TW201125583A - Anti-EpCAM antibodies that induce apoptosis of cancer cells and methods using same - Google Patents

Abstract

The present invention provides antibodies (such as chimeric and humanized antibodies) specifically bind to epithelial cell adhesion/activating molecule EpCAM expressed on cancer cells and induce cancer cell apoptosis. In addition, the present invention also provides use of the antibodies described herein for diagnostic and therapeutic purposes.

Description

201125583 VI. Description of the invention: [Reciprocal References] This application claims US Provisional Application No. 61/289,729, filed on December 23, 2009, and US Provisional Application No. 61/294,008, filed on January 11, 2010 RIGHTS, the entire contents of which are incorporated herein by reference. Φ 。 。 Φ Φ Φ Φ Φ Φ Φ Φ Φ Φ Φ Φ Φ Φ Φ Φ Φ Φ Φ Φ Φ Φ Φ Φ Φ Φ Φ Φ Φ Φ Φ Φ Φ Φ Φ Φ Φ Φ Φ These antibodies have the property of eliciting cell death (e.g., apoptosis) in these cancer cells in the absence of cytotoxin binding and immune effector functions. These anti-systems can be used as diagnostic and therapeutic agents. [Prior Art] I Due to epithelial cell adhesion/activation molecules (EpCAM/CD326, also known as 17-1A antigen, HEA125, MK-1, EGP-2, EGP34, GA733-2, KSA, TROP-1, KS1/4 And ESA) is often one of the earliest and most important immunotherapy stems in the treatment of cancer from most different sources of cancer. (Herlyn et al. (1979) Proc Natl Acad Sci USA 76: 1438-1442; Went et al. (2004) Hum Pathol 35: 122-128). This antigen is a relatively small (3 14 amino acid (aa)) type I transmembrane domain protein' which is highly retained during evolution and has been reported to regulate non-calcium ion-dependent homotypic cell-cell adhesion (Litvinov et al. (1994) 201125583 J Cell Biology 125 : 437-446). The molecular system consists of a short intracellular region of 26 aa, a transmembrane region of 23-aa, an extracellular region of 242-aa, and a signal peptide of 23-aa, in which α-actinin (α-actinin) The two binding sites are presented in a short intracellular region of 26 aa to be linked to the actin cytoskeleton (Balzar et al. (1998) Mol Cell Biol. 18(8): 4833-4843), while the 23-aa signal is successful. The peptide line separates from the mature protein. The extracellular region of the β EpCAM antigen has three Ν-bond glycosylation sites. The differential glycation status between normal and malignant tissues has been reported in certain cancer types (Pauli et al. (2003) Cancer Lett 193: 25-32). The current pattern of tertiary extracellular structures contains three regions. Since twelve cysteine residues are present, there are two regions similar to the epidermal growth factor (EGF)-type replica (Balzar et al. (2001) Mol Cell Biol 21: 257 〇 2 58 0). However, some studies indicate that the second EGF-type copy of EpCAM is in fact the thyroglobulin (τγ) region (Linnenbach et al. (1989) Proc Natl Acad Sci USA 86: 27-31; Chong and Speicher (2001) J Biol Chem 276: 5804-5813). The third region is unique in its cysteine-deficient region (CPR)' and is not associated with any of the conventional molecules (Baeuerle PA and Gires Ο (2007) Br J Cancer 96: 417-423). EpCAM in humans is epithelial-specific. Most epithelial cells exhibit EpCAM, except for squamous epithelium and certain epithelial cell types (such as 'epidermal keratinocytes, hepatocytes, parietal cells, and myoepithelial cells (Balzar et al. (1999) J Mol Med 77: 699- 712; Momburg et al. (1987) Cancer Res 47: 2883-2891). Table 201125583 is now on the basal side membrane of normal epithelial cells. In epithelial-derived tumors, higher levels of expression are usually found (Balzar et al. (1999). J Mol Med 77: 699-712; Winter et al. (2003) Am J Pathol 163: 2139-2148; Went et al. (2004) Hum Pathol 35: 122-128; Went et al. (2006) Br J Cancer 94: 128-1 35). Since epithelial cells are known to be the most important cell type in human malignant tumor production, more than 90% of all malignant tumor lines are from the epithelium (Birchmeiera et al. (1996) Acta Anatomica; 156 (3); 217 -226), EpCAM is currently regarded as one of the most frequent and strongest tumor-associated antigens, and many times it has been independently found to be an immune tumor-associated antigen of a monoclonal antibody (Gottlinger et al. (1986) Int J Cancer 38 : 47-5 3; Edwards et al. (1986) Cancer Res 46: 1306-1317; Spurr et al. (1986) Int J Cancer 38: 63 1-636; Momburg et al. (1987) Cancer Res 47.2883-2891; Sch6n et al. (1994) J Investig Dermatol 102: 987-991; Bumol et al. (1988) Hybridoma 7: 407-415; Quak et al. (1990) Hybridoma 9: 377-387). Proteins have been found to be expressed in a variety of human adenocarcinomas and squamous cell carcinomas. (Went et al. (2004) Hum Pathol 35: 122-128). Recent studies using immunohistochemistry (IHC) staining and microarray technology have analyzed a significant number of breast, ovarian, kidney, esophage, colon cancer Number of patients with gastric cancer, prostate cancer and lung cancer (Spizzo et al. (2004) Breast

Cancer Res Treat 86: 207-213; Spizzo et al. (2006) Gynecol Oncol 103: 483-488; Stoecklein et al. (2006) BMC Cancer 6: 165; Kimura et al. (2007) Int J 〇nc〇l. : 171_179 ; 201125583

Went et al. (2005) Am J Surg Pathol 29: 83-88; Went et al. (2006) Br J Cancer 94: 128-135). The data highlights the possibility of EpCAM as a target for immunotherapy for human cancer treatment. Although the density is lower than that of tumor cells (Kim et al. (2〇〇4) Clin Cancer

Res 10: 5464-5 471; Osta et al. (2004) Cancer Res 64: 5818-5824), EpCAM present on normal epithelial cells has been a continuing focus of treatment with single sputum-EpCAM antibody targets. The data warranted was derived from the study of human EpCAM in genetically transgenic mice under the EpCAM-specific regulatory sequence. Studies have shown that although EpCAM is specifically expressed on normal epithelial cells, its tight structure makes iv-applied antibodies inaccessible, thus causing near-limitation (McLaughnn et al. (2001) Cancer Res 61: 4105-4111). . Based on these data, EpCAM is considered to be an effective target for anti-tumor treatment of monoclonal antibodies. Indeed, the first monoclonal antibody to be used in human cancer therapy is in fact a murine IgG2a antibody that recognizes EpCAM, called mAb 17-1A (later named edrecolomab and Panorexs) (Sears et al. (1982) Lancet. 1 (8275): 762-765; Sears et al. (1984) J Biol Response Mod 3(2): 138-150). Since then, ELISA and other EpCAM-specific murine, chimeric and anthropomorphic antibodies have also been born with (individual) antibodies, heterozygous bispecific (triple function) antibodies or with toxins, radioisotopes or Any form of cytotoxin (IL-2 or GM-CSF) conjugates for preclinical or clinical trials for cancer treatment (Velders et al. (1994) Cancer Res 54(7): 1753-1759; Raum et al. (2001) Cancer Immunol Immunother 50(3): 141-150; Elias 201125583 et al. (1994) Am J Respir Crit Care Med 150: 11 14-1 122; Di Paolo et al. (2003) Clin Cancer Res 9 : 2837-2848; Andratschke et al. (2007) AntiCancer Res 27(1A): 431-436; Xiang et al. (1997) Cancer Res 57(21): 4948-4955; Schanzer et al. (2006) J Immunother 29(5): 477-488 Wimberger et al. (2003) Int J Cancer 105(2): 241-248; Amann et al. (2008) Cancer Res 68(1): 143-151). To date, many different immunotherapeutic approaches to EpCAM are still in clinical trials (Baeuerle PA and Gires Ο (2007) Br J Cancer 96: 417-423). Clinical trial data have indicated that anti-EpcAM antibodies alone (such as ezetuzumab (17-1A; Panorexs) and adidalumumab (MT201) have only limited anti-tumor effects (Punt) Et al. (2002) Lancet 360. 671-677; Micromet, Inc (2006) Final Data from Two Phase II Trials Indicate Activity of Adecatumumab (MT201) in Breast and Prostate Cancer. Press Release) 'Similar to Activated Complement System-Dependent Cytotoxicity (CDC) and antibody-dependent cytotoxicity (ADCC) effects (Schwartzberg (2001) Crit Rev Oncol

Hematol 40(1): 17-24; Naundorf et al. (2002) Int J Cancer 100(1): 101-110; Prang et al. (2005) Br J Cancer 92(2): 342-349; Oberneder et al. 2006) Eur J Cancer 42(15): 2530-253 8). Antibodies that bind very potent effector mechanisms, such as IL-2, PE toxin or anti-CD3, appear to have a better anti-tumor effect. However, 'some negative effects also limit the systemic 201125583 application of the above anti-EpCAM antibodies (Baeuerle PA and Gires Ο (2007) Br J Cancer 9ό: 417-423) ° "Insufficient" or "Difference" in the current anti-EpCAM trial The fact that limited "anti-tumor efficacy" indicates that there is still a need to develop anti-EpCAM antibodies with improved anti-tumor function. All references, publications and patent applications disclosed herein are hereby incorporated by reference in their entirety. SUMMARY OF THE INVENTION The present invention is based on the discovery of anti-EpCAM monoclonal antibodies, which can elicit tumor cell apoptosis in different EpCAM-positive cancer cell lines in addition to their CDC and ADCC effector functions. The antibody having an extracellular apoptosis-initiating activity was shown to be advantageous in a mouse xenograft mode having an EpCAM-positive cancer cell line. The present invention provides an isolated monoclonal antibody that specifically binds to an epitope in amino acid 24-63 of human EpCAM (SEQ ID NO: 1), wherein the individual antibody binds to an epitope on the cell surface of a cancer cell in vitro. Induces apoptosis in human cancer cells. In certain embodiments, the apoptosis-initiating activity of the individual antibody against human lung cancer cell line NCI-H358 is at least about 90% of the activity of an antibody selected from the group consisting of 12H8, 1F10, 1G10, 2D11, 6D11, and 4D2. The apoptosis-initiating activity was measured by culturing human lung cancer cells under an antibody concentration of about 1 〇 ug/ml for about i6 2 〇 hours. The amino acid sequence of the heavy and light chain variant regions of 12H8, 1F10, 1G10, 201125583 2D1 1, 6D1 1 and 4D2 is shown in Figures 3-8. NCI-H358 is derived from bronchoalveolar cell carcinoma, and the cell line was deposited with the American Type Culture Collection on October 7, 2009 and the patented name is PTA-10386. NCI-H358 is also available from ATCC under access number CRL-5807. NCI-H358 is also deposited at the Food Industry Development Research Institute (Hsinchu, Taiwan) and the patent deposit name is BCRC960419. In certain embodiments, the binding of an antibody to an epitope in amino acid 24-63 of human EpCAM is dependent on the presence of amino acid residues Q24, E25 and N42 of human EpCAM. In certain embodiments, the binding of an antibody to an epitope in amino acid 24-63 of human EpCAM is dependent on the presence of amino acid residues Q24, E25, E26, N37, N41, Q47 and T49 of human EpCAM. In certain embodiments, the binding of an antibody to an epitope in amino acid 24-63 of human EpCAM is dependent on the presence of amino acid residues E25, V40 and R44 of human EpCAM. In certain embodiments, the binding of an antibody to an epitope in amino acid 24-63 of human EpCAM is dependent on the presence of amino acid residues N41, N43 and R44 of human EpCAM. In certain embodiments, the binding of an antibody to an epitope in amino acid 24-63 of human EpCAM is dependent on amino acid residues Q24, E25, A35, F39, V40, N41, R44, Q45 and Q47 of human EpCAM. The presence. In certain embodiments, the invention provides a monoclonal antibody that specifically binds to human EpCAM, comprising three SEQ ID NO: 3 heavy chain complementarity determining regions and/or three SEQ ID NO: 5 light bond complementarity determining regions . In some embodiments of 201125583, the present invention provides a monoclonal antibody that specifically binds to human EpCAM, which comprises three sequences of the heavy chain complementarity determining region and three sequence numbers of the sequence of ^^ _ 徊 幻 幻 旒. : 9 light chain complementarity determining region. Something

In the embodiment, the present invention provides an antibody that specifically binds to a human (10) singular isolate, which comprises three complementarity determining regions of the sequence and/or two light chain complementarity determining regions of the SEQ ID NO: 13. In certain embodiments, the invention provides a monoclonal antibody that specifically binds to human "CAM" which comprises three SEQ ID NO: 15 heavy bond complementarity determining regions and/or three SEQ ID NO: 17 light chain complementary Determining Regions. In certain embodiments, the invention provides a monoclonal antibody that specifically binds to human EpCAM, comprising three SEQ ID NO: 19 heavy chain complementarity determining regions and/or three SEQ ID NO: 21 light chains Complementarity determining region. In certain embodiments, the invention provides a monoclonal antibody that specifically binds to human EpCAM, which comprises three SEQ ID NO: 23 heavy chain complementarity determining regions and/or two SEQ ID NO: 25 The bond complementarity determining region. In certain embodiments, the invention provides a single antibody, comprising a heavy bond variant comprising an amino acid sequence of SEQ ID NO: 3 and/or an amino acid sequence comprising SEQ ID NO: 5. Light chain variant region. In certain embodiments, the invention provides a single antibody, comprising a heavy chain variant comprising the amino acid sequence of SEQ ID NO: 7 and/or an amino acid comprising SEQ ID NO: 9. Sequence of light chain variants. In some embodiments, the invention provides a monoclonal antibody that comprises a heavy chain variant region comprising the amino acid sequence of SEQ ID NO: 11 and/or a light chain variant region comprising the amino acid sequence of SEQ ID NO: 13. In certain embodiments, the invention provides 10 201125583 isolated antibody, comprising a heavy chain variant comprising the amino acid sequence of SEQ ID NO: 15 and/or a light chain comprising the amino acid sequence of SEQ ID NO: 17. Variant regions. In certain embodiments, the invention provides a single antibody, comprising a heavy chain variant comprising an amino acid sequence of SEQ ID NO: 19 and/or a light comprising an amino acid sequence of SEQ ID NO: 21. Chain variant region. In certain embodiments, the invention provides an isolated antibody, comprising a heavy chain variant comprising the amino acid sequence of SEQ ID NO: 23 and/or comprising an amino acid sequence of SEQ ID NO: 25. Light chain variation region.

In certain embodiments, the antibody elicits apoptosis in a human cancer cell selected from the group consisting of breast cancer cells, colorectal cancer cells, gastric cancer cells, lung cancer cells, prostate cancer cells, pancreatic cancer cells, and throat cancer Cells and ovarian cancer cells. In certain embodiments, the antibody recombines an antibody', for example, comprising a heavy chain constant region and a light chain definitive region of a human antibody, in certain embodiments, an anti-systematic anthropomorphic antibody. The invention also provides antigen-binding fragments of the anti-EpCAM antibodies described herein. In some embodiments, the anti-systemic bispecific antibody comprises a specificity discrimination m m < a first binding region and a second binding region that uniquely distinguishes between different transcripts. In certain embodiments, the AJ_*, ' of the bispecific antibody. The D region includes three heavy chain complementarity determining regions and/or three light chain complementarity determining regions of the anti-EpCAM antibodies described herein. In some instances, the first binding region of the 雔 _ 抗体 antibody comprises the heavy chain variant region and/or the light chain variant region of the anti-EpCAM inclusions described herein. In certain embodiments, the second binding to CD3 (e.g., human 13. human CD3) is mediated. 201125583 The invention also provides a single-chain, dual-specific antibody comprising (4) a first antigen-binding region that specifically binds to an amino acid of human EpCAM 2"3 of the epitope" wherein the first antigen-binding region comprises a heavy chain variation Region (vhepCAM) and light chain variant region (VlEpCam); and (8) second antigen binding region'-specific binding to human CD3 antigen, wherein the second antigen binding region includes heavy chain variation region (VHCD3) and light chain variation region (VLCD3) ); the order in which the variation region is configured from the N_ terminal to the c terminal is

VLEpCAM-VHEpCAM-VHCD3-VLCD3. In certain embodiments, the VhEpC AM and VLEPCAM lines in the first antigen binding region are derived from an antibody (eg, a single antibody), wherein the individual antibody binds to an epitope on the cell surface of the cancer cell in vitro (eg, Apoptosis of human cancer cells is elicited by the epitope in the amino acid 24_63 of human EpCAM. In certain embodiments, the apoptosis-initiating activity of the individual antibody against human lung cancer cell line NCI-H3 58 is at least about 9 antibodies selected from the group consisting of 12H8, 1F10, 1G10, 2D11, 6D11 and 4D2. 〇%, wherein apoptosis-initiating activity was measured by culturing human lung cancer cells under an antibody concentration of about i 〇 ug/ml for about 16-2 hrs. In certain embodiments, the single-chain, bispecific antibody further comprises a peptide linker between VLEpC AM and VHEpCAM, between VHEpCAM and VhCD3, and/or between VhCD3 and VlCD3. In certain embodiments, the peptide linker between VLEpCAM and VHEpCAM comprises the amino acid sequence of SEQ ID NO: 49. In certain embodiments, the peptide linker between VHCD3 and VLCD3 comprises the amino acid sequence of SEQ ID NO:53. In certain embodiments 12 201125583, the peptide linker between VHEpCAM and VHCD3 comprises the amino acid sequence of the sequence number: 51. In certain embodiments, the first antigen binding region comprises VHEpCAM and VLEpCAM selected from the group consisting of: (a) VHEpCAM comprises three CDRs of SEQ ID NO: 3, and VLEpCAM comprises three CDRs of SEQ ID NO: 5 (b) VHEpCAM includes three CDRs with SEQ ID NO: 7 and VLEpCAM includes three CDRs with SEQ ID NO: 9; (c) VHEpCAM includes three SEQ ID NO: 1 CDR, and VLEpCAM includes three SEQ ID: CDR of 13; (d) VHEpCAM includes three CDRs of SEQ ID NO: 15 and VLEpCAM includes three CDRs of SEQ ID NO: 17; (e) VHEpCAM includes three CDRs of SEQ ID NO: 19, and VLEpCAM includes three sequences Number: 21 CDR; and (f) VHEpCAM includes three CDRs of SEQ ID NO: 23, and VLEpCAM includes three CDRs of SEQ ID NO: 25. In some embodiments, VHEpCAM and VLEpCAM are anthropomorphic. In certain embodiments, the first antigen binding region comprises VHEpCAM and VLEpCAM selected from the group consisting of: (a) VHEpCAM comprises the amino acid sequence of SEQ ID NO: 27, and VLEpCAM comprises the amino group of SEQ ID NO: 29. Acid sequence; (b) VHEpCAM includes the amino acid sequence of SEQ ID NO: 31, and VLEpCAM includes the amino acid sequence of SEQ ID NO: 33; and (c) VHEpCAM includes the amino acid sequence of SEQ ID NO: 35, and VlEPCAM includes SEQ ID NO: 37 amino acid sequence. 13 201125583 In certain embodiments, the second antigen binding region is specific and binds to a CD3e, CD3Y or CD3S chain. In certain embodiments, the second antigen binding region comprises VHCD3 and VLCD3, wherein VHCD3 comprises the amino acid sequence of SEQ ID NO: 55 and/or wherein VLCD3 comprises the amino acid sequence of SEQ ID NO: 57. In certain embodiments, the second antigen binding region comprises VHCD3 and VLCD3, wherein VHCD3 comprises three CDRs of the amino acid sequence of SEQ ID NO: 55, and/or wherein VlCD3 comprises three amino acid sequences of SEQ ID NO: 57 CDR. In some embodiments, 'VHCD3 and/or VLCD3 are anthropomorphic. In certain embodiments, the 'bispecific antibody comprises a human non-clearin sequence (HSA) at the C-terminus of the bispecific antibody. In some embodiments, the human serum albumin sequence comprises the amino acid sequence of SEQ ID NO: 45 or Sequence No.: 47. In certain embodiments, the bispecific antibody further comprises a peptide linker between VLCD3 and the human albumin sequence. In certain embodiments, the peptide linker between VLCD3 and the human serum albumin sequence comprises the amino acid sequence of SEQ ID NO: 51. In certain embodiments, the 'bispecific antibody comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 39 and SEQ ID NO: 41 and SEQ ID NO: 43. The invention also provides pharmaceutical compositions comprising an antibody as described herein and a pharmaceutically acceptable carrier, in certain embodiments, an anti-EpCAM antibody as described herein. In certain embodiments, the anti-systems single chain bispecific antibodies described herein. 14 201125583 The invention also provides an isolated polynucleotide comprising one or more nucleic acid sequences encoding an antibody (e.g., an anti-EpCAM antibody) described herein. In certain embodiments, the polynucleotide comprises one or more amino acid sequences encoding a single-chain, bispecific antibody described herein. The invention also provides vectors comprising the polynucleotides described herein. The invention also provides host cells comprising the vectors described herein. The invention also provides a method of producing an antibody (e.g., an anti-Ep CAM antibody) described herein, comprising culturing an antibody-producing host cell described herein and obtaining the antibody from the cell culture fluid. In certain embodiments, the anti-system is a single-chain, bispecific antibody described herein. In certain embodiments, the host cell comprises a vector comprising one or more nucleic acid sequences encoding the antibody.

