US10385349B2 - Sensor for NADP (H) and development of alcohol dehydrogenases - Google Patents

Sensor for NADP (H) and development of alcohol dehydrogenases Download PDF

Info

Publication number
US10385349B2
US10385349B2 US14/424,559 US201314424559A US10385349B2 US 10385349 B2 US10385349 B2 US 10385349B2 US 201314424559 A US201314424559 A US 201314424559A US 10385349 B2 US10385349 B2 US 10385349B2
Authority
US
United States
Prior art keywords
nadp
nucleic acid
cell
gene
soxs
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active, expires
Application number
US14/424,559
Other versions
US20150299715A1 (en
Inventor
Solvej Siedler
Georg Schendzielorz
Stephan Binder
Lothar Eggeling
Stephanie Bringer-Meyer
Michael Bott
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Forschungszentrum Juelich GmbH
Original Assignee
Forschungszentrum Juelich GmbH
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Forschungszentrum Juelich GmbH filed Critical Forschungszentrum Juelich GmbH
Assigned to FORSCHUNGSZENTRUM JULICH GMBH reassignment FORSCHUNGSZENTRUM JULICH GMBH ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: BOTT, MICHAEL, EGGELING, LOTHAR, BINDER, STEPHAN, BRINGER-MEYER, STEPHANIE, SCHENDZIELORZ, Georg, SIEDLER, Solvej
Publication of US20150299715A1 publication Critical patent/US20150299715A1/en
Application granted granted Critical
Publication of US10385349B2 publication Critical patent/US10385349B2/en
Active legal-status Critical Current
Adjusted expiration legal-status Critical

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70Vectors or expression systems specially adapted for E. coli
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/045Hydroxy compounds, e.g. alcohols; Salts thereof, e.g. alcoholates
    • A61K31/07Retinol compounds, e.g. vitamin A
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/26Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving oxidoreductase
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6897Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids involving reporter genes operably linked to promoters
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y101/00Oxidoreductases acting on the CH-OH group of donors (1.1)
    • GPHYSICS
    • G06COMPUTING OR CALCULATING; COUNTING
    • G06FELECTRIC DIGITAL DATA PROCESSING
    • G06F16/00Information retrieval; Database structures therefor; File system structures therefor
    • GPHYSICS
    • G06COMPUTING OR CALCULATING; COUNTING
    • G06NCOMPUTING ARRANGEMENTS BASED ON SPECIFIC COMPUTATIONAL MODELS
    • G06N3/00Computing arrangements based on biological models
    • G06N3/004Artificial life, i.e. computing arrangements simulating life
    • G06N3/006Artificial life, i.e. computing arrangements simulating life based on simulated virtual individual or collective life forms, e.g. social simulations or particle swarm optimisation [PSO]
    • GPHYSICS
    • G06COMPUTING OR CALCULATING; COUNTING
    • G06NCOMPUTING ARRANGEMENTS BASED ON SPECIFIC COMPUTATIONAL MODELS
    • G06N5/00Computing arrangements using knowledge-based models
    • G06N5/04Inference or reasoning models
    • G06N5/045Explanation of inference; Explainable artificial intelligence [XAI]; Interpretable artificial intelligence
    • GPHYSICS
    • G06COMPUTING OR CALCULATING; COUNTING
    • G06QINFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR ADMINISTRATIVE, COMMERCIAL, FINANCIAL, MANAGERIAL OR SUPERVISORY PURPOSES; SYSTEMS OR METHODS SPECIALLY ADAPTED FOR ADMINISTRATIVE, COMMERCIAL, FINANCIAL, MANAGERIAL OR SUPERVISORY PURPOSES, NOT OTHERWISE PROVIDED FOR
    • G06Q10/00Administration; Management
    • G06Q10/04Forecasting or optimisation specially adapted for administrative or management purposes, e.g. linear programming or "cutting stock problem"
    • GPHYSICS
    • G06COMPUTING OR CALCULATING; COUNTING
    • G06QINFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR ADMINISTRATIVE, COMMERCIAL, FINANCIAL, MANAGERIAL OR SUPERVISORY PURPOSES; SYSTEMS OR METHODS SPECIALLY ADAPTED FOR ADMINISTRATIVE, COMMERCIAL, FINANCIAL, MANAGERIAL OR SUPERVISORY PURPOSES, NOT OTHERWISE PROVIDED FOR
    • G06Q10/00Administration; Management
    • G06Q10/06Resources, workflows, human or project management; Enterprise or organisation planning; Enterprise or organisation modelling
    • G06Q10/063Operations research, analysis or management
    • G06Q10/0639Performance analysis of employees; Performance analysis of enterprise or organisation operations
    • G06Q10/06395Quality analysis or management
    • HELECTRICITY
    • H04ELECTRIC COMMUNICATION TECHNIQUE
    • H04MTELEPHONIC COMMUNICATION
    • H04M1/00Substation equipment, e.g. for use by subscribers
    • H04M1/72Mobile telephones; Cordless telephones, i.e. devices for establishing wireless links to base stations without route selection
    • H04M1/725Cordless telephones
    • H04M1/737Characterised by transmission of electromagnetic waves other than radio waves, e.g. infrared waves

