US11345940B2 - Microorganism of genus Corynebacterium producing L-arginine and method for producing L-arginine using the same - Google Patents

Microorganism of genus Corynebacterium producing L-arginine and method for producing L-arginine using the same Download PDF

Info

Publication number
US11345940B2
US11345940B2 US16/461,490 US201816461490A US11345940B2 US 11345940 B2 US11345940 B2 US 11345940B2 US 201816461490 A US201816461490 A US 201816461490A US 11345940 B2 US11345940 B2 US 11345940B2
Authority
US
United States
Prior art keywords
arginine
microorganism
seq
producing
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
US16/461,490
Other versions
US20210139937A1 (en
Inventor
Seon Hye Kim
Hyung Joon Kim
Haena OH
Byoung Hoon Yoon
Min Gyeong Kang
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
CJ CheilJedang Corp
Original Assignee
CJ CheilJedang Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by CJ CheilJedang Corp filed Critical CJ CheilJedang Corp
Assigned to CJ CHEILJEDANG CORPORATION reassignment CJ CHEILJEDANG CORPORATION ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: KANG, MIN GYEONG, KIM, HYUNG JOON, KIM, SEON HYE, OH, Haena, YOON, BYOUNG HOON
Publication of US20210139937A1 publication Critical patent/US20210139937A1/en
Application granted granted Critical
Publication of US11345940B2 publication Critical patent/US11345940B2/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/34Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Corynebacterium (G)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20Bacteria; Culture media therefor
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/77Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Corynebacterium; for Brevibacterium
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00Preparation of nitrogen-containing organic compounds
    • C12P13/04Alpha- or beta- amino acids
    • C12P13/10Citrulline; Arginine; Ornithine
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70Vectors or expression systems specially adapted for E. coli
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12RINDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00Microorganisms ; Processes using microorganisms
    • C12R2001/01Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/15Corynebacterium