The present invention is also a method for screening an antibody which specifically binds to human EpCAM and induces apoptosis of a human cancer cell in a test tube, comprising: (a) an effective concentration of a single monoclonal antibody specifically binding to human epCam in a test tube; To culture cancer cells; (b) to measure apoptosis of cancer cells caused by monoclonal antibodies alone; and (c) to compare with control antibodies, if the antibody has higher apoptosis-initiating activity, select the antibody . In certain embodiments, the anti-system anti-EpCAM antibodies described herein. In certain embodiments, the anti-systems are described herein as single-chain, bispecific antibodies. In certain embodiments, apoptosis/priming activity is measured by staining cancer cells with Annexin v and Pr〇pidium Iodide. In some embodiments, the cancer cell line is selected from the group consisting of: breast cancer cells, colorectal cancer cells, gastric cancer cells, lung cancer cells, prostaglandin 15 201125583 adenocarcinoma cells, pancreatic cancer cells, throat cancer cells, and ovaries cancer cell. In certain embodiments, the control antibody system is selected from the group consisting of: 12H8, 1F10, 1G10, 2D1 1, 6D1 1 and 4D2 » In certain embodiments, apoptosis-initiating activity is selected 90% of the antibodies of the group consisting of 12H8, 1F10, 1G10, 2D11, 6D1 1 and 4D2. The invention also provides methods of treating, delaying the development and/or avoiding cancer in an individual comprising applying to the individual an effective amount of an antibody described herein. In certain embodiments, the anti-EPCAM antibodies described herein are used. In certain embodiments, a single chain, bispecific antibody described herein is used. In some embodiments, the cancer is selected from the group consisting of breast cancer cells, colorectal cancer cells, gastric cancer cells, lung cancer cells, prostate cancer cells, sputum cancer cells, throat cancer cells, and ovarian cancer cells. In certain embodiments, the individual is selected by detecting binding of the antibody to the cancer cell in the individual. In certain embodiments, the method further comprises applying a second anti-cancer agent to the individual. In certain embodiments, the second anti-cancer agent is a chemotherapeutic agent (e.g., ' oxaliplatin) e. The invention also provides kits comprising the antibodies described herein. In some embodiments the 'sets include the anti-EpC am antibodies described herein. In some embodiments the 'sets' include the single-chain, bispecific antibodies described herein. In some embodiments, the "set may further include instructions for administering an effective amount of an antibody to the individual to treat the cancer in the individual. In certain embodiments, the kit may further comprise a second anti-cancer agent and/or an antibody to be administered to the individual and 16 201125583 to treat the cancer of the individual. The second anti-cancer agent pharmaceutical composition is known for treatment. Combine all the features described in this article to open 4 ϋΚτ » __

One, some or other embodiments of different embodiments are described. A person skilled in the art will be able to specifically bind a target (such as a saccharide, a polynucleotide, a lipid, a polypeptide, etc.) through at least one antigen discrimination site located in a variant region of an immunoglobulin molecule. ) an immunoglobulin molecule. The terminology used herein includes not only intact multi-strain or monoclonal antibodies, but also antigen-binding fragments thereof (such as Fab, Fab, F(ab,) 2, Fv), single-stranded (ScFv), mutations thereof, including A fusion protein of an antibody portion, and any other modified structure of an immunoglobulin molecule comprising a position at which the antigen is distinguished. Antibodies include any type of antibody, such as IgG, IgA or IgM (or a subtype thereof), and the antibody does not have to be of any particular type. Immunoglobulins can be classified into different types depending on the antibody amino acid sequence of the heavy chain constant region of the immunoglobulin. There are five main types of immunoglobulins: IgA, IgD, igE, IgG and IgM, and many of these types can be further distinguished into subtypes (homotypes) such as IgG1, IgG2, IgG3, IgG4, IgAl and igA2. The heavy-chain constant regions corresponding to different types of immunoglobulins are called α, 5, ε, 7 and //, respectively. Conventional subunits of different types of immunoglobulins 17 201125583 Structure and three-dimensional structure. The antibodies of the invention are further contemplated to include bispecific, multi-specific, single-stranded, chimeric, and anthropomorphic molecules that are administered by at least one CDR region of an antibody to have affinity for the polypeptide. A single domain antibody is included, which is either a variant region of an antibody heavy chain or a variant region of an antibody light chain. Holt et al, A 21: 484-490, 2003. It is also known in the art to make a region antibody comprising a variant region of an antibody heavy chain or a variant region of an antibody light chain. The antibody of this region comprises two of the six naturally occurring complementarity determining regions of the antibody. See, for example, Muyldermans, i?ev. Mo Plant Bioiec/mo/. 74:277-302, 2001 〇 "Essence of antibodies" as used herein refers to antibodies that are substantially homogeneous antibodies, ie, in addition to a small number of possible naturally occurring mutations, constitute the population The individual resistance systems are the same. The monoclonal antibodies are not mixtures of different anti-[beta] bodies relative to the preparation of multiple antibodies that typically include different antibodies directed against different epitopes (epitopes). The modifier "single plant" indicates the property of the anti-system derived from a substantially homogeneous antibody population and should not be construed as requiring antibody production by any particular method. For example, a monoclonal antibody to be used in accordance with the present invention can be produced by the fusion tumor method first described by Kohler and Milstein, (1975), ed., 256: 495, or by, for example, U.S. Patent No. 4,816,567. The reorganization method is manufactured. The phage library produced by the technique described in, for example, McCafferty et al. (199 〇), 348: 552 554, can also be isolated from a single antibody. It is to be understood that the monoclonal antibodies used herein include hostile antibodies, pseudo-201125583 humanized antibodies, human antibodies, single-chain antibodies, single-domain antibodies, bispecific antibodies, polyspecific antibodies and antigen-binding fragments thereof. As used herein, "chimeric antibody" refers to a region of a variant or variant region that is derived from a first species and a constant region from a second species. The complete chimeric antibody comprises two chimeric light chains and two chimeric heavy chains. The manufacture of antibodies is known in the art (Cabilly et al. (1984), /V%·ΑαΑ t/, 81:3273_3277; Harlow and Lane

Antibodies: a Laboratory Manual, Cold Spring Call Harbor Laboratory). In general, among these chimeric antibodies, the variable region of both the light bond and the heavy chain mimics the antibody variant region derived from a mammalian species and the constant portion is homologous to the antibody sequence derived from another species. In one embodiment, the amino acid modification can be carried out in the variant region and/or the constant region. An "isolated" anti-system is an antibody that has been identified and isolated and/or obtained from the components of its natural environment. • “Alone antibody” as used herein is not conjugated to a cytotoxic group or an isotope-labeled antibody. As used herein, "substantially pure" means that the material is at least 5% pure (ie, no contaminants), more preferably at least 9% pure, more preferably at least 95% pure, more preferably at least 98% pure, more Good system is at least 99〇/. Pure. As used herein, a "humanized" antibody represents a non-human (eg, murine) antibody material, a specialized chimeric immunoglobulin, immunoglobulin comprising a sequence derived from a non-human immunoglobulin. A bond, or a fragment thereof, 19 201125583 (such as Fv, Fab, Fab, F(ab') 2 or other antigen-binding subsequence of an antibody). Most, the residues of the complementarity determining region (CDR) of the anthropomorphic anti-system recipient are replaced by human immunoglobulins (accepting antibodies) that are replaced by residues of the CDRs of non-human species (donating antibodies), such as non-human species such as A mouse, rat or rabbit having the desired specificity, affinity and ability. In some instances, the Fv framework region (FR) residues of the human immunoglobulin are replaced by corresponding non-human residues. Furthermore, anthropomorphic antibodies can include residues that are not found in the CDR or framework sequences of the antibody or input, but are included to further enhance and optimize antibody performance. Generally, an anthropomorphic antibody comprises substantially all of at least one (usually two) variant regions, wherein all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin' and all or substantially All fr regions are those FR regions of the human immunoglobulin consensus sequence. Preferably, the anthropomorphic antibody also includes at least a portion of the immunoglobulin constant region or region (Fc), which is typically a human immunoglobulin. The antibody may have an Fc region modified as described in w〇 99/58572. Other forms of anthropomorphic antibodies may have one or more CDRs (-, two, three, four, five, six) that are altered with reference to the original antibody, which are also referred to as _ or more CDRs "derived from" one or more The CDRs from the original antibody. As used herein, "human antibody" means an amino acid sequence corresponding to an antibody produced by a human and/or an antibody that has been made using any of the amino acid sequences produced by any of the human antibody techniques, as is conventional in the art or described herein. A definition of such a human antibody includes an antibody comprising at least one human heavy chain polypeptide 20 201125583 or at least one human light chain polypeptide. One of the above examples is an antibody comprising a murine light chain and a human heavy bond polypeptide. Human antibodies can be produced using different techniques known in the art. In one embodiment, the human anti-system is selected from a phage library, wherein the phage library exhibits human antibodies (Vaughan et al. 1996, Nature Biotechnology, 14: 309-314; Sheets et al. (1998), PNAS, (USA) 95: 6157 -6162 ; Hoogenboom and Shao! ^!·,^...,/·^/^/· 方zo/.,227:381; Marks et al. (1991), J. Mo/· 5ζ·〇/., 222: 581). Human antibodies can also be produced by introducing a human immunoglobulin locus into a transgenic animal (e.g., a mouse), and the endogenous immunoglobulin gene in the transgenic animal has been partially or completely deactivated. This method is described in U.S. Patent Nos. 5,545,807, 5,545,806, 5,569,825, 5,625,126, 5,63 3,425 and 5,6 61,016. Alternatively, human antibodies can be prepared by immortalization of human sputum granules that produce antibodies against the antigen of interest, which can be obtained from an individual or have been immunized in vitro. See, for example, C〇ie et al. Monoclonal and Cancer Therapy, Alan R. Liss, p. 77 (1985); Boerner et al. (1991), 乂, i47 (1): 86-95; and US Patent No. 5,750,373 e antibody "Variable regions" represent single or combined antibody light chain variant regions or antibody heavy chain variant regions. The heavy and light chain variant regions are each composed of four framework regions (FRs) connected by three complementarity determining regions (CDr), also referred to as highly variable regions. The CDRs in each strand are held close together by the FR' and contribute to the formation of the 21 201125583 antigen-binding site of the antibody with the CDRs of the other strands. There are at least two techniques for breaking CDRs: (1) One method is based on sequence variability between species (ie, Kabat et al. Sequence of Proteins of Immunological Interest, (5th ed., 1991, National Institutes of Health, Bethesda). MD)); and (2) are based on crystallographic studies of antigen-antibody complexes (Al-lazikani et al. (1997) Λ Mo/Kappa. 273: 927-948). A CDR as used herein may refer to CDRs as defined by either or both methods. The "constant region" of an antibody represents a single or combined antibody light chain constant region or antibody heavy chain constant region. Antibody constant regions typically provide structural stability to other biological functions such as antibody binding, secretion, transplacental mobility, and complement binding, but are not involved in antigen binding. The amino acid sequence in the constant region gene and the corresponding exon sequence depend on the species from which it is derived; however, the change in the allotype in the amino acid sequence is relatively limited in the specific species of the species. . The variant regions of each strand are bound to the constant region by linking the polypeptide sequences. The linked sequence is encoded by a combination of the "j" sequence of the light chain gene and the "D" sequence and the "J" sequence of the heavy bond gene. As used herein, "antibody-dependent cell-mediated cytotoxicity" and "ADCC" represent cell-mediated responses in which non-specific cytotoxic cells (such as natural killer (NK) cells) that express Fc receptors (FcR). , neutrophils and macrophages) identify binding antibodies on the target cells and then cause lysis of the target cells. The in-tube ADCC assay (as described in U.S. Patent No. 5,500,362 or 5,821,337) can be used to assess the ADCC activity of the knife of the 201122583 master. Useful effector cells of the above assay include peripheral blood mononuclear cells (PBMC) # NK cells. Alternatively or additionally, the adcc activity of the molecule of interest may be tested in vivo (e.g., the animal model disclosed in Clynes et al. 1998, (us A), 95:652-656). "Complement-dependent cytotoxicity" and rCDC" represent the cleavage of the target in the presence of complement. The complement activation pathway is caused by the binding of the first complement (Clq) of the complement system to a molecule (e. g., an antibody) complexed with a homologous antigen. To determine complement activation, a cdc assay such as that described in Gazzan 〇 Sant〇r〇 et al., /2, 163 (1996) can be performed. The vocabulary "polypeptide", "winning peptide", "peptide" and "protein" are used interchangeably to refer to amino acid polymers of any length. The polymer may be linear or branched, which may include a modified amino acid, and which may be interrupted by a non-amino acid and also comprise an amino acid polymer that has been modified by nature or insertion; for example, a disulfide bond , saccharification, lipidation, acetylation, phosphorylation, or any other manipulation or modification (eg, engagement with a labeling component). Also included in the definition are, for example, polypeptides comprising one or more amino acid analogs (including, for example, unnatural amino acids, etc.), as well as other techniques known in the art. Since the polypeptides of the present invention are based on antibodies Therefore, it can be understood that the polyscore can be a single bond or a link. Alternately, "nucleotides" or "nucleic acids" are used herein to refer to nucleotide polymers of any length and including DNA and RNA. The nucleotide may be a deoxyribonucleotide, a ribonucleotide, a modified nucleotide or base and/or 23 201125583 an analog thereof, or any matrix which may be incorporated into the polymer by DNA or rNA polymerase. Polynucleotides can include modified nucleotides (such as methylated nucleotides and analogs thereof). If present, the modification of the nucleotide structure can be given before or after the polymer combination. The nucleotide sequence can be interrupted by a non-nucleotide component. The polynucleotide may be further modified after polymerization, for example, by labeling components. Other types of modification include, for example, "capping dip"; replacing one or more naturally occurring nucleotides with an analog; intranucleotide modifications, such as having no charge linkage (such as methyl phosphate, phosphotriester) , nucleotides of phosphoamidate, cabamate, etc., and those having a charged linkage (such as phosphorothioate, phosphorodithioate, etc.), including overhangs Some of the nucleotides (eg, proteins (such as nucleases, toxins, antibodies, signal peptides, polylysines, etc.)), with intercalating agents (such as pyridine' psoralen (ps〇ralen), etc. Those nucleotides, those comprising a chelate (such as a metal, a radioactive metal, boron, an oxidizing metal, etc.), those comprising an alkylating agent, a modified linkage (such as an alpha) Those nucleotides that constitute a nucleic acid, etc., as well as unmodified forms of the polynucleotide. Furthermore, any hydroxyl group normally present in the sugar may be substituted by, for example, a phosphonic acid group, a phosphate group, protected by a standard protecting group, or activated to prepare additional nucleotides. Additional links, or can be joined to the solid support. The 5' and 3' terminal OH can be phosphorylated or substituted with an amine or oxime-20 carbon atom. Other hydroxyl groups can also be derivatized to standard protecting groups. The polynucleotide may also comprise a similar form of ribose or deoxyribose known in the art 'including, for example, 2,-〇-mercapto-, 2,_〇-allyl, 2,-fluoro or 2, · 24 201125583 Azide-ribose, carbocyclic analogues, oxime:-isomeric sugars, epimeric sugars such as arabinose, xylose or lyxose, piperanose, beta-flavored sugar, Sedoheptulose, an acyclic analog and an absic nucleoside analog (eg, methyl riboside) can be substituted with one or more phosphodiester linkages by an alternate linking group. These alternative linking groups include, but are not limited to, the phosphate in the examples from p(0)S ("thioate"), P(S)S ("dithioate") , ((〇)NR2 ("amidate"), P(〇)R, p(〇)〇r, c〇 or CH2 ("formacetal"), where each R or R' is The H or substituted or unsubstituted selectivity comprises an ether (1〇C)-linked alkyl group (1_2〇C), an aryl group, an alkenyl group, a cycloalkyl group, a cycloalkenyl group or an araldyi. It is not necessary to have the same linkage in all the polynucleotides. The above can be used for all of the polynucleic acids mentioned herein, including RNA and DNA. As used herein, "vector" means a construct that is capable of transmitting and preferably capable of expressing one or more of the genes or sequences of interest in a host cell. Examples of vectors include, but are not limited to, viral vectors, naked DNA or RNA expression vectors, plastids, cosmid or sputum vectors, DNA or RNA expression vectors that bind to cationic I collectors, and loaded with lipids. DNA or RNA expression vectors in the body, and certain eukaryotic cells (eg, producer cells). As used herein, "expression control sequence" means a nucleic acid sequence that directs transcription of a nucleic acid. The expression control sequence can be a promoter (such as a persistent or inducible promoter) or an enhancer. The expression control sequence is operably linked to the nucleic acid sequence to be transcribed. 25 201125583 The "effective dose" or "effective amount" of a drug, compound or pharmaceutical composition as used herein is sufficient to produce a beneficial or desired result. With regard to prophylactic applications, beneficial or desirable outcomes include, for example, eliminating or reducing risk, reducing severity, or delaying the onset of the disease, including biochemical, tissue and/or behavioral symptoms of the disease, its complications, and the development of the disease. Intermediate pathological phenomenon. With regard to therapeutic applications, beneficial or desirable outcomes include, for example, reducing one or more symptoms resulting from the disease, improving the quality of life of those suffering from the disease 'reducing the dosage of other drugs needed to treat the disease, and increasing the other drug treatment (eg, Clinical outcomes such as calibrating effects, delaying progression of the disease, and/or prolonging survival. In the case of a cancer or tumor, the effective amount of the drug may have a reduced number of cancer cells; a reduction in tumor size; inhibition (ie, slowing down to some extent and preferably stopping) infiltration of cancer cells into surrounding organs; inhibition (ie, ' slow down to To some extent, and preferably to stop) tumor metastasis; inhibit tumor growth to some extent; and/or alleviate one or more symptoms associated with abnormalities to some extent. One or more doses can be applied to apply an effective dose. With respect to the intent of the present invention, an effective amount of a drug, compound or pharmaceutical composition is an amount sufficient to effect the prevention or treatment treatment directly or indirectly. As understood in the clinical arts, an effective dosage of the drug, compound or pharmaceutical composition can be achieved with or without another drug, compound or pharmaceutical composition. Thus, the application of one or more therapeutic agents can be considered an "effective dose" if one or more other agents are combined to achieve the desired result and a single agent can be considered an effective dose. 26 201125583 The term "collocation" as used herein refers to the application of a sputum treatment form in addition to another form of treatment. Thus, "collocation" means applying a form of treatment before, during or after the application of other forms of treatment to an individual.

As used herein, "treatment" is a method of obtaining a favorable or desired result, preferably with clinical results. With regard to the intent of the present invention, advantageous or desired results include, but are not limited to, one or more of the following: reducing (or destroying) the thinning of cancer cells, reducing the symptoms of the disease, and improving the quality of life of those suffering from the disease. , reducing the dose of other drugs needed to treat the disease, delaying the progression of the disease and/or prolonging the survival of the individual. As used herein, "delayed development of disease" means delaying, obstructing, slowing, hindering, stabilizing, and/or delaying the progression of a disease (eg, cancer). This delay can be any time of varying length, depending on the history and/or treatment of the individual. It will be understood by those skilled in the art that a sufficient or significant delay may actually include blocking, wherein the individual does not develop the disease. For example, late cancer can be delayed, such as the development of metastasis. An individual or a subject is a mammal, preferably a human. Nursing animals also include, but are not limited to, farm animals, sport animals, pets (e.g., cats, dogs, horses), primates, mice, and rats. As used herein, the term "specificity discrimination j" or "special-sexual binding" represents a measurable and reproducible interaction (such as attraction or binding between a target and an antibody), which exists in a heterogeneous molecular population including biomolecules. The next is to confirm the existence of the target. For example, specificity or preferential binding of a target or epitope to an anti-system with more affinity, binding (10) (8) (7), easier or with a greater duration (above other 27 201125583 epitopes in combination with other targets or targets) An antibody that binds to this target or epitope. By reading this definition, it is understood that, for example, antibodies (or portions) that are specific or preferentially associated with a first target may or may not be specific or preferentially associated with a second target. Therefore, "exclusive-sexual integration" or "priority combination" does not necessarily require (although it may include) exclusionary associations. The binding constant of the antibody specifically binding to the target is at least about Μ3 Μ or 1 0 4 Μ ―1, sometimes about 〇5 M or 丨〇6 M, other examples about 10 6M-1 or 107M-1, about l08M-丨 to 109M·l, or about lo 10M 1 to 10nM-1 or higher. Many forms of immunoassays can be used to select antibodies that are specific for their immune response to a particular protein. For example, the solid phase ELIS A immunoassay is routinely used to select monoclonal antibodies that are specific for a protein-specific immune response. See, for example, Harlow and Lane (1988) Antibodies, A Laboratory Manual, Cold Spring Harbor Publications, New York, for a description of the forms and conditions of immunoassays for determining a specific immune response. As used herein, the terms "cancer," "tumor," "cancerous," and "malignant" represent or describe a physiological condition in a mammal that is generally characterized by unregulated cell growth. Examples of cancer include, but are not limited to, carcinoma, which includes adenocarcinoma, lymphoma, blastoma, melanoma, and sarcoma. More specific examples of such cancers include squamous cell carcinoma, small cell lung cancer, non-small cell lung cancer, lung adenocarcinoma, lung squamous cell carcinoma, gastrointestinal cancer, Hodgkin's and non- - Hodgkin's lymphoma, sputum cancer, neuroblastoma, cervical cancer, glioma, ovarian cancer, liver cancer (such as 'hepatic carcinoma and liver cancer (hepatoma)) , bladder cancer, milk 28 201125583 Cancer colon cancer, colorectal cancer, endometrial or uterine cancer, salivary gland cancer, kidney cancer (such as renal cell carcinoma and Wilm's (view), basal cell carcinoma , melanoma, prostate cancer, squamous adenocarcinoma, testicular cancer, esophageal cancer and different types of head and neck cancer. The singular forms "a" and "the" are used in the s Examples of antibodies to antibodies include one or more antibodies (e.g., molar amounts) and include equivalents and the like as known in the art. References herein to "about" values or parameters include (and describe) embodiments that are directed to a value or parameter. For example, the description of the reference X _1 includes a description of "X". It will be understood that aspects and variations of the invention described herein include those that "comprise" and/or "substantially". The antibody and the polypeptide which specifically bind to EpCAM - the present invention provides an isolated antibody and a self-antibody-derived polypeptide and any antibody-binding reagent which specifically binds EpCAM on the cell surface of a cancer cell in a test tube and The lack of cytotoxic junctions and immune effector functions (including ADCC and CDC activity) triggers parenchymal apoptosis in cancer cells. The present invention provides an isolated monoclonal antibody that specifically binds to an epitope in amino acid 24-63 of human EpCAM, wherein an antibody in a test tube elicits a human cancer cell after binding to an epitope on the surface of a cell of a cancer cell Apoptosis. In certain embodiments, the cell apoptosis-initiating activity of the individual antibody against human 29 201125583 lung cancer cell line N CI - Η 3 5 8 is at least selected from the group consisting of 12Η8, 1F10, 1G10, 2D11, 6D11, and 4D2. 90% of the activity of the antibody 'The apoptosis/initiation activity was measured by culturing human lung cancer cells under an antibody concentration of about 1 〇 Ug/mi for about 16-20 hours. In certain embodiments, the antibody or polypeptide of the invention binds to human EpC AM and/or naturally occurring variants as shown in Figure 1. In certain embodiments, the antibody or polypeptide of the present invention expresses EpCAM on the cell surface of a cancer cell in a test tube, and the antibody alone or the polypeptide induces apoptosis of the cancer cell. In certain embodiments, the antibody or polymorphic cell apoptosis-initiating activity is at least about 90% of the activity of an antibody selected from the group consisting of 12H8, 1F10, 1G10, 2D11, 6D11, and 4D2, wherein Human lung cancer cells NCI-H358 were cultured for about 16-20 hours under antibody or polypeptide at a concentration of about 1 ug/ml to measure apoptosis-priming activity. In certain embodiments, the apoptosis-initiating activity of the antibody or polypeptide is at least about 95%, at least about the activity of an antibody selected from the group consisting of 12H8, 1F10, 1G10, 2D11, 6D11 and 4D2. 100% or higher. The human lung cancer cell line NCI-H358 is derived from bronchoalveolar cell carcinoma and is available from ATCC under ATCC Accession No. PTA-10386. The antibody of the present invention and the polypeptide can induce apoptosis alone after expressing EpCAM on the cell surface of the cancer cell. The term "priming apoptosis" as used herein means that the antibody or polypeptide of the present invention directly interacts with a molecule expressed on the cell surface, and the binding/crossing 30 201125583 interaction alone is sufficient to induce apoptosis in the cell. Other factors such as cytotoxic junctions, other immune effector functions (ie, complement-dependent cytotoxicity (CDC), antibody-dependent cytotoxicity (ADCC) or phagocytosis) or cross-linking without the aid of other factors Agent. The term "apopt〇sis" as used herein refers to a gene-directed process of cell destruction in cells. Apoptosis is different from necrosis; it includes cytoskeletal disruption, cytoplasmic contraction and coagulation, and phospholipid serine appears on the outer surface of the cell membrane and blister, causing the formation of cell membrane vesicles or apoptotic bodies. This process is also known as "planned cell death." Peculiar phenomena are found during apoptosis, such as cell surface curvature, condensation of nuclear filaments, fragmentation of chromosomal DNA, and loss of mitochondrial function. Many conventional techniques can be used to detect apoptosis, such as by Annexin V, propidium iodide, DNA fragment assays and (Invitrogen) staining of cells. In some embodiments, a group that can be stained with Annexin v and Acetone linkages while Annexin V+/PI+, Annexin V+/PI- and Annexin V-/PI+ binding percentages are considered dead cells. In certain embodiments, an antibody or polypeptide of the invention binds to an epitope in the amino acid 24-63 of the sequence No. 1. Binding specificity depends on the presence of a particular amino acid residue in the region. For example, the binding antibody or polypeptide can depend on the presence of the following amino acid residue groups: (1) Q24, Ε25 and Ν42; (2) Q24, Ε25, Ε26, Ν37, Ν41, Q47 and Τ49; (3) Ε25, V40 and R44; (4) Ν41, Ν43 and R44; or (5) Q24, Ε25, Α35, F39, V40, Ν41, R44, Q45 and Q47. To determine if the binding of the antibody depends on the presence of the amino acid residue 31 201125583, the antibody pair mutation can be compared as described in Example 6; the relative binding activity of EpC AM to wild type EpCAM. If the amino acid is mutated to an unrelated amino acid (for example, mutated to the corresponding murine EpCAM amino acid residue or a non-conservative mutation), the relative binding activity is reduced by more than 5〇0/〇, which is considered to be the binding of the antibody. The presence of the amino acid residue. In certain embodiments, the monoclonal antibody provided by the present invention and any group selected from the group consisting of 12H8, 1F10, lG10, 2Dn, 6Dn and 4D2