Definitions

  • the present invention relates to an NADP(H) nanosensor, a cell, a method for isolating genes which code for NADP(H)-dependent enzymes, and the use of an NADP(H) nanosensor.
  • NADP(H)-dependent enzymes in the chemical industry as a catalyst is disclosed in a large number of examples.
  • alcohol dehydrogenases also called oxidoreductases or ketoreductases
  • ketoreductases are employed for reducing carbonyl groups.
  • the enantiospecificity and regiospecificity is used for reducing prochiral ketones.
  • ketoreductases which serve for the synthesis of useful chemical compounds are the asymmetric reduction of 4-chloroacetoacetate esters (U.S. Pat. Nos. 5,559,030, 5,700,670 and 5,891,685), the reduction of dicarboxylic acids (U.S. Pat. No.
  • 6,645,746 discloses an amino acid sequence from Candida magnoliae which can be used for reducing tert-butyl-(5S)-6-chloro-5-hydroxy-3-oxohexanoate to tert-butyl-(3R,5S)-6-chloro-3,5-dihydroxyhexa-noate with the aid of NADP(H).
  • the enzyme preferably co-expressed with glucose dehydrogenase from Bacillus megaterium is employed, the regeneration of the cofactor NADP(H) being carried out with the aid of glucose dehydrogenase and with glucose as a cosubstrate.
  • WO-A-2004/1111083 describes a process for the enantioselective enzymatic reduction of ketones, in particular 2- and 3-oxo acid esters, wherein the reaction is catalysed by an oxidoreductase from Pichia capsulata .
  • WO-A-2005/108593 describes a process for the preparation of 1-butanol in which 2-butanone is reduced with a carbonyl reductase, for example from Candida parapsilosis , and a coenzyme in a two-phase system.
  • EP-A-2 061 880 discloses a process for the NADP(H)-dependent enzymatic preparation of alkenone derivatives from ⁇ , ⁇ -unsaturated alkynone derivatives, wherein the corresponding reductase is used in purified form or also in the form of the microorganism itself.
  • EP-A-2 087 127 describes a process for the preparation of continuation derivatives by enantioselective enzymatic reduction of secodione derivatives using an oxidoreductase/dehydrogenase in the presence of NADP(H).
  • NADP(H)-dependent enzymes so-called enoate reductases
  • enoate reductases are also used for enantiospecific reduction of enoates.
  • 6R 6-levodione
  • NADP(H)-dependent enzymes in coupled systems where, for example, the reduction is followed by a cyclisation to the epoxide is furthermore described.
  • NADP(H) Enzymatic provision of NADP(H) is also necessary if monooxygenases are employed, as in the case of the very thoroughly investigated monooxygenase P450 BM3 (CYP102A1) from Bacillus megaterium ( Appl. Microbiol. Biotechnol . (2012) 95:357-367).
  • This fatty acid hydroxylase oxidises a wide range of substrates, such as alkanes, alkenes and aromatic hydrocarbons.
  • the monooxygenase catalyses the hydroxylation, but requires the stoichiometric supply of NADP(H).
  • NADP(H)-dependent enzymes are also employed for reductive amination, such as, for example, of 2-keto acids to the corresponding D-amino acid (WO-A-2006/113085), or of 6-aminocaproic acid from 2-ketopimelate (WO-A-2012/031911).
  • NADP(H)-dependent enzymes can be found, for example, in Hollmann, Arendsa and Holtmann ( Green Chemistry, 2011, 13, 2285-2313), or also the textbook “ Industrial Biotransformations ” by Liese, Seelbach, and Wandrey (Wiley-VCH Verlag, 2006, ISBN: 3-527-31001-0).
  • NADP(H)-dependent enzymes are to be employed, it is initially a prerequisite to provide suitable enzymes which ensure high conversions and a high stereospecificity. A prerequisite of this in turn is screening for such enzymes, which can be carried out in various ways.
  • Desired enzymes can also be used by utilisation of the natural diversitivity. For example, by obtaining enzymes from organisms or metagenomic libraries, which in turn must be tested specifically. Diversitivity can also be established by man by mutagenising existing enzymes and then testing the enzymes obtained for modified substrate specificity. Examples for generating various enzymes by molecular techniques are disclosed in WO-A-2012/069434, where NADP(H)-dependent enzymes for the preparation of n-heterocyclic optically active alcohols are obtained.
  • the direct test for desired conversion of the educt into the product has hitherto preferably been carried out in microtiter plates with 96, 384 or even 1,536 wells. These plates render possible parallel testing of 96, 384 or 1.536 enzymes.
  • the product of the desired enzyme reaction can be determined directly by chromatography techniques. This method requires the removal of a sample from the 96, 384 or 1,536 wells and chromatographic separation for detection of the reaction products, which can be, for example, alcohols or carbonyl compounds. Needless to say, such a procedure is complex and time-consuming. Indirect tests are therefore often used. The fact that NADP(H) absorbs at 340 nm but NADP does not is thus utilised.
  • the amount of NADP(H) consumed can in principle be determined via this.
  • the conversion of NADP into NADP(H) can also be measured in this way.
  • the reduction of the cofactor NADP is determined by the increase in absorption at 340 nm.
  • the intrinsic fluorescence of the reduced cofactor can equally also be used for the quantification. This is effected in microtiter reader apparatuses.
  • the change in pH accompanying the NADP(H) consumption is determined by a colour indicator (U.S. Pat. No. 7,642,073).
  • a colour indicator U.S. Pat. No. 7,642,073
  • the wavelength of the change in colour can be determined, which in turn is determined in microtiter reader apparatuses.
  • analyte is covalently bonded to a fluorescent group before the reaction is carried out.
  • the fluorescence of the fluorescent group should change, for example by splitting off of the group or by a change in the structure of the analyte. The change in fluorescence is then a measure of the conversion of the analyte.
  • a disadvantage of this, however, is that the fluorescent group often influences the reactivity of the analyte.
  • WO-A-2007/131696 describes that by providing a fluorescent dyestuff and a macrocyclic structure in the sample to be investigated and measuring a fluorescence property of the fluorescent dyestuff at two points in time at least, the analyte concentration can be determined.
  • the macrocyclic structure thereby binds the dyestuff and within the concentration range to be investigated for the analyte this displaces the fluorescent dyestuff from the macrocyclic structure.
  • the present invention was based on the object of overcoming the disadvantages emerging from the prior art in connection with isolating new NADP(H)-dependent enzymes.
  • the present invention was based on the object of providing a tool which can be used in order to be able to isolate in a high throughput screening, for example by means of FACS, from a cell suspension in the simplest possible manner those cells which possibly express new NADP(H)-dependent enzymes.
  • the isolation of these cells should comprise no cell breakdown, and in particular also no analytical determination of the concentration of particular educts, products or cofactors.
  • the present invention was moreover based on the object of providing a cell which, after a gene for a potential NADP(H)-dependent enzyme, for example in the form of a plasmid, has been introduced into the cell, can be analysed particularly easily, and in particular without the need for a cell breakdown, as to whether the gene expressed by this cell in fact codes for an NADP(H)-dependent enzyme.
  • a cell identified in this manner should moreover should be able to be separated off as far as possible in a targeted manner in a high throughput screening, for example by means of FACS, from a large number of cells, for example from a cell suspension.
  • the intracellular NADP or NADP(H) concentration and therefore indirectly the activity of NADP(H)-dependent enzymes in a cell, can be determined in vivo particularly easily. If a cell containing the NADP(H) nanosensor according to the invention is characterised by a high activity of NADP(H)-dependent enzymes, the concentration of NADP is correspondingly high (and the NADP(H) concentration correspondingly low).
  • the regulator is capable of influencing the affinity of the RNA polymerase for the promoter controlling the expression of the autofluorescent protein, or the stability of the mRNA coding for the autofluorescent protein.
  • the expression of the autofluorescent protein is thus controlled according to the reduction state of the cell, and in turn can be monitored in a simple manner by irradiation with electromagnetic radiation, which excites the autofluorescent protein to emission of light.
  • the emission of light by the cells is thus an indicator for the reduction state of the cell and consequently for the extent of the expression of NADP(H)-dependent enzymes.
  • the regulator is the Sox regulator (SoxR) and the promoter sequence is the soxS promoter sequence.
  • SoxR Sox regulator
  • the gene for SoxR from E. coli K12 is deposited under accession numbers b4063, ECK4055 in the National Center for Biotechnology Information (NCBI) database of the National Library of Medicine (Bethesda, Md., USA).
  • SoxR contains two [2Fe-2S] clusters, which are essential for the transcription activity.
  • Each SoxR polypeptide contains a [2Fe-2S] cluster which detects the reduction state of the cell.
  • Both Fe-SoxR and apo-SoxR bind to the promoter region, but only Fe-SoxR contributes towards promoter activation in the oxidised form.
  • the redox state of the iron-sulphur cluster regulates the SoxR activity.
  • the target gene of SoxR is the adjacent soxS, the sequence of which is deposited under numbers b4062, ECK4054 in the National Center for Biotechnology Information (NCBI) database of the National Library of Medicine (Bethesda, Md., USA).
  • NCBI National Center for Biotechnology Information
  • the reduction state of the cell can be promoted, if appropriate, by NADP(H)-dependent reductases, such as Rsx or RseC.
  • components i) and ii) are formed by the intergenic region from E. coli , which is located between soxR and soxS and which comprises the SoxR binding sequence, the soxS promoter sequence following the SoxR binding sequence and a sequence following the soxS promoter sequence, which corresponds at the level of the mRNA to a ribosome binding site, or by a nucleic acid sequence homologous to this.
  • Components i) and ii) in this context are preferably formed by a nucleic acid sequence selected from the group consisting of:
  • this comprises
  • sequence b) following a sequence a) is to be understood according to the invention as meaning that the sequence b) does not necessarily have to be bonded directly to the sequence a), but that an intermediate sequence can also be located between sequence a) and sequence b).
  • the NADP(H) nanosensor comprises as component ( ⁇ 1) the E. coli gene for soxR (soxR) or a nucleic acid sequence homologous to this, component ( ⁇ 1) preferably being selected from the group consisting of:
  • nucleic acid sequences which code for polypeptides includes all sequences which appear to be possible according to the proviso of degeneration of the genetic code.
  • nucleic acid sequences can be identified using a sequence comparison program (BLAST. Altschul et al. J. Mol. Biol. 1990, 215, 403-410). The percentage homology between two amino acid sequences can likewise be readily determined by the person skilled in the art using methods know from the prior art.
  • a suitable program which can be employed according to the invention is BLASTp (Altschul et al., 1997; “Gapped BLAST and PSI-BLAST: a new generation of protein database search programs”; Nucleic Acids Res. 25(17): 3389-3402).
  • the person skilled in the art can find instructions for hybridisation inter alia in the handbook “ The DIG System User's Guide for Filter Hybridization ” of Boehringer Mannheim GmbH (Mannheim, Germany, 1993) and in Liebl et al. ( International Journal of Systematic Bacteriology 41: 255-260 (1991)).
  • the hybridisation takes place under stringent conditions, that is to say only hybrids in which the probe, for example the nucleotide sequence complementary to soxR or soxS or the intergenic region of soxRS from E. coli , and the target sequence, i.e. the polynucleotides treated with the probe, are at least 70% identical.
  • the stringency of the hybridisation including the washing steps is influenced or determined by varying the buffer composition, the temperature and the salt concentration.
  • the hybridisation reaction is in general carried out at a relatively low stringency compared with the washing steps (Hybaid Hybridisation Guide, Hybaid Limited, Teddington, UK, 1996).
  • a buffer corresponding to 5 ⁇ SSC buffer can be employed at a temperature of approx. 50° C.-68° C.
  • probes can also hybridise with polynucleotides which have less than 70% identity to the sequence of the probe. Such hybrids are less stable and are removed by washing under stringent conditions.
  • the washing steps are carried out at temperatures of approx. 62° C.-68° C., preferably of 64° C.-68° C. or approx. 66° C.-68° C. particularly preferably of approx. 66° C.-68° C. It is possible, where appropriate, to lower the salt concentration to a concentration corresponding to 0.2 ⁇ SSC or 0.1 ⁇ SSC. By increasing the hybridisation temperature stepwise in steps of approx. 1-2° C. from 50° C. to 68° C.
  • polynucleotide fragments which code for soxR or soxS or the intergenic region of soxRS which have, for example, at least 70% or at least 80% or at least 90% to 95% or at least 96% to 98% or at least 99% identity to the sequence of the probe employed can be isolated. Further instructions for the hybridisation are obtainable on the market in the form of so-called kits (e.g. DIG Easy Hyb from Roche Diagnostics GmbH, Mannheim, Germany, catalogue no. 1603558).
  • kits e.g. DIG Easy Hyb from Roche Diagnostics GmbH, Mannheim, Germany, catalogue no. 1603558.
  • the NADP(H) nanosensor comprises as component ( ⁇ 4) a nucleic acid sequence which codes for an autofluorescent protein and which follows ( ⁇ 2) or ⁇ 3), preferably the target gene soxS ( ⁇ 3), in particular the first 5 to 200 nucleotides of the target gene soxS, and is under the control the soxS promoter sequence, as component iii).
  • the gene sequence according to component iii) coding for the autofluorescent protein is under the control of the promoter sequence ii) (according to the first variant described above for the particular embodiment of the NADP(H) nanosensor according to the invention, the gene sequence ( ⁇ 4) coding for the autofluorescent protein is under the control of the soxS promoter sequence).
  • the term “under control of the promoter sequence” in this context is preferably to be understood as meaning that the gene sequence coding for the auto fluorescent protein is functionally linked to the promoter.
  • the promoter and the gene sequence coding for the autofluorescent protein are functionally linked if these two sequences and optionally further regulative elements, such as, for example, a terminator or a ribosome binding site, are arranged sequentially such that each of the regulative elements can fulfil its function in the transgenic expression of the nucleic acid sequence.
  • a direct linking in the chemical sense is not absolutely necessary.
  • Genetic control sequences, such as, for example, enhancer sequences can also exert their function on the target sequence from further removed positions or even from other DNA molecules. Arrangements in which the gene sequence coding for the autofluorescent protein is positioned alter the promoter sequence (i.e. at the 3′ end), so that the two sequences are bonded covalently to one another, are preferred.
  • the distance between the gene sequence coding for the autofluorescent protein and the promoter sequence is less than 200 base pairs, particularly preferably less than 100 base pairs, very particularly preferably less than 50 base pairs. It is also possible for the gene sequence coding for the autofluorescent protein and the promoter to be linked functionally to one another such that there is still a part sequence of the homologous gene (that is to say that gene of which the expression in the wild-type cell is regulated by the promoter) between these two gene sequences (according to the particular embodiment of the NADP(H) nanosensor described above, pans of the soxS gene according to component ( ⁇ 3) can accordingly be between the soxS promoter sequence and the nucleic acid sequence ( ⁇ 4) coding for the autofluorescent protein).
  • the lengths of such part sequences of the homologous gene are not critical as long as the functional capacity of the autofluorescent protein, that is to say its property of being fluorescent when excited with light of a particular wavelength, is not noticeably impaired.
  • the soxS part sequence ( ⁇ 3) preferably comprises at least the first 5 nucleotides, still more preferably at least the first 10 nucleotides and still more preferably at least the first 20 nucleotides, but preferably at most the first 200 nucleotides, still more preferably at most the first 150 nucleotides and still more preferably at most the first 100 nucleotides of the soxS gene.
  • the nucleic acid sequence (iii) (or ( ⁇ 4) and ( ⁇ 4)) coding for an autofluorescent protein preferably comprises genes coding for fluorescent proteins which code for fluorescent proteins of the genus Aequora , such as green fluorescent protein (GFP), and variants thereof which are fluorescent in a different wavelength range (e.g. yellow fluorescent protein (YFP), blue fluorescent protein (BFP), cyan fluorescent protein (CFP)) or of which the fluorescence is enhanced (e.g. enhanced green fluorescent protein (EGFP), enhanced yellow fluorescent protein (EYFP), enhanced blue fluorescent protein (EBFP) or enhanced cyan fluorescent protein (ECFP).
  • GFP green fluorescent protein
  • YFP yellow fluorescent protein
  • BFP blue fluorescent protein
  • CFP cyan fluorescent protein
  • Gene sequences which code for other autofluorescent proteins e.g.
  • a photoreceptor protein which contains a so-called LOV domain can likewise be used.
  • the particularly preferred autofluorescent protein in this context is EYFP.
  • this comprises
  • Components ( ⁇ 1), ( ⁇ 2, ( ⁇ 3) and ( ⁇ 4) which are preferred are those components which have already been mentioned above as preferred components ( ⁇ 1), ( ⁇ 2), ( ⁇ 3) and ( ⁇ 4) in connection with the first variant of the particularly preferred embodiment of the NADP(H) nanosensor according to the invention.
  • NADP(H) nanosensor according to the invention can be present in the cell in the episomal or chromosomal form.
  • suitable cells which may be mentioned in particular are Escherichia coli, Pseudomonas fluorescens, Corynebacterium glutamicum, Bacillus subtilis or another Eubacterium , or also Saccharomyces cerevisiae or another yeast.
  • the cells according to the invention are suitable for establishing whether particular gene sequences code for an NADP(H)-dependent enzyme.
  • the gene coding for a potential NADP(H)-dependent enzyme is introduced into the cell and expressed.
  • the emission of light by the cells is an indicator for the reduction state of the cell and consequently for the extent of the expression of NADP(H)-dependent enzymes.
  • an “NADP(H)-dependent enzyme” is understood as meaning any enzyme which is involved in at least a part step of the conversion of a substrate into a reaction product which is chemically different from this substrate, NADP(H) being involved as a cofactor in at least one part step of this conversion.
  • the NADP(H)-dependent enzyme in this context is preferably selected from the group consisting of alcohol dehydrogenases, aldehyde dehydrogenases, lactate dehydrogenases, enoate reductases, epoxide reductases, diaminopimelate dehydrogenases, amino acid dehydrogenases, aldehyde oxidoreductases, alkane reductases, amine reductases, epoxide dehydrogenases, carboxylic acid dehydrogenases, hydroxy acid ketoreductases and hydroxy acid dehalogenases.
  • a contribution towards achieving the abovementioned objects is also made by a recombinant cell comprising a nucleic acid sequence coding for an autofluorescent protein, wherein the extent of the expression of the autofluorescent protein in the cell depends on the intracellular NADP(H) availability.
  • particularly preferred cells are the cells described above, in particular cells comprising the NADP(H) sensor according to the invention.
  • New NADP(H)-dependent enzymes and mutated NADP(H)-dependent enzymes with increased or modified substrate recognition can be isolated with the aid of this method.
  • Sensors and cells which are preferred as the NADP(H) sensor and as the cell are those which have already been described above as preferred sensors or cells in connection with the sensor according to the invention or the cell according to the invention.
  • a cell according to the invention is first prepared by introducing the NADP(H) nanosensor according to the invention into a cell, it being possible for this introduction to be carried out in the episomal or chromosomal form.
  • a gene which may code for an NADP(H)-dependent enzyme is then introduced into individual cells of a cell suspension of the cells obtained in method step (II), it being possible for the gene to be, in particular, a mutated, plasmid-coded gene of an NADP(H)-dependent enzyme.
  • an in vitro mutagenesis is preferably carried out with the aid of an error-prone polymerase chain reaction (PCR) and an amplification technique.
  • the gene to be mutated is subjected to a PCR using a polymerase which, depending on the conditions of the reaction, incorporates individual bases incorrectly into the synthesized genes (Tindall, K. R, and T. A. Kunkel: “Fidelity of DNA synthesis by the Thermus aquaticus DNA polymerase”; Biochemistry, 1988, 27 (16), pages 6008-13).
  • a frequent variant of this method comprises the use of manganese(II) ions or of nucleotide analogues in the PCR batch (Cadwell R. C et al. (1992); PCR Methods Appl. (2), pages 28-33/Leung D. W. et al. (1989) Techniques (I), pages 11-15).
  • the mutations can be, for example, point mutations, and e.g. substitutions, deletions or insertions can be generated by the polymerase.
  • the mutation rate is between 1-40 mutations per 1 kb, preferably 1-5 mutations per 1 kb.
  • mutations can also be produced with the aid of saturation mutagenesis using the Stratagene QuikChange Kit (La Jolla, Calif., USA), or also using a method called SeSam (EP 1 670 914 B1), with which any existing nucleotide is transferred under saturation into any possible nucleotide.
  • NADP(H)-dependent enzymes of which the activity can be analysed with the nanosensor-carrying host in a high throughput are, for example, 1,2-dehydroreticulin reductases (1.5.1.27), 2-enoyl-CoA reductase (1.3.1.10), 2-enoyl-CoA reductases (1.3.1.39), alkenal/one oxidoreductases (1.3.1.74) cytochrome P450 reductase (1.6.2.4), NADP(H) dehydrogenases (1.6.99.1), NADP(H) dehydrogenases (flavin) (1.6.8.2), NADP(H) dehydrogenases (quinone) (1.6.5.10), NADP(H)-dependent 1,5-anhydro-D-fructose reductases (1.1.1.263), NADP(H)-dependent cytochrome P450 reductases (1.6.2.4), diaphorases (1.6.99.1), DT-diaphor
  • the plasmids which contain mutations in genes of the NADP(H)-dependent enzymes are then introduced into the microorganism, such as, for example, E. coli or C. glutamicum , by transformation.
  • transformation includes all methods for transfer of polynucleotides, in particular DNA, into a desired bacterium. These include inter alia the use of isolated DNA in transformation, electro transformation or electroporation, transfer by cell contact, as in conjugation, or transfer of DNA by means of particle bombardment.
  • a gene which optionally codes for an NADP(H)-dependent enzyme has been introduced into individual cells of a cell suspension from the cells obtained in method (II) (and expressed), the cells are then incubated in method step (IV) with a substrate for an NADP(H)-dependent enzyme, and in method step (V) individual cells in the cell suspension with an increased activity of NADP(H)-dependent enzymes are then identified by detection of the intracellular fluorescence activity.
  • the cell suspension is exposed to electromagnetic radiation in that frequency which excites the autofluorescent protein of the NADP(H) nanosensor to emission of light.
  • FACS fluorescence activated cell sorting
  • step (VII) the genes coding for an NADP(H)-dependent enzyme in the identified cells are then isolated and if appropriate analysed, for example by isolating the enzyme-carrying plasmids from the cells which have been separated off and identifying and verifying, by sequencing, their mutation which lead to modified fluorescence.
  • a contribution towards achieving the abovementioned objects is also made by the use of the NADP(H) nanosensor according to the invention for identifying, in vivo, genes which code for an NADP(H)-dependent enzyme.
  • FIG. 1 shows the mode of functioning of the NADP(H) nanosensor according to the invention by the example of the particularly preferred embodiment described above.
  • FIG. 2 shows the specific fluorescence of the E. coli BL21(DE3) cells, prepared in Example 3, with the NADP(H) nanosensor according to the invention (pSensox) and expressed alcohol dehydrogenase (Lbadh) (solid squares).
  • the fluorescence of the nanosensor pSennegK with inactive alcohol dehydrogenase is shown as a control (open squares).
  • FIG. 3 shows a diagram of the formation of the autofluorescent protein as transcriptional (top) and translational (bottom) fusion.
  • the NADP(H) nanosensor can comprise the E. coli gene for SoxR (soxR), the intergenic region from E. coli following this, which is located between soxR and soxS and which comprises the soxR binding sequence and the soxS promoter sequence following the SoxR binding sequence, a part sequence of the soxS gene from E. coli (soxS′) following this and a nucleic acid sequence following this, under the control of the soxS promoter sequence, which codes for a autofluorescent protein (AFP).
  • AFP autofluorescent protein
  • the [2Fe-2S] clusters are present in a form reduced by SoxR bound to the promoter.
  • the [2Fe-2S] clusters are oxidised, and the resulting distortion of the soxS promoter region renders transcription initiation of the target gene possible for the RNA polymerase.
  • the native target gene soxS is fused with an autofluorescent protein (AFP).
  • AFP autofluorescent protein
  • NADP(H)-dependent enzymes cause increased expression of soxS′-AFP by consumption of NADP(H) and therefore increased fluorescence of cells as a result of increased NADP(H) consumption.
  • FIG. 3 shows at the top the transcriptional and at the bottom the translational fusion.
  • a transcript is formed by the promoter PI, which is, for example, the soxS promoter controlled by SoxR.
  • the promoter PI which is, for example, the soxS promoter controlled by SoxR.
  • the fusion protein in which the autofluorescent protein contains additional amino acid sequences.
  • SoxS_for_SphI SEQ. ID. No. 04
  • SoxR_rev_SalI SEQ. ID. No. 05
  • chromosomal DNA from E. coli DIS5 ⁇
  • the gene soxR as amplified together with the intergenic region of soxR-soxS and the first 63 nucleotides of soxS.
  • SoxS_for_SphI ATCTGCATGCTTACGGCTGGCAATATGCTCGTC SoxR rev SalI: GCTAGTCGACCAAACTAAACCGCCCTTGTG
  • EYFP_for_SphI AGAGGCATGCAAGGAGAATTACATGGTGAGCAAGGGCGAGG
  • EYFP_rev_ClaI GCGCATCGATTTATTACTTGTACAGCTCGTCCATG
  • the vector pBtacLbadh codes for the NADPH-dependent alcohol dehydrogenase from Lactobacillus brevis (Lbadh). It is described in Ernst et al. (Ernst M, Kaup B, Müller M, Bringer-Meyer S, Sahm H, Appl. Microbiol. Biotechnol. 2005, 66(6), pages 629-34).
  • the vector pBtacLbadh was treated with the restriction enzymes SalI and ClaI, and the vector fragment ⁇ 5.0 kb in size was isolated from the agarose gel and treated with alkaline phosphatase and purified with the QIAquick Gel Extraction Kit (cat. no. 28704) from Quiagen (Hilden, Germany).
  • the two PCR products and the vector were then ligated by means of T4 DNA ligase from New England Biolabs (New England Biolabs, 240 County Road, Ipswich, Mass. 01938-2723).
  • the ligation batch was transformed directly into the E. coli strain DH5 ⁇ .
  • Selection of plasmid-carrying cells was carried out by plating out the transformation batch on LB agar (Sambrook et al.: “Molecular cloning: a laboratory manual”, 2nd edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.), which had been supplemented with 50 mg/l of ampicillin.
  • Plasmid DNA was isolated from a transformant and checked by treatment with the restriction enzyme BamHI with subsequent agarose gel electrophoresis. The plasmid was called pSenSox and is deposited as the sequence SEQ. ID. No. 08.
  • pSennegK was created as a derivative with modified alcohol dehydrogenase. Lbadh.
  • ADH_negK_for SEQ. ID. No. 09
  • ADH_negK_rev SEQ. ID. No. 10
  • an inactive Lbadh was amplified with an alcohol dehydrogenase deleted by 221 bp.
  • the resulting fragment was ligated with the ⁇ 5.7 kb size vector fragment containing the gene eyfp together with a ribosome binding site.
  • the sequence of the resulting vector is deposited as SEQ. ID. No. 11.
  • ADH_negK_for ACAAGAATTCGCTAAGAGTGTCGGCACTCC
  • ADH_negK_rev GGCCAAGCTTCCGAAGAAGACACCATCAAG
  • pSen-L194S was created as a further derivative with modified alcohol dehydrogenase. Lbadh.
  • L194S_for SEQ. ID. No. 12
  • L194S_rev SEQ. ID. No. 13
  • pSenSox was amplified as a template for targeted insertion of the mutation.
  • the plasmid generated was verified by means of sequencing.
  • the sequence of the resulting vector is deposited as SEQ. ID. No. 14.
  • pSen-L194A was created as a further derivative with modified alcohol dehydrogenase, Lbadh.
  • L194A_for SEQ. ID. No. 15
  • L194A_rev SEQ. ID. No. 16
  • pSenSox was amplified as a template for targeted insertion of the mutation.
  • the plasmid generated was verified by means of sequencing.
  • the sequence of the resulting vector is deposited as SEQ. ID. No. 17.
  • E. coli BL21(DE3) (Life Technologies GmbH, Frankfurter Stra ⁇ e 129B, 64293 Darmstadt) was transformed with the plasmid pSenSox.
  • 5 ml of 2 ⁇ YT medium (16 g/l of tryptone, 10 g/l of yeast extract. 5 g/l of NaCl) was inoculated with an individual colony and the culture was incubated overnight at 37° C. and 130 rpm.
  • the main culture was inoculated to an OD of 0.05 in 50 ml of 2 ⁇ TY and was incubated at 37° C. and 130 rpm. At the OD of 0.31 mM IPTG was added and the culture was incubated for a further 3 hours to an OD of 5-6.
  • FIG. 2 shows an increase in the fluorescence with increasing MAA concentration. This increase is due to pSenSox, since a control reaction with the plasmid pSennegK with inactive alcohol dehydrogenase, which, however, is otherwise identical to pSenSox, causes no increase in fluorescence.
  • the strain E. coli BL 21(DE3) (Life Technologies GmbH, Frankfurter Stral ⁇ e 129B, 64293 Darmstadt) was transformed in each case with pSennegK, pSen-L194S and pSen-L194A.
  • the strain E. coli BL21(DE3) pSenSox described in Example 2 was transformed with pET28a as the second plasmid.
  • the vector mentioned last was obtained from Novagen (Life Technologies GmbH.
  • Example 2 0.9 mil portions of the cells were then each introduced into a reaction vessel of the Flowerplate microtiter plate (48-well) of the BioLector cultivation system (m2plabs GmbH, Aachen, Germany). Methyl acetoacetate (MAA) was in each case added, in 0.1 ml, to the cell suspension to a final concentration of 40 mM. The Flowerplate microtiter plate was then incubated at 30° C., 1,200 rpm, shaking radius 3 mm, and the specific fluorescence was determined. The specific fluorescence obtained after 19 hours is shown in Table 1.
  • MAA Methyl acetoacetate
  • the alcohol dehydrogenase activity of the recombinant E. coli cells was determined in the individual batches. For this, the cells were harvested at 10.000 ⁇ g, 4° C., 5 min and taken up in 100 mM potassium phosphate buffer, pH 6.5, 1 mM dithiothreitol, 1 mM MgCl 2 . The cells were broken down by means of the Silamat S5 (Ivoclar Vivadent GmbH, Germany) with the aid of glass beads of 0.1 mm diameter. The crude extract which was obtained after centrifugation at 16.000 ⁇ g, 4° C., 20 min was employed in the enzyme test for quantification of the alcohol dehydrogenase activity.
  • the test contained 5 mM methyl acetoacetate, 0.25 mM NADPH and 1 mM MgCl 2 in 100 mM potassium phosphate buffer, pH 6.5, and 0.01-0.1 ml of crude extract.
  • the reduction of NADP(H) was monitored at 340 nm and 30° C.
  • An enzyme unit (U) is stated as that amount of crude extract which reduces 0.001 mmol of NADP(H) per minute. It is likewise given in Table 1.
  • the alcohol dehydrogenase Lbadh from Lactococcus lactis has a high activity with methyl acetoacetate, but only a low activity of about 10% with 4-methyl-2-pentanone as the substrate.
  • random mutations were inserted into pSenSox by error-prone PCR (epPCR).
  • SEQ. ID. No. 18 ACAAGAATTCGCTAAGAGTGTCGGCACTCC
  • SEQ. ID. No. 19 GGCCAAGCTTCCGAAGAAGACACCATCAAG were used as primers. The reactions were incubated for 30 minutes. The reaction products were then treated with BamHI and SalI and ligated with the vector pSenSox likewise treated beforehand.
  • E. coli DH5 ⁇ mer was transformed with the ligation products (Grant, 1990, Proceedings of the National Academy of Sciences, USA, 87, pages 4645-4649). After incubation for 30 h. transformants were washed off from the plates with 10 ml of 2 ⁇ YT and diluted tenfold in fresh 2 ⁇ YT medium. After incubation for 4 hours at 37° C., 20 mM 4-methyl-2-pentanone was added as the substrate, and after a further incubation for three hours the batches were sent for FACS analysis and sorting.
  • the cell suspension in 2 ⁇ YT medium was adjusted to an optical density of less than 0.1 and passed immediately to the FACS ARIA II high-speed cell sorter (Becton Dickinson GmbH, Tullastr. 8-12, 69126 Heidelberg).
  • the analysis was carried out with the excitation wavelengths of 488 and 633 nm and the detection at the emission wavelengths of 530 ⁇ 15 nm and 660 ⁇ 10 nm under a sample pressure of 70 psi.
  • the data were analysed with the software version BD DIVA 6.1.3 belonging to the apparatus.
  • BD FACSflow was used as the sheath fluid.
  • the electronic gating was set with the aid of the forward and backward scatter in order to exclude non-bacterial particles.
  • the next level of the electronic gating was selected, in order to exclude non-fluorescent cells. In this manner, 123 fluorescent cells were sorted out on Petri dishes which contained 2 ⁇ YT medium.
  • Reaction vessels of the Flowerplate microtiter plate (48-well) of the BioLector cultivation system (m2plabs GmbH, Aachen, Germany) were inoculated, as described in Example 2, with the colonies obtained after incubation for 30 hours at 37° C.
  • 20 mM 4-methyl-2-pentanone and not methyl acetoacetate was used as the substrate.
  • the mutant with the plasmid pSen-A93M obtained in this way has a specific activity increased by 26% compared with the starting strain (Table 2), and a conversion rate with 4-methyl-2-pentanone as the substrate increased by 37%.
  • the sequence of the plasmid pSen-A93M is deposited as SEQ. ID. No. 20.
  • Alcohol dehydrogenase Specific Strain IPTG activity U mg ⁇ 1 ) fluorescence BL21(DE3) pSennegK ⁇ 0.03 ⁇ 0.01 0.06 BL21(DE3) pSenSox, ⁇ 0.5 ⁇ 0.1 0.09 pET28a BL21(DE3) pSenL194S ⁇ 0.7 ⁇ 0.3 0.11 BL21(DE3) pSenL194A ⁇ 2.7 ⁇ 0.6 0.17 BL21(DE3) pSenSox ⁇ 6.2 ⁇ 0.6 0.38 BL21(DE3) pSenSox + 15.2 ⁇ 2.0 0.45
  • SoxS_for_SphI_tl SEQ. ID. No. 21
  • SoxR_rev_SalI_tl SEQ. ID. No. 22
  • SoxS_for_SphI_tl ATCTGCATGCCGGCTGGTCAATATGCTCGTC SoxR_rev_SalI_tl: GCTAGTCGACCAAACTAAAGCGCCCTTGTG
  • EYFP_for_SphI_tl AGAGGCATGCGTGAGCAAGGGCGAGG EYFP_rev_ClaI_tl: GCGCATCGATTTATTACTTGTACAGCTCGTCATG
  • the vector pBtacLbadh codes for the NADPH-dependent alcohol dehydrogenase from Lactobacillus brevis (Lbadh). It is described in Ernst et al. (Ernst M, Kaup B. Müller M. Bringer-Meyer S, Sahm H, Appl. Microbiol. Biotechnol. 2005, 66(6), pages 629-34).
  • the vector pBtacLbadh was treated with the restriction enzymes SalI and ClaI, and the vector fragment ⁇ 5.0 kb in size was isolated from the agarose gel and treated with alkaline phosphatase and purified with the QIAquick Gel Extraction Kit (cat. no. 28704) from Quiagen (Hilden, Germany).
  • the two PCR products and the vector were then ligated by means of T4 DNA ligase from New England BioLabs (New England Biolabs, 240 County Road, Ipswich, Mass. 01938-2723).
  • the ligation batch was transformed directly into the E. coli strain DH5 ⁇ .
  • Selection of plasmid-carrying cells was carried out by plating out the transformation batch on LB agar (Sambrook et al.: “Molecular cloning: a laboratory manual”, 2nd edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.), which had been supplemented with 50 mg/l of ampicillin.
  • Plasmid DNA was isolated from a transformant and checked by treatment with the restriction enzyme BamHI with subsequent agarose gel electrophoresis.
  • the plasmid was called pSenSox_tl and is deposited as the sequence SEQ. ID. No. 25.

