SK16852000A3 - Recombinant baculovirus-based insecticides - Google Patents

Abstract

The present invention provides isolated recombinant Plutella xylostella baculovirus for use as insecticidal agents. Preferably, a recombinant baculovirus according to the invention has incorporated within its genome a gene encoding an insecticidal toxin. The invention also provides insecticidal compositions and formulations comprising recombinant Plutella xylostella baculoviruses and methods for killing insect pests and for reducing insect infestation of crops.

Description

ΝΑ INSECTICIDES BASE OF RECOMBINANT BACULOVIRUS

Technical field

The present invention relates to improved Plutella xylostella baculoviruses useful as biological insecticides. The invention provides recombinant baculoviruses that have been genetically engineered to contain genes encoding insecticidal toxins.

BACKGROUND OF THE INVENTION

Baculoviruses are insect viruses that are useful as biological insecticides. More than 400 baculovirus isolates have been described. Autographa californica nuclear polyhedrosis virus (AcMNPV), a typical representative of the Baculoviridae family, was originally isolated from Autographa californica, a night butterfly commonly known as the clover caterpillar. This virus infects 12 families and more than 30 Lepidopteran insects (Granados et al., The Biology of Baculoviruses, I, 99 (1986)). AcMNPV is not known to productively infect any species outside this range.

The life cycle of baculoviruses, such as AcMNPV, has two stages. Each stage of the life cycle is represented by a specific form of virus: developed virions (BV) that are not closed, and occlusion bodies (OB).

In the natural form of infecting insects, numerous virions are found in a form embedded in a paracrystalline protein matrix known as an occlusion body (OB), also referred to as a polyhedral inclusion body (PIB). Protein viral coatings are referred to as polyhedra. The polyhedrin protein having a molecular weight of 29 kD is the major virus encoded by the structural protein of viral occlusion (U.S. Patent No. 4,745,051).

Viral occlusions are an important part of the natural life cycle of a baculovirus because they provide a means for horizontal (insect to insect) transmission between susceptible insect species. In the environment, susceptible insects (usually at larval stage) consume viral occlusions in a contaminated food such as a plant.

587 / B ·· ···· · · ··· ·

Crystalline occlusions dissociate in the intestine of susceptible insects to release infectious viral particles. These occlusion-derived viruses (ODVs) replicate in the cells of the middle intestinal tissue.

It is believed that the viral particles enter the cells by endocytosis or fusion and that the viral DNA is uncoated at the site of the nuclear pore or nucleus. Viral DNA replication is detected within 6 hours. 10-12 hours after infection (p. I.), Secondary infection spreads to other insect tissues through extracellular spread of virus (BV) from the cell surface. The BV form of the virus is responsible for the spread of the virus between cells in infected insects, as well as for the transmission of infection in cell culture.

Later, in the infection cycle (12 hours p.i), polyhedrin protein can be detected in the infected cells. For 18 - 24 p. i. The polyhedrin protein is folded in the nucleus of the infected cell and the viral particles are immersed in protein occlusions. Viral occlusions accumulate in large numbers for 4-5 days, until the lysis of the cell. These polyhedra have no active role in the spread of infection in the larvae. BV proliferates and spreads in hemolymph, leading to larval death.

After the death of the infected larvae, millions of polyhedres remain in decaying tissue while BVs degrade. When another larva eats polyhedra, for example in contaminated plant material or other food, the cycle is repeated.

In conclusion, the closed form of the virus is responsible for the initial infection of insects in the intestine as well as for the stability of the virus in the environment. ODVs are essentially non-infectious when administered by infection, but are highly infectious when administered orally. The non-closed form of the virus (i.e. BV) is responsible for the secondary infection and inter-cell infection. BVs are highly infectious to cells in culture or to insect internal tissues upon injection, but are essentially non-infectious when administered orally.

The main obstacle to the intensive use of insecticidal baculoviruses in agriculture is the time between the initial infection of the insect and its death. This period can be in the order of days to weeks. During this period, insects continue to feed, which further harms the plants. To reduce this, recombinant baculoviruses have been prepared that express insect control or modifying substances such as toxins, neuropeptides, hormones or enzymes (Tomalski,

587 / B ·· ···· · · · · · · ·

M. D. et al., Nature, 352, 82-85 (1991), Federici, In Vitro, 28, 50A (1992), Martens et al., App. and Envir. Microbiology, 56, 2764-2770 (1990), Menn et al., Agric. Food Chem., 37, 271-278 (1989), Eldridge et al., Insect Biochem., 21, 341-351 (1992), Hammock et al., Nature, 344, 458-461 (1990).

The second major obstacle to the use of insecticidal baculoviruses is the limited range of their hosts. Although the limited range of baculovirus hosts makes them safe for non-target organisms, it also prevents them from controlling various Lepidopteran pests present in the field. This is particularly true when the Lepidopteran family of insects to be controlled includes insects that are either non-permissive or semi-permissive for infection by the insecticidal baculovirus used. An insect that is non-permissive for infection is an insect that cannot be productively infected by any dose; an insect that is semi-permissive for infection is one that can be productively infected with a dose of virus that is at least one, but more often two or more orders of magnitude higher than the dose necessary for productive infection of susceptible hosts, i. permissive hosts. Prior to the present invention, no baculovirus of the genus Nucleopolyhedrovirus, for which the great-fever fly, Plutella xylostella, is a permissive host has been identified. These insects are important pests on many vegetables and have developed resistance to both chemical and biological insecticides.

Therefore, there is a need for biological insecticides that have (i) improved efficacy and shorter time between infection and mortality and (ii) a larger host range that allows control of a wide range of Lepidopteran insect pests, including, for example, Plutella xylostella.

SUMMARY OF THE INVENTION

The present invention provides recombinant baculoviruses for Plutella xylostella (PxNPV) having better insecticidal activity against Plutella xylostella than other natural and recombinant baculoviruses.

The recombinant PxNPVs of the present invention are PxNPVs containing one or more genetic alterations to native PxNPV. Between

587 / B · genetic alterations include, for example, insertion or deletion of one or more restriction sites; modification, deletion or duplication of one or more genes encoded by the virus; and inserting one or more genes encoding heterologous proteins, i. proteins that are not encoded by the virus or are encoded by another virus.

Preferably, the recombinant PxNPVs contain in their genomes a nucleic acid sequence encoding an insect-influencing substance, such as an insecticidal toxin, peptide hormone, enzyme, or receptor, that is operably linked to a promoter capable of activating transcription in the target insect. Preferably, the insecticidal toxin is an insecticide-influencing substance. It is expected that a recombinant baculovirus encoding an insecticidal toxin in the context of the PxNPV genome will have significantly better insecticidal properties.

Examples of insecticidal toxins are Aa1T, AaHIT1, AaHIT2, Lqh1T2, Lqq1TI, Lqq1T2, Bj1T1, Bj1T2, LqhP35, LqhalfalT, Smp1T2, SmpCT2, SmpCT3, SmpMT, DK9.2, DK112, DK11, DK11, DK11, DK11, DK11, DK11, NPS-326, NPS-331, NPS373, Tx4 (6-1), TxP-1, omega-atratoxins, alpha-conotoxins, μ-conotoxins, chlorotoxin and omega-conotoxins. In some embodiments, a natural secretory signal peptide, i. toxin-associated signal peptide; in other embodiments, a heterologous signal peptide was used to induce toxin secretion from infected insect cells. Examples of useful heterologous signal peptides are peptides derived from the pBMHPC-12 signal sequence from Bombyx mori; the adipoclitic hormone signal sequence from Mandura sexta; an apolipophorin signal sequence from Manduca sexta; chorionic signal sequence from Bombyx mori; cuticle signal sequence from Drosophila melanogaster; the Drosophila melanogaster esterase-6 signal sequence; and a sex-specific signal sequence from Bombyx mori.

The invention also encompasses direct ligation vectors that are designed to facilitate construction in recombinant PxNPV genomes by ligation of DNA fragments in vitro. Insertion of the DNA resulting from such ligation into a suitable host results in the production of recombinant PxNPV.

587 / B ·· ············

In another aspect, the invention provides expression cassettes encoding insecticidal toxins. The expression cassettes comprise a promoter sequence, preferably derived from the Drosophila meianogaster hsp70 promoter, which is operably linked to a nucleic acid sequence encoding a toxin. The expression cassettes of the present invention may also be comprised in plasmid vectors that are designed as modular expression vectors.

In yet another embodiment, the invention provides codon-optimized genes encoding insect toxins, such as those shown in FIG. 10 and 11, infra. Codon-optimized genes are those genes in which individual codons were present in the natural toxin coding sequence substituted with alternative codons that are more efficiently utilized by the protein synthesizing machinery in the insect cell.

In yet another aspect, the invention provides insecticidal compositions and compositions comprising at least one recombinant PxNPV of the present invention and an agriculturally acceptable carrier.

In yet another aspect, the invention provides a method of controlling insect pests and reducing pest infestation, comprising applying an insecticidally effective amount of an insecticidal composition or composition comprising PxNPV to a given area.

BRIEF DESCRIPTION OF THE DRAWINGS

Fig. 1 is a schematic representation of the procedures used to prepare pmd 205.1, pmd 216.1, and pmd 220.2 vectors for the production of viral ecdysteroid glucose transferase (egt) deleted gene PxNPV.

Fig. 2 is a schematic representation of the procedures used to prepare the LAB 50.2 vector.

Fig. 3 is a schematic representation of the structure of pMEV modular expression vectors.

587 / B ··············

Fig. 4 is a schematic representation of pMEV vectors containing various promoters.

Fig. 5 is a schematic representation of the cloning of sequences into modular expression vectors.

Fig. 6 shows the D. melanogaster hsp70 promoter module in pMEV5 and the amplification primers used for sequence isolation.

Fig. 7 shows the D. melanogaster hsp70 promoter module in pMEV6 and the amplification primers used for sequence isolation.

Fig. 8 is an illustration of the codon-optimized DNA sequence encoding Aa1T and shows the oligonucleotides and amplification primers used to synthesize the sequence.

Fig. 9 is a schematic representation of the structure of pMEV / ADK modular expression vectors.