Definitions

  • the present disclosure relates to a microorganism of the genus Corynebacterium producing L-arginine, and a method for producing L-arginine using the same.
  • L-Arginine is contained in its free form in plant seeds or garlic, and in addition to being used in amino acid fortified dietary supplements, it is widely used in medicaments, foods, and the like.
  • Examples of the medicinal applications of L-arginine include liver function enhancers, brain function enhancers, therapeutics for male infertility, and general amino acid formulations.
  • Representative among the foods to which L-arginine is applied are fish paste additives, health beverage additives, and salt substitutes for patients with hypertension. Therefore, L-arginine is a material that has recently attracted much attention.
  • Microorganisms of the genus Corynebacterium are gram-positive microorganisms widely used in the production of L-amino acids.
  • target material-specific approaches such as a method of increasing the expression of a gene encoding an enzyme mainly involved in L-arginine synthesis in a strain of Corynebacterium , or a method of deleting a gene unnecessary for the L-arginine biosynthesis, are mainly used (Korean Patent No. 10-1102263).
  • Korean Patent No. 10-1102263 Korean Patent No. 10-1102263
  • the present inventors have made intensive efforts to develop a microorganism capable of producing L-arginine with high efficiency, and as a result, they have completed the present disclosure by confirming that the production yield of L-arginine is increased in a microorganism of the genus Corynebacterium in which a gene encoding a protein, the function of which is unknown, is deleted.
  • An object of the present disclosure is to provide a microorganism of the genus Corynebacterium producing L-arginine, wherein a protein including an amino acid sequence of SEQ ID NO: 1 is inactivated.
  • Another object of the present disclosure is to provide a method for producing L-arginine by using the microorganism.
  • an aspect of the present disclosure provides a microorganism of the genus Corynebacterium producing L-arginine, wherein a protein including an amino acid sequence of SEQ ID NO: 1 is inactivated.
  • L-arginine refers to an L-amino acid having the chemical formula of C 6 H 14 N 4 O 2 , and is a conditionally essential amino acid present in all organisms.
  • L-Arginine is known to be mainly produced by microorganisms of the genus Corynebacterium , but it is known that these are subject to feedback inhibition by intracellular arginine (Vehary Sakanyan, et al., Microbiology, 142:9-108, 1996). Therefore, these microorganisms are known to have a limit in producing L-arginine with high yield.
  • the present inventors surprisingly found that the production of L-arginine was increased when a protein including an amino acid sequence of SEQ ID NO: 1, the function of which is unknown, was inactivated, thereby providing a novel microorganism for producing L-arginine.
  • protein including an amino acid sequence of SEQ ID NO: 1 refers to a protein that is inherently present in a microorganism of the genus Corynebacterium or a hypothetical protein whose function is not known.
  • the protein including an amino acid sequence of SEQ ID NO: 1 may be a protein (essentially) consisting of the amino acid sequence of SEQ ID NO: 1, but is not limited thereto.
  • a protein consisting of a particular SEQ ID NO in the present disclosure, such expression does not exclude a mutation in the protein that can occur by a meaningless sequence addition upstream or downstream of the amino acid sequence of the corresponding SEQ ID NO, or a naturally occurring mutation therein, or a silent mutation therein, as long as the protein having such mutation has an activity the same as or corresponding to that of the protein which consists of an amino acid sequence of the corresponding SEQ ID NO. Even when the sequence addition or mutation is present, it obviously belongs to the scope of the present disclosure.
  • the protein including an amino acid sequence of SEQ ID NO: 1 may include an amino acid sequence having a homology to SEQ ID NO: 1 of at least 80%.
  • the protein including an amino acid sequence having a homology to SEQ ID NO: 1 of at least 80% may include a protein including an amino acid sequence having a homology to the amino acid sequence of SEQ ID NO: 1 of at least 80%, specifically at least 83%, at least 84%, at least 88%, at least 90%, at least 93%, at least 95%, or at least 97%.
  • the protein including an amino acid sequence of SEQ ID NO: 1 may be encoded by a gene including the polynucleotide sequence of SEQ ID NO: 2.
  • the protein may be encoded by a gene consisting or essentially consisting of the polynucleotide sequence of SEQ ID NO: 2, but is not limited thereto.
  • the protein of the present disclosure may be encoded not only by a gene including the polynucleotide sequence of SEQ ID NO: 2, but also by a gene including a polynucleotide having a homology to SEQ ID NO: 2 of at least 80%.
  • a polynucleotide sequence capable of encoding a protein including an amino acid sequence having a homology to SEQ ID NO: 1 above of at least 80% can be included within the scope of the present disclosure, but the protein may be encoded by a gene including a polynucleotide sequence having a homology to the above polynucleotide sequence of SEQ ID NO: 2 of at least 80%, specifically at least 83%, at least 84%, at least 88%, at least 90%, at least 93%, at least 95%, or at least 97%.
  • variants of the sequences encoding the same amino acid sequence also can be included within the scope of the present disclosure.
  • homology refers to identity with a given amino acid sequence or nucleotide sequence, and the homology may be expressed as a percentage.
  • a homology sequence having identical or similar activity to the given amino acid sequence or polynucleotide sequence is expressed as “% homology”.
  • the homology to the amino acid sequence or nucleotide sequence can be determined, for example, by using the algorithm BLAST (see Karlin and Altschul, Pro. Natl. Acad. Sci. USA, 90, 5873(1993)) or FASTA (see Pearson, Methods Enzymol., 183, 63, 1990)). Based on the algorithm BLAST, a program called BLASTN or BLASTX has been developed (see http://www.ncbi.nlm.nih.gov).
  • the term “inactivation” means that the protein is not expressed at all, or the protein is expressed but exhibits no activity or a reduction in the activity, as compared with that of a parent strain, native strain, or a strain before modification.
  • the reduction refers to a concept including a case where the activity of a protein is reduced compared to that of a protein originally possessed in a microorganism due to modification, deletion, etc. of the gene encoding the protein, a case where the level of overall protein activity in cells is lower than that of the native strain or that of the strain before modification due to inhibition of expression or inhibition of translation of the gene encoding the same, or a combination thereof.
  • the inactivation may be accomplished by various methods well known in the art.
  • the methods may include 1) a method of deleting the entirety or part of the gene encoding the protein; 2) a method of modifying an expression control sequence so that expression of the gene encoding the protein is reduced; 3) a method of modifying the sequence of the gene encoding the protein so that the activity of the protein is removed or attenuated; 4) a method of introducing an antisense oligonucleotide (e.g., antisense RNA) which complementarily binds to a transcript of the gene encoding the protein; 5) a method of making the attachment of a ribosome impossible by forming a secondary structure by adding a Shine-Dalgarno sequence and its complementary sequence on the front end of the Shine-Dalgarno sequence of the gene encoding the protein; 6) a method of reverse transcription engineering (RTE), which adds a promoter to be reversely transcribed on the 3′ terminus
  • RTE
  • the method of modifying the expression control sequence may be achieved by applying a variety of methods well known in the art.
  • the method may be carried out by inducing a modification of the expression control sequence in the polynucleotide sequence via deletion, insertion, non-conservative or conservative substitution, or a combination thereof to further attenuate the activity of the expression control sequence, or by substituting the expression control sequence with a polynucleotide sequence having a weaker activity.
  • the expression control sequence may include a promoter, an operator sequence, a sequence encoding a ribosome-binding region, and sequences controlling the termination of transcription and translation, but is not limited thereto.
  • the method of modifying the nucleotide sequence may be carried out by inducing a modification in the sequence via deletion, insertion, non-conservative or conservative substitution, or a combination thereof in the nucleotide sequence to further attenuate the enzyme activity; or by substituting the nucleotide sequence with a nucleotide sequence which was improved to have weaker activity or a nucleotide sequence which was improved to have no activity, but is not limited thereto.
  • the method of deleting part or the entirety of the gene encoding the protein may be performed by substituting a polynucleotide encoding an endogenous target protein within the chromosome with a polynucleotide or a marker gene where part of the nucleotide sequence is deleted, via a vector for chromosomal insertion into the microorganism.
  • a method of deleting the polynucleotide by homologous recombination may be used, but is not limited thereto.
  • the method of deleting part or the entirety of the gene may be carried out by inducing a mutation using light such as UV, or chemicals, and by selecting a strain having the deleted target gene from the obtained mutants.
  • the method of deleting the gene may include a method of using a genetic recombination technique.
  • a nucleotide sequence or a vector including a nucleotide sequence having homology with a target gene is introduced into the microorganism to cause homologous recombination.
  • the nucleotide sequence or vector to be introduced may include a dominant selection marker.
  • microorganism producing L-arginine or “microorganism having L-arginine productivity” refers to a microorganism naturally having an ability to produce L-arginine or a microorganism which is prepared by imparting an ability to produce L-arginine to a parent strain having no ability to produce L-arginine.
  • the ability to produce L-arginine may be imparted by inactivating the activity of the protein including an amino acid sequence of SEQ ID NO: 1 and/or by enhancing expression of the gene encoding enzymes biosynthesizing L-arginine.
  • examples of the enzymes biosynthesizing L-arginine include N-acetylglutamyl phosphate reductase (ArgC), ornithine acetyltransferase (ArgJ), N-acetylglutamate kinase (ArgB), acetylornithine transaminase (ArgD), ornithine carbamoyltransferase (ArgF), argininosuccinic acid synthetase (ArgG), argininosuccinic acid lyase (argH), and carbamoyl phosphate synthetase.
  • the microorganism producing L-arginine is a microorganism in which a protein including an amino acid sequence of SEQ ID NO: 1 is inactivated.
  • the microorganism may be any microorganism capable of producing L-arginine by inactivating the protein including the amino acid sequence of SEQ ID NO: 1.
  • the microorganism may include a microorganism strain such as a microorganism of the genus Escherichia , a microorganism of the genus Serratia , a microorganism of the genus Erwinia , a microorganism of the genus Enterobacteria , a microorganism of the genus Salmonella , a microorganism of the genus Streptomyces , a microorganism of the genus Pseudomonas , a microorganism of the genus Brevibacterium , or a microorganism of the genus Corynebacterium , and specifically may be a microorganism of the genus Corynebacterium .
  • the microorganism may be a microorganism of the genus Corynebacterium producing L-arginine.
  • the “microorganism of the genus Corynebacterium producing L-arginine” refers to a microorganism of the genus Corynebacterium which has an L-arginine-producing ability naturally or due to modification. It is already known that the microorganism of the genus Corynebacterium can produce L-arginine. However, its L-arginine-producing ability is remarkably low, and genes or mechanisms involved in the production have not yet been revealed.
  • the microorganism of the genus Corynebacterium producing L-arginine refers to a native microorganism itself or a microorganism of the genus Corynebacterium in which the activity of a foreign gene involved in the L-arginine production mechanism is reinforced or inactivated so as to have an improved L-arginine-producing ability.
  • the “microorganism of the genus Corynebacterium ” may include all microorganisms of the genus Corynebacterium .
