US11147829B2 - Inhibition of expansion and function of pathogenic age-associated B cells and use for the prevention and treatment of autoimmune disease - Google Patents

Inhibition of expansion and function of pathogenic age-associated B cells and use for the prevention and treatment of autoimmune disease Download PDF

Info

Publication number
US11147829B2
US11147829B2 US16/523,055 US201916523055A US11147829B2 US 11147829 B2 US11147829 B2 US 11147829B2 US 201916523055 A US201916523055 A US 201916523055A US 11147829 B2 US11147829 B2 US 11147829B2
Authority
US
United States
Prior art keywords
cells
dko
abcs
irf5
mice
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
US16/523,055
Other versions
US20200188422A1 (en
Inventor
Alessandra Pernis
Michela Manni
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
New York Society for Relief of Ruptured and Crippled
Original Assignee
New York Society for Relief of Ruptured and Crippled
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by New York Society for Relief of Ruptured and Crippled filed Critical New York Society for Relief of Ruptured and Crippled
Priority to US16/523,055 priority Critical patent/US11147829B2/en
Assigned to NEW YORK SOCIETY FOR THE RUPTURED AND CRIPPLED MAINTAINING THE HOSPITAL FOR SPECIAL SURGERY reassignment NEW YORK SOCIETY FOR THE RUPTURED AND CRIPPLED MAINTAINING THE HOSPITAL FOR SPECIAL SURGERY ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: MANNI, MICHELA, PERNIS, ALESSANDRA
Publication of US20200188422A1 publication Critical patent/US20200188422A1/en
Priority to US17/459,213 priority patent/US11857563B2/en
Application granted granted Critical
Publication of US11147829B2 publication Critical patent/US11147829B2/en
Assigned to NEW YORK SOCIETY FOR THE RELIEF OF THE RUPTURED AND CRIPPLED, MAINTAINING THE HOSPITAL FOR SPECIAL SURGERY reassignment NEW YORK SOCIETY FOR THE RELIEF OF THE RUPTURED AND CRIPPLED, MAINTAINING THE HOSPITAL FOR SPECIAL SURGERY CORRECTIVE ASSIGNMENT TO CORRECT THE NAME OF THE ASSIGNEE PREVIOUSLY RECORDED ON REEL 049870 FRAME 0650. ASSIGNOR(S) HEREBY CONFIRMS THE ASSIGNEE NAME IS NEW YORK SOCIETY FOR THE RELIEF OF THE RUPTURED AND CRIPPLED, MAINTAINING THE HOSPITAL FOR SPECIAL SURGERY. Assignors: MANNI, MICHELA, PERNIS, ALESSANDRA
Priority to US18/511,908 priority patent/US20240131050A1/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/7105Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P5/00Drugs for disorders of the endocrine system
    • A61P5/48Drugs for disorders of the endocrine system of the pancreatic hormones
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/30Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
    • C07K16/3061Blood cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/12Type of nucleic acid catalytic nucleic acids, e.g. ribozymes
    • C12N2310/122Hairpin
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • C12N2310/141MicroRNAs, miRNAs
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications

