RU2792231C1 - mRNA-BASED VECTOR FOR INCREASED TARGET PROTEIN PRODUCTION IN MAMMALIAN CELLS (VARIANTS) - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: invention relates to the field of biotechnology, immunology and microbiology, in particular to mRNA-based vectors containing certain 5'- and 3'-non-translated regions for increased production of the target protein, as well as to a method for using the said vectors for the synthesis of the target protein in cells mammals.

EFFECT: invention provides for the creation of an mRNA-based vector that is stable and provides increased levels of target protein production, such as a vaccine antigen, antibody, therapeutic protein or enzyme.

8 cl, 7 dwg, 2 tbl, 9 ex

Description

Technical field

The invention relates to biotechnology and genetic engineering. The proposed vector can be used to develop vaccines against infectious diseases and antitumor vaccines, drugs for tumor immunotherapy. An mRNA-based vector can be used to create therapeutic drugs whose active ingredient is antibodies synthesized in vivo. There is also an option to use the invention for the synthesis of other therapeutic proteins in vivo.

State of the art

As is known, in 1961 S. Brenner and co-authors discovered matrix ribonucleic acid (mRNA), which is a key intermediate molecule necessary for gene expression in the form of proteins. In 1990, J.Wolff et al. showed for the first time that the target protein can be efficiently synthesized in vivo by intramuscular injection of pure RNA into mice [He Q, Gao H, Tan D, Zhang H, Wang JZ. mRNA cancer vaccines: Advances, trends and challenges. Acta Pharm Sin B. 2022 Jul;12(7):2969-2989. doi: 10.1016/j.apsb.2022.03.011. Epub 2022 Mar 23. PMID: 35345451; PMCID: PMC8942458.]. These developments stimulated the development of mRNA-based technology platforms, which are currently being actively used in various fields of medicine for the development of preventive and therapeutic agents.

The mRNA-based technology has a number of advantages that distinguish it from other technology platforms. Ribonucleic acid-based agents can be developed and tested in a short time. The technology allows proteins to be synthesized directly in the body, eliminating the need for protein purification and long-term stabilization. The natural properties of RNA make it possible to avoid anti-vector immunity, thus allowing for repeated administration of the drug. mRNA-based vaccines are capable of inducing both cellular and humoral immune responses. The ability to obtain mRNA in cell-free systems allows for a scalable and cost-effective production.

Currently, mRNA-based technology is being used to develop various drugs. In 2020, in response to the SARS-CoV-2 pandemic, two mRNA-based vaccines were developed: BNT162b2 from Pfizer/BioNTech (USA/Germany) and mRNA-1273 from Moderna (USA). Both vaccines showed high efficiency and were approved for use in many countries around the world. In addition, vaccines against influenza, AIDS, rabies, Zika fever, cytomegalovirus infection, metapneumovirus infection and other infectious diseases are at various stages of clinical research. mRNA-based technology is also being used to create anticancer drugs (against acute myeloid leukemia, colorectal cancer, melanoma, glioblastoma, malignant mesothelioma for the treatment of liver and brain metastases, etc.), which are currently undergoing clinical trials. Studies are underway on mRNA-based therapeutics for the treatment of genetic diseases (cystic fibrosis, propionic acidemia, methylmalonic acidemia, phenylketonuria, hemophilia), autoimmune diseases, metabolic disorders (type 2 diabetes), cardiovascular diseases (hypercholesterolemia, myocardial ischemia), fibrosis (hypertrophic scarring, liver fibrosis, pulmonary fibrosis, primary sclerosing cholangitis, anemia), etc. [Xu S, Yang K, Li R, Zhang L. mRNA Vaccine Era-Mechanisms, Drug Platform and Clinical Prospection. Int J Mol Sci. 2020 Sep 9;21(18):6582. doi: 10.3390/ijms21186582. PMID: 32916818; PMCID: PMC7554980; Qin S, Tang X, Chen Y, Chen K, Fan N, Xiao W, Zheng Q, Li G, Teng Y, Wu M, Song X. mRNA-based therapeutics: powerful and versatile tools to combat diseases. Signal Transduct Target Ther. 2022 May 21;7(1):166. doi: 10.1038/s41392-022-01007-w. PMID: 35597779; PMCID: PMC9123296].

Thus, mRNA is one of the most promising and sought-after technological platforms. However, its enormous potential may be limited due to low stability and insufficiently efficient production of the target protein.

Over several decades, various attempts have been made to obtain a stable mRNA-based vector that provides high efficiency in the production of the target protein.

Patent CN105849269B describes an RNA vector for efficient synthesis of a target protein containing a translational enhancer, a transcribed sequence, and a stabilizing element, which acts as a nuclear retention signal for mRNA. In this case, the mRNA retention signal in the nucleus is preferably an "expression and nuclear retention element" (expression and nuclear retention element, ENE) of the herpes virus associated with Kaposi's sarcoma. The transcribed sequence is selected from a list containing a ribonucleic acid encoding CD40L, CD70, caTLR4, or a ribonucleic acid specific for an antigen/disease. The use of the vector for therapeutic purposes is described.

Patent RU2650795C2 describes a nucleic acid containing: 1) a region encoding at least one peptide or protein; at least one histone mRNA hairpin and a poly(A) sequence or polyadenylation signal; or 2) a region encoding at least one peptide or protein; a poly(A) sequence; and at least one hairpin from a histone mRNA. Wherein, said peptide or protein contains a tumor-specific antigen or a fragment thereof.

EP3424524A2 describes a synthetic nucleic acid encoding at least one antigenic peptide or protein and at least one additional sequence targeting the antigenic peptides or proteins to cellular compartments of interest. In addition, the invention includes pharmaceutical compositions or vaccines, as well as kits containing these nucleic acid molecules. This invention can be used in the treatment of various diseases: tumor, infectious, autoimmune, transplant rejection.

An isolated polynucleotide sequence is known from US8785611B2 containing at least two mRNA translation enhancer elements (TEEs), in which at least one TEE consists of a full-length sequence selected from the group consisting of 5'-CGCGGCTGA-3', 5'- AGCCGCCGCA-3' and 5'-ACGCCGCCGA-3'. In addition, a vector for the production of a recombinant polypeptide in a eukaryotic cell is known, containing a eukaryotic promoter operably linked to a polynucleotide sequence containing at least one translation enhancer element, which is selected from the group consisting of 5'-CGCGGCTGA-3', 5'-AGCCGCCGCA -3' and 5'-ACGCCGCCGA-3'.

JP6759196B2 describes a nucleic acid having improved stability. This effect is achieved by fragmenting the 3' poly(A)-containing cassette (poly(dA:dT) region) with a random sequence of 10 nucleotides. Moreover, neither the sequence nor the position of the linker in the 3' poly(A) sequence led to a decrease in translation efficiency and stability of in vitro transcribed RNA.

US10335486B2 describes a method for treating cancer in a subject by inducing or enhancing an antitumor immune response, wherein the subject is first administered mRNA encoding an IL-23 polypeptide and an IL-12p40 polypeptide operably linked (with or without a linker) to an IL-23p19 polypeptide , the mRNA encoding the IL-18 polypeptide is introduced in the second step, and the mRNA encoding the OX40L polypeptide is introduced in the third step.

The invention JP6704850B2 is known, which describes a synthetic nucleic acid molecule containing an open reading frame, a 3'-untranslated region element (3'-UTR), which is a 3'-UTR sequence of a ribosomal protein gene and, optionally, a poly(A)-sequence and/or a polyadenylation signal. The invention further relates to a vector containing this synthetic nucleic acid, as well as to a cell containing this vector or this synthetic nucleic acid. The invention can be used for gene therapy and/or vaccination.

From patent CA2621444C a technical solution is known in which the nucleic acid molecule contains in the 5'→3' direction:
promoter; a transcribed nucleic acid sequence, one or two 3'-UTR sequences of the globin gene.

An mRNA-based vector is known that contains a 5'-untranslated region (5'-UTR) of human alpha-globin mRNA with an optimized Kozak sequence and a 3'-UTR containing two sequences derived from the mRNA of the AES gene and mitochondrially-encoded ribosomal 12S RNA (https://web.archive.org/web/20210105162941/https://mednet-communities.net/inn/db/media/docs/11889.doc). This solution, as the closest to the claimed one, was chosen as a prototype.