Groups of antibodies compete for binding to EpCAM. In certain embodiments, a monoclonal antibody provided by the present invention binds to the same epitope as any antibody selected from the group consisting of 12H8, 1F1〇, iG1〇, 2Du, 6D1 1 and 4D2. Competition assays can be used to determine if two antibodies bind to the same epitope by an identical or spatially overlapping epitope or an antibody competitively inhibits - antibody binding to an antigen. These tests are conventionally known in the art. In general, antigen or antigen-expressing cells are immobilized in a porous disk and the force of the mouth of the human body L x 仇 菔, which is not blocked by the heart-shaped antibody, is measured. The above-mentioned competitive assays are commonly used for labeling radioactive labels or enzyme labels. For example, EpCAM is conjugated to a second unlabeled antibody that binds EpCAM® = one labeled antibody to a gradually increasing concentration. The control group was treated with the first labeled antibody but the antibody was fixed. EpCA was not labeled ^ /ν , ρ in the first antibody to bind epCaiu

After treatment under the conditions, excess AM ^ ^ ^ unbound antibody was removed and the amount of labeled EpCAM bound to the field was measured. If the concentration of the test-labeled antibody is 100:1 or more, the antibody is relatively higher, or 1000:i is higher. = such as '500. 1 or (d) too much compared to the control sample 1 test combined with fixed EpCAM. Substantially reduced (e.g., 32 201125583 is reduced by at least about 50%, at least about 60%, at least about 7〇%, at least about 8〇〇/〇, or at least about 9〇%). To compete with the first antibody for binding to EpCAM. Other methods that can be used to localize antibody binding by Morris (1996) on ar 仏〇/〇灯 v 66 (Humana

"Epitope Mapping Protocols" in Press, Totowa, NJ). In certain embodiments, the anti-EpCAM antibody provided by the present invention comprises: a heavy chain variant region comprising one, two or three SEQ ID NO: 3 CDRs, and/or a light chain variant region, including one, two or Three SEQ ID NO: 5 CDRs. And R. Three sequence numbers: CDR of 9. In certain embodiments, the anti-EpCAM antibodies provided herein comprise: a heavy chain variant region comprising a 'two or two SEQ ID NO: 11 CDr; and/or a light chain variant region' comprising one, two or Three sequence numbers: CDRs of 丨3. In certain embodiments, the anti-EpCAM antibodies provided by the invention comprise: a heavy chain variant region comprising one, two or three sequence numbers: Cdr of 丨5; and/or a region of light chain variation, including one or two Or three serial numbers: 17 CDRs. In certain embodiments, the anti-EpCAM antibodies provided by the invention comprise: a heavy chain variant region comprising one, two or three CDRs of SEQ ID NO: 19; and/or a light chain variant region comprising one, two or Three SEQ ID NO: 21 CDRs. In certain embodiments, the anti-EpCAM antibodies provided by the present invention comprise: a heavy chain variant region comprising: one, 33 201125583 two or two SEQ ID NO: 23; and/or a light chain variant region, including one, two Or three sequence numbers: 25 CDRs. In some embodiments, the 'CDRs are Kabat CDRs. In other embodiments, the CDRs are Chothia CDRs. In other embodiments, the CDR system

Combination of Kabat and Chothia CDRs (also referred to as "combined CDRs" or "extended CDRs") ^ In other words, for any known embodiment comprising more than one CDR, the CDRs may be Kabat, Chothia And / or combination of any. In certain embodiments, an anti-EpCAM antibody described herein can have one or more CDRs, the amino acid sequence of the one or more CDRs being at least about 90%, at least about 91%, at least about 92%, at least About 93°/❶, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% are selected from the group consisting of 12H8, 1F10, 1G10, 2DH, 6D11, and 4D2. At least one, at least two, at least three, at least four, at least five or six CDRs of the antibody of the group formed. In certain embodiments, the anti-EpCAM antibodies provided herein comprise a heavy chain variant region comprising an amino acid sequence of SEQ ID NO: 3; and/or a light chain variant region comprising the amino acid sequence of SEQ ID NO: 5. In certain embodiments, the anti-EpCAM antibodies provided herein comprise a heavy chain variant region comprising an amino acid sequence of SEQ ID NO: 7; and/or a light chain variant region' comprising the amino acid sequence of SEQ ID NO: 9. In certain embodiments, the anti-EpCAM antibody provided by the present invention comprises a heavy chain variant region' comprising the amino acid sequence of sequence number: 11; and/or a light chain variant region comprising the amino acid sequence of sequence number: 13. In certain embodiments, the invention provides a 34 201125583 anti-EpC AM antibody comprising a heavy bond variant region comprising an amino acid sequence of SEQ ID NO: 15; and/or a light bond variant region comprising an SEQ ID NO: 1 7 amine Base acid sequence ° In certain embodiments, the anti-EpCAM antibody provided by the present invention comprises a heavy chain variant region, including the amino acid sequence of SEQ ID NO: 19; and/or a light bond variant region, including an amine of SEQ ID NO: 21. Base acid sequence. In certain embodiments, the anti-EpC AM antibody provided by the present invention comprises a heavy chain variant region comprising an amino acid sequence of SEQ ID NO: 23; and/or a light chain variant region comprising an amino acid sequence of SEQ ID NO: 25. . In certain embodiments, one or more of the amino acid residues in the heavy chain constant region and/or the light chain constant region of the antibody are modified (including amino acid insertions, deletions, and substitutions). The modified amino acid sequence is at least about 90% 'at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 980. /〇 or at least about 99% identical to the sequence before modification. Examples of cancer cells that exhibit EpCAM include, but are not limited to, breast cancer, colorectal cancer, gastric cancer, lung cancer, prostate cancer, pancreatic cancer, throat cancer, and ovarian cancer. The invention includes modifications to the antibodies or polypeptides described herein, including functionally equivalent antibodies that do not significantly affect their properties, as well as variants with increased or decreased activity and/or affinity. For example, the amino acid sequence of an antibody can be mutated to obtain an antibody having the desired binding affinity for EpCAM expressed by cancer cells. Routine practice in the modification of polypeptides is not necessarily described in detail herein. Examples of modified polypeptides include polypeptides having 35 201125583 conservative substituted amino acid residues, one or more amino acid deletions or additional or chemical analogs that do not significantly alter the functional activity.

Amino acid sequence insertion includes intra- and/or carboxy-terminal fusions of a length ranging from one residue to a poly-peptide comprising one hundred or more residues and insertion of a single or multiple amino acid residues . Examples of the terminal insertion include an antibody having an N-terminal thiol sulfhydryl residue or an antibody fused to an epitope tag. Insertion variants of other antibody molecules include fusions at the N- or C-terminus of the antibody that increase the serum half-life of the antibody. The substitution variant removes at least one amino acid residue in the antibody molecule and inserts a different residue at its position. The most interesting locations for substitution mutations include highly variable regions, but FR changes can also be considered. Conservative substitutions are shown in the table under the heading “Reservative Substitution”. If the above substitution results in a change in biological activity, more substantial changes referred to in the table below as "exemplary substitutions" or reference amino acid types can be introduced and the products screened. Table 1: Amino acid substitutions Original residues Conservative substitutions Exemplary substitutions Ala (A) Val Val ; Leu ; lie Arg ( R ) Lys Lys ; Gin ; Asn Asn ( N ) Gin Gin ; His ; Asp ; Lys ; Arg Asp (D) Glu Glu ; Asn Cys ( C ) Ser Ser ; Ala Gln ( Q ) Asn Asn ; Glu Glu ( E ) Asp Asp ; Gin Gly ( G ) Ala Ala 36 201125583

His(H) Arg Asn ; Gin ; Lys ; Arg He ( I ) Leu Leu ; Val ; Met ; Ala ; Phe ; Leukine Leu ( L ) lie , leucine , lie , Val , Met , Ala , Phe Lys (K) Arg Arg ; Gin ; Asn Met ( M ) Leu Leu ; Phe ; lie Phe (F) Tyr Leu ; Val ; lie ; Ala ; Tyr Pro (P) Ala Ala Ser(S) Thr Thr Thr(T) Ser Ser Trp(W) Tyr Tyr ; Phe Tyr(7) Phe Trp ; Phe ; Thr ; Ser Val(V) Leu lie ; Leu ; Met ; Phe ; Ala ;

A substantial modification of the biological properties of the antibody can be achieved by selective substitution, which significantly alters its effect on the maintenance of: (a) the structure of the backbone of the polypeptide in the substitution region, such as a sheet or helical configuration, ( b) the charge or hydrophobicity of the molecule at the target position, or (c) the bulk of the side chain. According to the common side chain characteristics, naturally occurring residues can be divided into several groups: (1) Non-polar: positive leucine, Met, Ala, Val, Leu, lie; (2) Polarity without charge: Cys, Ser, Thr (3) Acidic (negative): Asp, Glu; (4) Qualitative (positive): Lys, Arg; (5) Residues affecting chain direction: Gly, Pro; and (6) Aroma Family: Trp, Tyr, Phe, His. 37 201125583 By changing this genus j, a member of one of the cheeks is another type - conservative substitution. It is also common to replace any cysteine residues that are not involved in maintaining proper conformation with serine acid to prevent abnormal cross-linking with < Conversely, a cysteine linkage can be added to the antibody to improve its stability, particularly when against a systemic antibody fragment (e.g., an Fv fragment). Amino acid modifications range from altering or modifying one or more amino acids to a fully redesigned region (e.g., a variant region). Changes in the variant region can alter binding affinity and/or specificity. In certain embodiments, no more than one to five conservative amino acid substitutions are produced in the cdr region. In other embodiments, no more than u conservative amino acid substitutions are produced in the CDR regions. In still other embodiments, the CDR regions are CDRH3 and/or CDR L3. Modifications also include saccharification and non-glycation of polypeptides, as well as glycosylation, acetylation and phosphorylation of different peptides such as different carbohydrates. The antibody is saccharified at a conserved position in its region (Jefferis and

Lund, (1997), C/zew. //wmw«o/· 65:1 11-128 ; Wright and Morrison, (1997), 7767^C// 15:26-32). Oligosaccharides in the side chains of immunoglobulins affect the function of proteins (Boyd et al. (1996), Mo/. //wmwwo/. 32:1311-1318; Wittwe and Howard, (1990), 29:4175-4180), The intramolecular interaction between glycoprotein fractions can affect the conformation and presentation of glycoproteins on three-dimensional surfaces (Hefferis and Lund, supra; Wyss and Wagner, (1996), Cwrreni B/oiec/z. 7:409 -416). Oligosaccharides can also direct known glycoproteins to certain molecules based on a particular discriminating structure. Glycosylation of antibodies has also been published 38 201125583 Effects antibody-dependent cytotoxicity (ADCC). Specifically, β(1,4)-indolyl-glucosamine glucosyltransferase (GnTIII) having a tetracycline-regulated expression has been published (two-part GlcNAc sugar) CHO cells catalyzed by basal transferase have improved ADCC activity (Umana et al. (1999), S/oiec/7. 17: 176-180). Saccharification of antibodies is usually either N-linked or 〇-linked. The N-linker represents a saccharide moiety attached to the side chain of the aspartic acid residue. Three peptide sequence: aspartic acid-X-serine, aspartic acid _ χ _ sulphonic acid and aspartic acid - X-cysteine, in which X-amino acid except Proline acid; a recognition sequence for attaching a sugar moiety enzyme to a side chain of aspartic acid. Thus, the presence of any of these three peptide sequences in the polypeptide results in a potential saccharification position. 〇-linked saccharification represents the attachment of one of the sugar Ν 醯 醯 醯 galactose, galactose or xylose to a hydroxyl amino acid, most of which is usually seric acid or threonine (but can also be applied 5 - Lysine or 5-hydroxyl-amino acid). Attachment of the saccharification site to the antibody' can be conveniently accomplished by altering the amino acid sequence such that it comprises one or more of the above-described three-sequence sequences (for the Ν-linked saccharification site). Alterations can also be achieved by the addition of one or more serine or threonine residues to the original antibody sequence or by substitution with one or more serine or threonine residues (for 〇-linked glycation sites) . It is also possible to alter the glycosylation pattern of the antibody without altering the underlying nucleotide sequence. The bile is largely dependent on the host cell used to express the antibody. Since the cell used to express recombinant glycoproteins (e.g., 'antibodies) as a possible therapeutic method is rarely a natural cell, a change in the glycosylation pattern of the antibody can be expected (see, for example, Hse et al. (1997), */ · 仏C/iem. 272:9062-9070). The cola sees the effector function to modify the Fc region of an antibody described herein, for example, to increase antigen-dependent cell-mediated cytotoxicity (ADCC) and/or complement dependent cytotoxicity (CDC) of the antibody. This can be achieved by introducing one or more amino acid substitutions in the Fc region. Amino acids which are conventionally substituted in the art. The antibody of the present invention includes antibody fragments (such as Fab, Fab', F(ab')2, Fv, Fc, etc.), chimeric antibodies, single-stranded (ScFv), mutations thereof, fusion proteins comprising antibody portions, and Any other modified structure of an immunoglobulin molecule that includes the location of the antigen discrimination required for specificity. The antibody can be murine, rat, camel, human or any other source (including anthropomorphic antibodies). The binding affinity of polypeptides (including antibodies) to EpCAM may be less than about

500 nM, about 400 nM, about 300 nM, about 200 nM, about 1 〇〇 nM, about 50 nM, about 10 nM, about 1 nM, about 500 pM, about 1 〇〇 pM or about 50 pM. As is well known in the art, 'binding affinity can be expressed as kd or dissociation constant' and binding affinity increases corresponding to a decrease. One method for determining the binding affinity of an antibody to EpC AM is by measuring the binding affinity of an antibody monofunctional Fab fragment. In order to obtain a monofunctional Fab fragment, the papain can be used to cleave the antibody (for example, ruthenium (7) or recombination. It can be represented by surface plasmon resonance (B1Ac〇re3〇〇〇TM surface plasmon resonance (SPR) system, BIAc). 〇re, INC, piscaway nj) and 40 201125583 ELISA to determine the affinity of the Fab fragment of the antibody. Obtain the kinetic binding rate (k〇n) and the separation rate (k°ff) (usually measured at 25 ° C); Koff/kon calculates the equilibrium dissociation constant (Kd) value. It is known in the art and discloses a method for producing an antibody and a polymorph derived from the antibody. It is possible to test whether the produced antibody specifically binds to the amino group of human EpCAM expressed by the cancer cell. The epitope in acid 24-63.

The specificity of the antibody produced can be determined by immunoprecipitation or by in vitro binding assays such as radioimmunoassay (RIA) or enzyme linked immunosorbent assay (EUSA). The above techniques and tests are well known in the art. For example, the binding affinity of a single antibody can be determined by Scatchard analysis of Munson and Pollard (1980), /4 «"/ 107:220. The identified antibody can be further tested by techniques and methods described herein. The ability to elicit cell death (e.g., apoptosis) and/or inhibit cell growth or proliferation. The invention also provides a method of screening for antibodies that specifically bind to human EpCAM and elicit apoptosis in human cancer cells, including: Increasing cancer cells in vitro in an effective concentration that specifically binds to individual antibodies to human EpCAM; (b) measuring apoptosis of cancer cells induced by monoclonal antibodies alone; and (c) comparing control antibodies, The antibody has a high apoptosis-initiating activity, and the antibody is selected. Any method known in the art or known in the art can be used to measure the activity of the antibody-inducing cell. In some embodiments, the cell is selected. The death-initiating activity is at least selected from the group consisting of 12, 〇, 1 (^〇, 21) 11, 61) 11 and 4 〇 2: 41 201125583 Group of antibodies 80%, 90%, 95% of antibodies. Some real In the example, human cancer cell line is a breast cancer cell, a colorectal cancer cell, a gastric cancer cell, a lung cancer cell, a prostate cancer cell, a pancreatic cancer cell, a throat cancer cell, and an ovarian cancer cell. Screening for an anti-EpC having apoptosis-initiating activity The method of the am antibody is described in detail in Example 3. The antibodies of the present invention can also be produced by recombinant DNA methods, such as those described in U.S. Patent Nos. 4,816,567 and 6,331,415, which are incorporated herein by reference. Conventional procedures (eg, 'Using an oligonucleotide nuclease probe capable of specifically binding a gene encoding a heavy bond and a light chain of a murine antibody) are readily isolated and sequenced to encode a DNA of a monoclonal antibody of the present invention. The fusion tumor cells serve as a preferred source of the above 〇νΑ. Once isolated, the DNA can be placed into a expression vector, and then the expression vector can be transfected into a host cell that does not otherwise produce an immunoglobulin protein (such as a private monkey COS). Cells, Chinese hamster ovary (CHO) cells or bone marrow cancer cells) to synthesize monoclonal antibodies in recombinant host cells. DnA can also be modified, for example by The coding sequences of the heavy and light chain constant regions are substituted for the replacement homologous murine sequence (U.S. Pat. No. 4,816,567) or by covalent attachment of all or part of the non-immunoglobulin polypeptide sequence to the immunoglobulin coding sequence. The above non-immunoglobulin polypeptide can be substituted for the constant region of the antibody of the present invention or can replace the variant region of an antigen-binding position of the antibody of the present invention to produce a chimeric bivalent antibody. In a second embodiment, the present invention The anti-system is represented by two expression vectors. In certain embodiments, the first expression vector encoding the heavy chain of an antibody (eg, an anthropomorphic antibody) comprises a first portion encoding a variant region of an antibody heavy chain 42 201125583 and coding The second part of the strange region of the antibody heavy chain. In certain embodiments, a second expression vector encoding a light chain of an antibody comprises a first moiety encoding a variant region of an antibody light bond and a second portion encoding a constant region of the antibody light chain. Alternatively, an antibody (e.g., anthropomorphic antibody) of the invention is represented by a single expression vector. The single-expression vector encodes both the heavy and light chains of the antibodies of the invention. Lu The usual expression vector has transcriptional and translational regulatory sequences derived from species compatible with the host cell. In addition, vectors typically carry a specific gene capable of providing phenotypic screening in transfected cells. Many different eukaryotic cell recombinant host-vector expression systems are known and can be used in the present invention. For example, in eukaryotic microorganisms, Saccharomyces cerevisiae or common baker's yeast is the most commonly used 'even if many other lines are available (e.g., Pichia pastoris). A φ cell line derived from a multicellular organism (such as Sp2/0 or Chinese hamster ovary (CH0)) can be obtained from ATCC and can also be used as a host. A general carrier system suitable for eukaryotic transformation such as pSV2neo and pSV2gpt (ATCC), pSVL and pSVK3 (Pharmacia), and pBPV-1/pML2d (International Biotechnology, Inc.) ® are preferably used in the eukaryotic host cell useful in the present invention. It is a fusion tumor, bone cancer, plasmacytoma or lymphoma cells. However, other eukaryotic host cells can be suitably used, provided that the mammalian host cell is capable of discriminating the transcription and translation of the DNA sequence of the protein; by cleaving the leader sequence to treat the squamous squamous peptide and secreting the protein; Post-translational modifications Accordingly, the present invention provides eukaryotic host cells which are transformed by recombinant expression vectors (including the DNA constructs disclosed herein) and which are capable of exhibiting the antibodies or polymorphs of the present invention. In some embodiments, the transformed host cell of the invention thus includes at least a DNA construct comprising the light and heavy bond DNA sequences described herein, as well as transcriptional and translational regulatory sequences, transcription and translation.

The regulatory sequences are configured relative to the light and heavy chain 'encoding sequences' to direct the expression of the antibody or polypeptide. The sputum primary cells used in the present invention can be transformed in a number of ways by the standard transfection step of the technique. Electroporation techniques, protoplast fusion and phosphoric acid 35 sinking techniques available in standard transfection steps. The above techniques are generally described in F. T〇neguzzo et al. (1986), M〇/心"^^, 6.703-706, G. Chu et al. #wc/ez.c j(10) fine (1987), 15.13 1 1 1325 'D. RiCe et al. pr〇cw (1979), 79:7862-7865; and v. 0i et al. _ _ 々Μ • SW. (4) (1983), 80: 825-829. In an example of two expression vectors, two expression vectors can be delivered to a host cell separately or collectively (co-transfer or co-transfection). The invention also provides methods of producing antibodies or polypeptides, including Host cells comprising a expression vector encoding an antibody or a polypeptide are cultured and the antibody or polypeptide is obtained from the culture by methods well known to those skilled in the art. In some embodiments, the antibody is purified by conventional immunoglobulin purification steps or 44 201125583, such as Protein A-Sepharose (pr〇tein octo-ose agarose gel), hydrocarbyl apatite chromatography (hydr Xylapatite chr〇mat〇graphy), osmotic electrophoresis, dialysis or affinity chromatography β. Further, the desired antibody can be produced in the gene transfer animal. Appropriate gene transfer animals can be obtained according to standard methods, including microinjection of the appropriate expression vector into the egg, transfer of the egg to the pseudopregnant female, and selection of the desired antibody progeny. The present invention also provides chimeric antibodies that specifically discriminate EPCAM. For example, the variant and constant regions of a chimeric antibody are from different species. In certain embodiments, the variable regions of both the heavy and light chains are derived from the murine antibodies described herein. In certain embodiments, the variant region comprises the amino acid sequence of the variant region of SEQ ID NO: 3, 5, 7, 9 11 13, 15, 17, 19, 21, 23 or 25. In certain embodiments, both the heavy and light chains are derived from human antibodies. The chimeric antibodies of the invention can be prepared by establishing well-established techniques in the art. (d) such as 'US special (4) 6, just, 9G1, US Patent No. M52, 852, US Patent No. 6,329, 5G8, US Patent No. 612〇767 and US Patent No. 5,677,427, each of which can be taken by reference The chimeric anti-sputum is prepared by inserting the CDNA of the heavy bond and the light chain variant region of the antibody into the expression vector, and the expression vector can express the chimeric antibody of the present invention once introduced into the eukaryotic host cell. Preferably, the expression vector carries a functionally complete constant heavy or light chain sequence such that any variant heavy or light chain sequence can be readily inserted into the expression vector. 45 201125583 The present invention provides anthropomorphic antibodies that specifically recognize EpCAM. Anthropo-antibody A human antibody in which the CDR residues are substituted by CDR residues of a non-human species such as a mouse, rat or rabbit and have the desired specificity, affinity and ability. In certain instances, the Fv architecture residues of a human antibody are replaced by corresponding non-human residues. There are four steps in anthropomorphic monoclonal antibodies. It is: (1) determining the nucleotide and predicted amino acid sequences of the initial antibody light and heavy chain variant regions (2) designing anthropomorphic antibodies, ie determining the antibody architecture region used in the anthropomorphic treatment process (3) Actual anthropomorphic methods/techniques and transfection and expression of anthropomorphic antibodies. See, for example, U.S. Patent Nos. 4,816,567, 5,807,715, 5,866,692 > 6,331,415, 5,530,101, 5,693,761 ^ 5'693,762, 5,585'089, 6,180,370 and 6,548,64. For example, the constant region can be designed to more closely resemble a human constant region to avoid an immune response if the antibody is used in human clinical trials and treatment. See, for example, U.S. Patent Nos. 5,997,867 and 5,866,692. • It is important to retain high affinity for antigens and other beneficial biological properties to anthropomorphic systems. To achieve this goal, anthropomorphic antibodies can be prepared by analysis of the parental sequence and the use of a two-dimensional model of the parental and anthropomorphic 歹|J. A three-dimensional immunoglobulin model can be generally obtained and known to those skilled in the art. A computer program for describing and suggesting possible three-dimensional conformational structures of candidate immunoglobulin sequences. Examination of these displays allows for the analysis of the possible role of the residue in the function of the candidate immunoglobulin sequence, i.e., the ability of the residue to influence the antigen of the candidate immunoglobulin to bind thereto. In this method, the FR residues can be selected and combined with the input sequence 46 201125583 to achieve desired antibody characteristics, such as increased affinity for the target antigen. In general, CDR residues are directly and largely involved in affecting antigen binding. Anthropomorphic antibodies may also include modifications in the pivot region to improve one or more properties of the antibody. In another alternative, antibodies can be screened and recombinantly produced by phage display technology: see, for example, U.S. Patent Nos. 5,565,332, 5,580,717, 5,733,743 and 6,265,150; and Winter et al./wwwwo/. 12:433-455 (1994) ). Alternatively, phage display technology (McCafferty et al. iVaiwre 348:552-553 (1990)) can produce human antibodies and antibody fragments in vitro using immunoglobulin variant (V) region repertoires from unimmunized donors. According to this technique, the antibody V region gene is in-frame-incorporated into any of the major or minor coat protein genes of the filamentous phage (such as M13 or fd) and is on the surface of the phage particle. Presenting functional antibody fragments. Since the filamentous microparticles contain a single-stranded DNA replica of the phage genome, screening based on the functional properties of the antibody also results in the screening of genes encoding antibodies exhibiting these properties. Thus, phage mimics certain properties of B cells. Phage display can be performed in different forms; see, for example, j〇hnson, Kevin S. and Chiswell, David J., Cwrrewi / «iSirwciwra/ 3, 564-571 (1993). The source of many V-gene fragments can be used for the presentation of bacillus. Clackson et al. iVaiMre 352:624-628 (1991) isolated a large number of different anti-oral oxaz〇l〇ne antibodies from a small random combination of V genes derived from the spleens of immunized mice. According to the technique described by Mark et al./Mo-, 222:581-597 (1991) or Griffith et al. 47 201125583 丄 12:725-734 (1993), the V gene pool from non-immune human donors can be constructed and substantially Monoclonal antibodies directed against different antigens, including autoantigens. In the natural immune response, antibody genes accumulate mutations at high rates (somatic hypermutation). Certain introduced changes can confer higher affinity and preferentially replicate and differentiate B cells that exhibit high affinity surface immunoglobulin during subsequent antigen challenge. The natural "chain shuffling" technique can be applied to simulate this natural process. Marks et al. 10:779-783 (1992)). In this method, the affinity of the "primary" human antibody obtained by phage display can be improved by replacing the heavy and light chains by a library of naturally occurring variants (libraries) of the V region genes of the unimmunized donor. District gene. This technique produces antibodies and antibody fragments with affinity in the pM-nM range.