Definitions

  • This invention relates to the field of preventing and treating autoimmune and lymphoproliferative disease by targeting pathogenic age-associated B cells as well as methods of detecting these pathogenic age-associated B cells as a method of diagnosing and predicting autoimmune disease and other lymphoproliferative and chronic inflammatory disorders.
  • the invention also provides targets for drug development and basic research for autoimmune diseases and other lymphoproliferative and chronic inflammatory disorders.
  • Autoimmune diseases such as systemic lupus erythematosus (SLE), also known as lupus, occur when the immune system of a vertebrate attacks the tissue of self rather than an infectious agent.
  • SLE systemic lupus erythematosus
  • Other autoimmune illnesses include rheumatoid arthritis, inflammatory bowel disease, and Type 1 diabetes.
  • Autoimmune disorders can furthermore be associated with the development of lymphoproliferative disorders such as lymphomas.
  • T and B cell subsets Precise regulation of the expansion and function of T and B cell subsets is critical for the prevention of autoimmune disorders like SLE, a disease which preferentially affects females (Eisenberg 2003; Cohen-Solal and Diamond 2011).
  • Murine studies have recently uncovered the existence of a unique subset of B cells termed age/autoimmunity-associated B cells (ABCs) that preferentially expands in females with age.
  • ABSs age/autoimmunity-associated B cells
  • B220 and CD19 In addition to classical B cell markers like B220 and CD19, ABCs can also express markers such as CD11c and CD11b and are known to require T-bet for their generation. Formation of ABCs is promoted by TLR7/9 engagement and cytokines like IFN ⁇ and IL-21.
  • ABCs increase prematurely in murine models of lupus and can produce anti-chromatin antibodies.
  • B cells with features similar to ABCs have also been detected in human autoimmune disorders including SLE.
  • ABCs characteristically express T-bet and their generation depends on this transcription factor, hence, these cells are also known as CD11c+Tbet+ B cells (Naradikian et al. 2016a; Naradikian et al. 2016; Rubtsova et al. 2017).
  • the molecular pathways that promote the expansion and pathogenic function of ABCs in autoimmune settings are largely unknown.
  • IRF4 Interferon Regulatory Factor
  • the SWEF family is a small family of proteins comprised of SWAP-70 and its homolog, DEF6 (Gupta et al. 2003; Tanaka et al. 2003; Ripich et al 2003).
  • these proteins also control the cytoskeletal dynamics of T and B cells by regulating the activation of Rho GTPases (Biswas et al. 2010).
  • the SWEF proteins play an important immunoregulatory role in vivo as evidenced by the finding that the simultaneous lack of DEF6 and SWAP-70 (in Doubleknockout DKO mice) leads to the development of SLE in C57BL/6 mice, which, similarly to human SLE, preferentially affects females (Biswas et al. 2012).
  • the development of autoimmunity in DKO mice is associated with dysregulation of both T and B cell compartments including expansion of T FH cells, increased IL-21 production, and enhanced formation of germinal centers, and plasma cells (Biswas et al. 2012).
  • the DEF6 locus has recently been identified as a genetic risk factor for human SLE (Sun et al. 2016).
  • the current invention is based on the discovery that age-associated B cells (“ABCs”) expand and become pathogenic (“pathogenic ABCs) upon interaction of certain proteins.
  • ABCs age-associated B cells
  • pathogenic ABCs pathogenic ABCs
  • IRF5 interferon regulatory factor 5
  • the aberrant expansion of ABCs is abolished or decreased by two proteins in the SWEF family, SWAP-70 and DEF6.
  • One embodiment of the current invention is a method of abolishing or decreasing pathogenic ABCs in a subject in need thereof by administering an effective amount of an agent that agonizes, activates or increases the expression and/or activity of SWAP-70 and DEF6.
  • a further embodiment of the current invention is a method of preventing and/or treating an autoimmune or lymphoproliferative disease by abolishing or decreasing pathogenic ABCs in a subject in need thereof by administering an effective amount of an agent that agonizes, activates or increases the expression and/or activity of SWAP-70 and DEF6.
  • Another embodiment of the current invention is a method of abolishing or decreasing pathogenic ABCs in a subject in need thereof by administering an effective amount of an agent that antagonizes, inhibits or reduces the expression and/or activity of IRF5.
  • a further embodiment of the current invention is a method of preventing and/or treating an autoimmune or lymphoproliferative disease by abolishing or decreasing pathogenic ABCs in a subject in need thereof by administering an effective amount of an agent that antagonizes, inhibits or decreases the expression and/or activity of IRF5.
  • Another embodiment of the current invention is a method of abolishing or decreasing pathogenic ABCs in a subject in need thereof by administering an effective amount of an agent that antagonizes, inhibits or reduces the expression of certain genes that are upregulated in pathogenic ABCs.
  • a further embodiment of the current invention is a method of preventing and/or treating an autoimmune or lymphoproliferative disease by abolishing or decreasing pathogenic ABCs in a subject in need thereof by administering an effective amount of an agent that antagonizes, inhibits or decreases the expression of certain genes that are upregulated in pathogenic ABCs.
  • a further embodiment of the current invention is a method of abolishing or decreasing pathogenic ABCs in a subject in need thereof by administering an effective amount of an agent that agonizes, activates or increases the number or expression of certain genes that are downregulated in pathogenic ABCs.
  • Yet a further embodiment of the current invention is a method of preventing and/or treating an autoimmune or lymphoproliferative disease by abolishing or decreasing pathogenic ABCs in a subject in need thereof by administering an effective amount of an agent that agonizes, activates or increases the number or expression of certain genes that are downregulated in pathogenic ABCs.
  • a further embodiment of the invention is a method of preventing and/or treating an autoimmune disease in a subject in need thereof by administering an effective amount of an agent that antagonizes or inhibits the ability of pathogenic ABCs to differentiate into plasma cells.
  • the autoimmune disease is systemic lupus erythematosus, rheumatoid arthritis, type 1 diabetes, multiple sclerosis, myasthenia gravis, Graves disease, pernicious anemia, scleroderma, psoriasis, inflammatory bowel diseases, Hashimoto's disease, Addison's disease, and Sjögren's syndrome.
  • the lymphoproliferative disease is Hodgkin's lymphoma or non-Hodgkin's lymphoma.
  • a further embodiment of the current invention is a method of detecting pathogenic ABCs.
  • the detection of pathogenic ABCs makes it possible to diagnose that a subject has an autoimmune or lymphoproliferative disease or predict that a subject will develop an autoimmune or lymphoproliferative disease.
  • a method for detecting pathogenic ABCs comprises obtaining a sample from a subject and detecting the presence of pathogenic ABCs, wherein the pathogenic ABCs comprise B cells that express CD11c, as well as additional markers such as B220, CD86, MHCII and IgM, but downregulate CD5.
  • the presence of the pathogenic ABCs can also be detected by detecting the expression of one or more genes as compared to a reference value of the expression of the same genes in ABCs that are not pathogenic or the same genes in other non-pathogenic B cells, such as follicular B cells.
  • the expression of the genes from the pathogenic ABCs from a subject with a suspected autoimmune or lymphoproliferative disease can be compared to a reference value of the expression of the same genes in non-pathogenic ABCs or other B cells from a healthy donor or control.
  • the levels of expressed genes may be measured as absolute or relative. Absolute quantitation measure concentrations of specific RNA and requires a calibration curve. Relative quantification measures fold change differences of specific RNA in comparison to housekeeping genes. Relative quantification is usually adequate to investigate physiological changes in gene expression levels.
  • a further embodiment of the invention is abolishing or decreasing the pathogenic ABCs, by the methods set forth herein.
  • a further embodiment of the current invention is a method of evaluating or monitoring subjects with an autoimmune or lymphoproliferative disease for their response to treatment by the detection of pathogenic ABCs.
  • a method for detecting pathogenic ABCs comprises obtaining a sample from a subject, isolating B cells and detecting the presence of pathogenic ABCs, wherein the pathogenic ABCs comprise B cells that express cell markers CD11c, and additional markers such as B220, CD86, MHC11 and IgM, but downregulate CD5.
  • the presence of the pathogenic ABCs can also be detected by detecting the expression of one or more genes, as compared to the expression of the same genes in ABCs that are not pathogenic or the same genes in other B cells. In this method, the expression of the genes from the cells of the subject are compared before and after treatment.
  • the present invention also provides for methods and tools for drug design, testing of agents, and tools for basic research into the causes and etiology of pathogenic ABCs, and autoimmune or lymphoproliferative disease.
  • a further embodiment of the present invention is a method and/or assay for identifying a test agent for abolishing or decreasing pathogenic ABCs comprising contacting or incubating a test agent with a nucleotide comprising the gene for SWAP-70 or DEF6 which expresses a measurable phenotype, and measuring the phenotype before and after contact or incubation with the test agent, wherein if the expression of the measurable phenotype is increased after the contact or incubation with the test agent, the test agent is identified as an agent that can abolish or decrease pathogenic ABCs.
  • the measurable phenotype can be one that is native to the gene or one that is artificially linked, such as a reporter gene.
  • a further embodiment of the present invention is a method and/or assay for identifying a test agent for abolishing or decreasing pathogenic ABCs, comprising transforming a host cell with a gene construct comprising the gene for SWAP-70 or DEF6, detecting the expression of the gene in the host cell, contacting the test agent with the host cell, and detecting the expression of the gene from the host cell after contact with the test agent or compound, wherein if the expression of the gene is increased after contact with the test agent or compound, the test agent is identified as an agent that can abolish or decrease pathogenic ABCs.
  • One embodiment is a method and/or assay for identifying a test agent for abolishing or decreasing pathogenic ABCs, comprising contacting or incubating the test agent with IRF5, and detecting the presence of a complex between the test agent, wherein if a complex between the test agent and IRF5 is detected, the test agent is identified as an agent that can abolish or decrease pathogenic ABCs.
  • Another embodiment of the present invention is a method and/or assay for identifying a test agent for abolishing or decreasing pathogenic ABCs, comprising contacting or incubating the test agent with IRF5 and a known antibody of IRF5, and detecting the presence and quantity of unbound antibody, wherein the presence of the unbound antibody indicates that the test agent is binding to IRF5 and the test agent is identified as an agent that can abolish or decrease pathogenic ABCs.
  • a further embodiment of the present invention is a method and/or assay for identifying a test agent for abolishing or decreasing pathogenic ABCs comprising contacting or incubating a test agent to a nucleotide comprising the gene for IRF5, and determining if the test agent binds to the gene, wherein if the test agent binds to the nucleotide, the test agent is identified as an agent that can abolish or decrease pathogenic ABCs.
  • a further embodiment of the present invention is a method and/or assay for identifying a test agent for abolishing or decreasing pathogenic ABCs comprising contacting or incubating a test agent with a nucleotide comprising the gene for IRF5 which expresses a measurable phenotype, and measuring the phenotype before and after contact or incubation with the test agent, wherein if the expression of the measurable phenotype is decreased after the contact or incubation with the test agent, the test agent is identified as an agent that can abolish or decrease pathogenic ABCs.
  • the measurable phenotype can be one that is native to the gene or one that is artificially linked, such as a reporter gene.
  • One embodiment of the present invention is a method and/or assay for identifying a test agent for abolishing or decreasing pathogenic ABCs, comprising transforming a host cell with a gene construct comprising the gene for IRF5, detecting the expression of the gene in the host cell, contacting the test agent with the host cell, and detecting the expression of the gene from the host cell after contact with the test agent or compound, wherein if the expression of the gene is reduced or decreased after contact with the test agent or compound, the test agent is identified as an agent that can abolish or decrease pathogenic ABCs.
  • a further embodiment of the present invention is a method and/or assay for identifying a test agent for abolishing or decreasing pathogenic ABCs comprising contacting or incubating a test agent to a nucleotide comprising a gene that is upregulated in pathogenic ABCs, and determining if the test agent binds to the gene, wherein if the test agent binds to the nucleotide, the test agent is identified as an agent that can abolish or decrease pathogenic ABCs.
  • a further embodiment of the present invention is a method and/or assay for identifying a test agent for abolishing or decreasing pathogenic ABCs comprising contacting or incubating a test agent with a nucleotide comprising a gene that is upregulated in pathogenic ABCs which expresses a measurable phenotype, and measuring the phenotype before and after contact or incubation with the test agent, wherein if the expression of the measurable phenotype is decreased after the contact or incubation with the test agent, the test agent is identified as an agent that can abolish or decrease pathogenic ABCs.
  • the measurable phenotype can be one that is native to the gene or one that is artificially linked, such as a reporter gene.
  • a further embodiment of the present invention is a method and/or assay for identifying a test agent for abolishing or decreasing pathogenic ABCs, comprising transforming a host cell with a gene construct comprising a gene that is upregulated in pathogenic ABCs, detecting the expression of the gene in the host cell, contacting the test agent with the host cell, and detecting the expression of the gene from the host cell after contact with the test agent or compound, wherein if the expression of the gene is reduced or decreased after contact with the test agent or compound, the test agent is identified as an agent that can abolish or decrease pathogenic ABCs.
  • a further embodiment of the present invention is a method and/or assay for identifying a test agent for abolishing or decreasing pathogenic ABCs comprising contacting or incubating a test agent with a nucleotide comprising a gene that is downregulated in pathogenic ABCs which expresses a measurable phenotype, and measuring the phenotype before and after contact or incubation with the test agent, wherein if the expression of the measurable phenotype is increased after the contact or incubation with the test agent, the test agent is identified as an agent that can abolish or decrease pathogenic ABCs.
  • the measurable phenotype can be one that is native to the gene or one that is artificially linked, such as a reporter gene.
  • a further embodiment of the present invention is a method and/or assay for identifying a test agent for abolishing or decreasing pathogenic ABCs, comprising transforming a host cell with a gene construct comprising a gene that is downregulated in pathogenic ABCs, detecting the expression of the gene in the host cell, contacting the test agent with the host cell, and detecting the expression of the gene from the host cell after contact with the test agent or compound, wherein if the expression of the gene is increased after contact with the test agent or compound, the test agent is identified as an agent that can abolish or decrease pathogenic ABCs.
  • test agent identified by these methods and assays would be useful in preventing and/or treating an autoimmune or lymphoproliferative disease.
  • the present invention also includes kits.
  • FIG. 1 shows the result showing the spontaneous expansion of ABCs in DKO mice.
  • FACS flow cytometric analysis
  • FIG. 1C is representative FACS plots and graphs for CD11b and CD11c expression after gating on B220+CD19+ cells in the spleens of 10 weeks old WT and DKO female mice.
  • FIG. 1D is representative FACS plots and graphs for CD11c and CD11b expression gated on B220+CD19+ cells in the spleens of WT, DKO, Def6ko and Swap70ko female mice (18-24 weeks old).
  • FIG. 1D is representative FACS plots and graphs for CD11c and CD11b expression gated on B220+CD19+ cells in the spleens of WT,
  • FIG. 1E are histograms that show relative expression (percentage) of the indicated marker on CD11c+CD11b+B220+CD19+ and CD11c ⁇ CD11b ⁇ B220+CD19+ cells in the spleens of
  • 1G are graphs of the levels of anti-dsDNAIgG2c, anti-nRNP, and anti-Cardiolipin IgG antibodies in the supernatants of sorted ABC (CD11c+CD11b+B220+CD19+) and FoB (CD11c ⁇ CD11b ⁇ CD23+B220+CD19+) B cells stimulated in vitro ⁇ 1 ⁇ g/ml imiquimod for 7 days as measured by ELISA (representative of 4 independent experiments). Mean ⁇ SEM is shown. ***: p ⁇ 0.001 (One-way ANOVA).
  • FIG. 2 shows the results that IL-21 regulates the generation of DKO ABCs in vitro and in vivo.
  • FIG. 2A is representative FACS plots and graph of the generation of ABCs (CD11c+T-bet+B220+) from cultures of CD23+ B cells purified from WT and DKO female mice (8-10 weeks of age) stimulated with ⁇ IgM and ⁇ CD40, alone or with IL-21 or imiquimod for 3 days.
  • Graph shows frequencies of cells in mice as combined results of 5 independent experiments. Mean ⁇ SEM is shown. ****: p ⁇ 0.0001. (One-way ANOVA).
  • FIG. 2B is representative FACs plots and graph of generation of ABCs (CD11c+CD11b+B220+) B cells from cultures of CD23+ B cells purified from WT and DKO female mice (8-10 weeks of age) stimulated with ⁇ IgM and ⁇ CD40 (5 ⁇ g/ml), alone or with IL-21 or imiquimod. Graph shows frequencies of cells in mice as combined results of 5 independent experiments. ***: p ⁇ 0.001. (One-way ANOVA).
  • FIG. 2C is representative FACS plots and graphs of ABCs in the spleens from aging (greater than 24 weeks-old) wild type, DKO, or IL-21ko DKO female mice for CD11c and CD11b expression gated on B220+ cells.
  • FIG. 2D shows representative FACS plots and graphs of ABCs in the spleens from aging (greater than 24 weeks-old) wild type, DKO, or SAPko DKO female mice for CD11c and CD11b (left panels) expression gated on B220+ cells.
  • FIG. 3 shows the results showing differentially expressed genes in pathogenic ABCs.
  • FIG. 3B is a volcano plot of differentially expressed genes in FoB wild type and FoB DKO mice. Colors indicate differentially expressed genes (P value ⁇ 0.01, Fold change >2) belonging to selected GSEA Hallmark pathways as indicated.
  • FIG. 3C shows the results of flow cytometry analysis showing the proliferation of CD11c ⁇ T-bet ⁇ B220+ cells in the spleens of WT and DKO female mice (>23 weeks old, left panel) or of CD11c ⁇ T25 bet ⁇ B220+ cells and CD11c+T-bet+B220+ (ABCs) in the spleens of DKO female
  • FIG. 3F are graphs of cell viability of CD23+ B cells purified from WT and DKO female mice (6-9 weeks old) and stimulated with ⁇ IgM and ⁇ CD40, alone or with IL-21 or imiquimod for 3 or 5 days assessed by staining with CaspGlow orcpropidium iodide as indicated.
  • FIG. 3G is a volcano plot comparing gene expression in FoB (CD11c ⁇ CD11b ⁇ CD23+ B220+CD19+) and ABC (CD11c+CD11b+B220+CD19+) cells sorted from DKO female mice (>20 weeks old). Colors indicate differentially expressed genes (P value ⁇ 0.01, Fold change >2, DKOFoB/DKO ABC) belonging to selected GSEA pathways as indicated.
  • FIG. 3G is a volcano plot comparing gene expression in FoB (CD11c ⁇ CD11b ⁇ CD23+ B220+CD19+) and ABC (CD11c+CD11b+B220+CD19+) cells sorted
  • MsigDB GO_inflammatory_response gene set
  • 3I are graphs that show the results of qPCR analysis of the expression of Ccl5, Ifn ⁇ , and Cxcl10 mRNA in sorted FoB (B220+CD19+CD11c ⁇ CD11b ⁇ CD23+) cells from WT and DKO female mice and ABC (B220+CD19+CD11c+CD11b+) cells from DKO female mice as indicated.
  • the data were normalized relative to ppia mRNA expression.
  • Data are representative of 2 (Ccl5) or 3 (Ifn ⁇ and Cxcl10) independent experiments.
  • 3J are graphs of qPCR analysis of the expression of the indicated mRNA (gene) in FACS sorted FoB (B220+CD19+CD11c ⁇ CD11b ⁇ CD23+) cells from WT and DKO female mice and ABC (B220+CD19+CD11c+CD11b+) cells from DKO female mice. The data were normalized relative to ppia mRNA expression.
  • FIG. 3K shows selected GSEA pathways analysis of DKO FoB compared to DKO ABC cells.
  • FIG. 4 shows that the chromatin landscape of DKO ABCs is enriched in IRF and AP-1/BATF motifs.
  • FIG. 4B are representative UCSC Genome Browser tracks displaying ATAC-seq normalized tag densities at representative genomic regions Cxcl10 cluster, Il6, and IFN ⁇ genes. Highlighted are ABC-specific ATAC-seq peaks.
  • FIG. 4B are representative UCSC Genome Browser tracks displaying
  • FIG. 4C is graph of motif density distribution relative to the peak summit for IRF, T-bet and POU2F2 motifs in ABC-specific ATAC-seq peaks.
  • FIG. 5 shows the results showing WT and DKO ABCs exhibit a distinctive transcriptional and chromatin profile.
  • FIG. 5A is a graph of the expression of selected transcription factors transcripts in WT and DKO ABC cells as identified by RNA-seq analysis.
  • FIG. 5C shows violin plot analysis of all genes, Ig genes and ARCHS4 Macrophage genes in WT and DKO.
  • FIG. 5A is a graph of the expression of selected transcription factors transcripts in WT and DKO ABC cells as identified by RNA-seq analysis.
  • FIG. 5B shows the hierarchical clustering of log-transformed counts per million (cpm) for differentially expressed genes identified by
  • FIG. 5D are graphs of the results of qPCR analysis of the expression of representative genes in sorted ABC (B220+CD19+CD11c+CD11b+) cells from WT and DKO female mice as indicated. The data were normalized relative to ppia mRNA expression. Data are representative of 2 independent experiments. ns: not significant, *: p ⁇ 0.05, **: p ⁇ 0.01 ***: p ⁇ 0.001.
  • FIG. 5E are graphs of qPCR expression analysis of the indicated genes in FACS sorted ABC (B220+CD19+CD11c+CD11b+) cells from WT and DKO female mice (>24 weeks). The data were normalized relative to ppia mRNA expression.
  • FIG. 5E are graphs of the results of qPCR analysis of the expression of representative genes in sorted ABC (B220+CD19+CD11c+CD11b+) cells from WT and DKO female mice (>24 weeks). The data were normalized relative to ppia mRNA expression.
  • FIG. 5G are graphs of functionally enriched Gene Ontology (GO) categories of WT-specific and DKO-specific peaks of ATAC-seq.
  • FIG. 6 shows the results that IRF5 regulates the IL-21-mediated formation of DKO ABCs.
  • FIG. 6A is representative FACS plots of purified wild type, DKO and CD21Cre IRF5 fl/ ⁇ DKO (8-10 weeks of age) CD23+ B cells were treated with a combination of ⁇ CD40, ⁇ IgM, IL-21 and/or imiquimod. CD11c+Tbet+B cells in each culture condition were assayed by FACS at day 3. Representative FACS plot of 6 independent experiments is shown.
  • FIG. 6C shows graphs of the analysis of the expression and production of IL-6 in cultures of cells stimulated ⁇ IL-21 as assessed by qPCR and ELISA. qPCR data were normalized relative to ppia mRNA expression. Data are representative of 3 independent experiments. Mean ⁇ SEM is shown. ns: not significant, ***: p ⁇ 0.001, ****: p ⁇ 0.0001. (One-way ANOVA).
  • FIG. 6D shows graphs of the analysis of the expression and production of Cxcl10 in cultures of cells stimulated with and without IL-21 as assessed by qPCR (left panel) and ELISA (right panel). qPCR data were normalized relative to ppia mRNA expression. Data are representative of 3 independent experiments. Mean ⁇ SEM is shown.
  • FIG. 6E shows graphs of amount of IgG and IgG2c in the supernatants of cells stimulated ⁇ IL-21 7 days as analyzed by ELISA. Data are representative of 3 independent experiments. Mean ⁇ SEM is shown. ns: not significant, ****: p ⁇ 0.0001. (One-way ANOVA).
  • FIG. 6F shows the results of qPCR analysis of the expression of Jun in cultures of cells stimulated ⁇ IL-21. Data were normalized relative to ppia mRNA expression. Data are representative of 2 independent experiments. Mean ⁇ SEM is shown. **: p ⁇ 0.01 ***: p ⁇ 0.001; ****: p ⁇ 0.0001.
  • FIG. 6E shows graphs of amount of IgG and IgG2c in the supernatants of cells stimulated ⁇ IL-21 7 days as analyzed by ELISA. Data are representative of 3 independent experiments. Mean ⁇ SEM is shown. ns: not significant, ****: p ⁇ 0.0001. (One-way ANOVA).
  • FIG. 6F shows the results of
  • 6G are graphs of the results of ChIP assays performed with an IRF5 antibody on cells stimulated with IL-21 for 2 days. Immunoprecipitated DNA was analyzed by qPCR using primers within the ABC-specific ATAC-seq peaks at the CXCL10 cluster (Cl), IgG2c, Jun, and the IL-6 TSS. Data are representative of 4 (IL-6 TSS and CXCL10 Cl) or 2 (IgG2c and Jun) independent experiments. Mean ⁇ SEM is shown. ***: p ⁇ 0.001; ****: p ⁇ 0.0001. (One-way ANOVA). FIG.
  • 6H is a Western blot of nuclear extracts prepared from CD23+ B cells purified from WT, DKO and CD21Cre IRF5 fl/ ⁇ DKO female mice (8-10 weeks of age) stimulated with ⁇ IgM (5 ⁇ g/ml), ⁇ CD40 (5 ⁇ g/ml), IL-21 (50 ng/ml) or imiquimod (1 ⁇ g/ml) for 3 days. Extracts were analyzed by Western blotting with pSTAT3, STAT3, IRF5, and HDAC1 antibodies. Data are representative of 2 independent experiments.
  • FIG. 6I are graphs of the results of a ChIP assay performed with a T-bet antibody.
  • FIG. 6J show Western Blots of nuclear extracts prepared from cells stimulated with and without IL-21 for 2 days and subjected to ONP assay with a biotinylated oligonucleotide from the CXCL10 Cl. Precipitated proteins were analyzed by Western blotting with an IRF5 and T-bet antibody as indicated. Data are representative of 2 independent experiments.
  • FIG. 6J show Western Blots of nuclear extracts prepared from cells stimulated with and without IL-21 for 2 days and subjected to ONP assay with a biotinylated oligonucleotide from the CXCL10 Cl. Precipitated proteins were analyzed by Western blotting with an IRF5 and T-bet antibody as indicated. Data are representative of 2 independent experiments.
  • FIG. 6K shows Western Blots of nuclear extracts from 293T cells transiently transfected as indicated and subjected to ONP assay with a biotinylated oligonucleotide from the CXCL10 Cl or IL-6 TSS. Precipitated proteins were analyzed by Western blotting with an IRF5 or T-bet antibody. Data are representative of 2 independent experiments.
  • FIG. 6L is a Western blot of IRF5/SWEF proteins coimmunoprecipitation from nuclear extracts from cells stimulated with or without IL-21 for 2 days. Immunoprecipitation was performed with an IRF5 antibody and probed with a DEF6, SWAP-70 or IRF5 antibody as indicated. Data are representative of 2 independent experiments.
  • FIG. 6M is a Western blot of nuclear extracts of 293T cells transiently transfected with various constructs as indicated. Immunoprecipitations were performed using an anti-HA antibody. Immunoprecipitates were analyzed by Western blotting using HA antibodies. Data are representative of 2 independent experiments with similar results.
  • FIG. 6N is a Western blot of nuclear extracts of 293T cells subjected to ONP assay with a biotinylated oligonucleotide from the IL-6 TSS. Precipitated proteins were analyzed by Western blotting with an IRF5 antibody. Data are representative of 2 independent experiments.
  • FIG. 6O is a Western blot of 293T cells transiently transfected with various constructs as indicated. Immunoprecipitations were performed using an anti-HA antibody. Immunoprecipitates were analyzed by Western blotting using an anti-FLAG, T-bet or HA antibodies. Data are representative of 2 independent experiments with similar results.
  • FIG. 7 shows the results that monoallelic deletion of IRF5 abolishes accumulation of ABCs and lupus development in DKO mice.
  • FIG. 7A shows representative FACS plots of CD11c and CD11b expression in CD11c+CD11b+ B cells in the spleens of WT, IRF5 fl/fl DKO, IRF5 fl/ ⁇ DKO and CD21Cre IRF5 fl/ ⁇ DKO female mice (>20 weeks-old).
  • FIG. 7A shows representative FACS plots of CD11c and CD11b expression in CD11c+CD11b+ B cells in the spleens of WT, IRF5 fl/fl DKO, IRF5 fl/ ⁇ DKO and CD21C
  • FIG. 7C are graphs of percentages and absolute numbers of B220+CD19+CD11c+Tbet+ B cells in the spleens of WT, IRF5 fl/fl DKO, IRF5 fl/ ⁇ DKO, CD11cCre IRF5 fl/ ⁇ DKO and CD21Cre IRF5 fl/ ⁇ DKO female mice (>20 weeks-old).
  • FIG. 7D are graphs of percentages and absolute numbers of B220+CD19+CD21-CD23-CD11c+CD11b+ B cells in the spleens of WT, IRF5 fl/fl DKO, IRF5 fl/ ⁇ DKO, CD11cCre IRF5 fl/ ⁇ DKO and CD21Cre IRF5 fl/ ⁇ DKO female mice (>20 weeks-old).
  • FIGS 7F are graphs quantifying flow cytometric analysis of T FH (CD4+CXCR5+PD1+Foxp3 ⁇ ), germinal center (GC) B cells (B220+FAS+GL-7+), and plasma cells (PC) (B220 int CD138+) in spleens of WT, IRF5 fl/fl DKO, IRF5 fl/ ⁇ DKO, CD11cCre IRF5 fl/ ⁇ DKO and CD21Cre IRF5 fl/ ⁇ DKO mice (>20 weeks).
  • FIG. 7H show graphs of the intensity score of stained cells to determine anti-nuclear antibodies (ANAs) in sera (1:200) from WT, IRF5 fl/fl DKO, IRF5 fl/ ⁇ DKO, CD11cCre IRF5 fl/ ⁇ DKO and CD21Cre IRF5 fl/ ⁇ DKO mice (>20 weeks old).
  • the graphs are quantification of PAS staining of 3 independent experiments.
  • FIG. 8 shows that a subset of CD11c+ DKO B cells upregulates PC markers.
  • FIG. 8A is a representative FACS plot for CD11c and CD11b expression gated on CD19 Blimp1-yfphi cells from spleens of aging Blimp1-yfp.DKO female mice.
  • FIG. 9 shows that DKO ABCs exhibit sex specific differences in autoantibody production.
  • FIG. 9A is a scatter plot showing frequencies of ABCs of individual mice as indicated.
  • FIG. 9B is a graph of the results of ABCs sorted from spleens of aging DKO female or DKO male mice cultured in vitro ⁇ 1 ⁇ g/ml of Imiquimod, assayed by ELISA on day 7.
  • FIG. 9C is a graph of the results of ABCs sorted from spleens of aging DKO male or Yaa-DKO male mice cultured in vitro ⁇ 1 ⁇ g/ml of Imiquimod, assayed by ELISA on day 7.
  • FIG. 9A is a scatter plot showing frequencies of ABCs of individual mice as indicated.
  • FIG. 9B is a graph of the results of ABCs sorted from spleens of aging DKO female or DKO male mice cultured in vitro ⁇ 1 ⁇ g/ml of Imiquimod, ass
  • FIG. 9D show graphs of frequencies of ABC expressing the indicated markers using flow cytometric analysis of B220+ B cells in the spleens of WT and DKO female and male mice and Yaa-DKO male mice (>20 weeks-old).
  • FIG. 9E is a graph showing the qPCR expression analysis of IL13Ra1 in FACS-sorted FoB (B220+CD19+CD11c ⁇ CD11b ⁇ CD23+) cells and ABC (B220+CD19+CD11c+CD11b+) cells from WT and DKO female and male mice and Yaa-DKO male mice (>20 weeks old). The data were normalized relative to ppia mRNA expression.
  • FIG. 10 show the expression of Rho-kinase 1 and 2 in different populations of cells.
  • FIG. 10A shows the indicated cells assayed with ROCK2 in vitro kinase assay.
  • FIG. 10B shows the expression of phospho IRF4 in some of the same cells (plasmablasts) as assessed by Western blotting with a pIRF4 Antibody.
  • FIG. 10C shows the same cells used in FIG. 10A assayed with a ROCK1 in vitro kinase assay.
  • pathogenic age-associated B cells and “pathogenic ABCs” is used herein to denote the novel subset of B cells described herein that promote disease.
  • DKO ABCs and “autoimmune prone ABCs” also denote these cells.
  • subject as used in this application means an animal with an immune system such as avians and mammals.
  • the invention can be used in veterinary medicine, e.g., to treat companion animals, farm animals, laboratory animals in zoological parks, and animals in the wild.
  • the invention is particularly desirable for human medical applications.
  • the term “patient” as used in this application means a human subject.
  • the “patient” is one suffering with an autoimmune or lymphoproliferative disease or suspected of suffering from an autoimmune or lymphoproliferative disease, such as systemic lupus erythematosus or lymphoma.
  • detection means as used herein means to discover the presence or existence of.
  • diagnosis means to determine what physical disease or illness a subject or patient has, in this case an autoimmune or lymphoproliferative disease.
  • identification means to recognize a disease state or a clinical manifestation or severity of a disease state in a subject or patient.
  • the term also is used in relation to test agents and their ability to have a particular action or efficacy.
  • prediction means to tell in advance based upon special knowledge.
  • reference value means an amount or a quantity of a particular protein or nucleic acid in a sample from a healthy control or healthy donor.
  • health control is used interchangeably in this application and are a human subject who is not suffering from systemic lupus erythematosus or any other autoimmune or lymphoproliferative disease.
  • treat refers to a means to slow down, relieve, ameliorate or alleviate at least one of the symptoms of the disease, or reverse the disease after its onset.
  • prevent refers to acting prior to overt disease onset, to prevent the disease from developing or minimize the extent of the disease or slow its course of development.
  • agent means a substance that produces or is capable of producing an effect and would include, but is not limited to, chemicals, pharmaceuticals, biologics, small organic molecules, antibodies, nucleic acids, peptides, and proteins.
  • terapéuticaally effective amount is used herein to mean an amount sufficient to cause an improvement in a clinically significant condition in the subject, or delays or minimizes or mitigates one or more symptoms associated with the disease, or results in a desired beneficial change of physiology in the subject.
  • the phrase “in need thereof” indicates a subject has an autoimmune or lymphoproliferative disease, is suspected of having an autoimmune or lymphoproliferative disease, or has risk factors for an autoimmune or lymphoproliferative disease.
  • expression profile refers to any description or measurement of one or more of the genes that are expressed by a cell, tissue, or organism under or in response to a particular condition. Expression profiles can identify genes that are upregulated, downregulated, or unaffected under particular conditions. Gene expression can be detected at the nucleic acid level or at the protein level. The expression profiling at the nucleic acid level can be accomplished using any available technology to measure gene transcript levels. For example, the method could employ in situ hybridization, Northern hybridization or hybridization to a nucleic acid microarray, such as an oligonucleotide microarray, or a cDNA microarray.
  • the method could employ reverse transcriptase-polymerase chain reaction (RT-PCR) such as fluorescent dye-based quantitative real time PCR (TaqMan® PCR).
  • RT-PCR reverse transcriptase-polymerase chain reaction
  • TaqMan® PCR fluorescent dye-based quantitative real time PCR
  • nucleic acid expression profiles were obtained using Affymetrix GeneChip® oligonucleotide microarrays.
  • the expression profiling at the protein level can be accomplished using any available technology to measure protein levels, e.g., using peptide-specific capture agent arrays.
  • gene means a DNA sequence that codes for or corresponds to a particular sequence of amino acids which comprise all or part of one or more proteins or enzymes, and may or may not include regulatory DNA sequences, such as promoter sequences, which determine for example the conditions under which the gene is expressed. Some genes, which are not structural genes, may be transcribed from DNA to RNA, but are not translated into an amino acid sequence. Other genes may function as regulators of structural genes or as regulators of DNA transcription. “Transcript” or “gene transcript” is a sequence of RNA produced by transcription of a particular gene. Thus, the expression of the gene can be measured via the transcript.
  • antisense DNA is the non-coding strand complementary to the coding strand in double-stranded DNA.
  • nucleic acid hybridization refers to anti-parallel hydrogen bonding between two single-stranded nucleic acids, in which A pairs with T (or U if an RNA nucleic acid) and C pairs with G.
  • Nucleic acid molecules are “hybridizable” to each other when at least one strand of one nucleic acid molecule can form hydrogen bonds with the complementary bases of another nucleic acid molecule under defined stringency conditions. Stringency of hybridization is determined, e.g., by (i) the temperature at which hybridization and/or washing is performed, and (ii) the ionic strength and (iii) concentration of denaturants such as formamide of the hybridization and washing solutions, as well as other parameters.
  • Hybridization requires that the two strands contain substantially complementary sequences. Depending on the stringency of hybridization, however, some degree of mismatches may be tolerated. Under “low stringency” conditions, a greater percentage of mismatches are tolerable (i.e., will not prevent formation of an anti-parallel hybrid).
  • vector means the vehicle by which a DNA or RNA sequence (e.g. a foreign gene) can be introduced into a host cell, so as to transform the host and promote expression (e.g. transcription and translation) of the introduced sequence.
  • Vectors include, but are not limited to, plasmids, phages, and viruses.
  • host cell means any cell of any organism that is selected, modified, transformed, grown, used or manipulated in any way, for the production of a substance by the cell, for example, the expression by the cell of a gene, a DNA or RNA sequence, a protein or an enzyme. Host cells can further be used for screening or other assays, as described herein.
  • a “polynucleotide” or “nucleotide sequence” is a series of nucleotide bases (also called “nucleotides”) in a nucleic acid, such as DNA and RNA, and means any chain of two or more nucleotides.
  • a nucleotide sequence typically carries genetic information, including the information used by cellular machinery to make proteins and enzymes. These terms include double or single stranded genomic and cDNA, RNA, any synthetic and genetically manipulated polynucleotide, and both sense and anti-sense polynucleotide.
  • PNA protein nucleic acids
  • Nucleic acid refers to deoxyribonucleotides or ribonucleotides and polymers thereof in either single- or double-stranded form.
  • the nucleic acids herein may be flanked by natural regulatory (expression control) sequences, or may be associated with heterologous sequences, including promoters, internal ribosome entry sites (IRES) and other ribosome binding site sequences, enhancers, response elements, suppressors, signal sequences, polyadenylation sequences, introns, 5′- and 3′-non-coding regions, and the like.
  • IVS internal ribosome entry sites
  • nucleic acids containing known nucleotide analogs or modified backbone residues or linkages, which are synthetic, naturally occurring, and non-naturally occurring, which have similar binding properties as the reference nucleic acid, and which are metabolized in a manner similar to the reference nucleotides.
  • the nucleic acids may also be modified by many means known in the art.
  • Non-limiting examples of such modifications include methylation, “caps”, substitution of one or more of the naturally occurring nucleotides with an analog, and internucleotide modifications such as, for example, those with uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoroamidates, and carbamates) and with charged linkages (e.g., phosphorothioates, and phosphorodithioates).
  • uncharged linkages e.g., methyl phosphonates, phosphotriesters, phosphoroamidates, and carbamates
  • charged linkages e.g., phosphorothioates, and phosphorodithioates
  • Polynucleotides may contain one or more additional covalently linked moieties, such as, for example, proteins (e.g., nucleases, toxins, antibodies, signal peptides, and poly-L-lysine), intercalators (e.g., acridine, and psoralen), chelators (e.g., metals, radioactive metals, iron, and oxidative metals), and alkylators.
  • proteins e.g., nucleases, toxins, antibodies, signal peptides, and poly-L-lysine
  • intercalators e.g., acridine, and psoralen
  • chelators e.g., metals, radioactive metals, iron, and oxidative metals
  • alkylators e.g., metals, radioactive metals, iron, and oxidative metals
  • Modifications of the ribose-phosphate backbone may be done to facilitate the addition of labels, or to increase the stability and half-life of such molecules in physiological environments.
  • Nucleic acid analogs can find use in the methods of the invention as well as mixtures of naturally occurring nucleic acids and analogs.
  • the polynucleotides herein may also be modified with a label capable of providing a detectable signal, either directly or indirectly.
  • Exemplary labels include radioisotopes, fluorescent molecules, and biotin.
  • polypeptide as used herein means a compound of two or more amino acids linked by a peptide bond. “Polypeptide” is used herein interchangeably with the term “protein.”
  • the term “about” or “approximately” means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system, i.e., the degree of precision required for a particular purpose, such as a pharmaceutical formulation.
  • “about” can mean within 1 or more than 1 standard deviations, per the practice in the art.
  • “about” can mean a range of up to 20%, preferably up to 10%, more preferably up to 5%, and more preferably still up to 1% of a given value.
  • the term can mean within an order of magnitude, preferably within 5-fold, and more preferably within 2-fold, of a value.
  • the term “about” meaning within an acceptable error range for the particular value should be assumed.
  • Age-associated B cells are a B cell subset, which exhibits unique phenotypic and functional characteristics and can be regulated by T-bet. Although ABCs accumulate in autoimmune disorders, they can also accumulate in non-autoimmune subjects. Additionally, some ABCs produce autoantibodies, and some do not. A detailed understanding of the molecular pathways that promote their expansion and function in autoimmune settings is largely unknown. However, as shown herein, some ABCs are benign and some are pathogenic, causing autoimmune and lymphoproliferative diseases as well as chronic inflammatory disorders. The current invention is based upon the discovery of these pathogenic ABCs (i.e., ABCs that cause or are associated with disease) and the proteins that regulate their expansion, function and differentiation.
  • pathogenic ABCs i.e., ABCs that cause or are associated with disease
  • pathogenic ABCs express CD11c (Example 2).
  • SWAP70 and DEF6 SWEF deficient mice which develop a lupus-like syndrome
  • ABCs from these mice express many of the cell markers found in ABCs from wild type mice including CD86, MHCII and IgM.
  • CD86, MHCII and IgM the cell markers found in ABCs from wild type mice
  • these cells downregulated CD5, which others reported that ABCs do express (see Rubtsova et al. 2015).
  • these pathogenic ABCs are detected at a much earlier age in the DKO mice than the benign ABCs found in wild type mice.
  • These pathogenic ABCs also secrete anti-dsDNA IgG2c and other autoantibodies. See Example 2.
  • the genome-wide transcriptional profiling demonstrated that the SWEF proteins regulate several key processes that can impact the expansion and function of ABCs.
  • the GSEA pathway analysis identified alterations in a number of pathways involved in the control of cellular proliferation, which can play a crucial role in the premature accumulation of ABCs in DKO mice.
  • This analysis also revealed a marked ability of pathogenic ABCs to promote inflammation via the production of chemokines and cytokines.
  • the contribution of ABCs to autoimmune pathophysiology is multifactorial and encompasses both production of autoantibodies especially of the pathogenic IgG2a/c isotype and the ability to promote inflammation via recruitment of inflammatory cells and production of pro-inflammatory cytokines. See Example 4.
  • IRF5 downstream of IL-21 signaling implicates IRF5 downstream of IL-21 signaling thus positioning IRF5 as a common mediator of two key stimulatory pathways for ABC generation in autoimmune settings, IL21 and TLR7.
  • the convergence of these two pathways onto IRF5 is likely to contribute to the dramatic effect observed upon monoallelic deletion of IRF5 on the development of disease in the model used herein (Example 8).
  • Such strong gene dosage effects may be particular relevant for human SLE where IRF5 risk variants have been shown to result in alterations in IRF5 levels (Cham et al. 2012; Lazzari and Jefferies 2014).
  • DKO ABCs While most DKO ABCs express surface IgM, the ability of these cells to produce anti-dsDNA IgG2c upon stimulation suggests that they can undergo class switching and differentiate into PCs.
  • Studies using Blimp1 reporter DKO mice have indeed demonstrated the presence of CD11c+CD19loBlimp1hi cells in the spleens of DKO female mice (Example 9). These cells also express high levels of CD138 and IRF4 suggesting that they represent a population of ABCs that has differentiated toward PCs.
  • IL-21 has also been associated with several autoimmune disorders including rheumatoid arthritis and inflammatory bowel disease (Sarra et al. 2013; Eames et al. 2016).
  • one embodiment of the current invention is a method of abolishing or reducing pathogenic ABCs in a subject in need thereof by administering a therapeutically effective amount of an agent that antagonizes, inhibits or reduces the expression and/or activity of IRF5.
  • a further embodiment of the current invention is a method of preventing and/or treating an autoimmune or lymphoproliferative disease by abolishing or reducing pathogenic ABCs in a subject in need thereof by administering a therapeutically effective amount of an agent that antagonizes, inhibits or reduces the expression and/or activity of IRF5.
  • Methods for reducing expression of a protein are also well known in the art. Reduction of IRF5 expression may be at the transcriptional, translational or post-translational level.
  • IRF5 as used herein includes human IRF5, which is encoded by the human IRF5 gene located at chromosome 7q32 (OMIM ID 607218).
  • IRF5 is a member of the IRF family; it is a transcription factor that possesses a helix-turn-helix DNA-binding motif and mediates virus- and interferon (IFN)-induced signaling pathways. It is appreciated that several isoforms/transcriptional variants of IRF5 are known.
  • the inhibitor of IRF5 inhibits at least the expression or activity of any human IRF5 variant. It is also well known that IRF5 is polymorphic, and a large number of polymorphisms, including SNPs are known.
  • the inhibitor of IRF5 also inhibits expression or activity of naturally-occurring variants of human IRF5 in which one or more of the amino acid residues have been replaced with another amino acid.
  • One agent for inhibition of IRF5 is a small molecule.
  • IRF5-specific RNAi IRF5-specific short RNA
  • IRF5-specific antisense e.g., IRF5-specific morpholinos
  • triplet-forming oligonucleotides IRF5-specific ribozymes.
  • Short RNA molecules include short interfering RNA (siRNA), small temporal RNAs (stRNAs), short hairpin RNA (shRNA), and micro-RNAs (miRNAs).
  • Short interfering RNAs silence genes through an mRNA degradation pathway, while stRNAs and miRNAs are approximately 21 or 22 nt RNAs that are processed from endogenously encoded hairpin-structured precursors, and function to silence genes via translational repression. See, e.g., McManus et al. (2002). RNA 8(6):842-50; Morris et al. (2004). Science 305(5688):1289-92; He and Hannon. (2004). Nat. Rev. Genet. 5(7):522-31.
  • IRF5 siRNA are commercially available, for example, as On-target SMMRT pool reagents from Dharmacon, USA (catalogue No. L-011706-00-0005), and from Santa Cruz Biotechnology, USA (catalogue No. sc-72044).
  • RNA interference, or RNAi a form of post-transcriptional gene silencing (“PTGS”), describes effects that result from the introduction of double-stranded RNA into cells (reviewed in Fire. (1999). Trends Genet. 15:358-363; Sharp. (1999) Genes Dev. 13:139-141; Hunter. (1999). Curr. Biol. 9:R440-R442; Baulcombe. (1999). Curr. Biol. 9:R599-R601; Vaucheret et al. (1998). Plant J. 16:651-659).
  • RNAi The active agent in RNAi is a long double-stranded (antiparallel duplex) RNA, with one of the strands corresponding or complementary to the RNA which is to be inhibited.
  • the inhibited RNA is the target RNA.
  • the long double stranded RNA is chopped into smaller duplexes of approximately 20 to 25 nucleotide pairs, after which the mechanism by which the smaller RNAs inhibit expression of the target is largely unknown at this time. While RNAi was shown initially to work well in lower eukaryotes, for mammalian cells, it was thought that RNAi might be suitable only for studies on the oocyte and the preimplantation embryo.
  • RNAi would work in human cells if the RNA strands were provided as pre-sized duplexes of about 19 nucleotide pairs, and RNAi worked particularly well with small unpaired 3′ extensions on the end of each strand (Elbashir et al. (2001). Nature 411:494-498).
  • siRNA short interfering RNA
  • small interfering RNA were applied to cultured cells by transfection in oligofectamine micelles.
  • siRNAs to the gene encoding IRF5 can be specifically designed using computer programs.
  • Illustrative nucleotide sequences encoding the amino acid sequences of these components are readily available.
  • siRNA sequences to inhibit the expression of a target protein are commercially available and find use.
  • One program, siDESIGN from Dharmacon, Inc. (Lafayette, Colo.) permits predicting siRNAs for any nucleic acid sequence, and is available on the internet at dharmacon.com.
  • Programs for designing siRNAs are also available from others, including Genscript (available on the internet at genscript.com/ssl-bin/app/rnai) and, to academic and non-profit researchers, from the Whitehead Institute for Biomedical Research found on the worldwide web at “jura.wi.mit.edu/pubint/http://iona.wi.mit.edu/siRNAext/.”
  • double-stranded (ds) RNA is a powerful way of interfering with gene expression in a range of organisms that has recently been shown to be successful in mammals (Wianny and Zernicka-Goetz. (2002), Nat. Cell. Biol. 2:70-75).
  • Double stranded RNA corresponding to the sequences of a IRF5 polynucleotides can be introduced into or expressed in cells of a candidate organism to interfere with IRF5 activity.
  • MicroRNA can also be used to inhibit IRF5.
  • MicroRNAs are small non-coding RNAs averaging 22 nucleotides that regulate the expression of their target mRNA transcripts by binding. Binding of microRNAs to their targets is specified by complementary base pairing between positions 2-8 of the microRNA and the target 3′ untranslated region (3′ UTR), an mRNA component that influences translation, stability and localization. Additionally, this microRNA can also be modified for increasing other desirable properties, such as increased stability, decreased degradation in the body, and increased cellular uptake.
  • Ribozymes are RNA molecules capable of cleaving targeted RNA or DNA. Examples of ribozymes are described in, for example, U.S. Pat. Nos. 5,180,818; 5,168,053; 5,149,796; 5,116,742; 5,093,246; and 4,987,071, all incorporated herein by reference. Ribozymes specific for IRF5 can be designed by reference to the IRF5 cDNA sequence.
  • a further approach is to express anti-sense constructs directed against the polynucleotides of IRF5 to inhibit gene function and to abolish or decrease pathogenic ABCs.
  • Antisense oligonucleotides are single-stranded nucleic acids, which can specifically bind to a complementary nucleic acid sequence. By binding to the appropriate target sequence, an RNA-RNA, a DNA-DNA, or RNA-DNA duplex is formed. By binding to the target nucleic acid, antisense oligonucleotides can inhibit the function of the target nucleic acid. Typically, antisense oligonucleotides are 15 to 35 bases in length. However, it is appreciated that it may be desirable to use oligonucleotides with lengths outside this range, for example 10, 11, 12, 13, or 14 bases, or 36, 37, 38, 39 or 40 bases. Thus, with knowledge of the IRF5 cDNA sequence, polynucleotide inhibitors of IRF5 expression can be produced using methods well known in the art.
  • the antisense molecules may be expressed from any suitable genetic construct and delivered to the subject.
  • the genetic construct which expresses the antisense molecule comprises at least a portion of the IRF5 cDNA or gene operatively linked to a promoter which can express the antisense molecule in the cell.
  • the genetic construct is adapted for delivery to a human cell.
  • agents would include antibodies to the components of IRF5. Such antibodies are commercially available or can be produced by methods known in the art.
  • antibody and “antibodies” include polyclonal antibodies, monoclonal antibodies, humanized or chimeric antibodies, single chain Fv antibody fragments, Fab fragments, and F(ab′) 2 fragments.
  • Polyclonal antibodies are heterogeneous populations of antibody molecules that are specific for a particular antigen, while monoclonal antibodies are homogeneous populations of antibodies to a particular epitope contained within an antigen.
  • Monoclonal antibodies and humanized antibodies are particularly useful in the present invention.
  • Antibody fragments that have specific binding affinity for a target of interest can be generated by known techniques. Such antibody fragments include, but are not limited to, F(ab′) 2 fragments that can be produced by pepsin digestion of an antibody molecule, and Fab fragments that can be generated by reducing the disulfide bridges of F(ab′) 2 fragments. Alternatively, Fab expression libraries can be constructed. Single chain Fv antibody fragments are formed by linking the heavy and light chain fragments of the Fv region via an amino acid bridge (e.g., 15 to 18 amino acids), resulting in a single chain polypeptide. Single chain Fv antibody fragments recognizing a target of interest can be produced through standard techniques, such as those disclosed in U.S. Pat. No. 4,946,778.
  • IRF5 is polymorphic, and a large number of polymorphisms, including SNPs are known.
  • the inhibitor of IRF5 also inhibits at least one function or activity of naturally-occurring variants of human IRF5 in which one or more of the amino acid residues have been replaced with another amino acid.
  • the IRF5 inhibitor may be one that inhibits at least one function or activity of an orthologue of IRF5 in another species, for example IRF5 from a horse, dog, pig, cow, sheep, rat, mouse, guinea pig or a primate. It will be appreciated, that when the inhibitor is administered to a particular individual, the inhibitor is one that modulates at least one function or activity of IRF5 from the same species as that individual. Thus, when the patient is a human patient, the inhibitor inhibits at least one function or activity of human IRF5, and so on.
  • polynucleotide inhibitors such as siRNA molecules, antisense molecules and ribozymes
  • polynucleotide inhibitors of IRF5 may be administered directly, or may be administered in the form of a polynucleotide that encodes the inhibitor.
  • an inhibitor of IRF5 which is a polynucleotide includes the meanings of administering the inhibitor directly, or administering a polynucleotide that encodes the inhibitor, typically in the form of a vector.
  • the inhibitor may be a dominant-negative mutant of IRF5.
  • the dominant-negative mutant may have a mutated or deleted DNA binding domain (DBD).
  • DBD DNA binding domain
  • Specific examples of mutations that have dominant-negative effect include a mutation at Alanine at position 68, especially when substituted with Proline, which results in complete loss of DNA binding activity (Yang et al. (2009). Plos One v4(5):e5500).
  • Suitable methods, routes and compositions for preparing polypeptide inhibitors of IRF5 and nucleic acid molecules that encode them and administering them to a patient are known in the art and described below, and include viral vectors such as adenoviral vectors.
  • the current invention is based upon the discovery that reducing the aberrant expansion of pathogenic ABCs depend on two SWEF proteins, SWAP70 and DEF6. Thus, increasing the expression and/or activity of these proteins can reduce or abolish pathogenic ABCs. Methods for increasing expression and/or activity of a protein are also well known in the art. Increasing SWEF expression may be at the transcriptional, translational or post-translational level.
  • a further embodiment of the current invention is a method of abolishing or reducing pathogenic ABCs in a subject in need thereof by administering a therapeutically effective amount of an agent that agonizes, activates or increases the expression and/or activity of SWAP-70 and/or DEF6.
  • agents that can be used in this method include but are not limited to agents for increasing the expression of the gene encoding SWAP-70 and/or DEF6 and include nucleic acids which encode the SWAP-70 and/or DEF6 proteins, or the entire SWAP-70 and/or DEF6 gene, or a nucleic acid that is substantially homologous to the SWAP-70 and/or DEF6 genes, or a variant, mutant, fragment, homologue or derivative of the SWAP-70 and/or DEF6 genes that produces a protein that maintains or increases their function.
  • the gene or a nucleic acid which encodes the SWAP-70 and/or DEF6 proteins, or a nucleic acid that is substantially homologous to the SWAP-70 and/or DEF6 genes, or a variant, mutant, fragment, homologue or derivative of the SWAP-70 and/or DEF6 genes that produce proteins with maintained or increased function can also be used in the methods of the invention.
  • sequences of human SWAP-70 and DEF6 are available on the National Center for Biotechnology Database and can be used to manufacture variants, mutants, fragments, homologues and derivatives which maintain or have increased function.
  • DNA or other nucleic acids such as mRNA can also be used in the method.
  • any agent or agents that increase or upregulate the expression of SWAP-70 and/or DEF6 would also most likely increase SWAP-70 and/or DEF6 proteins, alternatively, an agent or agents that directly increase or promote the activation, amount and/or activity of the proteins can be used in the methods.
  • administering the proteins can be used in the methods. This includes the administration of a polypeptide, or a variant thereof having at least 90% sequence identity with the SWAP 70 and/or DEF6 polypeptides.
  • the variant of the polypeptide has at least 91% sequence identity, or at least 92% sequence identity, or at least 93% sequence identity, or at least 94% sequence identity, or at least 95% sequence identity, or at least 96% sequence identity, or at least 97% sequence identity, or at least 98% sequence identity, or at least 99% sequence identity, with the sequence of the polypeptide of which it is a variant.
  • the variant of the polypeptide has at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity with the sequence of the SWAP70 and/or DEF6 polypeptide.
  • variants may be made, for example, using the methods of recombinant DNA technology, protein engineering and site-directed mutagenesis, which are well known in the art, and discussed in more detail below.
  • the percent sequence identity between two polypeptides may be determined using suitable computer programs.