Based on the prototype, a vaccine against COVID-19 BNT-162b2, Pfizer/BioNTech, was obtained, which showed high efficiency against various variants of SARS-CoV-2 (from 65.5% to 95%) [Andrews N et al. Covid-19 Vaccine Effectiveness against the Omicron (B.1.1.529) Variant. N Engl J Med. 2022 Apr 21;386(16):1532-1546. doi: 10.1056/NEJMoa2119451. Epub 2022 Mar 2. PMID: 35249272; PMCID: PMC8908811]. However, there is an opinion that the mRNA-based vector was designed in a non-optimal way, which could negatively affect the production of the target protein [Xia X. Detailed Dissection and Critical Evaluation of the Pfizer/BioNTech and Moderna mRNA Vaccines. Vaccines (Basel). 2021 Jul 3;9(7):734. doi: 10.3390/vaccines9070734. PMID: 34358150; PMCID: PMC8310186].

Thus, there is currently an urgent need to develop an mRNA-based vector that would overcome the existing technical problems associated with insufficient efficiency in the production of the target protein.

Disclosure of invention

The purpose of this development is to create a vector based on matrix ribonucleic acid, which ensures high efficiency in the production of the target protein.

The technical result is to create a vector based on mRNA, which is stable and provides increased levels of production of the target protein.

The specified technical result is achieved by creating a vector based on mRNA for increased production of the target protein, containing a 5'-non-translated region selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4 , a region encoding the target protein, and a 3'-nontranslated region selected from SEQ ID NO:5.

Also, the technical result is achieved by the fact that an mRNA-based vector has been created for increased production of the target protein, containing a 5'-untranslated region selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, the region encoding the target protein , and a 3'-untranslated region selected from SEQ ID NO:6.

At the same time, in the developed variants of the mRNA-based vector, the region encoding the target protein can be a sequence encoding the vaccine antigen. Also, the target protein coding region may be an antibody coding sequence. In addition, there is a variant of the invention, in which the region encoding the target protein is a sequence encoding a therapeutic protein. Also, the target protein coding region may be an enzyme-coding sequence.

This technical result is also achieved by the fact that a method has been developed for using mRNA-based vector variants for target protein synthesis in mammalian cells. In addition, a method is provided for using an mRNA-based vector for in vivo synthesis of a target protein.

Implementation of the invention

Brief description of the drawings.

On FIG. Figure 1 shows the results of evaluating luciferase activity in HeLa cells after adding variants of the developed mRNA-based vector or prototype to them by lipofection.

On the y-axis - luminescence intensity, rel. units,

On the abscissa axis - the names of the experimental groups:

1) mRNA-cas-luc-glo

2) mRNA-hsp-luc-glo

3) mRNA-tpl-luc-glo

4) mRNA-his-luc-glo

5) mRNA-cas-luc-cyt

6) mRNA-hsp-luc-cyt

7) mRNA-tpl-luc-cyt

8) Control mRNA (containing the sequence encoding luciferase)

9) Negative control (buffer solution).

On FIG. Figure 2 shows the results of evaluating luciferase activity in mice 3 hours after intravenous administration of the developed mRNA-based vector (mRNA-cas-luc-glo) packaged in lipid particles.

On the left is the control animal, which was injected with a buffer solution.

On the right is an animal that was intravenously injected with the mRNA-cas-luc-glo vector packaged in lipid particles.

от 0,1*10⁹ отн. ед. до 0,3*10⁹ отн. ед.;A - luminescence intensity

from 0.1*10 ⁹ rel. units up to 0.3*10 ⁹ rel. units;

от 0,4*10⁹ отн. ед. до 0,7*10⁹ отн. ед.;B - luminescence intensity

from 0.4*10 ⁹ rel. units up to 0.7*10 ⁹ rel. units;

от 0,8*10⁹ отн. ед. до 0,9*10⁹ отн. ед.;C - luminescence intensity

from 0.8*10 ⁹ rel. units up to 0.9*10 ⁹ rel. units;

The scale shows the luminescence intensity (relative luminescence units).

On FIG. Figure 3 shows the results of the assessment of luciferase activity in mice 3 hours after intramuscular injection of the developed mRNA-based vector (mRNA-cas-luc-glo) packaged in lipid particles.

On the left is the control animal, which was injected with a buffer solution.

On the right is an animal that was intramuscularly injected with the mRNA-cas-luc-glo vector packaged in lipid particles.

от 0,1*10⁸ отн. ед. до 0,2*10⁸ отн. ед.;A - luminescence intensity

from 0.1*10 ⁸ rel. units up to 0.2*10 ⁸ rel. units;

от 0,3*10⁸ отн. ед. до 0,6*10⁸ отн. ед.;B - luminescence intensity

from 0.3*10 ⁸ rel. units up to 0.6*10 ⁸ rel. units;

от 0,7*10⁸ отн. ед. до 0,9*10⁸ отн. ед.;C - luminescence intensity

from 0.7*10 ⁸ rel. units up to 0.9*10 ⁸ rel. units;

The scale shows the luminescence intensity (relative luminescence units).

On FIG. Figure 4 shows the results of assessing the effectiveness of immunization with the developed mRNA-based vector in assessing the proportion of proliferating CD4+ lymphocytes in response to antigen stimulation (S protein of the SARS-CoV-2 virus).

The y-axis is the number of proliferating cells, %.

Abscissa - experimental groups.

1) mRNA-cas-S-glo, 3 µg/mouse

2) mRNA-hsp-S-glo, 3 µg/mouse

3) mRNA-tpl-S-glo, 3 µg/mouse

4) mRNA-his-S-glo, 3 µg/mouse

5) mRNA-cas-S-cyt, 3 µg/mouse

6) mRNA-hsp-S-cyt, 3 µg/mouse

7) mRNA-tpl-S-cyt, 3 µg/mouse

8) Control mRNA (containing the S sequence of the SARS-CoV-2 protein)

9) Buffer solution

On FIG. Figure 5 shows the results of evaluating the effectiveness of immunization with the developed mRNA-based vector in assessing the proportion of proliferating CD8+ lymphocytes in response to antigen stimulation (S protein of the SARS-CoV-2 virus).

The y-axis is the number of proliferating cells, %.

Abscissa - experimental groups.

1) mRNA-cas-S-glo, 3 µg/mouse

2) mRNA-hsp-S-glo, 3 µg/mouse

3) mRNA-tpl-S-glo, 3 µg/mouse

4) mRNA-his-S-glo, 3 µg/mouse

5) mRNA-cas-S-cyt, 3 µg/mouse

6) mRNA-hsp-S-cyt, 3 µg/mouse

7) mRNA-tpl-S-cyt, 3 µg/mouse

8) Control mRNA (containing the S sequence of the SARS-CoV-2 protein)

9) Buffer solution

On FIG. 6 shows the results of evaluating the production of a single-domain antibody against SARS-CoV-2 RBD in mice after the introduction of the developed mRNA-based vector.

The y-axis is the amount of antibodies, µg/ml

Abscissa - experimental groups.

1) mRNA-cas-C5-glo, 10 µg/mouse

2) mRNA-hsp-C5-glo, 10 µg/mouse

3) mRNA-tpl-C5-glo, 10 µg/mouse

On FIG. 7 shows the results of evaluating the production of a single-domain antibody against SARS-CoV-2 RBD in mice after the introduction of the developed mRNA-based vector.

The y-axis is the amount of antibodies, µg/ml

Abscissa - experimental groups.

4) mRNA-his-C5-glo, 10 µg/mouse

5) mRNA-cas-C5-cyt, 10 µg/mouse

6) mRNA-hsp-C5-cyt, 10 µg/mouse

7) mRNA-tpl-C5-cyt. 10 µg/mouse

List of sequences explaining the essence of the invention

SEQ ID NO: 1 ribonuleic acid sequence representing the 5'-UTR of human caspase 8 mRNA;

SEQ ID NO: 2 ribonuleic acid sequence representing the 5'-UTR of HSP70 heat shock protein mRNA;

SEQ ID NO:3 ribonuleic acid sequence representing the 5'-UTR of late adenoviral RNA (TPL);

SEQ ID NO: 4 ribonuleic acid sequence representing the 5'-UTR based on human histone h1.2 mRNA;

SEQ ID NO: 5 ribonuleic acid sequence representing the 3'-UTR of hemoglobin alpha subunit mRNA;

SEQ ID NO:6 ribonuleic acid sequence, which is the mRNA of the alpha chain of cytochrome b-245.