  • the microorganism may be Corynebacterium glutamicum, Corynebacterium ammoniagenes, Corynebacterium thermoaminogenes, Brevibacterium flavum, Corynebacterium efficiens, Corynebacterium marls, Corynebacterium lubricantis, Corynebacterium doosanense, Corynebacterium pilosum, Corynebacterium cystitidis, Corynebacterium uterequi, Corynebacterium renale , or Brevibacterium lactofermentum , and more specifically may be Corynebacterium glutamicum.
  • the present disclosure provides a method for producing L-arginine, comprising: culturing the microorganism according to the present disclosure in a medium.
  • microorganism according to the present disclosure is as described above.
  • the culturing of the microorganism of the genus Corynebacterium may be carried out using any culture condition and culturing method known in the art.
  • the term “culturing” means that microorganisms are grown in appropriately artificially controlled environmental conditions.
  • the method of culturing the microorganism of the genus Corynebacterium producing L-arginine may be carried out using a method widely known in the art. Specifically, a batch process or a continuous process such as a fed-batch process or a repeated fed-batch process may be used for the culturing, but the culturing is not limited thereto.
  • a medium For use in the culturing, a medium must satisfy the requirement of the strain employed.
  • Culture media suitable for use in culturing Corynebacteria strains are well known in the art (e.g., Manual of Methods for General Bacteriology by the American Society for Bacteriology, Washington D.C., USA, 1981).
  • Sugar sources that may be used in the medium include sugars and carbohydrates such as glucose, saccharose, lactose, fructose, maltose, starch, or cellulose; oils and fats such as soybean oil, sunflower oil, castor oil, or coconut oil; fatty acids such as palmitic acid, stearic acid, or linoleic acid; alcohols such as glycerol or ethanol; and organic acids such as acetic acid. These substances may be used individually or in a mixture, but are not limited thereto.
  • sugars and carbohydrates such as glucose, saccharose, lactose, fructose, maltose, starch, or cellulose
  • oils and fats such as soybean oil, sunflower oil, castor oil, or coconut oil
  • fatty acids such as palmitic acid, stearic acid, or linoleic acid
  • alcohols such as glycerol or ethanol
  • organic acids such as acetic acid.
  • Nitrogen sources which may be used include compounds containing organic nitrogen, such as peptone, yeast extract, meat extract, malt extract, corn steep liquor, soybean meal, and urea, or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate.
  • the nitrogen sources may also be used individually or as a mixture, but are not limited thereto.
  • Phosphorus sources which may be used include potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium salts.
  • the culture medium may furthermore contain metal salts such as magnesium sulfate or iron sulfate, which are required for growth.
  • essential growth substances such as amino acids and vitamins may be used in addition to the above-mentioned substances.
  • suitable precursors may be added to the culture medium. Said substances may be added to the culture in a batch or a continuous manner by a suitable method during culturing.
  • the pH of the culture product may be controlled by using basic compounds such as sodium hydroxide, potassium hydroxide, ammonia, or aqueous ammonia; or acidic compounds such as phosphoric acid or sulfuric acid in a suitable manner.
  • Foaming can be controlled by using antifoaming agents such as fatty acid polyglycol esters. Aerobic conditions can be maintained by introducing oxygen or oxygen containing gas mixtures (e.g., air) into the culture.
  • the culture temperature may be usually from 20° C. to 45° C., specifically from 25° C. to 40° C. Culturing may be continued until a desired amount of L-amino acids has been produced. Specifically, the culturing time may be 10 hours to 160 hours.
  • the culturing may be performed continuously or in a batch process or in a fed-batch or repeated fed-batch process. This culturing may be performed using any method well known in the art.
  • the separation of L-arginine from a culture product may be carried out by a conventional method known in the art.
  • methods such as centrifugation, filtration, ion exchange chromatography, crystallization, etc. may be used.
  • a supernatant, obtained by centrifuging the culture product at a low speed and removing biomass may be separated by ion exchange chromatography, but the method is not limited thereto.
  • recovering L-arginine from the microorganism or the medium may be further included after the culturing.
  • the recovering may include a purification process.
  • the microorganism of the present disclosure which produces L-arginine, can produce L-arginine with high efficiency. Additionally, the produced L-arginine can be applied not only to animal feeds or animal feed additives, but also to various products such as human food or food additives, medicines, etc.
  • a vector library was constructed in the following manner.
  • a plasmid obtained using the EZ-Tn5TM ⁇ R6K ⁇ ori/KAN-2>Tnp TransposomeTM Kit (Epicentre) was transformed into the parent strain by an electric pulse method (Appl. Microbiol. Biotechnol. (1999) 52:541-545). Then, the strain was spread on a complex medium plate containing kanamycin (25 mg/L), and thereby about 20,000 colonies were obtained.
  • Example 1 Each of about 20,000 colonies obtained in Example 1 was inoculated onto 300 ⁇ L of the following selective medium and cultured in a 96-deep-well plate at 30° C. at 1,000 rpm for about 24 hours.
  • KCCM10741P/mt-10 was finally selected as a strain whose L-arginine productivity was significantly increased.
  • Example 3 an experiment was performed on the mutant strain finally selected in Example 3 in order to identify genes deleted by random insertion of the transposon.
  • Genomic DNA was extracted from KCCM10741P/mt-10, digested, and then ligated, and the ligation product was transformed into E. coli DH5 ⁇ .
  • the transformed E. coli cells were plated on an LB solid medium containing kanamycin (25 mg/L). Twenty transformed colonies were selected, and then plasmids containing an unknown gene portion were obtained.
  • the nucleotide sequences were analyzed using primer 1 (SEQ ID NO: 3) and primer 2 (SEQ ID NO: 4) of the EZ-Tn5TM ⁇ R6K ⁇ ori/KAN-2>Tnp TransposomeTM Kit. As a result, it was confirmed that the deleted and inactivated gene had the nucleotide sequence of SEQ ID NO: 2 encoding the amino acid sequence of SEQ ID NO: 1
  • Primer 1 (SEQ ID NO: 3): ACCTACAACAAAGCTCTCATCAACC
  • Primer 2 (SEQ ID NO: 4): CTACCCTGTGGAACACCTACATCT
  • the gene above was selected as a candidate gene for deletion.
  • primers 3 to 6 shown in Table 2 were synthesized in order to prepare a recombinant vector capable of deleting the gene on the chromosome of the microorganism of the genus Corynebacterium .
  • primer 3 SEQ ID NO: 5
  • primer 4 SEQ ID NO: 6
  • primer 5 SEQ ID NO: 7
  • primer 6 SEQ ID NO: 8
  • PCR was carried out for a total of 30 cycles under the following conditions: denaturation at 94° C. for 30 seconds, annealing at 56° C. for 30 seconds, and polymerization at 72° C. for 1 minute. Thereafter, the polymerization reaction was carried out at 72° C. for 7 minutes.
  • a pDZ vector (Korean Patent No. 10-0924065), which is not replicable in Corynebacterium glutamicum , was treated with an XhoI restriction enzyme, and then the obtained PCR product was fusion-cloned. The fusion cloning was carried out using an In-Fusion® HD Cloning Kit (Clontech). Thereafter, the resultant was transformed into E. coli DH5 ⁇ , and then plated on an LB solid medium containing kanamycin (25 mg/L).
  • a colony transformed with a plasmid having the desired gene inserted therein was selected by PCR, and then the plasmid was isolated using a plasmid extraction technique.
  • the plasmid was named “pDZ- ⁇ RS1”.
  • Example 6 Construction of Corynebacterium glutamicum KCCM10741P with the Deletion of the Gene Comprising the Nucleotide Sequence of SEQ ID NO: 2, and Evaluation of L-Arginine Productivity of the Constructed Strain
  • the recombinant plasmid pDZ- ⁇ RS1 prepared in Example 5 was transformed into Corynebacterium glutamicum KCCM10741P, which is an L-arginine-producing strain, by homologous recombination on the chromosome (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999).
  • the transformant was grown on a solid medium plate containing 4% sucrose to allow a second recombination to take place. After completion of the second recombination, deletion of the gene on the chromosome of the transformed Corynebacterium glutamicum strain was confirmed by PCR using primer 3 and primer 6. The recombinant strain was named “ Corynebacterium glutamicum KCCM10741P-RS1”.
  • the constructed Corynebacterium glutamicum KCCM10741P-RS1 strain and the parent strain Corynebacterium glutamicum KCCM10741P were cultured in the following manner.
  • Each of the parent strain Corynebacterium glutamicum KCCM10741P and the Corynebacterium glutamicum KCCM10741P-RS1 strain constructed in Example 6 was inoculated into a 250 mL corner-baffled flask containing 25 mL of the following seed medium and shake-cultured at 200 rpm at 30° C. for 20 hours. Next, 1 mL of each of the seed cultures was inoculated into a 250 mL corner-baffle flask containing 24 mL of the following production medium and shake-cultured at 200 rpm at 30° C. for 72 hours.
  • the composition of the seed medium and the composition of the production medium were as follows.
  • KCCM10741P-RS1 in which the gene is deleted from Corynebacterium glutamicum KCCM10741P (i.e., the L-arginine-producing strain), had the L-arginine productivity which is increased by 25% on average compared to the parent strain.
  • the KCCM10741P-RS1 strain was named “CA06-2830”, and was deposited to the Korean Culture Center of Microorganisms (KCCM), which is an international depositary authority under the Budapest Treaty, on Dec. 15, 2017, and assigned Accession No. KCCM12187P.
  • KCCM Korean Culture Center of Microorganisms
  • the L-arginine productivity could be improved by deleting the gene comprising the nucleotide sequence of SEQ ID NO: 2 from the microorganism of the genus Corynebacterium.
  • a recombinant vector capable of attenuating the gene comprising the nucleotide sequence of SEQ ID NO: 2 on the chromosome of the strain of the genus Corynebacterium .
  • the initiation codon of the gene was replaced from ATG to TTG to attenuate the gene.
  • primer 3 and primers 7 to 9 shown in Table 4 below were synthesized.
  • primer 3 SEQ ID NO: 5
  • primer 7 SEQ ID NO: 9
  • primer 8 SEQ ID NO: 10
  • primer 9 SEQ ID NO: 11
  • PCR was carried out with the chromosomal DNA of Corynebacterium glutamicum KCCM10741P as a template using primer 3, primer 7, primer 8, and primer 9.
  • PCR was carried out for a total of 30 cycles under the following conditions: denaturation at 94° C. for 30 seconds, annealing at 56° C.
  • a pDZ vector (Korean Patent No. 10-0924065), which is not replicable in Corynebacterium glutamicum , was treated with an XhoI restriction enzyme, and then the obtained PCR product was fusion-cloned. The fusion cloning was carried out using an In-Fusion® HD Cloning Kit (Clontech). Thereafter, the resultant was transformed into E. coli DH5 ⁇ , and then plated on an LB solid medium containing kanamycin (25 mg/L).
  • a colony transformed with a plasmid having the desired gene inserted therein was selected by PCR, and then the plasmid was isolated using a plasmid extraction technique.
  • the plasmid was named “pDZ- ⁇ RS2”.
  • Example 8 Construction of Corynebacterium glutamicum KCCM10741P in which the Gene Comprising the Nucleotide Sequence of SEQ ID NO: 2 is Attenuated, and Evaluation of L-Arginine Productivity of the Constructed Strain
  • the recombinant plasmid pDZ- ⁇ RS2 prepared in Example 7 was transformed into Corynebacterium glutamicum KCCM10741P, which is an L-arginine-producing strain, by homologous recombination on the chromosome (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999).
  • the transformant was grown on a solid medium plate containing 4% sucrose to allow a second recombination to take place.
  • the nucleotide sequence of the transformed Corynebacterium glutamicum strain obtained after the second recombination was analyzed using primer 3 and primer 9 to identify the strain in which the initiation codon of the gene comprising the nucleotide sequence of SEQ ID NO: 2 is substituted with TTG.
  • the recombinant strain was named “ Corynebacterium glutamicum KCCM10741P-R52”.
  • Each of the parent strain Corynebacterium glutamicum KCCM10741P and the Corynebacterium glutamicum KCCM10741P-RS2 strain constructed above was cultured in the same manner as in Example 6 in order to analyze the L-arginine productivity. Thereafter, the amount of L-arginine produced was measured by HPLC, and the concentration of L-arginine analyzed is shown in Table 5 below.
  • the L-arginine productivity could be improved by attenuating the expression of the gene comprising the nucleotide sequence of SEQ ID NO: 2 in the microorganism of the genus Corynebacterium.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

