every two months, once every three months, once every six months, or once every year.
For example, irofulven may be administered at a treatment regimen of, e.g., about 0.05 mg/kg to 5 mg/kg, about 0.06 mg/kg to 4 mg/kg, about 0.1 mg/kg to 3 mg/kg, about 0.2 mg/kg to 2 mg/kg, about 0.3 mg/kg to 1 mg/kg, about 0.4 mg/kg to 1 mg/kg, about 0.2 mg/kg to 4 mg/kg, about 0.35 mg/kg to 4.5 mg/kg, about 0.25 mg/kg to 3.5 mg/kg, about 0.15 mg/kg to 2.5 mg/kg, about 0.45 mg/kg to about 1 mg/kg, about 0.45 mg/kg to about 2 mg/kg, or about 0.45 mg/kg to about 4 mg/kg on day 1 and day 8 every 3 weeks. In particular, irofulven may be administered at a treatment regimen of about 0.45 mg/kg on day 1 and day 8 every 3 weeks. The treatment regimen may be repeated one to five times, one to ten times, one to fifteen times, one to twenty times, or more. The administration of irofulven can be repeated at such a frequency for a certain period of time, followed by a period without treatment. Such repeated administrations can occur over a course of therapy lasting a specified length of time (e.g., at least 1 week, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, 6 months, 8 months, 10 months, 12 months, 18 months, 24 months, 36 months, 48 months, or 60 months).
Irofulven can be administered in a pharmaceutical composition that includes one or more pharmaceutically acceptable carriers, excipients, or diluents. Examples of suitable carriers, excipients, or diluents of irofulven include, e.g., saline, sterile water, polyalkylene glycols, oils of vegetable origin, hydrogenated napthalenes, suitable buffer, 1,3-butanediol, Ringer's solution and/or sodium chloride solution. Exemplary formulations for parenteral administration can include solutions prepared in water suitably mixed with a surfactant, e.g., hydroxypropylcellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, DMSO and mixtures thereof with or without alcohol, and in oils. Under ordinary conditions of storage and use, these preparations may contain a preservative to prevent the growth of microorganisms. Other exemplary carriers, excipients, or diluents are described in the Handbook of Pharmaceutical Excipients, 6th Edition, Rowe et al., Eds., Pharmaceutical Press (2009), hereby incorporated by reference in its entirety.
Kits
Kits of the invention can be used for determining the responsiveness of a cancer patient (e.g., a patient having a solid tumor cancer, such as prostate cancer, ovarian cancer, or hepatocellular carcinoma (HCC), or a hematological cancer, such as lymphoma (e.g., cutaneous T-cell lymphoma (CTCL)) to irofulven. Kits of the invention can include reagents and/or materials for, e.g., collecting and/or purifying nucleic acids from biological samples (such as those obtained from a patient to be treated with a target drug(s) of the invention), reagents for amplifying such nucleic acids to produce an amplified sample, and/or at least one device of the invention. Reagents for amplifying nucleic acids may include, e.g., PCR reagents, including but not limited to DNA polymerase, RNA polymerase, PCR buffer, magnesium chloride solutions, nucleic acid primers (e.g., primers designed to target particular biomarkers of responsiveness to a target drug(s) of interest), and/or any other PCR reagents as are well known in the art. In particular, kits useful in the method may include includes one or more of the following: a kit for RNA extraction from tumors (e.g., Trizol for mRNA, mirVana miRNA isolation kit from Ambion Inc), a kit for RNA labeling (e.g., MessageAmp from Ambion Inc., FlashTag from Genisphere Inc), a microarray for measuring biomarker expression (e.g., HG-U133A, HG-U133_Plus2 or miRNA-1.0 from Affymetrix Inc), a microarray hybridization station and scanner (e.g., GeneChip System 3000Dx from Affymetrix Inc), and/or software for analyzing the expression of biomarker genes or RNAs (e.g., miRNAs) as described in herein (e.g., implemented in R from R-Project or S-Plus from Insightful Corp.).
For example, a kit of the invention can include one or more probes capable of detecting one or more biomarkers of Tables 1-4 (e.g., the kit may include probes for the biomarkers of Tables 1-4). Such probes can, for example, include nucleic acids capable of hybridizing to the biomarker based on nucleic acid sequence complementarity. In particular, a probe has at least 85% sequence identity (e.g., 85%, 90%, 95%, 97%, 98%, 99%, or 100% sequence identity) to a nucleic acid sequence that is complementary or identical to at least 5 (e.g., at least 15) consecutive nucleotides of one or more biomarkers. The probes can be attached a solid surface, such as a microarray. The kit may include NanoString capture probes, NanoString reporter probes, and/or one or more nCounter cartridges. The kit may include reagents for next generation sequencing, including but not limited to poly(T) oligonucleotides, dye terminators, sequencing adapters, adapter ligation reagents, reverse transcriptase, primers (e.g., random primers), DNA-cleaving enzymes, polymerases, and/or any combination thereof. The kit may also be one that includes a protein array and/or reagents for detection of the polypeptide product(s) of one or more biomarkers of Tables 1-4.
The following examples are intended to illustrate, rather than limit, the invention.
EXAMPLES Example 1
Identification of Biomarkers of Sensitivity and Resistance to Irofulven Using Affymetrix HG-U133A Arrays
DNA chip measurements of the 60 cancer cell lines of the NCI60 data set were performed using Affymetrix HG-U133A arrays and logit normalized. For each array, the logit transformation was performed followed by a Z-transformation to mean zero and SD 1, and correlated to growth inhibition (log(GI50)). Growth inhibition data of irofulven against the same cell lines were downloaded from the National Cancer Institute. Each gene's expression in each cell line was correlated to the growth of those cell lines (log(GI50)) in the presence of irofulven. The Pearson correlation coefficient was then determined to identify genes positively and negatively correlated to sensitivity to irofulven. Tables 1 and 2 show the top positively correlated genes (the biomarkers of sensitivity) and negatively correlated genes (the biomarkers of resistance) using the Affymetrix HG-U133A arrays.
TABLE 1
Biomarkers of sensitivity to irofulven. Dashes indicate that the
Affymetrix probeset has not been mapped to a specific gene.
Affymetrix IDs refer to the array type HG-U133A.
Affymetrix
Probe
Gene Affymetrix ID Correlation Affymetrix Probe Sequence SEQ ID NO:
S100A10 200872_at 0.571 AGAGTTGTCCAAAGGGTCGCTTAAG 1
ATP1B1 201242_s_at 0.554 TGATCACAAGCACAAATCTTTCCCA 2
CTBP2 201220_x_at 0.549 ACACCCTGCTCTACAATGTTGCATC 3
ASPH 209135_at 0.539 AAAGCTGTGCTGTCGGTGATACAGA 4
LAPTM4B 214039_s_at 0.525 GTTACAAAGTCAGCAACTCTCCTGT 5
CTBP2 210835_s_at 0.524 TGCACGCATAGGATTGAAGACAGTA 6
MYOF 201798_s_at 0.519 CCAGTAGCAGGTTACGCCATGTCAC 7
TJP1 202011_at 0.518 AATACACCACTACATTCTGTTAATC 8
ASPH 210896_s_at 0.517 GTAACGCCTTGAGCTGGGTTGATTG 9
LPP 202822_at 0.511 GTTTGGTGCACTCTCGTGGGAGACA 10
PFN2 204992_s_at 0.503 CCCCAGGGACATTCCATCATTGCAA 11
ACTN1 208636_at 0.499 CAAGCACAAAGTTATATTCCATCCT 12
CKAP4 200999_s_at 0.474 TGTGTAATTGTTTGCTGTATCTCCC 13
MYOF 211864_s_at 0.46 TACCAAATCGACCAGAAACCTCCTT 14
PPIC 204517_at 0.455 CACCTGCTTAGGGACTTTGAACTTA 15
MET 203510_at 0.454 AAACTTGTCCTTAGATTAATGTGTC 16
CEBPD 203973_s_at 0.454 AAGCGGCGCAACCAGGAGATGCAGC 17
PAPSS2 203060_s_at 0.452 GATTTCAAGCTGTTCTGAGACATCT 18
UGDH 203343_at 0.448 TTAATTTCCAGTCACCCCAAATATG 19
FKBP9 212169_at 0.448 AACAAGGTGACATTTTTCTGCTGCC 20
NQO1 210519_s_at 0.446 GTGGCTTCCAAGTCTTAGAACCTCA 21
EGFR 201983_s_at 0.443 AAAATCCAGACTCTTTCGATACCCA 22
LAPTM4B 208767_s_at 0.44 AACTTCCCCCAAATCTGATGGACCT 23
RBPMS 209488_s_at 0.44 AATTCCGCAAACACTACGACTAGAG 24
ANXA2 210427_x_at 0.439 CGTGGCCATCCCTGTGAGGGTGACG 25
NQO1 201468_s_at 0.435 TTCATCTTCACTGCAATTTTGTGTA 26
LAPTM4B 208029_s_at 0.433 ACATGGGGTGACATGCCTCGTATGT 27
ANXA2 213503_x_at 0.433 CTCACCATGCTTCCAGCTAACAGGT 28
ANXA2 201590_x_at 0.43 GAGGGTGACGTTAGCATTACCCCCA 29
SEPT10 212698_s_at 0.43 TGATGACTTCATGCTTTATTATGCC 30
ALCAM 201952_at 0.425 ACAGCTGTCAGAACCTCGAGAGCAG 31
NQO1 201467_s_at 0.423 TCTCTGCAAGGGATCCACGGGGACA 32
SKAP2 204362_at 0.422 GCAAATGGCAGTGTGCTGTCACCTG 33
CAPN2 208683_at 0.422 GACACGAGGCCCTTGGCAGGGAATA 34
RCN1 201063_at 0.42 ACAATGCATTTCCTCAGTGATCACT 35
TXNRD1 201266_at 0.418 ACACGTGCTTGTGGACATCAGCCTC 36
ACTN1 208637_x_at 0.418 GGCGCTGTACGGCGAGAGTGACCTC 37
CALM1 209563_x_at 0.416 TGGCCAGTTTTTCATGCATGCAGCT 38
CALM2
CALM3
LAMB1 201505_at 0.412 AAGAGTCAGCTGATGCCAGAAGGAA 39
CTSL1 202087_s_at 0.411 GAAACCATTGTGGAATTGCCTCAGC 40
TGIF1 203313_s_at 0.41 ACTTACAGCTTAACCCATTTTCAAG 41
ANXA2P2 208816_x_at 0.41 AAGCCCTTGTATTTTGCTGATCAGC 42
CALM1 200653_s_at 0.408 GAAGAAATCCGTGAGGCATTCCGAG 43
CALM2
CALM3
CD24 209771_x_at 0.403 GAACACTCTTGCTTTATTCCAGAAT 44
CALM1 211984_at 0.403 AATTTGGTCAAGTCTACTCTTCCGT 45
CALM2
CALM3
PLXNB2 208890_s_at 0.397 AGAAAAAGCGGTACGATGCCTTCCT 46
SDC4 202071_at 0.396 CAGTAACCACATGCGGCTGTTTAAA 47
ACTN4 200601_at 0.394 TAACCAAGGAGGGGCCAGTGGATTC 48
TNFRSF12A 218368_s_at 0.389 AACACTAGGGGCTGGCCCACTAGGA 49
LOC100652886 201506_at 0.386 CTTTTATGGGGCCCTGTCCAGGTAG 50
LOC100653157
TGFBI
SQSTM1 201471_s_at 0.385 CTGCCTTCTTCCAGGATCAGGGGTT 51
CD24 216379_x_at 0.384 AATAGACACTCCCCGAAGTCTTTTG 52
ALDH7A1 208951_at 0.381 ACACAGAGACTTTTGCTCCGATTCT 53
LIF 205266_at 0.379 GTAGCATTTCCCTGCAGATGGTACA 54
AMOTL2 203002_at 0.377 TTTTTAGTTCTCCTTGATTCTTTGT 55
MYO1B 212364_at 0.377 ATGACCAGGTTAAATCCCTCTACAT 56
CDC42BPA 214464_at 0.377 AGCTCTGCAGTATTCAACTGTTGAT 57
CCND1 208712_at 0.374 AACCAAAAGAATTTGCACCCCGCTG 58
AGRN 212285_s_at 0.374 GAGCTCACTGTGGGATGGGGTTGAC 59
CD24 266_s_at 0.373 GTAATCTAATATGGCCACAGTAGTC 60
CD24 208651_x_at 0.372 AATAGCCACATTTAGAACACTTTTT 61
CD24 208650_s_at 0.371 AATCTGCTGGAGTTTCATGTACAAG 62
RBPMS 209487_at 0.37 AATTAGATTTGTCTCTGGGAATGTG 63
CALM1 200655_s_at 0.368 AACCATCAACATTGCTGTTCAAAGA 64
CALM2
CALM3
LGALS3 208949_s_at 0.367 CACTTTAACCCACGCTTCAATGAGA 65
CALM1 211985_s_at 0.367 TCGGCAACTTACACACATTGAAAAT 66
CALM2
CALM3
PPP1R3C 204284_at 0.365 TGTACACAACTCACATCCTTCATAT 67
LMNA 212086_x_at 0.362 TTCGGGGACAATCTGGTCACCCGCT 68
ADAM9 202381_at 0.361 ATCTGAACTTTCAAAGCTTGCTATT 69
FZD6 203987_at 0.361 GAGTGTCCACTATTGATTGTATTAT 70
TMSB10 217733_s_at 0.361 GCAGGAGAAGAACACCCTGCCGACC 71
AMIGO2 222108_at 0.359 ATATTGGTTCATGTGCTTGTGTATA 72
PLK2 201939_at 0.358 AGCTTTTGGCTGCGTAACTGTGAAC 73
NFIB 209289_at 0.357 TGAACGAATTTATTTTCCCCTCAGT 74
ULK2 204062_s_at 0.355 ACAGTTCACCAAATAGCTAGTCATG 75
AVPI1 218631_at 0.354 CATTTCACCACTCATGCTACTAATC 76
CYR61 201289_at 0.353 GTGGAGTTGATGACTTTCTGTTTTC 77
EXT1 201995_at 0.353 GGCCAATGAGAACTCAACTCCTGGC 78
TM4SF1 209386_at 0.353 AAAGCCTTTTGTCCTCCAAAGATGA 79
COTL1 221059_s_at 0.351 TGCAAGCTGCGAGGATGGCTTGGGC 80
PRSS23 202458_at 0.35 GAGGGGTGACACAGTGTTCCCTCCT 81
YES1 202933_s_at 0.348 AGCTTTTCGTCTTCAGTGTCTTAAT 82
G6PD 202275_at 0.347 CCAGAGCTTATTGGCCACTGGGTCT 83
BASP1 202391_at 0.347 CATTCTTCCTCTCCAGATATTTTTG 84
ZFP36L1 211962_s_at 0.347 ATGGTTTTTGCTCTAGAATACCGTA 85
FAIM 220643_s_at 0.345 GGACCAAAGTCACTAATGTTTTACA 86
FLNB 208614_s_at 0.344 TCAGCCTGGGCAGTCTTACCAAAAT 87
CAV2 203323_at 0.343 CCTAGGCCATTGCAGCATCCTTAGA 88
ABCC3 208161_s_at 0.343 CACCCCTAGGAACTCAGTCCTGTAC 89
MIR21 220990_s_at 0.342 TAAGGTAAGGTATCCACCCTCGATG 90
VMP1
FTH1 214211_at 0.341 TAGAACTAAGGGTTCCCGACTCTGA 91
PLOD2 202620_s_at 0.34 TCCATTTTATTCTTCTGAGTGTCTA 92
MXRA7 212509_s_at 0.34 CAGCATCAACCCCTATGGCATGCAT 93
ANXA4 201301_s_at 0.339 AAAGTACTGCTTGTTCTCTGTGGAG 94
PYGL 202990_at 0.339 AGAGAACCTGTTCATCTTTGGCATG 95
OLFML2A 213075_at 0.338 CCAATTGTGCTGAGTCTCCTACTAG 96
CYP1B1 202437_s_at 0.336 TAGCCTTTACTGTTTGATATACCAA 97
CAMSAP2 212765_at 0.335 GAGCATTGCTTACAGGTTTTTTGTT 98
GOLM1 217771_at 0.335 TGGGGCCTAGAAGTTACAGAGCATC 99
IER3 201631_s_at 0.334 GAGACTTCGGCGGACCATTAGGAAT 100
TABLE 2
Biomarkers of resistance to irofulven. Dashes indicate that the Affymetrix
probeset has not been mapped to a specific gene. Affymetrix IDs refer to
the array type HG-U133A.
Affymetrix
Probe
Gene Affymetrix ID Correlation Affymetrix Probe Sequence SEQ ID NO:
IGJ 212592_at −0.609 GCTCACCTGAAAGAGGTATGCTCTC 101
MZB1 221286_s_at −0.608 AAAGAAGCTGGGGCTTGCTCTGACG 102
CD8B 207979_s_at −0.59 GTAACATTGGGTCCTGGGTCTTTCA 103
ITGB7 205718_at −0.588 GAGGATGACGCCAGAGGCACGGTCG 104
CD28 206545_at −0.582 GATCAAACTCAGCAGTACTTGGGTG 105
CD53 203416_at −0.573 AAAGGGCAAGATCTCATTTCAATTT 106
IQGAP2 203474_at −0.567 ACTGTGATATAGGTACTCTGATTTA 107
HCLS1 202957_at −0.554 GTACGTCTAGATTGTGTGGTTTGCC 108
CD37 204192_at −0.536 CAACGACTCCACAATCCTAGATAAG 109
ICAM3 204949_at −0.527 GTACCCCGAGCTGCGGTGTTTGAAG 110
PIM2 204269_at −0.526 ACCGGACACCACCAGACAATAGGAT 111
ICAM2 213620_s_at −0.516 CTTGGGACATTGCCTTTTCTAGCCC 112
ICAM2 204683_at −0.512 CAAACACTCAGCCCCGAAGATGTTG 113
GLYR1 212414_s_at −0.509 ATGTGGCTGTTAATATGTGCTTGTT 114
SEPT6
CORO1A 209083_at −0.504 GATCGCCAGGTTCTACAAGCTGCAC 115
SLC43A3 213113_s_at −0.498 CTTTAGGCCTGTTTGGCTCCGAAGC 116
NFATC3 210555_s_at −0.497 TTGTGTGATCCAGCGTCATTTCCAC 117
SSBP2 203787_at −0.493 GTATATGTCTGCAATCATGGATAGG 118
PTPN7 204852_s_at −0.492 GGGTACAAGCTCCAGAACAGTAACC 119
NCKAP1L 209734_at −0.486 GTGGAAGCTGTGGTCACTTTCGCAG 120
RHOH 204951_at −0.474 GAGGCTTGGCCACTGGATGTTTTCA 121
MYB 204798_at −0.465 TGTGGTTGATAGCCAGTCACTGCCT 122
LCP1 208885_at −0.462 TTTGGAGGCAATCCTACCTTGCTTT 123
ARHGAP15 218870_at −0.458 ACCTCATGTCCACGCAAAGCTTGGG 124
LRMP 204674_at −0.454 AGTGGGATGTCTCTTCAGTTTATGA 125
FARSA 216602_s_at −0.453 TGGTGGGCCACAAGGTGAACCTGCA 126
SEPT6 212415_at −0.452 TAACCACCGATCAGCACAGCTGTCC 127
LAPTM5 201721_s_at −0.448 CATAGGCGAATCTGTTCTGCCCGAG 128
EVI2B 211742_s_at −0.447 ACATATACTTATTACCCAGTACAGT 129
USP7 201498_at −0.439 GAACATGTACAATTTGCCACTGGGA 130
CCND2 200953_s_at −0.436 ATGTTGTATTGGCTATGATGGTGAC 131
SEPT6 213666_at −0.435 AAAGGTGTGACCAGTCATTGCCCCT 132
RNASE6 213566_at −0.433 ATTTCTAACCCTGCAACTTTTGCCA 133
MYC 202431_s_at −0.432 AAAAGCCACAGCATACATCCTGTCC 134
CYTIP 209606_at −0.431 AAATCTTAGGTTTGCTTATGCCCAG 135
HBA1 209458_x_at −0.429 AGAGAACCCACCATGGTGCTGTCTC 136
HBA2
EVI2A 204774_at −0.428 AATTTAATGGTATCTTCCTTGCTGG 137
NARF 219862_s_at −0.428 CGGAGAGGTGGTGTTACGCTTTGCT 138
LAPTM5 201720_s_at −0.426 AGCTGCTCACAACTGGGTCAACGCT 139
MFNG 204153_s_at −0.426 GGTCCCAGCCAATTGTGATGATCCT 140
ARHGDIB 201288_at −0.424 GTCACTCAACGTGGTCCCTAGAACA 141
ZFP36L2 201369_s_at −0.422 GACGACTGAGGCAAGAGGGCGCCAG 142
MAGEA9 210437_at −0.42 GGTTCCTTGTCTATTGGGTGATTTG 143
MAGEA9B