Fig. 10 is an illustration of a codon-optimized DNA sequence encoding a Lqh1T2 toxin and shows the oligonucleotides and amplification primers used to synthesize the sequence.

Fig. 11 is an illustration of a codon optimized DNA sequence encoding an omega-ACTX-HV1 toxin and shows the oligonucleotides and amplification primers used to synthesize the sequence.

DETAILED DESCRIPTION OF THE INVENTION

Many techniques of molecular biology, microbiology, recombinant DNA, protein biochemistry, and insect virology known to those skilled in the art can be used in practicing the present invention, as fully explained in, for example, Sambrook et al., 1989, Molecular Cloning: A Laboratory Manual, 2 you d., Cold Spring Harbor Laboratory Press, Gold Spring Harbor, New York; Oligonucleotide Synthesis, 1984 (M.L. Gait, ed.); Ausubel et al., Current Protocols in Molecular Biology, 1997 (John Willey and Sons); Methods in Enzymology series (Academic Press, Inc.); Protein Purification: Principles and Practice, 2nd Ed. (Springer-Verlag, N.Y.); Summers et al., A Manual of Methods for Baculovirus Vectors and Insect Cell

587 / B ·· ············

···· ·· ·· ·· ·

Culture Procedures, Texas 1555, 1987, and O'Reilly et al., Baculovirus Expression Vectors: A Laboratory Manual, 1994 (Oxford Univ. Press, N.Y.).

The present invention provides isolated, purified, recombinant Plutella xylostella baculoviruses (PxNPV) which are useful as biological insecticides. PxNPV as used herein refers to a baculovirus isolate of the genus Nucleopolyhedrovirus (NPV), the natural version of which has been isolated from infected Plutella xylostella larvae and which is genetically different from other known baculoviruses and which exhibits a higher infectivity for Plutella xylostella larvae than other baculovirus. The genomic sequences of the recombinant PxNPVs of the present invention, excluding heterologous sequences, exhibit at least 90% sequence identity, and preferably at least 95% sequence identity, with the PxNPV genomic sequence deposited as ATCC VR-2607. PxNPV falling within the scope of the present invention can be identified by:

(i) By measuring infectivity for Plutella xylostella larvae. The PxNPV of the present invention typically exhibits infectivity to Plutella xylostella larvae that is at least two orders of magnitude higher than that of the V8 strain AcMNPV deposited as ATCC VR-2465.

(ii) Digesting the viral genomic DNA with HindIII, XhoI and / or PstI and comparing the resulting restriction fragments with those produced by digesting genomic DNA derived from PxNPV and non-PxNPV baculoviruses. The PxNPV of the present invention, excluding the fragments resulting from genetic alterations, has restriction fragments characteristic of PxNPV, i. fragments that arise from digestion of PxNPV and do not arise from digestion of DNA of other baculoviruses.

The inventors have found that the recombinant PxNPV of the present invention has superior insecticidal activity on Plutella xylostella larvae compared to wild-type PxNPV and / or recombinant NPV derived from other baculovirus species. The recombinant PxNPVs of the present invention are PxNPVs that contain one or more genetic alterations with respect to natural PxNPV. The term "genetic alteration" refers to any change in the sequence of the PxNPV genome, including, for example, the insertion or deletion of one or more restriction genes.

587 / B ········ · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · ·· places; modifications, deletions, or duplications of one or more genes encoded by the virus; and insertion of one or more genes encoding heterologous proteins, i. proteins that are not encoded by the virus or are encoded by another virus. For example, modified PxNPV whose genomes contain restriction sites absent in native PxNPV or vice versa that do not contain one or more restriction sites present in native PxNPV are within the scope of the present invention. The term "restriction site" refers to a nucleic acid sequence that is a recognition site for a restriction endonuclease. Typically, one or more restriction sites are added and / or deleted to create a cloning site not present in the native PxNPV, i. to create a sequence containing at least one unique restriction site for insertion of the heterologous gene into the PxNPV genome. Preferably, the recombinant PxNPV comprises at least one heterologous gene in its genome, including, for example, genes encoding insect-affecting substances such as insecticidal toxins, hormones, enzymes, or receptors.

Preferably, the recombinant PxNPV comprises a heterologous gene encoding an insecticidal toxin. Suitable insecticidal toxins include, for example, the toxins listed in the following table:

toxin link Aa1T, AaHIT1, AaHIT2 Darbon et al., Int. J. Peptide Protein Res., 20, 320-330, 1982 Loreta et al., Biochem., 29, 142-1501, 1990 LqhIT2 Zlotkin et al., Biochem., 30, 4814-4821, 1991; Zlotkin a et al., European Patent Application EP 0374753 A2, 1990 LqqlT1, LqqlT2 Zlotkin et al., Ar. of Biochem. and Biophys., 240, 877- 887 (1985); Zlotkin et al., European Patent Application EP 0374753A2, 1990 BjlT1, BjlT2 Loret et al., Biochem. Biophys. Acta, 701, 370-387, 1982; Zlotkin et al., European Patent Application, EP 0374753 A2, 1990 LqhP35 Zlotkin et al., European Patent Application EP 0374753

587 / B ···········································

A2, 1990 LphalfalT Eitan et al., Biochem., 29, 5941-5947, 1990 SmplT2 Zlotkin et al., European Patent Application EP 0374753 A2, 1990 SmpCT2 Zlotkin et al., European Patent Application EP 0374753 A2, 1990 SmpCT3 Zlotkin et al., European Patent Application EP 0374753 A2, 1990 PMSM Zlotkin et al., European Patent Application EP 0374753 A2, 1990 DK9.2 Krapcho et al., International Patent Application WO 92/15195, 1992 DK11 Krapcho et al., International Patent Application WO 92/15195, 1992 DK12 Krapcho et al., International Patent Application WO 92/15195, 1992 μ-agatoxín Skinner et al., J. Biol. Chem., 264, 2150-2155, 1989; Adams et al., J. Biol. Chem., 265, 861-867, 1990 King Kong toxin Hillyard et al., Biochem., 28, 358-361, 1989 pt6 Leisy et al., European Patent Application EP 0556160 A2, 1993 NPS-326 Krapcho et al., International Patent Application WO 93/15192, 1993 NPS-331 Krapcho et al., International Patent Application WO 93/15192, 1993 NSS-373 Krapcho et al., International Patent Application WO 93/15192, 1993 TX4 (6-1) Figueriredo et al., Toxicon, 33, 83-93, 1995 TxP-1 Tomalski et al., Toxicon, 27, 1151-1167, 1989 Omega - Attractotoxins Atkinson et al., International Patent Application WO 93/15108, 1993

587 / Β ·········································· B

a-conotoxins Gray et al., J. Biol. Chem., 256, 4734-4740, 1981; Gray a et al., Biochem., 23, 2796-2802, 1984 μ-conotoxins Cruz et al., J. Biol. Chem., 260, 9280-9288, 1989; Cruz a et al., Biochem., 28, 3437-3442, 1989 chlorotoxin Debin et al., Am. J. Physiol., 264, 361-369, 1993 omega - conotoxins Oliver et al., Biochem., 23, 5087-5090, 1984; Riviera a et al., J. Biol. Chem., 262, 1194-1198, 1987

The toxin coding sequence is operably linked to a promoter, i. the promoter sequence is placed upstream of the toxin coding sequence such that expression of the toxin is under the control of the promoter. The promoter may be a baculovirus-derived promoter such as DA26, 35K, 6.9K and the polyhedrin (polh) promoter (O'Reilly et al., J. Gen. Virol, 71, 1029 (1990); Friesen et al. J. Virol, 61, 2264, 1987, Wilson et al., J. Virol., 61, 661-666, 1987; Hooft van Iddekinger et al., Virol., 131, 561, 1983, and generally see Miller, ed. , The Baculoviruses, Plenum Press, New York, 1997). Alternatively, a host cell promoter such as the insect hsp70 promoter or actin promoter may be used. Any natural or synthetic promoter active in inducing transcription in target insect cells may be used.

Furthermore, the DNA sequence encoding the toxin may contain in front of it a sequence encoding a signal peptide which, in its parent cell, directs the secretion of the toxin. Alternatively, the toxin coding sequence may be fused in frame with the preceding DNA sequence encoding a heterologous signal sequence, i. a sequence derived from another source, including, for example, the sequence derived from the pBMHPC-12 signal sequence from Bombyx mori; the adipokinetic hormone signal sequence from Mandura sexta; apolipophorin signal sequences from Manduca sexta; chorionic signal sequences from Bombyx mori; cuticle signal sequences from Drosophila melanogaster; Drosophila melanogaster esterase-6 signal sequences; and sex-specific signal sequences from Bombyx sea, all of which are described in U.S. Pat. U.S. Patent No. 5,768,516; 5,547,871.

587 / B ········································

In some embodiments, the PxNPVs of the present invention contain in their genome a gene encoding a natural or mutant juvenile hormone esterase (JHE), whose expression may cause irreversible cessation of food intake and cocooning, and thus may lead to the death of the target insect, see for example WO 94/03588.

Recombinant PxNPVs can also be prepared by genetically engineering a natural or pre-existing recombinant PxNPV strain to result in modification of one or more of the functions encoded by the virus. For example, one or more viral genes, such as genes encoding a viral polyhedrin protein, an ecdysteroid glucosyltransferase (EGT), or a p10 protein, may be modified, deleted, or duplicated. In addition, the inserted sequences may be derived from other baculoviruses, such as the V8 region of the AcMNPV strain, which contains a determinant leading to a faster killing phenotype, as described in U.S. Pat. U.S. Patent No. 5,768,516; 5,662,897.

Examples of recombinant PxNPVs of the present invention are those having ATCC accession no. VR-2607, VR-2608 and VR-2609.

The present invention provides methods and compositions for constructing recombinant PxNPV. Any method known in the art may be used to prepare recombinant PxNPV. For example, co-infection of a suitable host cell with two strains of PxNPV may result in homologous recombination between two related sequences in vivo, which may result in recombinant PxNPV. Similarly, homologous recombination can occur in vivo in cells co-transfected with purified PxNPV virus genomic DNA and a second nucleic acid containing PxNPV sequences. Alternatively, recombinant PxNPV can be prepared by introducing isolated viral genomic DNA that has been previously modified in vitro into cells.