Landscapes

  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Business, Economics & Management (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Human Resources & Organizations (AREA)
  • Theoretical Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Strategic Management (AREA)
  • Economics (AREA)
  • General Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Development Economics (AREA)
  • Biotechnology (AREA)
  • Entrepreneurship & Innovation (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Data Mining & Analysis (AREA)
  • Marketing (AREA)
  • Operations Research (AREA)
  • General Business, Economics & Management (AREA)
  • Game Theory and Decision Science (AREA)
  • Educational Administration (AREA)
  • Tourism & Hospitality (AREA)
  • Quality & Reliability (AREA)
  • Immunology (AREA)
  • Analytical Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Evolutionary Computation (AREA)
  • Artificial Intelligence (AREA)
  • Software Systems (AREA)

Abstract

The present invention relates to an NADP(H) nanosensor comprising
  • i) a nucleic acid sequence to which a regulator is capable of binding, wherein the oxidation state of the regulator depends on the NADP(H) availability;
  • ii) a promoter sequence following the nucleic acid sequence i), to which an RNA polymerase is capable of binding, wherein the affinity of the RNA polymerase for the promoter sequence is influenced by the oxidation state of the regulator;
  • iii) a nucleic acid sequence which is under the control of the promoter sequence ii) and which codes for an autofluorescent protein.
The present invention also relates to a cell, a method for isolating genes which code for NADP(H)-dependent enzymes, and the use of an NADP(H) nanosensor.