NASP 201970_s_at −0.417 GTGACTGATATTTCCCACCTTGTCA 144
SMARCC1 201074_at −0.414 GAAGAAGGCCTAATCTCTCTCTTTT 145
ARHGAP6 206167_s_at −0.413 AAGTGCATAACTATTTTTGACCAGC 146
PTP4A3 206574_s_at −0.413 TGGCATCACCGTTGTGGACTGGCCG 147
SAMSN1 220330_s_at −0.411 TGGACACATTTTATCCTGATCCACA 148
HBA1 211745_x_at −0.409 TGGCGAGTATGGTGCGGAGGCCCTG 149
HBA2
CXCR4 211919_s_at −0.409 GTGGTCTATGTTGGCGTCTGGATCC 150
FEN1 204767_s_at −0.408 TGGACCTAGACTGTGCTTTTCTGTC 151
HBA1 204018_x_at −0.405 CTGACCTCCAAATACCGTTAAGCTG 152
HBA2
HBA1 211699_x_at −0.402 CGCACAAGCTTCGGGTGGACCCGGT 153
HBA2
SLC19A1 211576_s_at −0.401 GATGTGATGTGAATACTCTTCCCAC 154
ARHGEF3 218501_at −0.399 TCATGTGCATTCAAGCTGTGTGACA 155
CXCR4 209201_x_at −0.398 AGCACATCATGGTTGGCCTTATCCT 156
UTP3 209486_at −0.397 GAAATTCGTCATCTGTTGACACTTA 157
PDSS1 220865_s_at −0.396 GCAGCTATCTTACCAGACTGTGCCT 158
MAZ 207824_s_at −0.395 AAATGTGAGGCAGCTTTCGCCACGA 159
SELPLG 209879_at −0.395 CACTGCACTGCCATTGTCTTTTGGT 160
FARSA 202159_at −0.394 TCCTGTGTGGTGTGTCTACTGTGAG 161
LCP2 205269_at −0.394 TGTTTTTTACAGCCAAACCTCTGTC 162
STAT5A 203010_at −0.393 CCTCCCTCTGAGGCGTGAGGACTCG 163
CISH 221223_x_at −0.392 AAAGCCCATCCTGAGACATCTTGCT 164
MANIA1 221760_at −0.391 GGTTTTCATATGAGCTACACATTGT 165
HBA1 217414_x_at −0.388 TCAAGGCCGCCTGGGGTAAGGTCGG 166
HBA2
TCF4 222146_s_at −0.388 AACAGCTGTATTATCTTAAACCCAC 167
LAIR1 210644_s_at −0.385 CAGTTCCCTGGCTGTTTCTAGAGAC 168
MYLIP 220319_s_at −0.382 AGCTACGCAAGCTGAAGGAAGCCAT 169
IKZF1 205039_s_at −0.38 CGCCCATCCGTGCTATGACATGGAG 170
CXCR4 217028_at −0.379 GTATGTCTCGTGGTAGGACTGTAGA 171
TAPBPL 218747_s_at −0.377 GAACAGCCTTGGGAGTCATCTTTGC 172
ZFP36L2 201368_at −0.376 GTGAAGCAACCGCCTTAGTGCTGAA 173
IL2RG 204116_at −0.374 AACCCCAATCCTCTGACAGAAGAAC 174
TNFAIP8 210260_s_at −0.374 GTGTCATTGCCTTGAAATGCTTGCT 175
PRKCB 209685_s_at −0.372 GAAAAGGGCATTTGGCACCACTCTC 176
PAICS 201014_s_at −0.371 GATGTCTGGGAACACTGCATATCCA 177
IKZF1 205038_at −0.371 CCCATATCCCTTCTGTAATTTGTAC 178
EZH2 203358_s_at −0.368 CTGCCTTAGCTTCAGGAACCTCGAG 179
ADCK3 218168_s_at −0.368 CCCTTCCAATCTCTGTTCAGTGCAA 180
SRSF2 214882_s_at −0.365 AGTGCAGAGTGCTTGGCTGTTTCCT 181
VARS 201797_s_at −0.364 TGAGCTGGCGCTAAGCATCACGCGA 182
NDUFV1 208714_at −0.364 GACGGTGCTGATGGACTTCGATGCG 183
REPIN1 219041_s_at −0.363 CCTATAATTTCTACCTATTGGGCCT 184
GMFG 204220_at −0.362 GGCTGGGGACTGAATTCCTGATGTC 185
MCM7 208795_s_at −0.357 GTCAAAGGACTCTCTTCTAGGAGAC 186
TUFM 201113_at −0.356 ATGCCCGGGGAGGACCTGAAGTTCA 187
HMHA1 212873_at −0.355 CTCCCTTTTCCAGAACACCAGGTGT 188
SON 213538_at −0.355 TTGGGTACATAGCCCATTGCCCTTA 189
TXNIP 201008_s_at −0.353 TACAAGTTCGGCTTTGAGCTTCCTC 190
NPRL2 203246_s_at −0.353 GACTCGGGAAGAGCAGAGCCACCCT 191
TCF4 213891_s_at −0.353 GGGAAATTTTTTGCGACTGTACACA 192
NADK 208918_s_at −0.352 ATTTTTCCGCAAATCAGTCGGTTGA 193
RRP1B 212846_at −0.352 TGTTATCCTTTCTAATTTTTACTGA 194
MAP4K1 214219_x_at −0.352 CCAGCAACCTCTACATCCAGGAATG 195
DDX39A 201584_s_at −0.35 GCAGTTCAAGGATTTCCAGCGGCGG 196
MAP4K1 206296_x_at −0.35 GGTCAGCTTCAGGCCTTCTGGAAGC 197
TXNIP 201009_s_at −0.349 GAAGCAGCTTTACCTACTTGTTTCT 198
USP20 203965_at −0.348 GCGTCTTTGTTTCTATCAGTCTTTG 199
IFI16 208965_s_at −0.347 GACCTGGCTGAAACTCTTAAAAAAG 200
Example 2
Identification of Biomarkers of Sensitivity and Resistance to Irofulven Using Affymetrix HG-U133_Plus_2 Arrays
DNA chip measurements of the 60 cancer cell lines of the NCI60 data set were also performed using HG-U133_Plus_2 arrays and logit normalized. For each array, the logit transformation was performed followed by a Z-transformation to mean zero and SD 1, and correlated to growth inhibition (log(GI50)). Growth inhibition data of irofulven against the same cell lines were downloaded from the National Cancer Institute. Each gene's expression in each cell line was correlated to the growth of those cell lines (log(GI50)) in the presence of irofulven. The Pearson correlation coefficient was then determined to identify genes positively and negatively correlated to sensitivity to irofulven. Tables 3 and 4 show the top positively correlated genes (the biomarkers of sensitivity) and negatively correlated genes (the biomarkers of resistance) using the Affymetrix HG-U133_Plus_2 arrays. The Affymetrix HG-U133_Plus_2 array includes additional genes (e.g., PTGR1 and NME7) that are not included in the Affymetrix HG-U133A array, which were top ranking biomarkers of sensitivity and biomarkers of resistance, as shown in Tables 3 and 4.
TABLE 3
Biomarkers of sensitivity to irofulven. Dashes indicate that the Affymetrix
probeset has not been mapped to a specific gene. Affymetrix IDs refer to
the array type HG-U133_Plus_2.
Affymetrix
Probe
Gene Affymetrix ID Correlation Affymetrix Probe Sequence SEQ ID NO:
ATP1B1 201242_s_at 0.33 GGACCTACACTTAATCTATATGCTT 201
UCHL1 201387_s_at 0.3 AGCCCATGATGCCGTGGCACAGGAA 202
PTGR1 231897_at 0.3 AGGATTTGAAAACATGCCAGCTGCA 203
NME7 227556_at 0.29 GACACAGCTTTAGAACATACCGGAG 204
PLS3 201215_at 0.27 TGTACTCTTGCTTTGTCAAGCTGTT 205
S100A10 200872_at 0.27 GGACCTGGACCAGTGTAGAGATGGC 206
CD24 209771_x_at 0.27 GAACCTGGTCCTAAGCCTAAAAGTG 207
NQO1 210519_s_at 0.26 ATATAGCATTGGGCACACTCCAGCA 208
CD24 216379_x_at 0.26 CATGGTCACACACTGATGCTTAGAT 209
PTGR1 228824_s_at 0.26 AATGGAGAGGTCCTGCTTGAAGCTT 210
MYOF 201798_s_at 0.26 CCAGTAGCAGGTTACGCCATGTCAC 211
LAPTM4B 214039_s_at 0.26 ATATTTGATATACTTCTGCCTAACA 212
CALD1 212077_at 0.25 ATCACTGCTGACTTTTATTCCAATA 213
PDGFC 218718_at 0.25 AAGTAGACATTCAGATCCAGCCATT 214
BASP1 202391_at 0.25 TGGATCTCAATGCCAATCCTCCATT 215
NQO1 201468_s_at 0.25 AATAGTCAATTTCTACTTCTGGAAG 216
ID1 208937_s_at 0.25 CACCCTCAACGGCGAGATCAGCGCC 217
GJA1 201667_at 0.25 GAGTGGACTATTAAATGTGCCTAAA 218
ATP1B1 201243_s_at 0.25 GTTATGCTTGTATTGAATGCTGTCT 219
CD24 208650_s_at 0.24 GAGAGGTTTGACTAGATGATGGATG 220
EGR1 227404_s_at 0.24 TGAGCATGTCCCTCACAATTGCACA 221
PERP 222392_x_at 0.24 GTGCCACTAAAACAGCCTCAGGAGA 222
CYR61 201289_at 0.24 CTTCATTTTGGAGCTTGTGGAGTTG 223
AKR1B10 206561_s_at 0.24 GCAACCATACTCAGCTTCAACAGAA 224
PFN2 204992_s_at 0.24 TTGCTTCTATTGTTTGGGCCTTGTG 225
TFPI2 209278_s_at 0.23 GCTTTCACCTATACTGGCTGTGGAG 226
CTBP2 201218_at 0.23 GAGCCTTTGTATAGGTACATTCCTG 227
ASPH 209135_at 0.23 AGTAAGTTTTGCTGGATTTTTGTAG 228
PLK2 201939_at 0.23 CAGTTCTTGACTTTGGACAATCCCA 229
FAM213A 228155_at 0.22 CATATGATGTTTGAGTGCTGTTGTT 230
NQO1 201467_s_at 0.22 CATTCTCTGGCCAATTCAGAGTGGC 231
MYOF 211864_s_at 0.22 TACCAAATCGACCAGAAACCTCCTT 232
TM4SF1 209386_at 0.22 AAAGCCTTTTGTCCTCCAAAGATGA 233
ALCAM 201952_at 0.22 GGCAGCCACATGCACGAAGATGCTA 234
WWTR1 202133_at 0.22 CCATTTCTTTCACTGATTACACCAT 235
EDIL3 225275_at 0.22 ATAACCTTTGCAAACCTTCAAGCTG 236
COL1A1 1556499_s_at 0.22 TTTTTATCTTTGACCAACCGAACAT 237
TJP1 202011_at 0.22 GATACAATGCTGTGCCCTAAAGTGT 238
PLOD2 202620_s_at 0.22 TGTTGACTTGATGTTTTATCACTTC 239
YAP1 224894_at 0.22 ACACAGGGAAGTGACTTTGCTACAA 240
EGFR 201983_s_at 0.21 GTGTCAACAGCACATTCGACAGCCC 241
MET 203510_at 0.21 GCTGAACTGAATGGTACTTCGTATG 242
AJUBA 225806_at 0.21 AAAGCTCAATTCCTATTTTGGTGTG 243
CEBPD 203973_s_at 0.21 AGAAGCTACAGCCTGGACTTACCAC 244
ASPH 210896_s_at 0.21 CGCTCAGTGCTCTTACTAGATGAAC 245
AMIGO2 222108_at 0.21 GAGTAACTTCTTAAATCCCTGTTCT 246
AKR1C1 204151_x_at 0.21 ATCTCTCCTGCTTGGTGATTTCAGC 247
AKR1C2 209699_x_at 0.21 CACATCGCCTCTGGTTAAATCTCTC 248
LOC101930400
AKR1C3 209160_at 0.21 CAGTCAACTACAGCTGAGTCCATAG 249
LAPTM4B 208767_s_at 0.21 TTCACTAACCTTCCCTAGGCATTGA 250
PRSS23 202458_at 0.21 AGAATCACTCCTCTCAAATATGCCC 251
CKAP4 200999_s_at 0.21 CCATGAAGAGGTTTGCCGTCTGGGC 252
GPX8 227628_at 0.21 GAGCACTGTGTATGACTGAAATTTC 253
LOC101928916 202237_at 0.21 CAACAACGAAGGACTTTTCTCCCTG 254
NNMT
LAMC1 200771_at 0.21 TCACTTTAGCTGTTTGCCTTACTCT 255
TGFBI 201506_at 0.21 AGAAACTTGGATGTCACTGCCTGAC 256
LAPTM4B 208029_s_at 0.2 AAGACCATTAGAAAGCACCAGGCCG 257
CD24 266_s_at 0.2 CTACTGTGTGTGTGAATGAACACTC 258
PERP 217744_s_at 0.2 TTCTACACATCTGCCTAACTTGGGA 259
AKR1C2 211653_x_at 0.2 CCCCCCTAATTATCCATTTTCTGAT 260
LOC101930400
YAP1 224895_at 0.2 GTTTTATGTCCTTGTTCCTAATGTA 261
ABCC3 208161_s_at 0.2 CACCCCTAGGAACTCAGTCCTGTAC 262
LIMCH1 212328_at 0.2 TGGGTTCTTTGCATGTGGGTTCCAT 263
KRT19 201650_at 0.2 GCTGAGCATGAAAGCTGCCTTGGAA 264
CD24 208651_x_at 0.2 AACACTTTTTGTTATCAGTCAATAT 265
CRIM1 228496_s_at 0.2 TAAAGTTCAGCAACCTCTGTCCAAG 266
SEMA3C 203789_s_at 0.2 GTGACTTAATATCTATTCCATTTGT 267
TRIM16 204341_at 0.2 ATATGGTGCTGTTCTCTATGTGTTT 268
TSPAN6 209108_at 0.2 CTTGGGTCTAAGGCATCCACGACTG 269
PTPN14 226282_at 0.2 TCACCATCTCTTATGTTGTTGCCGT 270
NGFRAP1 217963_s_at 0.2 CAAGTGGGTCTTGTGTTGCCAGCTT 271
SLPI 203021_at 0.19 TCTGTCCTCCTAAGAAATCTGCCCA 272
LGALS3 208949_s_at 0.19 CACTTTAACCCACGCTTCAATGAGA 273
CTBP2 210554_s_at 0.19 GCACCCCAACGAGCAATAGCAGAGA 274
C19orf33 223631_s_at 0.19 TTCTCTTACCGCCATGGAGTTCGAC 275
PLOD2 202619_s_at 0.19 CTTAATGTCTGCTCTGAGCCTTAAA 276
PPIC 204517_at 0.19 CCCTTCCTCAAGTGGTGCTATTTTA 277
ERRFI1 224657_at 0.19 GGTACATTACTGCAATGTTCTCTTA 278
CTBP2 201220_x_at 0.19 GTTTGCCTGTGGTAGACACCTGCAC 279
NARR 1555630_a_at 0.19 AATGCATTGCATCAACCTACTATAG 280
RAB34
FAM213A 224435_at 0.19 AAACCACAGACTTTGGCCTCAGAGA 281
SEPT10 212698_s_at 0.19 ATAAAGTACCTTTGAGCATGAGTGT 282
LAPTM4B 1554679_a_at 0.19 GGTCCTTATTATTCTTCTGTTTATT 283
PON2 201876_at 0.19 GACTACTATGGCTGTTTAGAACTAC 284
CD24 209772_s_at 0.19 TGGAACTTCAAGTAACTCCTCCCAG 285
TPM1 210986_s_at 0.19 ATTCCTTTCTGATTGGCACACGTGC 286
RAB13 202252_at 0.19 ACTAGGGAATTTGCTCCTGTTCTGT 287
AKR1C1 216594_x_at 0.19 TGTGGTCCTGGCCAAGAGCTACAAT 288
PTK2 208820_at 0.19 AAAGCCATGTTGACTATTTTACAGC 289
LAMB1 201505_at 0.18 AAAGCTCAAGAATTAGCAAGACTGG 290
GPRC5A 203108_at 0.18 TCCCCAAACTTGCTGTCAATTCCGA 291
PAPSS2 203060_s_at 0.18 GATTTCAAGCTGTTCTGAGACATCT 292
LPP 241879_at 0.18 TAAACAGCCACAATCGCATTCAGTC 293
GNG11 204115_at 0.18 GGGAGAAACTGCATCCTAAGTGGAA 294
DDAH1 209094_at 0.18 TATGGTTATCCACTCTGTGTGCCAA 295
CYR61 210764_s_at 0.18 GAAATACCGGCCCAAGTACTGCGGT 296
GNG12 212294_at 0.18 GTAATAATGTCTTGTTTTTAGCCAT 297
TSPAN6 209109_s_at 0.18 ATTTCCTTTGGAGTTGCTTGCTTCC 298
LIMCH1 212327_at 0.18 TCCAAAAGCTAGTCCCTACTCTTTA 299
SFN 33323_r_at 0.18 CCATGTTTCCTCTCAATAAAGTTCC 300
TABLE 4
Biomarkers of resistance to irofulven. Dashes indicate that the Affymetrix
probeset has not been mapped to a specific gene. Affymetrix IDs refer to
the array type HG-U133_Plus_2.
Affymetrix
Probe
Gene Affymetrix ID Correlation Affymetrix Probe Sequence SEQ ID NO:
IGLC1 214677_x_at −0.31 AAGTCCCACAGAAGCTACAGCTGCC 301
IGLC1 209138_x_at −0.29 AAGACAGTGGCCCCTACAGAATGTT 302
CYAT1 215121_x_at −0.28 GAGCCGTGACAGTGGCCTGGAAGGC 303
IGLC1
IGLV1-44
LAPTM5 201721_s_at −0.26 AAAACAGTCCCTTCAAACACACAAT 304
ARHGDIB 201288_at −0.25 GTCTCCATCTCAGTACACAATCATT 305
IGLV1-44 215379_x_at −0.25 CTCCTCTGAGGAGCTTCAAGCCAAC 306
SLC43A3 213113_s_at −0.24 CGAAGCCTATATGTGCCTGGATCCT 307
LCP1 208885_at −0.24 TAAGCATCCTTAGGGTTCTGCCTCT 308
HCLS1 202957_at −0.22 CTGTCTACTGCAACTGTGATTTCCC 309
CD53 203416_at −0.22 AAAGGGCAAGATCTCATTTCAATTT 310
ARHGDIB 1555812_a_at −0.22 CTGTGGTGACAGATCCGAAAGCCCC 311
SLC43A3 210692_s_at −0.21 TCATCCTGCAAGTGATCAGCCGCTC 312
MZB1 221286_s_at −0.21 TAAAACCCAGTGACCTCACTTCTTT 313
RASSF5 223322_at −0.21 TGCTGCAACCGCTGTGAATGCTGCT 314
FAM46C 226811_at −0.2 TGTTCTATATTTGCATAGCCTTTGA 315
RCSD1 225763_at −0.2 CAAAAAGGCCTTATGTCACCACTGG 316
IGJ 212592_at −0.2 ATAGGTCAATTATATGTCTCCATTA 317
IGLC1 217148_x_at −0.19 TAATCGGCCCTCAGGGGTTTCTAAT 318
IGLJ3
IGLV2-14
IGLV@
LPXN 216250_s_at −0.19 TTTCACCTCTAGTGATGGCCCTACT 319
ITGB7 205718_at −0.19 TGCAAAGAGCGGACCCTGGACAACC 320
GTSF1 227711_at −0.19 AACTGACAAGCACACTTTTTTCCTC 321
IGLL3P 215946_x_at −0.19 GTGGCCCCTGCAGAATGTTCATAGG 322
ICAM2 213620_s_at −0.19 TAGTCACGGTGGTGTCGGTGTTGCT 323
PRSS2 205402_x_at −0.18 GAGAGCACAACATCGAAGTCCTGGA 324
MZB1 223565_at −0.18 TACACGATGTCCTGGACCGGAGCTG 325
IFITM1 214022_s_at −0.18 CAACCTTTGCACTCCACTGTGCAAT 326
IKZF1 227346_at −0.18 TGCAGTCATATTTCCAGTCTGCCTC 327
CELF2 202157_s_at −0.18 GTCACCTTTTGCTGAACTCACAGTT 328
RAC2 213603_s_at −0.18 GCCAGATGGTTGCTGCCACAACTTG 329
IFITM1 201601_x_at −0.18 ACCCTCTTCTTGAACTGGTGCTGTC 330
IFITM2
PVALB 205336_at −0.18 GATGTCGATGACAGACTTGCTGAAC 331
CYFIP2 215785_s_at −0.18 CAGCCTGCCATAGGATCCAACTGGA 332
CDK6 224847_at −0.18 GTGTTTCTGTTGCAGTGGCAAAGGT 333
MYB 204798_at −0.18 AAGCATGCGTTGCACTTCTTTTTTG 334
TCF4 212386_at −0.18 GTCTAGTGCTCTTTTGCTATAAAAT 335
CCND2 200953_s_at −0.17 TATGTTCATCACCCTTATATCATGT 336
PPM1K 235061_at −0.17 AAGACTCTTAGGCAGCTATGGGTTT 337
LAPTM5 201_720_s_at −0.17 TGTTCAAGTGCGTGTGGCGGTGCTA 338
CDK6 224851_at −0.17 GCTTCAGGCAACTTAGCTGTGTACA 339
IFI16 208966_x_at −0.17 GACATACTCAATCCTGATTCCAAGT 340
IFI16 206332_s_at −0.17 AGAAAGACATACTCAATCCTGATTC 341
EVI2A 204774_at −0.17 ACACCAGCTTATCAACCAACACAGC 342
CDK6 224848_at −0.17 GGGTGCATGTTCCTTAAAGGTGCAT 343
CORO1A 209083_at −0.17 GCTCCAGAAGCGCTTGGACAGGCTG 344
LINC00341 219563_at −0.17 GAGGGACCATATCTACTCTTGTCAT 345
SYNE3
LOC101928620 205267_at −0.16 GCAGGTGTGCTTAGCTCTTGATAGT 346
POU2AF1
CX3CR1 205898_at −0.16 GAAAATACCCCATCATTCATGCTAC 347
DOCK2 213160_at −0.16 GAAGGCAAACAGATCCCAGACTCGC 348
WIPF1 202664_at −0.16 GGTAGAGACTACCCTAGACATCTGC 349
TCF4 213891_s_at −0.16 AGGTTGTGTGCTGGAGTTCCTTCAA 350
ST3GAL6 210942_s_at −0.16 ACAGGAATTATTGCCATCACATTGG 351
GLYR1 212414_s_at −0.16 CAGTGTAGATGGCTCTTGTTTTTGT 352
SEPT6
TRBC1 211796_s_at −0.16 CAATGACTCCAGATACTGCCTGAGC 353
AZGP1 209309_at −0.16 AAAAAATCATCTCACCTTGAGCCCA 354
LY96 206584_at −0.16 ATCTCTATATAACTGTCAACACCAT 355
GIMAP2 232024_at −0.16 TGTTTTGTTGCTTACTCTTTAGTAT 356
HERC5 219863_at −0.16 ACATCATATTCCTTACCTCTTTTGG 357
IGLL5 217235_x_at −0.15 GGCTCCAGGCTGAGGATGAGGCTGA 358
ST3GAL6 213355_at −0.15 GGCTCTGGAAATCTAAGTTCATACT 359
ICAM3 204949_at −0.15 TGGTACTTATCAGTGCCAAGCGTCC 360
LCP2 205269_at −0.15 TGTTTTTTACAGCCAAACCTCTGTC 361
NCKAP1L 238668_at −0.15 GAATAGTTGTCTTTTGAGCCTCAGA 362
P2RY8 229686_at −0.15 TTGAGTCCGGGTGTTCAAGGGCCAA 363
CCR1 205098_at −0.15 CCAAGGACCCCTTATTTATCATGCC 364
GMFG 204220_at −0.15 AGCTGAGGAAATTCCGCTTCCGAAA 365
EVI2B 211742_s_at −0.15 TCCATCCTCAAATGACTCTTTTTTC 366
— 229670_at −0.15 GTGAAATCAGGGTGCTGTTACCAAA 367
BCL2 203685_at −0.15 GATGGAAAGGCTCGCTCAATCAAGA 368
RAC2 207419_s_at −0.15 ATCCACAGACGGACGTCTTCCTCAT 369
IQGAP2 203474_at −0.15 TACTGCCTCATGTAAAGACTCTTGC 370
IFI16 208965_s_at −0.15 ACTTCATTTTCTTAGCGTTTCTGGA 371
PPM1K 226773_at −0.15 CTGATGTGTCCCCAAACTGATTTAA 372
LEF1 221558_s_at −0.15 TGTAACACATAGTGGCTTCTCCGCC 373
SLC1A4 209610_s_at −0.15 GCTAACCCAGTATGTTCTTCTTTTT 374
CD38 205692_s_at −0.15 CTCCTTGACTCCTTGTGGTTTATGT 375
ALDH1A2 207016_s_at −0.15 TGAGCCCTGACAGATGCCGTATTTC 376
LOC101928635
SSBP2 203787_at −0.15 ACATTGACCCACAGGACATTGTAAA 377
PTPRC 212588_at −0.15 GCATTTAGTCCAATGTCTTTTTAAG 378
ERN1 227755_at −0.15 AGAAAGCATTACCAGTCACCTACTC 379
IRF4 204562_at −0.14 TGTGGGAGTCTTGGGTACTCGCACC 380
RHOH 204951_at −0.14 CCTCCTGCGTCAATGCCATGGAAGG 381