  • Polypeptides may be prepared using an in vivo or in vitro expression system.
  • an expression system is used that provides the polypeptides in a form that is suitable for pharmaceutical use, and such expression systems are known to the skilled person.
  • polypeptides of the invention suitable for pharmaceutical use can be prepared using techniques for peptide synthesis.
  • a nucleic acid molecule encoding, for example, the proteins or variants thereof, may be used to transform a host cell or host organism for expression of the desired polypeptide.
  • Suitable hosts and host cells are known in the art and may be any suitable fungal, prokaryotic or eukaryotic cell or cell line or organism, for example: bacterial strains, including gram-negative strains such as Escherichia coli and gram-positive strains such as Bacillus subtilis or of Bacillus brevis ; yeast cells, including Saccharomyces cerevisiae ; or Schizosaccharomyces pombe ; amphibian cells such as Xenopus oocytes; insect-derived cells, such SF9, Sf21, Schneider and Kc cells; plant cells, for example tobacco plants; or mammalian cells or cell lines, CHO-cells, BHK-cells (for example BHK-21 cells) and human cells or cell lines such as HeLa, as well as all other hosts or host cells that are known
  • polypeptides or variants thereof may be made by chemical synthesis, again using methods well known in the art for many years.
  • polypeptides for administration to a patient may be in the form of a fusion molecule in which the polypeptide is attached to a fusion partner to form a fusion protein.
  • fusion partners include polymers, polypeptides, lipophilic moieties, and succinyl groups.
  • Certain useful protein fusion partners include serum albumin and an antibody Fc domain
  • certain useful polymer fusion partners include, but are not limited to, polyethylene glycol, including polyethylene glycols having branched and/or linear chains.
  • the polypeptide may be PEGylated, or may comprise a fusion protein with an Fc fragment.
  • the polypeptide may be fused to or may comprise additional amino acids in a sequence that facilitates entry into cells (i.e. a cell-penetrating peptide).
  • a cell-penetrating peptide a sequence that facilitates entry into cells
  • the SWAP70, DEF6 or variant thereof or a polypeptide may further comprise the sequence of a cell-penetrating peptide (also known as a protein transduction domain) that facilitates entry into cells.
  • cell-penetrating peptides are generally short peptides of up to 30 residues having a net positive charge and act in a receptor-independent and energy-independent manner.
  • the polypeptide may be fused to or may comprise additional amino acids in a sequence that facilitates entry into the nucleus (i.e., a nuclear localization sequence (NLS), aka nuclear localization domain (NLD)).
  • NLS nuclear localization sequence
  • the SWAP70 or DEF6 protein or variant thereof may further comprise the sequence of an NLS that facilitates entry into the nucleus.
  • NLS includes any polypeptide sequence that, when fused to a target polypeptide, is capable of targeting it to the nucleus.
  • the NLS is one that is not under any external regulation (e.g. calcineurin regulation) but which permanently translocates a target polypeptide to the nucleus.
  • sequence of the cell-penetrating peptide and/or the NLS may be adjacent to the sequence of the protein or variant, or these sequences may be separated by one or more amino acids residues, such as glycine residues, acting as a spacer.
  • Fc-chimera Therapeutic proteins produced as an Fc-chimera are known in the art.
  • Etanercept the extracellular domain of TNFR2 combined with an Fc fragment, is a therapeutic polypeptide used to treat autoimmune diseases, such as rheumatoid arthritis.
  • the fusion partner may be a polymer, for example, polyethylene glycol (PEG).
  • PEG may comprise branched and/or linear chains.
  • a fusion partner comprises a chemically-derivatised polypeptide having at least one PEG moiety attached.
  • the fusion partner may be attached, either covalently or non-covalently, to the amino-terminus or the carboxy-terminus of the polypeptide.
  • the attachment may also occur at a location within the polypeptide other than the amino-terminus or the carboxy-terminus, for example, through an amino acid side chain (such as, for example, the side chain of cysteine, lysine, histidine, serine, or threonine).
  • certain genes are upregulated and/or enriched in pathogenic ABCs and some are downregulated.
  • one embodiment of the current invention is a method of abolishing or reducing pathogenic ABCs in a subject in need thereof by administering a therapeutically effective amount of an agent that antagonizes, inhibits or reduces the expression and/or activity of certain upregulated genes.
  • a further embodiment of the current invention is a method of preventing and/or treating an autoimmune or lymphoproliferative disease by abolishing or reducing pathogenic ABCs in a subject in need thereof by administering an therapeutically effective amount of an agent that antagonizes, inhibits or reduces the expression and/or activity of certain upregulated genes.
  • 111 genes listed in Table 1 were upregulated in pathogenic or DKO ABCs as compared to WT ABCs.
  • One or more of these upregulated genes would be a target for reduction of expression in order to reduce or abolish pathogenic ABCs.
  • the methods of the invention include the inhibition of one or more genes including but not limited to: Cxcl9, Cxcl10, Ccl4, Ccl5, Ccl8, Il1r2, Li2rb2, Il18r1, Il18rap, Csf1, Tbx21, Itgax, Itgam, Ctla4, Sema3d, Sema4c, Bmp6, Itga8, Ccl22, Tnsfsf4, Cxcr3, Ccr1, Plxnd1, Itgb1, Ifn ⁇ , Il6, Runx, MyoG, NF-kB, stat5, Hbp1, Srebf1, Zbtb32, Nfil3, IL-12a, CD28, CD9, FcRL5, CD30/CD30L, c-kit, CD15, CD244, CD68, Lmo7, Tnip3, Msc, Mist1, Id2, Insm1, TNFa, Thsd7a, IL-13/IL-13Ra1, IL-4,
  • genes whose expression and/or activity are upregulated in pathogenic ABCs as compared to benign ABCs include but are not limited to Stat5, Hbp1, Srebf1, Zbtb32, LifR, AP1 family members and Batf family members. These genes would also be considered targets for reduction of expression in order to reduce or abolish pathogenic ABCs.
  • genes related to higher immunoglobulin production including but not limited to Nfil3, Jun, and IL-9/IL-9R, would be targets for reduction of expression in order to reduce or abolish pathogenic ABCs.
  • the inhibition of these genes can be accomplished by any method known in the art including but not limited to the ones described above for decreasing expression of the gene that encodes IRF5, including but not limited to small molecules, RNAi, short RNA, antisense (e.g., morpholinos) and triplet-forming oligonucleotides, and ribozymes.
  • a further embodiment of the current invention is a method of abolishing or reducing pathogenic ABCs in a subject in need thereof by administering a therapeutically effective amount of an agent that agonizes, activates or increases the number, expression and/or activity of certain downregulated genes.
  • a further embodiment of the current invention is a method of preventing and/or treating an autoimmune or lymphoproliferative disease by abolishing or reducing pathogenic ABCs in a subject in need thereof by administering a therapeutically effective amount of an agent that agonizes, activates or increases the number, expression and/or activity of certain downregulated genes. This could be accomplished by introducing a nucleic acid encoding the gene or a portion into the subject as described above for increasing SWEF proteins.
  • genes listed in Table 2 were downregulated in pathogenic or DKO ABCs as compared to WT ABCs.
  • One or more of these downregulated genes would be a target for an increase of expression in order to reduce or abolish pathogenic ABCs.
  • genes that are downregulated in pathogenic ABCs include but are not limited to MafA, MafB, c-maf Mertk, Cebp, Rora, Bcl6, Pxk, Smad1, Emp2, Pouf2f2, PU.1, Rel, Foxj3, Hand1, Cebp, Rora, Prdm1, Spic, and Pparg.
  • genes related to myeloid-related genes including but not limited to AHR and PPARGc1a would be targets for an increase of expression in order to reduce or abolish pathogenic ABCs.
  • the SWAP-70, DEF6, or IRF5 inhibitor, or inhibitor or activator of a misregulated gene is a nucleic acid such as DNA, RNA, interfering RNA or microRNA
  • methods for delivery include receptor mediated endocytosis where the nucleic acid is coupled to a targeting molecule that can bind to a specific cell surface receptor, inducing endocytosis and transfer of the nucleic acid into cells. Coupling is normally achieved by covalently linking poly-lysine to the receptor molecule and then arranging for (reversible) binding of the negatively charged DNA or RNA to the positively charged poly-lysine component. Another approach utilizes the transferrin receptor or folate receptor which is expressed in many cell types.
  • the microRNA could be manufactured to have a guide strand which is identical to the microRNA of interest and a passenger strand that is modified and linked to a molecule for increasing cellular uptake
  • Another method to administer the nucleic acid to the proper tissue is direct injection/particle bombardment, where the nucleic acid is be injected directly with a syringe and needle into a specific tissue, such as muscle.
  • An alternative direct injection approach uses particle bombardment (‘gene gun’) techniques: nucleic acid is coated on to metal pellets and fired from a special gun into cells. Successful gene transfer into a number of different tissues has been obtained using this approach.
  • particle bombardment ‘gene gun’
  • Such direct injection techniques are simple and comparatively safe.
  • AAV adeno-associated viruses
  • Nucleic acid is delivered in these viral vectors is continually expressed, replacing the expression of the DNA or RNA that is not expressed in the subject.
  • AAV have different serotypes allowing for tissue-specific delivery due to the natural tropism toward different organs of each individual AAV serotype as well as the different cellular receptors with which each AAV serotype interacts.
  • tissue-specific promoters for expression allows for further specificity in addition to the AAV serotype.
  • mammalian virus vectors that can be used to deliver the DNA or RNA include oncoretroviral vectors, adenovirus vectors, Herpes simplex virus vectors, and lentiviruses.
  • Liposomes are spherical vesicles composed of synthetic lipid bilayers which mimic the structure of biological membranes.
  • the nucleic acid to be transferred is packaged in vitro with the liposomes and used directly for transferring the nucleic acid to a suitable target tissue in vivo.
  • the lipid coating allows the nucleic acid to survive in vivo, bind to cells and be endocytosed into the cells.
  • Cationic liposomes (where the positive charge on liposomes stabilize binding of negatively charged DNA), have are one type of liposome.
  • the nucleic acid can also be administered with a lipid to increase cellular uptake.
  • the nucleic acid may be administered in combination with a cationic lipid, including but not limited to, lipofectin, DOTMA, DOPE, and DOTAP.
  • lipid or liposomal formulations including nanoparticles and methods of administration have been described as for example in U.S. Patent Publication 2003/0203865, 2002/0150626, 2003/0032615, and 2004/0048787. Methods used for forming particles are also disclosed in U.S. Pat. Nos. 5,844,107, 5,877,302, 6,008,336, 6,077,835, 5,972,901, 6,200,801, and 5,972,900.
  • Nanoparticles are a colloidal carrier system that has been shown to improve the efficacy of an encapsulated drug by prolonging the serum half-life.
  • Polyalkylcyanoacrylates (PACAs) nanoparticles are a polymer colloidal drug delivery system that is in clinical development (described, for example, by Stella et al. (2000) J. Pharm. Sci., 89: 1452-1464; Brigger et al. (2001) Int. J. Pharm 214: 37-42; Calvo et al. (2001) Pharm. Res. 18: 1157-1166; and Li et al. (2001) Biol. Pharm.
  • Biodegradable poly(hydroxyl acids) such as the copolymers of poly(lactic acid) (PLA) and poly(lactic-co-glycolide) (PLGA) are being extensively used in biomedical applications and have received FDA approval for certain clinical applications.
  • PEG-PLGA nanoparticles have many desirable carrier features including (i) that the agent to be encapsulated comprises a reasonably high weight fraction (loading) of the total carrier system; (ii) that the amount of agent used in the first step of the encapsulation process is incorporated into the final carrier (entrapment efficiency) at a reasonably high level; (iii) that the carrier has the ability to be freeze-dried and reconstituted in solution without aggregation; (iv) that the carrier be biodegradable; (v) that the carrier system be of small size; and (vi) that the carrier enhances the particles persistence. Nanoparticles may be synthesized using virtually any biodegradable shell known in the art.
  • a polymer such as poly(lactic-acid) (PLA) or poly(lactic-co-glycolic acid) (PLGA) is used.
  • PLA poly(lactic-acid)
  • PLGA poly(lactic-co-glycolic acid)
  • the polymer is modified with a terminal carboxylic acid group (COOH) that increases the negative charge of the particle and thus limits the interaction with negatively charged nucleic acids.
  • COOH carboxylic acid group
  • Nanoparticles may also be modified with polyethylene glycol (PEG), which also increases the half-life and stability of the particles in circulation.
  • the COOH group may be converted to an N-hydroxysuccinimide (NHS) ester for covalent conjugation to amine-modified compounds.
  • polypeptides may be linked to the serum albumin or a derivative of albumin. Methods for linking polypeptides to albumin or albumin derivatives are well known in the art.
  • the compounds for administration to a patient will normally be formulated as a pharmaceutical composition, i.e. together with a pharmaceutically acceptable carrier, diluent or excipient.
  • phrases “pharmaceutically acceptable” refers to molecular entities and compositions that are physiologically tolerable and do not typically produce an allergic or similar untoward reaction, such as gastric upset, dizziness and the like, when administered to a human, and approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans.
  • Carrier refers to a diluent, adjuvant, excipient, or vehicle with which the therapeutic is administered.
  • Such pharmaceutical carriers can be sterile liquids, such as saline solutions in water and oils, including those of petroleum, animal, vegetable, or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil, and the like.
  • a saline solution is a preferred carrier when the pharmaceutical composition is administered intravenously.
  • Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions.
  • Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol, and the like.
  • the composition if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents.
  • Preferred methods of administration include oral; mucosal, such as nasal, sublingual, vaginal, buccal, or rectal; parenteral, such as subcutaneous, intravenous, bolus injection, intramuscular, or intraarterial; or transdermal administration to a subject. Most preferred method of administration are parenteral and oral.
  • Oral delivery can be performed by complexing a therapeutic composition of the present invention to a carrier capable of withstanding degradation by digestive enzymes in the gut of an animal.
  • examples of such carriers include plastic capsules or tablets, such as those known in the art.
  • One method of local administration is by direct injection.
  • Administration of a composition locally within the area of a target cell refers to injecting the composition centimeters and preferably, millimeters from the target cell or tissue.
  • the inhibitor may be provided in any suitable form, including without limitation, a tablet, a powder, an effervescent tablet, an effervescent powder, a capsule, a liquid, a suspension, a granule or a syrup.
  • a further embodiment of the invention provides methods of ex vivo cell therapy, wherein a population of pathogenic ABCs is obtained from the subject, contacted, incubated or treated with one of the agents disclosed herein for abolishing or decreasing pathogenic ABCs, and then administered back to the subject in need thereof.
  • the ex vivo treated cells of the present invention can be effected using any suitable route of introduction, such as intravenous, intraperitoneal, intra-gastrointestinal track, subcutaneous, transcutaneous, intramuscular, intracutaneous, intrathecal, epidural, and rectal. According to presently preferred embodiments, the ex vivo treated cells of the present invention may be introduced to the individual using intravenous and/or intraperitoneal administration.
  • agents and/or populations of cells are administered to the subject once.
  • agents and/or populations of cells are administered to the subject more than once (e.g., at least 2, 3, 4, 5, or more times).
  • the agents and/or populations of cells are administered to the subject at a regular interval, e.g., every six months.
  • ABCs those ABCs that would be found in subjects with or predicted to develop an autoimmune or lymphoproliferative disease, would have different gene expression profile than ABCs which are not pathogenic as well as other B cells.
  • the expansion and/or function of ABCs that are pathogenic are inhibited by the SWEF proteins and depend upon IRF5 and other IRFs and these cells differentially express certain genes, including but not limited to, Cxcl9, Cxcl10, Ccl4, Ccl5, Ccl8, Il1r2, Li2rb2, Il18r1, Il18rap, Csf1, Tbx21, Itgax, Itgam, Ctla4, Sema3d, Sema4c, Bmp6, Itga8, Ccl22, Tnsfsf4, Cxcr3.Ccr1, Plxnd1, Itgb1, Ifn ⁇ , Il6, AP1 family members like Jun, Batf family members, PU.1 and other Ets family members like SpiC, Runx, Myo
  • Most methods start with obtaining a sample of biological tissue or fluid that contains peripheral blood cells from the subject and extracting, isolating and/or purifying B cells from the tissue or fluid.
  • Preferred biological tissues include, but are not limited to, epidermal, whole blood, and plasma.
  • the biological tissue obtained from a lymph node or spleen biopsy.
  • Preferred fluids include, but are not limited to, plasma, saliva, and urine.
  • the isolated B cells can be stimulated with an agent including but not limited to IL21, TLR7 and combinations thereof.
  • nucleic acid is extracted, isolated and purified from the cells by methods known in the art.
  • a nucleic acid sample having the gene sequence(s) are prepared using known techniques.
  • the sample can be treated to lyse the cells, using known lysis buffers, sonication, electroporation, with purification and amplification occurring as needed, as will be understood by those in the skilled in the art.
  • the reactions can be accomplished in a variety of ways. Components of the reaction may be added simultaneously, or sequentially, in any order.
  • the reaction can include a variety of other reagents which can be useful in the methods and assays and would include but is not limited to salts, buffers, neutral proteins, such albumin, and detergents, which may be used to facilitate optimal hybridization and detection, and/or reduce non-specific or background interactions.
  • reagents that otherwise improve the efficiency of the assay such as protease inhibitors, nuclease inhibitors, and anti-microbial agents, can be used, depending on the sample preparation methods and purity.
  • nucleic acid sequence corresponding to a gene can be any length, with the understanding that longer sequences are more specific.
  • a nucleic acid corresponding to a gene is at least 20 nucleotides in length. Preferred ranges are from 20 to 100 nucleotides in length, with from 30 to 60 nucleotides being more preferred, and from 40 to 50 being most preferred.
  • nucleic acids when nucleic acids are to be detected preferred methods utilize cutting or shearing techniques to cut the nucleic acid sample containing the target sequence into a size that will facilitate handling and hybridization to the target. This can be accomplished by shearing the nucleic acid through mechanical forces, such as sonication, or by cleaving the nucleic acid using restriction endonucleases, or any other methods known in the art.
  • mechanical forces such as sonication
  • restriction endonucleases or any other methods known in the art.
  • the natural degradation that occurs during archiving results in “short” oligonucleotides.
  • the methods and assays of the invention can be done on oligonucleotides as short as 20-100 base pairs, with from 20 to 50 being preferred, and between 40 and 50, including 44, 45, 46, 47, 48 and 49 being the most preferred.
  • a preferred method of the invention is performing gene expression profiling of the sample.
  • Gene expression profiling refers to examining expression of one or more RNAs in a cell, preferably mRNA. Often at least or up to 10, 100, 100, 10,000 or more different mRNAs are examined in a single experiment.
  • the gene expression of the mRNA or other nucleic acid obtained from the B cells from the subject is compared to the reference gene expression of B cells from a healthy donor.
  • these cells are ABCs from a healthy donor, i.e., one without an autoimmune or lymphoproliferative disease.
  • the cells are other B cells from a healthy donor.
  • the gene expression of the B cells from the subject is being compared to ABCs from a healthy donor or control
  • a finding of at least one of the following genes being expressed at a lower level or less than the expression in the healthy donor or control would indicate the B cells from the subject are pathogenic ABCs: MafA, MafB, c-maf Mertk, Cebp, Rora, PU.1, Mertk, MafB, Spic, Pparg, Ppargc1a, and Prdm1.
  • the expression of any of the genes listed in Table 2 at a lower or lesser level than the expression in the healthy donor or control would indicate the B cells from the subject are pathogenic ABCs.
  • the B cells from the subject are pathogenic ABCs: Cxcl9, Cxcl10, Ccl4, Ccl5, Ccl8, Il1r2, Li2rb2, Il18r1, Il18rap, Csf1, Tbx21, Itgax, Itgam, Ctla4, Sema3d, Sema4c, Bmp6, Itga8, Ccl22, Tnsfsf4, Cxcr3, Ccr1, Plxnd1, Itgb1, Ifn ⁇ , Il6, AP1, Batf, Runx, MyoG, NF-kB, IL-9/IL-9R, IL13/IL-13Ra1, and IL-4.
  • the gene expression of the B cells from the subject is being compared to other B cells from a healthy donor or control, a finding of at least one of the following genes being expressed at a lower or lesser level than the expression in the healthy donor or control would indicate the B cells from the subject are pathogenic ABCs: Bcl6, Pxk, Smad1, Emp2, Pouf2f2, PU.1, Rel, Foxj3, and Hand1.
  • the gene expression from B cells of the subject after treatment can be compared to the gene expression from B cells from the subject before treatment.
  • the gene expression from the B cells of the subject can also be compared to the reference gene expression of the B cells from a healthy donor or control.
  • Methods for examining gene expression are often hybridization based, and include, Southern blots; Northern blots; dot blots; primer extension; nuclease protection; subtractive hybridization and isolation of non-duplexed molecules using, for example, hydroxyapatite; solution hybridization; filter hybridization; amplification techniques such as RT-PCR and other PCR-related techniques such as PCR with melting curve analysis, and PCR with mass spectrometry; fingerprinting, such as with restriction endonucleases; and the use of structure specific endonucleases.
  • mRNA expression can also be analyzed using mass spectrometry techniques (e.g., MALDI or SELDI), liquid chromatography, and capillary gel electrophoresis. Any additional method known in the art can be used to detect the presence or absence of the transcripts.
  • the level of protein product of the genes can be measured from a protein sample from the biological tissue or fluid using methods described below.
  • the preferred method for the detection of the transcripts is the use of arrays or microarrays or RNA-sequencing or nanostring.
  • probes any ordered arrangement on a surface or substrate of different molecules, referred to herein as “probes.”
  • Each different probe of any array is capable of specifically recognizing and/or binding to a particular molecule, which is referred to herein as its “target” in the context of arrays.
  • target molecules include mRNA transcripts, cRNA molecules, cDNA, PCR products, and proteins.
  • Microarrays, RNA-sequencing and nanostring are useful for simultaneously detecting the presence, absence and quantity of a plurality of different target molecules in a sample.
  • the presence and quantity, or absence, of the probe's target molecule in a sample may be readily determined by analyzing whether and how much of a target has bound to a probe at a particular location on the surface or substrate.
  • arrays used in the present invention are “addressable arrays” where each different probe is associated with a particular “address.”
  • the arrays used in the present invention are preferable nucleic acid arrays that comprise a plurality of nucleic acid probes immobilized on a surface or substrate.
  • the different nucleic acid probes are complementary to, and therefore can hybridize to, different target nucleic acid molecules in a sample.
  • each probe can be used to simultaneously detect the presence and quantity of a plurality of different genes, e.g., the presence and abundance of different mRNA molecules, or of nucleic acid molecules derived therefrom (for example, cDNA or cRNA).
  • the arrays are preferably reproducible, allowing multiple copies of a given array to be produced and the results from each easily compared to one another.
  • microarrays are small, and made from materials that are stable under binding conditions. A given binding site or unique set of binding sites in the microarray will specifically bind to the target. It will be appreciated that when cDNA complementary to the RNA of a cell is made and hybridized to a microarray under suitable conditions, the level or degree of hybridization to the site in the array corresponding to any particular gene will reflect the prevalence in the cell of mRNA transcribed from that gene.
  • cDNA complementary to the total cellular mRNA when detectably labeled (e.g., with a fluorophore) cDNA complementary to the total cellular mRNA is hybridized to a microarray, the site on the array corresponding to a gene (i.e., capable of specifically binding a nucleic acid product of the gene) that is not transcribed in the cell will have little or no signal, while a gene for which mRNA is highly prevalent will have a relatively strong signal.
  • a gene i.e., capable of specifically binding a nucleic acid product of the gene
  • GeneChip® (Affymetrix, Santa Clara, Calif.), generates data for the assessment of gene expression profiles and other biological assays. Oligonucleotide expression arrays simultaneously and quantitatively “interrogate” thousands of mRNA transcripts. Each transcript can be represented on a probe array by multiple probe pairs to differentiate among closely related members of gene families. Each probe contains millions of copies of a specific oligonucleotide probe, permitting the accurate and sensitive detection of even low-intensity mRNA hybridization patterns. After hybridization data is captured, using a scanner or optical detection systems, software can be used to automatically calculate the intensity values for each probe cell. Probe cell intensities can be used to calculate an average intensity for each gene, which correlates with mRNA abundance levels. Expression data can be quickly sorted based on any analysis parameter and displayed in a variety of graphical formats for any selected subset of genes.
  • microarrays that can be used in the assays and methods of the invention are microarrays synthesized in accordance with techniques sometimes referred to as VLSIPSTM (Very Large Scale Immobilized Polymer Synthesis) technologies as described, for example, in U.S. Pat. Nos.
  • VLSIPSTM Very Large Scale Immobilized Polymer Synthesis
  • exemplary arrays that are useful for use in the invention include, but are not limited to, Sentrix® Array or Sentrix® BeadChip Array available from Illumina®, Inc. (San Diego, Calif.) or others including beads in wells such as those described in U.S. Pat. Nos. 6,266,459; 6,355,431; 6,770,441; and 6,859,570. Arrays that have particle on the surface can also be used and include those described in U.S. Pat. Nos. 6,489,606; 7,106,513; 7,126,755; and 7,164,533.
  • An array of beads in a fluid format can also be used in methods for the invention.
  • Exemplary formats that can be used in the invention to distinguish beads in a fluid sample using microfluidic devices are described, for example, in U.S. Pat. No. 6,524,793.
  • Commercially available fluid formats for distinguishing beads include, for example, those used in XMAPTM technologies from Luminex or MPSSTM methods from Lynx Therapeutics.
  • a spotted microarray can also be used in a method of the invention.
  • An exemplary spotted microarray is a CodeLinkTM Array available from Amersham Biosciences.
  • microarray that is useful in the invention is one that is manufactured using inkjet printing methods such as SurePrintTM Technology available from Agilent Technologies.
  • Other microarrays that can be used in the invention include, without limitation, those described in U.S. Pat. Nos. 5,429,807; 5,436,327; 5,561,071; 5,583,211; 5,658,734; 5,837,858; 5,919,523; 6,287,768; 6,287,776; 6,288,220; 6,297,006; 6,291,193; and 6,514,751.
  • DASL can be used for quantitative measurements of RNA target sequences as well as for DNA target sequences. DASL is described, for example, in Fan et al. 2004.
  • SAGE serial analysis of gene expression
  • a short sequence tag typically about 10-14 bp
  • sequence tags can be linked together to form long serial molecules that can be cloned and sequenced. Quantitation of the number of times a particular tag is observed proves the expression level of the corresponding transcript (see, e.g., Velculescu et al. 1995; Velculescu et al. 1997; and de Waard et al. 1999).
  • Screening and diagnostic method of the current invention may involve the amplification of the target loci.
  • a preferred method for target amplification of nucleic acid sequences is using polymerases, in particular polymerase chain reaction (PCR).
  • PCR polymerase chain reaction
  • PCR or other polymerase-driven amplification methods obtain millions of copies of the relevant nucleic acid sequences which then can be used as substrates for probes or sequenced or used in other assays.
  • kits form for use by a health care provider and/or a diagnostic laboratory.
  • kits for the detection and quantitation of one or more of the genes can be incorporated into kits.
  • kits would include probes for one or more of the genes, reagents for isolating and purifying ABCs and other B cells and nucleic acids from biological tissue or bodily fluid, reagents for performing assays on the isolated and purified nucleic acid, instructions for use, and reference values or the means for obtaining reference values in a control sample for the included genes.
  • kits would have the probes attached to a solid state.
  • a most preferred embodiment would have the probes in a microarray format wherein nucleic acid probes for one or more of the genes differentially regulated in pathogenic ABCs would be in an ordered arrangement on a surface or substrate.
  • biomarkers disclosed herein can be used as the basis for drug screening assays and research tools.
  • IRF5, SWAP-70, and DEF6 polypeptides and proteins can be used in drug screening assays, free in solution, or affixed to a solid support. All of these forms can be used in binding assays to determine if agents being tested form complexes with the peptides, proteins or fragments, or if the agent being tested interferes with the formation of a complex between the peptide or protein and a known ligand.
  • High throughput screening can also be used to screen for therapeutic agents.
  • Small peptides or molecules can be synthesized and bound to a surface and contacted with the polypeptides, and washed. The bound peptide is visualized and detected by methods known in the art.
  • Antibodies to the polypeptides can also be used in competitive drug screening assays.
  • the antibodies compete with the agent being tested for binding to the polypeptides.
  • the antibodies can be used to find agents that have antigenic determinants on the polypeptides, which in turn can be used to develop monoclonal antibodies that target the active sites of the polypeptides.
  • the invention also provides for polypeptides to be used for rational drug design where structural analogs of biologically active polypeptides can be designed. Such analogs would interfere with the polypeptide in vivo, such as by non-productive binding to target.
  • the three-dimensional structure of the protein is determined by any method known in the art including but not limited to x-ray crystallography, and computer modeling. Information can also be obtained using the structure of homologous proteins or target-specific antibodies.
  • agents can be designed which act as inhibitors or antagonists of the polypeptides, or act as decoys, binding to target molecules non-productively and blocking binding of the active polypeptide, or which act as agonists.
  • a further embodiment of the present invention is gene constructs comprising the genes that encode IRF5, SWAP-70, and Def6 and any of the differentially expressed genes described herein, and a vector. These gene construct can be used for testing of therapeutic agents as well as basic research. These gene constructs can also be used to transform host cells can be transformed by methods known in the art.
  • the resulting transformed cells can be used for testing for therapeutic agents as well as basic research.
  • mice C57BL/6, CD21-Cre and CD11c-Cre were obtained from Jackson Laboratory.
  • DEF6 deficient mice were generated by Lexicon Pharmaceuticals, Inc. using a gene trapping strategy as previously described (Biswas et al. 2012).
  • Swap-70 deficient mice (Swap-70 ⁇ / ⁇ ) were generated by R. Jessberger as previously described (Biswas et al. 2012).
  • Def6 tr/tr Swap-70 ⁇ / ⁇ (DKO) mice were generated by crossing Def6 tr/tr (Def6ko) mice with Swap-70 ⁇ / ⁇ (Swap70ko) mice that had been backcrossed onto C57BL/6 background for greater than 10 generations (Biswas et al. 2012).
  • SAP ⁇ / ⁇ mice were obtained from Taconic and crossed to DKO mice to obtain SAP ⁇ / ⁇ DKO mice.
  • IL21 ⁇ / ⁇ mice on mixed strain background were obtained from the Mutant Mouse Regional Resource Centers (Lexicon strain ID 011723-UCD), and then backcrossed into a C57BL/6 background for greater than 10 generations and then crossed with DKO mice to obtain IL21 ⁇ / ⁇ DKO mice.
  • CD11c CreIRF4 fl/fl DKO mice were generated as previously described (Manni et al. 2015).
  • IRF5 fl/fl mice which do not carry the Dock2 mutation, were originally obtained from Paula Pitha-Rowe (Johns Hopkins University, MD) (Fang et al. 2012).
  • CD21-Cre mice were crossed with IRF5 fl/fl mice to produce CD21-Cre IRF5 fl/fl mice.
  • DKO mice expressing either CD21Cre or CD11cCre to produce IRF5 fl/fl DKO, CD21-Cre IRF5 fl/ ⁇ DKO, CD11cCre IRF fl/ ⁇ DKO, and IRF5 fl/ ⁇ DKO mice.
  • BLIMP-YFP-10BiT double reporter mice have been described previously (Parish et al 2014; Maynard et al. 2007) and were crossed with DKO mice to generate BLIMP-YFP-10BiT DKO mice as described in Chandrasekaran et al. 2016.
  • Yaa-DKO male mice were obtained by crossing DKO male mice with Yaa mice which carry a duplication of TLR7 on the Y chromosome (Deane et al. 2007).
  • mice used in the experiments were kept under specific pathogen-free conditions.
  • the experimental protocols were approved by the Institutional Animal Care and Use Committee of the Hospital for Special Surgery and WCMC/MSKCC.
  • CD11c N418), CD11b (M1/70), CD19 (6D5), B220 (RA3-6B2), T-bet (4B10), CD4 (RM4-5), CD21/CD35 (7E9), CD23 (B3B4), CD86 (GL-1), MHCII (AF6-120.1), IgG1 (RMG1-1) and IgG2a (RMG2a-62) were obtained from Biolegend.
  • Antibodies to CD43 (S7), CD138 (281-2), GL-7 and Fas (Jo2) were obtained from BD.
  • CXCR5 (2G8; BD)
  • B cells Single-cell suspensions from pooled spleens and lymph nodes were pre-enriched for B cells with B220 microbeads (Miltenyi Biotec) following the manufacturer instructions. B cells were stained with CD11c (N418), CD11b (M1/70), CD19 (6D5), B220 (RA3-6B2) and CD23 (B3B4) and were sorted on FACS Aria (Becton Dickinson).
  • CD23+ B cells were cultured in RPMI 1640 medium (Corning) supplemented with 10% FBS (Atlanta Biologicals), 100 U/ml Penicillin (Corning), 100 mg/ml Streptomycin (Corning), 1 ⁇ Non-Essential Amino Acids (Corning), 2 mM L-Glutamine (Corning), 25 mM Hepes and 50 ⁇ M ⁇ -Mercaptoethanol, and stimulated with 5 ⁇ g/ml F(ab′)2 anti-mouse IgM ( ⁇ IgM; Jackson ImmunoResearch Laboratories), 5 ⁇ g/ml Ultra-LEAF purified anti-mouse CD40 (Biolegend), in presence or absence of 50 ng/ml IL-21 (
  • ccl5 forward (SEQ ID NO: 1) 5′-GCCCACGTCAAGGAGTATTTCTA-3′; ccl5 reverse (SEQ ID NO: 2) 5′-ACACACTTGGCGGTTCCTTC-3′; il6 forward (SEQ ID NO: 3) 5′-GAGGATACCACTCCCAACAGAC-3′; il6 reverse (SEQ ID NO: 4) 5′-AAGTGCATCATCGTTGTTCATA-3′; cxcl10 forward (SEQ ID NO: 5) 5′-CCAAGTGCTGCCGTCATTTTC-3′; cxcl10 reverse (SEQ ID NO: 6) 5′-GGCTCGCAGGGATGATTTCAA-3′; ifn ⁇ forward (SEQ ID NO: 7) 5′-GGATATCTGGAGGAACTGGC-3′; Ifn ⁇ reverse (SEQ ID NO: 8) 5′-GCGCCAAGCATTCAATGAGCTC-3′; spi1 forward (SEQ ID NO: 9) 5′-TGCAGCTC
  • Expression plasmids for untagged and HA-tagged DEF6 were generated as described previously (Biswas et al. 2012).
  • the full-length wild type human SWAP-70 expression plasmid (pIRES2-EGFP-HA-SWAP70) was constructed by cloning the entire coding region of the human Swap-70 cDNA, fused in frame with a hemagglutinin (HA) epitope coding sequence at its 5′ end, into the pIRES2-EGFP bicistronic expression vector (Clonetech).
  • HA hemagglutinin
  • Various deletion mutants of human SWAP-70 were generated by PCR using appropriate primers.
  • the full-length wild type human IRF5 expression construct in pcDNA3 was a kind gift of Dr. Inez Rogatsky.
  • Full length human IRF5 (variant 5) and T-bet expression constructs were purchased from Genescript.
  • Expression plasmids for Flag-tagged IRF5 (variant 5) and its various deletion mutants were constructed in p3XFLAG-CMV-10 expression vector (Sigma) using IRF5 construct (Genescript) as a template.
  • Expression plasmid for untagged T-bet was generated in pIRES2-EGFP bicistronic expression vector (Clonetech) using T-bet expression construct (Genescript) as a PCR template.
  • Nuclear and cytoplasmic extracts were prepared with NEPER Nuclear and Cytoplasmic Extraction Reagents (Pierce), as previously described (Biswas et al. 2012).
  • cell extracts were analyzed by Western blotting with anti-STAT3 (BD Bioscience), anti-pSTAT3 (Y705) (Cell Signaling), anti-IRF5 (Cell Signaling) or anti-HDAC1 (Cell Signaling) antibodies.
  • cell extracts were immunoprecipitated with an anti-IRF5 (Cell Signaling), or anti-HA (3F10; Roche Applied Science) antibodies.
  • the immunoprecipitates were resolved by 8% SDS-PAGE, transferred to a nitrocellulose membrane, and then immunoblotting with either an anti-SWAP-70 antibody (Santa Cruz Biotechnology, Inc.), anti-DEF6 antiserum (Gupta et al. 2003) or anti-HA antibody (Roche Applied Science).
  • CD23+ B cells were purified and stimulated in vitro for 48 hours. After harvesting, the cells were cross-linked with formaldehyde, and chromatin extracts were prepared using the truChIP Chromatin Shearing Reagent Kit (Covaris) according to manufacturer instructions. The DNA-protein complexes were immunoprecipitated with an anti-IRF5 (Abcam, ab21689) or anti-T-bet (Santa Cruz; sc-21749X) specific antibody or a control antibody.
  • ONP assays were conducted as previously described (Biswas et al. 2010). Briefly, nuclear extracts were precleared with streptavidin-agarose beads and then incubated with trimerized biotinylated double-stranded oligonucleotide containing potential IRF binding site within the ATAC-seq peak at the IL-6 TSS (5′-TGCTGAGTCACTTTTAAAGAAAAAAAGAAGAGT-3′) (SEQ ID NO: 28) or the CXCL10 Cl (5′-CATAGAAAATGTTTTCAAAACCCGCATTCCGCTTATGCTGTCTGGTATCTGAAATAG ATCTGTCAGGGGGTCACATTTTATAAGCACCACTTCGTGTTTG-3′) (SEQ ID NO: 29).
  • Proteins bound to the biotin-labeled DNA were collected by streptavidin-agarose beads, separated by 8% SDS-PAGE, and analyzed by Western blotting using anti-mouse IRF5 Ab (Cell signaling), anti-human IRF5 Ab (Santa Cruz SC-390364) or an anti-T-bet Ab (Santa Cruz; sc-21749).
  • IL-6 and CXCL10 in culture supernatants were measured using the mouse ELISA Max Standard Set (Biolegend) and the mouse Quantikine ELISA kit (R&D Systems) respectively.
  • Anti-ssDNA and anti-nRNP IgG ELISAs were obtained from Alpha Diagnostic International. OD 450 was measured on a microplate reader. ANAs were detected on Hep-2 slides (MBL international) at a 1:200 dilution using Alexa Flour 488-conjugated anti-mouse IgG (Jackson ImmunoResearch). Fluorescent intensity was semi-quantitated by following the guidelines established by the Center for Disease Control, Atlanta, Ga.
  • Tissue specimens were fixed in 10% neutral buffered formalin and embedded in paraffin. Tissue sections were stained with periodic acid schiff (PAS) and analyzed by light microscopy.
  • PAS periodic acid schiff
  • the nephritis scoring system was adapted from the International Society of Nephrology/Renal Pathology Society (ISN/RPS) classification of human lupus nephritis. At least 40 glomeruli per mouse were evaluated. The final score accounted for morphological pattern (mesangial, capillary, membranous) and for the percentage of involved glomeruli.
  • Immunofluorescence analysis on frozen kidney sections was performed by staining with FITC-labeled goat anti-mouse IgG (Jackson ImmunoResearch Laboratories) and specimens were analyzed with a LSM 510 laser scanning confocal microscope (Carl Zeiss, Inc.). Images were captured by Q capture software. Five representative glomeruli per mouse were chosen and mean fluorescent intensity (MFI) was calculated using ImageJ software.
  • Genes that passed the filtering were considered to be differentially expressed.
  • Gene Set Enrichment Analysis was performed using the difference of log-transformed count per million (cpm) for contrasted conditions as a ranking metric.
  • Molecular Signatures DataBase v 5.2 (Broad Institute) was used as source of gene sets with defined functional relevance. Gene sets ranging between 15 and 1000 genes were included into analysis. Nominal p values were FDR corrected and gene sets with FDR ⁇ 0.05 were used to create GSEA enrichment plot.
  • unsupervised hierarchical clustering analysis of log-transformed expression values (cpm) in R was performed. The distances between genes were calculated as (1 ⁇ Pearson correlation). The Euclidean distance was used to determine the distances between samples. Ward.D2 methods was used to performs clustering. The expression values were z-transformed and visualized using heatmaps.
  • the nuclei of sorted WT and DKO ABC or DKO Follicular B cells were prepared by incubation of cells with nuclear preparation buffer (0.30 M sucrose, 10 mM Tris, pH 7.5, 60 mM KCl, 15 mM NaCl, 5 mM MgCl2, 0.1 mM EGTA, 0.1% NP40, 0.15 mM spermine, 0.5 mM spermidine and 2 mM 6AA) (Minnich et al. 2016). Libraries were prepared as described previously (Buenrosto et al. 2015). Paired-end 50 bp sequences were generated from samples on an Illumina HiSeq2500.
  • the makeTagDirectory was used followed by findPeaks command from HOMER version 4.7.2 to identify peaks of ATAC-seq.
  • a false discovery rate (FDR) threshold of 0.001 was used for all data sets.
  • the total number of mapped reads in each sample was normalized to ten million mapped reads. Peak-associated genes were defined based on the closest genes to these genomic regions using RefSeq coordinates of genes.
  • the annotatePeaks command from HOMER was used to calculate ATAC-seq tag densities from different experiments and to create heatmaps of tag densities. Sequencing data were visualized by preparing custom tracks for the UCSC Genome browser.
  • P values were calculated with unpaired two-tailed Student's t-test for two-group comparisons and by one-way ANOVA followed by Bonferroni's multiple comparisons test for multi-group comparisons. For statistical analysis of ANA intensity score the non-parametric Mann-Whitney test was used. P values of ⁇ 0.05 were considered significant. Ns: not significant, *: p ⁇ 0.05, **: p ⁇ 0.01 ***: p ⁇ 0.001***: p ⁇ 0.0001. Statistical analysis was performed with Graphpad Prism 5.
  • DKO female mice demonstrated a marked increase in the frequencies and numbers of splenic B cells expressing CD11c and CD11b ( FIG. 1A ). This increase could be observed by gating either on B220 alone or on both B220 and CD19 ( FIG. 1A ). Expansion of CD11c+CD11b+ B cells was primarily observed in spleens and, only minimally, in lymph nodes ( FIG. 1B ). Further staining for PDCA-1 confirmed that accumulation of these cells was not due to an increase in plasmacytoid dendritic cells (results not shown).
  • FIG. 1C While ABCs in wild type female mice are normally detected after 12 months of age, ABCs in DKO female mice started appearing by 10 weeks of age ( FIG. 1C ), were readily observed by 18 weeks of age ( FIG. 1D ), and comprised up to 15% of splenic B cells in older (>23 weeks) mice ( FIG. 1A ).
  • B cells express both DEF6 and SWAP-70 it was also examined whether lack of either DEF6 alone or SWAP-70 alone was sufficient to promote the accumulation of ABCs in vivo ( FIG. 1B ). While a small increase in the frequencies of these cells could be observed in the spleens of female mice lacking only DEF6 or only SWAP-70, their abundance did not reach the levels observed in DKO female mice ( FIG. 1B ). The premature expansion of CD11c+CD11b+ B cells observed in DKO mice was thus dependent on the concomitant absence of DEF6 and SWAP-70, thus, both SWEF proteins control the accumulation of these cells in vivo.
  • CD11c+CD11b+ B cells that accumulated in DKO female mice
  • Tbet a major regulator of ABC generation
  • CD11c+CD11b+ DKO B cells downregulated the expression of CD21 and CD23 and expressed high levels of CD86, MHCII, and IgM ( FIG. 1D ).
  • CD11c+CD11b+ DKO B cells did not express CD5, CD43, or CD93 ( FIG. 1D ). While most CD11c+CD11b+ DKO B cells expressed sIgM, a small number of these cells had undergone class-switching and expressed IgG1 and IgG2c ( FIG. 1F ).
  • CD11c+CD11b+ B cells from DKO mice were FACS-sorted and cultured in vitro in the presence or absence of the TLR7 agonist, imiquimod ( FIG. 1G ).
  • ABCs, but not Follicular B cells (FoB) from DKO mice secreted anti-dsDNA IgG2c ( FIG. 1G ). No anti-dsDNA IgG1 production was instead observed under these stimulatory conditions (not shown).
  • TLR7 stimulation of DKO ABCs also resulted in the production of anti-nRNP and anti-cardiolipin IgG antibodies ( FIG. 1G ).
  • DKO ABCs can thus directly contribute to the autoimmune syndrome in DKO mice by producing autoantibodies and are thus denoted as “pathogenic ABCs”.
  • Example 3 IL-21 Regulates the Generation of ABCs in DKO Mice In Vitro and In Vivo
  • T cells can also promote the generation of ABCs by providing contact-dependent signals and cytokines like IL-21 (Naradikian et al. 2016).
  • An in vitro system to directly investigate the ability of these signals to drive the formation of ABCs from B cells purified from 8 week-old wild type or DKO female mice (Example 1) was set up ( FIG. 2A ).
  • Culturing wild type or DKO B cells with ⁇ IgM (5 ⁇ g/ml) and ⁇ CD40 (5 ⁇ g/ml), either alone or with imiquimod, (1 ⁇ g/ml) did not result in the formation of CD11c+CD11b+ B cells.
  • DKO female mice that also lack IL-21 were generated. Accumulation of CD11c+CD11b+ B cells was completely abrogated in these mice as compared to age-matched female DKO mice ( FIG. 2C ). DKO mice lacking IL-21 also failed to accumulate TFH cells, germinal center (GC) B cells, and plasma cells, and failed to produce anti-dsDNA autoantibodies ( FIGS. 2E and 2F ).
  • B cells were sorted based on the levels of expression of CD11c and CD11b and RNA-Seq employed as described in Example 1 to compare the transcriptome of CD11c+CD11b+(ABC) DKO B cells to that of CD11c ⁇ CD11b ⁇ (FoB) B cells obtained from either wild type or DKO mice.
  • a total of 3049 genes were differentially expressed amongst the three different subsets ( FIG. 3A ).
  • a set of genes (cluster 2, DKO-specific up) was upregulated or downregulated (cluster 1, DKO-specific down) in DKO B cells irrespective of the expression of CD11c and CD11b suggesting that the lack of SWEF proteins altered the expression of these genes in B cells independently of their differentiation state ( FIG. 3A ).
  • CD11c ⁇ Tbet ⁇ DKO B cells contained a small population of highly proliferative cells ( FIG. 3C ). Strikingly, CD11c+Tbet+ DKO B cells proliferated even more robustly than CD11c ⁇ Tbet ⁇ DKO B cells ( FIG. 3C ).
  • WT and DKO B cells exhibited similar survival rates in vitro as assessed by either PI staining or Caspase 3 cleavage at different times after stimulation with ⁇ IgM (5 ⁇ g/ml), ⁇ CD40 (5 ⁇ g/ml), IL-21c (50 ng/ml) or imiquimod (1 ⁇ g/ml) for 3 or 5 days ( FIG. 3F ).
  • SWEF proteins regulate the proliferation of B cells, and play a particularly important role in restraining the capacity of pathogenic ABCs to proliferate in response to IL-21.
  • clusters 3 and 5 were specifically upregulated in CD11c+CD11b+ DKO B cells as compared to CD11c ⁇ CD11b ⁇ B cells obtained from either wild type or DKO mice.
  • DKO ABCs expressed higher levels of T-bet (Tbx21), CD11c (Itgax) and CD11b (Itgam), which were used for ABC isolation, as compared to FoBs ( FIG. 3G ).
  • GSEA was used to gain insights into the pathways that were uniquely upregulated in DKO ABC cells.
  • the top enriched sets included several gene sets enriched in transcripts controlling chemotaxis, integrin binding, cell adhesion, and inflammation ( FIGS. 3H and 3J ).
  • Prominent amongst the upregulated genes were a number of chemokines (e.g. Cxcl9, Cxcl10, Ccl4, Ccl5, Ccl8), cytokine receptors (Il1r2, Il2rb2, Il18r1, and Il18rap) and cytokines including Csf1 ( FIGS.
  • Example 5 the Chromatin Landscape of DKO ABC Cells is Enriched with IRF and AP-1/BATF Motifs as Compared to FoB Celle
  • ATAC-seq signals from sorted CD11c+CD11b+ DKO cells were compared to those from sorted CD11c ⁇ CD11b ⁇ cells from the same mice.
  • the focus of the analysis was on regions with higher signals and 3,666 ABC-specific peaks that satisfied those criteria were identified ( FIG. 4A ).
  • the ABC specific peaks were primarily found in intergenic (45%) and intronic (50%) regions and only rarely in promoters.
  • Loci which were differentially accessible in ABCs as compared to CD11c ⁇ CD11b ⁇ cells included a number of proinflammatory cytokines like IFN ⁇ and IL-6 and other ABC-specific targets like the CXCL10 cluster of genes ( FIG. 4B ).
  • DKO ABCs ABCs that aberrantly expand in this autoimmune setting, i.e., pathogenic ABCs, exhibited a unique chromatin landscape, which, in addition to T-bet motifs, is enriched in IRF and AP-1/BATF motifs and correlates with a distinctive transcriptional profile.
  • CD11c+CD11b+ B cells from older WT female mice were sorted and compared their transcriptional profiles to those of CD11c+CD11b+ B cells derived from DKO female mice.
  • WT and DKO ABCs expressed similar levels of T-bet (Tbx21) ( FIG. 5A ).
  • Tbx21 T-bet
  • FIG. 5A A total of 711 genes were differentially expressed between the two populations, of which 111 genes were upregulated in DKO ABCs as compared to WT ABCs and 600 genes were downregulated (Tables 1 and 2 and FIG. 5B ).
  • ABCs from DKO mice expressed higher levels of immunoglobulin gene transcripts than ABCs derived from WT mice but downregulated a subset of myeloid-related transcripts ( FIGS. 5B and 5C ).
  • the increased levels of immunoglobulin gene transcripts displayed by the DKO ABCs were not associated with changes in the expression of key regulators of plasma cell differentiation like IRF4, IRF8, Bcl6 or Blimp1 ( FIG. 5A ) suggesting that the differences between WT and DKO ABCs were not due to the presence of contaminating plasmablasts within the DKO ABC population.
  • DKO ABCs exhibited selective changes in the expression of other transcription factors including upregulation of Jun and NFIL-3 and downregulation of c-maf MafB, and PPAR- ⁇ while levels of PU.1 were similar to those of WT ABCs ( FIG. 5A ).
  • Differential expression of selected targets which included key regulators of apoptotic cell engulfment like Mertk and Axl, was further confirmed by qPCR ( FIG. 5D ).
  • the ABCs that accumulate in autoimmune-prone DKO female mice were endowed with a higher immunoglobulin producing capacity than WT ABCs but downregulate some of the myeloid related features that can be associated with this B cell subset.
  • MAFB, NDNF and Thsd7a were differentially expressed between wild type ABCs and DKO ABCs ( FIG. 5E ).
  • DKO ABC-specific accessible loci again displayed enrichment in IRF, AP-1/BATF, and T-bet binding motifs (Table 6).
  • the pattern associated with WT ABC-specific peaks was associated with enrichment in PU.1, MAF, and C/EBP binding motifs (Table 7).
  • the chromatin landscape of pathogenic autoimmune-prone ABCs was characterized by dual abnormalities whereby enrichment in IRF and AP-1/BATF motifs was coupled with depletion of PU.1- and MAF-bound regulatory regions.
  • IRF5 Given the high degree of homology amongst IRF DNA binding domains the possibility that another IRF may regulate the aberrant generation of DKO ABCs was investigated. The focus was on IRF5 given its ability to regulate the production of IgG2a/c, proinflammatory mediators like IL-6 and the strong association with SLE (Cham et al. 2012; Lazzari and Jefferies 2014). To facilitate these studies, DKO mice completely lacking IRF5 in B cells (CD21Cre-IRF5 fl/ ⁇ DKO) were generated and then assessed the ability of B cells from these mice to generate ABCs in vitro. Expression of IRF5 was similar in WT and DKO B cells and was absent in B cells from CD21Cre-IRF 5fl/ ⁇ DKO mice (results not shown).
  • ChIP-assays were performed to assess the binding of IRF5 to these regulatory regions.
  • DKO B cells exhibited enhanced binding of IRF5 to these sites upon IL-21 stimulation despite exhibiting similar levels of Stat3 phosphorylation and IRF5 nuclear translocation ( FIGS. 6G and 6H ).
  • Minimal IRF5 binding was observed in IRF5-deleted DKO B cells or when cells were stimulated in the absence of IL-21 supporting the specificity of the findings ( FIG. 6G ).
  • mice with monoallelic expression of IRF5 (IRF5f-DKO) exhibited an almost complete loss of ABC cells, irrespective of the markers used to identify the population ( FIGS. 7A-7D ).
  • Loss of ABCs was accompanied by marked decreases in splenomegaly, T FH cells, GC B cells and PC cells ( FIGS. 7E-7G ).
  • Further deletion of IRF5 using CD21Cre or CD11cCre to target B cells or CD11c+ cells did not result in additional decreases in the ABC compartment ( FIGS. 7A and 7B ).
  • Yaa-DKO male mice had an increased expansion of ABCs as compared to male DKO mice and enables them to produce anti-dsDNA IgG2a/c upon stimulation ( FIGS. 9A and 9C ).
  • FoB cells from WT male and Yaa DKO male mice and ABCs from male Yaa DKO mice as well as CD11c+ plasmablasts and CD11c ⁇ plasmablasts (PBs) from Yaa DKO mice were sorted as described in Example 1 and subjected to a ROCK1 or ROCK2 in vitro kinase assay (Biswas et al. 2012).
  • CD11c+ PCs downregulate CD11b expression ( FIG. 8 ) suggesting that as DKO ABCs undergo terminal differentiation they acquire unique characteristics.
  • a genome-wide approach is used to test the hypothesis that the transcriptional and epigenetic landscape of CD11c+ PCs is distinct from those of ABCs and of “classical” (CD11c ⁇ ) PCs.
  • ABCs CD11c+CD11b+CD19hiCD23-Blimp1 ⁇ CD138 ⁇
  • CD11c+ PCs CD11c+CD11b ⁇ CD19loBlimp1hiCD138hi
  • “classical” PCs CD11c ⁇ CD11b ⁇ B2201loCD19loBlimp1hiCD138hi) from aging DKO female mice are sorted.
  • control “classical” PCs are obtained by immunizing wt Blimp1-YFP reporter mice with NP-CGG as described (Jones et al. 2016).
  • RNA-seq and ATAC-seq are analyzed using will be subjected to RNA-seq and ATAC-seq as described in Example 1. These data are compared with previously performed genome-wide analyses (Shi et al. 2015). A selected number of targets are validated by QPCR, Western blotting, and/or FACS.
  • CD11c+ PCs express both IRF4 and IRF5 and that both IRF4 and IRF5 have been reported to regulate the expression of Blimp1 (Kwon et al. 2009), the hypothesis that IRF4 cooperates with IRF5 in regulating the differentiation/function of CD11c+ PCs is also tested using the materials and methods of Example 1.
  • the IRF4 fl/fl DKO mice, described in Example 1 are crossed to T-bet-Zsgreen-T2ACreERT2 DKO mice. This strategy minimizes the known impact of IRF4 deletion on other cellular compartments like DCs (which would be affected by using the CD11cCre line) and “classical” B cell compartments (which would be affected by using CD23Cre mice). While DKO mice do exhibit an accumulation of TFH cells that produce IFN ⁇ , as mentioned above, these cells do not express T-bet and thus should not be impacted by the removal of IRF4. All relevant control genotypes are also included.
  • IRF4 deletion is induced by tamoxifen administration (and verified by QPCR and or IC FACS) and the effects of removing IRF4 versus IRF5 (using the T-bet-Zsgreen-T2A-CreERT2IRF5 fl/fl DKO mice) are evaluated by performing a series of experiments which will include: i) a baseline FACS and serum Ig analysis of 8-12 week old mice, ii) a series of studies to assess PC differentiation in vitro upon exposure to different combinations of ABC-promoting stimuli, and iii) an evaluation of the development of lupus-like disease in aged groups of female mice as described in the previous examples. If warranted, additional genetic manipulations will also be investigated (e.g., IRF4fl/+IRF5fl/+).
  • a series of mixed bone marrow chimeras are also performed, which will take advantage of the kMTDKO mice. Briefly lethally irradiated kMTDKO recipient mice will be reconstituted with mixtures of 80% kMTDKO BM+20% of CD11c ⁇ Cre+IRF4fl/flDKO BM so that only CD11-c expressing DKO B cells will lack IRF4. Once appropriately reconstituted, a full analysis of young and aged mice is performed as described in detail above.
  • Example 10 A number of observations have implicated sex-specific pathways in the regulation of ABCs. As shown in Example 10, there is a striking sex-specific differences in the ability of ABCs to produce autoantibodies. Also, while ABCs accumulate in both DKO female and male mice, only ABCs from DKO female mice readily secreted anti-dsDNA IgG2c antibodies upon TLR7 stimulation (Example 10), suggesting that the ABCs from DKO females are functionally distinct from those obtained from DKO males. Dysregulation of TLR7 expression in DKO male mice, i.e., Yaa-DKO mice, rescued their ability to produce anti-dsDNA IgG2c (Example 10). Using the materials and methods described in Example 1, using both targeted and genome-wide approaches, the hypothesis that sex-specific pathways regulate not only the expansion but also the function and differentiation of ABCs is tested.
  • RNA-seq and ATAC-seq is performed on ABC cells sorted from DKO male and Yaa-DKO male mice (and sex-matched control mice). These profiles are compared to those obtained in ABCs from DKO female mice (Examples 4-6).
  • a motif analysis is performed to determine whether functionally relevant differences map to motifs of specific transcription factors.
  • the transcriptome of ABCs from DKO male and female mice show some similarities (since aberrant expansion of these cells is observed in both female and male DKOs).
  • the ABCS from DKO males and DKO females have crucial transcriptional differences that is revealed by a GSEA analysis and these distinctions reflect the differential expression of a selected group of pathways, and that the ATAC-seq demonstrates that these transcriptional differences are accompanied by differences in the chromatin landscape surrounding these genes.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Molecular Biology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Biomedical Technology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Cell Biology (AREA)
  • Wood Science & Technology (AREA)
  • Diabetes (AREA)
  • Epidemiology (AREA)
  • Endocrinology (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Hematology (AREA)
  • Physics & Mathematics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