Description

RELATED APPLICATION
This application is a National Stage application of PCT/EP2013/002481 filed Aug. 16, 2013, which claims priority to German Patent Application No. 10 2012 017 026.2 filed Aug. 28, 2012, the entire disclosures of which are hereby incorporated by reference.
The present invention relates to an NADP(H) nanosensor, a cell, a method for isolating genes which code for NADP(H)-dependent enzymes, and the use of an NADP(H) nanosensor.
The use of NADP(H)-dependent enzymes in the chemical industry as a catalyst is disclosed in a large number of examples. Thus, alcohol dehydrogenases, also called oxidoreductases or ketoreductases, are employed for reducing carbonyl groups. In particular, the enantiospecificity and regiospecificity is used for reducing prochiral ketones. Examples of such ketoreductases which serve for the synthesis of useful chemical compounds are the asymmetric reduction of 4-chloroacetoacetate esters (U.S. Pat. Nos. 5,559,030, 5,700,670 and 5,891,685), the reduction of dicarboxylic acids (U.S. Pat. No. 6,399,339), the reduction of tert-butyl-(S)-chloro-5-hydroxy-3-oxohexanoate (U.S. Pat. No. 6,645,746 and WO-A-01/40450), the reduction of pyrrolotriazine-based compounds (US-A-2006/0286646), the reduction of substituted acetophenones (U.S. Pat. No. 6,800,477, US-A-2012/0178142) or the reduction of hydroxythiolanes (WO-A-2005/054491), alpha-haloketones are likewise reduced enzymatically to alpha-haloalcohols. This can also be carried out by isolated enzymes or with whole cells (WO-A-2008/038050). By means of specific alcohol dehydrogenases from Lactobacillus brevis or Thermoanaerobium brokii, the reduction of the 8-chloro-6-oxooctanoic acid alkyl ester to the (R)- or (S)-8-chloro-6-hydroxyoctanoic acid alkyl ester, which is used as the precursor of (R)-α-lipoic acid and (S)-α-lipoic acid respectively, is effected (U.S. Pat. No. 7,157,253). Processes for the preparation of optically active alkanols wherein the preparation of, for example, (1S)-3-methylamino-1-(2-thienyl)-propan-1-ol und (1S)-3-chloro-1-(2-thienyl)-propan-1-ol is carried out by enzymatic reduction of the corresponding ketones are also described (WO-A-2006/094945). A process for preparing 3-hydroxybutyl 3-hydroxybutyrates enantiospecifically by means of ketoreductase or alcohol dehydrogenase is likewise known (US-A-2012/0064611). U.S. Pat. No. 6,645,746 discloses an amino acid sequence from Candida magnoliae which can be used for reducing tert-butyl-(5S)-6-chloro-5-hydroxy-3-oxohexanoate to tert-butyl-(3R,5S)-6-chloro-3,5-dihydroxyhexa-noate with the aid of NADP(H). In the description of this document the enzyme preferably co-expressed with glucose dehydrogenase from Bacillus megaterium is employed, the regeneration of the cofactor NADP(H) being carried out with the aid of glucose dehydrogenase and with glucose as a cosubstrate. WO-A-2004/1111083 describes a process for the enantioselective enzymatic reduction of ketones, in particular 2- and 3-oxo acid esters, wherein the reaction is catalysed by an oxidoreductase from Pichia capsulata. WO-A-2005/108593 describes a process for the preparation of 1-butanol in which 2-butanone is reduced with a carbonyl reductase, for example from Candida parapsilosis, and a coenzyme in a two-phase system. EP-A-2 061 880 discloses a process for the NADP(H)-dependent enzymatic preparation of alkenone derivatives from α,β-unsaturated alkynone derivatives, wherein the corresponding reductase is used in purified form or also in the form of the microorganism itself. EP-A-2 087 127 describes a process for the preparation of secol derivatives by enantioselective enzymatic reduction of secodione derivatives using an oxidoreductase/dehydrogenase in the presence of NADP(H).
In addition to the NADP(H)-dependent reduction of ketones and aldehydes, NADP(H)-dependent enzymes, so-called enoate reductases, are also used for enantiospecific reduction of enoates. Thus, Kataoka and colleagues have reported that by using an enoate reductase from Candida macedoniensis together with an NADP(H)-generating glucose dehydrogenase from E. coli ketoisophorone is reduced preoperatively to (6R)-levodione (Kataoka, Kotaka, Thiwthong, Wada, Nakamori, and Shimizu, J. Biotechnol., 2004, 114, 1-9).
The use of NADP(H)-dependent enzymes in coupled systems where, for example, the reduction is followed by a cyclisation to the epoxide is furthermore described.
The use of (R)- or (S)-selective alcohol dehydrogenases in order to form the corresponding enantiomer and subsequently to achieve the base-induced cyclisation to the particular epoxide is thus described (CA 2 612 407).
Enzymatic provision of NADP(H) is also necessary if monooxygenases are employed, as in the case of the very thoroughly investigated monooxygenase P450 BM3 (CYP102A1) from Bacillus megaterium (Appl. Microbiol. Biotechnol. (2012) 95:357-367). This fatty acid hydroxylase oxidises a wide range of substrates, such as alkanes, alkenes and aromatic hydrocarbons. The monooxygenase catalyses the hydroxylation, but requires the stoichiometric supply of NADP(H).
NADP(H)-dependent enzymes are also employed for reductive amination, such as, for example, of 2-keto acids to the corresponding D-amino acid (WO-A-2006/113085), or of 6-aminocaproic acid from 2-ketopimelate (WO-A-2012/031911).
An overview of the most diverse uses of NADP(H)-dependent enzymes can be found, for example, in Hollmann, Arendsa and Holtmann (Green Chemistry, 2011, 13, 2285-2313), or also the textbook “Industrial Biotransformations” by Liese, Seelbach, and Wandrey (Wiley-VCH Verlag, 2006, ISBN: 3-527-31001-0).
Regardless of the concrete reaction for which NADP(H)-dependent enzymes are to be employed, it is initially a prerequisite to provide suitable enzymes which ensure high conversions and a high stereospecificity. A prerequisite of this in turn is screening for such enzymes, which can be carried out in various ways.
Thus, companies offer enzyme collections, which must then be tested to ascertain whether they convert the desired educt into the desired product, such as, for example, Novozymes A/S located in Bagsværd, Denmark. Desired enzymes can also be used by utilisation of the natural diversitivity. For example, by obtaining enzymes from organisms or metagenomic libraries, which in turn must be tested specifically. Diversitivity can also be established by man by mutagenising existing enzymes and then testing the enzymes obtained for modified substrate specificity. Examples for generating various enzymes by molecular techniques are disclosed in WO-A-2012/069434, where NADP(H)-dependent enzymes for the preparation of n-heterocyclic optically active alcohols are obtained. Similar processes for the preparation of 12α-hydroxysteroid dehydrogenase mutants are also described (EP-A-2 441 771). The preparation of large gene libraries which undergo an analysis with a high throughput comprises cloning of the gene library into replicable expression vectors, transforming of the suitable cells with the resulting vector library and expressing the combinantly obtained genes under conditions under which the detection of the desired activity and the isolation of the vector which codes for the gene of which the product has been detected are facilitated.
The direct test for desired conversion of the educt into the product has hitherto preferably been carried out in microtiter plates with 96, 384 or even 1,536 wells. These plates render possible parallel testing of 96, 384 or 1.536 enzymes. The product of the desired enzyme reaction can be determined directly by chromatography techniques. This method requires the removal of a sample from the 96, 384 or 1,536 wells and chromatographic separation for detection of the reaction products, which can be, for example, alcohols or carbonyl compounds. Needless to say, such a procedure is complex and time-consuming. Indirect tests are therefore often used. The fact that NADP(H) absorbs at 340 nm but NADP does not is thus utilised. The amount of NADP(H) consumed can in principle be determined via this. Alternatively, in the carbonyl reductase-catalysed oxidation of an alcohol the conversion of NADP into NADP(H) can also be measured in this way. In this and comparable reactions, the reduction of the cofactor NADP is determined by the increase in absorption at 340 nm. The intrinsic fluorescence of the reduced cofactor can equally also be used for the quantification. This is effected in microtiter reader apparatuses.
In another method for determining the NADP(H) consumption for detection of the enzymatic reductive transamination and also the reduction of ketones, the change in pH accompanying the NADP(H) consumption is determined by a colour indicator (U.S. Pat. No. 7,642,073). By a suitable choice of the colour indicator the wavelength of the change in colour can be determined, which in turn is determined in microtiter reader apparatuses.
Specific microtiter plate systems in which a screening in the microtiter plate format with up to 1,536 wells is carried out via membranes with specific analyte binding properties and liquid streams are also described (EP-A-1 628 768).
Attempts have also been made to make analytes more easily detectable by coupling with a detectable group, for example of a fluorophore. For this, the analyte is covalently bonded to a fluorescent group before the reaction is carried out. When the reaction is carried out and the analyte is correspondingly reacted, the fluorescence of the fluorescent group should change, for example by splitting off of the group or by a change in the structure of the analyte. The change in fluorescence is then a measure of the conversion of the analyte. A disadvantage of this, however, is that the fluorescent group often influences the reactivity of the analyte. WO-A-2007/131696 describes that by providing a fluorescent dyestuff and a macrocyclic structure in the sample to be investigated and measuring a fluorescence property of the fluorescent dyestuff at two points in time at least, the analyte concentration can be determined. The macrocyclic structure thereby binds the dyestuff and within the concentration range to be investigated for the analyte this displaces the fluorescent dyestuff from the macrocyclic structure.
In the in vitro screening set-ups known from the prior art for isolating new NADP(H)-consuming enzymes or NADP(H)-consuming enzymes from gene libraries having a modified substrate specificity, a general disadvantage is that microtiter plate systems which do not render possible high throughput screening such as is possible, for example, with fluorescence-activated cell sorting (FACS) are used.
Furthermore, in in vitro screening set-ups for isolating new NADP(H)-dependent enzymes, cell lysates are often employed as a potential source of new enzymes, since isolation in the pure form is operationally difficult. The problem of such lysates or preparations in routine screening for new NADP(H)-dependent enzymes is, however, that the reaction batch typically contains insoluble material or other enzymes which interact with the NADP(H). This leads to high blank values or also a modified non-specific absorption at 340 nm, which reduces the accuracy and the value of the absorption measurement. The same applies to fluorescence measurement of the cofactor, which is likewise made difficult by insoluble material.
The present invention was based on the object of overcoming the disadvantages emerging from the prior art in connection with isolating new NADP(H)-dependent enzymes.
In particular, the present invention was based on the object of providing a tool which can be used in order to be able to isolate in a high throughput screening, for example by means of FACS, from a cell suspension in the simplest possible manner those cells which possibly express new NADP(H)-dependent enzymes. In particular, the isolation of these cells should comprise no cell breakdown, and in particular also no analytical determination of the concentration of particular educts, products or cofactors.
The present invention was moreover based on the objet of providing a cell which, after a gene for a potential NADP(H)-dependent enzyme, for example in the form of a plasmid, has been introduced into the cell, can be analysed particularly easily, and in particular without the need for a cell breakdown, as to whether the gene expressed by this cell in fact codes for an NADP(H)-dependent enzyme. A cell identified in this manner should moreover should be able to be separated off as far as possible in a targeted manner in a high throughput screening, for example by means of FACS, from a large number of cells, for example from a cell suspension.
A contribution towards achieving the abovementioned objects is made by an NADP(H) nanosensor comprising
  • i) a nucleic acid sequence to which a regulator is capable of binding, wherein the oxidation state of the regulator depends on the NADP(H) availability;
  • ii) a promoter sequence following the nucleic acid sequence i), to which an RNA polymerase is capable of binding, wherein the affinity of the RNA polymerase for the promoter sequence is influenced by the oxidation state of the regulator;
  • iii) a nucleic acid sequence which is under the control of the promoter sequence ii) and which codes for an autofluorescent protein.
It has been found, surprisingly, that using the NADP(H) nanosensor according to the invention the intracellular NADP or NADP(H) concentration, and therefore indirectly the activity of NADP(H)-dependent enzymes in a cell, can be determined in vivo particularly easily. If a cell containing the NADP(H) nanosensor according to the invention is characterised by a high activity of NADP(H)-dependent enzymes, the concentration of NADP is correspondingly high (and the NADP(H) concentration correspondingly low). Depending on this reduction state of the cell, the regulator is capable of influencing the affinity of the RNA polymerase for the promoter controlling the expression of the autofluorescent protein, or the stability of the mRNA coding for the autofluorescent protein. The expression of the autofluorescent protein is thus controlled according to the reduction state of the cell, and in turn can be monitored in a simple manner by irradiation with electromagnetic radiation, which excites the autofluorescent protein to emission of light. The emission of light by the cells is thus an indicator for the reduction state of the cell and consequently for the extent of the expression of NADP(H)-dependent enzymes.
According to a preferred embodiment of the NADP(H) nanosensor according to the invention, the regulator is the Sox regulator (SoxR) and the promoter sequence is the soxS promoter sequence. The gene for SoxR from E. coli K12 is deposited under accession numbers b4063, ECK4055 in the National Center for Biotechnology Information (NCBI) database of the National Library of Medicine (Bethesda, Md., USA). SoxR contains two [2Fe-2S] clusters, which are essential for the transcription activity. Each SoxR polypeptide contains a [2Fe-2S] cluster which detects the reduction state of the cell. Both Fe-SoxR and apo-SoxR bind to the promoter region, but only Fe-SoxR contributes towards promoter activation in the oxidised form. The redox state of the iron-sulphur cluster regulates the SoxR activity. The target gene of SoxR is the adjacent soxS, the sequence of which is deposited under numbers b4062, ECK4054 in the National Center for Biotechnology Information (NCBI) database of the National Library of Medicine (Bethesda, Md., USA). The reduction state of the cell can be promoted, if appropriate, by NADP(H)-dependent reductases, such as Rsx or RseC.
In this connection it is furthermore preferable for components i) and ii) to be formed by the intergenic region from E. coli, which is located between soxR and soxS and which comprises the SoxR binding sequence, the soxS promoter sequence following the SoxR binding sequence and a sequence following the soxS promoter sequence, which corresponds at the level of the mRNA to a ribosome binding site, or by a nucleic acid sequence homologous to this. Components i) and ii) in this context are preferably formed by a nucleic acid sequence selected from the group consisting of:
  • a) a nucleic acid sequence according to SEQ. ID. No. 01,
  • b) a nucleic acid sequence which has an identity of at least 70%, preferably at least 80%, still more preferably at least 85%, still more preferably at least 90%, still more preferably at least 91%, still more preferably at least 92%, still more preferably at least 93%, still more preferably at least 94%, still more preferably at least 95%, still more preferably at least 96%, still more preferably at least 97%, still more preferably at least 98% and most preferably at least 99% to the nucleic acid sequence of a), the nucleic acid sequence being able to bind SoxR such that the affinity of the RNA polymerase for the soxS promoter depends on the oxidation state of SoxR, and
  • c) a nucleic acid sequence which is capable of hybridising under stringent conditions with a complementary nucleic acid sequence according to a) or b), the nucleic acid sequence being able to bind SoxR such that the affinity of the RNA polymerase for the soxS promoter depends on the oxidation state of SoxR.
According to a first variant of this particularly preferred embodiment of the NADP(H) nanosensor according to the invention, this comprises
  • (α1) the E. coli gene for SoxR (soxR) or a nucleic acid sequence homologous to this;
  • (α2) the intergenic region from E. coli, following (α1), which is located between soxR and soxS and which comprises the SoxR binding sequence, the soxS promoter sequence following the SoxR binding sequence and a sequence following the soxS promoter sequence, which at the level of the mRNA corresponds to a ribosome binding site, or a nucleic acid sequence homologous to this, as defined above, as components i) and ii);
  • (α3) if appropriate a part sequence, following (α2), of the soxS gene from E. coli or a nucleic acid sequence homologous to this:
  • (α4) a nucleic acid sequence, which codes for an autofluorescent protein, following (α2) or (α3), preferably (α3) and which is under the control of the soxS promoter sequence, as component iii).
The wording “a sequence b) following a sequence a)” as used above and also in the following is to be understood according to the invention as meaning that the sequence b) does not necessarily have to be bonded directly to the sequence a), but that an intermediate sequence can also be located between sequence a) and sequence b).
According to this particular embodiment, the NADP(H) nanosensor comprises as component (α1) the E. coli gene for soxR (soxR) or a nucleic acid sequence homologous to this, component (α1) preferably being selected from the group consisting of:
  • a) a nucleic acid sequence according to SEQ. ID. No. 02,
  • b) a nucleic acid sequence coding for a polypeptide with an amino acid sequence according to SEQ. ID. No. 03,
  • c) a nucleic acid sequence which has an identity of at least 70%, preferably at least 80%, still more preferably at least 85%, still more preferably at least 90%, still more preferably at least 91%, still more preferably at least 92%, still more preferably at least 93%, still more preferably at least 94%, still more preferably at least 95%, still more preferably at least 96%, still more preferably at least 97%, still more preferably at least 98% and most preferably at least 99% to the nucleic acid sequence of a) or b), the nucleic acid sequence coding for a polypeptide which is capable of binding to the SoxR binding sequence in the intergenic region from E. coli which is located between soxR and soxS and the oxidation state thereof being capable of influencing the affinity of the RNA polymerase for the promoter sequence likewise located in the intergenic region from E. coli,
  • d) a nucleic acid sequence coding for a polypeptide which has a homology of at least 70%, preferably at least 80%, still more preferably at least 85%, still more preferably at least 90%, still more preferably at least 91%, still more preferably at least 92%, still more preferably at least 93%, still more preferably at least 94%, still more preferably at least 95%, still more preferably at least 96%, still more preferably at least 97%, still more preferably at least 98% and most preferably at least 99% to SEQ. ID. No. 03, the nucleic acid sequence coding for a polypeptide which is capable of binding to the SoxR binding sequence in the intergenic region from E. coli which is located between soxR and soxS and the oxidation state thereof being capable of influencing the affinity of the RNA polymerase for the promoter sequence likewise located in the intergenic region from E. coli, and
  • e) a nucleic acid sequence which is capable of hybridising under stringent conditions with a complementary nucleic acid sequence according to one of groups a) to d), the nucleic acid sequence coding for a polypeptide which is capable of binding to the SoxR binding sequence in the intergenic region from E. coli which is located between soxR and soxS and the oxidation state thereof being capable of influencing the affinity of the RNA polymerase for the promoter sequence likewise located in the intergenic region from E. coli.
The expression “homology” (or “identity”) as used herein can be defined by the equation H (%)=[1−V/X]×100, wherein H denotes homology, X is the total number of nucleobases/amino acids of the comparison sequence and V is the number of different nucleobases/amino acids of the sequence to be considered, with respect to the comparison sequence. In all cases, the term nucleic acid sequences which code for polypeptides includes all sequences which appear to be possible according to the proviso of degeneration of the genetic code.
The identity of nucleic acid sequences can be identified using a sequence comparison program (BLAST. Altschul et al. J. Mol. Biol. 1990, 215, 403-410). The percentage homology between two amino acid sequences can likewise be readily determined by the person skilled in the art using methods know from the prior art. A suitable program which can be employed according to the invention is BLASTp (Altschul et al., 1997; “Gapped BLAST and PSI-BLAST: a new generation of protein database search programs”; Nucleic Acids Res. 25(17): 3389-3402).
The person skilled in the art can find instructions for hybridisation inter alia in the handbook “The DIG System User's Guide for Filter Hybridization” of Boehringer Mannheim GmbH (Mannheim, Germany, 1993) and in Liebl et al. (International Journal of Systematic Bacteriology 41: 255-260 (1991)). The hybridisation takes place under stringent conditions, that is to say only hybrids in which the probe, for example the nucleotide sequence complementary to soxR or soxS or the intergenic region of soxRS from E. coli, and the target sequence, i.e. the polynucleotides treated with the probe, are at least 70% identical. It is known that the stringency of the hybridisation including the washing steps is influenced or determined by varying the buffer composition, the temperature and the salt concentration. The hybridisation reaction is in general carried out at a relatively low stringency compared with the washing steps (Hybaid Hybridisation Guide, Hybaid Limited, Teddington, UK, 1996). For the hybridisation reaction, for example, a buffer corresponding to 5×SSC buffer can be employed at a temperature of approx. 50° C.-68° C. In this context probes can also hybridise with polynucleotides which have less than 70% identity to the sequence of the probe. Such hybrids are less stable and are removed by washing under stringent conditions. This can be achieved, for example, by lowering the salt concentration to 2×SSC and if appropriate subsequently 0.5×SSC (The DIG System User's Guide for Filter Hybridization, Boehringer Mannheim, Mannheim, Germany, 1995), a temperature of approx. 50° C.-68° C. approx. 52° C.-68° C. approx. 54° C.-68° C., approx. 56° C.-68° C., approx. 58° C.-68° C. approx. 60° C.-68° C. approx. 62° C.-68° C. approx. 64° C.-68° C., approx. 66° C.-68° C. being established. Preferably, the washing steps are carried out at temperatures of approx. 62° C.-68° C., preferably of 64° C.-68° C. or approx. 66° C.-68° C. particularly preferably of approx. 66° C.-68° C. It is possible, where appropriate, to lower the salt concentration to a concentration corresponding to 0.2×SSC or 0.1×SSC. By increasing the hybridisation temperature stepwise in steps of approx. 1-2° C. from 50° C. to 68° C. polynucleotide fragments which code for soxR or soxS or the intergenic region of soxRS which have, for example, at least 70% or at least 80% or at least 90% to 95% or at least 96% to 98% or at least 99% identity to the sequence of the probe employed can be isolated. Further instructions for the hybridisation are obtainable on the market in the form of so-called kits (e.g. DIG Easy Hyb from Roche Diagnostics GmbH, Mannheim, Germany, catalogue no. 1603558).
The NADP(H) nanosensor according to this particular embodiment comprises as component (α4) a nucleic acid sequence which codes for an autofluorescent protein and which follows (α2) or α3), preferably the target gene soxS (α3), in particular the first 5 to 200 nucleotides of the target gene soxS, and is under the control the soxS promoter sequence, as component iii).