Messenger RNA (mRNA, messenger RNA) is an intermediate link in the flow of genetic information from gene to protein. Each naturally occurring mRNA has its own individual half-life. Various degradation rates of natural mRNAs are one of the tools for regulating gene expression. Unstable mRNAs provide transient gene expression at different time points, while long-lived mRNAs can be associated with continuous gene expression or the accumulation of individual proteins.

For synthetic mRNAs that are used for medical purposes, the stability and efficiency of translation are of paramount importance, since these characteristics significantly affect the pharmacokinetic and pharmacodynamic properties of drugs. Synthetic mRNA must maintain its structural integrity and remain functional during the production, storage and use of drugs. In addition, it should provide high efficiency of target protein production in vivo.

When constructing synthetic mRNAs, natural mechanisms of gene regulation are used. Naturally occurring eukaryotic mRNA molecules have been found to contain characteristic regulatory elements. For example, sequencing yeast mRNA alone revealed about 560 stabilizing and 851 destabilizing elements [Geisberg JV, Moqtaderi Z, Fan X, Ozsolak F, Struhl K. Global analysis of mRNA isoform half-lives reveals stabilizing and destabilizing elements in yeast. cell. 2014 Feb 13;156(4):812-24. doi: 10.1016/j.cell.2013.12.026. PMID: 24529382; PMCID: PMC3939777.].

To obtain an mRNA-based vector for increased production of the target protein, a synthetic mRNA construct was developed. By increasing the production of the target protein, the authors mean its production in amounts exceeding those that the analog can provide. Synthetic mRNA is constructed on the principle of natural mRNA and contains the following main elements:

1) 5'-cap. In the vast majority of eukaryotes, the 5' end of transcripts synthesized by RNA polymerase II is modified during transcription by the addition of 7-methylguanosine, which is called the 5' cap. This structure ensures efficient translation of mRNA, directs splicing of pre-mRNA and export of mRNA from the nucleus, limits mRNA degradation by cellular 5'→3' exonucleases, and allows recognition of foreign RNA. The minimal capping structure is m7GpppNp (7-methylguanosine connected by a 5',5'-triphosphate bridge to the first RNA nucleotide), which is also called cap 0. This structure is characteristic of plant and fungal mRNAs. For animal mRNA, cap 1 is more characteristic (it differs from cap 0 by methylation of the first nucleotide of the transcript at the 2'-O-position of ribose) and cap 2 (it differs from cap 0 by methylation of the first and second nucleotides of the transcript at the 2'-O-position of ribose).

An alternative to the 5'-cap for attracting the translational apparatus can be cap-independent viral sequences, such as, for example, the 5'-untranslated region of the tobacco mosaic virus (omega sequence) or internal ribosome entry sites (IRES).

In this invention, the authors used cap 1.

2) 5'-untranslated region (5'-UTR, synonyms: 5'-untranslated region, 5'-UTR). It is known that NTRs play an important role in the posttranscriptional regulation of gene expression, including modulation of mRNA transport from the nucleus, translation efficiency, subcellular localization, and mRNA stability.

Post-transcriptional regulation of gene expression is associated, among other things, with the first stage of translation initiation, the formation of the 48S pre-initiation complex (48S PIC) on mRNA. In the vast majority of eukaryotic mRNAs, this stage is associated with the mechanism of cap-dependent scanning. It is believed that it consists of three stages:

- attachment to the capped 5'-end of the mRNA of the 43S pre-initiation complex, consisting of a small subunit of the ribosome, initiator Met-tRNA and translation initiation factors eIF1, eIF1A, eIF2, eIF3 and eIF5;

- mRNA scanning in the 5'→3' direction in search of a start codon with the participation of factors of the eIF4 group;

- recognition of the start codon, stop scanning and dissociation of factors.

The start codon is often the AUG triplet closest to the 5' end. In the process of recognition of the start codon, its environment plays an important role. The first AUG can be skipped if it is surrounded by an unfavorable sequence - a process called "skip scanning". The Kozak consensus sequence, which plays an important role in translation initiation in eukaryotes, includes 3–6 nucleotides preceding the start codon and one–two nucleotides immediately after the start codon. In mammals, the optimal start codon context is considered to be GCCRCCAUGG.

The secondary structure of the 5'-UTR can also affect the efficiency of initiation. There is an opinion that a necessary condition for efficient translation is the absence of stable secondary structure elements inside the 5'-UTR. However, it was shown that the factor eIF4F together with the factor eIF4B provides efficient scanning of leaders with a secondary structure of moderate stability.

An important factor determining the efficiency of translation is also the length of the 5'-UTR. It was found that the extension of the 5'-UTR does not lead to a decrease in translation efficiency, however, an excessively short 5'-UTR (<20 nt) can provoke a skip scan. Therefore, mRNAs with short 5'-UTRs tend to show below average translation efficiency.

In 2008, a regulatory element was discovered - Translation Initiator on short 5'-UTR, which is present in a significant number of genes with basic cellular functions and a very short 5'-UTR. This regulatory element provides stable effective cap-dependent initiation when intracellular levels of eIF1 and eIF4A are subject to fluctuations.

In this invention, in order to increase the production efficiency of the target protein, the authors used 5'-UTRs taken from human caspase 8 mRNA (SEQ ID NO:1), or heat shock protein (HSP70) mRNA (SEQ ID NO:2), or late adenoviral RNAs. (TPL) (SEQ ID NO:3), or mRNA derived from human histone h1.2 mRNA (SEQ ID NO:4).

3) The sequence encoding the target protein. The mRNA-based vector of the present invention may contain any open reading frame (ORF). In this capacity, a sequence encoding an antigen of a human pathogen can be used. For example, the sequence encoding the S protein of the SARS-CoV-2 virus. Also, as the sequence encoding the target protein, the sequence encoding the antibody can be used. For example, a sequence encoding a single domain antibody against the RBD S protein of the SARS-CoV-2 virus. In addition, as a sequence encoding a target protein, a sequence encoding a therapeutic protein can be used. For example, a sequence encoding a single domain antibody against botulinum neurotoxin. Also, as a sequence encoding a target protein, an enzyme encoding sequence can be used. For example, the sequence encoding luciferase.

4) 3'-untranslated region (3'-UTR, 3'-untranslated region, 3'-UTR). It is known that 3'-UTRs play a crucial role in the post-transcriptional regulation of gene expression. In mammalian mRNA, this region often contains many regulatory cis-acting elements that are specifically recognized by RNA-binding proteins or miRNAs. Their interaction is critical for post-transcriptional regulation of gene expression.

The most common regulatory sequences in 3'-UTR mRNAs are AU-rich regulatory elements (AREs). These elements are 50 to 150 nucleotides in length and typically contain multiple copies of the AUUUA sequence. They have been shown to affect mRNA stability, alternative pre-mRNA processing, and translation efficiency. Cellular factors that bind to these elements are called ARE-binding proteins (ARE-BPs). Most of the known ARE-BPs (eg, TTP, BRF1, KSRP) stimulate deadenylation and thereby contribute to mRNA destabilization and degradation. However, some ARE-BPs, such as HuR, ELAV, can conversely stabilize mRNA. The final effect on mRNA strongly depends on ARE-BPs and their competition within the same transcript, as well as on the state of the cell, which can lead either to mRNA stabilization and translation enhancement, or, conversely, to mRNA destabilization and translation repression.

About 5% of human mRNAs contain GU-rich regulatory elements (GREs) in their 3'-UTRs. They resemble ARE in the nature of the base sequence motif, however, the minimum functional length of the element is 11 nucleotides (UGUUUGUUUGU). There is some functional similarity between GRE and ARE. These elements contribute to the regulation of post-transcriptional events such as deadenylation, mRNA decay, and pre-mRNA splicing.

Other regulatory elements found in the 3'-UTR are CU-rich elements (CURE). One of the widely characterized factors interacting with CURE is the polypyrimidine tract-binding protein (PTB). PTB can bind to distant sites in the same RNA molecule and thus can modulate its secondary structure. For example, in the case of viral IRES elements, PTB is involved in stabilizing the correct orientation of loops of RNA domains critical for attracting translational factors and ribosomes, and in the case of some cellular pre-mRNAs, it provides interaction with factors necessary for alternative splicing.