This current invention provides methods and agents for preventing and treating autoimmune and lymphoproliferative disease by targeting pathogenic age-associated B cells as well as methods of detecting these pathogenic age-associated B cells as a method of diagnosing and predicting autoimmune disease and other lymphoproliferative and chronic inflammatory disorders.
The current invention also provides targets for drug development and basic research for autoimmune diseases and other lymphoproliferative and chronic inflammatory disorders.

Description

CROSS REFERENCE TO RELATED APPLICATION
The present application is a Continuation of U.S. application Ser. No. 15/833,398, filed Dec. 6, 2017, and claims priority to U.S. Patent Application Ser. No. 62/430,732 filed Dec. 6, 2016, U.S. Patent Application Ser. No. 62/487,645 filed Apr. 20, 2017, and U.S. Patent Application Ser. No. 62/512,803 filed May 31, 2017, all of which are hereby incorporated by reference in their entirety.
GOVERNMENT SUPPORT CLAUSE
This invention was made with government support under AR064883 and AR070146 awarded by NIH. The government has certain rights in the invention.
FIELD OF THE INVENTION
This invention relates to the field of preventing and treating autoimmune and lymphoproliferative disease by targeting pathogenic age-associated B cells as well as methods of detecting these pathogenic age-associated B cells as a method of diagnosing and predicting autoimmune disease and other lymphoproliferative and chronic inflammatory disorders.
The invention also provides targets for drug development and basic research for autoimmune diseases and other lymphoproliferative and chronic inflammatory disorders.
BACKGROUND OF THE INVENTION
Autoimmune diseases, such as systemic lupus erythematosus (SLE), also known as lupus, occur when the immune system of a vertebrate attacks the tissue of self rather than an infectious agent. Other autoimmune illnesses include rheumatoid arthritis, inflammatory bowel disease, and Type 1 diabetes. Autoimmune disorders can furthermore be associated with the development of lymphoproliferative disorders such as lymphomas.
While the cause of lupus and other autoimmune diseases is unknown, theories on their origin include genetics, environment, infections, and the defective failure to process the products of an immune response.
Precise regulation of the expansion and function of T and B cell subsets is critical for the prevention of autoimmune disorders like SLE, a disease which preferentially affects females (Eisenberg 2003; Cohen-Solal and Diamond 2011). Murine studies have recently uncovered the existence of a unique subset of B cells termed age/autoimmunity-associated B cells (ABCs) that preferentially expands in females with age. In addition to classical B cell markers like B220 and CD19, ABCs can also express markers such as CD11c and CD11b and are known to require T-bet for their generation. Formation of ABCs is promoted by TLR7/9 engagement and cytokines like IFNγ and IL-21. ABCs increase prematurely in murine models of lupus and can produce anti-chromatin antibodies. B cells with features similar to ABCs have also been detected in human autoimmune disorders including SLE. ABCs characteristically express T-bet and their generation depends on this transcription factor, hence, these cells are also known as CD11c+Tbet+ B cells (Naradikian et al. 2016a; Naradikian et al. 2016; Rubtsova et al. 2017). The molecular pathways that promote the expansion and pathogenic function of ABCs in autoimmune settings are largely unknown.
Multiple lines of evidence have implicated members of the Interferon Regulatory Factor (IRF) family of transcription factors in autoimmunity and lupus development. Amongst the nine IRF family members, IRF4 plays a fundamental and multifaceted role in the activation of both T and B cells (Rogatsky et al. 2014). In addition to IRF4, studies have demonstrated strong associations between IRF5 variants and human autoimmune disorders, particularly SLE (Cham et al. 2012; Lazzari and Jefferies 2014). It is also unknown whether IRF4 and IRF 5 play a role in the function of ABCs.
The SWEF family is a small family of proteins comprised of SWAP-70 and its homolog, DEF6 (Gupta et al. 2003; Tanaka et al. 2003; Ripich et al 2003). In addition to regulating T and B cell function by regulating the activity of the transcription factor IRF4 (Biswas et al. 2012; Manni et al. 2015), these proteins also control the cytoskeletal dynamics of T and B cells by regulating the activation of Rho GTPases (Biswas et al. 2010). The SWEF proteins play an important immunoregulatory role in vivo as evidenced by the finding that the simultaneous lack of DEF6 and SWAP-70 (in Doubleknockout=DKO mice) leads to the development of SLE in C57BL/6 mice, which, similarly to human SLE, preferentially affects females (Biswas et al. 2012). The development of autoimmunity in DKO mice is associated with dysregulation of both T and B cell compartments including expansion of TFH cells, increased IL-21 production, and enhanced formation of germinal centers, and plasma cells (Biswas et al. 2012). In further support of a role for this family of proteins in autoimmunity, the DEF6 locus has recently been identified as a genetic risk factor for human SLE (Sun et al. 2016).
There are currently very few methods of predicting whom will develop lupus or other autoimmune diseases and lymphoproliferative disorders, and there are no current therapies for treating SLE other than treatment of the symptoms, and no preventative therapy. Thus, there is a need in the art for new treatments and diagnostics for SLE, and other autoimmune and lymphoproliferative diseases.
SUMMARY OF THE INVENTION
The current invention is based on the discovery that age-associated B cells (“ABCs”) expand and become pathogenic (“pathogenic ABCs) upon interaction of certain proteins. In particular, the aberrant expansion of ABCs depends on the transcription factor, interferon regulatory factor 5 (“IRF5”). Additionally, the aberrant expansion of ABCs is abolished or decreased by two proteins in the SWEF family, SWAP-70 and DEF6.
One embodiment of the current invention is a method of abolishing or decreasing pathogenic ABCs in a subject in need thereof by administering an effective amount of an agent that agonizes, activates or increases the expression and/or activity of SWAP-70 and DEF6.
A further embodiment of the current invention is a method of preventing and/or treating an autoimmune or lymphoproliferative disease by abolishing or decreasing pathogenic ABCs in a subject in need thereof by administering an effective amount of an agent that agonizes, activates or increases the expression and/or activity of SWAP-70 and DEF6.
Another embodiment of the current invention is a method of abolishing or decreasing pathogenic ABCs in a subject in need thereof by administering an effective amount of an agent that antagonizes, inhibits or reduces the expression and/or activity of IRF5.
A further embodiment of the current invention is a method of preventing and/or treating an autoimmune or lymphoproliferative disease by abolishing or decreasing pathogenic ABCs in a subject in need thereof by administering an effective amount of an agent that antagonizes, inhibits or decreases the expression and/or activity of IRF5.
Another embodiment of the current invention is a method of abolishing or decreasing pathogenic ABCs in a subject in need thereof by administering an effective amount of an agent that antagonizes, inhibits or reduces the expression of certain genes that are upregulated in pathogenic ABCs.
A further embodiment of the current invention is a method of preventing and/or treating an autoimmune or lymphoproliferative disease by abolishing or decreasing pathogenic ABCs in a subject in need thereof by administering an effective amount of an agent that antagonizes, inhibits or decreases the expression of certain genes that are upregulated in pathogenic ABCs.
A further embodiment of the current invention is a method of abolishing or decreasing pathogenic ABCs in a subject in need thereof by administering an effective amount of an agent that agonizes, activates or increases the number or expression of certain genes that are downregulated in pathogenic ABCs.
Yet a further embodiment of the current invention is a method of preventing and/or treating an autoimmune or lymphoproliferative disease by abolishing or decreasing pathogenic ABCs in a subject in need thereof by administering an effective amount of an agent that agonizes, activates or increases the number or expression of certain genes that are downregulated in pathogenic ABCs.
A further embodiment of the invention is a method of preventing and/or treating an autoimmune disease in a subject in need thereof by administering an effective amount of an agent that antagonizes or inhibits the ability of pathogenic ABCs to differentiate into plasma cells.
In some embodiments, the autoimmune disease is systemic lupus erythematosus, rheumatoid arthritis, type 1 diabetes, multiple sclerosis, myasthenia gravis, Graves disease, pernicious anemia, scleroderma, psoriasis, inflammatory bowel diseases, Hashimoto's disease, Addison's disease, and Sjögren's syndrome. In some embodiments, the lymphoproliferative disease is Hodgkin's lymphoma or non-Hodgkin's lymphoma.
A further embodiment of the current invention is a method of detecting pathogenic ABCs. The detection of pathogenic ABCs makes it possible to diagnose that a subject has an autoimmune or lymphoproliferative disease or predict that a subject will develop an autoimmune or lymphoproliferative disease. A method for detecting pathogenic ABCs comprises obtaining a sample from a subject and detecting the presence of pathogenic ABCs, wherein the pathogenic ABCs comprise B cells that express CD11c, as well as additional markers such as B220, CD86, MHCII and IgM, but downregulate CD5. The presence of the pathogenic ABCs can also be detected by detecting the expression of one or more genes as compared to a reference value of the expression of the same genes in ABCs that are not pathogenic or the same genes in other non-pathogenic B cells, such as follicular B cells.
The expression of the genes from the pathogenic ABCs from a subject with a suspected autoimmune or lymphoproliferative disease can be compared to a reference value of the expression of the same genes in non-pathogenic ABCs or other B cells from a healthy donor or control. The levels of expressed genes may be measured as absolute or relative. Absolute quantitation measure concentrations of specific RNA and requires a calibration curve. Relative quantification measures fold change differences of specific RNA in comparison to housekeeping genes. Relative quantification is usually adequate to investigate physiological changes in gene expression levels.
Once the pathogenic ABCs are detected, a further embodiment of the invention is abolishing or decreasing the pathogenic ABCs, by the methods set forth herein.
A further embodiment of the current invention is a method of evaluating or monitoring subjects with an autoimmune or lymphoproliferative disease for their response to treatment by the detection of pathogenic ABCs. A method for detecting pathogenic ABCs comprises obtaining a sample from a subject, isolating B cells and detecting the presence of pathogenic ABCs, wherein the pathogenic ABCs comprise B cells that express cell markers CD11c, and additional markers such as B220, CD86, MHC11 and IgM, but downregulate CD5. The presence of the pathogenic ABCs can also be detected by detecting the expression of one or more genes, as compared to the expression of the same genes in ABCs that are not pathogenic or the same genes in other B cells. In this method, the expression of the genes from the cells of the subject are compared before and after treatment.
The present invention also provides for methods and tools for drug design, testing of agents, and tools for basic research into the causes and etiology of pathogenic ABCs, and autoimmune or lymphoproliferative disease.
Thus, a further embodiment of the present invention is a method and/or assay for identifying a test agent for abolishing or decreasing pathogenic ABCs comprising contacting or incubating a test agent with a nucleotide comprising the gene for SWAP-70 or DEF6 which expresses a measurable phenotype, and measuring the phenotype before and after contact or incubation with the test agent, wherein if the expression of the measurable phenotype is increased after the contact or incubation with the test agent, the test agent is identified as an agent that can abolish or decrease pathogenic ABCs.
The measurable phenotype can be one that is native to the gene or one that is artificially linked, such as a reporter gene.
A further embodiment of the present invention is a method and/or assay for identifying a test agent for abolishing or decreasing pathogenic ABCs, comprising transforming a host cell with a gene construct comprising the gene for SWAP-70 or DEF6, detecting the expression of the gene in the host cell, contacting the test agent with the host cell, and detecting the expression of the gene from the host cell after contact with the test agent or compound, wherein if the expression of the gene is increased after contact with the test agent or compound, the test agent is identified as an agent that can abolish or decrease pathogenic ABCs.
One embodiment is a method and/or assay for identifying a test agent for abolishing or decreasing pathogenic ABCs, comprising contacting or incubating the test agent with IRF5, and detecting the presence of a complex between the test agent, wherein if a complex between the test agent and IRF5 is detected, the test agent is identified as an agent that can abolish or decrease pathogenic ABCs.
Another embodiment of the present invention is a method and/or assay for identifying a test agent for abolishing or decreasing pathogenic ABCs, comprising contacting or incubating the test agent with IRF5 and a known antibody of IRF5, and detecting the presence and quantity of unbound antibody, wherein the presence of the unbound antibody indicates that the test agent is binding to IRF5 and the test agent is identified as an agent that can abolish or decrease pathogenic ABCs.
A further embodiment of the present invention is a method and/or assay for identifying a test agent for abolishing or decreasing pathogenic ABCs comprising contacting or incubating a test agent to a nucleotide comprising the gene for IRF5, and determining if the test agent binds to the gene, wherein if the test agent binds to the nucleotide, the test agent is identified as an agent that can abolish or decrease pathogenic ABCs.
A further embodiment of the present invention is a method and/or assay for identifying a test agent for abolishing or decreasing pathogenic ABCs comprising contacting or incubating a test agent with a nucleotide comprising the gene for IRF5 which expresses a measurable phenotype, and measuring the phenotype before and after contact or incubation with the test agent, wherein if the expression of the measurable phenotype is decreased after the contact or incubation with the test agent, the test agent is identified as an agent that can abolish or decrease pathogenic ABCs.
The measurable phenotype can be one that is native to the gene or one that is artificially linked, such as a reporter gene.
One embodiment of the present invention is a method and/or assay for identifying a test agent for abolishing or decreasing pathogenic ABCs, comprising transforming a host cell with a gene construct comprising the gene for IRF5, detecting the expression of the gene in the host cell, contacting the test agent with the host cell, and detecting the expression of the gene from the host cell after contact with the test agent or compound, wherein if the expression of the gene is reduced or decreased after contact with the test agent or compound, the test agent is identified as an agent that can abolish or decrease pathogenic ABCs.
A further embodiment of the present invention is a method and/or assay for identifying a test agent for abolishing or decreasing pathogenic ABCs comprising contacting or incubating a test agent to a nucleotide comprising a gene that is upregulated in pathogenic ABCs, and determining if the test agent binds to the gene, wherein if the test agent binds to the nucleotide, the test agent is identified as an agent that can abolish or decrease pathogenic ABCs.
A further embodiment of the present invention is a method and/or assay for identifying a test agent for abolishing or decreasing pathogenic ABCs comprising contacting or incubating a test agent with a nucleotide comprising a gene that is upregulated in pathogenic ABCs which expresses a measurable phenotype, and measuring the phenotype before and after contact or incubation with the test agent, wherein if the expression of the measurable phenotype is decreased after the contact or incubation with the test agent, the test agent is identified as an agent that can abolish or decrease pathogenic ABCs.
The measurable phenotype can be one that is native to the gene or one that is artificially linked, such as a reporter gene.
A further embodiment of the present invention is a method and/or assay for identifying a test agent for abolishing or decreasing pathogenic ABCs, comprising transforming a host cell with a gene construct comprising a gene that is upregulated in pathogenic ABCs, detecting the expression of the gene in the host cell, contacting the test agent with the host cell, and detecting the expression of the gene from the host cell after contact with the test agent or compound, wherein if the expression of the gene is reduced or decreased after contact with the test agent or compound, the test agent is identified as an agent that can abolish or decrease pathogenic ABCs.
A further embodiment of the present invention is a method and/or assay for identifying a test agent for abolishing or decreasing pathogenic ABCs comprising contacting or incubating a test agent with a nucleotide comprising a gene that is downregulated in pathogenic ABCs which expresses a measurable phenotype, and measuring the phenotype before and after contact or incubation with the test agent, wherein if the expression of the measurable phenotype is increased after the contact or incubation with the test agent, the test agent is identified as an agent that can abolish or decrease pathogenic ABCs.
The measurable phenotype can be one that is native to the gene or one that is artificially linked, such as a reporter gene.
A further embodiment of the present invention is a method and/or assay for identifying a test agent for abolishing or decreasing pathogenic ABCs, comprising transforming a host cell with a gene construct comprising a gene that is downregulated in pathogenic ABCs, detecting the expression of the gene in the host cell, contacting the test agent with the host cell, and detecting the expression of the gene from the host cell after contact with the test agent or compound, wherein if the expression of the gene is increased after contact with the test agent or compound, the test agent is identified as an agent that can abolish or decrease pathogenic ABCs.
Any test agent identified by these methods and assays would be useful in preventing and/or treating an autoimmune or lymphoproliferative disease.
The present invention also includes kits.
BRIEF DESCRIPTION OF THE FIGURES
For the purpose of illustrating the invention, there are depicted in drawings certain embodiments of the invention. However, the invention is not limited to the precise arrangements and instrumentalities of the embodiments depicted in the drawings.
Certain abbreviations are used in the Figures and Brief Description of the Figures including: WT—wild type; FACS—flow cytometry analysis; and FoB cells—follicular B cells.
FIG. 1 shows the result showing the spontaneous expansion of ABCs in DKO mice. FIG. 1A is representative flow cytometric analysis (FACS) plots and graphs of ABC cells in the spleens from aging (greater than 23 weeks-old) wild type (WT) or DKO female mice. Graphs show frequencies and numbers of individual mice and mean value of 4-8 independent experiments (n=3-16). **: p≤0.01, ****: p≤0.0001. (two-tailed Student t-test). FIG. 1B is representative FACS plots and graphs for CD11b and CD11c expression after gating on B220+CD19+ cells in skin draining lymph nodes of WT, DKO, Def6ko (Def6tr/tr), and SWAP70ko (Swap-70−/−) mice (18-24 weeks old). Graphs show frequencies and numbers of cells in individual mice and mean value of 3 independent experiments (n=3-5). **: p≤0.01. (One-way ANOVA). FIG. 1C is representative FACS plots and graphs for CD11b and CD11c expression after gating on B220+CD19+ cells in the spleens of 10 weeks old WT and DKO female mice. Graphs show frequencies and numbers of individual mice and mean value of 2 independent experiments (n=4-5). **: p≤0.01; ***: p≤0.001. (two-tailed Student-t test). FIG. 1D is representative FACS plots and graphs for CD11c and CD11b expression gated on B220+CD19+ cells in the spleens of WT, DKO, Def6ko and Swap70ko female mice (18-24 weeks old). Graphs show frequencies and numbers for individual mice and mean values from 3 independent experiments (n=3-5). ****: p≤0.0001 (One-way ANOVA). FIG. 1E are histograms that show relative expression (percentage) of the indicated marker on CD11c+CD11b+B220+CD19+ and CD11c−CD11b−B220+CD19+ cells in the spleens of DKO female mice (greater than 18 weeks old). Data are representative of least 2 independent experiments (n=4-11). FIG. 1F is representative FACS plots and graphs for IgG and IgG2c expression on B220+CD19+CD11c+CD11b+ cells. Graphs show frequencies and numbers for individual mice and mean values from 16 independent experiments (n=17-30). **: p≤0.01, ***: p≤0.001, ****: p≤0.0001. (two-tailed Student-t test). FIG. 1G are graphs of the levels of anti-dsDNAIgG2c, anti-nRNP, and anti-Cardiolipin IgG antibodies in the supernatants of sorted ABC (CD11c+CD11b+B220+CD19+) and FoB (CD11c−CD11b−CD23+B220+CD19+) B cells stimulated in vitro±1 μg/ml imiquimod for 7 days as measured by ELISA (representative of 4 independent experiments). Mean±SEM is shown. ***: p≤0.001 (One-way ANOVA).
FIG. 2 shows the results that IL-21 regulates the generation of DKO ABCs in vitro and in vivo. FIG. 2A is representative FACS plots and graph of the generation of ABCs (CD11c+T-bet+B220+) from cultures of CD23+ B cells purified from WT and DKO female mice (8-10 weeks of age) stimulated with αIgM and αCD40, alone or with IL-21 or imiquimod for 3 days. Graph shows frequencies of cells in mice as combined results of 5 independent experiments. Mean±SEM is shown. ****: p≤0.0001. (One-way ANOVA). FIG. 2B is representative FACs plots and graph of generation of ABCs (CD11c+CD11b+B220+) B cells from cultures of CD23+ B cells purified from WT and DKO female mice (8-10 weeks of age) stimulated with αIgM and αCD40 (5 μg/ml), alone or with IL-21 or imiquimod. Graph shows frequencies of cells in mice as combined results of 5 independent experiments. ***: p≤0.001. (One-way ANOVA). FIG. 2C is representative FACS plots and graphs of ABCs in the spleens from aging (greater than 24 weeks-old) wild type, DKO, or IL-21ko DKO female mice for CD11c and CD11b expression gated on B220+ cells. Graphs show the frequencies and numbers of CD11c+CD11b+ cells of individual mice gated as indicated as well as the mean value of at least 4 independent experiments (n=5-8) ***: p<0.001, ****: p≤0.0001 (One-way ANOVA). FIG. 2D shows representative FACS plots and graphs of ABCs in the spleens from aging (greater than 24 weeks-old) wild type, DKO, or SAPko DKO female mice for CD11c and CD11b (left panels) expression gated on B220+ cells. Graphs show the frequencies and numbers of CD11c+CD11b+ cells of individual mice gated as indicated as well as the mean value of at least 4 independent experiments (n=4-7). ****: p≤0.0001. FIG. 2E show graphs of amount of IgG anti-ds DNA from serum from the indicated mice as assayed by ELISA. Graphs show data of individual mice and mean value of 4 independent experiments (n=6-8). ****: p≤0.0001. FIG. 2F are graphs showing the quantification (both in percentages and absolute numbers) of TFH (CD4+CXCR5+PD1+Foxp3−), germinal center (GC) B cells (B220+FAS+GL-7+), and B220intCD138+ plasma cells (PC) in spleens of WT, DKO, IL-21ko DKO or SAPko DKO female mice (>24 weeks old). Graphs show percentages and numbers of specific cells types in individual mice per genotype (n=4-8). *: p≤0.05; **: p≤0.01; ***: p≤0.001. ****: p≤0.0001. (One-way ANOVA).
FIG. 3 shows the results showing differentially expressed genes in pathogenic ABCs. FIG. 3A shows the hierarchical clustering of log-transformed counts per million (cpm) for differentially expressed genes identified by RNAseq analysis from FACS sorted ABC (B220+CD19+CD11c+CD11b+) from DKO female mice or FoB (B220+CD19+CD11cCD11bCD23+) cells from WT and DKO female mice (greater than 20 weeks old) (n=2 WT, 3 DKO/group). FIG. 3B is a volcano plot of differentially expressed genes in FoB wild type and FoB DKO mice. Colors indicate differentially expressed genes (P value <0.01, Fold change >2) belonging to selected GSEA Hallmark pathways as indicated. FIG. 3C shows the results of flow cytometry analysis showing the proliferation of CD11c−T-bet− B220+ cells in the spleens of WT and DKO female mice (>23 weeks old, left panel) or of CD11c−T25 bet−B220+ cells and CD11c+T-bet+B220+ (ABCs) in the spleens of DKO female mice (>23 weeks old) as assessed by Ki67 staining and flow cytometry. Shown is a representative histogram of 4 and 5 independent experiments, respectively (n=5 and 6 mice/group, respectively). FIG. 3D are graphs showing the apoptotic rate as measured by caspase 3 cleavage in CD11c−T-bet− B220+ B cells in WT and DKO mice or in CD11c−T-bet− B cells and CD11c+T-bet+ (ABC) B cells in DKO mice. Shown is a representative histogram. All data are representative of 3 independent experiments. (n=4 mice). FIG. 3E is a representative histogram of 5 independent experiments (n=5) showing the results of the proliferation of CD11c−T-bet−B220+ cells and ABCs (CD11c+T-bet+B220+) assessed by evaluating dilution of cell trace violet by flow cytometry. FIG. 3F are graphs of cell viability of CD23+ B cells purified from WT and DKO female mice (6-9 weeks old) and stimulated with αIgM and αCD40, alone or with IL-21 or imiquimod for 3 or 5 days assessed by staining with CaspGlow orcpropidium iodide as indicated. FIG. 3G is a volcano plot comparing gene expression in FoB (CD11c−CD11b−CD23+ B220+CD19+) and ABC (CD11c+CD11b+B220+CD19+) cells sorted from DKO female mice (>20 weeks old). Colors indicate differentially expressed genes (P value <0.01, Fold change >2, DKOFoB/DKO ABC) belonging to selected GSEA pathways as indicated. FIG. 3H shows hierarchical clustering of log-transform counts per million (cpm) for genes that belong to the GO_inflammatory_response gene set (MsigDB) identified by RNA-Seq analysis of RNA from FACS sorted FoB (B220+CD19+CD11c−CD11b−CD23+) and ABC (B220+CD19+CD11c+CD11b+) cells from DKO female mice (n=3). FIG. 3I are graphs that show the results of qPCR analysis of the expression of Ccl5, Ifnγ, and Cxcl10 mRNA in sorted FoB (B220+CD19+CD11c−CD11b− CD23+) cells from WT and DKO female mice and ABC (B220+CD19+CD11c+CD11b+) cells from DKO female mice as indicated. The data were normalized relative to ppia mRNA expression. Data are representative of 2 (Ccl5) or 3 (Ifnγ and Cxcl10) independent experiments. FIG. 3J are graphs of qPCR analysis of the expression of the indicated mRNA (gene) in FACS sorted FoB (B220+CD19+CD11c−CD11b−CD23+) cells from WT and DKO female mice and ABC (B220+CD19+CD11c+CD11b+) cells from DKO female mice. The data were normalized relative to ppia mRNA expression. FIG. 3K shows selected GSEA pathways analysis of DKO FoB compared to DKO ABC cells.
FIG. 4 shows that the chromatin landscape of DKO ABCs is enriched in IRF and AP-1/BATF motifs. FIG. 4A shows the normalized ATAC-seq tag density distributions for 4 kb window centered at the summit of ABC-specific peaks (n=3,666, top panel) and average distribution of ATAC-seq normalized tag densities (bottom). (n=2/group). FIG. 4B are representative UCSC Genome Browser tracks displaying ATAC-seq normalized tag densities at representative genomic regions Cxcl10 cluster, Il6, and IFNγ genes. Highlighted are ABC-specific ATAC-seq peaks. FIG. 4C is graph of motif density distribution relative to the peak summit for IRF, T-bet and POU2F2 motifs in ABC-specific ATAC-seq peaks. FIG. 4D is a graph of normalized tag counts for ABC and FOB expression (RNAseq) of total ABC-specific peaks associated genes (n=2,482) from three independent experiments (n=3) normalized tag counts.
FIG. 5 shows the results showing WT and DKO ABCs exhibit a distinctive transcriptional and chromatin profile. FIG. 5A is a graph of the expression of selected transcription factors transcripts in WT and DKO ABC cells as identified by RNA-seq analysis. FIG. 5B shows the hierarchical clustering of log-transformed counts per million (cpm) for differentially expressed genes identified by RNAseq analysis of RNA from FACS sorted ABC (B220+CD19+CD11c+CD11b+) cells from WT and DKO female mice (>20 weeks old). (n=2/group). FIG. 5C shows violin plot analysis of all genes, Ig genes and ARCHS4 Macrophage genes in WT and DKO. FIG. 5D are graphs of the results of qPCR analysis of the expression of representative genes in sorted ABC (B220+CD19+CD11c+CD11b+) cells from WT and DKO female mice as indicated. The data were normalized relative to ppia mRNA expression. Data are representative of 2 independent experiments. ns: not significant, *: p≤0.05, **: p≤0.01 ***: p≤0.001. FIG. 5E are graphs of qPCR expression analysis of the indicated genes in FACS sorted ABC (B220+CD19+CD11c+CD11b+) cells from WT and DKO female mice (>24 weeks). The data were normalized relative to ppia mRNA expression. FIG. 5F show normalized ATAC-seq tag density distributions for 4 kb window centered at the summit of WT-specific (right, n=27,483) or DKO-specific (left, n=1583) peaks and average distribution of ATAC-seq normalized tag densities (bottom). (n=2/group). Histograms show expression (RNAseq) of total ABC-specific peaks associated genes in WT and DKO from three independent experiments (n=2-3). The graphs show the quantitated results. FIG. 5G are graphs of functionally enriched Gene Ontology (GO) categories of WT-specific and DKO-specific peaks of ATAC-seq.
FIG. 6 shows the results that IRF5 regulates the IL-21-mediated formation of DKO ABCs. FIG. 6A is representative FACS plots of purified wild type, DKO and CD21Cre IRF5fl/−DKO (8-10 weeks of age) CD23+ B cells were treated with a combination of αCD40, αIgM, IL-21 and/or imiquimod. CD11c+Tbet+B cells in each culture condition were assayed by FACS at day 3. Representative FACS plot of 6 independent experiments is shown. FIG. 6B shows the graphical results of percentage of ABCs from the FAC analysis in FIG. 6A (n=6). Mean±SEM is shown. **: p≤0.01, ***: p≤0.001. (One-way ANOVA). FIG. 6C shows graphs of the analysis of the expression and production of IL-6 in cultures of cells stimulated±IL-21 as assessed by qPCR and ELISA. qPCR data were normalized relative to ppia mRNA expression. Data are representative of 3 independent experiments. Mean±SEM is shown. ns: not significant, ***: p≤0.001, ****: p≤0.0001. (One-way ANOVA). FIG. 6D shows graphs of the analysis of the expression and production of Cxcl10 in cultures of cells stimulated with and without IL-21 as assessed by qPCR (left panel) and ELISA (right panel). qPCR data were normalized relative to ppia mRNA expression. Data are representative of 3 independent experiments. Mean±SEM is shown. ns: not significant, ***: p≤0.001, ****: p≤0.0001. (One-way ANOVA). FIG. 6E shows graphs of amount of IgG and IgG2c in the supernatants of cells stimulated±IL-21 7 days as analyzed by ELISA. Data are representative of 3 independent experiments. Mean±SEM is shown. ns: not significant, ****: p≤0.0001. (One-way ANOVA). FIG. 6F shows the results of qPCR analysis of the expression of Jun in cultures of cells stimulated±IL-21. Data were normalized relative to ppia mRNA expression. Data are representative of 2 independent experiments. Mean±SEM is shown. **: p≤0.01 ***: p≤0.001; ****: p≤0.0001. FIG. 6G are graphs of the results of ChIP assays performed with an IRF5 antibody on cells stimulated with IL-21 for 2 days. Immunoprecipitated DNA was analyzed by qPCR using primers within the ABC-specific ATAC-seq peaks at the CXCL10 cluster (Cl), IgG2c, Jun, and the IL-6 TSS. Data are representative of 4 (IL-6 TSS and CXCL10 Cl) or 2 (IgG2c and Jun) independent experiments. Mean±SEM is shown. ***: p≤0.001; ****: p≤0.0001. (One-way ANOVA). FIG. 6H is a Western blot of nuclear extracts prepared from CD23+ B cells purified from WT, DKO and CD21Cre IRF5fl/− DKO female mice (8-10 weeks of age) stimulated with αIgM (5 μg/ml), αCD40 (5 μg/ml), IL-21 (50 ng/ml) or imiquimod (1 μg/ml) for 3 days. Extracts were analyzed by Western blotting with pSTAT3, STAT3, IRF5, and HDAC1 antibodies. Data are representative of 2 independent experiments. FIG. 6I are graphs of the results of a ChIP assay performed with a T-bet antibody. Data are representative of 4 (IL-6 TSS and CXCL10 Cl) or 2 (IgG2c and Jun) independent experiments. Mean±SEM is shown. *: p≤0.05, **: p≤0.01 ***: p≤0.001; ****: p≤0.0001. FIG. 6J show Western Blots of nuclear extracts prepared from cells stimulated with and without IL-21 for 2 days and subjected to ONP assay with a biotinylated oligonucleotide from the CXCL10 Cl. Precipitated proteins were analyzed by Western blotting with an IRF5 and T-bet antibody as indicated. Data are representative of 2 independent experiments. FIG. 6K shows Western Blots of nuclear extracts from 293T cells transiently transfected as indicated and subjected to ONP assay with a biotinylated oligonucleotide from the CXCL10 Cl or IL-6 TSS. Precipitated proteins were analyzed by Western blotting with an IRF5 or T-bet antibody. Data are representative of 2 independent experiments. FIG. 6L is a Western blot of IRF5/SWEF proteins coimmunoprecipitation from nuclear extracts from cells stimulated with or without IL-21 for 2 days. Immunoprecipitation was performed with an IRF5 antibody and probed with a DEF6, SWAP-70 or IRF5 antibody as indicated. Data are representative of 2 independent experiments. FIG. 6M is a Western blot of nuclear extracts of 293T cells transiently transfected with various constructs as indicated. Immunoprecipitations were performed using an anti-HA antibody. Immunoprecipitates were analyzed by Western blotting using HA antibodies. Data are representative of 2 independent experiments with similar results. FIG. 6N is a Western blot of nuclear extracts of 293T cells subjected to ONP assay with a biotinylated oligonucleotide from the IL-6 TSS. Precipitated proteins were analyzed by Western blotting with an IRF5 antibody. Data are representative of 2 independent experiments. FIG. 6O is a Western blot of 293T cells transiently transfected with various constructs as indicated. Immunoprecipitations were performed using an anti-HA antibody. Immunoprecipitates were analyzed by Western blotting using an anti-FLAG, T-bet or HA antibodies. Data are representative of 2 independent experiments with similar results.
FIG. 7 shows the results that monoallelic deletion of IRF5 abolishes accumulation of ABCs and lupus development in DKO mice. FIG. 7A shows representative FACS plots of CD11c and CD11b expression in CD11c+CD11b+ B cells in the spleens of WT, IRF5fl/fl DKO, IRF5fl/− DKO and CD21Cre IRF5fl/− DKO female mice (>20 weeks-old). FIG. 7B are graphs of the percentage and absolute numbers of ABCs (CD11c+CD11b+B220+) in mice of the indicated genotypes. (n=5-10 mice). ****: p≤0.0001. (One-way ANOVA). FIG. 7C are graphs of percentages and absolute numbers of B220+CD19+CD11c+Tbet+ B cells in the spleens of WT, IRF5fl/fl DKO, IRF5fl/− DKO, CD11cCre IRF5fl/− DKO and CD21Cre IRF5fl/− DKO female mice (>20 weeks-old). Graphs show percentages and numbers in individual mice (n=5-7). ***: p≤0.001; ****: p≤0.0001. (One-way ANOVA). FIG. 7D are graphs of percentages and absolute numbers of B220+CD19+CD21-CD23-CD11c+CD11b+ B cells in the spleens of WT, IRF5fl/fl DKO, IRF5fl/− DKO, CD11cCre IRF5fl/− DKO and CD21Cre IRF5fl/− DKO female mice (>20 weeks-old). Graphs show percentages and numbers in individual mice (n=5-7). ***: p≤0.001; ****: p≤0.0001. (One-Way ANOVA). FIG. 7E are graph shows percentages and absolute numbers of total splenocytes in WT, IRF5fl/fl DKO, IRF5fl/− DKO, CD11cCre IRF5fl/− DKO and CD21Cre IRF5fl/− DKO mice (>20 weeks of age) (n=5-10 mice). *: p≤0.05; ***: p≤0.001, ****: p≤0.0001. (One-way ANOVA). FIG. 7F are graphs quantifying flow cytometric analysis of TFH (CD4+CXCR5+PD1+Foxp3−), germinal center (GC) B cells (B220+FAS+GL-7+), and plasma cells (PC) (B220intCD138+) in spleens of WT, IRF5fl/fl DKO, IRF5fl/− DKO, CD11cCre IRF5fl/− DKO and CD21Cre IRF5fl/− DKO mice (>20 weeks). Graphs show percentages and numbers of specific cells types in individual mice (n=5-10). **: p≤0.01; ***: p≤0.001; ****: p≤0.0001. (One-way ANOVA). FIG. 7G are graphs quantifying flow cytometric analysis of Treg (CD4+Foxp3+), activated Treg (CD4+Foxp3+CD44+), and activated T cells (CD4+Foxp3−CD44+) in spleens of WT, IRF5fl/fl DKO, IRF5fl/− DKO, CD11cCre IRF5fl/− DKO and CD21Cre IRF5fl/− DKO mice ((>20 weeks). Graphs show frequencies and numbers of individual mice and mean value of 10 independent experiments (n=5-10). **: p≤0.01; ***: p≤0.001; ****: p≤0.0001. (One-way ANOVA). FIG. 7H show graphs of the intensity score of stained cells to determine anti-nuclear antibodies (ANAs) in sera (1:200) from WT, IRF5fl/fl DKO, IRF5fl/− DKO, CD11cCre IRF5fl/− DKO and CD21Cre IRF5fl/− DKO mice (>20 weeks old). Graph shows score of individual mice and mean value of 10 independent experiments (n=7-12). *: p≤0.05, **: p≤0.01 ***: p≤0.001 (Mann-Whitney test). FIG. 7I are graphs of the levels of anti-dsDNA IgG, IgG1, or IgG2c antibodies in the sera of WT, IRF5fl/fl DKO, IRF5fl/− DKO, CD11cCre IRF5fl/− DKO and CD21Cre IRF5fl/− DKO female mice (>20 weeks old) analyzed by ELISA (n=4-11). *: p≤0.05; ***: p≤0.001; ****: p≤0.0001. (One-way ANOVA). FIG. 7J are graphs of the levels of anti-ssDNA, cardiolipin and nRNP IgG antibodies in the sera of WT, IRF5fl/fl DKO, IRF5fl/− DKO, CD11cCre IRF5fl/− DKO and CD21Cre IRF5fl/− DKO female mice (>20 weeks old) analyzed by ELISA (n=4-19). *: p≤0.05; **: p≤0.01, ***: p≤0.001; ****: p≤0.0001. (One-way ANOVA). FIG. 7K show a graph of the glomerulonephritis score of WT, DKO and IRF5ko DKO mice (which include CD11cCre IRF5fl/− DKO and CD21Cre IRF5fl/− DKO mice) (n=3-6 mice/group). The graphs are quantification of PAS staining of 3 independent experiments. FIG. 7L is a graph showing the MFI quantification of IgG deposition from 3 independent experiments. (n=3-6 mice/group).
FIG. 8 shows that a subset of CD11c+ DKO B cells upregulates PC markers. FIG. 8A is a representative FACS plot for CD11c and CD11b expression gated on CD19 Blimp1-yfphi cells from spleens of aging Blimp1-yfp.DKO female mice. FIG. 8B are histograms showing the relative expression of the indicated marker on CD11c+ PCs (CD11c+ Blimp1hi CD19lo=red), ABCs (CD11c+CD11b+CD19+ Blimp1−=blue), and total B cells (CD19+=shaded gray) from aging Blimp1-yfp.DKO female mice.
FIG. 9 shows that DKO ABCs exhibit sex specific differences in autoantibody production. FIG. 9A is a scatter plot showing frequencies of ABCs of individual mice as indicated. FIG. 9B is a graph of the results of ABCs sorted from spleens of aging DKO female or DKO male mice cultured in vitro±1 μg/ml of Imiquimod, assayed by ELISA on day 7. FIG. 9C is a graph of the results of ABCs sorted from spleens of aging DKO male or Yaa-DKO male mice cultured in vitro±1 μg/ml of Imiquimod, assayed by ELISA on day 7. FIG. 9D show graphs of frequencies of ABC expressing the indicated markers using flow cytometric analysis of B220+ B cells in the spleens of WT and DKO female and male mice and Yaa-DKO male mice (>20 weeks-old). FIG. 9E is a graph showing the qPCR expression analysis of IL13Ra1 in FACS-sorted FoB (B220+CD19+CD11c−CD11b−CD23+) cells and ABC (B220+CD19+CD11c+CD11b+) cells from WT and DKO female and male mice and Yaa-DKO male mice (>20 weeks old). The data were normalized relative to ppia mRNA expression.
FIG. 10 show the expression of Rho- kinase 1 and 2 in different populations of cells. FIG. 10A shows the indicated cells assayed with ROCK2 in vitro kinase assay. FIG. 10B shows the expression of phospho IRF4 in some of the same cells (plasmablasts) as assessed by Western blotting with a pIRF4 Antibody. FIG. 10C shows the same cells used in FIG. 10A assayed with a ROCK1 in vitro kinase assay.
DETAILED DESCRIPTION OF THE INVENTION Definitions
The terms used in this specification generally have their ordinary meanings in the art, within the context of this invention and the specific context where each term is used. Certain terms are discussed below, or elsewhere in the specification, to provide additional guidance to the practitioner in describing the methods of the invention and how to use them. Moreover, it will be appreciated that the same thing can be said in more than one way. Consequently, alternative language and synonyms may be used for any one or more of the terms discussed herein, nor is any special significance to be placed upon whether or not a term is elaborated or discussed herein. Synonyms for certain terms are provided. A recital of one or more synonyms does not exclude the use of the other synonyms. The use of examples anywhere in the specification, including examples of any terms discussed herein, is illustrative only, and in no way limits the scope and meaning of the invention or any exemplified term. Likewise, the invention is not limited to its preferred embodiments.
The terms “pathogenic age-associated B cells”, and “pathogenic ABCs” is used herein to denote the novel subset of B cells described herein that promote disease. The terms “DKO ABCs” and “autoimmune prone ABCs” also denote these cells.
The term “subject” as used in this application means an animal with an immune system such as avians and mammals. Thus, the invention can be used in veterinary medicine, e.g., to treat companion animals, farm animals, laboratory animals in zoological parks, and animals in the wild. The invention is particularly desirable for human medical applications.
The term “patient” as used in this application means a human subject. In some embodiments of the present invention, the “patient” is one suffering with an autoimmune or lymphoproliferative disease or suspected of suffering from an autoimmune or lymphoproliferative disease, such as systemic lupus erythematosus or lymphoma.
The term “detection”, “detect”, “detecting” and the like as used herein means as used herein means to discover the presence or existence of.
The terms “diagnosis”, “diagnose”, diagnosing” and the like as used herein means to determine what physical disease or illness a subject or patient has, in this case an autoimmune or lymphoproliferative disease.
The terms “identification”, “identify”, “identifying” and the like as used herein means to recognize a disease state or a clinical manifestation or severity of a disease state in a subject or patient. The term also is used in relation to test agents and their ability to have a particular action or efficacy.
The terms “prediction”, “predict”, “predicting” and the like as used herein means to tell in advance based upon special knowledge.
The term “reference value” as used herein means an amount or a quantity of a particular protein or nucleic acid in a sample from a healthy control or healthy donor.
The terms “healthy control”, “healthy donor” and “HD” are used interchangeably in this application and are a human subject who is not suffering from systemic lupus erythematosus or any other autoimmune or lymphoproliferative disease.
The terms “treat”, “treatment”, and the like refer to a means to slow down, relieve, ameliorate or alleviate at least one of the symptoms of the disease, or reverse the disease after its onset.
The terms “prevent”, “prevention”, and the like refer to acting prior to overt disease onset, to prevent the disease from developing or minimize the extent of the disease or slow its course of development.
The term “agent” as used herein means a substance that produces or is capable of producing an effect and would include, but is not limited to, chemicals, pharmaceuticals, biologics, small organic molecules, antibodies, nucleic acids, peptides, and proteins.
The phrase “therapeutically effective amount” is used herein to mean an amount sufficient to cause an improvement in a clinically significant condition in the subject, or delays or minimizes or mitigates one or more symptoms associated with the disease, or results in a desired beneficial change of physiology in the subject.
The phrase “in need thereof” indicates a subject has an autoimmune or lymphoproliferative disease, is suspected of having an autoimmune or lymphoproliferative disease, or has risk factors for an autoimmune or lymphoproliferative disease.
The terms “expression profile” or “gene expression profile” refers to any description or measurement of one or more of the genes that are expressed by a cell, tissue, or organism under or in response to a particular condition. Expression profiles can identify genes that are upregulated, downregulated, or unaffected under particular conditions. Gene expression can be detected at the nucleic acid level or at the protein level. The expression profiling at the nucleic acid level can be accomplished using any available technology to measure gene transcript levels. For example, the method could employ in situ hybridization, Northern hybridization or hybridization to a nucleic acid microarray, such as an oligonucleotide microarray, or a cDNA microarray. Alternatively, the method could employ reverse transcriptase-polymerase chain reaction (RT-PCR) such as fluorescent dye-based quantitative real time PCR (TaqMan® PCR). In the Examples section provided below, nucleic acid expression profiles were obtained using Affymetrix GeneChip® oligonucleotide microarrays. The expression profiling at the protein level can be accomplished using any available technology to measure protein levels, e.g., using peptide-specific capture agent arrays.