FAM26F 229390_at −0.14 ATACGGTGATTCCTGTTCTTGGCTT 382
IGK IGKC 224795_x_at −0.14 CTCGCCCGTCACAAAGAGCTTCAAC 383
PTPRC 207238_s_at −0.14 AATGAGGAAACTCCAAACCTCCTGT 384
TCF4 222146_s_at −0.14 TATCTTAAACCCACATAAACACTTC 385
RASSF5 1554834_a_at −0.14 AGCACATTCCTTTTGCAGGTCTGAG 386
ARHGAP15 218870_at −0.14 ACGTTGTCACCGGAGCACTGAAGAT 387
LOC101928361
— 236191_at −0.14 GGAACACATTAGTCTATGGGACCTT 388
MAF 209348_s_at −0.14 GTATTTGGGACTGAATTGCACTAAG 389
CD8B 215332_s_at −0.14 TGTCCCCCTTGTGGAACCAAATGTA 390
LOC100996919
ATF3 202672_s_at −0.14 GAATTCTCCCAGCGTTAACACAAAA 391
CD3D 213539_at −0.14 TGCTCAGTACAGCCACCTTGGAGGA 392
SLC1A4 212811_x_at −0.14 GTTTTCATGAACTAGCAACCCCACC 393
IGK IGKC 221651_x_at −0.14 CTCGCCCGTCACAAAGAGCTTCAAC 394
IGK IGKC 221671_x_at −0.14 AAATCTGGAACTGCCTCTGTTGTGT 395
SAMSN1 220330_s_at −0.14 GTATCTCTAACATTCCAAATTACTG 396
PIM2 204269_at −0.14 CCCTAGCCTAGGGTCCCATATTGGG 397
DOCK8 225502_at −0.14 GTAATGGTGGACTAATTGCTGTATA 398
TCF4 203753_at −0.14 GTGCAACTTGAGGGACGACTTTCTT 399
PTPN7 204852_s_at −0.14 TCATCCATCTCAGCATCAACACAAT 400
Example 3
Predicting Responsiveness to Irofulven in Various Cancer Patient Populations
An mRNA-based predictor of responsiveness to irofulven developed according to the methods of the invention was applied to 3,522 patients having a variety of cancers. Each patient had a pre-treatment measurement of gene expression with an Affymetrix array. The predicted irofulven sensitivity of each patient was calculated as the difference between the mean of the expression levels of the biomarkers of sensitivity and the mean of the expression levels of the biomarkers of resistance for the patient. When the patients were grouped by cancer types, and cancer types predicted to be more responsive to irofulven were identified (FIG. 1).
Of 27 different cancer types, solid tumor cancers were predicted to be more responsive to irofulven treatment than hematological cancers. In particular, patients with prostate cancer, ovarian cancer, hepatocellular carcinoma (HCC), breast cancer, cervical cancer, renal cell carcinoma (RCC), esophageal cancer, melanoma, glioma, pancreatic cancer, gastrointestinal stromal tumors (GIST), sarcoma, estrogen receptor-positive (ERpos) breast cancer, non-small cell lung carcinoma (NSCLC), colon cancer, bladder cancer, and squamous cell carcinoma of the head and neck (SCCHN) were predict to be more responsive to irofulven treatment. Patients with hematological cancer types were also predicted to be responsive to irofulven treatment, in particular, cutaneous T-cell lymphoma (CTCL), multiple myeloma, acute myelogenous leukemia (AML), acute lympho-blastic leukemia (ALL), chronic lymphocytic leukemia (CLL), myelodysplastic syndrome (MDS), chronic myelogenous leukemia-chronic phase (CMLCP), diffuse large B-cell lymphoma (DLBCL), peripheral T-cell lymphoma (PTCL), and Hodgkin's lymphoma patients were predicted to be the most responsive to irofulven.
The median of the boxplots shown in FIG. 1 is a cutoff that may be used to separate patients predicted to be responsive to irofulven treatment from patients predicted to be non-responsive to irofulven treatment for a given cancer type. Values above the median indicate patients predicted to be responsive to irofulven, while values below the median indicate patients predicted to be non-responsive to irofulven. For a test sample from an individual patient, it is useful to compare the test sample to the reference population for the same cancer type. If the test sample is above the median for the reference population of the same cancer type, then the patient is predicted to be responsive to irofulven treatment. If the test sample is below the median for the reference population of the same cancer type, then the patient is predicted to be non-responsive to irofulven treatment. This method for predicting patient responsiveness can also be used when the reference cancer population consists of only two patients: a patient responsive to irofulven treatment and a patient non-responsive to irofulven treatment.
Example 4
Predicting Responsiveness of Prostate Cancer Patients to Irofulven
The diagnostic methods of the present invention can be used to predict the responsiveness of a prostate cancer patient to treatment with irofulven. In particular, the prostate cancer patient may be one that has not previously received any cancer treatment or one that has received a cancer treatment other than irofulven. Moreover, the patient may be one diagnosed with prostate cancer or one with recurrence of prostate cancer. The patient may also have prostate cancer that is resistant to treatment, such as treatment with docetaxel, cabazitaxel, mitoxantrone, estramustine, prednisone, and/or surgery.
A biological sample (e.g., a prostate tissue sample) may be obtained from the patient through methods well known in the art. The sample may be frozen and/or prepared, e.g., by formalin fixation and paraffin embedding. In particular, mRNA can be isolated from the sample and a gene expression profile can be determined, e.g., using a microarray platform, such as the Affymetrix HG-U133A or HG-U133_Plus_2 array, for one or more of the biomarkers shown in Tables 1-4. One or more of the biomarkers shown in Tables 1-4 can also be measured, e.g., by sequencing or PCR-based techniques, such as those described herein.
For example, the expression level of one or more biomarkers of sensitivity to irofulven can be determined in the sample from the patient, such as one or more of ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), ID1 (SEQ ID NO: 217), and GJA1 (SEQ ID NO: 218). In particular, the biomarker is ATP1B1 (SEQ ID NO: 201). The expression level of one or more biomarkers of resistance to irofulven can also be determined in the sample from the patient, such as one or more of IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), CD53 (SEQ ID NO: 310), MZB1 (SEQ ID NO: 313), RASSF5 (SEQ ID NO: 314 or 386), FAM46C (SEQ ID NO: 315), RCSD1 (SEQ ID NO: 316), IGJ (SEQ ID NO: 317), LPXN (SEQ ID NO: 319), ITGB7 (SEQ ID NO: 320), and GTSF1 (SEQ ID NO: 321). In particular, the biomarker is IGLC1 (SEQ ID NO: 301, 302, 303, or 318).
The prostate cancer patient may be responsive to irofulven if the expression level of one or more of the biomarkers of sensitivity is substantially similar to the expression level of the biomarkers of sensitivity in a cell or tissue known to be sensitive to irofulven. The prostate cancer patient may also be responsive to irofulven if the expression level of one or more of the biomarkers of resistance is substantially dissimilar to the expression level of the biomarkers of resistance in a cell or tissue known to be resistant to irofulven. If the patient is predicted to be responsive, then the patient can be administered irofulven, such as irofulven administered intravenously at a dose of about 0.05 mg/kg to 5 mg/kg (e.g., about 0.1 mg/kg to 1 mg/kg, such as about 0.45 mg/kg). Conversely, if the patient is predicted to be non-responsive to irofulven treatment, then the patient can be administered one or more therapies other than irofulven, such as radiation or a therapeutic agent (e.g., docetaxel, cabazitaxel, mitoxantrone, estramustine, prednisone, and/or another therapeutic agent described herein).
Example 5
Predicting Responsiveness of Ovarian Cancer Patients to Irofulven
The diagnostic methods of the present invention can be used to predict the responsiveness of an ovarian cancer patient to treatment with irofulven. In particular, the ovarian cancer patient may be one that has not previously received any cancer treatment or one that has received a cancer treatment other than irofulven. Moreover, the patient may be one diagnosed with ovarian cancer or one with recurrence of ovarian cancer. The patient may also have ovarian cancer that is resistant to treatment, such as treatment with docetaxel, carboplatin, bevacizumab, paclitaxel, gemcitabine, doxorubicin, topotecan, etoposide, tamoxifen, and/or letrozole.
A biological sample (e.g., an ovarian tissue sample) may be obtained from the patient through methods well known in the art. The sample may be frozen and/or prepared, e.g., by formalin fixation and paraffin embedding. In particular, mRNA can be isolated from the sample and a gene expression profile can be determined, e.g., using a microarray platform, such as the Affymetrix HG-U133A or HG-U133_Plus_2 array, for one or more of the biomarkers shown in Tables 1-4. One or more of the biomarkers shown in Tables 1-4 can also be measured, e.g., by sequencing or PCR-based techniques, such as those described herein.
For example, the expression level of one or more biomarkers of sensitivity to irofulven can be determined in the sample from the patient, such as one or more of ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), ID1 (SEQ ID NO: 217), and GJA1 (SEQ ID NO: 218). In particular, the biomarker is ATP1B1 (SEQ ID NO: 201). The expression level of one or more biomarkers of resistance to irofulven can also be determined in the sample from the patient, such as one or more of IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), CD53 (SEQ ID NO: 310), MZB1 (SEQ ID NO: 313), RASSF5 (SEQ ID NO: 314 or 386), FAM46C (SEQ ID NO: 315), RCSD1 (SEQ ID NO: 316), IGJ (SEQ ID NO: 317), LPXN (SEQ ID NO: 319), ITGB7 (SEQ ID NO: 320), and GTSF1 (SEQ ID NO: 321). In particular, the biomarker is IGLC1 (SEQ ID NO: 301, 302, 303, or 318).
The ovarian cancer patient may be responsive to irofulven if the expression level of one or more of the biomarkers of sensitivity is substantially similar to the expression level of the biomarkers of sensitivity in a cell or tissue known to be sensitive to irofulven. The ovarian cancer patient may also be responsive to irofulven if the expression level of one or more of the biomarkers of resistance is substantially dissimilar to the expression level of the biomarkers of resistance in a cell or tissue known to be resistant to irofulven. If the patient is predicted to be responsive, then the patient can be administered irofulven, such as irofulven administered intravenously at a dose of about 0.05 mg/kg to 5 mg/kg (e.g., about 0.1 mg/kg to 1 mg/kg, such as about 0.45 mg/kg). Conversely, if the patient is predicted to be non-responsive to irofulven treatment, then the patient can be administered one or more therapies other than irofulven, such as radiation or a therapeutic agent (e.g., docetaxel, carboplatin, bevacizumab, paclitaxel, gemcitabine, doxorubicin, topotecan, etoposide, tamoxifen, letrozole, and/or another therapeutic agent described herein).
Example 6
Predicting Responsiveness of Hepatocellular Carcinoma (HCC) Patients to Irofulven
The diagnostic methods of the present invention can be used to predict the responsiveness of a hepatocellular carcinoma (HCC) patient to treatment with irofulven. In particular, the HCC patient may be one that has not previously received any cancer treatment or one that has received a cancer treatment other than irofulven. Moreover, the patient may be one diagnosed with HCC or one with recurrence of HCC. The patient may also have HCC that is resistant to treatment, such as treatment with sorafenib, doxorubicin, cisplatin, fluorouracil, gemcitabine, capecitabine, oxaliplatin, interferon-alpha, and/or 5-fluorouracil (5-FU).
A biological sample (e.g., a liver tissue sample) may be obtained from the patient through methods well known in the art. The sample may be frozen and/or prepared, e.g., by formalin fixation and paraffin embedding. In particular, mRNA can be isolated from the sample and a gene expression profile can be determined, e.g., using a microarray platform, such as the Affymetrix HG-U133A or HG-U133_Plus_2 array, for one or more of the biomarkers shown in Tables 1-4. One or more of the biomarkers shown in Tables 1-4 can also be measured, e.g., by sequencing or PCR-based techniques, such as those described herein.
For example, the expression level of one or more biomarkers of sensitivity to irofulven can be determined in the sample from the patient, such as one or more of ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), ID1 (SEQ ID NO: 217), and GJA1 (SEQ ID NO: 218). In particular, the biomarker is ATP1B1 (SEQ ID NO: 201). The expression level of one or more biomarkers of resistance to irofulven can also be determined in the sample from the patient, such as one or more of IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), CD53 (SEQ ID NO: 310), MZB1 (SEQ ID NO: 313), RASSF5 (SEQ ID NO: 314 or 386), FAM46C (SEQ ID NO: 315), RCSD1 (SEQ ID NO: 316), IGJ (SEQ ID NO: 317), LPXN (SEQ ID NO: 319), ITGB7 (SEQ ID NO: 320), and GTSF1 (SEQ ID NO: 321). In particular, the biomarker is IGLC1 (SEQ ID NO: 301, 302, 303, or 318).
The HCC patient may be responsive to irofulven if the expression level of one or more of the biomarkers of sensitivity is substantially similar to the expression level of the biomarkers of sensitivity in a cell or tissue known to be sensitive to irofulven. The HCC patient may also be responsive to irofulven if the expression level of one or more of the biomarkers of resistance is substantially dissimilar to the expression level of the biomarkers of resistance in a cell or tissue known to be resistant to irofulven. If the patient is predicted to be responsive, then the patient can be administered irofulven, such as irofulven administered intravenously at a dose of about 0.05 mg/kg to 5 mg/kg (e.g., about 0.1 mg/kg to 1 mg/kg, such as about 0.45 mg/kg). Conversely, if the patient is predicted to be non-responsive to irofulven treatment, then the patient can be administered one or more therapies other than irofulven, such as radiation or a therapeutic agent (e.g., docetaxel, carboplatin, bevacizumab, paclitaxel, gemcitabine, doxorubicin, topotecan, etoposide, tamoxifen, letrozole, and/or another therapeutic agent described herein).
OTHER EMBODIMENTS
All publications, patents, and patent applications mentioned in the above specification are hereby incorporated by reference. Various modifications and variations of the described device and methods of use of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention that are obvious to those skilled in the art are intended to be within the scope of the invention. For example, it is anticipated that measuring the level of proteins, metabolites, identifying genetic mutations and DNA copy number variations, all will be useful in determining patient responsiveness.