CA-rich elements (CAREs) have a stabilizing effect on mRNA. The main partner interacting with CARE is the hnRNP L protein, which changes the susceptibility of mRNA to degradation by endo- or exo-nucleases. In the 3'-UTR of individual mRNAs, there may be specific regulatory elements characteristic of them, for example, elements that are sensitive to the concentration of iron ions; an element necessary for the insertion of selenocysteine, etc.

In addition, the 3'-UTR contains sequences that are complementary to miRNAs. These are special regulatory RNA molecules, interaction with which suppresses mRNA translation. The mature miRNA is part of an active RNA-induced gene shutdown complex (RISC). Proteins of the Argonaute family play a central role in the functioning of RISC. Some of them can cut the target transcript directly, while others recruit additional proteins to effect translational repression.

The secondary structure of the 3'-UTR is also of great importance for translation. Modulation of the secondary structure of the 3'-UTR by proteins or other means can change its specificity for binding to various trans factors, thereby regulating gene expression at the post-transcriptional level.

The result of the collective effect of all factors associated with the 3'-UTR of the same mRNA depends on many factors, such as their affinity for binding sites, representation and localization in the cell, which may vary depending on the physiological state.

In this invention, in order to increase the production efficiency of the target protein, the authors used a 3'-UTR taken from hemoglobin alpha subunit mRNA (SEQ ID NO:5) or cytochrome b-245 alpha chain mRNA (SEQ ID NO:6).

5) Poly(A)-tail (poly(A)-tail). It is a regulatory sequence consisting mainly of adenosine nucleotides. The length of this sequence affects the half-life of the mRNA molecule and can be regulated by a number of enzymes. The poly(A) tail is essential for mRNA transport from the nucleus, its translation and stability.

The poly(A) tail is often complexed with a poly(A)-binding protein (PABP), whose molecules perform several functions at once. PABP contains four RNA-binding domains, and its complex with the poly(A) tail not only protects mRNA from degradation, but also acts as an enhancer of translation initiation and termination. PABP can interact with the 5' end of mRNA through translation initiation factors such as eIF4G and eIF4E, which in turn regulates its stability and translation efficiency. However, PABP can also bind to adenylation complexes or be involved in the miRNA-mediated translation inhibition process. The conflicting function of PABP indicates that different lengths of the poly(A) sequence may have different effects on the efficiency of mRNA translation.

In this invention, the authors used a poly(A)-tail consisting of 30 adenosine residues, a 10-nucleotide linker sequence and another 70 adenosine residues.

Example 1. Obtaining mRNA molecules.

At the first stage of the work, it was necessary to develop an mRNA design. Synthetic mRNA contains the following elements:

1) Co-transcriptionally embedded cap analog (cap analog). In this invention, the authors used cap 1.

2) 5'-untranslated region (5'-UTR, 5'-untranslated region, 5'-UTR). This region has been shown to be of key importance for the regulation of gene expression at the post-transcriptional level. In the course of the work, several variants of the mRNA-based vector were obtained, in which one of the following elements was used:

- 5'-UTR from human caspase 8 mRNA (SEQ ID NO:1);

- 5'-UTR from HSP70 heat shock protein mRNA (SEQ ID NO:2);

- 5'-UTR from late adenovirus RNA (TPL) (SEQ ID NO:3);

- 5'-UTR based on human histone h1.2 mRNA (SEQ ID NO:4).

3) The region encoding the target protein. The developed mRNA-based vector can be used to develop means for the prevention of diseases caused by infectious agents, as well as therapeutic agents. Infectious agents may include pathogens that are triggers for the development of tumor diseases. In a particular case, the region encoding the target protein may be a sequence encoding a vaccine antigen, antibody, therapeutic protein or enzyme. For example, the authors obtained mRNA-based vectors containing:

- sequence encoding the S-protein of the SARS-CoV-2 virus (vaccine antigen),

- a sequence encoding a single-domain antibody against the RBD S-protein of the SARS-CoV-2 virus (antibody),

- a sequence encoding a single-domain antibody against botulinum neurotoxin (for the treatment of botulism),

- sequence encoding luciferase (enzyme).

4) 3'-untranslated region (3'-UTR, 3'-untranslated region, 3'-UTR). This element plays an important role in mRNA stabilization and translation regulation. One of the following elements was used to generate mRNA-based vector variants for increased target protein production:

- 3'-UTR from hemoglobin alpha subunit mRNA (SEQ ID NO:5);

- 3'-UTR from cytochrome b-245 alpha chain mRNA (SEQ ID NO:6).

5) Poly(A)-tail (poly(A)-tail). The authors used a poly(A) tail consisting of 30 adenosine residues, a 10-nucleotide linker sequence, and another 70 adenosine residues.

Thus, the design of 28 vectors was carried out:

1. An mRNA-based vector for increased production of the target protein mRNA-cas-S-glo, containing the 5'-untranslated region of SEQ ID NO: 1, the region encoding the S protein of SARS-CoV-2 and the 3'-untranslated region of SEQ ID NO :5.

2. An mRNA-based vector for increased production of the target protein mRNA-hsp-S-glo, containing the 5'-untranslated region of SEQ ID NO:2, the region encoding the S protein of SARS-CoV-2 and the 3'-untranslated region of SEQ ID NO :5.

3. An mRNA-based vector for increased production of the target protein mRNA-tpl-S-glo, containing the 5'-untranslated region of SEQ ID NO:3, the region encoding the S protein of SARS-CoV-2 and the 3'-untranslated region of SEQ ID NO :5.

4. An mRNA-based vector for increased production of the target protein mRNA-his-S-glo, containing the 5'-untranslated region of SEQ ID NO:4, the region encoding the S protein of SARS-CoV-2 and the 3'-untranslated region of SEQ ID NO :5.

5. An mRNA-based vector for increased production of the target mRNA-cas-S-cyt protein, containing the 5' untranslated region of SEQ ID NO:1, the region encoding the S protein of SARS-CoV-2, and the 3' untranslated region of SEQ ID NO : 6.

6. An mRNA-based vector for increased production of the target protein mRNA-hsp-S-cyt, containing the 5'-untranslated region of SEQ ID NO:2, the region encoding the S protein of SARS-CoV-2 and the 3'-untranslated region of SEQ ID NO : 6.

7. An mRNA-based vector for increased production of the target mRNA-tpl-S-cyt protein, containing the 5' untranslated region of SEQ ID NO:3, the region encoding the S protein of SARS-CoV-2, and the 3' untranslated region of SEQ ID NO :6.

8. An mRNA-based vector for increased production of the target protein mRNA-cas-C5-glo, containing the 5'-untranslated region of SEQ ID NO:1, the region encoding the C5 single-domain antibody against SARS-CoV-2 RBD, and the 3'-untranslated region SEQ ID NO:5.

9. An mRNA-based vector for increased production of the target mRNA-hsp-C5-glo protein, containing the 5'-untranslated region of SEQ ID NO:2, the region encoding the C5 single-domain antibody against SARS-CoV-2 RBD, and the 3'-untranslated region SEQ ID NO:5.

10. An mRNA-based vector for increased production of the target mRNA-tpl-C5-glo protein, containing the 5'-untranslated region of SEQ ID NO:3, the region encoding the C5 single-domain antibody against SARS-CoV-2 RBD, and the 3'-untranslated region SEQ ID NO:5.

11. An mRNA-based vector for increased production of the target mRNA-his-C5-glo protein, containing the 5'-untranslated region of SEQ ID NO:4, the region encoding the C5 single-domain antibody against SARS-CoV-2 RBD, and the 3'-untranslated region SEQ ID NO:5.

12. An mRNA-based vector for increased production of the target mRNA-cas-C5-cyt protein, containing the 5'-untranslated region of SEQ ID NO:1, the region encoding the C5 single-domain antibody against SARS-CoV-2 RBD, and the 3'-untranslated region SEQ ID NO: 1.

13. An mRNA-based vector for increased production of the target mRNA-hsp-C5-cyt protein, containing the 5'-untranslated region of SEQ ID NO:2, the region encoding the C5 single-domain antibody against SARS-CoV-2 RBD, and the 3'-untranslated region SEQ ID NO: 6.