A microorganism of the genus Corynebacterium producing L-arginine, and a method for producing L-arginine using the same.

Description

CROSS-REFERENCE TO RELATED APPLICATION
This application is the U.S. national phase of PCT Application No. PCT/KR2018/016115 filed on Dec. 18, 2018, which claims priority to KR Patent Application No. 10-2017-0175046 filed on Dec. 19, 2017, the disclosures of which are incorporated in their entirety by reference herein.
SEQUENCE LISTING
The text file OPA18459-SequenceListing of size 6.35 KB created Sep. 23, 2020, filed herewith, is hereby incorporated by reference.
TECHNICAL FIELD
The present disclosure relates to a microorganism of the genus Corynebacterium producing L-arginine, and a method for producing L-arginine using the same.
BACKGROUND ART
L-Arginine is contained in its free form in plant seeds or garlic, and in addition to being used in amino acid fortified dietary supplements, it is widely used in medicaments, foods, and the like. Examples of the medicinal applications of L-arginine include liver function enhancers, brain function enhancers, therapeutics for male infertility, and general amino acid formulations. Representative among the foods to which L-arginine is applied are fish paste additives, health beverage additives, and salt substitutes for patients with hypertension. Therefore, L-arginine is a material that has recently attracted much attention.
Microorganisms of the genus Corynebacterium, in particular Corynebacterium glutamicum, are gram-positive microorganisms widely used in the production of L-amino acids. For the production of L-arginine, target material-specific approaches, such as a method of increasing the expression of a gene encoding an enzyme mainly involved in L-arginine synthesis in a strain of Corynebacterium, or a method of deleting a gene unnecessary for the L-arginine biosynthesis, are mainly used (Korean Patent No. 10-1102263). However, there is still a growing need for research on methods that can efficiently produce L-arginine with high yield.
Under such circumstances, the present inventors have made intensive efforts to develop a microorganism capable of producing L-arginine with high efficiency, and as a result, they have completed the present disclosure by confirming that the production yield of L-arginine is increased in a microorganism of the genus Corynebacterium in which a gene encoding a protein, the function of which is unknown, is deleted.
DISCLOSURE Technical Problem
An object of the present disclosure is to provide a microorganism of the genus Corynebacterium producing L-arginine, wherein a protein including an amino acid sequence of SEQ ID NO: 1 is inactivated.
Another object of the present disclosure is to provide a method for producing L-arginine by using the microorganism.
Technical Solution
Hereinbelow, the present disclosure will be described in detail. Meanwhile, each of the explanations and exemplary embodiments disclosed herein can be applied to other explanations and exemplary embodiments. That is, all combinations of various factors disclosed herein belong to the scope of the present disclosure. Furthermore, the scope of the present disclosure should not be limited by the specific disclosure provided hereinbelow.
In order to achieve the above objects, an aspect of the present disclosure provides a microorganism of the genus Corynebacterium producing L-arginine, wherein a protein including an amino acid sequence of SEQ ID NO: 1 is inactivated.
As used herein, the term “L-arginine” refers to an L-amino acid having the chemical formula of C6H14N4O2, and is a conditionally essential amino acid present in all organisms. L-Arginine is known to be mainly produced by microorganisms of the genus Corynebacterium, but it is known that these are subject to feedback inhibition by intracellular arginine (Vehary Sakanyan, et al., Microbiology, 142:9-108, 1996). Therefore, these microorganisms are known to have a limit in producing L-arginine with high yield. The present inventors surprisingly found that the production of L-arginine was increased when a protein including an amino acid sequence of SEQ ID NO: 1, the function of which is unknown, was inactivated, thereby providing a novel microorganism for producing L-arginine.
As used herein, the term “protein including an amino acid sequence of SEQ ID NO: 1” refers to a protein that is inherently present in a microorganism of the genus Corynebacterium or a hypothetical protein whose function is not known. For example, the protein including an amino acid sequence of SEQ ID NO: 1 may be a protein (essentially) consisting of the amino acid sequence of SEQ ID NO: 1, but is not limited thereto.
Additionally, although described as “a protein consisting of a particular SEQ ID NO” in the present disclosure, such expression does not exclude a mutation in the protein that can occur by a meaningless sequence addition upstream or downstream of the amino acid sequence of the corresponding SEQ ID NO, or a naturally occurring mutation therein, or a silent mutation therein, as long as the protein having such mutation has an activity the same as or corresponding to that of the protein which consists of an amino acid sequence of the corresponding SEQ ID NO. Even when the sequence addition or mutation is present, it obviously belongs to the scope of the present disclosure.
In one exemplary embodiment, the protein including an amino acid sequence of SEQ ID NO: 1 may include an amino acid sequence having a homology to SEQ ID NO: 1 of at least 80%. The protein including an amino acid sequence having a homology to SEQ ID NO: 1 of at least 80% may include a protein including an amino acid sequence having a homology to the amino acid sequence of SEQ ID NO: 1 of at least 80%, specifically at least 83%, at least 84%, at least 88%, at least 90%, at least 93%, at least 95%, or at least 97%. It is apparent that a protein having an amino acid sequence in which the sequence is partially deleted, modified, substituted, or inserted is included in the scope of the present disclosure, as long as a sequence having a homology to the sequence shows biological activity practically equivalent or corresponding to an amino acid sequence of SEQ ID NO: 1.
Additionally, the protein including an amino acid sequence of SEQ ID NO: 1 may be encoded by a gene including the polynucleotide sequence of SEQ ID NO: 2. In addition, the protein may be encoded by a gene consisting or essentially consisting of the polynucleotide sequence of SEQ ID NO: 2, but is not limited thereto.
Additionally, the protein of the present disclosure may be encoded not only by a gene including the polynucleotide sequence of SEQ ID NO: 2, but also by a gene including a polynucleotide having a homology to SEQ ID NO: 2 of at least 80%.
Specifically, a polynucleotide sequence capable of encoding a protein including an amino acid sequence having a homology to SEQ ID NO: 1 above of at least 80% can be included within the scope of the present disclosure, but the protein may be encoded by a gene including a polynucleotide sequence having a homology to the above polynucleotide sequence of SEQ ID NO: 2 of at least 80%, specifically at least 83%, at least 84%, at least 88%, at least 90%, at least 93%, at least 95%, or at least 97%. In addition, based on genetic code degeneracy, variants of the sequences encoding the same amino acid sequence also can be included within the scope of the present disclosure.
As used herein, the term “homology” refers to identity with a given amino acid sequence or nucleotide sequence, and the homology may be expressed as a percentage. In the present disclosure, a homology sequence having identical or similar activity to the given amino acid sequence or polynucleotide sequence is expressed as “% homology”.
The homology to the amino acid sequence or nucleotide sequence can be determined, for example, by using the algorithm BLAST (see Karlin and Altschul, Pro. Natl. Acad. Sci. USA, 90, 5873(1993)) or FASTA (see Pearson, Methods Enzymol., 183, 63, 1990)). Based on the algorithm BLAST, a program called BLASTN or BLASTX has been developed (see http://www.ncbi.nlm.nih.gov).
As used herein, the term “inactivation” means that the protein is not expressed at all, or the protein is expressed but exhibits no activity or a reduction in the activity, as compared with that of a parent strain, native strain, or a strain before modification. The reduction refers to a concept including a case where the activity of a protein is reduced compared to that of a protein originally possessed in a microorganism due to modification, deletion, etc. of the gene encoding the protein, a case where the level of overall protein activity in cells is lower than that of the native strain or that of the strain before modification due to inhibition of expression or inhibition of translation of the gene encoding the same, or a combination thereof.
In the present disclosure, it was identified for the first time that the inactivation of the protein is related to the productivity of L-arginine.
In the present disclosure, the inactivation may be accomplished by various methods well known in the art. Examples of the methods may include 1) a method of deleting the entirety or part of the gene encoding the protein; 2) a method of modifying an expression control sequence so that expression of the gene encoding the protein is reduced; 3) a method of modifying the sequence of the gene encoding the protein so that the activity of the protein is removed or attenuated; 4) a method of introducing an antisense oligonucleotide (e.g., antisense RNA) which complementarily binds to a transcript of the gene encoding the protein; 5) a method of making the attachment of a ribosome impossible by forming a secondary structure by adding a Shine-Dalgarno sequence and its complementary sequence on the front end of the Shine-Dalgarno sequence of the gene encoding the protein; 6) a method of reverse transcription engineering (RTE), which adds a promoter to be reversely transcribed on the 3′ terminus of the open reading frame (ORF) of the polynucleotide sequence of the gene encoding the protein, etc., and may also include a combination thereof, but are not particularly limited thereto.
Specifically, the method of modifying the expression control sequence may be achieved by applying a variety of methods well known in the art. For example, the method may be carried out by inducing a modification of the expression control sequence in the polynucleotide sequence via deletion, insertion, non-conservative or conservative substitution, or a combination thereof to further attenuate the activity of the expression control sequence, or by substituting the expression control sequence with a polynucleotide sequence having a weaker activity. The expression control sequence may include a promoter, an operator sequence, a sequence encoding a ribosome-binding region, and sequences controlling the termination of transcription and translation, but is not limited thereto.
Furthermore, the method of modifying the nucleotide sequence may be carried out by inducing a modification in the sequence via deletion, insertion, non-conservative or conservative substitution, or a combination thereof in the nucleotide sequence to further attenuate the enzyme activity; or by substituting the nucleotide sequence with a nucleotide sequence which was improved to have weaker activity or a nucleotide sequence which was improved to have no activity, but is not limited thereto.
Additionally, the method of deleting part or the entirety of the gene encoding the protein may be performed by substituting a polynucleotide encoding an endogenous target protein within the chromosome with a polynucleotide or a marker gene where part of the nucleotide sequence is deleted, via a vector for chromosomal insertion into the microorganism. In an exemplary embodiment of the method of deleting part or the entirety of the polynucleotide, a method of deleting the polynucleotide by homologous recombination may be used, but is not limited thereto.
Additionally, the method of deleting part or the entirety of the gene may be carried out by inducing a mutation using light such as UV, or chemicals, and by selecting a strain having the deleted target gene from the obtained mutants. The method of deleting the gene may include a method of using a genetic recombination technique. For example, a nucleotide sequence or a vector including a nucleotide sequence having homology with a target gene is introduced into the microorganism to cause homologous recombination. Further, the nucleotide sequence or vector to be introduced may include a dominant selection marker.