Waterhouse et al., chest c/. and 21:2265-2266 (1993) have described strategies for generating very large phage antibody libraries (also known as "mother of all libraries"). Gene shuffling can also be used to obtain human antibodies from caries antibodies. Human antibodies have similar affinities and specificities to the initial caries antibodies. According to this method (also referred to as "epitope imprinting"), the heavy-chain or light-chain V region gene of the carioid antibody obtained by the phage display technology is replaced with the human V region gene library to produce a carious-human chimera. The choice on the antigen results in the selection of an epitope-controlled (imprinted) partner that is capable of restoring functional antigen-binding positions. Human antibodies are obtained by repeated treatment to replace the remaining caries-like ν region (see PCT Α 案 〇 〇 / / / / / / / / 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。 Unlike the traditional humanization of dentate antibodies by CDR grafting, this technology provides a full range of human antibodies that do not have a framework or CDR residue of the caries source. It is obvious that although the above is about anthropomorphic antibodies, the general principles discussed apply to custom antibody applications such as dogs, cats, primates, horses and cattle. In certain embodiments, the anti-system is a fully human antibody. A non-human antibody that specifically binds to an antigen can be used to produce a fully human antibody that binds to an antigen. For example, a person skilled in the art can apply a strand exchange technique in which the heavy chain of a non-human antibody is expressed in conjunction with a library of expressions representing different human light chains. The hybrid antibody (containing a human light bond and a non-human heavy bond) is then screened for antigen binding. The light bonds involved in antigen binding are then presented together with the human antibody heavy chain library. The human antibody was screened again for antigen binding. For example, the technique of this method is described in U.S. Patent No. 5'565'332. In addition, the antigen can be used to inoculate an animal whose gene is transferred to the human immunoglobulin gene. See, for example, U.S. Patent No. 5,661, 〇16. The antibody may be a bispecific antibody (a monoclonal antibody having binding specificity for at least two different antigens (including epitopes)). The dual-species antibody provided by the present invention includes a first binding region that specifically recognizes EpCAM, and a second binding region that specifically discriminates different antigens. In certain embodiments, the second binding region of the bispecific antibody specifically discriminates cD3 (e.g., human CD3). In certain embodiments, the bispecific antibody comprises a heavy chain variant region and/or a light chain variant region, and the heavy chain variant region comprises one, two or three derived from any of the anti-EpCAM antibodies described herein (eg, 8 lGl) The CDRs of the heavy chain of 〇, 1F10, 2D11, 6D11, 4D2), the light chain variant region comprises one, two or three derived from any of the 49 201125583 anti-EpCAM antibodies described herein (eg, i2H8, 1G10, 1F10, 2D1) 1, CDR of the light chain of 6D1 1, 4D2).

Bispecific antibodies that bind both EpCAM and CD3 can be made using methods known in the art. For example, two bispecific antibodies with a combination of EpCAM and CD3 are currently being tested in clinical trials. Catumomamab is a bispecific antibody designed for the treatment of patients with malignant ascites in clinical development (Fresenius Biotech & Trion, Clin Cancer Res 2007; 13(13): 3899 &gt British Journal of Cancer 2007 ; 97 : 3 15 - 321, Journal of Experimental & Clinical Cancer Research 2009 .* 28 .* 18, J Clin Oncol 2009 ; 27 : 15s (suppl ; abstr 3036)) ° MT110 is another A bispecific T-cell junction (BiTE) antibody of the type that utilizes a single-chain Fv (scFv) construct. MT110 is currently being tested in stage 1 lung cancer patients with gastric cancer (Micromet Inc., Bethesda, Cancer Res 2009; 69(12): 4941-4, Molecular Immunology 2006; 43: 1 129-1 143 · Cancer Res 2008; 68 ( 1): 143-51> Cancer Res 2009; 69(12): 4941-4, Immunobiology 2009; 214: 441-453) ° Methods for generating bispecific antibodies in the art (see, for example, Suresh et al. (1986) , Mei/zoA ί «five "zymo/ogy 121:210). Traditionally, recombinant production of bispecific antibodies has been based on the common expression of two immunoglobulin heavy chain-light chain pairs, which have different specificities (Millstein and Cuello, (1983), iVaiwre 305, 537-539) » A 50 201125583 In some embodiments, the dual-specific antibody specifically binds both EpCAM and (10). According to the method for producing a bispecific antibody, the antibody variant region having the desired specificity (antibody-antigen binding site) is fused to the immunoglobulin constant region sequence. The fusion is preferably a constant region of the immunoglobulin heavy chain (including at least a portion of the hub, CH2 and (5) regions). Preferably, the first heavy chain constant region (chi) comprising the desired position for light chain binding is in at least one fusion. The DNA encoding the immunoglobulin heavy chain fusion and, if desired, the immunoglobulin light linkage is inserted into a different expression vector' and co-transfected into the appropriate host organism. The unequal ratio of the trimeric peptide chains used in the construction provides an optimum yield. In this embodiment, the method provides for adjusting the reciprocal ratio of the trimeric peptide fragments to each other. However, when the performance of at least two identical ratios of the peptide peptide results in high yield or when the ratio is not of a specific significance, it is possible to insert a coding sequence of two or all three polypeptide bonds into a expression vector. In the Φ method, the bispecific resistance system consists of a heterozygous immunoglobulin heavy chain with a first binding specificity in one arm and a hybrid immunoglobulin heavy chain-light chain pair in the other arm (providing a second binding) Specificity). This immunoglobulin light chain promotes the separation of the desired bispecific compound from the unwanted immunoglobulin chain only in the asymmetric structure of half of the bispecific molecule. This method is described in PCT Publication WO 94/04690, published March 3, 1994. HeteroconjUgate antibodies comprising two covalently linked antibodies are also within the scope of the invention. The above antibodies have been used to direct the immune system 51 201125583 system cells to unwanted cells (U.S. Patent No. 4,676,980) and for the treatment of HIV infection (PCT Publications WO 91/00360 and WO 92/2003 73; and EP 03 0 89). Heteroconjugate antibodies can be produced using any convenient cross-linking method. Suitable crosslinkers and techniques are well known in the art and are described in U.S. Patent No. 4,676,980. Single-chain Fv fragments can also be produced, as described, for example, in Iliades et al. 1997, 409:437-441. The coupling of the above single-stranded fragments using different linkers is described in Kortt et al. 1997, corpse roiez•«五 10:423-43 3. Many techniques for recombinant production and use of antibodies are well known in the art. The present invention provides single-chain, bispecific antibodies, e.g., single-chain, bispecific antibodies comprising (a) a first antigen-binding region, a specific binding to human EpC AM, and (b) a second antigen-binding region, specifically binding to a human CD3 antigen. The first antigen binding region specifically binds to human EpCAM, e.g., it specifically binds to an epitope in amino acid 24-63 of human EpCAM. In certain embodiments, the first antigen binding region comprises a heavy chain variant region (VHEpCAM) and/or a light chain variant region (VLEpCAM). The second antigen binding region specifically binds to the human CD3 antigen. In certain embodiments, the second antigen binding region comprises a heavy chain variant region (VHCD3) and/or a light chain variant region (VLCD3). The arrangement of the variant regions from the N-terminus to the C-terminus allows the bispecific antibodies provided herein to specifically bind to human EpCAM and specifically bind to human CD3 antigens, for example, the N-terminal to C-terminal arrangement of the variant regions, such as VLEpCAM_VHEpCAM-VHCD3-VLCD3 or

VlCD3-VhCD3-VhEPCAM-VlEpCAM. In certain embodiments, the single-chain, bispecific antibody provided by the present invention includes: (a) a first antigen binding region that specifically binds to an epitope in amino acid 24-63 of human EpCAM, wherein the first antigen binds The region includes a heavy chain variant region (VHEpCAM) and a light chain variant region (VLEpCAM); and (b) a second antigen binding region that specifically binds to a human CD3 antigen, wherein the second antigen binding region comprises a heavy chain variant region (VHCD3) and The light chain variation region (VLCD3); wherein the variation region from the N-terminus to the C-terminus is VLEpCAM-VHEpCAM-VHCD3-VLCD3. "VLEpCAM" and "VHEpCAM" respectively mean a light chain and a heavy chain which specifically bind to the anti-EpCAM antibody or antigen-binding region of EpCAM. "VlCD3" and "VhCD3" mean a light chain and a heavy chain which specifically bind to the anti-CD3 antibody of CD3 or the variable region of the antigen-binding region, respectively. In certain embodiments, the first antigen binding region comprises VHEpCAM and VLEpCAM. In certain embodiments, the first antigen binding region comprises: VHEpCAM comprising one, two or three CDRs of SEQ ID NO: 3 and/or VLEpCAM comprising one, two or three CDRs of SEQ ID NO: 5. In certain embodiments, the first antigen binding region comprises: VHEpCAM comprising one, two or three CDRs of SEQ ID NO: 7; and/or VLEpCAM comprising one, two or three CDRs of SEQ ID NO: 9. In certain embodiments, the first antigen binding region comprises: VHEpC AM comprising one, two or three CDRs of SEQ ID NO: 11; and/or VLEpCAM comprising one, two or three CDRs of SEQ ID NO: 13. . In certain embodiments, the first antigen binding region comprises: VHEpC AM, comprising one, two or three SEQ ID NO: 15 CDR; 53 201125583 and/or VLEpCAM, comprising one, two or three SEQ ID NO: 17 CDR. In certain embodiments, the first antigen binding region comprises: VHEpC AM, comprising one, two or three CDRs of the sequence 歹ij number···9; and/or VlEpCAM, including one, two or three sequence numbers : CDR of 21 . In certain embodiments, the first antigen binding region comprises: VHEpCAM comprising one, two or three CDRs of SEQ ID NO: 23; and/or VlEpCAM comprising one, two or three CDRs of SEQ ID NO: 25. In certain embodiments, VHEpCAM and/or VLEpCAM are anthropomorphized. In certain embodiments, VHCD3 and/or VLCD3 are anthropomorphized. In certain embodiments, the first antigen binding region comprises VHEpCAM, comprising the amino acid sequence of SEQ ID NO: 27; and/or VLEpCAM, comprising the amino acid sequence of SEQ ID NO: 29. In certain embodiments, the first antigen binding region comprises VHEpCAM, comprising the amino acid sequence of SEQ ID NO: 31; and/or VLEpCAM, comprising the amino acid sequence of SEQ ID NO: 33. In certain embodiments, the first antigen binding region comprises VHEpCAM, comprising the amino acid sequence of SEQ ID NO: 35; and/or VLEpCAM, comprising the amino acid sequence of SEQ ID NO: 37. In certain embodiments, a single-chain, bispecific antibody comprises a peptide linker between two variant regions (e.g., between VLEpCAM and VHEpCAM, between VHEpCAM and VHCD3, and/or between VHCD3 and VLCD3). In certain embodiments, the bispecific antibody further comprises a human serum albumin sequence (HSA), such as a bispecific antibody comprising a HSA at the C-54 201125583 end of the bispecific antibody. The human serum albumin sequence may comprise the amino acid sequence of SEQ ID NO: 45 or SEQ ID NO: 47. In certain embodiments, the bispecific antibody further comprises a zygote linker between the variant region (such as VLEpCAM, VHEpCAM, VhCD3 or VlCD3) and the human serum albumin sequence. A peptide linker or variant region (eg, VLCD3) provided herein between a peptide linker (such as between two variant regions (such as between VLEpCAM and VHEpCAM, between VHEpCAM and VhCD3, or between VhCD3 and VlCD3) The peptide linker to the human serum albumin sequence can include at least about 1 amino acid, 2 amino acid, 3 amino acid, 4 amino acid, 5 amino acid, 8 amino acid, 10 amine Any of a base acid, 12 amino acid, 15 amino acid, 18 amino acid, 20 amino acid, 25 amino acid or 30 amino acid. In certain embodiments, the peptide linker comprises about 1 amine. Acid, 2 amino acid, 3 amino acid, 4 amino acid, 5 amino acid, 8 amino acid, 10 amino acid, 12 amino acid, 15 amino acid, 18 amino acid, 20 amine Any of a base acid, a 25 amino acid or a 30 amino acid. The peptide linker can be any of the following: SEQ ID NO: 49 amino acid sequence of; SEQ ID NO: 53 amino acid sequence; SEQ ID NO: 51 amino acid sequence; S; GS; GGS; GGGS ( SEQ ID NO: 63); GGGGSGGGGS (SEQ ID NO: 64), GGGGSGGGGSGGGGSGGGGS (SEQ ID NO: 65); GGGGSGGGGSGGGGSGGGGSGGGGS (SEQ ID NO: 66); AAAGGSGG (SEQ ID NO: 77); GGGGSGGRASGGGGS (SEQ ID NO: 78); GGGGSGGRASGGGGSGGGGS (SEQ ID NO: : 67); STDGNT (SEQ ID NO: 68); GGSGG (SEQ ID NO: 69); SAKTTP (SEQ ID NO: 70); SAKTTPKLGG (SEQ ID NO: 55 201125583 71); RADAAP (SEQ ID NO: 72); RADAAPTVS (SEQ ID NO: : 73) ; RADAAAAGGPGS (SEQ ID NO: 74); RADAAAAGGGGSGGGGSGGGGSGGGGS (SEQ ID NO: 75); and GGKGSGGKGTGGKGSGGKGS (SEQ ID NO: 76). In certain embodiments, the peptide linker between VLEpCAM and VHEpCAM comprises the amino acid sequence of SEQ ID NO: 49. In certain embodiments, the peptide linker between VHCD3 and VLCD3 comprises the amino acid sequence of SEQ ID NO:53. In certain embodiments, the peptide linker between VHEpCAM and VHCD3 comprises the amino acid sequence of SEQ ID NO: 51. In certain embodiments, the peptide linker between VLCD3 and the human serum albumin sequence comprises the amino acid sequence of SEQ ID NO: 51. In certain embodiments, the second antigen binding region specifically binds to a CD3e, CD3y or CD35 chain. In certain embodiments, the second antigen binding region comprises VHCD3 and/or VLCD3. In certain embodiments, VHCD3 comprises the amino acid sequence of sequence number: 55. In certain embodiments, VLCD3 comprises the amino acid sequence of SEQ ID NO: 57. In certain embodiments, VHCD3 comprises one, two or three CDRs of the amino acid sequence of SEQ ID NO: 55. In certain embodiments, VlCD3 comprises one, two or three CDRs of the sequence number: 57 amino acid sequence. In certain embodiments, VHCD3 is anthropomorphized. In some embodiments, the VLCD 3 is anthropomorphized. The bispecific antibodies described herein may include the amino acid sequence of SEQ ID NO: 39, SEQ ID NO: 41 or SEQ ID NO: 43. The polynucleotide construct used to produce the single-chain, bispecific antibody provided herein may further comprise a signal peptide sequence (for example, a signal peptide is added to the bispecific antibody provided herein; Any signal peptide sequence known to those skilled in the art can be used. The signal peptide sequences used in Example 8 can be applied. In certain embodiments of the bispecific antibodies provided herein, the bispecific antibodies include histidine labeling ( For example, a 6XHis tag), such as a bispecific antibody, includes a 6XHis tag at the C-terminus of the antibody. In certain embodiments of the bispecific antibodies provided herein, the bispecific antibody does not include a histidine tag. The invention not only includes the above-mentioned monoclonal antibodies, but also includes any fragments thereof containing the active binding regions of the antibodies, such as Fab, F(ab')2, scFv, FV fragments, etc. The techniques can be used to establish quite perfect techniques from this paper. The monoclonal antibody produced the above fragment (R〇usseaux et al. (1986), in Mei/zoA £«z;; wo/·, 121:663_69 Academic

Press). Techniques for preparing antibody fragments are known in the art. For example, antibody fragments are cleaved with pepsin to produce an antibody fragment called F(ab,)2. This fragment can be further cleaved with a thiol reducing agent and a selective thiol group (cleavage from disulfide bonding) to generate a 5 〇 Kd Fab' monovalent fragment. Alternatively, enzymatic cleavage using papain directly produces two monovalent Fab fragments and Fc fragments. These methods are described, for example, in U.S. Patent Nos. 4,036,945 and 4,331,647, the entireties of each of each of See also Nisonoff et al. (i960), Arch Biochem. Biophys. 89: 230; Porter (1959), Biochem. J. 73: 119 > Smyth (1967), Methods in Enzymology ii; 57 201125583 421-426 〇 or ' The Fab can be produced by inserting the DNA encoding the Fab of the antibody into a prokaryotic expression vector or a eukaryotic expression vector, and directing the vector to a prokaryote or eukaryote to express the Fab.

In addition to the selection of primary cells, factors affecting the process of recombinant production of antibodies include growth patterns, media formulations, culture densities, oxidative pH, purification protocols, and the like. A number of methods have been proposed for altering the glycosylation pattern achieved in a particular host organism, including the introduction or overexpression of certain enzymes involved in the production of oligobiliary (U.S. Patent No. 5, (d), 33, 5, 510, 261 and 5, 278, 299). The brewing or some types of saccharification can be removed from glycoproteins, such as endoglycosidase H(1), N-sugar (tetra) F, endosaccharide (tetra) Fb (tetra) enzyme, and inner sugar (iv) ρ3. In addition, 'recombinant host cells can be inherited Designed to be defective in the treatment of certain types of polysaccharides. Technical cards are known for these and similar techniques. In some embodiments, the coupling techniques employed in the art can be used to modify the antibody of the present invention. However, it is not limited to enzyme means, oxidative substitution and sonication. For example, Kang Tian 攸 应用 应用 应用 应用 应用 应用 应用 应用 应用 应用 应用 应用 应用 应用 应用 应用 应用 应用 应用 应用 应用 应用 应用 应用 。 。 。 。 。 。 。 。 。 。 。 。 Standard assays for screening, some of which are described below and in the Examples. The antibodies or polypeptides of the invention can be conjugated (eg, linked) to a reagent (❹' therapeutic agent) and a label. Examples of therapeutic agents are radioactive. Partial, cytotoxic or chemotherapeutic molecule. The antibody (or polyphonic) of the invention can be linked to a label, such as Laoguang 58 201125583

3H, 14c, 15N, 35S, 90Y, "Tc, mIn, 12 scoops, molecules, radioactive molecules, enzymes or other labels conventionally known in the art. The term "marker" as used herein refers to any molecule that can be detected. In some embodiments, the antibody can be labeled by incorporation of a radiolabeled amino acid. In certain embodiments, a biotin moiety that is detectable by a labeled avidin (e.g., streptavidin comprising a fluorescent label or enzyme activity detectable by optical or colorimetric detection) can be attached to the antibody. In certain embodiments, the reagent may be incorporated or attached to another reagent, and the reagent is recombined with the antibody of interest. For example, the label may be incorporated or attached to an antibody, and the antibody is specifically bound. Concerned about antibodies. In some embodiments, the marker or marker can also be therapeutic. A number of methods for labeling polypeptides and glycoproteins are known in the art and can be applied. Some general types of markers include, but are not limited to, enzymes, fluorescent, chemiluminescent, and radioactive labels. Examples of labels for polypeptides include, but are not limited to, the following: radioisotopes or radionuclides (such as ui, 丄N, δ > -Y, -Tc, mIn ^ nsj % η, I} camping markers (such as , fluorescent isothiocyanate (FITC), rhodamine, lanthanide ph〇sph〇rs, phycoerythrin (PE), enzyme labeling (such as horseradish peroxidase, ••galactosidase, luciferase (1UCife(10)), assay acid oxidase, glucose oxidase, glucose-6-phosphate dehydrogenase, alcohol dehydrogenase, malate dehydrogenase, penicillinase (penicillin) (ase), luminescent enzyme) (―(4)), secondary receptor discrimination such as 'leucine zipper pair sequence, secondary antibody binding position, metal, region, epitope tag). In some embodiments, the markers are attached by spacer arms of different lengths to reduce possible spatial obstructions. 59 201125583 The invention also provides pharmaceutical compositions comprising an antibody or polyacid as described herein, and a pharmaceutically acceptable carrier or excipient. Pharmaceutically acceptable excipients are well known in the art and are relatively inert materials which promote the application of a pharmaceutically effective substance. For example, the excipient can be given a shape or a viscous or as a diluent. Suitable excipients include, but are not limited to, stabilizers, wetting and emulsifiers, salts of different osmotic pressures, encapsulants, buffers, and skin penetration enhancers. Occupational agents and parenteral and parenteral drug delivery systems