14. An mRNA-based vector for increased production of the target mRNA-tpl-C5-cyt protein, containing the 5'-untranslated region of SEQ ID NO:3, the region encoding the C5 single-domain antibody against SARS-CoV-2 RBD, and the 3'-untranslated region SEQ ID NO:6.

15. An mRNA-based vector for increased production of the target protein mRNA-cas-B11-glo, containing the 5'-untranslated region of SEQ ID NO: 1, the region encoding single-domain antibody B11 against botulinum neurotoxin and the 3'-untranslated region of SEQ ID NO: 5.

16. An mRNA-based vector for increased production of the target protein mRNA-hsp-B11-glo, containing the 5'-untranslated region of SEQ ID NO: 2, the region encoding single-domain antibody B11 against botulinum neurotoxin and the 3'-untranslated region of SEQ ID NO: 5.

17. An mRNA-based vector for increased production of the target protein mRNA-tpl-B11-glo, containing the 5'-untranslated region of SEQ ID NO:3, the region encoding single-domain antibody B11 against botulinum neurotoxin and the 3'-untranslated region of SEQ ID NO: 5.

18. An mRNA-based vector for increased production of the target protein mRNA-his-B11-glo, containing the 5'-untranslated region of SEQ ID NO:4, the region encoding single-domain antibody B11 against botulinum neurotoxin and the 3'-untranslated region of SEQ ID NO: 5.

19. An mRNA-based vector for increased production of the target mRNA-cas-B11-cyt protein, containing the 5'-untranslated region of SEQ ID NO: 1, the region encoding single-domain antibody B11 against botulinum neurotoxin and the 3'-untranslated region of SEQ ID NO: 6.

20. An mRNA-based vector for increased production of the target protein mRNA-hsp-B11-cyt, containing the 5'-untranslated region of SEQ ID NO:2, the region encoding single-domain antibody B11 against botulinum neurotoxin and the 3'-untranslated region of SEQ ID NO: 6.

21. An mRNA-based vector for increased production of the target mRNA-tpl-B11-cyt protein, containing the 5'-untranslated region of SEQ ID NO:3, the region encoding single-domain antibody B11 against botulinum neurotoxin, and the 3'-untranslated region of SEQ ID NO: 6.

22. An mRNA-based vector for increased production of the target mRNA-cas-luc-glo protein, containing the 5' untranslated region of SEQ ID NO:1, the luciferase-coding region, and the 3' untranslated region of SEQ ID NO:5.

23. An mRNA-based vector for increased production of the target mRNA-hsp-luc-glo protein, containing the 5' untranslated region of SEQ ID NO:2, the luciferase-coding region, and the 3' untranslated region of SEQ ID NO:5.

24. An mRNA-based vector for increased production of the target mRNA-tpl-luc-glo protein, containing the 5' untranslated region of SEQ ID NO:3, the luciferase-coding region, and the 3' untranslated region of SEQ ID NO:5.

25. An mRNA-based vector for increased production of the target mRNA-his-luc-glo protein, containing the 5' untranslated region of SEQ ID NO:4, the luciferase-coding region, and the 3' untranslated region of SEQ ID NO:5.

26. An mRNA-based vector for increased production of the target mRNA-cas-luc-cyt protein, containing the 5' untranslated region of SEQ ID NO:1, the luciferase-coding region, and the 3' untranslated region of SEQ ID NO:6.

27. An mRNA-based vector for increased production of the target mRNA-hsp-luc-cyt protein, containing the 5' untranslated region of SEQ ID NO:2, the luciferase-coding region, and the 3' untranslated region of SEQ ID NO:6.

28. An mRNA-based vector for increased production of the target mRNA-tpl-luccyt protein, containing the 5' untranslated region of SEQ ID NO:3, the luciferase-coding region, and the 3' untranslated region of SEQ ID NO:6.

Based on the mRNA design, a template DNA sequence was developed, which was then obtained using genetic engineering methods. Next, the resulting template DNA, which was a plasmid, was linearized using BsmBI-v2 restriction enzyme (New England Biolabs) at 55°C for 3 hours. After that, template DNA was purified from the reaction mixture by precipitation with a mixture of phenol, chloroform, and isoamyl alcohol (25:24:1) saturated with 20 mM Tris-HCl pH 7.9 (PC).

Next, the transcription reaction was carried out in vitro. To do this, the following was added to the test tube: DNA template, buffer for T7 transcription, DTT, a mixture of pHTP, T7 RNA polymerase, an RNase inhibitor, and sterile water. Next, incubation was carried out for 1.5 hours at a temperature of 37°C. To remove the DNA template, DNase was added to the reaction mixture (at the rate of 1 u per 1 µg of the DNA template) and incubated for 10 minutes at 37°C. Purification of mRNA from the reaction mixture was carried out by HPLC. Capping was carried out co-transcriptionally.

Thus, as a result of the work carried out, 28 mRNA-based vector variants were obtained for increased production of the target protein. In addition, 4 control mRNA molecules were obtained in a similar way, designed by analogy with the prototype and containing sequences encoding target proteins (luciferase, or the S-protein of the SARS-CoV-2 virus, or a single-domain antibody against the RBD S-protein of the SARS-CoV virus -2, or single-domain antibody against botulinum neurotoxin).

Example 2 Packaging of mRNA molecules into lipid particles.

The mRNA preparations obtained in Example 1 were encapsulated in lipid nanoparticles (LNPs) using a microfluidic mixing process of an mRNA solution (pH 3.0) with a solution of lipids dissolved in alcohol. To do this, lipids were dissolved in 96% ethanol at molar ratios of 46.3:9:42.7:1.6 (ionizable lipid (ALC-0315): distearoylphosphatidylcholine: cholesterol: pegylated lipid (PEG lipid)). The lipid solution was combined with 10 mM citrate buffer (pH 3.0) containing mRNA (0.2 mg/ml) in a 3:1 v/v ratio (aqueous solution:ethanol) using microfluidic mixing with a Nanoassmblr Benchtop (Precision NanoSystems). The ratio of ionizable nitrogen atoms in the ionizable lipid to the number of phosphate groups in the mRNA (N:P ratio) is 6 for each composition. The preparations were dialyzed against PBS (phosphate buffered saline), pH 7.2, in Slide-A-Lyzer dialysis cassettes (Thermo Fisher Scientific) for at least 24 hours. The resulting formulations were then sterilized through a 0.22 μm filter and stored at 4° C. (PBS) until use. Particle size and zeta potential were measured by dynamic light scattering using a Zetasizer Nano ZS instrument (Malvern Panalytical). The mRNA encapsulation was about 90% (measured using the RiboGreen - Quant-iT™ RiboGreen™ RNA Reagent assay, Thermo Fisher Scientific).

As a result of this work, 32 preparations of lipid particles containing mRNA were obtained (28 experimental samples and 4 control samples). The resulting lipid particles were used to deliver mRNA to mammalian cells.

Example 3. Evaluation of the stability of lipid particles containing the developed vector based on mRNA.

The purpose of this experiment was to assess the stability of the resulting lipid particles containing the developed vector based on mRNA when stored in a refrigerator in the temperature range from +4°C to +8°C.

For the experiment, two aliquots were selected from each of the 28 experimental samples of the obtained lipid particles containing the developed mRNA-based vector. One aliquot was used to assess the level of production of the target protein, which was determined in vitro on HeLa cells. Another aliquot was placed in a refrigerator, which maintains the temperature in the range from +4°C to +8°C. After 3 months, these aliquots were also used to assess the level of production of the target protein in vitro on HeLa cells under similar conditions.

The results of the experiment showed that the storage of aliquots of lipid particles containing the developed mRNA-based vector for 3 months in the temperature range of +4°C to +8°C did not lead to a significant decrease in the level of production of the target protein.

Example 4. Comparative evaluation of the efficiency of target protein production in mammalian cells after adding variants of the developed vector based on mRNA and a control preparation.

HeLa human cervical carcinoma cells were grown in DMEM culture medium (Gibco), 10% FBS (Sigma-Aldrich) supplemented with 2 mM L-glutamine (Gibco) and a mixture of antibiotics (penicillin/streptomycin) 1% (Gibco) in an incubator under conditions 37°C, 5% CO ₂ .