The terms “gene”, “gene transcript”, and “transcript” are used somewhat interchangeable in the application. The term “gene”, also called a “structural gene” means a DNA sequence that codes for or corresponds to a particular sequence of amino acids which comprise all or part of one or more proteins or enzymes, and may or may not include regulatory DNA sequences, such as promoter sequences, which determine for example the conditions under which the gene is expressed. Some genes, which are not structural genes, may be transcribed from DNA to RNA, but are not translated into an amino acid sequence. Other genes may function as regulators of structural genes or as regulators of DNA transcription. “Transcript” or “gene transcript” is a sequence of RNA produced by transcription of a particular gene. Thus, the expression of the gene can be measured via the transcript.
The term “antisense DNA” is the non-coding strand complementary to the coding strand in double-stranded DNA.
The term “nucleic acid hybridization” refers to anti-parallel hydrogen bonding between two single-stranded nucleic acids, in which A pairs with T (or U if an RNA nucleic acid) and C pairs with G. Nucleic acid molecules are “hybridizable” to each other when at least one strand of one nucleic acid molecule can form hydrogen bonds with the complementary bases of another nucleic acid molecule under defined stringency conditions. Stringency of hybridization is determined, e.g., by (i) the temperature at which hybridization and/or washing is performed, and (ii) the ionic strength and (iii) concentration of denaturants such as formamide of the hybridization and washing solutions, as well as other parameters. Hybridization requires that the two strands contain substantially complementary sequences. Depending on the stringency of hybridization, however, some degree of mismatches may be tolerated. Under “low stringency” conditions, a greater percentage of mismatches are tolerable (i.e., will not prevent formation of an anti-parallel hybrid).
The terms “vector”, “cloning vector” and “expression vector” mean the vehicle by which a DNA or RNA sequence (e.g. a foreign gene) can be introduced into a host cell, so as to transform the host and promote expression (e.g. transcription and translation) of the introduced sequence. Vectors include, but are not limited to, plasmids, phages, and viruses.
The term “host cell” means any cell of any organism that is selected, modified, transformed, grown, used or manipulated in any way, for the production of a substance by the cell, for example, the expression by the cell of a gene, a DNA or RNA sequence, a protein or an enzyme. Host cells can further be used for screening or other assays, as described herein.
A “polynucleotide” or “nucleotide sequence” is a series of nucleotide bases (also called “nucleotides”) in a nucleic acid, such as DNA and RNA, and means any chain of two or more nucleotides. A nucleotide sequence typically carries genetic information, including the information used by cellular machinery to make proteins and enzymes. These terms include double or single stranded genomic and cDNA, RNA, any synthetic and genetically manipulated polynucleotide, and both sense and anti-sense polynucleotide. This includes single- and double-stranded molecules, i.e., DNA-DNA, DNA-RNA and RNA-RNA hybrids, as well as “protein nucleic acids” (PNA) formed by conjugating bases to an amino acid backbone. This also includes nucleic acids containing modified bases, for example thio-uracil, thio-guanine and fluoro-uracil.
“Nucleic acid” refers to deoxyribonucleotides or ribonucleotides and polymers thereof in either single- or double-stranded form. The nucleic acids herein may be flanked by natural regulatory (expression control) sequences, or may be associated with heterologous sequences, including promoters, internal ribosome entry sites (IRES) and other ribosome binding site sequences, enhancers, response elements, suppressors, signal sequences, polyadenylation sequences, introns, 5′- and 3′-non-coding regions, and the like. The term encompasses nucleic acids containing known nucleotide analogs or modified backbone residues or linkages, which are synthetic, naturally occurring, and non-naturally occurring, which have similar binding properties as the reference nucleic acid, and which are metabolized in a manner similar to the reference nucleotides. The nucleic acids may also be modified by many means known in the art. Non-limiting examples of such modifications include methylation, “caps”, substitution of one or more of the naturally occurring nucleotides with an analog, and internucleotide modifications such as, for example, those with uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoroamidates, and carbamates) and with charged linkages (e.g., phosphorothioates, and phosphorodithioates). Polynucleotides may contain one or more additional covalently linked moieties, such as, for example, proteins (e.g., nucleases, toxins, antibodies, signal peptides, and poly-L-lysine), intercalators (e.g., acridine, and psoralen), chelators (e.g., metals, radioactive metals, iron, and oxidative metals), and alkylators. The polynucleotides may be derivatized by formation of a methyl or ethyl phosphotriester or an alkyl phosphoramidate linkage. Modifications of the ribose-phosphate backbone may be done to facilitate the addition of labels, or to increase the stability and half-life of such molecules in physiological environments. Nucleic acid analogs can find use in the methods of the invention as well as mixtures of naturally occurring nucleic acids and analogs. Furthermore, the polynucleotides herein may also be modified with a label capable of providing a detectable signal, either directly or indirectly. Exemplary labels include radioisotopes, fluorescent molecules, and biotin.
The term “polypeptide” as used herein means a compound of two or more amino acids linked by a peptide bond. “Polypeptide” is used herein interchangeably with the term “protein.”
The term “about” or “approximately” means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system, i.e., the degree of precision required for a particular purpose, such as a pharmaceutical formulation. For example, “about” can mean within 1 or more than 1 standard deviations, per the practice in the art. Alternatively, “about” can mean a range of up to 20%, preferably up to 10%, more preferably up to 5%, and more preferably still up to 1% of a given value. Alternatively, particularly with respect to biological systems or processes, the term can mean within an order of magnitude, preferably within 5-fold, and more preferably within 2-fold, of a value. Where particular values are described in the application and claims, unless otherwise stated, the term “about” meaning within an acceptable error range for the particular value should be assumed.
Pathogenic Age-Associated B Cells, their Regulation and Role in Autoimmune Disease
Age-associated B cells (ABCs) are a B cell subset, which exhibits unique phenotypic and functional characteristics and can be regulated by T-bet. Although ABCs accumulate in autoimmune disorders, they can also accumulate in non-autoimmune subjects. Additionally, some ABCs produce autoantibodies, and some do not. A detailed understanding of the molecular pathways that promote their expansion and function in autoimmune settings is largely unknown. However, as shown herein, some ABCs are benign and some are pathogenic, causing autoimmune and lymphoproliferative diseases as well as chronic inflammatory disorders. The current invention is based upon the discovery of these pathogenic ABCs (i.e., ABCs that cause or are associated with disease) and the proteins that regulate their expansion, function and differentiation.
In particular, pathogenic ABCs express CD11c (Example 2). Using double knockout mice for SWAP70 and DEF6 (SWEF deficient) which develop a lupus-like syndrome, it was found that ABCs from these mice express many of the cell markers found in ABCs from wild type mice including CD86, MHCII and IgM. However, these cells downregulated CD5, which others reported that ABCs do express (see Rubtsova et al. 2015). Additionally, these pathogenic ABCs are detected at a much earlier age in the DKO mice than the benign ABCs found in wild type mice. These pathogenic ABCs also secrete anti-dsDNA IgG2c and other autoantibodies. See Example 2.
These pathogenic ABCs from the DKO mice exhibited an IL-21-dependent expansion with pro-inflammatory capabilities, produced autoantibodies, and as compared to ABCs from wild type non-autoimmune female mice, displayed a distinctive transcriptome marked by increased Ig transcription and diminished expression of a subset of myeloid-related programs. Chromatin accessibility profiles revealed a unique chromatin landscape in ABCs from DKO mice, which is enriched in open chromatin regions containing IRF, AP1/BATF, and T-bet binding motifs but depleted in regions containing motifs targeted by PU.1 and MAF. Furthermore, it is shown herein that in the absence of SWEF proteins, IL-21 stimulation of B cells leads to dysregulated IRF5 activity and that the generation of pathogenic ABCs and lupus development in DKO female mice does not occur. Thus, the generation of pathogenic ABCs is controlled at least in part by IRF5 and SWEF proteins. Taken together these studies uncover a new genetic pathway that controls the generation of pathogenic ABCs in autoimmunity as well as the distinction between these pathogenic ABCs and those that accumulate normally, benign ABCs. See Examples 3-8.
The genome-wide transcriptional profiling demonstrated that the SWEF proteins regulate several key processes that can impact the expansion and function of ABCs. In particular, the GSEA pathway analysis identified alterations in a number of pathways involved in the control of cellular proliferation, which can play a crucial role in the premature accumulation of ABCs in DKO mice. This analysis also revealed a marked ability of pathogenic ABCs to promote inflammation via the production of chemokines and cytokines. Thus, the contribution of ABCs to autoimmune pathophysiology is multifactorial and encompasses both production of autoantibodies especially of the pathogenic IgG2a/c isotype and the ability to promote inflammation via recruitment of inflammatory cells and production of pro-inflammatory cytokines. See Example 4.
The absence of SWEF proteins also resulted in increased binding of T-bet to several ABC specific peaks suggesting cooperativity between IRF5 and T-bet at least for some ABC specific regulatory regions. The notion that such cooperativity is at play was further reinforced by the decreased binding of T-bet to ABC-specific regions in the absence of IRF5 and by mutational analysis, which revealed an important role for the DNA binding domain of IRF5 in the optimal recruitment of T-bet to ABC-specific sites. See Example 7.
The enrichment in IRF motifs in DKO ABCs was mechanistically linked with an increase in the activity of IRF5 due to the lack of the inhibitory effects of the SWEF proteins. Coimmunoprecipitation experiments demonstrated that endogenous IRF5 can interact with both DEF6 and SWAP-70 supporting the idea that its activity can be inhibited by a heterodimer of the two SWEF proteins. Interaction of the SWEF proteins with IRF5 was mediated by the IRF Association Domain (IAD) of IRF5 in line with the known ability of this family to interact with the IAD of IRF4 and the presence of structural similarities between the IAD of IRF4 and that of IRF5. Indeed, the SWEF proteins do not interact with IRF2, which carries a distinct type of IAD. See Example 7.
The work described herein now implicates IRF5 downstream of IL-21 signaling thus positioning IRF5 as a common mediator of two key stimulatory pathways for ABC generation in autoimmune settings, IL21 and TLR7. The convergence of these two pathways onto IRF5 is likely to contribute to the dramatic effect observed upon monoallelic deletion of IRF5 on the development of disease in the model used herein (Example 8). Such strong gene dosage effects may be particular relevant for human SLE where IRF5 risk variants have been shown to result in alterations in IRF5 levels (Cham et al. 2012; Lazzari and Jefferies 2014).
In addition to enrichment for IRF and AP-1/BATF motifs, which could be observed irrespective of whether DKO ABCs were compared to DKO FoBs or to WT ABCs, comparison of the chromatin landscapes of wild type and DKO ABCs revealed that pathogenic ABCs also exhibited a marked loss of accessible chromatin regions containing PU.1, MAF, and C/EBP motifs. These epigenetic changes were associated with downregulation of MAF and MAFB expression but maintenance of PU.1 levels. Importantly, given the known repressive role of PU.1 on the quantity of antibody production and plasma cell differentiation, selective depletion of PU.1-bound peaks could also lessen the PU.1-mediated inhibitory effects and directly contribute to the increased levels of Ig transcription of DKO ABCs as well as enhance their ability to differentiate into plasma cells upon exposure to additional environmental stimuli. Thus, the presence of dysregulated IRF5 activity combined with the loss of PU.1-containing repressive complexes could represent a critical mechanism employed by autoimmune-prone ABCs to bypass critical checkpoints governing the transition of B cells into antibody secreting cells.
While most DKO ABCs express surface IgM, the ability of these cells to produce anti-dsDNA IgG2c upon stimulation suggests that they can undergo class switching and differentiate into PCs. Studies using Blimp1 reporter DKO mice have indeed demonstrated the presence of CD11c+CD19loBlimp1hi cells in the spleens of DKO female mice (Example 9). These cells also express high levels of CD138 and IRF4 suggesting that they represent a population of ABCs that has differentiated toward PCs.
One of the most striking features of the autoimmune syndrome that develops in DKO mice is the finding that, as observed for human SLE, this disorder preferentially affects the female gender. Interestingly ABCs accumulate in both DKO female and male mice. Unlike pathogenic ABCs from DKO male mice, however, ABCs from DKO female mice readily secreted anti-dsDNA IgG2c antibodies upon TLR7 stimulation suggesting that the pathogenic potential of DKO ABCs differs in female and male mice. Remarkably, crossing DKO male mice to Yaa mice (which carry a duplication of TLR7 on the Y chromosome) leads to their ability to produce anti-dsDNA IgG2c upon stimulation (Example 10).
Taken together, these studies have led to the hypothesis that ABCs can undergo further differentiation into CD11c+ PCs and that the differentiation of ABCs into CD11c+ PCs is regulated by sex-specific mechanisms. By investigating the transcriptional and epigenetic profiles of CD11c+ PCs from DKO mice as compared to CD11c− PCs, and examining whether IRF4 cooperates with IRF5 in regulating the differentiation/function of CD11c+ PCs, it will be shown that the CD11c+ PC cells from DKO mice have a unique transcriptional and epigenetic profile and that IRF4 and IRF5 regulate the differentiation of the pathogenic ABCs to PCs (Example 11). The contribution of sex-specific pathways to the differentiation/function of CD11c+ PCs will also be investigated (Example 12). Since aberrant B cell and PC homeostasis is one of the hallmarks of SLE and several lymphoproliferative diseases, these studies will provide fundamental insights into the molecular features that characterize the PCs that expand in autoimmune and lymphoproliferative settings.
Thus the work reported herein shows that pathogenic ABC cells play a role in autoimmunity. Importantly these studies demonstrate that there is a subset of CD11c+ cells that uniquely relies on the cooperation of Tbet and IRF5 for their expansion and function. The genome-wide analysis set forth herein demonstrates that these cells exhibit a unique transcriptional profile that is associated with a distinctive chromatin landscape, especially when compared to non-pathogenic ABCs. Additionally, DEF6 and SWAP-70 regulate IRF5 activity thus controlling its accessibility to key target genes and its cooperativity with Tbet.
Furthermore, aberrancies and/or polymorphisms in IL-21, its receptor, or IRF5 have also been associated with several autoimmune disorders including rheumatoid arthritis and inflammatory bowel disease (Sarra et al. 2013; Eames et al. 2016). The dysregulation in the ability of the SWEF proteins to restrain IRF5 activity in response to IL-21 and, therefore, properly control ABC expansion and function, could also contribute to other autoimmune diseases.
Given that the ABCs are known to accumulate in non-autoimmune mice these studies also provide key information into the factors that regulate the expansion of these cells into pathogenic ABCs. The identification of these factors controlling the expansion and function of pathogenic ABC cells, which include DEF6, SWAP-70, IRF5, IL-21, and a number of genes, also provides a method to develop new therapeutic targets for therapeutic intervention for autoimmune, lymphoproliferative and aging-related diseases.
Inhibition of Interferon Regulatory Factor 5 (IRF5)
It has been discovered that the transcription factor, interferon regulatory factor 5, is necessary for ABCs to become pathogenic and cause autoimmune and lymphoproliferative disease. Thus, one embodiment of the current invention is a method of abolishing or reducing pathogenic ABCs in a subject in need thereof by administering a therapeutically effective amount of an agent that antagonizes, inhibits or reduces the expression and/or activity of IRF5. A further embodiment of the current invention is a method of preventing and/or treating an autoimmune or lymphoproliferative disease by abolishing or reducing pathogenic ABCs in a subject in need thereof by administering a therapeutically effective amount of an agent that antagonizes, inhibits or reduces the expression and/or activity of IRF5. Methods for reducing expression of a protein are also well known in the art. Reduction of IRF5 expression may be at the transcriptional, translational or post-translational level.
IRF5 as used herein includes human IRF5, which is encoded by the human IRF5 gene located at chromosome 7q32 (OMIM ID 607218). IRF5 is a member of the IRF family; it is a transcription factor that possesses a helix-turn-helix DNA-binding motif and mediates virus- and interferon (IFN)-induced signaling pathways. It is appreciated that several isoforms/transcriptional variants of IRF5 are known. Preferably, the inhibitor of IRF5 inhibits at least the expression or activity of any human IRF5 variant. It is also well known that IRF5 is polymorphic, and a large number of polymorphisms, including SNPs are known. Thus, in an embodiment, the inhibitor of IRF5 also inhibits expression or activity of naturally-occurring variants of human IRF5 in which one or more of the amino acid residues have been replaced with another amino acid.
One agent for inhibition of IRF5 is a small molecule.
Additional inhibitors of IRF5 expression and activity include IRF5-specific RNAi, IRF5-specific short RNA, IRF5-specific antisense (e.g., IRF5-specific morpholinos) and triplet-forming oligonucleotides, and IRF5-specific ribozymes.
Short RNA molecules include short interfering RNA (siRNA), small temporal RNAs (stRNAs), short hairpin RNA (shRNA), and micro-RNAs (miRNAs). Short interfering RNAs silence genes through an mRNA degradation pathway, while stRNAs and miRNAs are approximately 21 or 22 nt RNAs that are processed from endogenously encoded hairpin-structured precursors, and function to silence genes via translational repression. See, e.g., McManus et al. (2002). RNA 8(6):842-50; Morris et al. (2004). Science 305(5688):1289-92; He and Hannon. (2004). Nat. Rev. Genet. 5(7):522-31. IRF5 siRNA are commercially available, for example, as On-target SMMRT pool reagents from Dharmacon, USA (catalogue No. L-011706-00-0005), and from Santa Cruz Biotechnology, USA (catalogue No. sc-72044).
“RNA interference, or RNAi” a form of post-transcriptional gene silencing (“PTGS”), describes effects that result from the introduction of double-stranded RNA into cells (reviewed in Fire. (1999). Trends Genet. 15:358-363; Sharp. (1999) Genes Dev. 13:139-141; Hunter. (1999). Curr. Biol. 9:R440-R442; Baulcombe. (1999). Curr. Biol. 9:R599-R601; Vaucheret et al. (1998). Plant J. 16:651-659). The active agent in RNAi is a long double-stranded (antiparallel duplex) RNA, with one of the strands corresponding or complementary to the RNA which is to be inhibited. The inhibited RNA is the target RNA. The long double stranded RNA is chopped into smaller duplexes of approximately 20 to 25 nucleotide pairs, after which the mechanism by which the smaller RNAs inhibit expression of the target is largely unknown at this time. While RNAi was shown initially to work well in lower eukaryotes, for mammalian cells, it was thought that RNAi might be suitable only for studies on the oocyte and the preimplantation embryo.
More recently, it was shown that RNAi would work in human cells if the RNA strands were provided as pre-sized duplexes of about 19 nucleotide pairs, and RNAi worked particularly well with small unpaired 3′ extensions on the end of each strand (Elbashir et al. (2001). Nature 411:494-498). In this report, “short interfering RNA” (siRNA, also referred to as small interfering RNA) were applied to cultured cells by transfection in oligofectamine micelles. These RNA duplexes were too short to elicit sequence-nonspecific responses like apoptosis, yet they efficiently initiated RNAi. Many laboratories then tested the use of siRNA to knock out target genes in mammalian cells. The results demonstrated that siRNA works quite well in most instances.
For purposes of reducing the activity of IRF5, siRNAs to the gene encoding IRF5 can be specifically designed using computer programs. Illustrative nucleotide sequences encoding the amino acid sequences of these components are readily available.
Software programs for predicting siRNA sequences to inhibit the expression of a target protein are commercially available and find use. One program, siDESIGN from Dharmacon, Inc. (Lafayette, Colo.), permits predicting siRNAs for any nucleic acid sequence, and is available on the internet at dharmacon.com. Programs for designing siRNAs are also available from others, including Genscript (available on the internet at genscript.com/ssl-bin/app/rnai) and, to academic and non-profit researchers, from the Whitehead Institute for Biomedical Research found on the worldwide web at “jura.wi.mit.edu/pubint/http://iona.wi.mit.edu/siRNAext/.”
Alternatively, double-stranded (ds) RNA is a powerful way of interfering with gene expression in a range of organisms that has recently been shown to be successful in mammals (Wianny and Zernicka-Goetz. (2002), Nat. Cell. Biol. 2:70-75). Double stranded RNA corresponding to the sequences of a IRF5 polynucleotides can be introduced into or expressed in cells of a candidate organism to interfere with IRF5 activity.
MicroRNA can also be used to inhibit IRF5. MicroRNAs are small non-coding RNAs averaging 22 nucleotides that regulate the expression of their target mRNA transcripts by binding. Binding of microRNAs to their targets is specified by complementary base pairing between positions 2-8 of the microRNA and the target 3′ untranslated region (3′ UTR), an mRNA component that influences translation, stability and localization. Additionally, this microRNA can also be modified for increasing other desirable properties, such as increased stability, decreased degradation in the body, and increased cellular uptake.
Ribozymes are RNA molecules capable of cleaving targeted RNA or DNA. Examples of ribozymes are described in, for example, U.S. Pat. Nos. 5,180,818; 5,168,053; 5,149,796; 5,116,742; 5,093,246; and 4,987,071, all incorporated herein by reference. Ribozymes specific for IRF5 can be designed by reference to the IRF5 cDNA sequence.
A further approach is to express anti-sense constructs directed against the polynucleotides of IRF5 to inhibit gene function and to abolish or decrease pathogenic ABCs.
Antisense oligonucleotides are single-stranded nucleic acids, which can specifically bind to a complementary nucleic acid sequence. By binding to the appropriate target sequence, an RNA-RNA, a DNA-DNA, or RNA-DNA duplex is formed. By binding to the target nucleic acid, antisense oligonucleotides can inhibit the function of the target nucleic acid. Typically, antisense oligonucleotides are 15 to 35 bases in length. However, it is appreciated that it may be desirable to use oligonucleotides with lengths outside this range, for example 10, 11, 12, 13, or 14 bases, or 36, 37, 38, 39 or 40 bases. Thus, with knowledge of the IRF5 cDNA sequence, polynucleotide inhibitors of IRF5 expression can be produced using methods well known in the art.
The antisense molecules may be expressed from any suitable genetic construct and delivered to the subject. Typically, the genetic construct which expresses the antisense molecule comprises at least a portion of the IRF5 cDNA or gene operatively linked to a promoter which can express the antisense molecule in the cell. Preferably, the genetic construct is adapted for delivery to a human cell.
Other agents would include antibodies to the components of IRF5. Such antibodies are commercially available or can be produced by methods known in the art.
The terms “antibody” and “antibodies” include polyclonal antibodies, monoclonal antibodies, humanized or chimeric antibodies, single chain Fv antibody fragments, Fab fragments, and F(ab′)2 fragments. Polyclonal antibodies are heterogeneous populations of antibody molecules that are specific for a particular antigen, while monoclonal antibodies are homogeneous populations of antibodies to a particular epitope contained within an antigen. Monoclonal antibodies and humanized antibodies are particularly useful in the present invention.
Antibody fragments that have specific binding affinity for a target of interest can be generated by known techniques. Such antibody fragments include, but are not limited to, F(ab′)2 fragments that can be produced by pepsin digestion of an antibody molecule, and Fab fragments that can be generated by reducing the disulfide bridges of F(ab′)2 fragments. Alternatively, Fab expression libraries can be constructed. Single chain Fv antibody fragments are formed by linking the heavy and light chain fragments of the Fv region via an amino acid bridge (e.g., 15 to 18 amino acids), resulting in a single chain polypeptide. Single chain Fv antibody fragments recognizing a target of interest can be produced through standard techniques, such as those disclosed in U.S. Pat. No. 4,946,778.
It is also well known that IRF5 is polymorphic, and a large number of polymorphisms, including SNPs are known. Thus, in an embodiment, the inhibitor of IRF5 also inhibits at least one function or activity of naturally-occurring variants of human IRF5 in which one or more of the amino acid residues have been replaced with another amino acid.
It is also appreciated that the IRF5 inhibitor may be one that inhibits at least one function or activity of an orthologue of IRF5 in another species, for example IRF5 from a horse, dog, pig, cow, sheep, rat, mouse, guinea pig or a primate. It will be appreciated, that when the inhibitor is administered to a particular individual, the inhibitor is one that modulates at least one function or activity of IRF5 from the same species as that individual. Thus, when the patient is a human patient, the inhibitor inhibits at least one function or activity of human IRF5, and so on.
Methods and routes of administering polynucleotide inhibitors, such as siRNA molecules, antisense molecules and ribozymes, to a patient, are well known in the art and described in more detail below. It is appreciated that polynucleotide inhibitors of IRF5 may be administered directly, or may be administered in the form of a polynucleotide that encodes the inhibitor. Thus, as used herein, unless the context demands otherwise, by administering to the individual an inhibitor of IRF5 which is a polynucleotide, includes the meanings of administering the inhibitor directly, or administering a polynucleotide that encodes the inhibitor, typically in the form of a vector.
In a further embodiment, the inhibitor may be a dominant-negative mutant of IRF5. As well as those mentioned above, the dominant-negative mutant may have a mutated or deleted DNA binding domain (DBD). Specific examples of mutations that have dominant-negative effect include a mutation at Alanine at position 68, especially when substituted with Proline, which results in complete loss of DNA binding activity (Yang et al. (2009). Plos One v4(5):e5500). Suitable methods, routes and compositions for preparing polypeptide inhibitors of IRF5 and nucleic acid molecules that encode them and administering them to a patient are known in the art and described below, and include viral vectors such as adenoviral vectors.
Agonizing, Activating or Increasing SWEF Proteins
As discussed above, the current invention is based upon the discovery that reducing the aberrant expansion of pathogenic ABCs depend on two SWEF proteins, SWAP70 and DEF6. Thus, increasing the expression and/or activity of these proteins can reduce or abolish pathogenic ABCs. Methods for increasing expression and/or activity of a protein are also well known in the art. Increasing SWEF expression may be at the transcriptional, translational or post-translational level.
Thus, a further embodiment of the current invention is a method of abolishing or reducing pathogenic ABCs in a subject in need thereof by administering a therapeutically effective amount of an agent that agonizes, activates or increases the expression and/or activity of SWAP-70 and/or DEF6. Such agents that can be used in this method include but are not limited to agents for increasing the expression of the gene encoding SWAP-70 and/or DEF6 and include nucleic acids which encode the SWAP-70 and/or DEF6 proteins, or the entire SWAP-70 and/or DEF6 gene, or a nucleic acid that is substantially homologous to the SWAP-70 and/or DEF6 genes, or a variant, mutant, fragment, homologue or derivative of the SWAP-70 and/or DEF6 genes that produces a protein that maintains or increases their function.
The gene or a nucleic acid which encodes the SWAP-70 and/or DEF6 proteins, or a nucleic acid that is substantially homologous to the SWAP-70 and/or DEF6 genes, or a variant, mutant, fragment, homologue or derivative of the SWAP-70 and/or DEF6 genes that produce proteins with maintained or increased function can also be used in the methods of the invention.
The sequences of human SWAP-70 and DEF6 are available on the National Center for Biotechnology Database and can be used to manufacture variants, mutants, fragments, homologues and derivatives which maintain or have increased function.
DNA or other nucleic acids such as mRNA can also be used in the method.
While it would be understood that any agent or agents that increase or upregulate the expression of SWAP-70 and/or DEF6, would also most likely increase SWAP-70 and/or DEF6 proteins, alternatively, an agent or agents that directly increase or promote the activation, amount and/or activity of the proteins can be used in the methods.
Alternatively, administering the proteins can be used in the methods. This includes the administration of a polypeptide, or a variant thereof having at least 90% sequence identity with the SWAP 70 and/or DEF6 polypeptides.
In an embodiment, the variant of the polypeptide has at least 91% sequence identity, or at least 92% sequence identity, or at least 93% sequence identity, or at least 94% sequence identity, or at least 95% sequence identity, or at least 96% sequence identity, or at least 97% sequence identity, or at least 98% sequence identity, or at least 99% sequence identity, with the sequence of the polypeptide of which it is a variant. Thus, preferably, the variant of the polypeptide has at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity with the sequence of the SWAP70 and/or DEF6 polypeptide. Such variants may be made, for example, using the methods of recombinant DNA technology, protein engineering and site-directed mutagenesis, which are well known in the art, and discussed in more detail below.
The percent sequence identity between two polypeptides may be determined using suitable computer programs.
Polypeptides, may be prepared using an in vivo or in vitro expression system. Preferably, an expression system is used that provides the polypeptides in a form that is suitable for pharmaceutical use, and such expression systems are known to the skilled person. As is clear to the skilled person, polypeptides of the invention suitable for pharmaceutical use can be prepared using techniques for peptide synthesis.
A nucleic acid molecule encoding, for example, the proteins or variants thereof, may be used to transform a host cell or host organism for expression of the desired polypeptide. Suitable hosts and host cells are known in the art and may be any suitable fungal, prokaryotic or eukaryotic cell or cell line or organism, for example: bacterial strains, including gram-negative strains such as Escherichia coli and gram-positive strains such as Bacillus subtilis or of Bacillus brevis; yeast cells, including Saccharomyces cerevisiae; or Schizosaccharomyces pombe; amphibian cells such as Xenopus oocytes; insect-derived cells, such SF9, Sf21, Schneider and Kc cells; plant cells, for example tobacco plants; or mammalian cells or cell lines, CHO-cells, BHK-cells (for example BHK-21 cells) and human cells or cell lines such as HeLa, as well as all other hosts or host cells that are known and can be used for the expression and production of polypeptides.
The polypeptides or variants thereof, may be made by chemical synthesis, again using methods well known in the art for many years. In certain embodiments, polypeptides for administration to a patient may be in the form of a fusion molecule in which the polypeptide is attached to a fusion partner to form a fusion protein. Many different types of fusion partners are known in the art. One skilled in the art can select a suitable fusion partner according to the intended use of the fusion protein. Examples of fusion partners include polymers, polypeptides, lipophilic moieties, and succinyl groups. Certain useful protein fusion partners include serum albumin and an antibody Fc domain, and certain useful polymer fusion partners include, but are not limited to, polyethylene glycol, including polyethylene glycols having branched and/or linear chains. In certain embodiments, the polypeptide may be PEGylated, or may comprise a fusion protein with an Fc fragment.
In an embodiment, the polypeptide may be fused to or may comprise additional amino acids in a sequence that facilitates entry into cells (i.e. a cell-penetrating peptide). Thus, for example, the SWAP70, DEF6 or variant thereof or a polypeptide may further comprise the sequence of a cell-penetrating peptide (also known as a protein transduction domain) that facilitates entry into cells. As is well known in the art, cell-penetrating peptides are generally short peptides of up to 30 residues having a net positive charge and act in a receptor-independent and energy-independent manner.
Additionally or alternatively, the polypeptide may be fused to or may comprise additional amino acids in a sequence that facilitates entry into the nucleus (i.e., a nuclear localization sequence (NLS), aka nuclear localization domain (NLD)). Thus, for example, the SWAP70 or DEF6 protein or variant thereof may further comprise the sequence of an NLS that facilitates entry into the nucleus. NLS includes any polypeptide sequence that, when fused to a target polypeptide, is capable of targeting it to the nucleus. Typically, the NLS is one that is not under any external regulation (e.g. calcineurin regulation) but which permanently translocates a target polypeptide to the nucleus.
It is appreciated that the sequence of the cell-penetrating peptide and/or the NLS may be adjacent to the sequence of the protein or variant, or these sequences may be separated by one or more amino acids residues, such as glycine residues, acting as a spacer.
Therapeutic proteins produced as an Fc-chimera are known in the art. For example, Etanercept, the extracellular domain of TNFR2 combined with an Fc fragment, is a therapeutic polypeptide used to treat autoimmune diseases, such as rheumatoid arthritis.
In certain embodiments, the fusion partner may be a polymer, for example, polyethylene glycol (PEG). PEG may comprise branched and/or linear chains. In certain embodiments, a fusion partner comprises a chemically-derivatised polypeptide having at least one PEG moiety attached.
The fusion partner may be attached, either covalently or non-covalently, to the amino-terminus or the carboxy-terminus of the polypeptide. The attachment may also occur at a location within the polypeptide other than the amino-terminus or the carboxy-terminus, for example, through an amino acid side chain (such as, for example, the side chain of cysteine, lysine, histidine, serine, or threonine).
Modulating Genes that Upregulated and Downregulated in Pathogenic ABCs
As shown herein, certain genes are upregulated and/or enriched in pathogenic ABCs and some are downregulated.
Thus, one embodiment of the current invention is a method of abolishing or reducing pathogenic ABCs in a subject in need thereof by administering a therapeutically effective amount of an agent that antagonizes, inhibits or reduces the expression and/or activity of certain upregulated genes. A further embodiment of the current invention is a method of preventing and/or treating an autoimmune or lymphoproliferative disease by abolishing or reducing pathogenic ABCs in a subject in need thereof by administering an therapeutically effective amount of an agent that antagonizes, inhibits or reduces the expression and/or activity of certain upregulated genes.
In particular, 111 genes listed in Table 1 were upregulated in pathogenic or DKO ABCs as compared to WT ABCs. One or more of these upregulated genes would be a target for reduction of expression in order to reduce or abolish pathogenic ABCs.
More specifically, the methods of the invention include the inhibition of one or more genes including but not limited to: Cxcl9, Cxcl10, Ccl4, Ccl5, Ccl8, Il1r2, Li2rb2, Il18r1, Il18rap, Csf1, Tbx21, Itgax, Itgam, Ctla4, Sema3d, Sema4c, Bmp6, Itga8, Ccl22, Tnsfsf4, Cxcr3, Ccr1, Plxnd1, Itgb1, Ifnγ, Il6, Runx, MyoG, NF-kB, stat5, Hbp1, Srebf1, Zbtb32, Nfil3, IL-12a, CD28, CD9, FcRL5, CD30/CD30L, c-kit, CD15, CD244, CD68, Lmo7, Tnip3, Msc, Mist1, Id2, Insm1, TNFa, Thsd7a, IL-13/IL-13Ra1, IL-4, IL-5, and NDNF.
Other genes whose expression and/or activity are upregulated in pathogenic ABCs as compared to benign ABCs include but are not limited to Stat5, Hbp1, Srebf1, Zbtb32, LifR, AP1 family members and Batf family members. These genes would also be considered targets for reduction of expression in order to reduce or abolish pathogenic ABCs.
Most specifically, one or more genes related to higher immunoglobulin production including but not limited to Nfil3, Jun, and IL-9/IL-9R, would be targets for reduction of expression in order to reduce or abolish pathogenic ABCs.
The inhibition of these genes can be accomplished by any method known in the art including but not limited to the ones described above for decreasing expression of the gene that encodes IRF5, including but not limited to small molecules, RNAi, short RNA, antisense (e.g., morpholinos) and triplet-forming oligonucleotides, and ribozymes.
A further embodiment of the current invention is a method of abolishing or reducing pathogenic ABCs in a subject in need thereof by administering a therapeutically effective amount of an agent that agonizes, activates or increases the number, expression and/or activity of certain downregulated genes. A further embodiment of the current invention is a method of preventing and/or treating an autoimmune or lymphoproliferative disease by abolishing or reducing pathogenic ABCs in a subject in need thereof by administering a therapeutically effective amount of an agent that agonizes, activates or increases the number, expression and/or activity of certain downregulated genes. This could be accomplished by introducing a nucleic acid encoding the gene or a portion into the subject as described above for increasing SWEF proteins.
In particular, the genes listed in Table 2 were downregulated in pathogenic or DKO ABCs as compared to WT ABCs. One or more of these downregulated genes would be a target for an increase of expression in order to reduce or abolish pathogenic ABCs. More specifically, genes that are downregulated in pathogenic ABCs include but are not limited to MafA, MafB, c-maf Mertk, Cebp, Rora, Bcl6, Pxk, Smad1, Emp2, Pouf2f2, PU.1, Rel, Foxj3, Hand1, Cebp, Rora, Prdm1, Spic, and Pparg. More specifically, one or more genes related to myeloid-related genes including but not limited to AHR and PPARGc1a would be targets for an increase of expression in order to reduce or abolish pathogenic ABCs.
TABLE 1
Genes Upregulated in Pathogenic (DKO) ABCs
Genes Genes Genes Genes
Gm9825 Nfil3 Socs1 Slc25a19
Gdpd3 Igkv8-21 Serpina3f 9330175E14Rik
Hmga1-rs1 Igkv3-10 Ighv1-61 C920025E04Rik
Gm4841 Igkv4-80 Gm16710 Glo1
Thsd7a Gm10505 Tmem176b Gatsl3
H2-T10 Igkv17-121 Cplx2 Fgl2
Adm lghv14-3 Trp73 Gas7
Ighe Igkv4-68 Tmem176a Egr2
Ndnf Hspg2 Slc30a4 Il2ra
Igkv5-45 Il12a Ndrg1 Zbtb32
Lifr Ighv5-16 Jun Csf1
Ighv1-84 Igkv6-20 Camkk1 Igkv16-104
Igkv3-2 Ighv3-6 Iigp1 Fscn1
Ighg1 Sox5 Nostrin Tmem231
Dnah8 Ighv9-2 Lrrk2 H2-T24
Ighv5-2 Il9r Il4i1 Gnb4
Igkv17-127 Gramd2 Eml5 Lipc
Tagap1 Ffar2 H2-Q6 Havcr1
Ighv1-85 Slc22a15 Prr5l Akap5
Zfp365 Igkv6-25 Csf2rb2 Mical3_1
Tnip3 Igkv13-84 Nlrc3 Hipk2
Wdfy1 Plcg1 Plscr1 Lmo7
Igkv6-14 Gadd45g Pdcd1lg2 Pmepa1
Pard3b Wee1 Ermard
Aox4 Lamp3 Osm
Igkv4-74 Nrp2 Ighv1-52
Igkvl4-126 Gm2619 Rec8
lgkv3-5 Myo3b Igkv11-125
Ighv9-1 Chst7 Trio
TABLE 2
Genes Downregulated in Pathogenic (DKO) ABCs
Genes Genes Genes Genes Genes Genes
Rnaset2b Dnase1l3 Slc37a2 Dennd2d Pld3 Calcrl
Rap2a Gclm Kcnk6 Nr4a1 Ighv5-9 Itga2
Hpcal1 Tns3 Myo10 Slc35f6 Igkv6-13 Gpm6b
4632428N05Rik P2rx4 Dram2 Cr2_1 Plekhg3 Smad1
Mcfd2 Cfp Tmem206 Esr1 Rnf149 Rtp4
Rnps1 8430419L09Rik Nagk Igkv1-132 Gna12 Arl4d
Spred1 Adrb2 Ldlr Arhgap18 Rasgef1b Tmem51
Fam105a Il6ra Mid1 Erlin2 Megf8 S100a4
Zfp36l2 Lpin1 Arhgap19 Stard8 Dip2c Hmga1
Asah2 Por Glul Megf9 Plcl1 Il13ra1
Akr1b10 Wwp1 Lag3 Abcc5 Blvra Hsd11b1
Il6st Dmxl2 Slc29a1 Rab11fip5 Swap70 Itsn1
Cebpb Galnt7 Arrb2 Marveld1 Fam149a Cmtm3
Arrdc3 Ubtd1 Ppap2a Pik3cb Ifnlr1 Osbpl1a
Cyb5a Cttn Asah1 Pcyox1 Bmf Lpar5
P4ha1 Etv5 Hexa Nfix Lmbrd2 Efnb1
Leprot Hip1 Comt Ece1 Alpl Pira2
Slc7a7 Ets2 Tlr4 Paqr4 Lcp2 Pvrl4
Apobec2 Gm4951 Ifih1 Fam26f Clec7a_1 Cd1d1
Mpp6 Eno3 Cd63 RP23-458B6.6 Mcoln2 Skp2
Hes1 Gna15 Emr1 Slc46a1 1190002N15Rik Abcb4
Slc43a2 St3gal4 Nucb2 Fhod1 Mllt4 Gstm1
Hs6st1 Csf2ra Rab6b Rbpms Slc48a1 Mpeg1
Ccdc88b Lgals3bp Slc8b1 Tlr3 Tcn2 Smagp
Lgmn Sh2d1b2 Fez2 Spon1 Slc15a2 Ftl1
Plin2 Man1c1 Dfna5 Gab2 Kcnk13 Slc1a3
Tenm4 Nxpe4 Plxna1 Tmem65 Gm13994 Mgst1
Hist1h1c Kif13a Pla2g7 Nxpe5 Ppm1h Sgk1
Rab20 C5ar2 Rnf150 Rgl1 Ms4a7 C3
Basp1 Lipa A4galt Angptl4 Abcg3 B430306N03Rik
Prkra Dnajb13 1700025G04Rik E330020D12Rik Crisp3 Lst1
Pkp4 Sema4c Rab32 Nfam1 Fcgrt Ckb
Itfg3 Ppap2b Gsr Aoah Acer3 Ctnnd1
Rasa4 Syt15 Aph1b Marcks Tyrobp Slamf8
Gsto1 Vamp5 Asph Ninj1 Cadm1 Tbc1d4
Map4k3 Ms4a6d P2rx7 Parp12 Sirpa Mcoln3
Arhgap39 Hist1h2bc Akr1c13 Pla2g15 Slc9a9 Epb4.1l1
Igsf8 Acot11 Lima1 Galc Btnl6 Pla2g4a
Sh3bgrl2 Fads1 Myo9a Fcgr4 Smox Gas6
Id2 Rnase4 Klk1 Scamp1 Ccl5 Dram1
Slc12a2 4931406C07Rik Cyp27a1 Hpgds Lyz2 Ifitm2
Slc16a7 Myof Idh1 Tmem141 Osgin1 Ggt5
Pde2a Fam102b Cln8 Crim1 Lpcat2 Camk1
Plxnb2 Gbp8 Mitf Mical2 Ppt2 Avpi1
Lrp8 Ighv1-7 Tmem26 Tppp Ccnd1 Cd200r4
Tle1 Car2 Ctsl Abcb1a Sdc3 Scn1b
Dhrs3 Rsad2 Slc39a8 Fam213b Ctsb Cd5l
Cd36 Dse Scarb1 Anpep Serpinb6a Bmpr2
Cyb5r1 Hsd3b7 Fabp4 Pstpip2 Il11ra1 Asb2
Cpq Mt1 Fblim1 Ctsd Igha Lrrc25
Kdelc2 Tbc1d8 Cmtm4 Metrnl Cxcl9 Ctsf
Mgat4b Plod1 Dab2ip Cd200r1 Pald1 Frmd4a
Rragd Slc12a7 Hnrnpll Ptafr Lrp12 Ptgs1
I830077J02Rik Cd68 Abca9 Slc8a1 Cd244 Adam23
Timp2 Anxa3 Npl Dlg2 Hk3 Sirpb1b
Arsg Def6 Fcer1g Itga9 Il18 Tbxas1
Tspan15 Tifab Actn1 Tlr13 Snx24 B3galnt1
Creg1 Tmem86a Gpr35 Fcgr1 Dock4 Havcr2
Parvb Sepp1 Tlr8 Cdc42ep2 Arhgap32 Sash1
Rgs10 Tnfrsf1a Fcgr3 Fpr1 Pla2g2d C1qa
Il18bp Trim47 Sall2 Pdgfc Cd302 Ltbr
Sema6d Stk39 Lair1 C6 Lrp5 C1qc
Siglech Ppfia4 Clec4a3 Tgfbi AF251705 Trf
Tnfrsf21 Ubd Lilra5 Dmpk Fgd4 Dock5
Cnksr3 Tbc1d2b Slc4a1 Clec4a1 Nr1h3 Pdgfb
Soga1 Sirpb1a Acot1 Itgad Agap1 Epb4.1l3
Gdpd1 Dock7 Amz1 Kcnj2 Aatk Kcna2
Ifitm3 Rxra Clec12a Itgb5 Hba-a1 Rab3il1
Ccl6 Fmnl2 Raver2 Mafb Acp2 Alas2
AI607873 6430548M08Rik Adamdec1 Jup Gtf2ird1 Pygl
Cebpa Cttnbp2nl Iqgap2 Aif1 Pak1 Pparg
Nuak1 Pigz F11r Adrbk2 Wdfy3 Mrc1
Matn2 Ttyh2 Lrp1 Abcd2 Siglece Cmklr1
Ifi204 Nptxr Fzd7 Igsf6 Clec1b Hba-a2
Adap2 Dgat2 Csf3r Sqrdl Pid1 Pdlim4
Tgm2 Spic Slc16a10 Snta1 Scamp5 Fyb
Large Rin2 Unc5a Rims3 Oaf Klrk1
Adam22 Tns1 Hap1 Ear2 Tjp1 Maf
Enpp4 Klra2 Slc22a23 Tfec C1qb Tsku
Genes Genes Genes Genes Genes
Tcf7l2 Serpinb9b Vnn3 Adrb1 Ptgis
Slc7a8 Ptprm Pilrb2 Clec4n Ccl24
Cd4 Cela1 Cd300e 1810011H11Rik Nfasc
Hfe Slc11a1 Hmox1 Apobr A530099J19Rik
Dgki Kcnj10 Rnf144b Cmbl
Trpm2 Dysf Axl Mrap
Aph1c Nos1 Igf1 Hs3st2
Hbb-bs Apoc1 Slco2b1 Nav1_l
Ccdc148 Gm5150 Treml4 Gpd1
Nlrp3 Frmd4b Fkbp9 Slc40a1
Clec4a2 Gfra2 Slc16a9 Gsta4
Tgm1 Ccr3 Pilrb1 Enpp2
Hebp1 Kcnj16 Vcam1 Slc45a3
Hbb-bt Hpgd Gzma B4galt4
Tspan4 Gm13710 Pilra Akr1b7
Cystm1 Lrp4 St6galnac2 Agmo
Kctd12b Ptplad2 Abcc3 Tspan9
Sulf2 Cd14 Galnt3 RP24-247B20.1
Paqr9 Mpzl1 Gm4980 Kitl
Mertk Sort1 Cd300ld Apol7c
Prkar1b Slc7a2 Hcar2 Lphn3
Nid2 Csf1r Fcna Sdc2
Tnfaip2 Stab2 Emr4 Glis3
Mras Vwf Epor Gpr141
Erbb2 Clec4b1 Pcolce2 Cd163
Tmem37 Cd300a Vstm4 Rps13
Tnfrsf11a Crip2 Dlc1 Col14a1