Claims (20)

The invention claimed is:
1. A method of determining irofulven sensitivity in a patient by detecting expression of a biomarker in the patient with a cancer that is resistant to one or more cancer therapies other than irofulven comprising:
(a) isolating nucleic acid molecules obtained from a sample from the patient: and
(b) measuring in the sample:
i) the level of expression of one or more biomarkers of irofulven sensitivity selected from the biomarkers of Tables 1 and 3; and/or
ii) the level of expression of one or more biomarkers of irofulven resistance selected from the biomarkers of Tables 2 and 4; and
(c) determining irofulven sensitivity in the patient based on the level of expression of the one or more biomarkers of irofulven sensitivity and/or the one or more biomarkers of irofulven resistance.
2. A method of determining responsiveness of a cancer in a patient having cancer to irofulven comprising:
(a) contacting one or more nucleic acid molecules obtained from a sample from the patient with a device comprising:
i) one or more single-stranded nucleic acid molecules capable of specifically hybridizing with the nucleotides of one or more biomarkers of irofulven sensitivity selected from the biomarkers of Tables 1 and 3; and/or
ii) one or more single-stranded nucleic acid molecules capable of specifically hybridizing with the nucleotides of one or more biomarkers of irofulven resistance selected from the biomarkers of Tables 2 and 4;
(b) measuring hybridization, or an amplification product resulting from hybridization, between the one or more nucleic acid molecules from the patient and the single-stranded nucleic acid molecules of the device to detect a level of expression of one or more of the biomarkers of irofulven sensitivity and/or one or more of the biomarkers of irofulven resistance; and
(c) determining irofulven sensitivity in the patient based on the level of expression of the one or more biomarkers of irofulven sensitivity and/or the one or more biomarkers of irofulven resistance.
3. The method of claim 1, wherein one or more of the cancer therapies comprises surgery, radiation, or a therapeutic agent.
4. The method of claim 2, wherein the patient is resistant to one or more cancer therapies other than irofulven, wherein one or more of the cancer therapies comprises surgery, radiation, or a therapeutic agent.
5. The method of claim 1, wherein the biomarker of sensitivity is selected from one or more of ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), ID1 (SEQ ID NO: 217), and GJA1 (SEQ ID NO: 218) and/or the biomarker of resistance is selected from one or more of IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), CD53 (SEQ ID NO: 310), MZB1 (SEQ ID NO: 313), RASSF5 (SEQ ID NO: 314 or 386), FAM46C (SEQ ID NO: 315), RCSD1 (SEQ ID NO: 316), IGJ (SEQ ID NO: 317), LPXN (SEQ ID NO: 319), ITGB7 (SEQ ID NO: 320), and GTSF1 (SEQ ID NO: 321).
6. The method of claim 2, wherein the biomarker of sensitivity is selected from one or more of ATP1B1 (SEQ ID NO: 201 or 219), UCHL1 (SEQ ID NO: 202), PTGR1 (SEQ ID NO: 203 or 210), NME7 (SEQ ID NO: 204), PLS3 (SEQ ID NO: 205), S100A10 (SEQ ID NO: 206), CD24 (SEQ ID NO: 207, 209, or 220), NQO1 (SEQ ID NO: 208 or 216), MYOF (SEQ ID NO: 211), LAPTM4B (SEQ ID NO: 212), CALD1 (SEQ ID NO: 213), PDGFC (SEQ ID NO: 214), BASP1 (SEQ ID NO: 215), ID1 (SEQ ID NO: 217), and GJA1 (SEQ ID NO: 218) and/or the biomarker of resistance is selected from one or more of IGLC1 (SEQ ID NO: 301, 302, 303, or 318), LAPTM5 (SEQ ID NO: 304 or 338), ARHGDIB (SEQ ID NO: 305 or 311), SLC43A3 (SEQ ID NO: 307), LCP1 (SEQ ID NO: 308), HCLS1 (SEQ ID NO: 309), CD53 (SEQ ID NO: 310), MZB1 (SEQ ID NO: 313), RASSF5 (SEQ ID NO: 314 or 386), FAM46C (SEQ ID NO: 315), RCSD1 (SEQ ID NO: 316), IGJ (SEQ ID NO: 317), LPXN (SEQ ID NO: 319), ITGB7 (SEQ ID NO: 320), and GTSF1 (SEQ ID NO: 321).
7. The method of claim 1, wherein the method is performed using a device.
8. The method of claim 2, wherein the device is a microarray.
9. The method of claim 1, wherein the method comprises performing an assay selected from the group consisting of microarray, quantitative reverse transcriptase polymerase chain reaction (qRT-PCR), RNA-seq, and Nanostring analysis.
10. The method of claim 2, wherein the method comprises performing an assay selected from the group consisting of microarray, quantitative reverse transcriptase polymerase chain reaction (qRT-PCR), RNA-seq, and Nanostring analysis.
11. The method of claim 1, wherein the level of expression of one or more of the biomarkers of sensitivity and/or one or more of the biomarkers of resistance is determined by detecting the level of mRNA transcribed from one or more genes encoding one or more of the biomarkers of Tables 1-4.
12. The method of claim 2, wherein the level of expression of one or more of the biomarkers of sensitivity and/or one or more of the biomarkers of resistance is determined by detecting the level of mRNA transcribed from one or more genes encoding one or more of the biomarkers of Tables 1-4.
13. The method of claim 1, wherein the cancer is selected from a solid tumor cancer and a hematological cancer and/or wherein the cancer is selected from the group consisting of prostate cancer, ovarian cancer, hepatocellular carcinoma (HCC), cervical cancer, renal cell carcinoma (RCC), esophageal cancer, melanoma, glioma, pancreatic cancer, gastrointestinal stromal tumors (GIST), sarcoma, estrogen receptor-positive (ERpos) breast cancer, non-small cell lung carcinoma (NSCLC), colon cancer, bladder cancer, squamous cell carcinoma of the head and neck (SCCHN), acute myelogenous leukemia (AML), acute lympho-blastic leukemia (ALL), chronic lymphocytic leukemia (CLL), myelodysplastic syndrome (MDS), chronic myelogenous leukemia—chronic phase (CMLCP), diffuse large B-cell lymphoma (DLBCL), cutaneous T-cell lymphoma (CTCL), peripheral T-cell lymphoma (PTCL), and Hodgkin's lymphoma.
14. The method of claim 2, wherein the cancer is selected from a solid tumor cancer and a hematological cancer and/or wherein the cancer is selected from the group consisting of prostate cancer, ovarian cancer, hepatocellular carcinoma (HCC), cervical cancer, renal cell carcinoma (RCC), esophageal cancer, melanoma, glioma, pancreatic cancer, gastrointestinal stromal tumors (GIST), sarcoma, estrogen receptor-positive (ERpos) breast cancer, non-small cell lung carcinoma (NSCLC), colon cancer, bladder cancer, squamous cell carcinoma of the head and neck (SCCHN), acute myelogenous leukemia (AML), acute lympho-blastic leukemia (ALL), chronic lymphocytic leukemia (CLL), myelodysplastic syndrome (MDS), chronic myelogenous leukemia—chronic phase (CMLCP), diffuse large B-cell lymphoma (DLBCL), cutaneous T-cell lymphoma (CTCL), peripheral T-cell lymphoma (PTCL), and Hodgkin's lymphoma.
15. The method of claim 1, wherein: (a) the sample from the patient is a tumor sample; (b) the patient exhibits cancer relapse after treatment with a therapeutic agent other than irofulven; (c) the patient exhibits cancer relapse prior to treatment with irofulven; or (d) the patient has not been administered a treatment for cancer.
16. The method of claim 2, wherein: (a) the sample from the patient is a tumor sample; (b) the patient exhibits cancer relapse after treatment with a therapeutic agent other than irofulven; (c) the patient exhibits cancer relapse prior to treatment with irofulven; or (d) the patient has not been administered a treatment for cancer.
17. The method of claim 1, wherein the biomarker of sensitivity is ATP1B1 (SEQ ID NO: 201 or 219) and/or the biomarker of resistance is IGLC1 (SEQ ID NO: 301, 302, 303, or 318).
18. The method of claim 17, wherein the biomarker of sensitivity is ATP1B1 (SEQ ID NO: 201 or 219) and the biomarker of resistance is IGLC1 (SEQ ID NO: 301, 302, 303, or 318).
19. The method of claim 2, wherein the biomarker of sensitivity is ATP1B1 (SEQ ID NO: 201 or 219) and/or the biomarker of resistance is IGLC1 (SEQ ID NO: 301, 302, 303, or 318).
20. The method of claim 19, wherein the biomarker of sensitivity is ATP1B1 (SEQ ID NO: 201 or 219) and the biomarker of resistance is IGLC1 (SEQ ID NO: 301, 302, 303, or 318).
US16/927,725 2016-10-07 2020-07-13 Methods for predicting drug responsiveness in cancer patients Active US11421284B2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US16/927,725 US11421284B2 (en) 2016-10-07 2020-07-13 Methods for predicting drug responsiveness in cancer patients