According to the invention, the gene sequence according to component iii) coding for the autofluorescent protein is under the control of the promoter sequence ii) (according to the first variant described above for the particular embodiment of the NADP(H) nanosensor according to the invention, the gene sequence (α4) coding for the autofluorescent protein is under the control of the soxS promoter sequence). The term “under control of the promoter sequence” in this context is preferably to be understood as meaning that the gene sequence coding for the auto fluorescent protein is functionally linked to the promoter. The promoter and the gene sequence coding for the autofluorescent protein are functionally linked if these two sequences and optionally further regulative elements, such as, for example, a terminator or a ribosome binding site, are arranged sequentially such that each of the regulative elements can fulfil its function in the transgenic expression of the nucleic acid sequence. For this, a direct linking in the chemical sense is not absolutely necessary. Genetic control sequences, such as, for example, enhancer sequences, can also exert their function on the target sequence from further removed positions or even from other DNA molecules. Arrangements in which the gene sequence coding for the autofluorescent protein is positioned alter the promoter sequence (i.e. at the 3′ end), so that the two sequences are bonded covalently to one another, are preferred. Preferably, in this context the distance between the gene sequence coding for the autofluorescent protein and the promoter sequence is less than 200 base pairs, particularly preferably less than 100 base pairs, very particularly preferably less than 50 base pairs. It is also possible for the gene sequence coding for the autofluorescent protein and the promoter to be linked functionally to one another such that there is still a part sequence of the homologous gene (that is to say that gene of which the expression in the wild-type cell is regulated by the promoter) between these two gene sequences (according to the particular embodiment of the NADP(H) nanosensor described above, pans of the soxS gene according to component (α3) can accordingly be between the soxS promoter sequence and the nucleic acid sequence (α4) coding for the autofluorescent protein). In the expression of such a DNA construct, a fusion protein is obtained from the autofluorescent protein and the amino acid sequence which is coded by the corresponding part sequence of the homologous gene (=translational fusion). The lengths of such part sequences of the homologous gene are not critical as long as the functional capacity of the autofluorescent protein, that is to say its property of being fluorescent when excited with light of a particular wavelength, is not noticeably impaired. In the case of the particular embodiment of the NADP(H) nanosensor according to the invention described above, the soxS part sequence (α3) preferably comprises at least the first 5 nucleotides, still more preferably at least the first 10 nucleotides and still more preferably at least the first 20 nucleotides, but preferably at most the first 200 nucleotides, still more preferably at most the first 150 nucleotides and still more preferably at most the first 100 nucleotides of the soxS gene.
The nucleic acid sequence (iii) (or (α4) and (β4)) coding for an autofluorescent protein preferably comprises genes coding for fluorescent proteins which code for fluorescent proteins of the genus Aequora, such as green fluorescent protein (GFP), and variants thereof which are fluorescent in a different wavelength range (e.g. yellow fluorescent protein (YFP), blue fluorescent protein (BFP), cyan fluorescent protein (CFP)) or of which the fluorescence is enhanced (e.g. enhanced green fluorescent protein (EGFP), enhanced yellow fluorescent protein (EYFP), enhanced blue fluorescent protein (EBFP) or enhanced cyan fluorescent protein (ECFP). Gene sequences which code for other autofluorescent proteins. e.g. DsRed, HcRed, AsRed, AmCyan, ZsGreen, AcGFP, ZsYellow, such as are known from BD Biosciences, Franklin Lakes, USA, can furthermore also be used according to the invention. A photoreceptor protein which contains a so-called LOV domain can likewise be used. The particularly preferred autofluorescent protein in this context is EYFP.
According to a second variant of the particularly preferred embodiment of the NADP(H) nanosensor according to the invention, this comprises
  • (β1) the E. coli gene for SoxR (soxR) or a nucleic acid sequence homologous to this;
  • (β2) the intergenic region from E. coli, following (β1), which is located between soxR and soxS and which comprises the SoxR binding sequence, the soxS promoter sequence following the SoxR binding sequence and a sequence following the soxS promoter sequence which at the level of the mRNA corresponds to a ribosome binding site, or a nucleic acid sequence homologous to this, as defined above, as components i) and ii);
  • (β3) the sequence of the soxS gene from E. coli following (β2) and under the control of the soxS promoter sequence, a part sequence of this gene or a nucleic acid sequence homologous to this;
  • (β′) a further sequence following (β3) which at the mRNA level corresponds to a ribosome binding site;
  • (β4) a nucleic acid sequence, which codes for an autofluorescent protein, following (β′) and which is under the control of the soxS promoter sequence, as component iii).
Components (β1), (β2, (β3) and (β4) which are preferred are those components which have already been mentioned above as preferred components (α1), (α2), (α3) and (α4) in connection with the first variant of the particularly preferred embodiment of the NADP(H) nanosensor according to the invention, During the expression of such a DNA construct, SoxS or a fragment of this protein and, separately from this, the autofluorescent protein are formed (=transcriptional fusion).
A contribution towards achieving the abovementioned objects is also made by a cell comprising an NADP(H) nanosensor according to the invention. In this context the NADP(H) nanosensor according to the invention can be present in the cell in the episomal or chromosomal form.
Examples of suitable cells which may be mentioned in particular are Escherichia coli, Pseudomonas fluorescens, Corynebacterium glutamicum, Bacillus subtilis or another Eubacterium, or also Saccharomyces cerevisiae or another yeast.
The cells according to the invention are suitable for establishing whether particular gene sequences code for an NADP(H)-dependent enzyme. For this, the gene coding for a potential NADP(H)-dependent enzyme is introduced into the cell and expressed. As described above, the emission of light by the cells is an indicator for the reduction state of the cell and consequently for the extent of the expression of NADP(H)-dependent enzymes.
In this context, according to the invention an “NADP(H)-dependent enzyme” is understood as meaning any enzyme which is involved in at least a part step of the conversion of a substrate into a reaction product which is chemically different from this substrate, NADP(H) being involved as a cofactor in at least one part step of this conversion.
According to a preferred embodiment of the cell according to the invention, this accordingly furthermore comprises, in addition to the NADP(H) nanosensor according to the invention, a plasmid with an optionally mutated gene which codes for an NADP(H)-dependent enzyme. The NADP(H)-dependent enzyme in this context is preferably selected from the group consisting of alcohol dehydrogenases, aldehyde dehydrogenases, lactate dehydrogenases, enoate reductases, epoxide reductases, diaminopimelate dehydrogenases, amino acid dehydrogenases, aldehyde oxidoreductases, alkane reductases, amine reductases, epoxide dehydrogenases, carboxylic acid dehydrogenases, hydroxy acid ketoreductases and hydroxy acid dehalogenases.
A contribution towards achieving the abovementioned objects is also made by a recombinant cell comprising a nucleic acid sequence coding for an autofluorescent protein, wherein the extent of the expression of the autofluorescent protein in the cell depends on the intracellular NADP(H) availability. In this connection particularly preferred cells are the cells described above, in particular cells comprising the NADP(H) sensor according to the invention.
A contribution towards achieving the abovementioned objects is also made by a method for isolating genes which code for NADP(H)-dependent enzymes, comprising the method steps:
  • (I) providing an NADP(H) nanosensor according to the invention;
  • (II) introducing the NADP(H) nanosensor into a cell;
  • (III) introducing a gene which may code for an NADP(H)-dependent enzyme into individual cells of a cell suspension of the cells obtained in method step (II);
  • (IV) incubating the cells with a substrate for the NADP(H)-dependent enzyme;
  • (V) identifying individual cells in the cell suspension with an increased activity of NADP(H)-dependent enzymes by detection of the intracellular fluorescence activity;
  • (VI) separating off the identified cells from the cell suspension;
  • (VII) isolating the genes coding for an NADP(H)-dependent enzyme in the identified cells.
New NADP(H)-dependent enzymes and mutated NADP(H)-dependent enzymes with increased or modified substrate recognition can be isolated with the aid of this method.
Sensors and cells which are preferred as the NADP(H) sensor and as the cell are those which have already been described above as preferred sensors or cells in connection with the sensor according to the invention or the cell according to the invention.
In method steps (I) and (II) a cell according to the invention is first prepared by introducing the NADP(H) nanosensor according to the invention into a cell, it being possible for this introduction to be carried out in the episomal or chromosomal form.
In method step (III) of the method according to the invention a gene which may code for an NADP(H)-dependent enzyme is then introduced into individual cells of a cell suspension of the cells obtained in method step (II), it being possible for the gene to be, in particular, a mutated, plasmid-coded gene of an NADP(H)-dependent enzyme. To introduce the site-nonspecific mutations into the plasmid-coded genes of the NADP(H)-dependent enzymes to increase the diversity, an in vitro mutagenesis is preferably carried out with the aid of an error-prone polymerase chain reaction (PCR) and an amplification technique. In this context the gene to be mutated is subjected to a PCR using a polymerase which, depending on the conditions of the reaction, incorporates individual bases incorrectly into the synthesized genes (Tindall, K. R, and T. A. Kunkel: “Fidelity of DNA synthesis by the Thermus aquaticus DNA polymerase”; Biochemistry, 1988, 27 (16), pages 6008-13). A frequent variant of this method comprises the use of manganese(II) ions or of nucleotide analogues in the PCR batch (Cadwell R. C et al. (1992); PCR Methods Appl. (2), pages 28-33/Leung D. W. et al. (1989) Techniques (I), pages 11-15). These techniques for introduction of mutations are called “error-prone PCR (epPCR)” (Labrou N E: “Random mutagenesis methods for in vitro directed enzyme evolution”: Curr. Protein. Pept. Sci. 2010 (11), pages: 91-100). The mutations can be, for example, point mutations, and e.g. substitutions, deletions or insertions can be generated by the polymerase. The mutation rate is between 1-40 mutations per 1 kb, preferably 1-5 mutations per 1 kb. However, mutations can also be produced with the aid of saturation mutagenesis using the Stratagene QuikChange Kit (La Jolla, Calif., USA), or also using a method called SeSam (EP 1 670 914 B1), with which any existing nucleotide is transferred under saturation into any possible nucleotide.
Possible NADP(H)-dependent enzymes of which the activity can be analysed with the nanosensor-carrying host in a high throughput are, for example, 1,2-dehydroreticulin reductases (1.5.1.27), 2-enoyl-CoA reductase (1.3.1.10), 2-enoyl-CoA reductases (1.3.1.39), alkenal/one oxidoreductases (1.3.1.74) cytochrome P450 reductase (1.6.2.4), NADP(H) dehydrogenases (1.6.99.1), NADP(H) dehydrogenases (flavin) (1.6.8.2), NADP(H) dehydrogenases (quinone) (1.6.5.10), NADP(H)-dependent 1,5-anhydro-D-fructose reductases (1.1.1.263), NADP(H)-dependent cytochrome P450 reductases (1.6.2.4), diaphorases (1.6.99.1), DT-diaphorases (1.6.5.5), ferredoxin reductases (1.18.1.2), NADP(H) oxidases (1.6.3.1, 1.6.5.10, 1.6.3.1, 1.6.3.1, 1.6.3.1), P450 oxidoreductase (1.6.2.4), P450 reductase (1.6.2.4), peroxidase (1.11.1.2), quinone acceptor oxidoreductase (1.6.5.5), quinone oxidoreductase (1.6.5.10), NADP(H)-specific FMN reductase (1.5.1.38), thioredoxin reductase (1.8.1.9), transhydrogenase (1.6.1.2), NADP(H)-aldehyde reductase (1.1.1.2), aldopentose reductase (1.1.1.21), NADP(H)-aldose reductase (1.1.1.21), NADP(H)-carbonyl reductase (1.1.1.184), NADP(H)-CYP reductase (1.6.2.4), NADP(H)-cytochrome c oxidoreductase (1.6.2.4), NADP(H)-cytochrome c reductase (1.1.1.2), NADP(H)-cytochrome f reductase (1.6.2.5), NADP(H)-cytochrome P450 reductase (1.6.2.4) and NADP(H)-cytochrome P450 reductase (1.14.13.68).
The plasmids which contain mutations in genes of the NADP(H)-dependent enzymes are then introduced into the microorganism, such as, for example, E. coli or C. glutamicum, by transformation. In this context the term “transformation” includes all methods for transfer of polynucleotides, in particular DNA, into a desired bacterium. These include inter alia the use of isolated DNA in transformation, electro transformation or electroporation, transfer by cell contact, as in conjugation, or transfer of DNA by means of particle bombardment.
After in process step (III) a gene which optionally codes for an NADP(H)-dependent enzyme has been introduced into individual cells of a cell suspension from the cells obtained in method (II) (and expressed), the cells are then incubated in method step (IV) with a substrate for an NADP(H)-dependent enzyme, and in method step (V) individual cells in the cell suspension with an increased activity of NADP(H)-dependent enzymes are then identified by detection of the intracellular fluorescence activity. For this, the cell suspension is exposed to electromagnetic radiation in that frequency which excites the autofluorescent protein of the NADP(H) nanosensor to emission of light.
In method step (VI) the identified cells are then separated off from the cell suspension, this separating off preferably being carried out by means of flow cytometry (FACS=fluorescence activated cell sorting), very particularly preferably by means of high throughput flow cytometry (HT-FACS=high throughput fluorescence activated cell sorting). Details on the analysis of cell suspensions by means of flow cytometry can be found, for example, in Sack U, Tarnok A. Rothe G (eds.): Zelluläre Diagnostik, Grundlagen, Methoden und klinische Anwendungen der Durchflusszytometric, Basel, Karger, 2007, pages 27-70.
In method step (VII) the genes coding for an NADP(H)-dependent enzyme in the identified cells are then isolated and if appropriate analysed, for example by isolating the enzyme-carrying plasmids from the cells which have been separated off and identifying and verifying, by sequencing, their mutation which lead to modified fluorescence.
A contribution towards achieving the abovementioned objects is also made by the use of the NADP(H) nanosensor according to the invention for identifying, in vivo, genes which code for an NADP(H)-dependent enzyme.
The invention is now explained in more detail with the aid of figures and non-limiting examples.
FIG. 1 shows the mode of functioning of the NADP(H) nanosensor according to the invention by the example of the particularly preferred embodiment described above.
FIG. 2 shows the specific fluorescence of the E. coli BL21(DE3) cells, prepared in Example 3, with the NADP(H) nanosensor according to the invention (pSensox) and expressed alcohol dehydrogenase (Lbadh) (solid squares). The fluorescence of the nanosensor pSennegK with inactive alcohol dehydrogenase is shown as a control (open squares).
FIG. 3 shows a diagram of the formation of the autofluorescent protein as transcriptional (top) and translational (bottom) fusion.
According to FIG. 1, the NADP(H) nanosensor can comprise the E. coli gene for SoxR (soxR), the intergenic region from E. coli following this, which is located between soxR and soxS and which comprises the soxR binding sequence and the soxS promoter sequence following the SoxR binding sequence, a part sequence of the soxS gene from E. coli (soxS′) following this and a nucleic acid sequence following this, under the control of the soxS promoter sequence, which codes for a autofluorescent protein (AFP). At a high cytosol NADP(H) concentration (top left in FIG. 1), the [2Fe-2S] clusters (rhomb) are present in a form reduced by SoxR bound to the promoter. At a low NADP(H) availability (top right in FIG. 1), the [2Fe-2S] clusters are oxidised, and the resulting distortion of the soxS promoter region renders transcription initiation of the target gene possible for the RNA polymerase. According to the invention the native target gene soxS is fused with an autofluorescent protein (AFP). NADP(H)-dependent enzymes cause increased expression of soxS′-AFP by consumption of NADP(H) and therefore increased fluorescence of cells as a result of increased NADP(H) consumption.
FIG. 3 shows at the top the transcriptional and at the bottom the translational fusion. In both cases a transcript is formed by the promoter PI, which is, for example, the soxS promoter controlled by SoxR. Whereas during transcriptional fusion two separate peptides are formed due to a second ribosome binding site (RBS), during translational fusion a single peptide is formed, the fusion protein, in which the autofluorescent protein contains additional amino acid sequences.
EXAMPLES Example 1
Construction of the NADPH Nanosensor (Transcriptional Fusion)
With the primer pairs SoxS_for_SphI (SEQ. ID. No. 04) and SoxR_rev_SalI (SEQ. ID. No. 05) and chromosomal DNA from E. coli DIS5α as the template, the gene soxR as amplified together with the intergenic region of soxR-soxS and the first 63 nucleotides of soxS.
SoxS_for_SphI:
ATCTGCATGCTTACGGCTGGCAATATGCTCGTC
SoxR rev SalI:
GCTAGTCGACCAAACTAAACCGCCCTTGTG
With the primer pairs EYFP_for_SphI (SEQ. ID. No. 06) and EYFP_rev_ClaI (SEQ. ID. No. 07) and the vector pSenLys as the template, the gene eyfp was amplified together with a ribosome binding site. The vector pSenLys is described in the patent application WO-A-2011/138006.
EYFP_for_SphI:
AGAGGCATGCAAGGAGAATTACATGGTGAGCAAGGGCGAGG
EYFP_rev_ClaI:
GCGCATCGATTTATTACTTGTACAGCTCGTCCATG
The vector pBtacLbadh codes for the NADPH-dependent alcohol dehydrogenase from Lactobacillus brevis (Lbadh). It is described in Ernst et al. (Ernst M, Kaup B, Müller M, Bringer-Meyer S, Sahm H, Appl. Microbiol. Biotechnol. 2005, 66(6), pages 629-34). The vector pBtacLbadh was treated with the restriction enzymes SalI and ClaI, and the vector fragment˜5.0 kb in size was isolated from the agarose gel and treated with alkaline phosphatase and purified with the QIAquick Gel Extraction Kit (cat. no. 28704) from Quiagen (Hilden, Germany). The two PCR products and the vector were then ligated by means of T4 DNA ligase from New England Biolabs (New England Biolabs, 240 County Road, Ipswich, Mass. 01938-2723). The ligation batch was transformed directly into the E. coli strain DH5α. Selection of plasmid-carrying cells was carried out by plating out the transformation batch on LB agar (Sambrook et al.: “Molecular cloning: a laboratory manual”, 2nd edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.), which had been supplemented with 50 mg/l of ampicillin. Plasmid DNA was isolated from a transformant and checked by treatment with the restriction enzyme BamHI with subsequent agarose gel electrophoresis. The plasmid was called pSenSox and is deposited as the sequence SEQ. ID. No. 08.
pSennegK was created as a derivative with modified alcohol dehydrogenase. Lbadh. For this, with the primers ADH_negK_for (SEQ. ID. No. 09) and ADH_negK_rev (SEQ. ID. No. 10) and again pBtacLbadh as the template, an inactive Lbadh was amplified with an alcohol dehydrogenase deleted by 221 bp. The resulting fragment was ligated with the ˜5.7 kb size vector fragment containing the gene eyfp together with a ribosome binding site. The sequence of the resulting vector is deposited as SEQ. ID. No. 11.
ADH_negK_for:
ACAAGAATTCGCTAAGAGTGTCGGCACTCC
ADH_negK_rev:
GGCCAAGCTTCCGAAGAAGACACCATCAAG
pSen-L194S was created as a further derivative with modified alcohol dehydrogenase. Lbadh. For this, with the primers L194S_for (SEQ. ID. No. 12) and L194S_rev (SEQ. ID. No. 13), pSenSox was amplified as a template for targeted insertion of the mutation. The plasmid generated was verified by means of sequencing. The sequence of the resulting vector is deposited as SEQ. ID. No. 14.
L194S_for:
CTGGCTACATCAAGCACCATCTGTTGATG
L194S_rev:
CGGCCCCTGGTAGGTCATCAACAGATGGTG
pSen-L194A was created as a further derivative with modified alcohol dehydrogenase, Lbadh. For this, with the primers L194A_for (SEQ. ID. No. 15) and L194A_rev (SEQ. ID. No. 16), pSenSox was amplified as a template for targeted insertion of the mutation. The plasmid generated was verified by means of sequencing. The sequence of the resulting vector is deposited as SEQ. ID. No. 17.
L194A_for:
CTGGCTACATCAAGACACCAGCGGTTGATG
L194A_rev:
CGGCCCCTGGTAGGTCATCAACCGCTGGTG
Example 2
Use of the NADP(H) Nanosensor for Monitoring Alcohol Dehydrogenase-Dependent Product Formation
E. coli BL21(DE3) (Life Technologies GmbH, Frankfurter Straβe 129B, 64293 Darmstadt) was transformed with the plasmid pSenSox. 5 ml of 2×YT medium (16 g/l of tryptone, 10 g/l of yeast extract. 5 g/l of NaCl) was inoculated with an individual colony and the culture was incubated overnight at 37° C. and 130 rpm. Using this preculture the main culture was inoculated to an OD of 0.05 in 50 ml of 2×TY and was incubated at 37° C. and 130 rpm. At the OD of 0.31 mM IPTG was added and the culture was incubated for a further 3 hours to an OD of 5-6.
0.9 ml portions of the cell suspension were then introduced into a reaction vessel of the Flowerplate microtiter plate (48-well) of the BioLector cultivation system (m2plabs GmbH, Aachen, Germany). Methyl acetoacetate (MAA) was added to the cell suspension in increasing concentration in a constant volume of 0.1 ml. The Flowerplate microtiter plate was then incubated at 30° C. 1,200 rpm, shaking radius 3 mm. In the BioLector cultivation system the growth was recorded online as scattered light at 620 nm, and the fluorescence of the culture was recorded continuously at an excitation wavelength of 485 nm and an emission wavelength of 520 nm. The specific fluorescence after 10 hours was plotted against the amount of MAA added and is shown in FIG. 2 (0-70 mM methyl acetoacetate was added to individual batches and after 10 hours the specific fluorescence was determined, this being shown as squares filled with black; E. coli BL21(DE3) pSennegK with inactive Lbadh served as a negative control (empty squares). FIG. 2 shows an increase in the fluorescence with increasing MAA concentration. This increase is due to pSenSox, since a control reaction with the plasmid pSennegK with inactive alcohol dehydrogenase, which, however, is otherwise identical to pSenSox, causes no increase in fluorescence.
Example 3
Use of the NADP(H) Nanosensor for Determining Different Alcohol Dehydrogenase Activities
The strain E. coli BL21(DE3) (Life Technologies GmbH, Frankfurter Stralβe 129B, 64293 Darmstadt) was transformed in each case with pSennegK, pSen-L194S and pSen-L194A. In addition, the strain E. coli BL21(DE3) pSenSox described in Example 2 was transformed with pET28a as the second plasmid. The vector mentioned last was obtained from Novagen (Life Technologies GmbH. Frankfurter Straβe 129B, 64293 Darmstadt), 5 ml of 2×YT medium (16 g/l of tryptone, 10 g/l of yeast extract, 5 g/l of NaCl) was inoculated with an individual colony of the particular strain and the culture was incubated overnight at 37° C. and 130 rpm. Using this preculture the main culture was inoculated to an OD of 0.05 in 50 ml of 2×TY and was incubated at 37° C. and 130 rpm. At the OD of 0.3 no IPTG was added or 1 mM IPTG was added to the strain E. coli BL21(DE3) pSenSox and the culture was incubated for a further 3 hours to an OD of 5-6.
As described in Example 2, 0.9 mil portions of the cells were then each introduced into a reaction vessel of the Flowerplate microtiter plate (48-well) of the BioLector cultivation system (m2plabs GmbH, Aachen, Germany). Methyl acetoacetate (MAA) was in each case added, in 0.1 ml, to the cell suspension to a final concentration of 40 mM. The Flowerplate microtiter plate was then incubated at 30° C., 1,200 rpm, shaking radius 3 mm, and the specific fluorescence was determined. The specific fluorescence obtained after 19 hours is shown in Table 1.
In addition, the alcohol dehydrogenase activity of the recombinant E. coli cells was determined in the individual batches. For this, the cells were harvested at 10.000×g, 4° C., 5 min and taken up in 100 mM potassium phosphate buffer, pH 6.5, 1 mM dithiothreitol, 1 mM MgCl2. The cells were broken down by means of the Silamat S5 (Ivoclar Vivadent GmbH, Germany) with the aid of glass beads of 0.1 mm diameter. The crude extract which was obtained after centrifugation at 16.000×g, 4° C., 20 min was employed in the enzyme test for quantification of the alcohol dehydrogenase activity. The test contained 5 mM methyl acetoacetate, 0.25 mM NADPH and 1 mM MgCl2 in 100 mM potassium phosphate buffer, pH 6.5, and 0.01-0.1 ml of crude extract. The reduction of NADP(H) was monitored at 340 nm and 30° C. An enzyme unit (U) is stated as that amount of crude extract which reduces 0.001 mmol of NADP(H) per minute. It is likewise given in Table 1.
Example 4
Isolation of Mutated Alcohol Dehydrogenase with Modified Substrate Recognition
The alcohol dehydrogenase Lbadh from Lactococcus lactis has a high activity with methyl acetoacetate, but only a low activity of about 10% with 4-methyl-2-pentanone as the substrate. In order to evolve an Lbadh with a higher activity, random mutations were inserted into pSenSox by error-prone PCR (epPCR). To insert the mutations, 10 ng of pSenSox were employed as the template per reaction, as well as 0.1-0.8 mM Mn2+, at the lower concentrations of below <0.2 mM Mn2+ a total concentration of at least 0.2 mM being established with Mg2+, 0.5 μl of Taq polymerase from Fermentas (catalogue no. EP0401) was added per reaction. The polynucleotides
SEQ. ID. No. 18:
ACAAGAATTCGCTAAGAGTGTCGGCACTCC
SEQ. ID. No. 19:
GGCCAAGCTTCCGAAGAAGACACCATCAAG