Administration of Agents
When the SWAP-70, DEF6, or IRF5 inhibitor, or inhibitor or activator of a misregulated gene, is a nucleic acid such as DNA, RNA, interfering RNA or microRNA, methods for delivery include receptor mediated endocytosis where the nucleic acid is coupled to a targeting molecule that can bind to a specific cell surface receptor, inducing endocytosis and transfer of the nucleic acid into cells. Coupling is normally achieved by covalently linking poly-lysine to the receptor molecule and then arranging for (reversible) binding of the negatively charged DNA or RNA to the positively charged poly-lysine component. Another approach utilizes the transferrin receptor or folate receptor which is expressed in many cell types. When producing the microRNA for this method of administration, the microRNA could be manufactured to have a guide strand which is identical to the microRNA of interest and a passenger strand that is modified and linked to a molecule for increasing cellular uptake
Another method to administer the nucleic acid to the proper tissue is direct injection/particle bombardment, where the nucleic acid is be injected directly with a syringe and needle into a specific tissue, such as muscle.
An alternative direct injection approach uses particle bombardment (‘gene gun’) techniques: nucleic acid is coated on to metal pellets and fired from a special gun into cells. Successful gene transfer into a number of different tissues has been obtained using this approach. Such direct injection techniques are simple and comparatively safe.
Another method for delivery of nucleic acid to the proper tissue or cell is by using adeno-associated viruses (AAV). Nucleic acid is delivered in these viral vectors is continually expressed, replacing the expression of the DNA or RNA that is not expressed in the subject. Also, AAV have different serotypes allowing for tissue-specific delivery due to the natural tropism toward different organs of each individual AAV serotype as well as the different cellular receptors with which each AAV serotype interacts. The use of tissue-specific promoters for expression allows for further specificity in addition to the AAV serotype.
Other mammalian virus vectors that can be used to deliver the DNA or RNA include oncoretroviral vectors, adenovirus vectors, Herpes simplex virus vectors, and lentiviruses.
Liposomes are spherical vesicles composed of synthetic lipid bilayers which mimic the structure of biological membranes. The nucleic acid to be transferred is packaged in vitro with the liposomes and used directly for transferring the nucleic acid to a suitable target tissue in vivo. The lipid coating allows the nucleic acid to survive in vivo, bind to cells and be endocytosed into the cells. Cationic liposomes (where the positive charge on liposomes stabilize binding of negatively charged DNA), have are one type of liposome.
The nucleic acid can also be administered with a lipid to increase cellular uptake. The nucleic acid may be administered in combination with a cationic lipid, including but not limited to, lipofectin, DOTMA, DOPE, and DOTAP.
Other lipid or liposomal formulations including nanoparticles and methods of administration have been described as for example in U.S. Patent Publication 2003/0203865, 2002/0150626, 2003/0032615, and 2004/0048787. Methods used for forming particles are also disclosed in U.S. Pat. Nos. 5,844,107, 5,877,302, 6,008,336, 6,077,835, 5,972,901, 6,200,801, and 5,972,900.
The polypeptide or nucleic acid molecule for administration to the patient may be formulated as a nanoparticle. Nanoparticles are a colloidal carrier system that has been shown to improve the efficacy of an encapsulated drug by prolonging the serum half-life. Polyalkylcyanoacrylates (PACAs) nanoparticles are a polymer colloidal drug delivery system that is in clinical development (described, for example, by Stella et al. (2000) J. Pharm. Sci., 89: 1452-1464; Brigger et al. (2001) Int. J. Pharm 214: 37-42; Calvo et al. (2001) Pharm. Res. 18: 1157-1166; and Li et al. (2001) Biol. Pharm. Bull. 24: 662-665). Biodegradable poly(hydroxyl acids), such as the copolymers of poly(lactic acid) (PLA) and poly(lactic-co-glycolide) (PLGA) are being extensively used in biomedical applications and have received FDA approval for certain clinical applications. In addition, PEG-PLGA nanoparticles have many desirable carrier features including (i) that the agent to be encapsulated comprises a reasonably high weight fraction (loading) of the total carrier system; (ii) that the amount of agent used in the first step of the encapsulation process is incorporated into the final carrier (entrapment efficiency) at a reasonably high level; (iii) that the carrier has the ability to be freeze-dried and reconstituted in solution without aggregation; (iv) that the carrier be biodegradable; (v) that the carrier system be of small size; and (vi) that the carrier enhances the particles persistence. Nanoparticles may be synthesized using virtually any biodegradable shell known in the art. In one embodiment, a polymer, such as poly(lactic-acid) (PLA) or poly(lactic-co-glycolic acid) (PLGA) is used. Such polymers are biocompatible and biodegradable, and are subject to modifications that desirably increase the photochemical efficacy and circulation lifetime of the nanoparticle. In one embodiment, the polymer is modified with a terminal carboxylic acid group (COOH) that increases the negative charge of the particle and thus limits the interaction with negatively charged nucleic acids. Nanoparticles may also be modified with polyethylene glycol (PEG), which also increases the half-life and stability of the particles in circulation. Alternatively, the COOH group may be converted to an N-hydroxysuccinimide (NHS) ester for covalent conjugation to amine-modified compounds.
Other protein modifications to stabilize a polypeptide, for example to prevent degradation, as are well known in the art may also be employed. Specific amino acids may be modified to reduce cleavage of the polypeptide in vivo. Typically, N- or C-terminal regions are modified to reduce protease activity on the polypeptide. A stabilizing modification is any modification capable of stabilizing a protein, enhancing the in vitro half life of a protein, enhancing circulatory half life of a protein and/or reducing proteolytic degradation of a protein. For example, polypeptides may be linked to the serum albumin or a derivative of albumin. Methods for linking polypeptides to albumin or albumin derivatives are well known in the art.
It is appreciated that the compounds for administration to a patient, for example as described above, will normally be formulated as a pharmaceutical composition, i.e. together with a pharmaceutically acceptable carrier, diluent or excipient.
The phrase “pharmaceutically acceptable” refers to molecular entities and compositions that are physiologically tolerable and do not typically produce an allergic or similar untoward reaction, such as gastric upset, dizziness and the like, when administered to a human, and approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans. “Carrier” refers to a diluent, adjuvant, excipient, or vehicle with which the therapeutic is administered. Such pharmaceutical carriers can be sterile liquids, such as saline solutions in water and oils, including those of petroleum, animal, vegetable, or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil, and the like. A saline solution is a preferred carrier when the pharmaceutical composition is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions. Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol, and the like. The composition, if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents.
Preferred methods of administration include oral; mucosal, such as nasal, sublingual, vaginal, buccal, or rectal; parenteral, such as subcutaneous, intravenous, bolus injection, intramuscular, or intraarterial; or transdermal administration to a subject. Most preferred method of administration are parenteral and oral.
These administrations can be performed using methods standard in the art. Oral delivery can be performed by complexing a therapeutic composition of the present invention to a carrier capable of withstanding degradation by digestive enzymes in the gut of an animal. Examples of such carriers, include plastic capsules or tablets, such as those known in the art. One method of local administration is by direct injection. Administration of a composition locally within the area of a target cell refers to injecting the composition centimeters and preferably, millimeters from the target cell or tissue. The inhibitor may be provided in any suitable form, including without limitation, a tablet, a powder, an effervescent tablet, an effervescent powder, a capsule, a liquid, a suspension, a granule or a syrup.
Alternatively, a further embodiment of the invention provides methods of ex vivo cell therapy, wherein a population of pathogenic ABCs is obtained from the subject, contacted, incubated or treated with one of the agents disclosed herein for abolishing or decreasing pathogenic ABCs, and then administered back to the subject in need thereof.
Obtaining the pathogenic ABCs from the subject would be the same as set forth below for detection of pathogenic ABCs. Administration of the ex vivo treated cells of the present invention can be effected using any suitable route of introduction, such as intravenous, intraperitoneal, intra-gastrointestinal track, subcutaneous, transcutaneous, intramuscular, intracutaneous, intrathecal, epidural, and rectal. According to presently preferred embodiments, the ex vivo treated cells of the present invention may be introduced to the individual using intravenous and/or intraperitoneal administration.
Also within the scope of the present disclosure are multiple administrations (e.g., doses) of the agents and/or populations of cells. In some embodiments, the agents and/or populations of cells are administered to the subject once. In some embodiments, agents and/or populations of cells are administered to the subject more than once (e.g., at least 2, 3, 4, 5, or more times). In some embodiments, the agents and/or populations of cells are administered to the subject at a regular interval, e.g., every six months.
Detection of Pathogenic ABCs
It has also been discovered that pathogenic ABCs, those ABCs that would be found in subjects with or predicted to develop an autoimmune or lymphoproliferative disease, would have different gene expression profile than ABCs which are not pathogenic as well as other B cells. The expansion and/or function of ABCs that are pathogenic are inhibited by the SWEF proteins and depend upon IRF5 and other IRFs and these cells differentially express certain genes, including but not limited to, Cxcl9, Cxcl10, Ccl4, Ccl5, Ccl8, Il1r2, Li2rb2, Il18r1, Il18rap, Csf1, Tbx21, Itgax, Itgam, Ctla4, Sema3d, Sema4c, Bmp6, Itga8, Ccl22, Tnsfsf4, Cxcr3.Ccr1, Plxnd1, Itgb1, Ifnγ, Il6, AP1 family members like Jun, Batf family members, PU.1 and other Ets family members like SpiC, Runx, MyoG, NF-kB, Stat5, Hbp1, Srebf1 and 2, Zbtb32, Nfil3, LifR, Bcl6, Pxk, Smad1, Emp2, Pouf2f2, Rel, Foxj3, Hand1, MafA, MafB, c-Maf Cebp, Rora, Prdm1, Mertk, Axl, Pparg, CD28, CD9, FcRL5, CD36, CD30/CD30L, c-kit, CD15, CD244, CD68, LXRa, AHR, LDLR, Lmo7, Tnip3, Ppargc1a, Msc, and Mist1.
Most methods start with obtaining a sample of biological tissue or fluid that contains peripheral blood cells from the subject and extracting, isolating and/or purifying B cells from the tissue or fluid.
Preferred biological tissues include, but are not limited to, epidermal, whole blood, and plasma. The biological tissue obtained from a lymph node or spleen biopsy.
Preferred fluids include, but are not limited to, plasma, saliva, and urine.
The isolated B cells can be stimulated with an agent including but not limited to IL21, TLR7 and combinations thereof.
After stimulation nucleic acid is extracted, isolated and purified from the cells by methods known in the art.
If required, a nucleic acid sample having the gene sequence(s) are prepared using known techniques. For example, the sample can be treated to lyse the cells, using known lysis buffers, sonication, electroporation, with purification and amplification occurring as needed, as will be understood by those in the skilled in the art. In addition, the reactions can be accomplished in a variety of ways. Components of the reaction may be added simultaneously, or sequentially, in any order. In addition, the reaction can include a variety of other reagents which can be useful in the methods and assays and would include but is not limited to salts, buffers, neutral proteins, such albumin, and detergents, which may be used to facilitate optimal hybridization and detection, and/or reduce non-specific or background interactions. Also reagents that otherwise improve the efficiency of the assay, such as protease inhibitors, nuclease inhibitors, and anti-microbial agents, can be used, depending on the sample preparation methods and purity.
Once prepared, mRNA or other nucleic acids are analyzed by methods known to those of skill in the art. The nucleic acid sequence corresponding to a gene can be any length, with the understanding that longer sequences are more specific. Preferably a nucleic acid corresponding to a gene is at least 20 nucleotides in length. Preferred ranges are from 20 to 100 nucleotides in length, with from 30 to 60 nucleotides being more preferred, and from 40 to 50 being most preferred.
In addition, when nucleic acids are to be detected preferred methods utilize cutting or shearing techniques to cut the nucleic acid sample containing the target sequence into a size that will facilitate handling and hybridization to the target. This can be accomplished by shearing the nucleic acid through mechanical forces, such as sonication, or by cleaving the nucleic acid using restriction endonucleases, or any other methods known in the art. However, in most cases, the natural degradation that occurs during archiving results in “short” oligonucleotides. In general, the methods and assays of the invention can be done on oligonucleotides as short as 20-100 base pairs, with from 20 to 50 being preferred, and between 40 and 50, including 44, 45, 46, 47, 48 and 49 being the most preferred.
A preferred method of the invention is performing gene expression profiling of the sample. Gene expression profiling refers to examining expression of one or more RNAs in a cell, preferably mRNA. Often at least or up to 10, 100, 100, 10,000 or more different mRNAs are examined in a single experiment.
In a preferred method and assay of the invention, the gene expression of the mRNA or other nucleic acid obtained from the B cells from the subject is compared to the reference gene expression of B cells from a healthy donor. In some cases, these cells are ABCs from a healthy donor, i.e., one without an autoimmune or lymphoproliferative disease. In some cases, the cells are other B cells from a healthy donor.
When the gene expression of the B cells from the subject is being compared to ABCs from a healthy donor or control, a finding of at least one of the following genes being expressed at a higher or greater level than the expression in the healthy donor or control would indicate the B cells from the subject are pathogenic ABCs: Stat5, Hbp1, Srebf1, Zbtb32, Jun, Nfil3, LifR, and AP1-Batf. The expression of any of the genes listed in Table 1 at a higher or greater level than the expression in the healthy donor or control would indicate the B cells from the subject are pathogenic ABCs
When the gene expression of the B cells from the subject is being compared to ABCs from a healthy donor or control, a finding of at least one of the following genes being expressed at a lower level or less than the expression in the healthy donor or control would indicate the B cells from the subject are pathogenic ABCs: MafA, MafB, c-maf Mertk, Cebp, Rora, PU.1, Mertk, MafB, Spic, Pparg, Ppargc1a, and Prdm1. The expression of any of the genes listed in Table 2 at a lower or lesser level than the expression in the healthy donor or control would indicate the B cells from the subject are pathogenic ABCs.
When the gene expression of the B cells from the subject is being compared to other B cells a healthy donor or control, a finding of at least one of the following genes being expressed at a higher or greater level than the expression in the healthy donor or control would indicate the B cells from the subject are pathogenic ABCs: Cxcl9, Cxcl10, Ccl4, Ccl5, Ccl8, Il1r2, Li2rb2, Il18r1, Il18rap, Csf1, Tbx21, Itgax, Itgam, Ctla4, Sema3d, Sema4c, Bmp6, Itga8, Ccl22, Tnsfsf4, Cxcr3, Ccr1, Plxnd1, Itgb1, Ifnγ, Il6, AP1, Batf, Runx, MyoG, NF-kB, IL-9/IL-9R, IL13/IL-13Ra1, and IL-4.
When the gene expression of the B cells from the subject is being compared to other B cells from a healthy donor or control, a finding of at least one of the following genes being expressed at a lower or lesser level than the expression in the healthy donor or control would indicate the B cells from the subject are pathogenic ABCs: Bcl6, Pxk, Smad1, Emp2, Pouf2f2, PU.1, Rel, Foxj3, and Hand1.
When a method of detecting pathogenic ABCs is used to monitor response to treatment in a subject, the gene expression from B cells of the subject after treatment can be compared to the gene expression from B cells from the subject before treatment. The gene expression from the B cells of the subject can also be compared to the reference gene expression of the B cells from a healthy donor or control.
Typically expression is compared to expression of a consistently expressed housekeeping gene transcript, the relative expression determined, and then the expression of the subject is compared to the reference expression of the healthy control:
Methods for examining gene expression, are often hybridization based, and include, Southern blots; Northern blots; dot blots; primer extension; nuclease protection; subtractive hybridization and isolation of non-duplexed molecules using, for example, hydroxyapatite; solution hybridization; filter hybridization; amplification techniques such as RT-PCR and other PCR-related techniques such as PCR with melting curve analysis, and PCR with mass spectrometry; fingerprinting, such as with restriction endonucleases; and the use of structure specific endonucleases. mRNA expression can also be analyzed using mass spectrometry techniques (e.g., MALDI or SELDI), liquid chromatography, and capillary gel electrophoresis. Any additional method known in the art can be used to detect the presence or absence of the transcripts.
Alternatively, the level of protein product of the genes can be measured from a protein sample from the biological tissue or fluid using methods described below.
For a general description of these techniques, see also Sambrook et al. 1989; Kriegler 1990; and Ausebel et al. 1990.
The preferred method for the detection of the transcripts is the use of arrays or microarrays or RNA-sequencing or nanostring.
These terms are used interchangeably and refer to any ordered arrangement on a surface or substrate of different molecules, referred to herein as “probes.” Each different probe of any array is capable of specifically recognizing and/or binding to a particular molecule, which is referred to herein as its “target” in the context of arrays. Examples of typical target molecules that can be detected using microarrays include mRNA transcripts, cRNA molecules, cDNA, PCR products, and proteins.
Microarrays, RNA-sequencing and nanostring are useful for simultaneously detecting the presence, absence and quantity of a plurality of different target molecules in a sample. The presence and quantity, or absence, of the probe's target molecule in a sample may be readily determined by analyzing whether and how much of a target has bound to a probe at a particular location on the surface or substrate.
In a preferred embodiment, arrays used in the present invention are “addressable arrays” where each different probe is associated with a particular “address.”
The arrays used in the present invention are preferable nucleic acid arrays that comprise a plurality of nucleic acid probes immobilized on a surface or substrate. The different nucleic acid probes are complementary to, and therefore can hybridize to, different target nucleic acid molecules in a sample. Thus, each probe can be used to simultaneously detect the presence and quantity of a plurality of different genes, e.g., the presence and abundance of different mRNA molecules, or of nucleic acid molecules derived therefrom (for example, cDNA or cRNA).
The arrays are preferably reproducible, allowing multiple copies of a given array to be produced and the results from each easily compared to one another. Preferably microarrays are small, and made from materials that are stable under binding conditions. A given binding site or unique set of binding sites in the microarray will specifically bind to the target. It will be appreciated that when cDNA complementary to the RNA of a cell is made and hybridized to a microarray under suitable conditions, the level or degree of hybridization to the site in the array corresponding to any particular gene will reflect the prevalence in the cell of mRNA transcribed from that gene. For example, when detectably labeled (e.g., with a fluorophore) cDNA complementary to the total cellular mRNA is hybridized to a microarray, the site on the array corresponding to a gene (i.e., capable of specifically binding a nucleic acid product of the gene) that is not transcribed in the cell will have little or no signal, while a gene for which mRNA is highly prevalent will have a relatively strong signal.
By way of example, GeneChip® (Affymetrix, Santa Clara, Calif.), generates data for the assessment of gene expression profiles and other biological assays. Oligonucleotide expression arrays simultaneously and quantitatively “interrogate” thousands of mRNA transcripts. Each transcript can be represented on a probe array by multiple probe pairs to differentiate among closely related members of gene families. Each probe contains millions of copies of a specific oligonucleotide probe, permitting the accurate and sensitive detection of even low-intensity mRNA hybridization patterns. After hybridization data is captured, using a scanner or optical detection systems, software can be used to automatically calculate the intensity values for each probe cell. Probe cell intensities can be used to calculate an average intensity for each gene, which correlates with mRNA abundance levels. Expression data can be quickly sorted based on any analysis parameter and displayed in a variety of graphical formats for any selected subset of genes.
Further examples of microarrays that can be used in the assays and methods of the invention are microarrays synthesized in accordance with techniques sometimes referred to as VLSIPS™ (Very Large Scale Immobilized Polymer Synthesis) technologies as described, for example, in U.S. Pat. Nos. 5,324,633; 5,744,305; 5,451,683; 5,482,867; 5,491,074; 5,624,711; 5,795,716; 5,831,070; 5,856,101; 5,858,659; 5,874,219; 5,968,740; 5,974,164; 5,981,185; 5,981,956; 6,025,601; 6,033,860; 6,090,555; 6,136,269; 6,022,963; 6,083,697; 6,291,183; 6,309,831; 6,416,949; 6,428,752 and 6,482,591.
Other exemplary arrays that are useful for use in the invention include, but are not limited to, Sentrix® Array or Sentrix® BeadChip Array available from Illumina®, Inc. (San Diego, Calif.) or others including beads in wells such as those described in U.S. Pat. Nos. 6,266,459; 6,355,431; 6,770,441; and 6,859,570. Arrays that have particle on the surface can also be used and include those described in U.S. Pat. Nos. 6,489,606; 7,106,513; 7,126,755; and 7,164,533.
An array of beads in a fluid format, such as a fluid stream of a flow cytometer or similar device, can also be used in methods for the invention. Exemplary formats that can be used in the invention to distinguish beads in a fluid sample using microfluidic devices are described, for example, in U.S. Pat. No. 6,524,793. Commercially available fluid formats for distinguishing beads include, for example, those used in XMAP™ technologies from Luminex or MPSS™ methods from Lynx Therapeutics.
A spotted microarray can also be used in a method of the invention. An exemplary spotted microarray is a CodeLink™ Array available from Amersham Biosciences.
Another microarray that is useful in the invention is one that is manufactured using inkjet printing methods such as SurePrint™ Technology available from Agilent Technologies. Other microarrays that can be used in the invention include, without limitation, those described in U.S. Pat. Nos. 5,429,807; 5,436,327; 5,561,071; 5,583,211; 5,658,734; 5,837,858; 5,919,523; 6,287,768; 6,287,776; 6,288,220; 6,297,006; 6,291,193; and 6,514,751.
DASL can be used for quantitative measurements of RNA target sequences as well as for DNA target sequences. DASL is described, for example, in Fan et al. 2004.
Additional techniques for rapid gene sequencing and analysis of gene expression include, SAGE (serial analysis of gene expression). For SAGE, a short sequence tag (typically about 10-14 bp) contains sufficient information to uniquely identify a transcript. These sequence tags can be linked together to form long serial molecules that can be cloned and sequenced. Quantitation of the number of times a particular tag is observed proves the expression level of the corresponding transcript (see, e.g., Velculescu et al. 1995; Velculescu et al. 1997; and de Waard et al. 1999).
Screening and diagnostic method of the current invention may involve the amplification of the target loci. A preferred method for target amplification of nucleic acid sequences is using polymerases, in particular polymerase chain reaction (PCR). PCR or other polymerase-driven amplification methods obtain millions of copies of the relevant nucleic acid sequences which then can be used as substrates for probes or sequenced or used in other assays.
Kits
It is contemplated that all of the assays disclosed herein can be in kit form for use by a health care provider and/or a diagnostic laboratory.
Assays for the detection and quantitation of one or more of the genes can be incorporated into kits. Such kits would include probes for one or more of the genes, reagents for isolating and purifying ABCs and other B cells and nucleic acids from biological tissue or bodily fluid, reagents for performing assays on the isolated and purified nucleic acid, instructions for use, and reference values or the means for obtaining reference values in a control sample for the included genes.
A preferred embodiment of these kits would have the probes attached to a solid state. A most preferred embodiment would have the probes in a microarray format wherein nucleic acid probes for one or more of the genes differentially regulated in pathogenic ABCs would be in an ordered arrangement on a surface or substrate.
Drug Screening Assays and Research Tools
All of the biomarkers disclosed herein can be used as the basis for drug screening assays and research tools.
In one embodiment, IRF5, SWAP-70, and DEF6 polypeptides and proteins can be used in drug screening assays, free in solution, or affixed to a solid support. All of these forms can be used in binding assays to determine if agents being tested form complexes with the peptides, proteins or fragments, or if the agent being tested interferes with the formation of a complex between the peptide or protein and a known ligand.
High throughput screening can also be used to screen for therapeutic agents. Small peptides or molecules can be synthesized and bound to a surface and contacted with the polypeptides, and washed. The bound peptide is visualized and detected by methods known in the art.
Antibodies to the polypeptides can also be used in competitive drug screening assays. The antibodies compete with the agent being tested for binding to the polypeptides. The antibodies can be used to find agents that have antigenic determinants on the polypeptides, which in turn can be used to develop monoclonal antibodies that target the active sites of the polypeptides.
The invention also provides for polypeptides to be used for rational drug design where structural analogs of biologically active polypeptides can be designed. Such analogs would interfere with the polypeptide in vivo, such as by non-productive binding to target. In this approach the three-dimensional structure of the protein is determined by any method known in the art including but not limited to x-ray crystallography, and computer modeling. Information can also be obtained using the structure of homologous proteins or target-specific antibodies.
Using these techniques, agents can be designed which act as inhibitors or antagonists of the polypeptides, or act as decoys, binding to target molecules non-productively and blocking binding of the active polypeptide, or which act as agonists.
A further embodiment of the present invention is gene constructs comprising the genes that encode IRF5, SWAP-70, and Def6 and any of the differentially expressed genes described herein, and a vector. These gene construct can be used for testing of therapeutic agents as well as basic research. These gene constructs can also be used to transform host cells can be transformed by methods known in the art.
The resulting transformed cells can be used for testing for therapeutic agents as well as basic research.
EXAMPLES
The present invention may be better understood by reference to the following non-limiting examples, which are presented in order to more fully illustrate the preferred embodiments of the invention. They should in no way be construed to limit the broad scope of the invention.
Example 1—Materials and Methods
Mice
C57BL/6, CD21-Cre and CD11c-Cre were obtained from Jackson Laboratory. DEF6 deficient (Def6tr/tr) mice were generated by Lexicon Pharmaceuticals, Inc. using a gene trapping strategy as previously described (Biswas et al. 2012). Swap-70 deficient mice (Swap-70−/−) were generated by R. Jessberger as previously described (Biswas et al. 2012). Def6tr/tr Swap-70−/− (DKO) mice were generated by crossing Def6tr/tr (Def6ko) mice with Swap-70−/− (Swap70ko) mice that had been backcrossed onto C57BL/6 background for greater than 10 generations (Biswas et al. 2012).
SAP−/− mice were obtained from Taconic and crossed to DKO mice to obtain SAP−/− DKO mice. IL21−/− mice on mixed strain background were obtained from the Mutant Mouse Regional Resource Centers (Lexicon strain ID 011723-UCD), and then backcrossed into a C57BL/6 background for greater than 10 generations and then crossed with DKO mice to obtain IL21−/− DKO mice.
CD11c CreIRF4fl/fl DKO mice were generated as previously described (Manni et al. 2015).
IRF5fl/fl mice, which do not carry the Dock2 mutation, were originally obtained from Paula Pitha-Rowe (Johns Hopkins University, MD) (Fang et al. 2012). CD21-Cre mice were crossed with IRF5fl/fl mice to produce CD21-Cre IRF5fl/fl mice. These mice were further crossed with DKO mice expressing either CD21Cre or CD11cCre to produce IRF5fl/fl DKO, CD21-Cre IRF5fl/− DKO, CD11cCre IRFfl/− DKO, and IRF5fl/− DKO mice.
BLIMP-YFP-10BiT double reporter mice have been described previously (Parish et al 2014; Maynard et al. 2007) and were crossed with DKO mice to generate BLIMP-YFP-10BiT DKO mice as described in Chandrasekaran et al. 2016.
Yaa-DKO male mice were obtained by crossing DKO male mice with Yaa mice which carry a duplication of TLR7 on the Y chromosome (Deane et al. 2007).
All mice used in the experiments were kept under specific pathogen-free conditions. The experimental protocols were approved by the Institutional Animal Care and Use Committee of the Hospital for Special Surgery and WCMC/MSKCC.
Antibodies and Flow Cytometry
The following monoclonal antibodies to mouse proteins were used for multiparameter flow cytometry: CD11c (N418), CD11b (M1/70), CD19 (6D5), B220 (RA3-6B2), T-bet (4B10), CD4 (RM4-5), CD21/CD35 (7E9), CD23 (B3B4), CD86 (GL-1), MHCII (AF6-120.1), IgG1 (RMG1-1) and IgG2a (RMG2a-62) were obtained from Biolegend. Antibodies to CD43 (S7), CD138 (281-2), GL-7 and Fas (Jo2) were obtained from BD. Antibodies to Ki-67 (SolA15), IgD (11-26), IgM (II/41), CD93 (AA4.1), CD5 (53-7.3), PDCA-1 (eBio927), PD1 (J43) and Foxp3 (FJK-16s) were obtained from Ebioscience.
For staining of CXCR5 (2G8; BD), cells were incubated in dark at room temperature for 25 minutes.
For intracellular staining, cells were fixed after surface staining at 4° C. with the Foxp3 Staining Buffer Set (eBioscience) following the manufacturer instruction.
For active caspase-3 staining, cells were stained using the CaspGLOW Active Caspase-3 Staining kit (BioVision) following the manufacturer instructions. For viability analysis, cells were stained with 0.5 μg of propidium iodide/samples prior to acquisition. Data were acquired on FACS Canto (Becton Dickinson) and analyzed with FlowJo (TreeStar) software.
Cell Sorting and B Cell Differentiation
Single-cell suspensions from pooled spleens and lymph nodes were pre-enriched for B cells with B220 microbeads (Miltenyi Biotec) following the manufacturer instructions. B cells were stained with CD11c (N418), CD11b (M1/70), CD19 (6D5), B220 (RA3-6B2) and CD23 (B3B4) and were sorted on FACS Aria (Becton Dickinson).
B Cell Differentiation
Single-cell suspensions from pooled spleens were enriched for B cells with biotinylated anti-CD23 (BD Bioscience) and streptavidin microbeads (Miltenyi Biotec) following the manufacturer instructions. CD23+ B cells were cultured in RPMI 1640 medium (Corning) supplemented with 10% FBS (Atlanta Biologicals), 100 U/ml Penicillin (Corning), 100 mg/ml Streptomycin (Corning), 1× Non-Essential Amino Acids (Corning), 2 mM L-Glutamine (Corning), 25 mM Hepes and 50 μM β-Mercaptoethanol, and stimulated with 5 μg/ml F(ab′)2 anti-mouse IgM (αIgM; Jackson ImmunoResearch Laboratories), 5 μg/ml Ultra-LEAF purified anti-mouse CD40 (Biolegend), in presence or absence of 50 ng/ml IL-21 (Peprotech), 1 μg/ml imiquimod (Invivogen), 10 ng/ml IL-4 (Peprotech) or 20 ng/ml IFN-γ (Peprotech). For proliferation assays, CD23+ B cells were labelled with 2.5 μM CFSE or Cell trace violet (Invitrogen) for 1 minute at room temperature prior stimulation.
Real-Time RT-PCR
Total RNA was isolated from cells using RNeasy Plus Mini kit (Qiagen). cDNAs were prepared using the iScript cDNA synthesis kit (Biorad). and analyzed for the expression of the gene of interest by real-time PCR using the iTaq Universal SYBR Green Supermix (Biorad). Gene expression was calculated using the ΔΔCt method and normalized to Cyclophilin a Lifr and Jun primers were obtained from Qiagen.
ccl5 forward
(SEQ ID NO: 1)
5′-GCCCACGTCAAGGAGTATTTCTA-3′;
ccl5 reverse
(SEQ ID NO: 2)
5′-ACACACTTGGCGGTTCCTTC-3′;
il6 forward
(SEQ ID NO: 3)
5′-GAGGATACCACTCCCAACAGAC-3′;
il6 reverse
(SEQ ID NO: 4)
5′-AAGTGCATCATCGTTGTTCATA-3′;
cxcl10 forward
(SEQ ID NO: 5)
5′-CCAAGTGCTGCCGTCATTTTC-3′;
cxcl10 reverse
(SEQ ID NO: 6)
5′-GGCTCGCAGGGATGATTTCAA-3′;
ifnγ forward
(SEQ ID NO: 7)
5′-GGATATCTGGAGGAACTGGC-3′;
Ifnγ reverse
(SEQ ID NO: 8)
5′-GCGCCAAGCATTCAATGAGCTC-3′;
spi1 forward
(SEQ ID NO: 9)
5′-TGCAGCTCTGTGAAGTGGTT-3′;
spi1 reverse
(SEQ ID NO: 10)
5′-AGCGATGGAGAAAGCCATAG-3′;
zbtb32 forward
(SEQ ID NO: 11)
5′-TCCAGATACGGTGCTCCCTTCT-3′;
zbtb32 reverse 
(SEQ ID NO: 12)
5′-CCAGAGAGCTTTGGAGTGGTTC-3′;
Nfil3 forward
(SEQ ID NO: 13)
5′-AATTCATTCCGGACGAGAAG-3′;
Nfil3 reverse
(SEQ ID NO: 14)
5′-CGATCAGCTTGTTCTCCAAA-3′;
Maf forward
(SEQ ID NO: 15)
5′-AGCAGTTGGTGACCATGTCG-3′;
maf reverse
(SEQ ID NO: 16)
5′-TGGAGATCTCCTGCTTGAGG-3′;
axl forward
(SEQ ID NO: 17)
5′-CGAGAGGTGACCTTGGAAC-3′;