In Remington, The Science and Practice 〇f pha_cy 2 she

Ed. Mack Publishing (2000). In certain embodiments, the invention provides compositions (described herein) for use in any of the methods described herein, whether used as a pharmaceutical agent and/or as a manufacturing agent. Polynucleotides, Vectors, and Host Cells The invention also provides polynucleotides which comprise a nucleotide sequence encoding any of the antibodies and polypeptides described herein. In certain embodiments, the polypeptide comprises a sequence of light and/or heavy chain variant regions. In certain embodiments, the polynucleotide comprises one or more nucleic acid sequences encoding an anti-EpCAM antibody described herein. In certain embodiments, a polynucleotide comprises one or more nucleic acid sequences encoding a single-chain, bispecific antibody described herein. In certain embodiments, the polynucleotide comprises a nucleic acid sequence encoding a heavy chain variant region and a nucleic acid sequence encoding a light chain variant region comprising one, two or three SEQ ID NO: 3 CDRs and a light chain The variant region includes one, two or three CDRs of sequence number: 5. In certain embodiments, the '60 201125583 polynucleotide comprises a nucleic acid sequence encoding a heavy chain variant region and a nucleic acid sequence encoding a light chain variant region. The heavy chain variant region comprises one, two or three CDRs of SEQ ID NO: 7. The light chain variant region comprises one, two or three CDRs of sequence number: 9. In certain embodiments, the polynucleotide comprises a nucleic acid sequence encoding a heavy chain variant region and a nucleic acid sequence encoding a light chain variant region. The heavy chain variant region comprises one, two or three SEQ ID NO: 11 CDRs and a light chain The variant region includes a 'two or three sequence number: the CDR of J3. In certain embodiments, a 'polynucleotide comprises a nucleic acid sequence encoding a heavy bond variant region and a nucleic acid sequence encoding a light chain variant region, the heavy chain variant region comprising one, two or three SEQ ID NO: 15 CDRs and light The strand variant region includes one, two or three sequence numbers: the CDR of 17. In certain embodiments, the polynucleotide comprises a nucleic acid sequence encoding a heavy chain variant region and a nucleic acid sequence encoding a light chain variant region, the heavy chain variant region comprising one, two or three sequence numbers: 19 CDRs and light bonds The variant region includes one, two or three sequence numbers: the CDR of 21. In certain embodiments, the polynucleotide comprises a nucleic acid sequence encoding a heavy chain variant region and a nucleic acid sequence encoding a light chain variant region, the heavy chain variant region comprising one, two or three SEQ ID NO: 23 CDR and light chain The variant region includes one, two or three CDRs with a sequence number: 25. In certain embodiments, the polynucleotide comprises a nucleic acid sequence encoding a heavy chain variant region and/or a nucleic acid sequence encoding a light bond variant region, the heavy bond variant region comprising the amino acid sequence of SEQ ID NO: 3, and the light chain variation The region includes the amino acid sequence of SEQ ID NO: 5. In certain embodiments, the polynucleotide comprises a nucleic acid sequence encoding a heavy chain variant region and/or a nucleic acid encoding a light chain variant region 61 201125583 sequence, and the heavy chain variant region comprises a sequence number: amino acid sequence of 7' The strand variation region includes the amino acid sequence of SEQ ID NO: 9. In certain embodiments, the polynucleotide comprises a nucleic acid sequence encoding a heavy chain variant region and/or a nucleic acid sequence encoding a light chain variant region, the heavy chain variant region comprising the amino acid sequence of SEQ ID NO: 11 and a light chain variant The region includes the amino acid sequence of SEQ ID NO: 13. In certain embodiments, the polynucleotide comprises a nucleic acid sequence encoding a heavy chain variant region and/or a nucleic acid sequence encoding a light chain variant region, the heavy chain variant region comprising the amino acid sequence of SEQ ID NO: 15 and a light chain variant The region includes the amino acid sequence of SEQ ID NO: 17. In certain embodiments, the polynucleotide comprises a nucleic acid sequence encoding a heavy chain variant region and/or a nucleic acid sequence encoding a light chain variant region, the heavy chain variant region comprising the amino acid sequence of SEQ ID NO: 19, and the light chain variation The region includes the sequence number: amino acid sequence of 2 1 . In certain embodiments, the polynucleotide comprises a nucleic acid sequence encoding a heavy chain variant region and/or a nucleic acid sequence encoding a light chain variant region, the heavy chain variant region comprising the amino acid sequence of SEQ ID NO: 23, and the light chain variation The region includes the sequence number: 25 amino acid sequence. In certain embodiments, the polynucleotide comprises one or more nucleic acid sequences encoding a single-chain, bispecific antibody, and the single-chain, bispecific antibody comprises (a) a first antigen-binding region that specifically binds to human EpCAM (eg, Specifically binding to an epitope in amino acid 24-63 of human EpC AM), wherein the first antigen binding region comprises a heavy chain variant region (VHEpCAM) and/or a light chain variant region (VLEpCAM); and/or (b) a second antigen-binding region that specifically binds to a human CD3 antigen' wherein the second antigen-binding region comprises a heavy bond variant region (VHCD3) and/or a light chain variant region (VLCD3); wherein the region of the variant region is cis 62 201125583, for example by The order of arrangement from the N-terminus to the C-terminus is VLEpCAM-VHEpCAM-VHCD3-VLCD3. In certain embodiments, the polynucleic acid comprises the nucleic acid sequence of SEQ ID NO: 4 and/or the nucleic acid sequence of SEQ ID NO: 6. In certain embodiments, the polynucleotide comprises a nucleic acid sequence of SEQ ID NO: 8 and/or a nucleic acid sequence of SEQ ID NO: 10. In certain embodiments, the 'polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 12 and/or the nucleic acid sequence of SEQ ID NO: 14. In certain embodiments, the polynucleotide comprises a nucleic acid sequence of SEQ ID NO: 16 and/or a nucleic acid sequence of SEQ ID NO: 18. In certain embodiments, the 'polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 20 and/or the nucleic acid sequence of SEQ ID NO: 22. In certain embodiments, the polynucleotide comprises a nucleic acid sequence of SEQ ID NO: 24 and/or a nucleic acid sequence of SEQ ID NO: 26. In certain embodiments, the polynucleotide comprises a nucleic acid sequence of SEQ ID NO: 28 and/or a nucleic acid sequence of SEQ ID NO: 30. In certain embodiments, the polynucleotide comprises a nucleic acid sequence of SEQ ID NO: 32 and/or a nucleic acid sequence of SEQ ID NO: 34. In certain embodiments, the 'polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 36 and/or the nucleic acid sequence of SEQ ID NO: 38. In certain embodiments, the polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 56 and/or the nucleic acid sequence of SEQ ID NO: 58. In certain embodiments, the polynucleotide comprises a nucleic acid sequence of SEQ ID NO:40. In certain embodiments, the polynucleotide comprises a nucleic acid sequence of SEQ ID NO: 42. In certain embodiments, the polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 44. Those skilled in the art will appreciate that due to the degradation of the genetic code, a number of nucleotide sequences encode one of the polypeptides described herein. 63 201125583 of these polynucleotides, some of which have minimal homology to the nucleotide sequence of any native gene. Thus, the present invention specifically considers changes in polynucleotides resulting from differences in codon usage. Furthermore, the dual gene of the gene comprising the polynucleotide sequence provided herein is within the scope of the invention. A dual gene is an endogenous gene that is altered by one or more mutations, such as deletion, addition and/or substitution of nucleotides. The resulting mRNA and protein may, if not necessarily, have altered structure or function. Dual genes can be identified using standard techniques such as 'hybridization, amplification and/or database sequence alignment. The polynucleotide of the present invention can be obtained by chemical synthesis, recombinant methods or PCR. Methods of synthesizing chemical polynucleotides are well known in the art and need not be described in detail herein. Those skilled in the art can utilize the sequences provided herein and commercial DNA synthesizers to generate the desired DNA sequence. For the preparation of polynucleotides by recombinant methods, a polynucleotide comprising the desired sequence can be inserted into a suitable vector and the vector subsequently introduced into a suitable host cell for replication and amplification' as further described herein. The polynucleotide can be inserted into a host cell by any means known in the art. The exogenous polynucleotide is introduced into the transformed cell by direct ingestion, endocytosis, transfection 'F-mating or electroporation. Once introduced, the exogenous polynucleotide can be maintained in the cell as a non-incorporated vector (e. g., plastid) or incorporated into the host cell genome. The polynucleic acid thus amplified can be isolated from the host cell by a conventional method in the art. See, for example, Sambrook et al. (1989). Or 'PCR can produce DNA sequences. PCR technology is well known in the art and is described in U.S. Patent Nos. 4,683,195, 4,800,159, 4,754,065 64 201125583 and 4,683,202 and PCR: The Polymeraase Chain Reaction,

The invention also provides vectors (such as selection vectors, expression vectors) comprising a nucleic acid sequence encoding any of the polypeptides (including antibodies) described herein. Appropriate selection vectors can be constructed according to standard techniques or selected from a wide variety of techniques. Although the selection of the selection vector may vary depending on the host cell for which the application is intended, useful selection vectors typically have the ability to self-replicate, have a single target with specific restriction enzymes and/or carry a vector for selection. Marker gene of the plant. Suitable examples include plastid and bacterial viruses such as pUC18, PUC19, Bluescript (eg 'pBS SK+) and its derivatives, mpU, mpi9, pBR322, PMB9, ColE, PCR RP4 'phage DNA, and shuttle vectors, such as PSA3 and pAT28 . These and many other selection vectors are available from commercial vendors such as BioRad, Strathegene and Invitr〇gen. The expression vector is typically a replicable polynucleotide construct comprising a polynucleotide according to the invention. Performance carrier. The expression vector can be replicated in the host cell

Promoters, enhancers, and terminators). One or more translational controls are also required for hang-ups, such as ribosome binding positions, translation start positions, and termination ciphers. A vector comprising a polynucleotide of interest can be introduced into a host cell by a number of suitable means, including electroporation, application of calcium chloride, gasification hydrazine, calcium sulphate, DEAE-polydextrose (DEAE-dextran) or other substances. Transfection, micro; main shot as a hit; lipofection (lip0fecti〇n); and infection (for example, when the vector is an infectious agent such as vaccinia virus). The choice of introduction vector or polynucleotide will generally depend on the characteristics of the host cell. In certain embodiments, the vector comprises a polynucleotide comprising one or more amino acid sequences encoding an antibody (e.g., an anti-EpCAM antibody) described herein. In certain embodiments, the vector comprises a polynucleotide comprising one or more amino acid sequences encoding a single-chain, bispecific antibody described herein. The invention also provides host cells comprising any of the polynucleotides described herein (eg, a polynucleotide comprising one or more amino acid sequences encoding an antibody (eg, an anti-EpCAM antibody) described herein (eg, an anti-EpCAM antibody) Or a vector (eg, a vector comprising a polynucleotide comprising one or more amino acid sequences encoding an antibody (eg, an anti-EpCAM antibody) described herein). Any host cell capable of overexpressing heterologous DNA can be used for the isolation of genes encoding antibodies, polypeptides or proteins. Non-limiting examples of mammalian host cells include, but are not limited to, COS, HeLa, and CH0 cells. See also PCT Publication W0 87/04462. Suitable non-mammalian host cells include prokaryotes (such as £.co/i or β. with yeast (such as; or amp/aciis). In certain embodiments, the host cell comprises a polynucleotide comprising One or more of the amino acid sequences of the single-chain, bispecific antibodies described herein, cit.

The invention provides for the use of an antibody of the invention (eg, an anti-EpCAM antibody), a polypeptide, and a polynucleic acid (eg, a polynucleic acid comprising one or more amino acid sequences encoding an anti-EpCAM antibody) Detecting, diagnosing, and monitoring diseases, abnormalities, or symptoms associated with EpCAM performance, EpCAM exhibits increased or decreased performance and/or inappropriate performance relative to normal sample lines (eg, tissues and/or cells that typically lack EpCAM performance) The presence of a single-stranded, bispecific antibody described herein or a polynucleotide comprising one or more amino acid sequences encoding a single-bond, bispecific antibody described herein, in certain embodiments. In one embodiment, the method includes detecting EpCAM expression in a sample taken from the subject' and the subject is suspected of having cancer (eg, breast cancer, colorectal cancer, stomach cancer, lung cancer, prostate cancer, pancreatic cancer, throat cancer) Preferably, the method for detecting ovarian cancer comprises contacting the sample with the antibody, polypeptide or polynucleotide of the present invention and determining whether the level of binding is different from the binding level of the control or the comparative sample. Whether the antibody or polypeptide described herein is suitable for treating a patient. The term "sample" or "biological sample" as used herein refers to the entire organism or a portion of its tissues, cells or components (eg, body fluids include (but are not limited to) ) Liquid A, mucus, lymph, joint fluid, cerebrospinal fluid, saliva, amniotic fluid, amniotic cord blood, urine, vaginal fluid and semen). The "sample" or "biological sample" is further represented by the whole organism or its organization, 67 201125583 A homogenate, lysate or extract prepared from a portion of a cell or component that includes, but is not limited to, plasma, gold, spinal fluid, lymph, outer parts of the skin, respiratory tract, intestinal tract and genitourinary tract , tears, saliva, milk, blood cells, tumors, organs. Most of the samples have been removed automatically, but the words "sample" or "biological sample" can also represent cells or tissues analyzed in vivo, that is, no need to Removal of animals. Generally, 'samples' or 'biological samples' contain cells from animals, but the term also means To measure cancer-related polynucleic acid or polypeptide levels of non-cellular biological materials, such as non-cellular parts of blood, saliva or urine. "Sample" or "biological sample" further represents the medium, for example, has been proliferated A nutrient soup or gel in which it contains a cellular component, such as a protein or nucleic acid molecule. In the embodiment, the antibody is contacted with the cell or cell/tissue lysate and the binding of the antibody to the cell is determined. In the case of binding activity of control cells of the same tissue type, this represents the cancerousness of the test cell line. In some embodiments, the test cell line is derived from human tissue. A number of techniques are known for detecting specific antibody-antigen binding. Methods. Exemplary immunoassays that can be performed in accordance with the present invention include fluorescence polarization immunoassay (FPIA), fluorescent immunoassay (FIA), enzyme immunoassay (EIA), and turbidity inhibition immunoassay (nephei) 〇metric inhibition immunoassay (NIA), enzyme-linked immunosorbent assay (ELISA) and radioimmunoassay (RIA). The indicator moiety or labeling group can be attached to the test antibody and selected to meet the needs of the applicable test equipment and the different methods typically employed in the compatible immunoassay steps. 68 201125583 Suitable markers include, without limitation, radionuclides (such as mi, 13ΐι, S, 3h, or 32P), enzymes (such as alkaline phosphatase, horseradish peroxidase, luminescent enzyme, or galactosides) Enzyme), fluorescent moiety or protein (such as fluorescein, rhodamine, phycoerythrin, GFp or BFp) or luminescent (such as Q_tum Dot c〇rp〇mi〇n, ρ&1〇 Μ.,Μ Provided QdotTM nanoparticle). Those skilled in the art are familiar with the general techniques that will be applied to the various immunoassays described above.

For diagnostic purposes, a detectable moiety can be used to label a polypeptide comprising an antibody, and the detectable moiety includes, but is not limited to, a radioisotope, a fluorescent label, and many other enzyme-matrix labels as is known in the art. A method of joining a label to an antibody is known in the art. In certain embodiments, it is not necessary to label a polypeptide comprising an antibody of the present invention, and a labeled antibody that binds to the antibody of the present invention can be used to detect its presence. The antibodies of the present invention can be applied to any of the conventional test methods, such as competitive binding assays, direct and indirect gamma, ΛJ beta assays and immunosuppression assays. Z〇1a, M〇n〇clonal Antib〇dies: A M_ai 〇f pp.147-158 (CRC Press, Inc. 1987) 抗体 Antibodies and polypeptides can also be used in in vivo diagnostic assays, such as in vivo imaging. The antibody or polypeptide is usually labeled with a radionuclide (such as '(1) 匕, 99tc, 丨4匸, (1), 125I or 3H) so that immunofluorescence angiography (immUn〇SCinti〇graphy) can be used to locate the cell of interest. Or organization. Antibodies can also be used as pathology (using techniques known in the art) (iv). 69 201125583 Therapeutic Applications The antibodies of the present invention are capable of causing cell death of cancer cells in the absence of cytotoxic junctions, immune effector functions or cross-linkers in vitro. These antibodies can have a more potent anti-cancer effect in vivo. Thus, the invention provides therapeutic applications of an antibody of the invention (e.g., an anti-EpCAM antibody described herein) and a polypeptide in the treatment of cancer, delaying the progression of cancer, and/or avoiding cancer, such as breast cancer, colorectal cancer, Gastric cancer, lung cancer, prostate cancer, pancreatic cancer, throat cancer and ovarian cancer. Any cancer cell that exhibits EpCAM that is recognized by the antibodies described herein can be treated. The method can further comprise the step of detecting binding between the antibody or polyphosphate described herein and the tumor or cancer cell in the subject to be treated. In certain embodiments, the anti-system is a single-chain, bispecific antibody provided herein. In certain embodiments, the single-chain, bispecific antibody comprises (a) a first antigen binding region that specifically binds to human EpCAM (eg, specifically binds to an epitope in amino acid 24-63 of human EpCAM), wherein An antigen binding region includes a heavy chain variant region (VhEpCAm) and/or a light chain variant region (VLEpC AM); and/or (b) a second antigen binding region that specifically binds to a human CD3 antigen' wherein the second antigen binding region comprises The heavy bond variant region (VHCD3) and/or the light chain variant region (VlCD3); wherein the sequence of the variant regions is configured (eg, 'the order from the N-terminus to the C-terminus is VLEpCAM-VHEpCAM-VHCD3-VLCD3). Typically, an effective dosage composition comprising an antibody or a polypeptide is applied to a subject in need of treatment, thereby inhibiting the growth of cancer cells and/or triggering the death of cancer cells. Preferably, the composition is formulated as a pharmaceutically acceptable carrier. In one embodiment, the composition is configured to be applied by intraperitoneal, intravenous, subcutaneous and intramuscular injection, and other forms of application, such as oral, mucosal, inhalation, sublingual, and the like. In another embodiment, the invention also contemplates the application of an antibody or a polymeric composition of the invention that incorporates other molecules, such as 'detectable 仏5 or therapeutic or cytotoxic agents. Reagents can include, but are not limited to, radioisotopes, toxins, toxoids, inflammatory agents, enzymes, antisense molecules, peptides, cytokines, or chemotherapeutic agents. Those skilled in the art are generally familiar with methods of joining antibodies to the above molecules. See, for example, the PCT publications WO 92/08495, WO 91/14438, WO 89/12624, and U.S. Patent No. 5,314,995, the entire disclosure of which is incorporated herein by reference. In one embodiment, the composition comprises an antibody or a polypeptide that binds to a cytotoxic agent. The cytotoxic agent can include any agent that is detrimental to the cells. Preferred cytotoxic agent types that can be conjugated to the antibody or fragment include, but are not limited to, Pacific paclitaxol, cyt〇chalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, Etoposide, tenoposide, vincristine, vinblastine, colchicin, doxorubicin, daunorubicin Daunorubicin), dihydroxy 71 201125583 anthracin dione, mitoxantrone, mithramycin, actinomycin D, 1-dehydrocinone ( 1-dehydrotestosterone), glucocorticoids, procaine, tetracaine, lidocaine, propranolol and puromycin And analogs or homologs as described above. The dosage required for treatment depends on the route of application chosen, the nature of the formulation,

The type of disease, subject size, body weight, surface area, age and sex of the subject; other agents applied and the judgment of the attending physician. The appropriate dose range is 0.01 - 1000.0 mg / kg. Generally, any of the following dosages can be applied: at least about 5 mg/kg (body weight); at least about 10 mg/kg (body weight); at least about 3 mg/kg (body weight); at least about 1 mg/kg (body weight); at least About 750 pg/kg (body weight); at least about 50 〇 Pg/kg (body weight); at least about 250 pg/kg (body weight); at least about 1 〇〇

Pg/kg (body weight); a dose of at least about 5 〇Jig/kg (weight at least about (weight)' of at least about 1 pg/kg (body weight) or less. Repeat for days or longer (depending on symptoms) In terms of application, the treatment continues until the onset of symptoms of the disease in which the desired disease symptoms occur. "The exemplary dosing regimen involves the application of a weekly dose of about 6 mg/kg of antibody. However, depending on the drug degenerative pattern that the physician wants to achieve, Other dosing regimens are useful. Empirical considerations (9), such as half-life), generally aid in the determination of the dose. The progress of this treatment can be easily monitored by conventional techniques and experiments. In some subjects, higher than - dose is required. The frequency of application can be determined and adjusted during the course of treatment. For example, the frequency of application can be determined or adjusted depending on the type of cancer to be treated and the phase of the 2011, 2011, 583, the application of the agent for prophylactic or therapeutic purposes, prior treatment, the patient's clinical history and response to the agent, and the judgment of the attending physician. The clinician typically applies a therapeutic antibody (e. g., 'chimeric 5F1 antibody) until the appropriate dose is reached to achieve the desired result. In some instances, a sustained continuous release formulation of the antibody is appropriate. Different formulations and devices that are continuously released are known in the art. In one embodiment, the dose of the antibody or polypeptide can be empirically determined on a subject that has been administered one or more applications. The subject is given an increased dose of antibody or polypeptide. To determine the efficacy of an antibody or a peptide, a marker of disease symptoms (e.g., EpCAM) can be monitored. In vivo efficiency can also be measured by determining tumor burden or volume, time to disease progression (TDP), and/or determining reaction rate (RR). The application of the antibody or polypeptide according to the methods of the invention may be sustained or periodic 'depending on the physiological symptoms such as the recipient, the treatment or prevention of the intended treatment, and other factors known as the β-antibody or polypeptide of the skilled physician. The application may be substantially continuous for a predetermined period of time or may be a continuous interval of dose. Other formulations include suitable delivery forms well known in the art including, but not limited to, carriers such as liposomes. See, for example, Mahato et al. (1997) P/mrm. 14:853-859. Liposomal preparations include, but are not limited to, cytofectins, multilamellar vesicles, and unilamellar vesicles. In another embodiment, the composition may include one or more anti-cancer agents, one or more antibodies described herein, or an antibody that may bind to a different antigen 73 201125583 or a polypeptide. The above compositions may comprise at least one, at least two, at least three, at least four, at least five different antibodies. The antibody and other anti-cancer agents may be in the same formulation (eg, a mixture, as is commonly indicated in the art), or in a different formulation (but simultaneously or sequentially), and are particularly useful for treating a wide range of individual populations. Any of the antibodies or polypeptides of the invention may also be used to deliver and express any of the antibodies or polypeptides of the invention in a desired cell. It will be apparent that expression vectors can be used to directly express antibodies or polypeptides. Expression vectors can be applied by any means known in the art, such as intraperitoneal, intravenous, intramuscular, subcutaneous, intrathecal, intraventricular, oral, enteral, parenteral, intranasal, dermal, Sublingual or by inhalation. For example, application of the expression carrier includes local or systemic application, including injection, oral, microprojectile or catheter application and topical application. Those skilled in the art are familiar with the application of performance carriers to achieve the performance of exogenous proteins in vivo. Reference to, for example, U.S. Patent Nos. 6,436,908, 6,413,942 and 6,376,471 ° may also employ targeted delivery of a therapeutic composition comprising a polynucleotide encoding any of the antibodies or polypeptides of the invention. Receptor-mediated DNA delivery techniques are described, for example, in 'Seeeis et al. TVewc/·? (1993) 1 1:202 ’ Chiou et al. Gewe TTzerapewn.d.