were used as primers. The reactions were incubated for 30 minutes. The reaction products were then treated with BamHI and SalI and ligated with the vector pSenSox likewise treated beforehand.
E. coli DH5αmer was transformed with the ligation products (Grant, 1990, Proceedings of the National Academy of Sciences, USA, 87, pages 4645-4649). After incubation for 30 h. transformants were washed off from the plates with 10 ml of 2×YT and diluted tenfold in fresh 2×YT medium. After incubation for 4 hours at 37° C., 20 mM 4-methyl-2-pentanone was added as the substrate, and after a further incubation for three hours the batches were sent for FACS analysis and sorting.
For FACS analysis and sorting of the cells with high fluorescence, the cell suspension in 2×YT medium was adjusted to an optical density of less than 0.1 and passed immediately to the FACS ARIA II high-speed cell sorter (Becton Dickinson GmbH, Tullastr. 8-12, 69126 Heidelberg). The analysis was carried out with the excitation wavelengths of 488 and 633 nm and the detection at the emission wavelengths of 530±15 nm and 660±10 nm under a sample pressure of 70 psi. The data were analysed with the software version BD DIVA 6.1.3 belonging to the apparatus. BD FACSflow was used as the sheath fluid. The electronic gating was set with the aid of the forward and backward scatter in order to exclude non-bacterial particles. In order to sort EYFP-positive cells, the next level of the electronic gating was selected, in order to exclude non-fluorescent cells. In this manner, 123 fluorescent cells were sorted out on Petri dishes which contained 2×YT medium.
Reaction vessels of the Flowerplate microtiter plate (48-well) of the BioLector cultivation system (m2plabs GmbH, Aachen, Germany) were inoculated, as described in Example 2, with the colonies obtained after incubation for 30 hours at 37° C. However, 20 mM 4-methyl-2-pentanone and not methyl acetoacetate was used as the substrate. After 120 minutes the specific fluorescence was quantified, and a clone was selected, the alcohol dehydrogenase activity of which was determined in the enzyme test as described in Example 3, 20 mM 4-methyl-2-pentanone was used as the substrate here.
The mutant with the plasmid pSen-A93M obtained in this way has a specific activity increased by 26% compared with the starting strain (Table 2), and a conversion rate with 4-methyl-2-pentanone as the substrate increased by 37%. The sequence of the plasmid pSen-A93M is deposited as SEQ. ID. No. 20.
TABLE 1
Correlation of the alcohol dehydrogenase activity
of whole cells with the specific fluorescence.
Alcohol dehydrogenase Specific
Strain IPTG activity (U mg−1) fluorescence
BL21(DE3) pSennegK 0.03 ± 0.01 0.06
BL21(DE3) pSenSox, 0.5 ± 0.1 0.09
pET28a
BL21(DE3) pSenL194S 0.7 ± 0.3 0.11
BL21(DE3) pSenL194A 2.7 ± 0.6 0.17
BL21(DE3) pSenSox 6.2 ± 0.6 0.38
BL21(DE3) pSenSox + 15.2 ± 2.0  0.45
TABLE 2
Increase in the activity and conversion rate of the alcohol
dehydrogenase isolated by means of the NADP(H) nanosensor
and FACS with 4-methyl-2-pentanone as the substrate.
Alcohol dehydrogenase vmax KM
Strain activity (U mg−1) (U mg−1) (mM)
DH5α pSensox 1.9 ± 0.2 1.9 ± 0.02 0.10 ± 0.01
DH5α pSenA93M 2.4 ± 0.1 2.6 ± 0.03 0.88 ± 0.03
Example 5
Construction of the NADPH Nanosensor (Translational Fusion)
With the primer pairs SoxS_for_SphI_tl (SEQ. ID. No. 21) and SoxR_rev_SalI_tl (SEQ. ID. No. 22) and chromosomal DNA from E. coli DH5α as the template, the gene soxR was amplified together with the intergenic region of soxR-soxS and the first 63 nucleotides of soxS.
SoxS_for_SphI_tl:
ATCTGCATGCCGGCTGGTCAATATGCTCGTC
SoxR_rev_SalI_tl:
GCTAGTCGACCAAACTAAAGCGCCCTTGTG
With the primer pairs EYFP_for_SphI_tl (SEQ. ID. No. 23) and EYFP_rev_ClaI_tl (SEQ. ID. No. 24) and the vector pSenLys as the template, the gene eyfp was amplified. The vector pSenLys is described in the patent application WO-A-2011/138006.
EYFP_for_SphI_tl:
AGAGGCATGCGTGAGCAAGGGCGAGG
EYFP_rev_ClaI_tl:
GCGCATCGATTTATTACTTGTACAGCTCGTCATG
The vector pBtacLbadh codes for the NADPH-dependent alcohol dehydrogenase from Lactobacillus brevis (Lbadh). It is described in Ernst et al. (Ernst M, Kaup B. Müller M. Bringer-Meyer S, Sahm H, Appl. Microbiol. Biotechnol. 2005, 66(6), pages 629-34). The vector pBtacLbadh was treated with the restriction enzymes SalI and ClaI, and the vector fragment˜5.0 kb in size was isolated from the agarose gel and treated with alkaline phosphatase and purified with the QIAquick Gel Extraction Kit (cat. no. 28704) from Quiagen (Hilden, Germany). The two PCR products and the vector were then ligated by means of T4 DNA ligase from New England BioLabs (New England Biolabs, 240 County Road, Ipswich, Mass. 01938-2723). The ligation batch was transformed directly into the E. coli strain DH5α. Selection of plasmid-carrying cells was carried out by plating out the transformation batch on LB agar (Sambrook et al.: “Molecular cloning: a laboratory manual”, 2nd edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.), which had been supplemented with 50 mg/l of ampicillin. Plasmid DNA was isolated from a transformant and checked by treatment with the restriction enzyme BamHI with subsequent agarose gel electrophoresis. The plasmid was called pSenSox_tl and is deposited as the sequence SEQ. ID. No. 25.