In one series, recombinant PxNPVs are prepared using direct ligation vectors and modular expression vectors. These components and methods of using them for the preparation of recombinant PxNPV are described below.

587 / B · e · e e e e e e e 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 · · · · · · · · · · ·

PxNPV-derived direct ligation vectors

Direct ligation viral vectors contain purified genomic DNA of PxNPV viruses that can be used to construct recombinant PxNPV genomes by in vitro DNA ligation. Direct ligation vectors direct the production of recombinant PxNPV virions upon introduction into a suitable host cell. In some embodiments, containing PxNPV vectors for direct ligation of PxNPV genomic DNA that has been modified to include at least one cloning site that is not present in native PxNPV. The cloning site contains one or more restriction sites that are either not present in the genome of the native PxNPV or are not present in the nucleic acid encoding or regulating the essential functions of the PxNPV virus. In the second case, the direct ligation vectors of the present invention are engineered to have deleted any restriction sites that are outside the cloning site, such that the cloning site contains one unique restriction site. Digestion of the vector for direct ligation by one or more restriction enzymes specific for the cloning site then results in a DNA preparation into which a heterologous nucleic acid segment can be inserted, usually in one ligation step, without disrupting the underlying viral functions. After ligation of the heterologous nucleic acid into a vector for direct ligation, the resulting DNA preparation can be introduced into a suitable host cell to propagate recombinant PxNPV. Direct ligation vectors simplify the production of recombinant PxNPV by eliminating the dependence on in vivo recombination producing recombinant viruses, see, for example, International Patent Application WO 94/28114.

Cloning sites for use in PxNPV direct ligation vectors are designed by first selecting one or more restriction enzymes that either (i) do not digest PxNPV DNA at all, or (ii) recognize a small number of sites that do not lie in a nucleic acid encoding or regulating essential functions of PxNPV virus . Selection is accomplished by (i) screening the PxNPV DNA sequence or (ii) digesting the PxNPV DNA enzyme and detecting the presence or absence of digestion products. If the enzyme recognizes a small number of sites, they may be disrupted using conventional techniques (such as

587 / B ························· Restriction enzyme digestion followed by sticky ending and religions) to yield PxNPV DNA that does not contain these sites but retains viral replication and infectivity.

After selection of one or more restriction sites, the cloning site is inserted by any suitable means, including homologous in vivo recombination or in vitro ligation, into PxNPV DNA (or natural or modified as described above to inactivate one or more restriction sites). Preferably, the cloning site comprises at least non-overlapping restriction sites to allow (i) direct cloning of the nucleic acid insert and / or (ii) independent insertion of many nucleic acid inserts.

Additional modifications, including, for example, modifications that result in inactivation of a viral gene, such as a gene encoding polyhedrin, an ecdysteroid glucosyltransferase (EGT), or a p10 protein, can be introduced to prepare direct ligation vectors from PxNPV. In some embodiments, the cloned site is inserted at the site at which it causes such inactivation.

Modular expression vectors and expression cassettes

Modular expression vectors for use in the present invention are plasmid vectors containing an expression cassette that can be excised from a modular expression vector and ligated into the PxNPV direct ligation vectors described above. Typically, the expression cassette comprises, in the 5'-3 'direction: a promoter sequence operably linked to a 5' untranslated region (UTR) that contains a start site for transcription; a sequence comprising one or more restriction sites to facilitate insertion of the heterologous gene (this sequence is designated an "insertion site"); and a 3 'UTR sequence comprising at least a 3' terminal mRNA processing and polyadenylation site. The expression cassette flanked at one end with suitable restriction sites compatible with the PxNPV direct ligation vector.

587 / B ······························································ ·· ·· ···

Suitable promoters for use in modular expression vectors include baculovirus promoters and host cell promoters. Suitable baculovirus promoters include, for example, the DA26, 35K, 6.9K and polyhedrin (polh) promoters. Suitable host cell promoters include, for example, hsp70 and an active promoter, preferably insect-derived. A "derived from" promoter sequence is a sequence containing modifications, including deletions, insertions, substitutions, and duplications of the natural promoter sequence. The only requirement is the efficacy of the final promoter in the target insect cells in terms of directing the expression of the heterologous gene to which it is operably linked.

The expression cassettes may also contain sequences encoding signal sequences that direct the secretion of the heterologous protein. The signal sequences may be sequences associated with a heterologous protein or may be derived from another protein. Suitable signal sequences include, for example, sequences derived from the pBMHPC-12 signal sequence from Bombyx mori; the adipokinetic hormone signal sequence of Mandura sexta; an apolipophorin signal sequence from Manduca sexta; a chorionic signal sequence from Bombyx mori; a cuticle signal sequence from Drosophila melanogaster; from the Drosophila melanogaster esterase-6 signal sequence; and from a sex-specific signal sequence from Bombyx mori. The nucleic acid sequence encoding the signal peptide is inserted between the 5-UTR and the start of the mature heterologous protein. The junction between the 3 'end of the signal peptide coding sequence and the beginning of the mature heterologous protein is designed such that insertion of the heterologous sequence results in a fusion protein between the signal peptide and the heterologous sequence in the reading frame. A sequence "derived from" a known signal sequence is a sequence comprising modifications, including deletions, insertions, and substitutions of amino acid residues in the signal sequence. The only requirement is the efficacy of the resulting signal sequence in the target insect cells in terms of controlling the secretion of the heterologous sequence to which it is bound from the insect cells.

Heterologous sequences for use in the present invention include, for example, sequences encoding insect-affecting substances, such as insecticidal toxins, hormones, enzymes, and receptors. Suitable insecticidal toxins

587 / B ·················

4Γ · ········ ι u ···································lll include AalT, AaHITI, AaHIT2, LqhlT2, LqqlTI, LqqlT2, BjlT1 BjlT2.

LqhP35, LqhalfalT, SmplT2, SmpCT2, SmpCT3, SmpMT, DK9.2, DK11, DK12, μagatoxin, King Kong toxin, Pt6, NPS-326, NPS-331, NPS-373, Tx4 (6-1), TxP-1 , omega-atratoxins, alpha-conotoxins, μ-conotoxins, chlorotoxin and omega-conotoxins.

The nucleic acid sequences encoding the insect-influencing substance and / or signal peptides may correspond to the natural nucleic acid sequences encoding the peptides. Alternatively, the sequences may be altered to utilize optimal codons for known genes in the viral vector (or in close related strains) and / or in insects that are targeted by the insecticidal viruses of the present invention. Codon-optimized sequences, i. sequences in which a nucleic acid sequence encoding a particular amino acid has been modified without changing the amino acid encoded at this position can be designed using methods well known in the art, such as comparing codon usage in known virus and / or target insect gene sequences and nucleic acid sequences acids encoding signal peptides and insect-modifying substances according to the present invention. Suitably, the use of codons in sequences encoding signal peptides and insect-influencing substances reflects codon usage in a viral vector or in a target insect. Examples of codon-optimized toxin sequences are shown in FIG. 10 and 11.

Production of recombinant PxNPV

Recombinant PxNPVs can be produced by either (i) co-transfecting PxNPV DNA and heterologous sequences into a suitable host cell to allow for homologous recombination in vivo, or (ii) in vitro ligation of the heterologous sequence into a direct ligation vector followed by insertion of the construct into a suitable host cell to allow virus propagation. A suitable host cell is any cell that promotes baculovirus replication, including, for example, Sf9 cells, Sf21 cells, and High Five ™ cells (Invitrogen, Carlsbad, CA). The isolated virus of the present invention is a virus that has been cloned, for example, by plaque purification in tissue culture, or which has otherwise been prepared from a single viral genotype.

587 / B • e ··· ·····················

Typically, the modular expression vector is designed to contain an expression cassette in which a suitable promoter sequence is operably linked to a sequence encoding a heterologous protein, i. expression of the heterologous protein is under the control of the promoter. The expression cassette is excised from the modular expression vector and is inserted into the PxNPV direct ligation vector by DNA ligation in vitro. The ligation mixture is then transferred to a suitable host cell. Recombinant PxNPVs are obtained from the culture medium and LC50 and LT50 are determined by any suitable method, including, for example, a food spray test, a food incorporation test, and a leaf soak test.

LC ₅₀ is the virus concentration at which 50% of the infected larvae perish during the test. LT ₅₀ is the time after infection when 50% of the infected larvae die after exposure to a certain dose of virus.

Preferably, the PxNPV of the present invention has an LC _{50 of} about 1 x 10 ⁵ OBs / 16 cm ² or less for Plutella xylostella larvae as measured by the standard food virus deposition test described in Example 6. Other baculovirus isolates usually have a higher IC ₅₀ of Plutella xylostella larvae, ie they are less effective due to their infectivity for other insect species.

Insecticidal compositions and preparations

The present invention provides insecticidal compositions and compositions comprising one or more recombinant PxNPV. Preferably, the recombinant PxNPV of the present invention kills Plutella xylostella larvae more efficiently than native PxNPV or recombinant versions of other baculoviruses (see, for example, Example 11 below).

The insecticidal composition of the present invention comprises at least one recombinant PxNPV. The insecticidal composition comprises at least one recombinant PxNPV in an insecticidally effective amount and an agriculturally acceptable carrier. An insecticidally effective amount is an amount that causes a detectable reduction in infestation, as reflected by the amount or number of insect pests in a given area or crop amount; insect damage

587 / B ······························ · · · · · · · · · · · · · · · · · · · · · · · or any other suitable infestation parameter. The composition may be in the form of wettable powders, dispersible granules, granules, suspensions, emulsions, aerosol solutions, baits and other conventional forms of insecticidal compositions. Suitable carriers are, for example, water, alcohol, hydrocarbons or other organic solvents or mineral, animal or vegetable oils or powders such as talc, clay, silicate or diatomaceous earth. Wetting agents, coating agents, UV protection agents, dispersing agents and binders may also be included. Nutrients such as sugar may be added to increase insect intake and / or to attract insects. Flow-enhancing agents, such as clay-based flow-enhancing agents, may be added to minimize sintering of wettable powders or other dry formulations. The preparation can be made in the form of coated particles or in the form of a microencapsulated material. The composition must be non-phytotoxic and must not impair the integrity of the recombinant PxNPV contained in the composition so that no components of the composition impair the uptake of the composition by insects or any function of the virus. Examples of formulations are described in EP published application 0 697 170 A1; PCT Application WA 92/191025 and U.S. Pat. U.S. Patent No. 5,768,516; 4,948,586.