The next day, the cell culture at ~70% confluence was transfected with mRNA-based variants of the developed vector. 24 hours before transfection, cells were seeded into a 96-well plate at a rate of 3*10 ⁴ cells/well. On the day of the experiment, the medium in the plate was changed to OptiMEM lipofection medium (Gibco). Next, 30 ng mRNA (one of the options listed below) in 20 µl Opti-MEM (Gibco) per well was mixed with a solution of 0.06 µl GenJectorTM-U (Molecta) in 3 µl Opti-MEM (per well), incubated for 15 min, then 0.4 μl of 100 mM D-luciferin (Promega) was added per well, and then 23 μl of the resulting mixture was added to the cells. The following mRNA variants were used in the experiment:

1) mRNA-cas-luc-glo

2) mRNA-hsp-luc-glo

3) mRNA-tpl-luc-glo

4) mRNA-his-luc-glo

5) mRNA-cas-luc-cyt

6) mRNA-hsp-luc-cyt

7) mRNA-tpl-luc-cyt

8) Control mRNA (with luciferase sequence)

9) Negative control (buffer solution).

Real-time luminescence measurements were taken overnight in a CLARIOstar plate reader (BMG Labtech) equipped with an atmosphere control unit to maintain 5% CO2 at 37°C (signal integration time - 5 s). All experiments were repeated at least three times (including with different cell passages) and then the average values were calculated.

This example describes how to use the developed vector for the synthesis of the target protein in mammalian cells. Protein synthesis occurs inside mammalian cells, under conditions that ensure cell viability (for example, temperature 37°C and 5% CO2) and is realized due to the design features of the mRNA-based vector. The vector delivers the protein-coding RNA sequence to mammalian cells and ensures its successful translation.

The results of the experiment are presented in Fig. 1. As can be seen from the results obtained, the level of luciferase expression in cells to which variants of the developed vector were added was significantly higher than in control cells to which the prototype was added.

Thus, as a result of the work carried out, an mRNA-based vector was developed that provides increased production of the target protein.

Example 5. Evaluation of the ability of the developed vector based on mRNA encoding the luciferase enzyme to provide the synthesis of the target protein in vivo.

In this experiment, mice of the BALB/c line weighing about 18 g were used. The animals were divided into several experimental groups, which were injected with:

1) mRNA-cas-luc-glo packaged in lipid particles (example 2), intravenously 3.3 µg/100 µl;

2) Phosphate buffer, intravenously, 100 µl;

3) mRNA-cas-luc-glo packaged in lipid particles (example 2), intramuscularly, 3.3 μg/100 μl;

4) Phosphate buffer, intramuscularly, 100 µl.

3 hours after the administration of the experimental agents, mice were intraperitoneally injected with 100 μl of a solution of D-luciferin in PBS (25 mg/ml). Five minutes after injection, animals were anesthetized with 1-2% isoflurane and placed on an IVIS Lumina III imaging system (Perkin Elmer). Mice photographs were processed with Living Image software (Perkin Elmer).

This example describes a method for using the developed vector for the synthesis of a target protein in mammalian cells, characterized in that the synthesis of the target protein occurs in vivo. Protein synthesis occurs inside mammalian cells and is provided due to the design features of the mRNA-based vector. The vector delivers the protein-coding RNA sequence to mammalian cells and ensures its successful translation in vivo (under conditions of a living organism).

Doses of mRNA-based vector from 2 μg/dose to 5 μg/dose have been investigated in this work, however, it will be apparent to the artisan of ordinary skill that doses may differ depending on the particular mammalian species. The lower end of the dose range is determined by the level at which it is possible to detect the expression of the target protein, and the upper end of the range will be determined by economic feasibility and the concentration at which toxicity is achieved.

The results of the experiment are presented in Fig. 2 (groups 1,2) and FIG. 3 (groups 3,4). As can be seen from the obtained data, after intravenous administration of the mRNA-based vector, the maximum levels of luciferase expression are visualized in the upper part of the animal's abdominal cavity, presumably in the liver region. Whereas after intramuscular injection of the mRNA-based vector, the maximum levels of luciferase expression are visualized mainly in the area of the injection site and, to a lesser extent, in the upper part of the animal's abdominal cavity.

Thus, the results of the experiment show that the developed mRNA-based vector ensures efficient production of the luciferase enzyme in vivo. In addition, it can be concluded that the pharmacokinetics of the agent containing the developed mRNA-based vector may differ depending on the route of administration.

Example 6. Evaluation of the ability of various variants of the developed vector based on mRNA encoding the S-protein of the SARS-CoV-2 virus to induce a humoral immune response against the SARS-CoV-2 virus in animals.

BALB/c mice weighing 18-20 g were used in the experiment. Animals were randomly divided into groups of 5 mice, which were injected twice intramuscularly with different variants of the vector, which were pre-packaged in lipid particles (example 2):

1) mRNA-cas-S-glo, 2 µg/mouse

2) mRNA-hsp-S-glo, 2 µg/mouse

3) mRNA-tpl-S-glo, 2 µg/mouse

4) mRNA-his-S-glo, 2 µg/mouse

5) mRNA-cas-S-cyt, 2 µg/mouse

6) mRNA-hsp-S-cyt, 2 µg/mouse

7) mRNA-tpl-S-cyt, 2 µg/mouse

8) Control mRNA (with the S sequence of the SARS-CoV-2 protein), 2 µg/mouse

9) mRNA-cas-S-glo, 5 µg/mouse

10) mRNA-hsp-S-glo, 5 µg/mouse

11) mRNA-tpl-S-glo, 5 µg/mouse

12) mRNA-his-S-glo, 5 µg/mouse

13) mRNA-cas-S-cyt, 5 µg/mouse

14) mRNA-hsp-S-cyt, 5 µg/mouse

15) mRNA-tpl-S-cyt, 5 µg/mouse

16) Control mRNA (with SARS-CoV-2 S protein sequence), 2 µg/mouse

17) Negative control (buffer solution).

Three weeks later, the animals were bled from the tail vein and the blood serum was isolated. The antibody titer was determined by enzyme immunoassay (ELISA) according to the following protocol:

1) The antigen - the S-protein of the SARS-CoV-2 virus - was adsorbed on the wells of a 96-well ELISA plate for 16 hours at a temperature of +4°C.

2) Next, to get rid of non-specific binding, 5% milk dissolved in a buffer to block a non-specific signal was added to the plate in a volume of 100 μl per well. Incubated on a shaker at 37°C for an hour.

3) Serum samples from immunized mice were first diluted 100-fold and then a series of two-fold dilutions was made. A total of 12 dilutions of each sample were prepared.

4) Add 50 µl of each diluted serum sample to the wells of the plate.

5) Further incubation was carried out for 1 hour at 37°C.

6) After incubation, the wells were washed three times with phosphate buffer.

7) Secondary antibodies against mouse IgG conjugated with horseradish peroxidase were then added.

8) Further incubation was carried out for 1 hour at 37°C.

9) After incubation, the wells were washed three times with phosphate buffer.

10) Then a solution of tetramethylbenzidine (TMB) was added, which is a substrate for horseradish peroxidase and, as a result of the reaction, turns into a colored compound.

11) The reaction was stopped after 15 minutes by adding sulfuric acid. Next, using a spectrophotometer measured the optical density of the solution (OD) in each well at a wavelength of 450 nm.

12) The antibody titer was determined as the last dilution in which the optical density of the solution was significantly higher than in the negative control group. The results obtained (geometric mean) are presented in Table 1.

Table 1 - The geometric mean of the IgG titer of antibodies to SARS-CoV-2 S protein in the blood serum of mice immunized with various variants of the developed mRNA-based vector. Experimental group Antibody titer 1 mRNA-cas-S-glo, 2 µg/mouse 1838 2 mRNA-hsp-S-glo, 2 µg/mouse 2425 3 mRNA-tpl-S-glo, 2 µg/mouse 2111 4 mRNA-his-S-glo, 2 µg/mouse 1838 5 mRNA-cas-S-cyt, 2 µg/mouse 2425 6 mRNA-hsp-S-cyt, 2 µg/mouse 2111 7 mRNA-tpl-S-cyt, 2 µg/mouse 1838 8 Control mRNA (with SARS-CoV-2 S-protein coding sequence), 2 µg/mouse 1393 9 mRNA-cas-S-glo, 5 µg/mouse 25600 10 mRNA-hsp-S-glo, 5 µg/mouse 29407 eleven mRNA-tpl-S-glo, 5 µg/mouse 38802 12 mRNA-his-S-glo, 5 µg/mouse 33779 13 mRNA-cas-S-cyt, 5 µg/mouse 29407 14 mRNA-hsp-S-cyt, 5 µg/mouse 33779 15 mRNA-tpl-S-cyt, 5 µg/mouse 29407 16 Control mRNA (with SARS-CoV-2 S-protein coding sequence), 5 µg/mouse 22286 17 Negative control (buffer solution). 0

As can be seen from the results of the experiment, double intramuscular injection of all variants of the developed vector based on mRNA encoding the S protein of the SARS-CoV-2 virus at concentrations from 2 µg/mouse to 5 µg/mouse induces the development of a humoral immune response.