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US15/289,026 US9725769B1 (en) 2016-10-07 2016-10-07 Methods for predicting drug responsiveness in cancer patients
US15/647,464 US20180100197A1 (en) 2016-10-07 2017-07-12 Methods for predicting drug responsiveness in cancer patients
US16/927,725 US11421284B2 (en) 2016-10-07 2020-07-13 Methods for predicting drug responsiveness in cancer patients

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US15/647,464 Continuation US20180100197A1 (en) 2016-10-07 2017-07-12 Methods for predicting drug responsiveness in cancer patients

Publications (2)

Publication Number Publication Date
US20200340067A1 US20200340067A1 (en) 2020-10-29
US11421284B2 true US11421284B2 (en) 2022-08-23

Family

ID=59411071

Family Applications (3)

Application Number Title Priority Date Filing Date
US15/289,026 Active US9725769B1 (en) 2016-10-07 2016-10-07 Methods for predicting drug responsiveness in cancer patients
US15/647,464 Abandoned US20180100197A1 (en) 2016-10-07 2017-07-12 Methods for predicting drug responsiveness in cancer patients
US16/927,725 Active US11421284B2 (en) 2016-10-07 2020-07-13 Methods for predicting drug responsiveness in cancer patients

Family Applications Before (2)

Application Number Title Priority Date Filing Date
US15/289,026 Active US9725769B1 (en) 2016-10-07 2016-10-07 Methods for predicting drug responsiveness in cancer patients
US15/647,464 Abandoned US20180100197A1 (en) 2016-10-07 2017-07-12 Methods for predicting drug responsiveness in cancer patients

Country Status (1)

Country Link
US (3) US9725769B1 (en)