Claims (6)

The invention claimed is:
1. A cell comprising an NADPH(H) nanosensor, wherein the NADP(H) nanosensor comprises:
i) a nucleic acid to which a regulator is capable of binding, wherein the oxidation state of the regulator depends on the cell's intra-cellular NADP(H) availability;
ii) a promoter following the nucleic acid i), to which an RNA polymerase is capable of binding, wherein the affinity of the RNA polymerase for the promoter is influenced by the oxidation state of the regulator;
iii) a nucleic acid which is under the control of the promoter ii) and which codes for an autofluorescent protein, wherein the autofluorescent protein is selected from the group consisting of green fluorescent protein (GFP), yellow fluorescent protein (YFP), blue fluorescent protein (BFP), cyan fluorescent protein (CFP), enhanced green fluorescent protein (EGFP), enhanced yellow fluorescent protein (EYFP), enhanced blue fluorescent protein (EBFP), enhanced cyan fluorescent protein (ECFP), DsRed, HcRed, AsRed, Am Cyan, ZsGreen, AcGFP and Zs Yellow, or a photoreceptor protein which contains a LOY domain,
wherein components i) and ii) together have a nucleic acid sequence according to SEQ. ID. No. 01,
wherein the NADP(H) nanosensor is present in the cell in the episomal form,
wherein the cell, in addition to the NADP(H)-nanosensor, comprises a gene which codes for an NADP(H)-dependent enzyme that has been introduced into the cell, and
wherein the cell is Escherichia coli (E. coli).
2. The cell according to claim 1, wherein the NADP(H) nanosensor comprises:
(α1) the E. coli gene for SoxR (soxR);
(α2) components i) and ii) downstream of (α1);
(α3) at least the first 5 nucleotides of the soxS gene from E. coli following (α2);
(α4) a nucleic acid which codes for an autofluorescent protein, following (α2) or (α3) and which is under the control of the soxS promoter, as component iii).
3. The cell according to claim 1, wherein the NADP(H) nanosensor comprises:
(β1) the E. coli gene for SoxR (soxR);
(β2) components i) and ii) downstream of (β1);
(β3) the soxS gene from E. coli following (β2) and under the control of the soxS promoter or a part of this gene;
(β3′) a further nucleic acid following (β3) which at the mRNA level corresponds to a ribosome binding site;
(β4) a nucleic acid, which codes for an autofluorescent protein, following (β3′) and which is under the control of the soxS promoter, as component iii).
4. The cell according to claim 2 or 3, wherein component (α1) or (β1) is selected from the group consisting of:
a) a nucleic acid sequence according to SEQ. ID. No. 02, and
b) a nucleic acid sequence coding for a polypeptide with an amino acid sequence according to SEQ. ID. No. 03.
5. The cell according to claim 1, wherein the nucleic acid (iii) which codes for an auto fluorescent protein is the gene coding for enhanced yellow fluorescent protein (EYFP).
6. The cell according to claim 1, wherein the NADP(H) dependent enzyme is selected from the group consisting of alcohol dehydrogenases, aldehyde dehydrogenases, lactate dehydrogenases, enoate reductases, epoxide reductases, diaminopimelate dehydrogenases, amino acid dehydrogenases, aldehyde oxidoreductases, alkane reductases, amine reductases, epoxide dehydrogenases, carboxylic acid dehydrogenases, hydroxy acid ketoreductases and hydroxy acid dehalogenases.
US14/424,559 2012-08-28 2013-08-16 Sensor for NADP (H) and development of alcohol dehydrogenases Active 2034-12-18 US10385349B2 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
DE102012017026.2 2012-08-28
DE102012017026.2A DE102012017026A1 (en) 2012-08-28 2012-08-28 Sensor for NADP (H) and development of alcohol dehydrogenases
DE102012017026 2012-08-28
PCT/EP2013/002481 WO2014032777A1 (en) 2012-08-28 2013-08-16 Sensor for nadp (h) and development of alcohol dehydrogenases

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2013/002481 A-371-Of-International WO2014032777A1 (en) 2012-08-28 2013-08-16 Sensor for nadp (h) and development of alcohol dehydrogenases

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US16/518,544 Division US11875298B2 (en) 2012-08-28 2019-07-22 Sensor for NADP (H) and development of alcohol dehydrogenases

Publications (2)

Publication Number Publication Date
US20150299715A1 US20150299715A1 (en) 2015-10-22
US10385349B2 true US10385349B2 (en) 2019-08-20

Family

ID=49034040

Family Applications (2)

Application Number Title Priority Date Filing Date
US14/424,559 Active 2034-12-18 US10385349B2 (en) 2012-08-28 2013-08-16 Sensor for NADP (H) and development of alcohol dehydrogenases
US16/518,544 Active 2036-06-22 US11875298B2 (en) 2012-08-28 2019-07-22 Sensor for NADP (H) and development of alcohol dehydrogenases

Family Applications After (1)

Application Number Title Priority Date Filing Date
US16/518,544 Active 2036-06-22 US11875298B2 (en) 2012-08-28 2019-07-22 Sensor for NADP (H) and development of alcohol dehydrogenases

Country Status (9)

Country Link
US (2) US10385349B2 (en)
EP (1) EP2890810B1 (en)
JP (1) JP6228982B2 (en)
CN (1) CN104781419B (en)
DE (1) DE102012017026A1 (en)
DK (1) DK2890810T3 (en)
ES (1) ES2645467T3 (en)
HU (1) HUE034622T2 (en)
WO (1) WO2014032777A1 (en)