And Applications Of Direct Gene Transfer (JA Wolff, ed.) (1994); Wu et al.//. 5ζ·ο/. Chew. (1988) 263:621; Wu et al. J. Biol. Chem. (1994) 269 : 542 ; Zenke et al. (1990), Proc. Natl. Acad. Sci. USA, name V.3655 ·, et al. (1991), J. 74 201125583 &// C/zew· 266:338. The therapeutic composition comprising the polynucleotide is applied in a range of from about 100 ng to about 200 mg for topical application in a gene therapy regimen. A range of DNA concentrations of from about 5 ng to about 50 mg, from about 1 yg to about 2 mg, from about 5 to about 5 Å, and from about 20 pg to about 1 Torr may also be employed during the gene therapy regimen. The therapeutic polynucleotides of the invention can be delivered using a gene delivery vehicle and a polymorph. The gene delivery vehicle can be a viral or non-viral source (see generally Jolly (1994), Cancer Gene Therapy 1:51 I Kimura (1994), Human Gene Therapy 5:845; Connelly (1985), Human Gene l:i85; An endogenous mammalian or heterologous survivor promoter can be utilized with Kaplitt (1994) at 6: 148) to elicit the expression of the above coding sequences. The performance of the coding sequence can be either continuous or modulated. Viral vectors are known in the art for delivery of the desired polynucleotide and for expression in the desired cells. Exemplary viral vectors include, but are not limited to, recombinant retroviruses, such as PCT Publication WO 90/07936, WO 94/03622, WO 93/25698, WO 93/25234, WO 93/1 1230, WO 93/10218 , WO 91/02805, U.S. Patent No. 5,219,740, 4,777,127, GB Patent No. 2,200,651 and EP Patent No. 0 345 242; α-virus-type carriers such as Sindbis virus vector, Semliki forest virus (ATCC VR-67, ATCC VR-1247), Ross River virus (ATCC VR-373, ATCC VR-1246) and Venezuelan (Venezuelan) equine encephalitis virus (ATCC VR-923, ATCC VR-1250, ATCC VR 1249, ATCC VR-532)); and gland 75 201125583 related virus (AAV) vectors 'such as PCT publications w〇94/l2649, WO 93/03769, WO 93/1 919, WO 94/2893 8, WO 95/1 1984 and WO 95/00655. Curiel (1992) can also be used to apply the DNA of the ligation as described in 3:147 to kill the adenovirus. Non-viral delivery vehicles and methods may also be employed, including, but not limited to, polycation-concentrated DNA associated with or unrelated to killing adenovirus alone (see, for example, 'Curiel (1992), 3..147); Ligand_ Ligation of DNA (see, for example, ' wu (1989), /•仏0/.264:16985); eukaryotic cells transport vehicle cells (see, for example, U.S. Patent No. 5,814,482, PCT Publication No. WO 95/07994, WO 96 /17072, WO 95/30763 and WO 97/42338) with nuclear charge neutralization or fusion with cell membranes. Exemplary bare DNA introduction methods can also be applied to the PCT publication WO 90/I 1092 and U.S. Patent No. 5,580,859. Liposomes that can be used as gene delivery vehicles are described in U.S. Patent No. 5,422,120, PCT Publication No. WO 95/13796, WO 94/23697, WO 91/14445, and EP Patent No. 524 968. Additional methods are described in Philip (1994), Afo/.Ce// 5ζ·〇/. 14:241 1 and Woffendin (1994), US 91:1581. Furthermore, the invention provides a method of treating cancer, delaying the progression of cancer and/or avoiding cancer in an individual comprising a) applying to the individual an effective amount of a composition comprising an antibody of the invention, and b) applying a second cancer treatment to the individual. In certain embodiments, the second therapy includes surgery, radiation, hormonal therapy, gene therapy, other antibody therapies, and chemotherapy. The composition comprising the antibody and the second therapy can be simultaneously (e.g., 76, 2011, 583, e.g., simultaneously applied) and/or sequentially (e.g., sequentially applied). For example, the time interval between the application comprising the antibody and the second treatment is no more than about 15 minutes, such as no more than about 1 〇, 5 or 1 knive. Alternatively, the composition comprising the antibody is applied with the second therapy for a time interval of more than about 15 minutes, such as more than 2, 3, 40 or 60 minutes, i days, 2 days, 3 days, 2 weeks or } months or Any longer. The composition comprising the antibody of the present invention may be applied successively or simultaneously with one or more other therapeutic agents such as chemotherapeutic agents (such as 5-FU, 5-FU/MTX, 5-FU/Sports Folin (5_FU/Rocky tumor) ), Levamisole, Irin〇tecan, Oxahplatm, Capecitabin or Uracil/Tegafur, immunoadjuvant , growth inhibitors, cytotoxic agents and cytokines. The amount of antibody and therapeutic agent will depend on the type of drug being applied, the pathological symptoms of the treatment, and the schedule and route of administration, but will generally be less than the amount used for each individual application. Following application of a composition comprising an antibody as described herein, the efficacy of the composition in a test tube and in vivo can be assessed by various methods known to those skilled in the art. A variety of animal models for testing the anti-cancer activity of candidate compositions are known. These include athymic nude mice or scid/scid mice with ectopically transplanted human tumors, or genetic murine tumor patterns (eg, p53 knockout mice). The in vivo properties of these animal models make it particularly predictive of responses in human patients. Cells can be introduced into syngeneic mice using standard techniques to produce animals of the above model, such as subcutaneous injections, intravenous injection of 77 201125583 tail, spleen transplantation, intraperitoneal perfusion, and subcapsular infusion. Manufactured Articles and Kits The present invention also provides articles of manufacture or kits for use in the present methods. The article of manufacture or kit of the present invention comprises one or more containers comprising the purified antibodies or polypeptides described herein and instructions for use in accordance with any of the methods of the invention described herein. In certain embodiments, these instructions include the description of the application of antibodies to treat, delay, and/or avoid cancer according to any of the methods described herein, such as breast cancer, colorectal cancer, gastric cancer, lung cancer, prostate cancer, pancreas Dirty cancer, throat cancer and ovarian cancer. The kit may further comprise selecting a description of the individual suitable for treatment based on whether the individual has a disease and disease stage, or whether EpCAM is manifested on a cancer cell of the individual. In certain embodiments, a manufactured article or kit of cancer cells in a test sample comprises an antibody or a polypeptide as described herein and a plurality of reagents that detect antibody or polypeptide binding cells in the sample. Instructions for the use of antibodies or polypeptides for treatment, delayed development, and/or avoidance of cancer typically include information such as the intended treatment dose, dosing schedule, and route of administration. The container can be a single dose, a large package (e.g., multiple, dosage package) or a sub unit dose. The instructions provided in the article of manufacture or kit of the present invention are typically written in the label or package insert (eg, a sheet of paper contained within the kit) but may also accept instructions for machine identification (eg, magnetic or Instructions for the use of optical storage trays). The label or package insert indicates that the composition is used to treat, delay, and/or avoid the cancer described herein. Instructions for use can be provided to perform any of the methods described in the text. Spoon 'The article of manufacture or kit of the present invention is in a suitable package. Appropriate equipment includes, but is not limited to, syrup, bottles, cans, and packaging (I pack sealed mail or plastic bags). Also included are device-specific devices such as inhalers, nasal applicators (eg, 'or perfusion devices (eg, micropumps). Manufacturing articles or kits) can be used with specific device applications (eg, containers can be It is an intravenous solution bag or a vial with a stopper that can be pierced by a primary injection needle). The container may also have a sterile access port (e.g., the container may be an intravenous solution bag or a vial having a stopper for a hypodermic needle). At least one active agent in the composition = one antibody. The container may further comprise a second pharmaceutical second: the article or kit may optionally provide additional ingredients, such as a buffer and instructions. "The usual set includes the container to remove the flower and the label or package embedded on or adjacent to the container. Things. The article or kit may comprise any of the anti-EpCAM anti-keys described herein. In some embodiments, the article of manufacture or kit includes the single and specific antibodies provided herein. In some embodiments, the genus (the genus of the human genus EpCAM) is exemplified by the genus of the human genus EpCAM (Example 14, · = human amino acid EpCAM) 2 wherein the epitope of the &-> κ Μ-63, the antigen-binding region includes a heavy chain or a light chain iron (4) hetero region (vhEpcam) and / bond mutation Q (VLEPCAM); and / or (8) Stem _ > specific secretive human ', the first antigen binding region, 眭,,, σ human CD3 antigen, wherein the $1 technology* original binding region includes 79 201125583 heavy chain variation region (VHCD3) and / or light chain variation The region (VlCD3); wherein the order of the mutated regions is, for example, from the N_ terminal to the c_ terminal, is VLEpCAM-VHEpCAM-VHCD3-VLCD3. Examples The following examples are provided for the description and are not intended to limit the present invention. 1 : Production of anti-hEpCAM antibody (1) Production of anti-hEpCAM antibody by cancer cell immunization Human breast cancer cell line T-47D (BCRC 60250) and chorionic cancer cell line were obtained from Food Industry Development Research Institute (Hsinchu, Taiwan). BeWo (CCRC 60073). Maintain T-47D at 90 in a humidified environment of 370C and 5% C〇2 % of RpMi 164® medium (GIBCO BRL) with 2 mM L-glutamic acid was adjusted to contain 1.5 g/L sodium bicarbonate, 4.5 g/L glucose, 1 mM HEPES, 1.0 mM sodium pyruvate With 0.2 units/ml of bovine insulin; plus 1% fetal calf serum® (FBS), 100 units/ml penicillin and 100 Mg/ml streptomycin (GIBCO BRL) at 37 ° C and 5% C02 In a humid environment, BeWo was grown at 85%. In a Ham, s F12K medium (GIBCO BRL) with 2 mM L-. glutamic acid, the medium was adjusted to contain i.5 g/L sodium bicarbonate; I5% FBS, 100 units/mi penicillin and 1〇〇pg/ml streptomycin (GIBCO BRL) were added. Balbs were immunized with lxl〇7 T-47D or BeWo cells in 500 μΐ PBS every two weeks. /c mice three times. The final increase was given by the same 80 201125583 number of cells 3 to 5 days prior to fusion, in which spleen cells were obtained and fused with X63 bone marrow cancer cells to add FBS (Hyclone) and contain HAT (Hybri-Max ®, Sigma H0262, final concentration of 100 μΜ hypoxanthine, 0.4 μΜ ammonia and 16 μΜ thymidine DMEM growth and screening of fusion tumors . Three fusion tumor cell lines m290-lG10, m342-12H8.3 and m342-15FlM, which secrete monoclonal antibodies 1G10 (IgG!, ruler), 12Η8 (IgG2a, ruler) and 15F11 (IgG2a, ruler), have been produced. (2) Production of anti-hEpCAM antibody by recombinant protein A cDNA encoding the extracellular region of human EpCAM (amino acid 1-264) was amplified by PCR. To facilitate purification of the expressed recombinant protein, the extracellular region of human EpCAM is expressed as a fusion protein fused to the human immunoglobulin r 1 heavy chain constant region (EpCAM Exd-Crl). The expression plastid (pcDNA5/FRT-EpEXD) was stably transfected into Chinese hamster ovary (CHO) cells (Invitrogen, catalog number R75 8-07) by Lipofectamine 2000 (Invitrogen, Cat. No. 11668-500) according to the manufacturer's instructions. Stable cell line CHO/ in Ham's F12 containing 10% FBS and 600 ug/ml Hygromycin B (CA IN-10687-010), very low-Ig (Invitrogen, Cat. No. 16250-078) Exd-Crl » The medium was collected and the hEpCAM extracellular region (EpCAM Exd-Crl) recombinant protein was collected using Protein A tourose gel (Amersham Bioscience). The native Balb/c mice were perfused with 50 micrograms of purified EpCAM Exd_Crl recombinant protein in CFA, followed by three times of 201125583 grams of purified recombinant protein in ifa every three weeks. Three days after the final increase, mouse spleen cells were harvested and fused with X63 bone marrow cancer cells. The fusion tumors were screened with DMEM supplemented with 1 〇% FBS (Hyclone) and containing HAT (Hybri-Max®, Sigma H0262, final concentration 100 μΜ hypoxanthine, 0.4 μΜ aminoxanthine and 16 μΜ thymidine). It has been identified and further analyzed to secrete monoclonal antibodies 2D1 1 (IgGn /〇, 8Β8 (IgG,, ruler), 1F10 (IgG!,1), 6D1 1 (IgG!, ruler), 4D2 (IgG!, ruler) and 6B2 (IgG!, ruler) fusion tumor strains m322-2D11.19, m322-8B8.16, m338-lF10.3, m338-6Dl 1.8, m338-4D2.20 and m338-6B2.3. Example 2: Production Characterization of anti-EpCAM strains (1) Establishment of CHO/EpCAM cell line The cDNA encoding full-length human EpCAM (amino acid 1-3 14) was amplified by PCR from a cDNA pool generated by T-47D cells. The modified pcDNA 3.1/Myc-His(+)A vector (Invitrogen) was then transfected into a 6-well plate at 80-90% confluence using Lipofectamine 2000 (Invitrogen > Catalog No. 1 1 668-500). Chinese hamster ovary (CHOW® cells. Screened transfectants in FI 2/10% FBS medium containing 600 ug/ml wet mycin B (CA IN-10687-010). Anti-EpCAM by flow cytometry Antibodies to identify transfected cells expressing hEpCAM. (2) Binding of selected anti-EpCAM strains to CHO/EpCAM cells. 1 x 10 5 CHO/EpCAM or CHO parental cells were implanted into V-bottom 96-well plates. And concentrated at 0.1 pg/ml Purified anti-EpCAM anti-82 201125583 body or mouse IgG control antibody 9E10 was cultured. 300 χ diluted human cell high-immune serum (HPS 300 χ) was used as a positive binding control for the two cell lines at 4 ° C. After 1 hour of incubation, cells were washed twice with 200 μM FACS buffer (1x FBS in 1x PBS) to 1 pg/ml goat-anti-mouse IgG-PE in 100 μM FACS buffer (Southern Biotech) , catalog number 1032-09) stained and then incubated for 30 minutes at 4° C. Cells were washed three times with FACS buffer and analyzed by flow cytometry (BD LSR, BD Life Sciences).

Table 2: Combination of 0.1 pg/ml anti-EpCAM antibody to CHO/EpCAM and CHO cells (FACS, mean fluorescence intensity (MFI)) Strain CHO/EpCAM CHO 12H8 6649 5 15F11 64 5 1G10 6178 5 2D11 3718 6 6D11 1347 5 4D2 1745 5 1F10 5634 6 6B2 1348 5 8B8 1661 5 9E10 6 5 HPS 300x 95 61 The results in Table 2 show that all strains are human EpCAM specific because they bind only to CHO/EpCAM but not to parental CHO cells. . Furthermore, these strains exhibited different binding abilities to CHO/EpCAM cells ranging from 64 (15F11) to 6649 (12H8). 83 201125583 Example 3: Cytotoxic effects of anti-EpCAM antibodies in cancer cell lines (1) Cytotoxicity of anti-EpCAM antibodies in different cancer cell lines. About antibody cytotoxicity assay, 4-5 X 1 4 cancer cells Implanted into each well of a flat-bottom 96-well plate, followed by dilution of different concentrations (1, 3 or 10 pg/ml) of anti-EpCAM (12H8, 1G10, 1F10, 2D11, 6D11 and 4D2) or control (9E10) in the medium The antibody is added to the cells. After incubation at 37 ° C for 17-20 hours, 0.3 μΐ of FITC-conjugated Annexin V (Strong Biotech Corp, catalogue number AVK250) in 50 pl of Annexin V binding buffer (Strong Biotech Corp, Cat. No. AVK250) at room temperature will The cells were stained for 20 minutes. After washing, the cells were then stained with a 0.3 μl filling bit in 200 μl Annexin V binding buffer. Annexin V and sputum propionate were used as a combined indicator of cell death. Data were acquired from the BDFACSCalibur based on the obtained 3,000-5,000 cells and analyzed by the Cell Quest software. The percentage of combination of Annexin V+/PI+, Annexin V+/PI- and Annexin V-/PI + groups was regarded as dead cells. Table 3: Cytotoxic effect test of anti-EpCAM antibody in EpCAM-positive cancer cells. Type of cancer and cell strain test mAb test concentration pg/ml untreated medium control 1.0 3.0 10 breast cancer T-47D 12H8 49 54 56 20 1G10 45 58 64 1F10 51 50 50 2D11 36 48 45 84 201125583

6D11 25 40 44 4D2 35 44 45 9E10 14 16 18 Colorectal cancer DLD-1 12H8 61 67 72 15 1G10 28 40 60 1F10 65 65 61 2D11 18 41 48 6D11 28 53 62 4D2 31 51 62 9E10 14 14 15 Gastric cancer NCI- N87 12H8 67 62 66 35 1G10 50 60 60 1F10 57 57 57 2D11 45 48 51 6D11 41 51 57 4D2 49 52 55 9E10 35 33 33 Lung cancer NCI-H520 12H8 24 29 34 19 1G10 32 41 55 1F10 40 46 57 2D11 41 44 52 6D11 38 42 49 4D2 24 30 32 9E10 29 24 25 Prostate cancer LNCaP 12H8 61 67 58 20 1G10 42 55 45 1F10 47 53 48 2D11 40 39 40 6D11 38 43 44 4D2 49 52 50 9E10 26 28 28 Throat cancer FaDu 12H8 42 43 44 18 1G10 40 50 51 1F10 44 42 45 2D11 34 45 46 6D11 26 39 37 4D2 37 43 46 9E10 17 15 14 Ovarian cancer NIH: OVCAR-3 12H8 59 62 63 25 1G10 40 50 52 1F10 53 57 59 85 201125583 2D11 43 55 56 6D11 46 52 55 4D2 40 51 56 9E10 22 25 27 Table 3 Overview! , 3 and ι〇μ§/ιηι anti-EpCAM mAbs (12H8, 1G10, 1F10, 2D11, 6D11 and 4D2) or 9E10 (isotype control) cultured different cancer cells overnight after Annexin V and PI staining results (representing cells Toxin effect results showed that strains 12H8, 1G10, 1F10, 2D11, 6D11 and 4D2 were available in breast cancer (T-47D), colorectal cancer (DLD-1), gastric cancer (NCI-N87), lung cancer (NCI-H520), prostate cancer. (LNCaP), Throat Cancer (FaDu) and Ovarian Cancer (NIH: OVCAR-3) Cancer cells cause parenchymal cell death. (V not all anti-EpCAM antibodies can trigger substantial cytotoxicity. 5xl〇4 NCI-H3 58 cells were implanted into each well of a 96-well plate, and then 1 〇pg/m 丨 of anti-EpCAM or control (9E10) mAbs diluted in the medium was added to the cells. After incubation at 370 c for Η hours, at room temperature FIT·3 μl of FITC• Bonding in 50 μΐ Annexin V Binding Buffer (Strong Bi〇tech Corp, Cat. No. AVK250)

Annexin V (Strong Biotech Corp, catalog number AVK250) stained the cells for 20 minutes. After washing, the cells were then stained with 0.3 μl of propidium iodide in 2 μl of Annexin v combined with buffer. Annexin V and propidium iodide were used as a combined indicator of cell death. According to the obtained 3,000-5,000 cells obtained by Bd FACSCalibur and by the cells 86 201125583

Quest software analysis. The percentage of binding between Annexin V+/PI+, Annexin V+/PI- and Annexin V-/PI+ groups was considered as dead cells. Table 4: Anti-EpCAM mAbs trigger cell death of NCI-H3 58 lung cancer cells mAb 9E10 12H8 1F10 1G10 2D11 6D11 4D2 6B2 15F11 8B8 Test 1 1 36 32 46 41 45 43 7 4 2 Test 2 -1 33 30 42 32 40 41 2 2 31 Test 3 -4 31 40 48 47 44 45 -4 -5 5 Test 4 4 40 39 47 44 43 46 15 4 12 Test 5 -1 28 37 42 33 40 43 1 -5 18 Average ± -0.2 33.6 35.6 45.0 39.4 42.4 43.6 4.2 0.0 13.6 Standard ±1.3 ±2.1 ±2.0 ±1.3 ±3.0 ±1.0 ±0.9 ±3.2 ±2.1 ±5.2 Poor P value P<P<P<P<P<P< 0.24 0.94 0.03 0.01 0.01 0.01 0.01 0.01 0.01

% of Annexin V+PI staining (minus unprocessed background)

*t-test P value < 0.01 (compared to treatment with isotype control antibody 9E10) Table 4 summarizes the cell death induced by anti-EpCAM strain in NCI-H358 lung cancer cells. It is clear from five independent experiments that strains i2H8, 1F10, 1G10, 2DH, 6D11 and 4D2 can induce parenchymal cell death (Annexin V+PI staining is 30% higher or higher than background), whereas strains 6B2, 15F11 and 8B8 Almost no cell death in the NCI_H358 lung cancer cell line was elicited. This data clearly shows that not all anti-EpCAM antibodies have a substantial cytotoxic effect (i.e., Annexin V + Pi staining is 30% or higher above background). 87 201125583 Example 4: Synergistic effect of anti-epCAM antibody and oxaliplatin

Oxali face combined with the injection of 2 other chemotherapeutic agents 5 _ fluorourine, bite / leukoma (leucovorin) (5_Fu / lV) is currently considered as one of the first line of treatment for patients with colon or rectal cancer ( Andr0 et al. (2〇〇4) N

Engl J Med 350(23) : 2343-235 1). To test the cytotoxicity of anti-EpCAM antibodies in the presence of oxaliline, 1 χ 10 COLO 205 cells were seeded into 96-well plates, followed by dilutions of 0.03, 0.3 and 3 pg/ml in the medium. Anti-EpCAM or control (9E10) mAbs were added to cells at concentrations of 0, 0.01, 0.1 and 1 jxg/ml of oxaliplatin. After incubation at 37 ° C for 24 hours, FIT·3 μΐ of FITC-conjugated Annexin v (Str〇ng Biotech Corp) in 5 μμΐ Annexin V Binding Buffer (Strong Biotech Corp, Cat. No. AVK250) at room temperature , catalog number AVK250) stain the cells for 20 minutes. After washing, the cells were stained with 3 μl of moth propidium in 200 μM Annexin V binding buffer. Application of Annexin V and discogenic bite as a combined indicator of cell death. Based on the obtained 3, 〇〇〇_5, sputum cells were acquired from the BD FACSCalibur and analyzed by the Cell Quest software. will

The percentage of binding between Annexin V+/PI+, Annexin V+/PI- and Annexin V-/PI + groups was considered as dead cells. Table 5: mAb concentration of anti-EpC AM antibody in combination with oxaliplatin in c〇LO 205 cells. pg/ml test oxapine platinum concentration pg/ml 0 0.01 0.1 1 no added mAb 1 1 1 2 88 201125583 12H8 0.03 9 10 9 14 0.3 20 23 23 "35 3 17 22 26 1F10 0.03 -1 -1 1 5 0.3 6 10 10 22 54 " 3 52 57 —— - _ 61 1G10 0.03 2 1 2 3 0.3 5 4 5 1〇3 46 38 44 S4 9E10 (for 0.03 -1 0 1 3 ~~' photo) 0.3 -5 4 -1 3 3 0 -3 -1 2 Annexin V+ΡΙ% dyed (minus not Treatment Background) Table 5 summarizes the cell death induced by anti-EpCAM strains (12H8, 1G10 and ifi〇) in combination with the chemotherapeutic agent oxaliplatin in COLO 205 colon cancer cells. The results show that anti-EpCAM antibody and Osa Synergistic cytotoxic effects in COLO205 cells, especially high concentrations of anti-EpCAM mAbs (0.3 vs. 3 pg/ml) and oxaliplatin 〇μβ/Γη1). Example 5. Selected anti-EpCAM antibodies Evaluation of anti-tumor effect in vivo in xenograft mode Study of in vitro in vitro apoptosis-initiating activity of anti-EpCAM antibodies with any living body In vivo bio-association. Study antibody 12H8 (effective cytotoxicity) and 6B2 (very microcytotoxicity). On day 3, 5 x 10 6 DLD-1 or 3 x 10 6 NCI-H358 cells were subcutaneously implanted into SCID mice (6-7). Weekly area. After 1 day after inoculation of tumor_cells, 12.5 111§/1{; (for 〇1^-1) or 30 mg/kg (of 〇1^-1) or 30 mg/kg (in the intraperitoneal > main 〇11111?88) The antibody against NCi_H358) was treated and repeated in centroids 89 201125583 8, 11, 15, 18, 22 and 25 days. As a control, the same dose of 9E10 (mouse anti-myc antibody) was applied. Five or six mice were used in each experimental group. Tumor volume was measured by calipers every two weeks (mm3) and tumor size was calculated using the following formula: π/6 X larger diameter X (smaller diameter) 2 (Kievit Ε, Cancer Research, 60: 6649-55). Statistical analysis of tumor growth was performed using Student's t-test.