Example 7. Determination of the efficiency of immunization of mice with various variants of a vector based on mRNA encoding the S protein of the SARS-CoV-2 virus, by assessing the proportion of proliferating lymphocytes.

Proliferative analysis allows you to evaluate the ability of lymphocytes to intensively divide after encountering an antigen. In order to assess proliferation, the authors used the staining of lymphocytes with the fluorescent dye CFSE (carboxyfluorescein diacetate succinimidyl ester). This dye binds to cellular proteins, persists for a long time, and is never transferred to neighboring cells in the population. However, the fluorescent label is passed on to daughter cells. The concentration of the label, and hence the intensity of fluorescence, decrease exactly by a factor of two. Therefore, dividing cells can be easily tracked by the decrease in their fluorescence.

The mice of the C57BL/6 line were used in the experiment. Mice were randomly divided into groups of 3 animals, which were injected twice intramuscularly with various variants of the vector, which were pre-packaged in lipid particles (example 2):

1) mRNA-cas-S-glo, 3 µg/mouse

2) mRNA-hsp-S-glo, 3 µg/mouse

3) mRNA-tpl-S-glo, 3 µg/mouse

4) mRNA-his-S-glo, 3 µg/mouse

5) mRNA-cas-S-cyt, 3 µg/mouse

6) mRNA-hsp-S-cyt, 3 µg/mouse

7) mRNA-tpl-S-cyt, 3 µg/mouse

8) Control mRNA (with SARS-CoV-2 S protein sequence), 3 µg/mouse

9) Buffer solution (negative control)

After two weeks, the animals were euthanized. Lymphocytes were isolated from the spleen by centrifugation in a ficoll-urographin gradient. The isolated cells were then stained with CFSE according to [Quah BJ, Warren HS, Parish CR. Monitoring lymphocyte proliferation in vitro and in vivo with the intracellular fluorescent dye carboxyfluorescein diacetate succinimidyl ester. Nat Protocol. 2007;2(9):2049-56. doi: 10.1038/nprot.2007.296. PMID: 17853860.] and cultured in the presence of antigen. The cells were then analyzed by flow cytometry. On FIG. Figure 4 shows the results of evaluating the effectiveness of immunization with the developed mRNA-based vector in assessing the proportion of proliferating CD4+ lymphocytes in response to antigen stimulation. On FIG. Figure 5 shows the results of evaluating the effectiveness of immunization with the developed mRNA-based vector in assessing the proportion of proliferating CD8+ lymphocytes in response to antigen stimulation. As can be seen from the results of the experiment, all variants of the developed vector based on mRNA encoding the S-protein of the SARS-CoV-2 virus effectively stimulate the proliferation of lymphocytes at this dose.

Thus, it can be concluded that the resulting mRNA-based constructs induce the formation of an antigen-specific immune response (both CD4+ and CD8+).

Example 8 Expression of single domain antibodies against SARS-CoV-2 RBD S protein in animals after administration of mRNA-based vector variants.

One of the promising approaches to the treatment of viral infections is antibody-based therapy. Administration of antibodies is approved for the immunoprophylaxis and treatment of viral infections caused by respiratory syncytial virus and Ebola virus. To date, several monoclonal antibodies are already in use for the treatment of COVID-19 (bamlanivimab plus etsevimab, casirivimab plus imdevimab and sotrovimab). Administration of these antibodies to non-hospital patients with COVID-19 symptoms and risk factors for disease progression has been shown to reduce the risk of hospitalization and death.

A promising direction in this area is the use of single-domain antibodies. The small size and nature of these antibodies allows them to bind epitopes not available to conventional antibodies, in particular concave epitopes such as grooves and clefts. Single domain antibodies show strong binding affinity and are also very stable over a wide temperature and pH range.

The authors of the patent obtained mRNA-based vector variants containing a region encoding a single-domain antibody against the RBD S protein of the SARS-CoV-2 virus (Example 1):

1. An mRNA-based vector for increased production of the target protein mRNA-cas-C5-glo, containing the 5'-untranslated region of SEQ ID NO:1, the region encoding the C5 single-domain antibody against the RBD S protein of the SARS-CoV-2 virus, and The 3'-untranslated region of SEQ ID NO:5.

2. An mRNA-based vector for increased production of the target protein mRNA-hsp-C5-glo, containing the 5'-untranslated region of SEQ ID NO:2, the region encoding the C5 single-domain antibody against the RBD S protein of the SARS-CoV-2 virus, and The 3'-untranslated region of SEQ ID NO:5.

3. An mRNA-based vector for increased production of the target protein mRNA-tpl-C5-glo, containing the 5'-untranslated region of SEQ ID NO:3, the region encoding the C5 single-domain antibody against the RBD S protein of the SARS-CoV-2 virus, and The 3'-untranslated region of SEQ ID NO:5.

4. An mRNA-based vector for increased production of the target protein mRNA-his-C5-glo, containing the 5'-untranslated region of SEQ ID NO:4, the region encoding the C5 single-domain antibody against the RBD S protein of the SARS-CoV-2 virus, and The 3'-untranslated region of SEQ ID NO:5.

5. An mRNA-based vector for increased production of the target mRNA-cas-C5-cyt protein, containing the 5' untranslated region of SEQ ID NO:1, the region encoding the C5 single-domain antibody against SARS-CoV-2 RBD S protein, and 3'-untranslated region SEQ ID NO: 1.

6. An mRNA-based vector for increased production of the target mRNA-hsp-C5-cyt protein, containing the 5' untranslated region of SEQ ID NO:2, the region encoding the C5 single-domain antibody against the SARS-CoV-2 RBD S protein, and 3'-untranslated region of SEQ ID NO: 6.

7. An mRNA-based vector for increased production of the target mRNA-tpl-C5-cyt protein, containing the 5' untranslated region of SEQ ID NO:3, the region encoding the C5 single-domain antibody against the SARS-CoV-2 RBD S protein, and The 3'-untranslated region of SEQ ID NO:6.

To evaluate the expression of a single-domain antibody against the RBD S-protein of the SARS-CoV-2 virus, an experiment was carried out using BALB/c mice, females 16-18 g. mRNA encoding single domain antibody (10 μg/mouse) packaged in lipid particles (example 2) or buffer solution (negative control). After 2 hours, 4 hours, 8 hours, 24 hours, 5 days (120 hours), 7 days (168 hours), 14 days (334 hours), peripheral blood was collected from the tail vein. The blood was incubated for 30 min at 37°C, centrifuged for 10 min at 1100 rpm to separate the serum.

The resulting sera were analyzed by ELISA using the SARS-CoV-2 FRT test system (manufactured by Medgamal).

The sera were titrated in dilution buffer, the p2c5-Fc antibody was titrated in parallel to build a calibration curve under the same conditions. Titrated sera and antibody were added to the plates and incubated for 1 hour at 37°C at 350 rpm on a plate thermoshaker, then washed 4 times with washing buffer (PSBT with 0.05% tween-20), the polyclonal goat anti-human IgG conjugate was added. HRP-conjugated antibodies" (MilliporeSigma, Burlington, MA, USA) diluted 1:20000 in dilution buffer and incubated for 1 hour at 37°C at 350 rpm, washed 4 times with wash buffer and 100 µl of one-component TMB " HBO Immunotech", incubated for 15 min. The reaction was stopped with a 1M sulfuric acid solution and the optical density was measured on a plate spectrophotometer at a wavelength of 450 nm. Next, the concentration of single-domain antibodies in the blood of animals in the experimental groups was determined using the calibration curve.