Families Citing this family (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE102012017026A1 (en) * 2012-08-28 2014-03-06 Forschungszentrum Jülich GmbH Sensor for NADP (H) and development of alcohol dehydrogenases
DE102012024435A1 (en) 2012-12-14 2014-07-10 Forschungszentrum Jülich GmbH A method of identifying a cell having an intracellular concentration of a particular metabolite which is higher than its wild type, wherein the alteration of the cell is achieved by recombining, and a method of producing a genetically modified cell of its wild type with optimized production of a particular metabolite, a method of Production of this metabolite, as well as suitable nucleic acids
WO2015117232A1 (en) * 2014-02-06 2015-08-13 The University Of British Columbia Methods for sequential screening with co-culture based detection of metagenomic elements conferring heterologous metabolite secretion
CN106047826B (en) * 2016-07-06 2019-08-20 华东理工大学 Aldehyde dehydrogenase, its recombinant expression transformants and the application in the synthesis of statin precursor
KR101997841B1 (en) * 2016-11-04 2019-07-08 한국과학기술원 Genetic Circuit Containg SoxRS varient and Screening Method of thereof
CN108132318B (en) * 2016-12-01 2021-03-09 山东蓝康药业股份有限公司 NADPH separation and purification method
WO2018106932A2 (en) * 2016-12-07 2018-06-14 University Of Maryland, College Park Compositions and methods for electronic control of gene expression
CN110229828B (en) * 2019-05-31 2022-03-15 天津大学 Mutant gene soxR of escherichia coli global regulatory factor and application thereof
CN110982832B (en) * 2019-11-12 2021-09-24 北京理工大学 A kind of radiation biological dosimeter, preparation method and application

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1525163A (en) 2003-09-17 2004-09-01 中国科学院长春应用化学研究所 Preparation method of deoxyribonucleic acid electrochemical nanosensor
US20050067303A1 (en) 2002-02-22 2005-03-31 Isis Innovation Limited Electrochemical detection of nadh or naph
CN101305280A (en) 2005-06-10 2008-11-12 吉卢比有限公司 Diagnostic nanosensors and their use in medicine
CN101386828A (en) 2008-07-09 2009-03-18 温州医学院 Reporting bacterial strain sensitive to oxidation-reduction cycle reactant and preparation method thereof
CN102517378A (en) 2011-11-16 2012-06-27 浙江工业大学 Screening and identification method of alcohol dehydrogenase based on NAD (Nicotinamide Adenine Diuncleotide) (P) (Phosphate) H (Hydrogen) fluorescence

Family Cites Families (32)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPS57163341A (en) 1981-03-30 1982-10-07 Sumitomo Chem Co Ltd Preparation of racemized cyclopropanecarboxylic acid derivative
JP3155107B2 (en) 1993-01-12 2001-04-09 ダイセル化学工業株式会社 Method for producing optically active 4-halo-3-hydroxybutyrate
JPH08336393A (en) 1995-04-13 1996-12-24 Mitsubishi Chem Corp Process for producing optically active γ-substituted-β-hydroxybutyric acid ester
US5891685A (en) 1996-06-03 1999-04-06 Mitsubishi Chemical Corporation Method for producing ester of (S)-γ-halogenated-β-hydroxybutyric acid
DE19857302C2 (en) 1998-12-14 2000-10-26 Forschungszentrum Juelich Gmbh Process for the enantioselective reduction of 3,5-dioxocarboxylic acids, their salts and esters
SI20642A (en) 1999-12-03 2002-02-28 Kaneka Corporation Novel carbonyl reductase, gene thereof and method of using the same
US7202070B2 (en) 2000-10-31 2007-04-10 Biocatalytics, Inc. Method for reductive amination of a ketone using a mutated enzyme
MXPA03008437A (en) 2001-03-22 2004-01-29 Bristol Myers Squibb Co Stereoselective reduction of substituted acetophenone.
DE10152113C1 (en) 2001-10-23 2003-03-06 Viatris Gmbh Alkyl (R)- or (S)-8-chloro-6-hydroxy-octanoate preparation, for use as intermediate for (R)- or (S)-alpha-lipoic acid, by enzymatic reduction of 6-oxo compound using alcohol dehydrogenases or carbonyl reductase
GB0311902D0 (en) 2003-05-22 2003-06-25 Cambridge Life Sciences Assay method and apparatus
DE10327454A1 (en) 2003-06-18 2005-01-20 Juelich Enzyme Products Gmbh Oxidoreductase from Pichia capsulata
ATE384789T1 (en) 2003-10-02 2008-02-15 Basf Ag METHOD FOR SEQUENCE SATURATION MUTAGENesis (SESAME)
EP1712633A1 (en) 2003-12-02 2006-10-18 Mercian Corporation Process for producing optically active tetrahydrothiophene derivative and method of crystallizing optically active tetrahydrothiophen-3-ol
AT413541B (en) 2004-05-10 2006-03-15 Iep Gmbh PROCESS FOR THE PREPARATION OF 2-BUTANOL
DE102005010804A1 (en) 2005-03-07 2006-09-14 Basf Ag Process for the preparation of optically active alcohols
EP1896574A2 (en) 2005-03-28 2008-03-12 BioCatalytics Inc. D-amino acid dehydrogenase and method of making d-amino acids
WO2006130657A2 (en) 2005-05-31 2006-12-07 Bristol-Myers Squibb Company Stereoselective reduction process for the preparation of pyrrolotriazine compounds
DE102005028312B4 (en) 2005-06-18 2008-05-08 Archimica Gmbh Process for the preparation of enantiomerically pure epoxides by ADH reduction of α-leaving group-substituted ketones and cyclization
DE102006023083A1 (en) 2006-05-16 2007-11-22 Jacobs University Bremen Ggmbh Determination of concentration changes
EP1894999A1 (en) 2006-09-01 2008-03-05 Basf Se Process for enzymatic reduction of alkyne derivatives
GB0619240D0 (en) 2006-09-29 2006-11-08 Almac Sciences Ltd Reduction of alpha-halo ketones
AT504542B1 (en) 2006-12-07 2008-09-15 Iep Gmbh METHOD FOR THE ENANTIOSELECTIVE ENZYMATIC REDUCTION OF SECODION DERIVATIVES
KR101502634B1 (en) 2007-02-08 2015-03-16 코덱시스, 인코포레이티드 Ketoreductases and uses thereof
US9034613B2 (en) 2009-04-16 2015-05-19 Isis Innovation Limited Process for the preparation of (3R)-hydroxybutyl (3R)-hydroxybutyrate by enzymatic enantioselective reduction employing Lactobacillus brevis alcohol dehydrogenase
DE102010019059A1 (en) 2010-05-03 2011-11-03 Forschungszentrum Jülich GmbH Sensors for intracellular metabolite detection
EA201300325A1 (en) 2010-09-10 2013-08-30 ДСМ АйПи АССЕТС Б.В. OBTAINING 6-AMINOCAPRONIC ACID FROM ALPHA-KETOPYMELINIC ACID
EP2441771A1 (en) 2010-10-13 2012-04-18 PharmaZell GmbH New 12alpha-hydroxysteroid dehydrogenase mutants, method for their manufacture and application thereof
EP2643467A1 (en) 2010-11-24 2013-10-02 Basf Se Method for producing n-heterocyclic optically active alcohols
DE102012017026A1 (en) * 2012-08-28 2014-03-06 Forschungszentrum Jülich GmbH Sensor for NADP (H) and development of alcohol dehydrogenases
US9044530B2 (en) 2012-12-19 2015-06-02 Southwest Research Institute Fabrication of bone regeneration scaffolds and bone filler material using a perfusion flow system
AU2014225458A1 (en) 2013-03-07 2015-07-09 Allosource Consistent calcium content bone allograft systems and methods
CN105636600A (en) 2013-09-02 2016-06-01 玛芬股份有限公司 Cell seeding compositions and methods for treating bone regions

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050067303A1 (en) 2002-02-22 2005-03-31 Isis Innovation Limited Electrochemical detection of nadh or naph
JP2005517960A (en) 2002-02-22 2005-06-16 アイシス・イノベーション・リミテッド Electrochemical detection of NADH or NAPH
CN1525163A (en) 2003-09-17 2004-09-01 中国科学院长春应用化学研究所 Preparation method of deoxyribonucleic acid electrochemical nanosensor
CN101305280A (en) 2005-06-10 2008-11-12 吉卢比有限公司 Diagnostic nanosensors and their use in medicine
CN101386828A (en) 2008-07-09 2009-03-18 温州医学院 Reporting bacterial strain sensitive to oxidation-reduction cycle reactant and preparation method thereof
CN102517378A (en) 2011-11-16 2012-06-27 浙江工业大学 Screening and identification method of alcohol dehydrogenase based on NAD (Nicotinamide Adenine Diuncleotide) (P) (Phosphate) H (Hydrogen) fluorescence

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
D'Autreaux et al.; "ROS as signaling molecules: Mechanisms that generate specificity in ROS homeostasis"; Nature Reviews Molecular Cell Biology; vol. 8, Oct. 2007; pp. 813-824.
Kabir et al.; "Investigation into the effect of soxR and soxS genes deletion on the central metabolism of Escherichia coli based on gene expressions and enzyme activities"; Biochemical Engineering Journal; vol. 30; No. 1; May 1, 2006; pp. 39-47.
Kim Yang Hee et al.; "Iron oxide/carbon black (Fe2O3/CB) composite electrode for the detection of reduced nicotinamide cofactors using an amperometric method under a low overpotential"; Biosensors and Bioelectronics; vol. 25; No. 5; Jan. 2010; pp. 1160-1165.
Kobayashi Kazuo et al.; "Activation of SoxR-Dependent Transcription in Pseudomonas aeruginosa"; Journal of Biochemistry; vol. 136; No. 5; Nov. 2004; pp. 607-615.
Krapp et al.; "The soxRS Response of Escherichia coli can be induced in the absence of oxidative stress and oxygen by modulation of NADPH content"; Microbiology; vol. 157; No. Part 4; Apr. 2011; pp. 957-965.
Lee Jin Hyung et al.; "An oxidative stress-specific bacterial cell array chip for toxicity analysis"; Biosensors and Bioelectronics; vol. 22; No. 9-10; Apr. 2007; pp. 2223-2229.
Lu et al.; "Quantitative and Kinetic Study of Oxidative Stress Regulons Using Green Fluorescent Protein"; Wiley InterScience; Jan. 25, 2005; pp. 574-587.
Mauri et al., Vascular Cell Adhesion Molecule-1 (VCAM-1) Gene Transcription and Expression Are Regulated through an Antioxidant-sensitive Mechanism in Human Vascular Endothelial Cells; J Clin. Invest. vol. 92, pp. 1866-1874, 1993. *

Also Published As

Publication number Publication date
EP2890810B1 (en) 2017-08-02
US11875298B2 (en) 2024-01-16
EP2890810A1 (en) 2015-07-08
US20230297924A9 (en) 2023-09-21
US20200027049A1 (en) 2020-01-23
CN104781419A (en) 2015-07-15
DE102012017026A1 (en) 2014-03-06
ES2645467T3 (en) 2017-12-05
CN104781419B (en) 2018-09-11
JP2015528287A (en) 2015-09-28
JP6228982B2 (en) 2017-11-08
US20150299715A1 (en) 2015-10-22
DK2890810T3 (en) 2017-11-13
WO2014032777A1 (en) 2014-03-06
HUE034622T2 (en) 2018-02-28

Similar Documents

Publication Publication Date Title
CN104781419B (en) The research and development of NADP (H) sensor and alcohol dehydrogenase
JP6911066B2 (en) Flavin-linked glucose dehydrogenase, method for producing flavin-linked glucose dehydrogenase, and method for measuring glucose using the same.
CN108779429B (en) Functional expression of monooxygenases and methods of use
JP7042085B2 (en) Cytochrome fusion glucose dehydrogenase and glucose measurement method
JP2002522072A (en) DNA shuffling of monooxygenase gene for production of industrial chemicals.
JP7186261B2 (en) Biotechnological production of ω-functionalized carboxylic acids and their esters
CN113583989B (en) Modified threonine transaldolase and application thereof
JP7084867B2 (en) Flavin-bound glucose dehydrogenase variant
KR20200010285A (en) Genomic Engineering of Biosynthetic Pathways Inducing Increased NADPH
KR20210144816A (en) Methods for Construction of Chimeric Plasmid Libraries
JP2003533228A (en) Directed evolution of oxidase enzymes
CA2349868A1 (en) Cytochrome p450 monooxygenase and nadph cytochrome p450 oxidoreductase genes and proteins related to the omega hydroxylase complex of candida tropicalis and methods relating thereto
Qin et al. Directed evolution of Baeyer–Villiger monooxygenase for highly secretory expressed in Pichia pastoris and efficient preparation of chiral pyrazole sulfoxide
CN116496997A (en) Carbonyl reductase mutant and application thereof
WO2011011292A2 (en) Combinatorial methods for optimizing engineered microorganism function
JP6934720B2 (en) Flavin-bound glucose dehydrogenase with improved substrate specificity
JP5622321B2 (en) Thermostable 1,5-anhydroglucitol dehydrogenase and method for measuring 1,5-anhydroglucitol using the same
KR102690858B1 (en) A recombinant microorganism capable of growing solely on CO2 and formic acid and a method of producing useful materials using the same
JP6392534B2 (en) Protein having leucine acid production activity and use thereof
JP2018201486A (en) Glucose dehydrogenase with high storage stability and continuous glucose monitoring
JP2003310274A (en) Glucose dehydrogenase and gene encoding the same
US20060094099A1 (en) Inactivated enzyme variants and associated process and reagent system
KR102067475B1 (en) Gene Circuit for Selecting 3-Hydroxypropionic Acid Using Responding 3-Hydroxypropionic Acid Transcription Factor and Method for Screening of 3-Hydroxypropionic Acid Producing Strain
KR102194697B1 (en) Gene Circuit for Selecting 3-Hydroxypropionic Acid Using Responding 3-Hydroxypropionic Acid Transcription Factor and Method for Screening of 3-Hydroxypropionic Acid Producing Strain
CN113677795A (en) Novel DAHP synthase

Legal Events

Date Code Title Description
AS Assignment

Owner name: FORSCHUNGSZENTRUM JULICH GMBH, GERMANY

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:SIEDLER, SOLVEJ;SCHENDZIELORZ, GEORG;BINDER, STEPHAN;AND OTHERS;SIGNING DATES FROM 20150317 TO 20150320;REEL/FRAME:035661/0813

STPP Information on status: patent application and granting procedure in general

Free format text: RESPONSE TO NON-FINAL OFFICE ACTION ENTERED AND FORWARDED TO EXAMINER

STPP Information on status: patent application and granting procedure in general

Free format text: NOTICE OF ALLOWANCE MAILED -- APPLICATION RECEIVED IN OFFICE OF PUBLICATIONS

STPP Information on status: patent application and granting procedure in general

Free format text: PUBLICATIONS -- ISSUE FEE PAYMENT VERIFIED

STCF Information on status: patent grant

Free format text: PATENTED CASE

MAFP Maintenance fee payment

Free format text: PAYMENT OF MAINTENANCE FEE, 4TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1551); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

Year of fee payment: 4