As used herein, the term “microorganism producing L-arginine” or “microorganism having L-arginine productivity” refers to a microorganism naturally having an ability to produce L-arginine or a microorganism which is prepared by imparting an ability to produce L-arginine to a parent strain having no ability to produce L-arginine. For example, the ability to produce L-arginine may be imparted by inactivating the activity of the protein including an amino acid sequence of SEQ ID NO: 1 and/or by enhancing expression of the gene encoding enzymes biosynthesizing L-arginine.
Herein, examples of the enzymes biosynthesizing L-arginine include N-acetylglutamyl phosphate reductase (ArgC), ornithine acetyltransferase (ArgJ), N-acetylglutamate kinase (ArgB), acetylornithine transaminase (ArgD), ornithine carbamoyltransferase (ArgF), argininosuccinic acid synthetase (ArgG), argininosuccinic acid lyase (argH), and carbamoyl phosphate synthetase. These enzymes are placed in the Arg operon (argCJBDFRGH) and are regulated by an arginine repressor encoded by argR (J Bacteriol. 2002 December; 184(23):6602-14.). Therefore, an ability to produce L-arginine may be imparted by attenuating the arginine repressor (US2002-0045223) or overexpressing at least one of the biosynthesis genes.
In the present disclosure, the microorganism producing L-arginine is a microorganism in which a protein including an amino acid sequence of SEQ ID NO: 1 is inactivated. In addition, for the purpose of the present disclosure, the microorganism may be any microorganism capable of producing L-arginine by inactivating the protein including the amino acid sequence of SEQ ID NO: 1. As a specific example, the microorganism may include a microorganism strain such as a microorganism of the genus Escherichia, a microorganism of the genus Serratia, a microorganism of the genus Erwinia, a microorganism of the genus Enterobacteria, a microorganism of the genus Salmonella, a microorganism of the genus Streptomyces, a microorganism of the genus Pseudomonas, a microorganism of the genus Brevibacterium, or a microorganism of the genus Corynebacterium, and specifically may be a microorganism of the genus Corynebacterium. For the purpose of the present disclosure, the microorganism may be a microorganism of the genus Corynebacterium producing L-arginine.
The “microorganism of the genus Corynebacterium producing L-arginine” refers to a microorganism of the genus Corynebacterium which has an L-arginine-producing ability naturally or due to modification. It is already known that the microorganism of the genus Corynebacterium can produce L-arginine. However, its L-arginine-producing ability is remarkably low, and genes or mechanisms involved in the production have not yet been revealed. Therefore, in the present disclosure, the microorganism of the genus Corynebacterium producing L-arginine refers to a native microorganism itself or a microorganism of the genus Corynebacterium in which the activity of a foreign gene involved in the L-arginine production mechanism is reinforced or inactivated so as to have an improved L-arginine-producing ability.
In the present disclosure, the “microorganism of the genus Corynebacterium” may include all microorganisms of the genus Corynebacterium. Specifically, the microorganism may be Corynebacterium glutamicum, Corynebacterium ammoniagenes, Corynebacterium thermoaminogenes, Brevibacterium flavum, Corynebacterium efficiens, Corynebacterium marls, Corynebacterium lubricantis, Corynebacterium doosanense, Corynebacterium pilosum, Corynebacterium cystitidis, Corynebacterium uterequi, Corynebacterium renale, or Brevibacterium lactofermentum, and more specifically may be Corynebacterium glutamicum.
The present disclosure provides a method for producing L-arginine, comprising: culturing the microorganism according to the present disclosure in a medium.
The microorganism according to the present disclosure is as described above.
In the method of the present disclosure, the culturing of the microorganism of the genus Corynebacterium may be carried out using any culture condition and culturing method known in the art.
As used herein, the term “culturing” means that microorganisms are grown in appropriately artificially controlled environmental conditions. In the present disclosure, the method of culturing the microorganism of the genus Corynebacterium producing L-arginine may be carried out using a method widely known in the art. Specifically, a batch process or a continuous process such as a fed-batch process or a repeated fed-batch process may be used for the culturing, but the culturing is not limited thereto.
For use in the culturing, a medium must satisfy the requirement of the strain employed. Culture media suitable for use in culturing Corynebacteria strains are well known in the art (e.g., Manual of Methods for General Bacteriology by the American Society for Bacteriology, Washington D.C., USA, 1981).
Sugar sources that may be used in the medium include sugars and carbohydrates such as glucose, saccharose, lactose, fructose, maltose, starch, or cellulose; oils and fats such as soybean oil, sunflower oil, castor oil, or coconut oil; fatty acids such as palmitic acid, stearic acid, or linoleic acid; alcohols such as glycerol or ethanol; and organic acids such as acetic acid. These substances may be used individually or in a mixture, but are not limited thereto.
Nitrogen sources which may be used include compounds containing organic nitrogen, such as peptone, yeast extract, meat extract, malt extract, corn steep liquor, soybean meal, and urea, or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate. The nitrogen sources may also be used individually or as a mixture, but are not limited thereto.
Phosphorus sources which may be used include potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium salts. The culture medium may furthermore contain metal salts such as magnesium sulfate or iron sulfate, which are required for growth. Finally, essential growth substances such as amino acids and vitamins may be used in addition to the above-mentioned substances. Moreover, suitable precursors may be added to the culture medium. Said substances may be added to the culture in a batch or a continuous manner by a suitable method during culturing.
The pH of the culture product may be controlled by using basic compounds such as sodium hydroxide, potassium hydroxide, ammonia, or aqueous ammonia; or acidic compounds such as phosphoric acid or sulfuric acid in a suitable manner. Foaming can be controlled by using antifoaming agents such as fatty acid polyglycol esters. Aerobic conditions can be maintained by introducing oxygen or oxygen containing gas mixtures (e.g., air) into the culture. The culture temperature may be usually from 20° C. to 45° C., specifically from 25° C. to 40° C. Culturing may be continued until a desired amount of L-amino acids has been produced. Specifically, the culturing time may be 10 hours to 160 hours.
In the method of the present disclosure, the culturing may be performed continuously or in a batch process or in a fed-batch or repeated fed-batch process. This culturing may be performed using any method well known in the art.
The separation of L-arginine from a culture product may be carried out by a conventional method known in the art. For the separation method above, methods such as centrifugation, filtration, ion exchange chromatography, crystallization, etc. may be used. For example, a supernatant, obtained by centrifuging the culture product at a low speed and removing biomass, may be separated by ion exchange chromatography, but the method is not limited thereto.
In the method of the present disclosure, recovering L-arginine from the microorganism or the medium may be further included after the culturing.
The recovering may include a purification process.
Advantageous Effects
The microorganism of the present disclosure, which produces L-arginine, can produce L-arginine with high efficiency. Additionally, the produced L-arginine can be applied not only to animal feeds or animal feed additives, but also to various products such as human food or food additives, medicines, etc.
DETAILED DESCRIPTION OF THE INVENTION
Hereinbelow, the present disclosure will be described in detail with accompanying exemplary embodiments. However, the exemplary embodiments disclosed herein are only for illustrative purposes and should not be construed as limiting the scope of the present disclosure.
Example 1: Construction of Random Mutant Library Using Transposon
To obtain a strain having increased L-arginine productivity, a vector library was constructed in the following manner.
First, using Corynebacterium glutamicum KCCM10741P (Korean Patent No. 0791659) as a parent strain, a plasmid obtained using the EZ-Tn5™ <R6Kγori/KAN-2>Tnp Transposome™ Kit (Epicentre) was transformed into the parent strain by an electric pulse method (Appl. Microbiol. Biotechnol. (1999) 52:541-545). Then, the strain was spread on a complex medium plate containing kanamycin (25 mg/L), and thereby about 20,000 colonies were obtained.
<Complex Medium Plate (pH 7.0)>
10 g glucose, 10 g peptone, 5 g beef extract, 5 g yeast extract, 18.5 g brain heart infusion, 2.5 g NaCl, 2 g urea, 91 g sorbitol, 20 g agar (per liter of distilled water)
Example 2: Random Mutant Library Screening Using Transposon
Each of about 20,000 colonies obtained in Example 1 was inoculated onto 300 μL of the following selective medium and cultured in a 96-deep-well plate at 30° C. at 1,000 rpm for about 24 hours.
<Selective Medium (pH 8.0)>
10 g glucose, 5.5 g ammonium sulfate, 1.2 g MgSO47H2O, 0.8 g KH2PO4, 16.4 g K2HPO4, 100 μg biotin, 1 mg thiamine HCl, 2 mg calcium-pantothenate, 2 mg nicotinamide (per liter of distilled water)
To analyze the amount of L-arginine produced in the culture, the ninhydrin method was used (Moore, S., Stein, W. H., Photometric ninhydrin method for use in the chromatography of amino acids. J. Biol. Chem. 1948, 176, 367-388).
After completion of the culturing, 10 μL of the culture supernatant was reacted with 190 μL of a ninhydrin reaction solution at 65° C. for 30 minutes, and then the absorbance at a wavelength of 570 nm was measured with a spectrophotometer. Based on the results of the measurement, about 60 colonies showing higher absorbance than the Corynebacterium glutamicum KCCM10741P strain used as the control were selected as mutant strains. It was confirmed that other colonies showed absorbance similar to or lower than that of the Corynebacterium glutamicum KCCM10741P strain used as the control.
About 60 strains selected as described above were cultured again in the same manner as described above, and then subjected to the ninhydrin reaction. As a result, the top ten mutant strains having increased L-arginine productivity compared to the Corynebacterium glutamicum KCCM10741P strain used as the parent strain were selected.
Example 3: Analysis of L-Arginine Productivity of Selected Random Mutant Strains
In order to finally select strains whose L-arginine productivity was reproducibly increased from the ten mutants selected in Example 2, flask culture was performed using the following medium. After completing of the culturing, the concentration of L-arginine in the culture was analyzed by HPLC. The concentration of L-arginine produced by each of the mutant strains is shown in Table 1 below.
<Production Medium (pH 7.0)>
6% glucose, 3% ammonium sulfate, 0.1% monopotassium phosphate, 0.2% magnesium sulfate heptahydrate, 1.5% corn steep liquor (CSL), 1% NaCl, 0.5% yeast extract, 100 mg/L biotin, 3% CaCO3, (per liter of distilled water)
TABLE 1
Concentrations of L-arginine produced
by 10 selected random mutant strains
L-Arginine (g/L)
Strains Batch 1 Batch 2 Batch 3 Average
Control KCCM10741P 3 3.1 3.1 3.07
1 KCCM10741P/mt-1 2.8 3 2.7 2.83
2 KCCM10741P/mt-2 3.1 3 3.2 3.10
3 KCCM10741P/mt-3 3.3 3.2 3.4 3.30
4 KCCM10741P/mt-4 2.5 2.2 2.1 2.27
5 KCCM10741P/mt-5 2.9 3 3.2 3.03
6 KCCM10741P/mt-6 3.5 3.2 3.2 3.30
7 KCCM10741P/mt-7 3.2 3.3 3.3 3.27
8 KCCM10741P/mt-8 3.4 3 3.2 3.20
9 KCCM10741P/mt-9 2.7 2.7 3 2.80
10 KCCM10741P/mt-10 3.6 3.9 3.5 3.67
Among the 10 selected mutant strains, KCCM10741P/mt-10 was finally selected as a strain whose L-arginine productivity was significantly increased.
Example 4: Identification of Causes of Increased L-Arginine Productivity of Finally Selected Strain
In this Example, an experiment was performed on the mutant strain finally selected in Example 3 in order to identify genes deleted by random insertion of the transposon.