The insecticidal compositions of the present invention may comprise one or more chemical insecticides and / or one or more biological control agents other than PxNPV. Chemical insecticides include, for example, pyrethroids, pyrazolines, organophosphates, carbamates, formadines and pyrroles, all well known in the art. Examples of compounds are described in PCT applications 96/03048, 96/01055 and 95/95741. Biological control agents include, for example, nonPxNPV baculoviruses (natural or recombinant); Bacillus thuringiensis, Nosema polyvora, M. grandis, Bracon mellitor, entomopathogenic fungi and arthropods.

The present invention also provides a method for controlling insect pests. The method comprises contacting the insects with an insecticidally effective amount of a composition or composition of the present invention. The invention also provides a method for reducing insect infestation of crops comprising applying an insecticidally effective amount of a composition or composition of the present invention to a given area. The insecticidal compositions are applied using conventional techniques such as spraying or dusting crops. Usually, the compositions are administered in a dosage

587 / B between approximately 2.4 x 10 ⁸ and approximately 2.4 x 10 ¹² OB / hectare (OB are occlusion bodies).

Effective dosages depend, for example, on the target insect recombinant used

PxNPV and from the crop being treated. The dosage containing the insecticidally effective amount can be determined by those skilled in the art using conventional methods.

• · ··· · · · · ··· · ··· ················

DETAILED DESCRIPTION OF THE INVENTION

The following examples illustrate but do not limit the present invention.

Example 1

Construction of Egt deleted deleted recombinant PxNPV containing beta-galactosidase

The following experiments were carried out to prepare a recombinant PxNPV in which the viral ecdysteroid glucosyltransferase (egt) gene is deleted and replaced with an E. coli marker gene for beta-galactosidase (beta-gal).

A stock of natural PxNPV that has been passaged on insects was plaque purified using conventional procedures described by O'Reilly et al., Baculovirus Expression Vectors: A Laboratory Manual, Oxford University Press, New York, NY, 199) to prepare a clonal virus stock. for genetic modification. The integrity of this pool, designated PxNPV-3, was confirmed by comparing the nature of the restriction fragments to that of the original pool of PxNPV. Bioassays against a panel of insect species also confirmed that virulence corresponds to the uncloned parent virus.

Fig. 1 illustrates the procedure used to construct a transfer vector for disrupting the egt gene in PxNPV by inserting a beta-galactosidase gene. The close similarity of the nature of the restriction fragments of AcNPV and PxNPV shows the homology at the DNA level that allows the use of V8-based transfer vectors of the AcNPV strain described in U.S. Pat. U.S. Patent No. 5,768,516; A vector containing a beta-gal cartridge, designated pmd 216.1, was prepared as follows. The BamH1-to-XbaI fragment containing the beta-gal gene under the control of the Drosophila melanogaster hsp70 promoter was isolated from pAcDyl (Zuidema et al., J. Gen. Virol., 71, 2201 (1990)). This fragment was then subcloned into pBluescript ™ Sk +. (Stratagene, La Jolla, CA) between the BamHi and XbaI polylinker sites. Pst "G" fragment

587 / B ·············································

The AcNPV strain V8vEGTDEL, which contains the egt gene and the neighboring region (see U.S. Patent No. 5,662,897) was then subcloned into the pUC9 polylinker at the PstI site. The resulting plasmid was designated pmd 205.1.

The final transfer vector was prepared by performing a four-fragment ligation between (i) pBluescript ™ Sk + digested with BamHI and PstI, which was dephosphorylated with calf intestinal phosphatase; (ii) a 0.975 kb Bgl II- to Pvull pmd 205.1 fragment; (iii) a 3.86 kb SmaI-to-XbaI beta-gal fragment of pmd 216.1; and (iv) a 1.6 kb XbaI-to-PstI fragment of pmd 205.1. The resulting transfer vector, designated pmd 220.2, contained a marker hsp70-directed beta-gal gene cloned into the egt deletion site.

The beta-gal labeled with egt gene deleted PxNPV was prepared by homologous recombination between pmd 220.2 and PxNPV-3 DNA co-transfected into cultured Sf-9 cells. 1 µg pmd 220.2 DNA and 250 ng PxNPV-3 DNA were mixed with 252 µg Lipofectin (Gibco BRL, Gaithersburg, MD) in a final volume of 200 µΙ TNMFH (JRH Biosciences, Lenexa, KS). After incubation at ambient temperature for 15 minutes, the mixture was transferred to a final volume of 2.0 ml TNM-FH complete medium (TNMFH plus 10% fetal bovine serum and 1% plurinic F68 (Gibco BRL, Gaithersburg, MD)). The mixture was overlaid with 2.75 x 10 ⁵ Sf-9 cells, which were then cultured in wells of a standard 6-well tissue culture plate. The cells were changed medium every 24 hours and the developed virus was harvested after another 96 hours. Recombinant viruses were positive for occlusion bodies (occ +) and expressed the betagal gene. Recombinants (occ + / blue plaques) were identified by three rounds of plaque purification in the presence of 100 µg / ml 5-bromo-4-chloro-3-indolyl-beta-Dgalactopyranoside (X-gal). The resulting virus was designated T96-19.1.1.1.

Example 2

Construction of the Direct Ligation of the PxNPV Viral Vector with the deleted egt gene

587 / B ······························ ··· ·· · ···· ·· ·· ·· ·· ···

The following experiments were carried out to prepare a direct ligation vector derived from PxNPV (see International Patent Application US 94/06079). This vector contains a poly-linker sequence (designated "Bsu-Sse linker sequence") inserted into the PxNPV genome at the egt site.

Two oligonucleotides having the sequences were synthesized to prepare the Bsu-Sse linker:

5'-CCTCAGGGCAGCTTAAGGCAGCGGACCGGCAGCCTGCAGG-3 '(Oligo 32) and

5'-CCTGCAGGCTGCCGGTCCGCTGCCTTAAGCTGCCCTGAGG-3 '(Oligo 33).

After heat treatment, the two oligomers encode several restriction endonuclease sites, including Bsu 361 and Sse 83871 sites, which are useful in the construction of recombinant viruses. Each was diluted to a concentration of 30 pmol / μΙ in a buffer for heat treatment containing 10 mM Tris-HCl (pH 7.5), 100 mM NaCl and 1 mM EDTA. The mixture was heated to 95 ° C for 10 minutes and then slowly cooled to ambient temperature over several hours.

The heat-treated oligonucleotides were inserted into the pmd 205.1 transfer vector as follows. The Pmd 205.1 vector was digested by Spel, which spends it at a single site located just before the egt deletion (Fig. 2). The ends of the digested plasmid were complemented with Klenow DNA polymerase I fragment in the presence of all four nucleotides. 100 ng of the linearized plasmid was then ligated to 15 pmoles of the double-stranded linker sequence using T4 DNA ligase in a total volume of 10 μΙ. Upon completion of the ligation reaction, T4 ligase was heat inactivated and the mixture was treated with polynucleotide kinase. The 8.8 kb DNA band was purified by low-melting preparative 1% agarose gel electrophoresis (BioRad, Richmond, VA). A gel band containing 8.8 kb of linear DNA was thawed at 65 ° C and gel ligation using an approximately 1/10 goal band was used to recirculate DNA, which was then used to transform DH5alpha, E. coli cells.

587 / B ··························· · ···· ·· ·· ·· ·· ·

The resulting plasmids were screened by polymerase chain reaction (PCR) to determine the orientation of the Bsu-Sse linker relative to the egt gene. Oligo and 33 were separately paired with the EGT 1 oligomer (5'GCGGCCAATATATTGGCCGTGTTT-3 '), which is specific to the 5' region of the egt gene for the deletion. The orientation of the Bsu-Sse linker in LAB 50.2 is shown in FIG. Second

A direct ligation vector of PxNPV with the egt gene fused was prepared by homologous recombination between LAB 50.2 and T96-19.1.1.1 PxNPV viral DNA, which were simultaneously transfected into cultured Sf9 cells as described in Example 1 using 1 µg LAB 50.2 and 250 ng T96-19.1. 1.1 viral DNA. In this case, the recombinant viruses were positive for the occlusion bodies and did not express the beta-gal gene. Recombinant (occ + / white) viruses were identified by three rounds of plaque purification in the presence of 100 µg / ml X-gal. The virus obtained was designated T97-8.1.1.1 (ATCC Accession No. VR-2608).

Example 3

Construction of modular expression vectors useful for the production of recombinant PxNPV A. pMEV 1-4

The design, construction and use of the vectors pMEV1, pMEV2, pMEV3 and pMEV4 for the expression of foreign genes under the control of baculovirus promoters are described in International Patent Application US 94/06079. These vectors have the general structure shown in FIG. 3. Each vector was derived from a pBluescript SK + plasmid (Stratagene, La Jolla, CA) by substituting a region between the SstI and XhoI sites in the pBluescript poly-linker sequence with an expression cassette consisting of the following elements: (i) short synthetic linker DNA with restriction recognition sites the enzymes SstI, Sse 8387I and StuI; (ii) a promoter module consisting of a promoter and a complete 5 'untranslated region (UTR) of the selected AcMNPV viral gene; (iii) a poly-linker module that facilitates insertion of the protein-encoding region of interest; (iv) the 3 'UTR of the module that is

587 / B «· ···································· It consists of the complete 3'-untranslated region of the AcMNPV 6.9K gene (parent protein); and (v) short synthetic linker DNAs with recognition sites for the restriction enzymes StuI, Bsu36I, and XhoI.