Families Citing this family (28)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DK177532B1 (en) 2009-09-17 2013-09-08 Bio Bedst Aps Medical use of sPLA2 hydrolysable liposomes
US11135182B2 (en) 2014-04-10 2021-10-05 Af Chemicals, Llc Affinity medicant conjugates
US10570457B2 (en) 2014-09-26 2020-02-25 Medical Prognosis Institute A/S Methods for predicting drug responsiveness
US20210215711A1 (en) 2016-02-08 2021-07-15 Somalogic, Inc. Nonalcoholic Fatty Liver Disease (NAFLD) and Nonalcoholic Steatohepatitis (NASH) Biomarkers and Uses Thereof
US9725769B1 (en) 2016-10-07 2017-08-08 Oncology Venture ApS Methods for predicting drug responsiveness in cancer patients
AU2017258901A1 (en) 2016-12-30 2018-07-19 Allarity Therapeutics Europe ApS Methods for predicting drug responsiveness in cancer patients
AU2018202878A1 (en) 2017-05-16 2018-12-06 Allarity Therapeutics Europe ApS Methods for predicting drug responsiveness in cancer patients
CN108310383A (en) * 2018-01-16 2018-07-24 重庆医科大学 Purposes of the NQO1 inhibitor in preparing cancer treatment drug
JP7489966B2 (en) * 2018-09-04 2024-05-24 ランタン ファルマ インコーポレイテッド Illudin analogues, their uses, and methods for synthesizing them
US20210230662A1 (en) * 2018-10-14 2021-07-29 Lantern Pharma Inc. Methods for the Treatment of Solid Tumor Cancers Using Illudins and Biomarkers
CA3116552A1 (en) * 2018-10-14 2020-04-23 Lantern Pharma Inc. Methods for the treatment of solid tumor cancers using illudins and biomarkers
WO2020092528A1 (en) 2018-10-31 2020-05-07 Gilead Sciences, Inc. Substituted 6-azabenzimidazole compounds having hpk1 inhibitory activity
PE20211655A1 (en) 2018-10-31 2021-08-24 Gilead Sciences Inc 6-AZABENZIMIDAZOLE COMPOUNDS SUBSTITUTED AS HPK1 INHIBITORS
EP3667323B1 (en) 2018-12-11 2024-11-13 AF Chemical LLC Methods, compositions and devices for treating cancer with illudofulvenes
MX2021008918A (en) 2019-01-31 2021-08-24 Ionis Pharmaceuticals Inc Modulators of yap1 expression.
TWI826690B (en) 2019-05-23 2023-12-21 美商基利科學股份有限公司 Substituted eneoxindoles and uses thereof
US11591295B2 (en) 2019-11-25 2023-02-28 Af Chemicals Llc Affinity illudofulvene conjugates
EP4103948A1 (en) * 2020-02-10 2022-12-21 SomaLogic Operating Co., Inc. Nonalcoholic steatohepatitis (nash) biomarkers and uses thereof
US20230128143A1 (en) * 2020-03-25 2023-04-27 The Children's Medical Center Corporation Method for treating cancer
CA3178039A1 (en) * 2020-05-08 2021-11-11 Lantern Pharma Inc. Method for treating pancreatic cancer
CA3199512A1 (en) * 2020-11-18 2022-05-27 Kishor Bhatia Cancer drug sensitivity determining markers
EP4274662A4 (en) * 2021-01-08 2024-11-27 Lantern Pharma Inc. TREATMENT OF BRAIN METASTASES AND CENTRAL NERVOUS SYSTEM METASTASES WITH ILLUDINS OR HYDROXYLUREA METHYL ACYLFULVENE
CN112852964B (en) * 2021-03-08 2022-02-11 镇江市第一人民医院 Circular RNA hsa _ circ _0059707, specific amplification primer thereof and application
KR20230170695A (en) * 2021-04-12 2023-12-19 랜턴 파마 인코포레이티드 Methods of treating lung cancer and non-small cell lung cancer
KR20240073856A (en) * 2021-07-29 2024-05-27 랜턴 파마 인코포레이티드 Treatment of cancer using a combination of spironolactone and acylfulvene
MX2024006078A (en) * 2021-11-18 2024-08-09 Lantern Pharma Inc Method for treating cancer with acylfulvene and radiation.
EP4541425A3 (en) * 2022-06-07 2025-05-21 Lantern Pharma Inc. Treating cancers with combinations of acylfulvenes with ibrutinib or bortezomib
CN117887844B (en) * 2023-12-28 2024-08-23 中山大学附属第一医院 Application of USP20 in liver cancer radiotherapy sensitization

Citations (65)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000026247A2 (en) 1998-11-05 2000-05-11 Parker Hughes Institute Ikaros isoforms and mutants
WO2000031930A1 (en) 1998-11-25 2000-06-02 British Telecommunications Public Limited Company Messaging platform
WO2000035473A2 (en) 1998-12-18 2000-06-22 Scios Inc. Methods for detection and use of differentially expressed genes in disease states
US20010051344A1 (en) 1994-06-17 2001-12-13 Shalon Tidhar Dari Methods for constructing subarrays and uses thereof
US20020164663A1 (en) 1998-12-08 2002-11-07 Board Of Regents, The University Of Texas System Methods and compositions for detection, diagnosis and prediction of antiestrogen-resistant breast cancer
US20030017481A1 (en) 1999-04-09 2003-01-23 Whitehead Institute For Biomedical Research Methods for classifying samples and ascertaining previously unknown classes
US20030073083A1 (en) 1999-04-09 2003-04-17 Pablo Tamayo Methods for predicting chemosensitivity or chemoresistance
WO2003082078A2 (en) 2002-03-28 2003-10-09 Medical College Of Ohio Method and compositions for the diagnosis and treatment of non-small cell lung cancer using gene expression profiles
CA2428112A1 (en) 2002-05-21 2003-11-21 Bayer Aktiengesellschaft Methods and compositions for the prediction, diagnosis, prognosis, prevention and treatment of malignant neoplasia
WO2003097052A2 (en) 2002-05-17 2003-11-27 Celgene Corporation Methods and compositions using immunomodulatory compounds for treatment and management of cancers and other diseases
JP2004043446A (en) 2002-05-15 2004-02-12 Schering Ag Histone deacetylase inhibitor and use thereof
US20040072722A1 (en) 2002-10-10 2004-04-15 Kornblith Paul L. Methods for assessing efficacy of chemotherapeutic agents
WO2005005601A2 (en) 2003-06-09 2005-01-20 The Regents Of The University Of Michigan Compositions and methods for treating and diagnosing cancer
WO2005014856A1 (en) 2003-08-08 2005-02-17 Canbas Co., Ltd. Sensitivity test to predict efficacy of anti-cancer therapies
WO2005047534A2 (en) 2003-10-28 2005-05-26 Bayer Healthcare Ag Methods and compositions for the response prediction of malig-nant neoplasia to treatment
US6911306B1 (en) 1999-10-18 2005-06-28 Emory University TMS1 compositions and methods of use
EP1550731A1 (en) 2003-12-30 2005-07-06 Eppendorf Array Technologies SA A method for quantitative determination of multi-drug resistance in tumours
WO2005066371A2 (en) 2003-12-31 2005-07-21 The Penn State Research Foundation Methods for predicting and overcoming resistance to chemotherapy in ovarian cancer and for predicting colon cancer occurrence
WO2005087948A2 (en) 2004-03-12 2005-09-22 The Queen's University Of Belfast Cancer treatment and assays for determining resistance to platinum-based chemotherapeutic agent
WO2005094863A1 (en) 2004-03-30 2005-10-13 Den Kgl.Veterinær-Og Landbohøjskole Improvements in cancer treatment and cancer treatment efficacy prediction by blocking and decting protease inhibitors
WO2005100606A2 (en) 2004-04-09 2005-10-27 Genomic Health, Inc. Gene expression markers for predicting response to chemotherapy
US20060105360A1 (en) 2004-02-09 2006-05-18 Croce Carlo M Diagnosis and treatment of cancers with microRNA located in or near cancer associated chromosomal features
US20060121511A1 (en) 2004-11-30 2006-06-08 Hyerim Lee Biomarkers and methods for determining sensitivity to microtubule-stabilizing agents
WO2007072225A2 (en) 2005-12-01 2007-06-28 Medical Prognosis Institute Methods and devices for identifying biomarkers of treatment response and use thereof to predict treatment efficacy
US20070172844A1 (en) 2005-09-28 2007-07-26 University Of South Florida Individualized cancer treatments
WO2008073177A2 (en) 2006-09-21 2008-06-19 Nuclea Biomarkers, Llc Expression profiles associated with irinotecan treatment
WO2008073629A2 (en) 2006-11-03 2008-06-19 Board Of Regents, The University Of Texas System Bifunctional predictors of cancer treatment sensitivity and resistance
US20080227663A1 (en) 2007-01-19 2008-09-18 Biodot, Inc. Systems and methods for high speed array printing and hybridization
WO2008112283A2 (en) 2007-03-12 2008-09-18 Government Of The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Microrna profiling of androgen responsiveness for predicting the appropriate prostate cancer treatment
WO2008138578A2 (en) 2007-05-11 2008-11-20 Medical Prognosis Institute Methods, kits, and devices for identifying biomarkers of treatment response and use thereof to predict treatment efficacy
US20080306006A1 (en) 2006-01-05 2008-12-11 The Ohio State University MicroRna-Based Methods and Compositions for the Diagnosis, Prognosis and Treatment of Solid Cancers
US20090023149A1 (en) 2005-12-01 2009-01-22 Steen Knudsen Methods, kits and devices for identifying biomarkers of treatment response and use thereof to predict treatment efficacy
WO2009036332A1 (en) 2007-09-14 2009-03-19 Asuragen, Inc. Micrornas differentially expressed in cervical cancer and uses thereof
WO2009080437A1 (en) 2007-12-21 2009-07-02 Exiqon A/S Micro-rna based drug resistance analysis method
US20090221435A1 (en) 2006-02-08 2009-09-03 Dharmacon, Inc. Microarray for detecting and quantifying microrna
US20090239223A1 (en) 2006-07-13 2009-09-24 Siemens Healthcare Diagnostics Inc. Prediction of Breast Cancer Response to Taxane-Based Chemotherapy
WO2009141450A2 (en) 2008-05-23 2009-11-26 Liplasome Pharma A/S Liposomes for drug delivery and methods for preparation thereof
US7709616B2 (en) 2004-05-14 2010-05-04 Rosetta Genomics Inc. Micrornas and uses thereof
US20100240043A1 (en) 2007-10-19 2010-09-23 Cedars-Sinai Medical Center Methods of using genetic variants to diagnose and predict inflammatory bowel disease
WO2011032563A1 (en) 2009-09-17 2011-03-24 Bio-Bedst Aps Medical use of spla2 hydrolysable liposomes
CN102002490A (en) 2009-08-31 2011-04-06 上海市肿瘤研究所 9 microRNA markers for predicting whether primary liver cancer relapses
WO2011047689A2 (en) 2009-10-23 2011-04-28 Bio-Bedst Aps Liposomes with improved storage stability
US20110123990A1 (en) 2009-11-23 2011-05-26 Baker Joffre B Methods To Predict Clinical Outcome Of Cancer
WO2011098578A2 (en) 2010-02-12 2011-08-18 Bioneer A/S Liposome system for ocular administration
WO2011135459A2 (en) 2010-04-29 2011-11-03 Medical Prognosis Institute A/S Methods and devices for predicting treatment efficacy
US20120046186A1 (en) 2010-08-20 2012-02-23 Pelham Robert J Gene Expression Markers for Prediction of Response to Platinum-Based Chemotherapy Drugs
WO2012024543A1 (en) 2010-08-18 2012-02-23 Caris Life Sciences Luxembourg Holdings Circulating biomarkers for disease
WO2012106718A2 (en) 2011-02-04 2012-08-09 Bioarray Therapeutics, Inc. Methods of using gene expression signatures to select a method of treatment, predict prognosis, survival, and/or predict response to treatment
WO2012109233A2 (en) 2011-02-07 2012-08-16 Board Of Regents, The University Of Texas System Methods for predicting recurrence risk in breast cancer patients
US20120302626A1 (en) 2009-12-04 2012-11-29 Sandeep Dave Microrna and use thereof in identification of b cell malignancies
WO2012163541A1 (en) 2011-06-01 2012-12-06 Medical Prognosis Institute A/S Methods and devices for prognosis of cancer relapse
US20130059015A1 (en) 2010-03-11 2013-03-07 H. Lee Moffitt Cancer Center & Research Institute Human Cancer micro-RNA Expression Profiles Predictive of Chemo-Response
WO2013130465A2 (en) 2012-02-27 2013-09-06 Genomic Health, Inc. Gene expression markers for prediction of efficacy of platinum-based chemotherapy drugs
US20140148354A1 (en) * 2011-03-31 2014-05-29 St. Jude Children's Research Hospital Methods and compositions for identifying minimal residual disease in acute lymphoblastic leukemia
US20140236495A1 (en) * 2011-09-23 2014-08-21 Agency For Science, Technology And Research Patient stratification and determining clinical outcome for cancer patients
RU2528247C2 (en) 2013-05-07 2014-09-10 Федеральное государственное бюджетное учреждение науки институт биоорганической химии им. академиков М.М. Шемякина и Ю.А. Овчинникова Российской академии наук (ИБХ РАН) Method of evaluation of sensitivity of lung cancer cells to doxorubicin based on expression levels of marker genes and set for its implementation
US20140294730A1 (en) 2013-03-29 2014-10-02 University Of Virginia Patent Foundation Compositions and methods for diagnosing and monitoring ovarian cancer progression and treatment
WO2014195032A1 (en) 2013-06-07 2014-12-11 Medical Prognosis Institute A/S Methods and devices for predicting treatment efficacy of fulvestrant in cancer patients
WO2015135035A2 (en) * 2014-03-11 2015-09-17 The Council Of The Queensland Institute Of Medical Research Determining cancer agressiveness, prognosis and responsiveness to treatment
US20150353928A1 (en) 2011-09-14 2015-12-10 Georgetown University Genes Contributing to Survival of Cancer Cells
US20160199399A1 (en) 2015-01-09 2016-07-14 Medical Prognosis Institute A/S Methods for predicting drug responsiveness in cancer patients
US9725769B1 (en) 2016-10-07 2017-08-08 Oncology Venture ApS Methods for predicting drug responsiveness in cancer patients
US20170283884A1 (en) 2014-09-26 2017-10-05 Medical Prognosis Institute A/S Methods for predicting drug responsiveness
US20180087113A1 (en) 2016-09-27 2018-03-29 Oncology Venture ApS Methods for predicting drug responsiveness in cancer patients
US20180202004A1 (en) 2016-12-30 2018-07-19 Oncology Venture ApS Methods for predicting drug responsiveness in cancer patients