DNA Constructs
Expression plasmids for untagged and HA-tagged DEF6 were generated as described previously (Biswas et al. 2012). The full-length wild type human SWAP-70 expression plasmid (pIRES2-EGFP-HA-SWAP70) was constructed by cloning the entire coding region of the human Swap-70 cDNA, fused in frame with a hemagglutinin (HA) epitope coding sequence at its 5′ end, into the pIRES2-EGFP bicistronic expression vector (Clonetech). Various deletion mutants of human SWAP-70 were generated by PCR using appropriate primers. The full-length wild type human IRF5 expression construct in pcDNA3 was a kind gift of Dr. Inez Rogatsky. Full length human IRF5 (variant 5) and T-bet expression constructs were purchased from Genescript. Expression plasmids for Flag-tagged IRF5 (variant 5) and its various deletion mutants were constructed in p3XFLAG-CMV-10 expression vector (Sigma) using IRF5 construct (Genescript) as a template. Expression plasmid for untagged T-bet was generated in pIRES2-EGFP bicistronic expression vector (Clonetech) using T-bet expression construct (Genescript) as a PCR template.
Western Blotting and Immunoprecipitation
Nuclear and cytoplasmic extracts were prepared with NEPER Nuclear and Cytoplasmic Extraction Reagents (Pierce), as previously described (Biswas et al. 2012). For expression analysis cell extracts were analyzed by Western blotting with anti-STAT3 (BD Bioscience), anti-pSTAT3 (Y705) (Cell Signaling), anti-IRF5 (Cell Signaling) or anti-HDAC1 (Cell Signaling) antibodies. For protein-protein interaction studies, cell extracts were immunoprecipitated with an anti-IRF5 (Cell Signaling), or anti-HA (3F10; Roche Applied Science) antibodies. The immunoprecipitates were resolved by 8% SDS-PAGE, transferred to a nitrocellulose membrane, and then immunoblotting with either an anti-SWAP-70 antibody (Santa Cruz Biotechnology, Inc.), anti-DEF6 antiserum (Gupta et al. 2003) or anti-HA antibody (Roche Applied Science).
ChIP Assays
CD23+ B cells were purified and stimulated in vitro for 48 hours. After harvesting, the cells were cross-linked with formaldehyde, and chromatin extracts were prepared using the truChIP Chromatin Shearing Reagent Kit (Covaris) according to manufacturer instructions. The DNA-protein complexes were immunoprecipitated with an anti-IRF5 (Abcam, ab21689) or anti-T-bet (Santa Cruz; sc-21749X) specific antibody or a control antibody. After cross-linking was reversed and proteins were digested, the DNA was purified from the immunoprecipitates as well as from input extracts, and then analyzed by quantitative PCR using the following primers within the ABC-specific ATAC-seq peaks (murine):
I16 TSS (Forward):
(SEQ ID NO: 18)
5′-AGCTTCTCTTTCTCCTTATAAAACATTG-3′;
I16 TSS (Reverse);
(SEQ ID NO: 19)
5′-GCATCGAAAGAATCACAACTAGG-3′;
Cxcl10 Cluster (Forward): 
(SEQ ID NO: 20)
5′-AGTAGTCCCCACTGTCTGACT-3′;
Cxcl10 Cluster (Reverse): 
(SEQ ID NO: 21)
5′-GTGAGTCCCTTTAGCACCAGA-3′;
Zeb2 Exon8 (Forward):
(SEQ ID NO: 22)
5′-AGCAGTCCCTTTATGAACGG-3′;
Zeb2 Exon8 (Reverse):
(SEQ ID NO: 23)
5′-GCTTCCATCCCTACACCTAAG-3′;
Jun (Forward):
(SEQ ID NO: 24)
5′-AGAACAGCTTTTGAGCACCG-3′;
Jun (Reverse):
(SEQ ID NO: 25)
5′-TGGCTTCAAAGTGACTAACAGCA-3′;
IgG2c (Forward):
(SEQ ID NO: 26)
5′-TGTAATGCCTGGTTGCCTCC-3′;
IgG2c (Reverse)
(SEQ ID NO: 27)
5′-GTTCGGGACCCACAGTACATT-3.

ONP Assays
ONP assays were conducted as previously described (Biswas et al. 2010). Briefly, nuclear extracts were precleared with streptavidin-agarose beads and then incubated with trimerized biotinylated double-stranded oligonucleotide containing potential IRF binding site within the ATAC-seq peak at the IL-6 TSS (5′-TGCTGAGTCACTTTTAAAGAAAAAAAGAAGAGT-3′) (SEQ ID NO: 28) or the CXCL10 Cl (5′-CATAGAAAATGTTTTCAAAACCCGCATTCCGCTTATGCTGTCTGGTATCTGAAATAG ATCTGTCAGGGGGTCACATTTTATAAGCACCACTTCGTGTTTG-3′) (SEQ ID NO: 29). Proteins bound to the biotin-labeled DNA were collected by streptavidin-agarose beads, separated by 8% SDS-PAGE, and analyzed by Western blotting using anti-mouse IRF5 Ab (Cell signaling), anti-human IRF5 Ab (Santa Cruz SC-390364) or an anti-T-bet Ab (Santa Cruz; sc-21749).
Cytokines ELISA
IL-6 and CXCL10 in culture supernatants were measured using the mouse ELISA Max Standard Set (Biolegend) and the mouse Quantikine ELISA kit (R&D Systems) respectively.
Anti-ds DNA ELISA and ANA
For anti-dsDNA ELISA, plates were coated with 100 μg/ml salmon sperm DNA (Invitrogen AM9680) at 37° C. overnight and blocked in 2% BSA in PBS, at room temperature for 2 hours. For anti-cardiolipin ELISA Immulon 2HB plates (ThermoFisher) were coated with 75 μg/ml of cardiolipin dissolved in 100% ethanol at room temperature overnight. Sera were diluted 1:200 and incubated on coated plates at room temperature for 2 hours. Plates were then incubated with horseradish peroxidase-labelled goat anti-mouse IgG, IgG1 or IgG2 Fc antibody for 1 hour (eBioscience). Anti-ssDNA and anti-nRNP IgG ELISAs were obtained from Alpha Diagnostic International. OD450 was measured on a microplate reader. ANAs were detected on Hep-2 slides (MBL international) at a 1:200 dilution using Alexa Flour 488-conjugated anti-mouse IgG (Jackson ImmunoResearch). Fluorescent intensity was semi-quantitated by following the guidelines established by the Center for Disease Control, Atlanta, Ga.
Histology and Immunofluorescence Staining
Tissue specimens were fixed in 10% neutral buffered formalin and embedded in paraffin. Tissue sections were stained with periodic acid schiff (PAS) and analyzed by light microscopy. The nephritis scoring system was adapted from the International Society of Nephrology/Renal Pathology Society (ISN/RPS) classification of human lupus nephritis. At least 40 glomeruli per mouse were evaluated. The final score accounted for morphological pattern (mesangial, capillary, membranous) and for the percentage of involved glomeruli. Immunofluorescence analysis on frozen kidney sections was performed by staining with FITC-labeled goat anti-mouse IgG (Jackson ImmunoResearch Laboratories) and specimens were analyzed with a LSM 510 laser scanning confocal microscope (Carl Zeiss, Inc.). Images were captured by Q capture software. Five representative glomeruli per mouse were chosen and mean fluorescent intensity (MFI) was calculated using ImageJ software.
RNA Seq Analysis
Total RNA was isolated using RNeasy Plus Mini kit (Qiagen). SMARTSeq v3 Ultra Low Input RNA Kit (Clontech) followed by Nextera library preparation were used to prepare Illumina-compatible sequencing libraries. Quality of all RNA and library preparations were evaluated with BioAnalyser 2100 (Agilent). Sequencing libraries were pair-end sequenced by the Weill Cornell Epigenomics Core using HiSeq2500 at the depth of ˜30-50 million fragments per sample. Sequencing performance was evaluated using FASTQC. 50-bp paired reads were mapped to mouse genome (mm10, build 38.75, 41,128 genes and 87,108 transcripts) with CLC Bio Genomic Workbench 7.5 software (Qiagen).
Duplicated reads with more than 5 copies were discarded. Read count tables were created using unique exon read counts and the differential expression was analyzed using EDGER (Bioconductor). Genes with the expression levels less than 1 cpm in at least three conditions were considered non-expressing and removed from further analysis. A negative binomial generalized log-linear model was fit to read counts for each gene. A likelihood ratio tests with the null hypothesis that the pairwise contrasts of the coefficients are equal to zero was used to evaluate the significance of differences in expression between analyzed groups. Benjamini-Hochberg false discovery rate (FDR) procedure was used to correct for multiple testing. Genes with a FDR-corrected p-value >0.01 and less than 2 fold change were filtered out. Genes that passed the filtering were considered to be differentially expressed. Gene Set Enrichment Analysis was performed using the difference of log-transformed count per million (cpm) for contrasted conditions as a ranking metric. Molecular Signatures DataBase v 5.2 (Broad Institute) was used as source of gene sets with defined functional relevance. Gene sets ranging between 15 and 1000 genes were included into analysis. Nominal p values were FDR corrected and gene sets with FDR<0.05 were used to create GSEA enrichment plot. To define the groups of potentially co-regulated genes, unsupervised hierarchical clustering analysis of log-transformed expression values (cpm) in R was performed. The distances between genes were calculated as (1−Pearson correlation). The Euclidean distance was used to determine the distances between samples. Ward.D2 methods was used to performs clustering. The expression values were z-transformed and visualized using heatmaps.
ATAC-seq, Peak Calling and Annotation
The nuclei of sorted WT and DKO ABC or DKO Follicular B cells were prepared by incubation of cells with nuclear preparation buffer (0.30 M sucrose, 10 mM Tris, pH 7.5, 60 mM KCl, 15 mM NaCl, 5 mM MgCl2, 0.1 mM EGTA, 0.1% NP40, 0.15 mM spermine, 0.5 mM spermidine and 2 mM 6AA) (Minnich et al. 2016). Libraries were prepared as described previously (Buenrosto et al. 2015). Paired-end 50 bp sequences were generated from samples on an Illumina HiSeq2500. The makeTagDirectory was used followed by findPeaks command from HOMER version 4.7.2 to identify peaks of ATAC-seq. A false discovery rate (FDR) threshold of 0.001 was used for all data sets. The following HOMER command was used: cmd=findPeaks <sample tag directory>-style factor or histone-o <output file>-i <input tag directory>. The total number of mapped reads in each sample was normalized to ten million mapped reads. Peak-associated genes were defined based on the closest genes to these genomic regions using RefSeq coordinates of genes. The annotatePeaks command from HOMER was used to calculate ATAC-seq tag densities from different experiments and to create heatmaps of tag densities. Sequencing data were visualized by preparing custom tracks for the UCSC Genome browser.
Motif Enrichment Analysis
De novo transcription factor motif analysis was performed with motif finder program findMotifsGenome from HOMER package, on given ATAC-seq peaks. Peak sequences were compared to random genomic fragments of the same size and normalized G+C content to identify motifs enriched in the targeted sequences.
Statistics
P values were calculated with unpaired two-tailed Student's t-test for two-group comparisons and by one-way ANOVA followed by Bonferroni's multiple comparisons test for multi-group comparisons. For statistical analysis of ANA intensity score the non-parametric Mann-Whitney test was used. P values of <0.05 were considered significant. Ns: not significant, *: p≤0.05, **: p≤0.01 ***: p≤0.001***: p≤0.0001. Statistical analysis was performed with Graphpad Prism 5.
Example 2—Female DKO Mice have Premature Expansion of Pathogenic ABCs, which is Dependent on the Absence of Both SWEF Proteins and Contribute to Lupus
The finding that ABCs expand in autoimmune mouse strains coupled with the spontaneous development of autoimmunity in DKO mice prompted the investigation as to whether this B cell subset accumulates prematurely in these mice. The mice and methods described in Example 1 were used.
As compared to wild type mice, DKO female mice demonstrated a marked increase in the frequencies and numbers of splenic B cells expressing CD11c and CD11b (FIG. 1A). This increase could be observed by gating either on B220 alone or on both B220 and CD19 (FIG. 1A). Expansion of CD11c+CD11b+ B cells was primarily observed in spleens and, only minimally, in lymph nodes (FIG. 1B). Further staining for PDCA-1 confirmed that accumulation of these cells was not due to an increase in plasmacytoid dendritic cells (results not shown).
While ABCs in wild type female mice are normally detected after 12 months of age, ABCs in DKO female mice started appearing by 10 weeks of age (FIG. 1C), were readily observed by 18 weeks of age (FIG. 1D), and comprised up to 15% of splenic B cells in older (>23 weeks) mice (FIG. 1A).
Since B cells express both DEF6 and SWAP-70, it was also examined whether lack of either DEF6 alone or SWAP-70 alone was sufficient to promote the accumulation of ABCs in vivo (FIG. 1B). While a small increase in the frequencies of these cells could be observed in the spleens of female mice lacking only DEF6 or only SWAP-70, their abundance did not reach the levels observed in DKO female mice (FIG. 1B). The premature expansion of CD11c+CD11b+ B cells observed in DKO mice was thus dependent on the concomitant absence of DEF6 and SWAP-70, thus, both SWEF proteins control the accumulation of these cells in vivo.
To further characterize the CD11c+CD11b+ B cells that accumulated in DKO female mice, the expression of several markers whose presence or absence defines ABCs was examined (FIG. 1E). As expected, the expression of Tbet, a major regulator of ABC generation, was significantly higher in CD11c+CD11b+ DKO B cells as compared to CD11c−CD11b− DKO B cells and corresponded to a marked expansion of CD11c+T-bet+ B cells in DKO female mice. Moreover, CD11c+CD11b+ DKO B cells downregulated the expression of CD21 and CD23 and expressed high levels of CD86, MHCII, and IgM (FIG. 1D). CD11c+CD11b+ DKO B cells did not express CD5, CD43, or CD93 (FIG. 1D). While most CD11c+CD11b+ DKO B cells expressed sIgM, a small number of these cells had undergone class-switching and expressed IgG1 and IgG2c (FIG. 1F).
In order to investigate whether ABCs contribute to the development of lupus in DKO female mice, their ability to produce autoantibodies was investigated. CD11c+CD11b+ B cells from DKO mice were FACS-sorted and cultured in vitro in the presence or absence of the TLR7 agonist, imiquimod (FIG. 1G). ABCs, but not Follicular B cells (FoB) from DKO mice secreted anti-dsDNA IgG2c (FIG. 1G). No anti-dsDNA IgG1 production was instead observed under these stimulatory conditions (not shown). TLR7 stimulation of DKO ABCs also resulted in the production of anti-nRNP and anti-cardiolipin IgG antibodies (FIG. 1G). DKO ABCs can thus directly contribute to the autoimmune syndrome in DKO mice by producing autoantibodies and are thus denoted as “pathogenic ABCs”.
Example 3—IL-21 Regulates the Generation of ABCs in DKO Mice In Vitro and In Vivo
In addition to TLRs, T cells can also promote the generation of ABCs by providing contact-dependent signals and cytokines like IL-21 (Naradikian et al. 2016). An in vitro system to directly investigate the ability of these signals to drive the formation of ABCs from B cells purified from 8 week-old wild type or DKO female mice (Example 1) was set up (FIG. 2A). Culturing wild type or DKO B cells with αIgM (5 μg/ml) and αCD40 (5 μg/ml), either alone or with imiquimod, (1 μg/ml) did not result in the formation of CD11c+CD11b+ B cells. However, the addition of IL-21 (50 ng/ml) led to a significantly greater population of CD11c+CD11b+ cells in cultures of DKO than wild type B cells (FIG. 2A). A population of CD11c+CD11b− B cells could also be observed in these DKO cultures (FIG. 2A). Similar results were obtained by using either CD11c and T-bet or CD11c and CD11b as markers (FIGS. 2A and 2B). In line with previous reports (Naradkian et al. 2016a), stimulation of wild type and DKO B cells with either IL-4 or IFNγ alone did not result in the formation of CD11c+T-bet+ B cells and addition of IL-4 inhibited the IL-21-mediated formation of these cells in both wild type and DKO cultures (results not shown). DKO B cells therefore exhibited an increased ability to generate ABCs in vitro in response to IL-21 stimulation.
To further evaluate the importance of IL-21 in the aberrant expansion of ABCs observed in DKO mice, DKO female mice that also lack IL-21 (IL-21ko DKO) were generated. Accumulation of CD11c+CD11b+ B cells was completely abrogated in these mice as compared to age-matched female DKO mice (FIG. 2C). DKO mice lacking IL-21 also failed to accumulate TFH cells, germinal center (GC) B cells, and plasma cells, and failed to produce anti-dsDNA autoantibodies (FIGS. 2E and 2F).
To determine whether, in addition to IL-21 production, direct T-B interactions were also necessary for the expansion of DKO ABCs in vivo, their presence in DKO mice that lack SAP (SLAM-associated protein) was examined. SAP is required to mediate sustained interactions between T and B cells (Fang et al. 2012). As shown in FIG. 2D, the concomitant absence of SAP in DKO mice (SAPko DKO) resulted in diminished accumulation of pathogenic ABCs. This was again accompanied by profound reductions in TFH cells, GC B cells, plasma cells and markedly lower anti-dsDNA autoantibody titers (FIGS. 2E and 2F). Thus, the aberrant expansion of pathogenic ABCs observed in DKO mice is dependent on IL-21 and cognate T-B cell interactions, signals that also control the development of lupus.
Example 4—The SWEF Proteins Regulate the Proliferation and Proinflammatory Capacity of ABCs
B cells were sorted based on the levels of expression of CD11c and CD11b and RNA-Seq employed as described in Example 1 to compare the transcriptome of CD11c+CD11b+(ABC) DKO B cells to that of CD11c−CD11b− (FoB) B cells obtained from either wild type or DKO mice. A total of 3049 genes were differentially expressed amongst the three different subsets (FIG. 3A). A set of genes (cluster 2, DKO-specific up) was upregulated or downregulated (cluster 1, DKO-specific down) in DKO B cells irrespective of the expression of CD11c and CD11b suggesting that the lack of SWEF proteins altered the expression of these genes in B cells independently of their differentiation state (FIG. 3A).
To gain insights into the critical processes controlled by the SWEF proteins in B cells, the transcriptional profile of FoBs from wild type mice was first compared to that of FoBs from DKO mice. Based on gene set enrichment analysis (GSEA) (FIG. 3B) lack of the SWEF proteins affected the control of B cell proliferation, potentially, via E2F family of transcription factors and regulators of the G2/M checkpoint such as Wee1 and Chek1.
To extend and confirm these observations, the proliferative capabilities of B cells in wild type and DKO mice were assessed by staining for Ki67. As compared to wild type B cells, CD11c− Tbet− DKO B cells contained a small population of highly proliferative cells (FIG. 3C). Strikingly, CD11c+Tbet+ DKO B cells proliferated even more robustly than CD11c−Tbet− DKO B cells (FIG. 3C).
No differences in apoptotic rates were instead observed between wild type and DKO B cells (FIG. 3D). In vitro experiments wherein CD23+ B cells were purified from wild type and DKO female mice (6-9 weeks old), labeled with CFSE and cultured with αIgM (5 μg/ml), αCD40 (5 μg/ml), and IL-21 (50 ng/ml) for 3 days, demonstrated that DKO ABCs proliferated to a greater extent than WT ABCs upon stimulation with IL-21 (FIG. 3E). In line with the in vivo findings, WT and DKO B cells exhibited similar survival rates in vitro as assessed by either PI staining or Caspase 3 cleavage at different times after stimulation with αIgM (5 μg/ml), αCD40 (5 μg/ml), IL-21c (50 ng/ml) or imiquimod (1 μg/ml) for 3 or 5 days (FIG. 3F). Thus, SWEF proteins regulate the proliferation of B cells, and play a particularly important role in restraining the capacity of pathogenic ABCs to proliferate in response to IL-21.
In addition to clusters 1 and 2 that were differentially expressed in all DKO B cells, the transcriptomic analysis also uncovered additional clusters of genes (clusters 3 and 5), which were specifically upregulated in CD11c+CD11b+ DKO B cells as compared to CD11c−CD11b− B cells obtained from either wild type or DKO mice (FIGS. 3A and 3G). As expected, DKO ABCs expressed higher levels of T-bet (Tbx21), CD11c (Itgax) and CD11b (Itgam), which were used for ABC isolation, as compared to FoBs (FIG. 3G).
GSEA was used to gain insights into the pathways that were uniquely upregulated in DKO ABC cells. Notably the top enriched sets (FDR, q<0.05) included several gene sets enriched in transcripts controlling chemotaxis, integrin binding, cell adhesion, and inflammation (FIGS. 3H and 3J). Prominent amongst the upregulated genes were a number of chemokines (e.g. Cxcl9, Cxcl10, Ccl4, Ccl5, Ccl8), cytokine receptors (Il1r2, Il2rb2, Il18r1, and Il18rap) and cytokines including Csf1 (FIGS. 3G and 3K), some of which were further validated by qPCR in FoB and ABC populations sorted from WT and DKO female mice (FIGS. 3I and 3J). Thus, as compared to FoBs, the ABCs from DKO female mice were endowed with proinflammatory capabilities and unique migratory and adhesive attributes. In addition to promoting the proliferation of pathogenic ABC cells, the lack of SWEF proteins altered their migratory/adhesive attributes and endowed them with enhanced proinflammatory functions.
Example 5—the Chromatin Landscape of DKO ABC Cells is Enriched with IRF and AP-1/BATF Motifs as Compared to FoB Celle
The distinctive transcriptional program of DKO ABC cells suggested that these cells might exhibit a unique chromatin landscape. To directly address this possibility, ATAC-seq (assay for transposase-accessible chromatin using sequencing), which enables the identification of accessible regions of chromatin even in small number of cells as described in Example 1 and Buenrostro et al. 2015 was employed.
ATAC-seq signals from sorted CD11c+CD11b+ DKO cells were compared to those from sorted CD11c−CD11b− cells from the same mice. The focus of the analysis was on regions with higher signals and 3,666 ABC-specific peaks that satisfied those criteria were identified (FIG. 4A). The ABC specific peaks were primarily found in intergenic (45%) and intronic (50%) regions and only rarely in promoters. Loci which were differentially accessible in ABCs as compared to CD11c−CD11b− cells included a number of proinflammatory cytokines like IFNγ and IL-6 and other ABC-specific targets like the CXCL10 cluster of genes (FIG. 4B). Consistent with the results of the transcriptomic analysis, ABC-specific peaks were positively associated with transcriptionally active genes in ABC DKO cells as compared to FoB DKO cells and pathway analysis showed that many of the differentially expressed ATAC-seq associated genes were involved in locomotion and cellular adhesion (Table 5 and FIG. 4D).
To gain insights into the molecular mechanisms responsible for the distinctive chromatin profile of DKO ABCs, the transcription factor motifs enriched in ABC specific peaks were determined (Tables 3 and 4). ABC-specific accessible loci displayed enrichment in AP-1/BATF, IRF, and T-bet binding motifs (Table 3). Interestingly, the ABC specific peaks exhibited substantial positional bias in the distribution of IRF and T-bet binding motifs, which coincided with the peak summit (FIG. 4C). This pattern contrasted with that observed in FoB-specific peaks, which exhibited enrichment in motifs for a distinct set of transcription factors including POU2F2 (Tables 3 and 4, FIG. 4C). Thus, DKO ABCs, ABCs that aberrantly expand in this autoimmune setting, i.e., pathogenic ABCs, exhibited a unique chromatin landscape, which, in addition to T-bet motifs, is enriched in IRF and AP-1/BATF motifs and correlates with a distinctive transcriptional profile.
TABLE 3
Best Match for Motifs in DKO ABC-Specific Peaks
Best Match P-value
AP1-BATF  1e−116
IRF  1e−107
T-bet  1e−102
PU.1 1e−73
RUNX 1e−72
MyoG 1e−45
NF-κB 1e−28
TABLE 4
Best Match for Motifs for DKO FoB-Specific Peaks
Best Match P-value
POU2F2 1e−81
E2A-PU.1 1e−41
REF 1e−14
Foxj3 1e−14
Hand1 1e−12
TABLE 5
Functionally Enriched Gene Ontology (GO) Categories of Genes
associated with ABC-Specific Peaks of ATAC-seq (n = 487).
Description P-value FDR q-value
GO_IMMUNE_SYSTEM PROCESS 4.17E−27 1.85E−23
GO_POSTIVE_REGULATION 1.02E−22 2.25E−19
OF_RESPONSE_TO_STIMULUS
GO_LOCOMOTION 3.04E−21 4.28E−18
GO_CELLULAR_RESPONSE 3.86E−21 4.28E−18
TO_ORG ANIC_SUBSTANCE
GO_BIOLOGICAL_ADHESION 1.40E−20 1.25E−17
Example 6—Distinctive Transcriptional and Epigenomic Programs of Autoimmune Prone DKO ABCs as Compared to Non-Autoimmune ABCs
To gain insights into the programs that are specifically dysregulated in pathogenic, autoimmune-prone DKO ABCs as compared to the ABCs that slowly accumulate in non-autoimmune WT female mice, CD11c+CD11b+ B cells from older WT female mice were sorted and compared their transcriptional profiles to those of CD11c+CD11b+ B cells derived from DKO female mice.
WT and DKO ABCs expressed similar levels of T-bet (Tbx21) (FIG. 5A). A total of 711 genes were differentially expressed between the two populations, of which 111 genes were upregulated in DKO ABCs as compared to WT ABCs and 600 genes were downregulated (Tables 1 and 2 and FIG. 5B). Notably, ABCs from DKO mice expressed higher levels of immunoglobulin gene transcripts than ABCs derived from WT mice but downregulated a subset of myeloid-related transcripts (FIGS. 5B and 5C). The increased levels of immunoglobulin gene transcripts displayed by the DKO ABCs were not associated with changes in the expression of key regulators of plasma cell differentiation like IRF4, IRF8, Bcl6 or Blimp1 (FIG. 5A) suggesting that the differences between WT and DKO ABCs were not due to the presence of contaminating plasmablasts within the DKO ABC population.
DKO ABCs, however, exhibited selective changes in the expression of other transcription factors including upregulation of Jun and NFIL-3 and downregulation of c-maf MafB, and PPAR-γ while levels of PU.1 were similar to those of WT ABCs (FIG. 5A). Differential expression of selected targets, which included key regulators of apoptotic cell engulfment like Mertk and Axl, was further confirmed by qPCR (FIG. 5D). Thus, the ABCs that accumulate in autoimmune-prone DKO female mice were endowed with a higher immunoglobulin producing capacity than WT ABCs but downregulate some of the myeloid related features that can be associated with this B cell subset. Also as shown by qPCR, MAFB, NDNF and Thsd7a were differentially expressed between wild type ABCs and DKO ABCs (FIG. 5E).
To investigate the differences in the chromatin landscape of WT and DKO ABCs that might accompany these distinct transcriptional profiles, ATAC-seq signals from sorted WT ABCs were compared to those of DKO ABCs. 27,483 WT ABC-specific peaks and 1,583 DKO-ABC specific peaks (FIG. 5F) were identified. Most of the WT or DKO ABC-specific peaks were primarily found in intergenic and intronic regions and only rarely in promoters, with 44% being intergenic and 46% being intronic regions in the WT-ABC specific peaks (n=27,483) and 51% being intergenic and 43% being intronic regions of DK-ABC specific peaks (n=1,583). DKO ABC-specific accessible loci again displayed enrichment in IRF, AP-1/BATF, and T-bet binding motifs (Table 6). In contrast, the pattern associated with WT ABC-specific peaks was associated with enrichment in PU.1, MAF, and C/EBP binding motifs (Table 7). These results were consistent with the downregulation of MAF and MAF-B observed in DKO ABCs and were reflected in differences in the accessibility of the MAF and MAF-B loci in the ATAC-seq (results not shown). In line with the results of the transcriptomic analysis and supporting the idea that the differential chromatin accessibility between WT and DKO ABCs is functionally important, gene ontology (GO) categories of genes associated with WT-specific or DKO-specific peaks of ATAC-seq indicated that WT ABC-specific peaks were positively associated with transcriptional programs regulating phagocytosis and other myeloid-related functions while DKO ABC-specific peaks were enriched in processes linked to B cell differentiation, activation and Ig regulation (FIG. 5G).
Thus, in comparison to the ABCs that slowly accumulate in WT mice with age, i.e., non-pathogenic ABCs, the chromatin landscape of pathogenic autoimmune-prone ABCs was characterized by dual abnormalities whereby enrichment in IRF and AP-1/BATF motifs was coupled with depletion of PU.1- and MAF-bound regulatory regions.
TABLE 6
Best Matches to Motifs in DKO ABC-Specific ATAC-seq Peaks
Best Match P-value
IRF 1e−81
AP1-BATF 1e−29
STAT5 1e−28
Hbp1 1e−27
SREBF1 1e−25
Tbet 1e−24
TABLE 7
Best Matches to Motifs in WT ABC-Specific ATAC-seq Peaks
Best Match P-value
PU.1  1e−1151
MafA 1e−165
CEBP 1e−109
RORA 1e−107
PRDM1 1e−84 
PU.l-RF 1e−68 
Example 7—Expansion of ABCs Depends Upon IRF5
While ABC generation is known to be dependent on Tbet (Rubtsova et al. 2015; Naradikian et al. 2016), the role of the IRFs in the formation and function of ABCs is unknown. Given that the SWEF proteins can regulate the activity of IRF4 (Biswas et al. 2012; Manni et al. 2015), an analysis of whether the aberrant expansion of ABCs in DKO mice might depend on this transcription factor was performed, using CD11c-Cre IRF4fl/flDKO mice (Manni et al. 2015.) However, it was determined that deleting IRF4 in CD11c+ expressing cells did not affect the accumulation of ABCs (results not shown) or any of the autoimmune parameters that characterize the development of lupus in DKO mice (Manni et al. 2015). Thus, the dysregulated expansion of ABCs in DKO mice does not rely on IRF4.
Given the high degree of homology amongst IRF DNA binding domains the possibility that another IRF may regulate the aberrant generation of DKO ABCs was investigated. The focus was on IRF5 given its ability to regulate the production of IgG2a/c, proinflammatory mediators like IL-6 and the strong association with SLE (Cham et al. 2012; Lazzari and Jefferies 2014). To facilitate these studies, DKO mice completely lacking IRF5 in B cells (CD21Cre-IRF5fl/−DKO) were generated and then assessed the ability of B cells from these mice to generate ABCs in vitro. Expression of IRF5 was similar in WT and DKO B cells and was absent in B cells from CD21Cre-IRF5fl/− DKO mice (results not shown).
Lack of IRF5 markedly diminished the ability of DKO B cells to generate ABCs in cultures supplemented with IL-21 (FIGS. 6A and 6B). The increased ability of DKO B cells to produce IL-6 and CXCL10 upon IL-21 stimulation was also decreased by the absence of IRF5 (FIGS. 6C and 6D). Deleting IRF5 in DKO B cells also profoundly decreased the IL-21-mediated production of IgG2c, but not that of IgG (FIG. 6E). Expression of Jun was also dysregulated in DKO B cells in an IL-21- and IRF-5-dependent manner (FIG. 6F). Thus, the IL-21 driven abnormalities in ABC generation and function exhibited by DKO B cells are dependent on the presence of IRF5.
Given that the ATAC-seq analysis had revealed an enrichment of IRF binding sites in ABC specific peaks located at the 116 TSS, the Cxcl10 cluster, the IgG2c region, and Jun, ChIP-assays were performed to assess the binding of IRF5 to these regulatory regions. As compared to wild type B cells, DKO B cells exhibited enhanced binding of IRF5 to these sites upon IL-21 stimulation despite exhibiting similar levels of Stat3 phosphorylation and IRF5 nuclear translocation (FIGS. 6G and 6H). Minimal IRF5 binding was observed in IRF5-deleted DKO B cells or when cells were stimulated in the absence of IL-21 supporting the specificity of the findings (FIG. 6G).
To evaluate whether ABC-specific peaks bound by IRF5 could also be targeted by T-bet, ChIP-assays with a T-bet antibody were performed (FIG. 6I). DKO B cells exhibited increased binding of T-bet to the ABC-specific region at the CXCL10 cluster, the IgG2c peak, and Jun but not to the IL-6 TSS or the negative control, a site in Zeb2 gene previously shown not to bind T-bet (Dominguez et al. 2015). Notably, IRF5 deletion in DKO B cells resulted in decreased binding of T-bet to the CXCL10 cluster, the IgG2c peak, and Jun. Further corroboration that IL-21 stimulation of DKO B cells leads to an aberrant ability of IRF5 and T-bet to target the CXCL10 cluster was obtained by performing oligonucleotide precipitation assays (ONPs). As observed with the ChIP assays, the presence of IRF5 was necessary for the ability of T-bet to bind to the CXCL10 cluster while no binding of T-bet to the IL-6 TSS could be detected (FIG. 6J). Co-transfection of T-bet with IRF5 coupled with a mutational analysis further confirmed that optimal recruitment of T-bet to the CXCL10 cluster requires DNA binding by IRF5 (FIG. 6K) Taken together these findings support a model whereby, in the absence of SWEF proteins, IL-21 stimulation leads to an increased ability of IRF5 to target ABC-specific peaks. Targeting of these regions by IRF5 subsequently enables strong recruitment of T-bet to a subset of these sites.
To delineate the mechanisms by which the lack of SWEF proteins results in enhanced IRF5 activity, the possibility that they can directly interact with IRF5 and thus restrain its activity was investigated. As shown in FIG. 6L, coimmunoprecipitation experiments indeed revealed that endogenous IRF5 in B cells interacts with both DEF6 and SWAP-70. A mutational analysis furthermore revealed that the association of IRF5 with either DEF6 or SWAP-70 maps to the C-terminal portion of the SWEF proteins, which contains their IRF-interacting region, and requires the IAD (IRF Association Domain) of IRF5, a domain within IRFs known to mediate protein-protein interaction (results not shown). No interaction of either DEF6 or SWAP-70 with T-bet could instead be detected (FIG. 6M). Co-transfections of IRF5 with DEF6 or SWAP-70 followed by ONP assays demonstrated that the full-length SWEF proteins, but not mutants of these molecules which are unable to interact with IRF5, interfere with the ability of IRF5 to bind to the IL-6 TSS (FIG. 6N). Since DEF6 and SWAP-70 can heterodimerize (FIG. 6O), these results show that interaction of IRF5 with a SWEF heterodimer can directly regulate IRF5 activity and thus indirectly alter the recruitment of T-bet to selected target genes.
Example 8—Monoallelic Deletion of IRF5 Abolishes Accumulation of ABCs and Lupus Development in DKO Mice
To further evaluate the role of IRF5 in the generation of ABC cells the effects of manipulating IRF5 levels on the in vivo expansion of ABCs in DKO mice was examined. Remarkably mice with monoallelic expression of IRF5 (IRF5f-DKO) exhibited an almost complete loss of ABC cells, irrespective of the markers used to identify the population (FIGS. 7A-7D). Loss of ABCs was accompanied by marked decreases in splenomegaly, TFH cells, GC B cells and PC cells (FIGS. 7E-7G). Further deletion of IRF5 using CD21Cre or CD11cCre to target B cells or CD11c+ cells did not result in additional decreases in the ABC compartment (FIGS. 7A and 7B).
Monoallelic expression of IRF5 in DKO female mice also resulted in a profound decrease in autoantibody production as evidence by both anti-antibody (ANA) staining (FIG. 7H) and anti-dsDNA titers (FIG. 7I). Reduction in anti-dsDNA titers primarily reflected decreases in the production of pathogenic IgG2c anti-dsDNA Abs rather than IgG1 anti-dsDNA Abs (FIG. 7I). Production of other autoantibodies like anti-ssDNA, anti-Cardiolipin, and anti-nRNP Abs was also markedly affected by the loss of IRF5 (FIG. 7J). Consistent with these results, manipulating IRF5 expression also ameliorated several parameters of renal injury observed in DKO mice including the expansion of mesangial matrix, the presence of hyaline deposits, the decrease in capillary loops, and the deposition of immune complexes (FIGS. 7K and 7L). Thus, the aberrant expansion of pathogenic ABCs in DKO female mice observed in vivo was dependent on IRF5 and alterations in IRF5 levels exerted profound effects on the spontaneous development of lupus in DKO female mice.
Example 9—DKO B Cells Upregulates Blimp1, IRF4 and CD138
While ABCs classically express IgM, the ability of ABCs to produce anti-dsDNAIgG2c upon stimulation in vitro prompted the investigation as to whether the ABCs can undergo class switching and differentiate into plasmablasts/plasma cells (PB/PCs). Using the Blimp1-reporter DKO mice and other materials and methods described in Example 1, a population of CD11c+ B cells that expressed high levels of Blimp1, IRF4, and CD138 (FIG. 8) suggesting that ABCs further differentiate into CD11c+ PB/PCs.
Example 10—DKO ABCs Exhibit Sex-Specific Differences in Auto-Ab Production
One of the striking features of the lupus syndrome that develops in DKO mice is the finding that, as observed for human SLE, this disorder preferentially affects females (Biswas et al. 2010).
Cells were sorted from aging DKO female, DKO male and Yaa-DKO male mice using the materials and methods described in Example 1. qPCR was also performed as described in Example 1.
Interestingly ABCs also accumulated in DKO male mice albeit to a slightly lesser extent than DKO female mice (FIG. 9A). Studies demonstrated no differences in BCR repertoire and SHM between female and male DKO ABCs using next-gen sequencing (not shown). Unlike ABCs from DKO male mice, however, ABCs from DKO female mice readily secreted anti-dsDNA IgG2c antibodies upon TLR7 stimulation (FIG. 9B) suggesting that the pathogenic potential of DKO ABCs differs in female and male mice.
Yaa-DKO male mice had an increased expansion of ABCs as compared to male DKO mice and enables them to produce anti-dsDNA IgG2a/c upon stimulation (FIGS. 9A and 9C).
Additionally, expression of cell markers on the ABCs in both DKO female and Yaa-DKO male mice were similar and included CXCR3, CD28, CD9, FCRL5, CD36, CD30, CD30L, c-kit, CD15, CD244, and CD68 (FIG. 9D). Expression of Il13ra1 was also increased in ABCs from DKO female, DKO male, and Yaa-DKO mice (FIG. 9E).
Taken together these results suggest that sex-specific factors regulate the pathogenic potential of ABCs.
Example 11—Pathogenic ABCs Express Active Rho-Kinases (ROCK) 1 and 2
FoB cells from WT male and Yaa DKO male mice and ABCs from male Yaa DKO mice as well as CD11c+ plasmablasts and CD11c− plasmablasts (PBs) from Yaa DKO mice were sorted as described in Example 1 and subjected to a ROCK1 or ROCK2 in vitro kinase assay (Biswas et al. 2012).
Increased ROCK2 activity was observed in ABCs and CD11c− plasmablasts (FIG. 10A). Consistent with these results, phosphorylation of IRF4, a ROCK2 target, was observed in CD11c− but not in CD11c+ plasmablasts (FIG. 10B). However, in contrast to the findings for ROCK2, the same populations demonstrated that ROCK1 is activated at higher levels in ABCs and CD11c+ PBs but not in CD11c− PBs (FIG. 10C).
Example 12—The Transcriptional and Epigenetic Profiles of CD11c+ PCs
While ABCs express both CD11c and CD11b, CD11c+ PCs downregulate CD11b expression (FIG. 8) suggesting that as DKO ABCs undergo terminal differentiation they acquire unique characteristics. Using the material and methods described in Example 1, a genome-wide approach is used to test the hypothesis that the transcriptional and epigenetic landscape of CD11c+ PCs is distinct from those of ABCs and of “classical” (CD11c−) PCs.
With the aid of the Blimp-YFP reporter, ABCs (CD11c+CD11b+CD19hiCD23-Blimp1−CD138−), CD11c+ PCs (CD11c+CD11b−CD19loBlimp1hiCD138hi), and “classical” PCs (CD11c−CD11b−B2201loCD19loBlimp1hiCD138hi) from aging DKO female mice are sorted. As control “classical” PCs are obtained by immunizing wt Blimp1-YFP reporter mice with NP-CGG as described (Jones et al. 2016).
The different sorted populations are analyzed using will be subjected to RNA-seq and ATAC-seq as described in Example 1. These data are compared with previously performed genome-wide analyses (Shi et al. 2015). A selected number of targets are validated by QPCR, Western blotting, and/or FACS.
Given that CD11c+ PCs express both IRF4 and IRF5 and that both IRF4 and IRF5 have been reported to regulate the expression of Blimp1 (Kwon et al. 2009), the hypothesis that IRF4 cooperates with IRF5 in regulating the differentiation/function of CD11c+ PCs is also tested using the materials and methods of Example 1.
The IRF4fl/fl DKO mice, described in Example 1 are crossed to T-bet-Zsgreen-T2ACreERT2 DKO mice. This strategy minimizes the known impact of IRF4 deletion on other cellular compartments like DCs (which would be affected by using the CD11cCre line) and “classical” B cell compartments (which would be affected by using CD23Cre mice). While DKO mice do exhibit an accumulation of TFH cells that produce IFNγ, as mentioned above, these cells do not express T-bet and thus should not be impacted by the removal of IRF4. All relevant control genotypes are also included.
Once these mice have been generated, IRF4 deletion is induced by tamoxifen administration (and verified by QPCR and or IC FACS) and the effects of removing IRF4 versus IRF5 (using the T-bet-Zsgreen-T2A-CreERT2IRF5fl/fl DKO mice) are evaluated by performing a series of experiments which will include: i) a baseline FACS and serum Ig analysis of 8-12 week old mice, ii) a series of studies to assess PC differentiation in vitro upon exposure to different combinations of ABC-promoting stimuli, and iii) an evaluation of the development of lupus-like disease in aged groups of female mice as described in the previous examples. If warranted, additional genetic manipulations will also be investigated (e.g., IRF4fl/+IRF5fl/+).
A series of mixed bone marrow chimeras are also performed, which will take advantage of the kMTDKO mice. Briefly lethally irradiated kMTDKO recipient mice will be reconstituted with mixtures of 80% kMTDKO BM+20% of CD11c−Cre+IRF4fl/flDKO BM so that only CD11-c expressing DKO B cells will lack IRF4. Once appropriately reconstituted, a full analysis of young and aged mice is performed as described in detail above.
These experiments show a unique transcriptional and epigenetic profile of the CD11c+ PC cells from DKO mice. They also show that both IRF4 and IRF5 regulate the differentiation of these cells from ABCs as well as their function. IRF4 and IRF5 co-regulate a common set of targets in addition to each of them controlling separate targets.
Example 13—Sex-Specific Mechanisms Controlling ABCs
A number of observations have implicated sex-specific pathways in the regulation of ABCs. As shown in Example 10, there is a striking sex-specific differences in the ability of ABCs to produce autoantibodies. Also, while ABCs accumulate in both DKO female and male mice, only ABCs from DKO female mice readily secreted anti-dsDNA IgG2c antibodies upon TLR7 stimulation (Example 10), suggesting that the ABCs from DKO females are functionally distinct from those obtained from DKO males. Dysregulation of TLR7 expression in DKO male mice, i.e., Yaa-DKO mice, rescued their ability to produce anti-dsDNA IgG2c (Example 10). Using the materials and methods described in Example 1, using both targeted and genome-wide approaches, the hypothesis that sex-specific pathways regulate not only the expansion but also the function and differentiation of ABCs is tested.
To gain new insights into additional sex-specific pathways that might control the function/differentiation of ABCs, RNA-seq and ATAC-seq is performed on ABC cells sorted from DKO male and Yaa-DKO male mice (and sex-matched control mice). These profiles are compared to those obtained in ABCs from DKO female mice (Examples 4-6). A motif analysis is performed to determine whether functionally relevant differences map to motifs of specific transcription factors.
These studies are complemented by experiments in primary B cells purified from young female DKO, male DKO, and Yaa-DKO male mice (and appropriately sex-matched wt controls), which are cultured in vitro±ABC-promoting stimuli (which include IL-21, IFNγ, and TLR7 added in various combinations to αIgM+αCD40) followed by evaluations of ABC formation/function/differentiation by FACS and QPCR/Western of selected targets as well as additional assays like ChIP-QPCR and ONPs as described in Example 1.
The transcriptome of ABCs from DKO male and female mice show some similarities (since aberrant expansion of these cells is observed in both female and male DKOs). The ABCS from DKO males and DKO females have crucial transcriptional differences that is revealed by a GSEA analysis and these distinctions reflect the differential expression of a selected group of pathways, and that the ATAC-seq demonstrates that these transcriptional differences are accompanied by differences in the chromatin landscape surrounding these genes.
REFERENCES
  • Biswas et al. IRF4 and its regulators: evolving insights into the pathogenesis of inflammatory arthritis? Immunological Reviews 2010, 233(1):79-96.
  • Biswas et al. Dual regulation of IRF4 function in T and B cells is required for the coordination of T-B cell interactions and the prevention of autoimmunity. Journal of Experimental Medicine 2012, 209:581-596.
  • Buenrostro et al. ATAC-seq: A Method for Assaying Chromatin Accessibility Genome-Wide. Curr. Protoc. Mol. Biol. 2015, 109:21 29 21-29.
  • Buenrostro et al. Single-cell chromatin accessibility reveals principles of regulatory variation. Nature 2015a, 523:486-490.
  • Cham et al. Interferon regulatory factor 5 in the pathogenesis of systemic lupus erythematosus. Clinical and Developmental Immunology 2012, 780436.
  • Chandrasekaran et al. Regulation of Effector Treg Cells in Murine Lupus. Arthritis and Rheumatology 2016, 68(6):1454-1466.
  • Cohen-Solal and Diamond Lessons from an anti-DNA autoantibody. Molecular Immunology 2011, 48(11):1328-1331.
  • Deane et al. Control of toll-like receptor 7 expression is essential to restrict autoimmunity and dendritic cell proliferation. Immunity 2007 November, 7(5):801-10.
  • Eames et al. Interferon regulatory factor 5 in human autoimmunity and murine models of autoimmune disease. Translational research: Journal of Laboratory and Clinical Medicine 2016, 167(1):167-182.
  • Eisenberg Mechanisms of autoimmunity. Immunologic research 2003, 27(2-3):203-218.
  • Fan et al. Keap1 facilitates p62-mediated ubiquitin aggregate clearance via autophagy. Autophagy 2010, 6(5):614-621.
  • Fang et al. Unique contribution of IRF-5-Ikaros axis to the B-cell IgG2a response. Genes Immun. 2012, 13:421-430.
  • Gupta et al. Molecular cloning of IBP, a SWAP-70 homologous GEF, which is highly expressed in the immune system. Human Immunology 2003, 64:389-401.
  • Hao et al. A B-cell subset uniquely responsive to innate stimuli accumulates in aged mice. Blood 2011, 118:1294-1304.
  • Jones et al. mTOR has distinct functions in generating versus sustaining humoral immunity. J. Clin. Invest. 2016, 126:4250-4261.
  • Kwon et al. Analysis of interleukin-21-induced Prdm1 gene regulation reveals functional cooperation of STAT3 and IRF4 transcription factors. Immunity 2009, 31: 941-952.
  • Lazzari and Jefferies IRF5-mediated signaling and implications for SLE. Clin. Immunol. 2014, 153:343-352.
  • Manni et al. IRF4-Dependent and IRF4-Independent Pathways Contribute to DC Dysfunction in Lupus. PloS one 2015, 10(11):e0141927.
  • Maynard et al.: Regulatory T cells expressing interleukin 10 develop from Foxp3+ and Foxp3-precursor cells in the absence of interleukin 10. Nature Immunology 2007, 8(9):931-941.
  • Minnich et al. Multifunctional role of the transcription factor Blimp-1 in coordinating plasma cell differentiation. Nature Immunology 2016, 17:331-343.
  • Naradikian et al. Cutting Edge: IL-4, IL-21, and IFN-gamma Interact To Govern T-bet and CD11c Expression in TLR-Activated B Cells. Journal of Immunology 2016a, 197(4):1023-1028.
  • Naradikian et al. Age-associated B cells: key mediators of both protective and autoreactive humoral responses. Immunological Reviews 2016, 269(1): 118-129.
  • Parish et al: Chronic viral infection promotes sustained Th1-derived immunoregulatory IL-10 via BLIMP-1. J. Clin. Invest. 2014, 124(8):3455-3468.
  • Ripich et al. SWEF Proteins Distinctly Control Maintenance and Differentiation of Hematopoietic Stem Cells. PloS one 2016, 11(8):e0161060.
  • Rubtsova et al. Age-Associated B Cells: A T-bet-Dependent Effector with Roles in Protective and Pathogenic Immunity. Journal of Immunology 2015, 195(5):1933-1937.
  • Rubtsova et al. B cells expressing the transcription factor T-bet drive lupus-like autoimmunity. J Clin. Invest. 2017, 127:1392-1404.
  • Rogatsky et al. Epigenetics and the IRFs: a complex interplay in the control of immunity and autoimmunity. Autoimmunity 2014, 47:242-255.
  • Sarra et al. Interleukin-21 in chronic inflammatory diseases. Biofactors 2013, 39:368-373.
  • Shi et al. Transcriptional profiling of mouse B cell terminal differentiation defines a signature for antibody-secreting plasma cells. Nature Immunology 2015, 16:663-673.
  • Sun et al. High-density genotyping of immune-related loci identifies new SLE risk variants in individuals with Asian ancestry. Nature Genetics 2016, 48(3):323-330.
  • Tanaka et al. SWAP-70-like adapter of T cells, an adapter protein that regulates early TCR-initiated signaling in Th2 lineage cells. Immunity 2003, 18:403-414.