As shown in FIG. 4, the promoter modules in vectors pMEV1 to pMEV4 are derived from genes that are expressed at various stages of the virus life cycle. The DA26 promoter module in pMEV1 and the 35K promoter module in pMEV4 are derived from genes that are expressed early in the virus life cycle; that is, before starting DNA synthesis. The 6.9K promoter module in pMEV2 is derived from the "late" structural gene that is expressed after DNA synthesis has begun, and the polyhedrin (polh) gene promoter module in pMEV3 is derived from the "very late" gene that encodes the major structural component viral occlusion bodies.

The polylinker module was designed to allow the location of the protein coding region in the immediate vicinity of the 5 'UTR promoter module without insertion of additional linker sequences. As shown in FIG. 5, the polylinker comprises a Esp3l site that is located such that digestion of the Esp3l vector cleaves it between positions -4 and -5 in the upper chain of the promoter module and in junction between the promoter and polylinker modules in the lower chain. Treatment of DNA digested with Esp31 DNA polymerase in the presence of four standard 2'-deoxynucleoside triphosphates (dNTPs) creates a linearized vector that is terminated by a sticky end at the exact 3 'end of the promoter module. This segment may be linked to a 5 'fragment terminated by sticky ends, the sequence of which starts with the ATG initiation codon of the desired region encoding the protein. To facilitate direct cloning of the protein-encoding fragment, the 3 'end of the fragment is prepared to contain a recognition site for one of the enzymes that cleaves the polylinker module (as illustrated by BamHI in Fig. 5) and both the protein-encoding fragment and the vector are digested by that enzyme. before ligation.

A key feature of these vectors is the presence of restriction enzyme recognition sites Sse8387l and Bsu361 at one end of the expression cassette. This allows the inserted sequences to be excised from the modular expression vector and theirs

587 / B ························· Ligation to the direct ligation PxNPV vectors of the present invention (see, for example, Example 2, supra).

B. pMEV5 and pMEV6

Two vectors, pMEV5 and pMEV6, were prepared to contain the D. melanogaster promoter of the hsp70 gene (the main heat shock protein). pMEV5 contains a 724 bp segment of the D. melanogaster hsp70 promoter / 5 'UTR (designated hsp70Bam in Fig. 4) ranging from position -493 to position +231 relative to the hsp70 gene transcription start site. pMEV6 contains the 475 bp segment of the same promoter / 5 'UTR (designated hsp70Xba in Fig. PD2), ranging from position -244 to position +231.

The promoter modules used to prepare pMEV5 and pMEV6 were synthesized by PCR amplification using the phcHSP70PL plasmid (Morris et al., J. Virol., 66, 7397 (1992)) as a template. The oligonucleotide primers for each reaction and the amplified product sequences are shown in FIG. 6 and 7 (for pMEV5 and pMEV6, respectively). Each of the primers has a two-part structure. The 5 'portion has no sequence homology to the phcHSP70PL template and is used to incorporate specific restriction sites into the ends of the final PCR product. These sites include the SstI, Sse8387I and StuI sites at the 5 'end of the PCR product and the Esp3 and XbaI sites at the 3' end of the PCR product (see Figures 6 and 7). The 3 'portion of each primer contains sequences homologous to the phcHSP70PL template and defines one boundary of the hps70-specific sequence in each module.

Prior to PCR reactions, the (-) chain primer (HSP70Esp) was phosphorylated at its 5 'end by incubating 200 pmoles of primer for 30 minutes at 37 ° C in 10 ml reaction mixture containing 70 mM Tris-HCl (pH 7.5), 10 mM MgCl 2, 5 mM DTT, 1 mM ATP and 10 units of T4 polynucleotide kinase (New England Biolabs, Beverly, MA). PCR reactions were then performed in separate Micro Amp tubes (Perkin Elmer, Norwalk, CT) using the following procedure. 50 pmoles of each primer were mixed with 0.25 - 1.0 ng phcHSP70PL DNA in a 50 μΙ reaction mixture containing 200 μΜ dNTP, 1X cloned Pfu polymerase buffer (Stratagene, La Jolla, CA) and 5 units of cloned Pfu DNA polymerase (Stratagene, La Jolla, CA). The samples were placed in a Perkin Elmer Model 9600 thermal cycler (Perkin Elmer,

587 / B ················································ · ·

Norwalk, CT) and processed in two cycles at 1 minute at 94 ° C (denaturation degree), 1.5 minutes at 50 ° C (heat treatment degree) and 3 minutes at 72 ° C (degree of expansion) followed by 28 cycles of 1 minute at 94 ° C, 1.5 minutes at 55 ° C and 3 minutes at 72 ° C. In the last cycle, the expansion reaction was carried out for an additional 7 minutes and the reaction mixture was cooled to 4 ° C. The amplification products were extracted once with phenol: chloroform: isoamyl alcohol (25: 24: 1) adjusted to 0.3 M sodium acetate and precipitated with ethanol.

After dissolution in a suitable reaction buffer, the DNA was digested with PstI (which cleaves it at the Sse8387l site) and fragments containing the putative hsp70 promoter modules were purified by low-melting 1.2% agarose gel with preparative grade (BioRad, Richmond, CA). . The base vector for the construction of pMEV5 and pMEV6 was prepared by digesting pMEV1 with EcoRI and ending with a Klenow fragment of DNA polymerase I in the presence of all four nucleotides. After secondary cleavage of the Sse8387l vector and dephosphorylation of the ends with calf intestinal alkaline phosphatase, a large (3.1 kb) fragment containing the pBluescript skeleton and 3 'UTR and polylinker modules was purified on a low melting agarose gel and ligated individually with purified hsp70 promoter modules. formation of pMEV5 and pMEV6.

C. pMEV5 / ADK-AalT and pMEV6 / ADK-AalT The pMEV5 and pMEV6 vectors described above were further processed to contain the gene encoding AalT, an insect-specific toxin present in the venom of the East African scorpion Andoctuonus australi (Hector) (Zlotkin and et al., Biochimie, 53, 1073 (1971)). When injected into the body cavity of the insect larvae, AalT binds selectively to voltage-sensitive sodium channels and causes transient contractile paralysis. Chronic administration of the toxin that can be achieved by infection of larvae with AalT-producing baculoviruses is associated with prolongation of paralysis and possibly death (Stewart et al., Nature, 352, 85 (1991); Maeda et al., Virol., 184, 777 (1991) McCutchen et al., Biotechnol., 9, 848 (1991)). U. U.S. Patent 5,547,871 discloses a codon-optimized ADK-Aa1T gene sequence in which the secretion of Aa1T toxin is driven by a signal peptide from the Manduca sexta adipokinetic hormone (ADK) gene. The insertion of the ADK-AalT coding region into pMEV1 vectors 31,587 / B pMEV4 (to obtain plasmids pMEV1 / ADK-AalT - pMEV4 / ADK-AalT) is described. in International Patent Application US 94/06079.

For the construction of pMEV5 and pMEV6 derivatives encoding ADK-AalT, a fragment containing the ADK-AalT gene sequence was synthesized by PCR using pMEV3 / ADK-AalT as a template. The primer (+) chain, designated PD30, started at the initiator ATG codon of the ADK signal peptide. The primer (-) strand, designated 69K3UT, was selected to induce DNA synthesis downstream of the polylinker module; that is, in the 3 'UTR of pMEV3 / ADK-AalT. The sequences of the primers and amplified DNA fragment are shown in FIG. 8th

Prior to amplification, the 5 'end of primer (+) chain was dephosphorylated as above for HSP70Esp. The PCR reaction was also performed as described above, except that amplification was performed at 25 cycles of 1 minute at 94 ° C, 1.5 minutes at 52 ° C and 3 minutes at 72 ° C. After synthesis, the DNA was digested with BamHI, which cleaved it in the polylinker module, and a 274 bp 5'-sticky / 3'-BamHI fragment containing the ADK-Aa1T coding region was inserted into pMEV5 and pMEV6. The structures of the resulting plasmids pMEV5 / ADK-AalT and pMEV6 / ADK-AalT were confirmed by restriction enzyme analysis and partial DNA sequence determination.

D. MEVS vectors comprising an ADK signal peptide module

The following experiments were carried out to prepare a series of modular expression vectors containing DNA encoding the ADK signal peptide (see above), which can be used to direct the secretion of any inserted sequence. A series of vectors (designated pMEV1 / ADK to pMEV6 / ADK) were prepared in which a 57 bp sequence of optimized codons for the ADK signal peptide (residues 1-57 in Fig. 8) were placed between the promoter and polylinker modules. The expression cassettes in these vectors have the general structure shown in FIG. 9th

To prepare a series of pMEVx / ADK vectors, a DNA fragment containing the promoter module and bound ADJ signal peptide was obtained from the respective pMEVx / ADK-Aa1T vectors by PCR. The primer for the (+) strand for each reaction was a promoter-specific oligonucleotide that induces DNA synthesis at the 5 'end of the promoter module and inserts the restriction sites for SstI, Sse8387l and StuI to 5'

587 / B end of the amplified fragment. The templates and primers for the (+) chain for each reaction are shown in the following table.

• * · ·····························

templat Primer sequence pMEVl / ADK- AaIT DA26FZ 5’- AGCAGCGAGCTCCTGCAGGCCTACGCGT AATTCGATATAGAC -3 * pMEV2 / ADK- AaIT 69KFZ 5'-AGCAGCGAGCTCCTGCAGGCCTATGCCG TGTCCAATTGCAAG -3 ’ pMEV3 / ADK- Aatto PHF 5’- AGCAGCGAGCTCCTGCAGGCCTGACGCA CAAACTAATATCAC -3 ' pMEV4 / ADK- AaIT 35KPRO1 5 * - AGCAGCGAGCTCCTGCAGGCCTCITGAT GTCTCCGATTTC -3 ' pMEV5 / ADK- AaIT hsp70Bam 5'- AGCAGCGAGCTCCTGCAGGCCTGATCCT TAAATTGTATCCTA -3 ’ pMEV6 / ADK- Aatto HSP70Xba 5'- AGCAGCGAGCTCCTGCAGGCCTAGAATC CCAAAACAAACTGG -3 '

The primer for the (-) chain for each reaction, designated ADKRev (5'CGGATCTAGACACGTCTCGGGCCTCAGCGATAATCACGAAGGC-3 ') induces synthesis from the 3' end of the ADK signal peptide and inserts the Esp3l and XbaI sites into the 3 'end of the amplified fragment. The PCR reaction was also performed as described above for pMEV5-6 except that amplification was performed at 25 cycles for 1 minute at 94 ° C, 1.5 minutes at 52 ° C and 3 minutes at 72 ° C. DNA synthesized from all templates except pMEV5 / ADK-AalT was digested with PstI, which cleaves it at the Sse8387l site upstream of the promoter and XbaI that cleaves it after the ADK signal peptide, and a fragment containing the promoter module and signal peptide was inserted between PstI (Sse8387 ) and Xba I sites in one of the existing pMEVx vectors, such as pMEV1.