The results of the experiment are presented in Fig. 6, 7.

As can be seen from the presented results, after intramuscular injection of all ten variants of the developed mRNA-based vector, single-domain antibodies against RBD SARS-CoV-2 were developed in animals.

Example 9. Evaluation of the therapeutic properties of various variants of the developed mRNA-based vector encoding a single-domain antibody against botulinum neurotoxin.

Botulinum neurotoxin is produced by the anaerobic Gram-positive bacterium Clostridium botulinum. It is the strongest organic toxin known to science and one of the most poisonous substances in the world. The main mechanism of action of botulinum neurotoxin is realized at the presynaptic level through inhibition of the release of acetylcholine in the terminals of cholinergic neurons, which leads to peripheral neuroparalysis of the skeletal and autonomic nervous systems.

Vaccination, although an effective method of combating botulism, remains an undesirable strategy due to the widespread therapeutic use of botulinum neurotoxin in various pathological conditions. Therefore, the actual direction is the development of various therapeutic agents against botulism.

The purpose of this experiment is to evaluate the therapeutic properties of various variants of the developed mRNA-based vector encoding a single-domain antibody against botulinum neurotoxin.

BALB/c mice weighing 18–20 g were used in the experiment. The animals were injected with botulinum neurotoxin (BoNT/A) from Clostridium botulinum strain A98 at a dose of 5LD50.

Further, the animals were divided into several experimental groups (3 mice per group), which were administered once intramuscularly:

1) mRNA-cas-B11-glo

2) mRNA-hsp-B11-glo

3) mRNA-tpl-B11-glo

4) mRNA-his-B11-glo

5) mRNA-cas-B11-cyt

6) mRNA-hsp-B11-cyt

7) mRNA-tpl-B11-cyt

8) Buffer solution

Mice were monitored for clinical symptoms at intervals of 0, 4, 8, 26 and 48 hours post infection. Clinical symptoms were scored on a scale of 0 (no symptoms), 1 (mild symptoms), 2 (moderate symptoms), 3 (severe symptoms = humane endpoint). Time of death was defined as the time the mouse was found dead or euthanized at the end point. The results of the experiment are shown in Table 2.

Table 2. Survival of animals after administration of botulinum neurotoxin in various experimental groups The number of live animals after the introduction of 5LD50 BoNT/A at different time intervals from the beginning of the experiment, % after 0 hours after 4 hours after 8 hours after 24 hours after 48 hours mRNA-cas-B11-glo 100 100 100 100 100 mRNA-hsp-B11-glo 100 100 100 100 100 mRNA-tpl-B11-glo 100 100 100 100 100 mRNA-his-B11-glo 100 100 100 100 100 mRNA-cas-B11-cyt 100 100 100 100 100 mRNA-hsp-B11-cyt 100 100 100 100 100 mRNA-tpl-B11-cyt 100 100 100 100 100 buffer solution 100 100 0 0 0

As can be seen from the results of the experiment, all variants of the developed vector based on mRNA encoding single-domain antibody B11 have a therapeutic effect and prevent the death of animals from botulinum neurotoxin.

Industrial Applicability

All the above examples confirm the effectiveness of all variants of mRNA-based vectors and the possibility of their use for the creation of prophylactic and therapeutic agents, as well as their industrial applicability.

--->

<?xml version="1.0" encoding="UTF-8"?>

<!DOCTYPE ST26SequenceListing PUBLIC "-//WIPO//DTD Sequence Listing

1.3//EN" "ST26SequenceListing_V1_3.dtd">

<ST26SequenceListing dtdVersion="V1_3" fileName="vector based

mRNA.xml" softwareName="WIPO Sequence" softwareVersion="2.1.2"

productionDate="2022-10-21">

<ApplicationIdentification>

<IPOfficeCode>EN</IPOfficeCode>

<ApplicationNumberText>2022-10-21</ApplicationNumberText>

<FilingDate>2022-10-21</FilingDate>

</ApplicationIdentification>

<ApplicantFileReference>2022-10-21</ApplicantFileReference>

<ApplicantName languageCode="en">federal state

budget institution &quot;National Research Center

epidemiology and microbiology named after honorary academician

N.F.Gamalei&quot; Ministry of Health of the Russian

Federations</ApplicantName>

<ApplicantNameLatin>The National Research Center for Epidemiology

and Microbiology named after Honorary Academician N.F. Gamaleya of

the Ministry of Health of the Russian Federation</ApplicantNameLatin>

<InventionTitle languageCode="en">MRNA-based vector for

increased target protein production in mammalian cells

(options)</InventionTitle>

<SequenceTotalQuantity>6</SequenceTotalQuantity>

<SequenceData sequenceIDNumber="1">

<INSDSeq>

<INSDSeq_length>208</INSDSeq_length>

<INSDSeq_moltype>RNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..208</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>mRNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q7">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>Homo sapiens</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>tgctctgagtttttggtttctgtttcaccttgtgtctgagctggtctga

aggctggttgttcagactgagcttcctgcctgcctgtaccccgccaacagcttcagaagaaggagcagcc

cctgggtgcgtccactttctgggcacgtgaggttgggccttggccgcctgagcccttgagttggtcactt

gaaccttgggaatattgag</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="2">

<INSDSeq>

<INSDSeq_length>214</INSDSeq_length>

<INSDSeq_moltype>RNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..214</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>mRNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q8">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>Homo sapiens</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>aacggctagcctgaggagctgctgcgacagtccactacctttttcgaga

gtgactcccgttgtcccaaggcttcccagagcgaacctgtgcggctgcaggcaccggcgcgtcgagtttc

cggcgtccggaaggaccgagctcttctcgcggatccagtgttccgtttccagcccccaatctcagagccg

agccgacagagagcagggaaccggc</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="3">

<INSDSeq>

<INSDSeq_length>202</INSDSeq_length>

<INSDSeq_moltype>RNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..202</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>mRNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q9">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>Human adenovirus</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>actctcttcgcatcgctgtctgcgaggggccagctgttgggctcgcggtt

gaggacaaactcttcgcggtctttccagtactcttggatcggaaacccgtcggcctccgaacggtactcc

gccaccgagggacctgagcgagtccgcatcgaccggatcggaaaacctctcgagaaaggcgtctaaccag

tcacagtcgcaag</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="4">

<INSDSeq>

<INSDSeq_length>51</INSDSeq_length>

<INSDSeq_moltype>RNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..51</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other RNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q10">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>synthetic construct</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>atcggcgctttgccacttgtacccgagttttgattctcaagatggcgg

ca</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="5">

<INSDSeq>

<INSDSeq_length>111</INSDSeq_length>

<INSDSeq_moltype>RNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..111</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>mRNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q11">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>Homo sapiens</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>gctggagcctcggtggcctagcttcttgccccttgggcctccccccagc

ccctcctccccttcctgcacccgtacccccgtggtctttgaataaagtctgagtgggcggca</INSDSe

q_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="6">

<INSDSeq>

<INSDSeq_length>64</INSDSeq_length>

<INSDSeq_moltype>RNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..64</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>mRNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q6">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>Homo sapiens</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>cctcgccccggacctgccctcccgccaggtgcacccacctgcaataaat

gcagcgaagccggga</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

</ST26SequenceListing>

<---

Claims (8)

1. An mRNA-based vector for increased production of a target protein, containing a 5'-untranslated region selected from SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, a region encoding the target protein , and a 3'-untranslated region selected from SEQ ID NO: 5. 2. An mRNA-based vector for increased production of a target protein, containing a 5'-untranslated region selected from SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, a region encoding the target protein, and a 3'-untranslated region selected from SEQ ID NO: 6. 3. The vector according to claim 1 or 2, wherein the region encoding the target protein is a sequence encoding a vaccine antigen. 4. A vector according to claim 1 or 2, wherein the target protein coding region is an antibody coding sequence. 5. The vector according to claim 1 or 2, wherein the region encoding the target protein is a sequence encoding the therapeutic protein. 6. The vector according to claim 1 or 2, wherein the target protein coding region is an enzyme coding sequence. 7. The method of using the vector according to claim 1 or 2 for the synthesis of the target protein in mammalian cells. 8. The method of using the vector according to claim 7, characterized in that the synthesis of the target protein occurs in vivo.

Images