Genomic DNA was extracted from KCCM10741P/mt-10, digested, and then ligated, and the ligation product was transformed into E. coli DH5α. The transformed E. coli cells were plated on an LB solid medium containing kanamycin (25 mg/L). Twenty transformed colonies were selected, and then plasmids containing an unknown gene portion were obtained. The nucleotide sequences were analyzed using primer 1 (SEQ ID NO: 3) and primer 2 (SEQ ID NO: 4) of the EZ-Tn5™ <R6Kγori/KAN-2>Tnp Transposome™ Kit. As a result, it was confirmed that the deleted and inactivated gene had the nucleotide sequence of SEQ ID NO: 2 encoding the amino acid sequence of SEQ ID NO: 1
Primer 1 (SEQ ID NO: 3): 
ACCTACAACAAAGCTCTCATCAACC
Primer 2 (SEQ ID NO: 4):
CTACCCTGTGGAACACCTACATCT
Accordingly, in order to confirm whether the protein including the amino acid sequence of SEQ ID NO: 1 has an effect on the ability to produce L-arginine upon inactivation of the protein, the gene above was selected as a candidate gene for deletion.
Example 5: Construction of Recombinant Vector for Deletion of the Gene Comprising the Nucleotide Sequence of SEQ ID NO: 2
In this Example, in order to confirm the influence of the inactivation of the gene comprising the nucleotide sequence of SEQ ID NO: 2 and that of the production of L-arginine, a recombinant plasmid for deleting the gene, selected in Example 4, on the chromosome of the Corynebacterium L-arginine-producing strain was constructed.
First, primers 3 to 6 shown in Table 2 were synthesized in order to prepare a recombinant vector capable of deleting the gene on the chromosome of the microorganism of the genus Corynebacterium.
TABLE 2 
Primers used Nucleotide sequences
Primer 3 (SEQ ID NO: 5) CCGCTCGAGACATCGAAATCGTA
AGGGTA
Primer 4 (SEQ ID NO: 6) CAGCATTGACAAGCAGTTCT
Primer 5 (SEQ ID NO: 7) AGAACTGCTTGTCAATGCTGGGC
CCTTTCCCAGGTGGCAT
Primer 6 (SEQ ID NO: 8) CCGCTCGAGAAGGCCACCGCTGC
AGACCG
Specifically, in order to delete the ORF region (SEQ ID NO: 2) of the gene, primer 3 (SEQ ID NO: 5), primer 4 (SEQ ID NO: 6), primer 5 (SEQ ID NO: 7), and primer 6 (SEQ ID NO: 8) were synthesized so that an XhoI restriction enzyme site is present at both the 5′ terminus and the 3′ terminus. PCR was carried out with the chromosomal DNA of Corynebacterium glutamicum KCCM10741P as a template using primers 3 to 6 above. As a result, it was confirmed that each of the DNA fragments corresponding to the front and rear portions of the part where the protein encoded by the gene is encoded was amplified by 500 bp, respectively. Herein, after denaturation at 95° C. for 5 minutes, PCR was carried out for a total of 30 cycles under the following conditions: denaturation at 94° C. for 30 seconds, annealing at 56° C. for 30 seconds, and polymerization at 72° C. for 1 minute. Thereafter, the polymerization reaction was carried out at 72° C. for 7 minutes. Next, a pDZ vector (Korean Patent No. 10-0924065), which is not replicable in Corynebacterium glutamicum, was treated with an XhoI restriction enzyme, and then the obtained PCR product was fusion-cloned. The fusion cloning was carried out using an In-Fusion® HD Cloning Kit (Clontech). Thereafter, the resultant was transformed into E. coli DH5α, and then plated on an LB solid medium containing kanamycin (25 mg/L).
A colony transformed with a plasmid having the desired gene inserted therein was selected by PCR, and then the plasmid was isolated using a plasmid extraction technique. The plasmid was named “pDZ-ΔRS1”.
Example 6: Construction of Corynebacterium glutamicum KCCM10741P with the Deletion of the Gene Comprising the Nucleotide Sequence of SEQ ID NO: 2, and Evaluation of L-Arginine Productivity of the Constructed Strain
Based on the L-arginine-producing strain of the genus Corynebacterium, which is the KCCM10741P strain, a strain in which the gene comprising the nucleotide sequence of SEQ ID NO: 2 is deleted was constructed, and the L-arginine productivity of the constructed strain was evaluated.
Specifically, the recombinant plasmid pDZ-ΔRS1 prepared in Example 5 was transformed into Corynebacterium glutamicum KCCM10741P, which is an L-arginine-producing strain, by homologous recombination on the chromosome (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999).
Next, the transformant was grown on a solid medium plate containing 4% sucrose to allow a second recombination to take place. After completion of the second recombination, deletion of the gene on the chromosome of the transformed Corynebacterium glutamicum strain was confirmed by PCR using primer 3 and primer 6. The recombinant strain was named “Corynebacterium glutamicum KCCM10741P-RS1”.
In order to analyze the L-arginine productivity, the constructed Corynebacterium glutamicum KCCM10741P-RS1 strain and the parent strain Corynebacterium glutamicum KCCM10741P were cultured in the following manner.
Each of the parent strain Corynebacterium glutamicum KCCM10741P and the Corynebacterium glutamicum KCCM10741P-RS1 strain constructed in Example 6 was inoculated into a 250 mL corner-baffled flask containing 25 mL of the following seed medium and shake-cultured at 200 rpm at 30° C. for 20 hours. Next, 1 mL of each of the seed cultures was inoculated into a 250 mL corner-baffle flask containing 24 mL of the following production medium and shake-cultured at 200 rpm at 30° C. for 72 hours. The composition of the seed medium and the composition of the production medium were as follows.
<Seed Medium (pH 7.0)>
20 g glucose, 10 g peptone, 5 g yeast extract, 1.5 g urea, 4 g KH2PO4, 8 g K2HPO4, 0.5 g MgSO4·7H2O, 100 μg biotin, 1 mg thiamine HCl, 2 mg calcium pantothenate, 2 mg nicotinamide (per liter of distilled water)
<Production Medium (pH 7.0)>
6% glucose, 3% ammonium sulfate, 0.1% monopotassium phosphate, 0.2% magnesium sulfate heptahydrate, 1.5% corn steep liquor (CSL), 1% NaCl, 0.5% yeast extract, 100 mg/L biotin (per liter of distilled water)
After completion of the culturing, the amount of L-arginine produced was measured by HPLC, and the concentration of L-arginine analyzed is shown in Table 3 below.
TABLE 3
Analysis of L-arginine productivity of Corynebacterium glutamicum
KCCM10741P in which the gene comprising the nucleotide
sequence of SEQ ID NO: 2 is deleted
L-Arginine (g/L)
Strains Batch 1 Batch 2 Batch 3 Average
KCCM10741P 3.0 3.1 3.1 3.06
KCCM10741P-RS1 3.8 3.9 3.8 3.83
Based on the results above, it was confirmed that KCCM10741P-RS1, in which the gene is deleted from Corynebacterium glutamicum KCCM10741P (i.e., the L-arginine-producing strain), had the L-arginine productivity which is increased by 25% on average compared to the parent strain.
The KCCM10741P-RS1 strain was named “CA06-2830”, and was deposited to the Korean Culture Center of Microorganisms (KCCM), which is an international depositary authority under the Budapest Treaty, on Dec. 15, 2017, and assigned Accession No. KCCM12187P.
Therefore, it was confirmed that the L-arginine productivity could be improved by deleting the gene comprising the nucleotide sequence of SEQ ID NO: 2 from the microorganism of the genus Corynebacterium.
Example 7: Construction of Recombinant Vector for Attenuating the Gene
Comprising the Nucleotide Sequence of SEQ ID NO: 2
In order to construct a recombinant vector capable of attenuating the gene comprising the nucleotide sequence of SEQ ID NO: 2 on the chromosome of the strain of the genus Corynebacterium, the initiation codon of the gene was replaced from ATG to TTG to attenuate the gene. Further, in order to construct a fragment therefor, primer 3 and primers 7 to 9 shown in Table 4 below were synthesized.
TABLE 4 
Gene Primers used Nucleotide sequences
SEQ ID Primer 3  CCGCTCGAGACATCGAAATCGTA
NO: 2 (SEQ ID NO: 5) AGGGTA
Primer 7  GATCCACAGTCCCAATATTCTCG
(SEQ ID NO: 9) CTTCTTC
Primer 8  GAAGAAGCGAGAATATTGGGAC
(SEQ ID NO: 10) TGTGGATC
Primer 9  CCGCTCGAGCAGCATTGACAAGC
(SEQ ID NO: 11) AGTTCT
In order to amplify the ORF region (SEQ ID NO: 2) of the gene, primer 3 (SEQ ID NO: 5), primer 7 (SEQ ID NO: 9), primer 8 (SEQ ID NO: 10), and primer 9 (SEQ ID NO: 11) were synthesized so that an XhoI restriction enzyme site is present at both the 5′ terminus and the 3′ terminus. PCR was carried out with the chromosomal DNA of Corynebacterium glutamicum KCCM10741P as a template using primer 3, primer 7, primer 8, and primer 9. Herein, after denaturation at 95° C. for 5 minutes, PCR was carried out for a total of 30 cycles under the following conditions: denaturation at 94° C. for 30 seconds, annealing at 56° C. for 30 seconds, and polymerization at 72° C. for 1 minute. Thereafter, the polymerization reaction was carried out at 72° C. for 7 minutes. Next, a pDZ vector (Korean Patent No. 10-0924065), which is not replicable in Corynebacterium glutamicum, was treated with an XhoI restriction enzyme, and then the obtained PCR product was fusion-cloned. The fusion cloning was carried out using an In-Fusion® HD Cloning Kit (Clontech). Thereafter, the resultant was transformed into E. coli DH5α, and then plated on an LB solid medium containing kanamycin (25 mg/L).
A colony transformed with a plasmid having the desired gene inserted therein was selected by PCR, and then the plasmid was isolated using a plasmid extraction technique. The plasmid was named “pDZ-ΔRS2”.
Example 8: Construction of Corynebacterium glutamicum KCCM10741P in which the Gene Comprising the Nucleotide Sequence of SEQ ID NO: 2 is Attenuated, and Evaluation of L-Arginine Productivity of the Constructed Strain
The recombinant plasmid pDZ-ΔRS2 prepared in Example 7 was transformed into Corynebacterium glutamicum KCCM10741P, which is an L-arginine-producing strain, by homologous recombination on the chromosome (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999).
Next, the transformant was grown on a solid medium plate containing 4% sucrose to allow a second recombination to take place. The nucleotide sequence of the transformed Corynebacterium glutamicum strain obtained after the second recombination was analyzed using primer 3 and primer 9 to identify the strain in which the initiation codon of the gene comprising the nucleotide sequence of SEQ ID NO: 2 is substituted with TTG. The recombinant strain was named “Corynebacterium glutamicum KCCM10741P-R52”.
Each of the parent strain Corynebacterium glutamicum KCCM10741P and the Corynebacterium glutamicum KCCM10741P-RS2 strain constructed above was cultured in the same manner as in Example 6 in order to analyze the L-arginine productivity. Thereafter, the amount of L-arginine produced was measured by HPLC, and the concentration of L-arginine analyzed is shown in Table 5 below.
TABLE 5
Analysis of L-arginine productivity of Corynebacterium glutamicum
KCCM10741P in which the gene comprising the nucleotide
sequence of SEQ ID NO: 2 is attenuated
L-Arginine (g/L)
Strains Batch 1 Batch 2 Batch 3 Average
KCCM10741P 4.2 4.2 4.1 4.17
KCCM10741P-RS2 4.6 4.8 4.6 4.67
As shown in the results above, it was confirmed that when the gene comprising the nucleotide sequence of SEQ ID NO: 2 was attenuated in the L-arginine-producing strain KCCM10741P, the L-arginine productivity of the strain was increased by 12% on average.
Therefore, it was confirmed that the L-arginine productivity could be improved by attenuating the expression of the gene comprising the nucleotide sequence of SEQ ID NO: 2 in the microorganism of the genus Corynebacterium.
From the above results, it can be seen that in the strain in which the gene comprising the nucleotide sequence of SEQ ID NO: 2 is deleted or attenuated, the L-arginine productivity is increased, and this suggests that L-arginine can be mass-produced in the microorganism when the activity of the protein encoded by the gene is inactivated.
While the present disclosure has been described with reference to the particular illustrative embodiments, it will be understood by those skilled in the art to which the present disclosure pertains that the present disclosure may be embodied in other specific forms without departing from the technical spirit or essential characteristics of the present disclosure. Therefore, the embodiments described above are considered to be illustrative in all respects and not restrictive. Furthermore, the scope of the present disclosure is defined by the appended claims rather than the detailed description, and it should be understood that all modifications or variations derived from the meanings and scope of the present disclosure and equivalents thereof are included in the scope of the appended claims.
Accession Number
Depositary Institution: Korean Culture Center of Microorganisms (KCCM) (International Depositary Authority)
Accession Number: KCCM12187P
Date of Deposit: Dec. 15, 2017