Since the hspľOBam promoter module in vpMEV5 contains an internal XbaI site, the hsp70Bam / ADK module must be inserted into the pMEVx work frame in two parts. Therefore, one part of the DNA synthesized from the pMEV5 / ADK-Aa1T template was digested with PstI and XhoI and the other part was digested with XhoI and XbaI. PstI / XhoI

587 / B · fragment · representing the 5 'segment of the hsp70Bam / ADK module was combined with Xhol The XbaI fragment representing the 3 'segment of the hsp70Bam / ADK module and was ligated into the PstI / XbaI fragment of the vector prepared from pMEV1.

Each prepared pMEVx / ADK vector had an identical structure to the corresponding pMEVx vector except for the insertion of a 57 bp ADK signal peptide between the promoter and the polylinker module.

Example 4

Construction of modular expression vectors encoding insecticidal toxins

The following experiments were performed to prepare modular expression vectors encoding insecticidal toxins suitable for insertion into the recombinant PxNPVs of the present invention.

A. Txp-I

Psoriasis toxin toxin TxP-1 is a paralytic neurotoxin isolated from venom poison, Pyemotes tritici (Tomalski et al., Toxicon, 27, 151 (1989)). The Tox34 gene encodes a precursor protein of 291 amino acids (Tomalski et al., Nature, 352, 82 (1991)).

To test the efficacy of the tox34 gene in recombinant PxNPV, three different Txp-1 constructs were prepared that differed in the amino-terminal signal sequence driving secretion of toxin from cells. One construct contained a natural tox34 amino-terminal sequence; one contained an ADK signal peptide instead of the amino terminal 40 residues of tox34 preprotein; and one contained an ADK signal peptide instead of the amino terminal 26 residues of the tox34 preprotein.

Three different segments of the tox34 gene corresponding to codons 1-291 (designated tox34), 27-291 (designated tox34L) and 40-291 (tox34S) were synthesized by PCR and engineered for cloning into one or more of the modular expression vectors described above. The template for the amplification reactions was the plasmid pHSP70tox34 (Lu et al., Biological Control, 7, 320 (1996)). The chain primers (+) for each amplification are shown in the following table.

587 / B ·· ···· · · · · · ·

fragment primer sequence Tox34 TOX34ATG 5 ’- ATGAAAATTTGTACATmTTATTCC -3 ' tox34L TOX34NT1 5 * - gttaaaccititaggtcttttaataatatttcc -3 ' tox34S TOX34NT2 5 '- GATAATGGCAATGTCGAATCTGTA - 3'

The primer (-) of the chain designated TOX34CT2, 5'-GTACCCCCGGGATCCAATTT AACACAGTCTTGAATCACTT-3 'induces synthesis from the 3'-end of the tox34 coding region and inserts restriction sites for BamH1 and Xmal (SmaI) into the 3' end of the amplified fragment. Prior to amplification, the 5 'end of each primer (+) chain was phosphorylated using the procedure described above for primer HSP10Esp in Example 3. PCR reactions were performed as described in Example 3, except that the cycles consisted of 2 cycles of 1 minute at 94 ° C. ° C, 1.5 minutes at 45 ° C and 3 minutes at 72 ° C and then 28 cycles of 1 minute at 94 ° C, 1.5 minutes at 55 ° C and 3 minutes at 72 ° C.

After synthesis, the DNA was digested with XmaI, and the 5'-sticky / 3'-XmaI fragments of the tox34 coding region (designated tox34, tox34L and tox34S) were purified and cloned into MEV vectors as described in Example 3, except that the polylinker was digested with XmaI. (which cleaves it at the SmaI site) instead of BamHl.

The following table includes the components from which each MEVS vector expressing TxP-1 was prepared.

construct vector Txp-I encoding fragment pMEVl / Tox34 pMEVl Tox34 pMEV5 / Tox34 pMEV5 Tox34 pMEV6 / Tox34 pMEV Tox34 pMEVl / ADK-Tox34L pMEVl / ADK tox34L pMEVl / ADK-tox34S pMEVl / ADK tox34S pMEV2 / ADK-Tox34L pMEV2 / ADK tox34L pMEV2 / ADK-tox34S PMEV2 / ADK tox34S

587 / B · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · ·· ·

B. LqHIT2

In addition to excitatory toxins such as AalT, many Buthinae scorpion toxins contain a second type of insect-specific toxin that causes field, progressive atonic paralysis (Zlotkin et al., Biochemistry, 30, 4814 (1991)). The best studied member of this group is the toxin LqhlT2, which was isolated from the scorpion Leiurus quinquestriatus hebreaeus. The cloned cDNA for LghlT2 showed the presence of a 21 amino acid signal peptide and three C-terminal amino acids (GlyLys-Lys) that are removed from the peptide post-translationally (Zlotkin et al., Ar. Insect. Biochem. Physiol., 22, 55 (1993)). )).

To investigate the ability of the LqhlT2 toxin to improve the insecticidal activity of PxNPV, the DNA sequence encoding the mature LqhlT2 toxin was assembled and cloned into four different pMEVx / ADK expression vectors: pMEV1 / ADK, pMEV2 / ADK, pMEV5 / ADK, and pMEV6 / ADK. The sequence of the toxin coding region shown in FIG. 10 differs from the native cDNA sequence at 27 of the 61 codons; these changes were inserted so that codon usage in the synthetic coding region for LqhlT2 reflects the overall codon usage in the AcMNPV genome (Ayres et al., 1994).

Assembly of the DNA fragment containing the coding region for Lqh1T2 was performed in several steps. First, four nucleotides were synthesized, which together represent the two chains of the Lqh1T2 coding region and a small portion of the 3 'flanking linker DNA sequence (Figure 10). Prior to use, the 5 'ends of the LqhlT2F2 oligonucleotides (containing the 3' part (+) strand) and the LqhlT2R3 (containing the 3 'part (-) of the chain) were phosphorylated using the procedure described in Example 3. 40 μιτιόΙ of each oligonucleotide mM NaCl by briefly heating to 95 ° C and then slowly cooling the mixture to 60 ° C. The total volume of the mixture was adjusted to 40 μΙ and the two halves of the LqhlT2 coding region (LqhlT2F1: LqhlT2R3 and LqhlT2F2: LqhlT2R4) were ligated. Due to the presence of incomplete synthesis products in each oligonucleotide, the initial ligation resulted in a heterogeneous mixture of fragments of 200-1000 bp in length. The desired product was isolated from this PCR mixture, using a 0.5 μΙ ligation reaction mixture as the source of template and LqhlT2 PCRF oligonucleotides (phosphorylated at its 5 'end), and

587 / B ·····························

LqhlT2 PCRR primers (Fig. 10). Amplification was performed for 25 cycles of 1 minute at 94 ° C, 1.5 minutes at 55 ° C, and 3 minutes at 72 ° C as described in Example 3. After synthesis, the DNA was digested with BamHI, which cleaved a junction segment adjacent to the regulatory codon. , and the desired 190 bp 5'-sticky / 3'-BamHI fragment was purified by gel electrophoresis and cloned into the MEV vectors pMEV1 / ADK, pMEV2 / ADK, pMEV5 / ADK, and pMEV6 / ADK as shown in Example 3 and in FIG. . 5. The sequence of the Lqh1T2 coding region in each vector was confirmed by DNA sequencing.

B. Omega-ACTX-HV1

Omega-attractotoxins are a family of insecticidal peptide toxins isolated from Australian spiders. The best studied member of this family is omega-attractionotoxin-HV1 (omega-ACTX-HV1), a 37-residue peptide toxin isolated from the venom of the Hadronyche versuta spider (International Patent Application AU 93/00039). Omega-ACTX-HV1 inhibits voltage-dependent insect calcium channels and is lethal to Helicoverpa armigera larvae, but is harmless to newborn mice.

Based on the omega-ACTX-HV1 amino acid sequence, two oligonucleotides were designed that represent the two strands of the omega-ACTX-HV1 coding region and a small portion of the 3 'flanking linker DNA. Codon usage in the omegaACTX-HV1 coding region is designed to correspond to codon usage in the AcMNPV genome (Ayres et al., 1994). The sequences of these oligonucleotides are shown in FIG. 11. Due to the length of the ACTXHV1F and ACTXHV1R oligonucleotides, it is highly likely that each will be significantly contaminated with products of incomplete synthesis. Therefore, a PCR strategy similar to that used for LqhlT2 was also used to synthesize a fragment of the omega-ACTX-HV1 coding region suitable for cloning into MEVS vectors. In this case, 0.1 pmoles of each oligonucleotide were mixed, and the mixture was used as a template for PCR amplification of the omega-ACTX-HV1 product of the desired length. The primers for the reaction were ACTXPCRF (phosphorylated at its 5 'end) and ACTXPCRR. The PCR reaction was performed as above, except that amplification was performed for 15 minutes at 94 ° C, 1.5 minutes at 55 ° C and 3 minutes at 72 ° C. After amplification, the DNA was digested with BamHI, which cleaved the junction adjacent to the termination

587 / B · codon and desired 118 / B · · · · · · · · · · · · · · · · · · · · · · · The bp 5'-sticky / 3'-BamHI fragment was purified by goal electrophoresis and cloned into the MEV vectors pMEV1 / ADK, pMEV2 / ADK, pMEV5 / ADK, and pMEV6 / ADK. The sequence of the omega-ACTX-HV1 coding region in each vector was confirmed by DNA sequencing.