Table 6 (a): In vivo anti-tumor effect of anti-EpCAM inAbs in colorectal cancer DLD-1 xenograft (mean volume ± SD) mAb, day d29 d32 d36 d39 d43 d46 d49 9E10 1201 fiber 135Si248 1665 ± 334 1759±349 2186b422 2606£283 3014t276 6B2 947 194 1060±140 1386tl94 154H232 1825Ϊ341 215 (Μ50 24251450 12H8 296tl54* 396±156* 521±189* 619Ϊ232* 727i270* 839±292* 89&t207* * t test P Value < 0.05, relative to control antibody 9E10

Table 6(b): In vivo anti-tumor effect of anti-EpCAM mAbs in lung cancer NCI-H358 xenografts (average tumor volume) Day d46 d50 d53 d57 d60 d64 d67 9E10 630±297 877±337 1249±451 1336 ±468 1532±548 1809±634 1938±610 6B2 539±148 724±135 862±101 1016±182 1064±181 1198±193 1360±240 12H8 325±132* 475士224* 597±304* 656±274* 680±279* 859±326* 1076±464* * t test P value < 〇.〇5, relative to control antibody 9E10 treatment 90 201125583 As shown in Table 6 (a) and Table 6 (b), strong The anti-EpCAM antibody 12H8, which has a cytotoxic effect in a test tube, effectively inhibits tumor growth of colorectal cancer (DLD-1) and lung cancer (NCI-H358), whereas antibody 6B2 has a relatively small inhibitory effect. Example 6: Epitope mapping (1) Generation of mutant region I of hEpCAM cDNA encoding the sequence of the first EGF-type replica (amino acid 1-63) (EGF-I) of human EpCAM was amplified by PCR. To facilitate purification of the expressed recombinant protein, this region was expressed as a fusion protein fused to the constant region of the human immunoglobulin 71 heavy chain (EGFI-Crl) in the pVac4AlASP vector. The mutation shown in Fig. 2 was introduced into the wild-type EGF-I region by overlapping PCR and PCR-type site-directed mutagenesis. The plastids expressing wild-type or mutant EpCAM-Crl fusion proteins were transiently transfected into COS-7 cells by Lipofectamine 2000 (Invitrogen, Cat. No. 1 1668) according to the manufacturer's instructions. Cells were grown in DMEM containing 10% FBS Very Low-Ig (Invitrogen, Cat. No. 16250) before collecting the medium to purify the wild type and mutant EGFI-Crl recombinant protein using Protein G Sepharose (Amersham Bioscience). 5 days. (2) Combination of wild-type and mutant EpCAM proteins by anti-EpCAM strain

Direct ELISA was used to test the reactivity of anti-EpCAM antibodies to different EpCAM mutations. Briefly, the purified EpCAM EGF-1 fusion protein (WT, Q24A, E25K, E26D, A35T, N37R, F39A, 91 201125583 V40E, N41A, N42E, N43A, R44G, Q45A, Q47A or T49A) is irrelevant The control (CEA-Crl) was previously diluted to 0.5 pg/ml in coating buffer (8.4 g of NaHC03, 3.4 g of Na2C03, pH 9.5 in 1 L H20) and distributed to (100 μΐ/well) 96-well plate in. After incubation overnight at 4 ° C, block with 1% BSA (200 μM/well) in PBS for 2 hours at room temperature, followed by 0.1 pg/ml primary antibody (anti-EpCAM) at room temperature. Strain or 9E10) peroxidase-binding secondary antibody (goat anti-mouse IgG (H+L) (Southern Biotech, catalog number 103 1-05) and goat anti-human IgG) H+L) (Jackson ImmunoResearch, catalog number 109-035-088)) was incubated for 1 hour. The plate was then washed 3 times with PBST and then the enzyme substrate TMB (BD Biosciences, catalog number 555214) was added. After the recommended incubation time, 2N H2S04 (50 μM per well) was added to stop the reaction. The optical density at 450 nm was measured on an ELISA disk reader.

Table 7(a): Relative binding activity of anti-EpCAM strain to mutant EpC AM relative to wild-type EpCAM mAb WT Q24A E25K E26D Α35Γ N37R F39A V40E N41A N^E N43A R44G Qt5A Q47A T49A 12H8 100 0 1 94 95 94 96 93 81 23 96 91 89 93 94 1G10 100 44 3 1 89 1 78 71 23 93 96 95 80 49 17 1F10 100 93 10 98 93 97 81 1 63 95 100 1 84 92 94 2D11 100 99 93 97 95 94 97 93 12 58 5 7 89 96 95 6D11 100 47 4 57 39 69 23 2 2 83 65 2 8 33 67 4D2 100 41 2 52 27 64 11 1 0 82 57 1 4 23 63 Study and compare individual anti-EpCAM antibodies to individual EpCAM mutations (Fig. 2) and the combination of wild-type EpCAM molecules. The number 92 in Table 7(a) 201125583 represents the percentage of binding activity of each antibody to each mutant protein relative to its binding to wild-type (WT) protein (set to 100%). Each number represents two (for 12H8) or three. The average of data for independent ELISA assays (for 1G10, 1F10, 2D11, 6D11, 4D2). Table 7(b): Residues necessary for anti-EpC AM antibody binding mAb Residues 12H8 Q24, E25 and N42 1G10 Q24, E25, E26, N37, N4 Bu Q47 and T49 1F10 E25, V40 and R44 2D11 N4 Bu N43 And R44 --- 6D11 Q24, E25, A35, F39, V40, N41, R44, 〇4Γ^〇^ρ 4D2 Q24, E25, A35, F39, V40, N4, R44, necessary for the knot. Mutations in the EGF-I region (amino acid 24-63) caused less than 50% of the amino acid to be considered as antibody binding. "Table 7 (b) summarizes the necessary residues for each antibody strain. Example 7: 12H8, 1G10, 1F10, 2D11, 4D2 light chain and heavy chain variation regions were cloned by PCR amplification of cDNAs of 12H8, lG10, lF10, 2Dli, D2 and light chain and heavy chain variant regions (V regions), and selected with 6l&gt u6Di TOPO (Invitrogen) for sequence determination. Nucleotide sequences were obtained from a number of PCRII. The strains were analyzed and analyzed. Figures 3-8 show that the peaches are identified as UgG, (IgG2a〇(IgG丨' 幻, (4) "丨", 2 called owe), 4D2 (IgG丨, ruler) and 6D11 (IgG丨, ruler) light chain $

Mature amino acid sequence of Kabat CDRs. It has been described that the gas is immune to 崠93 201125583 protein IgGl (Honjo et al. Cell 18: 559-568, 1979), IgG2a (Olio et al. Proc Natl Acad Sci US A. 78(4): 2442-2446, 1981 ), /c light key (Hieter et al. Cell 22 (1 Pt 1): 197_207, 1980) and the constant region of the same type as the λ 1 light key (Seising et al. Proc Natl Acad Sci US A. 79 . 4681-4685, 1982) sequence. Example 8: Evaluation of anti-EpCAM and anti-CD3 bispecific antibodies ("anti-EpCAMx anti-CD3 bsAbs") Materials and Methods Anthropomorphism of anti-EpCAM antibodies and EpCAM-specific of single-stranded fragment variant regions (scFv) The Arm Generation Complementarity Determining Region (CDR) Grafting Line is used to generate a variant region of anthropomorphic 12H8B (hl2H8B), 2H8Cc.2 (hl2H8C) and h2D1 1B. For hl2H8Cc.2, the BLASTP search for the entire redundant Genebank database was used to identify human antibodies that share most of the sequence identity/similarity with ml2H8. The CDRs of the murine 12H8 heavy chain were inserted into the framework sequence of the human antibody AAA17956 (Genebank No. AAA17956) heavy chain variant region (66.7% sequence identity to the murine 12H8 heavy chain). The CDRs of the murine 12H8 light chain were incorporated into the framework sequence of the human antibody AAA86778 (Genebank No. AAA86778) light-key variant region (69.2% sequence identity to the murine 12H8 light chain). For h2DllB, the sequence of the murine 2D11 variant region was compared with the database of the sequence of the anthropomorphic murine antibody to find the murine antibody 94 with the most sequence identity/similarity to murine 2D11. And the corresponding anthropomorphic framework sequence "Therefore, the CDR of the murine 2DU heavy chain was incorporated into the framework sequence of the human antibody VHIII heavy chain variant region (the antibody of the murine antibody A4.6.1 (Baca M. et al. Chem. 1997, 272: 10678_10684.), whose heavy chain sequence shows the greatest identity/similarity to the murine 2D11 heavy chain), and incorporates the CDRs of the murine 2Du light chain into the framework sequence of the human antibody REI (Verh 〇eyen me et al. Immunology 1993, 78: 364-370.) (Accepting antibodies against murine antibody HMGF1, the light chain of which shows the greatest sequence identity/similarity to the murine 2DU light bond) ^ Apply a similar method to generate hl2H8B, the CDR of the murine 12H8 is incorporated into the framework sequence of the human heavy chain subgroup 3 (VH III) and the human/c 1 (vlh) variant region (Studnicka GM et al., Protein Eng. 1994, 7(6): 805- 14). Nucleotides are synthesized to generate anthropomorphic 12H8 and 2D11 variants. The combined VH and V1 fragments were then inserted into the pcDNA5-FRT-hIgGlK vector. The combination of both the humanized antibody heavy chain and the light bond gene is expressed by the plastids hl2H8B/pcDNA5-FRT-hIgGlK, hl2H8Cc.2/pcDNA5-FRT-hIgGlK and h2D1 lB/pcDNA5-FRT-hIgGlK Functional studies of hl2H8B, hl2H8C and h2DllB antibodies. The VH and VL regions of hl2H8B, hl2H8Cc.2 and h2DllB are used to generate a single-stranded fragment (scFv) of the variant region.

Construction and performance of AbGn bsAbs 95 201125583 Anti-EpCAMx anti-CD3 bsAbs were constructed by fusing two variant single-stranded fragments (scFv) through a 5-amino acid linker (L5) (Fig. 9 & Table 8) )The combination. Table 8. Anti-EpCAMx anti-CD3 constructs Constructor name Constructs Description Region configuration HAS fusion h2DllB-vl h2DllBx Anti-CD3 VL-VH-VH-VL-His6 No h2DllB-v2.1 h2DllBx Anti-CD3xHSA Vl-Vh -Vh-Vl-HS A-His6 full-length hl2H8B-vl hl2H8Bx anti-CD3 VL-VH-VH-VL-His6 no hl2H8B-v2.1 hl2H8Bx anti-CD3xHSA Vl-Vh-Vh-Vl-HS A-His6 full length hl2H8C -vl hl2H8Cx anti-CD3 VL-VH-VH-VL-His6 no hl2H8C-v2.1 hl2H8Cx anti-CD3xHSA Vl-Vh-Vh-Vl-HS A-His6 full length hl2H8C-v2.1-sHS A hl2H8C> CD3xsHSA Vl-Vh-Vh-Vl-sHS A-His6 short type

The EpCAM-specific single-chain Fv fragment is derived from the VH and Vl regions of hl2H8B, hl2H8Cc_2 and h2D1B. A 15-amino acid linker (Li5) was inserted between the VL and VH regions to form an scFv. All candidates share the same T cell-specific arm derived from the scFv of mouse monoclonal antibodies against human CD3s (CD3s). To generate anti-EpCAMx anti-CD3 bsAbs, the 3' end of the anti-EpCAM arm VH was bonded to the 5' end of the CD3s arm VH via a 5-amino acid linker (L5). The 6xHis sequence was incorporated into the 3' end of the CD3s arm for subsequent affinity purification. This bsAb consisting of only two scFvs is called version 1 (vl). For version 2.1 constructs, insert additional cDNA encoding the full-length (NCBI reference sequence: NM_000477.5) or partial human serum albumin (HSA or SHSA) 96 201125583 between the CD3s arm of the scFv and the 6xHis sequence (Mtiller D Et al. J Biol Chem 2007, 282: 12650-12660). The 3' end of the CD3s arm VL is bonded to the 5' end of the HSA/sHSA via a 5-amino acid linker (L5). The construct with full-length human serum albumin is called hl2H8C-v2.1, and the construct with partial human serum albumin is called hl2H8C-v2.1-sHSA. The sequence of hl2H8B VL (amino acid sequence is SEQ ID NO: 29; nucleic acid sequence is SEQ ID NO: 30) is shown in Figure 10A. The sequence of M2H8B Vh (amino acid sequence is SEQ ID NO: 27; nucleic acid sequence is SEQ ID NO: 28) is shown in Figure 10B. The sequence of hl2H8C (amino acid sequence is SEQ ID NO: 33; nucleic acid sequence is SEQ ID NO: 34) is shown in Figure 11A. The sequence of hl2H8C VH (amino acid sequence is SEQ ID NO: 3 1 ; nucleic acid sequence is SEQ ID NO: 32) is shown in Figure 11B. The sequence of h2DllB VL (amino acid sequence is SEQ ID NO: 37; nucleic acid sequence is SEQ ID NO: 38) is shown in Figure 12a. The sequence of h2DllB VH (amino acid sequence is SEQ ID NO: 35; nucleic acid sequence is SEQ ID NO: 36) is shown in Figure 12B. The sequence of anti-CD3 VL (amino acid sequence is SEQ ID NO: 57; nucleic acid sequence is SEQ ID NO: 58) is shown in Figure 13A. The sequence of anti-CD3 % (amino acid sequence is SEQ ID NO: 55; nucleic acid sequence is SEQ ID NO: 56) is shown in Figure 13B.

The sequence of the linker (匕) inserted between the VL and VH of the anti-EpCAM scFv (amino acid sequence is SEQ ID NO: 49; nucleic acid sequence is SEQ ID NO: 50) is shown as follows: 1GGGGSGGGGSGGGGS 97 201125583

1 GGTGGTGGTGGTTCTGGCGGCGGCGGCTCCGGTGGTGGTGGTTCT The sequence of the linker (L5) inserted between the two scFvs (amino acid sequence is SEQ ID NO: 51; nucleic acid sequence is SEQ ID NO: 52) is shown as follows:

1 G G G G S 1 GGTGGAGGCGGATCC The sequence of the linker between the VH and VL inserted into the anti-CD3 scFv (amino acid sequence is SEQ ID NO: 53; nucleic acid sequence is SEQ ID NO: 54) is shown as follows:

1 VEGGSGGSGGSGGSGGVD 1 GTCGAAGGTGGAAGTGGAGGTTCTGGTGGAAGTGGAGGTTCAGGTGGAGTCGAC The linker (L5) was used between anti-CD3 scFv and HSA/sHSA. The sequence of vl version hl2H8B bsAb ("hl2H8B_vl") (amino acid sequence is SEQ ID NO: 39; nucleic acid sequence is SEQ ID NO: 40) is shown in Figure 14A. The sequence of vl version hl2H8C bsAb ("hl2H8C-vl") (amino acid sequence is SEQ ID NO: 41; nucleic acid sequence is SEQ ID NO: 42) is shown in Figure 14B. The sequence of vl version h2DllB bsAb ("h2DllB-vl") (amino acid sequence is SEQ ID NO: 43; nucleic acid sequence is SEQ ID NO: 44) is shown in Figure 14C. 98 201125583 The full-length sequence of albumin for bsAb fusion (amino acid sequence is SEQ ID NO: 45; nucleic acid sequence is SEQ ID NO: 46) is shown in Figure 15A. The sequence of the short albumin for bsAb fusion (amino acid sequence: SEQ ID NO: 47; nucleic acid sequence: SEQ ID NO: 48) is shown in Figure 15B. The construct of bsAbs further comprises a signal peptide sequence at the N-terminus, such as signal peptide 1 (amino acid sequence is SEQ ID NO: 59; nucleic acid sequence is SEQ ID NO: 60) or signal peptide 2 (amino acid sequence is SEQ ID NO: 61; nucleic acid sequence is SEQ ID NO: 62). The sequence of the signal peptide is shown below: Signal peptide 1:

1 MKLPVRLLVLMFWIPVSSS 1 ATGAAATTGCCTGTTAGGCTGTTGGTGCTGATGTTCTGGATTCCTGTTTCCAGCAGT Signal peptide 2 :

1 METDTLLLWVLLLWVPGSTG 1 ATGGAGACAGACACACTCCTGCTATGGGTGCTGCTGCTCTGGGTTCCAGGTTCCACCGGT The combined sequences were inserted into the expression vector pcDNA5-FRT (Invitrogen) and transfected into Chinese hamster ovary (CHO) cells. The culture suspension containing the bsAb was collected for further purification and functional studies.

Purification of AbGn bsAbs A suspension of cell culture medium containing secreted bsAb was collected from 100% confluent CHO cell culture medium. The C-terminal 6xHis tail of the bsAb was extracted from the suspension by a fixed metal-affinity chromatography technique with nickel-loaded Ni-NTA resin (Chelating Sephoarose Fast Flow, GE). 99 201125583 bsAb ° The precipitated protein product was buffer-exchanged to phosphoric acid. A salt buffer (150 mM NaCl containing 25 mM discate buffer, ρH7.2) was concentrated and concentrated with Amicon Ultra-1 (Millipore). The concentrated protein was then applied to a colloidal filtration on a HiLoad 16/60 Superdex 200 column (Amersham) to obtain monomeric bispecific Abs. The final product was sterile filtered through a 2-.2-μιη filter prior to use. Cell lines and medium Human pancreatic cancer cells panc 02.03, lung cancer cells NCI-H358 and multiple myeloma cells RPMI 8226 were obtained from the American Type Culture Collection (Manassas, VA, USA). Human colorectal cancer cell DLD-1 was obtained from the Taiwan New Bamboo Food Industry Development Research Institute. Maintain NCI-H3 58, RPMI 8226 and DLD-1 in 1.5 g/L sodium bicarbonate, 4.5 g/L glucose, 10 mM HEPES and 1.0 mM sodium pyruvate with 10% FBS, 100 units/ml penicillin In RPMI 1640 medium (GIBCO BRL) with 100 pg/ml streptomycin (GIBCO BRL). Pane 02.03 was cultured in RPMI 1640 medium (GIBCO BRL) with the same change and 15% FBS (Hyclone), 100 units/ml penicillin and 100 pg/ml levothelin (GIBCO BRL). The stable cell line CHO/EpCAM was maintained in Ham's F12 medium containing 10% FBS and 600 pg/ml wetmycin B. The cells were all cultured in a humidified environment at 37 ° C and 5% CO 2 . FACS analysis of the bsAb binding assay 100 201125583 BsAbs were tested for binding to human CD3 on human lymphocyte cells purified by Ficoll density configuration. The human EpCam stably transfected cell line CHO/EpCAM was used to test the binding of bsAbs to human EpCAM. 2χ105 cells were seeded into wells of 96-well, v_chassis and cultured for 3 min at 4 〇C in undiluted medium suspension. The cells were then washed twice with FACS buffer (1XPBS + 1% FBS). The pE_conjugated anti-6xHis Tag antibody (AD 1 · 1 · 1 〇, Abeam) was added and the cells were incubated at 40 C for 30 minutes. A cell line cultured in a medium without bsAb and stained with anti-6xHis Tag PE-conjugated antibody was used as a negative control (only 2nd). The cells were then washed twice with FACS buffer and bsAb binding was analyzed by flow cytometry. FACS-type cytotoxicity test Human peripheral jk liquid mononuclear cells ("PBMC") were prepared from whole blood samples of healthy donors by Ficoll density and used as effector cells in the assay. According to the manufacturer's instructions, the target cells are labeled with carboxyfluorescein diaeetate succinimidyl ester (CFSE) (Invitrogen, catalog number CU57) or fluorescent film dye PKH-26 ( Sigma-Aldrich, catalog number PKH26GL). Briefly' wash the target cells once in PBS or serum-free medium and adjust the cell concentration to 1χ1〇6 cells per ml (for CFSE labeling) in PBS containing 〇·1% BSA with Diluent C per ml 5 x 106 cells (for PKH-26 labeling). 101 201125583 For CFSE labeling, the phase π county is connected, and the same volume (1V) of the target cell suspension is added to the 2.5 μΜ CFSE, 饬, **. mouth. The cells were labeled for 5 minutes at 37 ° C before the reaction was terminated by adding 1 μM full medium (containing % FBS). For the PKH-26 label, by adding 4 μιη of pKH 26 B (tetra) to (4)

DUuent C is used to prepare 2χ ρκΗ·26 dye working solution (such as 〇 6 Μ). The same volume of GV) of the target cell suspension was added to the 2χρΚΗ_26 dye working solution and immediately mixed by pipetting. Cells were labeled by mixing for 5 minutes with periodic addition of the same volume of FBS (2 V) to stop the reaction. After the step of washing three times with complete medium, the labeled target cells were counted and mixed with effector cells in a complete medium at a ratio of 10: 1 or 5: 效应 effector _ to target cells. Target cells (1.5 χ 104) and effector cells (7.5 χ 104 to 1. 5 x 10 〇 5) in a 5 〇 μ1 cell culture medium volume were added to each well of a 96-well flat disk. 50 microliters of indicated concentration of purified bsAb or medium suspension (culture suspension) or 50 microliters of complete medium (as untreated control) was added to the well. In a 5% C〇2 wet incubator and 3*7. (: The cells were cultured for 18-20 hours. The cells were then harvested and conjugated with Annexin V at 50 μl FITC-at room temperature ("rt") (Strong Biotech Corp. catalog number AVK250; 50 μl Annexin V binding buffer 〇. 3 μιη The material was stained for 15-20 minutes. After washing, the cells were stained with 50 μM iodide (ΡΙ, 50 μΐ Annexin V binding buffer 0.3 μl material) and flow cytometry (BD LSR, BD) Life Sciences) 102 201125583 was analyzed. PKH-26-positive cells were blocked for analysis and dead cells were calculated by combining the percentage of Annexin V-/ΡΙ+, Annexin V+/PI+ and Annexin V+/PI-groups. For the CFSE-labeling assay, the Annexin V staining step can be omitted and CFSE-positive cells can be stopped for analysis and the percentage of dead cells counted only in the PI+ group. The cell growth inhibition assay is measured by the colorimetric WST-type cell proliferation assay. BsAb-mediated lung cancer cell killing. Ficoll density was configured from healthy donors to separate peripheral blood mononuclear cells (PBMC) (6xl06 cells/ml) and then in complete medium with an equal volume of target Symptomatic cells (丨2χ丨〇6 cells/ml) were mixed. Add 50 μl of a mixture of cells containing 3×1 〇4 target cells and 1.5×10 05 effector cells to a 96 well flat plate. Concentrated purified bsAb or medium suspension or complete medium (as untreated (υτ) control) was added to the corresponding φ well. After co-cultivation for 2 days (40-44 hours) at 37 ° C and 50/〇C02 The unattached pbmc was removed by two PBS washes. The surviving adherent cancer cells were cultured in WST-1 solution (1 〇μ丨 cell proliferation reagent WST-1 (Roche) in ι00 μ丨 medium) at 370C until 〇D45〇 The absorbance of the untreated control sample at nm reached [5-2] (about 2 hours). At least two passes and average absorbance values were performed in all experiments. The percentage of cell growth inhibition was calculated as follows: Percent inhibition of cell growth = (UT〇 D45 〇 - sample Xianzhou) service map "X 100%. 103 201125583 DLD-1 human colorectal cancer xenograft six to seven weeks old female non-obese diabetic severe - combined immunodeficiency (NOD-SCID) mice (Bi〇iasco ) for in vivo research These mice carry NOD and SCID mutations, resulting in the lack of T cells, B cells, natural killer cells (NK) and macrophages. Human effector cells are isolated from whole blood samples from healthy donors. Peripheral blood mononuclear cells (PBMC) were prepared by Fic〇U density configuration. 5 x 106 DLD-1 cancer cells in 0.1 mL of medium were subcutaneously inoculated to the left/right side of the mice. After 8 days of natural growth, when the tumor was measured to be about 50-200 mm3 as follows, 5xl〇6 h PBMCs were injected as intra-tumor ("IT") as effector cells and the mice were divided into the following groups, volume = [ (length) x (width) 2 bu. Treatment of 3 treatment groups with hPBMC IT injection at 1〇pg/mouse dose of hl2H8C-v2.1, hl2H8C-v2.1-sHSA bsAb or vehicle (PBS) intravenously ("iv") Eight animals per group were treated for 1 hour, while treatment was repeated for 8 consecutive days. An additional cohort of 4 animals was maintained in DLD-1 only cells to assess the non-specific effects elicited by hPBMC effector cells (data not shown). The progress of each tumor was monitored twice a week until the average tumor size reached a volume of approximately 1.25 cc, at which time the mice were sacrificed. The average tumor size at time is presented for comparison between treatment groups. Statistical comparisons of paired data were performed by Student's t test.