Claims (6)

The invention claimed is:
1. A microorganism obtained from Corynebacterium glutamicum that produces L-arginine, wherein the microorganism is modified by inactivation of an endogenous protein comprising the amino acid sequence of SEQ ID NO: 1, and wherein the modified microorganism has increased production of L-arginine.
2. The microorganism of claim 1, wherein the protein is encoded by a gene consisting of a nucleotide sequence of SEQ ID NO: 2.
3. A method for producing L-arginine, comprising:
culturing the microorganism of claim 1 in a medium.
4. The method for producing L-arginine of claim 3, further comprising:
recovering L-arginine from the microorganism or the medium.
5. A method for producing L-arginine, comprising:
culturing the microorganism of claim 2 in a medium.
6. The method for producing L-arginine of claim 5, further comprising: recovering L-arginine from the microorganism or the medium.
US16/461,490 2017-12-19 2018-12-18 Microorganism of genus Corynebacterium producing L-arginine and method for producing L-arginine using the same Active US11345940B2 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
KR1020170175046A KR101999454B1 (en) 2017-12-19 2017-12-19 A microorganism of corynebacterium genus having L-arginine productivity and method for producing L-arginine using the same
KR10-2017-0175046 2017-12-19
PCT/KR2018/016115 WO2019124932A2 (en) 2017-12-19 2018-12-18 Corynebacterium sp. microorganism producing l-arginine and l-arginine production method using same

Publications (2)

Publication Number Publication Date
US20210139937A1 US20210139937A1 (en) 2021-05-13
US11345940B2 true US11345940B2 (en) 2022-05-31

Family

ID=66994823

Family Applications (1)

Application Number Title Priority Date Filing Date
US16/461,490 Active US11345940B2 (en) 2017-12-19 2018-12-18 Microorganism of genus Corynebacterium producing L-arginine and method for producing L-arginine using the same

Country Status (17)

Country Link
US (1) US11345940B2 (en)
EP (1) EP3546581B1 (en)
JP (1) JP6806895B2 (en)
KR (1) KR101999454B1 (en)
CN (1) CN110234767B (en)
AR (1) AR114561A1 (en)
AU (1) AU2018353929B2 (en)
BR (1) BR112019015993B1 (en)
CL (1) CL2019002319A1 (en)
IL (1) IL266290B2 (en)
MX (1) MX383967B (en)
MY (1) MY204785A (en)
PE (1) PE20191702A1 (en)
PH (1) PH12019500940A1 (en)
RU (1) RU2716573C1 (en)
TW (1) TWI736816B (en)
WO (1) WO2019124932A2 (en)

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20220139085A (en) * 2021-04-07 2022-10-14 씨제이제일제당 (주) A genus of Corynebacterium microorganism for producing L- arginine and a method for producing L-arginine using the same
KR102734703B1 (en) * 2021-10-15 2024-11-26 씨제이제일제당 주식회사 A genus of Corynebacterium microorganism for producing L- arginine and a method for producing L-arginine using the same
KR102778373B1 (en) * 2022-01-03 2025-03-11 전남대학교 산학협력단 A gene of cold shock protein from Bacillus sp. and production of L-arginine by recombinant Corynebacterium glutamicum with the gene
KR102778362B1 (en) * 2022-01-03 2025-03-11 전남대학교 산학협력단 A gene of cold shock protein from Bacillus butanolivorans and production of L-arginine by recombinant Corynebacterium glutamicum with the gene
KR20240177871A (en) * 2023-06-20 2024-12-30 씨제이제일제당 (주) Microorganisms for producing l-citrulline and process for producing l-citrulline using the same
KR20250075805A (en) * 2023-11-21 2025-05-29 대상 주식회사 A microorganism of Corynebacterium genus having enhanced L-amino acid productivity and a method for producing L-amino acid using the same

Citations (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3878044A (en) 1972-10-09 1975-04-15 Ajinomoto Kk Method of producing L-arginine by fermentation
EP1108790A2 (en) 1999-12-16 2001-06-20 Kyowa Hakko Kogyo Co., Ltd. Novel polynucleotides
US20020045223A1 (en) 2000-04-28 2002-04-18 Ajinomoto Co., Inc. Arginine repressor deficient strain of coryneform bacterium and method for producing L-arginine
WO2007037503A1 (en) 2005-09-27 2007-04-05 Ajinomoto Co., Inc. An l-amino acid-producing bacterium and a method for producing an l-amino acid
KR100791659B1 (en) 2006-07-13 2008-01-03 씨제이 주식회사 Microorganisms Producing Arginine and Method of Making L-Arginine Using the Same
KR100924065B1 (en) 2006-09-15 2009-10-27 씨제이제일제당 (주) A corynebacteria having enhanced L-lysine productivity and a method of producing L-lysine using the same
US8993272B2 (en) 2009-04-01 2015-03-31 Cj Cheiljedang Corporation Microorganisms of Corynebacterium with improved 5′-inosinic acid productivity, and method for producing nucleic acids using same
WO2015165740A2 (en) 2014-04-30 2015-11-05 Evonik Degussa Gmbh Method for producing l-amino acids in corynebacteria using a glycine cleavage system
US20170226545A1 (en) 2014-10-13 2017-08-10 Cj Cheiljedang Corporation A microorganism of genus corynebacterium having an ability to produce l-arginine and a method for producing l-arginine using the same
US10870871B2 (en) * 2017-06-14 2020-12-22 Cj Cheiljedang Corporation Polypeptide and method for producing ornithine-based product using the same

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP4745753B2 (en) * 2005-08-09 2011-08-10 財団法人地球環境産業技術研究機構 Method for producing amino acids under reducing conditions using coryneform bacteria
EP2674499B1 (en) * 2011-02-09 2020-04-01 Kyowa Hakko Bio Co., Ltd. Method for producing target substance by fermentation process
RU2496867C2 (en) * 2011-04-25 2013-10-27 Закрытое акционерное общество "Научно-исследовательский институт Аджиномото-Генетика" (ЗАО "АГРИ") Method to produce l-amino acid of glutamate family using coryneformic bacterium
CN104271754A (en) * 2012-04-13 2015-01-07 协和发酵生化株式会社 Method for producing amino acid
KR101481782B1 (en) * 2012-12-28 2015-01-13 대상 주식회사 Mutant Strain with improved Amino acid production by inactivating GOGAT
KR101500073B1 (en) * 2013-04-23 2015-03-06 씨제이제일제당 (주) Microorganism of the genus corynebacterium with enhanced l-arginine productivity and method for producing l-arginine using the same
KR101574233B1 (en) * 2013-12-26 2015-12-07 대상 주식회사 Mutant Strain with improved Amino acid production by inactivating isocitrate lyase
KR101694811B1 (en) * 2015-07-15 2017-01-13 대상 주식회사 Mutant Strain with improved Amino acid production by inactivating malic enzyme or lactate dehydrogenase