Example 5

Construction of recombinant PxNPV

The following experiments were performed to construct recombinant PxNPV encoding insecticidal toxins.

Viral DNA was prepared from occlusive bodies (O'Reilly et al., 1994). The purified DNA was digested with Bsu36l and Sse8387l using approximately 5 units of enzyme / gg DNA. Size exclusion chromatography or sucrose gradient purification was used to separate the viral genomic DNA from the excised fragment. The linearized viral DNA obtained was precipitated with ethanol and resuspended in 10 ml Tris-HCl pH 8.0 / 1 mM EDTA at a concentration of 0.2 - 1 μg / μl.

0.5 gg of linearized DNA was then ligated with 15 ng of purified Bsu361 / Sse8387l digested fragment from a suitable MEV vector in a reaction volume of 5 μΙ overnight at 15 ° C. The mixture was then used to transfect Sf-9 cells as described in Example 1. The culture medium was changed 24 hours after transfection. After another 72 hours, the culture supernatant was harvested, diluted and used for reinfection of Sf-9 cells for plaque isolation. Random plaques were scraped and used to infect the wells of a 48-well plate containing 6 x 10 ⁴ Sf-9 cells / well in 0.5 ml TNM-FH complete medium. Recombinants were identified using primers specific for the inserted gene. Plaque virus giving positive wells was purified by two additional rounds of plaque purification.

The following table provides information for the various recombinant PxNPVs that have been prepared.

587 / B • · · · · · · · · ·

·· · ········

virus Used M EV PxEGTDEL / 35K ADK-AalT PMEV4 / ADK-AaIT PxEGTDEL / hspľOBam ADK-Aa PMEV5 / ADK-AaIT PxEGTDEL / DA26 tox34 PMEV1 / Tox34 PxEGTDEL / hspľOBam tox34 PMEV5 / Tox34 PxEGTDEL / hsplOXba tox34 PMEV6 / Tox34 PxEGTDEL / DA26 ADK-tox34S PMEV1 / ADK-tox34S PxEGTDEL / DA26 ADK-tox34L PMEV1 / ADK-tox34L PxEGTDEL / 6.9K AD-tox34S PMEV2 / ADK-tox34S PxEGTDEL / 6.9K ADK-tox34L PMEV2 / ADK-tox34L Ac (V8) EGTDEL / DA26 ADK-AalT PMEV4 / ADK-AaIT PxEGTDEL / DA26 ADK-LqhlT1 PMEV1 / ADK-LqhIT2 PxEGTDEL / 6.9K ADK-LqhlT1 PMEV2 / ADK-LqhIT2 PxEGTDEL / hsplOBam ADK-LqhlT2 PMEV5 / ADK-LqhIT2 PxEGTDEL / hsplOXba ADK-LqhlT2 PMEV6 / ADK-LqhIT2 PxEGTDEL / DA 26 ADK-omega-ACTX-HV1 PMEV1 / ADK-Omega-ACTX-H V1 PxEGTDEL / 6.9K ADK-Omega-ACTX-HV1 PMEV2 / ADK-oemga-ACTX-HV1 PxEGTDEL / hspľOBam ADK-omega-ACTX- HV1 PMEV5 / ADK-omega-ACTX-HV1 PxEGTDEL / hspľOXba ADK-omega-ACTX- HV1 PMEV5 / ADK-omega-ACTX-HV1

587 / B ···························

Example 6

Efficacy of recombinant PxNPV expressing insecticidal proteins

The following experiments were performed to test the insecticidal activity of the recombinant PxNPVs of the present invention.

A standard virus loading test was performed on a second Plutella xylostella larvae instalation (2-3 days of age, 0.15 - 0.3 mg) to determine the dose necessary to achieve 50% mortality in the test insect population (ie LC50). Virus stocks were serially diluted in 0.01% sodium dodecyl sulphate and 50 μΙ aliquots of virus suspensions were used for surface contamination of 15 mm round areas containing linseed oil boosted Stoneville food (Southland Products Incorporated, Lake Village, AK). Individual larvae were placed in each area and fed contaminated food for the duration of the test. Dead larvae were counted twice a day during the first three days of the test and then at least once a day until the onset of the pupae on the sixth or seventh day. Data from repeated experiments were summarized and analyzed by probit analysis (Finney, 1952). The median time for lethality (LT ₅₀ ) was determined from probit time-to-death analysis at a single dose.

The results are shown in the following tables. For comparison, the concentrations of occlusion bodies (OB) are given as OB / 16 cm ^{2 of} food.

rPxNPV LC50 (OB / 16cm ² ) LT ₅₀ (days) horses. 4.5 x 10 ⁴ PxEGTDEL / 35K ADK-AalT 9.34 x 10 ² 2.69 wt PxNPV 5,97x10 ⁴ 4.39

587 / B ···································· · ·· ·· ·· ·

Probit values were determined from four copies with approximately 32 larvae / dose.

rPxNPV LC50 (OB / 16cm ² ) TL50 (days) horses. 4.5 x 10 ³ YT ₅ o (days) of horse. 4,5x10 ⁴ PxEGTDEL / 35K ADK-AalT 7 x 10 ² 3.7 3.0 PxEGTDEL / hsp70 ADK-AalT 6 x 10 ² 3.7 2.7 Ac (V8) EGTDEL / DA26 ADK- AaIT 6.3 x 10 ⁵ ND * 4.0

* ND - not determined

Probit values were determined from four copies with approximately 32 larvae / dose.

These results indicate that (i) the addition of the toxin gene to the PxNPV genome not only increases the virus killing rate, but also significantly reduces the effective LC50 for Plutella xylostella larvae; and (ii) the recombinant PxNPV has a significantly lower IC ₅₀ with a much higher killing rate as compared to closely related recombinant AcNPV. Since Plutella xylostella is a significant plant pest, this finding is essential in the choice of recombinant baculovirus for use as a biopesticide on the agricultural market.

The following tables show data from recombinant PxNPV assays expressing a second insect-selective toxin, tox34.

rPxNPV LT ₅₀ (days) horses. 4.5 x 10 ³ LT ₅₀ (days) horses. 4.5 x 10 ⁴ PxEGTDEL / DA6 tox34 4.5 3.4 PxEGTDEL / hsp70Bam tox34 2.6 1.9 PxEGTDEL / hsplOXba tox34 2.0 1.8 PxEGTDEL / DA26 ADK-tox34S 3.7 2.7

587 / B ··································· ·· ·· ·· ·· ···

PxEGTDEL / DA26 ADK-tox34L 3.1 2.4 PxEGTDEL / 6.9K ADK-tox34S 2.9 1.6 PxEGTDEL / 6.9K ADK'tox34L 3.2 1.8 PxEGTDEL / hspľOBam ADK-AalT 3.0 2.2

Probit values were determined from four copies with approximately 32 larvae / dose.

rPxNPV Average LC50 (OB / 16cm ² ) LT ₅₀ (days) horses. 4.5 x 10 ³ PxEGTDEL / hsp70 Xba tox34 0,8x10 ² 2.4 PxEGTDEL / hsp70Bam ADK-AalT 2,9x10 ² 3.3 wt PxNPV 165 x10 ² 4.6 with horse. 4.5 x 10 ⁴

Data suggest that the increased efficacy of recombinant PxNPV is not limited to AalT expressing constructs. PxNPVs expressing tox34 have as low LT ₅₀ and LC ₅₀ as recombinants expressing AalT. In some cases (ie, PxEGTDEL / hsp1OXba tox34), the expression of tox34 by recombinant PxNPV results in significantly lower IC ₅₀ than the AalT expressing recombinants.

All patents, patent applications, articles, publications, and test methods disclosed herein are hereby incorporated by reference in their entirety.

Many variations of the present invention will be apparent to those skilled in the art upon reading the above description. Such clear variations are within the scope of the present invention.

Claims (57)