Claims (2)

The invention claimed is:
1. A method of abolishing or decreasing pathogenic age-associated B cells in a subject in need thereof, comprising the administration of a therapeutically effective amount of a nucleic acid which encodes DEF6 protein and a nucleic acid which encodes SWAP-70 protein, wherein the nucleic acid which encodes DEF6 protein and the nucleic acid which encodes SWAP-70 protein abolish or decrease the pathogenic age-associated B cells, and wherein the pathogenic age-associated B cells are CD11c+ and secrete anti-dsDNA IgG.
2. The method of claim 1, wherein the nucleic acids are delivered directly to the pathogenic age-associated B cells in the subject.
US16/523,055 2016-12-06 2019-07-26 Inhibition of expansion and function of pathogenic age-associated B cells and use for the prevention and treatment of autoimmune disease Active US11147829B2 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
US16/523,055 US11147829B2 (en) 2016-12-06 2019-07-26 Inhibition of expansion and function of pathogenic age-associated B cells and use for the prevention and treatment of autoimmune disease
US17/459,213 US11857563B2 (en) 2016-12-06 2021-08-27 Inhibition of expansion and function of pathogenic age-associated B cells and use for the prevention and treatment of autoimmune disease
US18/511,908 US20240131050A1 (en) 2016-12-06 2023-11-16 Inhibition of expansion and function of pathogenic age-associated b cells and use for the prevention and treatment of autoimmune disease

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
US201662430732P 2016-12-06 2016-12-06
US201762487645P 2017-04-20 2017-04-20
US201762512803P 2017-05-31 2017-05-31
US15/833,398 US20180153922A1 (en) 2016-12-06 2017-12-06 Inhibition of expansion and function of pathogenic age-associated b cells and use for the prevention and treatment of autoimmune disease
US16/523,055 US11147829B2 (en) 2016-12-06 2019-07-26 Inhibition of expansion and function of pathogenic age-associated B cells and use for the prevention and treatment of autoimmune disease

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US15/833,398 Continuation US20180153922A1 (en) 2016-12-06 2017-12-06 Inhibition of expansion and function of pathogenic age-associated b cells and use for the prevention and treatment of autoimmune disease

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US17/459,213 Continuation US11857563B2 (en) 2016-12-06 2021-08-27 Inhibition of expansion and function of pathogenic age-associated B cells and use for the prevention and treatment of autoimmune disease

Publications (2)

Publication Number Publication Date
US20200188422A1 US20200188422A1 (en) 2020-06-18
US11147829B2 true US11147829B2 (en) 2021-10-19

Family

ID=62240653

Family Applications (4)

Application Number Title Priority Date Filing Date
US15/833,398 Abandoned US20180153922A1 (en) 2016-12-06 2017-12-06 Inhibition of expansion and function of pathogenic age-associated b cells and use for the prevention and treatment of autoimmune disease
US16/523,055 Active US11147829B2 (en) 2016-12-06 2019-07-26 Inhibition of expansion and function of pathogenic age-associated B cells and use for the prevention and treatment of autoimmune disease
US17/459,213 Active 2038-01-12 US11857563B2 (en) 2016-12-06 2021-08-27 Inhibition of expansion and function of pathogenic age-associated B cells and use for the prevention and treatment of autoimmune disease
US18/511,908 Abandoned US20240131050A1 (en) 2016-12-06 2023-11-16 Inhibition of expansion and function of pathogenic age-associated b cells and use for the prevention and treatment of autoimmune disease

Family Applications Before (1)

Application Number Title Priority Date Filing Date
US15/833,398 Abandoned US20180153922A1 (en) 2016-12-06 2017-12-06 Inhibition of expansion and function of pathogenic age-associated b cells and use for the prevention and treatment of autoimmune disease

Family Applications After (2)

Application Number Title Priority Date Filing Date
US17/459,213 Active 2038-01-12 US11857563B2 (en) 2016-12-06 2021-08-27 Inhibition of expansion and function of pathogenic age-associated B cells and use for the prevention and treatment of autoimmune disease
US18/511,908 Abandoned US20240131050A1 (en) 2016-12-06 2023-11-16 Inhibition of expansion and function of pathogenic age-associated b cells and use for the prevention and treatment of autoimmune disease

Country Status (1)

Country Link
US (4) US20180153922A1 (en)

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110910950A (en) * 2019-11-18 2020-03-24 广州竞远生物科技有限公司 Flow method for combined analysis of single-cell scRNA-seq and scATAC-seq
WO2022003595A1 (en) * 2020-07-01 2022-01-06 Janssen Biotech, Inc. Methods of safe administration of an irf5 antisense oligonucleotide
CN114272378B (en) * 2020-09-27 2023-06-23 四川大学华西医院 Use of a reagent for loss of CTTNBP2NL function in the preparation of medicines for treating diseases
CN112285363A (en) * 2020-10-16 2021-01-29 中国科学院心理研究所 Diagnosis of autoimmune neurological disorders

Citations (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4479957A (en) 1973-04-02 1984-10-30 Eli Lilly And Company Use of vindesine in treating acute lymphatic leukemia and _other susceptible neoplasms
US20030166018A1 (en) * 2002-03-01 2003-09-04 Matthias Wabl Methods for identifying agents that modulate mast cell degranulation
US20140037645A1 (en) 2008-11-07 2014-02-06 National Jewish Health Diagonsis and treatment of autoimmune diseases by targeting autoimmune-related b cells ("abcs")
US8785433B2 (en) 2007-05-18 2014-07-22 Glaxosmithkline Llc Quinoline derivatives as PI3 kinase inhibitors
WO2014122245A1 (en) 2013-02-11 2014-08-14 Technische Universität Dresden Method for inhibiting the swap-70 protein
US9249145B2 (en) 2009-09-01 2016-02-02 Incyte Holdings Corporation Heterocyclic derivatives of pyrazol-4-yl-pyrrolo[2,3-d]pyrimidines as janus kinase inhibitors
US9409886B2 (en) 2007-07-05 2016-08-09 Array Biopharma Inc. Pyrimidyl cyclopentanes as AKT protein kinase inhibitors
US9464088B2 (en) 2010-03-10 2016-10-11 Incyte Holdings Corporation Piperidin-4-yl azetidine derivatives as JAK1 inhibitors
US9637492B2 (en) 2008-03-14 2017-05-02 Intellikine Llc Benzothiazole kinase inhibitors and methods of use
US9682981B2 (en) 2010-04-21 2017-06-20 Plexxikon Inc. Compounds and methods for kinase modulation, and indications therefor
US9802937B2 (en) 2011-04-21 2017-10-31 Origenis Gmbh Substituted pyrazolo{4,3-D}pyrimidines as kinase inhibitors
US10023571B2 (en) 2015-09-02 2018-07-17 Nimbus Lakshimi, Inc. TYK2 inhibitors and uses thereof

Patent Citations (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4479957A (en) 1973-04-02 1984-10-30 Eli Lilly And Company Use of vindesine in treating acute lymphatic leukemia and _other susceptible neoplasms
US20030166018A1 (en) * 2002-03-01 2003-09-04 Matthias Wabl Methods for identifying agents that modulate mast cell degranulation
US8785433B2 (en) 2007-05-18 2014-07-22 Glaxosmithkline Llc Quinoline derivatives as PI3 kinase inhibitors
US9409886B2 (en) 2007-07-05 2016-08-09 Array Biopharma Inc. Pyrimidyl cyclopentanes as AKT protein kinase inhibitors
US9637492B2 (en) 2008-03-14 2017-05-02 Intellikine Llc Benzothiazole kinase inhibitors and methods of use
US20140037645A1 (en) 2008-11-07 2014-02-06 National Jewish Health Diagonsis and treatment of autoimmune diseases by targeting autoimmune-related b cells ("abcs")
US9249145B2 (en) 2009-09-01 2016-02-02 Incyte Holdings Corporation Heterocyclic derivatives of pyrazol-4-yl-pyrrolo[2,3-d]pyrimidines as janus kinase inhibitors
US9464088B2 (en) 2010-03-10 2016-10-11 Incyte Holdings Corporation Piperidin-4-yl azetidine derivatives as JAK1 inhibitors
US9682981B2 (en) 2010-04-21 2017-06-20 Plexxikon Inc. Compounds and methods for kinase modulation, and indications therefor
US9802937B2 (en) 2011-04-21 2017-10-31 Origenis Gmbh Substituted pyrazolo{4,3-D}pyrimidines as kinase inhibitors
US20160003846A1 (en) 2013-02-11 2016-01-07 Thorne Limited Method for inhibiting the swap-70 protein
WO2014122245A1 (en) 2013-02-11 2014-08-14 Technische Universität Dresden Method for inhibiting the swap-70 protein
US10023571B2 (en) 2015-09-02 2018-07-17 Nimbus Lakshimi, Inc. TYK2 inhibitors and uses thereof

Non-Patent Citations (33)

* Cited by examiner, † Cited by third party
Title
Biswas et al., "IRF4 and its regulators: evolving insights into the pathogenesis of inflammatory arthritis?" Immunological Reviews Jan. 2010, 233(1):79-96.
Biswas et al.,"Dual regulation of IRF4 function in T and B cells is required for the coordination of T-B cell interactions and the prevention of autoimmunity". Journal of Experimental Medicine Mar. 12, 2012, 209:581-596.
Buenrostro et al., "ATAC-seq: A Method for Assaying Chromatin Accessibility Genome-Wide". Curr. Protoc. Mol. Biol. Jan. 5, 2015, 109:21 29 21-29.
Buenrostro et al., "Single-cell chromatin accessibility reveals principles of regulatory variation". Nature Jul. 23, 2015, 523:486-490.
Cham et al., "Interferon regulatory factor 5 in the pathogenesis of systemic lupus erythematosus". Clinical and Developmental Immunology Sep. 12, 2012, 780436.
Chandrasekaran et al., "Regulation of Effector Treg Cells in Murine Lupus". Arthritis and Rheumatology Jun. 2016, 68(6):1454-1466.
Cohen-Solal and Diamond, "Lessons from an anti-DNA autoantibody". Molecular Immunology Jun. 2011, 48(11):1328-1331.
Deane et al., "Control of toll-like receptor 7 expression is essential to restrict autoimmunity and dendritic cell proliferation". Immunity Nov. 2007, 7(5):801-10.
Eames et al., "Interferon regulatory factor 5 in human autoimmunity and murine models of autoimmune disease". Translational research: Journal of Laboratory and Clinical Medicine 2016, 167(1):167-182. Accepted for publication Jun. 30, 2015.
Eisenberg, "Mechanisms of autoimmunity". Immunologic research Jun. 2003, 27(2-3):203-218.
Fan et al., "Keap1 facilitates p62-mediated ubiquitin aggregate clearance via autophagy". Autophagy Jul. 2010, 6(5):614-621.
Fang et al., "Unique contribution of IRF-5-Ikaros axis to the B-cell IgG2a response". Genes Immun. Jul. 2012, 13:421-430.
Gupta et al., "Molecular cloning of IBP, a SWAP-70 homologous GEF, which is highly expressed in the immune system". Human Immunology Apr. 2003, 64:389-401.
Hao et al, "A B-cell subset uniquely responsive to innate stimuli accumulates in aged mice". Blood Apr. 23, 2011, 118:1294-1304.
Jones et al. mTOR has distinct functions in generating versus sustaining humoral immunity. J. Clin. Invest. Nov. 2016, 126:4250-4261.
Kwon et al., "Analysis of interleukin-21-induced Prdm1 gene regulation reveals functional cooperation of STAT3 and IRF4 transcription factors". Immunity Dec. 18, 2009, 31: 941-952.
Lazzari and Jefferies, "IRF5-mediated signaling and implications for SLE". Clin. Immunol. Jun. 10, 2014, 153:343-352.
Manni et al., "IRF4-Dependent and IRF4-Independent Pathways Contribute to DC Dysfunction in Lupus". PloS one Nov. 6, 2015, 10(11):e0141927.
Marian et al. (Arthritis Research & Therapy, 2012, 14(Suppl 4)S3). *
Maynard et al., "Regulatory T cells expressing interleukin 10 develop from Foxp3+ and Foxp3-precursor cells in the absence of interleukin 10". Nature Immunology Aug. 12, 2007, 8(9):931-941.
Minnich et al., "Multifunctional role of the transcription factor Blimp-1 in coordinating plasma cell differentiation". Nature Immunology Jan. 18, 2016, 17:331-343.
Naradikian et al, "Cutting Edge: IL-4, IL-21, and IFN-gamma Interact to Govern T-bet and CD11c Expression in TLR-Activated B Cells". Journal of Immunology Jul. 2016a, 197(4):1023-1028.
Naradikian et al., "Age-associated B cells: key mediators of both protective and autoreactive humoral responses". Immunological Reviews Jan. 2016, 269(1):118-129.
Oka et al. (J. Biol. Chem., 2007, 282, pp. 2011-2018). *
Parish et al., "Chronic viral infection promotes sustained Th1-derived immunoregulatory IL-10 via BLIMP-1". J. Clin. Invest. Aug. 2014, 124(8):3455-3468.
Ripich et al., "SWEF Proteins Distinctly Control Maintenance and Differentiation of Hematopoietic Stem Cells". PloS one Aug. 25, 2016, 11(8):e0161060.
Rogatsky et al., "Epigenetics and the IRFs: a complex interplay in the control of immunity and autoimmunity". Autoimmunity 2014, 47:242-255. Published Online Nov. 11, 2013.
Rubtsova et al., "Age-Associated B Cells: A T-bet-Dependent Effector with Roles in Protective and Pathogenic Immunity". Journal of Immunology Sep. 1, 2015, 195(5):1933-1937.
Rubtsova et al., "B cells expressing the transcription factor T-bet drive lupus-like autoimmunity". J Clin. Invest. Apr. 2017, 127:1392-1404.
Sarra et al., "Interleukin-21 in chronic inflammatory diseases". Biofactors Mar. 29, 2013,39:368-373.
Shi et al., "Transcriptional profiling of mouse B cell terminal differentiation defines a signature for antibody-secreting plasma cells". Nature Immunology Apr. 20, 2015, 16:663-673.
Sun et al., "High-density genotyping of immune-related loci identifies new SLE risk variants in individuals with Asian ancestry". Nature Genetics Feb. 24, 2016, 48(3):323-330.
Tanaka et al., "SWAP-70-like adapter of T cells, an adapter protein that regulates early TCR-initiated signaling in Th2 lineage cells". Immunity Mar. 2003, 18:403-414.

Also Published As

Publication number Publication date
US20240131050A1 (en) 2024-04-25
US20210393670A1 (en) 2021-12-23
US11857563B2 (en) 2024-01-02
US20180153922A1 (en) 2018-06-07
US20200188422A1 (en) 2020-06-18

Similar Documents

Publication Publication Date Title
Béziat et al. Humans with inherited T cell CD28 deficiency are susceptible to skin papillomaviruses but are otherwise healthy
US11857563B2 (en) Inhibition of expansion and function of pathogenic age-associated B cells and use for the prevention and treatment of autoimmune disease
US12043870B2 (en) Methods and compositions for detecting and modulating an immunotherapy resistance gene signature in cancer
KR102135601B1 (en) Methods for treating hair loss disorders
US20200157633A1 (en) Methods and compositions for detecting and modulating an immunotherapy resistance gene signature in cancer
US20130078244A1 (en) Methods for detecting and regulating alopecia areata and gene cohorts thereof
US20180223368A1 (en) Methods for diagnosing and treating follicular lymphoma
US20220017960A1 (en) Inflammation-enabling polypeptides and uses thereof
US20160046996A1 (en) Common and Rare Genetic Variations Associated with Common Variable Immunodeficiency (CVID) and Methods of Use Thereof for the Treatment and Diagnosis of the Same
US20230105008A1 (en) Methods and compositions for identifying castration resistant neuroendocrine prostate cancer
US20220025465A1 (en) Systems and methods for characterizing and treating cancer
EP2855516B1 (en) Inflammation-enabling polypeptides and uses thereof
US20240398831A1 (en) Compositions comprising small molecule regulators of tumor immunity and methods of using same
US20170072071A1 (en) Inflammation-enabling polypeptides and uses thereof
KR101822731B1 (en) Use of MMP-9 Facilitating a H3 N-terminal tail Proteolysis for proficient Osteoclastogenesis
US20150218242A1 (en) TIF1-Gamma for Treating and Diagnosing Inflammatory Diseases
US20160326585A1 (en) Inflammation-enabling polypeptides and uses thereof
US20240327520A1 (en) Methods and compositions for pkc-delta inhibition and cancer immunotherapy
Mescheriakova et al. Genetics of multiple sclerosis
JP2011004619A (en) Method for examining immunological disease, and method for screening medicine for preventing or treating immunological disease
JP2018164442A (en) Method for determining, preventing or treating cutaneous squamous cell carcinoma
JPWO2003072778A1 (en) Testing method for allergic diseases
WO2015010744A1 (en) Seronegative spondyloarthropathy diagnosis and treatment
JP2006333770A (en) Blood cell-specific genes in patients with angiitis
JP2007135581A (en) Blood cell specific genes in patients with autoimmune thrombocytopenic purpura (ITP)

Legal Events

Date Code Title Description
AS Assignment

Owner name: NEW YORK SOCIETY FOR THE RUPTURED AND CRIPPLED MAINTAINING THE HOSPITAL FOR SPECIAL SURGERY, NEW YORK

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:PERNIS, ALESSANDRA;MANNI, MICHELA;REEL/FRAME:049870/0650

Effective date: 20171208

FEPP Fee payment procedure

Free format text: ENTITY STATUS SET TO UNDISCOUNTED (ORIGINAL EVENT CODE: BIG.); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY

FEPP Fee payment procedure

Free format text: ENTITY STATUS SET TO SMALL (ORIGINAL EVENT CODE: SMAL); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY

STPP Information on status: patent application and granting procedure in general

Free format text: DOCKETED NEW CASE - READY FOR EXAMINATION

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION MAILED

STPP Information on status: patent application and granting procedure in general

Free format text: FINAL REJECTION MAILED

STPP Information on status: patent application and granting procedure in general

Free format text: RESPONSE AFTER FINAL ACTION FORWARDED TO EXAMINER

STPP Information on status: patent application and granting procedure in general

Free format text: NOTICE OF ALLOWANCE MAILED -- APPLICATION RECEIVED IN OFFICE OF PUBLICATIONS

STPP Information on status: patent application and granting procedure in general

Free format text: PUBLICATIONS -- ISSUE FEE PAYMENT VERIFIED

STCF Information on status: patent grant

Free format text: PATENTED CASE

AS Assignment

Owner name: NEW YORK SOCIETY FOR THE RELIEF OF THE RUPTURED AND CRIPPLED, MAINTAINING THE HOSPITAL FOR SPECIAL SURGERY, NEW YORK

Free format text: CORRECTIVE ASSIGNMENT TO CORRECT THE NAME OF THE ASSIGNEE PREVIOUSLY RECORDED ON REEL 049870 FRAME 0650. ASSIGNOR(S) HEREBY CONFIRMS THE ASSIGNEE NAME IS NEW YORK SOCIETY FOR THE RELIEF OF THE RUPTURED AND CRIPPLED, MAINTAINING THE HOSPITAL FOR SPECIAL SURGERY;ASSIGNORS:PERNIS, ALESSANDRA;MANNI, MICHELA;REEL/FRAME:064465/0251

Effective date: 20171208

MAFP Maintenance fee payment

Free format text: PAYMENT OF MAINTENANCE FEE, 4TH YR, SMALL ENTITY (ORIGINAL EVENT CODE: M2551); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY

Year of fee payment: 4