Patent Citations (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3878044A (en) 1972-10-09 1975-04-15 Ajinomoto Kk Method of producing L-arginine by fermentation
EP1108790A2 (en) 1999-12-16 2001-06-20 Kyowa Hakko Kogyo Co., Ltd. Novel polynucleotides
US20020045223A1 (en) 2000-04-28 2002-04-18 Ajinomoto Co., Inc. Arginine repressor deficient strain of coryneform bacterium and method for producing L-arginine
WO2007037503A1 (en) 2005-09-27 2007-04-05 Ajinomoto Co., Inc. An l-amino acid-producing bacterium and a method for producing an l-amino acid
KR101102263B1 (en) 2005-09-27 2012-01-03 아지노모토 가부시키가이샤 L-amino acid producing bacteria and L-amino acid production method
KR100791659B1 (en) 2006-07-13 2008-01-03 씨제이 주식회사 Microorganisms Producing Arginine and Method of Making L-Arginine Using the Same
US8034602B2 (en) 2006-07-13 2011-10-11 Cj Cheiljedang Corporation Method for producing L-arginine using Corynebacterium glutamicum
KR100924065B1 (en) 2006-09-15 2009-10-27 씨제이제일제당 (주) A corynebacteria having enhanced L-lysine productivity and a method of producing L-lysine using the same
US8993272B2 (en) 2009-04-01 2015-03-31 Cj Cheiljedang Corporation Microorganisms of Corynebacterium with improved 5′-inosinic acid productivity, and method for producing nucleic acids using same
WO2015165740A2 (en) 2014-04-30 2015-11-05 Evonik Degussa Gmbh Method for producing l-amino acids in corynebacteria using a glycine cleavage system
US20170226545A1 (en) 2014-10-13 2017-08-10 Cj Cheiljedang Corporation A microorganism of genus corynebacterium having an ability to produce l-arginine and a method for producing l-arginine using the same
US10870871B2 (en) * 2017-06-14 2020-12-22 Cj Cheiljedang Corporation Polypeptide and method for producing ornithine-based product using the same

Non-Patent Citations (12)

* Cited by examiner, † Cited by third party
Title
Gerhardt et a, Manual of Methods for General Bacteriology by the American Society for Bacteriology, Washington D.C., USA, 1981, 1 page.
Ghochikyan et al, Arginine Operator Binding by Heterologous and Chimeric ArgR Repressors from Escherichia coli and Bacillus stearothermophilus, J Bacteriol. Dec. 2002; vol. 184 No. 23, pp. 6602-6614, 13 pages.
International Search Report, Corynebacterium sp. Microorganism Producing L-Arginine and L-Arginine Production Method Using Same, WO2019/124932A3, Jun. 27, 2019, CJ Cheiljedang Corpration, mailing date of ISR May 23, 2019, 5 pages including English Translation.
Karlin and Altschul, Applications and statistics for multiple high-scoring segments in molecular sequences Pro. Natl. Acad. Sci. USA, 90, pp. 5873-5877, Jun. 1993, 5 pages.
Lipman and Pearson, Rapid and Sensitive Sequence Comparison with FASTP and FASTA, Methods in Enzymology, vol. 183, p. 63-98, Copyright 1990, 36 pages.
M.E. Van Der Rest er al., A heat shock following electroporation induces highly efficient transformation of Corynebacterium glutamicum with xenogeneic plasmid DNA, Appl. Microbiol. Biotechnol. (1999) 52:541-545, 5 pages.
Moore S., Stein W. H., Photometric ninhydrin method for use in the chromatography of amino acids. J. Biol. Chem. Jun. 8, 1948, 176, 367-388, 23 pages.
Nishio, Y., et al., Corynebacterium glutamicum DNA, complete genome, strain: AJ1511, GenBank: APO17557.2, Jun. 17, 2017, National Center for Biotechnology Information, U.S. National Library of Medicine, Bethesda, Maryland, 2 pages.
Nishio, Y., et al., UPF0272 protein cgR_2381 [Corynebacterium glutamicum], GenBank: BAV24083.1, Jun. 17, 2017, National Center for Biotechnology Information, U.S. National Library of Medicine, Bethesda, Maryland, 575 pages.
Office Action dated Dec. 7, 2021 for Indian Appn. No. 201937026262, 7 pgs.
Seok Hyun Park et al., Metabolic engineering of Corynebacterium glutamicum for L-arginine production, Nature Communications, Aug. 5, 2014, pp. 1-9, vol. 5, Macmillan Publishers Limited, London, United Kingdom, 9 pages.
Vehary Sakanyan et al., Genes and enzymes of the acetyl cycle of arginine biosynthesis in Corynebacterium glutamicum: enzyme evolution in the early steps of the arginine pathway, Microbiology, 142:9-108, 1996, 10 pages.

Also Published As

Publication number Publication date
CN110234767B (en) 2023-10-20
BR112019015993B1 (en) 2024-01-23
CL2019002319A1 (en) 2020-01-03
WO2019124932A3 (en) 2019-08-15
MX2019009383A (en) 2020-02-12
EP3546581A2 (en) 2019-10-02
KR101999454B1 (en) 2019-07-11
PH12019500940A1 (en) 2019-12-02
WO2019124932A2 (en) 2019-06-27
CN110234767A (en) 2019-09-13
JP2020504598A (en) 2020-02-13
KR20190073844A (en) 2019-06-27
MX383967B (en) 2025-03-14
BR112019015993A2 (en) 2020-05-26
AU2018353929A1 (en) 2019-07-04
TW201940699A (en) 2019-10-16
AU2018353929B2 (en) 2021-08-05
IL266290B2 (en) 2023-06-01
MY204785A (en) 2024-09-12
TWI736816B (en) 2021-08-21
AR114561A1 (en) 2020-09-23
JP6806895B2 (en) 2021-01-06
EP3546581B1 (en) 2026-04-01
PE20191702A1 (en) 2019-11-27
RU2716573C1 (en) 2020-03-12
US20210139937A1 (en) 2021-05-13
EP3546581A4 (en) 2020-08-26
IL266290A (en) 2019-07-31

Similar Documents

Publication Publication Date Title
US11345940B2 (en) Microorganism of genus Corynebacterium producing L-arginine and method for producing L-arginine using the same
AU2019212400B8 (en) Microorganism Of Genus Corynebacterium For Producing L-Amino Acid And Method For Producing L-Amino Acid By Using Same
KR101835935B1 (en) A microorganism of genus corynebacterium having an ability to produce L-arginine and a method for producing L-arginine using the same
JP6297134B2 (en) Microorganism having putrescine productivity and putrescine production method using the same
KR101766964B1 (en) A microorganism of corynebacterium genus having L-lysine productivity and method for producing L-lysine using the same
KR102269639B1 (en) Mutant of Corynebacterium glutamicum with enhanced L-glutamic acid productivity and method for preparing L-glutamic acid using the same
US11104925B2 (en) Microorganism producing L-lysine and method for producing L-lysine using the same
KR101740807B1 (en) A microorganism of corynebacterium genus having L-lysine productivity and method for producing L-lysine using the same
EP4269598A1 (en) Microorganism of genus corynebacterium, producing l-amino acids, and method for producing l-amino acids using same
WO2008088149A1 (en) Corynebacterium glutamicum variety producing l-arginine and method for fabricating the same
EP3106516A1 (en) Recombinant microorganism of genus escherichia with l-threonine productivity, and method for producing l-threonine using same
HK40013311A (en) Microorganism of genus corynebacterium producing l-arginine and method for producing l-arginine using the same
HK40013311B (en) Microorganism of genus corynebacterium producing l-arginine and method for producing l-arginine using the same

Legal Events

Date Code Title Description
FEPP Fee payment procedure

Free format text: ENTITY STATUS SET TO UNDISCOUNTED (ORIGINAL EVENT CODE: BIG.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

AS Assignment

Owner name: CJ CHEILJEDANG CORPORATION, KOREA, REPUBLIC OF

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:KIM, SEON HYE;KIM, HYUNG JOON;OH, HAENA;AND OTHERS;REEL/FRAME:049480/0305

Effective date: 20190514

STPP Information on status: patent application and granting procedure in general

Free format text: RESPONSE TO NON-FINAL OFFICE ACTION ENTERED AND FORWARDED TO EXAMINER

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION MAILED

STPP Information on status: patent application and granting procedure in general

Free format text: RESPONSE TO NON-FINAL OFFICE ACTION ENTERED AND FORWARDED TO EXAMINER

STPP Information on status: patent application and granting procedure in general

Free format text: NOTICE OF ALLOWANCE MAILED -- APPLICATION RECEIVED IN OFFICE OF PUBLICATIONS

STPP Information on status: patent application and granting procedure in general

Free format text: PUBLICATIONS -- ISSUE FEE PAYMENT VERIFIED

STCF Information on status: patent grant

Free format text: PATENTED CASE

MAFP Maintenance fee payment

Free format text: PAYMENT OF MAINTENANCE FEE, 4TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1551); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

Year of fee payment: 4