Patent Citations (77)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20010051344A1 (en) 1994-06-17 2001-12-13 Shalon Tidhar Dari Methods for constructing subarrays and uses thereof
WO2000026247A2 (en) 1998-11-05 2000-05-11 Parker Hughes Institute Ikaros isoforms and mutants
WO2000031930A1 (en) 1998-11-25 2000-06-02 British Telecommunications Public Limited Company Messaging platform
US20020164663A1 (en) 1998-12-08 2002-11-07 Board Of Regents, The University Of Texas System Methods and compositions for detection, diagnosis and prediction of antiestrogen-resistant breast cancer
WO2000035473A2 (en) 1998-12-18 2000-06-22 Scios Inc. Methods for detection and use of differentially expressed genes in disease states
US20030073083A1 (en) 1999-04-09 2003-04-17 Pablo Tamayo Methods for predicting chemosensitivity or chemoresistance
US7239986B2 (en) 1999-04-09 2007-07-03 Whitehead Institute For Biomedical Research Methods for classifying samples and ascertaining previously unknown classes
US20030017481A1 (en) 1999-04-09 2003-01-23 Whitehead Institute For Biomedical Research Methods for classifying samples and ascertaining previously unknown classes
US6911306B1 (en) 1999-10-18 2005-06-28 Emory University TMS1 compositions and methods of use
WO2003082078A2 (en) 2002-03-28 2003-10-09 Medical College Of Ohio Method and compositions for the diagnosis and treatment of non-small cell lung cancer using gene expression profiles
US20050260586A1 (en) 2002-03-28 2005-11-24 Demuth Jeffrey P Method and compositions for the diagnosis and treatment of non-small cell lung cancer using gene expression profiles
JP2004043446A (en) 2002-05-15 2004-02-12 Schering Ag Histone deacetylase inhibitor and use thereof
WO2003097052A2 (en) 2002-05-17 2003-11-27 Celgene Corporation Methods and compositions using immunomodulatory compounds for treatment and management of cancers and other diseases
US20040018525A1 (en) 2002-05-21 2004-01-29 Bayer Aktiengesellschaft Methods and compositions for the prediction, diagnosis, prognosis, prevention and treatment of malignant neoplasma
CA2428112A1 (en) 2002-05-21 2003-11-21 Bayer Aktiengesellschaft Methods and compositions for the prediction, diagnosis, prognosis, prevention and treatment of malignant neoplasia
US20040072722A1 (en) 2002-10-10 2004-04-15 Kornblith Paul L. Methods for assessing efficacy of chemotherapeutic agents
WO2005005601A2 (en) 2003-06-09 2005-01-20 The Regents Of The University Of Michigan Compositions and methods for treating and diagnosing cancer
WO2005014856A1 (en) 2003-08-08 2005-02-17 Canbas Co., Ltd. Sensitivity test to predict efficacy of anti-cancer therapies
WO2005047534A2 (en) 2003-10-28 2005-05-26 Bayer Healthcare Ag Methods and compositions for the response prediction of malig-nant neoplasia to treatment
EP1550731A1 (en) 2003-12-30 2005-07-06 Eppendorf Array Technologies SA A method for quantitative determination of multi-drug resistance in tumours
WO2005066371A2 (en) 2003-12-31 2005-07-21 The Penn State Research Foundation Methods for predicting and overcoming resistance to chemotherapy in ovarian cancer and for predicting colon cancer occurrence
US20050176669A1 (en) 2003-12-31 2005-08-11 The Penn State Research Foundation Methods for predicting and overcoming resistance to chemotherapy in ovarian cancer and for predicting colon cancer occurrence
US20060105360A1 (en) 2004-02-09 2006-05-18 Croce Carlo M Diagnosis and treatment of cancers with microRNA located in or near cancer associated chromosomal features
WO2005087948A2 (en) 2004-03-12 2005-09-22 The Queen's University Of Belfast Cancer treatment and assays for determining resistance to platinum-based chemotherapeutic agent
WO2005094863A1 (en) 2004-03-30 2005-10-13 Den Kgl.Veterinær-Og Landbohøjskole Improvements in cancer treatment and cancer treatment efficacy prediction by blocking and decting protease inhibitors
US20050260646A1 (en) 2004-04-09 2005-11-24 Genomic Health Inc. Gene expression markers for predicting response to chemotherapy
WO2005100606A2 (en) 2004-04-09 2005-10-27 Genomic Health, Inc. Gene expression markers for predicting response to chemotherapy
US7709616B2 (en) 2004-05-14 2010-05-04 Rosetta Genomics Inc. Micrornas and uses thereof
US20060121511A1 (en) 2004-11-30 2006-06-08 Hyerim Lee Biomarkers and methods for determining sensitivity to microtubule-stabilizing agents
US20070172844A1 (en) 2005-09-28 2007-07-26 University Of South Florida Individualized cancer treatments
US20090023149A1 (en) 2005-12-01 2009-01-22 Steen Knudsen Methods, kits and devices for identifying biomarkers of treatment response and use thereof to predict treatment efficacy
US8445198B2 (en) 2005-12-01 2013-05-21 Medical Prognosis Institute Methods, kits and devices for identifying biomarkers of treatment response and use thereof to predict treatment efficacy
WO2007072225A2 (en) 2005-12-01 2007-06-28 Medical Prognosis Institute Methods and devices for identifying biomarkers of treatment response and use thereof to predict treatment efficacy
US20080306006A1 (en) 2006-01-05 2008-12-11 The Ohio State University MicroRna-Based Methods and Compositions for the Diagnosis, Prognosis and Treatment of Solid Cancers
US20120214703A1 (en) 2006-01-05 2012-08-23 The Ohio State University Methods for Diagnosing Stomach Cancer Using MicroRNA Signatures
US20090221435A1 (en) 2006-02-08 2009-09-03 Dharmacon, Inc. Microarray for detecting and quantifying microrna
US20090239223A1 (en) 2006-07-13 2009-09-24 Siemens Healthcare Diagnostics Inc. Prediction of Breast Cancer Response to Taxane-Based Chemotherapy
WO2008073177A2 (en) 2006-09-21 2008-06-19 Nuclea Biomarkers, Llc Expression profiles associated with irinotecan treatment
EP2081950B1 (en) 2006-09-21 2013-03-20 Nuclea Biomarkers LLC Expression profiles associated with irinotecan treatment
WO2008073629A2 (en) 2006-11-03 2008-06-19 Board Of Regents, The University Of Texas System Bifunctional predictors of cancer treatment sensitivity and resistance
US20080227663A1 (en) 2007-01-19 2008-09-18 Biodot, Inc. Systems and methods for high speed array printing and hybridization
WO2008112283A2 (en) 2007-03-12 2008-09-18 Government Of The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Microrna profiling of androgen responsiveness for predicting the appropriate prostate cancer treatment
WO2008138578A2 (en) 2007-05-11 2008-11-20 Medical Prognosis Institute Methods, kits, and devices for identifying biomarkers of treatment response and use thereof to predict treatment efficacy
WO2009036332A1 (en) 2007-09-14 2009-03-19 Asuragen, Inc. Micrornas differentially expressed in cervical cancer and uses thereof
US20100240043A1 (en) 2007-10-19 2010-09-23 Cedars-Sinai Medical Center Methods of using genetic variants to diagnose and predict inflammatory bowel disease
WO2009080437A1 (en) 2007-12-21 2009-07-02 Exiqon A/S Micro-rna based drug resistance analysis method
WO2009141450A2 (en) 2008-05-23 2009-11-26 Liplasome Pharma A/S Liposomes for drug delivery and methods for preparation thereof
CN102002490A (en) 2009-08-31 2011-04-06 上海市肿瘤研究所 9 microRNA markers for predicting whether primary liver cancer relapses
US20120177726A1 (en) 2009-09-17 2012-07-12 Bio-Bedst Aps Medical use of spla2 hydrolysable liposomes
WO2011032563A1 (en) 2009-09-17 2011-03-24 Bio-Bedst Aps Medical use of spla2 hydrolysable liposomes
WO2011047689A2 (en) 2009-10-23 2011-04-28 Bio-Bedst Aps Liposomes with improved storage stability
US20110123990A1 (en) 2009-11-23 2011-05-26 Baker Joffre B Methods To Predict Clinical Outcome Of Cancer
US20120302626A1 (en) 2009-12-04 2012-11-29 Sandeep Dave Microrna and use thereof in identification of b cell malignancies
WO2011098578A2 (en) 2010-02-12 2011-08-18 Bioneer A/S Liposome system for ocular administration
US20130059015A1 (en) 2010-03-11 2013-03-07 H. Lee Moffitt Cancer Center & Research Institute Human Cancer micro-RNA Expression Profiles Predictive of Chemo-Response
WO2011135459A2 (en) 2010-04-29 2011-11-03 Medical Prognosis Institute A/S Methods and devices for predicting treatment efficacy
US9598734B2 (en) 2010-04-29 2017-03-21 Medical Prognosis Institute A/S Methods and devices for predicting treatment efficacy
US20130053275A1 (en) 2010-04-29 2013-02-28 Medical Prognosis Institute A/S Methods and devices for predicting treatment efficacy
WO2012024543A1 (en) 2010-08-18 2012-02-23 Caris Life Sciences Luxembourg Holdings Circulating biomarkers for disease
US20120046186A1 (en) 2010-08-20 2012-02-23 Pelham Robert J Gene Expression Markers for Prediction of Response to Platinum-Based Chemotherapy Drugs
WO2012106718A2 (en) 2011-02-04 2012-08-09 Bioarray Therapeutics, Inc. Methods of using gene expression signatures to select a method of treatment, predict prognosis, survival, and/or predict response to treatment
WO2012109233A2 (en) 2011-02-07 2012-08-16 Board Of Regents, The University Of Texas System Methods for predicting recurrence risk in breast cancer patients
US20140148354A1 (en) * 2011-03-31 2014-05-29 St. Jude Children's Research Hospital Methods and compositions for identifying minimal residual disease in acute lymphoblastic leukemia
WO2012163541A1 (en) 2011-06-01 2012-12-06 Medical Prognosis Institute A/S Methods and devices for prognosis of cancer relapse
US20150353928A1 (en) 2011-09-14 2015-12-10 Georgetown University Genes Contributing to Survival of Cancer Cells
US20140236495A1 (en) * 2011-09-23 2014-08-21 Agency For Science, Technology And Research Patient stratification and determining clinical outcome for cancer patients
WO2013130465A2 (en) 2012-02-27 2013-09-06 Genomic Health, Inc. Gene expression markers for prediction of efficacy of platinum-based chemotherapy drugs
US20140294730A1 (en) 2013-03-29 2014-10-02 University Of Virginia Patent Foundation Compositions and methods for diagnosing and monitoring ovarian cancer progression and treatment
RU2528247C2 (en) 2013-05-07 2014-09-10 Федеральное государственное бюджетное учреждение науки институт биоорганической химии им. академиков М.М. Шемякина и Ю.А. Овчинникова Российской академии наук (ИБХ РАН) Method of evaluation of sensitivity of lung cancer cells to doxorubicin based on expression levels of marker genes and set for its implementation
WO2014195032A1 (en) 2013-06-07 2014-12-11 Medical Prognosis Institute A/S Methods and devices for predicting treatment efficacy of fulvestrant in cancer patients
WO2015135035A2 (en) * 2014-03-11 2015-09-17 The Council Of The Queensland Institute Of Medical Research Determining cancer agressiveness, prognosis and responsiveness to treatment
US20170283884A1 (en) 2014-09-26 2017-10-05 Medical Prognosis Institute A/S Methods for predicting drug responsiveness
US20160199399A1 (en) 2015-01-09 2016-07-14 Medical Prognosis Institute A/S Methods for predicting drug responsiveness in cancer patients
US20180087113A1 (en) 2016-09-27 2018-03-29 Oncology Venture ApS Methods for predicting drug responsiveness in cancer patients
US9725769B1 (en) 2016-10-07 2017-08-08 Oncology Venture ApS Methods for predicting drug responsiveness in cancer patients
US20180100197A1 (en) 2016-10-07 2018-04-12 Oncology Venture ApS Methods for predicting drug responsiveness in cancer patients
US20180202004A1 (en) 2016-12-30 2018-07-19 Oncology Venture ApS Methods for predicting drug responsiveness in cancer patients

Non-Patent Citations (79)