AbGn-constructed bsAbs bind to target cells 104 201125583 The binding of anti-EpCAMx anti-CD3 bsAbs to EpCAM-positive and CD3-positive cells was investigated by FACS analysis. BsAbs were tested for binding to human CD3 on human lymphocytes prepared from two donors (donor N095 and donor N094). See Table 9A. The human EpCAM stably transfected cell line CHO/EpCAM was used to test the binding of bsAbs to human EpCAM. See Table 9B. The results showed that h2D1 ΙΒ-vl, h2Dl.1Β-ν2.1, hl2H8B-v2.1 and hl2H8C-v2.1 were able to bind human lymphocytes and CHO/EpCAM cells (Table 9A & 9B). Table 9. AbGn-constructed anti-EpCAM X anti-CD3 bsAbs bind human lymphocytes (A) from two different donors to EpCAM-expressing CHO cells (CHO/EpCAM) (B) (A) CD3-arm binding . The percentage (%) of positive lymphocytes bound to each individual bsAbs in hPBMC in the undiluted medium suspension is shown from left to right in the table. Control or containing bsAb medium suspension unstained anti-His (only 2nd) h2DllB-vl h2DllB- v2.1 hl2H8C- v2.1 hl2H8B- v2.1 blocked lymphocyte donor N095 1% 2% 77% 73 % 55% 58% Donor N094 1% 1% 68% 65% 47% 51% A cell line cultured in the medium without bsAb and cultured with anti-6xHis Tag PE-conjugated antibody was used as a negative control (only 2nd). The results showed that 105 201125583 h2Dl ΙΒ-vl, h2Dl 1B-v2.1, hl2H8B-v2.1 and hl2H8C-v2.1 were able to bind human lymphocytes. (B) EpCAM-arm binding. The mean calender intensity (MFI) of each individual bsAbs in the undiluted medium suspension is shown from left to right in the table. Control or bsAb medium suspension was not stained with anti-His (only 2nd) h2DllB-vl h2DllB- v2.1 hl2H8C -v2.1 hl2H8B -v2.1 CHO/EpCAM 5 4 1701 1871 1801 1555 with bsAb-free medium The cell line cultured with anti- 6xHis Tag PE-conjugated antibody was used as a negative control (only 2nd). The results showed that h2D1 lB-vl, h2Dl 1Β-ν2.1, hl2H8B-v2.1 and hl2H8C-v2_l were able to express CHO cells in combination with EpCAM.

In vitro cytotoxic potency of AbGn bsAbs and human T lymphocytes The specificity of bsAb was studied in CHO cell lines with or without human EpCAM expression. Effector cells (human PBMC) were mixed with target cells at a 10:1 effector-specific-target ratio and cultured with dilutions (2x, 6x and 20x) of a series of media suspensions. After 20 hours of incubation, target cell death was determined by flow cytometry (indicated by positive propidium iodide staining) (Table 10). Although no cell death of the parental CHO cells was actually found in the presence of T cells and bsAb, a medium suspension containing h2D1 lB-vl, hl2H8B-vl, hl2H8B-v2.1, 106 201125583 hKHSC-W and hl2H8C_v2" was used. Treatment can effectively elicit cell death in EpCAM-expressing CHO cells. Table 10. Target cell lysis of different combinations of bsAbs °/〇 of specific target cells (minus untreated background value) Cell C ΉΟ/EpCAM CHO " ~~ Dilution multiple 2x 6x 20x 2x 6x 2〇y h2DllB -vl 31.4 30^9~~ 17.3 0.7 0 0 1 h2DllB-v2.1 2.2 1.2 0 4.3 2.2 〇~5 ~ hl2H8B-vl 43.6 41.9 37.2 0.4 0 〇hl2H8B-v2.1 33.2 27.4 a 13.5 1.1 0.1 0.4 hl2H8C- Vl 46.3 49.4 43.2 0.2 0 〇hl2H8C-v2.1 58.7 53.6 46.4 0.4 0.3 0.3 Parental CHO or stably transfected CHO/EpCAM line as the target cell in the cytotoxicity test' test line in human PBMC at a ratio of 1:5 A series of dilutions in the presence and suspension of the bsAb medium. Target cell lysis was determined by flow cytometry in such a way that the target cells became a percentage of propidium iodide-positive after 20 hours of culture. The F ASC-type apoptosis assay and cell proliferation assay are used to determine the extent to which a purified bsAb or a medium suspension containing bsAb is specifically cytotoxic to human cancer cells in the presence of human PBMC. Effector cells were mixed with target cells at an effector-to-target ratio of 5:1 and cultured overnight with a series of diluted medium suspensions and purified bsAbs. For human pancreatic cancer (panc.〇2.〇3), lung cancer (NCI-H3 58) and multiple myeloid carcinoma cells (RPMI 8226), the dose response of target 107 201125583 cell apoptosis or growth inhibition is shown in the first 16 and 17

In vivo efficacy studies of AbGn bsAbs Xenograft mouse models were used to assess the cytotoxicity of bsAb hl2H8C-v2.1 and hl2H8C-v2.1-sHSA-directed T cells in vivo. Human PBMC prepared from healthy blood donors were injected directly into the tumor prior to bsAb treatment. One hour after injection into the hPBMC tumor, the mice were then divided into 3 groups, which received 10 pg/mouse of hl2H8C-v2.1, hl2H8C-v2.1-sHSA or vehicle (PBS), respectively. The treatment was repeated for 8 consecutive days. Determining the natural growth of solid subcutaneous DLD-1 tumors by caliper measurement and as a measure of efficacy (Figure 18). As shown in Figure 18, with respect to the pBs treatment control, pair with established DLD-1 Tumor-bearing NOD-SCID mice exerting bsAbs (hl2H8C-v2.1 and hl2H8C-v2.1-sHSA) are effective in inhibiting tumor growth. On day 22, the average tumor volume in the two treatment groups was 494.3 mm3 and 890.0 mm3' significantly less than the 1438.5 mm3 of the control group. Although some of the above inventions have been described in detail by way of illustration and example (for clarity of understanding) The examples are not to be construed as limiting the scope of the invention. [Simple description of the diagram] Figure 1 shows the amino acid sequence of human EpCAM (sequence number: ". 108 201125583 Figure 2 shows the EGF-Ι region of human EpCAM (amino acid 24-63) (sequence number: 2) The amino acid sequence and the substituted amino acid in the mutant strain. Figure 3 shows the sequence of the murine antibody 12H8 variant region. Figure 3A shows the amino acid of the heavy chain variant region (SEQ ID NO: 3) and nucleic acid (sequence No.: 4) Sequence, and Figure 3B shows the sequence of amino acid (SEQ ID NO: 5) and nucleic acid (SEQ ID NO: 6) in the light chain variant region. The CDR sequence has a bottom line. Figure 4 shows the murine antibody 1G10 variant. Sequence of the region. Figure 4A shows the amino acid (SEQ ID NO: 7) and nucleic acid (SEQ ID NO: 8) sequences of the heavy chain variant region, and Figure 4B shows the amino acid of the light chain variant region (SEQ ID NO: 9 And the nucleic acid (SEQ ID NO: 10) sequence. The CDR sequence has a bottom line. Figure 5 shows the sequence of the murine antibody 1F10 variant region. Figure 5A shows the heavy chain variant region of the amino acid (SEQ ID NO: 11) and nucleic acid (SEQ ID NO: 丨 2) sequence, and Figure 5B shows the amino acid of the light chain variant region SEQ ID NO: 13) and nucleic acid (SEQ ID NO: 14) sequence. The CDR sequence has a bottom line. # Figure 6 shows the sequence of the murine antibody 2D11 variant region. Figure 6A shows the amino acid of the heavy chain variant region (SEQ ID NO: : 15) and the nucleic acid (SEQ ID NO: 16) sequence, and Figure 6B shows the amino acid (SEQ ID NO: 17) and nucleic acid (SEQ ID NO: 18) sequences of the light chain variant region. The CDR sequence has a bottom line. The figure shows the sequence of the murine antibody 4d2 variant region. Figure 7A shows the amino acid sequence of the heavy chain variant region (SEQ ID NO: 19) and the nucleic acid (SEQ ID NO: 20) sequence, while Figure 7B shows the amine of the light chain variant region. The base acid (SEQ ID NO: 21) and the nucleic acid (SEQ ID NO: 22) sequence. The CDR sequence has a bottom line 109 201125583 line. Figure 8 shows the sequence of the murine antibody 6D11 variant region. Figure 8A shows the amine of the heavy chain variant region. The base acid (SEQ ID NO: 23) and nucleic acid (SEQ ID NO: 24) sequence ' and Figure 8B shows the amino acid of the light bond variant (SEQ ID NO: 25) and nucleic acid (SEQ ID NO: 26) sequence. There is a bottom line. Figures 9A and 9B show no HSA fusion ( Figure 9A) and the construct of anti-EpCAM and anti-CD3 bispecific antibody with HSA fusion (Fig. 9B). Figure 10A shows the sequence of hl2H8B VL (amino acid sequence is SEQ ID NO: 29; nucleic acid sequence is SEQ ID NO: 30). Figure 10B shows the sequence of Μ2Η8β V η (amino acid sequence is SEQ ID NO: 2 7; nucleic acid sequence is SEQ ID NO: 28). Figure 11 shows the sequence of hl2H8C VL (amino acid sequence is SEQ ID NO: 33; nucleic acid sequence is SEQ ID NO: 34). Figure 11B shows the sequence of hl2H8 (: VH (amino acid sequence is SEQ ID NO: 3 1 ; nucleic acid sequence is #column number: 32). Figure 12A shows the sequence of h2DllB VL (amino acid sequence is "々* 夕丨 编号: 37; nucleic acid sequence is SEQ ID NO: 38 > Figure 12B shows the sequence of h2DliB VH (amino acid sequence is SEQ ID NO: 35; nucleic acid sequence is #column number: 36). Figure 13A shows anti-CD3 The sequence of VL (amino acid sequence is 歹!!: 57; nucleic acid sequence is SEQ ID NO: 58). 13B圄ss - 1 q翊 is not resistant to VH sequence (amino acid sequence is sequence number: 55; nuclear Stuffed as a sequence 110 201125583 column number: 56). Figure 14 shows the sequence of the vl version of anti-EpCAM X anti-CD3 bsAbs. Figure 14A: sequence of vl version hl2H8B bsAb ("hl2H8B-vl") (Amino acid sequence is SEQ ID NO: 39; nucleic acid sequence is SEQ ID NO: 40). Figure 14B: Sequence of vl version hl2H8C bsAb ("hl2H8C-vl") (amino acid sequence is SEQ ID NO: 41; nucleic acid sequence For sequence number: 42). Figure 14C: Sequence of vl version h2DllB bsAb ("h2DllB-vl") (Amino acid sequence is SEQ ID NO: 43; nucleic acid sequence is SEQ ID NO: 44). Figure 15A shows the sequence of full-length albumin for bsAb fusion (amino acid sequence is SEQ ID NO: 45; nucleic acid sequence is SEQ ID NO: 46). Figure 15B shows the sequence of short albumin for bsAb fusion (amino acid sequence is SEQ ID NO: 47; nucleic acid sequence is SEQ ID NO: 48). Figures 16A and 16B show The effect of AbGn bsAbs on cytotoxic activity (% of cell death) in pancreatic cancer cells Pane 02.03 (Fig. 16A) and multiple bone marrow cancer cells RPMI 8266 (Fig. 16B) in the presence of human PBMC. Figure 17A Figure 17B shows the % growth inhibition effect of bsAbs in pancreatic cancer cells Pane 02.03 (Fig. 17A) and lung cancer cells NCI-H358 (Fig. 17B) in the presence of hPBMC. Figure 18 shows hl2H8CX anti-CD3 ( Antitumor activity of hl2H8C-v2.1 and hl2H8C-v2.1-sHSA) in human DLD-1 colorectal cancer xenograft mode (mean soil SEM) (* relative to PBS control group, p<0.05). 111 201125583 Main component symbol description]

112

Claims (1)

201125583 VII. Scope of application: 1. An isolated monoclonal antibody that specifically binds to one of the amino acids 24-63 of human EpC AM, wherein the individual antibody binds to cells of human cancer cells in vitro. The epitope on the surface induces apoptosis of the cancer cell, and the apoptosis-initiating activity of the single antibody against the human lung cancer cell line NCI-H358 is at least about one selected from the group consisting of 12H8, 1F10, 1G10, 2D11, 6D11 and 90% of the activity of the antibody of the group consisting of 4D2, wherein the apoptosis-initiating activity is measured by culturing the human lung cancer cell line with an antibody at a concentration of about 10 ug/ml for about 16-20 hours. 2. The antibody of claim 1, wherein the binding of the antibody to an epitope in amino acid 24-63 of human EpCAM is dependent on the presence of an amino acid residue selected from the group consisting of: (1) Residues of human EpCAM Q24, E25 and N42; (2) Residues of human EpCAM Q24, E25, E26, N37, N4, Q47 and T49; (3) Residues E25, V40 and R44 of human EpCAM; (4) Residues of human EpCAM N41, N43 and R44; and (5) Residues of human EpCAM Q24, E25, A35, F39, V40, N41, R44, Q45 and Q47. 3. The antibody of any one of claims 1 or 2, 113 201125583 The antibody elicits apoptosis of a human cancer cell selected from the group consisting of breast cancer cells, colorectal cancer cells , gastric cancer cells, lung cancer cells, prostate cancer cells, sputum cancer cells, throat cancer cells and printed cancer cells. 4. A monoclonal antibody that specifically binds to human EpCAM' which comprises three SEQ ID NO: 3 heavy chain complementarity determining regions and three SEQ ID NO: 5 light chain complementarity determining regions. 5. The antibody of claim 4, wherein the antibody comprises a heavy chain variation region comprising an amino acid sequence of SEQ ID NO: 3 and a light chain variation comprising an amino acid sequence of SEQ ID NO: 5. Area. 6. The antibody of claim 5, which further comprises a heavy chain constant region and a light chain constant region from one human antibody. 7. The antibody of any one of claims 4-6, wherein the anti-system is an anthropomorphic antibody. 8. A monoclonal antibody that specifically binds to human EpCAM, comprising: a heavy chain variant region comprising an amino acid sequence of SEQ ID NO: 3 or a light chain variant region comprising an amino acid sequence of SEQ ID NO: 5. . 9. A monoclonal antibody that specifically binds to human epCam, and its package 114 201125583 includes two sequences. The heavy bond complementarity determining region of 7 and the three sequence number: 9 light chain complementarity determining region. The antibody of claim 9, wherein the antibody comprises a heavy chain variation region comprising an amino acid sequence of SEQ ID NO: 7 and a light chain variation comprising an amino acid sequence of SEQ ID NO: 9. Area. U. The antibody of claim 1, wherein the antibody comprises a heavy chain constant region and a light chain constant region. 12. The antibody of any one of claims 9-11, wherein the anti-system is an anthropomorphic antibody. 13. An isolated antibody that specifically binds to human epCAM, comprising a heavy chain variant comprising the amino acid sequence of SEQ ID NO: 7 or a light chain comprising an amino acid sequence of SEQ ID NO: 9. Variation zone. 14. A monoclonal antibody that specifically binds to human jgpCAM, comprising two SEQ ID NO: 11 heavy bond complementarity determining regions and three sequence numbers: 13 light chain complementarity determining regions. The antibody of claim 14, wherein the antibody comprises a heavy chain variant region comprising the amino acid sequence of SEQ ID NO: 11 and a light chain variant region comprising the amino acid sequence of SEQ ID NO: 13. 115 201125583 More includes an antibody from a μ. As claimed in claim 15, one of the human antibody heavy chain binding and a light chain strange region, such as the patent application scope ι4_ΐ6, the anti-system is anthropomorphic. The antibody according to any one of the preceding claims, wherein the individual antibody of the L ° human _ EPCAM comprises a heavy chain variation region comprising the amino acid sequence of SEQ ID NO: 11: Ge Yi Xu The light chain variant region of the amino acid sequence numbered 13. 19. A monoclonal antibody that specifically binds to human Epc AM, comprising two SEQ ID NO: 15 heavy chain complementarity determining regions and three sequence numbers: 轻7 light chain complementarity determining region. 20. The antibody of claim 9, wherein the antibody comprises a heavy bond variant comprising the amino acid sequence of SEQ ID NO: 15 and a light chain comprising the amino acid sequence of SEQ ID NO: 17. Variation zone. 21. The antibody of claim 20, further comprising a heavy chain constant region and a light chain constant region from a human antibody. The antibody of any one of claims 19 to 21, wherein the anti-system is an anthropomorphic antibody. 116 201125583 23. An individual antibody that binds to human _ EpCAM, comprising a heavy chain variant comprising the amino acid sequence of SEQ ID NO: 15 or an amino acid sequence comprising SEQ ID NO: 17. Light chain variation region. 24. A monoclonal antibody that specifically binds to human epCAM, comprising three SEQ ID NO: 19 heavy chain complementarity determining regions and three sequence numbers: 21 light chain complementarity determining regions. The antibody of claim 24, wherein the antibody comprises a heavy chain variation region comprising the amino acid sequence of SEQ ID NO: 19 and an amino acid sequence comprising the sequence number: 2 1 Light chain variation region. 26. The antibody of claim 25, further comprising a heavy chain constant region and a light chain constant region from a human antibody. The antibody of any one of claims 24 to 26, wherein the anti-system is an anthropomorphic antibody. 28. A monoclonal antibody that specifically binds to human epCAM, comprising a heavy chain variant comprising the amino acid sequence of SEQ ID NO: 19 or - a light chain variant comprising the amino acid sequence of SEQ ID NO: 21. Area. 29. A monoclonal antibody that specifically binds to human EpCAM, and its composition 117 201125583 comprises two heavy chain complementarity determining regions of SEQ ID NO: 23 and three light chain complementarity determining regions: 30. The antibody of claim 29, wherein the antibody comprises a heavy chain variation region comprising the amino acid sequence of SEQ ID NO: 23 and a light chain variant region comprising the amino acid sequence of SEQ ID NO: 25. . 31. The antibody of claim 3, further comprising a heavy chain constant region and a light chain constant region from one of the human antibodies. The antibody according to any one of claims 29 to 31, wherein the anti-system is an anthropomorphic antibody. 33. A monoclonal antibody that specifically binds to human EpC AM, comprising a heavy bond variant comprising an amino acid sequence of SEQ ID NO: 23. or a light bond variant comprising an amino acid sequence of SEQ ID NO: 25. . 34. A single-chain, bispecific antibody comprising (4) a first antigen-binding region, specifically binding to an epitope of amino acid 24.63 of human EpCAM, wherein the first antigen binding region comprises a heavy chain variation The region (VHEpCAM) and a light chain variant region (VlEpCAM); and a second antigen binding region specifically bind to the human CD3 antigen, wherein the second antigen binding region comprises a heavy chain variation region (VhCD3) and a light chain variation region (VLCD3), wherein the order of the variation regions from the N• terminal to the c_ terminal is 118 201125583 VLEpCAM-VHEpCAM-VHCD3-VLCD3. 35. A bispecific antibody as described in claim 34, further comprising a peptide linker between VLEPCAM and VHEPCAM, between vHEpCAM and VhCD3, and/or between VHCD3 and VLCD3. 36. The bispecific antibody according to claim 35, wherein the peptide linker between the VLEPCAM and the VHEPCAM comprises the amino acid sequence of sequence number: 49. 37. The bispecific antibody according to claim 35, wherein the peptide linker between the VHCD3 and VLCD3 comprises the amino acid sequence of SEQ ID NO: 53. 38. The bispecific antibody according to claim 35, wherein the peptide linker between the VHEPCAM and VHCD3 comprises the amino acid sequence of the sequence number: 51. The bispecific antibody according to any one of claims 34 to 38, wherein the first antigen binding region comprises VHEpCAM and VLEpCAM selected from the group consisting of: (4) VHEPCAM comprises three sequence numbers: 3 CDR, while VLEpCAM includes three CDRs with SEQ ID NO: 5; (b) VHEPCAM includes three CDRs with SEQ ID NO: 7 and vLEpCAM 119 201125583 includes three CDRs with SEQ ID NO: 9; (c) VHEpCAM includes three sequences Number: 11 CDR, while VLEpCAM includes three CDRs with sequence number: 13; (d) VHEpCAM includes three CDRs with SEQ ID NO: 15 and VLEpCAM includes three CDRs with SEQ ID NO: 17; (e) VHEpCAM includes three SEQ ID NO: 19 CDRs, while VLEpCAM includes three CDRs of SEQ ID NO: 21; and (f) VHEpCAM includes three CDRs of SEQ ID NO: 23, and ® VLEpCAM includes three CDRs of SEQ ID NO: 25. 40. The bispecific antibody of any one of claims 34-39, wherein the VHEpCAM is anthropomorphized with the VLEpCAM system. The bispecific antibody according to any one of claims 34 to 40, wherein the first antigen-binding region comprises VHEpCAM and VHEpCAM selected from the group consisting of: (a) VHEpCAM comprises a sequence ID: 27 amino acid sequence, and VLEpCAM includes SEQ ID NO: 29 amino acid sequence; (b) VHEpCAM includes SEQ ID NO: 31 amino acid sequence, and VLEpCAM includes SEQ ID NO: 33 amino acid sequence; And (c) VHEpCAM includes the amino acid sequence of SEQ ID NO: 35, and VLEpCAM includes the amino acid sequence of SEQ ID NO: 37. 42. The dual specificity 120 201125583 antibody as claimed in any one of claims 34 to 41 wherein the second antigen binding region specifically binds to a CD3g, CD3Y or CD38 chain. 43. The bispecific antibody as claimed in any one of claims 34 to 42 wherein the second antigen binding region comprises the VhCD3 and the VLCD3 ' wherein the VHCD3 comprises the amino acid sequence of SEQ ID NO: 55, And wherein the VLCD3 comprises the amino acid sequence of SEQ ID NO: 57. 44. The bispecific antibody according to any one of claims 34-43, further comprising a human serum albumin sequence (HSA) in the bispecific antibody (45). The bispecific antibody according to the invention of claim 44, wherein the human albumin sequence comprises the amino acid sequence of SEQ ID NO: 45 or SEQ ID NO: 47. 46. The antibody is further comprising a peptide linker between the VLCD3 and the human serum albumin sequence. 47. The bispecific antibody according to claim 46, wherein the VLCD3 and the human serum albumin The peptide linker between the sequences includes the amino acid sequence of SEQ ID NO: 51. The method of claim </ RTI> </ RTI> </ RTI> <RTIgt; 39. Amino acid sequence of the group consisting of 41 and SEQ ID NO: 43. 49. A pharmaceutical composition comprising the antibody of any one of claims 1 to 48 and a pharmaceutically acceptable carrier. .- An exonuclease comprising a nucleic acid sequence encoding an antibody according to any one of claims 1 to 48. 51. A vector comprising the polynucleotide β 52 of claim 5 of the patent application. - a host cell which comprises a vector of claim 5 of the patent application. 53. A method of producing an antibody comprising culturing a host cell of claim 52 which produces an antibody encoded by the nucleic acid and The cell culture medium recovers the antibody. 54. A method for screening an antibody that specifically binds to human EpCAM in a test tube and elicits apoptosis of a human cancer cell, comprising: (a) an effective concentration of one in a test tube Specifically, a cancer cell is cultured in combination with a single antibody of human EpCAM; (b) measuring apoptosis of cancer cells induced by the monoclonal antibody alone; and 122 201125583 () right relative to a control antibody If the cell has a high cell/week-initiation activity, the antibody is selected. 55. As in the method of the 54th item of the material range, the cell death cell triggers the active system 'by the cancer The method of any one of the inventions, wherein the cancer cell line is selected from the group consisting of: a breast cancer cell, a colorectal cancer cell, and a method of any one of the following: , a method of any one of the inventions, wherein the method of claim 5, wherein the method of claim 5, wherein the method of claim 5, wherein The selection-cell>peripheral-priming activity is at least 9% antibody of an antibody selected from the group consisting of deletion, ifi〇igi〇, 2D 6D11 and 4D2. 58. A method of treatment - one of the individual's cancers or a method of delaying the progression of the cancer, which comprises administering to the individual an effective amount of the antibody of any of the above-mentioned patents. 59. The method according to claim 58 wherein the cancer is selected from the group consisting of breast cancer, colorectal cancer, stomach cancer, lung 123 201125583 cancer prostate cancer, pancreatic cancer, throat cancer and ovary cancer. The method of any of claims 58 or 59, further comprising applying a second anti-cancer agent to the individual. 6 1 - / &gt; L-rjj. The method of claim 60, wherein the second anti-cancer agent is a chemotherapeutic agent. 62. The method of claim 1, wherein the second anticancer agent is oxaliplatin. 63. A kit comprising antibodies to any of the items in claims 1-48. 64. The kit of claim 63, further comprising instructions for administering an effective amount of the antibody to the individual to treat the cancer in the individual. 65. The kit of any of claims 63 or 64, further comprising a second anti-cancer agent. 66. The kit of claim 65, further comprising the use of the antibody and the second anti-cancer agent simultaneously to treat cancer in the individual.