PATENT CLAIMS An isolated recombinant Plutella xylostella baculovirus (PxNPV) having a genetic alteration with respect to natural PxNPV, wherein said alteration is selected from the group consisting of (a) insertion or deletion of a restriction site; (b) modifying, deleting or duplicating the gene encoded by the virus; (c) insertion of a gene encoding a heterologous protein; and (d) any combination of the above-mentioned aiterations. The recombinant baculovirus according to claim 1, having an insect nucleic acid sequence encoding an insect affecting substance operably linked to a promoter capable of activating transcription in an insect cell, inserted into its genome. The recombinant baculovirus according to claim 2, wherein said insect-influencing substance is an insecticidal toxin. The recombinant baculovirus according to claim 3, wherein said toxin is selected from the group consisting of Aa1T, AaHIT1, AaHIT2, Lqh1T2, Lqq1T1, Lqq1T2, Bj1T1, Bj1T2, LqhP35, LqhalfalT, SmplT2, SmpT2, SmpT3, SmpCT3, SmpT3, SmpT3, SmpCT3. DK12, μagatoxin, King Kong toxin, Pt6, NPS-326, NPS-331, NPS-373, Tx4 (6-1), TxP-1, omega-atratoxins, alpha-conotoxins, μ-conotoxins, chlorotoxin and omega-conotoxins . The recombinant baculovirus according to claim 4, wherein said toxin is selected from the group consisting of Aa1T, TxP-1, Lqh1T2 and omega-attractionotoxin. The recombinant baculovirus according to claim 4, further comprising a sequence encoding a heterologous signal peptide, wherein said sequence encoding the signal peptide is fused in a working frame to a sequence encoding said toxin. The recombinant baculovirus of claim 6, wherein said signal peptide is selected from the group consisting of the pBMHPC-12 signal sequence from Bombyx mori; the adipokinetic hormone signal sequence of Mandura sexta; an apolipophorin signal sequence from Manduca sexta; a chorionic signal sequence from Bombyx mori; 31 587 / B ······················································ ·· Cuticle signal sequence from Drosophila melanogaster; the Drosophila melanogaster esterase-6 signal sequence; and a sex-specific signal sequence from Bombyx sea. The recombinant baculovirus according to claim 2, wherein said promoter is the hsp70 promoter. The recombinant baculovirus of claim 8, wherein said promoter is selected from the group consisting of hsp70Bam and hsp70 Xba. The recombinant baculovirus of claim 3, wherein said promoter is selected from the group consisting of DA26, 35K, 6.9K, polyhedrin, hsp70, and actin promoters. The recombinant baculovirus according to claim 3, wherein said genome has been further modified to inactivate the viral egt gene. The recombinant baculovirus of claim 3, further comprising a nucleic acid sequence encoding a juvenile hormone esterase (JHE) operably linked to a promoter capable of activating transcription in an insect cell. The recombinant baculovirus according to claim 5, wherein said promoter is the hsp70 promoter. A recombinant Plutella xylostella baculovirus having an inserted sequence encoding TsP-1 operably linked to the Drosophilla hsp70 promoter into its genome. 15. A recombinant Plutella xylostella baculovirus having an inserted AalT coding sequence operably linked to the Drosophila hsp70 promoter into its genome. 31 587 / B ···························· The recombinant baculovirus according to claim 1, wherein said genetic alteration forms a cloning site absent from native PxNPV. 17. The recombinant baculovirus of claim 16 having an insertion into said cloning site of a nucleic acid sequence encoding an insect-influencing substance operably linked to a promoter capable of activating transcription in an insect cell. The recombinant baculovirus according to claim 17, wherein said insect-influencing substance is an insecticidal toxin. The recombinant baculovirus according to claim 18, wherein said toxin is selected from the group consisting of Aa1T, AaHIT1, AaHIT2, Lqh1T2, Lqq1TI, Lqq1T2, Bj1T1, Bj1T2, LqhP35, LqhalfalT, SmplT2, SmpT2, SmpT3, SmpCT3, SmpT3, SmpCT3. DK12, μagatoxin, King Kong toxin, Pt6, NPS-326, NPS-331, NPS-373, Tx4 (6-1), TxP-1, omega-atratoxins, alpha-conotoxins, μ-conotoxins, chlorotoxin and omega-conotoxins . The recombinant baculovirus of claim 19, wherein said promoter is selected from the group consisting of DA26, 35K, 6.9K, polyhedrin, hsp70, and actin promoters. The recombinant baculovirus according to claim 20, wherein said genome has been further modified to inactivate the viral egt gene. The recombinant baculovirus according to claim 21, further comprising a nucleic acid sequence encoding a juvenile hormone esterase (JHE) operably linked to a promoter capable of activating transcription in an insect cell. A recombinant Plutella xylostella baculovirus selected from the group consisting of ATCC VR-2607, ATCC VR-2608 and ATCC VR-2609. 31 587 / B • t ······························ ·· ·· A direct ligation vector comprising genomic DNA isolated from the recombinant baculovirus of claim 1. The direct ligation vector of claim 24, wherein said DNA further comprises DNA encoding an insect-affecting substance operably linked to a promoter capable of activating transcription in an insect cell. The direct ligation vector of claim 25, wherein said insect-influencing substance comprises an insecticidal toxin selected from the group consisting of Aa1T, AaHIT1, AaHIT2, Lqh1T2, Lqq1T1, Lqq1T2, Bj1T2, LqhP35, LqhalfalT, Sm3T2, Smp2, Sm3T2, .2, DK11, DK12, μ-agatoxin, King Kong toxin, Pt6, NPS-326, NPS-331, NPS-373, Tx4 (6-1), TxP-1, omega-atratoxins, alpha-conotoxins, μ- conotoxins, chlorotoxin and omega-conotoxins. The direct ligation vector of claim 26, further comprising a sequence encoding a heterologous signal peptide, wherein said sequence encoding a signal peptide is fused to a working frame with a sequence encoding said toxin. The direct ligation vector of claim 27, wherein said signal peptide is selected from the group consisting of the pBMHPC-12 signal sequence from Bombyx mori; the adipokinetic hormone signal sequence of Mandura sexta; an apolipophorin signal sequence from Manduca sexta; a chorionic signal sequence from Bombyx mori; a cuticle signal sequence from Drosophila melanogaster; the Drosophila melanogaster esterase-6 signal sequence; and a sex-specific signal sequence from Bombyx sea. The direct ligation vector of claim 25, wherein said genome has been further modified to inactivate the viral egt gene. The direct ligation vector of claim 25, further comprising a nucleic acid sequence encoding a juvenile hormone esterase (JHE) operably linked to a promoter capable of activating transcription in an insect cell. 31 587 / B ·························· · · · · ·· ···· ·· ·· ·· ·· · A direct ligation vector comprising genomic DNA isolated from the recombinant baculovirus according to claim 16. A direct ligation vector comprising genomic DNA isolated from the recombinant baculovirus according to claim 19. A direct ligation vector comprising genomic DNA isolated from the recombinant baculovirus of claim 23. 34. An insecticidal composition comprising a recombinant Plutella xylostella baculovirus (PxNPV) having a genetic alteration to a native PxNPV and an agriculturally acceptable carrier, wherein said alteration is selected from the group consisting of (a) insertion or deletion of a restriction site; (b) modifying, deleting or duplicating the gene encoded by the virus; (c) insertion of a gene encoding a heterologous protein; and (d) any combination of the above alterations. 35. The insecticidal composition of claim 34, wherein said recombinant baculovirus has inserted into its genome a nucleic acid sequence encoding an insect affecting substance operably linked to a promoter capable of activating transcription in an insect cell. 36. An insecticidal composition according to claim 35, wherein said insect-influencing substance is an insecticidal toxin selected from the group consisting of Aa1T, AaHIT1, AaHIT2, Lqh1T2, Lqq1T2, Bj1T1, Bj1T2, Sm1P2, Sm2Tp1, Sm2Tp1, Sm2Tp1, Sm2Tp1, Sm2Tp1, Sm2Tp1, , SmpMT, DK9.2, DK11, DK12, μ-agatoxin, King Kong toxin, Pt6, NPS-326, NPS-331, NPS-373, Tx4 (6-1), TxP-1, omegaatratoxins, alpha-conotoxins, μ-conotoxins, chlorotoxin and omega-conotoxins. 37. The insecticidal composition of claim 36, wherein said recombinant baculovirus further comprises a sequence encoding a heterologous signal peptide, wherein said sequence encoding a signal peptide is fused in frame with a sequence encoding said toxin. 31 587 / B ················· Λ 4 · ······· · ········· · · · · · · · · · · 38. The insecticidal composition of claim 37, wherein the signal peptide is selected from the group consisting of the pBMHPC-12 signal sequence from Bombby mori; the adipokinetic hormone signal sequence of Mandura sexta; an apolipophorin signal sequence from Manduca sexta; a chorionic signal sequence from Bombyx mori; a cuticle signal sequence from Drosophila melanogaster; Drosophila melanogaster esterase-6 signal sequence; and a sex-specific signal sequence from Bombyx sea. I 39. The insecticidal composition of claim 36, wherein said genome has been further modified to inactivate the viral egt gene. 40. The insecticidal composition of claim 36, wherein said genetic alteration forms a cloning site absent from native PxNPV. 41. An insecticidal composition according to claim 40, wherein said baculovirus has inserted into said cloning site a nucleic acid sequence encoding an insect affecting substance operably linked to a promoter capable of activating transcription in an insect cell. 42. The insecticidal composition of claim 41, wherein said insect-influencing substance is an insecticidal toxin. 43. The insecticidal composition of claim 42, wherein said * toxin is selected from the group consisting of Aa1T, AaHIT1, AaHIT2, Lqh1T2, Lqq1TI, and. LqqlT2, BjlT1, BjlT2, LqhP35, LqhalfalT, SmplT2, SmpCT2, SmpCT3, SmpMT, DK9.2, DK11, DK12, μ-agatoxin, King Kong toxin, Pt6, NPS-326, NPS-331, NPS373, Tx4 (6-1), TxP-1, omega-atratoxins, alpha-conotoxins, μ-conotoxins , chlorotoxin and omega-conotoxins. 44. An insecticidal composition comprising the recombinant Plutella xylostella baculovirus of claim 2 and an agriculturally acceptable carrier. 31 587 / B ·························· • · «· · · · · · · · · · · 45. An insecticidal composition comprising a recombinant Plutella xylostella baculovirus according to claim 4 and an agriculturally acceptable carrier. 46. An insecticidal composition comprising the recombinant Plutella xylostella baculovirus of claim 7 and an agriculturally acceptable carrier. 47. An insecticidal composition comprising a recombinant Plutella xylostella baculovirus according to claim 14 and an agriculturally acceptable carrier. 48. An insecticidal composition comprising the recombinant Plutella xylostella baculovirus of claim 15 and an agriculturally acceptable carrier. 49. An insecticidal composition comprising the recombinant Plutella xylostella baculovirus of claim 20 and an agriculturally acceptable carrier. 50. An insecticidal composition comprising the recombinant Plutella xylostella baculovirus of claim 23 and an agriculturally acceptable carrier. 51. A method of killing insects comprising contacting said pests with an insecticidally effective amount of an insecticidal composition of claim 44. 52. A method of killing insects comprising contacting said pests with an insecticidally effective amount of an insecticidal composition of claim 45. 31,587 / B · · • a ···· • aa aaa and a • • a and and aa • • • • · • and and and and and • • · • • • · and and and • 4 ·· and · • a aa and aaa 53. A method of controlling insects comprising contacting said pests with an insecticidally effective amount of an insecticidal composition of claim 46. 54. A method of controlling insects comprising contacting said pests with an insecticidally effective amount of an insecticidal composition of claim 47. 55. A method of controlling insects comprising contacting said pests with an insecticidally effective amount of an insecticidal composition of claim 48. 56. A method of controlling insects comprising contacting said pests with an insecticidally effective amount of an insecticidal composition of claim 49. 57. A method of killing insects comprising contacting said pests with an insecticidally effective amount of an insecticidal composition of claim 50.