* Cited by examiner, † Cited by third party
Title
"Oncology Venture presents LiPlaCis on AACR in New Orleans," Press release issued by Oncology Venture Sweden AB, Hoersholm, Denmark, Mar. 4, 2016 (2 pages).
Abba et al., "Gene expression signature of estrogen receptor alpha status in breast cancer," BMC Genomics. 6:37 (2005) (13 pages).
Affymetrix Expression Probeset Details for HG-U133_PLUS_2:209083_AT, <https://www.affymetrix.com/analysis/netaffx/fullrecord.affx?pk=HG-U133_PLUS_2:209083_AT>, retrieved Nov. 27, 2018 (4 pages).
Agrawal et al., "Long-term effect of fulvestrant on hormone receptors and proliferation marker in breast cancer," EJC Supplements. 8(3):111 (2010).
Arienti et al., "Activity of lipoplatin in tumor and in normal cells in vitro," Anti-Cancer Drugs. 19(10):983-990 (2008) (8 pages).
Baker, "The central role of receiver operating characteristic (ROC) curves in evaluating tests for the early detection of cancer," J Natl Cancer Inst. 95(7):511-5 (2003).
Bild et al., "Oncogenic pathway signatures in human cancers as a guide to targeted therapies," Nature. 439(7074):353-7 (2006).
Boulikas, "Clinical overview on Lipoplatin™: a successful liposomal formulation of cisplatin," Expert Opin Investig Drugs. 18(8):1197-218 (2009) (23 pages).
Buhl et al., "A genetic response profile to predict efficacy of adjuvant 5-FU in colon cancer," Ann Oncol. 25(Suppl. 4):iv167-209 (2014) (1 page).
Canadian Examination Report for Canadian Patent Application No. 2,631,236, dated Mar. 19, 2015 (6 pages).
Casagrande et al., "Preclinical Activity of the Liposomal Cisplatin Lipoplatin in Ovarian Cancer," Clin Cancer Res. 20(21):5496-5506 (2014).
Castelli et al., "In silico analysis of microRNAS targeting the HLA-G 3′ untranslated region alleles and haplotypes," Hum Immunol. 70(12):1020-5 (2009).
Chow et al., "Increased expression of annexin I is associated with drug-resistance in nasopharyngeal carcinoma and other solid tumors," Proteomics Clin Appl. 3(6):654-62 (2009).
Dahlén et al., "Activation of the GLI oncogene through fusion with the beta-actin gene (ACTB) in a group of distinctive pericytic neoplasms: pericytoma with t(7;12)," Am J Pathol. 164(5):1645-53 (2004).
De Jonge et al., "Early cessation of the clinical development of LiPlaCis, a liposomal cisplatin formulation," Eur J Cancer. 46(16):3016-3021 (2010) (6 pages).
Decision of Rejection for Japanese Application No. 2008-542865, dated Oct. 21, 2013 (11 pages).
Decision on Rejection for Chinese Application No. 200680052220.2, dated Jun. 5, 2013 (8 pages).
Di Lisio, "MicroRNA expression in B-cell lymphomas," Doctoral Thesis, Facultad de Ciencias, Departamento de Biología Molecular, Universidad Autónoma de Madrid (2012) (223 pages).
Elstrom et al., "Response to second-line therapy defines the potential for cure in patients with recurrent diffuse large B-cell lymphoma: implications for the development of novel therapeutic strategies," Clin Lymphoma Myeloma Leuk. 10(3):192-6 (2010).
Etter et al., "The combination of chemotherapy and intraperitoneal MegaFas Ligand improves treatment of ovarian carcinoma," Gynecol Oncol. 107(1):14-21 (2007).
Fournier et al., "Gene expression signature in organized and growth-arrested mammary acini predicts good outcome in breast cancer," Cancer Res. 66(14):7095-7102 (2006).
Friis-Hansen et al., "Mir-449 inhibits growth of gastric cancer cells partly by inhibiting the expression of met and amphiregulin," Gastroenterology. 136(5):A-165 (2009) (1 page).
Fumagalli et al., "Oral vinorelbine and capecitabine plus bevacizumab in recurrent inflammatory breast cancer: gene profiling and response to treatment," Thirty-Third Annual CTRC-AACR San Antonio Breast Cancer Symposium, Dec. 8-12, San Antonio, TX. Cancer Res. 70(24 Suppl.): Abstract P6-12-06 (2010) (4 pages).
Gallardo et al., "miR-34a as a prognostic marker of relapse in surgically resected non-small-cell lung cancer," Carcinogenesis. 30(11):1903-9 (2009).
Genbank Accession No. AY889152.1. Retrieved on Mar. 5, 2013 (2 pages).
GenBank Accession No. HC040507.1: Sequence 486 from Patent EP2112235, 2009 (1 page).
Gerspach et al., "Therapeutic Targeting of CD95 and the TRAIL Death Receptors," Recent Pat Anticancer Drug Discov. 6(3):294-310 (2011).
Grimm et al., "Drugs interfering with apoptosis in breast cancer," Curr Pharm Des. 17(3):272-83 (2011).
Juncker-Jensen et al., "Insulin-like growth factor binding protein 2 is a marker for antiestrogen resistant human breast cancer cell lines but is not a major growth regulator," Growth Horm IGF Res. 16(4):224-39 (2006).
Knudsen et al., "Development and validation of a gene expression score that predicts response to fulvestrant in breast cancer patients," PLoS One. 9(2):e87415 (2014) (12 pages).
Koeppel et al., "Irofulven cytotoxicity depends on transcription-coupled nucleotide excision repair and is correlated with XPG expression in solid tumor cells," Clin Cancer Res. 10(16):5604-13 (2004) (11 pages).
Koeppel et al., Irofulven cytotoxicity depends on transcription-coupled nucleotide excision repair and is correlated with XPG expression in solid tumor cells, Clin Cancer Res. Aug. 15, 2004;10(16):5604-13. *
Kornmann et al., "Thymidylate synthase and dihydropyrimidine dehydrogenase mRNA expression levels: predictors for survival in colorectal cancer patients receiving adjuvant 5-fluorouracil," Clinical Cancer Res. 9(11):4116-24 (2003).
Kuter et al., "Dose-dependent change in biomarkers during neoadjuvant endocrine therapy with fulvestrant: results from NEWEST, a randomized Phase II study," Breast Cancer Res Treat. 133(1):237-46 (2012).
Lee et al., "Cancer pharmacogenomics: powerful tools in cancer chemotherapy and drug development," Oncologist. 10(2):104-11 (2005) (9 pages).
Li et al., "Intronic microRNA: discovery and biological implications," DNA Cell Biol. 26(4):195-207 (2007).
Li et al., "Selection of optimal oligonucleotide probes for microarrays using multiple criteria, global alignment and parameter estimation," Nucleic Acids Res. 33(19):6114-23 (2005).
Liang et al., "Caspase-mediated apoptosis and caspase-independent cell death induced by irofulven in prostate cancer cells," Mol Cancer Ther. 3(11):1385-96 (2004) (13 pages).
Liang et al., "Characterization of microRNA expression profiles in normal human tissues," BMC Genomics. 8(166): (2007) (20 pages).
Liang et al., Caspase-mediated apoptosis and caspase-independent cell death induced by irofulven in prostate cancer cells, Mol Cancer Ther. Nov. 2004;3(11):1385-96. *
Liu et al., "Roles of USF, Ikaros and Sp proteins in the transcriptional regulation of the human reduced folate carrier B promoter," Biochem J. 383(Pt 2):249-57 (2004).
López et al., Chapter 11: MicroRNAs in Lymphoma, MicroRNAs in Cancer Translational Research. W.C.S. Cho (ed.), 239-67 (2011).
McCune et al., "Prognosis of hormone-dependent breast cancers: implications of the presence of dysfunctional transcriptional networks activated by insulin via the immune transcription factor T-bet," Cancer Res. 70(2):685-96 (2010).
Medinger et al., "Gene-expression Profiling in Patients with Plasma Cell Myeloma Treated with Novel Agents," Cancer Genomics Proteomics. 13(4):275-9 (2016).
Michels, "The promises and challenges of epigenetic epidemiology," Exp Gerontol. 45(4):297-301 (2010).
Mizutani et al., "Significance of orotate phosphoribosyltransferase activity in renal cell carcinoma," J Urol. 171(2 Pt 1):605-10 (2004).
Nair et al., "A simple practice guide for dose conversion between animals and human," J Basic Clin Pharm. 7(2):27-31 (2016).
Nakamura et al., "Search of a group of genes involved with sensitivity to anticancer agent Cisplatin (CDDP) using cDNA microarray," Chiba Med J. 80(2):88 (2004) (2 pages).
Narita et al., "Lower expression of activating transcription factors 3 and 4 correlates with shorter progression-free survival in multiple myeloma patients receiving bortezomib plus dexamethasone therapy," Blood Cancer J. 5:e373 (2015) (8 pages).
NCode™ Multi-Species miRNA Microarray Probe Set, Version 2.0 (Cat. # MIRMPS2-01), retrieved from <http://www.invitrogen.com/site/us/en/home/Products-and-Services/Applications/epigenetics-noncoding-rna-research/miRNA-Profiling-/miRNA-Probe-Set-Files.html> (2009) (21 pages).
Nielsen et al., "Design of oligonucleotides for microarrays and perspectives for design of multi-transcriptome arrays," Nucleic Acids Res. 31(13):3491-6 (2003).
NIH DailyMed for Fluorouracil Injection, USP, revised May 2010, retrieved Jan. 29, 2019 (2010) (8 pages).
Nikas et al., "Prognosis of treatment response (pathological complete response) in breast cancer," Biomark Insights. 7:59-70 (2012).
Ocio et al., "The Activation of Fas Receptor by APO010, a Recombinant Form of Fas Ligand, Induces In Vitro and In Vivo Antimyeloma Activity," Blood. 110(11):1515 (2007) (4 pages) (Abstract Only).
Okumura et al., "Correlation between chemosensitivity and mRNA expression level of 5-fluorouracil-related metabolic enzymes during liver metastasis of colorectal cancer," Oncol Rep. 15(4):875-82 (2006).
Ooyama et al., "Gene expression analysis using human cancer xenografts to identify novel predictive marker genes for the efficacy of 5-fluorouracil-based drugs," Cancer Sci. 97(6):510-22 (2006).
Paul et al., "Impact of miRNA deregulation on mRNA expression profiles in response to environmental toxicant, nonylphenol," Mol Cell Toxicol. 7:259-69 (2011).
Pourhassan et al., "Revisiting the use of sPLA2-sensitive liposomes in cancer therapy," J Control Release. 261:163-173 (2017).
Pradervand et al., "Concordance among digital gene expression, microarrays, and qPCR when measuring differential expression of microRNAs," Biotechniques. 48(3):219-222 (2010).
Pre-Appeal Examination Report for Japanese Application No. 2008-542865, dated Mar. 27, 2014 (6 pages).
Questioning for Japanese Application No. 2008-542865, dated Aug. 11, 2014 (8 pages).
Reid et al., "Circulating microRNAs: Association with disease and potential use as biomarkers," Grit Rev Oncol Hematol. 80(2):193-208 (2011).
Rouillard et al., "OligoArray 2.0: design of oligonucleotide probes for DNA microarrays using a thermodynamic approach," Nucleic Acids Res. 31(12):3057-62 (2003).
Senzer et al., "Irofulven demonstrates clinical activity against metastatic hormone-refractory prostate cancer in a phase 2 single-agent trial," Am J Clin Oncol. 28(1):36-42 (2005).
Senzer et al., Irofulven demonstrates clinical activity against metastatic hormone-refractory prostate cancer in a phase 2 single-agent trial, Am J Clin Oncol. Feb. 2005;28(1):36-42. *
Sezaki et al., "Over-expression of the dominant-negative isoform of Ikaros confers resistance to dexamethasone-induced and anti-IgM-induced apoptosis," Br J Haematol. 121(1):165-9 (2003) (Abstract only).
Slonim, "From patterns to pathways: gene expression data analysis comes of age," Nat Genet. 32 Suppl:502-8 (2002).
Suresh et al., "Resistance/response molecular signature for oral tongue squamous cell carcinoma," Dis Markers. 32(1):51-64 (2012).
The Japanese Journal of Urology, 94(2):159 (APP-105) (2003).
Vangsted et al., "APO010 sensitivity in relapsed multiple myeloma patients," Annals of Oncol. 27(Supplement 6): vi15-vi42 (2016) (2 pages) (Abstract only).
Van't Veer et al., "Gene expression profiling predicts clinical outcome of breast cancer," Nature. 415(6871):530-6 (2002).
Verbrugge et al., "Combining radiotherapy with APO010 in cancer treatment," Clin Cancer Res. 15(6):2031-8 (2009) (9 pages).
Wang et al., "Independent Validation of a Model Using Cell Line Chemosensitivity to Predict Response to Therapy," J Natl Cancer Inst. 105(17): 1284-91 (2013).
Woynarowska et al., "Changes in prostate-specific antigen (PSA) level correlate with growth inhibition of prostate cancer cells treated in vitro with a novel anticancer drug, irofulven," Invest New Drugs. 19(4):283-91 (2001).
Woynarowska et al., Changes in prostate-specific antigen (PSA) level correlate with growth inhibition of prostate cancer cells treated in vitro with a novel anticancer drug, irofulven, Invest New Drugs. 2001;19(4):283-91. *
Xu et al., "[Association of miRNAs expression profiles with prognosis and relapse in childhood acute lymphoblastic leukemia]," Zhonghua Xue Ye Xue Za Zhi. 32(3):178-81 (Abstract only) (2011).
Yang et al., "The role of microRNA in human lung squamous cell carcinoma," Cancer Genet Cytogenet. 200(2):127-33 (2010).
Yin, "Screening of laryngeal carcinoma multidrug resistance-associated genes and study on reversion by Chinese herbs," China Doctoral Dissertations Full-text Database, Division of Medical and Hygiene Technology. 8:E072-85 (2010) (3 pages) (Abstract only).
Zhang et al., "MicroRNA-650 targets ING4 to promote gastric cancer tumorigenicity," Biochem Biophys Res Commun. 395(2):275-280 (2010).

Also Published As

Publication number Publication date
US20200340067A1 (en) 2020-10-29
US9725769B1 (en) 2017-08-08
US20180100197A1 (en) 2018-04-12

Similar Documents

Publication Publication Date Title
US20200340067A1 (en) Methods for predicting drug responsiveness in cancer patients
US10907214B2 (en) Methods for predicting drug responsiveness in cancer patients
US10900089B2 (en) Methods for predicting drug responsiveness in cancer patients
EP3299478A1 (en) Methods for predicting drug responsiveness in cancer patients
US20230349000A1 (en) Classification and prognosis of cancer
US20190231795A1 (en) Methods for treating cancer and predicting drug responsiveness in cancer patients
JP6246845B2 (en) Methods for quantifying prostate cancer prognosis using gene expression
HK1255416A1 (en) Methods for predicting drug responsiveness in cancer patients
US11035006B2 (en) Colorectal cancer recurrence gene expression signature
EP2707506B1 (en) Method of detecting cancer through generalized loss of stability of epigenetic domains, and compositions thereof
US20210164056A1 (en) Use of metastases-specific signatures for treatment of cancer
WO2015073949A1 (en) Method of subtyping high-grade bladder cancer and uses thereof
CN112292463A (en) Method for predicting drug responsiveness in cancer patients
US20250137066A1 (en) Compostions and methods for diagnosing lung cancers using gene expression profiles
CA2989497A1 (en) Methods for diagnosis of bladder cancer
WO2022152911A1 (en) Biomarkers for breast cancer detection
HK1262015A1 (en) Methods for predicting drug responsiveness in cancer patients
HK40006425A (en) Methods for treating cancer and predicting drug responsiveness in cancer patients
HK40040922A (en) Methods for predicting drug responsiveness in cancer patients
HK40030202B (en) Methods for detection of plasma cell dyscrasia
HK40030202A (en) Methods for detection of plasma cell dyscrasia
HK1193127B (en) Evaluating response to therapy of gastroenteropancreatic neuroendocrine neoplasms (gep-nens)

Legal Events

Date Code Title Description
FEPP Fee payment procedure

Free format text: ENTITY STATUS SET TO UNDISCOUNTED (ORIGINAL EVENT CODE: BIG.); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY

FEPP Fee payment procedure

Free format text: ENTITY STATUS SET TO SMALL (ORIGINAL EVENT CODE: SMAL); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY

STPP Information on status: patent application and granting procedure in general

Free format text: APPLICATION DISPATCHED FROM PREEXAM, NOT YET DOCKETED

STPP Information on status: patent application and granting procedure in general

Free format text: DOCKETED NEW CASE - READY FOR EXAMINATION

AS Assignment

Owner name: ONCOLOGY VENTURE APS, DENMARK

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:KNUDSEN, STEEN;REEL/FRAME:056230/0439

Effective date: 20161025

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION MAILED

AS Assignment

Owner name: ONCOLOGY VENTURE PRODUCT DEVELOPMENT APS, DENMARK

Free format text: CHANGE OF NAME;ASSIGNOR:ONCOLOGY VENTURE APS;REEL/FRAME:059985/0948

Effective date: 20180817

STPP Information on status: patent application and granting procedure in general

Free format text: RESPONSE TO NON-FINAL OFFICE ACTION ENTERED AND FORWARDED TO EXAMINER

STPP Information on status: patent application and granting procedure in general

Free format text: NOTICE OF ALLOWANCE MAILED -- APPLICATION RECEIVED IN OFFICE OF PUBLICATIONS

AS Assignment

Owner name: ALLARITY THERAPEUTICS EUROPE APS, DENMARK

Free format text: CHANGE OF NAME;ASSIGNOR:ONCOLOGY VENTURE PRODUCT DEVELOPMENT APS;REEL/FRAME:060344/0141

Effective date: 20211223

STPP Information on status: patent application and granting procedure in general

Free format text: PUBLICATIONS -- ISSUE FEE PAYMENT VERIFIED

STCF Information on status: patent grant

Free format text: PATENTED CASE

MAFP Maintenance fee payment

Free format text: PAYMENT OF MAINTENANCE FEE, 4TH YR, SMALL ENTITY (ORIGINAL EVENT CODE: M2551); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY

Year of fee payment: 4